(19)
(11)EP 2 855 687 B1

(12)EUROPEAN PATENT SPECIFICATION

(45)Mention of the grant of the patent:
22.04.2020 Bulletin 2020/17

(21)Application number: 13800646.5

(22)Date of filing:  03.06.2013
(51)International Patent Classification (IPC): 
C12P 7/52(2006.01)
C12N 1/21(2006.01)
C12N 1/20(2006.01)
(86)International application number:
PCT/US2013/043954
(87)International publication number:
WO 2013/184602 (12.12.2013 Gazette  2013/50)

(54)

MICROORGANISMS AND METHODS FOR PRODUCTION OF 4-HYDROXYBUTYRATE, 1,4-BUTANEDIOL AND RELATED COMPOUNDS

MIKROORGANISMEN UND VERFAHREN ZUR HERSTELLUNG VON 4-HYDROXYBUTYRAT, 1,4-BUTANDIOL UND VERWANDTEN VERBINDUNGEN

MICROORGANISMES ET PROCÉDÉS DE PRODUCTION DU 4-HYDROXYBUTYRATE, 1,4-BUTANEDIOL ET COMPOSÉS ASSOCIÉS


(84)Designated Contracting States:
AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

(30)Priority: 04.06.2012 US 201213655429

(43)Date of publication of application:
08.04.2015 Bulletin 2015/15

(73)Proprietor: Genomatica, Inc.
San Diego, CA 92121 (US)

(72)Inventors:
  • BURK, Mark, J.
    San Diego, CA 92121 (US)
  • PHARKYA, Priti
    San Diego, CA 92121 (US)
  • BURGARD, Anthony, P.
    San Diego, CA 92121 (US)
  • VAN DIEN, Stephen, J.
    San Diego, CA 92121 (US)
  • OSTERHOUT, Robin, E.
    San Diego, CA 92121 (US)
  • TRAWICK, John, D.
    San Diego, CA 92121 (US)
  • KUCHINSKAS, Michael, P.
    San Diego, CA 92121 (US)
  • STEER, Brian
    San Diego, CA 92121 (US)

(74)Representative: Hoffmann Eitle 
Patent- und Rechtsanwälte PartmbB Arabellastraße 30
81925 München
81925 München (DE)


(56)References cited: : 
WO-A1-2012/001003
US-A1- 2010 021 978
US-B2- 8 129 169
WO-A2-2008/115840
US-A1- 2011 217 742
  
  • HARRY YIM ET AL: "Metabolic engineering of Escherichia coli for direct production of 1,4-butanediol", NATURE CHEMICAL BIOLOGY, NATURE PUBLISHING GROUP, UNITED KINGDOM, vol. 7, no. 7, 1 July 2011 (2011-07-01), pages 445-452, XP002690293, ISSN: 1552-4469, DOI: 10.1038/NCHEMBIO.580 [retrieved on 2011-05-22]
  • RASHMI SAINI ET AL: "COutilizing microbes A comprehensive review", BIOTECHNOLOGY ADVANCES, ELSEVIER PUBLISHING, BARKING, GB, vol. 29, no. 6, 5 August 2011 (2011-08-05) , pages 949-960, XP028306429, ISSN: 0734-9750, DOI: 10.1016/J.BIOTECHADV.2011.08.009 [retrieved on 2011-08-12]
  • BARTON NELSON R ET AL: "An integrated biotechnology platform for developing sustainable chemical processes", JOURNAL OF INDUSTRIAL MICROBIOLOGY AND BIOTECHNOLOGY, BASINGSTOKE, GB, vol. 42, no. 3, 22 November 2014 (2014-11-22), pages 349-360, XP035446321, ISSN: 1367-5435, DOI: 10.1007/S10295-014-1541-1 [retrieved on 2014-11-22]
  • KHALAMEYZER, V ET AL.: 'Screening, Nucleotide Sequence, And Biochemical Characterization Of An Esterase From Pseudomonas fluorescens With High Activity Towards Lactone.' APPLIED AND ENVIRONMENTAL MICROBIOLOGY. vol. 65, no. 2, February 1999, pages 477 - 482, XP008089566
  • DATABASE UNIPROT [Online] December 2008 READ, TD ET AL.: 'Annotation Of The Yersinia Intermedia ATCC 29909 Genome.', XP003034309 Database accession no. C4SZW2
  
Note: Within nine months from the publication of the mention of the grant of the European patent, any person may give notice to the European Patent Office of opposition to the European patent granted. Notice of opposition shall be filed in a written reasoned statement. It shall not be deemed to have been filed until the opposition fee has been paid. (Art. 99(1) European Patent Convention).


Description


[0001] This invention relates generally to in silico design of organisms and engineering of organisms, more particularly to organisms having 4-hydroxybutyrate biosynthesis capability.

BACKGROUND OF THE INVENTION



[0002] The compound 4-hydroxybutanoic acid (4-hydroxybutanoate, 4-hydroxybutyrate, 4-HB) is a 4-carbon carboxylic acid that has industrial potential as a building block for various commodity and specialty chemicals. In particular, 4-HB has the potential to serve as a new entry point into the 1,4-butanediol family of chemicals, which includes solvents, resins, polymer precursors, and specialty chemicals. 1,4-Butanediol (BDO) is a polymer intermediate and industrial solvent with a global market of about 3 billion lb/year. BDO is currently produced from petrochemical precursors, primarily acetylene, maleic anhydride, and propylene oxide.

[0003] For example, acetylene is reacted with 2 molecules of formaldehyde in the Reppe synthesis reaction (Kroschwitz and Grant, Encyclopedia of Chem. Tech., John Wiley and Sons, Inc., New York (1999)), followed by catalytic hydrogenation to form 1,4-butanediol. It has been estimated that 90% of the acetylene produced in the U.S. is consumed for butanediol production. Alternatively, it can be formed by esterification and catalytic hydrogenation of maleic anhydride, which is derived from butane. Downstream, butanediol can be further transformed; for example, by oxidation to γ-butyrolactone, which can be further converted to pyrrolidone and N-methyl-pyrrolidone, or hydrogenolysis to tetrahydrofuran. These compounds have varied uses as polymer intermediates, solvents, and additives, and have a combined market of nearly 2 billion lb/year. It is desirable to develop a method for production of these chemicals by alternative means that not only substitute renewable for petroleum-based feedstocks, and also use less energy- and capital-intensive processes.

[0004] WO 2012/001003 A1 relates to a modified microorganism for the biological preparation of a hydroxy acid wherein the microorganism comprises a two-step metabolic pathway for the production of the said hydroxy acid from a hydroxy keto-acid through an intermediate hydroxy-aldehyde, catalysed by an enzyme having a 2-keto-acid decarboxylase activity and an enzyme having hydroxy aldehyde dehydrogenase activity. The invention also concerns a method for the fermentative production of a hydroxy acid.

[0005] US 8,129,169 B2 provides non-naturally occurring microbial organisms comprising a 1,4-butanediol (BDO) pathway comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO and further optimized for expression of BDO. Further provided are methods of using such microbial organisms to produce BDO.

[0006] US 2010/0021978 A1 relates to a non-naturally occurring microbial organism having a 3-hydroxypropanoic acid (3-HP) pathway that includes at least one exogenous nucleic acid encoding 3-HP pathway enzyme expressed in a sufficient amount to produce 3-HP. The 3-HP pathway includes a 2-keto acid decarboxylase, a CoA-dependent oxaloacetate dehydrogenase, or a malate decarboxylase. The application further relates to a method for producing 3-HP including culturing said non-naturally occurring microbial organism.

[0007] Thus, there exists a need for alternative means for effectively producing commercial quantities of 1,4-butanediol and its chemical precursors. The present invention satisfies this need and provides related advantages as well.

SUMMARY OF INVENTION



[0008] The invention provides non-naturally occurring microbial organisms having a 4-hydroxybutyrate pathway and being capable of producing 4-hydroxybutyrate, wherein the microbial organism comprises the genetic modifications as recited in the claims. The invention additionally provides methods of producing 4-hydroxybutyrate or 1,4-butanediol, using the microbial organisms.

BRIEF DESCRIPTION OF THE DRAWINGS



[0009] 

Figure 1 is a schematic diagram showing biochemical pathways to 4-hydroxybutyurate (4-HB) and to 1,4-butanediol production. The first 5 steps are endogenous to E. coli, while the remainder can be expressed heterologously. Enzymes catalyzing the biosynthetic reactions are: (1) succinyl-CoA synthetase; (2) CoA-independent succinic semialdehyde dehydrogenase; (3) α-ketoglutarate dehydrogenase; (4) glutamate:succinate semialdehyde transaminase; (5) glutamate decarboxylase; (6) CoA-dependent succinic semialdehyde dehydrogenase; (7) 4-hydroxybutanoate dehydrogenase; (8) α-ketoglutarate decarboxylase; (9) 4-hydroxybutyryl CoA:acetyl-CoA transferase; (10) butyrate kinase; (11) phosphotransbutyrylase; (12) aldehyde dehydrogenase; (13) alcohol dehydrogenase.

Figure 2 is a schematic diagram showing homoserine biosynthesis in E. coli.

Figure 3 shows the production of 4-HB in glucose minimal medium using E. coli strains harboring plasmids expressing various combinations of 4-HB pathway genes. (a) 4-HB concentration in culture broth; (b) succinate concentration in culture broth; (c) culture OD, measured at 600 nm. Clusters of bars represent the 24 hour, 48 hour, and 72 hour (if measured) timepoints. The codes along the x-axis indicate the strain/plasmid combination used. The first index refers to the host strain: 1, MG1655 lacIQ; 2, MG1655 ΔgabD lacIQ; 3, MG1655 ΔgabD ΔaldA lacIQ. The second index refers to the plasmid combination used: 1, pZE13-0004-0035 and pZA33-0036; 2, pZE13-0004-0035 and pZA33-0010n; 3, pZE13-0004-0008 and pZA33-0036; 4, pZE13-0004-0008 and pZA33-0010n; 5, Control vectors pZE13 and pZA33.

Figure 4 shows the production of 4-HB from glucose in E. coli strains expressing α-ketoglutarate decarboxylase from Mycobacterium tuberculosis. Strains 1-3 contain pZE13-0032 and pZA33-0036. Strain 4 expresses only the empty vectors pZE13 and pZA33. Host strains are as follows: 1 and 4, MG1655 lacIQ; 2, MG1655 ΔgabD lacIQ; 3, MG1655 ΔgabD ΔaldA lacIQ. The bars refer to concentration at 24 and 48 hours.

Figure 5 shows the production of BDO from 10 mM 4-HB in recombinant E. coli strains. Numbered positions correspond to experiments with MG1655 lacIQ containing pZA33-0024, expressing cat2 from P. gingivalis, and the following genes expressed on pZE13: 1, none (control); 2, 0002; 3, 0003; 4, 0003n; 5, 0011; 6, 0013; 7, 0023; 8, 0025; 9, 0008n; 10, 0035. Gene numbers are defined in Table 6. For each position, the bars refer to aerobic, microaerobic, and anaerobic conditions, respectively. Microaerobic conditions were created by sealing the culture tubes but not evacuating them.

Figure 6 shows the mass spectrum of 4-HB and BDO produced by MG1655 lacIQ pZE13-0004-0035-0002 pZA33-0034-0036 grown in M9 minimal medium supplemented with 4 g/L unlabeled glucose (a, c, e, and g) uniformly labeled 13C-glucose (b, d, f, and h). (a) and (b), mass 116 characteristic fragment of derivatized BDO, containing 2 carbon atoms; (c) and (d), mass 177 characteristic fragment of derivatized BDO, containing 1 carbon atom; (e) and (f), mass 117 characteristic fragment of derivatized 4-HB, containing 2 carbon atoms; (g) and (h), mass 233 characteristic fragment of derivatized 4-HB, containing 4 carbon atoms.

Figure 7 is a schematic process flow diagram of bioprocesses for the production of γ-butyrolactone. Panel (a) illustrates fed-batch fermentation with batch separation and panel (b) illustrates fed-batch fermentation with continuous separation.

Figures 8A and 8B show exemplary 1,4-butanediol (BDO) pathways. Figure 8A shows BDO pathways from succinyl-CoA. Figure 8B shows BDO pathways from alpha-ketoglutarate.

Figures 9A-9C show exemplary BDO pathways. Figure 9A and 9B show pathways from 4-aminobutyrate. Figure 9C shows a pathway from acetoactyl-CoA to 4-aminobutyrate.

Figure 10 shows exemplary BDO pathways from alpha-ketoglutarate.

Figure 11 shows exemplary BDO pathways from glutamate.

Figure 12 shows exemplary BDO pathways from acetoacetyl-CoA.

Figure 13 shows exemplary BDO pathways from homoserine.

Figures 14 shows the nucleotide and amino acid sequences of E. coli succinyl-CoA synthetase. Figure 14A shows the nucleotide sequence (SEQ ID NO:46) of the E. coli sucCD operon. Figures 14B (SEQ ID NO:47) and 14C (SEQ ID NO:48) show the amino acid sequences of the succinyl-CoA synthetase subunits encoded by the sucCD operon.

Figure 15 shows the nucleotide and amino acid sequences of Mycobacterium bovis alpha-ketoglutarate decarboxylase. Figure 15A shows the nucleotide sequence (SEQ ID NO:49) of Mycobacterium bovis sucA gene. Figure 15B shows the amino acid sequence (SEQ ID NO:50) of M. bovis alpha-ketoglutarate decarboxylase.

Figure 16 shows biosynthesis in E. coli of 4-hydroxybutyrate from glucose in minimal medium via alpha-ketoglutarate under anaerobic (microaerobic) conditions. The host strain is ECKh-401. The experiments are labeled based on the upstream pathway genes present on the plasmid pZA33 as follows: 1) 4hbd-sucA; 2) sucCD-sucD-4hbd; 3) sucCD-sucD-4hbd-sucA.

Figure 17 shows biosynthesis in E. coli of 4-hydroxybutyrate from glucose in minimal medium via succinate and alpha-ketoglutarate. The host strain is wild-type MG1655. The experiments are labeled based on the genes present on the plasmids pZE13 and pZA33 as follows: 1) empty control vectors 2) empty pZE13, pZA33-4hbd; 3) pZE13-sucA, pZA33-4hbd.

Figure 18A shows the nucleotide sequence (SEQ ID NO:51) of CoA-dependent succinate semialdehyde dehydrogenase (sucD) from Porphyromonas gingivalis, and Figure 18B shows the encoded amino acid sequence (SEQ ID NO:52).

Figure 19A shows the nucleotide sequence (SEQ ID NO:53) of 4-hydroxybutyrate dehydrogenase (4hbd) from Porphymonas gingivalis, and Figure 19B shows the encoded amino acid seqence (SEQ ID NO:54).

Figure 20A shows the nucleotide sequence (SEQ ID NO:55) of 4-hydroxybutyrate CoA transferase (cat2) from Porphyromonas gingivalis, and Figure 20B shows the encoded amino acid sequence (SEQ ID NO:56).

Figure 21A shows the nucleotide sequence (SEQ ID NO:57) of phosphotransbutyrylase (ptb) from Clostridium acetobutylicum, and Figure 21B shows the encoded amino acid sequence (SEQ ID NO:58).

Figure 22A shows the nucleotide sequence (SEQ ID NO:59) of butyrate kinase (buk1) from Clostridium acetobutylicum, and Figure 22B shows the encoded amino acid sequence (SEQ ID NO:60).

Figure 23 shows alternative nucleotide sequences for C. acetobutylicum 020 (phosphtransbutyrylase) with altered codons for more prevalent E. coli codons relative to the C. acetobutylicum native sequence. Figures 23A-23D (020A-020D, SEQ ID NOS:61-64, respectively) contain sequences with increasing numbers of rare E. coli codons replaced by more prevalent codons (A<B<C<D).

Figure 24 shows alternative nucleotide sequences for C. acetobuytlicum 021 (butyrate kinase) with altered codons for more prevalent E. coli codons relative to the C. acetobutylicum native sequence. Figures 24A-24D (021A-021B, SEQ ID NOS:65-68, respectively) contain sequences with increasing numbers of rare E. coli codons replaced by more prevalent codons (A<B<C<D).

Figure 25 shows improved expression of butyrate kinase (BK) and phosphotransbutyrylase (PTB) with optimized codons for expression in E. coli. Figure 25A shows sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) stained for proteins with Coomassie blue; lane 1, control vector with no insert; lane 2, expression of C. acetobutylicum native sequences in E. coli; lane 3, expression of 020B-021B codon optimized PTB-BK; lane 4, expression of 020C-021C codon optimized PTB-BK. The positions of BK and PTB are shown. Figure 25B shows the BK and PTB activities of native C. acetobutylicum sequence (2021n) compared to codon optimized 020B-021B (2021B) and 020C-021C (2021C).

Figure 26 shows production of BDO and gamma-butyrylactone (GBL) in various strains expressing BDO producing enzymes: Cat2 (034); 2021n; 2021B; 2021C.

Figure 27A shows the nucleotide sequence (SEQ ID NO:69) of the native Clostridium biejerinckii ald gene (025n), and Figure 27B shows the encoded amino acid sequence (SEQ ID NO:70).

Figures 28A-28D show alternative gene sequences for the Clostridium beijerinckii ald gene (025A-025D, SEQ ID NOS:71-74, respectively), in which increasing numbers of rare codons are replaced by more prevalent codons (A<B<C<D).

Figure 29 shows expression of native C. beijerinckii ald gene and codon optimized variants; no ins (control with no insert), 025n, 025A, 025B, 025C, 025D.

Figure 30 shows BDO or BDO and ethanol production in various strains. Figure 30 shows BDO production in strains containing the native C. beijerinckii ald gene (025n) or variants with optimized codons for expression in E. coli (025A-025D). Figure 30B shows production of ethanol and BDO in strains expressing the C. acetobutylicum AdhE2 enzyme (002C) compared to the codon optimized variant 025B. The third set shows expression of P. gingivalis sucD (035). In all cases, P. gingivalis Cat2 (034) is also expressed.

Figure 31A shows the nucleotide sequence (SEQ ID NO:75) of the adh1 gene from Geobacillus thermoglucosidasius, and Figure 31B shows the encoded amino acid sequence (SEQ ID NO:76).

Figure 32A shows the expression of the Geobacillus thermoglucosidasius adh1 gene in E. coli. Either whole cell lysates or supernatants were analyzed by SDS-PAGE and stained with Coomassie blue for plasmid with no insert, plasmid with 083 (Geotrichum capitatum N-benzyl-3-pyrrolidinol dehydrogenase) and plasmid with 084 (Geobacillus thermoglucosidasius adh1) inserts. Figure 32B shows the activity of 084 with butyraldehyde (diamonds) or 4-hydroxybutyraldehyde (squares) as substrates.

Figure 33 shows the production of BDO in various strains: plasmid with no insert; 025B, 025B-026n; 025B-026A; 025B-026B; 025B-026C; 025B-050; 025B-052; 025B-053; 025B-055; 025B-057; 025B-058; 025B-071; 025B-083; 025B-084; PTSlacO-025B; PTSlacO-025B-026n.

Figure 34 shows a plasmid map for the vector pRE118-V2.

Figure 35 shows the sequence (SEQ ID NO:77) of the ECKh-138 region encompassing the aceF and lpdA genes. The K. pneumonia lpdA gene is underlined, and the codon changed in the Glu354Lys mutant shaded.

Figure 36 shows the protein sequence comparison of the native E. coli lpdA (SEQ ID NO:78) and the mutant K. pneumonia lpdA (SEQ ID NO:79).

Figure 37 shows 4-hydroxybutyrate (left bars) and BDO (right bars) production in the strains AB3, MG1655 ΔldhA and ECKh-138. All strains expressed E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd on the medium copy plasmid pZA33, and P. gingivalis Cat2, C. acetobutylicum AdhE2 on the high copy plasmid pZE13.

Figure 38 shows the nucleotide sequence (SEQ ID NO:80) of the 5' end of the aceE gene fused to the pflB-p6 promoter and ribosome binding site (RBS). The 5' italicized sequence shows the start of the aroP gene, which is transcribed in the opposite direction from the pdh operon. The 3' italicized sequence shows the start of the aceE gene. In upper case: pflB RBS. Underlined: FNR binding site. In bold: pflB-p6 promoter sequence.

Figure 39 shows the nucleotide sequence (SEQ ID NO:81) in the aceF-lpdA region in the strain ECKh-456.

Figure 40 shows the production of 4-hydroxybutyrate, BDO and pyruvate (left to right bars, respectively) for each of strains ECKh-439, ECKh-455 and ECKh-456.

Figure 41A shows a schematic of the recombination sites for deletion of the mdh gene. Figure 41B shows the nucleotide sequence of the PCR product (SEQ ID NO:82) and the encoded amino acid sequence (SEQ ID NO:83) of the amplification of chloramphenicol resistance gene (CAT) flanked by FRT sites and homology regions from the mdh gene from the plasmid pKD3.

Figure 42 shows the sequence (SEQ ID NO:84) of the areA deleted region in strain ECKh-401.

Figure 43 shows the sequence (SEQ ID NO:85) of the region encompassing a mutated gltA gene of strain ECKh-422.

Figure 44 shows the citrate synthase activity of wild type gltA gene product and the R163L mutant. The assay was performed in the absence (diamonds) or presence of 0.4 mM NADH (squares).

Figure 45 shows the 4-hydroxybutyrate (left bars) and BDO (right bars) production in strains ECKh-401 and ECKh-422, both expressing genes for the complete BDO pathway on plasmids.

Figure 46 shows central metabolic fluxes and associated 95% confidence intervals from metabolic labeling experiments. Values are molar fluxes normalized to a glucose uptake rate of 1 mmol/hr. The result indicates that carbon flux is routed through citrate synthase in the oxidative direction and that most of the carbon enters the BDO pathway rather than completing the TCA cycle.

Figure 47 shows extracellular product formation for strains ECKh-138 and ECKh-422, both expressing the entire BDO pathway on plasmids. The products measured were acetate (Ace), pyruvate (Pyr), 4-hydroxybutyrate (4HB), 1,4-butanediol (BDO), ethanol (EtOH), and other products, which include gamma-butyrolactone (GBL), succinate, and lactate.

Figure 48 shows the sequence (SEQ ID NO:86) of the region following replacement of PEP carboxylase (ppc) by H. influenzae phosphoenolpyruvate carboxykinase (pepck). The pepck coding region is underlined.

Figure 49 shows growth of evolved pepCK strains grown in minimal medium containing 50 mM NaHCO3.

Figure 50 shows product formation in strain ECKh-453 expressing P. gingivalis Cat2 and C. beijerinckii Ald on the plasmid pZS*13. The products measured were 1,4-butanediol (BDO), pyruvate, 4-hydroxybutyrate (4HB), acetate, γ-butyrolactone (GBL) and ethanol.

Figure 51 shows BDO production of two strains, ECKh-453 and ECKh-432. Both contain the plasmid pZS*13 expressing P. gingivalis Cat2 and C. beijerinckii Ald. The cultures were grown under microaerobic conditions, with the vessels punctured with 27 or 18 gauge needles, as indicated.

Figure 52 shows the nucleotide sequence (SEQ ID NO:87) of the genomic DNA of strain ECKh-426 in the region of insertion of a polycistronic DNA fragment containing a promoter, sucCD gene, sucD gene, 4hbd gene and a terminator sequence.

Figure 53 shows the nucleotide sequence (SEQ ID NO:88) of the chromosomal region of strain ECKh-432 in the region of insertion of a polycistronic sequence containing a promoter, sucA gene, C. kluyveri 4hbd gene and a terminator sequence.

Figure 54 shows BDO synthesis from glucose in minimal medium in the ECKh-432 strain having upstream BDO pathway encoding genes intregrated into the chromosome and containing a plasmid harboring downstream BDO pathway genes.

Figure 55 shows a PCR product (SEQ ID NO:89) containing the non-phosphotransferase (non-PTS) sucrose utilization genes flanked by regions of homology to the rrnC region.

Figure 56 shows a schematic diagram of the integrations site in the rrnC operon.

Figure 57 shows average product concentration, normalized to culture OD600, after 48 hours of growth of strain ECKh-432 grown on glucose and strain ECKh-463 grown on sucrose. Both contain the plasmid pZS*13 expressing P. gingivalis Cat2 and C. beijerinckii Ald. The data is for 6 replicate cultures of each strain. The products measured were 1,4-butanediol (BDO), 4-hydroxybutyrate (4HB), γ-butyrolactone (GBL), pyruvate (PYR) and acetate (ACE) (left to right bars, respectively).

Figure 58 shows exemplary pathways to 1,4-butanediol from succcinyl-CoA and alpha-ketoglutarate. Abbreviations: A) Succinyl-CoA reductase (aldehyde forming), B) Alpha-ketoglutarate decarboxylase, C) 4-Hydroxybutyrate dehydrogenase, D) 4-Hydroxybutyrate reductase, E) 1,4-Butanediol dehydrogenase.

Figure 59A shows the nucleotide sequence (SEQ ID NO:90) of carboxylic acid reductase from Nocardia iowensis (GNM_720), and Figure 59B shows the encoded amino acid sequence (SEQ ID NO:91).

Figure 60A shows the nucleotide sequence (SEQ ID NO:92) of phosphpantetheine transferase, which was codon optimized, and Figure 60B shows the encoded amino acid sequence (SEQ ID NO:93).

Figure 61 shows a plasmid map of plasmid pZS*-13S-720 721opt.

Figures 62A and 62B show pathways to 1,4-butanediol from succinate, succcinyl-CoA, and alpha-ketoglutarate. Abbreviations: A) Succinyl-CoA reductase (aldehyde forming), B) Alpha-ketoglutarate decarboxylase, C) 4-Hydroxybutyrate dehydrogenase, D) 4-Hydroxybutyrate reductase, E) 1,4-Butanediol dehydrogenase, F) Succinate reductase, G) Succinyl-CoA transferase, H) Succinyl-CoA hydrolase, I) Succinyl-CoA synthetase (or Succinyl-CoA ligase), J) Glutamate dehydrogenase, K) Glutamate transaminase, L) Glutamate decarboxylase, M) 4-aminobutyrate dehydrogenase, N) 4-aminobutyrate transaminase, O) 4-Hydroxybutyrate kinase, P) Phosphotrans-4-hydroxybutyrylase, Q) 4-Hydroxybutyryl-CoA reductase (aldehyde forming), R) 4-hydroxybutyryl-phosphate reductase, S) Succinyl-CoA reductase (alcohol forming), T) 4-Hydroxybutyryl-CoA transferase, U) 4-Hydroxybutyryl-CoA hydrolase, V) 4-Hydroxybutyryl-CoA synthetase (or 4-Hydroxybutyryl-CoA ligase), W) 4-Hydroxybutyryl-CoA reductase (alcohol forming), X) Alpha-ketoglutarate reductase, Y) 5-Hydroxy-2-oxopentanoate dehydrogenase, Z) 5-Hydroxy-2-oxopentanoate decarboxylase, AA) 5-hydroxy-2-oxopentanoate dehydrogenase (decarboxylation).

Figure 63 shows pathways to putrescine from succinate, succcinyl-CoA, and alpha-ketoglutarate. Abbreviations: A) Succinyl-CoA reductase (aldehyde forming), B) Alpha-ketoglutarate decarboxylase, C) 4-Aminobutyrate reductase, D) Putrescine dehydrogenase , E) Putrescine transaminase, F) Succinate reductase, G) Succinyl-CoA transferase, H) Succinyl-CoA hydrolase, I) Succinyl-CoA synthetase (or Succinyl-CoA ligase), J) Glutamate dehydrogenase, K) Glutamate transaminase, L) Glutamate decarboxylase, M) 4-Aminobutyrate dehydrogenase, N) 4-Aminobutyrate transaminase, O) Alpha-ketoglutarate reductase, P) 5-Amino-2-oxopentanoate dehydrogenase, Q) 5-Amino-2-oxopentanoate transaminase, R) 5-Amino-2-oxopentanoate decarboxylase, S) Ornithine dehydrogenase, T) Ornithine transaminase, U) Ornithine decarboxylase.

Figure 64A shows the nucleotide sequence (SEQ ID NO:94) of carboxylic acid reductase from Mycobacterium smegmatis mc(2)155 (designated 890), and Figure 64B shows the encoded amino acid sequence (SEQ ID NO:95).

Figure 65A shows the nucleotide sequence (SEQ ID NO:96) of carboxylic acid reductase from Mycobacterium avium subspecies paratuberculosis K-10 (designated 891), and Figure 65B shows the encoded amino acid sequence (SEQ ID NO:97).

Figure 66A shows the nucleotide sequence (SEQ ID NO:98) of carboxylic acid reductase from Mycobacterium marinum M (designated 892), and Figure 66B shows the encoded amino acid sequence (SEQ ID NO:99).

Figure 67 shows a schematic of the E. coli MG1655 chromosome between nucleotides 760928 and 765930.

Figures 68a-68e shows a schematic of the sequences and oligonucleotides used in the construction of the sucCD deletion.

Figure 69 shows an exemplary BDO pathway. Enzyme names for each numbered step are as follows: (1) alpha-ketoglutarate decarboxylase; (2) CoA-dependent succinate semialdehyde dehydrogenase; (3) 4-hydroxybutyrate dehydrogenase; (4) 4-hydroxybutyryl-CoA transferase; (5) 4-hydroxybutyryl-CoA reductase; (6) 4-hydroxybutyraldehyde reductase.

Figure 70 shows an exemplary pathway for the formation of BDO from glucose. Abbreviations: G6P-glucsoe-6-phosphate, PEP- phosphoenolpyruvate, PYR- pyruvate, OA-oxaloacetate, ACCOA- acetyl-CoA, CIT- citrate, ICIT- isocitrate, AKG-alpha-ketoglutarate, SUCCOA- succinyl-CoA, SUCSAL- succinate semialdehyde, 4HB- 4-hydroxybutyrate, 4HBCoA- 4-hydroxybutyryl-CoA, 4HBALD- 4hydroxybutyraldehyde, BDO- 1,4-butanediol, GBL- gamma-butyrolactone. Genes of interest: ppc- PEP carboxylase, sucCD- succinyl-CoA synthetase, sucAB-lpdA- subunits of the AKG dehydrogenase complex, ybgC, tesB-acyl-CoenzymeA thioesterases

Figure 71 shows the average BDO and 4HB numbers from four replicates of a 4HB producing host strain that had the gene ppc overexpressed compared with the corresponding averages from four replicates of the control strain.

Figure 72 shows the reduction in the average ethanol numbers from the four replicates of the strain that had ppc overexpressed and compared with those from the control.

Figure 73 shows the average BDO and 4HB numbers from four replicates of a 4HB producing host strain that had the genes sucAB and mutant lpdA overexpressed on pZS*compared with the corresponding averages from four replicates of the control strain. ALD and ADH were expressed on the plasmid pPZSX23R.

Figure 74 shows the reduction in the average glutamate numbers from the four replicates of the strain that had the genes sucAB and mutant lpdA overexpressed on pZS* and compared with those from the control.

Figure 75 shows apparent equilibrium constant for lactonization of 4-HB to GBL as a function of pH (at 22°C) (from Efe et al., Biotechnol. Bioeng. 99:1392-1406 (2008)).

Figure 76 shows the average BDO and 4HB numbers from four replicates of a host strain capable of producing 4-hydrobutyryl-CoA that had the esterase integrated (2387) compared with the corresponding averages from four replicates of the control strain (2237).

Figure 77 shows the average GBL numbers from four replicates of a host strain that had the esterase integrated (2387) compared with the corresponding averages from four replicates of the control strain (2237). Lower GBL was observed with the strains that had the esterase integrated.

Figure 78 shows the average BDO and 4HB numbers from four replicates of a host strain that had the genes sucCD deleted (4269) compared with the corresponding averages from four replicates of the control strain (4070).

Figure 79 shows the average BDO and 4HB numbers from three replicates of a host strain that had the genes ybgC and tesB deleted (1197) compared with the corresponding averages from three replicates of the control strain (1136).

Figure 80 shows the average GBL numbers from three replicates of a host strain that had the genes ybgC and tesB deleted (1197) compared with the corresponding averages from three replicates of the control strain (1136).

Figure 81 shows the profile for the anion exchange elution, backflux activity, as well as the SDS page for the fractions.

Figure 82 shows the profile from the size exclusion chromatogrpahy, the backflux activity, as well as the SDS page for the fractions.

Figure 83 shows backflux activity from the size exclusion column and the SDS page.

Figure 84 shows the yjgB gene was cloned with a streptavidin tag, expressed and purified in order to characterize its properties. The results of the purification are via SDS-PAGE.

Figure 85 shows yjgB activity in 100mM BDO.

Figure 86 shows the average BDO, 4HB and GBL numbers for the strain 1872 versus strain 1889.

Figure 87 shows the average BDO, 4HB and GBL numbers for the strain 956 versus strain 879.

Figure 88 shows the average BDO, 4HB and GBL numbers of the strains, 1889, 2424, 2611 and 2471.

Figure 89A shows the nucleotide sequence of the Yersinia gene (locus yinte0001_13710) (SEQ ID NO:SEQ ID NO:177), and Figure 89B shows the encoded amino acid sequence (SEQ ID NO:179).

Figure 90A shows the nucleotide sequence of the gene from Agrobacterium tumefaciens (SEQ ID NO:178), and Figure 90B shows the encoded amino acid sequence (SEQ ID NO:180).

Figure 91 shows exemplary combinations of metabolic modifications corresponding to: (A) a genetic modification that increases expression of phosphoenolpyruvate carboxylase; (B) a genetic modification that increases expression of alpha-ketoglutarate dehydrogenase; (C) a genetic modification that increases expression of a non-phosphotransferase (PTS) glucose uptake system; (D) a genetic modification that increases expression of a gamma-butyrolactone esterase; (E) a genetic modification that decreases expression of succinyl-CoA synthetase; (F) a genetic modification that decreases expression of an acyl coenzyme A thioesterase; (G) a genetic modification that decreases expression of an alcohol dehydrogenase (H) a genetic modification that decreases expression of a non-energy-producing NADH dehydrogenase; (I) a genetic modification that decreases expression of a cytochrome oxidase; (J) a genetic modificatin that increases expression of pyruvate dehydrogenase; (K) a genetic modification that decreases expression of an aerobic respiratory control regulatory system; (L) a genetic modification that increases expression of an NADH insensitive citrate synthase; (M) a genetic modification that decreases expression of malate dehydrogenase; (N) a genetic modification that decreases expression of lactate dehydrogenase, (O) a genetic modification that decreases expression of alcohol dehydrogenase; and (P) a genetic modification that decreases expression of pyruvate formate lyase.


DETAILED DESCRIPTION OF THE DISCLOSURE



[0010] The present disclosure is directed to the design and production of cells and organisms having biosynthetic production capabilities for 4-hydroxybutanoic acid (4-HB), γ-butyrolactone, 1,4-butanediol (BDO), 4-hydroxybutanal (4-HBal), 4-hydroxybutyryl-CoA (4-HBCoA) and/or putrescine. The disclosure, in particular, relates to the design of microbial organisms capable of producing BDO, 4-HBal, 4-HBCoA and/or putrescine by introducing one or more nucleic acids encoding a BDO, 4-HBal, 4-HBCoA and/or putrescine pathway enzyme.

[0011] In one aspect, the disclosure utilizes in silico stoichiometric models of Escherichia coli metabolism that identify metabolic designs for biosynthetic production of 4-hydroxybutanoic acid (4-HB), 1,4-butanediol (BDO), 4-HBal, 4-HBCoA and/or putrescine. The results described herein indicate that metabolic pathways can be designed and recombinantly engineered to achieve the biosynthesis of 4-HBal, 4-HBCoA or 4-HB and downstream products such as 1,4-butanediol or putrescine in Escherichia coli and other cells or organisms. Biosynthetic production of 4-HB, 4-HBal, 4-HBCoA, BDO and/or putrescine, for example, for the in silico designs can be confirmed by construction of strains having the designed metabolic genotype. These metabolically engineered cells or organisms also can be subjected to adaptive evolution to further augment 4-HB, 4-HBal, 4-HBCoA, BDO and/or putrescine biosynthesis, including under conditions approaching theoretical maximum growth.

[0012] In certain aspects, the 4-HB, 4-HBal, 4-HBCoA, BDO and/or putrescine biosynthesis characteristics of the designed strains make them genetically stable and particularly useful in continuous bioprocesses. Separate strain design strategies were identified with incorporation of different non-native or heterologous reaction capabilities into E. coli or other host organisms leading to 4-HB and 1,4-butanediol producing metabolic pathways from either CoA-independent succinic semialdehyde dehydrogenase, succinyl-CoA synthetase and CoA-dependent succinic semialdehyde dehydrogenase, or glutamate:succinic semialdehyde transaminase. In silico metabolic designs were identified that resulted in the biosynthesis of 4-HB in both E.coli and yeast species from each of these metabolic pathways. The 1,4-butanediol intermediate γ-butyrolactone can be generated in culture by spontaneous cyclization under conditions at pH<7.5, particularly under acidic conditions, such as below pH 5.5, for example, pH<7, pH<6.5, pH<6, and particularly at pH<5.5 or lower.

[0013] Strains identified via the computational component of the platform can be put into actual production by genetically engineering any of the predicted metabolic alterations which lead to the biosynthetic production of 4-HB, 1,4-butanediol or other intermediate and/or downstream products. In yet a further aspect, strains exhibiting biosynthetic production of these compounds can be further subjected to adaptive evolution to further augment product biosynthesis. The levels of product biosynthesis yield following adaptive evolution also can be predicted by the computational component of the system.

[0014] In other specific aspects, microbial organisms were constructed to express a 4-HB biosynthetic pathway encoding the enzymatic steps from succinate to 4-HB and to 4-HB-CoA. Co-expression of succinate coenzyme A transferase, CoA-dependent succinic semialdehyde dehydrogenase, NAD-dependent 4-hydroxybutyrate dehydrogenase and 4-hydroxybutyrate coenzyme A transferase in a host microbial organism resulted in significant production of 4-HB compared to host microbial organisms lacking a 4-HB biosynthetic pathway. In a further specific aspect, 4-HB-producing microbial organisms were generated that utilized α-ketoglutarate as a substrate by introducing nucleic acids encoding α-ketoglutarate decarboxylase and NAD-dependent 4-hydroxybutyrate dehydrogenase.

[0015] In another specific aspect, microbial organisms containing a 1,4-butanediol (BDO) biosynthetic pathway were constructed that biosynthesized BDO when cultured in the presence of 4-HB. The BDO biosynthetic pathway consisted of a nucleic acid encoding either a multifunctional aldehyde/alcohol dehydrogenase or nucleic acids encoding an aldehyde dehydrogenawse and an alcohol dehydrogenase. To support growth on 4-HB substrates, these BDO-producing microbial organisms also expressed 4-hydroxybutyrate CoA transferase or 4-butyrate kinase in conjunction with phosphotranshydroxybutyrlase. In yet a further specific aspect, microbial organisms were generated that synthesized BDO through exogenous expression of nucleic acids encoding a functional 4-HB biosynthetic pathway and a functional BDO biosynthetic pathway. The 4-HB biosynthetic pathway consisted of succinate coenzyme A transferase, CoA-dependent succinic semialdehyde dehydrogenase, NAD-dependent 4-hydroxybutyrate dehydrogenase and 4-hydroxybutyrate coenzyme A transferase. The BDO pathway consisted of a multifunctional aldehyde/alcohol dehydrogenase. Further described herein are additional pathways for production of BDO (see Figures 8-13).

[0016] In a further aspect, described herein is the cloning and expression of a carboxylic acid reductase enzyme that functions in a 4-hydroxybutanal, 4-hydroxybutyryl-CoA or 1,4-butanediol metabolic pathway. Advantages of employing a carboxylic acid reductase as opposed to an acyl-CoA reductase to form 4-hydroxybutyraldehyde (4-hydroxybutanal) include lower ethanol and GBL byproduct formation accompanying the production of BDO. Also disclosed herein is the application of carboxylic acid reductase as part of additional numerous pathways to produce 1,4-butanediol and putrescine from the tricarboxylic acid (TCA) cycle metabolites, for example, succinate, succinyl-CoA, and/or alpha-ketoglutarate.

[0017] As used herein, the term "non-naturally occurring" when used in reference to a microbial organism or microorganism of the disclosure is intended to mean that the microbial organism has at least one genetic alteration not normally found in a naturally occurring strain of the referenced species, including wild-type strains of the referenced species. Genetic alterations include, for example, modifications introducing expressible nucleic acids encoding metabolic polypeptides, other nucleic acid additions, nucleic acid deletions and/or other functional disruption of the microbial organism's genetic material. Such modifications include, for example, coding regions and functional fragments thereof, for heterologous, homologous or both heterologous and homologous polypeptides for the referenced species. Additional modifications include, for example, non-coding regulatory regions in which the modifications alter expression of a gene or operon. Exemplary metabolic polypeptides include enzymes or proteins within a biosynthetic pathway for a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine family of compounds.

[0018] A metabolic modification refers to a biochemical reaction that is altered from its naturally occurring state. Therefore, non-naturally occurring microorganisms can have genetic modifications to nucleic acids encoding metabolic polypeptides or, functional fragments thereof. Exemplary metabolic modifications are disclosed herein.

[0019] As used herein, the term "isolated" when used in reference to a microbial organism is intended to mean an organism that is substantially free of at least one component as the referenced microbial organism is found in nature. The term includes a microbial organism that is removed from some or all components as it is found in its natural environment. The term also includes a microbial organism that is removed from some or all components as the microbial organism is found in non-naturally occurring environments. Therefore, an isolated microbial organism is partly or completely separated from other substances as it is found in nature or as it is grown, stored or subsisted in non-naturally occurring environments. Specific examples of isolated microbial organisms include partially pure microbes, substantially pure microbes and microbes cultured in a medium that is non-naturally occurring.

[0020] As used herein, the terms "microbial," "microbial organism" or "microorganism" are intended to mean any organism that exists as a microscopic cell that is included within the domains of archaea, bacteria or eukarya. Therefore, the term is intended to encompass prokaryotic or eukaryotic cells or organisms having a microscopic size and includes bacteria, archaea and eubacteria of all species as well as eukaryotic microorganisms such as yeast and fungi. The term also includes cell cultures of any species that can be cultured for the production of a biochemical.

[0021] As used herein, the term "4-hydroxybutanoic acid" is intended to mean a 4-hydroxy derivative of butyric acid having the chemical formula C4H8O3 and a molecular mass of 104.11 g/mol (126.09 g/mol for its sodium salt). The chemical compound 4-hydroxybutanoic acid also is known in the art as 4-HB, 4-hydroxybutyrate, gamma-hydroxybutyric acid or GHB. The term as it is used herein is intended to include any of the compound's various salt forms and include, for example, 4-hydroxybutanoate and 4-hydroxybutyrate. Specific examples of salt forms for 4-HB include sodium 4-HB and potassium 4-HB. Therefore, the terms 4-hydroxybutanoic acid, 4-HB, 4-hydroxybutyrate, 4-hydroxybutanoate, gamma-hydroxybutyric acid and GHB as well as other art recognized names are used synonymously herein.

[0022] As used herein, the term "monomeric" when used in reference to 4-HB is intended to mean 4-HB in a non-polymeric or underivatized form. Specific examples of polymeric 4-HB include poly-4-hydroxybutanoic acid and copolymers of, for example, 4-HB and 3-HB. A specific example of a derivatized form of 4-HB is 4-HB-CoA. Other polymeric 4-HB forms and other derivatized forms of 4-HB also are known in the art.

[0023] As used herein, the term "γ-butyrolactone" is intended to mean a lactone having the chemical formula C4H6O2 and a molecular mass of 86.089 g/mol. The chemical compound γ-butyrolactone also is know in the art as GBL, butyrolactone, 1,4-lactone, 4-butyrolactone, 4-hydroxybutyric acid lactone, and gamma-hydroxybutyric acid lactone. The term as it is used herein is intended to include any of the compound's various salt forms.

[0024] As used herein, the term "1,4-butanediol" is intended to mean an alcohol derivative of the alkane butane, carrying two hydroxyl groups which has the chemical formula C4H10O2 and a molecular mass of 90.12 g/mol. The chemical compound 1,4-butanediol also is known in the art as BDO and is a chemical intermediate or precursor for a family of compounds referred to herein as BDO family of compounds.

[0025] As used herein, the term "4-hydroxybutanal" is intended to mean an aledehyde having the chemical formula C4H8O2 and a molecular mass of 88.10512 g/mol. The chemical compound 4-hydroxybutanal (4-HBal) is also known in the art as 4-hydroxybutyraldehyde.

[0026] As used herein, the term "putrescine" is intended to mean a diamine having the chemical formula C4H12N2 and a molecular mass of 88.15148 g/mol. The chemical compound putrescine is also known in the art as 1,4-butanediamine, 1,4-diaminobutane, butylenediamine, tetramethylenediamine, tetramethyldiamine, and 1,4-butylenediamine.

[0027] As used herein, the term "tetrahydrofuran" is intended to mean a heterocyclic organic compound corresponding to the fully hydrogenated analog of the aromatic compound furan which has the chemical formula C4H8O and a molecular mass of 72.11 g/mol. The chemical compound tetrahydrofuran also is known in the art as THF, tetrahydrofuran, 1,4-epoxybutane, butylene oxide, cyclotetramethylene oxide, oxacyclopentane, diethylene oxide, oxolane, furanidine, hydrofuran, tetra-methylene oxide. The term as it is used herein is intended to include any of the compound's various salt forms.

[0028] As used herein, the term "CoA" or "coenzyme A" is intended to mean an organic cofactor or prosthetic group (nonprotein portion of an enzyme) whose presence is required for the activity of many enzymes (the apoenzyme) to form an active enzyme system. Coenzyme A functions in certain condensing enzymes, acts in acetyl or other acyl group transfer and in fatty acid synthesis and oxidation, pyruvate oxidation and in other acetylation.

[0029] As used herein, the term "substantially anaerobic" when used in reference to a culture or growth condition is intended to mean that the amount of oxygen is less than about 10% of saturation for dissolved oxygen in liquid media. The term also is intended to include sealed chambers of liquid or solid medium maintained with an atmosphere of less than about 1% oxygen.

[0030] The non-naturally occurring microbal organisms of the disclosure can contain stable genetic alterations, which refers to microorganisms that can be cultured for greater than five generations without loss of the alteration. Generally, stable genetic alterations include modifications that persist greater than 10 generations, particularly stable modifications will persist more than about 25 generations, and more particularly, stable genetic modifications will be greater than 50 generations, including indefinitely.

[0031] In the case of gene disruptions, a particularly useful stable genetic alteration is a gene deletion. The use of a gene deletion to introduce a stable genetic alteration is particularly useful to reduce the likelihood of a reversion to a phenotype prior to the genetic alteration. For example, if desired, stable growth-coupled production of a biochemical can be achieved, for example, by deletion of a gene encoding an enzyme catalyzing one or more reactions within a set of metabolic modifications. The stability of growth-coupled production of a biochemical can be further enhanced through multiple deletions, significantly reducing the likelihood of multiple compensatory reversions occurring for each disrupted activity.

[0032] Those skilled in the art will understand that the genetic alterations, including metabolic modifications exemplified herein are described with reference to a suitable source or host organism such as E. coli, yeast, or other organisms disclosed herein and their corresponding metabolic reactions or a suitable source organism for desired genetic material such as genes encoding enzymes for their corresponding metabolic reactions for a desired metabolic pathway. However, given the complete genome sequencing of a wide variety of organisms and the high level of skill in the area of genomics, those skilled in the art will readily be able to apply the teachings and guidance provided herein to essentially all other organisms. For example, the E. coli metabolic alterations exemplified herein can readily be applied to other species by incorporating the same or analogous encoding nucleic acid from species other than the referenced species. Such genetic alterations include, for example, genetic alterations of species homologs, in general, and in particular, orthologs, paralogs or nonorthologous gene displacements.

[0033] An ortholog is a gene or genes that are related by vertical descent and are responsible for substantially the same or identical functions in different organisms. For example, mouse epoxide hydrolase and human epoxide hydrolase can be considered orthologs for the biological function of hydrolysis of epoxides. Genes are related by vertical descent when, for example, they share sequence similarity of sufficient amount to indicate they are homologous, or related by evolution from a common ancestor. Genes can also be considered orthologs if they share three-dimensional structure but not necessarily sequence similarity, of a sufficient amount to indicate that they have evolved from a common ancestor to the extent that the primary sequence similarity is not identifiable. Genes that are orthologous can encode proteins with sequence similarity of about 25% to 100% amino acid sequence identity. Genes encoding proteins sharing an amino acid similarity less that 25% can also be considered to have arisen by vertical descent if their three-dimensional structure also shows similarities. Members of the serine protease family of enzymes, including tissue plasminogen activator and elastase, are considered to have arisen by vertical descent from a common ancestor.

[0034] Orthologs include genes or their encoded gene products that through, for example, evolution, have diverged in structure or overall activity. For example, where one species encodes a gene product exhibiting two functions and where such functions have been separated into distinct genes in a second species, the three genes and their corresponding products are considered to be orthologs. For the production, including growth-coupled production, of a biochemical product, those skilled in the art will understand that the orthologous gene harboring the metabolic activity to be introduced or disrupted is to be chosen for construction of the non-naturally occurring microorganism. An example of orthologs exhibiting separable activities is where distinct activities have been separated into distinct gene products between two or more species or within a single species. A specific example is the separation of elastase proteolysis and plasminogen proteolysis, two types of serine protease activity, into distinct molecules as plasminogen activator and elastase. A second example is the separation of mycoplasma 5'-3' exonuclease and Drosophila DNA polymerase III activity. The DNA polymerase from the first species can be considered an ortholog to either or both of the exonuclease or the polymerase from the second species and vice versa.

[0035] In contrast, paralogs are homologs related by, for example, duplication followed by evolutionary divergence and have similar or common, but not identical functions. Paralogs can originate or derive from, for example, the same species or from a different species. For example, microsomal epoxide hydrolase (epoxide hydrolase I) and soluble epoxide hydrolase (epoxide hydrolase II) can be considered paralogs because they represent two distinct enzymes, co-evolved from a common ancestor, that catalyze distinct reactions and have distinct functions in the same species. Paralogs are proteins from the same species with significant sequence similarity to each other suggesting that they are homologous, or related through co-evolution from a common ancestor. Groups of paralogous protein families include HipA homologs, luciferase genes, peptidases, and others.

[0036] A nonorthologous gene displacement is a nonorthologous gene from one species that can substitute for a referenced gene function in a different species. Substitution includes, for example, being able to perform substantially the same or a similar function in the species of origin compared to the referenced function in the different species. Although generally, a nonorthologous gene displacement will be identifiable as structurally related to a known gene encoding the referenced function, less structurally related but functionally similar genes and their corresponding gene products nevertheless will still fall within the meaning of the term as it is used herein. Functional similarity requires, for example, at least some structural similarity in the active site or binding region of a nonorthologous gene product compared to a gene encoding the function sought to be substituted. Therefore, a nonorthologous gene includes, for example, a paralog or an unrelated gene.

[0037] Therefore, in identifying and constructing the non-naturally occurring microbial organisms of the disclosure having 4-HB, GBL, 4-HBal, 4-HBCoA, BDO and/or putrescine biosynthetic capability, those skilled in the art will understand with applying the teaching and guidance provided herein to a particular species that the identification of metabolic modifications can include identification and inclusion or inactivation of orthologs. To the extent that paralogs and/or nonorthologous gene displacements are present in the referenced microorganism that encode an enzyme catalyzing a similar or substantially similar metabolic reaction, those skilled in the art also can utilize these evolutionally related genes. Similarly for a gene disruption, evolutionally related genes can also be disrupted or deleted in a host microbial organism to reduce or eliminate functional redundancy of enzymatic activities targeted for disruption.

[0038] Orthologs, paralogs and nonorthologous gene displacements can be determined by methods well known to those skilled in the art. For example, inspection of nucleic acid or amino acid sequences for two polypeptides will reveal sequence identity and similarities between the compared sequences. Based on such similarities, one skilled in the art can determine if the similarity is sufficiently high to indicate the proteins are related through evolution from a common ancestor. Algorithms well known to those skilled in the art, such as Align, BLAST, Clustal W and others compare and determine a raw sequence similarity or identity, and also determine the presence or significance of gaps in the sequence which can be assigned a weight or score. Such algorithms also are known in the art and are similarly applicable for determining nucleotide sequence similarity or identity. Parameters for sufficient similarity to determine relatedness are computed based on well known methods for calculating statistical similarity, or the chance of finding a similar match in a random polypeptide, and the significance of the match determined. A computer comparison of two or more sequences can, if desired, also be optimized visually by those skilled in the art. Related gene products or proteins can be expected to have a high similarity, for example, 25% to 100% sequence identity. Proteins that are unrelated can have an identity which is essentially the same as would be expected to occur by chance, if a database of sufficient size is scanned (about 5%). Sequences between 5% and 24% may or may not represent sufficient homology to conclude that the compared sequences are related. Additional statistical analysis to determine the significance of such matches given the size of the data set can be carried out to determine the relevance of these sequences.

[0039] Exemplary parameters for determining relatedness of two or more sequences using the BLAST algorithm, for example, can be as set forth below. Briefly, amino acid sequence alignments can be performed using BLASTP version 2.0.8 (Jan-05-1999) and the following parameters: Matrix: 0 BLOSUM62; gap open: 11; gap extension: 1; x_dropoff: 50; expect: 10.0; wordsize: 3; filter: on. Nucleic acid sequence alignments can be performed using BLASTN version 2.0.6 (Sept-16-1998) and the following parameters: Match: 1; mismatch: -2; gap open: 5; gap extension: 2; x_dropoff: 50; expect: 10.0; wordsize: 11; filter: off. Those skilled in the art will know what modifications can be made to the above parameters to either increase or decrease the stringency of the comparison, for example, and determine the relatedness of two or more sequences.

[0040] "Conservative amino acid substitution" or, simply, "conservative variations" of a particular sequence refers to the replacement of one amino acid, or series of amino acids, with essentially identical amino acid sequences. One of skill will recognize that individual substitutions, deletions or additions that alter, add or delete a single amino acid or a percentage of amino acids in an encoded sequence result in "conservative variations" where the alterations result in the deletion of an amino acid, addition of an amino acid, or substitution of an amino acid with a functionally similar amino acid. One of skill in the art will also recognize that an individual substitution, deletion or addition disclosed herein that refers to a specific variant, e.g. substitution of a Glycine a residue 34 with a Histidine (G34H), can include a conservative substitution made at the same residue as disclosed herein, e.g. instead of a Histindine being substituted at residue 34, an Arginine (R) or a Lysine (K) can be substituted.

[0041] Conservative substitution tables providing functionally similar amino acids are well known in the art. Conservative amino acid substitutions includes replacement of one amino acid with another having the same type of functional group or side chain polarity, size, shape or charge (e.g., aliphatic, aromatic, positively charged, negatively charged, polar, non-polar, positive polar, negative polar, uncharged polar, non-polar hydrophobic, ionizable acidic, ionizable basic, or sulfur containing residues).

[0042] As a non-limiting example, the following six groups each contain amino acids that can be conservative substitutions for one another:
  1. 1) Alanine (A), Serine (S), Threonine (T);
  2. 2) Aspartic acid (D), Glutamic acid (E);
  3. 3) Asparagine (N), Glutamine (Q);
  4. 4) Arginine (R), Lysine (K); Histidine (H);
  5. 5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); and
  6. 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W).


[0043] Thus, conservative amino acid substitutions of a polypeptide sequence disclosed herein can include substitutions of a percentage, such as less than 1%, 5% or 10%, of the amino acids of the polypeptide sequence, with a conservatively selected amino acid of the same conservative substitution group. Additionally, a conservatively substituted variation of a polypeptide sequence disclosed herein can contain no more than 1, 2, 3, 4, 5, 10, 20, 30, 50, or 100 substitutions with a conservatively substituted variation of the same conservative substitution group.

[0044] It is also understood that the addition or substitution of nucleic acid sequences which do not alter the encoded polypeptide activity of a nucleic acid molecule, such as the addition of a non-functional or non-coding sequence, is a conservative variation of the nucleic acid sequence. One of skill in the art will appreciate that many conservative variations of the nucleic acid molecules disclosed yield a functionally identical polypeptide. For example, owing to the degeneracy of the genetic code, silent substitutions (i.e., substitutions in a nucleic acid sequence which do not result in an alteration in an encoded polypeptide) are an implied feature of every nucleic acid sequence which encodes an amino acid. Similarly, conservative amino acid substitutions, in one or more amino acids in an amino acid sequence can be substituted with different amino acids with highly similar properties, are also readily identified as being highly similar to a disclosed construct. Such conservative variations of each disclosed sequence are a feature of the polypeptides disclosed herein.

[0045] Non-conservative modifications of a particular polypeptide are those which substitute any amino acid not characterized as a conservative substitution. For example, any substitution which crosses the bounds of the six groups set forth above. These include substitutions of basic or acidic amino acids for neutral amino acids (e.g., Aspartic acid (D), Glutamic acid (E), Asparagine (N), or Glutamine (Q) for Valine (V), Isoleucine (I), Leucine (L) or Methionine (M)), aromatic amino acid for basic or acidic amino acids (e.g., Phenylalanine (F), Tyrosine (Y) or Tryptophan (W) for Aspartic acid (D), Asparagine (N), Glutamic acid (E) or Glutamine (Q)), or any other substitution not replacing an amino acid with a like amino acid.

[0046] Disclosed herein are non-naturally occurring microbial biocatalyst or microbial organisms including a microbial organism having a 4-hydroxybutanoic acid (4-HB) biosynthetic pathway that includes at least one exogenous nucleic acid encoding 4-hydroxybutanoate dehydrogenase, CoA-independent succinic semialdehyde dehydrogenase, succinyl-CoA synthetase, CoA-dependent succinic semialdehyde dehydrogenase, glutamate:succinic semialdehyde transaminase, alpha-ketoglutarate decarboxylase, or glutamate decarboxylase, wherein the exogenous nucleic acid is expressed in sufficient amounts to produce monomeric 4-hydroxybutanoic acid (4-HB). 4-hydroxybutanoate dehydrogenase is also referred to as 4-hydroxybutyrate dehydrogenase or 4-HB dehydrogenase. Succinyl-CoA synthetase is also referred to as succinyl-CoA synthase or succinyl-CoA ligase.

[0047] Also disclosed herein is a non-naturally occurring microbial biocatalyst or microbial organism including a microbial organism having a 4-hydroxybutanoic acid (4-HB) biosynthetic pathway having at least one exogenous nucleic acid encoding 4-hydroxybutanoate dehydrogenase, succinyl-CoA synthetase, CoA-dependent succinic semialdehyde dehydrogenase, or α-ketoglutarate decarboxylase, wherein the exogenous nucleic acid is expressed in sufficient amounts to produce monomeric 4-hydroxybutanoic acid (4-HB).

[0048] The non-naturally occurring microbial biocatalysts or microbial organisms can include microbial organisms that employ combinations of metabolic reactions for biosynthetically producing the compounds of the disclosure. The biosynthesized compounds can be produced intracellularly and/or secreted into the culture medium. Exemplary compounds produced by the non-naturally occurring microorganisms include, for example, 4-hydroxybutanoic acid, 1,4-butanediol and γ-butyrolactone.

[0049] In one aspect, a non-naturally occurring microbial organism is engineered to produce 4-HB. This compound is one useful entry point into the 1,4-butanediol family of compounds. The biochemical reactions for formation of 4-HB from succinate, from succinate through succinyl-CoA or from α-ketoglutarate are shown in steps 1-8 of Figure 1.

[0050] It is understood that any combination of appropriate enzymes of a BDO, 4-HB, 4-HBal, 4-HBCoA and/or putrescine pathway can be used so long as conversion from a starting component to the BDO, 4-HBal, 4-HBCoA and/or putrescine product is achieved. Thus, it is understood that any of the metabolic pathways disclosed herein can be utilized and that it is well understood to those skilled in the art how to select appropriate enzymes to achieve a desired pathway, as disclosed herein.

[0051] In another aspect, disclosed herein is a non-naturally occurring microbial organism, comprising a microbial organism having a 1,4-butanediol (BDO) pathway comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO, the BDO pathway comprising 4-aminobutyrate CoA transferase, 4-aminobutyryl-CoA hydrolase, 4-aminobutyrate-CoA ligase, 4-aminobutyryl-CoA oxidoreductase (deaminating), 4-aminobutyryl-CoA transaminase, or 4-hydroxybutyryl-CoA dehydrogenase (see Example VII Table 17). The BDO pathway further can comprise 4-hydroxybutyryl-CoA reductase (alcohol forming), 4-hydroxybutyryl-CoA reductase, or 1,4-butanediol dehydrogenase.

[0052] It is understood by those skilled in the art that various combinations of the pathways can be utilized, as disclosed herein. For example, in a non-naturally occurring microbial organism, the nucleic acids can encode 4-aminobutyrate CoA transferase, 4-aminobutyryl-CoA hydrolase, or 4-aminobutyrate-CoA ligase; 4-aminobutyryl-CoA oxidoreductase (deaminating) or 4-aminobutyryl-CoA transaminase; and 4-hydroxybutyryl-CoA dehydrogenase. Other exemplary combinations are specifically describe below and further can be found in Figures 8-13. For example, the BDO pathway can further comprise 4-hydroxybutyryl-CoA reductase (alcohol forming), 4-hydroxybutyryl-CoA reductase, or 1,4-butanediol dehydrogenase.

[0053] Additionally disclosed herein is a non-naturally occurring microbial organism, comprising a microbial organism having a BDO pathway comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO, the BDO pathway comprising 4-aminobutyrate CoA transferase, 4-aminobutyryl-CoA hydrolase, 4-aminobutyrate-CoA ligase, 4-aminobutyryl-CoA reductase (alcohol forming), 4-aminobutyryl-CoA reductase, 4-aminobutan-1-ol dehydrogenase, 4-aminobutan-1-ol oxidoreductase (deaminating) or 4-aminobutan-1-ol transaminase (see Example VII and Table 18), and can further comprise 1,4-butanediol dehydrogenase. For example, the exogenous nucleic acids can encode 4-aminobutyrate CoA transferase, 4-aminobutyryl-CoA hydrolase, or 4-aminobutyrate-CoA ligase; 4-aminobutyryl-CoA reductase (alcohol forming); and 4-aminobutan-1-ol oxidoreductase (deaminating) or 4-aminobutan-1-ol transaminase. In addition, the nucleic acids can encode. 4-aminobutyrate CoA transferase, 4-aminobutyryl-CoA hydrolase, or 4-aminobutyrate-CoA ligase; 4-aminobutyryl-CoA reductase; 4-aminobutan-1-ol dehydrogenase; and 4-aminobutan-1-ol oxidoreductase (deaminating) or 4-aminobutan-1-ol transaminase.

[0054] Also disclosed herein is a non-naturally occurring microbial organism, comprising a microbial organism having a BDO pathway comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO, the BDO pathway comprising 4-aminobutyrate kinase, 4-aminobutyraldehyde dehydrogenase (phosphorylating), 4-aminobutan-1-ol dehydrogenase, 4-aminobutan-1-ol oxidoreductase (deaminating), 4-aminobutan-1-ol transaminase, [(4-aminobutanolyl)oxy]phosphonic acid oxidoreductase (deaminating), [(4-aminobutanolyl)oxy]phosphonic acid transaminase, 4-hydroxybutyryl-phosphate dehydrogenase, or 4-hydroxybutyraldehyde dehydrogenase (phosphorylating) (see Example VII and Table 19). For example, the exogenous nucleic acids can encode 4-aminobutyrate kinase; 4-aminobutyraldehyde dehydrogenase (phosphorylating); 4-aminobutan-1-ol dehydrogenase; and 4-aminobutan-1-ol oxidoreductase (deaminating) or 4-aminobutan-1-ol transaminase. Alternatively, the exogenous nucleic acids can encode 4-aminobutyrate kinase; [(4-aminobutanolyl)oxy]phosphonic acid oxidoreductase (deaminating) or [(4-aminobutanolyl)oxy]phosphonic acid transaminase; 4-hydroxybutyryl-phosphate dehydrogenase; and 4-hydroxybutyraldehyde dehydrogenase (phosphorylating).

