(19)
(11)EP 2 559 767 B1

(12)EUROPEAN PATENT SPECIFICATION

(45)Mention of the grant of the patent:
12.04.2017 Bulletin 2017/15

(21)Application number: 12192660.4

(22)Date of filing:  12.10.2007
(51)Int. Cl.: 
C12N 15/82  (2006.01)
A01H 5/00  (2006.01)

(54)

Plant microRNAs and methods of use thereof

Pflanzliche Mikro-RNAs und Verfahren zur Verwendung davon

Micro-ARN de plantes et leurs procédés d'utilisation


(84)Designated Contracting States:
AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC MT NL PL PT RO SE SI SK TR

(30)Priority: 12.10.2006 US 851187 P
29.03.2007 US 908826 P
31.08.2007 US 969195 P

(43)Date of publication of application:
20.02.2013 Bulletin 2013/08

(62)Application number of the earlier application in accordance with Art. 76 EPC:
07874082.6 / 2074227

(73)Proprietor: Monsanto Technology LLC
St. Louis, Missouri 63167 (US)

(72)Inventors:
  • Allen, Edwards
    St. Louis, MO 63167 (US)
  • Goldman, Barry S.
    St. Louis, MO 63167 (US)
  • Guo, Liang
    St. Louis, MO 63167 (US)
  • Heisel, Sara E.
    St. Louis, MO 63167 (US)
  • Huang, Shihshieh
    St. Louis, MO 63167 (US)
  • Ivashuta, Sergey I.
    St. Louis, MO 63167 (US)
  • Krieger, Elysia K.
    St. Louis, MO 63167 (US)
  • Roberts, James K.
    St. Louis, MO 63167 (US)
  • Zhang, Yuanji I.
    St. Louis, MO 63167 (US)

(74)Representative: dompatent von Kreisler Selting Werner - Partnerschaft von Patent- und Rechtsanwälten mbB 
Deichmannhaus am Dom Bahnhofsvorplatz 1
50667 Köln
50667 Köln (DE)


(56)References cited: : 
  
  • SCHWAB REBECCA ET AL: "Specific effects of MicroRNAs on the plant transcriptome", DEVELOPMENTAL CELL, CELL PRESS, US, vol. 8, no. 4, 1 April 2005 (2005-04-01), pages 517-527, XP002520530, ISSN: 1534-5807, DOI: 10.1016/J.DEVCEL.2005.01.018
  • ALLISON C MALLORY ET AL: "MicroRNA control of PHABULOSA in leaf development: importance of pairing to the microRNA 5' region", THE EMBO JOURNAL, vol. 23, no. 16, 18 August 2004 (2004-08-18), pages 3356-3364, XP055050718, ISSN: 0261-4189, DOI: 10.1038/sj.emboj.7600340
  • FRANCO-ZORILLA ET AL: "Target mimicry provides a new mechanism for regulation of microRNA activity", NATURE GENETICS, NATURE PUBLISHING GROUP, NEW YORK, US, vol. 39, no. 8, 1 August 2007 (2007-08-01) , pages 1033-1037, XP008112763, ISSN: 1061-4036, DOI: 10.1038/NG2079
  • MICHAEL J. AXTELL ET AL: "A Two-Hit Trigger for siRNA Biogenesis in Plants", CELL, vol. 127, no. 3, 1 November 2006 (2006-11-01), pages 565-577, XP055050713, ISSN: 0092-8674, DOI: 10.1016/j.cell.2006.09.032
  • PALATNIK JAVIER F ET AL: "Control of leaf morphogenesis by microRNAs", NATURE: INTERNATIONAL WEEKLY JOURNAL OF SCIENCE, NATURE PUBLISHING GROUP, UNITED KINGDOM, vol. 425, no. 6955, 18 September 2003 (2003-09-18), pages 257-263, XP002357529, ISSN: 0028-0836, DOI: 10.1038/NATURE01958
  • ALLISON C MALLORY ET AL: "Functions of microRNAs and related small RNAs in plants", NATURE GENETICS, vol. 38, no. 6s, 1 June 2006 (2006-06-01), pages S31-S36, XP055057928, ISSN: 1061-4036, DOI: 10.1038/ng1791
  • JOHN PAUL ALVAREZ ET AL: "Endogenous and synthetic microRNAs stimulate simultaneous, efficient, and localized regulation of multiple targets in diverse species", THE PLANT CELL, AMERICAN SOCIETY OF PLANT BIOLOGISTS, US, vol. 18, 1 April 2006 (2006-04-01), pages 1134-1151, XP008131065, ISSN: 1040-4651, DOI: 10.1105/TPC.105.040725
  • DUGAS D V ET AL: "MicroRNA regulation of gene expression in plants", CURRENT OPINION IN PLANT BIOLOGY, QUADRANT SUBSCRIPTION SERVICES, GB, vol. 7, no. 5, 1 October 2004 (2004-10-01) , pages 512-520, XP027554822, ISSN: 1369-5266 [retrieved on 2004-08-27]
  • BERKHOUT B ET AL: "The interplay between virus infection and the cellular RNA interference machinery", FEBS LETTERS, ELSEVIER, AMSTERDAM, NL, vol. 580, no. 12, 22 May 2006 (2006-05-22) , pages 2896-2902, XP028030562, ISSN: 0014-5793, DOI: 10.1016/J.FEBSLET.2006.02.070 [retrieved on 2006-05-22]
  • GITLIN LEONID ET AL: "Poliovirus escape from RNA interference: Short interfering RNA-target recognition and implications for therapeutic approaches", JOURNAL OF VIROLOGY, vol. 79, no. 2, January 2005 (2005-01), pages 1027-1035, XP007921704, ISSN: 0022-538X
 
Remarks:
 
Note: Within nine months from the publication of the mention of the grant of the European patent, any person may give notice to the European Patent Office of opposition to the European patent granted. Notice of opposition shall be filed in a written reasoned statement. It shall not be deemed to have been filed until the opposition fee has been paid. (Art. 99(1) European Patent Convention).


Description

FIELD OF THE INVENTION



[0001] This invention discloses a method of decreasing microRNAl activity in a plant cell by expression in the plant cell, a recombinant DNA construct comprising at least one miRNA decoy sequence, recognized and bound, but not cleaved, by a mature miRNA expressed in said plant cell, non-natural transgenic plant cells, plants, and seeds containing in their genome such a recombinant DNA construct.

BACKGROUND OF THE INVENTION



[0002] Several cellular pathways involved in RNA-mediated gene suppression have been described, each distinguished by a characteristic pathway and specific components. See, for example, the reviews by Brodersen and Voinnet (2006), Trends Genetics, 22:268-280, and Tomari and Zamore (2005) Genes & Dev., 19:517-529. The siRNA pathway involves the non-phased cleavage of a double-stranded RNA ("RNA duplex") to small interfering RNAs (siRNAs). The microRNA pathway involves microRNAs (miRNAs), non-protein coding RNAs generally of between about 19 to about 25 nucleotides (commonly about 20 - 24 nucleotides in plants) that guide cleavage in trans of target transcripts, negatively regulating the expression of genes involved in various regulation and development pathways. Plant miRNAs have been defined by a set of characteristics including a stem-loop precursor that is processed by DCL1 to a single specific ∼21-nucleotide miRNA, expression of a single pair of miRNA and miRNA* species from the RNA duplex with two-nucleotide 3' overhangs, and silencing of specific targets in trans. See Bartel (2004) Cell, 116:281-297; Kim (2005) Nature Rev. Mol. Cell Biol., 6:376-385; Jones-Rhoades et al. (2006) Annu. Rev. Plant Biol., 57:19-53; Ambros et al. (2003) RNA, 9:277-279. In the trans-acting siRNA (ta-siRNA) pathway, miRNAs serve to guide in-phase processing of siRNA primary transcripts in a process that requires an RNA-dependent RNA polymerase for production of an RNA duplex; trans-acting siRNAs are defined by lack of secondary structure, an miRNA target site that initiates production of double-stranded RNA, requirements of DCL4 and an RNA-dependent RNA polymerase (RDR6), and production of multiple perfectly phased ∼21-nucleotide small RNAs with perfectly matched duplexes with two- nucleotide 3' overhangs (see Allen et al. (2005) Cell, 121:207-221).

[0003] MicroRNAs (miRNAs) are non-protein coding RNAs, generally of between about 19 to about 25 nucleotides (commonly about 20 - 24 nucleotides in plants), that guide cleavage in trans of target transcripts, negatively regulating the expression of genes involved in various regulation and development pathways (Bartel (2004) Cell, 116:281-297). In some cases, miRNAs serve to guide in-phase processing of siRNA primary transcripts (see Allen et al. (2005) Cell, 121:207-221).

[0004] Some microRNA genes (MIR genes) have been identified and made publicly available in a database ('miRBase", available on line at microrna.sanger.ac.uk/sequences). The applicants have disclosed novel MIR genes, mature miRNAs, and miRNA recognition sites in U. S. Patent Application Publication 2006/0200878. Additional MIR genes and mature miRNAs are also described in U. S. Patent Application Publications 2005/0120415 and 2005/144669. MIR genes have been reported to occur in intergenic regions, both isolated and in clusters in the genome, but can also be located entirely or partially within introns of other genes (both protein-coding and non-protein-coding). For a recent review of miRNA biogenesis, see Kim (2005) Nature Rev. Mol. Cell Biol., 6:376-385. Transcription of MIR genes can be, at least in some cases, under promotional control of a MIR gene's own promoter. MIR gene transcription is probably generally mediated by RNA polymerase II (see, e. g., Aukerman. and Sakai (2003) Plant Cell, 15:2730-2741; Parizotto et al. (2004) Genes Dev.,18:2237-2242), and therefore could be amenable to gene silencing approaches that have been used in other polymerase II-transcribed genes. The primary transcript (which can be polycistronic) is termed a "pri-miRNA", a miRNA precursor molecule that can be quite large (several kilobases) and contains one or more local double-stranded or "hairpin" regions as well as the usual 5' "cap" and polyadenylated tail of an mRNA. See, for example, Figure 1 in Kim (2005) Nature Rev. Mol. Cell Biol., 6:376-385.

[0005] In plant cells, microRNA precursor molecules are believed to be largely processed in the nucleus. The pri-miRNA is processed to a shorter miRNA precursor molecule that also includes a stem-loop or fold-back structure and is termed the "pre-miRNA". In plants, miRNAs and siRNAs are formed by distinct DICER-like (DCL) enzymes, and in Arabidopsis a nuclear DCL enzyme (DCL1) is believed to be required for mature miRNA formation; see, for example, Ambros et al. (2003) RNA, 9:277-279, and Xie et al. (2004) PLoS Biol., 2:642-652. Additional reviews on microRNA biogenesis and function are found, for example, in Bartel (2004) Cell, 116:281-297; Murchison and Hannon (2004) Curr. Opin. Cell Biol., 16:223-229; and Dugas and Bartel (2004) Curr. Opin. Plant Biol., 7:512-520. MicroRNAs can thus be described in terms of RNA (e. g., RNA sequence of a mature miRNA or a miRNA precursor RNA molecule), or in terms of DNA (e. g., DNA sequence corresponding to a mature miRNA RNA sequence or DNA sequence encoding a MIR gene or fragment of a MIR gene or a miRNA precursor).

[0006] MIR gene families are estimated to account for 1% of at least some genomes and capable of influencing or regulating expression of about a third of all genes (see, e. g., Tomari et al. (2005) Curr. Biol., 15:R61-64; G. Tang (2005) Trends Biochem. Sci., 30:106-14; Kim (2005) Nature Rev. Mol. Cell Biol., 6:376-385). Because miRNAs are important regulatory elements in eukaryotes, including animals and plants, transgenic suppression of miRNAs could, for example, lead to the understanding of important biological processes or allow the manipulation of certain pathways (e. g., regulation of cellular differentiation, proliferation, and apoptosis) useful, for example, in biotechnological applications. See, for example, O'Donnell et al. (2005) Nature, 435:839-843; Cai et al. (2005) Proc. Natl. Acad. Sci. USA, 102:5570-5575; Morris and McManus (2005) Sci. STKE, pe41
(stke.sciencemag.org/cgi/reprint/sigtrans;2005/297/pe41.pdf). MicroRNA (MIR) genes have identifying characteristics, including conservation among plant species, a stable foldback structure, and processing of a specific miRNA/miRNA* duplex by Dicer-like enzymes (Ambros et al. (2003) RNA, 9:277-279). These characteristics have been used to identify miRNAs and their corresponding genes in plants (Xie et al. (2005) Plant Physiol., 138:2145-2154; Jones-Rhoades and Bartel (2004) Mol. Cell, 14:787-799; Reinhart et al. (2002) Genes Dev., 16:1616-1626; Sunkar and Zhu (2004) Plant Cell, 16:2001-2019). Publicly available microRNA genes are catalogued at miRBase (Griffiths-Jones et al. (2003) Nucleic Acids Res., 31:439-441).

[0007] MiRNAs are expressed in very specific cell types in Arabidopsis (see, for example, Kidner and Martienssen (2004) Nature, 428:81-84, Millar and Gubler (2005) Plant Cell, 17:705-721). Suppression can be limited to a side, edge, or other division between cell types, and is believed to be required for proper cell type patterning and specification (see, e. g., Palatnik et al. (2003) Nature, 425:257-263). Suppression of a GFP reporter gene containing an endogenous miR171 recognition site was found to limit expression to specific cells in transgenic Arabidopsis (Parizotto et al. (2004) Genes Dev., 18:2237-2242). Recognition sites of miRNAs have been validated in all regions of an mRNA, including the 5' untranslated region, coding region, and 3' untranslated region, indicating that the position of the miRNA target site relative to the coding sequence may not necessarily affect suppression (see, e. g., Jones-Rhoades and Bartel (2004). Mol. Cell, 14:787-799, Rhoades et al. (2002) Cell, 110:513-520, Allen et al. (2004) Nat. Genet., 36:1282-1290, Sunkar and Zhu (2004) Plant Cell, 16:2001-2019).

[0008] The mature miRNAs disclosed herein are processed from MIR genes that generally belong to canonical families conserved across distantly related plant species. These MIR genes and their encoded mature miRNAs are also useful, e. g., for modifying developmental pathways, e. g., by affecting cell differentiation or morphogenesis (see, for example, Palatnik et al. (2003) Nature, 425:257-263; Mallory et al. (2004) Curr. Biol., 14:1035-1046), to serve as sequence sources for engineered (non-naturally occurring) miRNAs that are designed to silence sequences other than the transcripts targetted by the naturally occurring miRNA sequence (see, for example, Parizotto et al. (2004) Genes Dev., 18:2237-2242; also see U.S. Patent Application Publications 2004/3411A1 and 2005/0120415, and to stabilize dsRNA. A MIR gene itself (or its native 5' or 3' untranslated regions, or its native promoter or other elements involved in its transcription) is useful as a target gene for gene suppression (e. g., by methods of the present invention), where suppression of the miRNA encoded by the MIR gene is desired. Promoters of MIR genes can have very specific expression patterns (e. g., cell-specific, tissue-specific, or temporally specific), and thus are useful in recombinant constructs to induce such specific transcription of a DNA sequence to which they are operably linked.

[0009] This invention provides a method of decreasing miRNA activity in a plant cell (including crop plants such as maize, rice, and soybean), by expression in the plant cell a recombinant DNA construct includingat least one miRNA decoy sequence recognized and bound, but not cleaved by a mature miRNA expression said plant cell. Also disclosed and claimed are non-natural transgenic plant cells, plants, and seeds containing in their genome such a recombinant DNA construct.

SUMMARY OF THE INVENTION



[0010] In one aspect, this invention provides a method of decreasing miRNA activity in a plant cell comprising expressing in a plant cell a recombinant DNA construct comprising a heterologous promoter operably linked to DNA encoding at least one synthetic miRNA decoy sequence consisting of 19 to 36 contiguous RNA nucleotides, wherein said synthetic miRNA decoy sequence is recognized and bound, but not cleaved, by a mature miRNA expressed in said plant cell, resulting in base-pairing between said synthetic miRNA decoy sequence and said mature miRNA, thereby forming a cleavage-resistant RNA duplex comprising at least one mismatch between said synthetic miRNA decoy sequence and said mature miRNA at positions 9, 10, or 11 of said mature plant miRNA, or at least one insertion at a position in said synthetic miRNA decoy sequence corresponding to positions 10-11 of said mature miRNA, whereby activity of said mature miRNA in said plant cell is decreased, relative to that wherein said recombinant DNA construct is not expressed in said plant cell..

[0011] Another aspect of this invention provides a non-natural transgenic plant cell in which activity of said mature miRNA has been decreased by the method said forth hereinbefore, i.e. said plant cell including any of the above mentioned recombinant DNA constructs. Further provided is a non-natural transgenic plant containing the non-natural transgenic plant cell said forth hereinbefore, including plants of any developmental stage, and including a regenerated plant prepared from the non-natural transgenic plant cells disclosed herein, or a progeny plant (which can be an inbred or hybrid progeny plant) of the regenerated plant, or seed of such a non-natural transgenic plant, said transgenic plant having in its genome and expression any of the above-mentioned recombinant DNA constructs, wherein said non-natural transgenic plant has at least one altered trait, relative to a plant lacking said recombinant DNA construct, selected from the traits: improved abiotic stress tolerance; improved biotic stress tolerance; improved resistance to a pest or pathogen of said plant; modified primary metabolite composition; modified secondary metabolite composition; modified trace element, carotenoid, or vitamin composition; improved yield; improved ability to use nitrogen or other nutrients; modified agronomic characteristics; modified growth or reproductive characteristics; and improved harvest, storage, or processing quality.

[0012] In a further aspect, this invention provides a non-natural transgenic crop plant having at least one altered trait, wherein said non-natural transgenic crop plant comprises and expresses the recombinant DNA construct as set forth hereinbefore, thereby resulting in said non-natural transgenic crop plant exhibiting at least one altered trait, relative to a crop plant not expressing said recombinant DNA construct, selected from the traits: improved abiotic stress tolerance; improved biotic stress tolerance; improved resistance to a pest or pathogen of said plant; modified primary metabolite composition; modified secondary metabolite composition; modified trace element, carotenoid, or vitamin composition; improved yield; improved ability to use nitrogen or other nutrients; modified agronomic characteristics; modified growth or reproductive characteristics; and improved harvest, storage, or processing quality.

[0013] Other specific embodiments of the invention are disclosed in the following detailed description.

BRIEF DESCRIPTION OF THE DRAWINGS



[0014] 

Figure 1 depicts a non-limiting example of a fold-back structure of a plant miRNA precursor sequence selected from SEQ ID NOS. 1036 - 2690, SEQ ID NOS. 3922 - 5497, SEQ ID NOS. 6684 - 8408, SEQ ID NOS. 8561 - 8417, SEQ ID NO. 8743, SEQ ID NO. 8800, and SEQ ID NOS. 8816 - 8819, more specifically, the fold-back structure of the miRNA precursor sequence having SEQ ID NO. 1136, which includes two short stem-loops, a loop, and two bulges. The miRNA precursor is processed in planta to a mature miRNA (in this particular example, to the mature miRNA having SEQ ID NO. 32).

Figures 2 and 3 depict non-limiting examples of DNA elements for suppressing expression of a target gene, e. g., an endogenous miRNA, as described in Example 3.

Figure 4 depicts Northern blot results for mature miRNAs isolated from different maize tissues, as described in Example 4.

Figure 5 depicts transcription profiles of probeset sequences including miRNA precursor sequences having expression patterns specific to maize male reproductive tissue (pollen), as described in Example 4.

Figure 6 depicts drought stages for soybean plants a relative scoring system from 1.0 (no effect or control) to 4.0, as described in Example 5.
As described in Example 6, Figure 7A depicts the fold-back structure of a miRMON18 precursor from maize (SEQ ID NO. 3936), Figure 7B depicts the fold-back structure of a miRMON18 precursor from rice (SEQ ID NO. 1763), and Figure 7C depicts the fold-back structure of a miR827precursor from Arabidopsis thaliana (SEQ ID NO. 8743). Figure 7D depicts a comparison of miR827 (SEQ ID NO. 8744) and miRMON18 (SEQ ID NO. 393, SEQ ID NO. 3227, or SEQ ID NO. 8742), with numbered arrows indicating positions 1, 10, and 21 of the mature miRNA; the nucleotide at position 10 is also underlined.

Figure 8 depicts expression patterns of miRMON18 as determined by Northern blots of the mature miRMON18 21-mer (Figure 8A) and transcription profiling of the miRMON18 precursor (Figure 8B), as described in Example 6.

Figure 9 depicts analysis of expression of the maize miRMON18 precursor (SEQ ID NO. 3936) in maize tissues from plants grown under water-deficient (drought) (Figure 9A), cold (Figure 9B), and nitrogen-deficient conditions (Figure 9C), as described in Example 6.

Figure 10 depicts results of northern blots of small RNAs in maize (Zea mays var. LH244), showing enhanced miRMON18 expression in maize endosperm and kernel, and strong miRMON18 suppression in leaves induced by nitrogen deficiency (Figure 10A), and strong miRMON18 expression in leaf tissue under phosphate-sufficient conditions and miRMON18 suppression under phosphate-deficient conditions (Figure 10B), as described in Example 6.

Figure 11 depicts a multiple sequence alignment of novel maize miRMON18 target genes containing the maize SPX domain (indicated by underlined sequence, where present) and the maize MFS domain (indicated by sequence in bold text), as described in Example 7.

Figure 12 depicts a phylogenetic tree constructed for the identified SPX genes, as described in Example 7; genes containing a predicted miRMON18 recognition site (in genes from species other than Arabidopsis thaliana) or a predicted miR827 recognition site (in genes from Arabidopsis thaliana) that has been experimentally validated are indicated in bold text.

Figure 13 depicts a miRMON18 genomic sequence (SEQ ID NO. 8800), as described in Example 8. This shows the miRMON18 transcript in upper-case text at nucleotides 2173 - 2788 a miRMON18 promoter element in lower-case text at nucleotides 211 - 2172, a leader element in lower-case text at nucleotides 2173 - 2308, a canonical TATA box (ending 25 nucleotides upstream of the transcription start site) in underlined lower-case text at nucleotides 2144 - 2147, the mature miRMON18 as underlined upper-case text at nucleotides 2419 - 2439, and the miRMON18* as underlined upper-case text at nucleotides 2322 - 2341.

Figure 14 depicts the predicted cleavage by miRMON18 of the rice sequences Os02g45520 (SEQ ID NO. 8784) and Os04g48390 (SEQ ID NO. 8786) and the maize sequence MRT4577_36529C (SEQ ID NO. 8788), as described in Example 9.

Figure 15 depicts the inverse correlation between the miRMON18 precursor (Figure 15A) and a miRMON18 target (Figure 15B), as described in Example 9. Figure 15B shows that the maize sequence MRT4577_36529C (SEQ ID NO. 8788), exhibited higher expression levels under nitrogen-deficient conditions than under nitrogen-sufficient conditions, i. e., an expression pattern opposite to that of the miRMON18 precursor as shown in Figure 15A.

Figure 16 depicts the vector pMON107261, which includes a CaMV 35S promoter driving expression of the maize miRMON18 transcript (e. g., nucleotides 2173 - 2788 of SEQ ID NO. 8800), as described in Example 10.

Figure 17A depicts the fold-back structures of maize miR399 precursors; Figure 17B depicts results of transcriptional profiling experiments, which demonstrate that the Zm-miR399 pri-miRNA is suppressed under nitrogen-deficient conditions (black bars) and is expressed under nitrogen-sufficient conditions (white bars), as described in Example 11.

Figure 18 depicts alignment of the maize cDNA sequences of the miR399 decoy sequences, with the consensus sequence given as SEQ ID NO. 8834, and reveals at least two groups of genes containing miR399 decoy sequences, as described in Example 11.

Figure 19 depicts experiments comparing expression of maize miR399 decoy sequences and miR399 precursors as described in Example 11. Figure 19A shows a transcription profile of group 1 miR399 decoy gene MRT4577_47862C.7 (SEQ ID NO. 8827) and Figure 19B shows a transcription profile of group 2 miR399 decoy gene MRT4577_36567C.8 (SEQ ID NO. 8829), indicating that these miR399 decoy sequences are down-regulated by nitrogen deficiency. These results were verified by northern blots measuring expression of the mature miR399 (Figure 19C) and of the miR399 decoy sequence MRT4577_47862C.7 (SEQ ID NO. 8827) (Figure 19D).

Figure 20 depicts transcription profiling experiments comparing expression of maize endogenous miR399 decoy cDNA sequences and the corresponding maize miR399 precursors under different temperature conditions, as described in Example 11. Group 2 miR399 decoy gene MRT4577_36567C.8 (SEQ ID NO. 8829) exhibited at least ten-fold or greater higher expression during nitrogen-sufficient conditions in maize leaf, especially during daylight hours (Figure 20A). This same gene exhibited at least a two-fold down-regulation in root (Figure 20B) and in shoot (Figure 20C) after extended exposure to cold.

Figure 21 depicts expression of endogenous miR399 decoy cDNA sequences in different tissues in both maize and soybean, as described in Example 11. Figure 21A depicts expression levels of the group 1 maize miR399 decoy sequence SEQ ID NO. 8827 (MRT4577_47862C, represented by probes A1ZM005814_at and AlZM005813_s_at), and the group 2 maize miR399 decoy sequence SEQ ID NO. 8829 (MRT4577_36567C, represented by probe A1ZM048024_at), as well as of the maize pri-miR399 sequence SEQ ID NO. 8818 (MRT4577_22487C.6 represented by probe A1ZM033468_at). Figure 21B depicts expression levels of the soybean miR399 decoy sequences SEQ ID NO. 8842 (MRT3847_217257C.2, represented by probe A1GM031412_at), SEQ ID NO. 8844 (MRT3847_236871C.2, represented by probe A1GM053788_at), SEQ ID NO. 8836 (MRT3847_238967C.1, represented by probe A1GM035741_at), and SEQ ID NO. 8838 (MRT3847_241832C.1, represented by probe A1GM069937_at).

Figure 22A depicts transcription profiling data in various soybean tissues of the soybean endogenous miR319 decoy SEQ ID NO. 8847 (MRT3847_41831C.6, represented by probe A1GM001017_at); Figure 22B depicts transcription profiling data in various maize tissues of the maize endogenous miR319 decoy SEQ ID NO. 8849 (MRT4577_577703C.1, represented by probe A1ZM012886_s_at), as described in Example 11.


DETAILED DESCRIPTION OF THE INVENTION



[0015] Unless defined otherwise, all technical and scientific terms used have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Generally, the nomenclature used and the manufacture or laboratory procedures described below are well known and commonly employed in the art. Conventional methods are used for these procedures, such as those provided in the art and various general references. Unless otherwise stated, nucleic acid sequences in the text of this specification are given, when read from left to right, in the 5' to 3' direction. Nucleic acid sequences may be provided as DNA or as RNA, as specified; disclosure of one necessarily defines the other, as is known to one of ordinary skill in the art. Where a term is provided in the singular, the inventors also contemplate aspects of the invention described by the plural of that term. The nomenclature used and the laboratory procedures described below are those well known and commonly employed in the art. Other technical terms used have their ordinary meaning in the art that they are used, as exemplified by a variety of technical dictionaries. The inventors do not intend to be limited to a mechanism or mode of action. Reference thereto is provided for illustrative purposes only.

RECOMBINANT DNA CONSTRUCTS



[0016] Described is a recombinant DNA construct including at least one transcribable DNA element for modulating the expression of at least one target gene, wherein the at least one transcribable DNA element is selected from the group consisting of: (a) a DNA element that transcribes to an miRNA precursor with the fold-back structure of a plant miRNA precursor sequence selected from SEQ ID NOS. 1036 - 2690, SEQ ID NOS. 3922 - 5497, SEQ ID NOS. 6684 - 8408, SEQ ID NOS. 8561 - 8417, SEQ ID NO. 8743, SEQ ID NO. 8800, and SEQ ID NOS. 8816 - 8819, wherein the miRNA precursor includes a contiguous segment of at least 90% of the nucleotides of the maize, rice, or soybean miRNA precursor sequence; (b) a DNA element that transcribes to an engineered miRNA precursor derived from the fold-back structure of a plant miRNA precursor sequence selected from SEQ ID NOS. 1036 - 2690, SEQ ID NOS. 3922 - 5497, SEQ ID NOS. 6684 - 8408, SEQ ID NOS. 8561 - 8417, SEQ ID NO. 8743, SEQ ID NO. 8800, and SEQ ID NOS. 8816 - 8819, wherein the engineered miRNA precursor includes a modified mature miRNA; (c) a DNA element that is located within or adjacent to a transgene transcription unit and that is transcribed to RNA including a miRNA recognition site recognized by a mature miRNA selected from a mature miRNA selected from SEQ ID NOS. 1 - 1035, SEQ ID NOS. 2730 - 3921, SEQ ID NOS. 5498 - 6683, SEQ ID NOS. 8409 - 8560, SEQ ID NO 8742, SEQ ID NO. 8744, SEQ ID NOS. 8812 - 8815, SEQ ID NO. 8845, and SEQ ID NO. 8850, or by a mature miRNA derived from a plant miRNA precursor sequence selected from SEQ ID NOS. 1036 - 2690, SEQ ID NOS. 3922 - 5497, SEQ ID NOS. 6684 - 8408, SEQ ID NOS. 8561 - 8417, SEQ ID NO. 8743, SEQ ID NO. 8800, and SEQ ID NOS. 8816 - 8819; and (d) a DNA element for suppressing expression of an endogenous miRNA derived from a plant miRNA precursor sequence selected from SEQ ID NOS. 1036 - 2690, SEQ ID NOS. 3922 - 5497, SEQ ID NOS. 6684 - 8408, SEQ ID NOS. 8561 - 8417, SEQ ID NO. 8743, SEQ ID NO. 8800, and SEQ ID NOS. 8816 - 8819. Target genes, the expression of which can be modulated by use of a recombinant DNA construct of this invention, are described under the heading "Target Genes". Embodiments and utilities of the at least one transcribable DNA element are described below.

(A) Expression of a native miRNA under non-native conditions.



