(19)
(11)EP 2 473 629 B1

(12)FASCICULE DE BREVET EUROPEEN

(45)Mention de la délivrance du brevet:
25.02.2015  Bulletin  2015/09

(21)Numéro de dépôt: 10763790.2

(22)Date de dépôt:  01.09.2010
(51)Int. Cl.: 
C12Q 1/68  (2006.01)
(86)Numéro de dépôt:
PCT/FR2010/051817
(87)Numéro de publication internationale:
WO 2011/027075 (10.03.2011 Gazette  2011/10)

(54)

IDENTIFICATION DU TROPISME CELLULAIRE DE VIRUS

IDENTIFIZIERUNG VON VIRUS TROPISMUS

IDENTIFICATION OF THE VIRAL CELLULAR TROPISM


(84)Etats contractants désignés:
AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO SE SI SK SM TR

(30)Priorité: 04.09.2009 FR 0956045

(43)Date de publication de la demande:
11.07.2012  Bulletin  2012/28

(73)Titulaires:
  • Centre National de la Recherche Scientifique (CNRS)
    75016 Paris (FR)
  • Assistance Publique Hôpitaux De Paris
    75184 Paris Cedex 04 (FR)
  • Université Paris Diderot - Paris 7
    75205 Paris Cedex 13 (FR)
  • Université Montpellier 2, Sciences et Techniques
    34095 Montpellier Cedex 5 (FR)

(72)Inventeurs:
  • LECELLIER, Charles-Henri
    F-34920 Le Cres (FR)
  • COURGNAUD, Valérie
    F-34090 Montpellier (FR)
  • BOUTTIER, Manuella
    F-34070 Montpellier (FR)
  • DESCAMPS, Diane
    F-75015 Paris (FR)
  • COLLIN, Gilles
    F-78300 Poissy (FR)

(74)Mandataire: Jacobson, Claude 
Cabinet Lavoix 2, Place d'Estienne d'Orves
75441 Paris Cedex 09
75441 Paris Cedex 09 (FR)


(56)Documents cités: : 
WO-A1-2009/033185
  
  • VAN BAELEN ET AL: "HIV-1 coreceptor usage determination in clinical isolates using clonal and population-based genotypic and phenotypic assays", JOURNAL OF VIROLOGICAL METHODS, ELSEVIER BV, NL LNKD- DOI:10.1016/J.JVIROMET.2007.06.003, vol. 146, no. 1-2, 3 novembre 2007 (2007-11-03), pages 61-73, XP022327138, ISSN: 0166-0934
  • SOULIÉ C ET AL: "[HIV tropism assays when first CCR5-antagonist becomes available]", MÉDECINE ET MALADIES INFECTIEUSES MAR 2008 LNKD- PUBMED:18455056, vol. 38 Suppl 1, mars 2008 (2008-03), pages S7-11, XP002578279, ISSN: 1769-6690
  
Il est rappelé que: Dans un délai de neuf mois à compter de la date de publication de la mention de la délivrance de brevet européen, toute personne peut faire opposition au brevet européen délivré, auprès de l'Office européen des brevets. L'opposition doit être formée par écrit et motivée. Elle n'est réputée formée qu'après paiement de la taxe d'opposition. (Art. 99(1) Convention sur le brevet européen).


Description

Domaine de l'invention



[0001] La présente invention comme définie par les revendications 1-16 concerne une méthode de caractérisation du tropisme cellulaire d'un virus, notamment du Virus d'Immunodéficience Humaine (VIH), et en particulier de la capacité du virus VIH à utiliser les récepteurs CXCR4 et/ou CCR5 pour entrer dans les cellules.

Arrière-plan technique



[0002] L'entrée du virus VIH dans les cellules implique plusieurs protéines virales dont les protéines d'enveloppe gp41 et gp120. La première étape du cycle de réplication du virus VIH fait intervenir la fixation du virus aux lymphocytes T4 auxiliaires par interaction de la protéine gp120 avec la protéine cellulaire CD4. En outre, pour que la fusion des membranes virale et cellulaire se produise, le virus VIH doit interagir avec un co-récepteur cellulaire. Les co-récepteurs les plus importants in vivo sont les récepteurs de chimiokines CXCR4 et CCR5. L'utilisation des différents co-récepteurs est associée à l'évolution du déficit immunitaire et, par conséquent, de l'infection : au début de l'infection, les virus dits R5 interagissent avec le co-récepteur CCR5, puis à un stade plus avancé, certains virus utilisent le co-récepteur CXCR4 (virus dits X4). A ce stade, la population virale comprend soit un mélange de virus R5 et X4, soit des virus à double tropisme R5/X4. Dans certains cas, les virus R5 peuvent induire directement l'apparition d'un SIDA, toutefois c'est l'apparition de virus X4 qui est généralement associée au développement de la maladie. Il est donc essentiel de pouvoir détecter précocement l'apparition des virus X4 chez le patient.

[0003] Ainsi, un certain nombre de méthodes ayant pour but de déterminer le tropisme cellulaire des virus VIH ont été développées.

[0004] Par exemple, le test TROFILE (MONOGRAM) est un test phénotypique du virus VIH proposé par la société Monogram Biosciences et Pfizer. Tout d'abord, une librairie de vecteurs contenant les régions codant l'enveloppe des virus VIH d'un patient est réalisée. Ces vecteurs sont ensuite amplifiés et les régions codant l'enveloppe sont clonées dans un vecteur exprimant un virus VIH dépourvu de protéine d'enveloppe et exprimant le gène de la luciférase. Enfin, les virus recombinants obtenus à partir de ces vecteurs sont utilisés pour infecter des cellules exprimant CD4 et CCR5 ou CXCR4. La capacité d'un virus à infecter ces cellules est déterminée par mesure de l'émission de lumière produite par la luciférase. Ce test présente plusieurs inconvénients, comme signalé en novembre 2007 par le TRT-5 à l'Afssaps et à la HAS (Haute Autorité de la Santé). Il a tout d'abord un coût très élevé. De plus, le délai de réception des résultats est de quatre à cinq semaines, ce qui n'est pas compatible avec une prise de décision rapide en cas de changement de traitement. En outre, il n'est pas impossible qu'un changement de tropisme viral puisse intervenir chez certains patients dans un tel délai. Par ailleurs, aucun test Trofile n'est disponible pour les virus de types VIH-2.

[0005] Il existe donc un réel besoin de tests alternatifs simples, rapides, fiables et peu coûteux permettant de déterminer le tropisme cellulaire des virus VIH. L'objet de la présente invention est de fournir de tels tests.

Résumé de l'invention



[0006] La présente invention comme définie par les revendications 1-16 découle de la mise en évidence inattendue, par les inventeurs, que l'expression de miRNA dans une cellule susceptible d'être infectée par un virus VIH est modulée en fonction du co-récepteur utilisé par le virus VIH pour entrer dans la cellule.

[0007] Ainsi, la présente invention concerne une méthode in vitro d'identification de microARN, ou de leurs ARNm cibles, dont l'expression, lors de l'infection de cellules par un virus utilisant un récepteur cellulaire et au moins un co-récepteur cellulaire pour entrer dans la cellule, est spécifiquement modifiée en fonction du co-récepteur cellulaire utilisé par le virus pour son entrée dans les cellules, comprenant :

i) déterminer les niveaux d'expression de microARN dans une cellule test, exprimant un récepteur, un premier co-récepteur et au moins un autre co-récepteur, après infection respectivement par un premier virus utilisant le premier co-récepteur et par au moins un autre virus utilisant un autre co-récepteur ;

ii) identifier les microARN dont le niveau d'expression est modulé lors de l'infection par chacun des virus par rapport au niveau d'expression dans des cellules non infectées ;

iii) comparer les microARN ainsi identifiés ;

iv) sélectionner les microARN dont la modification du niveau d'expression est spécifique de l'utilisation d'un co-récepteur ;

v) éventuellement identifier les ARNm cibles des micro-ARN ainsi sélectionnés.



[0008] L'invention concerne également méthode in vitro d'identification d'un co-récepteur cellulaire utilisé par un virus utilisant un récepteur cellulaire et au moins un co-récepteur cellulaire pour entrer dans une cellule, chez un patient infecté par le virus, comprenant :

i) mettre en contact un échantillon du patient susceptible de contenir le virus avec une cellule test exprimant un récepteur cellulaire du virus et au moins un co-récepteur cellulaire du virus ;

ii) déterminer le niveau d'expression d'au moins un miRNA et/ou d'au moins un ARNm cible d'un miRNA dans la cellule test ;

iii) comparer le niveau d'expression à une valeur prédéterminée ;

iv) en déduire si le virus utilise ou non un co-récepteur cellulaire exprimé par la cellule test.