[0055] Additionally disclosed herein is a non-naturally occurring microbial organism, comprising a microbial organism having a BDO pathway comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO, the BDO pathway comprising alpha-ketoglutarate 5-kinase, 2,5-dioxopentanoic semialdehyde dehydrogenase (phosphorylating), 2,5-dioxopentanoic acid reductase, alpha-ketoglutarate CoA transferase, alpha-ketoglutaryl-CoA hydrolase, alpha-ketoglutaryl-CoA ligase, alpha-ketoglutaryl-CoA reductase, 5-hydroxy-2-oxopentanoic acid dehydrogenase, alpha-ketoglutaryl-CoA reductase (alcohol forming), 5-hydroxy-2-oxopentanoic acid decarboxylase, or 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation) (see Example VIII and Table 20). The BDO pathway can further comprise 4-hydroxybutyryl-CoA reductase (alcohol forming), 4-hydroxybutyryl-CoA reductase, or 1,4-butanediol dehydrogenase. For example, the exogenous nucleic acids can encode alpha-ketoglutarate 5-kinase; 2,5-dioxopentanoic semialdehyde dehydrogenase (phosphorylating); 2,5-dioxopentanoic acid reductase; and 5-hydroxy-2-oxopentanoic acid decarboxylase. Alternatively, the exogenous nucleic acids can encode alpha-ketoglutarate 5-kinase; 2,5-dioxopentanoic semialdehyde dehydrogenase (phosphorylating); 2,5-dioxopentanoic acid reductase; and 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation). Alternatively, the exogenous nucleic acids can encode alpha-ketoglutarate CoA transferase, alpha-ketoglutaryl-CoA hydrolase, or alpha-ketoglutaryl-CoA ligase; alpha-ketoglutaryl-CoA reductase, 5-hydroxy-2-oxopentanoic acid dehydrogenase; and 5-hydroxy-2-oxopentanoic acid decarboxylase. In another aspect, the exogenous nucleic acids can encode alpha-ketoglutarate CoA transferase, alpha-ketoglutaryl-CoA hydrolase, or alpha-ketoglutaryl-CoA ligase; alpha-ketoglutaryl-CoA reductase, 5-hydroxy-2-oxopentanoic acid dehydrogenase, and 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation). Alternatively, the exogenous nucleic acids can encode alpha-ketoglutarate CoA transferase, alpha-ketoglutaryl-CoA hydrolase, or alpha-ketoglutaryl-CoA ligase; alpha-ketoglutaryl-CoA reductase (alcohol forming); and 5-hydroxy-2-oxopentanoic acid decarboxylase. In yet another aspect, the exogenous nucleic acids can encode alpha-ketoglutarate CoA transferase, alpha-ketoglutaryl-CoA hydrolase, or alpha-ketoglutaryl-CoA ligase; alpha-ketoglutaryl-CoA reductase (alcohol forming); and 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation).

[0056] Further disclosed herein is a non-naturally occurring microbial organism, comprising a microbial organism having a BDO pathway comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO, the BDO pathway comprising glutamate CoA transferase, glutamyl-CoA hydrolase, glutamyl-CoA ligase, glutamate 5-kinase, glutamate-5-semialdehyde dehydrogenase (phosphorylating), glutamyl-CoA reductase, glutamate-5-semialdehyde reductase, glutamyl-CoA reductase (alcohol forming), 2-amino-5-hydroxypentanoic acid oxidoreductase (deaminating), 2-amino-5-hydroxypentanoic acid transaminase, 5-hydroxy-2-oxopentanoic acid decarboxylase, 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation) (see Example IX and Table 21). For example, the exogenous nucleic acids can encode glutamate CoA transferase, glutamyl-CoA hydrolase, or glutamyl-CoA ligase; glutamyl-CoA reductase; glutamate-5-semialdehyde reductase; 2-amino-5-hydroxypentanoic acid oxidoreductase (deaminating) or 2-amino-5-hydroxypentanoic acid transaminase; and 5-hydroxy-2-oxopentanoic acid decarboxylase or 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation). Alternatively, the exogenous nucleic acids can encode glutamate 5-kinase; glutamate-5-semialdehyde dehydrogenase (phosphorylating); glutamate-5-semialdehyde reductase; 2-amino-5-hydroxypentanoic acid oxidoreductase (deaminating) or 2-amino-5-hydroxypentanoic acid transaminase; and 5-hydroxy-2-oxopentanoic acid decarboxylase or 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation). In still another aspect, the exogenous nucleic acids can encode glutamate CoA transferase, glutamyl-CoA hydrolase, or glutamyl-CoA ligase; glutamyl-CoA reductase (alcohol forming); 2-amino-5-hydroxypentanoic acid oxidoreductase (deaminating) or 2-amino-5-hydroxypentanoic acid transaminase; and 5-hydroxy-2-oxopentanoic acid decarboxylase or 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation). In yet another aspect, the exogenous nucleic acids can encode glutamate 5-kinase; glutamate-5-semialdehyde dehydrogenase (phosphorylating); 2-amino-5-hydroxypentanoic acid oxidoreductase (deaminating) or 2-amino-5-hydroxypentanoic acid transaminase; and 5-hydroxy-2-oxopentanoic acid decarboxylase or 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation).

[0057] Also disclosed herein is a non-naturally occurring microbial organism, comprising a microbial organism having a BDO pathway comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO, the BDO pathway comprising 3-hydroxybutyryl-CoA dehydrogenase, 3-hydroxybutyryl-CoA dehydratase, vinylacetyl-CoA Δ-isomerase, or 4-hydroxybutyryl-CoA dehydratase (see Example X and Table 22). For example, the exogenous nucleic acids can encode 3-hydroxybutyryl-CoA dehydrogenase; 3-hydroxybutyryl-CoA dehydratase; vinylacetyl-CoA Δ-isomerase; and 4-hydroxybutyryl-CoA dehydratase.

[0058] Further disclosed herein is a non-naturally occurring microbial organism, comprising a microbial organism having a BDO pathway comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO, the BDO pathway comprising homoserine deaminase, homoserine CoA transferase, homoserine-CoA hydrolase, homoserine-CoA ligase, homoserine-CoA deaminase, 4-hydroxybut-2-enoyl-CoA transferase, 4-hydroxybut-2-enoyl-CoA hydrolase, 4-hydroxybut-2-enoyl-CoA ligase, 4-hydroxybut-2-enoate reductase, 4-hydroxybutyryl-CoA transferase, 4-hydroxybutyryl-CoA hydrolase, 4-hydroxybutyryl-CoA ligase, or 4-hydroxybut-2-enoyl-CoA reductase (see Example XI and Table 23). For example, the exogenous nucleic acids can encode homoserine deaminase; 4-hydroxybut-2-enoyl-CoA transferase, 4-hydroxybut-2-enoyl-CoA hydrolase, 4-hydroxybut-2-enoyl-CoA ligase; 4-hydroxybut-2-enoyl-CoA reductase. Alternatively, the exogenous nucleic acids can encode homoserine CoA transferase, homoserine-CoA hydrolase, or homoserine-CoA ligase; homoserine-CoA deaminase; and 4-hydroxybut-2-enoyl-CoA reductase. In a further aspect, the exogenous nucleic acids can encode homoserine deaminase; 4-hydroxybut-2-enoate reductase; and 4-hydroxybutyryl-CoA transferase, 4-hydroxybutyryl-CoA hydrolase, or 4-hydroxybutyryl-CoA ligase. Alternatively, the exogenous nucleic acids can encode homoserine CoA transferase, homoserine-CoA hydrolase, or homoserine-CoA ligase; homoserine-CoA deaminase; and 4-hydroxybut-2-enoyl-CoA reductase.

[0059] Further disclosed herein is a non-naturally occurring microbial organism, comprising a microbial organism having a BDO pathway comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BOD, the BDO pathway comprising succinyl-CoA reductase (alcohol forming), 4-hydroxybutyryl-CoA hydrolase, 4-hydroxybutyryl-CoA ligase, 4-hydroxybutanal dehydrogenase (phosphorylating) (see Table 15). Such a BDO pathway can further comprise succinyl-CoA reductase, 4-hydroxybutyrate dehydrogenase, 4-hydroxybutyryl-CoA transferase, 4-hydroxybutyrate kinase, phosphotrans-4-hydroxybutyrylase, 4-hydroxybutyryl-CoA reductase, 4-hydroxybutyryl-CoA reductase (alcohol forming), or 1,4-butanediol dehydrogenase.

[0060] Additionally disclosed herein is a non-naturally occurring microbial organism, comprising a microbial organism having a BDO pathway comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO, the BDO pathway comprising glutamate dehydrogenase, 4-aminobutyrate oxidoreductase (deaminating), 4-aminobutyrate transaminase, glutamate decarboxylase, 4-hydroxybutyryl-CoA hydrolase, 4-hydroxybutyryl-CoA ligase, 4-hydroxybutanal dehydrogenase (phosphorylating)(see Table 16). Such a BDO pathway can further comprise alpha-ketoglutarate decarboxylase, 4-hydroxybutyrate dehydrogenase, 4-hydroxybutyryl-CoA transferase, 4-hydroxybutyrate kinase, phosphotrans-4-hydroxybutyrylase, 4-hydroxybutyryl-CoA reductase, 4-hydroxybutyryl-CoA reductase (alcohol forming), or 1,4-butanediol dehydrogenase.

[0061] The pathways described above are merely exemplary. One skilled in the art can readily select appropriate pathways from those disclosed herein to obtain a suitable BDO pathway or other metabolic pathway, as desired.

[0062] The disclosure provides genetically modified organisms that allow improved production of a desired product such as BDO by increasing the product or decreasing undesirable byproducts. As disclosed herein, the disclosure provides a non-naturally occurring microbial organism, comprising a microbial organism having a 1,4-butanediol (BDO) pathway comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO. In one aspect, the microbial organism is genetically modified to express exogenous succinyl-CoA synthetase (see Example XII). For example, the succinyl-CoA synthetase can be encoded by an Escherichia coli sucCD genes.

[0063] In another aspect, the microbial organism is genetically modified to express exogenous alpha-ketoglutarate decarboxylase (see Example XIII). For example, the alpha-ketoglutarate decarboxylase can be encoded by the Mycobacterium bovis sucA gene. In still another aspect, the microbial organism is genetically modified to express exogenous succinate semialdehyde dehydrogenase and 4-hydroxybutyrate dehydrogenase and optionally 4-hydroxybutyryl-CoA/acetyl-CoA transferase (see Example XIII). For example, the succinate semialdehyde dehydrogenase (CoA-dependent), 4-hydroxybutyrate dehydrogenase and 4-hydroxybutyryl-CoA/acetyl-CoA transferase can be encoded by Porphyromonas gingivalis W83 genes. In an additional aspect, the microbial organism is genetically modified to express exogenous butyrate kinase and phosphotransbutyrylase (see Example XIII). For example, the butyrate kinase and phosphotransbutyrylase can be encoded by Clostridium acetobutilicum buk1 and ptb genes.

[0064] In yet another aspect, the microbial organism is genetically modified to express exogenous 4-hydroxybutyryl-CoA reductase (see Example XIII). For example, the 4-hydroxybutyryl-CoA reductase can be encoded by Clostridium beijerinckii ald gene. Additionally, in an aspect of the disclosure, the microbial organism is genetically modified to express exogenous 4-hydroxybutanal reductase (see Example XIII). For example, the 4-hydroxybutanal reductase can be encoded by Geobacillus thermoglucosidasius adh1 gene. In another aspect, the microbial organism is genetically modified to express exogenous pyruvate dehydrogenase subunits (see Example XIV). For example, the exogenous pyruvate dehydrogenase can be NADH insensitive. The pyruvate dehydrogenase subunit can be encoded by the Klebsiella pneumonia lpdA gene. In a particular aspect, the pyruvate dehydrogenase subunit genes of the microbial organism can be under the control of a pyruvate formate lyase promoter.

[0065] In still another aspect, the microbial organism is genetically modified to disrupt a gene encoding an aerobic respiratory control regulatory system (see Example XV). For example, the disruption can be of the arcA gene. Such an organism can further comprise disruption of a gene encoding malate dehydrogenase. In a further aspect, the microbial organism is genetically modified to express an exogenous NADH insensitive citrate synthase(see Example XV). For example, the NADH insensitive citrate synthase can be encoded by gltA, such as an R163L mutant of gltA. In still another aspect, the microbial organism is genetically modified to express exogenous phosphoenolpyruvate carboxykinase (see Example XVI). For example, the phosphoenolpyruvate carboxykinase can be encoded by an Haemophilus influenza phosphoenolpyruvate carboxykinase gene.

[0066] In an additional aspect, the disclosure provides a non-naturally occurring microbial organism having a 4-hydroxybutyrate pathway and being capable of producing 4-hydroxybutyrate, wherein the microbial organism comprises a genetic modification that increases expression of phosphoenolpyruvate carboxylase (see Example XXXI). In such an aspect in which phosphoenolpyruvate expression is increased, the microbial organism can exhibit decreased production of ethanol, acetate, pyruvate or alanine, or a combination thereof, relative to a parent microbial organism in the absence of the genetic modification. As disclosed herein, the overexpression of posphoenolpyruvate (PEP) carboxylase leads to conversion of more phosphoenolpyruvate into oxaloacetate, thereby reducing flux from PEP into pyruvate and subsequently into acetyl-CoA (Example XXXI). Reducing flux from PEP to pyruvate and acetyl-CoA increases flux into the TCA cycle and consequently a 4HB or BDO pathway.

[0067] In yet another aspect, the disclosure provides a non-naturally occurring microbial organism having a 4-hydroxybutyrate pathway and being capable of producing 4-hydroxybutyrate, wherein the microbial organism comprises a genetic modification that increases expression of alpha-ketoglutarate dehydrogenase (see Example XXXII). The increased expression of alpha-ketoglutarate dehydrogenase can result in decreased production of glutamate relative to a parent microbial organism in the absence of the genetic modification. Such a microbial organism can also exhibit decreased production of ethanol, acetate, pyruvate or alanine, or a combination thereof, relative to a parent microbial organism in the absence of the genetic modification. As disclosed herein, the formation of glutamate can lead to a carbon loss and reduction in yield. Therefore, increased expression of alpha-ketoglutarate dehydrogenase can reduce glutamate as well as other by-products such as ethanol, acetate, alanine and/or pyruvate.

[0068] In a further aspect, the disclosure provides a non-naturally occurring microbial organism having a 4-hydroxybutyrate pathway and being capable of producing 4-hydroxybutyrate, wherein the microbial organism comprises a genetic modification that increases expression of a non-phosphotransferase (PTS) glucose uptake system (see Example XXXIII). In such an aspect, the genetic modification can comprise increased expression of a permease, glucokinase, or a glucose facilitator, or a combination thereof. In addition, such a microbial organism can exhibit decreased production of ethanol, acetate, pyruvate, or alanine, or a combination thereof, relative to a parent microbial organism in the absence of the genetic modification. The introduction of a non-PTS sucrose uptake system has been previously described in U.S. publication 2011/0045575 as a way to reduce pyruvate formation in a microbial organism utilizing sucrose as a carbon source. In contrast, the utilization of a non-PTS glucose uptake system, as described herein, is to provide a better balance between the available oxaloacetate in comparison to acetyl-CoA (see Example XXXIII).

[0069] In another aspect, the disclosure provides a non-naturally occurring microbial organism having a 4-hydroxybutyrate pathway and being capable of producing 4-hydroxybutyrate, wherein the microbial organism comprises a genetic modification that increases expression of a gamma-butyrolactone esterase (Example XXXIV). Such a microbial organism can exhibit decreased production of gamma-butyrolactone relative to a parent microbial organism in the absence of the genetic modification. As disclosed herein, gamma-butyrolactone is a byproduct formed during the fermentation of sugars to 1,4-butanediol. Gamma-butyrolactone can form from the unstable pathway intermediate 4-hydroxybutyryl-CoA as well as spontaneous lactonization of 4-hydroxybutyrate. As disclosed herein, the expression of a gamma-butyrolactone can accelerate the hydrolysis of gamma-butyrolactone to BDO, thereby improving BDO product yield and eliminating a byproduct (see Example XXXIV).

[0070] In additional aspects disclosed herein, a genetic modification can include gene disruptions or deletions to decrease expression of an enzyme. For example, in a further aspect, the disclosure provides a non-naturally occurring microbial organism having a 4-hydroxybutyrate pathway and being capable of producing 4-hydroxybutyrate, wherein the microbial organism comprises a genetic modification that decreases expression of succinyl-CoA synthetase (Example XXXV). In such an aspect, the microbial organism can exhibit increased production of 4-hydroxybutyrate relative to a parent microbial organism in the absence of the genetic modification. As described herein, repeated rounds of flux through the TCA cycle results in carbon loss as CO2. The deletion of succinyl-CoA synthetase blocks the TCA cycle downstream of succinyl-CoA, thereby reducing CO2 loss (see Example XXXV).

[0071] In a further aspect, the disclosure provides a non-naturally occurring microbial organism having a 4-hydroxybutyrate pathway and being capable of producing 4-hydroxybutyrate, wherein the microbial organism comprises a genetic modification that decreases expression of an acyl coenzyme A thioesterase (see Example XXXVI). In such an aspect the microbial organism can exhibit decreased production of gamma-butyrolactone relative to a parent microbial organism in the absence of the genetic modification. In yet a further aspect, such a microbial organism can comprise at least two genetic modifications that decrease expression of at least two acyl coenzyme A thioesterases. As disclosed herein, the BDO pathway intermediate 4-hydroxybutyryl-CoA spontaneously and enzymatically cyclizes to form gamma-butyrolactone (GBL). By deleting acyl coenzyme-A thioesterases, the formation of the byproduct GBL was reduced (see Example XXXVI).

[0072] In another aspect, the disclosure provides a non-naturally occurring microbial organism having a 4-hydroxybutyrate pathway and being capable of producing 4-hydroxybutyrate, wherein the microbial organism comprises a genetic modification that decreases expression of an alcohol dehydrogenase (see Example XXXVII). In such an aspect, the microbial organism can exhibit decreased backflux from a downstream product of the 4-hydroxybutyrate pathway relative to a parent microbial organism in the absence of said genetic modification. At high titers of BDO, a downstream product from 4-hydroxybutyrate, the high concentrations of product can result in backflux within the pathway or through side reactions, thereby resulting in a decreased product yield and/or an increase in toxic byproduct formation such as aldehydes. As described herein, several endogenous alcohol dehydrogenases were found to contribute to backflux, whereas deletion of one or more of the endogenous alcohol dehydrogenases decreased backflux without reducing production of 4-hydroxybutyrate or BDO, and in fact increased BDO formation (see Example XXXVII).

[0073] In still another aspect, the disclosure provides a non-naturally occurring microbial organism having a 4-hydroxybutyrate pathway and being capable of producing 4-hydroxybutyrate, wherein the microbial organism comprises a genetic modification that decreases expression of a non-energy-producing NADH dehydrogenase (see Example XXXVIII). The decreased expression of a non-energy-producging NADH dehydrogenase suppresses depletion of the NADH pool resulting from the activity of the non-energy-producing NADH dehydrogenase. Additionally, the microbial organisms exhibit increased energy efficiency in the microbial organism relative to a parent microbial organism in the absence of the genetic modification. As described herein, the electron transport chain has multiple NADH dehydrogenases and cytochrome oxidases with varying ability to translocate protons. Some NADH dehydrogenases consume NADH without linking the consumption to proton translocation and energy production, and such NADH dehydrogenases are considered to be non-energy-producing NADH dehydrogenases. One exemplary non-energy-producing NADH dehydrogenase is NADH II of E. coli (see Example XXXVIII). Additional genes encoding enzymes with non-energy producing NAD(P)H dehydrogenase activities include wrbA, yieF, and kefF. One skilled in the art will readily understand the meaning of a non-energy-producing NADH dehydrogenase as one that does not couple NADH oxidation to electron transport and proton translocation and the formation of ATP. By decreasing expression of a non-energy-producing NADH dehydrogenase, the depletion of the NADH pool within the cell is suppressed, thereby making the cell more energy efficient and/or allowing NADH to be utilized in desired synthetic pathways.

[0074] In a further aspect, the disclosure provides a non-naturally occurring microbial organism having a 4-hydroxybutyrate pathway and being capable of producing 4-hydroxybutyrate, wherein the microbial organism comprises a genetic modification that decreases expression of a cytochrome oxidase (see Example XXXIX). In such an aspect, the microbial organism can exhibit increased energy efficiency relative to a parent microbial organism in the absence of the genetic modification. As disclosed herein, cytochrome oxidases involved in the electron transport chain have different energy-conserving efficiencies. By decreasing expression of one or more cytochrome oxidases, the energy efficiency of the cell can be increased (see Example XXXIX). Even in a case where an increase in product yield is not observed under certain conditions (see Example XXXIX), such genetic modifications can be advantageous in providing a greater tolerance for a range of oxygen concentrations, in particular producing a product more efficiently in a large fermentor, where the available oxygen varies within the ferementor. By improving the energy efficiency of the microbial organism, the organism can tolerate lower oxygen conditions since need for energy production from the electron transport chain is reduced. Thus, in a particular aspect of the disclosure, the microbial organism can exhibt an increased tolerance to a range of oxygen concentrations relative to a parent microbial organism in the absence of said genetic modification.

[0075] The disclosure thus provides a non-naturally occurring microbial organism having a 4-hydroxybutyrate pathway and being capable of producing 4-hydroxybutyrate, wherein the microbial organism comprises a genetic modification, the genetic modification selected from: (A) a genetic modification that increases expression of phosphoenolpyruvate carboxylase; (B) a genetic modification that increases expression of alpha-ketoglutarate dehydrogenase; (C) a genetic modification that increases expression of a non-phosphotransferase (PTS) glucose uptake system; (D) a genetic modification that increases expression of a gamma-butyrolactone esterase; (E) a genetic modification that decreases expression of succinyl-CoA synthetase; (F) a genetic modification that decreases expression of an acyl coenzyme A thioesterase; (G) a genetic modification that decreases expression of an alcohol dehydrogenase; (H) a genetic modification that decreases expression of a non-energy-producing NADH dehydrogenase; (I) a genetic modification that decreases expression of a cytochrome oxidase; and (J) a combination of two or more, for example, three or more, four or more, five or more, six or more, seven or more, eight or more, or all nine of the genetic modifications of parts (A)-(I). In further particular aspects, (K) the microbial organism of part (A), (B), or (C) has decreased production of ethanol, acetate, pyruvate or alanine, or a combination thereof, relative to a parent microbial organism in the absence of said genetic modification; (L) the microbial organism of part (B) has decreased production of glutamate relative to a parent microbial organism in the absence of said genetic modification; (M) the microbial organism of part (C) has a genetic modification comprising increased expression of a permease, glucokinase, or a glucose facilitator, or a combination thereof; (N) the microbial organism of part (D) has decreased production of gamma-butyrolactone relative to a parent microbial organism in the absence of said genetic modification; (O) the microbial organism of part (E) has increased production of 4-hydroxybutyrate relative to a parent microbial organism in the absence of said genetic modification; (P) the microbial organism of part (F) has decreased production of gamma-butyrolactone relative to a parent microbial organism in the absence of said genetic modification; (Q) the microbial organism of part (F) has a genetic modification comprising at least two genetic modifications that decrease expression of at least two acyl coenzyme A thioesterases; (R) the microbial organism of part (G) has decreased backflux from a downstream product of the 4-hydroxybutyrate pathway relative to a parent microbial organism in the absence of said genetic modification; (S) the microbial organism of part (H) has suppressed depletion of the NADH pool or increased energy efficiency in the microbial organism, or a combination thereof, relative to a parent microbial organism in the absence of said genetic modification; (T) the microbial organism of part (I) has increased energy efficiency relative to a parent microbial organism in the absence of said genetic modification; or (U) the microbial organism of part (I) has increased tolerance to a range of oxygen concentrations relative to a parent microbial organism in the absence of said genetic modification. In a further aspect, the disclosure provides a microbial organism, where the microbial organism of parts (D) or (F) further comprises a 4-hydroxybutyryl-CoA pathway. The disclosure further provides a method for producing 4-hydroxybutyrate utilizing such microbial organisms. It is understood that such genetic modifications include, but are not limited to, the specifically described gene additions and disruptions described in Examples XXIV-XXXIX. It is understood that the genetic modifications described herein can be used alone or in combination with other genetic modifications, particularly those disclosed herein, as desired to provide desirable characteristics of a production strain. In the case of gene disruptions, it is understood that such disruptions involve disruption of an endogenous gene encoding an activity of a corresponding gene product to be decreased.

[0076] Although the pathways immediately above are directed to 4-HB pathways, it is understood, as disclosed herein, the 4-HB is a precursor to downstream products such as 1,4-butanediol (BDO). Further, as disclosed herein, a microbial organism having a 4-HB pathway can further include enzymes that convert 4-HB to a downstream product such as BDO, as desired. In addition, any of the pathways described herein that produce 4-HB are understood to provide a 4-HB pathway, even if additional steps in a pathway are also disclosed since such a pathway produces 4-HB. Thus, the disclosure provides microbial organisms comprising a 4-HB pathway or a BDO pathway, wherein the organism comprises one or more of the genetic modifications disclosed herein and produces 4-HB, 4-HB-CoA or BDO, as well as methods of producing 4-HB and/or BDO using such an organism. It is further understood that the genetic modifications can be used alone or in various combinations of one or more of the genetic modifications, as disclosed herein (see Examples). Additionally, it is understood that a genetic modification can result in a desired effect, including but not limited to increased product yield, decreased byproduct production, in particular toxic or growth suppressive byproducts, for example, aldehydes, improved strain culture growth or fermentation characteristics, improved ability to isolate or purify a desired product, and the like. Furthermore, it is understood that increased production of a downstream product, for example, BDO, can be indicative of increased production of an upstream product, for example, a pathway intermediate such as 4HB, where increased production of the downstream product indicates increased flux through an upstream product. One skilled in the art can readily understand these or other desirable characteristics of a microbial organism of the disclosure for producing a desired pathway product or intermediate. Thus, using methods disclosed herein and those well known in the art, one skilled in the art can incorporate various metabolic modifications, incorporate appropriate expression control elements and/or methods, and/or variant enzymes to provide a microbial organism having optimized production properties. It is further understood that such optimized production properties can be readily determined by those skilled in the art, including increasing or decreasing the expression level of a particular molecule, including metabolic modifications and/or enzymes or proteins of a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway.

[0077] As used herein, the term "parent microbial organism," when used in the context of a genetic modification, is understood to mean a parent organism or strain in which the particular genetic modification has not been made but otherwise has the same genetic makeup. For example, if a strain of microbial organism is used to make a genetic modification that increases expression of a gene product, the parent strain would be the starting strain into which the heterologous gene is introduced. Similarly, a parent microbial organism of an organism in which a genetic modification has been made to decrease expression, such as a gene disruption or gene deletion, the parent microbial organism would have the same genetic background except for the gene disruption or deletion. However, it is understood that a parent microbial organism can differ by more than one genetic modification, either gene addition and/or disruption, depending on whether a single or multiple genetic modifications are being considered. One skilled in the art will readily understand the meaning of such a parent microbial organism in that the microbial organism is considered to be an appropriate control, as understood in the art, for observing the effect of one or more genetic modifications.

[0078] In addition, it is understood by those skilled in the art that a genetic modification such as those disclosed herein can contribute to an increase in product yield, a decrease in byproduct formation, and/or improved characteristics of the microbial organism. Such improved characteristics include, but are not limited to, improved cell growth, increased energy efficiency, increased tolerance of a range of oxygen concentrations, particularly when manifested in a scaled up production process such as in large fermentors. A useful genetic modification may not alone, when compared to a parent microbial organism, exhibit an effect that can readily measured under a given set of conditions. However, a useful genetic modification can be advantageous if the modification on its on under a given set of conditions and/or in combination with one or more other genetic modifications is beneficial to the growth and/or production characteristics of the microbial organism.

[0079] It is understood that a genetic modification that increases expression of a desired enzyme is generally carried out by introducing into the microbial organism a heterologous nucleic acid encoding the desired enzyme. However, it is understood, as described herein, that a metabolic modification to increase expression can include modification of a regulatory region of an endogenous gene, such as a promoter and/or enhancer. Additionally, a genetic modification that decreases expression of a desired enzyme will generally involve a gene disruption or deletion, although modification of a regulatory to decrease expression can also be utilized, as disclosed herein.

[0080] It is further understood that any of a number of genetic modifications, as disclosed herein, can be used alone or in various combinations of one or more of the genetic modifications disclosed herein to increase the production of BDO in a BDO producing microbial organism. In a particular aspect, the microbial organism can be genetically modified to incorporate any and up to all of the genetic modifications that lead to increased production of BDO. In a particular aspect, the microbial organism containing a BDO pathway can be genetically modified to express exogenous succinyl-CoA synthetase; to express exogenous alpha-ketoglutarate decarboxylase; to express exogenous succinate semialdehyde dehydrogenase and 4-hydroxybutyrate dehydrogenase and optionally 4-hydroxybutyryl-CoA/acetyl-CoA transferase; to express exogenous butyrate kinase and phosphotransbutyrylase; to express exogenous 4-hydroxybutyryl-CoA reductase; and to express exogenous 4-hydroxybutanal reductase; to express exogenous pyruvate dehydrogenase; to disrupt a gene encoding an aerobic respiratory control regulatory system; to express an exogenous NADH insensitive citrate synthase; and to express exogenous phosphoenolpyruvate carboxykinase. Such strains for improved production are described in Examples XII-XIX. It is thus understood that, in addition to the modifications described above, such strains can additionally include other modifications disclosed herein. Such modifications include, but are not limited to, deletion of endogenous lactate dehydrogenase (ldhA), alcohol dehydrogenase (adhE), and/or pyruvate formate lyase (pflB)(see Examples XII-XIX and Table 28). Additional genetic modifications that can be introduced into a microbial organism include those described in Examples XXIV-XXXIX, alone or in combination, including in combination with other genetic modifications disclosed herein.

[0081] The disclosure additionally provides a microbial organism that, in addition to one or more of the metabolic modifications of (A)-(J) described above, optionally further comprises a metabolid modification selected from (i) a genetic modification that increases expression of pyruvate dehydrogenase; (ii) a genetic modification that decreases expression of an aerobic respiratory control regulatory system; (iii) a genetic modification that increases expression of an NADH insensitive citrate synthase; (iv) a genetic modification that decreases expression of malate dehydrogenase; (v) a genetic modification that decreases expression of lactate dehydrogenase; (vi) a genetic modification that decreases expression of alcohol dehydrogenase; (vii) a genetic modification that decreases expression of pyruvate formate lyase; and (viii) a combination of two or more, three or more, four or more, five or more, six or more, or all of the genetic modifications of parts (i)-(vii).

[0082] Exemplary combinations of metabolic modifications are described herein. As disclosed herein, any of a number of combinations of metabolic modifications can be included in a microbial organism of the disclosure. For the combinations listed immediately below in Tables 62 and 63 and in Figure 91, the following letter representations are used: (A) a genetic modification that increases expression of phosphoenolpyruvate carboxylase; (B) a genetic modification that increases expression of alpha-ketoglutarate dehydrogenase; (C) a genetic modification that increases expression of a non-phosphotransferase (PTS) glucose uptake system; (D) a genetic modification that increases expression of a gamma-butyrolactone esterase; (E) a genetic modification that decreases expression of succinyl-CoA synthetase; (F) a genetic modification that decreases expression of an acyl coenzyme A thioesterase; (G) a genetic modification that decreases expression of an alcohol dehydrogenase (H) a genetic modification that decreases expression of a non-energy-producing NADH dehydrogenase; (I) a genetic modification that decreases expression of a cytochrome oxidase; (J) a genetic modificatin that increases expression of pyruvate dehydrogenase; (K) a genetic modification that decreases expression of an aerobic respiratory control regulatory system; (L) a genetic modification that increases expression of an NADH insensitive citrate synthase; (M) a genetic modification that decreases expression of malate dehydrogenase; (N) a genetic modification that decreases expression of lactate dehydrogenase, (O) a genetic modification that decreases expression of alcohol dehydrogenase; and (P) a genetic modification that decreases expression of pyruvate formate lyase.

[0083] Exemplary combinations of metabolic modifications are designated, for example, as A-B, meaning that a microbial organisms comprises metabolic modifications A (a genetic modification that increases expression of phosphoenolpyruvate carboxylase) and B (a genetic modification that increases expression of alpha-ketoglutarate dehydrogenase). Exemplary combinations of metabolic modifications A-I are shown in Table 62.
Table 62. Exemplary combinations of metabolic modifications (in brackets).
[A-B-C-D-E-F-G-H-I],[A-B-C-D-E-F-G-H],[A-B-C-D-E-F-G-I],[A-B-C-D-E-F-H-I],[A-B-C-D-E-G-H-I],[A-B-C-D-F-G-H-I],[A-B-C-E-F-G-H-I],[A-B-D-E-F-G-H-I],[A-C-D-E-F-G-H-I],[B-C-D-E-F-G-H-I],[A-B-C-D-E-F-G],[A-B-C-D-E-F-H],[A-B-C-D-E-F-I],[A-B-C-D-E-G-H],[A-B-C-D-E-G-I],[A-B-C-D-E-H-I],[A-B-C-D-F-G-H],[A-B-C-D-F-G-I],[A-B-C-D-F-H-I],[A-B-C-D-G-H-I],[A-B-C-E-F-G-H],[A-B-C-E-F-G-I],[A-B-C-E-F-H-I],[A-B-C-E-G-H-I],[A-B-C-F-G-H-I],[A-B-D-E-F-G-H],[A-B-D-E-F-G-I],[A-B-D-E-F-H-I],[A-B-D-E-G-H-I],[A-B-D-F-G-H-I],[A-B-E-F-G-H-I],[A-C-D-E-F-G-H],[A-C-D-E-F-G-I],[A-C-D-E-F-H-I],[A-C-D-E-G-H-I],[A-C-D-F-G-H-I],[A-C-E-F-G-H-I],[A-D-E-F-G-H-I],[B-C-D-E-F-G-H],[B-C-D-E-F-G-I],[B-C-D-E-F-H-I],[B-C-D-E-G-H-I],[B-C-D-F-G-H-I],[B-C-E-F-G-H-I],[B-D-E-F-G-H-I],[C-D-E-F-G-H-I],[A-B-C-D-E-F],[A-B-C-D-E-G],[A-B-C-D-E-H],[A-B-C-D-E-I],[A-B-C-D-F-G],[A-B-C-D-F-H],[A-B-C-D-F-I],[A-B-C-D-G-H],[A-B-C-D-G-I],[A-B-C-D-H-I],[A-B-C-E-F-G],[A-B-C-E-F-H],[A-B-C-E-F-I],[A-B-C-E-G-H],[A-B-C-E-G-I],[A-B-C-E-H-I],[A-B-C-F-G-H],[A-B-C-F-G-I],[A-B-C-F-H-I],[A-B-C-G-H-I],[A-B-D-E-F-G],[A-B-D-E-F-H],[A-B-D-E-F-I],[A-B-D-E-G-H],[A-B-D-E-G-I],[A-B-D-E-H-I],[A-B-D-F-G-H],[A-B-D-F-G-I],[A-B-D-F-H-I],[A-B-D-G-H-I],[A-B-E-F -G-H],[A-B-E-F-G-I],[A-B-E-F-H-I],[A-B-E-G-H-I],[A-B-F-G-H-I],[A-C-D-E-F-G],[A-C-D-E-F-H],[A-C-D-E-F-I],[A-C-D-E-G-H],[A-C-D-E-G-I],[A-C-D-E-H-I],[A-C-D-F-G-H],[A-C-D-F-G-I],[A-C-D-F-H-I],[A-C-D-G-H-I],[A-C-E-F-G-H],[A-C-E-F-G-I],[A-C-E-F-H-I],[A-C-E-G-H-I],[A-C-F-G-H-I],[A-D-E-F-G-H],[A-D-E-F-G-I],[A-D-E-F-H-I],[A-D-E-G-H-I],[A-D-F-G-H-I],[A-E-F-G-H-I],[B-C-D-E-F-G],[B-C-D-E-F-H],[B-C-D-E-F-I],[B-C-D-E-G-H],[B-C-D-E-G-I],[B-C-D-E-H-I],[B-C-D-F-G-H],[B-C-D-F-G-I],[B-C-D-F-H-I],[B-C-D-G-H-I],[B-C-E-F-G-H],[B-C-E-F-G-I],[B-C-E-F-H-I],[B-C-E-G-H-I],[B-C-F-G-H-I],[B-D-E-F-G-H],[B-D-E-F-G-I],[B-D-E-F-H-I],[B-D-E-G-H-I],[B-D-F-G-H-I],[B-E-F-G-H-I],[C-D-E-F-G-H],[C-D-E-F-G-I],[C-D-E-F-H-I],[C-D-E-G-H-I],[C-D-F-G-H-I],[C-E-F-G-H-I],[D-E-F-G-H-I],[A-B-C-D-E],[A-B-C-D-F],[A-B-C-D-G],[A-B-C-D-H],
[A-B-C-D-I],[A-B-C-E-F],[A-B-C-E-G],[A-B-C-E-H],[A-B-C-E-I],[A-B-C-F-G],[A-B-C-F-H],[A-B-C-F-I],[A-B-C-G-H],[A-B-C-G-I],[A-B-C-H-I],[A-B-D-E-F],[A-B-D-E-G],[A-B-D-E-H],[A-B-D-E-I],[A-B-D-F-G],[A-B-D-F-H],[A-B-D-F-I],[A-B-D-G-H],[A-B-D-G-I],[A-B-D-H-I],[A-B-E-F-G],[A-B-E-F-H],[A-B-E-F-I],[A-B-E-G-H],[A-B-E-G-I],[A-B-E-H-I],[A-B-F-G-H],[A-B-F-G-I],[A-B-F-H-I],[A-B-G-H-I],[A-C-D-E-F],[A-C-D-E-G],[A-C-D-E-H],[A-C-D-E-I],[A-C-D-F-G],[A-C-D-F-H],[A-C-D-F-I],[A-C-D-G-H],[A-C-D-G-I],[A-C-D-H-I],[A-C-E-F-G],[A-C-E-F-H],[A-C-E-F-I],[A-C-E-G-H],[A-C-E-G-I],[A-C-E-H-I],[A-C-F-G-H],[A-C-F-G-I],[A-C-F-H-I],[A-C-G-H-I],[A-D-E-F-G],[A-D-E-F-H],[A-D-E-F-I],[A-D-E-G-H],[A-D-E-G-I],[A-D-E-H-I],[A-D-F-G-H],[A-D-F-G-I],[A-D-F-H-I],[A-D-G-H-I],[A-E-F-G-H],[A-E-F-G-I],[A-E-F-H-I],[A-E-G-H-I],[A-F-G-H-I],[B-C-D-E-F],[B-C-D-E-G],[B-C-D-E-H],[B-C-D-E-I],[B-C-D-F-G],[B-C-D-F-H],[B-C-D-F-I],[B-C-D-G-H],[B-C-D-G-I],[B-C-D-H-I],[B-C-E-F-G],[B-C-E-F-H],[B-C-E-F-I],[B-C-E-G-H],[B-C-E-G-I],[B-C-E-H-I],[B-C-F-G-H],[B-C-F-G-I],[B-C-F-H-I],[B-C-G-H-I],[B-D-E-F-G],[B-D-E-F-H],[B-D-E-F-I],[B-D-E-G-H],[B-D-E-G-I],[B-D-E-H-I],[B-D-F-G-H],[B-D-F-G-I],[B-D-F-H-I],[B-D-G-H-I],[B-E-F-G-H],[B-E-F-G-I],[B-E-F-H-I],[B-E-G-H-I],[B-F-G-H-I],[C-D-E-F-G],[C-D-E-F-H],[C-D-E-F-I],[C-D-E-G-H],[C-D-E-G-I],[C-D-E-H-I],[C-D-F-G-H],[C-D-F-G-I],[C-D-F-H-I],[C-D-G-H-I],[C-E-F-G-H],[C-E-F-G-I],[C-E-F-H-I],[C-E-G-H-I],[C-F-G-H-I],[D-E-F-G-H],[D-E-F-G-I],[D-E-F-H-I],[D-E-G-H-I],[D-F-G-H-I],[E-F-G-H-I],[A-B-C-D],[A-B-C-E],[A-B-C-F],[A-B-C-G],[A-B-C-H],[A-B-C-I],[A-B-D-E],[A-B-D-F],[A-B-D-G],[A-B-D-H],[A-B-D-I],[A-B-E-F],[A-B-E-G],[A-B-E-H],[A-B-E-I],[A-B-F-G],[A-B-F-H],[A-B-F-I],[A-B-G-H],[A-B-G-I],[A-B-H-I],[A-C-D-E],[A-C-D-F],[A-C-D-G],[A-C-D-H],[A-C-D-I],[A-C-E-F],[A-C-E-G],[A-C-E-H],[A-C-E-I],[A-C-F-G],[A-C-F-H],[A-C-F-I],[A-C-G-H],[A-C-G-I],[A-C-H-I],[A-D-E-F],[A-D-E-G],[A-D-E-H],[A-D-E-I],[A-D-F-G],[A-D-F-H],[A-D-F-I],[A-D-G-H],[A-D-G-I],[A-D-H-I],[A-E-F-G],[A-E-F-H],[A-E-F-I],[A-E-G-H],[A-E-G-I],[A-E-H-I],[A-F-G-H],[A-F-G-I],[A-F-H-I],[A-G-H-I],[B-C-D-E],[B-C-D-F],[B-C-D-G],[B-C-D-H],[B-C-D-I],[B-C-E-F],[B-C-E-G],[B-C-E-H],[B-C-E-I],[B-C-F-G],[B-C-F-H],[B-C-F-I],[B-C-G-H],[B-C-G-I],[B-C-H-I],[B-D-E-F],[B-D-E-G],[B-D-E-H],[B-D-E-I],[B-D-F-G],[B-D-F-H],[B-D-F-I],[B-D-G-H],[B-D-G-I],[B-D-H-I],[B-E-F-G],[B-E-F-H],[B-E-F-I],[B-E-G-H],[B-E-G-I],[B-E-H-I],[B-F-G-H],[B-F-G-I],[B-F-H-I],[B-G-H-I],[C-D-E-F],[C-D-E-G],[C-D-E-H],[C-D-E-I],[C-D-F-G],[C-D-F-H],[C-D-F-I],[C-D-G-H],[C-D-G-I],[C-D-H-I],[C-E-F-G],[C-E-F-H],[C-E-F-I],[C-E-G-H],[C-E-G-I],[C-E-H-I],[C-F-G-H],[C-F-G-I],[C-F-H-I],[C-G-H-I],[D-E-F-G],[D-E-F-H],[D-E-F-I],[D-E-G-H],[D-E-G-I],[D-E-H-I],[D-F-G-H],[D-F-G-I],[D-F-H-I],[D-G-H-I],[E-F-G-H],[E-F-G-I],[E-F-H-I],[E-G-H-I],[F-G-H-I],[A-B-C],[A-B-D],[A-B-E],[A-B-F],[A-B-G],[A-B-H],[A-B-I],[A-C-D],[A-C-E],[A-C-F],[A-C-G],[A-C-H],[A-C-I],[A-D-E],[A-D-F],[A-D-G],[A-D-H],[A-D-I],[A-E-F],[A-E-G],[A-E-H],[A-E-I],[A-F-G],[A-F-H],[A-F-I],[A-G-H],[A-G-I],[A-H-I],[B-C-D],[B-C-E],[B-C-F],[B-C-G],[B-C-H],[B-C-I],[B-D-E],[B-D-F],[B-D-G],[B-D-H],[B-D-I],[B-E-F],[B-E-G],[B-E-H],[B-E-I],[B-F-G],[B-F-H],[B-F-I],[B-G-H],[B-G-I],[B-H-I],[C-D-E],[C-D-F],[C-D-G],[C-D-H],[C-D-I],[C-E-F],[C-E-G],[C-E-H],[C-E-I],[C-F-G],[C-F-H],[C-F-I],[C-G-H],[C-G-I],[C-H-I],[D-E-F],[D-E-G],[D-E-H],[D-E-I],[D-F-G],[D-F-H],[D-F-I],[D-G-H],[D-G-I],[D-H-I],[E-F-G],[E-F-H],[E-F-I],[E-G-H],[E-G-I],[E-H-I],[F-G-H],[F-G-I],[F-H-I],[G-H-I],[A-B],[A-C],[A-D],[A-E],[A-F],[A-G],[A-H],[A-I],[B-C],[B-D],[B-E],[B-F],[B-G],[B-H],[B-I],[C-D],[C-E],[C-F],[C-G],[C-H],[C-I],[D-E],[D-F],[D-G],[D-H],[D-I],[E-F],[E-G],[E-H],[E-I],[F-G],[F-H],[F-I],[G-H],[G-I],[H-I]


[0084] Exemplary combinations of metabolic modifications J-P are shown in Table 63.
Table 63. Exemplary combinations of metabolic modifications (in brackets).
[J-K-L-M-N-O-P], [J-K-L-M-N-O], [J-K-L-M-N-P], [J-K-L-M-O-P], [J-K-L-N-O-P], [J-K-M-N-O-P], [J-L-M-N-O-P], [K-L-M-N-O-P], [J-K-L-M-N], [J-K-L-M-O], [J-K-L-M-P], [J-K-L-N-O], [J-K-L-N-P], [J-K-L-O-P], [J-K-M-N-O], [J-K-M-N-P], [J-K-M-O-P], [J-K-N-O-P], [J-L-M-N-O], [J-L-M-N-P], [J-L-M-O-P], [J-L-N-O-P], [J-M-N-O-P], [K-L-M-N-O], [K-L-M-N-P], [K-L-M-O-P], [K-L-N-O-P], [K-M-N-O-P], [L-M-N-O-P], [J-K-L-M], [J-K-L-N], [J-K-L-O], [J-K-L-P], [J-K-M-N], [J-K-M-O], [J-K-M-P], [J-K-N-O], [J-K-N-P], [J-K-O-P], [J-L-M-N], [J-L-M-O], [J-L-M-P], [J-L-N-O], [J-L-N-P], [J-L-O-P], [J-M-N-O], [J-M-N-P], [J-M-O-P], [J-N-O-P], [K-L-M-N], [K-L-M-O], [K-L-M-P], [K-L-N-O], [K-L-N-P], [K-L-O-P], [K-M-N-O], [K-M-N-P], [K-M-O-P], [K-N-O-P], [L-M-N-O], [L-M-N-P], [L-M-O-P], [L-N-O-P], [M-N-O-P], [J-K-L], [J-K-M], [J-K-N], [J-K-O], [J-K-P], [J-L-M], [J-L-N], [J-L-O], [J-L-P], [J-M-N], [J-M-O], [J-M-P], [J-N-O], [J-N-P], [J-O-P], [K-L-M], [K-L-N], [K-L-O], [K-L-P], [K-M-N], [K-M-O], [K-M-P], [K-N-O], [K-N-P], [K-O-P], [L-M-N], [L-M-O], [L-M-P], [L-N-O], [L-N-P], [L-O-P], [M-N-O], [M-N-P], [M-O-P], [N-O-P], [J-K], [J-L], [J-M], [J-N], [J-O], [J-P], [K-L], [K-M], [K-N], [K-O], [K-P], [L-M], [L-N], [L-O], [L-P], [M-N], [M-O], [M-P], [N-O], [N-P], [O-P]


[0085] It is understood that any of the various combinations of metabolic modifications shown in Tables 62 and 63 can be combined with each other, or with individual metabolic modifications A-P, to generate further combinations. For example, the combination A-B can be combined with P to generate the combination [A-B-P]; C combined with J-L-O to generate the combination [C-J-L-O]; the combination A-C-D-E-G combined with J-K to generate the combination [A-C-D-E-G-J-K], and so forth. Such additional combinations are merely exemplary, and one skilled in the art can readily utilize well known methods and the teachings provided herein to generate various desired combinations of metabolic modifications disclosed herein. Further exemplary combinatinos of the metabolic modifications of Tables 62 and 62 (metabolic modifications A-P) are shown in Figure 91. Thus, the disclosure provides a microbial organism comprising metabolic modifications selected from the combination of metabolic modifications shown in Table 62, Table 63 or Figure 91.

[0086] Additionally provided is a microbial organism in which one or more genes encoding the exogenously expressed enzymes are integrated into the fimD locus of the host organism (see Example XVII). For example, one or more genes encoding a BDO, 4-HB, 4-HBal, 4-HBCoA and/or putrescine pathway enzyme can be integrated into the fimD locus for increased production of BDO, 4-HB, 4-HBal, 4-HBCoA and/or putrescine. Further provided is a microbial organism expressing a non-phosphotransferase sucrose uptake system that increases production of BDO.

[0087] Although the genetically modified microbial organisms disclosed herein are exemplified with microbial organisms containing particular BDO, 4-HB, 4-HBal, 4-HBCoA and/or putrescine pathway enzymes, it is understood that such modifications can be incorporated into any microbial organism having a BDO, 4-HB, 4-HBal, 4-HBCoA and/or putrescine pathway suitable for enhanced production in the presence of the genetic modifications of any of the pathways disclosed herein. The microbial organisms of the disclosure can thus have any of the BDO, 4-HB, 4-HBal, 4-HBCoA and/or putrescine pathways disclosed herein (see, for example, Figures 1, 8-13, 58, 62 and 63). For example, if a depicted pathway shows a BDO pathway, whereas 4-hydroxybutyrate is an intermediate of the BDO pathway, it is understood, as disclosed herein, that a pathway to 4-hydroxybutyrate is also provided, if desired. Thus, the pathways described herein can produce an end product of a depicted pathway or a desired intermediate of a depicted pathway, as described herein.

[0088] In an aspect of the disclosure, a microbial organism is provided comprising a metabolic modification and a pathway to a desired product such as BDO, 4-HB, 4-HBal, 4-HBCoA and/or putrescine. Exemplary pathways are disclosed herein and include the pathways depicted in Figures 1, 8-13, 58, 62 and 63. In one aspect, the microbial organism comprises a 4-hydroxybutanoic acid (4-HB) and/or 1,4-butanediol (1,4-BDO) biosynthetic pathway comprising an α-ketoglutarate decarboxylase, or an α-ketoglutarate dehydrogenase and a CoA-dependent succinic semialdehyde dehydrogenase, or a glutamate:succinate semialdehyde transaminase and a glutamate decarboxylase; a 4-hydroxybutanoate dehydrogenase; a 4-hydroxybutyryl-CoA:acetyl-CoA transferase, or a butyrate kinase and a phosphotransbutyrylase; an aldehyde dehydrogenase; and an alcohol dehydrogenase.

[0089] In another aspect, the microbial organism can comprise a 4-HB and/or BDO pathway comprising alpha-ketoglutarate decarboxylase, or alpha-ketoglutarate dehydrogenase and CoA-dependent succinate semialdehyde dehydrogenase, or glutamate:succinate semialdehyde transaminase and glutamate decarboxylase; 4-hydroxybutyrate dehydrogenase; 4-hydroxybutyryl-CoA transferase, or 4-hydroxybutyrate kinase and phosphotrans-4-hydroxybutyrylase; 4-hydroxybutyryl-CoA reductase; and 4-hydroxybutyraldehyde reductase, or aldehyde/alcohol dehydrogenase. In still another aspect, the microbial organisms can comprise a 4-HB and/or BDO pathway comprising alpha-ketoglutarate decarboxylase, or succinyl-CoA synthetase and CoA-dependent succinate semialdehyde dehydrogenase; 4-hydroxybutyrate dehydrogenase; 4-hydroxybutyryl-CoA transferase, or 4-hydroxybutyrate kinase and phosphotrans-4-hydroxybutyrylase; and aldehyde dehydrogenase; and alcohol dehydrogenase, or aldehyde/alcohol dehydrogenase. In another aspect, the microbial organism can comprise a 4-HB and/or BDO pathway comprising alpha-ketoglutarate decarboxylase, or glutamate dehydrogenase and glutamate decarboxylase, and deaminating 4-aminobutyrate oxidoreductase or 4-aminobutyrate transaminase, or alpha-ketoglutarate dehydrogenase and CoA-dependent succinate semialdehyde dehydrogenase; 4-hydroxybutyrate dehydrogenase; and 4-hydroxybutyrate kinase and phosphotrans-4-hydroxybutyrylase and 4-hydroxybutyryl-CoA reductase and 4-hydroxybutyraldehyde reductase, or 4-hydroxybutyrate kinase and phosphorylating 4-hydroxybutanal dehydrogenase and 4-hydroxybutyraldehyde reductase, or 4-hydroxybutyrate kinase and phosphotrans-4-hydroxybutyrylase and alcohol forming 4-hydroxybutyryl-CoA reductase, or 4-hydroxybutyryl-CoA transferase or 4-hydroxybutyryl-CoA hydrolase or 4-hydroxybutyryl-CoA ligase and 4-hydroxybutyryl-CoA reductase and 4-hydroxybutyraldehyde reductase, or 4-hydroxybutyryl-CoA transferase or 4-hydroxybutyryl-CoA hydrolase or 4-hydroxybutyryl-CoA ligase and alcohol forming 4-hydroxybutyryl-CoA reductase. In yet another aspect, the microbial organism can comprise a BDO pathway comprising glutamate CoA transferase or glutamyl-CoA hydrolase or glutamyl-CoA ligase and glutamyl-CoA reductase and glutamate-5-semialdehyde reductase, or glutamate CoA transferase or glutamyl-CoA hydrolase or glutamyl-CoA ligase and alcohol forming glutamyl-CoA reductase, or glutamate 5-kinase and phosphorylating glutamate-5-semialdehyde dehydrogenase and glutamate-5-semialdehyde reductase; deaminating 2-amino-5-hydroxypentanoic acid oxidoreductase or 2-amino-5-hydroxypentanoic acid transaminase; and 5-hydroxy-2-oxopentanoic acid decarboxylase and 4-hydroxybutyraldehyde reductase, or decarboxylating 5-hydroxy-2-oxopentanoic acid dehydrogenase and 4-hydroxybutyryl-CoA reductase and 4-hydroxybutyraldehyde reductase; or decarboxylating 5-hydroxy-2-oxopentanoic acid dehydrogenase and alcohol forming 4-hydroxybutyryl-CoA reductase.

[0090] In a further aspect of the disclosure, the microbial organism can comprise a 4-HB and/or BDO pathway comprising 3-hydroxybutyryl-CoA dehydrogenase; 3-hydroxybutyryl-CoA dehydratase; vinylacetyl-CoA Δ-isomerase; 4-hydroxybutyryl-CoA dehydratase; and 4-hydroxybutyryl-CoA reductase (alcohol forming); or 4-hydroxybutyryl-CoA reductase and 1,4-butanediol dehydrogenase.

[0091] In still a further aspect of the disclosure, the microbial organism can comprise a 4-HB and/or BDO pathway comprising glutamate CoA transferase; glutamyl-CoA hydrolase; glutamyl-CoA ligase; glutamate 5-kinase; glutamate-5-semialdehyde dehydrogenase (phosphorylating; glutamyl-CoA reductase; glutamate-5-semialdehyde reductase; glutamyl-CoA reductase (alcohol forming); 2-amino-5-hydroxypentanoic acid oxidoreductase (deaminating); 2-amino-5-hydroxypentanoic acid transaminase; 5-hydroxy-2-oxopentanoic acid decarboxylase; and 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation); and optionally 4-hydroxybutyryl-CoA reductase (alcohol forming), 4-hydroxybutyryl-CoA reductase, or 1,4-butanediol dehydrogenase. In another aspect, the microbial organism can comprise a 4-HB and/or BDO pathway comprising glutamate CoA transferase; glutamyl-CoA hydrolase; glutamyl-CoA ligase; glutamate 5-kinase; glutamate-5-semialdehyde dehydrogenase (phosphorylating); glutamyl-CoA reductase; glutamate-5-semialdehyde reductase; glutamyl-CoA reductase (alcohol forming); 2-amino-5-hydroxypentanoic acid oxidoreductase (deaminating); 2-amino-5-hydroxypentanoic acid transaminase; 5-hydroxy-2-oxopentanoic acid decarboxylase; and 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation); and optionally 4-hydroxybutyryl-CoA reductase (alcohol forming), 4-hydroxybutyryl-CoA reductase, or 1,4-butanediol dehydrogenase.

[0092] In another aspect of the disclosure, the microbial organism can comprise a 4-HB and/or BDO pathway comprising glutamate dehydrogenase; glutamate decarboxylase; 4-aminobutyrate oxidoreductase (deaminating); and 4-hydroxybutyrate dehydrogenase; and further comprising (a) 4-hydroxybutyrate kinase; phosphotrans-4-hydroxybutyrylase; 4-hydroxybutyryl-CoA reductase; and 1,4-butanediol dehydrogenase; (b) 4-hydroxybutyryl-CoA transferase, 4-hydroxybutyryl-CoA hydrolase, or 4-hydroxybutyryl-CoA ligase; 4-hydroxybutyryl-CoA reductase; and 1,4-butanediol dehydrogenase; (c) 4-hydroxybutyryl-CoA transferase, 4-hydroxybutyryl-CoA hydrolase, or 4-hydroxybutyryl-CoA ligase; and 4-hydroxybutyryl-CoA reductase (alcohol forming); (d) 4-hydroxybutyrate kinase; 4-hydroxybutanal dehydrogenase (phosphorylating); or (e) 4-hydroxybutyrate kinase; phosphotrans-4-hydroxybutyrylase; and 4-hydroxybutyryl-CoA reductase (alcohol forming). In still another aspect, the microbial organism can comprise a 4-HB and/or BDO pathway comprising alpha-ketoglutarate decarboxylase, or glutamate dehydrogenase and glutamate decarboxylase and 4-aminobutyrate transaminase; and 4-hydroxybutyrate dehydrogenase; and further comprising (a) 4-hydroxybutyryl-CoA ligase; 4-hydroxybutyryl-CoA reductase; and 1,4-butanediol dehydrogenase; (b) 4-hydroxybutyryl-CoA transferase, 4-hydroxybutyryl-CoA hydrolase, or 4-hydroxybutyryl-CoA ligase; and 4-hydroxybutyryl-CoA reductase (alcohol forming); (c) 4-hydroxybutyrate kinase; 4-hydroxybutanal dehydrogenase (phosphorylating); and 1,4-butanediol dehydrogenase; or (d) 4-hydroxybutyrate kinase; phosphotrans-4-hydroxybutyrylase; and 4-hydroxybutyryl-CoA reductase (alcohol forming). In yet another aspect, the microbial organism can comprise a 4-HB and/or BDO pathway comprising alpha-ketoglutarate dehydrogenase; CoA-dependent succinic semialdehyde dehydrogenase; and 4-hydroxybutyrate dehydrogenase; and further comprising (a) 4-hydroxybutyryl-CoA ligase; 4-hydroxybutyryl-CoA reductase; and 1,4-butanediol dehydrogenase; (b) 4-hydroxybutyryl-CoA transferase, 4-hydroxybutyryl-CoA hydrolase, or 4-hydroxybutyryl-CoA ligase; and 4-hydroxybutyryl-CoA reductase (alcohol forming); (c) 4-hydroxybutyrate kinase; 4-hydroxybutanal dehydrogenase (phosphorylating); and 1,4-butanediol dehydrogenase; or (d) 4-hydroxybutyrate kinase; phosphotrans-4-hydroxybutyrylase; and 4-hydroxybutyryl-CoA reductase (alcohol forming).

[0093] In a further aspect, the microbial organism can comprise a 4-HB and/or 4-hydroxybutanal and/or BDO pathway comprising succinyl-CoA reductase (aldehyde forming); 4-hydroxybutyrate dehydrogenase; and 4-hydroxybutyrate reductase, also referred to herein as carboxylic acid reductase. In another aspect, the microbial organism can comprise a 4-HB and/or 4-hydroxybutanal and/or BDO pathway comprising alpha-ketoglutarate decarboxylase; 4-hydroxybutyrate dehydrogenase; and 4-hydroxybutyrate reductase, also referred to herein as carboxylic acid reductase.

[0094] In another aspect, the BDO pathway can comprise 4-hydroxybutanoate dehydrogenase, succinyl-CoA synthetase, CoA-dependent succinic semialdehyde dehydrogenase, 4-hydroxybutyrate:CoA transferase, 4-butyrate kinase, phosphotransbutyrylase, alpha-ketoglutarate decarboxylase, aldehyde dehydrogenase, alcohol dehydrogenase or an aldehyde/alcohol dehydrogenase (see Figure 1). Alternatively, the BDO pathway can comprise 4-aminobutyrate CoA transferase, 4-aminobutyryl-CoA hydrolase, 4-aminobutyrate-CoA ligase, 4-aminobutyryl-CoA oxidoreductase (deaminating), 4-aminobutyryl-CoA transaminase, or 4-hydroxybutyryl-CoA dehydrogenase (see Table 17). Such a BDO pathway can further comprise 4-hydroxybutyryl-CoA reductase (alcohol forming), 4-hydroxybutyryl-CoA reductase, or 1,4-butanediol dehydrogenase.

[0095] Additionally, the BDO pathway can comprise 4-aminobutyrate CoA transferase, 4-aminobutyryl-CoA hydrolase, 4-aminobutyrate-CoA ligase, 4-aminobutyryl-CoA reductase (alcohol forming), 4-aminobutyryl-CoA reductase, 4-aminobutan-1-ol dehydrogenase, 4-aminobutan-1-ol oxidoreductase (deaminating) or 4-aminobutan-1-ol transaminase (see Table 18). Also, the BDO pathway can comprise 4-aminobutyrate kinase, 4-aminobutyraldehyde dehydrogenase (phosphorylating), 4-aminobutan-1-ol dehydrogenase, 4-aminobutan-1-ol oxidoreductase (deaminating), 4-aminobutan-1-ol transaminase, [(4-aminobutanolyl)oxy]phosphonic acid oxidoreductase (deaminating), [(4-aminobutanolyl)oxy]phosphonic acid transaminase, 4-hydroxybutyryl-phosphate dehydrogenase, or 4-hydroxybutyraldehyde dehydrogenase (phosphorylating) (see Table 19). Such a pathway can further comprise 1,4-butanediol dehydrogenase.

[0096] The BDO pathway can also comprise alpha-ketoglutarate 5-kinase, 2,5-dioxopentanoic semialdehyde dehydrogenase (phosphorylating), 2,5-dioxopentanoic acid reductase, alpha-ketoglutarate CoA transferase, alpha-ketoglutaryl-CoA hydrolase, alpha-ketoglutaryl-CoA ligase, alpha-ketoglutaryl-CoA reductase, 5-hydroxy-2-oxopentanoic acid dehydrogenase, alpha-ketoglutaryl-CoA reductase (alcohol forming), 5-hydroxy-2-oxopentanoic acid decarboxylase, or 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation)(see Table 20). Such a BDO pathway can further comprise 4-hydroxybutyryl-CoA reductase (alcohol forming), 4-hydroxybutyryl-CoA reductase, or 1,4-butanediol dehydrogenase. Additionally, the BDO pathway can comprise glutamate CoA transferase, glutamyl-CoA hydrolase, glutamyl-CoA ligase, glutamate 5-kinase, glutamate-5-semialdehyde dehydrogenase (phosphorylating), glutamyl-CoA reductase, glutamate-5-semialdehyde reductase, glutamyl-CoA reductase (alcohol forming), 2-amino-5-hydroxypentanoic acid oxidoreductase (deaminating), 2-amino-5-hydroxypentanoic acid transaminase, 5-hydroxy-2-oxopentanoic acid decarboxylase, 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation)(see Table 21). Such a BDO pathway can further comprise 4-hydroxybutyryl-CoA reductase (alcohol forming), 4-hydroxybutyryl-CoA reductase, or 1,4-butanediol dehydrogenase.

[0097] Additionally, the BDO pathway can comprise 3-hydroxybutyryl-CoA dehydrogenase, 3-hydroxybutyryl-CoA dehydratase, vinylacetyl-CoA Δ-isomerase, or 4-hydroxybutyryl-CoA dehydratase (see Table 22). Also, the BDO pathway can comprise homoserine deaminase, homoserine CoA transferase, homoserine-CoA hydrolase, homoserine-CoA ligase, homoserine-CoA deaminase, 4-hydroxybut-2-enoyl-CoA transferase, 4-hydroxybut-2-enoyl-CoA hydrolase, 4-hydroxybut-2-enoyl-CoA ligase, 4-hydroxybut-2-enoate reductase, 4-hydroxybutyryl-CoA transferase, 4-hydroxybutyryl-CoA hydrolase, 4-hydroxybutyryl-CoA ligase, or 4-hydroxybut-2-enoyl-CoA reductase (see Table 23). Such a BDO pathway can further comprise 4-hydroxybutyryl-CoA reductase (alcohol forming), 4-hydroxybutyryl-CoA reductase, or 1,4-butanediol dehydrogenase.

[0098] The BDO pathway can additionally comprise succinyl-CoA reductase (alcohol forming), 4-hydroxybutyryl-CoA hydrolase, 4-hydroxybutyryl-CoA ligase, or 4-hydroxybutanal dehydrogenase (phosphorylating) (see Table 15). Such a pathway can further comprise succinyl-CoA reductase, 4-hydroxybutyrate dehydrogenase, 4-hydroxybutyryl-CoA transferase, 4-hydroxybutyrate kinase, phosphotrans-4-hydroxybutyrylase, 4-hydroxybutyryl-CoA reductase, 4-hydroxybutyryl-CoA reductase (alcohol forming), or 1,4-butanediol dehydrogenase. Also, the BDO pathway can comprise glutamate dehydrogenase, 4-aminobutyrate oxidoreductase (deaminating), 4-aminobutyrate transaminase, glutamate decarboxylase, 4-hydroxybutyryl-CoA hydrolase, 4-hydroxybutyryl-CoA ligase, or 4-hydroxybutanal dehydrogenase (phosphorylating)(see Table 16). Such a BDO pathway can further comprise alpha-ketoglutarate decarboxylase, 4-hydroxybutyrate dehydrogenase, 4-hydroxybutyryl-CoA transferase, 4-hydroxybutyrate kinase, phosphotrans-4-hydroxybutyrylase, 4-hydroxybutyryl-CoA reductase, 4-hydroxybutyryl-CoA reductase (alcohol forming), or 1,4-butanediol dehydrogenase.