[0017] The at least one transcribable DNA element for modulating the expression of at least one target gene includes a DNA element that transcribes to an miRNA precursor with the fold-back structure of a plant miRNA precursor sequence selected from SEQ ID NOS. 1036 - 2690, SEQ ID NOS. 3922 - 5497, SEQ ID NOS. 6684 - 8408, SEQ ID NOS. 8561-8417, SEQ ID NO. 8743, SEQ ID NO. 8800, and SEQ ID NOS. 8816 - 8819, wherein the miRNA precursor includes a contiguous segment of at least 90% of the nucleotides of the maize, rice, or soybean miRNA precursor sequence. It is preferred that the at least one target gene is an endogenous gene of a plant, and expression of the recombinant DNA construct in the plant results in suppression of the at least one target gene. By "miRNA precursor" is meant a transcribed RNA that is larger than a mature miRNA processed from the miRNA precursor, and that typically can be predicted to form a fold-back structure containing non-perfectly complementary double-stranded RNA regions. See Bartel (2004) Cell, 116:281-297; Kim (2005) Nature Rev. Mol. Cell Biol., 6:376-385; Jones-Rhoades et al. (2006) Annu. Rev. Plant Biol., 57:19-53; Ambros et al. (2003) RNA, 9:277-279. Examples of microRNA precursors include the primary miRNA transcript (pri-miRNA) as well as the pre-miRNA that is natively derived from a pri-miRNA; miRNA precursors also include non-natural RNA sequences that are predicted to form a fold-back structure containing non-perfectly complementary double-stranded RNA regions and are processed in vivo, generally by one or more cleavage steps, to a mature miRNA. By "miRNA precursor sequence" is meant an RNA sequence that includes at least the nucleotides of the miRNA precursor but that may include additional nucleotides (such that the miRNA precursor includes a contiguous segment of at least 90% of the nucleotides of the maize, rice, or soybean miRNA precursor sequence). Each miRNA precursor itself forms a fold-back structure that is identical or near-identical to the fold-back structure that is formed by at least part of the corresponding miRNA precursor sequence.

[0018] The miRNA precursor need not include all of the nucleotides contained in a plant miRNA precursor sequence selected from SEQ ID NOS. 1036 - 2690, SEQ ID NOS. 3922-5497, SEQ ID NOS. 6684 - 8408, SEQ ID NOS. 8561 - 8417, SEQ ID NO. 8743, SEQ ID NO. 8800, and SEQ ID NOS. 8816 - 8819, but preferably includes a contiguous segment of at least 80%, or at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% of the nucleotides of a plant miRNA precursor sequence selected from SEQ ID NOS. 1036 - 2690, SEQ ID NOS. 3922 - 5497, SEQ ID NOS. 6684 - 8408, SEQ ID NOS. 8561 - 8417, SEQ ID NO. 8743, SEQ ID NO. 8800, and SEQ ID NOS. 8816 - 8819.

[0019] It is preferred that the at least one target gene is an endogenous gene of a plant, and thus expression of the recombinant DNA construct in the plant results in suppression of the at least one target gene. Transcription of the recombinant DNA construct in a transgenic plant cell modulates the expression of any gene (endogenous genes or transgenes) that contains a sequence ("miRNA recognition site") that is substantially complementary to and recognized by the mature miRNA encoded by the miRNA precursor. Generally, transcription of the recombinant DNA construct results in suppression of an endogenous gene that contains a miRNA recognition site that is recognized by the mature miRNA encoded by the miRNA precursor. It is preferred that the recombinant DNA construct further includes a promoter other than the native promoter of the miRNA sequence. This permits expression of the mature miRNA under spatial or temporal or inducible conditions under which it would not natively be expressed. For example, the recombinant DNA construct can be designed to include a constitutive promoter and thus constitutively express a mature miRNA that is natively expressed (i. e., when expressed in the form of the endogenous miRNA precursor under the control of the native promoter) only under dark conditions. Promoters that are useful with this recombinant DNA construct are described under the heading "Promoters".

[0020] In one non-limiting example, the recombinant DNA construct includes a transcribable DNA element for modulating the expression of at least one target gene, wherein the at least one transcribable DNA element includes a DNA element that transcribes to an miRNA precursor that is a contiguous segment consisting of about 90% of the nucleotides of the maize miRNA precursor sequence having SEQ ID NO. 1136, and that is predicted to have a fold-back structure that is substantially the same (that is, having areas of double-stranded RNA stems and single-stranded loops or bulges in the same or approximately the same location) as the fold-back structure of the miRNA precursor sequence having SEQ ID NO. 1136. The fold-back structure of the miRNA precursor sequence having SEQ ID NO. 1136 includes about 118 nucleotides, with two short stem-loops projecting from a loop at the closed end of the fold-back structure, and two small bulges within the main double-stranded "stem" of the fold-back structure (Figure 1). The mature miRNA processed in planta from a miRNA precursor that is a contiguous segment consisting of about 90% of the nucleotides of the maize miRNA precursor sequence having SEQ ID NO. 1136 is preferably identical to that encoded by the fold-back structure of the miRNA precursor sequence having SEQ ID NO. 1136, i. e., the mature miRNA having SEQ ID NO. 32. Transcription of this recombinant DNA construct preferably results in suppression of at least one endogenous gene that contains a miRNA recognition site that is recognized by the mature miRNA having SEQ ID NO. 32. While the maize miRNA precursor sequence having SEQ ID NO. 1136 is natively expressed in kernel tissue but not in leaf (see Table 2), the recombinant DNA construct can further include a promoter other than the native promoter of the miRNA s precursor sequence having SEQ ID NO. 1136, e. g., a constitutive promoter, to allow transcription of a mature miRNA having SEQ ID NO. 32 in tissues in addition to kernel tissue.

(B) Expression of an engineered mature miRNA.



[0021] The at least one transcribable DNA element for modulating the expression of at least one target gene includes a DNA element that transcribes to an engineered miRNA precursor derived from the fold-back structure of a plant miRNA precursor sequence selected from SEQ ID NOS. 1036 - 2690, SEQ ID NOS. 3922 - 5497, SEQ ID NOS. 6684 - 8408, SEQ ID NOS. 8561 - 8417, SEQ ID NO. 8743, SEQ ID NO. 8800, and SEQ ID NOS. 8816 - 8819, wherein the engineered miRNA precursor includes a modified mature miRNA. It is preferred that the at least one target gene is an endogenous gene of a plant or an endogenous gene of a pest or pathogen of the plant, and expression of the recombinant DNA construct in the plant results in suppression of the at least one target gene. By "engineered" is meant that nucleotides are changed (substituted, deleted, or added) in a native miRNA precursor sequence such a plant miRNA precursor sequence selected from SEQ ID NOS. 1036 - 2690, SEQ ID NOS. 3922 - 5497, SEQ ID NOS. 6684 - 8408, SEQ ID NOS. 8561 - 8417, SEQ ID NO. 8743, SEQ ID NO. 8800, and SEQ ID NOS. 8816 - 8819, thereby resulting in an engineered miRNA precursor having substantially the same the fold-back structure as the native miRNA precursor sequence, but wherein the mature miRNA that is processed from the engineered miRNA precursor has a modified sequence (i. e., different from that of the native mature miRNA) that is designed to suppress a target gene different from the target genes natively suppressed by the native miRNA precursor sequence.

[0022] One general, non-limiting method for determining nucleotide changes in the native miRNA precursor sequence to produce the engineered miRNA precursor, useful in making a recombinant DNA construct, includes the steps:
  1. (a) Selecting a unique target sequence of at least 18 nucleotides specific to the target gene, e. g. by using sequence alignment tools such as BLAST (see, for example, Altschul et al. (1990) J. Mol. Biol., 215:403-410; Altschul et al. (1997) Nucleic Acids Res., 25:3389-3402), for example, of both maize cDNA and genomic DNA databases, to identify target transcript orthologues and any potential matches to unrelated genes, thereby avoiding unintentional silencing of non-target sequences.
  2. (b) Analyzing the target gene for undesirable sequences (e. g., matches to sequences from non-target species, especially animals), and score each potential 19-mer segment for GC content, Reynolds score (see Reynolds et al. (2004) Nature Biotechnol., 22:326-330), and functional asymmetry characterized by a negative difference in free energy ("ΔΔG") (see Khvorova et al. (2003) Cell, 115:209-216). Preferably 19-mers are selected that have all or most of the following characteristics: (1) a Reynolds score >4, (2) a GC content between about 40% to about 60%, (3) a negative ΔΔG, (4) a terminal adenosine, (5) lack of a consecutive run of 4 or more of the same nucleotide; (6) a location near the 3' terminus of the target gene; (7) minimal differences from the miRNA precursor transcript. Preferably multiple (3 or more) 19-mers are selected for testing.
  3. (c) Determining the reverse complement of the selected 19-mers to use in making a modified mature miRNA; the additional nucleotide at position 20 is preferably matched to the selected target sequence, and the nucleotide at position 21 is preferably chosen to be unpaired to prevent spreading of silencing on the target transcript.
  4. (d) Testing the engineered miRNA precursor, for example, in an Agrobacterium mediated transient Nicotiana benthamiana assay for modified mature miRNA expression and target repression.
and (e) Cloning the most effective engineered miRNA precursor into a construct for stable transformation of maize (see the sections under the headings "Making and Using Recombinant DNA Constructs" and "Making and Using Non-natural Transgenic plant Cells and Non-natural Transgenic Plants").

(C) Expression of a transgene and a miRNA recognition site.



[0023] The recombinant DNA construct further includes a transgene transcription unit, wherein the at least one transcribable DNA element for modulating the expression of at least one target gene includes a DNA element that is located within or adjacent to the transgene transcription unit and that is transcribed to RNA including a miRNA recognition site recognized by a mature miRNA derived from a plant miRNA precursor sequence selected from SEQ ID NOS. 1036 - 2690, SEQ ID NOS. 3922 - 5497, SEQ ID NOS. 6684 - 8408, SEQ ID NOS. 8561 - 8417, SEQ ID NO. 8743, SEQ ID NO. 8800, and SEQ ID NOS. 8816 - 8819, and the at least one target gene includes the transgene encoded by the transgene transcription unit, and wherein expression of the recombinant DNA construct in a plant results in expression of the transgene in cells of the plant wherein the mature miRNA is not natively expressed. It is preferred that the miRNA recognition sites are those predicted to be recognized by at least one mature miRNA selected from a mature miRNA selected from SEQ ID NOS. 1 - 1035, SEQ ID NOS. 2730 - 3921, SEQ ID NOS. 5498 - 6683, SEQ ID NOS. 8409 - 8560, SEQ ID NO 8742, SEQ ID NO. 8744, SEQ ID NOS. 8812 - 8815, SEQ ID NO. 8845, and SEQ ID NO. 8850, or by at least one mature miRNA derived from a plant miRNA precursor sequence selected from SEQ ID NOS. 1036 - 2690, SEQ ID NOS. 3922-5497, SEQ ID NOS. 6684 - 8408, SEQ ID NOS. 8561 - 8417, SEQ ID NO. 8743, SEQ ID NO. 8800, and SEQ ID NOS. 8816 - 8819. Prediction of a recognition site is achieved using methods known in the art, such as sequence complementarity rules as described by Zhang (2005) Nucleic Acids Res., 33:W701-704 and by Rhoades et al. (2002) Cell, 110:513-520.

[0024] Prediction of a miRNA recognition site permits identification and validation of endogenous genes regulated by miRNAs from a natively expressed miRNA precursor; this is useful, e. g., to eliminate or modify a miRNA recognition site in an endogenous gene in order to decouple expression of that gene from regulation by the endogenous miRNA that natively regulates expression of the gene. For example, the number of mispairs involving bases at positions 2 to 13 (in a miRNA recognition site having contiguous 21 nucleotides) can be increased to prevent recognition and cleavage by the miRNA.

[0025] These recombinant DNA constructs are particularly useful for in planta expression of the transgene under a specific spatial, temporal, or inducible pattern without the need of a promoter having that specific expression pattern. These recombinant DNA constructs allow, for example, the restricted expression of a gene transcribed by a constitutive promoter or a promoter with expression beyond the desired cell or tissue type(s). Restricted expression may be spatially or temporally restricted, e. g., restricted to specific tissues or cell types or files, or to specific developmental, reproductive, growth, or seasonal stages. Where a miRNA is expressed under particular conditions (e. g., under biotic stress such as crowding, allelopathic interactions or pest or pathogen infestation, or abiotic stress such as heat or cold stress, drought stress, nutrient stress, heavy metal or salt stress), the corresponding miRNA recognition site can be used for conditionally specific suppression, i. e., to suppress a transgene under the particular condition. In a non-limiting example, a recombinant DNA construct that encodes (a) a transgene under the control of a constitutive promoter and (b) a miRNA recognition site recognized by a mature miRNA that is specifically expressed only under conditions of water stress, can be used for expression of the transgene in a plant under non-water-stress conditions. In another non-limiting example, a recombinant DNA construct that encodes (a) a transgene expressing an insecticidal protein under the control of a promoter specifically inducible by wounding, and (b) a miRNA recognition site recognized by a mature miRNA that is expressed in tissues other than root, can be used for limited expression of the insecticidal protein in plant roots under conditions when the plant is wounded by an insect pest.

[0026] The transgene transcription unit includes at least a transgene, and optionally additional sequence such as a promoter, a promoter enhancer, a terminator, messenger RNA stabilizing or destabilizing sequence (see, e. g., Newman et al. (1993) Plant Cell, 5:701-714; Green (1993) Plant Physiol., 102:1065-1070; and Ohme-Takagi et al. (1993) Proc. Natl. Acad. Sci. USA, 90:11811-11815), sequence for localization or transport of the transgene transcript to a specific locale (e. g., mitochondrion, plastid, nucleolus, peroxisome, endoplasmic reticulum.), or other sequence related to the desired processing of the transgene. The transgene encoded by the transgene transcription unit can include any one or more genes of interest, including coding sequence, non-coding sequence, or both. Genes of interest can include any of the genes listed under "Target Genes", preferred examples of which include translatable (coding) sequence for genes encoding transcription factors and genes encoding enzymes involved in the biosynthesis or catabolism of molecules of interest (such as, amino acids, fatty acids and other lipids, sugars and other carbohydrates, biological polymers, and secondary metabolites including alkaloids, terpenoids, polyketides, non-ribosomal peptides, and secondary metabolites of mixed biosynthetic origin).

(D) Suppression of an endogenous or native miRNA.



[0027] The at least one transcribable DNA element for modulating the expression of at least one target gene includes a DNA element for suppressing expression of an endogenous miRNA derived from a plant miRNA precursor sequence selected from SEQ ID NOS. 1036-2690, SEQ ID NOS. 3922 - 5497, SEQ ID NOS. 6684 - 8408, SEQ ID NOS. 8561 - 8417, SEQ ID NO. 8743, SEQ ID NO. 8800, and SEQ ID NOS. 8816 - 8819. It is preferred that the at least one target gene is an endogenous gene of a plant, and expression of the endogenous gene is suppressed in cells of the plant where native expression of the endogenous miRNA occurs, and thus expression of the recombinant DNA construct in the cells results in expression of the endogenous gene in the cells.

[0028] The DNA element for suppressing expression includes at least one of:
  1. (a) DNA that includes at least one anti-sense DNA segment that is anti-sense to at least one segment of the target gene;
  2. (b) DNA that includes multiple copies of at least one anti-sense DNA segment that is anti-sense to at least one segment of the target gene;
  3. (c) DNA that includes at least one sense DNA segment that is at least one segment of the target gene;
  4. (d) DNA that includes multiple copies of at least one sense DNA segment that is at least one segment of the target gene;
  5. (e) DNA that transcribes to RNA for suppressing the target gene by forming double-stranded RNA and includes at least one anti-sense DNA segment that is anti-sense to at least one segment of the target gene and at least one sense DNA segment that is at least one segment of the target gene;
  6. (f) DNA that transcribes to RNA for suppressing the target gene by forming a single double-stranded RNA and includes multiple serial anti-sense DNA segments that are anti-sense to at least one segment of the target gene and multiple serial sense DNA segments that are at least one segment of the target gene;
  7. (g) DNA that transcribes to RNA for suppressing the target gene by forming multiple double strands of RNA and includes multiple anti-sense DNA segments that are anti-sense to at least one segment of the target gene and multiple sense DNA segments that are at least one segment of the target gene, and wherein the multiple anti-sense DNA segments and the multiple sense DNA segments are arranged in a series of inverted repeats;
  8. (h) DNA that includes nucleotides derived from a plant miRNA;
  9. (i) DNA that includes nucleotides of a siRNA;
  10. (j) DNA that transcribes to an RNA aptamer capable of binding to a ligand; and
  11. (k) DNA that transcribes to an RNA aptamer capable of binding to a ligand, and DNA that transcribes to regulatory RNA capable of regulating expression of the target gene, wherein the regulation is dependent on the conformation of the regulatory RNA, and the conformation of the regulatory RNA is allosterically affected by the binding state of the RNA aptamer.


[0029] DNA elements for suppressing expression are described further in Example 3 and depicted in Figures 2 and 3.

[0030] The recombinant DNA construct includes DNA designed to be transcribed to single-stranded RNA or to at least partially double-stranded RNA (such as in a "kissing stem-loop" arrangement), or to an RNA that assumes a secondary structure or three-dimensional configuration (e. g., a large loop of antisense sequence of the target gene or an aptamer) that confers on the transcript an additional desired characteristic, such as increased stability, increased half-life in vivo, or cell or tissue specificity. In one example, the spacer is transcribed to a stabilizing loop that links the first and second series of contiguous RNA segments (see, for example, Di Giusto and King (2004) J. Biol. Chem., 279:46483-46489). In another example, the recombinant DNA construct includes DNA that transcribes to RNA including an RNA aptamer (e. g., an aptamer that binds to a cell-specific ligand) that allows cell- or tissue-specific targetting of the recombinant RNA duplex.

[0031] The recombinant DNA construct is made by commonly used techniques, such as those described under the heading "Making and Using Recombinant DNA Constructs" and illustrated in the working Examples. The recombinant DNA construct is particularly useful for making non-natural transgenic plant cells, non-natural transgenic plants, and transgenic seeds as discussed below under "Transgenic Plant Cells and Transgenic Plants".

[0032] The effects of a miRNA on its target gene can be controlled by alternative methods described in detail below under "MicroRNA Decoy Sequences".

Target Genes



[0033] The recombinant DNA construct can be designed to suppress any target gene or genes. The target gene can be translatable (coding) sequence, or can be non-coding sequence (such as non-coding regulatory sequence), or both, and can include at least one gene selected from the group consisting of a eukaryotic target gene, a non-eukaryotic target gene, a microRNA precursor DNA sequence, and a microRNA promoter. The target gene can be native (endogenous) to the cell (e. g., a cell of a plant or animal) in which the recombinant DNA construct is transcribed, or can be native to a pest or pathogen of the plant or animal in which the recombinant DNA construct is transcribed. The target gene can be an exogenous gene, such as a transgene in a plant. A target gene can be a native gene targetted for suppression, with or without concurrent expression of an exogenous transgene, for example, by including a gene expression element in the recombinant DNA construct, or in a separate recombinant DNA construct. For example, it can be desirable to replace a native gene with an exogenous transgene homologue.

[0034] The target gene can include a single gene or part of a single gene that is targetted for suppression, or can include, for example, multiple consecutive segments of a target gene, multiple non-consecutive segments of a target gene, multiple alleles of a target gene, or multiple target genes from one or more species. A target gene can include any sequence from any species (including non-eukaryotes such as bacteria, and viruses; fungi; plants, including monocots and dicots, such as crop plants, ornamental plants, and non-domesticated or wild plants; invertebrates such as arthropods, annelids, nematodes, and molluscs; and vertebrates such as amphibians, fish, birds, domestic or wild mammals, and even humans.

[0035] The target gene is exogenous to the plant in which the recombinant DNA construct is to be transcribed, but endogenous to a pest or pathogen (e. g., viruses, bacteria, fungi, oomycetes, and invertebrates such as insects, nematodes, and molluscs) of the plant. The target gene can include multiple target genes, or multiple segments of one or more genes. It is preferred that, the target gene or genes is a gene or genes of an invertebrate pest or pathogen of the plant, such target genes are particularly useful in providing non-natural transgenic plants having resistance to one or more plant pests or pathogens, for example, resistance to a nematode such as soybean cyst nematode or root knot nematode or to a pest insect.

[0036] The target gene can be translatable (coding) sequence, or can be non-coding sequence (such as non-coding regulatory sequence), or both. Non-limiting examples of a target gene include non-translatable (non-coding) sequence, such as, but not limited to, 5' untranslated regions, promoters, enhancers, or other non-coding transcriptional regions, 3' untranslated regions, terminators, and introns. Target genes include genes encoding microRNAs, small interfering RNAs, RNA components of ribosomes or ribozymes, small nucleolar RNAs, and other non-coding RNAs (see, for example, non-coding RNA sequences provided publicly at rfam.wustl.edu; Erdmann et al. (2001) Nucleic Acids Res., 29:189-193; Gottesman (2005) Trends Genet., 21:399-404; Griffiths-Jones et al. (2005) Nucleic Acids Res., 33:121-124). One specific example of a target gene includes a microRNA recognition site (that is, the site on an RNA strand to which a mature miRNA binds and induces cleavage). Another specific example of a target gene includes a microRNA precursor sequence native to a pest or pathogen of the non-natural transgenic plant, that is, the primary transcript encoding a microRNA, or the RNA intermediates processed from this primary transcript (e. g., a nuclear-limited pri-miRNA or a pre-miRNA which can be exported from the nucleus into the cytoplasm). See, for example, Lee et al. (2002) EMBO Journal, 21:4663-4670; Reinhart et al. (2002) Genes & Dev., 16:161611626; Lund et al. (2004) Science, 303:95-98; and Millar and Waterhouse (2005) Funct. Integer. Genomics, 5:129-135. Target genes can also include translatable (coding) sequence for genes encoding transcription factors and genes encoding enzymes involved in the biosynthesis or catabolism of molecules of interest (such as amino acids, fatty acids and other lipids, sugars and other carbohydrates, biological polymers, and secondary metabolites including alkaloids, terpenoids, polyketides, non-ribosomal peptides, and secondary metabolites of mixed biosynthetic origin).

[0037] It is preferred that the target gene is an essential gene of a plant pest or pathogen. Essential genes include genes that are required for development of the pest or pathogen to a fertile reproductive adult. Essential genes include genes that, when silenced or suppressed, result in the death of the organism (as an adult or at any developmental stage, including gametes) or in the organism's inability to successfully reproduce (e. g., sterility in a male or female parent or lethality to the zygote, embryo, or larva). A description of nematode essential genes is found, e. g., in Kemphues, K. "Essential Genes" (December 24, 2005), WormBook, ed. The C. elegans Research Community, WormBook, doi/10.1895/wormbook.1.57.1, available on line at www.wormbook.org. Non-limiting examples of nematode essential genes include major sperm protein, RNA polymerase II, and chitin synthase (see, e. g., U. S. Patent Application Publication US20040098761); additional soybean cyst nematode essential genes are provided in U. S. Patent Application Publication 2007/0271630. A description of insect genes is publicly available at the Drosophila genome database (available on line at flybase.bio.indiana.edu/). The majority of predicted Drosophila genes have been analyzed for function by a cell culture-based RNA interference screen, resulting in 438 essential genes being identified; see Boutros et al. (2004) Science, 303:832-835, and supporting material available on line at www.sciencemag.org/cgi/content/full/303/5659/832/DC1. A description of bacterial and fungal essential genes is provided in the Database of Essential Genes ("DEG", available on line at tubic.tju.edu.cn/deg/); see Zhang et al. (2004) Nucleic Acids Res., 32:D271-D272.

[0038] Plant pest invertebrates include pest nematodes, pest molluscs (slugs and snails), and pest insects. Plant pathogens of interest include fungi, oomycetes, bacteria (e. g., the bacteria that cause leaf spotting, fireblight, crown gall, and bacterial wilt), mollicutes, and viruses (e. g., the viruses that cause mosaics, vein banding, flecking, spotting, or abnormal growth). See also G. N. Agrios, "Plant Pathology" (Fourth Edition), Academic Press, San Diego, 1997, 635 pp., for descriptions of fungi, bacteria, mollicutes (including mycoplasmas and spiroplasmas), viruses, nematodes, parasitic higher plants, and flagellate protozoans, all of which are plant pests or pathogens of interest. See also the continually updated compilation of plant pests and pathogens and the diseases caused by such on the American Phytopathological Society's "Common Names of Plant Diseases", compiled by the Committee on Standardization of Common Names for Plant Diseases of The American Phytopathological Society, 1978-2005, available online at www.apsnet.org/online/common/top.asp.

[0039] Non-limiting examples of fungal plant pathogens of particular interest include, e. g., the fungi that cause powdery mildew, rust, leaf spot and blight, damping-off, root rot, crown rot, cotton boll rot, stem canker, twig canker, vascular wilt, smut, or mold, including, but not limited to, Fusarium spp., Phakospora spp., Rhizoctonia spp., Aspergillus spp., Gibberella spp., Pyricularia spp., and Alternaria spp.. Specific examples of fungal plant pathogens include Phakospora pachirhizi (Asian soybean rust), Puccinia sorghi (corn common rust), Puccinia polysora (corn Southern rust), Fusarium oxysporum and other Fusarium spp., Alternaria spp., Penicillium spp., Rhizoctonia solani, Exserohilum turcicum (Northern corn leaf blight), Bipolaris maydis (Southern corn leaf blight), Ustilago maydis (corn smut), Fusarium graminearum (Gibberella zeae), Fusarium verticilliodes (Gibberella moniliformis), F. proliferatum (G. fujikuroi var. intermedia), F. subglutinans (G. subglutinans), Diplodia maydis, Sporisorium holci-sorghi, Colletotrichum graminicola, Setosphaeria turcica, Aureobasidium zeae, Sclerotinia sclerotiorum, and the numerous fungal species provided in Tables 4 and 5 of U. S. Patent 6,194,636. Non-limiting examples of plant pathogens include pathogens previously classified as fungi but more recently classified as oomycetes. Specific examples of oomycete plant pathogens of particular interest include members of the genus Pythium (e. g., Pythium aphanidermatum) and Phytophthora (e. g., Phytophthora infestans, Phytophthora sojae,) and organisms that cause downy mildew (e. g., Peronospora farinosa).

[0040] Non-limiting examples of bacterial pathogens include the mycoplasmas that cause yellows disease and spiroplasmas such as Spiroplasma kunkelii, which causes corn stunt, eubacteria such as Pseudomonas avenae, Pseudomonas andropogonis, Erwinia stewartii, Pseudomonas syringae pv. syringae, Xylella fastidiosa, and the numerous bacterial species listed in Table 3 of U. S. Patent 6,194,636.

[0041] Non-limiting examples of viral plant pathogens of particular interest include maize dwarf mosaic virus (MDMV), sugarcane mosaic virus (SCMV, formerly MDMV strain B), wheat streak mosaic virus (WSMV), maize chlorotic dwarf virus (MCDV), barley yellow dwarf virus (BYDV), banana bunchy top virus (BBTV), and the numerous viruses listed in Table 2 of U. S. Patent 6,194,636.

[0042] Non-limiting examples of invertebrate pests include cyst nematodes Heterodera spp. especially soybean cyst nematode Heterodera glycines, root knot nematodes Meloidogyne spp., lance nematodes Hoplolaimus spp., stunt nematodes Tylenchorhynchus spp., spiral nematodes Helicotylenchus spp., lesion nematodes Pratylenchus spp., ring nematodes Criconema spp., foliar nematodes Aphelenchus spp. or Aphelenchoides spp., corn rootworms, Lygus spp., aphids and similar sap-sucking insects such as phylloxera (Daktulosphaira vitifoliae), corn borers, cutworms, armyworms, leafhoppers, Japanese beetles, grasshoppers, and other pest coleopterans, dipterans, and lepidopterans. Specific examples of invertebrate pests include pests capable of infesting the root systems of crop plants, e. g., northern corn rootworm (Diabrotica barbers), southern corn rootworm (Diabrotica undecimpunctata), Western corn rootworm (Diabrotica virgifera), corn root aphid (Anuraphis maidiradicis), black cutworm (Agrotis ipsilon), glassy cutworm (Crymodes devastator), dingy cutworm (Feltia ducens), claybacked cutworm (Agrotis gladiaria), wireworm (Melanotus spp., Aeolus mellillus), wheat wireworm (Aeolus mancus), sand wireworm (Horistonotus uhlerii), maize billbug (Sphenophorus maidis), timothy billbug (Sphenophorus zeae), bluegrass billbug (Sphenophorus parvulus), southern corn billbug (Sphenophorus callosus), white grubs (Phyllophaga spp.), seedcorn maggot (Delia platura), grape colaspis (Colaspis brunnea), seedcorn beetle (Stenolophus lecontei), and slender seedcorn beetle (Clivinia impressifrons), as well as the parasitic nematodes listed in Table 6 of U. S. Patent 6,194,636.

[0043] Invertebrate pests of particular interest, especially in but not limited to southern hemisphere regions (including South and Central America) include aphids, corn rootworms, spodoptera, noctuideae, potato beetle, Lygus spp., any hemipteran, homopteran, or heteropteran, any lepidopteran, any coleopteran, nematodes, cutworms, earworms, armyworms, borers, leaf rollers, and others. Arthropod pests specifically encompassed by this invention include various cutworm species including cutworm (Agrotis repleta), black cutworm (Agrotis ipsilon), cutworm (Anicla ignicans), granulate cutworm (Feltia subterranea), "gusano aspero" (Agrotis malefida); Mediterranean flour moth (Anagasta kuehniella), square-necked grain beetle (Cathartus quadricollis), flea beetle (Chaetocnema spp), rice moth (Corcyra cephalonica), corn rootworm or "vaquita de San Antonio" (Diabotica speciosa), sugarcane borer (Diatraea saccharalis), lesser cornstalk borer (Elasmopalpus lignosellus), brown stink bug (Euschistus spp.), corn earworm (Helicoverpa zea), flat grain beetle (Laemophloeus minutus), grass looper moth (Mocis latipes), sawtoothed grain beetle (Oryzaephilus surinamensis), meal moth (Pyralis farinalis), Indian meal moth (Plodia interpunctella), corn leaf aphid (Rhopalosiphum maidis), brown burrowing bug or "chinche subterranea" (Scaptocoris castanea), greenbug (Schizaphis graminum), grain weevil (Sitophilus zeamais), Angoumois grain moth (Sitotroga cerealella), fall armyworm (Spodoptera frugiperda), cadelle beetle (Tenebroides mauritanicus), two-spotted spider mite (Tetranychus urticae), red flour beetle (Triboleum castaneum), cotton leafworm (Alabama argillacea), boll weevil (Anthonomus grandis), cotton aphid (Aphis gossypii), sweet potato whitefly (Bemisia tabaci), various thrips species (Frankliniella spp.), cotton earworm (Helicoverpa zea), "oruga bolillera" (e. g., Helicoverpa geletopoeon), tobacco budworm (Heliothis virescens), stinkbug (Nezara viridula), pink bollworm (Pectinophora gossypiella), beet armyworm (Spodoptera exigua), spider mites (Tetranychus spp.), onion thrips (trips tabaci), greenhouse whitefly (Trialeurodes vaporarium), velvetbean caterpillar (Anticarsia gemmatalis), spotted maize beetle or "astilo moteado" (Astylus atromaculatus), "oruga de la alfalfa" (Colias lesbia), "chinche marrón" or "chinche de los cuernos" (Dichelops furcatus), "alquiche chico" (Edessa miditabunda), blister beetles (Epicauta spp.), "barrenador del brote" (Epinotia aporema), "oruga verde del yuyo colorado" (Loxostege bifidalis), rootknot nematodes (Meloidogyne spp.), "oruga cuarteadora" (Mocis repanda), southern green stink bug (Nezara viridula), "chinche de la alfalfa" (Piezodorus guildinii), green cloverworm (Plathypena scabra), soybean looper (Pseudoplusia includens), looper moth "isoca medidora del girasol" (Rachiplusia nu), yellow woolybear (Spilosoma virginica), yellowstriped armyworm (Spodoptera ornithogalli), various root weevils (family Curculionidae), various wireworms (family Elateridae), and various white grubs (family Scarabaeidae). Nematode pests specifically encompassed by this invention include nematode pests of maize (Belonolaimus spp., Trichodorus spp., Longidorus spp., Dolichodorus spp., Anguina spp., Pratylenchus spp., Meloidogyne spp., Heterodera spp.), soybean (Heterodera glycines, Meloidogyne spp., Belonolaimus spp.), bananas (Radopholus similis, Meloidogyne spp., Helicotylenchus spp.), sugarcane (Heterodera sacchari, Pratylenchus spp., Meloidogyne spp.), oranges (Tylenchulus spp., Radopholus spp., Belonolaimus spp., Pratylenchus spp., Xiphinema spp.), coffee (Meloidogyne spp., Pratylenchus spp.), coconut palm (Bursaphelenchus spp.), tomatoes (Meloidogyne spp., Belonolaimus spp., Nacobbus spp.), grapes (Meloidogyne spp., Xiphinema spp., Tylenchulus spp., Criconemella spp.), lemon and lime (Tylenchulus spp., Radopholus spp., Belonolaimus spp., Pratylenchus spp., Xiphinema spp.), cacao (Meloidogyne spp., Rotylenchulus reniformis), pineapple (Meloidogyne spp., Pratylenchus spp., Rotylenchulus reniformis), papaya (Meloidogyne spp., Rotylenchulus reniformis), grapefruit (Tylenchulus spp., Radopholus spp. Belonolaimus spp., Pratylenchus spp., Xiphinema spp., and broad beans (Meloidogyne spp.).