Description de l'invention



[0009] Le terme « miRNA » ou « microARN » se réfère à une classe d'ARN, généralement de 20 à 25 nucléotides de long, impliqués dans la régulation post-transcriptionelle de certains gènes spécifiques en dégradant ou bloquant la traduction de l'ARNm issu de la transcription de ces gènes. Par « ARNm cible » d'un miRNA, on entend un ARNm dont on sait ou dont on a déterminé qu'il est dégradé ou dont la traduction est bloquée par ledit miRNA. Les miRNAS sont notamment décrits dans Griffiths-Jones ((2004) Nucleic Acids Res 32:D109-D111), dans Griffiths-Jones et al. ((2008) Nucleic Acids Res 36:D154-D158)et dans la base de donnée sur les miRNA (miRBase, http://microARN.sanger.ac.uk).

[0010] L'expression « virus » telle qu'utilisée ici comprend tous les types de virus. En particulier le virus peut être sélectionné dans le groupe des virus dont des variants ou des espèces sont plus ou moins pathogènes, par exemple les rétrovirus en particulier le virus VIH, les virus de la grippe, les coronavirus, les virus de la rougeole, les herpesvirus (dont les virus EBV, Simplex et CMV), les papillomavirus. Préférentiellement, le virus est un rétrovirus sélectionné parmi les retrovirus humains notamment VIH, HTLV-I et XMRV. Encore plus préférentiellement, le virus est le VIH et en particulier les virus VIH-1 et VIH-2 (notamment décrits dans la base de donnée HIV databases, http://www.hiv.|an|.gov/content/index). Si le virus selon l'invention est le VIH, les virus utilisés pour réaliser les infections peuvent, par exemple, être des virus prototypes comme les virus VIH-1, NL4.3, VIH-2 ROD ou VIH-1 NLAD8 ou des virus d'un patient. Les virus VIH selon l'invention peuvent utiliser un ou plusieurs co-récepteurs pour entrer dans les cellules cibles. Préférentiellement, dans les méthodes d'identification de micro-ARN selon l'invention, les virus VIH utilisés n'utilisent qu'un seul type de co-récepteur pour entrer dans une cellule.

[0011] Le terme « patient » désigne un être humain infecté par un virus. Préférentiellement, le virus est le VIH. Le patient peut alors avoir éventuellement développé un SIDA (Syndrome d'Immuno-Déficience Acquise). Eventuellement, le patient est sous traitement anti-rétroviral, par exemple sous traitement HAART (traitement anti-retroviral hautement actif (« Highly Active Anti-Retroviral Therapy »)).

[0012] Les termes « récepteur » et « récepteur cellulaire » selon l'invention désigne une structure de surface cellulaire, en générale une protéine, intervenant dans la reconnaissance d'une cellule cible par un virus et aboutissant en générale à la fixation de ce virus à la cellule cible. Les termes « co-récepteur » et « co-récepteur cellulaire » regroupe l'ensemble des protéines cellulaires de surface participant à l'entrée du virus à l'exclusion du récepteur cellulaire.

[0013] Lorsque le virus est le VIH, les termes « co-récepteur » et « co-récepteur cellulaire » regroupent plus spécifiquement l'ensemble des protéines cellulaires de surface participant à l'entrée du virus en plus de l'interaction entre le virus et le récepteur cellulaire CD4. L'entrée d'un virus VIH dans une cellule hôte implique la fusion entre les membranes cellulaire et virale. En particulier, le co-récepteur peut être sélectionné dans le groupe constitué de CXCR4, CCR5, CCR3, CCR2, CCR1, CCR4, CCR8, CCR9, CXCR2, STRL33, V28, gpr1, gpr15 et ChemR23. Préférentiellement, le co-récepteur est CCR5 ou CXCR4.

[0014] CXCR4 est également connu sous les noms de Fusin, LESTR et NPY3R. Le gène CRCR4 désigne ici préférentiellement la séquence du gène CXCR4 humain dont la séquence d'ARNm peut, par exemple, être la SEQ ID NO : 1 ou tout variant allélique ou polymorphique de celle-ci ainsi que les séquences orthologues présentes dans d'autres espèces. Le gène CXCR4 code la protéine CXCR4 pouvant avoir la séquence représentée par SEQ ID NO : 2 ou n'importe quel variant naturel de celle-ci.

[0015] CCR5 est également connu sous les noms de CKR-5 et CMKRB5. Le gène CCR5 désigne ici préférentiellement la séquence du gène CCR5 humain dont la séquence d'ARNm peut, par exemple, être la SEQ ID NO: 3 ou tout variant allélique ou polymorphique de celle-ci ainsi que les séquences orthologues présentes dans d'autres espèces. Le gène CCR5 code la protéine CCR5 pouvant avoir la séquence représentée par SEO ID NO : 4 ou n'importe quel variant naturel de celle-ci.

[0016] CCR3 est également connu sous les noms de CC-CKR-3, CKR-3 et CMKBR3. Le gène CCR3 désigne ici préférentiellement la séquence du gène CCR3 humain dont la séquence d'ARNm peut, par exemple, être la SEQ ID NO : 5 ou tout variant allélique ou polymorphique de celle-ci ainsi que les séquences orthologues présentes dans d'autres espèces. Le gène CCR3 code la protéine CCR3 pouvant avoir la séquence représentée par SEQ ID NO : 6 ou n'importe quel variant naturel de celle-ci.

[0017] CCR2 est également connu sous les noms de CCR2b et CMKBR2. Le gène CCR2 désigne ici préférentiellement la séquence du gène CCR2 humain dont la séquence d'ARNm peut, par exemple, être la SEQ ID NO: 7 ou tout variant allélique ou polymorphique de celle-ci ainsi que les séquences orthologues présentes dans d'autres espèces. Le gène CCR2 code la protéine CCR2 pouvant avoir la séquence représentée par SEQ ID NO : 8 ou n'importe quel variant naturel de celle-ci.

[0018] CCR1 est également connu sous les noms de CKR1 et CMKBR1. Le gène CCR11 désigne ici préférentiellement la séquence du gène CCR1 humain dont la séquence d'ARNm peut, par exemple, être la SEQ ID NO: 9 ou tout variant allélique ou polymorphique de celle-ci ainsi que les séquences orthologues présentes dans d'autres espèces. Le gène CCR1 code la protéine CCR1 pouvant avoir la séquence représentée par SEQ ID NO : 10 ou n'importe quel variant naturel de celle-ci.

[0019] CCR4 est également connu sous le nom de CKR-4. Le gène CCR4 désigne ici préférentiellement la séquence du gène CCR4 humain dont la séquence d'ARNm peut par exemple être la SEQ ID NO : 11 ou tout variant allélique ou polymorphique de celle-ci ainsi que les séquences orthologues présentes dans d'autres espèces. Le gène CCR4 code la protéine CCR4 pouvant être de séquence représentée par SEQ ID NO : 12 ou n'importe quel variant naturel de celle-ci.

[0020] CCR8 est également connu sous les noms de ChemR1, TER1 et CMKBR8. Le gène CCR8 désigne ici préférentiellement la séquence du gène CCR8 humain dont la séquence d'ARNm peut, par exemple, être la SEQ ID NO : 13 ou tout variant allélique ou polymorphique de celle-ci ainsi que les séquences orthologues présentes dans d'autres espèces. Le gène CCR8 code la protéine CCR8 pouvant avoir la séquence représentée par SEQ ID NO : 14 ou n'importe quel variant naturel de celle-ci.

[0021] CCR9 est également connu sous le nom de D6. Le gène CCR9 désigne ici préférentiellement la séquence du gène CCR9 humain dont la séquence d'ARNm peut, par exemple, être la SEQ ID NO : 15 ou tout variant allélique ou polymorphique de celle-ci ainsi que les séquences orthologues présentes dans d'autres espèces. Le gène CCR9 code la protéine CCR9 pouvant avoir la séquence représentée par SEQ ID NO : 16 ou n'importe quel variant naturel de celle-ci.

[0022] CXCR2 est également connu sous le nom de IL-8RB. Le gène CXCR2 désigne ici préférentiellement la séquence du gène CXCR2 humain dont la séquence d'ARNm peut, par exemple, être la SEQ ID NO : 17 ou tout variant allélique ou polymorphique de celle-ci ainsi que les séquences orthologues présentes dans d'autres espèces. Le gène CXCR2 code la protéine CXCR2 pouvant avoir la séquence représentée par SEQ ID NO : 18 ou n'importe quel variant naturel de celle-ci.

[0023] STRL33 est également connu sous les noms de Bonzo, CXCR6 et TYMSTR. Le gène STRL33 désigne ici préférentiellement la séquence du gène STRL33 humain dont la séquence d'ARNm peut, par exemple, être la SEQ ID NO : 19 ou tout variant allélique ou polymorphique de celle-ci ainsi que les séquences orthologues présentes dans d'autres espèces. Le gène STRL33 code la protéine STRL33 pouvant avoir la séquence représentée par SEQ ID NO : 20 ou n'importe quel variant naturel de celle-ci.