[0099] The disclosure additionally provides a non-naturally occurring microbial organism, comprising a 4-hydroxybutanal pathway comprising at least one exogenous nucleic acid encoding a 4-hydroxybutanal pathway enzyme expressed in a sufficient amount to produce 4-hydroxybutanal, the 4-hydroxybutanal pathway comprising succinyl-CoA reductase (aldehyde forming); 4-hydroxybutyrate dehydrogenase; and 4-hydroxybutyrate reductase (see Figure 58, steps A-C-D). The disclosure also provides a non-naturally occurring microbial organism, comprising a 4-hydroxybutanal pathway comprising at least one exogenous nucleic acid encoding a 4-hydroxybutanal pathway enzyme expressed in a sufficient amount to produce 4-hydroxybutanal, the 4-hydroxybutanal pathway comprising alpha-ketoglutarate decarboxylase; 4-hydroxybutyrate dehydrogenase; and 4-hydroxybutyrate reductase (Figure 58, steps B-C-D).

[0100] The disclosure further provides a non-naturally occurring microbial organism, comprising a 4-hydroxybutanal pathway comprising at least one exogenous nucleic acid encoding a 4-hydroxybutanal pathway enzyme expressed in a sufficient amount to produce 4-hydroxybutanal, the 4-hydroxybutanal pathway comprising succinate reductase; 4-hydroxybutyrate dehydrogenase, and 4-hydroxybutyrate reductase (see Figure 62, steps F-C-D). In yet another aspect, the disclosure provides a non-naturally occurring microbial organism, comprising a 4-hydroxybutanal pathway comprising at least one exogenous nucleic acid encoding a 4-hydroxybutanal pathway enzyme expressed in a sufficient amount to produce 4-hydroxybutanal, the 4-hydroxybutanal pathway comprising alpha-ketoglutarate decarboxylase, or glutamate dehydrogenase or glutamate transaminase and glutamate decarboxylase and 4-aminobutyrate dehydrogenase or 4-aminobutyrate transaminase; 4-hydroxybutyrate dehydrogenase; and 4-hydroxybutyrate reductase (see Figure 62, steps B or ((J or K)-L-(M or N))-C-D).

[0101] The disclosure also provides a non-naturally occurring microbial organism, comprising a 4-hydroxybutanal pathway comprising at least one exogenous nucleic acid encoding a 4-hydroxybutanal pathway enzyme expressed in a sufficient amount to produce 4-hydroxybutanal, the 4-hydroxybutanal pathway comprising alpha-ketoglutarate reductase; 5-hydroxy-2-oxopentanoate dehydrogenase; and 5-hydroxy-2-oxopentanoate decarboxylase (see Figure 62, steps X-Y-Z). In yet another aspect, the disclosure provides a non-naturally occurring microbial organism, comprising a 4-hydroxybutyryl-CoA pathway comprising at least one exogenous nucleic acid encoding a 4-hydroxybutyryl-CoA pathway enzyme expressed in a sufficient amount to produce 4-hydroxybutyryl-CoA, the 4-hydroxybutyryl-CoA pathway comprising alpha-ketoglutarate reductase; 5-hydroxy-2-oxopentanoate dehydrogenase; and 5-hydroxy-2-oxopentanoate dehydrogenase (decarboxylation) (see Figure 62, steps X-Y-AA).

[0102] The disclosure additionally provides a non-naturally occurring microbial organism, comprising a putrescine pathway comprising at least one exogenous nucleic acid encoding a putrescine pathway enzyme expressed in a sufficient amount to produce putrescine, the putrescine pathway comprising succinate reductase; 4-aminobutyrate dehydrogenase or 4-aminobutyrate transaminase; 4-aminobutyrate reductase; and putrescine dehydrogenase or putrescine transaminase (see Figure 63, steps F-M/N-C-D/E). In still another aspect, the disclosure provides a non-naturally occurring microbial organism, comprising a putrescine pathway comprising at least one exogenous nucleic acid encoding a putrescine pathway enzyme expressed in a sufficient amount to produce putrescine, the putrescine pathway comprising alpha-ketoglutarate decarboxylase; 4-aminobutyrate dehydrogenase or 4-aminobutyrate transaminase; 4-aminobutyrate reductase; and putrescine dehydrogenase or putrescine transaminase (see Figure 63, steps B-M/N-C-D/E). The disclosure additionally provides a non-naturally occurring microbial organism, comprising a putrescine pathway comprising at least one exogenous nucleic acid encoding a putrescine pathway enzyme expressed in a sufficient amount to produce putrescine, the putrescine pathway comprising glutamate dehydrogenase or glutamate transaminase; glutamate decarboxylase; 4-aminobutyrate reductase; and putrescine dehydrogenase or putrescine transaminase (see Figure 63, steps J/K-L-C-D/E).

[0103] The disclosure provides in another aspect a non-naturally occurring microbial organism, comprising a putrescine pathway comprising at least one exogenous nucleic acid encoding a putrescine pathway enzyme expressed in a sufficient amount to produce putrescine, the putrescine pathway comprising alpha-ketoglutarate reductase; 5-amino-2-oxopentanoate dehydrogenase or 5-amino-2-oxopentanoate transaminase; 5-amino-2-oxopentanoate decarboxylase; and putrescine dehydrogenase or putrescine transaminase (see Figure 63, steps O-P/Q-R-D/E). Also provided is a non-naturally occurring microbial organism, comprising a putrescine pathway comprising at least one exogenous nucleic acid encoding a putrescine pathway enzyme expressed in a sufficient amount to produce putrescine, the putrescine pathway comprising alpha-ketoglutarate reductase; 5-amino-2-oxopentanoate dehydrogenase or 5-amino-2-oxopentanoate transaminase; ornithine dehydrogenase or ornithine transaminase; and ornithine decarboxylase (see Figure 63, steps O-P/Q-S/T-U).

[0104] In an additional aspect, the disclosure provides a non-naturally occurring microbial organism having a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway, wherein the non-naturally occurring microbial organism comprises at least one exogenous nucleic acid encoding an enzyme or protein that converts a substrate of any of the pathways disclosed herein (see, for example, the Examples and Figures 1, 8-13, 58, 62 and 63). In an exmemplary aspect for producing BDO, the microbial organism can convert a substrate to a product selected from the group consisting of succinate to succinyl-CoA; succinyl-CoA to succinic semialdehyde; succinic semialdehyde to 4-hydroxybutrate; 4-hydroxybutyrate to 4-hydroxybutyryl-phosphate; 4-hydroxybutyryl-phosphate to 4-hydroxtbutyryl-CoA; 4-hydroxybutyryl-CoA to 4-hydroxybutanal; and 4-hydroxybutanal to 1,4-butanediol. In a pathway for producing 4-HBal, a microbial organism can convert, for example, succinate to succinic semialdehyde; succinic semialdehyde to 4-hydroxybutyrate; and 4-hydroxybutyrate to 4-hydroxybutanal. Such an organism can additionally include activity to convert 4-hydroxybutanal to 1,4-butanediol in order to produce BDO. Yet another pathway for producing 4-HBal can be, for example, alpha-ketoglutarate to succinic semialdehyde; succinic semialdehyde to 4-hydroxybutyrate; and 4-hydroxybutyrate to 4-hydroxybutanal. An alternative pathway for producing 4-HBal can be, for example, alpha-ketoglutarate to 2,5-dioxopentanoic acid; 2,5-dioxopentanoic acid to 5-hydroxy-2-oxopentanooic acid; and 5-hydroxy-2-oxopentanoic acid to 4-hydroxybutanal. An exemplary 4-hydroxybutyryl-CoA pathway can be, for example, alpha-ketoglutarate to 2,5-dioxopentanoic acid; 2,5-dioxopentanoic acid to 5-hydroxy-2-oxopentanoic acid; and 5-hydroxy-2-oxopentanoic acid to 4-hydroxybutyryl-CoA. An exemplary putrescine pathway can be, for example, succinate to succinyl-CoA; succinyl-CoA to succinic semialdehyde; succinic semialdehyde to 4-aminobutyrate; 4-aminobutyrate to 4-aminobutanal; and 4-aminobutanal to putrescine. An alternative putrescine pathway can be, for example, succinate to succinic semialdehyde; succinic semialdehyde to 4-aminobutyrate; 4-aminobutyrate to 4-aminobutanal; and 4-aminobutanal to putrescine. One skilled in the art will understand that these are merely exemplary and that any of the substrate-product pairs disclosed herein suitable to produce a desired product and for which an appropriate activity is available for the conversion can be readily determined by one skilled in the art based on the teachings herein. Thus, the disclosure provides a non-naturally occurring microbial organism containing at least one exogenous nucleic acid encoding an enzyme or protein, where the enzyme or protein converts the substrates and products of a pathway (see Figures 1, 8-13, 58, 62 and 63).

[0105] While generally described herein as a microbial organism that contains a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway, it is understood that the disclosure additionally provides a non-naturally occurring microbial organism comprising at least one exogenous nucleic acid encoding a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway enzyme or protein expressed in a sufficient amount to produce an intermediate of a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway. For example, as disclosed herein, 4-HB, 4-HBal, 4-HBCoA, BDO and putrescine pathways are exemplified in Figures 1, 8-13, 58, 62 and 63. Therefore, in addition to a microbial organism containing, for example, a BDO pathway that produces BDO, the disclosure additionally provides a non-naturally occurring microbial organism comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme, where the microbial organism produces a BDO pathway intermediate as a product rather than an intermediate of the pathway. In one exemplary aspect as shown in Figure 62, for example, the disclosure provides a microbial organism that produces succinyl-CoA, succinic semialdehyde, 4-hydroxybutyrate, 4-hydroxybutyryl-phosphate, 4-hydroxybutyryl-CoA, or 4-hydroxybutanal as a product rather than an intermediate. Another exemplary aspect includes, for example, a microbial organism that produces alpha-ketoglutarate, 2,5-dioxopentanoic acid, 5-hydroxy-2-oxopentanoic acid, or 4-hydroxybutanal as a product rather than an intermediate. An exemplary aspect in a putrescine pathway includes, for example, a microbial organism that produces glutamate, 4-aminobutyrate, or 4-aminobutanal as a product rather than an intermediate. An alternative aspect in a putrescine pathway can be, for example, a microbial organism that produces 2,5-dioxopentanoate, 5-amino-2-oxopentanoate, or ornithine as a product rather than an intermediate.

[0106] It is understood that any of the pathways disclosed herein, as described in the Examples and exemplified in the Figures, including the pathways of Figures 1, 8-13, 58, 62 and 63, can be utilized to generate a non-naturally occurring microbial organism that produces any pathway intermediate or product, as desired. As disclosed herein, such a microbial organism that produces an intermediate can be used in combination with another microbial organism expressing downstream pathway enzymes to produce a desired product. However, it is understood that a non-naturally occurring microbial organism that produces a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway intermediate can be utilized to produce the intermediate as a desired product.

[0107] The disclosure is described herein with general reference to the metabolic reaction, reactant or product thereof, or with specific reference to one or more nucleic acids or genes encoding an enzyme associated with or catalyzing the referenced metabolic reaction, reactant or product. Unless otherwise expressly stated herein, those skilled in the art will understand that reference to a reaction also constitutes reference to the reactants and products of the reaction. Similarly, unless otherwise expressly stated herein, reference to a reactant or product also references the reaction and that reference to any of these metabolic constituents also references the gene or genes encoding the enzymes that catalyze the referenced reaction, reactant or product. Likewise, given the well known fields of metabolic biochemistry, enzymology and genomics, reference herein to a gene or encoding nucleic acid also constitutes a reference to the corresponding encoded enzyme and the reaction it catalyzes as well as the reactants and products of the reaction.

[0108] As disclosed herein, the product 4-hydroxybutyrate, as well as other intermediates, are carboxylic acids, which can occur in various ionized forms, including fully protonated, partially protonated, and fully deprotonated forms. Accordingly, the suffix "-ate," or the acid form, can be used interchangeably to describe both the free acid form as well as any deprotonated form, in particular since the ionized form is known to depend on the pH in which the compound is found. It is understood that carboxylate products or intermediates includes ester forms of carboxylate products or pathway intermediates, such as O-carboxylate and S-carboxylate esters. O- and S-carboxylates can include lower alkyl, that is C1 to C6, branched or straight chain carboxylates. Some such O- or S-carboxylates include, without limitation, methyl, ethyl, n-propyl, n-butyl, i-propyl, sec-butyl, and tert-butyl, pentyl, hexyl O- or S-carboxylates, any of which can further possess an unsaturation, providing for example, propenyl, butenyl, pentyl, and hexenyl O- or S-carboxylates. O-carboxylates can be the product of a biosynthetic pathway. Exemplary O-carboxylates accessed via biosynthetic pathways can include, without limitation, methyl 4-hydroxybutyrate, ethyl 4-hydroxybutyrate, and n-propyl 4-hydroxybutyrate. Other biosynthetically accessible O-carboxylates can include medium to long chain groups, that is C7-C22, O-carboxylate esters derived from fatty alcohols, such heptyl, octyl, nonyl, decyl, undecyl, lauryl, tridecyl, myristyl, pentadecyl, cetyl, palmitolyl, heptadecyl, stearyl, nonadecyl, arachidyl, heneicosyl, and behenyl alcohols, any one of which can be optionally branched and/or contain unsaturations. O-carboxylate esters can also be accessed via a biochemical or chemical process, such as esterification of a free carboxylic acid product or transesterification of an O- or S-carboxylate. S-carboxylates are exemplified by CoA S-esters, cysteinyl S-esters, alkylthioesters, and various aryl and heteroaryl thioesters.

[0109] The production of 4-HB via biosynthetic modes using the microbial organisms of the disclosure is particularly useful because it can produce monomeric 4-HB. The non-naturally occurring microbial organisms of the disclosure and their biosynthesis of 4-HB and BDO family compounds also is particularly useful because the 4-HB product can be (1) secreted; (2) can be devoid of any derivatizations such as Coenzyme A; (3) avoids thermodynamic changes during biosynthesis; (4) allows direct biosynthesis of BDO, and (5) allows for the spontaneous chemical conversion of 4-HB to γ-butyrolactone (GBL) in acidic pH medium. This latter characteristic also is particularly useful for efficient chemical synthesis or biosynthesis of BDO family compounds such as 1,4-butanediol and/or tetrahydrofuran (THF), for example.

[0110] Microbial organisms generally lack the capacity to synthesize 4-HB and therefore any of the compounds disclosed herein to be within the 1,4-butanediol family of compounds or known by those in the art to be within the 1,4-butanediol family of compounds. Moreover, organisms having all of the requisite metabolic enzymatic capabilities are not known to produce 4-HB from the enzymes described and biochemical pathways exemplified herein. Rather, with the possible exception of a few anaerobic microorganisms described further below, the microorganisms having the enzymatic capability to use 4-HB as a substrate to produce, for example, succinate. In contrast, the non-naturally occurring microbial organisms of the disclosure can generate 4-HB, 4-HBal, 4-HBCoA, BDO and/or putrescine as a product. As described above, the biosynthesis of 4-HB in its monomeric form is not only particularly useful in chemical synthesis of BDO family of compounds, it also allows for the further biosynthesis of BDO family compounds and avoids altogether chemical synthesis procedures.

[0111] The non-naturally occurring microbial organisms of the disclosure that can produce 4-HB, 4-HBal, 4-HBCoA, BDO and/or putrescine are produced by ensuring that a host microbial organism includes functional capabilities for the complete biochemical synthesis of at least one 4-HB, 4-HBal, 4-HBCoA, BDO and/or putrscine biosynthetic pathway of the disclosure. Ensuring at least one requisite 4-HB, 4-HBal, 4-HBCoA or BDO biosynthetic pathway confers 4-HB biosynthesis capability onto the host microbial organism.

[0112] Several 4-HB biosynthetic pathways are exemplified herein and shown for purposes of illustration in Figure 1. Additional 4-HB and BDO pathways are described in Figures 8-13. One 4-HB biosynthetic pathway includes the biosynthesis of 4-HB from succinate (the succinate pathway). The enzymes participating in this 4-HB pathway include CoA-independent succinic semialdehyde dehydrogenase and 4-hydroxybutanoate dehydrogenase. In this pathway, CoA-independent succinic semialdehyde dehydrogenase catalyzes the reverse reaction to the arrow shown in Figure 1. Another 4-HB biosynthetic pathway includes the biosynthesis from succinate through succinyl-CoA (the succinyl-CoA pathway). The enzymes participating in this 4-HB pathway include succinyl-CoA synthetase, CoA-dependent succinic semialdehyde dehydrogenase and 4-hydroxybutanoate dehydrogenase. Three other 4-HB biosynthetic pathways include the biosynthesis of 4-HB from α-ketoglutarate (the α-ketoglutarate pathways). Hence, a third 4-HB biosynthetic pathway is the biosynthesis of succinic semialdehyde through glutamate:succinic semialdehyde transaminase, glutamate decarboxylase and 4-hydroxybutanoate dehydrogenase. A fourth 4-HB biosynthetic pathway also includes the biosynthesis of 4-HB from α-ketoglutarate, but utilizes α-ketoglutarate decarboxylase to catalyze succinic semialdehyde synthesis. 4-hydroxybutanoate dehydrogenase catalyzes the conversion of succinic semialdehyde to 4-HB. A fifth 4-HB biosynthetic pathway includes the biosynthesis from α-ketoglutarate through succinyl-CoA and utilizes α-ketoglutarate dehydrogenase to produce succinyl-CoA, which funnels into the succinyl-CoA pathway described above. Each of these 4-HB biosynthetic pathways, their substrates, reactants and products are described further below in the Examples. As described herein, 4-HB can further be biosynthetically converted to BDO by inclusion of appropriate enzymes to produce BDO (see Example). Thus, it is understood that a 4-HB pathway can be used with enzymes for converting 4-HB to BDO to generate a BDO pathway.

[0113] The non-naturally occurring microbial organisms of the disclosure can be produced by introducing expressible nucleic acids encoding one or more of the enzymes participating in one or more 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine biosynthetic pathways. Depending on the host microbial organism chosen for biosynthesis, nucleic acids for some or all of a particular 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine biosynthetic pathway can be expressed. For example, if a chosen host is deficient in one or more enzymes in a desired biosynthetic pathway, for example, the succinate to 4-HB pathway, then expressible nucleic acids for the deficient enzyme(s), for example, both CoA-independent succinic semialdehyde dehydrogenase and 4-hydroxybutanoate dehydrogenase in this example, are introduced into the host for subsequent exogenous expression. Alternatively, if the chosen host exhibits endogenous expression of some pathway enzymes, but is deficient in others, then an encoding nucleic acid is needed for the deficient enzyme(s) to achieve 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine biosynthesis. For example, if the chosen host exhibits endogenous CoA-independent succinic semialdehyde dehydrogenase, but is deficient in 4-hydroxybutanoate dehydrogenase, then an encoding nucleic acid is needed for this enzyme to achieve 4-HB biosynthesis. Thus, a non-naturally occurring microbial organism of the disclosure can be produced by introducing exogenous enzyme or protein activities to obtain a desired biosynthetic pathway or a desired biosynthetic pathway can be obtained by introducing one or more exogenous enzyme or protein activities that, together with one or more endogenous enzymes or proteins, produces a desired product such as 4-HB, 4-HBal, 4-HBCoA, BDO and/or putrescine.

[0114] In like fashion, where 4-HB biosynthesis is selected to occur through the succinate to succinyl-CoA pathway (the succinyl-CoA pathway), encoding nucleic acids for host deficiencies in the enzymes succinyl-CoA synthetase, CoA-dependent succinic semialdehyde dehydrogenase and/or 4-hydroxybutanoate dehydrogenase are to be exogenously expressed in the recipient host. Selection of 4-HB biosynthesis through the α-ketoglutarate to succinic semialdehyde pathway (the α-ketoglutarate pathway) can utilize exogenous expression for host deficiencies in one or more of the enzymes for glutamate:succinic semialdehyde transaminase, glutamate decarboxylase and/or 4-hydroxybutanoate dehydrogenase, or α-ketoglutarate decarboxylase and 4-hydroxybutanoate dehydrogenase. One skilled in the art can readily determine pathway enzymes for production of 4-HB or BDO, as disclosed herein.

[0115] Depending on the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine biosynthetic pathway constituents of a selected host microbial organism, the non-naturally occurring microbial organisms of the disclosure will include at least one exogenously expressed 4-HB, 4-HB, 4-HBCoA, BDO or putrescine pathway-encoding nucleic acid and up to all encoding nucleic acids for one or more 4-HB or BDO biosynthetic pathways. For example, 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine biosynthesis can be established in a host deficient in a pathway enzyme or protein through exogenous expression of the corresponding encoding nucleic acid. In a host deficient in all enzymes or proteins of a 4-HB, 4-HB, 4-HBCoA, BDO or putrescine pathway, exogenous expression of all enzyme or proteins in the pathway can be included, although it is understood that all enzymes or proteins of a pathway can be expressed even if the host contains at least one of the pathway enzymes or proteins. If desired, exogenous expression of all enzymes or proteins in a pathway for production of 4-HB, 4-HB, 4-HBCoA, BDO or putrescine can be included. For example, 4-HB biosynthesis can be established from all five pathways in a host deficient in 4-hydroxybutanoate dehydrogenase through exogenous expression of a 4-hydroxybutanoate dehydrogenase encoding nucleic acid. In contrast, 4-HB biosynthesis can be established from all five pathways in a host deficient in all eight enzymes through exogenous expression of all eight of CoA-independent succinic semialdehyde dehydrogenase, succinyl-CoA synthetase, CoA-dependent succinic semialdehyde dehydrogenase, glutamate:succinic semialdehyde transaminase, glutamate decarboxylase, α-ketoglutarate decarboxylase, α-ketoglutarate dehydrogenase and 4-hydroxybutanoate dehydrogenase.

[0116] Given the teachings and guidance provided herein, those skilled in the art will understand that the number of encoding nucleic acids to introduce in an expressible form will, at least, parallel 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway deficiencies of the selected host microbial organism. Therefore, a non-naturally occurring microbial organism of the disclosure can have one, two, three, four, five, six, seven, eight or up to all nucleic acids encoding the enzymes disclosed herein constituting one or more 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine biosynthetic pathways. In some aspects, the non-naturally occurring microbial organisms also can include other genetic modifications that facilitate or optimize 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine biosynthesis or that confer other useful functions onto the host microbial organism. One such other functionality can include, for example, augmentation of the synthesis of one or more of 4-HB pathway precursors such as succinate, succinyl-CoA, α-ketoglutarate, 4-aminobutyrate, glutamate, acetoacetyl-CoA, and/or homoserine.

[0117] Generally, a host microbial organism is selected such that it produces the precursor of a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway, either as a naturally produced molecule or as an engineered product that either provides de novo production of a desired precursor or increased production of a precursor naturally produced by the host microbial organism. For example, succinyl-CoA, α-ketoglutarate, 4-aminobutyrate, glutamate, acetoacetyl-CoA, and homoserine are produced naturally in a host organism such as E. coli. A host organism can be engineered to increase production of a precursor, as disclosed herein. In addition, a microbial organism that has been engineered to produce a desired precursor can be used as a host organism and further engineered to express enzymes or proteins of a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway.

[0118] In some aspects, a non-naturally occurring microbial organism of the disclosure is generated from a host that contains the enzymatic capability to synthesize 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine. In this specific aspect it can be useful to increase the synthesis or accumulation of a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway product to, for example, drive 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway reactions toward 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine production. Increased synthesis or accumulation can be accomplished by, for example, overexpression of nucleic acids encoding one or more of the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway enzymes disclosed herein. Over expression of the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway enzyme or enzymes can occur, for example, through exogenous expression of the endogenous gene or genes, or through exogenous expression of the heterologous gene or genes. Therefore, naturally occurring organisms can be readily generated to be non-naturally 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine producing microbial organisms of the disclosure through overexpression of one, two, three, four, five, six and so forth up to all nucleic acids encoding 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine biosynthetic pathway enzymes. In addition, a non-naturally occurring organism can be generated by mutagenesis of an endogenous gene that results in an increase in activity of an enzyme in the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine biosynthetic pathway.

[0119] In particularly useful aspects, exogenous expression of the encoding nucleic acids is employed. Exogenous expression confers the ability to custom tailor the expression and/or regulatory elements to the host and application to achieve a desired expression level that is controlled by the user. However, endogenous expression also can be utilized in other aspects such as by removing a negative regulatory effector or induction of the gene's promoter when linked to an inducible promoter or other regulatory element. Thus, an endogenous gene having a naturally occurring inducible promoter can be up-regulated by providing the appropriate inducing agent, or the regulatory region of an endogenous gene can be engineered to incorporate an inducible regulatory element, thereby allowing the regulation of increased expression of an endogenous gene at a desired time. Similarly, an inducible promoter can be included as a regulatory element for an exogenous gene introduced into a non-naturally occurring microbial organism (see Examples).

[0120] "Exogenous" as it is used herein is intended to mean that the referenced molecule or the referenced activity is introduced into the host microbial organism. The molecule can be introduced, for example, by introduction of an encoding nucleic acid into the host genetic material such as by integration into a host chromosome or as non-chromosomal genetic material such as a plasmid. Therefore, the term as it is used in reference to expression of an encoding nucleic acid refers to introduction of the encoding nucleic acid in an expressible form into the microbial organism. When used in reference to a biosynthetic activity, the term refers to an activity that is introduced into the host reference organism. The source can be, for example, a homologous or heterologous encoding nucleic acid that expresses the referenced activity following introduction into the host microbial organism. Therefore, the term "endogenous" refers to a referenced molecule or activity that is present in the host. Similarly, the term when used in reference to expression of an encoding nucleic acid refers to expression of an encoding nucleic acid contained within the microbial organism. The term "heterologous" refers to a molecule or activity derived from a source other than the referenced species whereas "homologous" refers to a molecule or activity derived from the host microbial organism. Accordingly, exogenous expression of an encoding nucleic acid of the disclosure can utilize either or both a heterologous or homologous encoding nucleic acid.

[0121] It is understood that when more than one exogenous nucleic acid is included in a microbial organism that the the more than one exogenous nucleic acids refers to the referenced encoding nucleic acid or biosynthetic activity, as discussed above. It is further understood, as disclosed herein, that such more than one exogenous nucleic acids can be introduced into the host microbial organism on separate nucleic acid molecules, on polycistronic nucleic acid molecules, or a combination thereof, and still be considered as more than one exogenous nucleic acid. For example, as disclosed herein a microbial organism can be engineered to express two or more exogenous nucleic acids encoding a desired pathway enzyme or protein. In the case where two exogenous nucleic acids encoding a desired activity are introduced into a host microbial organism, it is understood that the two exogenous nucleic acids can be introduced as a single nucleic acid, for example, on a single plasmid, on separate plasmids, can be integrated into the host chromosome at a single site or multiple sites, and still be considered as two exogenous nucleic acids. Similarly, it is understood that more than two exogenous nucleic acids can be introduced into a host organism in any desired combination, for example, on a single plasmid, on separate plasmids, can be integrated into the host chromosome at a single site or multiple sites, and still be considered as two or more exogenous nucleic acids, for example three exogenous nucleic acids. Thus, the number of referenced exogenous nucleic acids or biosynthetic activities refers to the number of encoding nucleic acids or the number of biosynthetic activities, not the number of separate nucleic acids introduced into the host organism.

[0122] As used herein, the term "gene disruption," or grammatical equivalents thereof, is intended to mean a genetic alteration that renders the encoded gene product inactive or attenuated. The genetic alteration can be, for example, deletion of the entire gene, deletion of a regulatory sequence required for transcription or translation, deletion of a portion of the gene which results in a truncated gene product, or by any of various mutation strategies that inactivate or attenuate the encoded gene product. One particularly useful method of gene disruption is complete gene deletion because it reduces or eliminates the occurrence of genetic reversions in the non-naturally occurring microorganisms of the disclosure. A gene disruption also includes a null mutation, which refers to a mutation within a gene or a region containing a gene that results in the gene not being transcribed into RNA and/or translated into a functional gene product. Such a null mutation can arise from many types of mutations including, for example, inactivating point mutations, deletion of a portion of a gene, entire gene deletions, or deletion of chromosomal segments.

[0123] As used herein, the term "attenuate," or grammatical equivalents thereof, is intended to mean to weaken, reduce or diminish the activity or amount of an enzyme or protein. Attenuation of the activity or amount of an enzyme or protein can mimic complete disruption if the attenuation causes the activity or amount to fall below a critical level required for a given pathway to function. However, the attenuation of the activity or amount of an enzyme or protein that mimics complete disruption for one pathway, can still be sufficient for a separate pathway to continue to function. For example, attenuation of an endogenous enzyme or protein can be sufficient to mimic the complete disruption of the same enzyme or protein for production of a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine of the disclosure, but the remaining activity or amount of enzyme or protein can still be sufficient to maintain other pathways, such as a pathway that is critical for the host microbial organism to survive, reproduce or grow. Attenuation of an enzyme or protein can also be weakening, reducing or diminishing the activity or amount of the enzyme or protein in an amount that is sufficient to increase yield of a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine of the disclosure, but does not necessarily mimic complete disruption of the enzyme or protein.

[0124] As used herein, the term "growth-coupled" when used in reference to the production of a biochemical product is intended to mean that the biosynthesis of the referenced biochemical product is produced during the growth phase of a microorganism. In a particular aspects, the growth-coupled production can optionally be obligatory, meaning that the biosynthesis of the referenced biochemical is an obligatory product produced during the growth phase of a microorganism.

[0125] Sources of encoding nucleic acids for a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway enzyme can include, for example, any species where the encoded gene product is capable of catalyzing the referenced reaction. Such species include both prokaryotic and eukaryotic organisms including, but not limited to, bacteria, including archaea and eubacteria, and eukaryotes, including yeast, plant, insect, animal, and mammal, including human. Exemplary species for such sources include, for example, Escherichia coli, Saccharomyces cerevisiae, Saccharomyces kluyveri, Clostridium kluyveri, Clostridium acetobutylicum, Clostridium beijerinckii, Clostridium saccharoperbutylacetonicum, Clostridium perfringens, Clostridium difficile, Clostridium botulinum, Clostridium tyrobutyricum, Clostridium tetanomorphum, Clostridium tetani, Clostridium propionicum, Clostridium aminobutyricum, Clostridium subterminale, Clostridium sticklandii, Ralstonia eutropha, Mycobacterium bovis, Mycobacterium tuberculosis, Porphyromonas gingivalis, Arabidopsis thaliana, Thermus thermophilus, Pseudomonas species, including Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas stutzeri, Pseudomonas fluorescens, Homo sapiens, Oryctolagus cuniculus, Rhodobacter spaeroides, Thermoanaerobacter brockii, Metallosphaera sedula, Leuconostoc mesenteroides, Chloroflexus aurantiacus, Roseiflexus castenholzii, Erythrobacter, Simmondsia chinensis, Acinetobacter species, including Acinetobacter calcoaceticus and Acinetobacter baylyi, Porphyromonas gingivalis, Sulfolobus tokodaii, Sulfolobus solfataricus, Sulfolobus acidocaldarius, Bacillus subtilis, Bacillus cereus, Bacillus megaterium, Bacillus brevis, Bacillus pumilus, Rattus norvegicus, Klebsiella pneumonia, Klebsiella oxytoca, Euglena gracilis, Treponema denticola, Moorella thermoacetica, Thermotoga maritima, Halobacterium salinarum, Geobacillus stearothermophilus, Aeropyrum pernix, Sus scrofa, Caenorhabditis elegans, Corynebacterium glutamicum, Acidaminococcus fermentans, Lactococcus lactis, Lactobacillus plantarum, Streptococcus thermophilus, Enterobacter aerogenes, Candida, Aspergillus terreus, Pedicoccus pentosaceus, Zymomonas mobilus, Acetobacter pasteurians, Kluyveromyces lactis, Eubacterium barkeri, Bacteroides capillosus, Anaerotruncus colihominis, Natranaerobius thermophilusm, Campylobacter jejuni, Haemophilus influenzae, Serratia marcescens, Citrobacter amalonaticus, Myxococcus xanthus, Fusobacterium nuleatum, Penicillium chrysogenum, marine gamma proteobacterium, butyrate-producing bacterium, Nocardia iowensis, Nocardia farcinica, Streptomyces griseus, Schizosaccharomyces pombe, Geobacillus thermoglucosidasius, Salmonella typhimurium, Vibrio cholera, Heliobacter pylori, Nicotiana tabacum, Oryza sativa, Haloferax mediterranei, Agrobacterium tumefaciens, Achromobacter denitrificans, Fusobacterium nucleatum, Streptomyces clavuligenus, Acinetobacter baumanii, Mus musculus, Lachancea kluyveri, Trichomonas vaginalis, Trypanosoma brucei, Pseudomonas stutzeri, Bradyrhizobium japonicum, Mesorhizobium loti, Bos taurus, Nicotiana glutinosa, Vibrio vulnificus, Selenomonas ruminantium, Vibrio parahaemolyticus, Archaeoglobus fulgidus, Haloarcula marismortui, Pyrobaculum aerophilum, Mycobacterium smegmatis MC2 155, Mycobacterium avium subsp. paratuberculosis K-10, Mycobacterium marinum M, Tsukamurella paurometabola DSM 20162, Cyanobium PCC7001, Dictyostelium discoideum AX4, and others disclosed herein (see Examples). For example, microbial organisms having 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine biosynthetic production are exemplified herein with reference to E. coli and yeast hosts. However, with the complete genome sequence available for now more than 550 species (with more than half of these available on public databases such as the NCBI), including 395 microorganism genomes and a variety of yeast, fungi, plant, and mammalian genomes, the identification of genes encoding the requisite 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine biosynthetic activity for one or more genes in related or distant species, including for example, homologues, orthologs, paralogs and nonorthologous gene displacements of known genes, and the interchange of genetic alterations between organisms is routine and well known in the art. Accordingly, the metabolic alterations allowing biosynthesis of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine and other compounds of the disclosure described herein with reference to a particular organism such as E. coli or yeast can be readily applied to other microorganisms, including prokaryotic and eukaryotic organisms alike. Given the teachings and guidance provided herein, those skilled in the art will know that a metabolic alteration exemplified in one organism can be applied equally to other organisms.

[0126] In some instances, such as when an alternative 4-HB, 4-HBal, BDO or putrescine biosynthetic pathway exists in an unrelated species, 4-HB, 4-HBal, BDO or putrescine biosynthesis can be conferred onto the host species by, for example, exogenous expression of a paralog or paralogs from the unrelated species that catalyzes a similar, yet non-identical metabolic reaction to replace the referenced reaction. Because certain differences among metabolic networks exist between different organisms, those skilled in the art will understand that the actual gene usage between different organisms may differ. However, given the teachings and guidance provided herein, those skilled in the art also will understand that the teachings and methods of the disclosure can be applied to all microbial organisms using the cognate metabolic alterations to those exemplified herein to construct a microbial organism in a species of interest that will synthesize 4-HB, such as monomeric 4-HB, 4-HBal, BDO or putrescine.

[0127] Host microbial organisms can be selected from, and the non-naturally occurring microbial organisms generated in, for example, bacteria, yeast, fungus or any of a variety of other microorganisms applicable to fermentation processes. Exemplary bacteria include any species selected from the order Enterobacteriales, family Enterobacteriaceae, including the genera Escherichia and Klebsiella; the order Aeromonadales, family Succinivibrionaceae, including the genus Anaerobiospirillum; the order Pasteurellales, family Pasteurellaceae, including the genera Actinobacillus and Mannheimia; the order Rhizobiales, family Bradyrhizobiaceae, including the genus Rhizobium; the order Bacillales, family Bacillaceae, including the genus Bacillus; the order Actinomycetales, families Corynebacteriaceae and Streptomycetaceae, including the genus Corynebacterium and the genus Streptomyces, respectively; order Rhodospirillales, family Acetobacteraceae, including the genus Gluconobacter; the order Sphingomonadales, family Sphingomonadaceae, including the genus Zymomonas; the order Lactobacillales, families Lactobacillaceae and Streptococcaceae, including the genus Lactobacillus and the genus Lactococcus, respectively; the order Clostridiales, family Clostridiaceae, genus Clostridium; and the order Pseudomonadales, family Pseudomonadaceae, including the genus Pseudomonas. Non-limiting species of host bacteria include Escherichia coli, Klebsiella oxytoca, Anaerobiospirillum succiniciproducens, Actinobacillus succinogenes, Mannheimia succiniciproducens, Rhizobium etli, Bacillus subtilis, Corynebacterium glutamicum, Gluconobacter oxydans, Zymomonas mobilis, Lactococcus lactis, Lactobacillus plantarum, Streptomyces coelicolor, Clostridium acetobutylicum, Pseudomonas fluorescens, and Pseudomonas putida.

[0128] Similarly, exemplary species of yeast or fungi include any species selected from the order Saccharomycetales, family Saccaromycetaceae, including the genera Saccharomyces, Kluyveromyces and Pichia; the order Saccharomycetales, family Dipodascaceae, including the genus Yarrowia; the order Schizosaccharomycetales, family Schizosaccaromycetaceae, including the genus Schizosaccharomyces; the order Eurotiales, family Trichocomaceae, including the genus Aspergillus; and the order Mucorales, family Mucoraceae, including the genus Rhizopus. Non-limiting species of host yeast or fungi include Saccharomyces cerevisiae, Schizosaccharomyces pombe, Kluyveromyces lactis, Kluyveromyces marxianus, Aspergillus terreus, Aspergillus niger, Pichia pastoris, Rhizopus arrhizus, Rhizobus oryzae, Yarrowia lipolytica, and the like. E. coli is a particularly useful host organism since it is a well characterized microbial organism suitable for genetic engineering. Other particularly useful host organisms include yeast such as Saccharomyces cerevisiae. It is understood that any suitable microbial host organism can be used to introduce metabolic and/or genetic modifications to produce a desired product.

[0129] Methods for constructing and testing the expression levels of a non-naturally occurring 4-HB-, 4-HBal-, 4-HBCoA-, BDO-, or putrescine-producing host can be performed, for example, by recombinant and detection methods well known in the art. Such methods can be found described in, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, Third Ed., Cold Spring Harbor Laboratory, New York (2001); Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, MD (1999). 4-HB and GBL can be separated by, for example, HPLC using a Spherisorb 5 ODS1 column and a mobile phase of 70% 10 mM phosphate buffer (pH=7) and 30% methanol, and detected using a UV detector at 215 nm (Hennessy et al. 2004, J. Forensic Sci. 46(6):1-9). BDO is detected by gas chromatography or by HPLC and refractive index detector using an Aminex HPX-87H column and a mobile phase of 0.5 mM sulfuric acid (Gonzalez-Pajuelo et al., Met. Eng. 7:329-336 (2005)).

[0130] Exogenous nucleic acid sequences involved in a pathway for production of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine can be introduced stably or transiently into a host cell using techniques well known in the art including, but not limited to, conjugation, electroporation, chemical transformation, transduction, transfection, and ultrasound transformation. For exogenous expression in E. coli or other prokaryotic cells, some nucleic acid sequences in the genes or cDNAs of eukaryotic nucleic acids can encode targeting signals such as an N-terminal mitochondrial or other targeting signal, which can be removed before transformation into prokaryotic host cells, if desired. For example, removal of a mitochondrial leader sequence led to increased expression in E. coli (Hoffmeister et al., J. Biol. Chem. 280:4329-4338 (2005)). For exogenous expression in yeast or other eukaryotic cells, genes can be expressed in the cytosol without the addition of leader sequence, or can be targeted to mitochondrion or other organelles, or targeted for secretion, by the addition of a suitable targeting sequence such as a mitochondrial targeting or secretion signal suitable for the host cells. Thus, it is understood that appropriate modifications to a nucleic acid sequence to remove or include a targeting sequence can be incorporated into an exogenous nucleic acid sequence to impart desirable properties. Furthermore, genes can be subjected to codon optimization with techniques well known in the art to achieve optimized expression of the proteins.

[0131] An expression vector or vectors can be constructed to harbor one or more 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine biosynthetic pathway and/or one or more biosynthetic encoding nucleic acids as exemplified herein operably linked to expression control sequences functional in the host organism. Expression vectors applicable for use in the microbial host organisms of the disclosure include, for example, plasmids, phage vectors, viral vectors, episomes and artificial chromosomes, including vectors and selection sequences or markers operable for stable integration into a host chromosome. Additionally, the expression vectors can include one or more selectable marker genes and appropriate expression control sequences. Selectable marker genes also can be included that, for example, provide resistance to antibiotics or toxins, complement auxotrophic deficiencies, or supply critical nutrients not in the culture media. Expression control sequences can include constitutive and inducible promoters, transcription enhancers, transcription terminators, and the like which are well known in the art. When two or more exogenous encoding nucleic acids are to be co-expressed, both nucleic acids can be inserted, for example, into a single expression vector or in separate expression vectors. For single vector expression, the encoding nucleic acids can be operationally linked to one common expression control sequence or linked to different expression control sequences, such as one inducible promoter and one constitutive promoter. The transformation of exogenous nucleic acid sequences involved in a metabolic or synthetic pathway can be confirmed using methods well known in the art. Such methods include, for example, nucleic acid analysis such as Northern blots or polymerase chain reaction (PCR) amplification of mRNA, or immunoblotting for expression of gene products, or other suitable analytical methods to test the expression of an introduced nucleic acid sequence or its corresponding gene product. It is understood by those skilled in the art that the exogenous nucleic acid is expressed in a sufficient amount to produce the desired product, and it is further understood that expression levels can be optimized to obtain sufficient expression using methods well known in the art and as disclosed herein.

[0132] The non-naturally occurring microbial organisms of the disclosure are constructed using methods well known in the art as exemplified herein to exogenously express at least one nucleic acid encoding a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway enzyme in sufficient amounts to produce 4-HB, such as monomeric 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine. It is understood that the microbial organisms of the disclosure are cultured under conditions sufficient to produce 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine. Exemplary levels of expression for 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine enzymes in each pathway are described further below in the Examples. Following the teachings and guidance provided herein, the non-naturally occurring microbial organisms of the disclosure can achieve biosynthesis of 4-HB, such as monomeric 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine resulting in intracellular concentrations between about 0.1-200 mM or more, for example, 0.1-25 mM or more. Generally, the intracellular concentration of 4-HB, such as monomeric 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine is between about 3-150 mM or more, particularly about 5-125 mM or more, and more particularly between about 8-100 mM, for example, about 3-20mM, particularly between about 5-15 mM and more particularly between about 8-12 mM, including about 10 mM, 20 mM, 50 mM, 80 mM or more. Intracellular concentrations between and above each of these exemplary ranges also can be achieved from the non-naturally occurring microbial organisms of the disclosure. In particular aspects, the microbial organisms of the disclosure, particularly strains such as those disclosed herein (see Examples XII-XIX and Table 28), can provide improved production of a desired product such as 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine by increasing the production of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine and/or decreasing undesirable byproducts. Such production levels include, but are not limited to, those disclosed herein and including from about 1 gram to about 25 grams per liter, for example about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or even higher amounts of product per liter.

[0133] In addition to the culturing and fermentation conditions disclosed herein, growth condition for achieving biosynthesis of BDO, 4-HB, 4-HBCoA, 4-HBal and/or putrescine can include the addition of an osmoprotectant to the culturing conditions. In certain aspects, the non-naturally occurring microbial organisms of the disclosure can be sustained, cultured or fermented as described herein in the presence of an osmoprotectant. Briefly, an osmoprotectant refers to a compound that acts as an osmolyte and helps a microbial organism as described herein survive osmotic stress. Osmoprotectants include, but are not limited to, betaines, amino acids, and the sugar trehalose. Non-limiting examples of such are glycine betaine, praline betaine, dimethylthetin, dimethylslfonioproprionate, 3-dimethylsulfonio-2-methylproprionate, pipecolic acid, dimethylsulfonioacetate, choline, L-carnitine and ectoine. In one aspect, the osmoprotectant is glycine betaine. It is understood to one of ordinary skill in the art that the amount and type of osmoprotectant suitable for protecting a microbial organism described herein from osmotic stress will depend on the microbial organism used. The amount of osmoprotectant in the culturing conditions can be, for example, no more than about 0.1 mM, no more than about 0.5 mM, no more than about 1.0 mM, no more than about 1.5 mM, no more than about 2.0 mM, no more than about 2.5 mM, no more than about 3.0 mM, no more than about 5.0 mM, no more than about 7.0 mM, no more than about 10mM, no more than about 50mM, no more than about 100mM or no more than about 500mM.

[0134] In some aspects, culture conditions include anaerobic or substantially anaerobic growth or maintenance conditions. Exemplary anaerobic conditions have been described previously and are well known in the art. Exemplary anaerobic conditions for fermentation processes are described herein and are described, for example, in U.S. publication 2009/0047719, filed August 10, 2007. Any of these conditions can be employed with the non-naturally occurring microbial organisms as well as other anaerobic conditions well known in the art. Under such anaerobic conditions or substantially anaerobic, the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine producers can synthesize 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine at intracellular concentrations of 5-10 mM or more as well as all other concentrations exemplified herein. It is understood that, even though the above description refers to intracellular concentrations, 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine producing microbial organisms can produce 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine intracellularly and/or secrete the product into the culture medium.

[0135] Exemplary fermentation processes include, but are not limited to, fed-batch fermentation and batch separation; fed-batch fermentation and continuous separation; and continuous fermentation and continuous separation. In an exemplary batch fermentation protocol, the production organism is grown in a suitably sized bioreactor sparged with an appropriate gas. Under anaerobic conditions, the culture is sparged with an inert gas or combination of gases, for example, nitrogen, N2/CO2 mixture, argon, helium, and the like. As the cells grow and utilize the carbon source, additional carbon source(s) and/or other nutrients are fed into the bioreactor at a rate approximately balancing consumption of the carbon source and/or nutrients. The temperature of the bioreactor is maintained at a desired temperature, generally in the range of 22-37 degrees C, but the temperature can be maintained at a higher or lower temperature depending on the the growth characteristics of the production organism and/or desired conditions for the fermentation process. Growth continues for a desired period of time to achieve desired characteristics of the culture in the fermenter, for example, cell density, product concentration, and the like. In a batch fermentation process, the time period for the fermentation is generally in the range of several hours to several days, for example, 8 to 24 hours, or 1, 2, 3, 4 or 5 days, or up to a week, depending on the desired culture conditions. The pH can be controlled or not, as desired, in which case a culture in which pH is not controlled will typically decrease to pH 3-6 by the end of the run. Upon completion of the cultivation period, the fermenter contents can be passed through a cell separation unit, for example, a centrifuge, filtration unit, and the like, to remove cells and cell debris. In the case where the desired product is expressed intracellularly, the cells can be lysed or disrupted enzymatically or chemically prior to or after separation of cells from the fermentation broth, as desired, in order to release additional product. The fermentation broth can be transferred to a product separations unit. Isolation of product occurs by standard separations procedures employed in the art to separate a desired product from dilute aqueous solutions. Such methods include, but are not limited to, liquid-liquid extraction using a water immiscible organic solvent (e.g., toluene or other suitable solvents, including but not limited to diethyl ether, ethyl acetate, tetrahydrofuran (THF), methylene chloride, chloroform, benzene, pentane, hexane, heptane, petroleum ether, methyl tertiary butyl ether (MTBE), dioxane, dimethylformamide (DMF), dimethyl sulfoxide (DMSO), and the like) to provide an organic solution of the product, if appropriate, standard distillation methods, and the like, depending on the chemical characteristics of the product of the fermentation process.

[0136] In an exemplary fully continuous fermentation protocol, the production organism is generally first grown up in batch mode in order to achieve a desired cell density. When the carbon source and/or other nutrients are exhausted, feed medium of the same composition is supplied continuously at a desired rate, and fermentation liquid is withdrawn at the same rate. Under such conditions, the product concentration in the bioreactor generally remains constant, as well as the cell density. The temperature of the fermenter is maintained at a desired temperature, as discussed above. During the continuous fermentation phase, it is generally desirable to maintain a suitable pH range for optimized production. The pH can be monitored and maintained using routine methods, including the addition of suitable acids or bases to maintain a desired pH range. The bioreactor is operated continuously for extended periods of time, generally at least one week to several weeks and up to one month, or longer, as appropriate and desired. The fermentation liquid and/or culture is monitored periodically, including sampling up to every day, as desired, to assure consistency of product concentration and/or cell density. In continuous mode, fermenter contents are constantly removed as new feed medium is supplied. The exit stream, containing cells, medium, and product, are generally subjected to a continuous product separations procedure, with or without removing cells and cell debris, as desired. Continuous separations methods employed in the art can be used to separate the product from dilute aqueous solutions, including but not limited to continuous liquid-liquid extraction using a water immiscible organic solvent (e.g., toluene or other suitable solvents, including but not limited to diethyl ether, ethyl acetate, tetrahydrofuran (THF), methylene chloride, chloroform, benzene, pentane, hexane, heptane, petroleum ether, methyl tertiary butyl ether (MTBE), dioxane, dimethylformamide (DMF), dimethyl sulfoxide (DMSO), and the like), standard continuous distillation methods, and the like, or other methods well known in the art.

[0137] In some aspects, the carbon feedstock and other cellular uptake sources such as phosphate, ammonia, sulfate, chloride and other halogens can be chosen to alter the isotopic distribution of the atoms present in 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine or any 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway intermediate. The various carbon feedstock and other uptake sources enumerated above will be referred to herein, collectively, as "uptake sources." Uptake sources can provide isotopic enrichment for any atom present in the product 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine or 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway intermediate including any 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine impurities generated in diverging away from the pathway at any point. Isotopic enrichment can be achieved for any target atom including, for example, carbon, hydrogen, oxygen, nitrogen, sulfur, phosphorus, chloride or other halogens.

[0138] In some aspects, the uptake sources can be selected to alter the carbon-12, carbon-13, and carbon-14 ratios. In some aspects, the uptake sources can be selected to alter the oxygen-16, oxygen-17, and oxygen-18 ratios. In some aspects, the uptake sources can be selected to alter the hydrogen, deuterium, and tritium ratios. In some aspects, the uptake sources can be selected to alter the nitrogen-14 and nitrogen-15 ratios. In some aspects, the uptake sources can be selected to alter the sulfur-32, sulfur-33, sulfur-34, and sulfur-35 ratios. In some aspects, the uptake sources can be selected to alter the phosphorus-31, phosphorus-32, and phosphorus-33 ratios. In some aspects, the uptake sources can be selected to alter the chlorine-35, chlorine-36, and chlorine-37 ratios.

[0139] In some aspects, the isotopic ratio of a target atom can be varied to a desired ratio by selecting one or more uptake sources. An uptake source can be derived from a natural source, as found in nature, or from a man-made source, and one skilled in the art can select a natural source, a man-made source, or a combination thereof, to achieve a desired isotopic ratio of a target atom. An example of a man-made uptake source includes, for example, an uptake source that is at least partially derived from a chemical synthetic reaction. Such isotopically enriched uptake sources can be purchased commercially or prepared in the laboratory and/or optionally mixed with a natural source of the uptake source to achieve a desired isotopic ratio. In some aspects, a target atom isotopic ratio of an uptake source can be achieved by selecting a desired origin of the uptake source as found in nature. For example, as discussed herein, a natural source can be a biobased derived from or synthesized by a biological organism or a source such as petroleum-based products or the atmosphere. In some such aspects, a source of carbon, for example, can be selected from a fossil fuel-derived carbon source, which can be relatively depleted of carbon-14, or an environmental or atmospheric carbon source, such as CO2, which can possess a larger amount of carbon-14 than its petroleum-derived counterpart.

[0140] The unstable carbon isotope carbon-14 or radiocarbon makes up for roughly 1 in 1012 carbon atoms in the earth's atmosphere and has a half-life of about 5700 years. The stock of carbon is replenished in the upper atmosphere by a nuclear reaction involving cosmic rays and ordinary nitrogen (14N). Fossil fuels contain no carbon-14, as it decayed long ago. Burning of fossil fuels lowers the atmospheric carbon-14 fraction, the so-called "Suess effect".

[0141] Methods of determining the isotopic ratios of atoms in a compound are well known to those skilled in the art. Isotopic enrichment is readily assessed by mass spectrometry using techniques known in the art such as accelerated mass spectrometry (AMS), Stable Isotope Ratio Mass Spectrometry (SIRMS) and Site-Specific Natural Isotopic Fractionation by Nuclear Magnetic Resonance (SNIF-NMR). Such mass spectral techniques can be integrated with separation techniques such as liquid chromatography (LC), high performance liquid chromatography (HPLC) and/or gas chromatography, and the like.

[0142] In the case of carbon, ASTM D6866 was developed in the United States as a standardized analytical method for determining the biobased content of solid, liquid, and gaseous samples using radiocarbon dating by the American Society for Testing and Materials (ASTM) International. The standard is based on the use of radiocarbon dating for the determination of a product's biobased content. ASTM D6866 was first published in 2004, and the current active version of the standard is ASTM D6866-11 (effective April 1, 2011). Radiocarbon dating techniques are well known to those skilled in the art, including those described herein.

[0143] The biobased content of a compound is estimated by the ratio of carbon-14 (14C) to carbon-12 (12C). Specifically, the Fraction Modern (Fm) is computed from the expression: Fm = (S-B)/(M-B), where B, S and M represent the 14C/12C ratios of the blank, the sample and the modern reference, respectively. Fraction Modern is a measurement of the deviation of the 14C/12C ratio of a sample from "Modern." Modern is defined as 95% of the radiocarbon concentration (in AD 1950) of National Bureau of Standards (NBS) Oxalic Acid I (i.e., standard reference materials (SRM) 4990b) normalized to δ13CVPDB=-19 per mil. Olsson, The use of Oxalic acid as a Standard. in, Radiocarbon Variations and Absolute Chronology, Nobel Symposium, 12th Proc., John Wiley & Sons, New York (1970). Mass spectrometry results, for example, measured by ASM, are calculated using the internationally agreed upon definition of 0.95 times the specific activity of NBS Oxalic Acid I (SRM 4990b) normalized to δ13CVPDB=-19 per mil. This is equivalent to an absolute (AD 1950) 14C/12C ratio of 1.176 ± 0.010 x 10-12 (Karlen et al., Arkiv Geofysik, 4:465-471 (1968)). The standard calculations take into account the differential uptake of one isotope with respect to another, for example, the preferential uptake in biological systems of C12 over C13 over C14, and these corrections are reflected as a Fm corrected for δ13.

[0144] An oxalic acid standard (SRM 4990b or HOx 1) was made from a crop of 1955 sugar beet. Although there were 1000 lbs made, this oxalic acid standard is no longer commercially available. The Oxalic Acid II standard (HOx 2; N.I.S.T designation SRM 4990 C) was made from a crop of 1977 French beet molasses. In the early 1980's, a group of 12 laboratories measured the ratios of the two standards. The ratio of the activity of Oxalic acid II to 1 is 1.2933±0.001 (the weighted mean). The isotopic ratio of HOx II is -17.8 per mille. ASTM D6866-11 suggests use of the available Oxalic Acid II standard SRM 4990 C (Hox2) for the modern standard (see discussion of original vs. currently available oxalic acid standards in Mann, Radiocarbon, 25(2):519-527 (1983)). A Fm = 0% represents the entire lack of carbon-14 atoms in a material, thus indicating a fossil (for example, petroleum based) carbon source. A Fm = 100%, after correction for the post-1950 injection of carbon-14 into the atmosphere from nuclear bomb testing, indicates an entirely modern carbon source. As described herein, such a "modern" source includes biobased sources.

[0145] As described in ASTM D6866, the percent modern carbon (pMC) can be greater than 100% because of the continuing but diminishing effects of the 1950s nuclear testing programs, which resulted in a considerable enrichment of carbon-14 in the atmosphere as described in ASTM D6866-11. Because all sample carbon-14 activities are referenced to a "pre-bomb" standard, and because nearly all new biobased products are produced in a post-bomb environment, all pMC values (after correction for isotopic fraction) must be multiplied by 0.95 (as of 2010) to better reflect the true biobased content of the sample. A biobased content that is greater than 103% suggests that either an analytical error has occurred, or that the source of biobased carbon is more than several years old.

[0146] ASTM D6866 quantifies the biobased content relative to the material's total organic content and does not consider the inorganic carbon and other non-carbon containing substances present. For example, a product that is 50% starch-based material and 50% water would be considered to have a Biobased Content = 100% (50% organic content that is 100% biobased) based on ASTM D6866. In another example, a product that is 50% starch-based material, 25% petroleum-based, and 25% water would have a Biobased Content = 66.7% (75% organic content but only 50% of the product is biobased). In another example, a product that is 50% organic carbon and is a petroleum-based product would be considered to have a Biobased Content = 0% (50% organic carbon but from fossil sources). Thus, based on the well known methods and known standards for determining the biobased content of a compound or material, one skilled in the art can readily determine the biobased content and/or prepared downstream products that utilize of the disclosure having a desired biobased content.

[0147] Applications of carbon-14 dating techniques to quantify bio-based content of materials are known in the art (Currie et al., Nuclear Instruments and Methods in Physics Research B, 172:281-287 (2000)). For example, carbon-14 dating has been used to quantify bio-based content in terephthalate-containing materials (Colonna et al., Green Chemistry, 13:2543-2548 (2011)). Notably, polypropylene terephthalate (PPT) polymers derived from renewable 1,3-propanediol and petroleum-derived terephthalic acid resulted in Fm values near 30% (i.e., since 3/11 of the polymeric carbon derives from renewable 1,3-propanediol and 8/11 from the fossil end member terephthalic acid) (Currie et al., supra, 2000). In contrast, polybutylene terephthalate polymer derived from both renewable 1,4-butanediol and renewable terephthalic acid resulted in bio-based content exceeding 90% (Colonna et al., supra, 2011).

[0148] Accordingly, in some aspects, the present disclosure provides 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine or a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine intermediate that has a carbon-12, carbon-13, and carbon-14 ratio that reflects an atmospheric carbon uptake source. For example, in some aspects the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine or a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine intermediate can have an Fm value of at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or as much as 100%. In some such aspects, the uptake source is CO2. In some aspects, the present disclosure provides 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine or a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine intermediate that has a carbon-12, carbon-13, and carbon-14 ratio that reflects petroleum-based carbon uptake source. In this aspect, the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine or a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine intermediate can have an Fm value of less than 95%, less than 90%, less than 85%, less than 80%, less than 75%, less than 70%, less than 65%, less than 60%, less than 55%, less than 50%, less than 45%, less than 40%, less than 35%, less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, less than 2% or less than 1%. In some aspects, the present disclosure provides 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine or a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine intermediate that has a carbon-12, carbon-13, and carbon-14 ratio that is obtained by a combination of an atmospheric carbon uptake source with a petroleum-based uptake source. Using such a combination of uptake sources is one way by which the carbon-12, carbon-13, and carbon-14 ratio can be varied, and the respective ratios would reflect the proportions of the uptake sources.

[0149] Further, the present disclosure relates to the biologically produced 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine or 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine intermediate as disclosed herein, and to the products derived therefrom, wherein the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine or a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine intermediate has a carbon-12, carbon-13, and carbon-14 isotope ratio of about the same value as the CO2 that occurs in the environment. For example, in some aspects the disclosure provides: bioderived 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine or a bioderived 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine intermediate having a carbon-12 versus carbon-13 versus carbon-14 isotope ratio of about the same value as the CO2 that occurs in the environment, or any of the other ratios disclosed herein. It is understood, as disclosed herein, that a product can have a carbon-12 versus carbon-13 versus carbon-14 isotope ratio of about the same value as the CO2 that occurs in the environment, or any of the ratios disclosed herein, wherein the product is generated from bioderived 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine or a bioderived 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine intermediate as disclosed herein, wherein the bioderived product is chemically modified to generate a final product. Methods of chemically modifying a bioderived product of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine, or an intermediate thereof, to generate a desired product are well known to those skilled in the art, as described herein. The disclosure further provides plastics, elastic fibers, polyurethanes, polyesters, including polyhydroxyalkanoates such as poly-4-hydroxybutyrate (P4HB) or co-polymers thereof, poly(tetramethylene ether) glycol (PTMEG)(also referred to as PTMO, polytetramethylene oxide), polybutylene terepthalate (PBT), and polyurethane-polyurea copolymers, referred to as spandex, elastane or Lycra™, nylons, and the like, having a carbon-12 versus carbon-13 versus carbon-14 isotope ratio of about the same value as the CO2 that occurs in the environment, wherein the plastics, elastic fibers, polyurethanes, polyesters, including polyhydroxyalkanoates such as poly-4-hydroxybutyrate (P4HB) or co-polymers thereof, poly(tetramethylene ether) glycol (PTMEG)(also referred to as PTMO, polytetramethylene oxide), polybutylene terepthalate (PBT), and polyurethane-polyurea copolymers, referred to as spandex, elastane or Lycra™, and nylons are generated directly from or in combination with bioderived 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine or a bioderived 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine intermediate as disclosed herein.

[0150] The products 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine are chemicals commonly used in many commercial and industrial applications. Non-limiting examples of such applications include production of plastics, elastic fibers, polyurethanes, polyesters, including polyhydroxyalkanoates such as poly-4-hydroxybutyrate (P4HB) or co-polymers thereof, poly(tetramethylene ether) glycol (PTMEG)(also referred to as PTMO, polytetramethylene oxide), polybutylene terepthalate (PBT), and polyurethane-polyurea copolymers, referred to as spandex, elastane or Lycra™, and nylons. Moreover, 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine are also used as a raw material in the production of a wide range of products including plastics, elastic fibers, polyurethanes, polyesters, including polyhydroxyalkanoates such as poly-4-hydroxybutyrate (P4HB) or co-polymers thereof, poly(tetramethylene ether) glycol (PTMEG)(also referred to as PTMO, polytetramethylene oxide), polybutylene terepthalate (PBT), and polyurethane-polyurea copolymers, referred to as spandex, elastane or Lycra™, nylons. Accordingly, in some aspects, the disclosure provides biobased plastics, elastic fibers, polyurethanes, polyesters, including polyhydroxyalkanoates such as poly-4-hydroxybutyrate (P4HB) or co-polymers thereof, poly(tetramethylene ether) glycol (PTMEG)(also referred to as PTMO, polytetramethylene oxide), polybutylene terepthalate (PBT), and polyurethane-polyurea copolymers, referred to as spandex, elastane or Lycra™, nylons comprising one or more bioderived 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine or bioderived 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine intermediate produced by a non-naturally occurring microorganism of the disclosure or produced using a method disclosed herein.

[0151] As used herein, the term "bioderived" means derived from or synthesized by a biological organism and can be considered a renewable resource since it can be generated by a biological organism. Such a biological organism, in particular the microbial organisms of the disclosure disclosed herein, can utilize feedstock or biomass, such as, sugars or carbohydrates obtained from an agricultural, plant, bacterial, or animal source. Alternatively, the biological organism can utilize atmospheric carbon. As used herein, the term "biobased" means a product as described above that is composed, in whole or in part, of a bioderived compound of the disclosure. A biobased or bioderived product is in contrast to a petroleum derived product, wherein such a product is derived from or synthesized from petroleum or a petrochemical feedstock.