[0044] Target genes from pests can include invertebrate genes for major sperm protein, alpha tubulin, beta tubulin, vacuolar ATPase, glyceraldehyde-3-phosphate dehydrogenase, RNA polymerase II, chitin synthase, cytochromes, miRNAs, miRNA precursor molecules, miRNA promoters, as well as other genes such as those disclosed in U. S. Patent Application Publication 2006/0021087, WO 05/110068, and in Table II of U. S. Patent Application Publication 2004/0098761. Target genes from pathogens can include genes for viral translation initiation factors, viral replicases, miRNAs, miRNA precursor molecules, fungal tubulin, fungal vacuolar ATPase, fungal chitin synthase, fungal MAP kinases, fungal Pac1 Tyr/Thr phosphatase, enzymes involved in nutrient transport (e. g., amino acid transporters or sugar transporters), enzymes involved in fungal cell wall biosynthesis, cutinases, melanin biosynthetic enzymes, polygalacturonases, pectinases, pectin lyases, cellulases, proteases, genes that interact with plant avirulence genes, and other genes involved in invasion and replication of the pathogen in the infected plant. Thus, a target gene need not be endogenous to the plant in which the recombinant DNA construct is transcribed. A recombinant DNA construct can be transcribed in a plant and used to suppress a gene of a pathogen or pest that may infest the plant.

[0045] Specific, non-limiting examples of suitable target genes also include amino acid catabolic genes (such as the maize LKR/SDH gene encoding lysine-ketoglutarate reductase (LKR) and saccharopine dehydrogenase (SDH), and its homologues), maize zein genes, genes involved in fatty acid synthesis (e. g., plant microsomal fatty acid desaturases and plant acyl-ACP thioesterases, such as those disclosed in U. S. Patent Numbers 6,426,448, 6,372,965, and 6,872,872), genes involved in multi-step biosynthesis pathways, where it may be of interest to regulate the level of one or more intermediates, such as genes encoding enzymes for polyhydroxyalkanoate biosynthesis (see, for example, U. S. Patent No. 5,750,848); and genes encoding cell-cycle control proteins, such as proteins with cyclin-dependent kinase (CDK) inhibitor-like activity (see, for example, genes disclosed in WO 050/07829). Target genes can include genes encoding undesirable proteins (e. g., allergens or toxins) or the enzymes for the biosynthesis of undesirable compounds (e. g., undesirable flavor or odor components). Thus, one embodiment of the invention is a non-natural transgenic plant or tissue of such a plant that is improved by the suppression of allergenic proteins or toxins, e. g., a peanut, soybean, or wheat kernel with decreased allergenicity. Target genes can include genes involved in fruit ripening, such as polygalacturonase. Target genes can include genes where expression is preferably limited to a particular cell or tissue or developmental stage, or where expression is preferably transient, that is to say, where constitutive or general suppression, or suppression that spreads through many tissues, is not necessarily desired. Thus, other examples of suitable target genes include genes encoding proteins that, when expressed in transgenic plants, make the transgenic plants resistant to pests or pathogens (see, for example, genes for cholesterol oxidase as disclosed in U. S. Patent No. 5,763,245); genes where expression is pest- or pathogen-induced; and genes which can induce or restore fertility (see, for example, the barstar/barnase genes described in U. S. Patent No. 6,759,575).

[0046] The recombinant DNA construct can be designed to be more specifically suppress the target gene, for example, by designing the recombinant DNA construct to encode a mature miRNA to include regions substantially non-identical (or non-complementary) to a non-target gene sequence. Non-target genes can include any gene not intended to be silenced or suppressed, either in a plant containing the recombinant DNA construct or in organisms that may come into contact with the recombinant DNA construct. A non-target gene sequence can include any sequence from any species (including non-eukaryotes such as bacteria, and viruses; fungi; plants, including monocots and dicots, such as crop plants, ornamental plants, and non-domesticated or wild plants; invertebrates such as arthropods, annelids, nematodes, and molluscs; and vertebrates such as amphibians, fish, birds, domestic or wild mammals, and even humans).

[0047] The target gene is a gene endogenous to a given species, such as a given plant (such as agriculturally or commercially important plants, including monocots and dicots), and the non-target gene can be, e. g., a gene of a non-target species, such as another plant species or a gene of a virus, fungus, bacterium, invertebrate, or vertebrate, even a human. One non-limiting example is where the recombinant DNA construct is designed to suppress a target gene that is a gene endogenous to a single species (e. g., Western corn rootworm, Diabrotica virgifera virgifera LeConte) but to not suppress a non-target gene such as genes from related, even closely related, species (e. g., Northern corn rootworm, Diabrotica barberi Smith and Lawrence, or Southern corn rootworm, Diabrotica undecimpunctata).

[0048] In cases where it is desirable to suppress a target gene across multiple species, it may be desirable to design the recombinant DNA construct to suppress a target gene sequence common to the multiple species in which the target gene is to be silenced. Thus, an RNA duplex can be selected to be specific for one taxon (for example, specific to a genus, family, or even a larger taxon such as a phylum, e. g., arthropoda) but not for other taxa (e. g., plants or vertebrates or mammals). In one non-limiting example a recombinant DNA construct for gene silencing can be selected so as to target pathogenic fungi (e. g., a Fusarium spp.) but not target any gene sequence from beneficial fungi.

[0049] In another non-limiting example a recombinant DNA construct for gene silencing in corn rootworm can be selected to be specific to all members of the genus Diabrotica. In a further example of this embodiment, such a Diabrotica-targetted recombinant DNA construct can be selected so as to not target any gene sequence from beneficial coleopterans (for example, predatory coccinellid beetles, commonly known as ladybugs or ladybirds) or other beneficial insect species.

[0050] The required degree of specificity of a recombinant DNA construct for silencing a target gene depends on various factors. Factors can include the size and nucleic acid sequence of a mature microRNA encoded by the recombinant DNA construct, and the relative importance of decreasing such a mature miRNA's potential to suppress non-target genes. In a non-limiting example, where such a mature miRNA is expected to be 21 base pairs in size, it is preferred that it includes DNA encoding a mature miRNA for silencing a target gene wherein the mature miRNA includes sequence that is substantially non-identical to a non-target gene sequence, such as fewer than 18, or fewer than 17, or fewer than 16, or fewer than 15 matches out of 21 contiguous nucleotides of a non-target gene sequence.

[0051] It may be desirable to design the recombinant DNA construct for silencing a target gene to include regions predicted to not generate undesirable polypeptides, for example, by screening the recombinant DNA construct for sequences that may encode known undesirable polypeptides or close homologues of these. Undesirable polypeptides include polypeptides homologous to known allergenic polypeptides and polypeptides homologous to known polypeptide toxins. Publicly available sequences encoding such undesirable potentially allergenic peptides are available, for example, the Food Allergy Research and Resource Program (FARRP) allergen database (available at allergenonline.com) or the Biotechnology Information for Food Safety Databases (available at www.iit.edu/~sgendel/fa.htm) (see also, for example, Gendel (1998) Adv. Food Nutr. Res., 42:63-92). Undesirable sequences can also include, for example, those polypeptide sequences annotated as known toxins or as potential or known allergens and contained in publicly available databases such as GenBank, EMBL, SwissProt, and others, which are searchable by the Entrez system (www.ncbi.nih.gov/Entrez). Non-limiting examples of undesirable, potentially allergenic peptide sequences include glycinin from soybean, oleosin and agglutinin from peanut, glutenins from wheat, casein, lactalbumin, and lactoglobulin from bovine milk, and tropomyosin from various shellfish (allergenonline.com). Non-limiting examples of undesirable, potentially toxic peptides include tetanus toxin tetA from Clostridium tetani, diarrheal toxins from Staphylococcus aureus, and venoms such as conotoxins from Conus spp. and neurotoxins from arthropods and reptiles (www.ncbi.nih.gov/Entrez).

[0052] In one non-limiting example, the recombinant DNA construct is screened to eliminate those transcribable sequences encoding polypeptides with perfect homology to a known allergen or toxin over 8 contiguous amino acids, or with at least 35% identity over at least 80 amino acids; such screens can be performed on any and all possible reading frames in both directions, on potential open reading frames that begin with AUG (ATG in the corresponding DNA), or on all possible reading frames, regardless of whether they start with an AUG (or ATG) or not. When a "hit" or match is made, that is, when a sequence that encodes a potential polypeptide with perfect homology to a known allergen or toxin over 8 contiguous amino acids (or at least about 35% identity over at least about 80 amino acids), is identified, the nucleic acid sequences corresponding to the hit can be avoided, eliminated, or modified when selecting sequences to be used in an RNA for silencing a target gene. The recombinant DNA construct can be designed so no potential open reading frame that begins with AUG (ATG in the corresponding DNA).

[0053] Avoiding, elimination of, or modification of, an undesired sequence can be achieved by any of a number of methods known to those skilled in the art. In some cases, the result can be novel sequences that are believed to not exist naturally. For example, avoiding certain sequences can be accomplished by joining together "clean" sequences into novel chimeric sequences to be used in the RHA duplex.

[0054] Applicants recognize that in some microRNA-mediated gene silencing, it is possible for imperfectly matching miRNA sequences to be effective at gene silencing. For example, it has been shown that mismatches near the center of a miRNA complementary site has stronger effects on the miRNA's gene silencing than do more distally located mismatches. See, for example, Figure 4 in Mallory et al. (2004) EMBO J., 23:3356-3364. In another example, it has been reported that, both the position of a mismatched base pair and the identity of the nucleotides forming the mismatch influence the ability of a given siRNA to silence a target gene, and that adenine-cytosine mismatches, in addition to the G:U wobble base pair, were well tolerated (see Du et al. (2005) Nucleic Acids Res., 33:1671-1677). Thus, a given strand of the recombinant DNA construct need not always have 100% sequence identity with the intended target gene, but generally would preferably have substantial sequence identity with the intended target gene, such as about 95%, about 90%, about 85%, or about 80% sequence identity with the intended target gene. Described in terms of complementarity, one strand of the recombinant DNA construct is preferably designed to have substantial complementarity to the intended target (e. g., a target messenger RNA or target non-coding RNA), such as about 95%, about 90%, about 85%, or about 80% complementarity to the intended target. In a non-limiting example, in the case of a recombinant DNA construct encoding a mature miRNA of 21 nucleotides, the encoded mature miRNA is designed to be is substantially but not perfectly complementary to 21 contiguous nucleotides of a target RNA; preferably the nucleotide at position 21 is unpaired with the corresponding position in the target RNA to prevent transitivity.

[0055] One skilled in the art would be capable of judging the importance given to screening for regions predicted to be more highly specific to the target gene or predicted to not generate undesirable polypeptides, relative to the importance given to other criteria, such as the percent sequence identity with the intended target gene or the predicted gene silencing efficiency of a given sequence. For example, a recombinant DNA construct that encodes a mature miRNA may be designed to be active across several species, and therefore one skilled in the art can determine that it is more important to include in the recombinant DNA construct DNA encoding a mature miRNA that is specific to the several species of interest, but less important to screen for regions predicted to have higher gene silencing efficiency or for regions predicted to generate undesirable polypeptides.

Promoters



[0056] Generally, the recombinant DNA construct of this invention includes a promoter, functional in a plant cell, and operably linked to the transcribable DNA element. In various embodiments, the promoter is selected from the group consisting of a constitutive promoter, a spatially specific promoter, a temporally specific promoter, a developmentally specific promoter, and an inducible promoter.

[0057] Non-constitutive promoters suitable for use with the recombinant DNA constructs of the invention include spatially specific promoters, temporally specific promoters, and inducible promoters. Spatially specific promoters can include organelle-, cell-, tissue-, or organ-specific promoters (e. g., a plastid-specific, a root-specific, a pollen-specific, or a seed-specific promoter for suppressing expression of the first target RNA in plastids, roots, pollen, or seeds, respectively). In many cases a seed-specific, embryo-specific, aleurone-specific, or endosperm-specific promoter is especially useful. Temporally specific promoters can include promoters that tend to promote expression during certain developmental stages in a plant's growth cycle, or during different times of day or night, or at different seasons in a year. Inducible promoters include promoters induced by chemicals or by environmental conditions such as, but not limited to, biotic or abiotic stress (e. g., water deficit or drought, heat, cold, high or low nutrient or salt levels, high or low light levels, or pest or pathogen infection). An expression-specific promoter can also include promoters that are generally constitutively expressed but at differing degrees or "strengths" of expression, including promoters commonly regarded as "strong promoters" or as "weak promoters".

[0058] Promoters of particular interest include the following non-limiting examples: an opaline synthase promoter isolated from T-DNA of Agrobacterium; a cauliflower mosaic virus 35S promoter; enhanced promoter elements or chimeric promoter elements such as an enhanced cauliflower mosaic virus (CaMV) 35S promoter linked to an enhancer element (an intron from heat shock protein 70 of Zea mays); root specific promoters such as those disclosed in U.S. Patents 5,837,848; 6,437,217 and 6,426,446; a maize L3 oleosin promoter disclosed in U.S. Patent 6,433,252; a promoter for a plant nuclear gene encoding a plastid-localized aldolase disclosed in U. S. Patent Application Publication 2004/0216189; cold-inducible promoters disclosed in U.S. Patent 6,084,089; salt-inducible promoters disclosed in U. S. Patent Number 6,140,078; light-inducible promoters disclosed in U.S. Patent 6,294,714; pathogen-inducible promoters disclosed in U.S. Patent 6,252,138; and water deficit-inducible promoters disclosed in U.S. Patent Application Publication 2004/0123347.

[0059] The promoter element can include nucleic acid sequences that are not naturally occurring promoters or promoter elements or homologues thereof but that can regulate expression of a gene. Examples of such "gene independent" regulatory sequences include naturally occurring or artificially designed RNA sequences that include a ligand-binding region or aptamer and a regulatory region (which can be cis-acting). See, for example, Isaacs et al. (2004) Nat. Biotechnol., 22:841-847, Bayer and Smolke (2005) Nature Biotechnol., 23:337-343, Mandal and Breaker (2004) Nature Rev. Mol. Cell Biol., 5:451-463, Davidson and Ellington (2005) Trends Biotechnol., 23:109-112, Winkler et al. (2002) Nature, 419:952-956, Sudarsan et al. (2003) RNA, 9:644-647, and Mandal and Breaker (2004) Nature Struct. Mol. Biol., 11:29-35. Such "riboregulators" can be selected or designed for specific spatial or temporal specificity, for example, to regulate translation of the exogenous gene only in the presence (or absence) of a given concentration of the appropriate ligand.

Making and Using Recombinant DNA Constructs



[0060] The recombinant DNA constructs of this invention are made by any method suitable to the intended application, taking into account, for example, the type of expression desired and convenience of use in the plant in which the construct is to be transcribed. General methods for making and using DNA constructs and vectors are well known in the art and described in detail in, for example, handbooks and laboratory manuals including Sambrook and Russell, "Molecular Cloning: A Laboratory Manual" (third edition), Cold Spring Harbor Laboratory Press, NY, 2001. An example of useful technology for building DNA constructs and vectors for transformation is disclosed in U. S. Patent Application Publication 2004/0115642 A1, incorporated herein by reference. DNA constructs can also be built using the GATEWAY™ cloning technology (available from Invitrogen Life Technologies, Carlsbad, CA), which uses the site-specific recombinase LR cloning reaction of the Integrase/att system from bacteriophage lambda vector construction, instead of restriction endonucleases and ligases. The LR cloning reaction is disclosed in U. S. Patents 5,888,732 and 6,277,608, and in U. S. Patent Application Publications 2001/283529, 2001/282319 and 2002/0007051, all of which are incorporated herein by reference. The GATEWAY™ Cloning Technology Instruction Manual, which is also supplied by Invitrogen, provides concise directions for routine cloning of any desired DNA into a vector comprising operable plant expression elements. Another alternative vector fabrication method employs ligation-independent cloning as disclosed by Aslandis et al. (1990) Nucleic Acids Res., 18:6069-6074 and Rashtchian et al. (1992) Biochem., 206:91-97, where a DNA fragment with single-stranded 5' and 3' ends is ligated into a desired vector which can then be amplified in vivo.

[0061] In certain embodiments, the DNA sequence of the recombinant DNA construct includes sequence that has been codon-optimized for the plant in which the recombinant DNA construct is to be expressed. For example, a recombinant DNA construct to be expressed in a plant can have all or parts of its sequence (e. g., the first gene suppression element or the gene expression element) codon-optimized for expression in a plant by methods known in the art. See, e. g., U. S. Patent 5,500,365, incorporated by reference, for a description of codon-optimization for plants; see also De Amicis and Marchetti (2000) Nucleic Acid Res., 28:3339-3346.

TRANSGENIC PLANT CELLS AND PLANTS



[0062] Further provided is a non-natural transgenic plant cell including any of the recombinant DNA constructs, as described above under the heading "Recombinant DNA Constructs". Further provided is a non-natural transgenic plant containing the non-natural transgenic plant cell as described above. The non-natural transgenic plant includes plants of any developmental stage, and includes a regenerated plant prepared from the transgenic plant cells disclosed herein, or a progeny plant (which can be an inbred or hybrid progeny plant) of the regenerated plant, or seed of such a transgenic plant. Also provided is a transgenic seed having in its genome any of the recombinant DNA constructs provided as described above. The non-natural transgenic plant cells, non-natural transgenic plants, and transgenic seeds are made by methods well-known in the art, as described below under the heading "Making and Using Non-natural Transgenic Plant Cells and Non-natural Transgenic Plants".

[0063] The non-natural transgenic plant cell can include an isolated plant cell (e. g., individual plant cells or cells grown in or on an artificial culture medium), or can include a plant cell in undifferentiated tissue (e. g., callus or any aggregation of plant cells). The non-natural transgenic plant cell can include a plant cell in at least one differentiated tissue selected from the group consisting of leaf (e. g., petiole and blade), root, stem (e. g., tuber, rhizome, stolon, bulb, and corm) stalk (e. g., xylem, phloem), wood, seed, fruit (e. g., nut, grain, fleshy fruits), and flower (e. g., stamen, filament, anther, pollen, carpel, pistil, ovary, ovules).

[0064] The non-natural transgenic plant cell or non-natural transgenic plant can be any suitable plant cell or plant of interest. Both transiently transformed and stably transformed plant cells are encompassed therewith. Stably transformed transgenic plants are particularly preferred. It is preferred that the non-natural transgenic plant is a fertile transgenic plant from which seed can be harvested, and the invention further claims transgenic seed of such transgenic plants, wherein the seed also contains the recombinant construct as described above.

Making and Using Non-natural Transgenic Plant Cells and Non-natural Transgenic Plants



[0065] Where a recombinant DNA construct is used to produce a non-natural transgenic plant cell, non-natural transgenic plant, or transgenic seed transformation can include any of the well-known and demonstrated methods and compositions. Suitable methods for plant transformation include virtually any method by which DNA can be introduced into a cell, such as by direct delivery of DNA (e. g., by PEG-mediated transformation of protoplasts, by electroporation, by agitation with silicon carbide fibers, and by acceleration of DNA coated particles), by Agrobacterium-mediated transformation, by viral or other vectors, etc. One preferred method of plant transformation is microprojectile bombardment, for example, as illustrated in U.S. Patents 5,015,580 (soy), 5,550,318 (maize), 5,538,880 (maize), 6,153,812 (wheat), 6,160,208 (maize), 6,288,312 (rice) and 6,399,861 (maize), and 6,403,865 (maize).

[0066] Another preferred method of plant transformation is Agrobacterium-mediated transformation. In one preferred embodiment, the non-natural transgenic plant cell of this invention is obtained by transformation by means of Agrobacterium containing a binary Ti plasmid system, wherein the Agrobacterium carries a first Ti plasmid and a second, chimeric plasmid containing at least one T-DNA border of a wild-type Ti plasmid, a promoter functional in the transformed plant cell and operably linked to a gene suppression construct of the invention. See, for example, the binary system described in U. S. Patent 5,159,135, incorporated by reference. Also see De Framond (1983) Biotechnology, 1:262-269; and Hoekema et al., (1983) Nature, 303:179. In such a binary system, the smaller plasmid, containing the T-DNA border or borders, can be conveniently constructed and manipulated in a suitable alternative host, such as E. coli, and then transferred into Agrobacterium.

[0067] Detailed procedures for Agrobacterium-mediated transformation of plants, especially crop plants, include, for example, procedures disclosed in U. S. Patents 5,004,863, 5,159,135, and 5,518,908 (cotton); 5,416,011, 5,569,834, 5,824,877 and 6,384,301 (soy); 5,591,616 and 5,981,840 (maize); 5,463,174 (brassicas), and in U. S. Patent Application Publication 2004/0244075 (maize). Similar methods have been reported for many plant species, both dicots and monocots, including, among others, peanut (Cheng et al. (1996) Plant Cell Rep., 15: 653); asparagus (Bytebier et al. (1987) Proc. Natl. Acad. Sci. U.S.A., 84:5345); barley (Wan and Lemaux (1994) Plant Physiol., 104:37); rice (Toriyama et al. (1988) Bio/Technology, 6:10; Zhang et al. (1988) Plant Cell Rep., 7:379; wheat (Vasil et al. (1992) Bio/Technology, 10:667; Becker et al. (1994) Plant J. , 5:299), alfalfa (Masoud et al. (1996) Transgen. Res., 5:313); and tomato (Sun et al. (2006) Plant Cell Physiol., 47:426-431). See also a description of vectors, transformation methods, and production of transformed Arabidopsis thaliana plants where transcription factors are constitutively expressed by a CaMV35S promoter, in U. S. Patent Application Publication 2003/0167537. Transgenic plant cells and transgenic plants can also be obtained by transformation with other vectors, such as, but not limited to, viral vectors (e. g., tobacco etch potyvirus (TEV), barley stripe mosaic virus (BSMV), and the viruses referenced in Edwardson and Christie, "The Potyvirus Group: Monograph No. 16, 1991, Agric. Exp. Station, Univ. of Florida), plasmids, cosmids, YACs (yeast artificial chromosomes), BACs (bacterial artificial chromosomes) or any other suitable cloning vector, when used with an appropriate transformation protocol, e. g., bacterial infection (e.g., with Agrobacterium as described above), binary bacterial artificial chromosome constructs, direct delivery of DNA (e. g., via PEG-mediated transformation, desiccation/inhibition-mediated DNA uptake, electroporation, agitation with silicon carbide fibers, and microprojectile bombardment). It would be clear to one of ordinary skill in the art that various transformation methodologies can be used and modified for production of stable transgenic plants from any number of plant species of interest.

[0068] Transformation methods to provide transgenic plant cells and transgenic plants containing stably integrated recombinant DNA are preferably practiced in tissue culture on media and in a controlled environment. "Media" refers to the numerous nutrient mixtures that are used to grow cells in vitro, that is, outside of the intact living organism. Recipient cell targets include meristem cells, callus, immature embryos or parts of embryos, and gametic cells such as microspores, pollen, sperm, and egg cells. Any cell from which a fertile plant can be regenerated is contemplated as a useful recipient cell for practice of the invention. Callus can be initiated from various tissue sources, including, but not limited to, immature embryos or parts of embryos, seedling apical meristems and microspores. Those cells which are capable of proliferating as callus can serve as recipient cells for genetic transformation. Practical transformation methods and materials for making non-natural transgenic plants of this invention (e. g., various media and recipient target cells, transformation of immature embryos, and subsequent regeneration of fertile transgenic plants) are disclosed, for example, in U. S. Patents 6,194,636 and 6,232,526 and U. S. Patent Application Publication 2004/0216189. Transgenic plants include transgenic plant tissue or parts, such as transgenic rootstock or transgenic graft or scion material, which can be used in combination with non-transgenic plant tissue or parts.

[0069] In general transformation practice, DNA is introduced into only a small percentage of target cells in any one transformation experiment. Marker genes are generally used to provide an efficient system for identification of those cells that are stably transformed by receiving and integrating a transgenic DNA construct into their genomes. Preferred marker genes provide selective markers which confer resistance to a selective agent, such as an antibiotic or herbicide. Any of the antibiotics or herbicides to which a plant cell may be resistant can be a useful agent for selection. Potentially transformed cells are exposed to the selective agent. In the population of surviving cells will be those cells where, generally, the resistance-conferring gene is integrated and expressed at sufficient levels to permit cell survival. Cells can be tested further to confirm stable integration of the recombinant DNA. Commonly used selective marker genes include those conferring resistance to antibiotics such as kanamycin or paromomycin (nptII), hygromycin B (aph IV) and gentamycin (aac3 and aacC4) or resistance to herbicides such as glufosinate (bar or pat) and glyphosate (EPSPS). Examples of useful selective marker genes and selection agents are illustrated in U. S. Patents 5,550,318, 5,633,435, 5,780,708, and 6,118,047. Screenable markers or reporters, such as markers that provide an ability to visually identify transformants can also be employed. Non-limiting examples of useful screenable markers include, for example, a gene expressing a protein that produces a detectable color by acting on a chromogenic substrate (e. g., beta-glucuronidase (GUS) (uidA) or luciferase (luc)) or that itself is detectable, such as green fluorescent protein (GFP) (gfp) or an immunogenic molecule. Those of skill in the art will recognize that many other useful markers or reporters are available for use.

[0070] Detecting or measuring the resulting change in expression of the target gene (or concurrent expression of a gene of interest) obtained by transcription of the recombinant construct in the non-natural transgenic plant of the invention can be achieved by any suitable methods, including protein detection methods (e. g., western blots, ELISAs, and other immunochemical methods), measurements of enzymatic activity, or nucleic acid detection methods (e. g., Southern blots, northern blots, PCR, RT-PCR, fluorescent in situ hybridization). Such methods are well known to those of ordinary skill in the art as evidenced by the numerous handbooks available; see, for example, Joseph Sambrook and David W. Russell, "Molecular Cloning: A Laboratory Manual" (third edition), Cold Spring Harbor Laboratory Press, NY, 2001; Frederick M. Ausubel et al. (editors) "Short Protocols in Molecular Biology" (fifth edition), John Wiley and Sons, 2002; John M. Walker (editor) "Protein Protocols Handbook" (second edition), Humana Press, 2002; and Leandro Peña (editor) "Transgenic Plants: Methods and Protocols", Humana Press, 2004.

[0071] Other suitable methods for detecting or measuring the resulting change in expression of the target gene (or concurrent expression of a gene of interest) obtained by transcription of the recombinant DNA in the non-natural transgenic plant of the invention include measurement of any other trait that is a direct or proxy indication of expression of the target gene (or concurrent expression of a gene of interest) in the transgenic plant in which the recombinant DNA is transcribed, relative to one in which the recombinant DNA is not transcribed, e. g., gross or microscopic morphological traits, growth rates, yield, reproductive or recruitment rates, resistance to pests or pathogens, or resistance to biotic or abiotic stress (e. g., water deficit stress, salt stress, nutrient stress, heat or cold stress). Such methods can use direct measurements of a phenotypic trait or proxy assays (e. g., in plants, these assays include plant part assays such as leaf or root assays to determine tolerance of abiotic stress).

[0072] The recombinant DNA constructs of the invention can be stacked with other recombinant DNA for imparting additional traits (e. g., in the case of transformed plants, traits including herbicide resistance, pest resistance, cold germination tolerance, water deficit tolerance) for example, by expressing or suppressing other genes. Constructs for coordinated decrease and increase of gene expression are disclosed in U.S. Patent Application Publication 2004/0126845.

[0073] Seeds of transgenic, fertile plants can be harvested and used to grow progeny generations, including hybrid generations, of non-natural transgenic plants of this invention that include the recombinant DNA construct in their genome. Thus, in addition to direct transformation of a plant with a recombinant DNA construct, non-natural transgenic plants can be prepared by crossing a first plant having the recombinant DNA with a second plant lacking the construct. For example, the recombinant DNA can be introduced into a plant line that is amenable to transformation to produce a non-natural transgenic plant, which can be crossed with a second plant line to introgress the recombinant DNA into the resulting progeny. A non-natural transgenic plant with one recombinant DNA (effecting change in expression of a target gene) can be crossed with a plant line having other recombinant DNA that confers one or more additional trait(s) (such as herbicide resistance, pest or disease resistance, environmental stress resistance, modified nutrient content, and yield improvement) to produce progeny plants having recombinant DNA that confers both the desired target sequence expression behavior and the additional trait(s).