[0024] V28 est également connu sous les noms de CMKBRL1, CX3CR1 et GPR13. Le gène V28 désigne ici préférentiellement la séquence du gène V28 humain dont la séquence d'ARNm peut, par exemple, être la SEQ ID NO : 21 ou tout variant allélique ou polymorphique de celle-ci ainsi que les séquences orthologues présentes dans d'autres espèces. Le gène V28 code la protéine V28 pouvant avoir la séquence représentée par SEQ ID NO : 22 ou n'importe quel variant naturel de celle-ci.

[0025] Le gène gpr1 ou GPR1 désigne ici préférentiellement la séquence du gène gpr1 humain dont la séquence d'ARNm peut, par exemple, être la SEQ ID NO : 23 ou tout variant allélique ou polymorphique de celle-ci ainsi que les séquences orthologues présentes dans d'autres espèces. Le gène gpr1 code la protéine gpr1 pouvant avoir la séquence représentée par SEQ ID NO : 24 ou n'importe quel variant naturel de celle-ci.

[0026] gpr15 ou GPR15 est également connu sous le nom de BOB. Le gène gpr15 désigne ici préférentiellement la séquence du gène gpr15 humain dont la séquence d'ARNm peut, par exemple, être la SEQ ID NO: 25 ou tout variant allélique ou polymorphique de celle-ci ainsi que les séquences orthologues présentes dans d'autres espèces. Le gène gpr15 code la protéine gpr15 pouvant avoir la séquence représentée par SEQ ID NO : 26 ou n'importe quel variant naturel de celle-ci.

[0027] Apj est également connu sous les noms de angiotensin-receptor-like, apelin receptor (APLNR) et AGTRL1. Le gène Apj désigne ici préférentiellement la séquence du gène Apj humain dont la séquence d'ARNm peut, par exemple, être la SEQ ID NO : 27 ou tout variant allélique ou polymorphique de celle-ci ainsi que les séquences orthologues présentes dans d'autres espèces. Le gène Apj code la protéine Apj pouvant avoir la séquence représentée par SEQ ID NO : 28 ou n'importe quel variant naturel de celle-ci.

[0028] Le gène ChemR23 est également connu sous les noms de CMKLR1 et DEZ. Le gène ChemR23 désigne ici préférentiellement la séquence du gène ChemR23 humain dont la séquence d'ARNm peut, par exemple, être la SEQ ID NO : 29 ou tout variant allélique ou polymorphique de celle-ci ainsi que les séquences orthologues présentes dans d'autres espèces. Le gène ChemR23 code la protéine ChemR23 pouvant avoir la séquence représentée par SEQ ID NO : 30 ou n'importe quel variant naturel de celle-ci.

[0029] Selon l'invention, on entend par « cellule test » toute cellule susceptible d'être infectée par un virus selon l'invention. Préférentiellement, quand le virus est le VIH, la cellule test selon l'invention exprime CD4, un premier et au moins un autre co-récepteur du virus VIH tel que défini ci-dessus. Encore préférentiellement, la cellule test selon l'invention exprime CXCR4 et CCR5. Une cellule test selon l'invention peut exprimer naturellement ces récepteurs ou être génétiquement modifiée afin d'exprimer ces récepteurs. La cellule test selon l'invention peut par exemple être une cellule dendritique, une cellule issue des lignées lymphoïde (préférentiellement un lymphocyte T) ou myéloïde (préférentiellement un macrophage), une cellule épithéliale ou un fibroblaste. Préférentiellement, la cellule test selon l'invention est sélectionnée dans le groupe comprenant les cellules Jurkat (notamment décrites dans Schneider et al. Int J Cancer (1997) 19(5) : 621-6), par exemple le clone de cellule Jurkat E6-1 (ATCC No : TIB-152), les cellules Jurkat-CCR5 (notamment décrites dans Alkhatib et al. (1996) Science 272 : 1955-1958 et AIDS reagent NIBSC, UK). Encore plus préférentiellement, la cellule test selon l'invention est une cellule Jurkat-CCR5.

[0030] Les techniques permettant d'infecter une cellule test selon l'invention par un virus VIH sont bien connues de l'homme du métier et sont notamment décrites dans Barré-Sinoussi et al. ((1983) Science 220(4599) : 868-71)).

[0031] Le niveau d'expression de microARN ou le niveau d'expression d'ARNm cible dans les cellules test peut être mesuré par toutes techniques connues de l'homme du métier. De nombreuses méthodes sont connues qui permettent de quantifier les ARN, par exemple, les méthodes fondées sur des PCR après transcription inverse (RT-PCR) utilisant des oligonucléotides spécifiques des séquences d'ARN ou des méthodes permettant l'hybridation de ces ARN, des duplicats ou triplicats de ces ARN avec des sondes sous conditions stringentes. Lorsque le niveau d'expression des ARNm cibles est mesuré, il est possible de réaliser une RT-PCR ou des puces cDNA spécifiques avec une seule sonde permettant la transcription inverse de toutes les ARNm. Les sondes selon l'invention sont préférentiellement déposées sur des microarrays. Les conditions stringentes peuvent facilement être déterminées par l'homme du métier. Par exemple, les conditions stringentes selon l'invention peuvent comprendre une étape d'hybridation de 10 à 20 heures, préférablement 16h, à une température de 40 à 50 °C, préférablement à 50°C, en présence d'une force ionique équivalente à celle induite par une concentration de 500mM à 2M de NaCl, préférablement 1 M de NaCl. D'autres produits peuvent également être ajoutés comme des solutions tampon, telles le Tris ou MES, de l'EDTA, du Tween et du BSA (sérum albumine bovine).

[0032] Les niveaux d'expression des microARN ou de leurs ARNm cibles ainsi mesurés, dans une cellule test respectivement infectée par un premier virus utilisant un premier co-récepteur et par au moins un autre virus utilisant un autre co-récepteurs, peuvent permettre d'identifier les microARN ou leurs ARNm cibles dont l'expression est modulée lors de l'infection par chacun des virus par rapport à des cellules non infectées. L'identification des microARN ou de leurs ARNm cibles dont l'expression est modulée lors de l'infection par chacun de virus peut être réalisée en comparant les niveaux d'expression des miRNA ou de leurs ARNm cibles mesurés après infection par chacun des virus avec le niveau d'expression desdits miRNA ou desdits ARNm cibles dans des cellules non infectées. Préférentiellement, pour qu'un microARN ou ses ARNm cibles soient considérés comme ayant une expression modulée lors de l'infection des cellules tests par un virus, cette expression est augmentée ou diminuée par rapport à l'expression dans les cellules tests non infectées d'un log2 du rapport (expression dudit miRNA dans des cellules infectées/ expression dudit miRNA dans des cellules non infectées) supérieure à 0,5 ou inférieur à -0,5 respectivement.

[0033] Les microARN ou leurs ARNm cibles identifiés comme ayant une expression modulée lors de l'infection par chacun des virus peuvent ensuite être comparés afin de sélectionner les miRNA ou leurs ARNm cibles dont l'expression est modifiée spécifiquement par l'utilisation d'un co-récepteur par le virus.

[0034] Par «modification du niveau d'expression spécifique de l'utilisation d'un co-récepteur » selon l'invention on entend une modification, augmentation ou diminution, de l'expression suffisante pour permettre d'identifier le co-récepteur utilisé par le virus.

[0035] Par « cellules tests non infectées » ou « cellules non infectées par le virus du patient », on entend des cellules n'ayant pas été mises en contact avec un virus quelque qu'il soit mais également les cellules infectées par un virus, notamment un rétrovirus, dont les co-récepteurs cellulaires sont présentés par les cellules test mais sont distincts du premier co-récepteur ou du au moins un autre co-récepteur utilisé par le virus pour entrer dans la cellule test dans les méthodes selon l'invention. Par exemple, ce virus peut être un virus VIH pseudotypé par une enveloppe amphotrope type VSV ou le virus PFV-1.

[0036] Par exemple, si l'expression d'un miRNA ou d'un de ses ARNm cibles est augmentée lors d'une infection avec un premier virus VIH utilisant le co-récepteur CXCR4 dans des cellules Jurkat-CCR5 (exprimant CXCR4 et CCR5) par rapport à l'expression du miRNA ou d'un de ses ARNm cibles dans des cellules Jurkat-CCR5 non infectées et que l'expression de ce miRNA ou d'un de ses ARNm cibles n'est pas augmentée lors d'une infection avec un deuxième virus VIH utilisant le co-récepteur CCR5 dans des cellules Jurkat-CCR5 par rapport à l'expression du miRNA ou d'un de ses ARNm cibles dans les cellules Jurkat-CCR5 non infectées, alors l'augmentation de l'expression dudit miRNA ou dudit ARNm cible est spécifique de l'utilisation du récepteur CXCR4 par le virus VIH.