[0152] In some aspects, the disclosure provides plastics, elastic fibers, polyurethanes, polyesters, including polyhydroxyalkanoates such as poly-4-hydroxybutyrate (P4HB) or co-polymers thereof, poly(tetramethylene ether) glycol (PTMEG)(also referred to as PTMO, polytetramethylene oxide), polybutylene terepthalate (PBT), and polyurethane-polyurea copolymers, referred to as spandex, elastane or Lycra™, nylons comprising bioderived 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine or bioderived 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine intermediate, wherein the bioderived 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine or bioderived 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine intermediate includes all or part of the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine or 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine intermediate used in the production of plastics, elastic fibers, polyurethanes, polyesters, including polyhydroxyalkanoates such as poly-4-hydroxybutyrate (P4HB) or co-polymers thereof, poly(tetramethylene ether) glycol (PTMEG)(also referred to as PTMO, polytetramethylene oxide), polybutylene terepthalate (PBT), and polyurethane-polyurea copolymers, referred to as spandex, elastane or Lycra™, and nylons. Thus, in some aspects, the disclosure provides a biobased plastics, elastic fibers, polyurethanes, polyesters, including polyhydroxyalkanoates such as poly-4-hydroxybutyrate (P4HB) or co-polymers thereof, poly(tetramethylene ether) glycol (PTMEG)(also referred to as PTMO, polytetramethylene oxide), polybutylene terepthalate (PBT), and polyurethane-polyurea copolymers, referred to as spandex, elastane or Lycra™, and nylons comprising at least 2%, at least 3%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98% or 100% bioderived 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine or bioderived 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine intermediate as disclosed herein. Additionally, in some aspects, the disclosure provides a biobased plastics, elastic fibers, polyurethanes, polyesters, including polyhydroxyalkanoates such as poly-4-hydroxybutyrate (P4HB) or co-polymers thereof, poly(tetramethylene ether) glycol (PTMEG)(also referred to as PTMO, polytetramethylene oxide), polybutylene terepthalate (PBT), and polyurethane-polyurea copolymers, referred to as spandex, elastane or Lycra™, and nylons wherein the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine or 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine intermediate used in its production is a combination of bioderived and petroleum derived 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine or 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine intermediate. For example, a biobased plastics, elastic fibers, polyurethanes, polyesters, including polyhydroxyalkanoates such as poly-4-hydroxybutyrate (P4HB) or co-polymers thereof, poly(tetramethylene ether) glycol (PTMEG)(also referred to as PTMO, polytetramethylene oxide), polybutylene terepthalate (PBT), and polyurethane-polyurea copolymers, referred to as spandex, elastane or Lycra™, and nylons can be produced using 50% bioderived the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine and 50% petroleum derived 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine or other desired ratios such as 60%/40%, 70%/30%, 80%/20%, 90%/10%, 95%/5%, 100%/0%, 40%/60%, 30%/70%, 20%/80%, 10%/90% of bioderived/petroleum derived precursors, so long as at least a portion of the product comprises a bioderived product produced by the microbial organisms disclosed herein. It is understood that methods for producing plastics, elastic fibers, polyurethanes, polyesters, including polyhydroxyalkanoates such as poly-4-hydroxybutyrate (P4HB) or co-polymers thereof, poly(tetramethylene ether) glycol (PTMEG)(also referred to as PTMO, polytetramethylene oxide), polybutylene terepthalate (PBT), and polyurethane-polyurea copolymers, referred to as spandex, elastane or Lycra™, and nylons using the bioderived 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine or bioderived 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine intermediate of the disclosure are well known in the art.

[0153] The disclosure additionally provides culture medium, which can be fermentation broth, comprising bioderived 4-hydroxybutyrate or 1,4-butanediol, or other products disclosed herein, for example, 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine, wherein the bioderived product has a carbon-12, carbon-13 and carbon-14 isotope ratio that reflects an atmospheric carbon dioxide uptake source. Such culture medium can comprise bioderived products such as 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine produced by a microbial organism of the disclosure as disclosed herein. In a particular aspects, the culture medium can be separated from a non-naturally occurring microbial organism having a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway, for example, a 4-hydroxybutyrate or 1,4-butanediol pathway. In another aspects, the disclosure provides bioderived a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine, for example, 4-hydroxybutyrate or 1,4-butanediol, having a carbon-12, carbon-13 and carbon-14 isotope ratio that reflects an atmospheric carbon dioxide uptake source, for example, produced by a microbial organism of the disclosure. In a particular aspects, the bioderived a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine, for example, 4-hydroxybutyrate or 1,4-butanediol of claim 4, can have an Fm value of at least 80%, at least 85%, at least 90%, at least 95% or at least 98%. Such bioderived products of the disclosure can be produced by the microbial organisms or methods of the disclosure, as disclosed herein.

[0154] The disclosure further provides a composition comprising bioderived 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine, for example, 4-hydroxybutyrate or 1,4-butanediol, and a compound other than the bioderived 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine, for example, 4-hydroxybutyrate or 1,4-butanediol. The compound other than the bioderived product can be a cellular portion, for example, a trace amount of a cellular portion of, or can be fermentation broth or culture medium or a purified or partially purified fraction thereof produced in the presence of, a non-naturally occurring microbial organism of the disclosure having a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine, for example, for example, a 4-hydroxybutyrate or 1,4-butanediol pathway. The composition can comprise, for example, a reduced level of a byproduct when produced by an organism having reduced byproduct formation, as disclosed herein. The composition can comprise, for example, bioderived 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine, for example, 4-hydroxybutyrate or 1,4-butanediol, or a cell lysate or culture supernatant of a microbial organism of the disclosure.

[0155] The disclosure additionally provides a biobased product comprising biobased 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine, where the biobased product is a plastic, elastic fiber, polyurethane, polyester, polyhydroxyalkanoate, poly-4-hydroxybutyrate (P4HB), or a co-polymer thereof, poly(tetramethylene ether) glycol (PTMEG), polybutylene terephthalate (PBT), polyurethane-polyurea copolymer, or nylon. In one aspects, the biobased product can comprise at least 5%, at least 10%, at least 20%, at least 30%, at least 40% or at least 50% bioderived 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine, for example, 4-hydroxybutyrate or 1,4-butanediol. In another aspects, a portion of the biobased product can comprise bioderived 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine, for example, 4-hydroxybutyrate or 1,4-butanediol, as a repeating unit, alone or in combination with other monomeric units to form a polymer. In another aspects, the disclosure provides a molded product obtained by molding a biobased product such as a plastic, elastic fiber, polyurethane, polyester, polyhydroxyalkanoate, poly-4-hydroxybutyrate (P4HB), or a co-polymer thereof, poly(tetramethylene ether) glycol (PTMEG), polybutylene terephthalate (PBT), polyurethane-polyurea copolymer, or nylon, or other product as disclosed herein. The disclosure further provides a process for producing a biobased product by chemically reacting bioderived 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine, for example, 4-hydroxybutyrate or 1,4-butanediol, with itself or another compound in a reaction that produces the biobased product. Such bioderived products of the disclosure can be produced by the microbial organisms or methods of the disclosure, as disclosed herein.

[0156] The culture conditions can include, for example, liquid culture procedures as well as fermentation and other large scale culture procedures. As described herein, particularly useful yields of the biosynthetic products of the disclosure can be obtained under anaerobic or substantially anaerobic culture conditions.

[0157] As described herein, one exemplary growth condition for achieving biosynthesis of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine includes anaerobic culture or fermentation conditions. In certain aspects, the non-naturally occurring microbial organisms of the disclosure can be sustained, cultured or fermented under anaerobic or substantially anaerobic conditions. Briefly, anaerobic conditions refers to an environment devoid of oxygen. Substantially anaerobic conditions include, for example, a culture, batch fermentation or continuous fermentation such that the dissolved oxygen concentration in the medium remains between 0 and 10% of saturation. Substantially anaerobic conditions also includes growing or resting cells in liquid medium or on solid agar inside a sealed chamber maintained with an atmosphere of less than 1% oxygen. The percent of oxygen can be maintained by, for example, sparging the culture with an N2/CO2 mixture or other suitable non-oxygen gas or gases.

[0158] The disclosure also provides a non-naturally occurring microbial biocatalyst including a microbial organism having 4-hydroxybutanoic acid (4-HB) and 1,4-butanediol (BDO) biosynthetic pathways that include at least one exogenous nucleic acid encoding 4-hydroxybutanoate dehydrogenase, CoA-independent succinic semialdehyde dehydrogenase, succinyl-CoA synthetase, CoA-dependent succinic semialdehyde dehydrogenase, 4-hydroxybutyrate:CoA transferase, glutamate:succinic semialdehyde transaminase, glutamate decarboxylase, CoA-independent aldehyde dehydrogenase, CoA-dependent aldehyde dehydrogenase or alcohol dehydrogenase, wherein the exogenous nucleic acid is expressed in sufficient amounts to produce 1,4-butanediol (BDO). 4-Hydroxybutyrate:CoA transferase also is known as 4-hydroxybutyryl CoA:acetyl-CoA transferase. Additional 4-HB or BDO pathway enzymes are also disclosed herein (see Examples and Figures 8-13).

[0159] The disclosure further provides non-naturally occurring microbial biocatalyst including a microbial organism having 4-hydroxybutanoic acid (4-HB) and 1,4-butanediol (BDO) biosynthetic pathways, the pathways include at least one exogenous nucleic acid encoding 4-hydroxybutanoate dehydrogenase, succinyl-CoA synthetase, CoA-dependent succinic semialdehyde dehydrogenase, 4-hydroxybutyrate:CoA transferase, 4-butyrate kinase, phosphotransbutyrylase, α-ketoglutarate decarboxylase, aldehyde dehydrogenase, alcohol dehydrogenase or an aldehyde/alcohol dehydrogenase, wherein the exogenous nucleic acid is expressed in sufficient amounts to produce 1,4-butanediol (BDO).

[0160] Non-naturally occurring microbial organisms also can be generated which biosynthesize BDO. As with the 4-HB producing microbial organisms of the disclosure, the BDO producing microbial organisms also can produce intracellularly or secret the BDO into the culture medium. Following the teachings and guidance provided previously for the construction of microbial organisms that synthesize 4-HB, additional BDO pathways can be incorporated into the 4-HB producing microbial organisms to generate organisms that also synthesize BDO and other BDO family compounds. The chemical synthesis of BDO and its downstream products are known. The non-naturally occurring microbial organisms of the disclosure capable of BDO biosynthesis circumvent these chemical synthesis using 4-HB as an entry point as illustrated in Figure 1. As described further below, the 4-HB producers also can be used to chemically convert 4-HB to GBL and then to BDO or THF, for example. Alternatively, the 4-HB producers can be further modified to include biosynthetic capabilities for conversion of 4-HB and/or GBL to BDO.

[0161] The additional BDO pathways to introduce into 4-HB producers include, for example, the exogenous expression in a host deficient background or the overexpression of one or more of the enzymes exemplified in Figure 1 as steps 9-13. One such pathway includes, for example, the enzyme activies necessary to carryout the reactions shown as steps 9, 12 and 13 in Figure 1, where the aldehyde and alcohol dehydrogenases can be separate enzymes or a multifunctional enzyme having both aldehyde and alcohol dehydrogenase activity. Another such pathway includes, for example, the enzyme activities necessary to carry out the reactions shown as steps 10, 11, 12 and 13 in Figure 1, also where the aldehyde and alcohol dehydrogenases can be separate enzymes or a multifunctional enzyme having both aldehyde and alcohol dehydrogenase activity. Accordingly, the additional BDO pathways to introduce into 4-HB producers include, for example, the exogenous expression in a host deficient background or the overexpression of one or more of a 4-hydroxybutyrate:CoA transferase, butyrate kinase, phosphotransbutyrylase, CoA-independent aldehyde dehydrogenase, CoA-dependent aldehyde dehydrogenase or an alcohol dehydrogenase. In the absence of endogenous acyl-CoA synthetase capable of modifying 4-HB, the non-naturally occurring BDO producing microbial organisms can further include an exogenous acyl-CoA synthetase selective for 4-HB, or the combination of multiple enzymes that have as a net reaction conversion of 4-HB into 4-HBCoA. As exemplified further below in the Examples, butyrate kinase and phosphotransbutyrylase exhibit BDO pathway activity and catalyze the conversions illustrated in Figure 1 with a 4-HB substrate. Therefore, these enzymes also can be referred to herein as 4-hydroxybutyrate kinase and phosphotranshydroxybutyrylase respectively.

[0162] Exemplary alcohol and aldehyde dehydrogenases that can be used for these in vivo conversions from 4-HB to BDO are listed below in Table 1.
Table 1. Alcohol and Aldehyde Dehydrogenases for Conversion of 4-HB to BDO.
ALCOHOL DEHYDROGENASES
  ec: 1.1.1.28 D-lactate dehydrogenase
ec:1.1.1.1 alcohol dehydrogenase ec:1.1.1.29 glycerate dehydrogenase
ec:1.1.1.2 alcohol dehydrogenase (NADP+) ec:1.1.1.30 3-hydroxybutyrate dehydrogenase
    ec:1.1.1.31 3-hydroxyisobutyrate dehydrogenase
ec:1.1.1.4 (R,R)-butanediol dehydrogenase ec:1.1.1.35 3-hydroxyacyl-CoA dehydrogenase
ec:1.1.1.5 acetoin dehydrogenase ec:1.1.1.36 acetoacetyl-CoA reductase
ec:1.1.1.6 glycerol dehydrogenase ec:1.1.1.37 malate dehydrogenase
ec:1.1.1.7 propanediol-phosphate dehydrogenase ec:1.1.1.38 malate dehydrogenase (oxaloacetate-decarboxylating)
ec:1.1.1.8 glycerol-3-phosphate dehydrogenase (NAD+)    
    ec:1.1.1.39 malate dehydrogenase (decarboxylating)
ec:1.1.1.11 D-arabinitol 4-dehydrogenase ec:1.1.1.40 malate dehydrogenase (oxaloacetate-decarboxylating) (NADP+)
ec:1.1.1.12 L-arabinitol 4-dehydrogenase    
ec:1.1.1.13 L-arabinitol 2-dehydrogenase ec:1.1.1.41 isocitrate dehydrogenase (NAD+)
ec:1.1.1.14 L-iditol 2-dehydrogenase ec:1.1.1.42 isocitrate dehydrogenase (NADP+)
ec:1.1.1.15 D-iditol 2-dehydrogenase ec:1.1.1.54 allyl-alcohol dehydrogenase
ec:1.1.1.16 galactitol 2-dehydrogenase ec:1.1.1.55 lactaldehyde reductase (NADPH)
ec:1.1.1.17 mannitol-1-phosphate 5-dehydrogenase ec: 1.1.1.56 ribitol 2-dehydrogenase
    ec:1.1.1.59 3-hydroxypropionate dehydrogenase
ec:1.1.1.18 inositol 2-dehydrogenase ec:1.1.1.60 2-hydroxy- 3 -oxopropionate reductase
ec:1.1.1.21 aldehyde reductase ec:1.1.1.61 4-hydroxybutyrate dehydrogenase
ec:1.1.1.23 histidinol dehydrogenase ec:1.1.1.66 omega-hydroxydecanoate dehydrogenase
ec:1.1.1.26 glyoxylate reductase  
ec:1.1.1.27 L-lactate dehydrogenase ec:1.1.1.67 mannitol 2 -dehydrogenase
ec:1.1.1.71 alcohol dehydrogenase [NAD(P)+] ec:1.1.1.140 sorbitol-6-phosphate 2-dehydrogenase
ec:1.1.1.72 glycerol dehydrogenase (NADP+) ec:1.1.1.142 D-pinitol dehydrogenase
ec:1.1.1.73 octanol dehydrogenase ec:1.1.1.143 sequoyitol dehydrogenase
ec:1.1.1.75 (R)-aminopropanol dehydrogenase ec:1.1.1.144 perillyl-alcohol dehydrogenase
ec:1.1.1.76 (S,S)-butanediol dehydrogenase ec:1.1.1.156 glycerol 2-dehydrogenase (NADP+)
ec:1.1.1.77 lactaldehyde reductase ec:1.1.1.157 3-hydroxybutyryl-CoA dehydrogenase
ec:1.1.1.78 methylglyoxal reductase (NADH-dependent)
ec:1.1.1.163 cyclopentanol dehydrogenase
ec:1.1.1.79 glyoxylate reductase (NADP+) ec:1.1.1.164 hexadecanol dehydrogenase
ec:1.1.1.80 isopropanol dehydrogenase (NADP+) ec:1.1.1.165 2-alkyn-1-ol dehydrogenase
ec:1.1.1.81 hydroxypyruvate reductase ec:1.1.1.166 hydroxycyclohexanecarboxylate dehydrogenase
ec:1.1.1.82 malate dehydrogenase (NADP+)
ec:1.1.1.83 D-malate dehydrogenase (decarboxylating) ec:1.1.1.167 hydroxymalonate dehydrogenase
ec:1.1.1.174 cyclohexane-1,2-diol dehydrogenase
ec:1.1.1.84 dimethylmalate dehydrogenase ec:1.1.1.177 glycerol-3-phosphate 1-dehydrogenase (NADP+)
ec:1.1.1.85 3-isopropylmalate dehydrogenase
ec:1.1.1.86 ketol-acid reductoisomerase ec:1.1.1.178 3 -hydroxy-2-methylbutyryl-CoA dehydrogenase
ec:1.1.1.87 homoisocitrate dehydrogenase
ec:1.1.1.88 hydroxymethylglutaryl-CoA reductase ec:1.1.1.185 L-glycol dehydrogenase
ec:1.1.1.190 indole-3-acetaldehyde reductase (NADH)
ec:1.1.1.90 aryl-alcohol dehydrogenase
ec:1.1.1.91 aryl-alcohol dehydrogenase (NADP+) ec:1.1.1.191 indole-3-acetaldehyde reductase (NADPH)
ec:1.1.1.92 oxaloglycolate reductase (decarboxylating)
ec:1.1.1.192 long-chain-alcohol dehydrogenase
ec:1.1.1.94 glycerol-3-phosphate dehydrogenase [NAD(P)+] ec:1.1.1.194 coniferyl-alcohol dehydrogenase
ec: 1.1.1.195 cinnamyl-alcohol dehydrogenase
ec:1.1.1.95 phosphoglycerate dehydrogenase ec:1.1.1.198 (+)-borneol dehydrogenase
ec:1.1.1.97 3-hydroxybenzyl-alcohol dehydrogenase ec:1.1.1.202 1,3-propanediol dehydrogenase
ec: 1.1.1.207 (-)-menthol dehydrogenase
ec:1.1.1.101 acylglycerone-phosphate reductase ec:1.1.1.208 (+)-neomenthol dehydrogenase
ec:1.1.1.103 L-threonine 3-dehydrogenase ec:1.1.1.216 farnesol dehydrogenase
ec:1.1.1.104 4-oxoproline reductase ec:1.1.1.217 benzyl-2-methyl-hydroxybutyrate dehydrogenase
ec:1.1.1.105 retinol dehydrogenase
ec:1.1.1.110 indolelactate dehydrogenase ec:1.1.1.222 (R)-4-hydroxyphenyllactate dehydrogenase
ec:1.1.1.112 indanol dehydrogenase
ec:1.1.1.113 L-xylose 1-dehydrogenase ec:1.1.1.223 isopiperitenol dehydrogenase
ec:1.1.1.129 L-threonate 3-dehydrogenase ec:1.1.1.226 4-hydroxycyclohexanecarboxylate dehydrogenase
ec:1.1.1.137 ribitol-5-phosphate 2-dehydrogenase
ec:1.1.1.138 mannitol 2-dehydrogenase (NADP+) reductase ec:1.1.1.229 diethyl 2-methyl-3-oxosuccinate dehydrogenase (phosphorylating)
ec:1.1.1.237 hydroxyphenylpyruvate reductase ec:1.2.1.13 glyceraldehyde-3-phosphate dehydrogenase (NADP+) (phosphorylating)
ec:1.1.1.244 methanol dehydrogenase
ec:1.1.1.245 cyclohexanol dehydrogenase ec:1.2.1.15 malonate-semialdehyde dehydrogenase
ec: 1.1.1.250 D-arabinitol 2-dehydrogenase
ec: 1.1.1.251 galactitol 1-phosphate 5-dehydrogenase ec:1.2.1.16 succinate-semialdehyde dehydrogenase [NAD(P)+]
ec:1.1.1.255 mannitol dehydrogenase ec:1.2.1.17 glyoxylate dehydrogenase (acylating)
ec: 1.1.1.256 fluoren-9-ol dehydrogenase ec:1.2.1.18 malonate-semialdehyde dehydrogenase (acetylating)
ec: 1.1.1.257 4 -(hydroxymethyl)benzene sulfonate dehydrogenase
ec:1.2.1.19 aminobutyraldehyde dehydrogenase
ec: 1.1.1.258 6-hydroxyhexanoate dehydrogenase ec:1.2.1.20 glutarate-semialdehyde dehydrogenase
ec:1.1.1.259 3-hydroxypimeloyl-CoA dehydrogenase
    ec:1.2.1.21 glycolaldehyde dehydrogenase
ec:1.1.1.261 glycerol-1-phosphate dehydrogenase [NAD(P)+] ec:1.2.1.22 lactaldehyde dehydrogenase
    ec:1.2.1.23 2-oxoaldehyde dehydrogenase (NAD+)
ec:1.1.1.265 3-methylbutanal reductase
ec:1.1.1.283 methylglyoxal reductase (NADPH-dependent) ec:1.2.1.24 succinate-semialdehyde dehydrogenase
ec: 1.1.1.286 isocitrate-homoisocitrate dehydrogenase ec:1.2.1.25 2-oxoisovalerate dehydrogenase (acylating)
ec:1.1.1.287 D-arabinitol dehydrogenase (NADP+) butanol dehydrogenase ec:1.2.1.26 2,5-dioxovalerate dehydrogenase
ec:1.2.1.27 methylmalonate-semialdehyde dehydrogenase (acylating)
ALDEHYDE DEHYDROGENASES ec:1.2.1.28 benzaldehyde dehydrogenase (NAD+)
ec:1.2.1.2 formate dehydrogenase
ec:1.2.1.3 aldehyde dehydrogenase (NAD+) ec:1.2.1.29 aryl-aldehyde dehydrogenase
ec:1.2.1.4 aldehyde dehydrogenase (NADP+) ec:1.2.1.30 aryl-aldehyde dehydrogenase (NADP+)
ec:1.2.1.5 aldehyde dehydrogenase [NAD(P)+]
ec:1.2.1.7 benzaldehyde dehydrogenase (NADP+) ec:1.2.1.31 L-aminoadipate-semialdehyde dehydrogenase
ec:1.2.1.8 betaine-aldehyde dehydrogenase ec:1.2.1.32 aminomuconate-semialdehyde dehydrogenase
ec:1.2.1.9 glyceraldehyde-3-phosphate dehydrogenase (NADP+)
ec:1.2.1.36 retinal dehydrogenase
ec:1.2.1.10 acetaldehyde dehydrogenase (acetylating) ec:1.2.1.39 henylacetaldehyde dehydrogenase
ec:1.2.1.41 glutamate-5-semialdehyde dehydrogenase
ec:1.2.1.11 aspartate-semialdehyde dehydrogenase
ec:1.2.1.42 hexadecanal dehydrogenase (acylating)
ec:1.2.1.12 glyceraldehyde-3-phosphate
ec:1.2.1.43 formate dehydrogenase (NADP+)   (acylating)
ec:1.2.1.45 4-carboxy-2-hydroxymuconate-6-semialdehyde dehydrogenase ec:1.2.1.59 glyceraldehyde-3-phosphate dehydrogenase (NAD(P)+) (phosphorylating)
ec:1.2.1.46 formaldehyde dehydrogenase ec:1.2.1.62 4-formylbenzenesulfonate dehydrogenase
ec:1.2.1.47 4-trimethylammoniobutyraldehyde dehydrogenase    
    ec:1.2.1.63 6-oxohexanoate dehydrogenase
ec:1.2.1.48 long-chain-aldehyde dehydrogenase ec:1.2.1.64 4-hydroxybenzaldehyde dehydrogenase
ec:1.2.1.49 2-oxoaldehyde dehydrogenase (NADP+)    
    ec:1.2.1.65 salicylaldehyde dehydrogenase
ec:1.2.1.51 pyruvate dehydrogenase (NADP+) ec:1.2.1.66 mycothiol-dependent formaldehyde dehydrogenase
ec:1.2.1.52 oxoglutarate dehydrogenase (NADP+)    
    ec:1.2.1.67 vanillin dehydrogenase
ec:1.2.1.53 4-hydroxyphenylacetaldehyde dehydrogenase ec:1.2.1.68 coniferyl-aldehyde dehydrogenase
    ec:1.2.1.69 fluoroacetaldehyde dehydrogenase
ec:1.2.1.57 butanal dehydrogenase ec:1.2.1.71 succinylglutamate-semialdehyde dehydrogenas
ec:1.2.1.58 phenylglyoxylate dehydrogenase    


[0163] Other exmplary enzymes and pathways are disclosed herein (see Examples). Furthermore, it is understood that enzymes can be utilized for carry out reactions for which the substrate is not the natural substrate. While the activity for the non-natural substrate may be lower than the natural substrate, it is understood that such enzymes can be utilized, either as naturally occurring or modified using the directed evolution or adaptive evolution, as disclosed herein (see also Examples).

[0164] BDO production through any of the pathways disclosed herein are based, in part, on the identification of the appropriate enzymes for conversion of precursors to BDO. A number of specific enzymes for several of the reaction steps have been identified. For those transformations where enzymes specific to the reaction precursors have not been identified, enzyme candidates have been identified that are best suited for catalyzing the reaction steps. Enzymes have been shown to operate on a broad range of substrates, as discussed below. In addition, advances in the field of protein engineering also make it feasible to alter enzymes to act efficiently on substrates, even if not a natural substrate. Described below are several examples of broad-specificity enzymes from diverse classes suitable for a BDO pathway as well as methods that have been used for evolving enzymes to act on non-natural substrates.

[0165] A key class of enzymes in BDO pathways is the oxidoreductases that interconvert ketones or aldehydes to alcohols (1.1.1). Numerous exemplary enzymes in this class can operate on a wide range of substrates. An alcohol dehydrogenase (1.1.1.1) purified from the soil bacterium Brevibacterium sp KU 1309 (Hirano et al., J. Biosc. Bioeng. 100:318-322 (2005)) was shown to operate on a plethora of aliphatic as well as aromatic alcohols with high activities. Table 2 shows the activity of the enzyme and its Km on different alcohols. The enzyme is reversible and has very high activity on several aldehydes also (Table 3).
Table 2. Relative activities of an alcohol dehydrogenase from Brevibacterium sp KU to oxidize various alcohols.
SubstrateRelative Activity (0%)Km (mM)
2-Phenylethanol 100* 0.025
(S)-2-Phenylpropanol 156 0.157
(R)-2-Phenylpropanol 63 0.020
Bynzyl alcohol 199 0.012
3-Phenylpropanol 135 0.033
Ethanol 76  
1-Butanol 111  
1-Octanol 101  
1-Dodecanol 68  
1-Phenylethanol 46  
2-Propanol 54  
*The activity of 2-phenylethanol, corresponding to 19.2 U/mg, was taken as 100%.
Table 3. Relative activities of an alcohol dehydrogenase from Brevibacterium sp KU 1309 to reduce various carbonyl compounds.
SubstrateRelative Activity (%)Km (mM)
Phenylacetaldehyde 100 0.261
2-Phenylpropionaldehyde 188 0.864
1-Octylaldehyde 87  
Acetophenone 0  


[0166] Lactate dehydrogenase (1.1.1.27) from Ralstonia eutropha is another enzyme that has been demonstrated to have high activities on several 2-oxoacids such as 2-oxobutyrate, 2-oxopentanoate and 2-oxoglutarate (a C5 compound analogous to 2-oxoadipate) (Steinbuchel and Schlegel, Eur. J. Biochem. 130:329-334 (1983)). Column 2 in Table 4 demonstrates the activities of ldhA from R. eutropha (formerly A. eutrophus) on different substrates (Steinbuchel and Schlegel, supra, 1983).
Table 4. The in vitro activity of R. eutropha ldhA (Steinbuchel and Schlegel, supra, 1983) on different substrates and compared with that on pyruvate.
Substrate Activity (%) of 
 L(+)-lactate dehydrogenase from A. eutrophusL(+)-lactate dehydrogenase from rabbit muscleD(-)-lactate dehydrogenase from L. leichmanii
Glyoxylate 8.7 23.9 5.0
Pyruvate 100.0 100.0 100.0
2-Oxobutyrate 107.0 18.6 1.1
2-Oxovalerate 125.0 0.7 0.0
3-Methyl-2-oxobutyrate 28.5 0.0 0.0
3-Methyl-2-oxovalerate 5.3 0.0 0.0
4-Methyl-2-oxopentanoate 39.0 1.4 1.1
Oxaloacetate 0.0 33.1 23.1
2-Oxoglutarate 79.6 0.0 0.0
3-Fluoropyruvate 33.6 74.3 40.0


[0167] Oxidoreductases that can convert 2-oxoacids to their acyl-CoA counterparts (1.2.1) have been shown to accept multiple substrates as well. For example, branched-chain 2-keto-acid dehydrogenase complex (BCKAD), also known as 2-oxoisovalerate dehydrogenase (1.2.1.25), participates in branched-chain amino acid degradation pathways, converting 2-keto acids derivatives of valine, leucine and isoleucine to their acyl-CoA derivatives and CO2. In some organisms including Rattus norvegicus (Paxton et al., Biochem. J. 234:295-303 (1986)) and Saccharomyces cerevisiae (Sinclair et al., Biochem. Mol Biol. Int. 32:911-922 (1993), this complex has been shown to have a broad substrate range that includes linear oxo-acids such as 2-oxobutanoate and alpha-ketoglutarate, in addition to the branched-chain amino acid precursors.

[0168] Members of yet another class of enzymes, namely aminotransferases (2.6.1), have been reported to act on multiple substrates. Aspartate aminotransferase (aspAT) from Pyrococcus fursious has been identified, expressed in E. coli and the recombinant protein characterized to demonstrate that the enzyme has the highest activities towards aspartate and alpha-ketoglutarate but lower, yet significant activities towards alanine, glutamate and the aromatic amino acids (Ward et al., Archaea 133-141 (2002)). In another instance, an aminotransferase indentified from Leishmania mexicana and expressed in E. coli (Vernal et al., FEMS Microbiol. Lett. 229:217-222 (2003)) was reported to have a broad substrate specificity towards tyrosine (activity considered 100% on tyrosine), phenylalanine (90%), tryptophan (85%), aspartate (30%), leucine (25%) and methionine (25%), respectively (Vernal et al., Mol. Biochem. Parasitol 96:83-92 (1998)). Similar broad specificity has been reported for a tyrosine aminotransferase from Trypanosoma cruzi, even though both of these enzymes have a sequence homology of only 6%. The latter enzyme can accept leucine, methionine as well as tyrosine, phenylalanine, tryptophan and alanine as efficient amino donors (Nowicki et al., Biochim. Biophys. Acta 1546: 268-281 (2001)).

[0169] CoA transferases (2.8.3) have been demonstrated to have the ability to act on more than one substrate. Specifically, a CoA transferase was purified from Clostridium acetobutylicum and was reported to have the highest activities on acetate, propionate, and butyrate. It also had significant activities with valerate, isobutyrate, and crotonate (Wiesenborn et al., Appl. Environ. Microbiol. 55:323-329 (1989)). In another study, the E. coli enzyme acyl-CoA:acetate-CoA transferase, also known as acetate-CoA transferase (EC 2.8.3.8), has been shown to transfer the CoA moiety to acetate from a variety of branched and linear acyl-CoA substrates, including isobutyrate (Matthies and Schink, App. Environm. Microbiol. 58:1435-1439 (1992)), valerate (Vanderwinkel et al., Biochem. Biophys. Res Commun. 33:902-908 (1968b)) and butanoate (Vanderwinkel et al., Biochem. Biophys. Res Commun. 33:902-908(1968a).

[0170] Other enzyme classes additionally support broad substrate specificity for enzymes. Some isomerases (5.3.3) have also been proven to operate on multiple substrates. For example, L-rhamnose isomerase from Pseudomonas stutzeri catalyzes the isomerization between various aldoalses and ketoses (Yoshida et al., J. Mol. Biol. 365:1505-1516 (2007)). These include isomerization between L-rhamnose and L-rhamnulose, L-mannose and L-fructose, L-xylose and L-xylulose, D-ribose and D-ribulose, and D-allose and D-psicose.

[0171] In yet another class of enzymes, the phosphotransferases (2.7.1), the homoserine kinase (2.7.1.39) from E. coli that converts L-homoserine to L-homoserine phosphate, was found to phosphorylate numerous homoserine analogs. In these substrates, the carboxyl functional group at the R-position had been replaced by an ester or by a hydroxymethyl group (Huo and Viola, Biochemistry 35:16180-16185 (1996)). Table 5 demonstrates the broad substrate specificity of this kinase.
Table 5. The substrate specificity of homoserine kinase.
Substratekcat% kcatKm (mM)kcat/Km
L-homoserine 18.3 ± 0.1 100 0.14 ± 0.04 184 ± 17
D-homoserine 8.3 ± 1.1 32 31.8 ± 7.2 0.26 ± 0.03
L-aspartate β-semialdehyde 2.1 ± 0.1 8.2 0.28 ± 0.02 7.5 ± 0.3
L-2-amino-1,4-butanediol 2.0 ± 0.5 7.9 11.6 ± 6.5 0.17 ± 0.06
L-2-amino-5-hydroxyvalerate 2.5 ± 0.4 9.9 1.1 ± 0.5 2.3 ± 0.3
L-homoserine methyl ester 14.7 ± 2.6 80 4.9 ± 2.0 3.0 ± 0.6
L-homoserine ethyl ester 13.6 ± 0.8 74 1.9 ± 0.5 7.2 ± 1.7
L-homoserine isopropyl ester 13.6 ± 1.4 74 1.2 ± 0.5 11.3 ± 1.1
L-homoserine n-propyl ester 14.0 ± 0.4 76 3.5 ± 0.4 4.0 ± 1.2
L-homoserine isobutyl ester 16.4 ± 0.8 84 6.9 ± 1.1 2.4 ± 0.3
L-homserine n-butyl ester 29.1 ± 1.2 160 5.8 ± 0.8 5.0 ± 0.5


[0172] Another class of enzymes useful in BDO pathways is the acid-thiol ligases (6.2.1). Like enzymes in other classes, certain enzymes in this class have been determined to have broad substrate specificity. For example, acyl CoA ligase from Pseudomonas putida has been demonstrated to work on several aliphatic substrates including acetic, propionic, butyric, valeric, hexanoic, heptanoic, and octanoic acids and on aromatic compounds such as phenylacetic and phenoxyacetic acids (Fernandez-Valverde et al., Appl. Environ. Microbiol. 59:1149-1154 (1993)). A related enzyme, malonyl CoA synthetase (6.3.4.9) from Rhizobium trifolii could convert several diacids, namely, ethyl-, propyl-, allyl-, isopropyl-, dimethyl-, cyclopropyl-, cyclopropylmethylene-, cyclobutyl-, and benzyl-malonate into their corresponding monothioesters (Pohl et al., J. Am. Chem. Soc. 123:5822-5823 (2001)). Similarly, decarboxylases (4.1.1) have also been found with broad substrate ranges. Pyruvate decarboxylase (PDC), also termed keto-acid decarboxylase, is a key enzyme in alcoholic fermentation, catalyzing the decarboxylation of pyruvate to acetaldehyde. The enzyme isolated from Saccharomyces cerevisiae has a broad substrate range for aliphatic 2-keto acids including 2-ketobutyrate, 2-ketovalerate, and 2-phenylpyruvate (Li and Jordan, Biochemistry 38:10004-10012 (1999)). Similarly, benzoylformate decarboxylase has a broad substrate range and has been the target of enzyme engineering studies. The enzyme from Pseudomonas putida has been extensively studied and crystal structures of this enzyme are available (Polovnikova et al., Biochemistry 42:1820-1830 (2003); Hasson et al., Biochemistry 37:9918-9930 (1998)). Branched chain alpha-ketoacid decarboxylase (BCKA) has been shown to act on a variety of compounds varying in chain length from 3 to 6 carbons (Oku and Kaneda, J. Biol. Chem. 263:18386-18396 (1998); Smit et al., Appl. Environ. Microbiol. 71:303-311 (2005b)). The enzyme in Lactococcus lactis has been characterized on a variety of branched and linear substrates including 2-oxobutanoate, 2-oxohexanoate, 2-oxopentanoate, 3-methyl-2-oxobutanoate, 4-methyl-2-oxobutanoate and isocaproate (Smit et al., Appl. Environ. Microbiol. 71:303-311 (2005a).

[0173] Interestingly, enzymes known to have one dominant activity have also been reported to catalyze a very different function. For example, the cofactor-dependent phosphoglycerate mutase (5.4.2.1) from Bacillus stearothermophilus and Bacillus subtilis is known to function as a phosphatase as well (Rigden et al., Protein Sci. 10:1835-1846 (2001)). The enzyme from B. stearothermophilus is known to have activity on several substrates, including 3-phosphoglycerate, alpha-napthylphosphate, p-nitrophenylphosphate, AMP, fructoses-6-phosphate, ribose-5-phosphate and CMP.

[0174] In contrast to these examples where the enzymes naturally have broad substrate specificities, numerous enzymes have been modified using directed evolution to broaden their specificity towards their non-natural substrates. Alternatively, the substrate preference of an enzyme has also been changed using directed evolution. Therefore, it is feasible to engineer a given enzyme for efficient function on a natural, for example, improved efficiency, or a non-natural substrate, for example, increased efficiency. For example, it has been reported that the enantioselectivity of a lipase from Pseudomonas aeruginosa was improved significantly (Reetz et al., Agnew. Chem. Int. Ed Engl. 36:2830-2832 (1997)). This enzyme hydrolyzed p-nitrophenyl 2-methyldecanoate with only 2% enantiomeric excess (ee) in favor of the (S)-acid. However, after four successive rounds of error-prone mutagenesis and screening, a variant was produced that catalyzed the requisite reaction with 81% ee (Reetz et al., Agnew. Chem. Int. Ed Engl. 36:2830-2832 (1997)).

[0175] Directed evolution methods have been used to modify an enzyme to function on an array of non-natural substrates. The substrate specificity of the lipase in P. aeruginosa was broadened by randomization of amino acid residues near the active site. This allowed for the acceptance of alpha-substituted carboxylic acid esters by this enzyme (Reetz et al., Agnew. Chem. Int. Ed Engl. 44:4192-4196 (2005)). In another successful modification of an enzyme, DNA shuffling was employed to create an Escherichia coli aminotransferase that accepted β-branched substrates, which were poorly accepted by the wild-type enzyme (Yano et al., Proc. Nat. Acad. Sci. U.S.A. 95:5511-5515 (1998)). Specifically, at the end of four rounds of shuffling, the activity of aspartate aminotransferase for valine and 2-oxovaline increased by up to five orders of magnitude, while decreasing the activity towards the natural substrate, aspartate, by up to 30-fold. Recently, an algorithm was used to design a retro-aldolase that could be used to catalyze the carbon-carbon bond cleavage in a non-natural and non-biological substrate, 4-hydroxy-4-(6-methoxy-2-naphthyl)-2-butanone (Jiang et al., Science 319:1387-1391 (2008)). These algorithms used different combinations of four different catalytic motifs to design new enzyme, and 20 of the selected designs for experimental characterization had fourfold improved rates over the uncatalyzed reaction (Jiang et al., Science 319:1387-1391 (2008)). Thus, not only are these engineering approaches capable of expanding the array of substrates on which an enzyme can act, but they allow the design and construction of very efficient enzymes. For example, a method of DNA shuffling (random chimeragenesis on transient templates or RACHITT) was reported to lead to an engineered monooxygenase that had an improved rate of desulfurization on complex substrates as well as 20-fold faster conversion of a non-natural substrate (Coco et al., Nat. Biotechnol. 19:354-359 (2001)). Similarly, the specific activity of a sluggish mutant triosephosphate isomerase enzyme was improved up to 19-fold from 1.3 fold (Hermes et al., Proc. Nat. Acad. Sci. U.S.A. 87:696-700 1990)). This enhancement in specific activity was accomplished by using random mutagenesis over the whole length of the protein and the improvement could be traced back to mutations in six amino acid residues.

[0176] The effectiveness of protein engineering approaches to alter the substrate specificity of an enzyme for a desired substrate has also been demonstrated in several studies. Isopropylmalate dehydrogenase from Thermus thermophilus was modified by changing residues close to the active site so that it could now act on malate and D-lactate as substrates (Fujita et al., Biosci. Biotechnol. Biochem. 65:2695-2700 (2001)). In this study as well as in others, it was pointed out that one or a few residues could be modified to alter the substrate specificity. For example, the dihydroflavonol 4-reductase for which a single amino acid was changed in the presumed substrate-binding region could preferentially reduce dihydrokaempferol (Johnson et al., Plant. J. 25:325-333 (2001)). The substrate specificity of a very specific isocitrate dehydrogenase from Escherichia coli was changed form isocitrate to isopropylmalate by changing one residue in the active site (Doyle et al., Biochemistry 40:4234-4241 (2001)). Similarly, the cofactor specificity of a NAD+-dependent 1,5-hydroxyprostaglandin dehydrogenase was altered to NADP+ by changing a few residues near the N-terminal end (Cho et al., Arch. Biochem. Biophys. 419:139-146 (2003)). Sequence analysis and molecular modeling analysis were used to identify the key residues for modification, which were further studied by site-directed mutagenesis.

[0177] Numerous examples exist spanning diverse classes of enzymes where the function of enzyme was changed to favor one non-natural substrate over the natural substrate of the enzyme. A fucosidase was evolved from a galactosidase in E. coli by DNA shuffling and screening (Zhang et al., Proc. Natl Acad. Sci. U.S.A. 94:4504-4509 (1997)). Similarly, aspartate aminotransferase from E. coli was converted into a tyrosine aminotransferase using homology modeling and site-directed mutagenesis (Onuffer and Kirsch, Protein Sci., 4:1750-1757 (1995)). Site-directed mutagenesis of two residues in the active site of benzoylformate decarboxylase from P. putida reportedly altered the affinity (Km) towards natural and non-natural substrates (Siegert et al., Protein Eng Des Sel 18:345-357 (2005)). Cytochrome c peroxidase (CCP) from Saccharomyces cerevisiae was subjected to directed molecular evolution to generate mutants with increased activity against the classical peroxidase substrate guaiacol, thus changing the substrate specificity of CCP from the protein cytochrome c to a small organic molecule. After three rounds of DNA shuffling and screening, mutants were isolated which possessed a 300-fold increased activity against guaiacol and up to 1000-fold increased specificity for this substrate relative to that for the natural substrate (Iffland et al., Biochemistry 39:10790-10798 (2000)).

[0178] In some cases, enzymes with different substrate preferences than either of the parent enzymes have been obtained. For example, biphenyl-dioxygenase-mediated degradation of polychlorinated biphenyls was improved by shuffling genes from two bacteria, Pseudomonas pseudoalcaligens and Burkholderia cepacia (Kumamaru et al., Nat. Biotechnol. 16:663-666 (1998)). The resulting chimeric biphenyl oxygenases showed different substrate preferences than both the parental enzymes and enhanced the degradation activity towards related biphenyl compounds and single aromatic ring hydrocarbons such as toluene and benzene which were originally poor substrates for the enzyme.

[0179] In addition to changing enzyme specificity, it is also possible to enhance the activities on substrates for which the enzymes naturally have low activities. One study demonstrated that amino acid racemase from P. putida that had broad substrate specificity (on lysine, arginine, alanine, serine, methionine, cysteine, leucine and histidine among others) but low activity towards tryptophan could be improved significantly by random mutagenesis (Kino et al., Appl. Microbiol. Biotechnol. 73:1299-1305 (2007)). Similarly, the active site of the bovine BCKAD was engineered to favor alternate substrate acetyl-CoA (Meng and Chuang, Biochemistry 33:12879-12885 (1994)). An interesting aspect of these approaches is that even if random methods have been applied to generate these mutated enzymes with efficacious activities, the exact mutations or structural changes that confer the improvement in activity can be identified. For example, in the aforementioned study, the mutations that facilitated improved activity on tryptophan was traced back to two different positions.

[0180] Directed evolution has also been used to express proteins that are difficult to express. For example, by subjecting horseradish peroxidase to random mutagenesis and gene recombination, mutants were identified that had more than 14-fold higher activity than the wild type (Lin et al., Biotechnol. Prog. 15:467-471 (1999)).

[0181] Another example of directed evolution shows the extensive modifications to which an enzyme can be subjected to achieve a range of desired functions. The enzyme lactate dehydrogenase from Bacillus stearothermophilus was subjected to site-directed mutagenesis, and three amino acid substitutions were made at sites that were believed to determine the specificity towards different hydroxyacids (Clarke et al., Biochem. Biophys. Res. Commun. 148:15-23 (1987)). After these mutations, the specificity for oxaloacetate over pyruvate was increased to 500 in contrast to the wild type enzyme that had a catalytic specificity for pyruvate over oxaloacetate of 1000. This enzyme was further engineered using site-directed mutagenesis to have activity towards branched-chain substituted pyruvates (Wilks et al., Biochemistry 29:8587-8591 (1990)). Specifically, the enzyme had a 55-fold improvement in Kcat for alpha-ketoisocaproate. Three structural modifications were made in the same enzyme to change its substrate specificity from lactate to malate. The enzyme was highly active and specific towards malate (Wilks et al., Science 242:1541-1544 (1988)). The same enzyme from B. stearothermophilus was subsequently engineered to have high catalytic activity towards alpha-keto acids with positively charged side chains, such as those containing ammonium groups (Hogan et al., Biochemistry 34:4225-4230 (1995)). Mutants with acidic amino acids introduced at position 102 of the enzyme favored binding of such side chain ammonium groups. The results obtained proved that the mutants showed up to 25-fold improvements in kcat/Km values for omega-amino-alpha-keto acid substrates. Interestingly, this enzyme was also structurally modified to function as a phenyllactate dehydrogenase instead of a lactate dehydrogenase (Wilks et al., Biochemistry 31:7802-7806 1992). Restriction sites were introduced into the gene for the enzyme which allowede a region of the gene to be excised. This region coded for a mobile surface loop of the polypeptide (residues 98-110) which normally seals the active site from bulk solvent and is a major determinant of substrate specificity. The variable length and sequence loops were inserted so that hydroxyacid dehydrogenases with altered substrate specificities were generated. With one longer loop construction, activity with pyruvate was reduced one-million-fold but activity with phenylpyruvate was largely unaltered. A switch in specificity (kcat/Km) of 390,000-fold was achieved. The 1700:1 selectivity of this enzyme for phenylpyruvate over pyruvate is that required in a phenyllactate dehydrogenase. The studies described above indicate that various approaches of enzyme engineering can be used to obtain enzymes for the BDO pathways as disclosed herein.

[0182] As disclosed herein, biosynthetic pathways to 1,4-butanediol from a number of central metabolic intermediates are can be utilized, including acetyl-CoA, succinyl-CoA, alpha-ketoglutarate, glutamate, 4-aminobutyrate, and homoserine. Acetyl-CoA, succinyl-CoA and alpha-ketoglutarate are common intermediates of the tricarboxylic acid (TCA) cycle, a series of reactions that is present in its entirety in nearly all living cells that utilize oxygen for cellular respiration and is present in truncated forms in a number of anaerobic organisms. Glutamate is an amino acid that is derived from alpha-ketoglutarate via glutamate dehydrogenase or any of a number of transamination reactions (see Figure 8B). 4-aminobutyrate can be formed by the decarboxylation of glutamate (see Figure 8B) or from acetoacetyl-CoA via the pathway disclosed in Figure 9C. Acetoacetyl-CoA is derived from the condensation of two acetyl-CoA molecules by way of the enzyme, acetyl-coenzyme A acetyltransferase, or equivalently, acetoacetyl-coenzyme A thiolase. Homoserine is an intermediate in threonine and methionine metabolism, formed from oxaloacetate via aspartate. The conversion of oxaloacetate to homoserine requires one NADH, two NADPH, and one ATP.

[0183] Pathways other than those exemplified above also can be employed to generate the biosynthesis of BDO in non-naturally occurring microbial organisms. In one aspect, biosynthesis can be achieved using a L-homoserine to BDO pathway (see Figure 13). This pathway has a molar yield of 0.90 mol/mol glucose, which appears restricted by the availability of reducing equivalents. A second pathway synthesizes BDO from acetoacetyl-CoA and is capable of achieving the maximum theoretical yield of 1.091 mol/mol glucose (see Figure 9). Implementation of either pathway can be achieved by introduction of two exogenous enzymes into a host organism such as E. coli, and both pathways can additionally complement BDO production via succinyl-CoA. Pathway enzymes, thermodynamics, theoretical yields and overall feasibility are described further below.

[0184] A homoserine pathway also can be engineered to generate BDO-producing microbial organisms. Homoserine is an intermediate in threonine and methionine metabolism, formed from oxaloacetate via aspartate. The conversion of oxaloacetate to homoserine requires one NADH, two NADPH, and one ATP (Figure 2). Once formed, homoserine feeds into biosynthetic pathways for both threonine and methionine. In most organisms, high levels of threonine or methionine feedback to repress the homoserine biosynthesis pathway (Caspi et al., Nucleic Acids Res. 34:D511-D516 (1990)).

[0185] The transformation of homoserine to 4-hydroxybutyrate (4-HB) can be accomplished in two enzymatic steps as described herein. The first step of this pathway is deamination of homoserine by a putative ammonia lyase. In step 2, the product alkene, 4-hydroxybut-2-enoate is reduced to 4-HB by a putative reductase at the cost of one NADH. 4-HB can then be converted to BDO.

[0186] Enzymes available for catalyzing the above transformations are disclosed herein. For example, the ammonia lyase in step 1 of the pathway closely resembles the chemistry of aspartate ammonia-lyase (aspartase). Aspartase is a widespread enzyme in microorganisms, and has been characterized extensively (Viola, R.E., Mol. Biol. 74:295-341 (2008)). The crystal structure of the E. coli aspartase has been solved (Shi et al., Biochemistry 36:9136-9144 (1997)), so it is therefore possible to directly engineer mutations in the enzyme's active site that would alter its substrate specificity to include homoserine. The oxidoreductase in step 2 has chemistry similar to several well-characterized enzymes including fumarate reductase in the E. coli TCA cycle. Since the thermodynamics of this reaction are highly favorable, an endogenous reductase with broad substrate specificity will likely be able to reduce 4-hydroxybut-2-enoate. The yield of this pathway under anaerobic conditions is 0.9 mol BDO per mol glucose.

[0187] The succinyl-CoA pathway was found to have a higher yield due to the fact that it is more energetically efficient. The conversion of one oxaloacetate molecule to BDO via the homoserine pathway will require the expenditure of 2 ATP equivalents. Because the conversion of glucose to two oxaloacetate molecules can generate a maximum of 3 ATP molecules assuming PEP carboxykinase to be reversible, the overall conversion of glucose to BDO via homoserine has a negative energetic yield. As expected, if it is assumed that energy can be generated via respiration, the maximum yield of the homoserine pathway increases to 1.05 mol/mol glucose which is 96% of the succinyl-CoA pathway yield. The succinyl-CoA pathway can channel some of the carbon flux through pyruvate dehydrogenase and the oxidative branch of the TCA cycle to generate both reducing equivalents and succinyl-CoA without an energetic expenditure. Thus, it does not encounter the same energetic difficulties as the homoserine pathway because not all of the flux is channeled through oxaloacetate to succinyl-CoA to BDO. Overall, the homoserine pathway demonstrates a high-yielding route to BDO.

[0188] An acetoacetate pathway also can be engineered to generate BDO-producing microbial organisms. Acetoacetate can be formed from acetyl-CoA by enzymes involved in fatty acid metabolism, including acetyl-CoA acetyltransferase and acetoacetyl-CoA transferase. Biosynthetic routes through acetoacetate are also particularly useful in microbial organisms that can metabolize single carbon compounds such as carbon monoxide, carbon dioxide or methanol to form acetyl-CoA.

[0189] A three step route from acetoacetyl-CoA to 4-aminobutyrate (see Figure 9C) can be used to synthesize BDO through acetoacetyl-CoA. 4-Aminobutyrate can be converted to succinic semialdehyde as shown in Figure 8B. Succinic semialdehyde, which is one reduction step removed from succinyl-CoA or one decarboxylation step removed from α-ketoglutarate, can be converted to BDO following three reductions steps (Figure 1). Briefly, step 1 of this pathway involves the conversion of acetoacetyl-CoA to acetoacetate by, for example, the E. coli acetoacetyl-CoA transferase encoded by the atoA and atoD genes (Hanai et al., Appl. Environ. Microbiol. 73: 7814-7818 (2007)). Step 2 of the acetoacetyl-CoA biopathway entails conversion of acetoacetate to 3-aminobutanoate by an ω-aminotransferase. The ω-amino acid:pyruvate aminotransferase (ω-APT) from Alcaligens denitrificans was overexpressed in E. coli and shown to have a high activity toward 3-aminobutanoate in vitro (Yun et al., Appl. Environ. Microbiol. 70:2529-2534 (2004)).

[0190] In step 2, a putative aminomutase shifts the amine group from the 3- to the 4-position of the carbon backbone. An aminomutase performing this function on 3-aminobutanoate has not been characterized, but an enzyme from Clostridium sticklandii has a very similar mechanism. The enzyme, D-lysine-5,6-aminomutase, is involved in lysine biosynthesis.

[0191] The synthetic route to BDO from acetoacetyl-CoA passes through 4-aminobutanoate, a metabolite in E. coli that is normally formed from decarboxylation of glutamate. Once formed, 4-aminobutanoate can be converted to succinic semialdehyde by 4-aminobutanoate transaminase (2.6.1.19), an enzyme which has been biochemically characterized.

[0192] One consideration for selecting candidate enzymes in this pathway is the stereoselectivity of the enzymes involved in steps 2 and 3. The ω-ABT in Alcaligens denitrificans is specific to the L-stereoisomer of 3-aminobutanoate, while D-lysine-5,6-aminomutase likely requires the D-stereoisomer. If enzymes with complementary stereoselectivity are not initially found or engineered, a third enzyme can be added to the pathway with racemase activity that can convert L-3-aminobutanoate to D-3-aminobutanoate. While amino acid racemases are widespread, whether these enzymes can function on ω-amino acids is not known.

[0193] The maximum theoretical molar yield of this pathway under anaerobic conditions is 1.091 mol/mol glucose. In order to generate flux from acetoacetyl-CoA to BDO it was necessary to assume that acetyl-CoA:acetoacetyl-CoA transferase is reversible. The function of this enzyme in E. coli is to metabolize short-chain fatty acids by first converting them into thioesters.

[0194] While the operation of acetyl-CoA:acetoacetyl-CoA transferase in the acetate-consuming direction has not been demonstrated experimentally in E. coli, studies on similar enzymes in other organisms support the assumption that this reaction is reversible. The enzyme butyryl-CoA:acetate:CoA transferase in gut microbes Roseburia sp. and F. prasnitzii operates in the acetate utilizing direction to produce butyrate (Duncan et al., Appl. Environ. Microbiol 68:5186-5190 (2002)). Another very similar enzyme, acetyl:succinate CoA-transferase in Trypanosoma brucei, also operates in the acetate utilizing direction. This reaction has a ΔrxnG close to equilibrium, so high concentrations of acetate can likely drive the reaction in the direction of interest. At the maximum theoretical BDO production rate of 1.09 mol/mol glucose simulations predict that E. coli can generate 1.098 mol ATP per mol glucose with no fermentation byproducts. This ATP yield should be sufficient for cell growth, maintenance, and production. The acetoacetatyl-CoA biopathway is a high-yielding route to BDO from acetyl-CoA.

[0195] Therefore, in addition to any of the various modifications exemplified previously for establishing 4-HB biosynthesis in a selected host, the BDO producing microbial organisms can include any of the previous combinations and permutations of 4-HB pathway metabolic modifications as well as any combination of expression for CoA-independent aldehyde dehydrogenase, CoA-dependent aldehyde dehydrogenase or an alcohol dehydrogenase or other enzymes disclosed herein to generate biosynthetic pathways for GBL and/or BDO. Therefore, the BDO producers of the disclosure can have exogenous expression of, for example, one, two, three, four, five, six, seven, eight, nine, or up to all enzymes corresponding to any of the 4-HB pathway and/or any of the BDO pathway enzymes disclosed herein.

[0196] Design and construction of the genetically modified microbial organisms is carried out using methods well known in the art to achieve sufficient amounts of expression to produce BDO. In particular, the non-naturally occurring microbial organisms of the disclosure can achieve biosynthesis of BDO resulting in intracellular concentrations between about 0.1-200 mM or more, such as about 0.1-25 mM or more, as discussed above. For example, the intracellular concentration of BDO is between about 3-20mM, particularly between about 5-15 mM and more particularly between about 8-12 mM, including about 10 mM or more. Intracellular concentrations between and above each of these exemplary ranges also can be achieved from the non-naturally occurring microbial organisms of the disclosure. As with the 4-HB producers, the BDO producers also can be sustained, cultured or fermented under anaerobic conditions.

[0197] The disclosure further provides a method for the production of 4-HB. The method includes culturing a non-naturally occurring microbial organism having a 4-hydroxybutanoic acid (4-HB) biosynthetic pathway comprising at least one exogenous nucleic acid encoding 4-hydroxybutanoate dehydrogenase, CoA-independent succinic semialdehyde dehydrogenase, succinyl-CoA synthetase, CoA-dependent succinic semialdehyde dehydrogenase, glutamate:succinic semialdehyde transaminase, α-ketoglutarate decarboxylase, or glutamate decarboxylase under substantially anaerobic conditions for a sufficient period of time to produce monomeric 4-hydroxybutanoic acid (4-HB). The method can additionally include chemical conversion of 4-HB to GBL and to BDO or THF, for example.

[0198] Additionally provided is a method for the production of 4-HB. The method includes culturing a non-naturally occurring microbial organism having a 4-hydroxybutanoic acid (4-HB) biosynthetic pathway including at least one exogenous nucleic acid encoding 4-hydroxybutanoate dehydrogenase, succinyl-CoA synthetase, CoA-dependent succinic semialdehyde dehydrogenase or α-ketoglutarate decarboxylase under substantially anaerobic conditions for a sufficient period of time to produce monomeric 4-hydroxybutanoic acid (4-HB). The 4-HB product can be secreted into the culture medium.

[0199] Further provided is a method for the production of BDO. The method includes culturing a non-naturally occurring microbial biocatalyst or microbial organism, comprising a microbial organism having 4-hydroxybutanoic acid (4-HB) and 1,4-butanediol (BDO) biosynthetic pathways, the pathways including at least one exogenous nucleic acid encoding 4-hydroxybutanoate dehydrogenase, succinyl-CoA synthetase, CoA-dependent succinic semialdehyde dehydrogenase, 4-hydroxybutyrate:CoA transferase, 4-hydroxybutyrate kinase, phosphotranshydroxybutyrylase, α-ketoglutarate decarboxylase, aldehyde dehydrogenase, alcohol dehydrogenase or an aldehyde/alcohol dehydrogenase for a sufficient period of time to produce 1,4-butanediol (BDO). The BDO product can be secreted into the culture medium.

[0200] Additionally provided are methods for producing BDO by culturing a non-naturally occurring microbial organism having a BDO pathway of the disclosure. The BDO pathway can comprise at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO, under conditions and for a sufficient period of time to produce BDO, the BDO pathway comprising 4-aminobutyrate CoA transferase, 4-aminobutyryl-CoA hydrolase, 4-aminobutyrate-CoA ligase, 4-aminobutyryl-CoA oxidoreductase (deaminating), 4-aminobutyryl-CoA transaminase, or 4-hydroxybutyryl-CoA dehydrogenase (see Example VII and Table 17).

[0201] Alternatively, the BDO pathway can compre at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO, under conditions and for a sufficient period of time to produce BDO, the BDO pathway comprising 4-aminobutyrate CoA transferase, 4-aminobutyryl-CoA hydrolase, 4-aminobutyrate-CoA ligase, 4-aminobutyryl-CoA reductase (alcohol forming), 4-aminobutyryl-CoA reductase, 4-aminobutan-1-ol dehydrogenase, 4-aminobutan-1-ol oxidoreductase (deaminating) or 4-aminobutan-1-ol transaminase (see Example VII and Table 18).

[0202] In addition, the disclosure provides a method for producing BDO, comprising culturing a non-naturally occurring microbial organism having a BDO pathway, the pathway comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO, under conditions and for a sufficient period of time to produce BDO, the BDO pathway comprising 4-aminobutyrate kinase, 4-aminobutyraldehyde dehydrogenase (phosphorylating), 4-aminobutan-1-ol dehydrogenase, 4-aminobutan-1-ol oxidoreductase (deaminating), 4-aminobutan-1-ol transaminase, [(4-aminobutanolyl)oxy]phosphonic acid oxidoreductase (deaminating), [(4-aminobutanolyl)oxy]phosphonic acid transaminase, 4-hydroxybutyryl-phosphate dehydrogenase, or 4-hydroxybutyraldehyde dehydrogenase (phosphorylating) (see Example VII and Table 19).

[0203] The disclosure further provides a method for producing BDO, comprising culturing a non-naturally occurring microbial organism having a BDO pathway, the pathway comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO, under conditions and for a sufficient period of time to produce BDO, the BDO pathway comprising alpha-ketoglutarate 5-kinase, 2,5-dioxopentanoic semialdehyde dehydrogenase (phosphorylating), 2,5-dioxopentanoic acid reductase, alpha-ketoglutarate CoA transferase, alpha-ketoglutaryl-CoA hydrolase, alpha-ketoglutaryl-CoA ligase, alpha-ketoglutaryl-CoA reductase, 5-hydroxy-2-oxopentanoic acid dehydrogenase, alpha-ketoglutaryl-CoA reductase (alcohol forming), 5-hydroxy-2-oxopentanoic acid decarboxylase, or 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation)(see Example VIII and Table 20).

[0204] The disclosure additionally provides a method for producing BDO, comprising culturing a non-naturally occurring microbial organism having a BDO pathway, the pathway comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO, under conditions and for a sufficient period of time to produce BDO, the BDO pathway comprising glutamate CoA transferase, glutamyl-CoA hydrolase, glutamyl-CoA ligase, glutamate 5-kinase, glutamate-5-semialdehyde dehydrogenase (phosphorylating), glutamyl-CoA reductase, glutamate-5-semialdehyde reductase, glutamyl-CoA reductase (alcohol forming), 2-amino-5-hydroxypentanoic acid oxidoreductase (deaminating), 2-amino-5-hydroxypentanoic acid transaminase, 5-hydroxy-2-oxopentanoic acid decarboxylase, 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation)(see Example IX and Table 21).

[0205] The disclosure additionally includes a method for producing BDO, comprising culturing a non-naturally occurring microbial organism having a BDO pathway, the pathway comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO, under conditions and for a sufficient period of time to produce BDO, the BDO pathway comprising 3-hydroxybutyryl-CoA dehydrogenase, 3-hydroxybutyryl-CoA dehydratase, vinylacetyl-CoA Δ-isomerase, or 4-hydroxybutyryl-CoA dehydratase (see Example X and Table 22).

[0206] Also provided is a method for producing BDO, comprising culturing a non-naturally occurring microbial organism having a BDO pathway, the pathway comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO, under conditions and for a sufficient period of time to produce BDO, the BDO pathway comprising homoserine deaminase, homoserine CoA transferase, homoserine-CoA hydrolase, homoserine-CoA ligase, homoserine-CoA deaminase, 4-hydroxybut-2-enoyl-CoA transferase, 4-hydroxybut-2-enoyl-CoA hydrolase, 4-hydroxybut-2-enoyl-CoA ligase, 4-hydroxybut-2-enoate reductase, 4-hydroxybutyryl-CoA transferase, 4-hydroxybutyryl-CoA hydrolase, 4-hydroxybutyryl-CoA ligase, or 4-hydroxybut-2-enoyl-CoA reductase (see Example XI and Table 23).

[0207] The disclosure additionally provides a method for producing BDO, comprising culturing a non-naturally occurring microbial organism having a BDO pathway, the pathway comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO, under conditions and for a sufficient period of time to produce BDO, the BDO pathway comprising succinyl-CoA reductase (alcohol forming), 4-hydroxybutyryl-CoA hydrolase, 4-hydroxybutyryl-CoA ligase, 4-hydroxybutanal dehydrogenase (phosphorylating). Such a BDO pathway can further comprise succinyl-CoA reductase, 4-hydroxybutyrate dehydrogenase, 4-hydroxybutyryl-CoA transferase, 4-hydroxybutyrate kinase, phosphotrans-4-hydroxybutyrylase, 4-hydroxybutyryl-CoA reductase, 4-hydroxybutyryl-CoA reductase (alcohol forming), or 1,4-butanediol dehydrogenase.

[0208] Also provided is a method for producing BDO, comprising culturing a non-naturally occurring microbial organism having a BDO pathway, the pathway comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO, under conditions and for a sufficient period of time to produce BDO, the BDO pathway comprising glutamate dehydrogenase, 4-aminobutyrate oxidoreductase (deaminating), 4-aminobutyrate transaminase, glutamate decarboxylase, 4-hydroxybutyryl-CoA hydrolase, 4-hydroxybutyryl-CoA ligase, 4-hydroxybutanal dehydrogenase (phosphorylating).