[0074] Typically, in such breeding for combining traits the transgenic plant donating the additional trait is a male line and the transgenic plant carrying the base traits is the female line. The progeny of this cross segregate such that some of the plant will carry the DNA for both parental traits and some will carry DNA for one parental trait; such plants can be identified by markers associated with parental recombinant DNA Progeny plants carrying DNA for both parental traits can be crossed back into the female parent line multiple times, e. g., usually 6 to 8 generations, to produce a progeny plant with substantially the same genotype as one original transgenic parental line but for the recombinant DNA of the other transgenic parental line.

[0075] Further disclosed is a non-natural transgenic plant grown from the above-mentioned transgenic seed. Non-natural transgenic plants are contemplated that grown directly from transgenic seed containing the recombinant DNA as well as progeny generations of plants, including inbred or hybrid plant lines, made by crossing a transgenic plant grown directly from transgenic seed to a second plant not grown from the same transgenic seed.

[0076] Crossing can include, for example, the following steps:
  1. (a) plant seeds of the first parent plant (e.g., non-transgenic or a transgenic) and a second parent plant that is transgenic according to the invention;
  2. (b) grow the seeds of the first and second parent plants into plants that bear flowers;
  3. (c) pollinate a flower from the first parent with pollen from the second parent; and
  4. (d) harvest seeds produced on the parent plant bearing the fertilized flower.


[0077] It is often desirable to introgress recombinant DNA into elite varieties, e.g., by backcrossing, to transfer a specific desirable trait from one source to an inbred or other plant that lacks that trait. This can be accomplished, for example, by first crossing a superior inbred ("A") (recurrent parent) to a donor inbred ("B") (non-recurrent parent), which carries the appropriate gene(s) for the trait in question, for example, a construct prepared in accordance with the current invention. The progeny of this cross first are selected in the resultant progeny for the desired trait to be transferred from the non-recurrent parent "B", and then the selected progeny are mated back to the superior recurrent parent "A". After five or more backcross generations with selection for the desired trait, the progeny are hemizygous for loci controlling the characteristic being transferred, but are like the superior parent for most or almost all other genes. The last backcross generation would be selfed to give progeny which are pure breeding for the gene(s) being transferred, i.e., one or more transformation events.

[0078] Through a series of breeding manipulations, a selected DNA construct can be moved from one line into an entirely different line without the need for further recombinant manipulation. One can thus produce inbred plants which are true breeding for one or more DNA constructs. By crossing different inbred plants, one can produce a large number of different hybrids with different combinations of DNA constructs. In this way, plants can be produced which have the desirable agronomic properties frequently associated with hybrids ("hybrid vigor"), as well as the desirable characteristics imparted by one or more DNA constructs.

[0079] Genetic markers can be used to assist in the introgression of one or more DNA constructs of the invention from one genetic background into another. Marker assisted selection offers advantages relative to conventional breeding in that it can be used to avoid errors caused by phenotypic variations. Further, genetic markers can provide data regarding the relative degree of elite germplasm in the individual progeny of a particular cross. For example, when a plant with a desired trait which otherwise has a non-agronomically desirable genetic background is crossed to an elite parent, genetic markers can be used to select progeny which not only possess the trait of interest, but also have a relatively large proportion of the desired germplasm. In this way, the number of generations required to introgress one or more traits into a particular genetic background is minimized. The usefulness of marker assisted selection in breeding non-natural transgenic plants of the current invention, as well as types of useful molecular markers, such as but not limited to SSRs and SNPs, are discussed in WO 02/062129 and U. S. Patent Application Publications Numbers 2002/0133852, 2003/0049612, and 2003/0005491.

[0080] In certain non-natural transgenic plant cells and non-natural transgenic plants , it may be desirable to concurrently express (or suppress) a gene of interest while also regulating expression of a target gene. Thus, in such cases, the non-natural transgenic plant contains recombinant DNA further including a gene expression (or suppression) element for expressing at least one gene of interest, and regulation of expression of a target gene is preferably effected with concurrent expression (or suppression) of the at least one gene of interest in the transgenic plant.

[0081] Thus, as described herein, the non-natural transgenic plant cells or non-natural transgenic plants can be obtained by use of any appropriate transient or stable, integrative or non-integrative transformation method known in the art or presently disclosed. The recombinant DNA constructs can be transcribed in any plant cell or tissue or in a whole plant of any developmental stage. Transgenic plants can be derived from any monocot or dicot plant, such as plants of commercial or agricultural interest, such as crop plants (especially crop plants used for human food or animal feed), wood- or pulp-producing trees, vegetable plants, fruit plants, and ornamental plants. Non-limiting examples of plants of interest include grain crop plants (such as wheat, oat, barley, maize, rye, triticale, rice, millet, sorghum, quinoa, amaranth, and buckwheat); forage crop plants (such as forage grasses and forage dicots including alfalfa, vetch and clover); oilseed crop plants (such as cotton, safflower, sunflower, soybean, canola, rapeseed, flax, peanuts, and oil palm); tree nuts (such as walnut, cashew, hazelnut, pecan and almond); sugarcane, coconut, date palm, olive, sugarbeet, tea, and coffee; wood- or pulp-producing trees; vegetable crop plants such as legumes (for example, beans, peas, lentils, alfalfa, peanut), lettuce, asparagus, artichoke, celery, carrot, radish, the brassicas (for example, cabbages, kales, mustards, and other leafy brassicas, broccoli, cauliflower, Brussels sprouts, turnip, kohlrabi), edible cucurbits (for example, cucumbers, melons, summer squashes, winter squashes), edible alliums (for example, onions, garlic, leeks, shallots, chives), edible members of the Solanaceae (for example, tomatoes, eggplants, potatoes, peppers, groundcherries), and edible members of the Chenopodiaceae (for example, beet, chard, spinach, quinoa, amaranth); fruit crop plants such as apple, pear, citrus fruits (for example, orange, lime, lemon, grapefruit, and others), stone fruits (for example, apricot, peach, plum, nectarine), banana, pineapple, grape, kiwifruit, papaya, avocado, and berries; and ornamental plants including ornamental flowering plants, ornamental trees and shrubs, ornamental groundcovers, and ornamental grasses. Preferred dicot plants include canola, broccoli, cabbage, carrot, cauliflower, Chinese cabbage, cucumber, dry beans, eggplant, fennel, garden beans, gourds, lettuces, melons, okra, peas, peppers, pumpkin, radishes, spinach, squash, watermelon, cotton, potato, quinoa, amaranth, buckwheat, safflower, soybean, sugarbeet, and sunflower. Preferred monocots include wheat, oat, barley, maize (including sweet corn and other varieties), rye, triticale, rice, ornamental and forage grasses, sorghum, millet, onions, leeks, and sugarcane, more preferably maize, wheat, and rice.

[0082] The ultimate goal in plant transformation is to produce plants which are useful to man. In this respect, non-natural transgenic plants can be used for virtually any purpose deemed of value to the grower or to the consumer. For example, one may wish to harvest the transgenic plant itself, or harvest transgenic seed of the transgenic plant for planting purposes, or products can be made from the transgenic plant or its seed such as oil, starch, ethanol or other fermentation products, animal feed or human food, pharmaceuticals, and various industrial products. For example, maize is used extensively in the food and feed industries, as well as in industrial applications. Further discussion of the uses of maize can be found, for example, in U. S. Patent Numbers 6,194,636, 6,207,879, 6,232,526, 6,426,446, 6,429,357, 6,433,252, 6,437,217, and 6,583,338, and WO 95/06128 and WO 02/057471. Thus, also disclosed are commodity products produced from a transgenic plant cell, plant, or seed of this invention, including harvested leaves, roots, shoots, tubers, stems, fruits, seeds, or other parts of a plant, meals, oils, extracts, fermentation or digestion products, crushed or whole grains or seeds of a plant, or any food or non-food product including such commodity products produced from a transgenic plant cell, plant, or seed as set forth herein before. The detection of one or more of nucleic acid sequences of the recombinant DNA constructs in one or more commodity or commodity products contemplated herein is de facto evidence that the commodity or commodity product contains or is derived from such a transgenic plant cell, plant, or seed.

[0083] The non-natural transgenic plant prepared from the non-natural transgenic plant cell is a transgenic plant having in its genome an above-mentioned recombinant DNA construct and has at least one additional altered trait, relative to a plant lacking the recombinant DNA construct, selected from the group of traits consisting of:
  1. (a) improved abiotic stress tolerance;
  2. (b) improved biotic stress tolerance;
  3. (c) modified primary metabolite composition;
  4. (d) modified secondary metabolite composition;
  5. (e) modified trace element, carotenoid, or vitamin composition;
  6. (f) improved yield;
  7. (g) improved ability to use nitrogen or other nutrients;
  8. (h) modified agronomic characteristics;
  9. (i) modified growth or reproductive characteristics; and
  10. (j) improved harvest, storage, or processing quality.


[0084] It is preferred that the non-natural transgenic plant is characterized by: improved tolerance of abiotic stress (e. g., tolerance of water deficit or drought, heat, cold, non-optimal nutrient or salt levels, non-optimal light levels) or of biotic stress (e. g., crowding, allelopathy, or wounding); by a modified primary metabolite (e. g., fatty acid, oil, amino acid, protein, sugar, or carbohydrate) composition; a modified secondary metabolite (e. g., alkaloids, terpenoids, polyketides, non-ribosomal peptides, and secondary metabolites of mixed biosynthetic origin) composition; a modified trace element (e. g., iron, zinc), carotenoid (e. g., beta-carotene, lycopene, lutein, zeaxanthin, or other carotenoids and xanthophylls), or vitamin (e. g., tocopherols) composition; improved yield (e. g., improved yield under non-stress conditions or improved yield under biotic or abiotic stress); improved ability to use nitrogen or other nutrients; modified agronomic characteristics (e. g., delayed ripening; delayed senescence; earlier or later maturity; improved shade tolerance; improved resistance to root or stalk lodging; improved resistance to "green snap" of stems; modified photoperiod response); modified growth or reproductive characteristics (e. g., intentional dwarfing; intentional male sterility, useful, e. g., in improved hybridization procedures; improved vegetative growth rate; improved germination; improved male or female fertility); improved harvest, storage, or processing quality (e. g., improved resistance to pests during storage, improved resistance to breakage, improved appeal to consumers); or any combination of these traits.

[0085] It is preferred that, transgenic seed, or seed produced by the non-natural transgenic plant, has modified primary metabolite (e. g., fatty acid, oil, amino acid, protein, sugar, or carbohydrate) composition, a modified secondary metabolite (e. g., alkaloids, terpenoids, polyketides, non-ribosomal peptides, and secondary metabolites of mixed biosynthetic origin) composition, a modified trace element (e. g., iron, zinc), carotenoid (e. g., beta-carotene, lycopene, lutein, zeaxanthin, or other carotenoids and xanthophylls), or vitamin (e. g., tocopherols,) composition, an improved harvest, storage, or processing quality, or a combination of these. For example, it can be desirable to modify the amino acid (e. g., lysine, methionine, tryptophan, or total protein), oil (e. g., fatty acid composition or total oil), carbohydrate (e. g., simple sugars or starches), trace element, carotenoid, or vitamin content of seeds of crop plants (e. g., canola, cotton, safflower, soybean, sugarbeet, sunflower, wheat, maize, or rice), preferably in combination with improved seed harvest, storage, or processing quality, and thus provide improved seed for use in animal feeds or human foods. In another instance, it can be desirable to change levels of native components of the transgenic plant or seed of a transgenic plant, for example, to decrease levels of proteins with low levels of lysine, methionine, or tryptophan, or to increase the levels of a desired amino acid or fatty acid, or to decrease levels of an allergenic protein or glycoprotein (e. g., peanut allergens including ara h 1, wheat allergens including gliadins and glutenins, soybean allergens including P34 allergen, globulins, glycinins, and conglycinins) or of a toxic metabolite (e. g., cyanogenic glycosides in cassava, solanum alkaloids in members of the Solanaceae).

METHODS OF GENE SUPPRESSION



[0086] Further disclosed is a method of effecting gene suppression, including the steps of: (a) providing a non-natural transgenic plant including a regenerated plant prepared from a non-natural transgenic plant cell, or a progeny plant of the regenerated plant (as described above under the heading "Transgenic Plant Cells and Plants"); and (b) transcribing the recombinant DNA construct in the non-natural transgenic plant; wherein the transcribing produces RNA that is capable of suppressing the at least one target gene in the non-natural transgenic plant, and whereby the at least one target gene is suppressed relative to its expression in the absence of transcription of the recombinant DNA construct.

[0087] The at least one target gene is at least one gene selected from the group consisting of a gene native to the transgenic plant, a transgene in the transgenic plant, and a gene native to a viral, a bacterial, a fungal, or an invertebrate pest or pathogen of the transgenic plant. Suitable target genes are described above under the heading "Target Genes". In some embodiments, the at least one target gene is a single target gene. In other embodiments, the at least one target gene is multiple target genes. Suppression of a target gene includes non-specific suppression, e. g., constitutive expression, as well as specific expression, e. g., spatially specific, temporally specific, developmentally specific, or inducible gene suppression. Specificity of suppression of the at least one target gene is achieved by techniques known to those skilled in the art, such as by selecting a promoter having the desired specific expression pattern, or by selecting a microRNA recognition site that is recognized by a mature miRNA having the desired specific expression pattern.

[0088] Transcription of the recombinant DNA construct is carried out by means known in the art. The transcription may be constitutive or non-specific, e. g., under the control of a constitutive promoter. In other cases the , transcription may occur under specific spatial, temporal, or inducible conditions. For example, the recombinant DNA construct can include a spatially, temporally, or inducible specific promoter. In another example, the recombinant DNA construct can include a riboswitch (DNA that transcribes to an RNA aptamer capable of binding to a ligand, and DNA that transcribes to regulatory RNA capable of regulating expression of the target gene, wherein the regulation is dependent on the conformation of the regulatory RNA, and the conformation of the regulatory RNA is allosterically affected by the binding state of the RNA aptamer) thereby allowing transcription of the recombinant DNA construct to be controlled by the binding state of the RNA aptamer and thus the presence (or absence) of the ligand.

[0089] Further disclosed is a method of concurrently effecting gene suppression of at least one target gene and gene expression of at least one gene of interest, including the steps of: (a) providing a non-natural transgenic plant including a regenerated plant prepared from the non-natural transgenic plant cell, or a progeny plant of the regenerated plant (as described above under the heading "Transgenic Plant Cells and Plants"), wherein the recombinant DNA construct further includes a gene expression element for expressing the at least one gene of interest; and (b) transcribing the recombinant DNA construct in the non-natural transgenic plant, wherein, when the recombinant DNA construct is transcribed in the non-natural transgenic plant, transcribed RNA that is capable of suppressing the at least one target gene and transcribed RNA encoding the at least one gene of interest are produced, whereby the at least one target gene is suppressed relative to its expression in the absence of transcription of the recombinant DNA construct and the at least one gene of interest is concurrently expressed.

[0090] A gene of interest can include any coding or non-coding sequence from any species (including non-eukaryotes such as bacteria, and viruses; fungi; plants, including monocots and dicots, such as crop plants, ornamental plants, and non-domesticated or wild plants; invertebrates such as arthropods, annelids, nematodes, and molluscs; and vertebrates such as amphibians, fish, birds, and mammals. Non-limiting examples of a non-coding sequence to be expressed by a gene expression element include 5' untranslated regions, promoters, enhancers, or other non-coding transcriptional regions, 3' untranslated regions, terminators, intron, microRNAs, microRNA precursor DNA sequences, small interfering RNAs, RNA components of ribosomes or ribozymes, small nucleolar RNAs, RNA aptamers capable of binding to a ligand, and other non-coding RNAs. Non-limiting examples of a gene of interest further include translatable (coding) sequence, such as genes encoding transcription factors and genes encoding enzymes involved in the biosynthesis or catabolism of molecules of interest (such as amino acids, fatty acids and other lipids, sugars and other carbohydrates, biological polymers, and secondary metabolites including alkaloids, terpenoids, polyketides, non-ribosomal peptides, and secondary metabolites of mixed biosynthetic origin). A gene of interest can be a gene native to the cell (e. g., a plant cell) in which the recombinant DNA construct of the invention is to be transcribed, or can be a non-native gene. A gene of interest can be a marker gene, for example, a selectable marker gene encoding antibiotic, antifungal, or herbicide resistance, or a marker gene encoding an easily detectable trait (e. g., in a plant cell, phytoene synthase or other genes imparting a particular pigment to the plant), or a gene encoding a detectable molecule, such as a fluorescent protein, luciferase, or a unique polypeptide or nucleic acid "tag" detectable by protein or nucleic acid detection methods, respectively). Selectable markers are genes of interest of particular utility in identifying successful processing of the constructs. Genes of interest include those genes also described above as target genes, under the heading "Target Genes".

[0091] The gene of interest to be expressed by the gene expression element can include at least one gene selected from the group consisting of a eukaryotic target gene, a non-eukaryotic target gene, and a microRNA precursor DNA sequence. The gene of interest can include a single gene or multiple genes (such as multiple copies of a single gene, multiple alleles of a single gene, or multiple genes including genes from multiple species). The gene expression element can include self-hydrolyzing peptide sequences, e. g., located between multiple sequences coding for one or more polypeptides (see, for example, the 2A and "2Alike" self-cleaving sequences from various species, including viruses, trypanosomes, and bacteria, disclosed by Donnelly et al. (2001), J. Gen. Virol., 82:1027-1041). Further, the gene expression element can include ribosomal "skip" sequences, e. g., located between multiple sequences coding for one or more polypeptides (see, for example, the aphthovirus foot-and-mouth disease virus (FMDV) 2A ribosomal "skip" sequences disclosed by Donnelly et al. (2001), J. Gen. Virol., 82:1013-1025).

ABIOTIC-STRESS-RESPONSIVE MIRNAs



[0092] Further described are miRNAs that exhibit an expression pattern that is responsive to abiotic stress, for example, a miRNA that exhibits an expression pattern characterized by regulation of the miRNA by nutrient stress, a miRNA that exhibits an expression pattern characterized by regulation of the miRNA by water stress, or a miRNA that exhibits an expression pattern characterized by regulation of the miRNA by temperature stress.

[0093] Examples 6 - 11 describe a novel miRNA that was identified in crop plants and assigned the trivial name miRMON18, which exhibits an expression pattern characterized by suppression of the miRNA under nutrient stress (i. e., nitrogen deficiency, phosphate deficiency, or both nitrogen and phosphate deficiency). The mature miRMON18 is a 21-nucleotide miRNA with the sequence UUAGAUGACCAUCAGCAAACA and was cloned from rice (SEQ ID NO. 393), maize (SEQ ID NO. 3227), and soybean (SEQ ID NO. 8742) small RNA libraries. Precursor sequences were identified in rice (SEQ ID NO. 1763) and in maize (SEQ ID NO. 3936).

[0094] Recombinant DNA constructs are described in detail under the heading "Recombinant DNA Constructs" above and are useful with any of the miRNAs disclosed herein, for example, a mature miRNA selected from SEQ ID NOS. 1 - 1035, SEQ ID NOS. 2730 - 3921, SEQ ID NOS. 5498 - 6683, SEQ ID NOS. 8409 - 8560, SEQ ID NO 8742, SEQ ID NO. 8744, SEQ ID NOS. 8812 - 8815, SEQ ID NO. 8845, and SEQ ID NO. 8850, or a mature miRNA derived from a plant miRNA precursor sequence selected from SEQ ID NOS. 1036 - 2690, SEQ ID NOS. 3922 - 5497, SEQ ID NOS. 6684 - 8408, SEQ ID NOS. 8561 - 8417, SEQ ID NO. 8743, SEQ ID NO. 8800, and SEQ ID NOS. 8816 - 8819. The description of recombinant DNA constructs also applies to miRNAs having a particular expression pattern, such as a nutrient-stress-responsive plant miRNA (e. g., miRMON18 and other miRNAs described in the Examples) as described in this section. The following description is directed to miRMON18 but is also applicable to other miRNAs regulated by abiotic stress, especially a miRNAs that exhibits an expression pattern characterized by suppression of the miRNA under nutrient stress, a miRNA that exhibits an expression pattern characterized by suppression of the miRNA under water stress, or a miRNA that exhibits an expression pattern characterized by suppression of the miRNA under temperature stress; non-limiting examples of miRNAs regulated by abiotic stress include miR399 and miR319.

[0095] Thus, described is a recombinant DNA construct including at least one transcribable DNA element for modulating the expression of at least one target gene, wherein the at least one transcribable DNA element is selected from the group consisting of: (a) a DNA element that transcribes to an miRNA precursor with the fold-back structure of a miRMON 18 precursor sequence selected from SEQ ID NO. 1763 and SEQ ID NO. 3936 and is processed to a mature miRMON18 miRNA having the sequence of UUAGAUGACCAUCAGCAAACA (SEQ ID NO. 393, SEQ ID NO. 3227, or SEQ ID NO. 8742); (b) a DNA element that transcribes to an engineered miRNA precursor derived from the fold-back structure of a miRMON18 precursor sequence selected from SEQ ID NO. 1763 and SEQ ID NO. 3936, wherein the engineered miRNA precursor includes a modified mature miRMON18 miRNA; (c) a DNA element that is located within or adjacent to a transgene transcription unit and that is transcribed to RNA including a miRNA recognition site recognized by a mature miRNA derived from a miRMON18 precursor sequence selected from SEQ ID NO. 1763 and SEQ ID NO. 3936; and (d) a DNA element for suppressing expression of an endogenous miRNA derived from a miRMON18 precursor sequence selected from SEQ ID NO. 1763 and SEQ ID NO. 3936. These embodiments directed to miRMON18 are described in more detail below.

(A) Expression of a native miRMON18 under non-native conditions.



[0096] Described is a recombinant DNA construct including at least one transcribable DNA element for modulating the expression of at least one target gene, wherein the at least one transcribable DNA element includes a DNA element that transcribes to a miRNA precursor with the fold-back structure of a miRMON18 precursor sequence selected from SEQ ID NO. 1763 and SEQ ID NO. 3936 and is processed to a mature miRMON18 miRNA having the sequence of SEQ ID NO. 393, SEQ ID NO. 3227, or SEQ ID NO. 8742, and the at least one target gene is an endogenous gene of a plant, and wherein expression of the recombinant DNA construct in the plant results in suppression of the at least one target gene. It is preferred that the miRNA precursor includes a contiguous segment of at least 90% of the nucleotides of the miRMON18 precursor sequence. Such constructs are especially useful for expression of miRMON18 in an expression pattern other than the native miRMON18 expression pattern (e. g., in different tissues, at different times, or at different levels of expression).

[0097] The miRMON18 precursor need not include all of the nucleotides contained in a miRMON18 precursor sequence selected from SEQ ID NO. 1763 and SEQ ID NO. 3936, but preferably includes a contiguous segment of at least 80%, or at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% of the nucleotides of a miRMON18 precursor sequence selected from SEQ ID NO. 1763 and SEQ ID NO. 3936. It is preferred that the miRNA precursor includes a contiguous segment of at least 90% of the nucleotides of a miRMON18 precursor sequence selected from SEQ ID NO. 1763 and SEQ ID NO. 3936. Regardless of the specific nucleotide sequence employed, the miRMON18 precursor forms a fold-back structure that is identical or near-identical to the fold-back structure formed by amiRMON18 precursor sequence selected from SEQ ID NO. 1763 and SEQ ID NO. 3936 and is processed in vivo by one or more steps to a mature miRMON18 miRNA having the sequence of SEQ ID NO. 393, SEQ ID NO. 3227, or SEQ ID NO. 8742.

[0098] It is preferred that the at least one target gene is an endogenous gene of a plant that includes at least one miRMON18 recognition site (target site), and expression of the recombinant DNA construct in the plant results in suppression of the at least one target gene. Further, it is preferred that the at least one target gene is an endogenous gene of a plant, and thus expression of the recombinant DNA construct in the plant results in suppression of the at least one target gene. Further it is preferred that the recombinant DNA construct further includes a promoter other than a native miRMON18 promoter. This permits expression of the mature miRMON18 miRNA under spatial or temporal or inducible conditions under which it would not natively be expressed. For example, the recombinant DNA construct can be designed to include a constitutive promoter and thus constitutively express a mature miRMON18 that has an expression pattern characterized by suppression of the miRNA under nutrient stress (i. e., nitrogen deficiency, phosphate deficiency, or both nitrogen and phosphate deficiency); this would result in constitutive suppression of the miRMON18 target gene. In another example, the recombinant DNA construct can be designed to include an inducible root-specific promoter and thus express a mature miRMON18 in root upon induction; this would result in suppression of the miRMON18 target gene in root tissue upon induction. Promoters that are useful with this recombinant DNA construct are described under the heading "Promoters".

(B) Expression of an engineered mature miRNA derived from miRMON18.



[0099] Described is a recombinant DNA construct that includes at least one transcribable DNA element for modulating the expression of at least one target gene, wherein the at least one transcribable DNA element for modulating the expression of at least one target gene includes a DNA element that transcribes to an engineered miRNA precursor derived from the fold-back structure of a miRMON18 precursor sequence selected from SEQ ID NO. 1763 and SEQ ID NO. 3936, wherein the engineered miRNA precursor includes a modified mature miRMON18 miRNA, wherein the at least one target gene is an endogenous gene of a plant or an endogenous gene of a pest or pathogen of the plant, and wherein expression of the recombinant DNA construct in the plant results in suppression of the at least one target gene.

[0100] It is preferred that the at least one target gene is an endogenous gene of a plant or an endogenous gene of a pest or pathogen of the plant, and expression of the recombinant DNA construct in the plant results in suppression of the at least one target gene. Suitable target genes are described above under the heading "Target Genes". By "engineered" is meant that nucleotides are changed (substituted, deleted, or added) in a native miRMON18 precursor sequence selected from SEQ ID NO. 1763 and SEQ ID NO. 3936, thereby resulting in an engineered miRNA precursor having substantially the same the fold-back structure as the native miRMON18 precursor sequence, but wherein the mature miRNA that is processed from the engineered miRMON18 precursor has a modified sequence (i. e., different from that of the native mature miRMON18) that is designed to suppress a target gene different from the target genes natively suppressed by the native miRMON18 precursor sequence. A general, non-limiting method for determining nucleotide changes in the native miRMON18 precursor sequence to produce the engineered miRNA precursor is described above under the heading "Expression of an engineered mature miRNA".

(C) Expression of a transgene and a miRMON18 recognition site.



[0101] Described is a recombinant DNA construct that includes at least one transcribable DNA element for modulating the expression of at least one target gene, and further includes a transgene transcription unit, wherein the at least one transcribable DNA element for modulating the expression of at least one target gene includes a DNA element that is located within or adjacent to the transgene transcription unit and that is transcribed to RNA including a miRNA recognition site recognized by a mature miRMON18 miRNA having the sequence of SEQ ID NO. 393, SEQ ID NO. 3227, or SEQ ID NO. 8742 or by a mature miRMON18 miRNA derived from a miRMON18 precursor sequence selected from SEQ ID NO. 1763 and SEQ ID NO. 3936, and the at least one target gene includes the transgene encoded by the transgene transcription unit, and wherein expression of the recombinant DNA construct in a plant results in expression of the transgene in cells of the plant wherein the mature miRMON18 miRNA is not natively expressed. Prediction of a miRMON18 recognition site is achieved using methods known in the art, such as sequence complementarity rules as described by Zhang (2005) Nucleic Acids Res., 33:W701-704 and by Rhoades et al. (2002) Cell, 110:513-520; non-limiting examples of miRMON18 recognition sites are provided in the working Examples below.

[0102] Prediction of a miRMON18 recognition site permits identification and validation of endogenous genes regulated by a mature miRMON18 from a natively expressed miRMON18 precursor; this is useful, e. g., to eliminate or modify a miRMON18 recognition site in an endogenous gene in order to decouple expression of that gene from regulation by the endogenous miRMON18 that natively regulates expression of the gene. In one embodiment, the number of mismatches (especially those corresponding to positions 2 to 13 of the mature miRMON18) between a miRMON18 recognition site and a mature miRMON18 can be increased to prevent recognition and cleavage by an endogenous miRMON18.

[0103] These recombinant DNA constructs are particularly useful for in planta expression of the transgene to be restricted according to the endogenous expression of miRMON18, that is, the transgene is expressed when miRMON18 is suppressed, such as under nutrient stress (i. e., nitrogen deficiency, phosphate deficiency, or both nitrogen and phosphate deficiency). Expression of the transgene can be further controlled by use of an appropriate promoter. In a non-limiting example, a recombinant DNA construct that encodes (a) a transgene under the control of a root-specific promoter and (b) a miRNA recognition site recognized by a mature miRMON18 that is specifically suppressed only under conditions of nitrogen (or phosphate) deficiency is used for expression of the transgene in roots of a plant under nitrogen-deficient (or phosphate-deficient) conditions.

[0104] The transgene transcription unit includes at least a transgene, and optionally additional sequence such as a promoter, a promoter enhancer, a terminator, messenger RNA stabilizing or destabilizing sequence (see, e. g., Newman et al. (1993) Plant Cell, 5:701-714; Green (1993) Plant Physiol., 102:1065-1070; and Ohme-Takagi et al. (1993) Proc. Natl. Acad. Sci. USA, 90:11811-11815), sequence for localization or transport of the transgene transcript to a specific locale (e. g., mitochondrion, plastid, nucleolus, peroxisome, endoplasmic reticulum.), or other sequence related to the desired processing of the transgene. The transgene encoded by the transgene transcription unit can include any one or more genes of interest, including coding sequence, non-coding sequence, or both. Genes of interest can include any of the genes listed under "Target Genes", preferred examples of which include translatable (coding) sequence for genes encoding transcription factors and genes encoding enzymes involved in the biosynthesis or catabolism of molecules of interest (such as amino acids, fatty acids and other lipids, sugars and other carbohydrates, biological polymers, and secondary metabolites including alkaloids, terpenoids, polyketides, non-ribosomal peptides, and secondary metabolites of mixed biosynthetic origin).

(D) Suppression of an endogenous or native miRMON18.



[0105] Described is a recombinant DNA construct that includes at least one transcribable DNA element for modulating the expression of at least one target gene, wherein the at least one transcribable DNA element includes a DNA element for suppressing expression of an endogenous mature miRMON18 miRNA derived from a miRMON18 precursor sequence selected from SEQ ID NO. 1763 and SEQ ID NO. 3936, wherein the at least one target gene is an endogenous gene of a plant, and wherein expression of the endogenous gene is suppressed in cells of the plant where native expression of the endogenous mature miRMON18 miRNA occurs, and wherein expression of the recombinant DNA construct in the cells results in expression of the endogenous gene in the cells. Such constructs are especially useful for suppression of a native or endogenous miRMON18 and thus for permitting expression of genes that have one or more miRMON18 recognition sites. It is preferred that the at least one target gene is an endogenous gene of a plant and includes one or more miRMON18 recognition sites, and expression of the endogenous gene is suppressed in cells of the plant where native expression of the mature miRMON18 occurs, and thus expression of the recombinant DNA construct in the cells results in expression of the endogenous target gene in the cells.