[0037] La présente invention peut concerner également une méthode in vitro d'identification de microARN ou de leurs ARNm cibles dont l'expression, lors de l'infection de cellules par un virus utilisant un récepteur et au moins un co-récepteur cellulaire pour entrer dans la cellule, est spécifiquement modifiée en fonction du co-récepteur cellulaire utilisé par le virus pour son entrée dans les cellules, comprenant :

i) déterminer les niveaux d'expression de microARN dans une cellule test, exprimant le récepteur, un premier co-récepteur et au moins un autre co-récepteur, après infection respectivement par un premier virus utilisant le premier co-récepteur et par au moins un autre virus utilisant un autre co-récepteur;

ii) comparer les niveaux d'expression des micro-ARN ainsi déterminés ;

iii) identifier les microARN dont la modification du niveau d'expression est spécifique de l'utilisation d'un co-récepteur.



[0038] Les niveaux d'expression des microARN ou de leurs ARNm cibles ainsi mesurés dans une cellule test après infection respectivement par un virus utilisant un premier co-récepteur et au moins un autre virus utilisant un autre co-récepteur peuvent alors être comparés directement entre eux. Cette comparaison permet alors d'identifier les microARN ou leur ARNm cibles dont la modification de l'expression est spécifique de l'utilisation du premier corécepteur ou du au moins un autre co-récepteur par le virus.

[0039] Les méthodes selon l'invention peuvent également comprendre un étape supplémentaire permettant d'identifier les ARNm cibles des micro-ARN caractéristiques ainsi identifiés dont la modification du niveau d'expression est spécifique de l'utilisation d'un co-récepteur par un virus pour entrer dans une cellule. Les cibles des miRNA peuvent être identifiées dans des bases de données, notamment miRBase (http://microrna.sanger.ac.uk/ et notamment décrite dans Griffiths-Jones et al (2008) Nucleic Acids Res 36, Griffiths-Jones et al. (2006) Nucleic Acids Res 34, Griffiths-Jones et al. (2004) Nucleic Acids Research 32) et TargetScan (http://www.targetscan.org/ et notamment décrite dans Lewis et al. (2005) Cell 120: 15-20, Grimson et al. (2007) Molecular Cell 27: 91-105, Friedman et al. (2009) Genome Research 19: 92-105).

[0040] L'expression « échantillon du patient susceptible de comprendre le virus VIH » comprend tous les liquides ou tissus biologiques provenant d'un patient et pouvant contenir des virus comme par exemple, le sang périphérique, les muqueuses génitales, les tissus lymphoïdes, le liquide céphalo-rachidien, le placenta ou le lait maternel. L'échantillon peut être mis directement en contact avec les cellules test. Préférentiellement, les virus sont extraits de l'échantillon avant contact avec les cellules hôtes. Par exemple, les virus des patients peuvent provenir d'isolats primaires issus d'un échantillon biologique et être obtenus par toutes méthodes connues de l'homme du métier, par exemple, l'isolement des virus VIH peut s'effectuer par co-culture des lymphocytes de patients infectées par le VIH avec des lymphocytes de donneurs séronégatifs pour le VIH notamment selon la technique décrite par Barre-Sinoussi et al ((1983) Science 220(4599):868-71). Le sang périphérique d'un patient infecté par le virus VIH peut également être traité de manière à séparer le plasma des cellules (comme cela est notamment décrit par Fang et al. (1995) Proc. Natl. Acad. Sci. USA 92:12110-4).

[0041] Afin de mettre en oeuvre la méthode d'identification d'un co-récepteur cellulaire utilisé par un virus utilisant un récepteur cellulaire et au moins un co-récepteur cellulaire pour entrer dans une cellule chez un patient, le niveau d'expression d'au moins un miRNA et/ou d'au moins un ARNm cible de ce miRNA est mesuré. De préférence ce miRNA et/ou son ARNm cible a été identifié comme ayant une modification du niveau d'expression spécifique de l'utilisation par le virus d'un co-récepteur. De préférence ce miRNA et/ou son ARNm cible aura été identifié par une méthode selon l'invention.

[0042] En particulier, la méthode d'identification de virus chez un patient selon l'invention peut être utilisée pour identifier des virus utilisant CXCR4 et/ou CCR5. De préférence ce miRNA et/ou son ARNm cible aura alors été identifié comme ayant une modification du niveau d'expression spécifique de l'utilisation par le virus VIH du récepteur CXCR4 et/ou CCR5. De préférence ce miRNA et/ou son ARNm cible aura été identifié par la méthode d'identification de miRNA selon l'invention.

[0043] Préférentiellement, la méthode selon l'invention est mise en oeuvre pour identifier la présence ou l'absence de virus utilisant le co-récepteur CXCR4 chez un patient. La méthode selon l'invention peut aussi être réalisée à plusieurs reprises sur des échantillons issus d'un même patient prélevés à différents moments au cours du temps afin d'identifier l'apparition de virus utilisant le récepteur CXCR4 et ainsi de suivre l'évolution de la maladie chez ce patient.

[0044] La valeur prédéterminée peut être une valeur unique comme, par exemple, un niveau ou une moyenne de niveaux d'expression d'un miRNA donné ou d'un ARNm cible donné.

[0045] Par exemple, afin d'identifier un virus utilisant un co-récepteur donnée, la valeur prédéterminée peut être la valeur de l'expression d'un miRNA donné ou d'un ARNm cible donné dans une cellule exprimant ce co-récepteur et infectée par un virus de référence connu pour utiliser ce co-récepteur pour entrer dans la cellule. Par exemple, afin d'identifier des virus utilisant CXCR4 et/ou CCR5 chez un patient, la valeur prédéterminée peut être la valeur de l'expression d'un miRNA donné ou d'un ARNm cible donné dans une cellule exprimant CXCR4 ou CCR5 après infection avec un virus VIH de référence utilisant CXCR4 ou CCR5 pour entrer dans une cellule.

[0046] La comparaison entre la valeur d'expression obtenue et la valeur prédéterminée permet de déterminer si le virus étudié utilise ou non le même co-récepteur que le virus de référence pour entrer dans les cellules. Par exemple, si la valeur obtenue est proche de la valeur prédéterminée, il est possible de déduire qu'un co-récepteur utilisé par le virus testé est identique à celui utilisé par le virus de référence pour entrer dans les cellules. Par valeur proche on entend préférentiellement des valeurs ne différant pas de plus de 50%, 40%, 30%, 20% ou 10% et encore plus préférentiellement de moins de 5%.

[0047] La valeur de référence peut également être, par exemple, la valeur de l'expression d'un miRNA donné ou d'un ARNm cible donné dans une cellule non infectée et donc en absence d'infection par le virus du patient. De préférence, il aura alors été préalablement montré que l'expression dudit miRNA ou dudit ARNm cible est modulée, augmentée ou diminuée, de façon spécifique après infection de la cellule avec un virus de référence utilisant un co-récepteur donné par rapport à l'expression dans une cellule non infectée. L'augmentation ou la diminution de la valeur d'expression d'un miRNA ou d'un ARNm cible de même nature que celle préalablement déterminée indique alors une utilisation d'un même co-récepteur par les virus. Par expression augmentée ou diminuée de même nature, on entend préférentiellement des valeurs de log2 du rapport (expression dudit miRNA et/ou d'un ARNm cible dans des cellules infectées/ expression dudit miRNA et/ou d'un ARNm cible dans des cellules non infectées) de même signe (négative ou positive respectivement). L'étape de comparaison du niveau d'expression à une valeur déterminée (iii) dans la méthode d'identification d'un co-récepteur utilisé par un virus d'un patient infecté selon l'invention est alors préférentiellement mise en oeuvre en déterminant si le niveau d'expression d'au moins un miRNA et/ou au moins un ARNm cible d'un miRNA est augmenté ou diminué par rapport au niveau d'expression du au moins un miRNA et/ou du au moins un ARNm cible d'un miRNA dans des cellules tests non infectées.

[0048] Par exemple, la mesure de l'expression d'un ou plusieurs microARN ou ARNm cible, dont l'expression a été montrée comme étant spécifiquement modifiée (augmentée ou diminuée) par des virus VIH de référence utilisant le co-récepteur CXCR4, dans des cellules non infectées peut être comparée a des mesures de l'expression desdits micro-ARN ou ARNm cibles dans des cellules après infection par des virus d'un patient. En cas d'absence de modulations prédéfinies de certains microARN, ce test identifiera que CXCR4 n'est pas un co-récepteur utilisé par un virus VIH du patient. Inversement, si les modulations prédéfinies (augmentation ou diminution) sont observées, le test identifiera que CXCR4 est un co-récepteur utilisé par le virus VIH du patient, il peut être noté qu'un tel virus peut être un virus à double tropisme par exemple, pouvant utiliser CCR5 et CXCR4.