[0209] The disclosure additionally provides methods of producing a desired product using the genetically modified organisms disclosed herein that allow improved production of a desired product such as BDO by increasing the product or decreasing undesirable byproducts. Thus, the disclosure provides a method for producing 1,4-butanediol (BDO), comprising culturing the non-naturally occurring microbial organisms disclosed herein under conditions and for a sufficient period of time to produce BDO. In one aspect, the disclosure provides a method of producing BDO using a non-naturally occurring microbial organism, comprising a microbial organism having a 1,4-butanediol (BDO) pathway comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO. In one aspect, the microbial organism is genetically modified to express exogenous succinyl-CoA synthetase (see Example XII). For example, the succinyl-CoA synthetase can be encoded by an Escherichia coli sucCD genes.

[0210] In another aspect, the microbial organism is genetically modified to express exogenous alpha-ketoglutarate decarboxylase (see Example XIII). For example, the alpha-ketoglutarate decarboxylase can be encoded by the Mycobacterium bovis sucA gene. In still another aspect, the microbial organism is genetically modified to express exogenous succinate semialdehyde dehydrogenase and 4-hydroxybutyrate dehydrogenase and optionally 4-hydroxybutyryl-CoA/acetyl-CoA transferase (see Example XIII). For example, the succinate semialdehyde dehydrogenase (CoA-dependent), 4-hydroxybutyrate dehydrogenase and 4-hydroxybutyryl-CoA/acetyl-CoA transferase can be encoded by Porphyromonas gingivalis W83 genes. In an additional aspect, the microbial organism is genetically modified to express exogenous butyrate kinase and phosphotransbutyrylase (see Example XIII). For example, the butyrate kinase and phosphotransbutyrylase can be encoded by Clostridium acetobutilicum buk1 and ptb genes.

[0211] In yet another aspect, the microbial organism is genetically modified to express exogenous 4-hydroxybutyryl-CoA reductase (see Example XIII). For example, the 4-hydroxybutyryl-CoA reductase can be encoded by Clostridium beijerinckii ald gene. Additionally, in an aspect of the disclosure, the microbial organism is genetically modified to express exogenous 4-hydroxybutanal reductase (see Example XIII). For example, the 4-hydroxybutanal reductase can be encoded by Geobacillus thermoglucosidasius adh1 gene. In another aspect, the microbial organism is genetically modified to express exogenous pyruvate dehydrogenase subunits (see Example XIV). For example, the exogenous pyruvate dehydrogenase can be NADH insensitive. The pyruvate dehydrogenase subunit can be encoded by the Klebsiella pneumonia lpdA gene. In a particular aspect, the pyruvate dehydrogenase subunit genes of the microbial organism can be under the control of a pyruvate formate lyase promoter.

[0212] In still another aspect, the microbial organism is genetically modified to disrupt a gene encoding an aerobic respiratory control regulatory system (see Example XV). For example, the disruption can be of the arcA gene. Such an organism can further comprise disruption of a gene encoding malate dehydrogenase. In a further aspect, the microbial organism is genetically modified to express an exogenous NADH insensitive citrate synthase(see Example XV). For example, the NADH insensitive citrate synthase can be encoded by gltA, such as an R163L mutant of gltA. In still another aspect, the microbial organism is genetically modified to express exogenous phosphoenolpyruvate carboxykinase (see Example XVI). For example, the phosphoenolpyruvate carboxykinase can be encoded by an Haemophilus influenza phosphoenolpyruvate carboxykinase gene. It is understood that strains exemplified herein for improved production of BDO can similarly be used, with appropriate modifications, to produce other desired products, for example, 4-hydroxybutyrate or other desired products disclosed herein.

[0213] The disclosure additionally provides a method for producing 4-hydroxybutanal by culturing a non-naturally occurring microbial organism, comprising a 4-hydroxybutanal pathway comprising at least one exogenous nucleic acid encoding a 4-hydroxybutanal pathway enzyme expressed in a sufficient amount to produce 4-hydroxybutanal, the 4-hydroxybutanal pathway comprising succinyl-CoA reductase (aldehyde forming); 4-hydroxybutyrate dehydrogenase; and 4-hydroxybutyrate reductase (see Figure 58, steps A-C-D). The disclosure also provides a method for producing 4-hydroxybutanal by culturing a non-naturally occurring microbial organism, comprising a 4-hydroxybutanal pathway comprising at least one exogenous nucleic acid encoding a 4-hydroxybutanal pathway enzyme expressed in a sufficient amount to produce 4-hydroxybutanal, the 4-hydroxybutanal pathway comprising alpha-ketoglutarate decarboxylase; 4-hydroxybutyrate dehydrogenase; and 4-hydroxybutyrate reductase (Figure 58, steps B-C-D).

[0214] The disclosure further provides a method for producing 4-hydroxybutanal by culturing a non-naturally occurring microbial organism, comprising a 4-hydroxybutanal pathway comprising at least one exogenous nucleic acid encoding a 4-hydroxybutanal pathway enzyme expressed in a sufficient amount to produce 4-hydroxybutanal, the 4-hydroxybutanal pathway comprising succinate reductase; 4-hydroxybutyrate dehydrogenase, and 4-hydroxybutyrate reductase (see Figure 62, steps F-C-D). In yet another aspect, the disclosure provides a method for producing 4-hydroxybutanal by culturing a non-naturally occurring microbial organism, comprising a 4-hydroxybutanal pathway comprising at least one exogenous nucleic acid encoding a 4-hydroxybutanal pathway enzyme expressed in a sufficient amount to produce 4-hydroxybutanal, the 4-hydroxybutanal pathway comprising alpha-ketoglutarate decarboxylase, or glutamate dehydrogenase or glutamate transaminase and glutamate decarboxylase and 4-aminobutyrate dehydrogenase or 4-aminobutyrate transaminase; 4-hydroxybutyrate dehydrogenase; and 4-hydroxybutyrate reductase (see Figure 62, steps B or ((J or K)-L-(M or N))-C-D).

[0215] The disclosure also provides a method for producing 4-hydroxybutanal by culturing a non-naturally occurring microbial organism, comprising a 4-hydroxybutanal pathway comprising at least one exogenous nucleic acid encoding a 4-hydroxybutanal pathway enzyme expressed in a sufficient amount to produce 4-hydroxybutanal, the 4-hydroxybutanal pathway comprising alpha-ketoglutarate reductase; 5-hydroxy-2-oxopentanoate dehydrogenase; and 5-hydroxy-2-oxopentanoate decarboxylase (see Figure 62, steps X-Y-Z). The disclosure furthur provides a method for producing 4-hydroxybutyryl-CoA by culturing a non-naturally occurring microbial organism, comprising a 4-hydroxybutyryl-CoA pathway comprising at least one exogenous nucleic acid encoding a 4-hydroxybutyryl-CoA pathway enzyme expressed in a sufficient amount to produce 4-hydroxybutyryl-CoA, the 4-hydroxybutyryl-CoA pathway comprising alpha-ketoglutarate reductase; 5-hydroxy-2-oxopentanoate dehydrogenase; and 5-hydroxy-2-oxopentanoate dehydrogenase (decarboxylation) (see Figure 62, steps X-Y-AA).

[0216] The disclosure additionally provides a method for producing putrescine by culturing a non-naturally occurring microbial organism, comprising a putrescine pathway comprising at least one exogenous nucleic acid encoding a putrescine pathway enzyme expressed in a sufficient amount to produce putrescine, the putrescine pathway comprising succinate reductase; 4-aminobutyrate dehydrogenase or 4-aminobutyrate transaminase; 4-aminobutyrate reductase; and putrescine dehydrogenase or putrescine transaminase (see Figure 63, steps F-M/N-C-D/E). In still another aspect, the disclosure provides a method for producing putrescine by culturing a non-naturally occurring microbial organism, comprising a putrescine pathway comprising at least one exogenous nucleic acid encoding a putrescine pathway enzyme expressed in a sufficient amount to produce putrescine, the putrescine pathway comprising alpha-ketoglutarate decarboxylase; 4-aminobutyrate dehydrogenase or 4-aminobutyrate transaminase; 4-aminobutyrate reductase; and putrescine dehydrogenase or putrescine transaminase (see Figure 63, steps B-M/N-C-D/E). The disclosure additionally provides a method for producing putrescine by culturing a non-naturally occurring microbial organism, comprising a putrescine pathway comprising at least one exogenous nucleic acid encoding a putrescine pathway enzyme expressed in a sufficient amount to produce putrescine, the putrescine pathway comprising glutamate dehydrogenase or glutamate transaminase; glutamate decarboxylase; 4-aminobutyrate reductase; and putrescine dehydrogenase or putrescine transaminase (see Figure 63, steps J/K-L-C-D/E).

[0217] The disclosure provides in another aspect a method for producing putrescine by culturing a non-naturally occurring microbial organism, comprising a putrescine pathway comprising at least one exogenous nucleic acid encoding a putrescine pathway enzyme expressed in a sufficient amount to produce putrescine, the putrescine pathway comprising alpha-ketoglutarate reductase; 5-amino-2-oxopentanoate dehydrogenase or 5-amino-2-oxopentanoate transaminase; 5-amino-2-oxopentanoate decarboxylase; and putrescine dehydrogenase or putrescine transaminase (see Figure 63, steps O-P/Q-R-D/E). Also provided is a method for producing putrescine by culturing a non-naturally occurring microbial organism, comprising a putrescine pathway comprising at least one exogenous nucleic acid encoding a putrescine pathway enzyme expressed in a sufficient amount to produce putrescine, the putrescine pathway comprising alpha-ketoglutarate reductase; 5-amino-2-oxopentanoate dehydrogenase or 5-amino-2-oxopentanoate transaminase; ornithine dehydrogenase or ornithine transaminase; and ornithine decarboxylase (see Figure 63, steps O-P/Q-S/T-U). It is understood that a microbial organism comprising any of the pathways disclosed herein can be used to produce a a desired product or intermediate, including 4-HB, 4-HBal, BDO or putrescine.

[0218] It is understood that, in methods of the disclosure, any of the one or more exogenous nucleic acids can be introduced into a microbial organism to produce a non-naturally occurring microbial organism of the disclosure. The nucleic acids can be introduced so as to confer, for example, a 4-HB, BDO, THF or GBL biosynthetic pathway onto the microbial organism. Alternatively, encoding nucleic acids can be introduced to produce an intermediate microbial organism having the biosynthetic capability to catalyze some of the required reactions to confer 4-HB, BDO, THF or GBL biosynthetic capability. For example, a non-naturally occurring microbial organism having a 4-HB biosynthetic pathway can comprise at least two exogenous nucleic acids encoding desired enzymes, such as the combination of 4-hydroxybutanoate dehydrogenase and α-ketoglutarate decarboxylase; 4-hydroxybutanoate dehydrogenase and CoA-independent succinic semialdehyde dehydrogenase; 4-hydroxybutanoate dehydrogenase and CoA-dependent succinic semialdehyde dehydrogenase; CoA-dependent succinic semialdehyde dehydrogenase and succinyl-CoA synthetase; succinyl-CoA synthetase and glutamate decarboxylase, and the like. Thus, it is understood that any combination of two or more enzymes of a biosynthetic pathway can be included in a non-naturally occurring microbial organism of the disclosure. Similarly, it is understood that any combination of three or more enzymes of a biosynthetic pathway can be included in a non-naturally occurring microbial organism of the disclosure, for example, 4-hydroxybutanoate dehydrogenase, α-ketoglutarate decarboxylase and CoA-dependent succinic semialdehyde dehydrogenase; CoA-independent succinic semialdehyde dehydrogenase and succinyl-CoA synthetase; 4-hydroxybutanoate dehydrogenase, CoA-dependent succinic semialdehyde dehydrogenase and glutamate:succinic semialdehyde transaminase, and so forth, as desired, so long as the combination of enzymes of the desired biosynthetic pathway results in production of the corresponding desired product.

[0219] Similarly, for example, with respect to any one or more exogenous nucleic acids introduced to confer BDO production, a non-naturally occurring microbial organism having a BDO biosynthetic pathway can comprise at least two exogenous nucleic acids encoding desired enzymes, such as the combination of 4-hydroxybutanoate dehydrogenase and α-ketoglutarate decarboxylase; 4-hydroxybutanoate dehydrogenase and 4-hydroxybutyryl CoA:acetyl-CoA transferase; 4-hydroxybutanoate dehydrogenase and butyrate kinase; 4-hydroxybutanoate dehydrogenase and phosphotransbutyrylase; 4-hydroxybutyryl CoA:acetyl-CoA transferase and aldehyde dehydrogenase; 4-hydroxybutyryl CoA:acetyl-CoA transferase and alcohol dehydrogenase; 4-hydroxybutyryl CoA:acetyl-CoA transferase and an aldehyde/alcohol dehydrogenase, 4-aminobutyrate-CoA transferase and 4-aminobutyryl-CoA transaminase; 4-aminobutyrate kinase and 4-aminobutan-1-ol oxidoreductase (deaminating), and the like. Thus, it is understood that any combination of two or more enzymes of a biosynthetic pathway can be included in a non-naturally occurring microbial organism of the disclosure. Similarly, it is understood that any combination of three or more enzymes of a biosynthetic pathway can be included in a non-naturally occurring microbial organism of the disclosure, for example, 4-hydroxybutanoate dehydrogenase, α-ketoglutarate decarboxylase and 4-hydroxybutyryl CoA:acetyl-CoA transferase; 4-hydroxybutanoate dehydrogenase, butyrate kinase and phosphotransbutyrylase; 4-hydroxybutanoate dehydrogenase, 4-hydroxybutyryl CoA:acetyl-CoA transferase and aldehyde dehydrogenase; 4-hydroxybutyryl CoA:acetyl-CoA transferase, aldehyde dehydrogenase and alcohol dehydrogenase; butyrate kinase, phosphotransbutyrylase and an aldehyde/alcohol dehydrogenase; 4-aminobutyryl-CoA hydrolase, 4-aminobutyryl-CoA reductase and 4-amino butan-1-ol transaminase; 3-hydroxybutyryl-CoA dehydrogenase, 3-hydroxybutyryl-CoA dehydratase and 4-hydroxybutyryl-CoA dehydratase, and the like. Similarly, any combination of four, five or more enzymes of a biosynthetic pathway as disclosed herein can be included in a non-naturally occurring microbial organism of the disclosure, as desired, so long as the combination of enzymes of the desired biosynthetic pathway results in production of the corresponding desired product.

[0220] Any of the non-naturally occurring microbial organisms described herein can be cultured to produce and/or secrete the biosynthetic products of the disclosure. For example, the 4-HB producers can be cultured for the biosynthetic production of 4-HB. The 4-HB can be isolated or be treated as described below to generate GBL, THF and/or BDO. Similarly, the BDO producers can be cultured for the biosynthetic production of BDO. The BDO can be isolated or subjected to further treatments for the chemical synthesis of BDO family compounds, as disclosed herein. Thus, the disclosure provides a method of producing a desired product such as 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine, for example, 4-HB or BDO using a microbial organism of the disclosure. Optionally, a purification or isolation step can be applied, for example, distillation, to purify the product such as 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine, for example, 4-hydroxybutyrate or 1,4-butanediol. Thus, the disclosure also provides a method for producing isolated or purified product such as 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine, for example, 4-hydroxybutyrate or 1,4-butanediol, by culturing the non-naturally occurring microbial organism of the disclosure under conditions and for a sufficient period of time to produce the product such as 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine, for example, 4-hydroxybutyrate or 1,4-butanediol, and isolating or purifying the product. The isolating or purifying can comprise a step such as distillation.

[0221] The growth medium can include, for example, any carbohydrate source which can supply a source of carbon to the non-naturally occurring microorganism. Such sources include, for example, sugars such as glucose, sucrose, xylose, arabinose, galactose, mannose, fructose and starch; or glycerol, and it is understood that a carbon source can be used alone as the sole source of carbon or in combination with other carbon sources described herein or known in the art. Other sources of carbohydrate include, for example, renewable feedstocks and biomass. Exemplary types of biomasses that can be used as feedstocks in the methods of the disclosure include cellulosic biomass, hemicellulosic biomass and lignin feedstocks or portions of feedstocks. Such biomass feedstocks contain, for example, carbohydrate substrates useful as carbon sources such as glucose, sucrose, xylose, arabinose, galactose, mannose, fructose and starch. Given the teachings and guidance provided herein, those skilled in the art will understand that renewable feedstocks and biomass other than those exemplified above also can be used for culturing the microbial organisms of the disclosure for the production of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine and other compounds of the disclosure.

[0222] Accordingly, given the teachings and guidance provided herein, those skilled in the art will understand that a non-naturally occurring microbial organism can be produced that secretes the biosynthesized compounds of the disclosure when grown on a carbon source such as a carbohydrate. Such compounds include, for example, 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine and any of the intermediates metabolites in the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathways and/or the combined 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathways. All that is required is to engineer in one or more of the enzyme activities shown in Figure 1 to achieve biosynthesis of the desired compound or intermediate including, for example, inclusion of some or all of the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine biosynthetic pathways. Accordingly, the disclosure provides a non-naturally occurring microbial organism that secretes 4-HB when grown on a carbohydrate, secretes BDO when grown on a carbohydrate and/or secretes any of the intermediate metabolites shown in Figures 1, 8-13, 58, 62 or 63 when grown on a carbohydrate. A BDO producing microbial organisms of the disclosure can initiate synthesis from, for example, succinate, succinyl-CoA, α-ketogluterate, succinic semialdehyde, 4-HB, 4-hydroxybutyrylphosphate, 4-hydroxybutyryl-CoA (4-HB-CoA) and/or 4-hydroxybutyraldehyde.

[0223] In some aspects, culture conditions include anaerobic or substantially anaerobic growth or maintenance conditions. Exemplary anaerobic conditions have been described previously and are well known in the art. Exemplary anaerobic conditions for fermentation processes are described below in the Examples. Any of these conditions can be employed with the non-naturally occurring microbial organisms as well as other anaerobic conditions well known in the art. Under such anaerobic conditions, the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine producers can synthesize monomeric 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine, respectively, at intracellular concentrations of 5-10 mM or more as well as all other concentrations exemplified previously.

[0224] A number of downstream compounds also can be generated for the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine producing non-naturally occurring microbial organisms of the disclosure. With respect to the 4-HB producing microbial organisms of the disclosure, monomeric 4-HB and GBL exist in equilibrium in the culture medium. The conversion of 4-HB to GBL can be efficiently accomplished by, for example, culturing the microbial organisms in acid pH medium. A pH less than or equal to 7.5, in particular at or below pH 5.5, spontaneously converts 4-HB to GBL.

[0225] The resultant GBL can be separated from 4-HB and other components in the culture using a variety of methods well known in the art. Such separation methods include, for example, the extraction procedures exemplified in the Examples as well as methods which include continuous liquid-liquid extraction, pervaporation, membrane filtration, membrane separation, reverse osmosis, electrodialysis, distillation, crystallization, centrifugation, extractive filtration, ion exchange chromatography, size exclusion chromatography, adsorption chromatography, and ultrafiltration. All of the above methods are well known in the art. Separated GBL can be further purified by, for example, distillation.

[0226] Another down stream compound that can be produced from the 4-HB producing non-naturally occurring microbial organisms of the disclosure includes, for example, BDO. This compound can be synthesized by, for example, chemical hydrogenation of GBL. Chemical hydrogenation reactions are well known in the art. One exemplary procedure includes the chemical reduction of 4-HB and/or GBL or a mixture of these two components deriving from the culture using a heterogeneous or homogeneous hydrogenation catalyst together with hydrogen, or a hydride-based reducing agent used stoichiometrically or catalytically, to produce 1,4-butanediol.

[0227] Other procedures well known in the art are equally applicable for the above chemical reaction and include, for example, WO No. 82/03854 (Bradley, et al.), which describes the hydrogenolysis of gamma-butyrolactone in the vapor phase over a copper oxide and zinc oxide catalyst. British Pat. No. 1,230,276, which describes the hydrogenation of gamma-butyrolactone using a copper oxide-chromium oxide catalyst. The hydrogenation is carried out in the liquid phase. Batch reactions also are exemplified having high total reactor pressures. Reactant and product partial pressures in the reactors are well above the respective dew points. British Pat. No. 1,314,126, which describes the hydrogenation of gamma-butyrolactone in the liquid phase over a nickel-cobalt-thorium oxide catalyst. Batch reactions are exemplified as having high total pressures and component partial pressures well above respective component dew points. British Pat. No. 1,344,557, which describes the hydrogenation of gamma-butyrolactone in the liquid phase over a copper oxide-chromium oxide catalyst. A vapor phase or vapor-containing mixed phase is indicated as suitable in some instances. A continuous flow tubular reactor is exemplified using high total reactor pressures. British Pat. No. 1,512,751, which describes the hydrogenation of gamma-butyrolactone to 1,4-butanediol in the liquid phase over a copper oxide-chromium oxide catalyst. Batch reactions are exemplified with high total reactor pressures and, where determinable, reactant and product partial pressures well above the respective dew points. U.S. Pat. No. 4,301,077, which describes the hydrogenation to 1,4-butanediol of gamma-butyrolactone over a Ru-Ni-Co-Zn catalyst. The reaction can be conducted in the liquid or gas phase or in a mixed liquid-gas phase. Exemplified are continuous flow liquid phase reactions at high total reactor pressures and relatively low reactor productivities. U.S. Pat. No. 4,048,196, which describes the production of 1,4-butanediol by the liquid phase hydrogenation of gamma-butyrolactone over a copper oxide-zinc oxide catalyst. Further exemplified is a continuous flow tubular reactor operating at high total reactor pressures and high reactant and product partial pressures. And U.S. Patent No. 4,652,685, which describes the hydrogenation of lactones to glycols.

[0228] A further downstream compound that can be produced form the 4-HB producing microbial organisms of the disclosure includes, for example, THF. This compound can be synthesized by, for example, chemical hydrogenation of GBL. One exemplary procedure well known in the art applicable for the conversion of GBL to THF includes, for example, chemical reduction of 4-HB and/or GBL or a mixture of these two components deriving from the culture using a heterogeneous or homogeneous hydrogenation catalyst together with hydrogen, or a hydride-based reducing agent used stoichiometrically or catalytically, to produce tetrahydrofuran. Other procedures well know in the art are equally applicable for the above chemical reaction and include, for example, U.S. Patent No. 6,686,310, which describes high surface area sol-gel route prepared hydrogenation catalysts. Processes for the reduction of maleic acid to tetrahydrofuran (THF) and 1,4-butanediol (BDO) and for the reduction of gamma butyrolactone to tetrahydrofuran and 1,4-butanediol also are described.

[0229] The culture conditions can include, for example, liquid culture procedures as well as fermentation and other large scale culture procedures. As described further below in the Examples, particularly useful yields of the biosynthetic products of the dislcosure can be obtained under anaerobic or substantially anaerobic culture conditions.

[0230] Suitable purification and/or assays to test for the production of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine can be performed using well known methods. Suitable replicates such as triplicate cultures can be grown for each engineered strain to be tested. For example, product and byproduct formation in the engineered production host can be monitored. The final product and intermediates, and other organic compounds, can be analyzed by methods such as HPLC (High Performance Liquid Chromatography), GC-MS (Gas Chromatography-Mass Spectroscopy) and LC-MS (Liquid Chromatography-Mass Spectroscopy) or other suitable analytical methods using routine procedures well known in the art. The release of product in the fermentation broth can also be tested with the culture supernatant. Byproducts and residual glucose can be quantified by HPLC using, for example, a refractive index detector for glucose and alcohols, and a UV detector for organic acids (Lin et al., Biotechnol. Bioeng. 90:775-779 (2005)), or other suitable assay and detection methods well known in the art. The individual enzyme or protein activities from the exogenous DNA sequences can also be assayed using methods well known in the art.

[0231] The 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine product can be separated from other components in the culture using a variety of methods well known in the art. Such separation methods include, for example, extraction procedures as well as methods that include continuous liquid-liquid extraction, pervaporation, membrane filtration, membrane separation, reverse osmosis, electrodialysis, distillation, crystallization, centrifugation, extractive filtration, ion exchange chromatography, size exclusion chromatography, adsorption chromatography, and ultrafiltration. All of the above methods are well known in the art.

[0232] The disclosure further provides a method of manufacturing 4-HB. The method includes fermenting a non-naturally occurring microbial organism having a 4-hydroxybutanoic acid (4-HB) biosynthetic pathway comprising at least one exogenous nucleic acid encoding 4-hydroxybutanoate dehydrogenase, CoA-independent succinic semialdehyde dehydrogenase, succinyl-CoA synthetase, CoA-dependent succinic semialdehyde dehydrogenase, glutamate:succinic semialdehyde transaminase, a-ketoglutarate decarboxylase, or glutamate decarboxylase under substantially anaerobic conditions for a sufficient period of time to produce monomeric 4-hydroxybutanoic acid (4-HB), the process comprising fed-batch fermentation and batch separation; fed-batch fermentation and continuous separation, or continuous fermentation and continuous separation.

[0233] The culture and chemical hydrogenations described above also can be scaled up and grown continuously for manufacturing of 4-HB, 4-HBal, 4-HBCoA, GBL, BDO and/or THF or putrescine. Exemplary growth procedures include, for example, fed-batch fermentation and batch separation; fed-batch fermentation and continuous separation, or continuous fermentation and continuous separation. All of these processes are well known in the art. Employing the 4-HB producers allows for simultaneous 4-HB biosynthesis and chemical conversion to GBL, BDO and/or THF by employing the above hydrogenation procedures simultaneous with continuous cultures methods such as fermentation. Other hydrogenation procedures also are well known in the art and can be equally applied to the methods of the disclosure.

[0234] Fermentation procedures are particularly useful for the biosynthetic production of commercial quantities of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine. Generally, and as with non-continuous culture procedures, the continuous and/or near-continuous production of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine will include culturing a non-naturally occurring 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine producing organism of the disclosure in sufficient nutrients and medium to sustain and/or nearly sustain growth in an exponential phase. Continuous culture under such conditions can include, for example, growth or culturing 1 day, 2, 3, 4, 5, 6 or 7 days or more. Additionally, continuous culture can include longer time periods of 1 week, 2, 3, 4 or 5 or more weeks and up to several months. Alternatively, organisms of the disclosure can be cultured for hours, if suitable for a particular application. It is to be understood that the continuous and/or near-continuous culture conditions also can include all time intervals in between these exemplary periods. It is further understood that the time of culturing the microbial organism of the disclosure is for a sufficient period of time to produce a sufficient amount of product for a desired purpose.

[0235] Fermentation procedures are well known in the art. Briefly, fermentation for the biosynthetic production of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine or other 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine derived products, including intermediates, of the disclosure can be utilized in, for example, fed-batch fermentation and batch separation; fed-batch fermentation and continuous separation, or continuous fermentation and continuous separation. Examples of batch and continuous fermentation procedures well known in the art are exemplified further below in the Examples.

[0236] In addition to the above fermentation procedures using the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine producers of the disclosure for continuous production of substantial quantities of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine, including monomeric 4-HB, respectively, the 4-HB producers also can be, for example, simultaneously subjected to chemical synthesis procedures to convert the product to other compounds or the product as described previously for the chemical conversion of monomeric 4-HB to, for example, GBL, BDO and/or THF. The BDO producers can similarly be, for example, simultaneously subjected to chemical synthesis procedures as described previously for the chemical conversion of BDO to, for example, THF, GBL, pyrrolidones and/or other BDO family compounds. In addition, the products of the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine producers can be separated from the fermentation culture and sequentially subjected to chemical or enzymatic conversion to convert the product to other compounds, if desired, as disclosed herein.

[0237] Briefly, hydrogenation of GBL in the fermentation broth can be performed as described by Frost et al., Biotechnology Progress 18: 201-211 (2002). Another procedure for hydrogenation during fermentation include, for example, the methods described in, for example, U.S. Patent No. 5,478,952. This method is further exemplified in the Examples below.

[0238] Therefore, the disclosure additionally provides a method of manufacturing γ-butyrolactone (GBL), tetrahydrofuran (THF) or 1,4-butanediol (BDO). The method includes fermenting a non-naturally occurring microbial organism having 4-hydroxybutanoic acid (4-HB) and/or 1,4-butanediol (BDO) biosynthetic pathways, the pathways comprise at least one exogenous nucleic acid encoding 4-hydroxybutanoate dehydrogenase, CoA-independent succinic semialdehyde dehydrogenase, succinyl-CoA synthetase, CoA-dependent succinic semialdehyde dehydrogenase, 4-hydroxybutyrate:CoA transferase, glutamate:succinic semialdehyde transaminase, α-ketoglutarate decarboxylase, glutamate decarboxylase, 4-hydroxybutanoate kinase, phosphotransbutyrylase, CoA-independent 1,4-butanediol semialdehyde dehydrogenase, CoA-dependent 1,4-butanediol semialdehyde dehydrogenase, CoA-independent 1,4-butanediol alcohol dehydrogenase or CoA-dependent 1,4-butanediol alcohol dehydrogenase, under substantially anaerobic conditions for a sufficient period of time to produce 1,4-butanediol (BDO), GBL or THF, the fermenting comprising fed-batch fermentation and batch separation; fed-batch fermentation and continuous separation, or continuous fermentation and continuous separation.

[0239] In addition to the biosynthesis of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine and other products of the disclosure as described herein, the non-naturally occurring microbial organisms and methods of the disclosure also can be utilized in various combinations with each other and/or with other microbial organisms and methods well known in the art to achieve product biosynthesis by other routes. For example, one alternative to produce BDO other than use of the 4-HB producers and chemical steps or other than use of the BDO producer directly is through addition of another microbial organism capable of converting 4-HB or a 4-HB product exemplified herein to BDO.

[0240] One such procedure includes, for example, the fermentation of a 4-HB producing microbial organism of the disclosure to produce 4-HB, as described above and below. The 4-HB can then be used as a substrate for a second microbial organism that converts 4-HB to, for example, BDO, GBL and/or THF. The 4-HB can be added directly to another culture of the second organism or the original culture of 4-HB producers can be depleted of these microbial organisms by, for example, cell separation, and then subsequent addition of the second organism to the fermentation broth can utilized to produce the final product without intermediate purification steps. One exemplary second organism having the capacity to biochemically utilize 4-HB as a substrate for conversion to BDO, for example, is Clostridium acetobutylicum (see, for example, Jewell et al., Current Microbiology, 13:215-19 (1986)).

[0241] Thus, such a procedure includes, for example, the fermentation of a microbial organism that produces a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway intermediate. The 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway intermediate can then be used as a substrate for a second microbial organism that converts the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway intermediate to 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine. The 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway intermediate can be added directly to another culture of the second organism or the original culture of the 4-HB, 4-HBal, 4-HBCoA BDO or putrescine pathway intermediate producers can be depleted of these microbial organisms by, for example, cell separation, and then subsequent addition of the second organism to the fermentation broth can be utilized to produce the final product without intermediate purification steps.

[0242] In other aspects, the non-naturally occurring microbial organisms and methods of the disclosure can be assembled in a wide variety of subpathways to achieve biosynthesis of, for example, 4-HB and/or BDO as described. In these aspects, biosynthetic pathways for a desired product of the disclosure can be segregated into different microbial organisms and the different microbial organisms can be co-cultured to produce the final product. In such a biosynthetic scheme, the product of one microbial organism is the substrate for a second microbial organism until the final product is synthesized. For example, the biosynthesis of BDO can be accomplished as described previously by constructing a microbial organism that contains biosynthetic pathways for conversion of one pathway intermediate to another pathway intermediate or the product, for example, a substrate such as endogenous succinate through 4-HB to the final product BDO. Alternatively, BDO also can be biosynthetically produced from microbial organisms through co-culture or co-fermentation using two organisms in the same vessel. A first microbial organism being a 4-HB producer with genes to produce 4-HB from succinic acid, and a second microbial organism being a BDO producer with genes to convert 4-HB to BDO. For example, the biosynthesis of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine can be accomplished by constructing a microbial organism that contains biosynthetic pathways for conversion of one pathway intermediate to another pathway intermediate or the product. Alternatively, 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine also can be biosynthetically produced from microbial organisms through co-culture or co-fermentation using two organisms in the same vessel, where the first microbial organism produces a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine intermediate and the second microbial organism converts the intermediate to 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine.

[0243] Given the teachings and guidance provided herein, those skilled in the art will understand that a wide variety of combinations and permutations exist for the non-naturally occurring microbial organisms and methods of the disclosure together with other microbial organisms, with the co-culture of other non-naturally occurring microbial organisms having subpathways and with combinations of other chemical and/or biochemical procedures well known in the art to produce 4-HB, 4-HBal, BDO, GBL, THF and putrescine products of the disclosure.

[0244] Similarly, it is understood by those skilled in the art that a host organism can be selected based on desired characteristics for introduction of one or more gene disruptions to increase production of4-HB, 4-HBal, 4-HBCoA, BDO or putrescine. Thus, it is understood that, if a genetic modification is to be introduced into a host organism to disrupt a gene, any homologs, orthologs or paralogs that catalyze similar, yet non-identical metabolic reactions can similarly be disrupted to ensure that a desired metabolic reaction is sufficiently disrupted. Because certain differences exist among metabolic networks between different organisms, those skilled in the art will understand that the actual genes disrupted in a given organism may differ between organisms. However, given the teachings and guidance provided herein, those skilled in the art also will understand that the methods of the disclosure can be applied to any suitable host microorganism to identify the cognate metabolic alterations needed to construct an organism in a species of interest that will increase 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine biosynthesis. In a particular aspect, the increased production couples biosynthesis of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine to growth of the organism, and can obligatorily couple production of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine to growth of the organism if desired and as disclosed herein.

[0245] It is understood that, in methods of the disclosure, any of the one or more exogenous nucleic acids can be introduced into a microbial organism to produce a non-naturally occurring microbial organism of the disclosure. The nucleic acids can be introduced so as to confer, for example, a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine biosynthetic pathway onto the microbial organism. Alternatively, encoding nucleic acids can be introduced to produce an intermediate microbial organism having the biosynthetic capability to catalyze some of the required reactions to confer 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine biosynthetic capability. For example, a non-naturally occurring microbial organism having a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine biosynthetic pathway can comprise at least two exogenous nucleic acids encoding desired enzymes or proteins, such as the combination of enzymes as disclosed herein (see Examples and Figures 1, 8-13, 58, 62 and 63), and the like. Thus, it is understood that any combination of two or more enzymes or proteins of a biosynthetic pathway can be included in a non-naturally occurring microbial organism of the disclosure. Similarly, it is understood that any combination of three or more enzymes or proteins of a biosynthetic pathway can be included in a non-naturally occurring microbial organism of the disclosure, for example, and so forth, as desired and disclosed herein, so long as the combination of enzymes and/or proteins of the desired biosynthetic pathway results in production of the corresponding desired product. Similarly, any combination of four or more enzymes or proteins of a biosynthetic pathway as disclosed herein can be included in a non-naturally occurring microbial organism of the disclosure, as desired, so long as the combination of enzymes and/or proteins of the desired biosynthetic pathway results in production of the corresponding desired product.

[0246] As disclosed herein, esterases were utilized to convert gamma-butyrolactone to 4-hydroxybutyrate. Exemplary esterases include, but are not limited to, esterases from Yersinia intermedia 29909 (locus yinte0001_13710) and Agrobacterium tumefaciens str. C58 (Carlier et al., Mol. Plant Microbe Interact. 17(9):951-957 (2004))(see Example XXXIV). The nucleotide sequence and amino acid sequence of the Yersinia gene (locus yinte0001_13710) is shown in Figure 89 (see also GenBank ZP_04636075.1; GI:238792441). The nucleotide and amino acid sequence of the gene from Agrobacterium tumefaciens is shown in Figure 90. Additionally exemplary esterases include AttM of Escherichia coli KTE10 (GenBank ZP_19612688.1, GI:432369596) and attM of Photorhabdus asymbiotica (GenBank YP_003039319.1 GI:253987963).

[0247] The disclosure additionally provides a method for reducing gamma-butyrolactone production in a cell or cell culture by expressing in the cell a gamma-butyrolactone esterase. The gamma-butyrolactone esterase can be, for example, a gamma-butyrolactone esterase of Yersinia or a polypeptide having at least 90% identity to a gamma-butyrolactone esterase of Yersinia. In a particular aspect, the gamma-butyrolactone esterase is encoded by a nucleic acid encoding the amino acid sequence of SEQ ID NO:179, or a nucleic acid encoding a polypeptide having at least 90% identity to SEQ ID NO:179. The disclosure further provides utilizing a gamma-butyrolactone esterase to decrease the amount of gamma-butyrolactone in a sample in vitro.

[0248] In certain aspects, the nucleic acid molecule that encodes an amino acid sequence disclosed herein, for example, a nucleic acid molecule encoding a 4-HB, GBL, 4-HBal, 4-HBCoA, BDO and/or putrescine pathway enzyme or protein of the disclosure, can have at least a certain identity to a nucleotide sequence disclosed herein. Accordingly, in some aspects, the nucleic acid molecule can have a nucleotide sequence of at least 65% identity, at least 70% identity, at least 75% identity, at least 80% identity, at least 85% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, or at least 99% identity to a nucleotide sequence disclosed herein. In other aspects, the nucleic acid molecule that encodes an amino acid sequence can encode an amino acid sequence having at least 65% identity, at least 70% identity, at least 75% identity, at least 80% identity, at least 85% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, or at least 99% identity to an amino acid sequence disclosed herein. Accordingly, in some aspects of the disclosure, a nucleic acid molecule encoding a 4-HB, GBL, 4-HBal, 4-HBCoA, BDO and/or putrescine pathway enzyme or protein has a nucleotide sequence of at least 65% identity, at least 70% identity, at least 75% identity, at least 80% identity, at least 85% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, or at least 99% identity to a nucleic acid disclosed herein by SEQ ID NO, GenBank and/or GI number or a nucleic acid molecule that hybridizes to a nucleic acid molecule that encodes an amino acid sequence disclosed herein by SEQ ID NO, GenBank and/or GI number.

[0249] Such nucleic acid molecules can be provided in a vector containing a nucleic acid molecule disclosed herein. In some aspects, the vector can be an expression vector as disclosed herein. The vector can be contained in a host cell. In some aspects, the host cell can be a non-naturally occurring microbial organism having a pathway that produces 4-HB, GBL, 4-HBal, 4-HBCoA, BDO and/or putrescine. The nucleic acid molecule contained in the host cell can be expressed using methods well known to one of skill in the art, such as using a promoter and/or enhancer that allows expression of the nucleic acid molecule in a desired host cell. Any of a variety of inducible promoters or enhancers can also be included in the vector for regulated expression of a nucleic acid molecule.

[0250] A host cell of the disclosure can have the nucleic acid molecule integrated into the host chromosome. Integration of the nucleic acid molecule can be done using methods well known to one of skill in the art, such as those disclosed herein. For example, the methods used to integrate nucleic acids into a host chromosome described herein is not limited to the precise nucleic acid molecule integrated. In is understood that one of skill in the art would be able to apply these same methods for integration of desired nucleic acids at the same or alternative sites within the genome of a host cell. In some aspects, integration of the nucleic acid molecule of the disclosure can be site-specific. In some aspects, the site specific integration will be of a minimal amount of the nucleic acid molecule such as the coding region of the desired polypeptide, which can be expressed by an endogenous host promoter. Methods of site-specific integration are well known to those of skill in the art, any number of which can be used to generate the host cells of the disclosure. Alternatively, the nucleic acid molecule can be expressed in a cell where the nucleic acid molecule is not integrated into a host chromosome, for example, expressed in a cell from a plasmid or other vector, as disclosed herein.

[0251] In some aspects, the host cell of the disclosure is a species of microorganism that is capable of fermentation. Exemplary microorganisms that are capable of fermentation are described herein. Furthermore, in some aspects, the disclosure provides culture medium having one or more host cells of the disclosure. In some aspect, the culture medium can be purified or substantially purified from a host cell of the disclosure following culturing of the host cell for production of 4-HB, GBL, 4-HBal, 4-HBCoA, BDO and/or putrescine. Methods of purifying or substantially purifying culture medium are well known to one skilled in the art and any one of which can be used to generate the culture medium of the disclosure, including those methods disclosed herein.

[0252] In some aspects, the disclosure provides a host strain, a method of constructing a host strain, or a method of fermentation to produce 4-HB, GBL, 4-HBal, 4-HBCoA, BDO and/or putrescine with the host strain, wherein the host strain includes a deletion and/or modification that attenuates expression or activity of one or more, up to all, native host genes encoding a polypeptide (enzyme) that catalyzes the same reaction in a 4-HB, GBL, 4-HBal, 4-HBCoA, BDO and/or putrescine pathway disclosed herein. In some aspects, the host strain provides an improved yield of 4-HB, GBL, 4-HBal, 4-HBCoA, BDO and/or putrescine in the fermentation compared to the parent strain before the deletion and/or modification.

[0253] "Homology" or "identity" or "similarity" refers to sequence similarity between two polypeptides or between two nucleic acid molecules. Homology can be determined by comparing a position in each sequence which may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same base or amino acid, then the molecules are homologous at that position. A degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences.

[0254] A polypeptide or polypeptide region (or a polynucleotide or polynucleotide region) has a certain percentage (for example, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99%) of "sequence identity" to another sequence means that, when aligned, that percentage of amino acids (or nucleotide bases) are the same in comparing the two sequences. Sequence identity (also known as homology or similarity) refers to sequence similarity between two nucleic acid molecules or between two polypeptides. Identity can be determined by comparing a position in each sequence, which may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same base or amino acid, then the molecules are identical at that position. A degree of identity between sequences is a function of the number of matching or homologous positions shared by the sequences. This alignment and the percent homology or sequence identity can be determined using software programs known in the art, for example those described in Ausubel et al., supra. Default parameters can be used for the alignment. One alignment program well known in the art is BLAST, which can be used with default parameters. In particular, programs are BLASTN and BLASTP, using the following default parameters: Genetic code = standard; filter = none; strand = both; cutoff = 60; expect = 10; Matrix = BLOSUM62; Descriptions = 50 sequences; sort by = HIGH SCORE; Databases = non-redundant, GenBank + EMBL + DDBJ + PDB + GenBank CDS translations + SwissProtein + SPupdate + PIR. Details of these programs can be found at the National Center for Biotechnology Information (NCBI).

[0255] A nucleic acid molecule encoding a 4-HB, GBL, 4-HBal, 4-HBCoA, BDO and/or putrescine pathway enzyme or protein of the disclosure can also include a nucleic acid molecule that hybridizes to a nucleic acid disclosed herein by SEQ ID NO, GenBank and/or GI number or a nucleic acid molecule that hybridizes to a nucleic acid molecule that encodes an amino acid sequence disclosed herein by SEQ ID NO, GenBank and/or GI number. Hybridization conditions can include highly stringent, moderately stringent, or low stringency hybridization conditions that are well known to one of skill in the art such as those described herein. Similarly, a nucleic acid molecule that can be used in the disclosure can be described as having a certain percent sequence identity to a nucleic acid disclosed herein by SEQ ID NO, GenBank and/or GI number or a nucleic acid molecule that hybridizes to a nucleic acid molecule that encodes an amino acid sequence disclosed herein by SEQ ID NO, GenBank and/or GI number. For example, the nucleic acid molecule can have at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to a nucleic acid described herein.

[0256] Stringent hybridization refers to conditions under which hybridized polynucleotides are stable. As known to those of skill in the art, the stability of hybridized polynucleotides is reflected in the melting temperature (Tm) of the hybrids. In general, the stability of hybridized polynucleotides is a function of the salt concentration, for example, the sodium ion concentration and temperature. A hybridization reaction can be performed under conditions of lower stringency, followed by washes of varying, but higher, stringency. Reference to hybridization stringency relates to such washing conditions. Highly stringent hybridization includes conditions that permit hybridization of only those nucleic acid sequences that form stable hybridized polynucleotides in 0.018M NaCl at 65°C, for example, if a hybrid is not stable in 0.018M NaCl at 65°C, it will not be stable under high stringency conditions, as contemplated herein. High stringency conditions can be provided, for example, by hybridization in 50% formamide, 5X Denhart's solution, 5X SSPE, 0.2% SDS at 42°C, followed by washing in 0.1X SSPE, and 0.1% SDS at 65°C. Hybridization conditions other than highly stringent hybridization conditions can also be used to describe the nucleic acid sequences disclosed herein. For example, the phrase moderately stringent hybridization refers to conditions equivalent to hybridization in 50% formamide, 5X Denhart's solution, 5X SSPE, 0.2% SDS at 42°C, followed by washing in 0.2X SSPE, 0.2% SDS, at 42°C. The phrase low stringency hybridization refers to conditions equivalent to hybridization in 10% formamide, 5X Denhart's solution, 6X SSPE, 0.2% SDS at 22°C, followed by washing in 1X SSPE, 0.2% SDS, at 37°C. Denhart's solution contains 1% Ficoll, 1% polyvinylpyrolidone, and 1% bovine serum albumin (BSA). 20X SSPE (sodium chloride, sodium phosphate, ethylene diamide tetraacetic acid (EDTA)) contains 3M sodium chloride, 0.2M sodium phosphate, and 0.025 M (EDTA). Other suitable low, moderate and high stringency hybridization buffers and conditions are well known to those of skill in the art and are described, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual, Third Ed., Cold Spring Harbor Laboratory, New York (2001); and Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, MD (1999).

[0257] If desired, encoded polypeptides can be isolated by a variety of methods well-known in the art, for example, recombinant expression systems, precipitation, gel filtration, ionexchange, reverse-phase and affinity chromatography, and the like. Other well-known methods are described in Deutscher et al., Guide to Protein Purification: Methods in Enzymology, Vol. 182, (Academic Press, (1990)). Alternatively, the isolated polypeptides of the present disclosure can be obtained using well-known recombinant methods (see, for example, Sambrook et al., supra, 1989; Ausubel et al., supra, 1999). The methods and conditions for biochemical purification of a polypeptide of the disclosure can be chosen by those skilled in the art, and purification monitored, for example, by a functional assay.

[0258] One non-limiting example of a method for preparing a polypeptide is to express nucleic acids encoding the polypeptide in a suitable host cell, such as a bacterial cell, a yeast cell, or other suitable cell, using methods well known in the art, and recovering the expressed polypeptide, again using well-known purification methods, so described herein. Polypeptides can be isolated directly from cells that have been transformed with expression vectors as described herein. Recombinantly expressed polypeptides can also be expressed as fusion proteins with appropriate affinity tags, such as glutathione S transferase (GST) or poly His, and affinity purified, if desired. Thus, a polypeptide can be produced by a host cell, as disclosed herein. A polypeptide can also be produced by chemical synthesis using a method of polypeptide synthesis well know to one skilled in the art.

[0259] In some aspects, the disclosure provides using a polypeptide disclosed herein as a biocatalyst. A "biocatalyst," as used herein, refers to a biological substance that initiates or modifies the rate of a chemical reaction. A biocatalyst can be an enzyme. A polypeptide of can be used to increase the rate of conversion of a substrate to a product as disclosed herein. In the context of an industrial reaction, a polypeptide can be used, absent a host cell, to improve reactions generating 4-HB, GBL, 4-HBal, 4-HBCoA, BDO and/or putrescine, for example, using in vitro methods.

[0260] In some aspects, the disclosure provides a method of constructing a host strain that can include, among other steps, introducing a vector disclosed herein into a host cell that is capable of fermentation. Vectors can be introduced stably or transiently into a host cell using techniques well known in the art including, but not limited to, conjugation, electroporation, chemical transformation, transduction, transfection, and ultrasound transformation. Additional methods are disclosed herein, any one of which can be used in the method of the disclosure.

[0261] To generate better producers, metabolic modeling can be utilized to optimize growth conditions. Modeling can also be used to design gene knockouts that additionally optimize utilization of the pathway (see, for example, U.S. patent publications US 2002/0012939, US 2003/0224363, US 2004/0029149, US 2004/0072723, US 2003/0059792, US 2002/0168654 and US 2004/0009466, and U.S. Patent No. 7,127,379). Modeling analysis allows reliable predictions of the effects on cell growth of shifting the metabolism towards more efficient production of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine.

[0262] One computational method for identifying and designing metabolic alterations favoring biosynthesis of a desired product is the OptKnock computational framework (Burgard et al., Biotechnol. Bioeng. 84:647-657 (2003)). OptKnock is a metabolic modeling and simulation program that suggests gene deletion or disruption strategies that result in genetically stable microorganisms which overproduce the target product. Specifically, the framework examines the complete metabolic and/or biochemical network of a microorganism in order to suggest genetic manipulations that force the desired biochemical to become an obligatory byproduct of cell growth. By coupling biochemical production with cell growth through strategically placed gene deletions or other functional gene disruption, the growth selection pressures imposed on the engineered strains after long periods of time in a bioreactor lead to improvements in performance as a result of the compulsory growth-coupled biochemical production. Lastly, when gene deletions are constructed there is a negligible possibility of the designed strains reverting to their wild-type states because the genes selected by OptKnock are to be completely removed from the genome. Therefore, this computational methodology can be used to either identify alternative pathways that lead to biosynthesis of a desired product or used in connection with the non-naturally occurring microbial organisms for further optimization of biosynthesis of a desired product.

[0263] Briefly, OptKnock is a term used herein to refer to a computational method and system for modeling cellular metabolism. The OptKnock program relates to a framework of models and methods that incorporate particular constraints into flux balance analysis (FBA) models. These constraints include, for example, qualitative kinetic information, qualitative regulatory information, and/or DNA microarray experimental data. OptKnock also computes solutions to various metabolic problems by, for example, tightening the flux boundaries derived through flux balance models and subsequently probing the performance limits of metabolic networks in the presence of gene additions or deletions. OptKnock computational framework allows the construction of model formulations that allow an effective query of the performance limits of metabolic networks and provides methods for solving the resulting mixed-integer linear programming problems. The metabolic modeling and simulation methods referred to herein as OptKnock are described in, for example, U.S. publication 2002/0168654, filed January 10, 2002, in International Patent No. PCT/US02/00660, filed January 10, 2002, and U.S. publication 2009/0047719, filed August 10, 2007.

[0264] Another computational method for identifying and designing metabolic alterations favoring biosynthetic production of a product is a metabolic modeling and simulation system termed SimPheny®. This computational method and system is described in, for example, U.S. publication 2003/0233218, filed June 14, 2002, and in International Patent Application No. PCT/US03/18838, filed June 13, 2003. SimPheny® is a computational system that can be used to produce a network model in silico and to simulate the flux of mass, energy or charge through the chemical reactions of a biological system to define a solution space that contains any and all possible functionalities of the chemical reactions in the system, thereby determining a range of allowed activities for the biological system. This approach is referred to as constraints-based modeling because the solution space is defined by constraints such as the known stoichiometry of the included reactions as well as reaction thermodynamic and capacity constraints associated with maximum fluxes through reactions. The space defined by these constraints can be interrogated to determine the phenotypic capabilities and behavior of the biological system or of its biochemical components.

[0265] These computational approaches are consistent with biological realities because biological systems are flexible and can reach the same result in many different ways. Biological systems are designed through evolutionary mechanisms that have been restricted by fundamental constraints that all livi ng systems must face. Therefore, constraints-based modeling strategy embraces these general realities. Further, the ability to continuously impose further restrictions on a network model via the tightening of constraints results in a reduction in the size of the solution space, thereby enhancing the precision with which physiological performance or phenotype can be predicted.

[0266] Given the teachings and guidance provided herein, those skilled in the art will be able to apply various computational frameworks for metabolic modeling and simulation to design and implement biosynthesis of a desired compound in host microbial organisms. Such metabolic modeling and simulation methods include, for example, the computational systems exemplified above as SimPheny® and OptKnock. For illustration of the disclosure, some methods are described herein with reference to the OptKnock computation framework for modeling and simulation. Those skilled in the art will know how to apply the identification, design and implementation of the metabolic alterations using OptKnock to any of such other metabolic modeling and simulation computational frameworks and methods well known in the art.

[0267] The methods described above will provide one set of metabolic reactions to disrupt. Elimination of each reaction within the set or metabolic modification can result in a desired product as an obligatory product during the growth phase of the organism. Because the reactions are known, a solution to the bilevel OptKnock problem also will provide the associated gene or genes encoding one or more enzymes that catalyze each reaction within the set of reactions. Identification of a set of reactions and their corresponding genes encoding the enzymes participating in each reaction is generally an automated process, accomplished through correlation of the reactions with a reaction database having a relationship between enzymes and encoding genes.

[0268] Once identified, the set of reactions that are to be disrupted in order to achieve production of a desired product are implemented in the target cell or organism by functional disruption of at least one gene encoding each metabolic reaction within the set. One particularly useful means to achieve functional disruption of the reaction set is by deletion of each encoding gene. However, in some instances, it can be beneficial to disrupt the reaction by other genetic aberrations including, for example, mutation, deletion of regulatory regions such as promoters or cis binding sites for regulatory factors, or by truncation of the coding sequence at any of a number of locations. These latter aberrations, resulting in less than total deletion of the gene set can be useful, for example, when rapid assessments of the coupling of a product are desired or when genetic reversion is less likely to occur.

[0269] To identify additional productive solutions to the above described bilevel OptKnock problem which lead to further sets of reactions to disrupt or metabolic modifications that can result in the biosynthesis, including growth-coupled biosynthesis of a desired product, an optimization method, termed integer cuts, can be implemented. This method proceeds by iteratively solving the OptKnock problem exemplified above with the incorporation of an additional constraint referred to as an integer cut at each iteration. Integer cut constraints effectively prevent the solution procedure from choosing the exact same set of reactions identified in any previous iteration that obligatorily couples product biosynthesis to growth. For example, if a previously identified growth-coupled metabolic modification specifies reactions 1, 2, and 3 for disruption, then the following constraint prevents the same reactions from being simultaneously considered in subsequent solutions. The integer cut method is well known in the art and can be found described in, for example, Burgard et al., Biotechnol. Prog. 17:791-797 (2001). As with all methods described herein with reference to their use in combination with the OptKnock computational framework for metabolic modeling and simulation, the integer cut method of reducing redundancy in iterative computational analysis also can be applied with other computational frameworks well known in the art including, for example, SimPheny®.

[0270] The methods exemplified herein allow the construction of cells and organisms that biosynthetically produce a desired product, including the obligatory coupling of production of a target biochemical product to growth of the cell or organism engineered to harbor the identified genetic alterations. Therefore, the computational methods described herein allow the identification and implementation of metabolic modifications that are identified by an in silico method selected from OptKnock or SimPheny®. The set of metabolic modifications can include, for example, addition of one or more biosynthetic pathway enzymes and/or functional disruption of one or more metabolic reactions including, for example, disruption by gene deletion.

[0271] As discussed above, the OptKnock methodology was developed on the premise that mutant microbial networks can be evolved towards their computationally predicted maximum-growth phenotypes when subjected to long periods of growth selection. In other words, the approach leverages an organism's ability to self-optimize under selective pressures. The OptKnock framework allows for the exhaustive enumeration of gene deletion combinations that force a coupling between biochemical production and cell growth based on network stoichiometry. The identification of optimal gene/reaction knockouts requires the solution of a bilevel optimization problem that chooses the set of active reactions such that an optimal growth solution for the resulting network overproduces the biochemical of interest (Burgard et al., Biotechnol. Bioeng. 84:647-657 (2003)).

[0272] An in silico stoichiometric model of E. coli metabolism can be employed to identify essential genes for metabolic pathways as exemplified previously and described in, for example, U.S. patent publications US 2002/0012939, US 2003/0224363, US 2004/0029149, US 2004/0072723, US 2003/0059792, US 2002/0168654 and US 2004/0009466, and in U.S. Patent No. 7,127,379. As disclosed herein, the OptKnock mathematical framework can be applied to pinpoint gene deletions leading to the growth-coupled production of a desired product. Further, the solution of the bilevel OptKnock problem provides only one set of deletions. To enumerate all meaningful solutions, that is, all sets of knockouts leading to growth-coupled production formation, an optimization technique, termed integer cuts, can be implemented. This entails iteratively solving the OptKnock problem with the incorporation of an additional constraint referred to as an integer cut at each iteration, as discussed above.

[0273] The methods exemplified above and further illustrated in the Examples below allow the construction of cells and organisms that biosynthetically produce, including obligatory couple production of a target biochemical product to growth of the cell or organism engineered to harbor the identified genetic alterations. In this regard, metabolic alterations have been identified that result in the biosynthesis of 4-HB and 1,4-butanediol. Microorganism strains constructed with the identified metabolic alterations produce elevated levels of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine compared to unmodified microbial organisms. These strains can be beneficially used for the commercial production of 4-HB, BDO, THF, GBL, 4-HBal, 4-HBCoA or putrescine, for example, in continuous fermentation process without being subjected to the negative selective pressures.

[0274] Therefore, the computational methods described herein allow the identification and implementation of metabolic modifications that are identified by an in silico method selected from OptKnock or SimPheny®. The set of metabolic modifications can include, for example, addition of one or more biosynthetic pathway enzymes and/.or functional disruption of one or more metabolic reactions including, for example, disruption by gene deletion.

[0275] It is understood that modifications which do not substantially affect the activity of the various aspects of this disclosure are also included within the definition of the disclosure provided herein. Accordingly, the following examples are intended to illustrate but not limit the present disclosure.

[0276] Any of the non-naturally occurring microbial organisms described herein can be cultured to produce and/or secrete the biosynthetic products of the disclosure. For example, the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine producers can be cultured for the biosynthetic production of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine. Accordingly, in some aspects, the disclosure provides culture medium having the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine or 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway intermediate described herein. In some aspects, the culture medium can also be separated from the non-naturally occurring microbial organisms of the disclosure that produced the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine or 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway intermediate. Methods for separating a microbial organism from culture medium are well known in the art. Exemplary methods include filtration, flocculation, precipitation, centrifugation, sedimentation, and the like.

[0277] For the production of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine, the recombinant strains are cultured in a medium with carbon source and other essential nutrients. It is sometimes and can be highly desirable to maintain anaerobic conditions in the fermenter to reduce the cost of the overall process. Such conditions can be obtained, for example, by first sparging the medium with nitrogen and then sealing the flasks with a septum and crimp-cap. For strains where growth is not observed anaerobically, microaerobic or substantially anaerobic conditions can be applied by perforating the septum with a small hole for limited aeration. Exemplary anaerobic conditions have been described previously and are well-known in the art. Exemplary aerobic and anaerobic conditions are described, for example, in U.S. publication 2009/0047719, filed August 10, 2007. Fermentations can be performed in a batch, fed-batch or continuous manner, as disclosed herein. Fermentations can also be conducted in two phases, if desired. The first phase can be aerobic to allow for high growth and therefore high productivity, followed by an anaerobic phase of high 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine yields.

[0278] If desired, the pH of the medium can be maintained at a desired pH, in particular neutral pH, such as a pH of around 7 by addition of a base, such as NaOH or other bases, or acid, as needed to maintain the culture medium at a desirable pH. The growth rate can be determined by measuring optical density using a spectrophotometer (600 nm), and the glucose uptake rate by monitoring carbon source depletion over time.

[0279] In addition to renewable feedstocks such as those exemplified above, the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine producing microbial organisms of the disclosure also can be modified for growth on syngas as its source of carbon. In this specific aspect, one or more proteins or enzymes are expressed in the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine producing organisms to provide a metabolic pathway for utilization of syngas or other gaseous carbon source.

[0280] Synthesis gas, also known as syngas or producer gas, is the major product of gasification of coal and of carbonaceous materials such as biomass materials, including agricultural crops and residues. Syngas is a mixture primarily of H2 and CO and can be obtained from the gasification of any organic feedstock, including but not limited to coal, coal oil, natural gas, biomass, and waste organic matter. Gasification is generally carried out under a high fuel to oxygen ratio. Although largely H2 and CO, syngas can also include CO2 and other gases in smaller quantities. Thus, synthesis gas provides a cost effective source of gaseous carbon such as CO and, additionally, CO2.

[0281] The Wood-Ljungdahl pathway catalyzes the conversion of CO and H2 to acetyl-CoA and other products such as acetate. Organisms capable of utilizing CO and syngas also generally have the capability of utilizing CO2 and CO2/H2 mixtures through the same basic set of enzymes and transformations encompassed by the Wood-Ljungdahl pathway. H2-dependent conversion of CO2 to acetate by microorganisms was recognized long before it was revealed that CO also could be used by the same organisms and that the same pathways were involved. Many acetogens have been shown to grow in the presence of CO2 and produce compounds such as acetate as long as hydrogen is present to supply the necessary reducing equivalents (see for example, Drake, Acetogenesis, pp. 3-60 Chapman and Hall, New York, (1994)). This can be summarized by the following equation:

Hence, non-naturally occurring microorganisms possessing the Wood-Ljungdahl pathway can utilize CO2 and H2 mixtures as well for the production of acetyl-CoA and other desired products.

[0282] The Wood-Ljungdahl pathway is well known in the art and consists of 12 reactions which can be separated into two branches: (1) methyl branch and (2) carbonyl branch. The methyl branch converts syngas to methyl-tetrahydrofolate (methyl-THF) whereas the carbonyl branch converts methyl-THF to acetyl-CoA. The reactions in the methyl branch are catalyzed in order by the following enzymes or proteins: ferredoxin oxidoreductase, formate dehydrogenase, formyltetrahydrofolate synthetase, methenyltetrahydrofolate cyclodehydratase, methylenetetrahydrofolate dehydrogenase and methylenetetrahydrofolate reductase. The reactions in the carbonyl branch are catalyzed in order by the following enzymes or proteins: methyltetrahydrofolate:corrinoid protein methyltransferase (for example, AcsE), corrinoid iron-sulfur protein, nickel-protein assembly protein (for example, AcsF), ferredoxin, acetyl-CoA synthase, carbon monoxide dehydrogenase and nickel-protein assembly protein (for example, CooC). Following the teachings and guidance provided herein for introducing a sufficient number of encoding nucleic acids to generate a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway, those skilled in the art will understand that the same engineering design also can be performed with respect to introducing at least the nucleic acids encoding the Wood-Ljungdahl enzymes or proteins absent in the host organism. Therefore, introduction of one or more encoding nucleic acids into the microbial organisms of the disclosure such that the modified organism contains the complete Wood-Ljungdahl pathway will confer syngas utilization ability.

[0283] Additionally, the reductive (reverse) tricarboxylic acid cycle coupled with carbon monoxide dehydrogenase and/or hydrogenase activities can also be used for the conversion of CO, CO2 and/or H2 to acetyl-CoA and other products such as acetate. Organisms capable of fixing carbon via the reductive TCA pathway can utilize one or more of the following enzymes: ATP citrate-lyase, citrate lyase, aconitase, isocitrate dehydrogenase, alpha-ketoglutarate:ferredoxin oxidoreductase, succinyl-CoA synthetase, succinyl-CoA transferase, fumarate reductase, fumarase, malate dehydrogenase, NAD(P)H:ferredoxin oxidoreductase, carbon monoxide dehydrogenase, and hydrogenase. Specifically, the reducing equivalents extracted from CO and/or H2 by carbon monoxide dehydrogenase and hydrogenase are utilized to fix CO2 via the reductive TCA cycle into acetyl-CoA or acetate. Acetate can be converted to acetyl-CoA by enzymes such as acetyl-CoA transferase, acetate kinase/phosphotransacetylase, and acetyl-CoA synthetase. Acetyl-CoA can be converted to the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine precursors, glyceraldehyde-3-phosphate, phosphoenolpyruvate, and pyruvate, by pyruvate:ferredoxin oxidoreductase and the enzymes of gluconeogenesis. Following the teachings and guidance provided herein for introducing a sufficient number of encoding nucleic acids to generate a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway, those skilled in the art will understand that the same engineering design also can be performed with respect to introducing at least the nucleic acids encoding the reductive TCA pathway enzymes or proteins absent in the host organism. Therefore, introduction of one or more encoding nucleic acids into the microbial organisms of the disclosure such that the modified organism contains the complete reductive TCA pathway will confer syngas utilization ability.

[0284] Accordingly, given the teachings and guidance provided herein, those skilled in the art will understand that a non-naturally occurring microbial organism can be produced that secretes the biosynthesized compounds of the disclosure when grown on a carbon source such as a carbohydrate. Such compounds include, for example, 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine and any of the intermediate metabolites in the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway. All that is required is to engineer in one or more of the required enzyme or protein activities to achieve biosynthesis of the desired compound or intermediate including, for example, inclusion of some or all of the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine biosynthetic pathways. Accordingly, the disclosure provides a non-naturally occurring microbial organism that produces and/or secretes 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine when grown on a carbohydrate or other carbon source and produces and/or secretes any of the intermediate metabolites shown in the 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway when grown on a carbohydrate or other carbon source. The 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine producing microbial organisms of the disclosure can initiate synthesis from an intermediate in a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway, as disclosed herein.

[0285] To generate better producers, metabolic modeling can be utilized to optimize growth conditions. Modeling can also be used to design gene knockouts that additionally optimize utilization of the pathway (see, for example, U.S. patent publications US 2002/0012939, US 2003/0224363, US 2004/0029149, US 2004/0072723, US 2003/0059792, US 2002/0168654 and US 2004/0009466, and U.S. Patent No. 7,127,379). Modeling analysis allows reliable predictions of the effects on cell growth of shifting the metabolism towards more efficient production of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine.