[0106] The DNA element for suppressing expression includes at least one of:
  1. (a) DNA that includes at least one anti-sense DNA segment that is anti-sense to at least one segment of the target gene;
  2. (b) DNA that includes multiple copies of at least one anti-sense DNA segment that is anti-sense to at least one segment of the target gene;
  3. (c) DNA that includes at least one sense DNA segment that is at least one segment of the target gene;
  4. (d) DNA that includes multiple copies of at least one sense DNA segment that is at least one segment of the target gene;
  5. (e) DNA that transcribes to RNA for suppressing the target gene by forming double-stranded RNA and includes at least one anti-sense DNA segment that is anti-sense to at least one segment of the target gene and at least one sense DNA segment that is at least one segment of the target gene;
  6. (f) DNA that transcribes to RNA for suppressing the target gene by forming a single double-stranded RNA and includes multiple serial anti-sense DNA segments that are anti-sense to at least one segment of the target gene and multiple serial sense DNA segments that are at least one segment of the target gene;
  7. (g) DNA that transcribes to RNA for suppressing the target gene by forming multiple double strands of RNA and includes multiple anti-sense DNA segments that are anti-sense to at least one segment of the target gene and multiple sense DNA segments that are at least one segment of the target gene, and wherein the multiple anti-sense DNA segments and the multiple sense DNA segments are arranged in a series of inverted repeats;
  8. (h) DNA that includes nucleotides derived from a plant miRNA;
  9. (i) DNA that includes nucleotides of a siRNA;
  10. (j) DNA that transcribes to an RNA aptamer capable of binding to a ligand; and
  11. (k) DNA that transcribes to an RNA aptamer capable of binding to a ligand, and DNA that transcribes to regulatory RNA capable of regulating expression of the target gene, wherein the regulation is dependent on the conformation of the regulatory RNA, and the conformation of the regulatory RNA is allosterically affected by the binding state of the RNA aptamer.


[0107] DNA elements for suppressing expression are described further in Example 3 and depicted in Figures 2 and 3. The effects of a miRNA on its target gene can also be controlled by alternative methods described in detail below under "MicroRNA Decoy Sequences".

[0108] The recombinant DNA construct may include DNA designed to be transcribed to single-stranded RNA or to at least partially double-stranded RNA (such as in a "kissing stem-loop" arrangement), or to an RNA that assumes a secondary structure or three-dimensional configuration (e. g., a large loop of antisense sequence of the target gene or an aptamer) that confers on the transcript an additional desired characteristic, such as increased stability, increased half-life in vivo, or cell or tissue specificity. In one example, the spacer is transcribed to a stabilizing loop that links the first and second series of contiguous RNA segments (see, for example, Di Giusto and King (2004) J. Biol. Chem., 279:46483-46489). In another example, the recombinant DNA construct includes DNA that transcribes to RNA including an RNA aptamer (e. g., an aptamer that binds to a cell-specific ligand) that allows cell- or tissue-specific targetting of the recombinant RNA duplex.

(E) miRNA-unresponsive transgenes, including miRMON18-unresponsive transgenes.



[0109] Also described is a recombinant DNA construct including a synthetic miRNA-unresponsive transgene sequence that is unresponsive to a given mature miRNA, wherein the synthetic miRNA-unresponsive transgene sequence is: (a) derived from a natively miRNA-responsive sequence by deletion or modification of all native miRNA recognition sites recognized by the given mature miRNA within the natively miRNA-responsive sequence, and (b) is not recognized by the given mature miRNA. This includes a recombinant DNA construct including a synthetic miRNA-unresponsive transgene sequence that is unresponsive to a mature miRNA selected from SEQ ID NOS. 1 - 1035, SEQ ID NOS. 2730 - 3921, SEQ ID NOS. 5498 - 6683, SEQ ID NOS. 8409 - 8560, SEQ ID NO 8742, SEQ ID NO. 8744, SEQ ID NOS. 8812 - 8815, SEQ ID NO. 8845, and SEQ ID NO. 8850, or unresponsive to a mature miRNA derived from a plant miRNA precursor sequence selected from SEQ ID NOS. 1036 - 2690, SEQ ID NOS. 3922 - 5497, SEQ ID NOS. 6684 - 8408, SEQ ID NOS. 8561-8417, SEQ ID NO. 8743, SEQ ID NO. 8800, and SEQ ID NOS. 8816 - 8819, wherein the synthetic miRNA-unresponsive transgene sequence is: (a) derived from a natively miRNA-responsive sequence by deletion or modification of all native miRNA recognition sites recognized by the given mature miRNA within the natively miRNA-responsive sequence, and (b) is not recognized by the given mature miRNA. Prediction of a recognition site is achieved using methods known in the art, such as sequence complementarity rules as described by Zhang (2005) Nucleic Acids Res., 33:W701-704 and by Rhoades et al. (2002) Cell, 110:513-520.

[0110] A recombinant DNA construct is preferred that includes a synthetic miRMON18-unresponsive transgene sequence, wherein the synthetic miRMON18-unresponsive transgene sequence is: (a) derived from a natively miRMON18-responsive sequence by deletion or modification of all native miRMON18 miRNA recognition sites (that is to say, deletion or modification of any recognition site that is recognized by a mature miRMON18 miRNA having the sequence of SEQ ID NO. 393, SEQ ID NO. 3227, or SEQ ID NO. 8742 or by a mature miRMON18 miRNA derived from a miRMON18 precursor sequence selected from SEQ ID NO. 1763 and SEQ ID NO. 3936) within the natively miRMON18-responsive sequence, and (b) is not recognized by a mature miRMON18 miRNA.

(F) Abiotic-stress-responsive miRNA promoters, including miRMON18 promoters.



[0111] Also described is a recombinant DNA construct including a promoter of a miRNA that exhibits an expression pattern characterized by regulation by abiotic stress, for example, a promoter of a miRNA that exhibits an expression pattern characterized by regulation of the miRNA by nutrient stress, a promoter of a miRNA that exhibits an expression pattern characterized by regulation of the miRNA by water stress, or a promoter of a miRNA that exhibits an expression pattern characterized by regulation of the miRNA by temperature stress. It is preferred that include a recombinant DNA construct includes a promoter of a miRNA that exhibits an expression pattern characterized by regulation of the miRNA by nutrient stress, wherein the nutrient stress comprises at least one nutrient deficiency selected from the group consisting of nitrogen deficiency and phosphate deficiency. The promoter may be that of a miRNA that is suppressed by nitrogen deficiency. In another case, the promoter may be that of a miRNA that is suppressed by inorganic phosphate deficiency. In yet another case, the promoter may be that of a miRNA that is suppressed by the co-occurrence of nitrogen and phosphate deficiency. In further cases, the promoter may be that of a miRNA that is upregulated by by nitrogen deficiency or by phosphate deficiency.

[0112] Particularly preferred is a recombinant DNA construct including a promoter of a miRNA that exhibits an expression pattern characterized by suppression of the miRNA under nutrient stress, wherein the nutrient stress comprises at least one nutrient deficiency selected from the group consisting of nitrogen deficiency and phosphate deficiency, and wherein the promoter includes at least one of: (a) the promoter of a maize miRNA that exhibits in leaf tissue strong expression under nitrogen-sufficient conditions and suppression under nitrogen-deficient conditions; (b) the promoter of a maize miRNA that exhibits in leaf tissue strong expression under phosphate-sufficient conditions and suppression under phosphate-deficient conditions; (c) a miRMON18 promoter having the sequence of SEQ ID NO. 8804; (d) a fragment of at least about 50 contiguous nucleotides having at least 85% identity to a segment of SEQ ID NO. 8804. Also preferred is that the promoter is operably linked to at least one of: (a) a gene suppression element, and (b) a gene expression element; preferably, this is useful for expressing the recombinant DNA construct in a plant

[0113] Non-limiting examples include the promoter having the sequence of nucleotides 211 - 2172 of SEQ ID NO. 8800; a fragment of at least about 50, at least about 100, at least about 150, at least about 200, at least about 300, at least about 400, or at least 500 contiguous nucleotides having at least 85%, at least 90%, at least 95%, or at least 98% identity to nucleotides 211 - 2172 of SEQ ID NO. 8800, wherein the fragment has promoter activity in at least one plant tissue that is characterized by strong expression under nitrogen-sufficient conditions and suppression under nitrogen-deficient conditions or strong expression under phosphate-sufficient conditions and suppression under phosphate-deficient conditions; and a fragment of at least about 50, at least about 100, at least about 150, at least about 200, at least about 300, at least about 400, or at least 500 contiguous nucleotides having at least 85%, at least 90%, at least 95%, or at least 98% identity to SEQ ID NO. 8804, wherein the fragment has promoter activity in at least one plant tissue that is characterized by strong expression under nitrogen-sufficient conditions and suppression under nitrogen-deficient conditions or strong expression under phosphate-sufficient conditions and suppression under phosphate-deficient conditions.

(G) Abiotic-stress-responsive transgenic plant cells and plants



[0114] Further described is a non-natural transgenic plant cell including any of the recombinant DNA constructs disclosed under this heading ("Abiotic-Stress-Responsive miRNAs"). Preferred is a non-natural transgenic plant prepared from a non-natural transgenic plant cell including a recombinant DNA construct including at least one transcribable DNA element for modulating the expression of at least one target gene, wherein the at least one transcribable DNA element includes a DNA element that transcribes to an miRNA precursor with the fold-back structure of a miRMON18 precursor sequence selected from SEQ ID NO. 1763, SEQ ID NO. 3936, and SEQ ID NO. 8800, wherein the miRNA precursor includes a contiguous segment of at least 90% of the nucleotides of the miRMON18 precursor sequence and is processed to a mature miRMON18 miRNA having the sequence of UUAGAUGACCAUCAGCAAACA (SEQ ID NO. 393, SEQ ID NO. 3227, or SEQ ID NO. 8742) and the at least one target gene is an endogenous gene of a plant and includes an SPX domain, and wherein expression of the recombinant DNA construct in the plant results in suppression of the at least one target gene; generally the recombinant DNA construct further includes a promoter other than the native miRMON18 promoter to drive expression of the mature miRMON18.

[0115] Further preferred is a non-natural transgenic plant prepared from a non-natural transgenic plant cell including a recombinant DNA construct including at least one transcribable DNA element for modulating the expression of at least one target gene, wherein the at least one transcribable DNA element includes a DNA element for suppressing expression of an endogenous mature miRMON18 miRNA derived from a miRMON18 precursor sequence selected from SEQ ID NO. 1763, SEQ ID NO. 3936, and SEQ ID NO. 8800, the at least one target gene is an endogenous gene of a plant and includes an SPX domain, and expression of the endogenous gene is suppressed in cells of the plant where native expression of the endogenous mature miRMON18 miRNA occurs, and wherein expression of the recombinant DNA construct in the cells results in expression of the endogenous gene in the cells. Suitable DNA elements for suppressing expression of an endogenous mature miRMON18 miRNA are described above under the heading "Suppression of an endogenous or native miRMON18".

MICRORNA DECOY SEQUENCES



[0116] Plant microRNAs regulate their target genes by recognizing and binding to a near-perfectly complementary sequence (miRNA recognition site) in the target transcript, followed by cleavage of the transcript by RNase III enzymes such as Ago1. In plants, certain mismatches between a given miRNA recognition site and the corresponding mature miRNA are not tolerated, particularly mismatched nucleotides at positions 10 and 11 of the mature miRNA. Positions within the mature miRNA are given in the 5' to 3' direction; for clarity, Figure 7D depicts examples of miRNAs, miR827 (SEQ ID NO. 8744) and miRMON18 (SEQ ID NO. 393, SEQ ID NO. 3227, or SEQ ID NO. 8742), with numbered arrows indicating positions 1, 10, and 21 of the mature miRNA; the nucleotide at position 10 is also underlined. Perfect complementarity between a given miRNA recognition site and the corresponding mature miRNA is usually required at positions 10 and 11 of the mature miRNA. See, for example, Franco-Zorrilla et al. (2007) Nature Genetics, 39:1033-1037; and Axtell et al. (2006) Cell, 127:565-577.

[0117] This characteristic of plant miRNAs was exploited to arrive at rules for predicting a "microRNA decoy sequence", i. e., a sequence that can be recognized and bound by an endogenous mature miRNA resulting in base-pairing between the miRNA decoy sequence and the endogenous mature miRNA, thereby forming a cleavage-resistant RNA duplex that is not cleaved because of the presence of mismatches between the miRNA decoy sequence and the mature miRNA. Mismatches include canonical mismatches (e. g., G-A, C-U, C-A) as well as G::U wobble pairs and indels (nucleotide insertions or deletions). In general, these rules define (1) mismatches that are required, and (2) mismatches that are permitted but not required.

[0118] Required mismatches include: (a) at least 1 mismatch between the miRNA decoy sequence and the endogenous mature miRNA at positions 9, 10, or 11 of the endogenous mature miRNA, or alternatively, (b) 1, 2, 3, 4, or 5 insertions (i. e., extra nucleotides) at a position in the miRNA decoy sequence corresponding to positions 9, 10, or 11 of the endogenous mature miRNA. In preferred embodiments, there exists either (a) at least 1 mismatch between the miRNA decoy sequence and the endogenous mature miRNA at positions 10 and/or 11 of the endogenous mature miRNA, or (b) at least 1 insertion at a position in the miRNA decoy sequence corresponding to positions 10 and/or 11 of the endogenous mature miRNA.

[0119] Mismatches that are permitted, but not required, include: (a) 0,1, or 2 mismatches between the miRNA decoy sequence and the endogenous mature miRNA at positions 1, 2, 3, 4, 5, 6, 7, 8, and 9 of the endogenous mature miRNA, and (b) 0, 1, 2, or 3 mismatches between the miRNA decoy sequence and the endogenous mature miRNA at positions 12 through the last position of the endogenous mature miRNA (i. e., at position 21 of a 21-nucleotide mature miRNA), wherein each of the mismatches at positions 12 through the last position of the endogenous mature miRNA is adjacent to at least one complementary base-pair (i. e., so that there is not more than 2 contiguous mismatches at positions 12 through the last position of the endogenous mature miRNA). In preferred embodiments, there exist no mismatches (i. e., there are all complementary base-pairs) at positions 1, 2, 3, 4, 5, 6, 7, and 8 of the endogenous mature miRNA.

[0120] The miRNA decoy sequence consists of 36 nucleotides. Specifically claimed embodiments include miRNA decoy sequences of 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, and 31 nucleotides. In non-limiting examples, a miRNA decoy sequence (for a 21-nucleotide mature miRNA) having a required mismatch consisting of a 4-nucleotide insertion at position 10 of the mature miRNA and a permitted mismatch consisting of a 1-nucleotide insertion at position 20 of the mature miRNA has a total of 26 nucleotides; a miRNA decoy sequence (for a 25-nucleotide mature miRNA) having a required mismatch consisting of a 5-nucleotide insertion at position 11 of the mature miRNA and permitted mismatches consisting of a canonical mismatch at position 20 of the mature miRNA and 1-nucleotide insertion at position 23 of the mature miRNA will have a total of 31 nucleotides.

[0121] Thus, described is a recombinant DNA construct that is transcribed to an RNA transcript including at least one miRNA decoy sequence that is recognized and bound by an endogenous mature miRNA but not cleaved (e. g., not cleaved by Argonaute or an AGO-like protein), wherein the endogenous miRNA is at least one miRNA selected from (a) mature miRNA selected from a mature miRNA selected from SEQ ID NOS. 1-1035, SEQ ID NOS. 2730 - 3921, SEQ ID NOS. 5498 - 6683, SEQ ID NOS. 8409 - 8560, SEQ ID NO 8742, SEQ ID NO. 8744, SEQ ID NOS. 8812 - 8815, SEQ ID NO. 8845, and SEQ ID NO. 8850, or (b) a mature miRNA derived from a plant miRNA precursor sequence selected from SEQ ID NOS. 1036 - 2690, SEQ ID NOS. 3922 - 5497, SEQ ID NOS. 6684 - 8408, SEQ ID NOS. 8561 - 8417, SEQ ID NO. 8743, SEQ ID NO. 8800, and SEQ ID NOS. 8816 - 8819; and the miRNA decoy sequence includes an RNA sequence of between 19 to 36 contiguous RNA nucleotides, wherein the miRNA decoy sequence is recognized and bound by the endogenous mature miRNA, resulting in base-pairing between the miRNA decoy sequence and the endogenous mature miRNA, thereby forming a cleavage-resistant RNA duplex including: (a) at least one mismatch between said miRNA decoy sequence and said endogenous mature miRNA at positions 9, 10, or 11 of said endogenous mature miRNA, or at least one insertion at a position in said miRNA decoy sequence corresponding to positions 10-11 of said endogenous mature miRNA, (b) 0,1, or 2 mismatches between said miRNA decoy sequence and said endogenous mature miRNA at positions 1, 2, 3, 4, 5, 6, 7, 8, and 9 of said endogenous mature miRNA, and (c) 0, 1, 2, or 3 mismatches between said miRNA decoy sequence and said endogenous mature miRNA at positions 12 through the last position of said endogenous mature miRNA, wherein each of said mismatches at positions 12 through the last position of said endogenous mature miRNA is adjacent to at least one complementary base-pair.

[0122] The recombinant DNA constructs include at least one miRNA decoy sequence, and can include multiple miRNA decoy sequences (either multiple copies of a single miRNA decoy sequence, or copies of different miRNA decoy sequences, or a combination of both). In one example, multiple copies of a miRNA decoy sequence are arranged in tandem in a recombinant DNA construct designed to decrease the activity of the corresponding mature miRNA. In another example, the activity of different mature miRNAs is decreased by expressing a single chimeric recombinant DNA construct that transcribes to multiple different miRNA decoy sequences. Expression of miRNA decoy sequences can be driven by various promoters, including, but not limited to, tissue-specific, cell-specific, temporally specific, inducible, or constitutive promoters, for example, any of the promoters described under the heading "Promoters". The miRNA decoy sequences can be located in various positions in a transcript. In a recombinant DNA construct that is intended to also transcribe to coding sequence, non-coding sequence (e. g., a miRNA), or both, the miRNA decoy sequence is preferably located in an intron or after the polyadenylation signal, to permit normal transcription of the coding sequence, non-coding sequence, or both.

[0123] Alternatively, analogous decoy sequences can be used to regulate the activity of other small RNAs involved in double-stranded RNA-mediated gene suppression, including trans-acting small interfering RNAs (ta-siRNAs), natural anti-sense transcript siRNAs (nat-siRNAs), and phased small RNAs (as described in U. S. Patent Application Publication 2008/0066206). These analogous ta-siRNA decoy sequences, nat-siRNAs decoy sequences, and phased small RNA decoy sequences are predicted using essentially the same rules as those for predicting miRNA decoy sequences, and have utilities similar to those of the miRNA decoy sequences.

[0124] The miRNA decoy sequence can be a naturally-occurring sequence or an artificial sequence. In one embodiment, the at least one miRNA decoy sequence includes a naturally occurring miRNA decoy sequence, for example, an endogenous miRNA decoy sequence identified by bioinformatics. In another embodiment the at least one miRNA decoy sequence includes a synthetic miRNA decoy sequence, for example, one that is designed ab initio to bind to a given mature miRNA to form a cleavage-resistant RNA duplex.

[0125] Thus, a recombinant DNA construct that is transcribed to an RNA transcript including at least one miRMON18 decoy sequence that is recognized and bound by an endogenous mature miRMON18 but not cleaved (e. g., not cleaved by Argonaute or an AGO-like protein), wherein the endogenous miRMON18 is at least one selected from (a) a mature miRMON18, or (b) a mature miRNA derived from a plant miRMON18 precursor sequence; and the miRMON18 decoy sequence includes an RNA sequence of between about 19 to about 36 contiguous RNA nucleotides, wherein the miRMON18 decoy sequence is recognized and bound by the endogenous mature miRMON18, resulting in base-pairing between the miRMON18 decoy sequence and the endogenous mature miRMON18, thereby forming a cleavage-resistant RNA duplex including: (a) at least one mismatch between the miRMON18 decoy sequence and the endogenous mature miRMON18 at positions 9, 10, or 11 of the endogenous mature miRMON18, or at least one insertion at a position in the miRMON18 decoy sequence corresponding to positions 10-11 of the endogenous mature miRMON18, (b) 0,1, or 2 mismatches between the miRMON18 decoy sequence and the endogenous mature miRMON18 at positions 1, 2, 3, 4, 5, 6, 7, 8, and 9 of the endogenous mature miRMON18, and (c) 0, 1, 2, or 3 mismatches between the miRMON18 decoy sequence and the endogenous mature miRMON18 at positions 12 through the last position of the endogenous mature miRMON18, wherein each of the mismatches at positions 12 through the last position of the endogenous mature miRMON18 is adjacent to at least one complementary base-pair; and wherein the at least one miRMON18 decoy sequence is recognized and bound but not cleaved by a mature miRMON18 miRNA. It is preferred that the mature miRMON18 has the sequence of SEQ ID NO. 393, SEQ ID NO. 3227, or SEQ ID NO. 874, or is a mature miRNA derived from a miRMON18 precursor sequence selected from SEQ ID NO. 1763 and SEQ ID NO. 3936. Further described is a method of providing a non-natural transgenic crop plant having improved yield under at least one nutrient deficiency selected from nitrogen deficiency and phosphate deficiency, including expressing in the non-natural transgenic crop plant a recombinant DNA construct that is transcribed to an RNA transcript including at least one miRMON18 decoy sequence.

[0126] Further described is a recombinant DNA construct that is transcribed to an RNA transcript including at least one miR399 decoy sequence that is recognized and bound by an endogenous mature miR399 but not cleaved (e. g., not cleaved by Argonaute or an AGO-like protein), wherein the endogenous miR399 is at least one selected from (a) a mature miR399, or (b) a mature miRNA derived from a miR399 precursor sequence selected from SEQ ID NOS. 8816 - 8819; and the miR399 decoy sequence includes an RNA sequence of between 19 to 36 contiguous RNA nucleotides, wherein the miR399 decoy sequence is recognized and bound by the endogenous mature miR399, resulting in base-pairing between the miR399 decoy sequence and the endogenous mature miR399, thereby forming a cleavage-resistant RNA duplex including: (a) at least one mismatch between the miR399 decoy sequence and the endogenous mature miR399 at positions 9, 10, or 11 of the endogenous mature miR399, or at least one insertion at a position in the miR399 decoy sequence corresponding to positions 10-11 of the endogenous mature miR399, (b) 0,1, or 2 mismatches between the miR399 decoy sequence and the endogenous mature miR399 at positions 1, 2, 3, 4, 5, 6, 7, 8, and 9 of the endogenous mature miR399, and (c) 0, 1, 2, or 3 mismatches between the miR399 decoy sequence and the endogenous mature miR399 at positions 12 through the last position of the endogenous mature miR399, wherein each of the mismatches at positions 12 through the last position of the endogenous mature miR399 is adjacent to at least one complementary base-pair; and wherein the at least one miR399 decoy sequence is recognized and bound but not cleaved by a mature miR399. It is preferred that the mature miR399 has the sequence of SEQ ID NOS. 8812 - 8815 or is a mature miRNA derived from a miR399 precursor sequence selected from SEQ ID NOS. 8816 - 8819. Further described is a method of providing a non-natural transgenic crop plant having improved yield under at least one nutrient deficiency selected from nitrogen deficiency and phosphate deficiency, including expressing in the non-natural transgenic crop plant a recombinant DNA construct that is transcribed to an RNA transcript including at least one miR399 decoy sequence.

[0127] Yet another embodiment of this invention is suppression of an endogenous miRNA decoy sequence, for example, by means of a gene suppression element (such as those described under the header "DNA element for suppressing expression"), especially driven by a cell- or tissue-specific or an inducible promoter.

[0128] Any of these recombinant DNA constructs described herein can be made by commonly used techniques, such as those described under the heading "Making and Using Recombinant DNA Constructs" and illustrated in the working Examples. The recombinant DNA constructs are particularly useful for making non-natural transgenic plant cells, non-natural transgenic plants, and transgenic seeds as discussed below under "Transgenic Plant Cells and Transgenic Plants".

[0129] Recombinant DNA constructs including a miRNA decoy sequence are useful for providing unique expression patterns for a synthetic miRNA that is engineered to suppress an endogenous gene; this is especially desirable for preventing adverse phenotypes caused by undesirable expression of the synthetic miRNA in certain tissues. For example, the synthetic miRNA can be used to suppress the endogenous gene only in specific tissues of a plant, e. g., by expression in the plant of a recombinant DNA construct including (a) a constitutive promoter driving expression of the synthetic miRNA, and (b) a tissue-specific promoter driving expression of a miRNA decoy sequence designed to sequester the synthetic miRNA.

[0130] Further described are methods useful in providing improved crop plants. This includes a method of providing a non-natural transgenic crop plant having at least one altered trait including expressing in the non-natural transgenic crop plant a recombinant DNA construct that is transcribed to an RNA transcript including at least one miRNA decoy sequence that is recognized and bound by an endogenous mature miRNA but not cleaved (e. g., not cleaved by Argonaute or an AGO-like protein), wherein the endogenous miRNA is at least one miRNA selected from (a) a mature miRNA selected from a mature miRNA selected from SEQ ID NOS. 1-1035, SEQ ID NOS. 2730 - 3921, SEQ ID NOS. 5498 - 6683, SEQ ID NOS. 8409 - 8560, SEQ ID NO 8742, SEQ ID NO. 8744, SEQ ID NOS. 8812 - 8815, SEQ ID NO. 8845, and SEQ ID NO. 8850, or (b) a mature miRNA derived from a plant miRNA precursor sequence selected from SEQ ID NOS. 1036 - 2690, SEQ ID NOS. 3922 - 5497, SEQ ID NOS. 6684 - 8408, SEQ ID NOS. 8561 - 8417, SEQ ID NO. 8743, SEQ ID NO. 8800, and SEQ ID NOS. 8816 - 8819; and the miRNA decoy sequence includes an RNA sequence of between 19 to 36 contiguous RNA nucleotides, wherein the miRNA decoy sequence is recognized and bound by the endogenous mature miRNA, resulting in base-pairing between the miRNA decoy sequence and the endogenous mature miRNA, thereby forming a cleavage-resistant RNA duplex including: (a) at least one mismatch between said miRNA decoy sequence and said endogenous mature miRNA at positions 9, 10, or 11 of said endogenous mature miRNA, or at least one insertion at a position in said miRNA decoy sequence corresponding to positions 10-11 of said endogenous mature miRNA, (b) 0,1, or 2 mismatches between said miRNA decoy sequence and said endogenous mature miRNA at positions 1, 2, 3, 4, 5, 6, 7, 8, and 9 of said endogenous mature miRNA, and (c) 0, 1, 2, or 3 mismatches between said miRNA decoy sequence and said endogenous mature miRNA at positions 12 through the last position of said endogenous mature miRNA, wherein each of said mismatches at positions 12 through the last position of said endogenous mature miRNA is adjacent to at least one complementary base-pair, thereby resulting in the non-natural transgenic crop plant exhibiting at least one altered trait, relative to a crop plant not expressing the recombinant DNA construct, selected from the group of traits consisting of:
  1. (i) improved abiotic stress tolerance;
  2. (ii) improved biotic stress tolerance;
  3. (iii) improved resistance to a pest or pathogen of the plant;
  4. (iv) modified primary metabolite composition;
  5. (v) modified secondary metabolite composition;
  6. (vi) modified trace element, carotenoid, or vitamin composition;
  7. (vii) improved yield;
  8. (viii) improved ability to use nitrogen or other nutrients;
  9. (ix) modified agronomic characteristics;
  10. (x) modified growth or reproductive characteristics; and
  11. (xi) improved harvest, storage, or processing quality.


[0131] Further described is a method of providing a non-natural transgenic crop plant having at least one altered trait including suppressing in the non-natural transgenic crop plant at least one endogenous miRNA decoy sequence that is recognized and bound by an endogenous mature miRNA but not cleaved (e. g., not cleaved by Argonaute or an AGO-like protein), wherein the endogenous miRNA is at least one miRNA selected from (a) a mature miRNA selected from a mature miRNA selected from SEQ ID NOS. 1-1035, SEQ ID NOS. 2730 - 3921, SEQ ID NOS. 5498 - 6683, SEQ ID NOS. 8409 - 8560, SEQ ID NO 8742, SEQ ID NO. 8744, SEQ ID NOS. 8812 - 8815, SEQ ID NO. 8845, and SEQ ID NO. 8850, or (b) a mature miRNA derived from a plant miRNA precursor sequence selected from SEQ ID NOS. 1036 - 2690, SEQ ID NOS. 3922 - 5497, SEQ ID NOS. 6684 - 8408, SEQ ID NOS. 8561 - 8417, SEQ ID NO. 8743, SEQ ID NO. 8800, and SEQ ID NOS. 8816 - 8819; and the miRNA decoy sequence includes an RNA sequence of between 19 to 36 contiguous RNA nucleotides, wherein the miRNA decoy sequence is recognized and bound by the endogenous mature miRNA, resulting in base-pairing between the miRNA decoy sequence and the endogenous mature miRNA, thereby forming a cleavage-resistant RNA duplex including: (a) at least one mismatch between said miRNA decoy sequence and said endogenous mature miRNA at positions 9, 10, or 11 of said endogenous mature miRNA, or at least one insertion at a position in said miRNA decoy sequence corresponding to positions 10-11 of said endogenous mature miRNA, (b) 0,1, or 2 mismatches between said miRNA decoy sequence and said endogenous mature miRNA at positions 1, 2, 3, 4, 5, 6, 7, 8, and 9 of said endogenous mature miRNA, and (c) 0, 1, 2, or 3 mismatches between said miRNA decoy sequence and said endogenous mature miRNA at positions 12 through the last position of said endogenous mature miRNA, wherein each of said mismatches at positions 12 through the last position of said endogenous mature miRNA is adjacent to at least one complementary base-pair; thereby resulting in the non-natural transgenic crop plant exhibiting at least one altered trait, relative to a crop plant not expressing the recombinant DNA construct, selected from the group of traits consisting of:
  1. (i) improved abiotic stress tolerance;
  2. (ii) improved biotic stress tolerance;
  3. (iii) improved resistance to a pest or pathogen of the plant;
  4. (iv) modified primary metabolite composition;
  5. (v) modified secondary metabolite composition;
  6. (vi) modified trace element, carotenoid, or vitamin composition;
  7. (vii) improved yield;
  8. (viii) improved ability to use nitrogen or other nutrients;
  9. (ix) modified agronomic characteristics;
  10. (x) modified growth or reproductive characteristics; and
  11. (xi) improved harvest, storage, or processing quality.