[0049] Le miRNA dont l'expression est déterminée peut être, par exemple, sélectionné dans le groupe constitué de hsa-miR-574-5p (notamment de SEQ ID NO : 31, ugagugugugugugugagugugu), hsa-miR-663 (notamment de SEQ ID NO: 32, aggcggggcgccgcgggaccgc), hsa-miR-149* (notamment de SEQ ID NO: 33, agggagggacgggggcugugc), hsa-miR-575 (notamment de SEQ ID NO: 34, gagccaguuggacaggagc), hsa-miR-638 (notamment de SEQ ID NO: 35, agggaucgcgggcggguggcggccu), hsa-miR-181b (notamment de SEQ ID NO: 36, aacauucauugcugucggugggu), hsa-let-7g (notamment de SEQ ID NO: 37, ugagguaguaguuuguacaguu), hsa-miR-30a (notamment de SEQ ID NO: 38, uguaaacauccucgacuggaag), hsa-miR-148a (notamment de SEQ ID NO: 39, ucagugcacuacagaacuuugu) et hsa-miR-9* (notamment de SEQ ID NO: 40, auaaagcuagauaaccgaaagu). Préférentiellement, le mi-RNA dont l'expression est déterminée est hsa-miR-638.

[0050] Les miRNA dont l'expression est déterminée peuvent également être des variants allélique ou polymorphique des SEQ ID NO: 31 à 40 ainsi que des séquences orthologues présentes dans d'autres espèces dérivant des miRNA de séquence SEQ ID NO : 31 à 40 et remplissant la même fonction, en particulier régulant l'expression des même ARNm cibles. Par exemple, ces miRNA peuvent dériver des miRNA de séquence SEQ ID NO : 31 à 40 par une ou plusieurs mutations d'acides nucléiques.

[0051] L'ARNm dont l'expression est déterminée peut être, par exemple, sélectionné dans le groupe constitué des ARNm cibles des miRNA de SEQ ID NO : 31 à 40 ou des miRNA en dérivant. En particulier, les ARNm cibles peuvent être identifiés dans des bases de données comme décrit ci-dessus.

[0052] Par exemple, une augmentation de l'expression d'au moins un miRNA sélectionné dans le groupe comprenant hsa-miR574-5p, hsa-miR-663, hsa-miR-149*, hsa-miR-575, hsa-miR-638 ou une diminution de l'expression d'au moins un microARN sélectionné dans le groupe comprenant hsa-miR-181b, hsa-let-7g, hsa-miR-30a, hsa-miR-148a et hsa-miR-9* indique que CXCR4 est un co-récepteur utilisé par un virus VIH du patient. Au contraire, une absence d'augmentation de l'expression d'au moins un miRNA sélectionné dans le groupe comprenant hsa-miR574-5p, hsa-miR-663, hsa-miR-149*, hsa-miR-575, hsa-miR-638 ou une absence de diminution de l'expression d'au moins un microARN sélectionné dans le groupe comprenant hsa-miR-181b, hsa-let-7g, hsa-miR-30a, hsa-miR-148a et hsa-miR-9* indique que CXCR4 n'est pas un co-récepteur utilisé par un virus du patient.

FIGURE



[0053] FIG. 1 : Expression de hsa-miR-638 en réponse à l'infection par des isolats primaires HIV-1 de tropisme CXCR4, CCR5 ou des virus à double tropisme (dual). Des cellules Jurkat-CCR5 sont infectées par 4 isolats DUAL (dual 1, dual 2, dual 3, dual 4), 4 isolats CXCR4 (X4 1, X4 2, X4 3, X4 4) et 3 isolats CCR5 (R5 1, R5 2, R5 3). Trois jours post-infection, les cellules sont lysées et les ARN sont analysés par RT-qPCR dirigée contre le hsa-miR-638. L'expression de hsa-miR-638 dans les cellules infectées est normalisée par l'expression de cellules contrôles Jurkat R5 non infectées (NI).

EXEMPLES


MATERIEL ET METHODES


Virus et lignées cellulaires



[0054] Les virus utilisés dans cette étude sont les virus prototypes VIH-1 NL4.3 et VIH-2 ROD utilisant tous les deux le co-récepteur CXCR4, le virus VIH-1 NLAD8 utilisant le co-récepteur CCR5 et des virus issus d'isolats primaires utilisant le co-récepteur CXCR4 (3 isolats nommés X4 1, X4 2, X4 3 et X4 4), utilisant le co-récepteur CCR5 (3 isolats nommés R5 1, R5 2 et R5 3) ou pouvant utiliser les deux co-récepteurs CXCR4 et CCR5 (4 isolats nommés dual 1, dual 2, dual 3 et dual 4) ainsi qu' un autre rétrovirus, le PFV-1, n'utilisant ni CD4, ni CXCR4 ni CCR5 pour son entrée.

[0055] Les lignées cellulaires Jurkat et Jurkat-CCR5 exprimant CCR5 de manière stable sont utilisées.

Infection


- infection par les virus prototypes



[0056] Les cellules Jurkat et Jurkat-CCR5 sont infectées pendant 3 jours par deux doses infectieuses de VIH-1 NL4.3, VIH-2 ROD afin de tenir compte des modulations liées à la multiplicité d'infection. Les cellules Jurkat-CCR5 sont infectées pendant 3 jours par VIH-1 NLAD8 ou PFV-1.

- infection par les virus issus d'isolats primaires



[0057] Les cellules Jurkat-CCR5 sont infectées pendant 3 jours par les virus X4 1, X4 2, X4 3 et X4 4, R5 1, R5 2, R5 3, dual 1, dual 2, dual 3 ou dual 4. Des cellules Jurkat-CCR5 non infectées sont utilisées en tant que témoin (NI).

Analyse de l'expression des microARN


- Analyse par puce micro-ARN



[0058] Trois jours après infection par les virus prototypes, les ARN sont extraits et soumis à analyse par puces microARN (LC Sciences ou Affymetrix).

- Analyse de l'expression de hsa-miR-638 par RT-PCR



[0059] Trois jours après infection par les virus issus d'isolats primaires, les cellules sont lysées et l'expression de hsa-miR-368 est analysée par RT-qPCR. L'expression de hsa-miR-368 dans les cellules infectées est normalisée par rapport à l'expression de hsa-miR-368 dans des cellules contrôles Jurkat-CCR5 non infectées (NI).

RESULTATS


Exemple 1 : identification des micro-ARN



[0060] Les modulations de l'expression des microARN induites par les virus prototypes VIH-1 NL4.3 et VIH-2 ROD, utilisant tous deux le co-récepteur CXCR4, ont été étudiées. Afin de limiter les variations inter-individus et de travailler avec un fond génétique identique (et donc un répertoire de microARN comparable), ces modulations sont étudiées à la fois au cours de l'infection de la lignée cellulaire Jurkat et de la lignée Jurkat exprimant CCR5. Trois jours après l'infection, les ARN des cellules Jurkat sont extraits et soumis à analyse par puces microARN. Le Tableau 1 met en évidence une sous-population de microARN modulés à la fois par VIH-1 NL4.3 et VIH-2 ROD.
Tableau 1. Modulations significatives (p<0,01) du répertoire de microARN cellulaires induites lors d'une infection par VIH-1 NL4.3 et VIH-2 ROD de cellules Jurkat et Jurkat-CCR5 à 1 et 100 TCID50
microARN dont l'expression est augmentée lors de l'infection par NL4.3 et ROD
hsa-miR-574-5p hsa-miR-575
hsa-miR-663 hsa-miR-638
hsa-miR-149*  
 
microARN dont l'expression est diminuée lors de l'infection par NL4.3 et ROD
hsa-miR-181b hsa-miR-374b
hsa-let-7g hsa-miR-148a
hsa-miR-26b hsa-miR-181d
hsa-let-7c hsa-miR-9*
hsa-miR-7 hsa-miR-98
hsa-miR-30a hsa-let-7e
hsa-miR-9  