[0286] One computational method for identifying and designing metabolic alterations favoring biosynthesis of a desired product is the OptKnock computational framework (Burgard et al., Biotechnol. Bioeng. 84:647-657 (2003)). OptKnock is a metabolic modeling and simulation program that suggests gene deletion strategies that result in genetically stable microorganisms which overproduce the target product. Specifically, the framework examines the complete metabolic and/or biochemical network of a microorganism in order to suggest genetic manipulations that force the desired biochemical to become an obligatory byproduct of cell growth. By coupling biochemical production with cell growth through strategically placed gene deletions or other functional gene disruption, the growth selection pressures imposed on the engineered strains after long periods of time in a bioreactor lead to improvements in performance as a result of the compulsory growth-coupled biochemical production. Lastly, when gene deletions are constructed there is a negligible possibility of the designed strains reverting to their wild-type states because the genes selected by OptKnock are to be completely removed from the genome. Therefore, this computational methodology can be used to either identify alternative pathways that lead to biosynthesis of a desired product or used in connection with the non-naturally occurring microbial organisms for further optimization of biosynthesis of a desired product.

[0287] Briefly, OptKnock is a term used herein to refer to a computational method and system for modeling cellular metabolism. The OptKnock program relates to a framework of models and methods that incorporate particular constraints into flux balance analysis (FBA) models. These constraints include, for example, qualitative kinetic information, qualitative regulatory information, and/or DNA microarray experimental data. OptKnock also computes solutions to various metabolic problems by, for example, tightening the flux boundaries derived through flux balance models and subsequently probing the performance limits of metabolic networks in the presence of gene additions or deletions. OptKnock computational framework allows the construction of model formulations that allow an effective query of the performance limits of metabolic networks and provides methods for solving the resulting mixed-integer linear programming problems. The metabolic modeling and simulation methods referred to herein as OptKnock are described in, for example, U.S. publication 2002/0168654, filed January 10, 2002, in International Patent No. PCT/US02/00660, filed January 10, 2002, and U.S. publication 2009/0047719, filed August 10, 2007.

[0288] Another computational method for identifying and designing metabolic alterations favoring biosynthetic production of a product is a metabolic modeling and simulation system termed SimPheny®. This computational method and system is described in, for example, U.S. publication 2003/0233218, filed June 14, 2002, and in International Patent Application No. PCT/US03/18838, filed June 13, 2003 (WO/2003/106998). SimPheny® is a computational system that can be used to produce a network model in silico and to simulate the flux of mass, energy or charge through the chemical reactions of a biological system to define a solution space that contains any and all possible functionalities of the chemical reactions in the system, thereby determining a range of allowed activities for the biological system. This approach is referred to as constraints-based modeling because the solution space is defined by constraints such as the known stoichiometry of the included reactions as well as reaction thermodynamic and capacity constraints associated with maximum fluxes through reactions. The space defined by these constraints can be interrogated to determine the phenotypic capabilities and behavior of the biological system or of its biochemical components.

[0289] These computational approaches are consistent with biological realities because biological systems are flexible and can reach the same result in many different ways. Biological systems are designed through evolutionary mechanisms that have been restricted by fundamental constraints that all living systems must face. Therefore, constraints-based modeling strategy embraces these general realities. Further, the ability to continuously impose further restrictions on a network model via the tightening of constraints results in a reduction in the size of the solution space, thereby enhancing the precision with which physiological performance or phenotype can be predicted.

[0290] Given the teachings and guidance provided herein, those skilled in the art will be able to apply various computational frameworks for metabolic modeling and simulation to design and implement biosynthesis of a desired compound in host microbial organisms. Such metabolic modeling and simulation methods include, for example, the computational systems exemplified above as SimPheny® and OptKnock. For illustration of the disclosure, some methods are described herein with reference to the OptKnock computation framework for modeling and simulation. Those skilled in the art will know how to apply the identification, design and implementation of the metabolic alterations using OptKnock to any of such other metabolic modeling and simulation computational frameworks and methods well known in the art.

[0291] The methods described above will provide one set of metabolic reactions to disrupt. Elimination of each reaction within the set or metabolic modification can result in a desired product as an obligatory product during the growth phase of the organism. Because the reactions are known, a solution to the bilevel OptKnock problem also will provide the associated gene or genes encoding one or more enzymes that catalyze each reaction within the set of reactions. Identification of a set of reactions and their corresponding genes encoding the enzymes participating in each reaction is generally an automated process, accomplished through correlation of the reactions with a reaction database having a relationship between enzymes and encoding genes.

[0292] Once identified, the set of reactions that are to be disrupted in order to achieve production of a desired product are implemented in the target cell or organism by functional disruption of at least one gene encoding each metabolic reaction within the set. One particularly useful means to achieve functional disruption of the reaction set is by deletion of each encoding gene. However, in some instances, it can be beneficial to disrupt the reaction by other genetic aberrations including, for example, mutation, deletion of regulatory regions such as promoters or cis binding sites for regulatory factors, or by truncation of the coding sequence at any of a number of locations. These latter aberrations, resulting in less than total deletion of the gene set can be useful, for example, when rapid assessments of the coupling of a product are desired or when genetic reversion is less likely to occur.

[0293] To identify additional productive solutions to the above described bilevel OptKnock problem which lead to further sets of reactions to disrupt or metabolic modifications that can result in the biosynthesis, including growth-coupled biosynthesis of a desired product, an optimization method, termed integer cuts, can be implemented. This method proceeds by iteratively solving the OptKnock problem exemplified above with the incorporation of an additional constraint referred to as an integer cut at each iteration. Integer cut constraints effectively prevent the solution procedure from choosing the exact same set of reactions identified in any previous iteration that obligatorily couples product biosynthesis to growth. For example, if a previously identified growth-coupled metabolic modification specifies reactions 1, 2, and 3 for disruption, then the following constraint prevents the same reactions from being simultaneously considered in subsequent solutions. The integer cut method is well known in the art and can be found described in, for example, Burgard et al., Biotechnol. Prog. 17:791-797 (2001). As with all methods described herein with reference to their use in combination with the OptKnock computational framework for metabolic modeling and simulation, the integer cut method of reducing redundancy in iterative computational analysis also can be applied with other computational frameworks well known in the art including, for example, SimPheny®.

[0294] The methods exemplified herein allow the construction of cells and organisms that biosynthetically produce a desired product, including the obligatory coupling of production of a target biochemical product to growth of the cell or organism engineered to harbor the identified genetic alterations. Therefore, the computational methods described herein allow the identification and implementation of metabolic modifications that are identified by an in silico method selected from OptKnock or SimPheny®. The set of metabolic modifications can include, for example, addition of one or more biosynthetic pathway enzymes and/or functional disruption of one or more metabolic reactions including, for example, disruption by gene deletion.

[0295] As discussed above, the OptKnock methodology was developed on the premise that mutant microbial networks can be evolved towards their computationally predicted maximum-growth phenotypes when subjected to long periods of growth selection. In other words, the approach leverages an organism's ability to self-optimize under selective pressures. The OptKnock framework allows for the exhaustive enumeration of gene deletion combinations that force a coupling between biochemical production and cell growth based on network stoichiometry. The identification of optimal gene/reaction knockouts requires the solution of a bilevel optimization problem that chooses the set of active reactions such that an optimal growth solution for the resulting network overproduces the biochemical of interest (Burgard et al., Biotechnol. Bioeng. 84:647-657 (2003)).

[0296] An in silico stoichiometric model of E. coli metabolism can be employed to identify essential genes for metabolic pathways as exemplified previously and described in, for example, U.S. patent publications US 2002/0012939, US 2003/0224363, US 2004/0029149, US 2004/0072723, US 2003/0059792, US 2002/0168654 and US 2004/0009466, and in U.S. Patent No. 7,127,379. As disclosed herein, the OptKnock mathematical framework can be applied to pinpoint gene deletions leading to the growth-coupled production of a desired product. Further, the solution of the bilevel OptKnock problem provides only one set of deletions. To enumerate all meaningful solutions, that is, all sets of knockouts leading to growth-coupled production formation, an optimization technique, termed integer cuts, can be implemented. This entails iteratively solving the OptKnock problem with the incorporation of an additional constraint referred to as an integer cut at each iteration, as discussed above.

[0297] Employing the methods exemplified above and herein, the methods of the disclosure allow the construction of cells and organisms that increase production of a desired product, for example, by coupling the production of a desired product to growth of the cell or organism engineered to harbor the identified genetic alterations. As disclosed herein, metabolic alterations have been identified that couple the production of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine to growth of the organism. Microbial organism strains constructed with the identified metabolic alterations produce elevated levels, relative to the absence of the metabolic alterations, of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine during the exponential growth phase. These strains can be beneficially used for the commercial production of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine in continuous fermentation process without being subjected to the negative selective pressures described previously. Although exemplified herein as metabolic alterations, in particular one or more gene disruptions, that confer growth coupled production of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine, it is understood that any gene disruption that increases the production of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine can be introduced into a host microbial organism, as desired.

[0298] Therefore, the methods of the disclosure provide a set of metabolic modifications that are identified by an in silico method such as OptKnock. The set of metabolic modifications can include functional disruption of one or more metabolic reactions including, for example, disruption by gene deletion. For 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine production, metabolic modifications can be selected from the set of metabolic modifications described herein, including the Examples.

[0299] Also provided is a method of producing a non-naturally occurring microbial organisms having stable growth-coupled production of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine. The method can include identifying in silico a set of metabolic modifications that increase production of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine, for example, increase production during exponential growth; genetically modifying an organism to contain the set of metabolic modifications that increase production of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine, and culturing the genetically modified organism. If desired, culturing can include adaptively evolving the genetically modified organism under conditions requiring production of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine. The methods of the disclosure are applicable to bacterium, yeast and fungus as well as a variety of other cells and microorganism, as disclosed herein.

[0300] Thus, the disclosure provides a non-naturally occurring microbial organism comprising one or more gene disruptions that confer increased production of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine. In one aspect, the one or more gene disruptions confer growth-coupled production of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine, and can, for example, confer stable growth-coupled production of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine. In another aspect, the one or more gene disruptions can confer obligatory coupling of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine production to growth of the microbial organism. Such one or more gene disruptions reduce the activity of the respective one or more encoded enzymes.

[0301] The non-naturally occurring microbial organism can have one or more gene disruptions included in a metabolic modification as described herein. As disclosed herein, the one or more gene disruptions can be a deletion. Such non-naturally occurring microbial organisms of the disclosure include bacteria, yeast, fungus, or any of a variety of other microorganisms applicable to fermentation processes, as disclosed herein.

[0302] Thus, the disclosure provides a non-naturally occurring microbial organism, comprising one or more gene disruptions, where the one or more gene disruptions occur in genes encoding proteins or enzymes where the one or more gene disruptions confer increased production of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine in the organism. The production of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine can be growth-coupled or not growth-coupled. In a particular aspect, the production of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine can be obligatorily coupled to growth of the organism, as disclosed herein.

[0303] The disclosure provides non naturally occurring microbial organisms having genetic alterations such as gene disruptions that increase production of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine, for example, growth-coupled production of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine. Product production can be, for example, obligatorily linked to the exponential growth phase of the microorganism by genetically altering the metabolic pathways of the cell, as disclosed herein. The genetic alterations can increase the production of the desired product or even make the desired product an obligatory product during the growth phase. Sets of metabolic alterations or transformations that result in increased production and elevated levels of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine biosynthesis are described herein. Each alteration within a set corresponds to the requisite metabolic reaction that should be functionally disrupted. Functional disruption of all reactions within each set can result in the increased production of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine by the engineered strain during the growth phase..

[0304] A number of metablic modifications that include gene disruptions are described herein. It is understood by those skilled in the art that one or more of the metabolic modifications, including gene disruptions, can be combined to increase 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine or otherwise improve characteristics of the microorganisms of th disclosure. Each of these non-naturally occurring alterations can result in increased production and an enhanced level of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine production, for example, during the exponential growth phase of the microbial organism, or otherwise improve the growth or production characteristics of the microorganisms producing 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine compared to a strain that does not contain such metabolic alterations, under appropriate culture conditions. Appropriate conditions include, for example, those disclosed herein, including conditions such as particular carbon sources or reactant availabilities and/or adaptive evolution.

[0305] Given the teachings and guidance provided herein, those skilled in the art will understand that to introduce a metabolic alteration such as disruption or attenuation of an enzyme or enzymatic reaction, it can be necessary to disrupt the catalytic activity of the one or more enzymes involved in the reaction. Alternatively, a metabolic alteration can include disruption of expression of a regulatory protein or cofactor necessary for enzyme activity or maximal activity. Furthermore, genetic loss of a cofactor necessary for an enzymatic reaction can also have the same effect as a disruption of the gene encoding the enzyme. Disruption can occur by a variety of methods including, for example, deletion of an encoding gene or incorporation of a genetic alteration in one or more of the encoding gene sequences. The encoding genes targeted for disruption can be one, some, or all of the genes encoding enzymes involved in the catalytic activity. For example, where a single enzyme is involved in a targeted catalytic activity, disruption can occur by a genetic alteration that reduces or eliminates the catalytic activity of the encoded gene product. Similarly, where the single enzyme is multimeric, including heteromeric, disruption can occur by a genetic alteration that reduces or destroys the function of one or all subunits of the encoded gene products. Destruction of activity can be accomplished by loss of the binding activity of one or more subunits required to form an active complex, by destruction of the catalytic subunit of the multimeric complex or by both. Other functions of multimeric protein association and activity also can be targeted in order to disrupt a metabolic reaction of the disclosure. Such other functions are well known to those skilled in the art. Similarly, a target enzyme activity can be reduced or eliminated by disrupting expression of a protein or enzyme that modifies and/or activates the target enzyme, for example, a molecule required to convert an apoenzyme to a holoenzyme. Further, some or all of the functions of a single polypeptide or multimeric complex can be disrupted according to the disclosure in order to reduce or abolish the catalytic activity of one or more enzymes involved in a reaction or metabolic modification of the disclosure. Similarly, some or all of enzymes involved in a reaction or metabolic modification of the disclosure can be disrupted so long as the targeted reaction is reduced or eliminated.

[0306] Given the teachings and guidance provided herein, those skilled in the art also will understand that an enzymatic reaction can be disrupted by reducing or eliminating reactions encoded by a common gene and/or by one or more orthologs of that gene exhibiting similar or substantially the same activity. Reduction of both the common gene and all orthologs can lead to complete abolishment of any catalytic activity of a targeted reaction. However, disruption of either the common gene or one or more orthologs can lead to a reduction in the catalytic activity of the targeted reaction sufficient to promote coupling of growth to product biosynthesis. Exemplified herein are both the common genes encoding catalytic activities for a variety of metabolic modifications as well as their orthologs. Those skilled in the art will understand that disruption of some or all of the genes encoding a enzyme of a targeted metabolic reaction can be practiced in the methods of the disclosure and incorporated into the non-naturally occurring microbial organisms of the disclosure in order to achieve the increased production of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine or growth-coupled product production.

[0307] Given the teachings and guidance provided herein, those skilled in the art also will understand that enzymatic activity or expression can be attenuated using well known methods. Reduction of the activity or amount of an enzyme can mimic complete disruption of a gene if the reduction causes activity of the enzyme to fall below a critical level that is normally required for a pathway to function. Reduction of enzymatic activity by various techniques rather than use of a gene disruption can be important for an organism's viability. Methods of reducing enzymatic activity that result in similar or identical effects of a gene disruption include, but are not limited to: reducing gene transcription or translation; destabilizing mRNA, protein or catalytic RNA; and mutating a gene that affects enzyme activity or kinetics (see Sambrook et al., Molecular Cloning: A Laboratory Manual, Third Ed., Cold Spring Harbor Laboratory, New York (2001); and Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, MD (1999). Natural or imposed regulatory controls can also accomplish enzyme attenuation including: promoter replacement (see Wang et al., Mol. Biotechnol. 52(2):300-308 (2012)); loss or alteration of transcription factors (Dietrick et al., Annu. Rev. Biochem. 79:563-590 (2010); and Simicevic et al., Mol. Biosyst. 6(3):462-468 (2010)); introduction of inhibitory RNAs or peptides such as siRNA, antisense RNA, RNA or peptide/small-molecule binding aptamers, ribozymes, aptazymes and riboswitches (Wieland et al., Methods 56(3):351-357 (2012); O'Sullivan, Anal. Bioanal. Chem. 372(1):44-48 (2002); and Lee et al., Curr. Opin. Biotechnol. 14(5):505-511 (2003)); and addition of drugs or other chemicals that reduce or disrupt enzymatic activity such as an enzyme inhibitor, an antibiotic or a target-specific drug.

[0308] One skilled in the art will also understand and recognize that attenuation of an enzyme can be done at various levels. For example, at the gene level, a mutation causing a partial or complete null phenotype, such as a gene disruption or a mutation causing epistatic genetic effects that mask the activity of a gene product (Miko, Nature Education 1(1) (2008)), can be used to attenuate an enzyme. At the gene expression level, methods for attenuation include: coupling transcription to an endogenous or exogenous inducer such as isopropylthio-β-galactoside (IPTG), then adding low amounts of inducer or no inducer during the production phase (Donovan et al., J. Ind. Microbiol. 16(3):145-154 (1996); and Hansen et al., Curr. Microbiol. 36(6):341-347 (1998)); introducing or modifying a positive or a negative regulator of a gene; modify histone acetylation/deacetylation in region in a eukaryotic chromosomal region where a gene is integrated (Yang et al., Curr. Opin. Genet. Dev. 13(2):143-153 (2003) and Kurdistani et al., Nat. Rev. Mol. Cell Biol. 4(4):276-284 (2003)); introducing a transposition to disrupt a promoter or a regulatory gene (Bleykasten-Brosshans et al., C. R. Biol. 33(8-9):679-686 (2011); and McCue et al., PLoS Genet. 8(2):e1002474 (2012)); flipping the orientation of a transposable element or promoter region so as to modulate gene expression of an adjacent gene (Wang et al., Genetics 120(4):875-885 (1988); Hayes, Annu. Rev. Genet. 37:3-29 (2003); in a diploid organism, deleting one allele resulting in loss of heterozygosity (Daigaku et al., Mutation Research/Fundamental and Molecular Mechanisms of Mutagenesis 600(1-2)177-183 (2006)); introducing nucleic acids that increase RNA degradation (Houseley et al., Cell, 136(4):763-776 (2009); or in bacteria, for example, introduction of a transfer-messenger RNA (tmRNA) tag, which can lead to RNA degradation and ribosomal stalling (Sunohara et al., RNA 10(3):378-386 (2004); and Sunohara et al., J. Biol. Chem. 279:15368-15375 (2004)). At the translational level, attenuation can include: introducing rare codons to limit translation (Angov, Biotechnol. J. 6(6):650-659 (2011)); introducing RNA interference molecules that block translation (Castel et al., Nat. Rev. Genet. 14(2):100-112 (2013); and Kawasaki et al., Curr. Opin. Mol. Ther. 7(2):125-131 (2005); modifying regions outside the coding sequence, such as introducing secondary structure into an untranslated region (UTR) to block translation or reduce efficiency of translation (Ringnér et al., PLoS Comput. Biol. 1(7):e72 (2005)); adding RNAase sites for rapid transcript degradation (Pasquinelli, Nat. Rev. Genet. 13(4):271-282 (2012); and Arraiano et al., FEMS Microbiol. Rev. 34(5):883-932 (2010); introducing antisense RNA oligomers or antisense transcripts (Nashizawa et al., Front. Biosci. 17:938-958 (2012)); introducing RNA or peptide aptamers, ribozymes, aptazymes, riboswitches (Wieland et al., Methods 56(3):351-357 (2012); O'Sullivan, Anal. Bioanal. Chem. 372(1):44-48 (2002); and Lee et al., Curr. Opin. Biotechnol. 14(5):505-511 (2003)); or introducing translational regulatory elements involving RNA structure that can prevent or reduce translation that can be controlled by the presence or absence of small molecules (Araujo et al., Comparative and Functional Genomics, Article ID 475731, 8 pages (2012). At the level of enzyme localization and/or longevity, enzyme attenuation can include: adding a degradation tag for faster protein turnover (Hochstrasser, Annual Rev. Genet. 30:405-439 (1996); and Yuan et al., PLoS One 8(4):e62529 (2013)); or adding a localization tag that results in the enzyme being secreted or localized to a subcellular compartment in a eukaryotic cell, where the enzyme would not be able to react with its normal substrate Nakai et al. Genomics 14(4):897-911 (1992); and Russell et al., J. Bact. 189(21)7581-7585 (2007)). At the level of post-translational regulation, enzyme attenuation can include: increasing intracellular concentration of known inhibitors; or modifying post-translational modified sites (Mann et al., Nature Biotech. 21:255-261 (2003)). At the level of enzyme activity, enzyme attenuation can include: adding an endogenous or an exogenous inhibitor, such as an enzyme inhibitor, an antibiotic, or a target-specific drug, to reduce enzyme activity; limiting availability of essential cofactors, such as vitamin B12, for an enzyme that requires the cofactor; chelating a metal ion that is required for enzyme activity; or introducing a dominant negative mutation. The applicability of a technique for attenuation described above can depend upon whether a given host microbial organism is prokaryotic or eukaryotic, and it is understand that a determination of what is the appropriate technique for a given host can be readily made by one skilled in the art.

[0309] In some aspects, microaerobic designs can be used based on the growth-coupled formation of the desired product. To examine this, production cones can be constructed for each strategy by first maximizing and, subsequently minimizing the product yields at different rates of biomass formation feasible in the network. If the rightmost boundary of all possible phenotypes of the mutant network is a single point, it implies that there is a unique optimum yield of the product at the maximum biomass formation rate possible in the network. In other cases, the rightmost boundary of the feasible phenotypes is a vertical line, indicating that at the point of maximum biomass the network can make any amount of the product in the calculated range, including the lowest amount at the bottommost point of the vertical line. Such designs are given a low priority.

[0310] The 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine production strategies identified by the methods disclosed herein such as the OptKnock framework are generally ranked on the basis of their (i) theoretical yields, and optionally (ii) growth-coupled 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine formation characteristics.

[0311] Accordingly, the disclosure also provides a non-naturally occurring microbial organism having a set of metabolic modifications that increase the yield of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine, optionally coupling 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine production to growth of the organism, or otherwise improve characteristics of the microorganisms producing 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine, where the set of metabolic modifications includes disruption of one or more genes, as described herein.

[0312] Each of the strains can be supplemented with additional deletions if it is determined that the strain designs do not sufficiently increase the production of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine and/or couple the formation of the product with biomass formation. Alternatively, some other enzymes not known to possess significant activity under the growth conditions can become active due to adaptive evolution or random mutagenesis. Such activities can also be knocked out. However, the list of gene deletion sets disclosed herein allows the construction of strains exhibiting high-yield production of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine, including growth-coupled production of4-HB, 4-HBal, 4-HBCoA, BDO or putrescine.

[0313] 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine can be harvested or isolated at any time point during the culturing of the microbial organism, for example, in a continuous and/or near-continuous culture period, as disclosed herein. Generally, the longer the microorganisms are maintained in a continuous and/or near-continuous growth phase, the proportionally greater amount of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine can be produced.

[0314] Therefore, the disclosure additionally provides a method for producing 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine that includes culturing a non-naturally occurring microbial organism having one or more gene disruptions, as disclosed herein. The disruptions can occur in one or more genes encoding an enzyme that increases production of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine, including optionally coupling 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine production to growth of the microorganism when the gene disruption reduces or eliminates an activity of the enzyme. For example, the disruptions can confer stable growth-coupled production of 4-HB, 4HBal, 4-HBCoA, BDO or putrescine onto the non-naturally ocurring microbial organism.

[0315] In some aspects, the gene disruption can include a complete gene deletion. In some aspects other methods to disrupt a gene include, for example, frameshifting by omission or addition of oligonucleotides or by mutations that render the gene inoperable. One skilled in the art will recognize the advantages of gene deletions, however, because of the stability it confers to the non-naturally occurring organism from reverting to a parental phenotype in which the gene disruption has not occurred. In particular, the gene disruptions are selected from the gene sets as disclosed herein.

[0316] Once computational or other predictions are made of one or more genes sets disruption to increase production of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine, the strains can be constructed, evolved, and tested. Gene disruptions, including gene deletions, are introduced into host organism by methods well known in the art. A particularly useful method for gene disruption is by homologous recombination, as disclosed herein.

[0317] The engineered strains can be characterized by measuring the growth rate, the substrate uptake rate, and/or the product/byproduct secretion rate. Cultures can be grown and used as inoculum for a fresh batch culture for which measurements are taken during exponential growth. The growth rate can be determined by measuring optical density using a spectrophotometer (A600). Concentrations of glucose and other organic acid byproducts in the culture supernatant can be determined by well known methods such as HPLC, GC-MS or other well known analytical methods suitable for the analysis of the desired product, as disclosed herein, and used to calculate uptake and secretion rates.

[0318] Strains containing gene disruptions can exhibit suboptimal growth rates until their metabolic networks have adjusted to their missing functionalities. To assist in this adjustment, the strains can be adaptively evolved. By subjecting the strains to adaptive evolution, cellular growth rate becomes the primary selection pressure and the mutant cells are compelled to reallocate their metabolic fluxes in order to enhance their rates of growth. This reprogramming of metabolism has been recently demonstrated for several E. coli mutants that had been adaptively evolved on various substrates to reach the growth rates predicted a priori by an in silico model (Fong and Palsson, Nat. Genet. 36:1056-1058 (2004)). The growth improvements brought about by adaptive evolution can be accompanied by enhanced rates of 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine production. The strains can optionally be adaptively evolved in replicate, running in parallel, to account for differences in the evolutionary patterns that can be exhibited by a host organism (Fong and Palsson, Nat. Genet. 36:1056-1058 (2004); Fong et al., J. Bacteriol. 185:6400-6408 (2003); Ibarra et al., Nature 420:186-189 (2002)) that could potentially result in one strain having superior production qualities over the others. Evolutions can be run for a period of time, typically 2-6 weeks, depending upon the rate of growth improvement attained. In general, evolutions are stopped once a stable phenotype is obtained.

[0319] Following the adaptive evolution process, the new strains are characterized again by measuring the growth rate, the substrate uptake rate, and the product/byproduct secretion rate. These results are compared to the theoretical predictions by plotting actual growth and production yields along side the production envelopes from metabolic modeling. The most successful design/evolution combinations are chosen to pursue further, and are characterized in lab-scale batch and continuous fermentations. The growth-coupled biochemical production concept behind the methods disclosed herein such as OptKnock approach should also result in the generation of genetically stable overproducers. Thus, the cultures are maintained in continuous mode for an extended period of time, for example, one month or more, to evaluate long-term stability. Periodic samples can be taken to ensure that yield and productivity are maintained.

[0320] Adaptive evolution is a powerful technique that can be used to increase growth rates of mutant or engineered microbial strains, or of wild-type strains growing under unnatural environmental conditions. It is especially useful for strains designed via methods such as OptKnock, which results in growth-coupled product formation. Therefore, evolution toward optimal growing strains will indirectly optimize production as well. Unique strains of E. coli K-12 MG1655 were created through gene knockouts and adaptive evolution. (Fong and Palsson, Nat. Genet. 36:1056-1058 (2004)). In this work, all adaptive evolutionary cultures were maintained in prolonged exponential growth by serial passage of batch cultures into fresh medium before the stationary phase was reached, thus rendering growth rate as the primary selection pressure. Knockout strains were constructed and evolved on minimal medium supplemented with different carbon substrates (four for each knockout strain). Evolution cultures were carried out in duplicate or triplicate, giving a total of 50 evolution knockout strains. The evolution cultures were maintained in exponential growth until a stable growth rate was reached. The computational predictions were accurate (within 10%) at predicting the post-evolution growth rate of the knockout strains in 38 out of the 50 cases examined. Furthermore, a combination of OptKnock design with adaptive evolution has led to improved lactic acid production strains. (Fong et al., Biotechnol. Bioeng. 91:643-648 (2005)). Similar methods can be applied to the strains disclosed herein and applied to various host strains.

[0321] There are a number of developed technologies for carrying out adaptive evolution. Exemplary methods are disclosed herein. In some aspects, optimization of a non-naturally occurring organism of the present disclosure includes utilizing adaptive evolution techniques to increase 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine production and/or stability of the producing strain.

[0322] Serial culture involves repetitive transfer of a small volume of grown culture to a much larger vessel containing fresh growth medium. When the cultured organisms have grown to saturation in the new vessel, the process is repeated. This method has been used to achieve the longest demonstrations of sustained culture in the literature (Lenski and Travisano, Proc. Natl. Acad. Sci. USA 91:6808-6814 (1994)) in experiments which clearly demonstrated consistent improvement in reproductive rate over a period of years. Typically, transfer of cultures is usually performed during exponential phase, so each day the transfer volume is precisely calculated to maintain exponential growth through the next 24 hour period. Manual serial dilution is inexpensive and easy to parallelize.

[0323] In continuous culture the growth of cells in a chemostat represents an extreme case of dilution in which a very high fraction of the cell population remains. As a culture grows and becomes saturated, a small proportion of the grown culture is replaced with fresh media, allowing the culture to continually grow at close to its maximum population size. Chemostats have been used to demonstrate short periods of rapid improvement in reproductive rate (Dykhuizen, Methods Enzymol. 613-631 (1993)). The potential usefulness of these devices was recognized, but traditional chemostats were unable to sustain long periods of selection for increased reproduction rate, due to the unintended selection of dilution-resistant (static) variants. These variants are able to resist dilution by adhering to the surface of the chemostat, and by doing so, outcompete less adherent individuals, including those that have higher reproductive rates, thus obviating the intended purpose of the device (Chao and Ramsdell, J. Gen. Microbiol 20:132-138 (1985)). One possible way to overcome this drawback is the implementation of a device with two growth chambers, which periodically undergo transient phases of sterilization, as described previously (Marliere and Mutzel, U.S. Patent No. 6,686,194).

[0324] Evolugator™ is a continuous culture device developed by Evolugate, LLC (Gainesville, FL) and exhibits significant time and effort savings over traditional evolution techniques (de Crecy et al.,. Appl. Microbiol. Biotechnol. 77:489-496 (2007)). The cells are maintained in prolonged exponential growth by the serial passage of batch cultures into fresh medium before the stationary phase is attained. By automating optical density measurement and liquid handling, the Evolugator™ can perform serial transfer at high rates using large culture volumes, thus approaching the efficiency of a chemostat in evolution of cell fitness. For example, a mutant of Acinetobacter sp ADP1 deficient in a component of the translation apparatus, and having severely hampered growth, was evolved in 200 generations to 80% of the wild-type growth rate. However, in contrast to the chemostat which maintains cells in a single vessel, the machine operates by moving from one "reactor" to the next in subdivided regions of a spool of tubing, thus eliminating any selection for wall-growth. The transfer volume is adjustable, and normally set to about 50%. A drawback to this device is that it is large and costly, thus running large numbers of evolutions in parallel is not practical. Furthermore, gas addition is not well regulated, and strict anaerobic conditions are not maintained with the current device configuration. Nevertheless, this is an alternative method to adaptively evolve a production strain.

[0325] As disclosed herein, a nucleic acid encoding a desired activity of a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway can be introduced into a host organism. In some cases, it can be desirable to modify an activity of a 4-HB, 4-HBal, 4-HBCoA BDO or putrescine pathway enzyme or protein to increase production of 4-HB, 4-HBal, 4-HBCoA BDO or putrescine. For example, known mutations that increase the activity of a protein or enzyme can be introduced into an encoding nucleic acid molecule. Additionally, optimization methods can be applied to increase the activity of an enzyme or protein and/or decrease an inhibitory activity, for example, decrease the activity of a negative regulator.

[0326] One such optimization method is directed evolution. Directed evolution is a powerful approach that involves the introduction of mutations targeted to a specific gene in order to improve and/or alter the properties of an enzyme. Improved and/or altered enzymes can be identified through the development and implementation of sensitive high-throughput screening assays that allow the automated screening of many enzyme variants (for example, >104). Iterative rounds of mutagenesis and screening typically are performed to afford an enzyme with optimized properties. Computational algorithms that can help to identify areas of the gene for mutagenesis also have been developed and can significantly reduce the number of enzyme variants that need to be generated and screened. Numerous directed evolution technologies have been developed (for reviews, see Hibbert et al., Biomol.Eng 22:11-19 (2005); Huisman and Lalonde, In Biocatalysis in the pharmaceutical and biotechnology industries pgs. 717-742 (2007), Patel (ed.), CRC Press; Otten and Quax. Biomol.Eng 22:1-9 (2005).; and Sen et al., Appl Biochem.Biotechnol 143:212-223 (2007)) to be effective at creating diverse variant libraries, and these methods have been successfully applied to the improvement of a wide range of properties across many enzyme classes. Enzyme characteristics that have been improved and/or altered by directed evolution technologies include, for example: selectivity/specificity, for conversion of non-natural substrates; temperature stability, for robust high temperature processing; pH stability, for bioprocessing under lower or higher pH conditions; substrate or product tolerance, so that high product titers can be achieved; binding (Km), including broadening substrate binding to include non-natural substrates; inhibition (Ki), to remove inhibition by products, substrates, or key intermediates; activity (kcat), to increases enzymatic reaction rates to achieve desired flux; expression levels, to increase protein yields and overall pathway flux; oxygen stability, for operation of air sensitive enzymes under aerobic conditions; and anaerobic activity, for operation of an aerobic enzyme in the absence of oxygen.

[0327] A number of exemplary methods have been developed for the mutagenesis and diversification of genes to target desired properties of specific enzymes. Such methods are well known to those skilled in the art. Any of these can be used to alter and/or optimize the activity of a 4-HB, 4-HBal, 4-HBCoA, BDO or putrescine pathway enzyme or protein. Such methods include, but are not limited to EpPCR, which introduces random point mutations by reducing the fidelity of DNA polymerase in PCR reactions (Pritchard et al., J Theor.Biol. 234:497-509 (2005)); Error-prone Rolling Circle Amplification (epRCA), which is similar to epPCR except a whole circular plasmid is used as the template and random 6-mers with exonuclease resistant thiophosphate linkages on the last 2 nucleotides are used to amplify the plasmid followed by transformation into cells in which the plasmid is re-circularized at tandem repeats (Fujii et al., Nucleic Acids Res. 32:e145 (2004); and Fujii et al., Nat. Protoc. 1:2493-2497 (2006)); DNA or Family Shuffling, which typically involves digestion of two or more variant genes with nucleases such as Dnase I or EndoV to generate a pool of random fragments that are reassembled by cycles of annealing and extension in the presence of DNA polymerase to create a library of chimeric genes (Stemmer, Proc Natl Acad Sci USA 91:10747-10751 (1994); and Stemmer, Nature 370:389-391 (1994)); Staggered Extension (StEP), which entails template priming followed by repeated cycles of 2 step PCR with denaturation and very short duration of annealing/extension (as short as 5 sec) (Zhao et al., Nat. Biotechnol. 16:258-261 (1998)); Random Priming Recombination (RPR), in which random sequence primers are used to generate many short DNA fragments complementary to different segments of the template (Shao et al., Nucleic Acids Res 26:681-683 (1998)).

[0328] Additional methods include Heteroduplex Recombination, in which linearized plasmid DNA is used to form heteroduplexes that are repaired by mismatch repair (Volkov et al, Nucleic Acids Res. 27:e18 (1999); and Volkov et al., Methods Enzymol. 328:456-463 (2000)); Random Chimeragenesis on Transient Templates (RACHITT), which employs Dnase I fragmentation and size fractionation of single stranded DNA (ssDNA) (Coco et al., Nat. Biotechnol. 19:354-359 (2001)); Recombined Extension on Truncated templates (RETT), which entails template switching of unidirectionally growing strands from primers in the presence of unidirectional ssDNA fragments used as a pool of templates (Lee et al., J. Molec. Catalysis 26:119-129 (2003)); Degenerate Oligonucleotide Gene Shuffling (DOGS), in which degenerate primers are used to control recombination between molecules; (Bergquist and Gibbs, Methods Mol.Biol 352:191-204 (2007); Bergquist et al., Biomol.Eng 22:63-72 (2005); Gibbs et al., Gene 271:13-20 (2001)); Incremental Truncation for the Creation of Hybrid Enzymes (ITCHY), which creates a combinatorial library with 1 base pair deletions of a gene or gene fragment of interest (Ostermeier et al., Proc. Natl. Acad. Sci. USA 96:3562-3567 (1999); and Ostermeier et al., Nat. Biotechnol. 17:1205-1209 (1999)); Thio-Incremental Truncation for the Creation of Hybrid Enzymes (THIO-ITCHY), which is similar to ITCHY except that phosphothioate dNTPs are used to generate truncations (Lutz et al., Nucleic Acids Res 29:E16 (2001)); SCRATCHY, which combines two methods for recombining genes, ITCHY and DNA shuffling (Lutz et al., Proc. Natl. Acad. Sci. USA 98:11248-11253 (2001)); Random Drift Mutagenesis (RNDM), in which mutations made via epPCR are followed by screening/selection for those retaining usable activity (Bergquist et al., Biomol. Eng. 22:63-72 (2005)); Sequence Saturation Mutagenesis (SeSaM), a random mutagenesis method that generates a pool of random length fragments using random incorporation of a phosphothioate nucleotide and cleavage, which is used as a template to extend in the presence of "universal" bases such as inosine, and replication of an inosine-containing complement gives random base incorporation and, consequently, mutagenesis (Wong et al., Biotechnol. J. 3:74-82 (2008); Wong et al., Nucleic Acids Res. 32:e26 (2004); and Wong et al., Anal. Biochem. 341:187-189 (2005)); Synthetic Shuffling, which uses overlapping oligonucleotides designed to encode "all genetic diversity in targets" and allows a very high diversity for the shuffled progeny (Ness et al., Nat. Biotechnol. 20:1251-1255 (2002)); Nucleotide Exchange and Excision Technology NexT, which exploits a combination of dUTP incorporation followed by treatment with uracil DNA glycosylase and then piperidine to perform endpoint DNA fragmentation (Muller et al., Nucleic Acids Res. 33:e117 (2005)).

[0329] Further methods include Sequence Homology-Independent Protein Recombination (SHIPREC), in which a linker is used to facilitate fusion between two distantly related or unrelated genes, and a range of chimeras is generated between the two genes, resulting in libraries of single-crossover hybrids (Sieber et al., Nat. Biotechnol. 19:456-460 (2001)); Gene Site Saturation Mutagenesis™ (GSSM™), in which the starting materials include a supercoiled double stranded DNA (dsDNA) plasmid containing an insert and two primers which are degenerate at the desired site of mutations (Kretz et al., Methods Enzymol. 388:3-11 (2004)); Combinatorial Cassette Mutagenesis (CCM), which involves the use of short oligonucleotide cassettes to replace limited regions with a large number of possible amino acid sequence alterations (Reidhaar-Olson et al. Methods Enzymol. 208:564-586 (1991); and Reidhaar-Olson et al. Science 241:53-57 (1988)); Combinatorial Multiple Cassette Mutagenesis (CMCM), which is essentially similar to CCM and uses epPCR at high mutation rate to identify hot spots and hot regions and then extension by CMCM to cover a defined region of protein sequence space (Reetz et al., Angew. Chem. Int. Ed Engl. 40:3589-3591 (2001)); the Mutator Strains technique, in which conditional ts mutator plasmids, utilizing the mutD5 gene, which encodes a mutant subunit of DNA polymerase III, to allow increases of 20 to 4000-X in random and natural mutation frequency during selection and block accumulation of deleterious mutations when selection is not required (Selifonova et al., Appl. Environ. Microbiol. 67:3645-3649 (2001)); Low et al., J. Mol. Biol. 260:359-3680 (1996)).

[0330] Additional exemplary methods include Look-Through Mutagenesis (LTM), which is a multidimensional mutagenesis method that assesses and optimizes combinatorial mutations of selected amino acids (Rajpal et al., Proc. Natl. Acad. Sci. USA 102:8466-8471 (2005)); Gene Reassembly, which is a DNA shuffling method that can be applied to multiple genes at one time or to create a large library of chimeras (multiple mutations) of a single gene (Tunable GeneReassembly™ (TGR™) Technology supplied by Verenium Corporation), in Silico Protein Design Automation (PDA), which is an optimization algorithm that anchors the structurally defined protein backbone possessing a particular fold, and searches sequence space for amino acid substitutions that can stabilize the fold and overall protein energetics, and generally works most effectively on proteins with known three-dimensional structures (Hayes et al., Proc. Natl. Acad. Sci. USA 99:15926-15931 (2002)); and Iterative Saturation Mutagenesis (ISM), which involves using knowledge of structure/function to choose a likely site for enzyme improvement, performing saturation mutagenesis at chosen site using a mutagenesis method such as Stratagene QuikChange (Stratagene; San Diego CA), screening/selecting for desired properties, and, using improved clone(s), starting over at another site and continue repeating until a desired activity is achieved (Reetz et al., Nat. Protoc. 2:891-903 (2007); and Reetz et al., Angew. Chem. Int. Ed Engl. 45:7745-7751 (2006)).

[0331] Any of the aforementioned methods for mutagenesis can be used alone or in any combination. Additionally, any one or combination of the directed evolution methods can be used in conjunction with adaptive evolution techniques, as described herein.

[0332] It is understood that modifications which do not substantially affect the activity of the various aspects of this disclosure are also provided within the definition of the disclosure provided herein. Accordingly, the following examples are intended to illustrate but not limit the present disclosure.

EXAMPLE I


Biosynthesis of 4-Hydroxybutanoic Acid



[0333] This example describes exemplary biochemical pathways for 4-HB production.

[0334] Previous reports of 4-HB synthesis in microbes have focused on this compound as an intermediate in production of the biodegradable plastic poly-hydroxyalkanoate (PHA) (U.S. Patent No. 6,117,658). The use of 4-HB/3-HB copolymers over poly-3-hydroxybutyrate polymer (PHB) can result in plastic that is less brittle (Saito and Doi, Intl. J. Biol. Macromol. 16:99-104 (1994)). The production of monomeric 4-HB described herein is a fundamentally distinct process for several reasons: (1) the product is secreted, as opposed to PHA which is produced intracellularly and remains in the cell; (2) for organisms that produce hydroxybutanoate polymers, free 4-HB is not produced, but rather the Coenzyme A derivative is used by the polyhydroxyalkanoate synthase; (3) in the case of the polymer, formation of the granular product changes thermodynamics; and (4) extracellular pH is not an issue for production of the polymer, whereas it will affect whether 4-HB is present in the free acid or conjugate base state, and also the equilibrium between 4-HB and GBL.

[0335] 4-HB can be produced in two enzymatic reduction steps from succinate, a central metabolite of the TCA cycle, with succinic semialdehyde as the intermediate (Figure 1). The first of these enzymes, succinic semialdehyde dehydrogenase, is native to many organisms including E. coli, in which both NADH- and NADPH-dependent enzymes have been found (Donnelly and Cooper, Eur. J. Biochem. 113:555-561 (1981); Donnelly and Cooper, J. Bacteriol. 145:1425-1427 (1981); Marek and Henson, J. Bacteriol.170:991-994 (1988)). There is also evidence supporting succinic semialdehyde dehydrogenase activity in S. cerevisiae (Ramos et al., Eur. J. Biochem. 149:401-404 (1985)), and a putative gene has been identified by sequence homology. However, most reports indicate that this enzyme proceeds in the direction of succinate synthesis, as shown in Figure 1 (Donnelly and Cooper, supra; Lutke-Eversloh and Steinbuchel, FEMS Microbiol. Lett. 181:63-71 (1999)), participating in the degradation pathway of 4-HB and gamma-aminobutyrate. Succinic semialdehyde also is natively produced by certain microbial organisms such as E. coli through the TCA cycle intermediate α-ketogluterate via the action of two enzymes: glutamate:succinic semialdehyde transaminase and glutamate decarboxylase. An alternative pathway, used by the obligate anaerobe Clostridium kluyveri to degrade succinate, activates succinate to succinyl-CoA, then converts succinyl-CoA to succinic semialdehyde using an alternative succinic semialdehyde dehydrogenase which is known to function in this direction (Sohling and Gottschalk, Eur. J. Biochem. 212:121-127 (1993)). However, this route has the energetic cost of ATP required to convert succinate to succinyl-CoA.

[0336] The second enzyme of the pathway, 4-hydroxybutanoate dehydrogenase, is not native to E. coli or yeast but is found in various bacteria such as C. kluyveri and Ralstonia eutropha (Lutke-Eversloh and Steinbuchel, supra; Sohling and Gottschalk, J. Bacteriol. 178:871-880 (1996); Valentin et al., Eur. J. Biochem. 227:43-60 (1995); Wolff and Kenealy, Protein Expr. Purif. 6:206-212 (1995)). These enzymes are known to be NADH-dependent, though NADPH-dependent forms also exist. An additional pathway to 4-HB from alpha-ketoglutarate was demonstrated in E. coli resulting in the accumulation of poly(4-hydroxybutyric acid) (Song et al., Wei Sheng Wu Xue.Bao. 45:382-386 (2005)). The recombinant strain required the overexpression of three heterologous genes, PHA synthase (R. eutropha), 4-hydroxybutyrate dehydrogenase (R. eutropha) and 4-hydroxybutyrate:CoA transferase (C. kluyveri), along with two native E. coli genes: glutamate:succinic semialdehyde transaminase and glutamate decarboxylase. Steps 4 and 5 in Figure 1 can alternatively be carried out by an alpha-ketoglutarate decarboxylase such as the one identified in Euglena gracilis (Shigeoka et al., Biochem. J. 282(Pt2):319-323 (1992); Shigeoka and Nakano, Arch. Biochem. Biophys. 288:22-28 (1991); Shigeoka and Nakano, Biochem J. 292(Pt 2):463-467 (1993)). However, this enzyme has not previously been applied to impact the production of 4-HB or related polymers in any organism.

[0337] The microbial production capabilities of 4-hydroxybutyrate were explored in two microbes, Escherichia coli and Saccharomyces cerevisiae, using in silico metabolic models of each organism. Potential pathways to 4-HB proceed via a succinate, succinyl-CoA, or alpha-ketoglutarate intermediate as shown in Figure 1.

[0338] A first step in the 4-HB production pathway from succinate involves the conversion of succinate to succinic semialdehyde via an NADH- or NADPH-dependant succinic semialdehyde dehydrogenase. In E. coli, gabD is an NADP-dependant succinic semialdehyde dehydrogenase and is part of a gene cluster involved in 4-aminobutyrate uptake and degradation (Niegemann et al.,. Arch. Microbiol. 160:454-460 (1993); Schneider et al., J. Bacteriol. 184:6976-6986 (2002)). sad is believed to encode the enzyme for NAD-dependant succinic semialdehyde dehydrogenase activity (Marek and Henson, supra). S. cerevisiae contains only the NADPH-dependant succinic semialdehyde dehydrogenase, putatively assigned to UGA2 , which localizes to the cytosol (Huh et al., Nature 425:686-691 (2003)). The maximum yield calculations assuming the succinate pathway to 4-HB in both E. coli and S. cerevisiae require only the assumption that a non-native 4-HB dehydrogenase has been added to their metabolic networks.

[0339] The pathway from succinyl-CoA to 4-hydroxybutyrate was described in U.S. Patent No. 6,117,658 as part of a process for making polyhydroxyalkanoates comprising 4-hydroxybutyrate monomer units. Clostridium kluyveri is one example organism known to possess CoA-dependant succinic semialdehyde dehydrogenase activity (Sohling and Gottschalk, supra; Sohling and Gottschalk, supra). In this study, it is assumed that this enzyme, from C. kluyveri or another organism, is expressed in E. coli or S. cerevisiae along with a non-native or heterologous 4-HB dehydrogenase to complete the pathway from succinyl-CoA to 4-HB. The pathway from alpha-ketoglutarate to 4-HB was demonstrated in E. coli resulting in the accumulation of poly(4-hydroxybutyric acid) to 30% of dry cell weight (Song et al., supra). As E. coli and S. cerevisiae natively or endogenously possess both glutamate:succinic semialdehyde transaminase and glutamate decarboxylase (Coleman et al., J. Biol. Chem. 276:244-250 (2001)), the pathway from AKG to 4-HB can be completed in both organisms by assuming only that a non-native 4-HB dehydrogenase is present.

EXAMPLE II


Biosynthesis of 1,4-Butanediol from Succinate and Alpha-ketoglutarate



[0340] This example illustrates the construction and biosynthetic production of 4-HB and BDO from microbial organisms. Pathways for 4-HB and BDO are disclosed herein.

[0341] There are several alternative enzymes that can be utilized in the pathway described above. The native or endogenous enzyme for conversion of succinate to succinyl-CoA (Step 1 in Figure 1) can be replaced by a CoA transferase such as that encoded by the cat1 gene C. kluyveri (Sohling and Gottschalk, Eur.J Biochem. 212:121-127 (1993)), which functions in a similar manner to Step 9. However, the production of acetate by this enzyme may not be optimal, as it might be secreted rather than being converted back to acetyl-CoA. In this respect, it also can be beneficial to eliminate acetate formation in Step 9. As one alternative to this CoA transferase, a mechanism can be employed in which the 4-HB is first phosphorylated by ATP and then converted to the CoA derivative, similar to the acetate kinase/phosphotransacetylase pathway in E. coli for the conversion of acetate to acetyl-CoA. The net cost of this route is one ATP, which is the same as is required to regenerate acetyl-CoA from acetate. The enzymes phosphotransbutyrylase (ptb) and butyrate kinase (bk) are known to carry out these steps on the non-hydroxylated molecules for butyrate production in C. acetobutylicum (Cary et al., Appl Environ Microbiol 56:1576-1583 (1990); Valentine, R. C. and R. S. Wolfe, J Biol Chem. 235:1948-1952 (1960)). These enzymes are reversible, allowing synthesis to proceed in the direction of 4-HB.

[0342] BDO also can be produced via α-ketoglutarate in addition to or instead of through succinate. A described previously, and exemplified further below, one pathway to accomplish product biosynthesis is with the production of succinic semialdehyde via α-ketoglutarate using the endogenous enzymes (Figure 1, Steps 4-5). An alternative is to use an α-ketoglutarate decarboxylase that can perform this conversion in one step (Figure 1, Step 8; Tian et al., Proc Natl Acad Sci US.A 102:10670-10675 (2005)).

[0343] For the construction of different strains of BDO-producing microbial organisms, a list of applicable genes was assembled for corroboration. Briefly, one or more genes within the 4-HB and/or BDO biosynthetic pathways were identified for each step of the complete BDO-producing pathway shown in Figure 1, using available literature resources, the NCBI genetic database, and homology searches. The genes cloned and assessed in this study are presented below in in Table 6, along with the appropriate references and URL citations to the polypeptide sequence. As discussed further below, some genes were synthesized for codon optimization while others were cloned via PCR from the genomic DNA of the native or wild-type organism. For some genes both approaches were used, and in this case the native genes are indicated by an "n" suffix to the gene identification number when used in an experiment. Note that only the DNA sequences differ; the proteins are identical.
Table 6. Genes expressed in host BDO-producting microbial organisms.
Gene ID numberReaction number (Fig. 1)Gene nameSource organismEnzyme nameLink to protein sequenceReference
             
0001 9 Cat2 Clostridium kluyveri DSM 555 4-hydroxybutyrate coenzyme A transferase www.ncbi.nlm.nih.gov/entrez/ viewer.fcgi?db=nuccore&id= 1228100 1
0002 12/13 adhE Clostridium acetobutylicu m ATCC 824 Aldehyde/ alcohol dehydrogenase www.ncbi.nlm.nih.gov/entrez/ viewer.fcgi?db=protein&val= 15004739 2
0003 12/13 adhE2 Clostridium acetobutylicu m ATCC 824 Aldehyde/ alcohol dehydrogenase www.ncbi.nlm.nih.gov/entrez/ viewer.fcgi?val=NP_149325. 1 2
0004 1 Cat1 Clostridium kluyveri DSM 555 Succinate coenzyme A transferase www.ncbi.nlm.nih.gov/entrez/ viewer.fcgi?db=nuccore&id= 1228100 1
0008 6 sucD Clostridium kluyveri DSM 555 Succinic semialdehyde dehydrogenase (CoA-dependent) www.ncbi.nlm.nih.gov/entrez/ viewer.fcgi?db=nuccore&id= 1228100 1
0009 7 4-HBd Ralstonia eutropha H16 4-hydroxybutyrate dehydrogenase (NAD-dependent) www.ncbi.nlm.nih.gov/entrez/ viewer.fcgi?val=YP_726053. 1 2
0010 7 4-HBd Clostridium kluyveri DSM 555 4-hydroxybutyrate dehydrogenase (NAD-dependent) www.ncbi.nlm.nih.gov/entrez/ viewer.fcgi?db=nuccore&id= 1228100 1
0011 12/13 adhE E. coli Aldehyde/ alcohol dehydrogenase www.shigen.nig.ac.jp/ecoli/pe c/genes.List.DetailAction.do?f romListFlag=true&featureTyp e=1&orfId=1219  
0012 12/13 yqhD E. coli Aldehyde/ alcohol dehydrogenase www.shigen.nig.ac.jp/ecoli/pe c/genes.List.DetailAction.do  
0013 13 bdhB Clostridium acetobutylicu m ATCC 824 Butanol dehydrogenase II www.ncbi.nlm.nih.gov/entrez/ viewer.fcgi?val=NP_349891. 1 2
0020 11 ptb Clostridium acetobutylicu m ATCC 824 Phosphotransbutyrylase www.ncbi.nlm.nih.gov/entrez/ viewer.fcgi?db=protein&id=1 5896327 2
0021 10 buk1 Clostridium acetobutylicu m ATCC 824 Butyrate kinase I www.ncbi.nlm.nih.gov/entrez/ viewer.fcgi?db=protein&id=2 0137334 2
0022 10 buk2 Clostridium acetobutylicu m ATCC 824 Butyrate kinase II www.ncbi.nlm.nih.gov/entrez/ viewer.fcgi?db=protein&id=2 0137415 2
0023 13 adhEm isolated from metalibrary of anaerobic sewage digester microbial consortia Alcohol dehydrogenase   (37)d}
0024 13 adhE Clostridium thermocellum Alcohol dehydrogenase www.genome.jp/dbget-bin/www_bget?cth:Cthe_0423  
0025 13 ald Clostridium beijerinckii Coenzyme A-acylating aldehyde dehydrogenase www.ncbi.nlm.nih.gov/entrez/ viewer.fcgi?db=protein&id=4 9036681 (31)d}
0026 13 bdhA Clostridium acetobutylicu m ATCC 824 Butanol dehydrogenase www.ncbi.nlm.nih.gov/entrez/ viewer.fcgi?val=NP_349892. 1 2
0027 12 bld Clostridium saccharoperb utylacetonicu m Butyraldehyde dehydrogenase www.ncbi.nlm.nih.gov/entrez/ viewer.fcgi?db=protein&id=3 1075383 4
0028 13 bdh Clostridium saccharoperb utylacetonicu m Butanol dehydrogenase www.ncbi.nlm.nih.gov/entrez/ viewer.fcgi?db=protein&id=1 24221917 4
0029 12/13 adhE Clostridium tetani Aldehyde/ alcohol dehydrogenase www.genome.jp/dbget-bin/www_bget?ctc:CTC01366  
0030 12/13 adhE Clostridium perfringens Aldehyde/ alcohol dehydrogenase www.genome.jp/dbget-bin/www_bget?cpe:CPE2531  
0031 12/13 adhE Clostridium difficile Aldehyde/ alcohol dehydrogenase www.genome.jp/dbget-bin/www_bget?cdf:CD2966  
0032 8 sucA Mycobacteriu m bovis BCG, Pasteur α-ketoglutarate decarboxylase www.ncbi.nlm.nih.gov/entrez/ viewer.fcgi?val=YP_977400. 1 5
0033 9 cat2 Clostridium aminobutyric um 4-hydroxybutyrate coenzyme A transferase www.ncbi.nlm.nih.gov/entrez/ viewer.fcgi?db=protein&val= 6249316  
0034 9 cat2 Porphyromon as gingivalis W83 4-hydroxybutyrate coenzyme A transferase www.ncbi.nlm.nih.gov/entrez/ viewer.fcgi?db=protein&val= 34541558  
0035 6 sucD Porphyromon as gingivalis W83 Succinic semialdehyde dehydrogenase (CoA-dependent) www.ncbi.nlm.nih.gov/entrez/ viewer.fcgi?val=NP_904963. 1  
0036 7 4-HBd Porphyromon as gingivalis W83 NAD-dependent 4-hydroxybutyrate dehydrogenase www.ncbi.nlm.nih.gov/entrez/ viewer.fcgi?val=NP_904964. 1  
0037 7 gbd Uncultured bacterium 4-hydroxybutyrate dehydrogenase www.ncbi.nlm.nih.gov/entrez/ viewer.fcgi?db=nuccore&id= 5916168 6
0038 1 sucCD E. coli Succinyl-CoA synthetase www.shigen.nig.ac.jp/ecoli/pe c/genes.List.DetailAction.do  
1Sohling and Gottschalk, Eur. J. Biochem. 212:121-127 (1993); Sohling and Gottschalk, J. Bacteriol. 178:871-880 (1996)
2Nolling et al., J., J. Bacteriol. 183:4823-4838 (2001)
3Pohlmann et al., Nat. Biotechnol. 24:1257-1262 (2006)
4Kosaka et al., Biosci. Biotechnol. Biochem. 71:58-68 (2007)
5Brosch et al., Proc. Natl. Acad. Sci. U.S.A. 104:5596-5601 (2007)
6Henne et al., Appl. Environ. Microbiol. 65:3901-3907 (1999)


[0344] Expression Vector Construction for BDO pathway. Vector backbones and some strains were obtained from Dr. Rolf Lutz of Expressys (expressys.de/). The vectors and strains are based on the pZ Expression System developed by Dr. Rolf Lutz and Prof. Hermann Bujard (Lutz, R. and H. Bujard, Nucleic Acids Res 25:1203-1210 (1997)). Vectors obtained were pZE13luc, pZA33luc, pZS* 13luc and pZE22luc and contained the luciferase gene as a stuffer fragment. To replace the luciferase stuffer fragment with a lacZ-alpha fragment flanked by appropriate restriction enzyme sites, the luciferase stuffer fragment was first removed from each vector by digestion with EcoRI and Xbal. The lacZ-alpha fragment was PCR amplified from pUC19 with the following primers:

lacZalpha-RI

lacZalpha 3'BB
5'-GACCCTAGGAAGCTTTCTAGAGTCGACCTATGCGGCATCAGAGCAGA-3' (SEQ ID NO:2).



[0345] This generated a fragment with a 5' end of EcoRI site, NheI site, a Ribosomal Binding Site, a SalI site and the start codon. On the 3' end of the fragment contained the stop codon, Xbal, HindIII, and AvrII sites. The PCR product was digested with EcoRI and AvrII and ligated into the base vectors digested with EcoRI and XbaI (XbaI and AvrII have compatible ends and generate a non-site). Because NheI and XbaI restriction enzyme sites generate compatible ends that can be ligated together (but generate a NheI/XbaI non-site that is not digested by either enzyme), the genes cloned into the vectors could be "Biobricked" together (openwetware.org/wiki/Synthetic_Biology:BioBricks). Briefly, this method allows joining an unlimited number of genes into the vector using the same 2 restriction sites (as long as the sites do not appear internal to the genes), because the sites between the genes are destroyed after each addition.

[0346] All vectors have the pZ designation followed by letters and numbers indication the origin of replication, antibiotic resistance marker and promoter/regulatory unit. The origin of replication is the second letter and is denoted by E for ColE1, A for p15A and S for pSC101 - based origins. The first number represents the antibiotic resistance marker (1 for Ampicillin, 2 for Kanamycin, 3 for Chloramphenicol, 4 for Spectinomycin and 5 for Tetracycline). The final number defines the promoter that regulated the gene of interest (1 for PLtetO-1, 2 for PLlacO-1, 3 for PAllacO-1, and 4 for Plac/ara-1). The MCS and the gene of interest follows immediately after. For the work discussed here we employed two base vectors, pZA33 and pZE13, modified for the biobricks insertions as discussed above. Once the gene(s) of interest have been cloned into them, resulting plasmids are indicated using the four digit gene codes given in Table 6; e.g., pZA33-XXXX-YYYY-...

[0347] Host Strain Construction. The parent strain in all studies described here is E. coli K-12 strain MG1655. Markerless deletion strains in adhE, gabD, and aldA were constructed under service contract by a third party using the redET method (Datsenko, K. A. and B. L. Wanner, Proc Natl Acad Sci US.A 97:6640-6645 (2000)). Subsequent strains were constructed via bacteriophage P1 mediated transduction (Miller, J. Experiments in Molecular Genetics, Cold Spring Harbor Laboratories, New York (1973)). Strain C600Z1 (laciq, PN25-tetR, SpR, lacY1, leuB6,mcrB+, supE44, thi-1, thr-1, tonA21) was obtained from Expressys and was used as a source of a lacIq allele for P1 transduction. Bacteriophage P1vir was grown on the C600Z1 E. coli strain, which has the spectinomycin resistance gene linked to the lacIq. The P1 lysate grown on C600Z1 was used to infect MG1655 with selection for spectinomycin resistance. The spectinomycin resistant colonies were then screened for the linked lacIq by determining the ability of the transductants to repress expression of a gene linked to a PA1lacO-1 promoter. The resulting strain was designated MG1655 lacIq. A similar procedure was used to introduce lacIQ into the deletion strains.

[0348] Production of 4-HB From Succinate. For construction of a 4-HB producer from succinate, genes encoding steps from succinate to 4-HB and 4-HB-CoA (1, 6, 7, and 9 in Figure 1) were assembled onto the pZA33 and pZE13 vectors as described below. Various combinations of genes were assessed, as well as constructs bearing incomplete pathways as controls (Tables 7 and 8). The plasmids were then transformed into host strains containing lacIQ, which allow inducible expression by addition of isopropyl β-D-1-thiogalactopyranoside (IPTG). Both wild-type and hosts with deletions in genes encoding the native succinic semialdehyde dehydrogenase (step 2 in Figure 1) were tested.

[0349] Activity of the heterologous enzymes were first tested in in vitro assays, using strain MG1655 lacIQ as the host for the plasmid constructs containing the pathway genes. Cells were grown aerobically in LB media (Difco) containing the appropriate antibiotics for each construct, and induced by addition of IPTG at 1 mM when the optical density (OD600) reached approximately 0.5. Cells were harvested after 6 hours, and enzyme assays conducted as discussed below.

[0350] In Vitro Enzyme Assays. To obtain crude extracts for activity assays, cells were harvested by centrifugation at 4,500 rpm (Beckman-Coulter, Allegera X-15R) for 10 min. The pellets were resuspended in 0.3 mL BugBuster (Novagen) reagent with benzonase and lysozyme, and lysis proceeded for 15 minutes at room temperature with gentle shaking. Cell-free lysate was obtained by centrifugation at 14,000 rpm (Eppendorf centrifuge 5402) for 30 min at 4°C. Cell protein in the sample was determined using the method of Bradford et al., Anal. Biochem. 72:248-254 (1976), and specific enzyme assays conducted as described below. Activities are reported in Units/mg protein, where a unit of activity is defined as the amount of enzyme required to convert 1 µmol of substrate in 1 min. at room temperature. In general, reported values are averages of at least 3 replicate assays.

[0351] Succinyl-CoA transferase (Cat1) activity was determined by monitoring the formation of acetyl-CoA from succinyl-CoA and acetate, following a previously described procedure Sohling and Gottschalk, J. Bacteriol. 178:871-880 (1996). Succinyl-CoA synthetase (SucCD) activity was determined by following the formation of succinyl-CoA from succinate and CoA in the presence of ATP. The experiment followed a procedure described by Cha and Parks, J. Biol. Chem. 239:1961-1967 (1964). CoA-dependent succinate semialdehyde dehydrogenase (SucD) activity was determined by following the conversion of NAD to NADH at 340 nm in the presence of succinate semialdehyde and CoA (Sohling and Gottschalk, Eur. J. Biochem. 212:121-127 (1993)). 4-HB dehydrogenase (4-HBd) enzyme activity was determined by monitoring the oxidation of NADH to NAD at 340 nm in the presence of succinate semialdehyde. The experiment followed a published procedure Gerhardt et al. Arch. Microbiol. 174:189-199 (2000). 4-HB CoA transferase (Cat2) activity was determined using a modified procedure from Scherf and Buckel, Appl. Environ. Microbiol. 57:2699-2702 (1991). The formation of 4-HB-CoA or butyryl-CoA formation from acetyl-CoA and 4-HB or butyrate was determined using HPLC.