[0132] Suppression of the at least one endogenous miRNA decoy sequence is achieved by any means, including expression in the non-natural transgenic crop plant a gene suppression element (e. g., such as the DNA elements for suppressing expression described under the heading "Suppression of an endogenous or native miRNA"), or by any other means of gene suppression.

[0133] In one non-limiting example, a transgenic plant overexpresses under conditions of nutrient sufficiency at least one miRNA decoy sequence for a miRNA that is natively expressed at high levels under conditions of nutrient sufficiency and at low levels under conditions of nutrient deficiency, thereby resulting in improved performance or yield under nutrient deficiency and improved nutrient utilization by the plant. For example, miRMON18 and miR399 are expressed at low levels during nitrogen- or phosphate-deficient conditions, and at high levels under nitrogen- and phosphate-sufficient conditions, and thus their native target genes are suppressed during nitrogen- or phosphate-deficient conditions and expressed at relatively higher levels under nitrogen- and phosphate-sufficient conditions; this results in improved nitrogen and/or phosphate utilization by the transgenic plant. Thus, a transgenic plant overexpressing a recombinant DNA construct including at least one miRMON18 decoy sequence (or at least one miR399 decoy sequence) results in a higher level of expression of the miRMON18 native target genes (or of the miR399 native target genes) during nitrogen- and phosphate-sufficient conditions, relative to a plant in which the recombinant DNA construct is not expressed. In a non-limiting example, a transgenic plant overexpressing a recombinant DNA construct including at least one miRMON18 decoy sequence is expected to accumulate relatively higher levels of the native miRMON18 targets (e. g., genes containing an SPX domain, such as the genes depicted in Figure 12, as described in Examples 7, 9, and 10).
This invention is further explained in the following Examples. Examples not covered by the scope of the claims are for illustrative purposes.

EXAMPLES


Example 1



[0134] This example describes non-limiting embodiments of methods for identifying crop plant (rice and maize) microRNAs and their precursor (foldback) structures, useful in making recombinant DNA constructs of this invention. Several small (19 to 25 nucleotide) RNA libraries were cloned from mature rice (Oryza sativa cv. Nipponbare) mature grain (3 replicates) and seedling and from corn (maize, Zea mays) leaf and kernel (39 days after pollination) by high-throughput sequencing (Margulies et al. (2005) Nature, 437:376-380). The sequences thus obtained were used for miRNA prediction in rice genomic and maize genomic sequences, respectively, employing a set of rules derived from previously characterized miRNAs, followed by manual inspection to eliminate poorly predicted foldback structures. Small RNAs that matched perfectly to annotated tRNA, rRNA, transposon/retrotransposon and other known repeats, and chloroplast or mitochondria genomes were excluded from the analysis.

[0135] The Institute for Genomic Research's rice genome annotation version 4.0 (publicly available at www.tigr.org) was used to predict two flanking genomic segments of ~310 nucleotides in which a given small RNA was located near the left or right terminus of the segment (thus giving either a sequence consisting of 280 nucleotides plus the small RNA plus 10 nucleotides, or a sequence consisting of 10 nucleotides plus the small RNA plus 280 nucleotides. The foldback structure of each segment thus obtained was predicted using the RNAfold program in the Vienna package as described by Hofacker et al. (1994) Monatsh. f. Chemie, 125:167-188. To facilitate the structure prediction, each small RNA was assigned a pseudo-abundance of 2.

[0136] The structures were filtered based on characteristics of validated miRNA precursors modified from those derived by Jones-Rhoades et al. (2006) Annu. Rev. Plant. Biol., 57:19-53. For rice miRNAs, the filtering requirements included: (1) the small RNA must be located wholly within one arm of the predicted foldback (stem-loop) structure; (2) the small RNA and its counterpart segment in the opposite arm must have nucleotide sequences of at least 75% complementarity to each other; and (3) the small RNA and its counterpart, when forming the imperfect duplex, must not contain a symmetric bulge larger than 3 nucleotides or an asymmetric bulge larger than 2 nucleotides. The predicted structures satisfying the above criteria were further filtered by selecting (1) only small RNAs of length of 20 or 21 nucleotides and having a uracil as the 5' terminal base; or (2) the small RNA that were sequenced at least 10 times. Final filtering steps included: (1) selecting small RNAs with fewer than 23 perfect matches to the genome to remove repetitive elements, and (2) the segment used for the prediction could not include small RNAs from the minus strand. In cases where multiple overlapping small RNAs were identified, the most abundant member of the cluster was chosen as the representative sequence.

[0137] In the case of maize miRNA prediction, the prediction/filtering procedures were modified from those used for the rice miRNAs, since a complete maize genome is not yet available. Small RNAs from the maize leaf and kernel libraries were analyzed independently to facilitate use of small RNA abundances for miRNA prediction. Small RNAs were mapped to Maize Assembled Gene Islands (MAGI version 4), a publicly available, assembled corn genomic sequence dataset as described by Fu et al. (2005), Proc. Natl. Acad. Sca. USA, 102:12282-12287. Sequences with small RNAs arising from both plus and minus strands were excluded. MicroRNA foldback structures were predicted and filtered using the same requirements as for rice, and were further manually inspected to eliminate structures with large (>100 nucleotide) or highly unpaired loop regions. Previously characterized miRNAs excluded by filters were used as an indicator of false negatives.

[0138] A total of 260676 unique small RNAs from rice in the size range of 19-25 nucleotides were analyzed for putative novel miRNAs. After filtering and manual inspection, 840 small RNAs corresponding to 1072 loci, were identified as novel rice miRNAs. Of the 27 known miRNA families present in the miRNA database "miRBase" (available at microrna.sanger.ac.uk/sequences/) and in the original unique sequence set 22 families were captured after filtering. The false negatives rate of 18.5% percent estimated based on characterized miRNAs (miRBase) indicate that the majority of miRNAs were captured by this approach. From a total of 126691 small RNAs from corn kernel, 116 novel maize miRNAs corresponding to 281 loci in the MAGI version 4.0 corn genomic sequence were identified; similarly, from a total of 53103 small RNAs from corn leaf, 79 novel maize miRNAs corresponding to 302 loci were identified. The rice and maize miRNAs and their corresponding miRNA precursor sequences, as well as the nucleotide position of the mature miRNA in each miRNA precursor sequence, are referred to by their respective sequence identification number in Table 1 as follows: corn kernel miRNAs (SEQ ID NOS. 1-116), corn leaf miRNAs (SEQ ID NOS. 117 -195), rice miRNAs (SEQ ID NOS. 196 -1035), corn kernel miRNA precursor sequences (SEQ ID NOS. 1036 -1316), corn leaf miRNA precursor sequences (SEQ ID NOS. 1317 -1618), and rice miRNA precursor sequences (SEQ ID NOS. 1619 - 2690). The total of 174 predicted novel maize miRNAs (representing 528 genomic loci) included 9 miRNA orthologues that were identical to known miRNAs previously identified in species other than corn; these are listed in Table 2.
Table 1: Maize and rice miRNAs and miRNA precursors
miRNA SEQ ID NO.pre-miRNA SEQ ID NO.Nucleotide position of miRNA in pre-miRNA miRNA SEQ ID NO.pre-miRNA SEQ ID NO.Nucleotide position of miRNA in pre-miRNA
fromto fromto
1 1067 11 31   15 1308 11 31
1 1236 166 186   16 1129 128 146
1 1269 166 186   16 1199 11 29
2 1251 172 192   17 1040 45 68
3 1115 167 187   17 1246 11 34
4 1240 11 31   17 1247 45 68
5 1262 100 120   18 1131 104 127
6 1074 11 31   19 1119 142 162
6 1229 11 31   19 1166 11 31
6 1234 11 31   19 1169 143 163
6 1235 76 96   19 1172 69 89
6 1274 11 31   19 1175 11 31
6 1275 11 31   19 1177 143 163
6 1276 11 31   19 1180 11 31
6 1277 11 31   19 1186 11 31
6 1278 11 31   20 1087 230 251
6 1279 76 96   20 1258 11 32
6 1280 76 96   21 1046 11 31
6 1281 11 31   21 1157 63 83
6 1282 11 31   21 1216 73 93
6 1283 11 31   22 1254 102 122
6 1284 11 31   23 1261 11 30
6 1285 76 96   24 1125 70 90
6 1286 11 31   24 1314 11 31
6 1287 11 31   24 1315 11 31
6 1288 11 31   25 1161 11 31
6 1289 11 31   26 1124 11 31
7 1205 70 90   27 1198 77 96
7 1221 116 136   28 1309 74 94
8 1041 11 31   29 1114 11 29
8 1196 78 98   29 1232 11 29
9 1110 92 113   30 1192 70 91
9 1182 79 100   31 1077 72 92
9 1255 11 32   32 1136 88 108
10 1106 64 84   33 1054 38 58
11 1194 64 84   34 1053 11 31
12 1048 74 94   34 1096 11 31
12 1257 11 31   34 1292 84 104
12 1266 74 94   34 1307 84 104
12 1267 74 94   34 1313 85 105
13 1059 72 92   35 1063 11 31
13 1068 11 31   35 1214 11 31
13 1237 11 31   36 1156 11 31
14 1226 11 31   37 1055 11 30
14 1249 69 89   38 1291 83 103
15 1066 11 31   39 1116 11 31
15 1233 11 31   39 1138 11 31
15 1256 11 31   40 1201 82 102
15 1260 11 31   41 1065 65 85
15 1265 115 135   41 1070 11 31
41 1088 65 85   63 1295 151 171
41 1113 11 31   63 1296 151 171
41 1154 11 31   63 1297 151 171
41 1163 11 31   63 1298 151 171
41 1173 63 83   63 1299 11 31
42 1310 11 31   63 1300 11 31
43 1122 105 125   63 1301 151 171
44 1159 86 106   63 1302 11 31
45 1081 11 31   63 1303 11 31
46 1104 11 31   63 1304 152 172
47 1108 11 31   63 1305 11 31
48 1057 11 31   64 1038 101 120
48 1162 185 205   64 1084 11 30
49 1112 127 147   64 1127 11 30
49 1130 11 31   64 1133 11 30
49 1144 11 31   64 1147 101 120
49 1145 11 31   64 1160 11 30
49 1168 11 31   64 1170 183 202
49 1195 115 135   64 1171 11 30
49 1211 122 142   64 1185 11 30
49 1215 11 31   64 1190 11 30
49 1217 127 147   64 1193 11 30
49 1219 11 31   64 1206 11 30
50 1056 11 30   64 1208 11 30
51 1036 60 80   64 1244 11 30
51 1089 11 31   64 1245 11 30
52 1143 64 84   64 1253 11 30
53 1060 36 56   64 1259 11 30
54 1058 206 226   64 1268 183 202
54 1064 199 219   65 1098 241 261
54 1128 199 219   65 1189 241 261
54 1224 197 217   66 1045 11 31
54 1242 200 220   66 1252 133 153
54 1272 11 31   67 1094 71 91
54 1312 11 31   68 1152 11 31
55 1141 70 90   68 1158 11 31
56 1061 11 30   68 1203 11 31
57 1183 114 134   69 1097 43 63
58 1140 132 152   70 1103 11 31
59 1126 11 31   71 1239 41 61
60 1181 11 31   72 1044 11 31
61 1204 47 67   73 1271 44 64
62 1037 89 109   74 1042 76 96
62 1071 11 31   75 1230 11 31
62 1146 11 31   76 1149 11 31
62 1148 11 31   77 1218 11 30
62 1270 11 31   78 1073 141 161
63 1227 11 31   79 1047 11 31
63 1231 11 31   80 1293 82 101
63 1243 11 31   81 1080 11 31
82 1316 11 31   105 1212 11 31
83 1118 11 31   105 1225 11 31
84 1050 11 31   106 1306 11 31
85 1072 115 135   107 1062 11 30
86 1085 31 51   107 1075 11 30
86 1241 31 51   107 1091 75 94
87 1187 11 31   107 1121 11 30
87 1197 11 31   107 1134 11 30
87 1207 39 59   107 1142 11 30
87 1213 38 58   107 1176 75 94
88 1117 91 111   107 1191 76 95
89 1101 47 67   107 1200 76 95
90 1174 155 174   107 1248 73 92
91 1209 149 169   107 1263 76 95
91 1273 149 169   108 1078 11 31
92 1039 11 31   109 1135 75 95
92 1228 55 75   110 1153 11 31
92 1238 55 75   111 1150 110 130
92 1250 55 75   112 1123 11 30
93 1099 11 30   113 1202 73 93
94 1132 145 165   114 1223 144 164
94 1139 140 160   115 1069 11 31
94 1167 11 31   115 1079 11 31
95 1052 11 31   115 1092 11 31
96 1049 11 30   115 1290 11 31
96 1105 11 30   116 1090 11 31
97 1051 66 85   116 1095 182 202
97 1100 136 155   116 1107 11 31
98 1164 11 31   116 1155 193 213
99 1086 73 93   116 1188 198 218
99 1093 11 31   116 1264 199 219
99 1294 70 90   117 1366 11 31
100 1109 83 103   117 1538 166 186
100 1111 11 31   117 1578 166 186
100 1137 11 31   118 1557 172 192
100 1151 11 31   119 1397 167 187
100 1179 36 56   120 1449 213 233
100 1184 11 31   120 1540 11 31
100 1210 11 31   121 1572 100 120
100 1222 72 92   122 1507 189 208
101 1043 35 55   123 1369 11 31
102 1311 67 87   123 1534 11 31
103 1082 11 31   123 1536 11 31
103 1120 11 31   123 1537 76 96
103 1165 147 167   123 1583 11 31
103 1178 147 167   123 1584 11 31
103 1220 11 31   123 1585 11 31
104 1076 131 151   123 1586 11 31
104 1083 131 151   123 1587 11 31
105 1102 11 31   123 1588 11 31
123 1589 76 96   146 1479 70 91
123 1590 76 96   147 1320 11 31
123 1591 11 31   147 1380 11 31
123 1592 11 31   147 1381 11 31
123 1593 11 31   147 1382 11 31
123 1594 11 31   147 1383 11 31
123 1595 76 96   147 1384 11 31
123 1596 11 31   147 1385 11 31
123 1597 11 31   147 1409 97 117
123 1598 11 31   147 1411 100 120
123 1599 11 31   147 1417 102 122
124 1505 70 90   147 1422 11 31
124 1522 116 136   147 1456 11 31
125 1324 11 31   147 1483 11 31
125 1484 78 98   147 1493 100 120
126 1466 79 100   147 1502 11 31
126 1560 11 32   147 1517 100 120
127 1389 64 84   147 1545 11 31
127 1401 11 31   147 1550 11 31
128 1482 64 84   147 1561 11 31
129 1337 74 94   147 1564 11 31
129 1565 11 31   147 1566 11 31
129 1576 74 94   147 1569 11 31
129 1577 74 94   148 1372 72 92
130 1559 11 31   149 1424 74 95
131 1532 11 31   149 1616 11 32
131 1554 69 89   150 1457 152 175
132 1365 11 31   150 1513 152 175
132 1535 11 31   150 1515 152 175
132 1562 11 31   151 1398 11 31
132 1568 11 31   151 1442 11 31
132 1575 115 135   151 1469 11 31
132 1612 11 31   151 1506 11 31
133 1451 156 176   151 1520 191 211
133 1519 107 127   151 1551 190 210
134 1413 128 146   151 1581 192 212
134 1500 11 29   152 1504 99 119
135 1406 232 252   153 1503 82 102
136 1489 80 102   154 1410 38 58
137 1543 11 31   155 1487 200 220
138 1558 102 122   156 1386 11 31
139 1549 56 75   156 1396 43 63
140 1571 11 30   156 1546 11 31
141 1462 11 31   156 1563 11 31
142 1514 11 31   156 1601 11 31
143 1613 74 94   157 1360 91 110
144 1611 68 88   157 1400 95 114
145 1418 11 31   157 1415 95 114
145 1459 11 31   157 1425 11 30
145 1460 11 31   157 1426 92 111
157 1453 11 30   172 1448 67 87
157 1474 127 146   172 1458 68 88
157 1480 56 75   172 1477 68 88
157 1527 91 110   173 1582 36 56
157 1552 11 30   174 1322 136 156
157 1570 57 76   174 1330 9 29
157 1618 58 77   174 1349 11 31
158 1394 11 31   174 1355 136 156
159 1421 11 30   174 1399 137 157
159 1450 207 226   174 1491 136 156
159 1495 11 30   174 1508 136 156
160 1423 202 222   174 1509 11 31
160 1529 11 31   175 1615 11 31
160 1533 199 219   176 1392 117 136
161 1447 11 31   176 1438 43 62
161 1555 11 31   176 1464 11 30
162 1336 11 30   176 1490 11 30
162 1579 11 30   176 1492 43 62
163 1454 133 153   176 1498 11 30
164 1553 11 31   176 1499 43 62
165 1343 11 31   176 1510 11 30
165 1353 11 31   177 1371 11 31
165 1468 168 188   178 1358 75 95
165 1475 113 133   178 1364 59 79
165 1512 113 133   178 1390 11 31
165 1547 107 127   178 1393 75 95
166 1432 128 148   178 1395 11 31
166 1548 128 148   178 1408 71 91
167 1350 11 30   178 1428 57 77
168 1405 72 91   178 1434 11 31
169 1429 38 58   178 1436 75 95
170 1376 198 218   178 1443 75 95
170 1416 11 31   178 1455 56 76
170 1440 11 31   178 1461 75 95
170 1465 199 219   178 1463 75 95
170 1614 11 31   178 1467 75 95
171 1420 138 158   178 1470 75 95
172 1317 67 87   178 1476 11 31
172 1326 67 87   178 1485 11 31
172 1333 67 87   178 1488 11 31
172 1338 67 87   178 1496 11 31
172 1339 68 88   178 1516 11 31
172 1340 67 87   178 1518 11 31
172 1341 67 87   178 1523 75 95
172 1344 67 87   178 1525 75 95
172 1346 68 88   178 1528 11 31
172 1348 67 87   178 1531 10 30
172 1352 67 87   178 1542 11 31
172 1431 68 88   178 1544 11 31
172 1437 67 87   178 1556 11 31
178 1567 11 31   191 1328 11 31
178 1573 11 31   191 1331 72 92
178 1574 75 95   191 1332 72 92
179 1435 55 75   191 1335 72 92
180 1402 113 133   191 1351 11 31
180 1441 11 31   191 1357 11 31
180 1521 103 123   191 1359 75 95
180 1617 105 125   191 1361 72 92
181 1329 33 53   191 1362 11 31
182 1334 11 31   191 1363 72 92
182 1345 211 231   191 1368 11 31
182 1347 11 31   191 1370 72 92
183 1452 36 56   191 1373 72 92
184 1407 144 164   191 1374 72 92
185 1404 11 31   191 1375 11 31
185 1412 11 31   191 1377 11 31
185 1419 11 31   191 1378 72 92
185 1481 11 31   191 1379 72 92
185 1494 11 31   192 1356 11 31
185 1524 11 31   193 1323 77 97
185 1526 11 31   193 1354 11 31
186 1478 11 31   193 1387 11 31
186 1511 11 31   193 1388 11 31
186 1539 11 31   193 1433 112 132
187 1430 112 132   193 1444 11 31
187 1439 241 261   193 1445 11 31
188 1342 11 31   193 1446 11 31
188 1541 11 31   193 1473 77 97
189 1367 11 31   193 1486 11 31
189 1391 63 83   193 1501 11 31
189 1414 11 31   193 1580 75 95
189 1427 11 31   194 1472 33 53
189 1530 11 31   195 1600 63 83
189 1602 11 31   196 1663 281 299
189 1603 11 31   197 2542 11 31
189 1604 11 31   198 2532 11 31
189 1605 10 30   199 1977 66 86
189 1606 11 31   200 1946 11 30
189 1607 11 31   201 2365 11 31
189 1608 11 31   202 1735 34 53
189 1609 11 31   203 2046 64 84
189 1610 11 31   204 1746 281 301
190 1403 11 31   205 1778 11 31
190 1471 11 31   206 2189 45 64
190 1497 11 31   207 2549 11 31
191 1318 72 92   208 2597 11 31
191 1319 72 92   209 2519 195 214
191 1321 11 31   210 1829 257 277
191 1325 11 31   211 2291 241 260
191 1327 11 31   212 1938 11 30
212 1994 11 30   249 2682 11 30
213 2056 144 164   250 2005 73 93
213 2265 137 157   250 2092 73 93
214 1950 264 283   250 2406 52 72
214 2039 225 244   251 2202 11 29
214 2148 225 244   252 1919 239 258
214 2358 225 244   253 2409 248 271
214 2491 209 228   254 1926 11 31
215 2116 194 213   255 2445 247 267
216 2273 258 278   256 1804 11 31
217 1631 252 270   257 1774 149 168
218 1679 11 31   258 2394 11 31
219 2304 11 30   259 1697 87 107
220 2071 85 105   260 2268 37 55
221 1813 281 301   261 2063 281 304
222 2604 201 220   262 1686 11 31
223 2054 11 30   263 2184 11 31
224 2653 124 147   264 2158 48 67
225 1761 134 153   264 2399 217 236
226 2554 11 29   265 2353 11 34
227 1713 259 277   266 2524 11 31
228 2557 11 31   267 2183 11 30
229 1860 11 31   268 2140 146 169
229 1922 41 61   269 2038 11 31
230 2582 11 31   270 2257 54 74
231 2309 104 122   271 2389 112 131
232 1913 11 31   272 2522 256 275
233 1747 11 31   273 2422 37 56
234 1644 11 30   274 1969 11 29
235 2174 11 31   275 2481 228 248
236 2017 100 120   276 2080 92 112
236 2120 98 118   277 2261 59 78
237 2010 113 132   278 2368 166 188
238 2528 11 31   279 1627 11 30
239 2417 11 30   280 2006 11 31
240 1802 112 130   281 2431 11 30
240 2299 200 218   282 2200 228 248
240 2591 243 261   283 2081 38 58
240 2592 11 29   284 1902 11 31
241 1643 11 30   285 2343 11 31
241 2122 11 30   286 1887 233 253
241 2280 11 30   287 2393 139 159
242 2489 11 30   288 2262 47 67
243 2074 274 294   289 2137 71 91
244 1890 266 285   290 2684 11 31
245 2139 193 216   291 1771 30 49
246 1892 80 100   292 1807 238 256
247 1861 55 77   292 1954 11 29
248 2676 11 30   293 2103 11 30
249 2681 272 291   294 2656 11 31
295 2488 11 30   333 2636 11 31
296 1848 63 83   334 1951 11 31
297 2514 37 57   335 2510 36 55
298 1845 11 31   336 1700 11 31
299 2157 11 30   336 2622 11 31
300 2415 69 89   337 2446 242 262
301 2520 278 298   338 2082 11 32
302 2584 11 31   339 2301 11 31
303 2474 11 30   340 1721 11 30
304 2536 32 51   341 1876 11 31
305 1728 281 301   342 2659 11 30
306 2228 11 31   343 1937 11 31
306 2240 11 31   344 1864 11 30
307 2483 11 30   345 1869 128 148
308 1784 11 29   346 1692 11 30
309 1847 125 145   347 2276 277 297
310 1872 42 61   348 2141 11 29
311 1759 11 34   349 2023 11 31
311 1999 11 34   350 2219 11 31
311 2223 11 34   351 2472 176 196
311 2543 11 34   352 1724 11 31
312 2232 141 160   353 1955 11 30
313 1658 103 122   354 2426 11 31
313 2107 146 165   355 1978 57 76
314 2581 11 31   356 1881 60 80
315 2471 11 31   357 1974 163 182
316 2106 72 92   358 2466 11 30
317 2043 66 86   359 1633 44 63
318 1963 200 219   359 1797 102 121
319 2121 11 30   359 1889 11 30
319 2373 11 30   359 2128 281 300
319 2475 11 30   359 2129 11 30
319 2566 96 115   359 2254 11 30
320 1685 11 31   360 2241 115 135
321 2464 11 31   360 2363 114 134
322 1822 39 57   361 2117 39 58
323 1858 11 31   361 2513 11 30
324 2003 40 60   361 2530 39 58
325 2531 35 54   362 2533 51 69
326 1827 11 30   363 1707 89 109
327 2465 11 30   364 1801 41 61
328 1973 11 30   365 2428 41 61
329 2279 262 281   366 2221 31 50
330 1857 62 81   366 2439 280 299
331 2527 11 31   367 1852 29 48
332 1755 46 66   367 2252 30 49
333 1850 11 31   368 2069 11 30
333 2145 11 31   369 2462 11 30
333 2296 11 31   370 2031 11 30
333 2400 11 31   371 2197 36 56
372 2603 11 30   404 1948 47 67
373 2111 74 93   404 2380 47 67
374 1790 11 31   405 2470 11 30
375 1840 89 112   406 1680 11 31
375 2463 89 112   406 2355 11 31
375 2634 89 112   407 2251 64 83
375 2655 89 112   408 2499 71 90
376 1866 50 70   409 1911 11 34
376 2004 280 300   410 2162 11 30
377 1714 271 290   411 2360 11 31
377 2482 271 290   412 2073 11 30
378 2587 11 31   413 2231 35 55
379 1675 11 31   414 1637 11 30
379 2234 11 31   415 1673 11 30
380 2249 11 31   416 1819 11 29
381 1701 11 29   417 2529 49 68
382 2555 64 83   418 1785 277 296
383 2271 11 30   419 2379 45 65
384 1796 45 64   420 1958 248 268
385 2113 11 31   420 2123 248 268
385 2230 60 80   420 2218 247 267
385 2277 11 31   421 1874 71 91
385 2302 11 31   422 2352 11 30
385 2392 11 31   422 2635 11 30
385 2590 60 80   423 2297 245 265
386 1883 210 229   424 2680 280 298
387 2494 40 59   425 2552 252 272
388 1928 11 31   426 1893 11 34
388 2193 11 31   427 2068 183 203
388 2617 11 31   428 2225 165 184
389 2013 11 30   429 1738 11 31
390 1862 11 30   430 2640 11 31
391 1824 276 294   431 2083 11 30
391 1984 152 170   432 2233 221 241
391 1985 11 29   433 2097 102 121
392 1968 11 30   434 2623 11 29
392 2505 11 30   435 2272 11 34
393 1763 108 128   436 2246 11 30
394 1667 137 157   436 2449 11 30
395 1952 11 30   437 2217 11 31
395 1983 11 30   438 1638 11 29
396 1789 11 31   438 1639 273 291
397 1907 42 60   438 1695 11 29
398 2668 11 31   439 2227 124 144
399 2138 11 31   439 2660 118 138
400 2175 11 31   440 1688 90 110
401 2323 11 31   441 1622 120 140
402 2669 11 31   442 2388 34 54
403 1795 95 114   443 1708 240 258
403 2326 11 30   443 1709 11 29
443 2179 11 29   482 1703 147 167
443 2547 11 29   483 1775 148 168
444 1699 11 31   484 1839 11 30
444 2099 11 31   485 2119 56 76
445 2550 11 31   486 1906 152 170
445 2601 11 31   486 2143 11 29
446 2020 11 31   487 2633 76 96
447 1915 281 300   488 1734 132 150
447 1916 11 30   488 2045 133 151
448 1705 174 193   488 2506 129 147
448 2027 173 192   488 2672 134 152
449 1677 11 31   489 1772 58 78
450 1870 77 97   490 1687 11 34
451 1781 11 31   491 2649 76 96
452 2480 85 105   492 2436 73 93
452 2512 84 104   493 1798 11 31
453 2454 129 149   494 2335 11 30
454 1719 48 68   495 2568 11 31
454 2347 48 68   496 2627 80 100
455 2435 11 31   497 2461 11 31
456 1811 11 31   498 1745 141 161
456 2154 11 31   498 1949 11 31
457 1901 207 227   499 2130 30 50
458 1917 174 194   500 1660 11 30
459 2053 55 74   501 2002 11 30
460 2476 11 32   502 1882 11 31
461 2091 11 30   503 1956 11 34
462 1668 46 65   504 1694 11 30
462 2503 46 65   504 1903 11 30
463 2420 254 274   504 2395 11 30
464 2626 281 302   504 2515 11 30
465 2468 281 301   505 2151 279 300
466 1908 281 301   506 1787 11 31
467 2247 203 222   506 2126 89 109
467 2553 182 201   506 2127 11 31
468 2455 11 30   507 2317 135 154
469 1859 34 54   508 2180 11 31
469 2334 34 54   509 2346 11 31
470 1828 11 30   509 2645 11 31
471 2586 11 30   510 1936 11 30
472 2014 11 30   510 2516 11 30
473 1788 11 31   511 2245 11 30
474 2632 11 31   512 2354 137 157
475 2509 11 31   512 2478 141 161
476 2535 11 30   513 2411 47 67
477 2147 11 31   514 1716 35 55
478 1960 11 31   515 2283 11 31
479 1783 11 31   516 2095 11 31
480 2541 11 31   517 2432 11 31
481 2169 202 221   518 2608 165 185
519 2041 11 30   557 2589 251 271
520 2487 11 31   558 2236 82 102
521 1757 35 54   559 2629 11 30
522 1702 221 241   560 1832 177 197
523 1792 72 94   561 1737 11 31
523 2266 62 84   562 2523 11 31
524 2258 11 31   563 1625 11 31
525 2458 65 85   563 2327 281 301
526 1682 80 100   564 1930 55 74
526 1760 66 86   564 2560 55 74
526 2035 80 100   565 2325 40 60
526 2253 62 82   566 1725 115 135
527 1765 42 62   567 1684 11 31
528 2098 11 30   568 1729 272 290
529 1710 196 215   568 1766 205 223
530 2371 124 143   568 2108 119 137
531 1920 11 30   568 2307 262 280
532 2396 11 31   568 2367 11 29
533 2518 126 145   569 2644 54 73
534 1962 255 276   570 1947 11 31
535 2366 54 74   570 2185 11 31
536 2671 234 254   570 2384 11 31
537 2308 178 197   571 2594 78 97
538 1953 11 31   572 2062 11 31
539 1704 41 60   573 2290 232 250
540 1768 133 153   574 2314 11 31
540 1803 129 149   575 1793 11 31
540 2114 216 236   576 1645 59 79
541 2374 11 31   576 2239 280 300
542 2613 11 30   577 2293 111 130
543 1820 176 195   578 1629 11 30
544 1776 11 31   579 2643 11 31
545 1897 158 177   580 1970 11 30
546 2434 112 132   581 1929 11 33
546 2517 112 132   582 2538 11 30
547 2168 11 31   583 1786 102 122
547 2690 11 31   583 2639 50 70
548 1794 11 30   584 1986 11 34
549 2311 55 75   585 1698 53 72
550 1676 11 31   585 2391 54 73
551 2131 11 31   586 1894 11 30
552 1753 11 31   587 2559 213 231
553 1867 11 31   587 2576 11 29
554 2544 11 31   588 1619 36 56
555 2407 11 31   589 1868 11 30
556 2595 270 290   590 1621 281 299
557 1681 251 271   591 2067 245 265
557 2339 251 271   592 2457 11 31
557 2375 222 242   593 2163 11 31
557 2473 251 271   594 2207 11 30
595 2190 34 53   627 2303 11 31
596 2206 30 49   627 2593 11 31
597 2364 11 31   628 2646 125 145
598 2673 11 31   629 2378 40 60
599 1886 244 264   630 2451 53 72
600 1844 68 87   631 1885 133 151
601 2016 11 31   632 2153 245 264
601 2089 11 31   633 2689 11 31
601 2161 11 31   634 2133 11 31
601 2306 11 31   635 1657 11 30
601 2429 11 31   635 2040 80 99
602 2332 37 57   636 2419 126 145
603 2338 68 88   637 2024 247 265
604 2638 74 93   638 1770 11 31
605 2036 11 29   639 1626 73 93
606 2619 11 32   640 2220 95 115
607 2001 90 109   641 2430 11 31
608 1640 11 29   642 2181 11 31
608 2502 11 29   643 2447 11 31
609 1964 69 87   644 1647 127 150
610 2152 11 31   644 1995 183 206
611 1764 11 31   644 2546 184 207
612 2146 179 198   645 2324 11 31
613 1837 190 210   646 2101 222 241
614 2427 105 125   647 1931 11 31
615 2178 11 30   648 1863 35 54
616 1750 11 31   648 2115 279 298
616 1923 11 31   649 2630 11 31
616 2172 11 31   650 2609 84 103
616 2259 11 31   651 2165 39 58
616 2275 11 31   652 1980 38 58
616 2610 11 31   653 2390 274 294
617 2548 112 132   654 1918 105 125
618 2135 84 104   655 1779 11 31
619 2479 100 119   656 2424 110 129
620 2007 55 75   657 1944 33 52
620 2008 11 31   658 2049 165 184
621 1642 91 111   659 2282 67 87
621 1865 98 118   660 2194 11 30
621 2048 106 126   661 2000 281 300
622 1654 11 30   662 2061 275 295
623 2526 11 31   663 2562 11 31
624 2410 11 31   664 1988 11 30
625 2450 11 31   665 1722 281 300
626 2571 274 292   666 2285 11 31
627 1649 11 31   667 2318 11 34
627 1717 11 31   668 2421 11 31
627 1943 11 31   669 2021 236 256
627 2094 11 31   670 2212 146 166
627 2260 11 31   671 1623 47 65
672 2029 11 30   707 2340 11 31
673 1810 11 31   708 1830 11 31
674 1875 11 31   709 1921 11 31
675 2284 107 127   710 2093 33 52
675 2397 107 127   711 1665 191 210
676 2109 11 31   712 2651 11 31
677 2337 11 30   713 2534 79 100
678 1942 11 30   713 2662 79 100
679 2572 11 31   714 2144 11 35
680 2173 11 30   715 2064 11 31
681 1992 11 31   716 2545 86 105
682 1849 11 30   717 1636 11 31
683 2565 63 82   718 2248 11 30
684 2086 11 30   719 2320 11 30
685 2561 53 72   720 1739 99 119
685 2625 53 72   721 2286 11 31
686 1834 60 80   722 2321 11 31
687 2077 11 30   723 2216 36 55
688 2051 92 112   724 1814 82 105
688 2508 81 101   725 2288 11 30
689 2484 11 31   726 2256 245 263
690 1666 68 89   727 1905 11 31
691 2105 11 30   727 2440 11 31
691 2599 11 30   728 1998 71 91
692 1630 33 53   729 1624 54 74
693 1971 68 88   730 1940 11 31
694 2047 11 30   730 2328 111 131
695 1674 207 226   731 1662 11 29
695 1909 72 91   732 2118 11 30
695 2198 246 265   733 1809 60 79
695 2199 11 30   733 2037 183 202
695 2537 80 99   733 2150 73 92
696 2319 11 35   734 2596 11 31
697 2011 195 215   735 2414 11 31
698 1818 11 29   736 2192 11 31
698 1846 11 29   737 2196 11 30
698 2030 11 29   738 2521 39 59
698 2166 11 29   739 1678 11 31
698 2242 37 55   740 1791 152 172
698 2674 62 80   740 1853 158 178
698 2675 11 29   740 2134 155 175
699 2647 11 31   741 2058 129 149
700 2686 214 234   742 1635 194 214
701 2018 151 170   742 1914 11 31
701 2351 125 144   742 2362 11 31
702 2614 234 253   743 1653 220 238
703 1957 11 31   743 2104 281 299
704 1731 11 30   744 2300 11 31
705 2079 218 238   745 1648 82 102
706 2370 281 301   746 2423 11 30
746 2648 11 30   780 2149 11 30
747 2305 11 30   780 2331 11 30
748 1855 11 30   780 2477 11 30
748 1961 11 30   780 2511 11 30
749 1982 11 34   781 2563 164 184
749 2022 11 34   782 2208 149 168
749 2075 11 34   783 2186 275 294
749 2292 11 34   784 1823 11 32
750 2344 11 29   785 1879 11 31
751 2019 53 73   786 2666 11 31
752 1758 74 94   787 2490 279 298
753 1780 32 52   788 1752 11 31
754 2631 99 119   789 2052 89 109
755 2564 11 31   789 2628 89 109
756 2570 11 31   790 1733 62 82
757 2574 44 63   791 1777 11 31
758 1880 11 29   791 2412 11 31
759 1799 11 31   791 2658 11 31
760 2469 85 104   792 1898 281 301
761 2066 11 30   793 1815 138 157
762 1826 11 31   794 2456 181 201
763 2382 11 31   795 2112 159 178
764 2132 233 253   796 1740 116 136
764 2177 233 253   797 2359 11 32
765 2688 11 31   798 2441 11 31
766 1773 87 105   799 2585 11 31
767 2160 11 31   800 2665 11 31
768 1945 225 244   801 2313 237 256
769 2342 266 284   802 1941 11 30
770 1712 102 121   803 1646 130 150
771 2087 11 30   804 2349 11 31
771 2235 11 30   805 1720 147 167
771 2567 11 30   805 2191 147 167
772 2270 11 31   806 2100 11 30
772 2312 11 31   807 1659 269 289
772 2383 11 31   808 2229 269 289
772 2657 11 31   809 2443 281 300
773 2176 178 197   810 2600 114 134
774 1748 11 30   811 2215 216 236
774 1842 11 30   812 1693 11 30
775 1723 45 64   813 1749 72 92
775 2615 45 64   813 2156 72 92
776 2072 11 31   813 2278 72 92
777 1655 11 30   813 2416 72 92
778 1989 123 146   813 2551 116 136
779 2032 11 30   814 2195 11 31
779 2263 11 30   815 2281 271 291
779 2425 11 30   816 2264 11 30
779 2620 11 30   817 1711 11 30
780 1805 11 30   818 1981 11 31
819 1854 11 30   862 1727 44 64
820 2413 148 168   863 2205 200 220
821 2404 262 282   864 2164 53 71
822 2090 44 64   865 2498 11 30
822 2654 112 132   866 1769 42 62
823 2525 44 64   867 1726 31 50
824 2402 128 147   868 1652 11 29
824 2606 135 154   868 1730 156 174
825 2387 11 31   868 1884 11 29
826 1762 11 31   868 1967 11 29
827 1895 36 55   869 1821 279 299
828 2467 11 31   870 1620 11 31
829 2102 11 31   871 1767 281 300
830 2588 11 30   872 2155 11 31
831 1671 11 31   873 1800 39 57
832 1650 11 30   874 2501 11 31
833 1843 281 300   875 2211 226 246
834 1976 30 49   876 2009 11 31
834 2448 30 49   877 2110 11 31
835 2125 11 30   878 1991 11 30
836 2255 11 31   879 2044 11 29
837 2683 37 56   880 1833 11 31
838 2274 11 30   881 2124 173 193
839 1634 11 31   882 2408 11 31
840 2605 281 300   883 1751 122 142
841 2497 124 143   884 1744 11 31
842 2685 11 31   885 2289 190 209
843 2376 281 301   886 1825 11 31
844 1925 82 102   887 2171 11 30
845 2438 11 31   888 2345 11 31
846 2607 11 31   889 2034 50 69
847 2398 71 90   890 2059 11 31
848 2459 165 185   891 2026 194 212
849 2460 234 254   892 2573 11 32
850 1975 11 30   893 1689 11 30
851 2579 11 30   893 2201 11 30
852 2042 11 30   894 1904 56 76
852 2385 85 104   895 2209 11 30
853 1933 11 31   896 1736 11 30
854 2159 214 234   897 2295 100 120
854 2369 214 234   898 2330 11 31
855 2187 41 60   899 1664 281 300
855 2237 44 63   900 2641 54 74
856 2269 207 227   901 2678 11 31
857 2050 11 31   902 1932 11 31
858 1987 82 101   903 1841 11 31
859 1656 11 31   903 2583 11 31
860 2210 11 31   903 2661 11 31
861 1900 11 30   904 2348 70 90
861 1979 11 30   905 2650 11 31
906 2507 46 65   945 1782 11 30
907 1910 47 66   946 1669 11 31
907 2618 35 54   947 2403 36 55
908 2057 134 154   948 1927 11 31
909 2070 11 31   949 2287 11 31
909 2667 11 31   950 2356 11 31
910 2167 73 92   951 2015 131 151
911 2310 68 88   952 2616 11 29
912 2578 11 30   953 2486 64 83
913 1706 33 53   954 1899 255 275
914 1670 34 54   955 1742 132 151
915 1683 71 91   956 2493 11 30
916 1754 11 31   957 1715 11 31
916 2226 11 31   958 2492 11 31
917 2028 272 292   959 1997 11 31
918 2214 11 30   959 2213 11 31
919 1806 84 104   960 1966 75 95
920 2333 281 301   961 2012 11 31
921 2316 11 30   962 2224 11 31
922 2025 11 31   963 2188 176 195
922 2315 11 31   964 2598 58 78
922 2405 11 31   965 2418 11 30
922 2437 11 31   966 2444 11 30
923 2357 261 281   967 2372 11 31
924 2381 11 31   968 1888 11 31
925 1871 82 101   969 1651 11 31
926 2433 186 205   970 2652 11 30
927 2377 273 292   971 1965 275 295
928 1632 270 290   972 1743 11 31
929 2485 118 138   973 1877 11 33
930 2540 11 30   974 2386 274 293
930 2602 11 30   975 2580 11 31
930 2670 11 30   976 2637 281 300
931 1812 11 31   977 2577 39 59
932 2294 240 260   978 1836 128 148
933 2687 37 56   979 2452 11 30
934 2401 86 106   980 2076 76 96
935 2084 11 31   981 1838 281 301
936 1661 113 133   982 1690 11 31
936 1939 112 132   983 2222 11 30
936 2088 112 132   984 1935 11 31
936 2677 90 110   985 1816 11 30
937 2078 11 30   986 1628 11 30
938 1934 273 292   987 2504 11 31
939 1851 280 298   988 2350 234 253
940 1817 11 30   989 1831 11 30
941 1835 11 30   990 2065 11 30
942 2495 11 30   991 2142 11 31
943 2267 130 150   992 1896 11 31
944 2621 11 31   993 1672 11 34
994 2624 11 31   1015 2611 35 55
995 1959 97 117   1016 2033 91 111
996 2238 235 255   1017 2569 135 155
996 2612 271 291   1018 2361 11 31
997 1972 238 258   1019 1718 11 31
998 2204 11 31   1020 2558 80 100
999 2496 94 114   1021 2243 105 124
1000 2055 79 99   1022 2136 11 30
1001 1691 11 34   1023 1878 11 31
1002 2336 11 30   1024 2182 11 31
1003 2096 11 31   1025 1891 77 96
1003 2539 131 151   1026 1924 140 160
1004 2085 11 31   1027 2341 255 275
1005 2298 11 31   1028 2244 147 167
1006 1641 245 264   1028 2556 142 162
1006 1996 11 30   1028 2663 114 134
1006 2203 11 30   1029 1756 225 244
1007 2679 153 173   1029 2329 195 214
1008 1741 11 31   1030 1856 11 31
1008 2322 11 31   1031 1808 139 159
1009 2642 11 29   1032 1873 57 76
1010 2442 11 31   1033 1993 72 92
1011 2575 11 31   1034 1696 55 78
1012 2250 11 31   1035 1912 33 53
1013 1732 54 77   1035 1990 33 53
1013 2060 53 76   1035 2500 33 53
1013 2453 53 76   1035 2664 33 53
1014 2170 60 80    
Table 2: Maize miRNAs
sRNA IDSEQ ID NO.Homolog*Predicted in Corn KernelPredicted in Corn Leaf
15996 3 ptc-miR390c y y
19644 4 osa-miR396e y y
25372 7 ptc-miR172f y y
35979 9 ath-miR167d y y
36116 10 osa-miR528 y y
56811 133 ptc-miR396e n y
59250 16 ptc-miR398c y y
432006 138 sbi-miR164c y y
1392730 32 ath-miR171a y n
*"ptc", Populus trichocarpa; "osa", Oryza sativa; "ath", Arabidopsis thaliana; "sbi", Sorghum bicolor