[0061] L'infection de cellules Jurkat-CCR5 par VIH-1 NLAD8 (de tropisme R5, Tableau 2) et par le rétrovirus PFV-1 témoin n'utilisant ni CD4, ni CXCR4 ni CCR5 pour son entrée entraîne également des modulations de l'expression de microARN.
Tableau 2. Modulations significatives (p<0,01) du répertoire de microARN cellulaires induites lors de l'infection VIH-1 NLAD8.
microARN dont l'expression est augmentée lors de l'infection par NLAD8
hsa-miR-19a hsa-miR-30b
hsa-miR-19b hsa-miR-23b
hsa-miR-30e hsa-miR-128
hsa-miR-29a hsa-miR-106a
hsa-miR-29c hsa-miR-15a
hsa-miR-342-3p hsa-miR-17
hsa-miR-30c hsa-miR-222
hsa-miR-92b hsa-miR-30d
hsa-miR-1280 hsa-miR-93
hsa-miR-16 hsa-miR-150
hsa-miR-18b hsa-let-7i
hsa-miR-92a hsa-miR-25
hsa-miR-18a hsa-miR-20b
hsa-miR-106b hsa-let-7g
hsa-miR-23a hsa-miR-191
hsa-miR-20a  
 
microARN dont l'expression est diminuée lors de l'infection par NLAD8
hsa-let-7d hsa-miR-923
hsa-let-7a hsa-miR-374b
hsa-miR-181b hsa-miR-342-5p
hsa-miR-21 hsa-miR-181d
hsa-miR-155 hsa-miR-638
hsa-miR-26b hsa-let-7b
hsa-miR-1826 hsa-miR-9
hsa-miR-423-5p hsa-miR-575
hsa-miR-7 hsa-miR-1246
hsa-miR-320c hsa-miR-98
hsa-miR-130b hsa-miR-149*
hsa-miR-182 hsa-let-7e
hsa-miR-320b hsa-miR-574-5p
hsa-miR-320d hsa-miR-483-5p
hsa-let-7c hsa-miR-375
hsa-miR-1275 hsa-miR-936
hsa-miR-320a  


[0062] Par comparaison de ces tableaux, on peut constater que l'expression de neuf microARN est systématiquement diminuée lors de l'infection, quelque soit le VIH et son tropisme (Tableau 3). L'expression de ces microARN n'est pas affectée par l'infection par PFV-1.
Tableau 3. Modulations significatives (p<0,01) du répertoire de microARN cellulaires induites lors de l'infection par NL4.3, ROD et NLAD8.
microARN dont l'expression est diminuée lors de l'infection par NL4.3, ROD et NLAD8
hsa-miR-181b hsa-miR-374b
hsa-miR-26b hsa-miR-181d
hsa-let-7c hsa-miR-98
hsa-miR-7 hsa-let-7e
hsa-miR-9  


[0063] Par ailleurs, l'expression de 5 microARN est augmentée lors de l'infection par NL4.3 ou ROD mais n'est pas augmentée lors de l'infection par NLAD8. Enfin, l'expression de 4 microARN est spécifiquement diminuée lors de l'infection par NL4.3 ou ROD mais n'est pas diminuée lors de l'infection par NLAD8 (Tableau 4). Aucun microARN dont l'expression est augmentée ou diminuée spécifiquement lors de l'infection par NL4.3 ou ROD n'est affecté lors de l'infection par PFV-1.
Tableau 4. Modulations significatives (p<0,01) du répertoire de microARN cellulaires induites spécifiquement lors de l'infection par NL4.3 et ROD (Augmentée, microARN dont l'expression est augmentée lors de l'infection, Diminuée : microARN dont l'expression est diminuée lors de l'infection).
nom du microARNinfection par NL4.3 ou RODSEQ ID NO :
hsa-miR-574-5p augmentée 33
hsa-miR-663 augmentée 34
hsa-miR-149* augmentée 35
hsa-miR-575 augmentée 36
hsa-miR-638 augmentée 37
hsa-miR-181b diminuée 38
hsa-let-7g diminuée 39
hsa-miR-30a diminuée 40
hsa-miR-148a diminuée 41
hsa-miR-9* diminuée 42


[0064] Ces résultats illustrent l'importance des modulations du répertoire de microARN cellulaires induites par l'entrée du virus. Ces analyses mettent également en évidence la possibilité, grâce aux méthodes selon l'invention, de distinguer l'utilisation d'un certain type de co-récepteur (ici CXCR4 ou CCR5) par le VIH sur la base des changements du répertoire cellulaire de microARN.

Exemple 2 :



[0065] Afin de valider les résultats ainsi obtenus, des cellules Jurkat-CCR5 (exprimant à la fois le récepteur CXCR4 et le récepteur CCR5) sont infectées par des virus issus d'isolats primaires utilisant le co-récepteur CXCR4 (X4 1, X4 2, X4 3 et X4 4), utilisant le co-récepteur CCR5 (R5 1, R5 2 et R5 3) ou pouvant utiliser les deux co-récepteurs CXCR4 et CCR5 (dual 1, dual 2, dual 3 et dual 4).

[0066] L'expression de hsa-miR-638 dans les cellules infectées ou non infectées (NI, témoin) est mesurée après 3 jours. Comme attendu et comme indiqué dans la figure 1, l'expression de hsa-miR-638 n'est pas modifiée dans les cellules non infectées. Cette expression n'est pas non plus statistiquement modifiée dans les cellules infectées par des virus utilisant uniquement CCR5 comme co-récepteur pour entrer dans les cellules (R5 1, R5 2 et R5 3) (FIG. 1). Par contre, cette expression est significativement augmentée dans les cellules ayant été infectées par un virus capable d'utiliser le co-récepteur CXCR4 pour entrer dans les cellules (X4 1, X4 2, X4 3, X4 4, dual 1, dual 2, dual 3 et dual 4) (FIG. 1).

[0067] Ces résultats indiquent que seule une infection faisant intervenir le co-récepteur CXCR4 induit une augmentation de l'expression de hsa-miR-638.

[0068] Ces résultats confirment donc les données obtenues dans l'exemple 1 et prouvent, si besoin était, que le niveau d'expression de ce micro-ARN dans une cellule infectée permet de déterminer le co-récepteur utilisé par le virus pour infecter cette cellule et permet donc d'identifier le tropisme de ce virus.

SEQUENCE LISTING



[0069] 

<110> Centre National de la Recherche Scientifique (CNRS)

<120> Identification du tropisme cellulaire de virus

<130> BFF09P0281

<160> 40

<170> PatentIn version 3.4

<210> 1
<211> 4320
<212> DNA
<213> Homo sapiens

<220>
<221> CDS
<222> (1038)..(1052)

<220>
<221> CDS
<222> (3185)..(4225)

<400> 1







<210> 2
<211> 352
<212> PRT
<213> Homo sapiens

<400> 2



<210> 3
<211> 1560
<212> DNA
<213> Homo sapiens

<220>
<221> CDS
<222> (358)..(1416)

<400> 3



<210> 4
<211> 352
<212> PRT
<213> Homo sapiens

<400> 4





<210> 5
<211> 5160
<212> DNA
<213> Homo sapiens

<220>
<221> CDS
<222> (4015)..(5082)

<400> 5







<210> 6
<211> 355
<212> PRT
<213> Homo sapiens

<400> 6



<210> 7
<211> 1680
<212> DNA
<213> Homo sapiens

<220>
<221> CDS
<222> (361)..(1485)

<400> 7





<210> 8
<211> 374
<212> PRT
<213> Homo sapiens

<400> 8



<210> 9
<211> 1260
<212> DNA
<213> Homo sapiens

<220>
<221> CDS
<222> (72)..(1139)

<400> 9



<210> 10
<211> 355
<212> PRT
<213> Homo sapiens

<400> 10





<210> 11
<211> 1380
<212> DNA
<213> Homo sapiens

<220>
<221> CDS
<222> (183)..(1265)

<400> 11



<210> 12
<211> 360
<212> PRT
<213> Homo sapiens

<400> 12



<210> 13
<211> 1320
<212> DNA
<213> Homo spaiens

<220>
<221> CDS
<222> (139)..(1206)

<400> 13





<210> 14
<211> 355
<212> PRT
<213> Homo spaiens

<400> 14



<210> 15
<211> 1186
<212> DNA
<213> Homo sapiens

<220>
<221> CDS
<222> (60)..(1169)

<400> 15





<210> 16
<211> 369
<212> PRT
<213> Homo sapiens

<400> 16



<210> 17
<211> 2400
<212> DNA
<213> Homo sapiens

<220>
<221> CDS
<222> (1178)..(2260)

<400> 17





<210> 18
<211> 360
<212> PRT
<213> Homo sapiens

<400> 18



<210> 19
<211> 1029
<212> DNA
<213> Homo sapiens

<220>
<221> CDS
<222> (1)..(1029)

<400> 19



<210> 20
<211> 342
<212> PRT
<213> Homo sapiens

<400> 20



<210> 21
<211> 1260
<212> DNA
<213> Homo sapiens

<220>
<221> CDS
<222> (93)..(1160)

<400> 21



<210> 22
<211> 355
<212> PRT
<213> Homo sapiens

<400> 22





<210> 23
<211> 1560
<212> DNA
<213> Homo sapiens

<220>
<221> CDS
<222> (387)..(1454)