[0352] Alcohol (ADH) and aldehyde (ALD) dehydrogenase was assayed in the reductive direction using a procedure adapted from several literature sources (Durre et al., FEMS Microbiol. Rev. 17:251-262 (1995); Palosaari and Rogers, J. Bacteriol. 170:2971-2976 (1988) and Welch et al., Arch. Biochem. Biophys. 273:309-318 (1989). The oxidation of NADH is followed by reading absorbance at 340 nM every four seconds for a total of 240 seconds at room temperature. The reductive assays were performed in 100 mM MOPS (adjusted to pH 7.5 with KOH), 0.4 mM NADH, and from 1 to 50 µl of cell extract. The reaction is started by adding the following reagents: 100 µl of 100 mM acetaldehyde or butyraldehyde for ADH, or 100 µl of 1 mM acetyl-CoA or butyryl-CoA for ALD. The Spectrophotometer is quickly blanked and then the kinetic read is started. The resulting slope of the reduction in absorbance at 340 nM per minute, along with the molar extinction coefficient of NAD(P)H at 340 nM (6000) and the protein concentration of the extract, can be used to determine the specific activity.

[0353] The enzyme activity of PTB is measured in the direction of butyryl-CoA to butyryl-phosphate as described in Cary et al. J. Bacteriol. 170:4613-4618 (1988). It provides inorganic phosphate for the conversion, and follows the increase in free CoA with the reagent 5,5'-dithiobis-(2-nitrobenzoic acid), or DTNB. DTNB rapidly reacts with thiol groups such as free CoA to release the yellow-colored 2-nitro-5-mercaptobenzoic acid (TNB), which absorbs at 412 nm with a molar extinction coefficient of 14,140 M cm-1. The assay buffer contained 150 mM potassium phosphate at pH 7.4, 0.1 mM DTNB, and 0.2 mM butyryl-CoA, and the reaction was started by addition of 2 to 50 µL cell extract. The enzyme activity of BK is measured in the direction of butyrate to butyryl-phosphate formation at the expense of ATP. The procedure is similar to the assay for acetate kinase previously described Rose et al., J. Biol. Chem. 211:737-756 (1954). However it has been found that another acetate kinase enzyme assay protocol provided by Sigma to be more useful and sensitive. This assay links conversion of ATP to ADP by acetate kinase to the linked conversion of ADP and phosphoenolpyruvate (PEP) to ATP and pyruvate by pyruvate kinase, followed by the conversion of pyruvate and NADH to lactate and NAD+ by lactate dehydrogenase. Substituting butyrate for acetate is the only major modification to allow the assay to follow BK enzyme activity. The assay mixture contained 80 mM triethanolamine buffer at pH 7.6, 200 mM sodium butyrate, 10 mM MgCl2, 0.1 mM NADH, 6.6 mM ATP, 1.8 mM phosphoenolpyruvate. Pyruvate kinase, lactate dehydrogenase, and myokinase were added according to the manufacturer's instructions. The reaction was started by adding 2 to 50 µL cell extract, and the reaction was monitored based on the decrease in absorbance at 340 nm indicating NADH oxidation.

[0354] Analysis of CoA Derivatives by HPLC. An HPLC based assay was developed to monitor enzymatic reactions involving coenzyme A (CoA) transfer. The developed method allowed enzyme activity characterization by quantitative determination of CoA, acetyl CoA (AcCoA), butyryl CoA (BuCoA) and 4-hydroxybutyrate CoA (4-HBCoA) present in in-vitro reaction mixtures. Sensitivity down to low µM was achieved, as well as excellent resolution of all the CoA derivatives of interest.

[0355] Chemical and sample preparation was performed as follows. Briefly, CoA, AcCoA, BuCoA and all other chemicals, were obtained from Sigma-Aldrich. The solvents, methanol and acetonitrile, were of HPLC grade. Standard calibration curves exhibited excellent linearity in the 0.01-1mg/mL concentration range. Enzymatic reaction mixtures contained 100mM Tris HCl buffer (pH 7), aliquots were taken at different time points, quenched with formic acid (0.04% final concentration) and directly analyzed by HPLC.

[0356] HPLC analysis was performed using an Agilent 1100 HPLC system equipped with a binary pump, degasser, thermostated autosampler and column compartment, and diode array detector (DAD), was used for the analysis. A reversed phase column, Kromasil 100 5um C18, 4.6x150mm (Peeke Scientific), was employed. 25mM potassium phosphate (pH 7) and methanol or acetonitrile, were used as aqueous and organic solvents at 1mL/min flow rate. Two methods were developed: a short one with a faster gradient for the analysis of well-resolved CoA, AcCoA and BuCoA, and a longer method for distinguishing between closely eluting AcCoA and 4-HBCoA. Short method employed acetonitrile gradient (0min - 5%, 6min - 30%, 6.5min - 5%, 10min - 5%) and resulted in the retention times 2.7, 4.1 and 5.5min for CoA, AcCoA and BuCoA, respectively. In the long method methanol was used with the following linear gradient: 0min - 5%, 20 min - 35%, 20.5min - 5%, 25min - 5%. The retention times for CoA, AcCoA, 4-HBCoA and BuCoA were 5.8, 8.4, 9.2 and 16.0 min, respectively. The injection volume was 5µL, column temperature 30°C, and UV absorbance was monitored at 260nm.

[0357] The results demonstrated activity of each of the four pathway steps (Table 7), though activity is clearly dependent on the gene source, position of the gene in the vector, and the context of other genes with which it is expressed. For example, gene 0035 encodes a succinic semialdehyde dehydrogenase that is more active than that encoded by 0008, and 0036 and 0010n are more active 4-HB dehydrogenase genes than 0009. There also seems to be better 4-HB dehydrogenase activity when there is another gene preceding it on the same operon.
Table 7. In vitro enzyme activities in cell extracts from MG1655 lacIQ containing the plasmids expressing genes in the 4-HB-CoA pathway. Activities are reported in Units/mg protein, where a unit of activity is defined as the amount of enzyme required to convert 1 µmol of substrate in 1 min. at room temperature.
Sample #pZE13 (a)pZA33 (b)OD600Cell Prot (c)Cat1SucD4HBdCat2
1 catl (0004)   2.71 6.43 1.232 0.00    
2 catl (0004)-sucD (0035)   2.03 5.00 0.761 2.57    
3 catl (0004)-sucD (0008)   1.04 3.01 0.783 0.01    
4 sucD (0035)   2.31 6.94   2.32    
5 sucD (0008)   1.10 4.16   0.05    
6   4hbd (0009) 2.81 7.94 0.003   0.25  
7   4hbd (0036) 2.63 7.84     3.31  
8   4hbd (0010n) 2.00 5.08     2.57  
9 catl (0004)-sucD (0035) 4hbd (0009) 2.07 5.04 0.600 1.85 0.01  
10 catl (0004)-sucD (0035) 4hbd (0036) 2.08 5.40 0.694 1.73 0.41  
11 catl (0004)-sucD (0035) 4hbd (0010n) 2.44 4.73 0.679 2.28 0.37  
12 cat1 (0004)-sucD (0008) 4hbd (0009) 1.08 3.99 0.572 -0.01 0.02  
13 cat1 (0004)-sucD (0008) 4hbd (0036) 0.77 2.60 0.898 -0.01 0.04  
14 cat1 (0004)-sucD (0008) 4hbd (0010n) 0.63 2.47 0.776 0.00 0.00  
15   cat2 (0034) 2.56 7.86       1.283
16   cat2(0034)-4hbd(0036) 3.13 8.04     24.86 0.993
17   cat2(0034)-4hbd(0010n) 2.38 7.03     7.45 0.675
18   4hbd(0036)-cat2(0034) 2.69 8.26     2.15 7.490
19   4hbd(0010n)-cat2(0034) 2.44 6.59     0.59 4.101
Genes expressed from Plac on pZE13, a high-copy plasmid with colE1 origin and ampicillin resistance. Gene identification numbers are as given in Table 6
Genes expressed from Plac on pZA33, a medium-copy plasmid with pACYC origin and chloramphenicol resistance.
(c) Cell protein given as mg protein per mL extract.


[0358] Recombinant strains containing genes in the 4-HB pathway were then evaluated for the ability to produce 4-HB in vivo from central metabolic intermediates. Cells were grown anaerobically in LB medium to OD600 of approximately 0.4, then induced with 1 mM IPTG. One hour later, sodium succinate was added to 10 mM, and samples taken for analysis following an additional 24 and 48 hours. 4-HB in the culture broth was analyzed by GC-MS as described below. The results indicate that the recombinant strain can produce over 2 mM 4-HB after 24 hours, compared to essentially zero in the control strain (Table 8).
Table 8. Production of 4-HB from succinate in E. coli strains harboring plasmids expressing various combinations of 4-HB pathway genes.
 24 Hours48 Hours
Sample #Host StrainpZE13pZA33OD6004HB, µM4HB norm. (a)OD6004HB, µM4HB norm. (a)
1 MG1655 laclq catl (0004)-sucD (0035) 4hbd (0009) 0.47 487 1036 1.04 1780 1711
2 MG1655 laclq catl (0004)-sucD (0035) 4hbd (0027) 0.41 111 270 0.99 214 217
3 MG1655 laclq catl (0004)-sucD (0035) 4hbd (0036) 0.47 863 1835 0.48 2152 4484
4 MG1655 laclq catl (0004)-sucD (0035) 4hbd (0010n) 0.46 956 2078 0.49 2221 4533
5 MG1655 laclq catl (0004)-sucD (0008) 4hbd (0009) 0.38 493 1296 0.37 1338 3616
6 MG1655 laclq catl (0004)-sucD (0008) 4hbd (0027) 0.32 26 81 0.27 87 323
7 MG1655 laclq catl (0004)-sucD (0008) 4hbd (0036) 0.24 506 2108 0.31 1448 4672
8 MG1655 laclq catl (0004)-sucD (0008) 4hbd (0010n) 0.24 78 324 0.56 233 416
9 MG1655 laclq gabD catl (0004)-sucD (0035) 4hbd (0009) 0.53 656 1237 1.03 1643 1595
10 MG1655 laclq gabD catl (0004)-sucD (0035) 4hbd (0027) 0.44 92 209 0.98 214 218
11 MG1655 laclq gabD catl (0004)-sucD (0035) 4hbd (0036) 0.51 1072 2102 0.97 2358 2431
12 MG1655 laclq gabD catl (0004)-sucD (0035) 4hbd (0010n) 0.51 981 1924 0.97 2121 2186
13 MG1655 laclq gabD catl (0004)-sucD (0008) 4hbd (0009) 0.35 407 1162 0.77 1178 1530
14 MG1655 laclq gabD catl (0004)-sucD (0008) 4hbd (0027) 0.51 19 36 1.07 50 47
15 MG1655 laclq gabD catl (0004)-sucD (0008) 4hbd (0036) 0.35 584 1669 0.78 1350 1731
16 MG1655 laclq gabD catl (0004)-sucD (0008) 4hbd (0010n) 0.32 74 232 0.82 232 283
17 MG1655 laclq vector only vector only 0.8 1 2 1.44 3 2
18 MG1655 laclq gabD vector only vector only 0.89 1 2 1.41 7 5
(a) Normalized 4-HB concentration, µM/OD600 units


[0359] An alternate to using a CoA transferase (cat1) to produce succinyl-CoA from succinate is to use the native E. coli sucCD genes, encoding succinyl-CoA synthetase. This gene cluster was cloned onto pZE13 along with candidate genes for the remaining steps to 4-HB to create pZE13-0038-0035-0036.

[0360] Production of 4-HB from Glucose. Although the above experiments demonstrate a functional pathway to 4-HB from a central metabolic intermediate (succinate), an industrial process would require the production of chemicals from low-cost carbohydrate feedstocks such as glucose or sucrose. Thus, the next set of experiments was aimed to determine whether endogenous succinate produced by the cells during growth on glucose could fuel the 4-HB pathway. Cells were grown anaerobically in M9 minimal medium (6.78 g/L Na2HPO4, 3.0 g/L KH2PO4, 0.5 g/L NaCl, 1.0 g/L NH4Cl, 1 mM MgSO4, 0.1 mM CaCl2) supplemented with 20 g/L glucose, 100 mM 3-(N-morpholino)propanesulfonic acid (MOPS) to improve the buffering capacity, 10 µg/mL thiamine, and the appropriate antibiotics. 0.25 mM IPTG was added when OD600 reached approximately 0.2, and samples taken for 4-HB analysis every 24 hours following induction. In all cases 4-HB plateaued after 24 hours, with a maximum of about 1 mM in the best strains (Figure 3a), while the succinate concentration continued to rise (Figure 3b). This indicates that the supply of succinate to the pathway is likely not limiting, and that the bottleneck may be in the activity of the enzymes themselves or in NADH availability. 0035 and 0036 are clearly the best gene candidates for CoA-dependent succinic semialdehyde dehydrogenase and 4-HB dehydrogenase, respectively. The elimination of one or both of the genes encoding known (gabD) or putative (aldA) native succinic semialdehyde dehydrogenases had little effect on performance. Finally, it should be noted that the cells grew to a much lower OD in the 4-HB-producing strains than in the controls (Figure 3c).

[0361] An alternate pathway for the production of 4-HB from glucose is via a-ketoglutarate. We explored the use of an α-ketoglutarate decarboxylase from Mycobacterium tuberculosis Tian et al., Proc. Natl. Acad. Sci. USA 102:10670-10675 (2005) to produce succinic semialdehyde directly from α-ketoglutarate (step 8 in Figure 1). To demonstrate that this gene (0032) was functional in vivo, we expressed it on pZE13 in the same host as 4-HB dehydrogenase (gene 0036) on pZA33. This strain was capable of producing over 1.0 mM 4-HB within 24 hours following induction with 1 mM IPTG (Figure 4). Since this strain does not express a CoA-dependent succinic semialdehyde dehydrogenase, the possibility of succinic semialdehyde production via succinyl-CoA is eliminated. It is also possible that the native genes responsible for producing succinic semialdehyde could function in this pathway (steps 4 and 5 in Figure 1); however, the amount of 4-HB produced when the pZE13-0032 plasmid was left out of the host is the negligible.

[0362] Production of BDO from 4-HB. The production of BDO from 4-HB required two reduction steps, catalyzed by dehydrogenases. Alcohol and aldehyde dehydrogenases (ADH and ALD, respectively) are NAD+/H and/or NADP+/H-dependent enzymes that together can reduce a carboxylic acid group on a molecule to an alcohol group, or in reverse, can perform the oxidation of an alcohol to a carboxylic acid. This biotransformation has been demonstrated in wild-type Clostridium acetobutylicum (Jewell et al., Current Microbiology, 13:215-19 (1986)), but neither the enzymes responsible nor the genes responsible were identified. In addition, it is not known whether activation to 4-HB-CoA is first required (step 9 in Figure 1), or if the aldehyde dehydrogenase (step 12) can act directly on 4-HB. We developed a list of candidate enzymes from C. acetobutylicum and related organisms based on known activity with the non-hydroxylated analogues to 4-HB and pathway intermediates, or by similarity to these characterized genes (Table 6). Since some of the candidates are multifunctional dehydrogenases, they could potentially catalyze both the NAD(P)H-dependent reduction of the acid (or CoA-derivative) to the aldehyde, and of the aldehyde to the alcohol. Before beginning work with these genes in E. coli, we first validated the result referenced above using C. acetobutylicum ATCC 824. Cells were grown in Schaedler broth (Accumedia, Lansing, MI) supplemented with 10 mM 4-HB, in an anaerobic atmosphere of 10% CO2, 10% H2, and 80% N2 at 30°C. Periodic culture samples were taken, centrifuged, and the broth analyzed for BDO by GC-MS as described below. BDO concentrations of 0.1 mM, 0.9 mM, and 1.5 mM were detected after 1 day, 2 days, and 7 days incubation, respectively. No BDO was detected in culture grown without 4-HB addition. To demonstrate that the BDO produced was derived from glucose, we grew the best BDO producing strain MG1655 lacIQ pZE13-0004-0035-0002 pZA33-0034-0036 in M9 minimal medium supplemented with 4 g/L uniformly labeled 13C-glucose. Cells were induced at OD of 0.67 with 1 mM IPTG, and a sample taken after 24 hours. Analysis of the culture supernatant was performed by mass spectrometry.

[0363] Gene candidates for the 4-HB to BDO conversion pathway were next tested for activity when expressed in the E. coli host MG1655 lacIQ. Recombinant strains containing each gene candidate expressed on pZA33 were grown in the presence of 0.25 mM IPTG for four hours at 37°C to fully induce expression of the enzyme. Four hours after induction, cells were harvested and assayed for ADH and ALD activity as described above. Since 4-HB-CoA and 4-hydroxybutyraldehyde are not available commercially, assays were performed using the non-hydroxylated substrates (Table 9). The ratio in activity between 4-carbon and 2-carbon substrates for C. acetobutylicum adhE2 (0002) and E. coli adhE (0011) were similar to those previously reported in the literature a Atsumi et al., Biochim. Biophys. Acta. 1207:1-11 (1994).
Table 9. In vitro enzyme activities in cell extracts from MG1655 lacIQ containing pZA33 expressing gene candidates for aldehyde and alcohol dehydrogenases. Activities are expressed in µmol min-1 mg cell protein-1. N.D., not determined.
  Aldehyde dehydrogenaseAlcohol dehydrogenase
GeneSubstrateButyryl-CoAAcetyl-CoAButyraldehydeAcetaldehyde
0002   0.0076 0.0046 0.0264 0.0247
0003n   0.0060 0.0072 0.0080 0.0075
0011   0.0069 0.0095 0.0265 0.0093
0013   N.D. N.D. 0.0130 0.0142
0023   0.0089 0.0137 0.0178 0.0235
0025   0 0.0001 N.D. N.D.
0026   0 0.0005 0.0024 0.0008


[0364] For the BDO production experiments, cat2 from Porphyromonas gingivalis W83 (gene 0034) was included on pZA33 for the conversion of 4-HB to 4-HB-CoA, while the candidate dehydrogenase genes were expressed on pZE13. The host strain was MG1655 lacIQ. Along with the alcohol and aldehyde dehydrogenase candidates, we also tested the ability of CoA-dependent succinic semialdehyde dehydrogenases (sucD) to function in this step, due to the similarity of the substrates. Cells were grown to an OD of about 0.5 in LB medium supplemented with 10 mM 4-HB, induced with 1 mM IPTG, and culture broth samples taken after 24 hours and analyzed for BDO as described below. The best BDO production occurred using adhE2 from C. acetobutylicum, sucD from C. kluyveri, or sucD from P. gingivalis (Figure 5). Interestingly, the absolute amount of BDO produced was higher under aerobic conditions; however, this is primarily due to the lower cell density achieved in anaerobic cultures. When normalized to cell OD, the BDO production per unit biomass is higher in anaerobic conditions (Table 10).
Table 10. Absolute and normalized BDO concentrations from cultures of cells expressing adhE2 from C. acetobutylicum, sucD from C. kluyveri, or sucD from P. gingivalis (data from experiments 2, 9, and 10 in Figure 3), as well as the negative control (experiment 1).
Gene expressedConditionsBDO (µM)OD (600nm)BDO/OD
none Aerobic 0 13.4 0
none Microaerobic 0.5 6.7 0.09
none Anaerobic 2.2 1.26 1.75
0002 Aerobic 138.3 9.12 15.2
0002 Microaerobic 48.2 5.52 8.73
0002 Anaerobic 54.7 1.35 40.5
0008n Aerobic 255.8 5.37 47.6
0008n Microaerobic 127.9 3.05 41.9
0008n Anaerobic 60.8 0.62 98.1
0035 Aerobic 21.3 14.0 1.52
0035 Microaerobic 13.1 4.14 3.16
0035 Anaerobic 21.3 1.06 20.1


[0365] As discussed above, it may be advantageous to use a route for converting 4-HB to 4-HB-CoA that does not generate acetate as a byproduct. To this aim, we tested the use of phosphotransbutyrylase (ptb) and butyrate kinase (bk) from C. acetobutylicum to carry out this conversion via steps 10 and 11 in Figure 1. The native ptb/bk operon from C. acetobutylicum (genes 0020 and 0021) was cloned and expressed in pZA33. Extracts from cells containing the resulting construct were taken and assayed for the two enzyme activities as described herein. The specific activity of BK was approximately 65 U/mg, while the specific activity of PTB was approximately 5 U/mg. One unit (U) of activity is defined as conversion of 1 µM substrate in 1 minute at room temperature. Finally, the construct was tested for participation in the conversion of 4-HB to BDO. Host strains were transformed with the pZA33-0020-0021 construct described and pZE 13-0002, and compared to use of cat2 in BDO production using the aerobic procedure used above in Figure 5. The BK/PTB strain produced 1 mM BDO, compared to 2 mM when using cat2 (Table 11). Interestingly, the results were dependent on whether the host strain contained a deletion in the native adhE gene.
Table 11. Absolute and normalized BDO concentrations from cultures of cells expressing adhE2 from C. acetobutylicum in pZE13 along with either cat2 from P. gingivalis (0034) or the PTB/BK genes from C. acetobutylicum on pZA33. Host strains were either MG1655 lacIQ or MG1655 ΔadhE lacIQ.
GenesHost StrainBDO (µM)OD (600nm)BDO/OD
0034 MG1655 lacIQ 0.827 19.9 0.042
0020+0021 MG1655 lacIQ 0.007 9.8 0.0007
0034 MG1655 ΔadhE lacIQ 2.084 12.5 0.166
0020+0021 MG1655 ΔadhE lacIQ 0.975 18.8 0.052


[0366] Production of BDO from Glucose. The final step of pathway corroboration is to express both the 4-HB and BDO segments of the pathway in E. coli and demonstrate production of BDO in glucose minimal medium. New plasmids were constructed so that all the required genes fit on two plamids. In general, cat1, adhE, and sucD genes were expressed from pZE13, and cat2 and 4-HBd were expressed from pZA33. Various combinations of gene source and gene order were tested in the MG1655 lacIQ background. Cells were grown anaerobically in M9 minimal medium (6.78 g/L Na2HPO4, 3.0 g/L KH2PO4, 0.5 g/L NaCl, 1.0 g/L NH4Cl, 1 mM MgSO4, 0.1 mM CaCl2) supplemented with 20 g/L glucose, 100 mM 3-(N-morpholino)propanesulfonic acid (MOPS) to improve the buffering capacity, 10 µg/mL thiamine, and the appropriate antibiotics. 0.25 mM IPTG was added approximately 15 hours following inoculation, and culture supernatant samples taken for BDO, 4-HB, and succinate analysis 24 and 48 hours following induction. The production of BDO appeared to show a dependency on gene order (Table 12). The highest BDO production, over 0.5 mM, was obtained with cat2 expressed first, followed by 4-HBd on pZA33, and cat1 followed by P. gingivalis sucD on pZE13. The addition of C. acetobutylicum adhE2 in the last position on pZE13 resulted in slight improvement. 4-HB and succinate were also produced at higher concentrations.
Table 12. Production of BDO, 4-HB, and succinate in recombinant E. coli strains expressing combinations of BDO pathway genes, grown in minimal medium supplemented with 20 g/L glucose. Concentrations are given in mM.
    24 Hours48 Hours
SamplepZE13pZA33Induction ODOD600nmSu4HBBDOOD600nmSu4HBBDO
1 cat1(0004)-sucD(0035) 4hbd (0036)-cat2(0034) 0.92 1.29 5.44 1.37 0.240 1.24 6.42 1.49 0.280
2 cat1(0004)-sucD(0008N) 4hbd (0036)-cat2(0034) 0.36 1.11 6.90 1.24 0.011 1.06 7.63 1.33 0.011
3 adhE(0002)-cat1(0004)-sucD(0035) 4hbd (0036)-cat2(0034) 0.20 0.44 0.34 1.84 0.050 0.60 1.93 2.67 0.119
4 cat1(0004)-sucD(0035)-adhE(0002) 4hbd (0036)-cat2(0034) 1.31 1.90 9.02 0.73 0.073 1.95 9.73 0.82 0.077
5 adhE(0002)-cat1(0004)-sucD(0008N) 4hbd (0036)-cat2(0034) 0.17 0.45 1.04 1.04 0.008 0.94 7.13 1.02 0.017
6 cat1(0004)-sucD(0008M)-adhE(0002) 4hbd (0036)-cat2(0034) 1.30 1.77 10.47 0.25 0.004 1.80 11.49 0.28 0.003
7 cat1(0004)-sucD(0035) cat2(0034)-4hbd(0036) 1.09 1.29 5.63 2.15 0.461 1.38 6.66 2.30 0.520
8 cat1(0004)-sucD(0008N) cat2(0034)-4hbd(0036) 1.81 2.01 11.28 0.02 0.000 2.24 11.13 0.02 0.000
9 adhE(0002)-cat1(0004)-sucD(0035) cat2(0034)-4hbd(0036) 0.24 1.99 2.02 2.32 0.106 0.89 4.85 2.41 0.186
10 cat1(0004)-sucD(0035)-adhE(0002) cat2(0034)-4hbd(0036) 0.98 1.17 5.30 2.08 0.569 1.33 6.15 2.14 0.640
11 adh E(0002)-cat1(0004)-sucD(0008N) cat2(0034)-4hbd(0036) 0.20 0.53 1.38 2.30 0.019 0.91 8.10 1.49 0.034
12 cat1(0004)-sucD(0008N)-adhE(0002) cat2(0034)-4hbd(0036) 2.14 2.73 12.07 0.16 0.000 3.10 11.79 0.17 0.002
13 vector only vector only 2.11 2.62 9.03 0.01 0.000 3.00 12.05 0.01 0.000


[0367] Analysis of BDO, 4-HB and succinate by GCMS. BDO, 4-HB and succinate in fermentation and cell culture samples were derivatized by silylation and quantitatively analyzed by GCMS using methods adapted from literature reports ((Simonov et al., J. Anal Chem.59:965-971 (2004)). The developed method demonstrated good sensitivity down to 1µM, linearity up to at least 25mM, as well as excellent selectivity and reproducibility.

[0368] Sample preparation was performed as follows: 100µL filtered (0.2µm or 0.45µm syringe filters) samples, e.g. fermentation broth, cell culture or standard solutions, were dried down in a Speed Vac Concentrator (Savant SVC-100H) for approximately 1 hour at ambient temperature, followed by the addition of 20µL 10mM cyclohexanol solution, as an internal standard, in dimethylformamide. The mixtures were vortexed and sonicated in a water bath (Branson 3510) for 15 min to ensure homogeneity. 100 µL silylation derivatization reagent, N,O-bis(trimethylsilyl)triflouro-acetimide (BSTFA) with 1% trimethylchlorosilane, was added, and the mixture was incubated at 70°C for 30 min. The derivatized samples were centrifuged for 5 min, and the clear solutions were directly injected into GCMS. All the chemicals and reagents were from Sigma-Aldrich, with the exception of BDO which was purchased from J.T.Baker.

[0369] GCMS was performed on an Agilent gas chromatograph 6890N, interfaced to a mass-selective detector (MSD) 5973N operated in electron impact ionization (EI) mode has been used for the analysis. A DB-5MS capillary column (J&W Scientific, Agilent Technologies), 30m x 0.25mm i.d. x 0.25 µm film thickness, was used. The GC was operated in a split injection mode introducing 1µL of sample at 20:1 split ratio. The injection port temperature was 250°C. Helium was used as a carrier gas, and the flow rate was maintained at 1.0 mL/min. A temperature gradient program was optimized to ensure good resolution of the analytes of interest and minimum matrix interference. The oven was initially held at 80°C for 1min, then ramped to 120°C at 2°C/min, followed by fast ramping to 320°C at 100°C/min and final hold for 6min at 320°C. The MS interface transfer line was maintained at 280°C. The data were acquired using 'lowmass' MS tune settings and 30-400 m/z mass-range scan. The total analysis time was 29 min including 3 min solvent delay. The retention times corresponded to 5.2, 10.5, 14.0 and 18.2 min for BSTFA-derivatized cyclohexanol, BDO, 4-HB and succinate, respectively. For quantitative analysis, the following specific mass fragments were selected (extracted ion chromatograms): m/z 157 for internal standard cyclohexanol, 116 for BDO, and 147 for both 4-HB and succinate. Standard calibration curves were constructed using analyte solutions in the corresponding cell culture or fermentation medium to match sample matrix as close as possible. GCMS data were processed using Environmental Data Analysis ChemStation software (Agilent Technologies).

[0370] The results indicated that most of the 4-HB and BDO produced were labeled with 13C (Figure 6, right-hand sides). Mass spectra from a parallel culture grown in unlabeled glucose are shown for comparison (Figure 6, left-hand sides). Note that the peaks seen are for fragments of the derivatized molecule containing different numbers of carbon atoms from the metabolite. The derivatization reagent also contributes some carbon and silicon atoms that naturally-occurring label distribution, so the results are not strictly quantitative.

[0371] Production of BDO from 4-HB using alternate pathways. The various alternate pathways were also tested for BDO production. This includes use of the native E. coli SucCD enzyme to convert succinate to succinyl-CoA (Table 13, rows 2-3), use of α-ketoglutarate decarboxylase in the α-ketoglutarate pathway (Table 13, row 4), and use of PTB/BK as an alternate means to generate the CoA-derivative of 4HB (Table 13, row 1). Strains were constructed containing plasmids expressing the genes indicated in Table 13, which encompass these variants. The results show that in all cases, production of 4-HB and BDO occurred (Table 13).
Table 13. Production of BDO, 4-HB, and succinate in recombinant E. coli strains genes for different BDO pathway variants, grown anaerobically in minimal medium supplemented with 20 g/L glucose, and harvested 24 hours after induction with 0.1 mM IPTG. Concentrations are given in mM.
Genes on pZE13Genes on pZA33Succinate4-HBBDO
0002+0004+0035 0020n-0021n-0036 0.336 2.91 0.230
0038+0035 0034-0036 0.814 2.81 0.126
0038+0035 0036-0034 0.741 2.57 0.114
0035+0032 0034-0036 5.01 0.538 0.154

EXAMPLE III


Biosynthesis of 4-Hydroxybutanoic Acid, γ-Butyrolactone and 1,4-Butanediol



[0372] This Example describes the biosynthetic production of 4-hydroxybutanoic acid, γ-butyrolactone and 1,4-butanediol using fermentation and other bioprocesses.

[0373] Methods for the integration of the 4-HB fermentation step into a complete process for the production of purified GBL, 1,4-butanediol (BDO) and tetrahydrofuran (THF) are described below. Since 4-HB and GBL are in equilibrium, the fermentation broth will contain both compounds. At low pH this equilibrium is shifted to favor GBL. Therefore, the fermentation can operate at pH 7.5 or less, generally pH 5.5 or less. After removal of biomass, the product stream enters into a separation step in which GBL is removed and the remaining stream enriched in 4-HB is recycled. Finally, GBL is distilled to remove any impurities. The process operates in one of three ways: 1) fed-batch fermentation and batch separation; 2) fed-batch fermentation and continuous separation; 3) continuous fermentation and continuous separation. The first two of these modes are shown schematically in Figure 7. The integrated fermentation procedures described below also are used for the BDO producing cells of the disclosure for biosynthesis of BDO and subsequent BDO family products.

[0374] Fermentation protocol to produce 4-HB/GBL (batch): The production organism is grown in a 10L bioreactor sparged with an N2/CO2 mixture, using 5 L broth containing 5 g/L potassium phosphate, 2.5 g/L ammonium chloride, 0.5 g/L magnesium sulfate, and 30 g/L corn steep liquor, and an initial glucose concentration of 20 g/L. As the cells grow and utilize the glucose, additional 70% glucose is fed into the bioreactor at a rate approximately balancing glucose consumption. The temperature of the bioreactor is maintained at 30 degrees C. Growth continues for approximately 24 hours, until 4-HB reaches a concentration of between 20-200 g/L, with the cell density being between 5 and 10 g/L. The pH is not controlled, and will typically decrease to pH 3-6 by the end of the run. Upon completion of the cultivation period, the fermenter contents are passed through a cell separation unit (e.g., centrifuge) to remove cells and cell debris, and the fermentation broth is transferred to a product separations unit. Isolation of 4-HB and/or GBL would take place by standard separations procedures employed in the art to separate organic products from dilute aqueous solutions, such as liquid-liquid extraction using a water immiscible organic solvent (e.g., toluene) to provide an organic solution of 4-HB/GBL. The resulting solution is then subjected to standard distillation methods to remove and recycle the organic solvent and to provide GBL (boiling point 204-205°C) which is isolated as a purified liquid.

[0375] Fermentation protocol to produce 4-HB/GBL (fully continuous): The production organism is first grown up in batch mode using the apparatus and medium composition described above, except that the initial glucose concentration is 30-50 g/L. When glucose is exhausted, feed medium of the same composition is supplied continuously at a rate between 0.5 L/hr and 1 L/hr, and liquid is withdrawn at the same rate. The 4-HB concentration in the bioreactor remains constant at 30-40 g/L, and the cell density remains constant between 3-5 g/L. Temperature is maintained at 30 degrees C, and the pH is maintained at 4.5 using concentrated NaOH and HCl, as required. The bioreactor is operated continuously for one month, with samples taken every day to assure consistency of 4-HB concentration. In continuous mode, fermenter contents are constantly removed as new feed medium is supplied. The exit stream, containing cells, medium, and products 4-HB and/or GBL, is then subjected to a continuous product separations procedure, with or without removing cells and cell debris, and would take place by standard continuous separations methods employed in the art to separate organic products from dilute aqueous solutions, such as continuous liquid-liquid extraction using a water immiscible organic solvent (e.g., toluene) to provide an organic solution of 4-HB/GBL. The resulting solution is subsequently subjected to standard continuous distillation methods to remove and recycle the organic solvent and to provide GBL (boiling point 204-205°C) which is isolated as a purified liquid.

[0376] GBL Reduction Protocol: Once GBL is isolated and purified as described above, it will then be subjected to reduction protocols such as those well known in the art (references cited) to produce 1,4-butanediol or tetrahydrofuran (THF) or a mixture thereof. Heterogeneous or homogeneous hydrogenation catalysts combined with GBL under hydrogen pressure are well known to provide the products 1,4-butanediol or tetrahydrofuran (THF) or a mixture thereof. It is important to note that the 4-HB/GBL product mixture that is separated from the fermentation broth, as described above, may be subjected directly, prior to GBL isolation and purification, to these same reduction protocols to provide the products 1,4-butanediol or tetrahydrofuran or a mixture thereof. The resulting products, 1,4-butanediol and THF are then isolated and purified by procedures well known in the art.

Fermentation and hydrogenation protocol to produce BDO or THF directly (batch):



[0377] Cells are grown in a 10L bioreactor sparged with an N2/CO2 mixture, using 5 L broth containing 5 g/L potassium phosphate, 2.5 g/L ammonium chloride, 0.5 g/L magnesium sulfate, and 30 g/L corn steep liquor, and an initial glucose concentration of 20 g/L. As the cells grow and utilize the glucose, additional 70% glucose is fed into the bioreactor at a rate approximately balancing glucose consumption. The temperature of the bioreactor is maintained at 30 degrees C. Growth continues for approximately 24 hours, until 4-HB reaches a concentration of between 20-200 g/L, with the cell density being between 5 and 10 g/L. The pH is not controlled, and will typically decrease to pH 3-6 by the end of the run. Upon completion of the cultivation period, the fermenter contents are passed through a cell separation unit (e.g., centrifuge) to remove cells and cell debris, and the fermentation broth is transferred to a reduction unit (e.g., hydrogenation vessel), where the mixture 4-HB/GBL is directly reduced to either 1,4-butanediol or THF or a mixture thereof. Following completion of the reduction procedure, the reactor contents are transferred to a product separations unit. Isolation of 1,4-butanediol and/or THF would take place by standard separations procedures employed in the art to separate organic products from dilute aqueous solutions, such as liquid-liquid extraction using a water immiscible organic solvent (e.g., toluene) to provide an organic solution of 1,4-butanediol and/or THF. The resulting solution is then subjected to standard distillation methods to remove and recycle the organic solvent and to provide 1,4-butanediol and/or THF which are isolated as a purified liquids.

[0378] Fermentation and hydrogenation protocol to produce BDO or THF directly (fully continuous): The cells are first grown up in batch mode using the apparatus and medium composition described above, except that the initial glucose concentration is 30-50 g/L. When glucose is exhausted, feed medium of the same composition is supplied continuously at a rate between 0.5 L/hr and 1 L/hr, and liquid is withdrawn at the same rate. The 4-HB concentration in the bioreactor remains constant at 30-40 g/L, and the cell density remains constant between 3-5 g/L. Temperature is maintained at 30 degrees C, and the pH is maintained at 4.5 using concentrated NaOH and HCl, as required. The bioreactor is operated continuously for one month, with samples taken every day to assure consistency of 4-HB concentration. In continuous mode, fermenter contents are constantly removed as new feed medium is supplied. The exit stream, containing cells, medium, and products 4-HB and/or GBL, is then passed through a cell separation unit (e.g., centrifuge) to remove cells and cell debris, and the fermentation broth is transferred to a continuous reduction unit (e.g., hydrogenation vessel), where the mixture 4-HB/GBL is directly reduced to either 1,4-butanediol or THF or a mixture thereof. Following completion of the reduction procedure, the reactor contents are transferred to a continuous product separations unit. Isolation of 1,4-butanediol and/or THF would take place by standard continuous separations procedures employed in the art to separate organic products from dilute aqueous solutions, such as liquid-liquid extraction using a water immiscible organic solvent (e.g., toluene) to provide an organic solution of 1,4-butanediol and/or THF. The resulting solution is then subjected to standard continuous distillation methods to remove and recycle the organic solvent and to provide 1,4-butanediol and/or THF which are isolated as a purified liquids.

[0379] Fermentation protocol to produce BDO directly (batch): The production organism is grown in a 10L bioreactor sparged with an N2/CO2 mixture, using 5 L broth containing 5 g/L potassium phosphate, 2.5 g/L ammonium chloride, 0.5 g/L magnesium sulfate, and 30 g/L corn steep liquor, and an initial glucose concentration of 20 g/L. As the cells grow and utilize the glucose, additional 70% glucose is fed into the bioreactor at a rate approximately balancing glucose consumption. The temperature of the bioreactor is maintained at 30 degrees C. Growth continues for approximately 24 hours, until BDO reaches a concentration of between 20-200 g/L, with the cell density generally being between 5 and 10 g/L. Upon completion of the cultivation period, the fermenter contents are passed through a cell separation unit (e.g., centrifuge) to remove cells and cell debris, and the fermentation broth is transferred to a product separations unit. Isolation of BDO would take place by standard separations procedures employed in the art to separate organic products from dilute aqueous solutions, such as liquid-liquid extraction using a water immiscible organic solvent (e.g., toluene) to provide an organic solution of BDO. The resulting solution is then subjected to standard distillation methods to remove and recycle the organic solvent and to provide BDO (boiling point 228-229°C) which is isolated as a purified liquid.

[0380] Fermentation protocol to produce BDO directly (fully continuous): The production organism is first grown up in batch mode using the apparatus and medium composition described above, except that the initial glucose concentration is 30-50 g/L. When glucose is exhausted, feed medium of the same composition is supplied continuously at a rate between 0.5 L/hr and 1 L/hr, and liquid is withdrawn at the same rate. The BDO concentration in the bioreactor remains constant at 30-40 g/L, and the cell density remains constant between 3-5 g/L. Temperature is maintained at 30 degrees C, and the pH is maintained at 4.5 using concentrated NaOH and HCl, as required. The bioreactor is operated continuously for one month, with samples taken every day to assure consistency of BDO concentration. In continuous mode, fermenter contents are constantly removed as new feed medium is supplied. The exit stream, containing cells, medium, and the product BDO, is then subjected to a continuous product separations procedure, with or without removing cells and cell debris, and would take place by standard continuous separations methods employed in the art to separate organic products from dilute aqueous solutions, such as continuous liquid-liquid extraction using a water immiscible organic solvent (e.g., toluene) to provide an organic solution of BDO. The resulting solution is subsequently subjected to standard continuous distillation methods to remove and recycle the organic solvent and to provide BDO (boiling point 228-229°C) which is isolated as a purified liquid (mpt 20°C).

EXAMPLE IV


Exemplary BDO Pathways



[0381] This example describes exemplary enzymes and corresponding genes for 1,4-butandiol (BDO) synthetic pathways.

[0382] Exemplary BDO synthetic pathways are shown in Figures 8-13. The pathways depicted in Figures 8-13 are from common central metabolic intermediates to 1,4-butanediol. All transformations depicted in Figures 8-13 fall into the 18 general categories of transformations shown in Table 14. Below is described a number of biochemically characterized candidate genes in each category. Specifically listed are genes that can be applied to catalyze the appropriate transformations in Figures 9-13 when cloned and expressed in a host organism. The top three exemplary genes for each of the key steps in Figures 9-13 are provided in Tables 15-23 (see below). Exemplary genes were provided for the pathways depicted in Figure 8 are described herein.
Table 14. Enzyme types required to convert common central metabolic intermediates into 1,4-butanediol. The first three digits of each label correspond to the first three Enzyme Commission number digits which denote the general type of transformation independent of substrate specificity.
LabelFunction
1.1.1.a Oxidoreductase (ketone to hydroxyl or aldehyde to alcohol)
1.1.1.c Oxidoreductase (2 step, acyl-CoA to alcohol)
1.2.1.b Oxidoreductase (acyl-CoA to aldehyde)
1.2.1.c Oxidoreductase (2-oxo acid to acvl-CoA, decarboxylation)
1.2.1.d Oxidoreductase (phosphorylating/dephosphorylating)
1.3.1.a Oxidoreductase operating on CH-CH donors
1.4.1.a Oxidoreductase operating on amino acids
2.3.1.a Acyltransferase (transferring phosphate group)
2.6.1.a Aminotransferase
2.7.2.a Phosphotransferase, carboxyl group acceptor
2.8.3.a Coenzyme-A transferase
3.1.2.a Thiolester hydrolase (CoA specific)
4.1.1.a Carboxy-lyase
4.2.1.a Hydro-lyase
4.3.1. a Ammonia-lyase
5.3.3.a Isomerase
5.4.3.a Aminomutase
6.2.1.a Acid-thiol ligase

1.1.1.a - Oxidoreductase (aldehyde to alcohol or ketone to hydroxyl)



[0383] Aldehyde to alcohol. Exemplary genes encoding enzymes that catalyze the conversion of an aldehyde to alcohol, that is, alcohol dehydrogenase or equivalently aldehyde reductase, include alrA encoding a medium-chain alcohol dehydrogenase for C2-C14 (Tani et al. Appl.Environ.Microbiol. 66:5231-5235 (2000)), ADH2 from Saccharomyces cerevisiae (Atsumi et al. Nature 451:86-89 (2008)), yqhD from E. coli which has preference for molecules longer than C(3) (Sulzenbacher et al. Journal of Molecular Biology 342:489-502 (2004)), and bdh I and bdh II from C. acetobutylicum which converts butyryaldehyde into butanol (Walter et al. Journal of Bacteriology 174:7149-7158 (1992)). The protein sequences for each of these exemplary gene products, if available, can be found using the following GenBank accession numbers:
GeneAccession No.GI No.Organism
alrA BAB12273.1 9967138 Acinetobacter sp. Strain M-1
ADH2 NP_014032.1 6323961 Saccharymyces cerevisiae
yqhD NP_417484.1 16130909 Escherichia coli
bdh I NP_349892.1 15896543 Clostridium acetobutylicum
bdh II NP_349891.1 15896542 Clostridium acetobutylicum


[0384] Enzymes exhibiting 4-hydroxybutyrate dehydrogenase activity (EC 1.1.1.61) also fall into this category. Such enzymes have been characterized in Ralstonia eutropha (Bravo et al. J.Forensic Sci. 49:379-387 (2004), Clostridium kluyveri (Wolff et al. Protein Expr.Purif. 6:206-212 (1995)) and Arabidopsis thaliana (Breitkreuz et al. J.Biol.Chem. 278:41552-41556 (2003)).
GeneAccession No.GI No.Organism
4hbd YP_726053.1 113867564 Ralstonia eutropha H16
4hbd L21902.1 146348486 Clostridium kluyveri DSM 555
4hbd Q94B07 75249805 Arabidopsis thaliana


[0385] Another exemplary enzyme is 3-hydroxyisobutyrate dehydrogenase which catalyzes the reversible oxidation of 3-hydroxyisobutyrate to methylmalonate semialdehyde. This enzyme participates in valine, leucine and isoleucine degradation and has been identified in bacteria, eukaryotes, and mammals. The enzyme encoded by P84067 from Thermus thermophilus HB8 has been structurally characterized (Lokanath et al. J Mol Biol 352:905-17 (2005)). The reversibility of the human 3-hydroxyisobutyrate dehydrogenase was demonstrated using isotopically-labeled substrate (Manning et al. Biochem J 231:481-484 (1985)). Additional genes encoding this enzyme include 3hidh in Homo sapiens (Hawes et al. Methods Enzymol. 324:218-228 (2000)) and Oryctolagus cuniculus (Chowdhury et al. Biosci.Biotechnol Biochem. 60:2043-2047 (1996); Hawes et al. Methods Enzymol. 324:218-228 (2000)), mmsb in Pseudomonas aeruginosa, and dhat in Pseudomonas putida (Aberhart et al. J Chem.Soc. [Perkin 1] 6:1404-1406 (1979); Chowdhury et al. Biosci.Biotechnol Biochem. 67:438-441 (2003); Chowdhury et al. Biosci.Biotechnol Biochem. 60:2043-2047 (1996)).
GeneAccession No.GI No.Organism
P84067 P84067 75345323 Thermus thermophilus
mmsb P28811.1 127211 Pseudomonas aeruginosa
dhat Q59477.1 2842618 Pseudomonas putida
3hidh P31937.2 12643395 Homo sapiens
3hidh P32185.1 416872 Oryctolagus cuniculus


[0386] Several 3-hydroxyisobutyrate dehydrogenase enzymes have also been shown to convert malonic semialdehyde to 3-hydroxyproprionic acid (3-HP). Three gene candidates exhibiting this activity are mmsB from Pseudomonas aeruginosa PAO1(62), mmsB from Pseudomonas putida KT2440 (Liao et al., US Publication 2005/0221466) and mmsB from Pseudomonas putida E23 (Chowdhury et al., Biosci.Biotechnol.Biochem. 60:2043-2047 (1996)). An enzyme with 3-hydroxybutyrate dehydrogenase activity in Alcaligenes faecalis M3A has also been identified (Gokam et al., US Patent No. 7,393,676; Liao et al., US Publication No. 2005/0221466). Additional gene candidates from other organisms including Rhodobacter spaeroides can be inferred by sequence similarity.
GeneAccession No.GI No.Organism
mmsB AAA25892.1 151363 Pseudomonas aeruginosa
mmsB NP_252259.1 15598765 Pseudomonas aeruginosa PAO1
mmsB NP_746775.1 26991350 Pseudomonas putida KT2440
mmsB JC7926 60729613 Pseudomonas putida E23
orfB1 AAL26884 16588720 Rhodobacter spaeroides


[0387] The conversion of malonic semialdehyde to 3-HP can also be accomplished by two other enzymes: NADH-dependent 3-hydroxypropionate dehydrogenase and NADPH-dependent malonate semialdehyde reductase. An NADH-dependent 3-hydroxypropionate dehydrogenase is thought to participate in beta-alanine biosynthesis pathways from propionate in bacteria and plants (Rathinasabapathi, B. Journal of Plant Pathology 159:671-674 (2002); Stadtman, E. R. J.Am.Chem.Soc. 77:5765-5766 (1955)). This enzyme has not been associated with a gene in any organism to date. NADPH-dependent malonate semialdehyde reductase catalyzes the reverse reaction in autotrophic CO2-fixing bacteria. Although the enzyme activity has been detected in Metallosphaera sedula, the identity of the gene is not known (Alber et al. J.Bacteriol. 188:8551-8559 (2006)).

[0388] Ketone to hydroxyl. There exist several exemplary alcohol dehydrogenases that convert a ketone to a hydroxyl functional group. Two such enzymes from E. coli are encoded by malate dehydrogenase (mdh) and lactate dehydrogenase (ldhA). In addition, lactate dehydrogenase from Ralstonia eutropha has been shown to demonstrate high activities on substrates of various chain lengths such as lactate, 2-oxobutyrate, 2-oxopentanoate and 2-oxoglutarate (Steinbuchel and. Schlegel, Eur.J.Biochem. 130:329-334 (1983)). Conversion of alpha-ketoadipate into alpha-hydroxyadipate can be catalyzed by 2-ketoadipate reductase, an enzyme reported to be found in rat and in human placenta (Suda et al. Arch.Biochem.Biophys. 176:610-620 (1976); Suda et al. Biochem.Biophys.Res.Commun. 77:586-591 (1977)). An additional candidate for this step is the mitochondrial 3-hydroxybutyrate dehydrogenase (bdh) from the human heart which has been cloned and characterized (Marks et al. J.Biol.Chem. 267:15459-15463 (1992)). This enzyme is a dehydrogenase that operates on a 3-hydroxyacid. Another exemplary alcohol dehydrogenase converts acetone to isopropanol as was shown in C. beijerinckii (Ismaiel et al. J.Bacteriol. 175:5097-5105 (1993)) and T. brockii (Lamed et al. Biochem. J. 195:183-190 (1981); Peretz and Burstein Biochemistry 28:6549-6555 (1989)).
GeneAccession No.GI No.Organism
mdh AAC76268.1 1789632 Escherichia coli
ldhA NP_415898.1 16129341 Escherichia coli
ldh YP_725182.1 113866693 Ralstonia eutropha
bdh AAA58352.1 177198 Homo sapiens
adh AAA23199.2 60592974 Clostridium beijerinckii NRRL B593
adh P14941.1 113443 Thermoanaerobacter brockii HTD4


[0389] Exemplary 3-hydroxyacyl dehydrogenases which convert acetoacetyl-CoA to 3-hydroxybutyryl-CoA include hbd from C. acetobutylicum (Boynton et al. Journal of Bacteriology 178:3015-3024 (1996)), hbd from C. beijerinckii (Colby et al. Appl Environ.Microbiol 58:3297-3302 (1992)), and a number of similar enzymes from Metallosphaera sedula (Berg et al. Archaea. Science 318:1782-1786 (2007)).
GeneAccession No.GI No.Organism
hbd NP_349314.1 15895965 Clostridium acetobutylicum
hbd AAM14586.1 20162442 Clostridium beijerinckii
Msed_1423 YP_001191505 146304189 Metallosphaera sedula
Msed_0399 YP_001190500 146303184 Metallosphaera sedula
Msed_0389 YP_001190490 146303174 Metallosphaera sedula
Msed_1993 YP_001192057 146304741 Metallosphaera sedula

1.1.1.c - Oxidoredutase (2 step, acyl-CoA to alcohol)



[0390] Exemplary 2-step oxidoreductases that convert an acyl-CoA to alcohol include those that transform substrates such as acetyl-CoA to ethanol (for example, adhE from E. coli (Kessler et al. FEBS.Lett. 281:59-63 (1991)) and butyryl-CoA to butanol (for example, adhE2 from C. acetobutylicum (Fontaine et al. J.Bacteriol. 184:821-830 (2002)). In addition to reducing acetyl-CoA to ethanol, the enzyme encoded by adhE in Leuconostoc mesenteroides has been shown to oxide the branched chain compound isobutyraldehyde to isobutyryl-CoA (Kazahaya et al. J.Gen.Appl.Microbiol. 18:43-55 (1972); Koo et al. Biotechnol Lett. 27:505-510 (2005)).
GeneAccession No.GI No.Organism
adhE NP_415757.1 16129202 Escherichia coli
adhE2 AAK09379.1 12958626 Clostridium acetobutylicum
adhE AAV66076.1 55818563 Leuconostoc mesenteroides


[0391] Another exemplary enzyme can convert malonyl-CoA to 3-HP. An NADPH-dependent enzyme with this activity has characterized in Chloroflexus aurantiacus where it participates in the 3-hydroxypropionate cycle (Hugler et al., J.Bacteriol. 184:2404-2410 (2002); Strauss and Fuchs, Eur.J.Biochem. 215:633-643 (1993)). This enzyme, with a mass of 300 kDa, is highly substrate-specific and shows little sequence similarity to other known oxidoreductases (Hugler et al., J.Bacteriol. 184:2404-2410 (2002)). No enzymes in other organisms have been shown to catalyze this specific reaction; however there is bioinformatic evidence that other organisms may have similar pathways (Klatt et al., Environ.Microbiol. 9:2067-2078 (2007)). Enzyme candidates in other organisms including Roseiflexus castenholzii, Erythrobacter sp. NAP1 and marine gamma proteobacterium HTCC2080 can be inferred by sequence similarity.
GeneAccession No.GI No.Organism
mcr AAS20429.1 42561982 Chloroflexus aurantiacus
Rcas_2929 YP_001433009.1 156742880 Roseiflexus castenholzii
NAP1_02720 ZP_ 01039179.1 85708113 Erythrobacter sp. NAP1
MGP2080_00535 ZP_01626393.1 119504313 marine gamma proteobacterium HTCC2080


[0392] Longer chain acyl-CoA molecules can be reduced by enzymes such as the jojoba (Simmondsia chinensis) FAR which encodes an alcohol-forming fatty acyl-CoA reductase. Its overexpression in E. coli resulted in FAR activity and the accumulation of fatty alcohol (Metz et al. Plant Physiology 122:635-644) 2000)).
GeneAccession No.GI No.Organism
FAR AAD38039.1 5020215 Simmondsia chinensis

1.2.1.b - Oxidoreductase (acyl-CoA to aldehyde)



[0393] Several acyl-CoA dehydrogenases are capable of reducing an acyl-CoA to its corresponding aldehyde. Exemplary genes that encode such enzymes include the Acinetobacter calcoaceticus acr1 encoding a fatty acyl-CoA reductase (Reiser and Somerville, J. Bacteriology 179:2969-2975 (1997)), the Acinetobacter sp. M-1 fatty acyl-CoA reductase (Ishige et al. Appl.Environ.Microbiol. 68:1192-1195 (2002)), and a CoA- and NADP- dependent succinate semialdehyde dehydrogenase encoded by the sucD gene in Clostridium kluyveri (Sohling and Gottschalk J Bacteriol 178:871-80 (1996); Sohling and Gottschalk J Bacteriol. 178:871-880 (1996)). SucD of P. gingivalis is another succinate semialdehyde dehydrogenase (Takahashi et al. J.Bacteriol. 182:4704-4710 (2000)). The enzyme acylating acetaldehyde dehydrogenase in Pseudomonas sp, encoded by bphG, is yet another as it has been demonstrated to oxidize and acylate acetaldehyde, propionaldehyde, butyraldehyde, isobutyraldehyde and formaldehyde (Powlowski et al. J Bacteriol. 175:377-385 (1993)).
GeneAccession No.GI No.Organism
acr1 YP_047869.1 50086359 Acinetobacter calcoaceticus
acr1 AAC45217 1684886 Acinetobacter baylyi
acr1 BAB85476.1 18857901 Acinetobacter sp. Strain M-1
sucD P38947.1 730847 Clostridium kluyveri
sucD NP_904963.1 34540484 Porphyromonas gingivalis
bphG BAA03892.1 425213 Pseudomonas sp


[0394] An additional enzyme type that converts an acyl-CoA to its corresponding aldehyde is malonyl-CoA reductase which transforms malonyl-CoA to malonic semialdehyde. Malonyl-CoA reductase is a key enzyme in autotrophic carbon fixation via the 3-hydroxypropionate cycle in thermoacidophilic archael bacteria (Berg et al. Science 318:1782-1786 (2007); Thauer, R. K. Science 318:1732-1733 (2007)). The enzyme utilizes NADPH as a cofactor and has been characterized in Metallosphaera and Sulfolobus spp (Alber et al. J.Bacteriol. 188:8551-8559 (2006); Hugler et al. J.Bacteriol. 184:2404-2410 (2002)). The enzyme is encoded by Msed_0709 in Metallosphaera sedula (Alber et al. J.Bacteriol. 188:8551-8559 (2006); Berg et al. Science 318:1782-1786 (2007)). A gene encoding a malonyl-CoA reductase from Sulfolobus tokodaii was cloned and heterologously expressed in E. coli (Alber et al. J.Bacteriol. 188:8551-8559 (2006)). Although the aldehyde dehydrogenase functionality of these enzymes is similar to the bifunctional dehydrogenase from Chloroflexus aurantiacus, there is little sequence similarity. Both malonyl-CoA reductase enzyme candidates have high sequence similarity to aspartate-semialdehyde dehydrogenase, an enzyme catalyzing the reduction and concurrent dephosphorylation of aspartyl-4-phosphate to aspartate semialdehyde. Additional gene candidates can be found by sequence homology to proteins in other organisms including Sulfolobus solfataricus and Sulfolobus acidocaldarius.
GeneAccession No.GI No.Organism
Msed_0709 YP_001190808.1 146303492 Metallosphaera sedula
mcr NP_378167.1 15922498 Sulfolobus tokodaii
asd-2 NP_343563.1 15898958 Sulfolobus solfataricus
Saci_2370 YP_256941.1 70608071 Sulfolobus acidocaldarius

1.2.1.c - Oxidoreductase (2-oxo acid to acyl-CoA, decarboxylation)



[0395] Enzymes in this family include 1) branched-chain 2-keto-acid dehydrogenase, 2) alpha-ketoglutarate dehydrogenase, and 3) the pyruvate dehydrogenase multienzyme complex (PDHC). These enzymes are multi-enzyme complexes that catalyze a series of partial reactions which result in acylating oxidative decarboxylation of 2-keto-acids. Each of the 2-keto-acid dehydrogenase complexes occupies key positions in intermediary metabolism, and enzyme activity is typically tightly regulated (Fries et al. Biochemistry 42:6996-7002 (2003)). The enzymes share a complex but common structure composed of multiple copies of three catalytic components: alpha-ketoacid decarboxylase (E1), dihydrolipoamide acyltransferase (E2) and dihydrolipoamide dehydrogenase (E3). The E3 component is shared among all 2-keto-acid dehydrogenase complexes in an organism, while the E1 and E2 components are encoded by different genes. The enzyme components are present in numerous copies in the complex and utilize multiple cofactors to catalyze a directed sequence of reactions via substrate channeling. The overall size of these dehydrogenase complexes is very large, with molecular masses between 4 and 10 million Da (that is, larger than a ribosome).

[0396] Activity of enzymes in the 2-keto-acid dehydrogenase family is normally low or limited under anaerobic conditions in E. coli. Increased production of NADH (or NADPH) could lead to a redox-imbalance, and NADH itself serves as an inhibitor to enzyme function. Engineering efforts have increased the anaerobic activity of the E. coli pyruvate dehydrogenase complex (Kim et al. Appl.Environ.Microbiol. 73:1766-1771 (2007); Kim et al. J.Bacteriol. 190:3851-3858) 2008); Zhou et al. Biotechnol.Lett. 30:335-342 (2008)). For example, the inhibitory effect of NADH can be overcome by engineering an H322Y mutation in the E3 component (Kim et al. J.Bacteriol. 190:3851-3858 (2008)). Structural studies of individual components and how they work together in complex provide insight into the catalytic mechanisms and architecture of enzymes in this family (Aevarsson et al. Nat.Struct.Biol. 6:785-792 (1999); Zhou et al. Proc.Natl.Acad.Sci.U.S.A. 98:14802-14807 (2001)). The substrate specificity of the dehydrogenase complexes varies in different organisms, but generally branched-chain keto-acid dehydrogenases have the broadest substrate range.