Example 2



[0139] Rice genes predicted to be targets of the novel rice miRNAs were predicted from The Institute for Genomic Research's rice genome annotation version 4.0 (publicly available at www.tigr.org), based on sequence complementarity rules as described by Zhang (2005) Nucleic Acids Res., 33:W701-704 and by Rhoades et al. (2002) Cell, 110:513-520. These predicted targets were sequences that included at least one miRNA recognition site recognized by a mature miRNA selected from SEQ ID NOS. 1-1035, SEQ ID NOS. 2730 - 3921, SEQ ID NOS. 5498 - 6683, SEQ ID NOS. 8409 - 8560, SEQ ID NO 8742, SEQ ID NO. 8744, SEQ ID NOS. 8812 - 8815, SEQ ID NO. 8845, and SEQ ID NO. 8850 or a mature miRNA derived from a plant miRNA precursor sequence selected from SEQ ID NOS. 1036 - 2690, SEQ ID NOS. 3922 - 5497, SEQ ID NOS. 6684 - 8408, SEQ ID NOS. 8561- 8417, SEQ ID NO. 8743, SEQ ID NO. 8800, and SEQ ID NOS. 8816 - 8819. Table 3 lists non-limiting examples of miRNA recognition sites (SEQ ID NOS. 2691- 2729) that are recognized by a rice mature miRNA (SEQ ID NO. 197).
Table 3
Os_miRNA_60735 miRNA sequence UCCGUCCCAAAAUAUAGCCAC (SEQ ID NO. 197)
Predicted rice targetmiRNA recognition site
Locus name and annotationNucleotide position in locusmRNA sequence corresponding to cDNASEQ ID NO.ScoreNo. of mismatches
LOC_Os01g65130.1|1197.m126 26|cDNA expressed protein 1086 - 1106 guugcuauauuuugggacgga 2691 1 1
LOC_Os11g37540.1|11981.m075 99|cDNA Serine/threonine-protein kinase Doa, putative, expressed 1925 - 1945 guugcuauauuuugggacgga 2692 1 1
LOC_Os08g36030.1|11978.m075 92|cDNA Plant viral-response family protein, expressed 1126 - 1146 auugcuauauuuugggacgga 2693 1 2
LOC_Os12g12470.2111982.m268 68|cDNA NADP-dependent oxidoreductase P1, putative, expressed 1095 - 1115 guuouuauauuuugggacgga 2694 1.5 2
LOC_Os09g20410.1|11979.m052 48|cDNA hypothetical protein 587 - 607 guugcuauauuuugggaugga 2695 1.5 2
LOC_Os06g12790.3|11976.m320 28|cDNA RAC-like GTP binding protein ARAC10, putative, expressed 3792 - 3812 auuguuauauuuugegacpga 2696 1.5 3
LOC_Os11g24540.1|11981.m063 80|cDNA signal peptide peptidase family protein, expressed 2004 - 2024 auuguuauauuuugggacgga 2697 1.5 3
LOC_Os02g38750.1|11972.m089 63|cDNA hypothetical protein 55 - 75 augcuuauauuuugggacgga 2698 1.5 3
LOC_Os07g49480.2|11977.m290 28|cDNA expressed protein 2531 - 2551 auuguuauauuuugggacgga 2699 1.5 3
LOC_Os01g56640.1111971.m975 46|cDNA transcription factor jumonji, putative, expressed 660 - 680 augauuauauuuugggacgga 2700 1.5 3
LOC_Os06g12790.2|11976.m322 47|cDNA RAC-like GTP binding protein ARAC10, putative, expressed 1947 - 1967 uuugcuauauuuugggaugga 2701 1.5 3
LOC_Os10g22560.1|11980.m052 63|cDNA POT family protein, expressed 1954 - 1974 uuugcuauauuuugggaugiza 2702 1.5 3
LOC_Os06g30280.1|11976.m075 72|cDNA expressed protein 1895 - 1915 guugcuauauuaugggacgga 2703 2 2
LOC_Os03g14800.3|11973.m069 17|cDNA aminotransferase, classes I and II family protein, expressed 1826 - 1846 aaapcuauauuuugggacgga 2704 2 3
LOC_Os05g25430.1111975.m068 36|cDNA protein kinase family protein, putative, expressed 684 - 704 guuguuauauuuuggsaugga 2705 2 3
LOC_Os04g41229.2|11974.m789 64|cDNA Helix-loop-helix DNA-binding domain containing protein, expressed 175 - 195 guugcuauauuuuggcacgga 2706 2.5 2
LOC_Os01g06740.1|11971.m073 04|cDNA Ribosome inactivating protein, expressed 1362 - 1382 gcaguuauauuuugggacgga 2707 2.5 3
LOC_Os03g14800.2|11973.m351 26|cDNA aminotransferase, classes I and II family protein, expressed 861 - 881 augcuuacauuuugggacgga 2708 2.5 4
LOC_Os09g36100.1|11979.m065 60|cDNA expressed protein 1469 - 1489 acaguuauauuuugggacgga 2709 2.5 4
LOC_Os 10g40740.1111980.m068 42|cDNA Helix-loop-helix DNA-binding domain containing protein, expressed 1049 - 1069 auacuuauauuuuggacgga 2710 2.5 4
LOC_Os06g04970.1|11976.m052 26|cDNA expressed protein 989 - 1009 auacuuauauuuugggacgga 2711 2.5 4
LOC_Os11g43760.1|11981.m082 11|cDNA Lipase family protein 2628 - 2648 auacuuauauuuugggacgga 2712 2.5 4
LOC_Os12g11660.1|11982.m051 45|cDNA expressed protein 1479 - 1499 guugauuuauuuugggacgga 2713 3 3.
LOC_Os01g64330.1|11971.m425 82|cDNA expressed protein 630 - 650 guugguuuauuuugggacgga 2714 3 3
LOC_Os07g04840.2|11977.m290 60|cDNA Oxygen-evolving enhancer protein 2, chloroplast precursor, putative, expressed 574 - 594 guugcuauauucuaggacgga 2715 3 3
LOC_Os09g13440.2|11979.m220 62|cDNA expressed protein 2068 - 2088 auugcuauauuuuggaaugga 2716 3 4
LOC_Os06g12790.1|11976.m059 95|cDNA RAC-like GTP binding protein ARAC10, putative, expressed 2271 - 2291 auugcuauauuuuggaaugga 2717 3 4
LOC_Os09g17730.1|11979.m050 31|cDNA proton pump interactor, putative, expressed 958 - 978 uucccuauauuuagggacgga 2718 3 4
LOC_Os11g40390.1|11981.m078 85|cDNA expressed protein 1302 - 1322 augcuuauauuuuggaacgga 2719 3 4
LOC_Os11g39670.1|11981.m078 14|cDNA seryl-tRNA synthetase family protein, expressed 924 - 944 auugcuauauuauaggacgga 2720 3 4
LOC_Os07g04840.1|11977.m049 51|cDNA Oxygen-evolving enhancer protein 2, chloroplast precursor, putative, expressed 4246 - 4266 uugucuuuuuuuugggacgga 2721 3 4
LOC_Os03g47960.1|11973.m098 09|cDNA HECT-domain-containing protein, putative, expressed 1125 - 1145 uuugcuauauuuugagaugga 2722 3 4
LOC_Os01g60780.1|11971.m122 06|cDNA integral membrane protein, putative, expressed 3110-3130 ugcgauauauuuugggacgga 2723 3 4
LOC_Os10g01820.1|11980.m217 47|cDNA expressed protein 711 - 731 augcuuauauuuugagacgga 2724 3 4
LOC_Os06g48030.3|11976.m321 66|cDNA Peroxidase 16 precursor, putative, expressed 1475 - 1495 cuguauuuauuuugggacgga 2725 3 4
LOC_Os02g02980.1|11972.m056 48|cDNA Enhanced disease susceptibility 5, putative, expressed 1357 - 1377 uuggcugaauuuggggpcgga 2726 3 5
LOC_Os08g32170.1|11978.m072 1l|cDNA oxidoreductase, 2OG-Fe oxygenase family protein, expressed 1297 - 1317 uuggcugaauuueagggcgga 2727 3 5
LOC_Os11g39670.2|11981.m288 46|cDNA seryl-tRNA synthetase family protein, expressed 114 - 134 guggcuuuauugugggguggu 2728 3 5
LOC_Os08g25010.1111978.m065 20|cDNA TBC domain containing protein, expressed 367 - 387 cugguuaaauugugg,2augga 2729 3 5

Example 3



[0140] This example describes non-limiting embodiments of recombinant DNA construct wherein the at least one transcribable DNA element for modulating the expression of at least one target gene includes a DNA element for suppressing expression of an endogenous miRNA derived from a plant miRNA precursor sequence selected from SEQ ID NOS. 1036 - 2690, SEQ ID NOS. 3922 - 5497, SEQ ID NOS. 6684 - 8408, SEQ ID NOS. 8561- 8417, SEQ ID NO. 8743, SEQ ID NO. 8800, and SEQ ID NOS. 8816 - 8819. More specifically, this example illustrates non-limiting examples of DNA elements for suppressing expression of a target gene, e. g., an endogenous miRNA or an endogenous miRNA decoy sequence.

[0141] Figure 2A schematically depicts non-limiting examples of DNA elements for suppressing expression of a target gene, e. g., an endogenous miRNA. These DNA elements include at least one first gene suppression element ("GSE" or "GSE1") for suppressing at least one first target gene, wherein the first gene suppression element is embedded in an intron flanked on one or on both sides by non-protein-coding DNA. These DNA elements utilize an intron (in many embodiments, an intron derived from a 5' untranslated region or an expression-enhancing intron is preferred) to deliver a gene suppression element without requiring the presence of any protein-coding exons (coding sequence). The DNA elements can optionally include at least one second gene suppression element ("GSE2") for suppressing at least one second target gene, at least one gene expression element ("GEE") for expressing at least one gene of interest (which can be coding or non-coding sequence or both), or both. In embodiments containing an optional gene expression element, the gene expression element can be located outside of (e. g., adjacent to) the intron. In some embodiments, the intron containing the first gene suppression element is 3' to a terminator.

[0142] To more clearly differentiate DNA elements of the invention (containing at least one gene suppression element embedded within a single intron flanked on one or on both sides by non-protein-coding DNA) from the prior art, Figure 2B schematically depicts examples of prior art recombinant DNA constructs. These constructs can contain a gene suppression element that is located adjacent to an intron flanked by protein-coding sequence, or between two discrete introns (wherein the gene suppression element is not embedded in either of the two discrete introns), or can include a gene expression element including a gene suppression element embedded within an intron which is flanked by multiple exons (e. g., exons including the coding sequence of a protein).

[0143] Figure 3 depicts various non-limiting examples of DNA elements for suppressing expression of a target gene, e. g., an endogenous miRNA, useful in the recombinant DNA constructs of the invention. Where drawn as a single strand (Figures 3A through 3E), these are conventionally depicted in 5' to 3' (left to right) transcriptional direction; the arrows indicate anti-sense sequence (arrowhead pointing to the left), or sense sequence (arrowhead pointing to the right). These DNA elements can include: DNA that includes at least one anti-sense DNA segment that is anti-sense to at least one segment of the at least one first target gene, or DNA that includes multiple copies of at least one anti-sense DNA segment that is anti-sense to at least one segment of the at least one first target gene (Figure 3A); DNA that includes at least one sense DNA segment that is at least one segment of the at least one first target gene, or DNA that includes multiple copies of at least one sense DNA segment that is at least one segment of the at least one first target gene (Figure 3B); DNA that transcribes to RNA for suppressing the at least one first target gene by forming double-stranded RNA and includes at least one anti-sense DNA segment that is anti-sense to at least one segment of the at least one target gene and at least one sense DNA segment that is at least one segment of the at least one first target gene (Figure 3C); DNA that transcribes to RNA for suppressing the at least one first target gene by forming a single double-stranded RNA and includes multiple serial anti-sense DNA segments that are anti-sense to at least one segment of the at least one first target gene and multiple serial sense DNA segments that are at least one segment of the at least one first target gene (Figure 3D); DNA that transcribes to RNA for suppressing the at least one first target gene by forming multiple double strands of RNA and includes multiple anti-sense DNA segments that are anti-sense to at least one segment of the at least one first target gene and multiple sense DNA segments that are at least one segment of the at least one first target gene, and wherein said multiple anti-sense DNA segments and the multiple sense DNA segments are arranged in a series of inverted repeats (Figure 3E); and DNA that includes nucleotides derived from a miRNA, or DNA that includes nucleotides of a siRNA (Figure 3F).

[0144] Figure 3F depicts various non-limiting arrangements of double-stranded RNA that can be transcribed from embodiments of DNA elements for suppressing expression of a target gene, e. g., an endogenous miRNA, useful in the recombinant DNA constructs of the invention. When such double-stranded RNA is formed, it can suppress one or more target genes, and can form a single double-stranded RNA or multiple double strands of RNA, or a single double-stranded RNA "stem" or multiple "stems". Where multiple double-stranded RNA "stems" are formed, they can be arranged in "hammerheads" or "cloverleaf" arrangements. In some embodiments, the double-stranded stems can form a "pseudoknot" arrangement (e. g., where spacer or loop RNA of one double-stranded stem forms part of a second double-stranded stem); see, for example, depictions of pseudoknot architectures in Staple and Butcher (2005) PLoS Biol., 3(6):e213. Spacer DNA (located between or adjacent to dsRNA regions) is optional but commonly included and generally includes DNA that does not correspond to the target gene (although in some embodiments can include sense or anti-sense DNA of the target gene). Spacer DNA can include sequence that transcribes to single-stranded RNA or to at least partially double-stranded RNA (such as in a "kissing stem-loop" arrangement), or to an RNA that assumes a secondary structure or three-dimensional configuration (e. g., a large loop of antisense sequence of the target gene or an aptamer) that confers on the transcript an additional desired characteristic, such as increased stability, increased half-life in vivo, or cell or tissue specificity.

[0145] Additional description of DNA elements and methods for suppressing expression of a target gene can be found, for example, in U. S. Patent Application Publication 2006/0200878, which is incorporated by reference herein.

Example 4



[0146] This example describes non-limiting embodiments of methods for using microRNAs, microRNA precursors, microRNA recognition sites, and microRNA promoters for modulating the expression of at least one target gene.

[0147] Various potential utilities of a miRNA or its recognition site are revealed by the miRNA's expression pattern. Knowledge of the spatial or temporal distribution or inducibility of a given mature miRNA's expression is useful, e. g., in designing recombinant constructs to be expressed in a spatially or temporally or inducibly specific manner. One non-limiting method of determining a mature miRNA's expression pattern is by isolation of the mature miRNA (or its precursor) and analyzing the expression pattern by Northern blots with the appropriate probe (i. e., probes specific for the mature miRNA or for the miRNA precursor).

[0148] Figure 4 depicts a non-limiting example of Northern blot results for mature miRNAs isolated from different maize tissues. One probe hybridized to mature miRNAs from two families (miR156 and miR157). Individual mature miRNAs were expressed at differing levels in specific cells or tissues, e. g., Zm-miR390 was not expressed, or expressed only at low levels, in root and adult leaf, and miR156 is expressed in roots, leaves, and tassel. Thus, for example, recombinant DNA construct of this invention including a transgene transcription unit driven by a constitutive promoter and a miRNA recognition site recognized by a maize miR390 mature miRNA is useful for expression of the transgene in root and adult leaf tissues but not in tissues where the mature miR390 is expressed at high levels. To further illustrate use of the constructs and methods of the invention to control expression of a transgene, a reporter gene is used as the transgene itself, or as a surrogate for the transgene. For example, where expression of a reporter gene (e. g., green fluorescent protein, GFP) is desired in maize stalk and immature ear tissue, a miR156 target site is included in a GFP expression cassette and expressed in a stably transgenic maize plant under the control of the CaMV 35S promoter. In tissues (e. g., roots, leaves, and tassel) where miR156 is strongly expressed, GFP expression is suppressed. The suppression phenotype may be limited to very specific cell types within the suppressed tissues, with neighboring cells showing expression or a gradient of expression of GFP adjacent to those cells expressing the mature miR156.

[0149] Another non-limiting method of determining a mature miRNA's expression pattern is by analyzing transcription profiles of nucleic acid sequences that include the mature miRNA sequence, for example, by following a general procedure including the steps of:
  1. (a) providing an initial miR sequence including the stem-loop region, e. g., from the publicly available miR sequences at the 'miRBase" database (available on line at microrna.sanger.ac.uk/sequences);
  2. (b) applying sequence analysis algorithms, such as BLAST as is well known in the art (see Altschul et al. (1990) J. Mol. Biol., 215:403-410) to identify homologous or identical sequences (e. g., from proprietary sequences on microarray probesets made with corn whole genome DNA); and
  3. (c) analyzing the transcription profiles of the homologous probeset sequences identified in step (b) and identifying miRNAs having an expression pattern in the desired tissues (i. e., male or female reproductive tissues).


[0150] Preferably, a fourth step is added:

(d) for homologous probeset sequences found to have the desired transcription profiles, confirming identification of the miRNA gene by either aligning the stem-loop sequence of the initial miR sequence to the probeset sequence, or for potentially novel miRNAs, determining the sequence is predicted to fold into a stem-loop structure characteristic of a miRNA. Also preferably, an optional step is used, wherein one or more BLAST comparisons against additional sequence datasets other than the probeset sequence dataset is included (prior to step (b) above), allowing the further identification of probes that fall outside of the predicted fold-back region of the miR gene; false positives, e. g., due to matches in the additional sequence dataset(s) that include incorrectly spliced contigs, are identified by their lack of miRNA characteristics such as proper fold-back structure, and removed.