<400> 23



<210> 24
<211> 355
<212> PRT
<213> Homo sapiens

<400> 24



<210> 25
<211> 1083
<212> DNA
<213> Homo sapiens

<220>
<221> CDS
<222> (1)..(1083)

<400> 25





<210> 26
<211> 360
<212> PRT
<213> Homo sapiens

<400> 26



<210> 27
<211> 1680
<212> DNA
<213> Homo sapiens

<220>
<221> CDS
<222> (450)..(1592)

<400> 27





<210> 28
<211> 380
<212> PRT
<213> Homo sapiens

<400> 28





<210> 29
<211> 1560
<212> DNA
<213> Homo sapiens

<220>
<221> CDS
<222> (355)..(1476)

<400> 29



<210> 30
<211> 373
<212> PRT
<213> Homo sapiens

<400> 30



<210> 31
<211> 23
<212> RNA
<213> Homo sapiens

<400> 31
ugagugugug ugugugagug ugu    23

<210> 32
<211> 22
<212> RNA
<213> Homo sapiens

<400> 32
aggcggggcg ccgcgggacc gc    22

<210> 33
<211> 21
<212> RNA
<213> Homo sapiens

<400> 33
agggagggac gggggcugug c    21

<210> 34
<211> 19
<212> RNA
<213> Homo sapiens

<400> 34
gagccaguug gacaggagc    19

<210> 35
<211> 25
<212> RNA
<213> Homo sapiens

<400> 35
agggaucgcg ggcggguggc ggccu    25

<210> 36
<211> 23
<212> RNA
<213> Homo sapiens

<400> 36
aacauucauu.gcugucggug ggu    23

<210> 37
<211> 22
<212> RNA
<213> Homo sapiens

<400> 37
ugagguagua guuuguacag uu    22

<210> 38
<211> 22
<212> RNA
<213> Homo sapiens

<400> 38
uguaaacauc cucgacugga ag    22

<210> 39
<211> 22
<212> RNA
<213> Homo sapiens

<400> 39
ucagugcacu acagaacuuu gu    22

<210> 40
<211> 22
<212> RNA
<213> Homo sapiens

<400> 40
auaaagcuag auaaccgaaa gu    22




Revendications

1. Méthode in vitro d'identification de microARN, ou de leurs ARNm cibles, dont l'expression, lors de l'infection de cellules par un virus utilisant un récepteur cellulaire et au moins un co-récepteur cellulaire pour entrer dans la cellule, est spécifiquement modifiée en fonction du co-récepteur cellulaire utilisé par le virus pour son entrée dans les cellules, comprenant :

i) déterminer les niveaux d'expression de microARN dans une cellule test, exprimant un récepteur, un premier co-récepteur et au moins un autre co-récepteur, après infection respectivement par un premier virus utilisant le premier co-récepteur et par au moins un autre virus utilisant un autre co-récepteur ;

ii) identifier les microARN dont le niveau d'expression est modulé lors de l'infection par chacun des virus par rapport au niveau d'expression dans des cellules non infectées ;

iii) comparer les microARN ainsi identifiés ;

iv) sélectionner les microARN dont la modification du niveau d'expression est spécifique de l'utilisation d'un co-récepteur ;

v) éventuellement identifier les ARNm cibles des micro-ARN ainsi sélectionnés.


 
2. Méthode selon la revendication 1, dans laquelle la cellule test exprime un premier et un deuxième co-récepteurs et est infectée par un premier virus utilisant le premier co-récepteur et un deuxième virus utilisant le deuxième co-récepteur pour entrer dans la cellule.
 
3. Méthode selon la revendication 1 ou 2, dans laquelle les virus sont des rétrovirus.
 
4. Méthode selon l'une des revendications 1 à 3, dans laquelle les virus sont des virus VIH.
 
5. Méthode selon la revendication 4, dans laquelle le co-récepteur utilisé par un des virus VIH est sélectionné dans le groupe constitué de CXCR4, CCR5, CCR3, CCR2, CCR1, CCR4, CCR8, CCR9, CXCR2, STRL33, V28, gpr1, gpr15 et ChemR23.
 
6. Méthode selon la revendication 5, dans laquelle le co-récepteur utilisé par le premier virus VIH est CXCR4 et le co-récepteur utilisé par le deuxième virus VIH est CCR5.
 
7. Méthode selon l'une des revendications 4 à 6, dans laquelle les cellules test sont les cellules Jurkat-CCR5.
 
8. Méthode in vitro d'identification d'un co-récepteur cellulaire utilisé par un virus utilisant un récepteur cellulaire et au moins un co-récepteur cellulaire pour entrer dans une cellule, chez un patient infecté par le virus, comprenant :

i) mettre en contact un échantillon du patient susceptible de contenir le virus avec une cellule test exprimant un récepteur cellulaire du virus et au moins un co-récepteur cellulaire du virus ;

ii) déterminer le niveau d'expression d'au moins un miRNA dont l'expression est spécifiquement modifiée en fonction du co-récepteur cellulaire utilisé par le virus pour son entrée dans les cellules et/ou d'au moins un ARNm cible dudit miRNA dans la cellule test ;

iii) comparer le niveau d'expression à une valeur prédéterminée ;

iv) en déduire si le virus utilise ou non un co-récepteur cellulaire exprimé par la cellule test.


 
9. Méthode selon la revendication 8, dans laquelle la valeur prédéterminée est le niveau d'expression du miRNA ou de l'ARNm dans une cellule test non infectée.
 
10. Méthode selon la revendication 8 ou 9, dans laquelle le virus est le virus VIH et dans laquelle la cellule test exprime le récepteur cellulaire CD4.
 
11. Méthode selon la revendication 10, dans laquelle la cellule test exprime un co-récepteur cellulaire sélectionné dans le groupe constitué de CXCR4, CCR5, CCR3, CCR2, CCR1, CCR4, CCR8, CCR9, CXCR2, STRL33, V28, gpr1, gpr15 et ChemR23.
 
12. Méthode selon la revendication 10, dans laquelle la cellule test exprime CXCR4.
 
13. Méthode selon l'une des revendication 10 à 12, dans laquelle le microARN est sélectionné dans le groupe constitué de hsa-miR574-5p, hsa-miR-663, hsa-miR-149*, hsa-miR-575, hsa-miR-638, hsa-miR-181b, hsa-let-7g, hsa-miR-30a, hsa-miR-148a et hsa-miR-9*.
 
14. Méthode selon la revendication 13, dans laquelle une augmentation de l'expression d'au moins un microARN sélectionné dans le groupe comprenant hsa-miR574-5p, hsa-miR-663, hsa-miR-149*, hsa-miR-575, hsa-miR-638 ou une diminution de l'expression d'au moins un microARN sélectionné dans le groupe comprenant hsa-miR-181 b, hsa-let-7g, hsa-miR-30a, hsa-miR-148a et hsa-miR-9* indique que CXCR4 est un co-récepteur utilisé par le virus VIH.
 
15. Méthode selon l'une des revendications 8 à 14, dans laquelle le niveau d'expression des microARN ou la quantité de mRNA est mesuré(e) par RT-PCR ou à l'aide d'une micropuce.
 
16. Méthode selon l'une des revendications 10 à 15, dans laquelle les cellules test sont sélectionnées dans le groupe constitué des cellules Jurkat et des cellules Jurkat-CCR5.
 


Ansprüche

1. in vitro-Identifikationsmethode von microRNA oder ihrer Ziel-mRNA, deren Expression bei der Infektion von Zellen durch ein Virus, das einen Zellrezeptor und mindestens einen Zell-Corezeptor verwendet, um in die Zelle einzudringen, in Abhängigkeit vom von dem Virus für sein Eindringen in die Zellen verwendeten Zell-Corezeptor speziell modifiziert ist, die umfasst:

i) Bestimmen der Expressionsniveaus von microRNA in einer Testzelle, die einen Rezeptor, einen ersten Corezeptor und mindestens einen anderen Corezeptor exprimiert, nach Infektion jeweils durch ein erstes Virus, das den ersten Corezeptor verwendet, und durch mindestens ein anderes Virus, das einen anderen Corezeptor verwendet,

ii) Identifizieren der microRNA, deren Expressionsniveau bei der Infektion durch jedes der Viren im Verhältnis zum Expressionsniveau in nicht infizierten Zellen moduliert ist,

iii) Vergleichen der derart identifizierten microRNA,

iv) Auswählen der microRNA, deren Modifikation des Expressionsniveaus für die Verwendung eines Corezeptors spezifisch ist,

v) eventuell identifizieren der Ziel-mRNA der derart ausgewählten microRNA.


 
2. Methode nach Anspruch 1, wobei die Testzelle einen ersten und einen zweiten Corezeptor exprimiert und von einem ersten Virus, das den ersten Corezeptor verwendet, und einem zweiten Virus, das den zweiten Corezeptor verwendet, um in die Zelle einzudringen, infiziert ist.
 
3. Methode nach Anspruch 1 oder 2, wobei die Viren Retroviren sind.
 
4. Methode nach einem der Ansprüche 1 bis 3, wobei die Viren HIV-Viren sind.
 
5. Methode nach Anspruch 4, wobei der von einem der HIV-Viren verwendete Corezeptor aus der Gruppe ausgewählt ist, die von CXCR4, CCR5, CCR3, CCR2, CCR1 , CCR4, CCR8, CCR9, CXCR2, STRL33, V28, gprl, gprl 5 und ChemR23 gebildet ist.
 
6. Methode nach Anspruch 5, wobei der von dem ersten HIV-Virus verwendete Corezeptor CXCR4 ist und der von dem zweiten HIV-Virus verwendete Corezeptor CCR5 ist.
 
7. Methode nach einem der Ansprüche 4 bis 6, wobei die Testzellen die Jurkat-CCR5-Zellen sind.
 
8. in vitro-Identifikationsmethode eines Zell-Corezeptors, der von einem Virus verwendet wird, das einen Zellrezeptor und mindestens einen Zell-Corezeptor verwendet, um bei einem von dem Virus infizierten Patienten in eine Zelle einzudringen , die umfasst:

i) Inkontaktversetzen einer Probe des Patienten, die das Virus enthalten könnte, mit einer Testzelle, die einen Zellrezeptor des Virus und mindestens einen Zell-Corezeptor des Virus exprimiert,

ii) Bestimmen des Expressionsniveaus mindestens einer miRNA, deren Expressionsniveau in Abhängigkeit von dem Zell-Corezeptor, der von dem Virus für sein Eindringen in die Zellen verwendet wird, speziell modifiziert ist, und/oder mindestens einer Ziel-mRNA der miRNA in der Testzelle,

iii) Vergleichen des Expressionsniveaus mit einem vorbestimmten Wert,

iv) Ableiten daraus, ob das Virus einen Zell-Corezeptor benutzt, der von der Testzelle exprimiert wird, oder nicht.


 
9. Methode nach Anspruch 8, wobei der vorbestimmte Wert das Expressionsniveau der miRNA oder der mRNA in einer nicht infizierten Testzelle ist.
 
10. Methode nach Anspruch 8 oder 9, wobei das Virus das HIV-Virus ist und wobei die Testzelle den Zellrezeptor CD4 exprimiert.
 
11. Methode nach Anspruch 10, wobei die Testzelle einen Zell-Corezeptor exprimiert, der aus der Gruppe ausgewählt ist, die von CXCR4, CCR5, CCR3, CCR2, CCR1, CCR4, CCR8, CCR9, CXCR2, STRL33, V28, gprl, gpr15 und ChemR23 gebildet ist.
 
12. Methode nach Anspruch 10, wobei die Testzelle CXCR4 exprimiert.
 
13. Methode nach einem der Ansprüche 10 bis 12, wobei die microRNA aus der Gruppe ausgewählt ist, die von hsa-miR574-5p, hsa-miR-663, hsa-miR-149*, hsa-miR-575, hsa-miR-638, hsa-miR-181 b, hsa-let-7g, hsa-miR-30a, hsa-miR-148a und hsa-miR-9* gebildet ist.
 
14. Methode nach Anspruch 13, wobei eine Erhöhung der Expression mindestens einer microRNA, ausgewählt aus der Gruppe umfassend hsa-miR574-5p, hsa-miR-663, hsa-miR-149*, hsa-miR-575, hsa-miR-638, oder eine Verringerung der Expression mindestens einer microRNA, ausgewählt aus der Gruppe unfassend hsa-miR-181b, hsa-let-7g, hsa-miR-30a, hsa-miR-148a und hsa-miR-9*, anzeigt, dass CXCR4 ein von dem HIV-Virus verwendeter Corezeptor ist.
 
15. Methode nach einem der Ansprüche 8 bis 14, wobei das Expressionsniveau der microRNA oder die Menge von mRNA durch RT-PCR oder mit Hilfe eines Mikrochips gemessen wird.
 
16. Methode nach einem der Ansprüche 10 bis 15, wobei die Testzellen aus der Gruppe ausgewählt sind, die von den Jurkat-Zellen und den Jurkat-CCR5-Zellen gebildet ist.
 


Claims

1. An in vitro method for identifying microRNAs, or their target mRNAs, the expression of which, during infection of cells by a virus using a cell receptor and at least one cell co-receptor for entering the cell, is specifically modified according to the cell co-receptor used by the virus for its entry into the cells, comprising:

i) determining the expression levels of microRNAs in a test cell, expressing a receptor, a first co-receptor and at least one other co-receptor, after infection by a first virus using the first co-receptor and by at least one other virus using another co-receptor, respectively;

ii) identifying the microRNAs, the expression level of which is modulated during the infection by each of the viruses relatively to the expression level in uninfected cells;

iii) comparing the thus-identified microRNAs;

iv) selecting the microRNAs, the modification of the expression level of which is specific to the use of a co-receptor;

v) optionally identifying the target mRNAs of the thereby selected microRNAs.


 
2. The method according to claim 1, wherein the test cell expresses a first and a second co-receptors and is infected with a first virus using the first co-receptor and a second virus using the second co-receptor for entering the cell.
 
3. The method according to claim 1 or 2, wherein the viruses are retroviruses.
 
4. The method according to any one of claims 1 to 3, wherein the viruses are HIV viruses.
 
5. The method according to claim 4, wherein the co-receptor used by one of the HIV viruses is selected from the group consisting of CXCR4, CCR5, CCR3, CCR2, CCR1, CCR4, CCR8, CCR9, CXCR2, STRL33, V28, gpr1, gpr15 and ChemR23.
 
6. The method according to claim 5, wherein the co-receptor used by the first HIV virus is CXCR4 and the co-receptor used by the second HIV virus is CCR5.
 
7. The method according to any one of claims 4 to 6, wherein the test cells are Jurkat-CCR5 cells.
 
8. An in vitro method for identifying a cell co-receptor used by a virus using a cell receptor and at least one cell co-receptor for entering a cell, in a patient infected with the virus, comprising:

i) putting a sample of the patient which may contain the virus in contact with a test cell expressing a cell receptor of the virus and at least one cell co-receptor of the virus;

ii) determining the expression level of at least one miRNA, the expression of which is specifically modified depending on the cell co-receptor used by the virus for its entry into the cells and/or of at least one target mRNA of said miRNA in the test cell;

iii) comparing the expression level with a predetermined value;

iv) inferring therefrom whether the virus uses or not a cell co-receptor expressed by the test cell.


 
9. The method according to claim 8, wherein the predetermined value is the expression level of the miRNA or of the mRNA in an uninfected test cell.
 
10. The method according to claim 8 or 9, wherein the virus is the HIV virus and wherein the test cell expresses the cell receptor CD4.
 
11. The method according to claim 10, wherein the test cell expresses a cell co-receptor selected from the group consisting of CXCR4, CCR5, CCR3, CCR2, CCR1, CCR4, CCR8, CCR9, CXCR2, STRL33, V28, gpr1, gpr15 and ChemR23.
 
12. The method according to claim 10, wherein the test cell expresses CXCR4.
 
13. The method according to any one of claims 10 to 12, wherein the microRNA is selected from the group consisting of hsa-miR574-5p, hsa-miR-663, hsa-miR-149*, hsa-miR-575, hsa-miR-638, hsa-miR-181b, hsa-let-7g, hsa-miR-30a, hsa-miR-148a and hsa-miR-9*.
 
14. The method according to claim 13, wherein an increase in the expression of at least one microRNA selected from the group comprising hsa-miR574-5p, hsa-miR-663, hsa-miR-149*, hsa-miR-575, hsa-miR-638 or a decrease in the expression of at least one microRNA selected from the group comprising hsa-miR-181b, hsa-let-7g, hsa-miR-30a, hsa-miR-148a and hsa-miR-9* indicates that CXCR4 is a co-receptor used by the HIV virus.
 
15. The method according to any one of claims 8 to 14, wherein the expression level of the microRNAs or the amount of mRNA is measured by RT-PCR or by means of a microchip.
 
16. The method according to any one of claims 10 to 15, wherein the test cells are selected from the group consisting of Jurkat cells and of Jurkat-CCR5 cells.
 




Dessins






RÉFÉRENCES CITÉES DANS LA DESCRIPTION



Cette liste de références citées par le demandeur vise uniquement à aider le lecteur et ne fait pas partie du document de brevet européen. Même si le plus grand soin a été accordé à sa conception, des erreurs ou des omissions ne peuvent être exclues et l'OEB décline toute responsabilité à cet égard.

Littérature non-brevet citée dans la description