[0151] Figure 5 depicts transcription profiles of probeset sequences that were identified, using the procedure described in the preceding paragraphs, as including miRNA precursor sequences having expression patterns specific to maize male reproductive tissue (pollen). Such miRNA precursors are suitable for use in recombinant DNA constructs of this invention designed for expression of a native miRNA (in this example, a pollen-specific miRNA) under non-native conditions (e. g., under the control of a promoter other than the promoter native to the miRNA precursor). These miRNA precursors are also useful for providing a "scaffold" sequence that can be modified or engineered to suppress a target gene other than the native or endogenous target gene. One non-limiting example of a recombinant DNA construct of this invention includes a strong constitutive promoter that is used to drive expression of transgene transcription unit encoding a Bacillus thuringiensis insecticidal protein or protein fragment ("Bt"), and a recognition site for a pollen-specific miRNA, resulting in strong Bt expression in tissues of the plant except for the pollen. Additionally, the native promoters of these miRNA precursors are useful for pollen-specific expression of any gene of interest.

[0152] In an alternative approach, an existing (native or endogenous) miRNA recognition site is identified, for example, using sequence complementarity rules as described by Zhang (2005) Nucleic Acids Res., 33:W701-704 and by Rhoades et al. (2002) Cell, 110:513-520. The native miRNA recognition site is mutated (e. g., by chemical mutagenesis) sufficiently to reduce or prevent cleavage (see Mallory et al. (2004) Curr. Biol., 14:1035-1046). In this way a gene containing a native miRNA recognition site and having desirable effects, e. g., increased leaf or seed size, can be mutated and thus expressed at levels higher than when the unmutated native or endogenous miRNA recognition site was present. One embodiment is to replace a native gene with an engineered homologue, wherein a native miRNA has been mutated or even deleted, that is less susceptible to cleavage by a given miRNA.

[0153] Another specific example of this approach is the inclusion of one or more recognition site for a mature miRNA not substantially expressed in maize roots but expressed in most other tissues (such as, but not limited to, miRNA162, miRNA164, or miRNA390 as depicted in Figure 4) in a recombinant DNA construct for the expression of a Bacillus thuringiensis insecticidal protein or protein fragment ("Bt", see, for example, the B. thuringiensis insecticidal sequences and methods of use thereof disclosed in U. S. Patent Number 6,953,835 and in U. S. Provisional Patent Application Number 60/713,111, filed on 31 August 2005, which are incorporated by reference herein) as the transgene, e. g., in a construct including the expression cassette e35S/Bt/hsp17. Including one or more of these recognition sites within the expression cassette reduces the expression of transcripts in most tissues other than root, but maintains high Bt target RNA expression levels in roots, such as is desirable for control of pests such as corn rootworm. In similar embodiments, combinations of different miRNA recognition sites are included in the construct to achieve the desired expression pattern in one or more specific tissues.

Example 5



[0154] This example describes additional non-limiting embodiments of crop plant microRNAs and their precursor (foldback) structures, useful in making recombinant DNA constructs of this invention. A total of 1327933 unique small RNAs (20 to 24 nucleotides long) were obtained by high-throughput sequencing of 30 corn (maize) libraries (Margulies et al. (2005) Nature, 437:376-380). The sequences obtained were used for predicting corn microRNAs and their precursor structures from maize genomic sequences using the procedures described above in Example 1. In total, 1192 small RNAs in 1576 proprietary maize genomic sequences were predicted to be new miRNAs. The corn miRNAs and their corresponding miRNA precursors, as well as the nucleotide position of the mature miRNA in each miRNA precursor sequence, are referred to by their respective sequence identification numbers in Table 4 as follows: corn miRNAs (SEQ ID NOS. 2730 - 3921) and corn miRNA precursor sequences (SEQ ID NOS. 3922 - 5497).
Table 4: Maize and rice miRNAs and miRNA precursors
miRNA SEQ ID NO.pre-miRNA SEQ ID NO.Nucleotide position of miRNA in pre-miRNA miRNA SEQ ID NO.pre-miRNA SEQ ID NO.Nucleotide position of miRNA in pre-miRNA
fromto fromto
2730 3928 84 104   2772 4059 11 34
2731 4099 92 113   2772 4051 104 127
2732 3935 11 31   2772 4056 11 34
2733 4093 11 31   2773 4215 11 34
2734 5134 11 32   2774 4718 215 237
2735 4864 188 211   2775 5098 37 56
2736 4123 11 30   2776 5011 11 30
2737 4108 4 27   2777 5262 62 82
2738 5217 11 33   2778 5022 11 30
2738 5277 11 33   2779 5369 47 66
2739 4328 71 90   2780 5038 11 34
2740 4635 42 62   2781 3974 1 24
2741 4591 11 34   2782 4933 103 124
2742 3925 11 34   2783 4380 89 109
2743 4036 11 34   2784 4752 11 33
2744 4586 11 32   2785 4341 209 232
2745 5245 37 57   2786 5408 11 31
2746 5417 30 53   2786 5356 11 31
2747 4527 171 190   2787 5048 37 57
2748 5486 11 32   2788 4920 153 174
2749 4440 11 32   2789 5366 35 55
2749 4428 11 32   2790 4159 203 222
2750 5469 241 261   2791 4798 44 67
2751 5066 11 30   2792 4530 11 31
2752 5095 61 82   2793 5269 11 31
2753 4468 113 133   2794 4334 6 29
2754 4924 37 59   2795 5287 11 30
2755 5242 11 30   2796 5362 11 30
2756 5292 83 103   2796 5396 11 30
2757 3959 11 33   2796 5344 11 30
2758 5489 150 171   2796 5310 11 30
2759 3929 11 34   2796 5360 11 30
2760 5153 11 30   2797 5440 118 138
2761 4251 11 34   2797 5456 118 138
2762 5361 35 55   2798 4962 70 93
2763 3995 11 34   2799 4522 11 34
2764 4448 11 30   2800 4286 11 34
2764 4473 11 30   2801 4299 11 30
2765 4784 11 30   2801 4235 11 30
2766 4478 63 83   2802 4103 11 32
2767 4477 11 34   2803 5136 37 58
2768 4275 11 33   2803 5208 37 58
2768 4223 11 33   2804 4894 11 31
2769 5084 11 31   2805 4413 11 30
2769 5063 61 81   2806 4807 11 34
2770 3985 11 34   2807 4844 426 449
2771 5384 11 32   2808 4022 118 141
2772 4053 11 34   2809 5312 11 30
2772 4058 113 136   2810 4270 52 71
2772 4057 113 136   2811 4233 8 30
2811 4244 253 275   2854 4726 11 34
2811 4293 75 97   2855 4606 11 34
2812 4517 55 77   2855 4729 11 34
2813 4456 40 59   2855 4565 11 34
2814 4258 87 107   2856 4684 11 33
2815 5276 242 261   2857 4660 11 34
2816 4638 54 77   2858 5284 92 115
2816 4815 54 77   2859 5354 60 83
2817 4378 11 34   2859 5395 61 84
2818 5298 33 54   2859 5336 11 34
2819 4208 11 30   2859 5394 11 34
2820 4187 11 30   2859 5430 11 34
2820 4176 11 30   2859 5449 11 34
2821 5333 103 123   2859 5355 11 34
2822 4958 11 31   2859 5444 226 249
2823 4500 11 34   2860 5070 56 77
2824 4373 11 34   2860 5077 11 32
2825 4024 11 34   2861 4086 111 134
2826 5407 47 67   2861 4089 11 34
2826 5448 11 31   2862 4461 298 321
2827 5479 230 253   2863 4663 54 75
2828 4201 53 72   2864 4878 37 57
2829 4709 204 224   2865 4965 11 34
2830 4525 141 160   2866 4232 11 34
2831 4876 125 147   2867 4007 40 62
2832 4122 11 31   2868 4991 64 83
2833 4060 109 132   2869 5180 35 56
2833 4055 11 34   2870 4247 71 92
2834 5302 74 94   2871 4179 11 34
2835 5308 60 79   2872 5470 35 56
2836 4238 75 95   2873 3983 65 88
2837 5119 11 32   2874 4263 11 31
2838 4873 83 103   2875 5204 64 83
2839 4947 11 30   2876 4364 11 30
2840 4791 231 253   2877 5359 218 238
2841 4567 11 33   2878 4291 11 34
2842 5463 11 33   2879 4217 11 34
2843 4957 42 62   2880 4921 11 30
2844 5205 38 61   2881 4075 11 34
2845 4239 65 85   2881 4067 11 34
2846 5059 149 169   2882 4508 11 34
2847 3964 79 102   2883 5120 11 33
2848 4516 48 71   2884 4276 34 53
2849 4121 11 32   2884 4318 34 53
2850 4526 72 95   2885 4598 11 32
2851 4659 11 30   2886 5445 72 91
2851 4670 11 30   2887 4045 38 60
2851 4668 11 30   2888 5473 11 34
2852 4206 616 636   2888 5324 11 34
2853 5331 443 465   2889 4030 11 33
2889 5363 116 138   2923 4981 122 141
2889 4039 11 33   2924 5071 11 32
2889 4035 11 33   2925 4620 45 65
2889 4029 106 128   2926 4008 11 34
2889 4031 11 33   2927 3994 252 275
2889 4032 11 33   2928 4280 11 34
2890 4174 11 34   2929 4142 77 97
2891 5271 35 58   2930 4982 11 30
2891 5109 36 59   2931 4917 4 27
2891 5163 35 58   2932 4126 106 128
2891 5159 35 58   2933 3945 202 222
2892 4578 11 34   2934 4269 11 32
2892 4774 11 34   2935 4483 154 177
2893 3934 155 178   2936 5393 46 69
2893 3923 11 34   2937 4319 186 208
2894 4504 11 31   2938 4080 69 92
2895 5196 60 80   2939 4918 11 33
2896 4863 11 33   2940 4499 11 30
2897 3953 11 34   2941 4327 304 323
2897 3967 46 69   2942 5146 121 144
2897 3955 11 34   2943 5106 208 228
2897 3949 49 72   2944 4680 11 30
2898 5397 11 32   2945 4209 11 34
2898 5392 11 32   2946 5453 132 151
2899 4383 36 59   2947 4166 137 157
2900 5240 36 59   2948 5386 11 32
2901 5005 58 80   2949 5199 11 32
2901 4880 58 80   2950 4969 44 63
2902 4750 11 32   2951 5033 179 199
2903 4279 11 34   2951 5091 180 200
2904 4230 229 248   2952 4063 11 34
2905 4955 39 59   2953 5232 138 158
2906 4736 51 70   2954 5494 11 31
2906 4605 51 70   2955 4972 11 30
2907 5379 138 158   2956 5008 245 268
2908 5435 11 32   2957 4111 6 26
2909 5127 11 31   2958 4501 37 56
2910 5368 11 31   2959 5349 11 34
2911 4877 11 34   2960 3971 11 31
2912 5023 50 73   2960 3956 217 237
2913 4087 11 32   2960 3963 92 112
2914 5303 174 193   2961 4044 54 76
2915 5461 54 77   2962 5050 11 33
2916 4789 44 63   2963 4421 116 138
2917 3937 11 34   2964 4083 200 219
2918 4218 135 158   2965 4566 11 32
2919 5040 119 139   2966 4193 11 34
2920 5147 11 34   2967 5376 62 85
2921 5329 54 77   2968 4787 31 50
2922 4135 67 86   2968 4759 31 50
2969 4333 53 72   3003 4285 11 34
2969 4385 53 72   3004 5351 11 32
2970 4391 11 32   3005 5477 49 69
2971 4537 11 30   3006 5237 11 34
2972 5317 133 153   3006 5219 11 34
2972 5318 136 156   3006 5238 11 34
2972 5446 62 82   3007 4246 11 31
2972 5380 136 156   3008 4466 41 62
2972 5471 162 182   3009 3977 11 34
2972 5452 136 156   3009 3979 37 60
2972 5341 140 160   3009 3975 37 60
2972 5460 11 31   3009 3972 38 61
2972 5374 11 31   3010 5112 11 32
2972 5451 137 157   3011 4085 254 277
2973 4084 11 34   3012 5003 313 336
2974 4116 41 60   3013 4625 11 30
2975 5468 11 31   3014 5459 108 131
2976 4474 11 34   3015 5143 85 104
2977 4744 11 34   3016 5334 34 57
2978 4447 11 34   3017 5482 11 30
2979 4738 11 30   3018 5326 139 161
2980 4132 11 34   3019 3941 69 92
2981 4505 11 30   3019 3938 69 92
2982 5124 11 33   3019 3943 69 92
2983 4888 35 58   3020 4682 11 30
2984 4558 11 34   3021 4214 115 138
2985 4449 41 60   3022 4691 11 32
2986 5410 116 136   3022 4753 11 32
2987 5030 11 34   3023 4717 11 30
2988 4767 11 30   3024 5018 78 97
2988 4633 11 30   3025 4776 11 31
2989 5288 35 56   3026 4105 11 34
2990 4101 245 266   3027 4115 11 30
2991 5178 11 32   3027 4167 173 192
2991 5198 8 29   3028 4892 640 659
2991 5275 11 32   3029 4154 11 32
2991 5185 11 32   3030 4749 11 32
2991 5160 11 32   3030 4783 11 32
2992 4097 11 34   3031 4611 179 200
2993 4656 11 31   3032 4721 11 34
2994 4514 219 241   3033 5365 118 138
2994 4398 219 241   3034 4705 112 131
2995 5437 11 34   3034 4570 113 132
2996 4117 39 58   3034 4827 104 123
2997 4446 11 31   3035 4714 42 63
2998 5421 6 27   3035 4829 11 32
2999 4259 11 30   3035 4733 43 64
3000 5423 11 31   3036 4617 11 33
3001 4948 101 121   3037 4847 126 146
3002 5268 11 31   3038 5130 11 31
3038 5223 11 31   3069 5258 11 34
3038 5156 11 31   3070 5188 44 67
3038 5248 11 31   3071 4054 43 66
3038 5183 11 31   3072 4542 38 60
3038 5278 11 31   3072 4742 38 60
3039 4314 60 80   3073 5260 11 30
3040 4502 113 136   3074 5434 213 234
3041 5327 117 140   3075 5381 11 30
3042 4363 11 31   3076 4312 94 117
3042 4503 11 31   3077 4874 11 34
3042 4388 107 127   3078 4930 89 108
3043 4370 39 59   3079 4139 11 34
3044 4151 138 161   3080 5174 94 116
3045 5170 11 30   3081 5121 120 139
3046 4061 11 34   3081 5184 121 140
3046 4073 11 34   3082 4722 11 34
3046 4070 11 34   3083 4836 11 30
3046 4065 11 34   3084 5193 11 34
3046 4062 102 125   3085 5315 115 138
3046 4064 11 34   3086 4664 172 195
3046 4076 11 34   3087 5162 11 31
3047 4546 11 33   3088 4914 70 89
3048 5311 118 137   3089 4110 220 243
3049 4204 11 31   3090 4102 11 34
3050 5370 11 34   3091 5279 11 34
3050 5357 49 72   3092 4141 193 216
3051 4671 11 32   3093 4869 11 34
3051 4716 11 32   3094 5135 11 30
3052 5346 102 123   3095 5041 56 79
3052 5465 102 123   3096 4553 42 63
3053 4409 59 80   3097 5020 37 58
3053 4467 59 80   3097 5017 37 58
3054 5001 59 82   3098 5442 174 194
3054 4853 60 83   3099 5382 74 94
3055 5429 39 61   3099 5330 11 31
3056 4518 6 26   3100 4495 11 34
3057 5062 11 34   3101 4253 75 96
3058 4207 155 174   3102 3944 41 64
3059 4492 11 34   3102 3942 11 34
3060 5224 50 73   3103 5073 58 77
3061 4047 97 120   3104 4137 142 163
3062 3984 1 24   3105 4066 11 31
3063 5385 50 73   3106 5028 70 90
3064 5090 58 77   3107 5267 105 128
3065 3940 11 30   3108 5169 11 33
3066 5353 36 56   3109 4543 165 184
3067 5358 11 34   3110 4702 11 31
3068 4697 206 226   3111 4313 11 34
3068 4674 207 227   3112 5132 140 159
3068 4560 206 226   3113 5404 4 24
3113 5398 4 24   3155 4405 11 31
3114 5116 11 34   3155 4462 11 31
3115 4818 11 31   3156 4990 200 220
3116 4026 48 71   3157 4497 74 96
3117 5141 136 159   3158 4041 11 34
3118 4420 11 30   3159 4646 46 67
3119 5013 11 30   3160 4623 385 404
3120 4336 11 30   3161 5202 11 30
3121 3999 34 53   3162 4970 11 33
3121 3998 34 53   3163 4788 204 227
3122 4631 37 58   3164 4937 11 30
3123 4127 11 30   3164 4837 11 30
3124 4180 11 31   3164 4893 11 30
3125 4104 11 34   3165 4694 11 32
3125 4106 11 34   3165 4792 11 32
3126 5047 11 31   3166 5388 71 90
3126 4908 11 31   3166 5387 71 90
3127 5350 38 59   3167 4443 35 58
3127 5457 38 59   3168 4867 59 78
3128 5467 41 61   3169 4692 29 48
3129 4602 11 31   3170 4224 11 31
3130 5348 70 90   3171 4498 11 34
3131 5034 11 31   3172 5273 11 32
3132 4773 43 62   3173 4927 54 77
3132 4614 51 70   3174 5024 11 31
3132 4687 51 70   3175 5431 265 285
3133 5026 8 28   3176 4315 40 63
3134 4376 11 33   3177 4575 11 33
3135 4748 66 87   3178 4459 193 216
3136 4402 160 180   3178 4340 194 217
3137 4379 188 208   3179 4194 11 34
3138 4779 115 135   3179 4152 99 122
3139 5426 52 71   3180 5436 92 111
3140 5295 38 57   3181 5427 35 54
3141 5094 11 31   3182 4033 39 61
3142 5415 50 73   3183 4643 223 243
3143 4794 104 125   3183 4609 223 243
3144 5250 11 34   3183 4808 223 243
3145 4735 11 34   3183 4802 181 201
3146 4799 11 34   3184 5145 227 250
3146 4703 6 29   3185 5029 67 90
3146 4615 45 68   3186 4261 185 207
3147 4686 205 224   3187 5036 169 188
3148 3980 70 90   3188 4146 11 33
3149 4109 221 244   3189 4549 11 31
3150 4610 57 76   3189 4576 11 31
3151 5167 176 196   3189 4548 11 31
3152 4149 11 34   3189 4594 11 31
3153 4384 1 20   3189 4732 4 24
3154 4899 143 164   3190 5015 11 34
3191 5046 64 84   3231 4819 11 32
3192 5280 11 34   3231 4689 11 32
3193 5343 152 173   3231 4662 11 32
3193 5352 11 32   3232 4658 10 33
3193 5490 11 32   3233 5340 154 176
3194 4465 11 34   3234 4375 11 33
3195 5142 11 32   3235 5131 9 31
3196 5039 11 31   3236 4724 139 159
3196 5053 11 31   3237 4256 52 74
3197 4521 68 88   3238 5051 34 55
3198 4975 11 30   3239 4453 32 55
3199 4415 11 33   3240 5372 11 30
3200 5261 37 59   3241 4444 135 154
3200 5113 11 33   3241 4365 11 30
3201 5087 11 34   3242 4731 150 169
3201 4866 122 145   3243 5213 11 31
3202 4834 11 31   3244 5314 11 31
3202 4651 11 31   3245 4854 11 30
3203 4513 217 239   3246 5320 187 207
3204 4175 57 80   3247 4938 99 122
3205 4839 11 34   3248 4489 11 32
3206 5253 41 60   3249 5474 11 30
3207 4881 11 33   3249 5371 11 30
3208 4715 11 31   3250 5002 11 30
3209 4618 400 423   3251 4699 34 57
3210 4648 11 30   3252 4153 11 31
3211 4362 45 65   3253 4130 11 34
3212 5149 226 248   3254 5138 11 33
3213 5286 81 102   3255 5222 50 72
3213 5300 81 102   3255 5200 50 72
3214 5074 11 34   3256 4107 11 31
3214 4849 11 34   3257 4858 75 94
3215 4762 52 72   3258 4826 11 33
3216 5377 11 34   3259 5042 44 67
3217 4751 34 53   3260 4696 11 32
3218 4841 11 30   3261 4953 221 241
3219 5186 11 31   3262 4931 11 32
3220 4520 30 49   3263 3987 212 235
3221 3986 116 139   3264 3968 96 119
3222 5420 149 168   3265 4629 71 90
3222 5450 149 168   3266 4600 11 31
3223 5282 35 57   3266 4564 207 227
3224 5319 104 124   3267 4419 45 67
3225 5100 35 56   3268 4964 41 60
3226 4250 11 31   3269 4950 153 172
3226 4268 11 31   3270 4801 33 52
3227 3936 111 131   3271 4048 238 261
3228 4191 37 60   3272 5118 11 34
3229 4740 11 34   3272 5151 11 34
3230 4300 118 141   3272 5264 11 34
3273 4357 11 32   3303 4321 11 34
3274 4009 11 32   3304 4185 49 69
3275 5265 11 30   3304 4136 49 69
3275 5225 29 48   3304 4287 49 69
3275 5126 11 30   3304 4322 49 69
3275 5270 11 30   3305 4588 11 34
3275 5251 105 124   3306 5236 11 34
3275 5137 1 20   3307 4143 11 30
3276 4213 218 238   3308 4302 11 30
3277 4071 36 59   3308 4240 11 30
3278 4678 11 31   3309 4366 11 32
3279 4377 11 30   3310 5472 52 73
3280 4895 40 59   3311 4649 11 30
3280 5108 40 59   3312 4490 11 34
3280 4997 40 59   3313 4642 113 133
3280 4840 40 59   3314 4559 232 252
3280 5014 40 59   3314 4701 232 252
3280 4890 40 59   3315 4216 11 31
3280 4851 40 59   3316 4339 37 59
3281 4506 11 30   3317 4423 138 157
3282 4353 38 59   3318 5241 55 78
3282 4346 38 59   3319 5255 34 54
3283 4234 257 277   3320 3927 40 60
3283 4168 323 343   3320 3930 40 60
3283 4220 245 265   3320 3926 40 60
3284 4273 11 33   3320 3932 45 65
3285 5243 166 187   3320 3922 39 59
3286 4393 142 165   3320 3924 132 152
3287 4359 11 30   3320 3933 40 60
3288 5211 11 34   3321 4254 60 79
3288 5175 11 34   3322 5166 213 236
3288 5283 11 34   3323 4647 61 81
3289 4308 157 178   3323 4657 61 81
3290 3982 11 34   3323 4603 61 81
3291 4052 11 32   3324 5235 73 96
3292 4589 11 34   3325 4406 34 55
3293 4852 52 72   3326 5207 8 30
3294 4389 118 141   3327 4800 11 32
3295 4768 36 57   3328 4942 11 32
3296 4812 11 32   3329 4796 11 34
3297 3978 37 56   3330 4998 35 56
3298 4761 11 30   3331 4741 240 261
3298 4685 11 30   3332 5306 60 83
3299 4825 11 33   3333 4555 181 203
3299 4745 11 33   3334 4909 41 60
3299 4770 11 33   3335 5304 11 34
3300 5086 56 78   3335 5383 11 34
3301 4486 11 31   3336 5462 31 50
3302 4870 41 61   3337 4636 11 33
3302 5060 41 61   3337 4683 11 33
3338 5105 40 63   3364 3970 11 34
3339 4552 100 122   3364 3965 11 34
3340 4078 39 62   3365 5161 50 71
3341 4835 11 31   3365 5165 50 71
3342 5187 75 96   3365 5173 50 71
3343 4679 158 181   3366 4460 11 30
3344 4865 11 32   3367 4690 11 31
3344 4862 11 32   3368 4337 87 110
3345 5274 11 34   3369 4534 201 222
3346 4936 11 33   3370 4040 7 30
3347 4352 11 31   3371 5004 11 34
3348 4221 11 31   3372 4720 41 63
3349 5072 11 31   3372 4554 40 62
3349 5083 11 31   3372 4688 40 62
3350 4695 117 139   3373 4401 11 31
3351 5230 71 94   3373 4355 139 159
3352 4961 167 187   3374 4418 11 33
3353 5227 11 30   3374 4412 11 33
3354 4147 92 115   3375 4098 38 58
3355 4536 11 33   3376 5378 11 31
3356 5443 110 130   3377 4562 11 30
3357 5321 247 266   3378 4813 38 57
3358 4196 28 47   3379 4804 153 173
3359 5487 35 56   3379 4613 153 173
3360 4227 11 30   3380 4088 11 34
3361 4488 119 139   3381 4644 229 252
3362 4001 107 130   3382 4708 11 31
3362 4003 8 31   3383 5206 11 30
3362 4012 105 128   3384 4301 36 59
3362 4011 112 135   3385 4471 11 31
3363 4926 136 155   3386 4951 11 30
3364 5433 11 34   3386 5097 11 30
3364 3961 11 34   3386 4904 11 30
3364 4005 11 34   3386 5107 11 30
3364 3960 11 34   3386 5007 11 30
3364 3947 151 174   3387 4298 204 223
3364 3976 11 34   3388 4984 41 64
3364 3966 106 129   3389 5027 11 31
3364 3973 11 34   3390 4082 51 73
3364 3950 11 34   3391 4640 165 184
3364 3958 11 34   3392 4427 11 31
3364 3962 11 34   3393 4411 11 30
3364 3969 11 34   3394 4855 45 68
3364 3957 11 34   3395 5220 11 32
3364 4002 104 127   3395 5272 11 32
3364 3954 11 34   3396 4335 11 32
3364 3952 7 30   3397 5476 215 236
3364 3946 11 34   3397 5390 215 236
3364 3948 11 34   3398 4442 87 107
3364 4006 11 34   3399 4838 11 30
3400 4222 37 58   3434 4574 11 34
3401 4435 11 34   3435 4231 11 34
3402 3990 11 34   3436 4439 215 238
3403 5176 200 219   3437 5454 84 104
3404 5297 49 72   3437 5328 78 98
3405 4095 61 84   3438 5228 11 30
3406 4906 11 32   3439 5432 34 53
3407 4172 11 31   3440 5144 11 30
3408 4226 74 96   3441 4424 136 159
3409 5195 79 98   3442 5290 11 30
3410 4941 33 54   3443 5332 11 31
3411 4330 11 31   3444 4090 11 34
3412 4666 11 30   3445 4743 190 210
3413 4316 72 95   3446 4438 11 34
3414 5168 33 53   3447 4069 11 31
3414 5210 33 53   3447 4072 11 31
3415 5484 37 60   3448 4392 11 34
3415 5491 47 70   3449 4828 11 31
3415 5401 37 60   3450 3992 81 104
3415 5455 37 60   3451 4868 45 64
3415 5458 37 60   3452 4128 11 31
3415 5402 38 61   3453 4338 111 134
3416 4960 11 34   3454 4288 11 31
3416 4919 11 34   3455 4202 11 30
3416 5035 11 34   3456 5010 11 34
3416 5093 11 34   3457 4928 48 71
3417 5406 64 84   3458 4601 43 64
3418 4512 56 78   3458 4723 43 64
3419 4793 197 217   3458 4582 11 32
3420 4712 42 61   3458 4786 11 32
3420 4675 42 61   3459 4929 117 136
3421 5103 11 30   3460 4074 11 34
3421 4923 11 30   3461 4183 11 30
3421 5043 11 30   3462 4450 126 149
3422 4203 11 30   3463 4805 39 62
3423 4369 255 274   3464 4898 11 30
3424 5488 11 31   3465 4949 76 97
3425 4857 11 33   3466 4769 32 51
3425 4910 11 33   3467 4833 43 66
3426 4403 11 34   3467 4550 43 66
3427 4356 75 98   3468 4988 50 73
3428 4354 11 32   3469 4414 47 66
3429 4766 11 31   3470 5064 34 55
3429 4730 11 31   3471 4381 117 138
3429 4760 11 31   3472 4939 11 34
3429 4561 11 31   3473 5115 11 32
3430 5244 11 30   3474 5139 11 33
3431 5294 11 34   3475 4907 83 102
3432 4985 74 93   3476 4343 11 34
3433 4000 11 34   3476 4348 42 65
3477 4091 54 75   3523 4150 11 31
3478 4932 60 80   3523 4296 11 31
3479 4775 11 32   3523 4118 11 31
3480 4345 11 32   3523 4320 11 31
3481 4900 11 31   3523 4294 11 31
3482 4155 11 34   3523 4225 11 31
3483 5226 287 309   3524 5447 1 22
3484 4283 45 64   3525 4612 11 31
3485 4935 245 265   3526 5057 87 106
3486 5214 72 91   3527 5122 11 30
3487 5189 46 69   3528 5291 133 153
3488 4529 156 179   3529 3931 123 143
3489 4367 11 34   3530 5068 119 138
3490 4563 11 32   3531 4971 32 52
3491 4585 11 30   3531 4885 32 52
3492 4049 114 137   3531 4915 33 53
3493 4795 39 60   3532 5079 11 30
3494 3988 11 30   3533 5293 53 76
3495 4050 74 97   3534 4331 11 32
3496 5335 11 32   3535 4094 231 254
3497 4634 11 30   3536 4368 11 33
3498 4934 11 30   3536 4484 11 33
3499 4624 65 84   3537 5342 142 161
3500 4911 76 96   3538 4482 45 68
3501 5466 11 33   3539 4886 127 146
3502 5316 146 165   3540 4015 86 109
3503 4832 34 54   3540 4018 11 34
3503 4756 34 54   3540 4017 85 108
3504 4342 11 33   3540 4025 85 108
3505 4622 37 56   3540 4016 85 108
3506 5289 11 30   3540 4014 11 34
3507 5464 130 153   3540 4023 85 108
3508 5054 11 30   3540 4021 85 108
3509 4480 11 34   3540 4020 85 108
3509 4351 11 34   3540 4027 11 34
3510 5325 11 33   3540 4028 11 34
3511 5475 11 31   3540 4013 85 108
3512 5305 11 33   3540 4019 85 108
3513 4307 63 86   3541 5140 11 30
3514 4290 37 59   3542 4823 185 205
3515 5281 11 33   3543 4806 11 32
3516 4544 114 137   3544 4954 11 30
3516 4739 214 237   3545 4292 11 30
3516 4681 32 55   3546 4184 11 32
3517 4332 79 102   3547 4989 11 31
3518 4747 52 74   3548 4496 11 34
3519 5391 11 32   3549 4311 50 69
3520 5192 11 30   3549 4112 11 30
3521 4249 40 62   3550 4568 11 30
3522 4816 303 326   3550 4540 11 30
3551 4822 78 99   3590