[0397] Alpha-ketoglutarate dehydrogenase (AKGD) converts alpha-ketoglutarate to succinyl-CoA and is the primary site of control of metabolic flux through the TCA cycle (Hansford, R. G. Curr.Top.Bioenerg. 10:217-278 (1980)). Encoded by genes sucA, sucB and lpd in E. coli, AKGD gene expression is downregulated under anaerobic conditions and during growth on glucose (Park et al. Mol.Microbiol. 15:473-482 (1995)). Although the substrate range of AKGD is narrow, structural studies of the catalytic core of the E2 component pinpoint specific residues responsible for substrate specificity (Knapp et al. J.Mol.Biol. 280:655-668 (1998)). The Bacillus subtilis AKGD, encoded by odhAB (E1 and E2) and pdhD (E3, shared domain), is regulated at the transcriptional level and is dependent on the carbon source and growth phase of the organism (Resnekov et al. Mol. Gen. Genet. 234:285-296 (1992)). In yeast, the LPD1 gene encoding the E3 component is regulated at the transcriptional level by glucose (Roy and Dawes J.Gen.Microbiol. 133:925-933 (1987)). The E1 component, encoded by KGD1, is also regulated by glucose and activated by the products of HAP2 and HAP3 (Repetto and Tzagoloff Mol.Cell Biol. 9:2695-2705 (1989)). The AKGD enzyme complex, inhibited by products NADH and succinyl-CoA, is well-studied in mammalian systems, as impaired function of has been linked to several neurological diseases (Tretter and dam-Vizi Philos.Trans.R.Soc.Lond B Biol.Sci. 360:2335-2345 (2005)).
GeneAccession No.GI No.Organism
sucA NP_415254.1 16128701 Escherichia coli str. K12 substr. MG1655
sucB NP_415255.1 16128702 Escherichia coli str. K12 substr. MG1655
lpd NP_414658.1 16128109 Escherichia coli str. K12 substr. MG1655
odhA P23129.2 51704265 Bacillus subtilis
odhB P16263.1 129041 Bacillus subtilis
pdhD P21880.1 118672 Bacillus subtilis
KGD1 NP_012141.1 6322066 Saccharomyces cerevisiae
KGD2 NP_010432.1 6320352 Saccharomyces cerevisiae
LPD1 NP_116635.1 14318501 Saccharomyces cerevisiae


[0398] Branched-chain 2-keto-acid dehydrogenase complex (BCKAD), also known as 2-oxoisovalerate dehydrogenase, participates in branched-chain amino acid degradation pathways, converting 2-keto acids derivatives of valine, leucine and isoleucine to their acyl-CoA derivatives and CO2. The complex has been studied in many organisms including Bacillus subtilis (Wang et al. Eur.J.Biochem. 213:1091-1099 (1993)), Rattus norvegicus (Namba et al. J.Biol.Chem. 244:4437-4447 (1969)) and Pseudomonas putida (Sokatch J.Bacteriol. 148:647-652 (1981)). In Bacillus subtilis the enzyme is encoded by genes pdhD (E3 component), bfmBB (E2 component), bfmBAA and bfmBAB (E1 component) (Wang et al. Eur.J.Biochem. 213:1091-1099 (1993)). In mammals, the complex is regulated by phosphorylation by specific phosphatases and protein kinases. The complex has been studied in rat hepatocites (Chicco et al. J.Biol.Chem. 269:19427-19434 (1994)) and is encoded by genes Bckdha (E1 alpha), Bckdhb (E1 beta), Dbt (E2), and Dld (E3). The E1 and E3 components of the Pseudomonas putida BCKAD complex have been crystallized (Aevarsson et al. Nat.Struct.Biol. 6:785-792 (1999); Mattevi Science 255:1544-1550 (1992)) and the enzyme complex has been studied (Sokatch et al. J.Bacteriol. 148:647-652 (1981)). Transcription of the P. putida BCKAD genes is activated by the gene product of bkdR (Hester et al. Eur.J.Biochem. 233:828-836 (1995)). In some organisms including Rattus norvegicus (Paxton et al. Biochem.J. 234:295-303 (1986)) and Saccharomyces cerevisiae (Sinclair et al. Biochem.Mol.Biol.Int. 31:911-922 (1993)), this complex has been shown to have a broad substrate range that includes linear oxo-acids such as 2-oxobutanoate and alpha-ketoglutarate, in addition to the branched-chain amino acid precursors. The active site of the bovine BCKAD was engineered to favor alternate substrate acetyl-CoA (Meng and Chuang, Biochemistry 33:12879-12885 (1994)).
GeneAccession No.GI No.Organism
bfmBB NP_390283.1 16079459 Bacillus subtilis
bfmBAA NP_390285.1 16079461 Bacillus subtilis
bfmBAB NP_390284.1 16079460 Bacillus subtilis
pdhD P21880.1 118672 Bacillus subtilis
lpdV P09063.1 118677 Pseudomonas putida
bkdB P09062.1 129044 Pseudomonas putida
bkdA1 NP_746515.1 26991090 Pseudomonas putida
bkdA2 NP_746516.1 26991091 Pseudomonas putida
Bckdha NP_036914.1 77736548 Rattus norvegicus
Bckdhb NP_062140.1 158749538 Rattus norvegicus
Dbt NP_445764.1 158749632 Rattus norvegicus
Dld NP_955417.1 40786469 Rattus norvegicus


[0399] The pyruvate dehydrogenase complex, catalyzing the conversion of pyruvate to acetyl-CoA, has also been extensively studied. In the E. coli enzyme, specific residues in the E1 component are responsible for substrate specificity (Bisswanger, H. J Biol Chem. 256:815-822 (1981); Bremer, J. Eur.J Biochem. 8:535-540 (1969); Gong et al. J Biol Chem. 275:13645-13653 (2000)). As mentioned previously, enzyme engineering efforts have improved the E. coli PDH enzyme activity under anaerobic conditions (Kim et al. Appl.Environ.Microbiol. 73:1766-1771 (2007); Kim J.Bacteriol. 190:3851-3858 (2008); Zhou et al. Biotechnol.Lett. 30:335-342 (2008)). In contrast to the E. coli PDH, the B. subtilis complex is active and required for growth under anaerobic conditions (Nakano J.Bacteriol. 179:6749-6755 (1997)). The Klebsiella pneumoniae PDH, characterized during growth on glycerol, is also active under anaerobic conditions (Menzel et al. J.Biotechnol. 56:135-142 (1997)). Crystal structures of the enzyme complex from bovine kidney (Zhou et al. Proc.Natl.Acad.Sci.U.S.A. 98:14802-14807 (2001)) and the E2 catalytic domain from Azotobacter vinelandii are available (Mattevi et al. Science 255:1544-1550 (1992)). Some mammalian PDH enzymes complexes can react on alternate substrates such as 2-oxobutanoate, although comparative kinetics of Rattus norvegicus PDH and BCKAD indicate that BCKAD has higher activity on 2-oxobutanoate as a substrate (Paxton et al. Biochem.J. 234:295-303 (1986)).
GeneAccession No.GI No.Organism
aceE NP_414656.1 16128107 Escherichia coli str. K12 substr. MG1655
aceF NP_414657.1 16128108 Escherichia coli str. K12 substr. MG1655
lpd NP_414658.1 16128109 Escherichia coli str. K12 substr. MG1655
pdhA P21881.1 3123238 Bacillus subtilis
pdhB P21882.1 129068 Bacillus subtilis
pdhC P21883.2 129054 Bacillus subtilis
pdhD P21880.1 118672 Bacillus subtilis
aceE YP_001333808.1 152968699 Klebsiella pneumonia MGH78578
aceF YP_001333809.1 152968700 Klebsiella pneumonia MGH78578
lpdA YP_001333810.1 152968701 Klebsiella pneumonia MGH78578
Pdha1 NP_001004072.2 124430510 Rattus norvegicus
Pdha2 NP_446446.1 16758900 Rattus norvegicus
Dlat NP_112287.1 78365255 Rattus norvegicus
Dld NP_955417.1 40786469 Rattus norvegicus


[0400] As an alternative to the large multienzyme 2-keto-acid dehydrogenase complexes described above, some anaerobic organisms utilize enzymes in the 2-ketoacid oxidoreductase family (OFOR) to catalyze acylating oxidative decarboxylation of 2-keto-acids. Unlike the dehydrogenase complexes, these enzymes contain iron-sulfur clusters, utilize different cofactors, and use ferredoxin or flavodixin as electron acceptors in lieu of NAD(P)H. While most enzymes in this family are specific to pyruvate as a substrate (POR) some 2-keto-acid:ferredoxin oxidoreductases have been shown to accept a broad range of 2-ketoacids as substrates including alpha-ketoglutarate and 2-oxobutanoate (Fukuda and Wakagi Biochim.Biophys.Acta 1597:74-80 (2002); Zhang et al. J.Biochem. 120:587-599 (1996)). One such enzyme is the OFOR from the thermoacidophilic archaeon Sulfolobus tokodaii 7, which contains an alpha and beta subunit encoded by gene ST2300 (Fukuda and Wakagi Biochim.Biophys.Acta 1597:74-80 (2002); Zhang et al. J.Biochem. 120:587-599 (1996)). A plasmid-based expression system has been developed for efficiently expressing this protein in E. coli (Fukuda et al. Eur.J.Biochem. 268:5639-5646 (2001)) and residues involved in substrate specificity were determined (Fukuda and Wakagi Biochim.Biophys.Acta 1597:74-80 (2002)). Two OFORs from Aeropyrum pernix str. K1 have also been recently cloned into E. coli, characterized, and found to react with a broad range of 2-oxoacids (Nishizawa et al. FEBS Lett. 579:2319-2322 (2005)). The gene sequences of these OFOR candidates are available, although they do not have GenBank identifiers assigned to date. There is bioinformatic evidence that similar enzymes are present in all archaea, some anaerobic bacteria and amitochondrial eukarya (Fukuda and Wakagi Biochim.Biophys.Acta 1597:74-80 (2005)). This class of enzyme is also interesting from an energetic standpoint, as reduced ferredoxin could be used to generate NADH by ferredoxin-NAD reductase (Petitdemange et al. Biochim.Biophys.Acta 421:334-337 (1976)). Also, since most of the enzymes are designed to operate under anaerobic conditions, less enzyme engineering may be required relative to enzymes in the 2-keto-acid dehydrogenase complex family for activity in an anaerobic environment.
GeneAccession No.GI No.Organism
ST2300 NP_378302.1 15922633 Sulfolobus tokodaii 7

1.2.1.d - Oxidoreductase (phosphorylating/dephosphorylating)



[0401] Exemplary enzymes in this class include glyceraldehyde 3-phosphate dehydrogenase which converts glyceraldehyde-3-phosphate into D-glycerate 1,3-bisphosphate (for example, E. coli gapA (Branlant and Branlant Eur.J.Biochem. 150:61-66(1985)), aspartate-semialdehyde dehydrogenase which converts L-aspartate-4-semialdehyde into L-4-aspartyl-phosphate (for example, E. coli asd (Biellmann et al. Eur.J.Biochem. 104:53-58 (1980)), N-acetyl-gamma-glutamyl-phosphate reductase which converts N-acetyl-L-glutamate-5-semialdehyde into N-acetyl-L-glutamyl-5-phosphate (for example, E. coli argC (Parsot et al. Gene 68:275-283 (1988)), and glutamate-5-semialdehyde dehydrogenase which converts L-glutamate-5-semialdehyde into L-glutamyl-5-phospate (for example, E. coli proA (Smith et al. J.Bacteriol. 157:545-551 (1984)).
GeneAccession No.GI No.Organism
gapA P0A9B2.2 71159358 Escherichia coli
asd NP_417891.1 16131307 Escherichia coli
argC NP_418393.1 16131796 Escherichia coli
proA NP_414778.1 16128229 Escherichia coli

1.3.1.a - Oxidoreductase operating on CH-CH donors



[0402] An exemplary enoyl-CoA reductase is the gene product of bcd from C. acetobutylicum (Atsumi et al. Metab Eng (2007); Boynton et al. Journal of Bacteriology 178:3015-3024 (1996), which naturally catalyzes the reduction of crotonyl-CoA to butyryl-CoA. Activity of this enzyme can be enhanced by expressing bcd in conjunction with expression of the C. acetobutylicum etfAB genes, which encode an electron transfer flavoprotein. An additional candidate for the enoyl-CoA reductase step is the mitochondrial enoyl-CoA reductase from E. gracilis (Hoffmeister et al. Journal of Biological Chemistry 280:4329-4338 (2005)). A construct derived from this sequence following the removal of its mitochondrial targeting leader sequence was cloned in E. coli resulting in an active enzyme (Hoffmeister et al., supra, (2005)). This approach is well known to those skilled in the art of expressing eukarytotic genes, particularly those with leader sequences that may target the gene product to a specific intracellular compartment, in prokaryotic organisms. A close homolog of this gene, TDE0597, from the prokaryote Treponema denticola represents a third enoyl-CoA reductase which has been cloned and expressed in E. coli (Tucci and Martin FEBS Letters 581:1561-1566 (2007)).
GeneAccession No.GI No.Organism
bcd NP_349317.1 15895968 Clostridium acetobutylicum
etfA NP_349315.1 15895966 Clostridium acetobutylicum
etfB NP_349316.1 15895967 Clostridium acetobutylicum
TER Q5EU90.1 62287512 Euglena gracilis
TDE0597 NP_971211.1 42526113 Treponema denticola


[0403] Exemplary 2-enoate reductase (EC 1.3.1.31) enzymes are known to catalyze the NADH-dependent reduction of a wide variety of α,β-unsaturated carboxylic acids and aldehydes (Rohdich et al. J.Biol.Chem. 276:5779-5787 (2001)). 2-Enoate reductase is encoded by enr in several species of Clostridia (Giesel and Simon Arch Microbiol. 135(1): p. 51-57 (2001) including C. tyrobutyricum, and C. thermoaceticum (now called Moorella thermoaceticum) (Rohdich et al., supra, (2001)). In the recently published genome sequence of C. kluyveri, 9 coding sequences for enoate reductases have been reported, out of which one has been characterized (Seedorf et al. Proc Natl Acad Sci U. S. A. 105(6):2128-33 (2008)). The enr genes from both C. tyrobutyricum and C. thermoaceticum have been cloned and sequenced and show 59% identity to each other. The former gene is also found to have approximately 75% similarity to the characterized gene in C. kluyveri (Giesel and Simon Arch Microbiol 135(1):51-57 (1983)). It has been reported based on these sequence results that enr is very similar to the dienoyl CoA reductase in E. coli (fadH) (163 Rohdich et al., supra (2001)). The C. thermoaceticum enr gene has also been expressed in an enzymatically active form in E. coli (163 Rohdich et al., supra (2001)).
GeneAccession No.GI No.Organism
fadH NP_417552.1 16130976 Escherichia coli
enr ACA54153.1 169405742 Clostridium botulinum A3 str
enr CAA71086.1 2765041 Clostridium tyrobutyricum
enr CAA76083.1 3402834 Clostridium kluyveri
enr YP_430895.1 83590886 Moorella thermoacetica

1.4.1.a - Oxidoreductase operating on amino acids



[0404] Most oxidoreductases operating on amino acids catalyze the oxidative deamination of alpha-amino acids with NAD+ or NADP+ as acceptor. Exemplary oxidoreductases operating on amino acids include glutamate dehydrogenase (deaminating), encoded by gdhA, leucine dehydrogenase (deaminating), encoded by ldh, and aspartate dehydrogenase (deaminating), encoded by nadX. The gdhA gene product from Escherichia coli (Korber et al. J.Mol.Biol. 234:1270-1273 (1993); McPherson and Wootton Nucleic.Acids Res. 11:5257-5266 (1983)), gdh from Thermotoga maritima (Kort et al. Extremophiles 1:52-60 (1997); Lebbink, et al. J.Mol.Biol. 280:287-296 (1998)); Lebbink et al. J.Mol.Biol. 289:357-369 (1999)), and gdhA1 from Halobacterium salinarum (Ingoldsby et al. Gene 349:237-244 (2005)) catalyze the reversible interconversion of glutamate to 2-oxoglutarate and ammonia, while favoring NADP(H), NAD(H), or both, respectively. The ldh gene of Bacillus cereus encodes the LeuDH protein that has a wide of range of substrates including leucine, isoleucine, valine, and 2-aminobutanoate (Ansorge and Kula Biotechnol Bioeng. 68:557-562 (2000); Stoyan et al. J.Biotechnol 54:77-80 (1997)). The nadX gene from Thermotoga maritime encoding for the aspartate dehydrogenase is involved in the biosynthesis of NAD (Yang et al. J.Biol.Chem. 278:8804-8808 (2003)).
GeneAccession No.GI No.Organism
gdhA P00370 118547 Escherichia coli
gdh P96110.4 6226595 Thermotoga maritima
gdhA1 NP_279651.1 15789827 Halobacterium salinarum
ldh P0A393 61222614 Bacillus cereus
nadX NP_229443.1 15644391 Thermotoga maritima


[0405] The lysine 6-dehydrogenase (deaminating), encoded by lysDH gene, catalyze the oxidative deamination of the ε-amino group of L-lysine to form 2-aminoadipate-6-semialdehyde, which in turn nonenzymatically cyclizes to form Δ1-piperideine-6-carboxylate (Misono and Nagasaki J.Bacteriol. 150:398-401 (1982)). The lysDH gene from Geobacillus stearothermophilus encodes a thermophilic NAD-dependent lysine 6-dehydrogenase (Heydari et al. Appl Environ.Microbiol 70:937-942 (2004)). In addition, the lysDH gene from Aeropyrum pernix K1 is identified through homology from genome projects.
GeneAccession No.GI No.Organism
lysDH AB052732 13429872 Geobacillus stearothermophilus
lysDH NP_147035.1 14602185 Aeropyrum pernix K1
ldh P0A393 61222614 Bacillus cereus

2.3.1.a - Acyltransferase (transferring phosphate group)



[0406] Exemplary phosphate transferring acyltransferases include phosphotransacetylase, encoded by pta, and phosphotransbutyrylase, encoded by ptb. The pta gene from E. coli encodes an enzyme that can convert acetyl-CoA into acetyl-phosphate, and vice versa (Suzuki, T. Biochim.Biophys.Acta 191:559-569 (1969)). This enzyme can also utilize propionyl-CoA instead of acetyl-CoA forming propionate in the process (Hesslinger et al. Mol.Microbiol 27:477-492 (1998)). Similarly, the ptb gene from C. acetobutylicum encodes an enzyme that can convert butyryl-CoA into butyryl-phosphate (Walter et al. Gene 134(1): p. 107-11 (1993)); Huang et al. J Mol Microbiol Biotechnol 2(1): p. 33-38 (2000). Additional ptb genes can be found in butyrate-producing bacterium L2-50 (Louis et al. J.Bacteriol. 186:2099-2106 (2004)) and Bacillus megaterium (Vazquez et al. Curr.Microbiol 42:345-349 (2001)).
GeneAccession No.GI No.Organism
pta NP_416800.1 16130232 Escherichia coli
ptb NP_349676 15896327 Clostridium acetobutylicum
ptb AAR19757.1 38425288 butyrate-producing bacterium L2-50
ptb CAC07932.1 10046659 Bacillus megaterium

2.6.1.a - Aminotransferase



[0407] Aspartate aminotransferase transfers an amino group from aspartate to alpha-ketoglutarate, forming glutamate and oxaloacetate. This conversion is catalyzed by, for example, the gene products of aspC from Escherichia coli (Yagi et al. FEBS Lett. 100:81-84 (1979); Yagi et al. Methods Enzymol. 113:83-89 (1985)), AAT2 from Saccharomyces cerevisiae (Yagi et al. J Biochem. 92:35-43 (1982)) and ASP5 from Arabidopsis thaliana (48, 108, 225 48. de la et al. Plant J 46:414-425 (2006); Kwok and Hanson J Exp.Bot. 55:595-604 (2004); Wilkie and Warren Protein Expr.Purif. 12:381-389 (1998)). Valine aminotransferase catalyzes the conversion of valine and pyruvate to 2-ketoisovalerate and alanine. The E. coli gene, avtA, encodes one such enzyme (Whalen and Berg J.Bacteriol. 150:739-746 (1982)). This gene product also catalyzes the amination of α-ketobutyrate to generate α-aminobutyrate, although the amine donor in this reaction has not been identified (Whalen and Berg J.Bacteriol. 158:571-574 (1984)). The gene product of the E. coli serC catalyzes two reactions, phosphoserine aminotransferase and phosphohydroxythreonine aminotransferase (Lam and Winkler J.Bacteriol. 172:6518-6528 (1990)), and activity on non-phosphorylated substrates could not be detected (Drewke et al. FEBS.Lett. 390:179-182 (1996)).
GeneAccession No.GI No.Organism
aspC NP_415448.1 16128895 Escherichia coli
AAT2 P23542.3 1703040 Saccharomyces cerevisiae
ASP5 P46248.2 20532373 Arabidopsis thaliana
avtA YP_ 026231.1 49176374 Escherichia coli
serC NP_415427.1 16128874 Escherichia coli


[0408] Cargill has developed a beta-alanine/alpha-ketoglutarate aminotransferase for producing 3-HP from beta-alanine via malonyl-semialdehyde (PCT/US2007/076252 (Jessen et al)). The gene product of SkPYD4 in Saccharomyces kluyveri was also shown to preferentially use beta-alanine as the amino group donor (Andersen et al. FEBS.J. 274:1804-1817 (2007)). SkUGA1 encodes a homologue of Saccharomyces cerevisiae GABA aminotransferase, UGA1 (Ramos et al. Eur.J.Biochem. 149:401-404 (1985)), whereas SkPYD4 encodes an enzyme involved in both β-alanine and GABA transamination (Andersen et al. FEBS.J. 274:1804-1817 (2007)). 3-Amino-2-methylpropionate transaminase catalyzes the transformation from methylmalonate semialdehyde to 3-amino-2-methylpropionate. The enzyme has been characterized in Rattus norvegicus and Sus scrofa and is encoded by Abat (Kakimoto et al. Biochim.Biophys.Acta 156:374-380 (1968); Tamaki et al. Methods Enzymol. 324:376-389 (2000)). Enzyme candidates in other organisms with high sequence homology to 3-amino-2-methylpropionate transaminase include Gta-1 in C. elegans and gabT in Bacillus subtilus. Additionally, one of the native GABA aminotransferases in E. coli, encoded by gene gabT, has been shown to have broad substrate specificity (Liu et al. Biochemistry 43:10896-10905 (2004); Schulz et al. Appl Environ Microbiol 56:1-6 (1990)). The gene product of puuE catalyzes the other 4-aminobutyrate transaminase in E. coli (Kurihara et al. J.Biol.Chem. 280:4602-4608 (2005)).
GeneAccession No.GI No.Organism
SkyPYD4 ABF58893.1 98626772 Saccharomyces kluyveri
SkUGA1 ABF58894.1 98626792 Saccharomyces kluyveri
UGA1 NP_011533.1 6321456 Saccharomyces cerevisiae
Abat P50554.3 122065191 Rattus norvegicus
Abat P80147.2 120968 Sus scrofa
Gta-1 Q21217.1 6016091 Caenorhabditis elegans
gabT P94427.1 6016090 Bacillus subtilus
gabT P22256.1 120779 Escherichia coli K12
puuE NP_415818.1 16129263 Escherichia coli K12


[0409] The X-ray crystal structures of E. coli 4-aminobutyrate transaminase unbound and bound to the inhibitor were reported (Liu et al. Biochemistry 43:10896-10905 (2004)). The substrates binding and substrate specificities were studied and suggested. The roles of active site residues were studied by site-directed mutagenesis and X-ray crystallography (Liu et al. Biochemistry 44:2982-2992 (2005)). Based on the structural information, attempt was made to engineer E. coli 4-aminobutyrate transaminase with novel enzymatic activity. These studies provide a base for evolving transaminase activity for BDO pathways.

2.7.2.a - Phosphotransferase, carboxyl group acceptor



[0410] Exemplary kinases include the E. coli acetate kinase, encoded by ackA (Skarstedt and Silverstein J.Biol.Chem. 251:6775-6783 (1976)), the C. acetobutylicum butyrate kinases, encoded by buk1 and buk2 (Walter et al. Gene 134(1):107-111 (1993) (Huang et al. J Mol Microbiol Biotechnol 2(1):33-38 (2000)], and the E. coli gamma-glutamyl kinase, encoded by proB (Smith et al. J.Bacteriol. 157:545-551 (1984)). These enzymes phosphorylate acetate, butyrate, and glutamate, respectively. The ackA gene product from E. coli also phosphorylates propionate (Hesslinger et al. Mol.Microbiol 27:477-492 (1998)).
GeneAccession No.GI No.Organism
ackA NP_416799.1 16130231 Escherichia coli
buk1 NP_349675 15896326 Clostridium acetobutylicum
buk2 Q97II1 20137415 Clostridium acetobutylicum
proB NP_414777.1 16128228 Escherichia coli

2.8.3.a - Coenzyme-A transferase



[0411] In the CoA-transferase family, E. coli enzyme acyl-CoA:acetate-CoA transferase, also known as acetate-CoA transferase (EC 2.8.3.8), has been shown to transfer the CoA moiety to acetate from a variety of branched and linear acyl-CoA substrates, including isobutyrate (Matthies and Schink Appl Environ Microbiol 58:1435-1439 (1992)), valerate (Vanderwinkel et al. Biochem.Biophys.Res Commun. 33:902-908 (1968)) and butanoate (Vanderwinkel, supra (1968)). This enzyme is encoded by atoA (alpha subunit) and atoD (beta subunit) in E. coli sp. K12 (Korolev et al. Acta Crystallogr.D Biol Crystallogr. 58:2116-2121 (2002); Vanderwinkel, supra (1968)) and actA and cg0592 in Corynebacterium glutamicum ATCC 13032 (Duncan et al. Appl Environ Microbiol 68:5186-5190 (2002)). Additional genes found by sequence homology include atoD and atoA in Escherichia coli UT189.
GeneAccession No.GI No.Organism
atoA P76459.1 2492994 Escherichia coli K12
atoD P76458.1 2492990 Escherichia coli K12
actA YP_226809.1 62391407 Corynebacterium glutamicum ATCC 13032
cg0592 YP_224801.1 62389399 Corynebacterium glutamicum ATCC 13032
atoA ABE07971.1 91073090 Escherichia coli UT189
atoD ABE07970.1 91073089 Escherichia coli UT189


[0412] Similar transformations are catalyzed by the gene products of cat1, cat2, and cat3 of Clostridium kluyveri which have been shown to exhibit succinyl-CoA, 4-hydroxybutyryl-CoA, and butyryl-CoA acetyltransferase activity, respectively (Seedorf et al. Proc Natl Acad Sci U.S.A. 105(6):2128-2133 (2008); Sohling and Gottschalk J Bacteriol 178(3):871-880 (1996)].
GeneAccession No.GI No.Organism
cat1 P38946.1 729048 Clostridium kluyveri
cat2 P38942.2 1705614 Clostridium kluyveri
cat3 EDK35586.1 146349050 Clostridium kluyveri


[0413] The glutaconate-CoA-transferase (EC 2.8.3.12) enzyme from anaerobic bacterium Acidaminococcus fermentans reacts with diacid glutaconyl-CoA and 3-butenoyl-CoA (Mack and Buckel FEBS Lett. 405:209-212 (1997)). The genes encoding this enzyme are gctA and gctB. This enzyme has reduced but detectable activity with other CoA derivatives including glutaryl-CoA, 2-hydroxyglutaryl-CoA, adipyl-CoA and acrylyl-CoA (Buckel et al. EurJ.Biochem. 118:315-321 (1981)). The enzyme has been cloned and expressed in E. coli (Mac et al. Eur.J.Biochem. 226:41-51 (1994)).
GeneAccession No.GI No.Organism
gctA CAA57199.1 559392 Acidaminococcus fermentans
gctB CAA57200.1 559393 Acidaminococcus fermentans

3.1.2.a - Thiolester hydrolase (CoA specific)



[0414] In the CoA hydrolase family, the enzyme 3-hydroxyisobutyryl-CoA hydrolase is specific for 3-HIBCoA and has been described to efficiently catalyze the desired transformation during valine degradation (Shimomura et al. J Biol Chem 269:14248-14253 (1994)). Genes encoding this enzyme include hibch of Rattus norvegicus (Shimomura et al., supra (1994); Shimomura et al. Methods Enzymol. 324:229-240 (2000) and Homo sapiens (Shimomura et al., supra, 2000). Candidate genes by sequence homology include hibch of Saccharomyces cerevisiae and BC_2292 of Bacillus cereus.
GeneAccession No.GI No.Organism
hibch Q5XIE6.2 146324906 Rattus norvegicus
hibch Q6NVY1.2 146324905 Homo sapiens
hibch P28817.2 2506374 Saccharomyces cerevisiae


[0415] The conversion of adipyl-CoA to adipate can be carried out by an acyl-CoA hydrolase or equivalently a thioesterase. The top E. coli gene candidate is tesB (Naggert et al. J Biol Chem. 266(17):11044-11050 (1991)] which shows high similarity to the human acot8 which is a dicarboxylic acid acetyltransferase with activity on adipyl-CoA (Westin et al. J Biol Chem 280(46): 38125-38132 (2005). This activity has also been characterized in the rat liver (Deana, Biochem Int. 26(4): p. 767-773 (1992)).
GeneAccession No.GI No.Organism
tesB NP_414986 16128437 Escherichia coli
acot8 CAA15502 3191970 Homo sapiens
acot8 NP_570112 51036669 Rattus norvegicus


[0416] Other potential E. coli thiolester hydrolases include the gene products of tesA (Bonner and Bloch, J Biol Chem. 247(10):3123-3133 (1972)), ybgC (Kuznetsova et al., FEMS Microbiol Rev. 29(2):263-279 (2005); Zhuang et al., FEBS Lett. 516(1-3):161-163 (2002)) paaI (Song et al., J Biol Chem. 281(16):11028-11038 (2006)), and ybdB (Leduc et al., J Bacteriol. 189(19):7112-7126 (2007)).
GeneAccession No.GI No.Organism
tesA NP_415027 16128478 Escherichia coli
ybgC NP_415264 16128711 Escherichia coli
paaI NP_415914 16129357 Escherichia coli
ybdB NP_415129 16128580 Escherichia coli


[0417] Several eukaryotic acetyl-CoA hydrolases (EC 3.1.2.1) have broad substrate specificity. The enzyme from Rattus norvegicus brain (Robinson et al. Biochem.Biophys. Res.Commun. 71:959-965 (1976)) can react with butyryl-CoA, hexanoyl-CoA and malonyl-CoA.
GeneAccession No.GI No.Organism
acot12 NP_570103.1 18543355 Rattus norvegicus

4.1.1.a - Carboxy-lyase



[0418] An exemplary carboxy-lyase is acetolactate decarboxylase which participates in citrate catabolism and branched-chain amino acid biosynthesis, converting 2-acetolactate to acetoin. In Lactococcus lactis the enzyme is composed of six subunits, encoded by gene aldB, and is activated by valine, leucine and isoleucine (Goupil et al. Appl.Environ.Microbiol. 62:2636-2640 (1996); Goupil-Feuillerat et al. J.Bacteriol. 182:5399-5408 (2000)). This enzyme has been overexpressed and characterized in E. coli (Phalip et al. FEBS Lett. 351:95-99 (1994)). In other organisms the enzyme is a dimer, encoded by aldC in Streptococcus thermophilus (Monnet et al. Lett.Appl.Microbiol. 36:399-405 (2003)), aldB in Bacillus brevis (Diderichsen et al. J.Bacteriol. 172:4315-4321 (1990); Najmudin et al. Acta Crystallogr.D.Biol.Crystallogr. 59:1073-1075 (2003)) and budA from Enterobacter aerogenes (Diderichsen et al. J.Bacteriol. 172:4315-4321 (1990)). The enzyme from Bacillus brevis was cloned and overexpressed in Bacillus subtilis and characterized crystallographically (Najmudin et al. Acta Crystallogr.D.Biol.Crystallogr. 59:1073-1075 (2003)). Additionally, the enzyme from Leuconostoc lactis has been purified and characterized but the gene has not been isolated (O'Sullivan et al. FEMS Microbiol.Lett. 194:245-249 (2001)).
GeneAccession No.GI No.Organism
aldB NP_267384.1 15673210 Lactococcus lactis
aldC Q8L208 75401480 Streptococcus thermophilus
aldB P23616.1 113592 Bacillus brevis
budA P05361.1 113593 Enterobacter aerogenes


[0419] Aconitate decarboxylase catalyzes the final step in itaconate biosynthesis in a strain of Candida and also in the filamentous fungus Aspergillus terreus (Bonnarme et al. J Bacteriol. 177:3573-3578 (1995); Willke and Vorlop Appl Microbiol Biotechnol 56:289-295 (2001)). Although itaconate is a compound of biotechnological interest, the aconitate decarboxylase gene or protein sequence has not been reported to date.

[0420] 4-oxalocronate decarboxylase has been isolated from numerous organisms and characterized. Genes encoding this enzyme include dmpH and dmpE in Pseudomonas sp. (strain 600) (Shingler et al. J Bacteriol. 174:711-724 (1992)), xylII and xylIII from Pseudomonas putida (Kato and Asano Arch.Microbiol 168:457-463 (1997); Lian and Whitman J.Am.Chem.Soc. 116:10403-10411 (1994); Stanley et al. Biochemistry 39:3514 (2000)) and Reut_B5691 and Reut_B5692 from Ralstonia eutropha JMP134 (Hughes et al. J Bacteriol. 158:79-83 (1984)). The genes encoding the enzyme from Pseudomonas sp. (strain 600) have been cloned and expressed in E. coli (Shingler et al. J Bacteriol. 174:711-724 (1992)).
GeneAccession No.GI No.Organism
dmpH CAA43228.1 45685 Pseudomonas sp. CF600
dmpE CAA43225.1 45682 Pseudomonas sp. CF600
xylII YP_ 709328.1 111116444 Pseudomonas putida
xylIII YP_709353.1 111116469 Pseudomonas putida
Reut_B5691 YP_299880.1 73539513 Ralstonia eutropha JMP134
Reut_B5692 YP_299881.1 73539514 Ralstonia eutropha JMP134


[0421] An additional class of decarboxylases has been characterized that catalyze the conversion of cinnamate (phenylacrylate) and substituted cinnamate derivatives to the corresponding styrene derivatives. These enzymes are common in a variety of organisms and specific genes encoding these enzymes that have been cloned and expressed in E. coli are: pad 1 from Saccharomyces cerevisae (Clausen et al. Gene 142:107-112 (1994)), pdc from Lactobacillus plantarum (Barthelmebs et al. Appl Environ Microbiol 67:1063-1069 (2001); Qi et al. Metab Eng 9:268-276 (2007); Rodriguez et al. J.Agric.Food Chem. 56:3068-3072 (2008)), pofK (pad) from Klebsiella oxytoca (Hashidoko et al. Biosci.Biotech.Biochem. 58:217-218 (1994); Uchiyama et al. Biosci.Biotechnol.Biochem. 72:116-123 (2008)), Pedicoccus pentosaceus (Barthelmebs et al. Appl Environ Microbiol 67:1063-1069 (2001)), and padC from Bacillus subtilis and Bacillus pumilus (Lingen et al. Protein Eng 15:585-593 (2002)). A ferulic acid decarboxylase from Pseudomonas fluorescens also has been purified and characterized (Huang et al. J.Bacteriol. 176:5912-5918 (1994)). Importantly, this class of enzymes have been shown to be stable and do not require either exogenous or internally bound co-factors, thus making these enzymes ideally suitable for biotransformations (Sariaslani, Annu.Rev.Microbiol. 61:51-69 (2007)).
GeneAccession No.GI No.Organism
pad1 AB368798 BAG32372.1 188496948 188496949 Saccharomyces cerevisae
pdc U63827 AAC45282.1 1762615, 1762616 Lactobacillus plantarum
pofK (pad) AB330293, BAF65031.1 149941607, 149941608 Klebsiella oxytoca
padC AF017117 AAC46254.1 2394281, 2394282 Bacillus subtilis
pad AJ276891 CAC16794.1 11322456, 11322458 Pedicoccus pentosaceus
pad AJ278683 CAC18719.1 11691809, 11691810 Bacillus pumilus


[0422] Additional decarboxylase enzymes can form succinic semialdehyde from alpha-ketoglutarate. These include the alpha-ketoglutarate decarboxylase enzymes from Euglena gracilis (Shigeoka et al. Biochem.J. 282(Pt 2):319-323 (1992); Shigeoka and Nakano Arch.Biochem.Biophys. 288:22-28 (1991); Shigeoka and Nakano Biochem.J. 292 (Pt 2):463-467 (1993)), whose corresponding gene sequence has yet to be determined, and from Mycobacterium tuberculosis (Tian et al. Proc Natl Acad Sci U.S.A. 102:10670-10675 (2005)). In addition, glutamate decarboxylase enzymes can convert glutamate into 4-aminobutyrate such as the products of the E. coli gadA and gadB genes (De Biase et al. Protein.Expr.Purif. 8:430-438 (1993)).
GeneAccession No.GI No.Organism
kgd O50463.4 160395583 Mycobacterium tuberculosis
gadA NP_417974 16131389 Escherichia coli
gadB NP_416010 16129452 Escherichia coli

Keto-acid decarboxylases



[0423] Pyruvate decarboxylase (PDC, EC 4.1.1.1), also termed keto-acid decarboxylase, is a key enzyme in alcoholic fermentation, catalyzing the decarboxylation of pyruvate to acetaldehyde. This enzyme has a broad substrate range for aliphatic 2-keto acids including 2-ketobutyrate, 2-ketovalerate, 3-hydroxypyruvate and 2-phenylpyruvate (Berg et al. Science 318:1782-1786 (2007)). The PDC from Zymomonas mobilus, encoded by pdc, has been a subject of directed engineering studies that altered the affinity for different substrates (Siegert et al. Protein Eng Des Sel 18:345-357 (2005)). The PDC from Saccharomyces cerevisiae has also been extensively studied, engineered for altered activity, and functionally expressed in E. coli (Killenberg-Jabs et al. Eur.J.Biochem. 268:1698-1704 (2001); Li and Jordan Biochemistry 38:10004-10012 (1999); ter Schure et al. Appl.Environ.Microbiol. 64:1303-1307 (1998)). The crystal structure of this enzyme is available (Killenberg-Jabs Eur.J.Biochem. 268:1698-1704 (2001)). Other well-characterized PDC candidates include the enzymes from Acetobacter pasteurians (Chandra et al. Arch.Microbiol. 176:443-451 (2001)) and Kluyveromyces lactis (Krieger et al. Eur.J.Biochem. 269:3256-3263 (2002)).
GeneAccession No.GI No.Organism
pdc P06672.1 118391 Zymomonas mobilus
pdc1 P06169 30923172 Saccharomyces cerevisiae
pdc Q8L388 75401616 Acetobacter pasteurians
pdc1 Q12629 52788279 Kluyveromyces lactis


[0424] Like PDC, benzoylformate decarboxylase (EC 4.1.1.7) has a broad substrate range and has been the target of enzyme engineering studies. The enzyme from Pseudomonas putida has been extensively studied and crystal structures of this enzyme are available (Hasson et al. Biochemistry 37:9918-9930 (1998); Polovnikova et al. Biochemistry 42:1820-1830 (2003)). Site-directed mutagenesis of two residues in the active site of the Pseudomonas putida enzyme altered the affinity (Km) of naturally and non-naturally occuring substrates (Siegert Protein Eng Des Sel 18:345-357 (2005)). The properties of this enzyme have been further modified by directed engineering (Lingen et al. Protein Eng 15:585-593 (2002)); Lingen Chembiochem 4:721-726 (2003)). The enzyme from Pseudomonas aeruginosa, encoded by mdlC, has also been characterized experimentally (Barrowman et al. FEMS Microbiology Letters 34:57-60 (1986)). Additional gene candidates from Pseudomonas stutzeri, Pseudomonas fluorescens and other organisms can be inferred by sequence homology or identified using a growth selection system developed in Pseudomonas putida (Henning et al. Appl.Environ.Microbiol. 72:7510-7517 (2006)).
GeneAccession No.GI No.Organism
mdlC P20906.2 3915757 Pseudomonas putida
mdlC Q9HUR2.1 81539678 Pseudomonas aeruginosa
dpgB ABN80423.1 126202187 Pseudomonas stutzeri
ilvB-1 YP_260581.1 70730840 Pseudomonas fluorescens

4.2.1.a - Hydro-lyase



[0425] The 2-(hydroxymethyl)glutarate dehydratase of Eubacterium barkeri is an exemplary hydro-lyase. This enzyme has been studied in the context of nicotinate catabolism and is encoded by hmd (Alhapel et al. Proc Natl Acad Sci U S A 103:12341-12346 (2006)). Similar enzymes with high sequence homology are found in Bacteroides capillosus, Anaerotruncus colihominis, and Natranaerobius thermophilius.
GeneAccession No.GI No.Organism
hmd ABC88407.1 86278275 Eubacterium barkeri
BACCAP_ 02294 ZP_ 02036683.1 154498305 Bacteroides capillosus ATCC 29799
ANACOL_02527 ZP_02443222.1 167771169 Anaerotruncus colihominis DSM 17241
NtherDRAFT_ 2368 ZP_02852366.1 169192667 Natranaerobius thermophilus JW/NM-WN-LF


[0426] A second exemplary hydro-lyase is fumarate hydratase, an enzyme catalyzing the dehydration of malate to fumarate. A wealth of structural information is available for this enzyme and researchers have successfully engineered the enzyme to alter activity, inhibition and localization (Weaver, T. Acta Crystallogr.D Biol Crystallogr. 61:1395-1401 (2005)). Additional fumarate hydratases include those encoded by fumC from Escherichia coli (Estevez et al. Protein Sci. 11:1552-1557 (2002); Hong and Lee Biotechnol.Bioprocess Eng. 9:252-255 (2004); Rose and Weaver Proc Natl Acad Sci US.A 101:3393-3397 (2004)), Campylobacter jejuni (Smith et al. Int.J Biochem.Cell Biol 31:961-975 (1999)) and Thermus thermophilus (Mizobata et al. Arch.Biochem.Biophys. 355:49-55 (1998)), and fumH from Rattus norvegicus (Kobayashi et al. J Biochem. 89:1923-1931(1981)). Similar enzymes with high sequence homology include fum1 from Arabidopsis thaliana and fumC from Corynebacterium glutamicum.
GeneAccession No.GI No.Organism
fumC P05042.1 120601 Escherichia coli K12
fumC 069294.1 9789756 Campylobacter jejuni
fumC P84127 75427690 Thermus thermophilus
fumH P14408.1 120605 Rattus norvegicus
fum1 P93033.2 39931311 Arabidopsis thaliana
fumC Q8NRN8.1 39931596 Corynebacterium glutamicum


[0427] Citramalate hydrolyase, also called 2-methylmalate dehydratase, converts 2-methylmalate to mesaconate. 2-Methylmalate dehydratase activity was detected in Clostridium tetanomorphum, Morganella morganii, Citrobacter amalonaticus in the context of the glutamate degradation VI pathway (Kato and Asano Arch.Microbiol 168:457-463 (1997)); however the genes encoding this enzyme have not been sequenced to date.

[0428] The gene product of crt from C. acetobutylicum catalyzes the dehydration of 3-hydroxybutyryl-CoA to crotonyl-CoA (Atsumi et al. Metab Eng.; 29 (2007)); Boynton et al. Journal of Bacteriology 178:3015-3024 (1996)). The enoyl-CoA hydratases, phaA and phaB, of P. putida are believed to carry out the hydroxylation of double bonds during phenylacetate catabolism; (Olivera et al. Proc Natl Acad Sci U S A 95(11):6419-6424 (1998)). The paaA and paaB from P. fluorescens catalyze analogous transformations (14 Olivera et al., supra, 1998). Lastly, a number of Escherichia coli genes have been shown to demonstrate enoyl-CoA hydratase functionality including maoC (Park and Lee J Bacteriol 185(18):5391-5397 (2003)), paaF (Park and Lee Biotechnol Bioeng. 86(6):681-686 (2004a)); Park and Lee Appl Biochem Biotechnol. 113-116: 335-346 (2004b)); Ismail et al. Eur J Biochem 270(14):p. 3047-3054 (2003), and paaG (Park and Lee, supra, 2004; Park and Lee supra, 2004b; Ismail et al., supra, 2003).
GeneAccession No.GI No.Organism
maoC NP_415905.1 16129348 Escherichia coli
paaF NP_415911.1 16129354 Escherichia coli
paaG NP_415912.1 16129355 Escherichia coli
crt NP_349318.1 15895969 Clostridium acetobutylicum
paaA NP_745427.1 26990002 Pseudomonas putida
paaB NP_745426.1 26990001 Pseudomonas putida
phaA ABF82233.1 106636093 Pseudomonas fluorescens
phaB ABF82234.1 106636094 Pseudomonas fluorescens


[0429] The E. coli genes fadA and fadB encode a multienzyme complex that exhibits ketoacyl-CoA thiolase, 3-hydroxyacyl-CoA dehydrogenase, and enoyl-CoA hydratase activities (Yang et al. Biochemistry 30(27): p. 6788-6795 (1991); Yang et al. J Biol Chem 265(18): p. 10424-10429 (1990); Yang et al. J Biol Chem 266(24): p. 16255 (1991); Nakahigashi and Inokuchi Nucleic Acids Res 18(16): p. 4937 (1990)). The fadI and fadJ genes encode similar functions and are naturally expressed only anaerobically (Campbell et al. Mol Microbiol 47(3): p. 793-805 (2003). A method for producing poly[(R)-3-hydroxybutyrate] in E. coli that involves activating fadB (by knocking out a negative regulator, fadR) and co-expressing a non-native ketothiolase (phaA from Ralstonia eutropha) has been described previously (Sato et al. J Biosci Bioeng 103(1): 38-44 (2007)). This work clearly demonstrates that a β-oxidation enzyme, in particular the gene product of fadB which encodes both 3-hydroxyacyl-CoA dehydrogenase and enoyl-CoA hydratase activities, can function as part of a pathway to produce longer chain molecules from acetyl-CoA precursors.
GeneAccession No.GI No.Organism
fadA YP_026272.1 49176430 Escherichia coli
fadB NP_418288.1 16131692 Escherichia coli
fadI NP_416844.1 16130275 Escherichia coli
fadJ NP_416843.1 16130274 Escherichia coli
fadR NP_415705.1 16129150 Escherichia coli

4.3.1.a - Ammonia-lyase



[0430] Aspartase (EC 4.3.1.1), catalyzing the deamination of aspartate to fumarate, is a widespread enzyme in microorganisms, and has been characterized extensively (Viola, R. E. Adv.Enzymol.Relat Areas Mol.Biol 74:295-341 (2000)). The crystal structure of the E. coli aspartase, encoded by aspA, has been solved (Shi et al. Biochemistry 36:9136-9144 (1997)). The E. coli enzyme has also been shown to react with alternate substrates aspartatephenylmethylester, asparagine, benzyl-aspartate and malate (Ma et al. Ann N.Y.Acad Sci 672:60-65 (1992)). In a separate study, directed evolution was been employed on this enzyme to alter substrate specificity (Asano et al. Biomol.Eng 22:95-101 (2005)). Enzymes with aspartase functionality have also been characterized in Haemophilus influenzae (Sjostrom et al. Biochim.Biophys.Acta 1324:182-190 (1997)), Pseudomonas fluorescens (Takagi et al. J.Biochem. 96:545-552 (1984)), Bacillus subtilus (Sjostrom et al. Biochim.Biophys.Acta 1324:182-190 (1997)) and Serratia marcescens (Takagi and Kisumi J Bacteriol. 161:1-6 (1985)).
GeneAccession No.GI No.Organism
aspA NP_418562 90111690 Escherichia coli K12 subsp. MG1655
aspA P44324.1 1168534 Haemophilus influenzae
aspA P07346.1 114273 Pseudomonas fluorescens
ansB P26899.1 114271 Bacillus subtilus
aspA P33109.1 416661 Serratia marcescens


[0431] 3-methylaspartase (EC 4.3.1.2), also known as beta-methylaspartase or 3-methylaspartate ammonia-lyase, catalyzes the deamination of threo-3-methylasparatate to mesaconate. The 3-methylaspartase from Clostridium tetanomorphum has been cloned, functionally expressed in E. coli, and crystallized (Asuncion et al. Acta Crystallogr.D Biol Crystallogr. 57:731-733 (2001); Asuncion et al. J Biol Chem. 277:8306-8311 (2002); Botting et al. Biochemistry 27:2953-2955 (1988); Goda et al. Biochemistry 31:10747-10756 (1992). In Citrobacter amalonaticus, this enzyme is encoded by BAA28709 (Kato and Asano Arch.Microbiol 168:457-463 (1997)). 3-Methylaspartase has also been crystallized from E. coli YG1002 (Asano and Kato FEMS Microbiol Lett. 118:255-258 (1994)) although the protein sequence is not listed in public databases such as GenBank. Sequence homology can be used to identify additional candidate genes, including CTC_02563 in C. tetani and ECs0761 in Escherichia coli O157:H7.
GeneAccession No.GI No.Organism
MAL AAB24070.1 259429 Clostridium tetanomorphum
BAA28709 BAA28709.1 3184397 Citrobacter amalonaticus
CTC_02563 NP_783085.1 28212141 Clostridium tetani
ECs0761 BAB34184.1 13360220 Escherichia coli O157:H7 str. Sakai


[0432] Ammonia-lyase enzyme candidates that form enoyl-CoA products include beta-alanyl-CoA ammonia-lyase (EC 4.3.1.6), which deaminates beta-alanyl-CoA, and 3-aminobutyryl-CoA ammonia-lyase (EC 4.3.1.14). Two beta-alanyl-CoA ammonia lyases have been identified and characterized in Clostridium propionicum (Herrmann et al. FEBS J. 272:813-821 (2005)). No other beta-alanyl-CoA ammonia lyases have been studied to date, but gene candidates can be identified by sequence similarity. One such candidate is MXAN_4385 in Myxococcus xanthus.
GeneAccession No.GI No.Organism
ac12 CAG29275.1 47496504 Clostridium propionicum
acl1 CAG29274.1 47496502 Clostridium propionicum
MXAN_4385 YP_632558.1 108756898 Myxococcus xanthus

5.3.3.a - Isomerase



[0433] The 4-hydroxybutyryl-CoA dehydratases from both Clostridium aminobutyrium and C. kluyveri catalyze the reversible conversion of 4-hydroxybutyryl-CoA to crotonyl-CoA and posses an intrinsic vinylacetyl-CoA Δ-isomerase activity (Scherf and Buckel Eur.J Biochem. 215:421-429 (1993); Scherf et al. Arch.Microbiol 161:239-245 (1994)). Both native enzymes were purified and characterized, including the N-terminal amino acid sequences (Scherf and Buckel, supra, 1993; Scherf et al., supra, 1994). The abfD genes from C. aminobutyrium and C. kluyveri match exactly with these N-terminal amino acid sequences, thus are encoding the 4-hydroxybutyryl-CoA dehydratases/vinylacetyl-CoA Δ-isomerase. In addition, the abfD gene from Porphyromonas gingivalis ATCC 33277 is identified through homology from genome projects.
GeneAccession No.GI No.Organism
abfD YP_001396399.1 153955634 Clostridium kluyveri DSM 555
abfD P55792 84028213 Clostridium aminobutyricum
abfD YP_001928843 188994591 Porphyromonas gingivalis ATCC 33277

5.4.3.a - Aminomutase



[0434] Lysine 2,3-aminomutase (EC 5.4.3.2) is an exemplary aminomutase that converts lysine to (3S)-3,6-diaminohexanoate, shifting an amine group from the 2- to the 3- position. The enzyme is found in bacteria that ferment lysine to acetate and butyrate, including as Fusobacterium nuleatum (kamA) (Barker et al. J.Bacteriol. 152:201-207 (1982)) and Clostridium subterminale (kamA) (Chirpich et al. J.Biol.Chem. 245:1778-1789 (1970)). The enzyme from Clostridium subterminale has been crystallized (Lepore et al. Proc.Natl.Acad.Sci.U.S.A 102:13819-13824 (2005)). An enzyme encoding this function is also encoded by yodO in Bacillus subtilus (Chen et al. Biochem.J. 348 Pt 3:539-549 (2000)). The enzyme utilizes pyridoxal 5'-phosphate as a cofactor, requires activation by S-Adenosylmethoionine, and is stereoselective, reacting with the only with L-lysine. The enzyme has not been shown to react with alternate substrates.
GeneAccession No.GI No.Organism
yodO O34676.1 4033499 Bacillus subtilus
kamA Q9XBQ8.1 75423266 Clostridium subterminale
kamA Q8RHX4 81485301 Fusobacterium nuleatum subsp. nuleatum


[0435] A second aminomutase, beta-lysine 5,6-aminomutase (EC 5.4.3.3), catalyzes the next step of lysine fermentation to acetate and butyrate, which transforms (3S)-3,6-diaminohexanoate to (3S,5S)-3,5-diaminohexanoate, shifting a terminal amine group from the 6- to the 5- position. This enzyme also catalyzes the conversion of lysine to 2,5-diaminohexanoate and is also called lysine-5,6-aminomutase (EC 5.4.3.4). The enzyme has been crystallized in Clostridium sticklandii (kamD, kamE) (Berkovitch et al. Proc.Natl.Acad.Sci. U.S.A 101:15870-15875 (2004)). The enzyme from Porphyromonas gingivalis has also been characterized (Tang et al. Biochemistry 41:8767-8776 (2002)).
GeneAccession No.GI No.Organism
kamD AAC79717.1 3928904 Clostridium sticklandii
kamE AAC79718.1 3928905 Clostridium sticklandii
kamD NC_002950.2 34539880, 34540809 Porphyromonas gingivalis W83
kamE NC_002950.2 34539880,34540810 Porphyromonas gingivalis W83


[0436] Ornithine 4,5-aminomutase (EC 5.4.3.5) converts D-ornithine to 2,4-diaminopentanoate, also shifting a terminal amine to the adjacent carbon. The enzyme from Clostridium sticklandii is encoded by two genes, oraE and oraS, and has been cloned, sequenced and expressed in E. coli (Chen et al. J.Biol.Chem. 276:44744-44750 (2001)). This enzyme has not been characterized in other organisms to date.
GeneAccession No.GI No.Organism
oraE AAK72502 17223685 Clostridium sticklandii
oraS AAK725 01 17223684 Clostridium sticklandii


[0437] Tyrosine 2,3-aminomutase (EC 5.4.3.6) participates in tyrosine biosynthesis, reversibly converting tyrosine to 3-amino-3-(4-hdyroxyphenyl)propanoate by shifting an amine from the 2- to the 3- position. In Streptomyces globisporus the enzyme has also been shown to react with tyrosine derivatives (Christenson et al. Biochemistry 42:12708-12718 (2003)). Sequence information is not available.

[0438] Leucine 2,3-aminomutase (EC 5.4.3.7) converts L-leucine to beta-leucine during leucine degradation and biosynthesis. An assay for leucine 2,3-aminomutase detected activity in many organisms (Poston, J. M. Methods Enzymol. 166:130-135 (1988)) but genes encoding the enzyme have not been identified to date.

[0439] Cargill has developed a novel 2,3-aminomutase enzyme to convert L-alanine to β-alanine, thus creating a pathway from pyruvate to 3-HP in four biochemical steps (Liao et al., U.S. Publication No. 2005-0221466).

6.2.1.a - Acid-thiol ligase



[0440] An exemplary acid-thiol ligase is the gene products of sucCD of E. coli which together catalyze the formation of succinyl-CoA from succinate with the concaminant consumption of one ATP, a reaction which is reversible in vivo (Buck et al. Biochemistry 24(22): p. 6245-6252 (1985)). Additional exemplary CoA-ligases include the rat dicarboxylate-CoA ligase for which the sequence is yet uncharacterized (Vamecq et al. Biochem J. 230(3): p. 683-693 (1985)), either of the two characterized phenylacetate-CoA ligases from P. chrysogenum (Lamas-Maceiras et al. Biochem J 395(1):147-155 (2006); Wang et al. Biochem Biophys Res Commun, 360(2):453-458 (2007)), the phenylacetate-CoA ligase from Pseudomonas putida (Martinez-Blanco et al. J Biol Chem. 265(12):7084-7090 (1990)), and the 6-carboxyhexanoate-CoA ligase from Bacillus subtilis (Bower et al. J Bacteriol 178(14):4122-4130 (1996)).
GeneAccession No.GI No.Organism
sucC NP_415256.1 16128703 Escherichia coli
sucD AAC73823.1 1786949 Escherichia coli
phl CAJ15517.1 77019264 Penicillium chrysogenum
phlB ABS 19624.1 152002983 Penicillium chrysogenum
paaF AAC24333.2 22711873 Pseudomonas putida
bioW NP_390902.2 50812281 Bacillus subtilis

EXAMPLE V


Exemplary BDO Pathway from Succinyl-CoA



[0441] This example describes exemplary BDO pathways from succinyl-CoA.

[0442] BDO pathways from succinyl-CoA are described herein and have been described previously (see U.S. application serial No. 12/049,256, filed March 14, 2008, and PCT application serial No. US08/57168, filed March 14, 2008, each of which is incorporated herein by reference). Additional pathways are shown in Figure 8A. Enzymes of such exemplary BDO pathways are listed in Table 15, along with exemplary genes encoding these enzymes.

[0443] Briefly, succinyl-CoA can be converted to succinic semialdehyde by succinyl-CoA reductase (or succinate semialdehyde dehydrogenase) (EC 1.2.1.b). Succinate semialdehyde can be converted to 4-hydroxybutyrate by 4-hydroxybutyrate dehydrogenase (EC 1.1.1.a), as previously described. Alternatively, succinyl-CoA can be converted to 4-hydroxybutyrate by succinyl-CoA reductase (alcohol forming) (EC 1.1.1.c). 4-Hydroxybutyrate can be converted to 4-hydroxybutyryl-CoA by 4-hydroxybutyryl-CoA transferase (EC 2.8.3.a), as previously described, or by 4-hydroxybutyryl-CoA hydrolase (EC 3.1.2.a) or 4-hydroxybutyryl-CoA ligase (or 4-hydroxybutyryl-CoA synthetase) (EC 6.2.1.a). Alternatively, 4-hydroxybutyrate can be converted to 4-hydroxybutyryl-phosphate by 4-hydroxybutyrate kinase (EC 2.7.2.a), as previously described. 4-Hydroxybutyryl-phosphate can be converted to 4-hydroxybutyryl-CoA by phosphotrans-4-hydroxybutyrylase (EC 2.3.1.a), as previously described. Alternatively, 4-hydroxybutyryl-phosphate can be converted to 4-hydroxybutanal by 4-hydroxybutanal dehydrogenase (phosphorylating) (EC 1.2.1.d). 4-Hydroxybutyryl-CoA can be converted to 4-hydroxybutanal by 4-hydroxybutyryl-CoA reductase (or 4-hydroxybutanal dehydrogenase) (EC 1.2.1.b). Alternatively, 4-hydroxybutyryl-CoA can be converted to 1,4-butanediol by 4-hydroxybutyryl-CoA reductase (alcohol forming) (EC 1.1.1.c). 4-Hydroxybutanal can be converted to 1,4-butanediol by 1,4-butanediol dehydrogenase (EC 1.1.1.a), as previously described.
TABLE 15. BDO pathway from succinyl-CoA.
FigureEC classDesired substrateDesired productEnzyme nameGene nameGenBank ID (if available)OrganismKnown Substrates
8A 1.2.1.b succinyl-CoA succinic semi aldehyde succinyl-CoA reductase (or succinate semialdehyde dehydrogenase) sucD P38947.1 Clostridium kluyveri succinyl-CoA
          sucD NP_904963.1 Porphyromonas gingivalis succinyl-CoA
          Msed_0709 YP_001190808. 1 Metallosphaera sedula malonyl-CoA
8A 1.1.1.a succinate semialdehyde 4-hydroxybutyrate 4-hydroxybutyrate dehydrogenase 4hbd YP_726053.1 Ralstonia eutropha H16 4-hydroxybutyrate
          4hbd L21902.1 Clostridium kluyveri DSM 555 4 -hydroxybutyrate
          4hbd Q94B07 Arabidopsis thaliana 4 -hydroxybutyrate
8A 1.1.1.c succinyl-CoA 4-hydroxybutyrate succinyl-CoA reductase (alcohol forming) adhE2 AAK09379.1 Clostridium acetobutylicum butanoyl-CoA
          mcr AAS20429.1 Chloroflexus aurantiacus malonyl-CoA
          FAR AAD38039.1 Simmondsia chinensis long chain acyl-CoA
8A 2.8.3.a 4-hydroxybutyrate 4-hydroxybutyryl-CoA 4-hydroxybutyryl-CoA transferase cat1, cat2, cat3 P38946.1, P38942.2, EDK35586.1 Clostridium kluyveri succinate, 4-hydroxybutyrate, butyrate
          gctA, gctB CAA57199.1, CAA57200.1 Acidaminococcus fermentans glutarate
          atoA, atoD P76459.1, P76458.1 Escherichia coli butanoate
8A 3.1.2.a 4-hydroxybutyrate 4-hydroxybutyryl-CoA 4-hydroxybutyryl-CoA hydrolase tesB acot12 NP_414986 NP_570103.1 Escherichia coli Rattus norvegicus adipyl-CoA butyryl-CoA
          hibch Q6NVY1.2 Homo sapiens 3-hydroxypropanoyl-CoA
8A 6.2.1.a 4-hydroxybutyrate 4-hydroxybutyryl-CoA 4-hydroxybutyryl-CoA ligase (or 4-hydroxybutyryl-CoA synthetase) sucCD NP_415256.1, AAC73823.1 Escherichia coli succinate
          phl CAJ15517.1 Penicillium chrysogenum phenylacetate
          bioW NP_390902.2 Bacillus subtilis 6-carboxyhexanoate
8A 2.7.2.a 4-hydroxybutyrate 4-hydroxybutyryl-phosphate 4-hydroxybutyrate kinase ackA NP_416799.1 Escherichia coli acetate, propionate
          buk1 NP_349675 Clostridium acetobutylicum butyrate
          buk2 Q97II1 Clostridium acetobutylicum butyrate
8A 2.3.1.a 4-hydroxybutyryl-phosphate 4-hydroxybutyryl-CoA phosphotrans-4-hydroxybutyrylase ptb NP_349676 Clostridium acetobutylicum butyryl-phosphate
          ptb AAR19757.1 butyrate-producing bacterium L2-50 butyryl-phosphate
          ptb CAC07932.1 Bacillus megaterium butyryl-phosphate
8A 1.2.1.d 4-hydroxybutyryl-phosphate 4-hydroxybutanal 4-hydroxybutanal dehydrogenase (phosphorylating) asd NP_417891.1 Escherichia coli L-4-aspartyl-phosphate
          proA NP_414778.1 Escherichia coli L-glutamyl-5-phospate
          gapA P0A9B2.2 Escherichia coli Glyceraldehyde-3-phosphate
8A 1.2.1.b 4-hydroxybutyryl -CoA 4-hydroxybutanal 4-hydroxybutyryl-CoA reductase (or 4-hydroxybutanal dehydrogenase) sucD P38947.1 Clostridium kluyveri succinyl-CoA
          sucD NP_904963.1 Porphyromonas gingivalis succinyl-CoA
          Msed_0709 YP_001190808 .1 Metallosphaera sedula malonyl-CoA
8A 1.1.1.c 4-hydroxybutyryl -CoA 1,4-butanediol 4-hydroxybutyryl-CoA reductase (alcohol forming) adhE2 AAK09379.1 Clostridium acetobutylicum butanoyl-CoA
          mcr AAS20429.1 Chloroflexus aurantiacus malonyl-CoA
          FAR AAD38039.1 Simmondsia chinensis long chain acyl-CoA
8A 1.1.1.a 4-hydroxybutanal 1,4-butanediol 1,4-butanediol dehydrogenase ADH2 NP_014032.1 Saccharymyces cerevisiae general
          yqhD NP_417484.1 Escherichia coli >C3
          4hbd L21902.1 Clostridium kluyveri DSM 555 Succinate semialdehyde

Additional Exemplary BDO Pathways from Alpha-ketoglutarate



[0444] This example describes exemplary BDO pathways from alpha-ketoglutarate.

[0445] BDO pathways from succinyl-CoA are described herein and have been described previously (see U.S. application serial No. 12/049,256, filed March 14, 2008, and PCT application serial No. US08/57168, filed March 14, 2008. Additional pathways are shown in Figure 8B. Enzymes of such exemplary BDO pathways are listed in Table 16, along with exemplary genes encoding these enzymes.

[0446] Briefly, alpha-ketoglutarate can be converted to succinic semialdehyde by alpha-ketoglutarate decarboxylase (EC 4.1.1.a), as previously described. Alternatively, alpha-ketoglutarate can be converted to glutamate by glutamate dehydrogenase (EC 1.4.1.a). 4-Aminobutyrate can be converted to succinic semialdehyde by 4-aminobutyrate oxidoreductase (deaminating) (EC 1.4.1.a) or 4-aminobutyrate transaminase (EC 2.6.1.a). Glutamate can be converted to 4-aminobutyrate by glutamate decarboxylase (EC 4.1.1.a). Succinate semialdehyde can be converted to 4-hydroxybutyrate by 4-hydroxybutyrate dehydrogenase (EC 1.1.1.a), as previously described. 4-Hydroxybutyrate can be converted to 4-hydroxybutyryl-CoA by 4-hydroxybutyryl-CoA transferase (EC 2.8.3.a), as previously described, or by 4-hydroxybutyryl-CoA hydrolase (EC 3.1.2.a), or 4-hydroxybutyryl-CoA ligase (or 4-hydroxybutyryl-CoA synthetase) (EC 6.2.1.a). 4-Hydroxybutyrate can be converted to 4-hydroxybutyryl-phosphate by 4-hydroxybutyrate kinase (EC 2.7.2.a). 4-Hydroxybutyryl-phosphate can be converted to 4-hydroxybutyryl-CoA by phosphotrans-4-hydroxybutyrylase (EC 2.3.1.a), as previously described. Alternatively, 4-hydroxybutyryl-phosphate can be converted to 4-hydroxybutanal by 4-hydroxybutanal dehydrogenase (phosphorylating) (EC 1.2.1.d). 4-Hydroxybutyryl-CoA can be converted to 4-hydroxybutanal by 4-hydroxybutyryl-CoA reductase (or 4-hydroxybutanal dehydrogenase) (EC 1.2.1.b), as previously described. 4-Hydroxybutyryl-CoA can be converted to 1,4-butanediol by 4-hydroxybutyryl-CoA reductase (alcohol forming) (EC 1.1.1.c). 4-Hydroxybutanal can be converted to 1,4-butanediol by 1,4-butanediol dehydrogenase (EC 1.1.1.a), as previously described.
TABLE 16. BDO pathway from alpha-ketoglutarate.
FigureEC classDesired substrateDesired productEnzyme nameGene nameGenBank ID (if available)OrganismKnown Substrates
8B 4.1.1.a alpha-ketoglutarate succinic semi aldehyde alpha-ketoglutarate decarboxylase kgd O50463.4 Mycobacterium tuberculosis alpha-ketoglutarate
          gadA NP_417974 Escherichia coli glutamate
          gadB NP_416010 Escherichia coli glutamate
8B 1.4.1.a alpha-ketoglutarate glutamate glutamate dehydrogenase gdhA P00370 Escherichia coli glutamate
          gdh P96110.4 Thermotoga maritima glutamate
          gdhA1 NP_279651.1 Halobacterium salinarum glutamate
8B 1.4.1.a 4-aminobutyrate succinic semi aldehyde 4-aminobutyrate oxidoreductase (de aminating) lysDH AB052732 Geobacillus stearothermophilus lysine
          lysDH NP_147035.1 Aeropyrum pernix K1 lysine
          ldh P0A393 Bacillus cereus leucine, isoleucine, valine, 2-aminobutanoate
8B 2.6.1.a 4-aminobutyrate succinic semi aldehyde 4-aminobutyrate transaminase gabT P22256.1 Escherichia coli 4-aminobutyryate
          puuE NP_415818.1 Escherichia coli 4-aminobutyryate
          UGA1 NP_011533.1 Saccharomyces cerevisiae 4-aminobutyryate
8B 4.1.1.a glutamate 4-aminobutyrate glutamate decarboxylase gadA NP_417974 Escherichia coli glutamate
          gadB NP_416010 Escherichia coli glutamate
          kgd O50463.4 Mycobacterium tuberculosis alpha-ketoglutarate
8B 1.1.1.a succinate semialdehyde 4-hydroxybutyrate 4-hydroxybutyrate dehydrogenase 4hbd YP_726053.1 Ralstonia eutropha H16 4-hydroxybutyrate
          4hbd L21902.1 Clostridium kluyveri DSM 555 4-hydroxybutyrate
          4hbd Q94B07 Arabidopsis thaliana 4-hydroxybutyrate
8B 2.8.3.a 4-hydroxybutyrate 4-hydroxybutyryl-CoA 4-hydroxybutyryl-CoA transferase cat1, cat2, cat3 P38946.1, P38942.2, EDK35586.1 Clostridium kluyveri succinate, 4-hydroxybutyrate, butyrate
          gctA, gctB CAA57199.1, CAA57200.1 Acidaminococcus fermentans glutarate
          atoA, atoD P76459.1, P76458.1 Escherichia coli butanoate
8B 3.1.2.a 4-hydroxybutyrate 4-hydroxybutyryl-CoA 4-hydroxybutyryl-CoA hydrolase tesB NP_414986 Escherichia coli adipyl-CoA
          acot12 NP_570103.1 Rattus norvegicus butyryl-CoA
          hibch Q6NVY1.2 Homo sapiens 3-hydroxypropano yl-CoA
8B 6.2.1.a 4-hydroxybutyrate 4-hydroxybutyryl-CoA 4-hydroxybutyryl-CoA ligase (or 4-hydroxybutyryl-CoA synthetase) sucCD NP_415256.1, AAC73823.1 Escherichia coli succinate
          phl CAJ15517.1 Penicillium chrysogenum phenylacetate
          bioW NP_390902.2 Bacillus subtilis 6-carboxyhexanoat e
8B 2.7.2.a 4-hydroxybutyrate 4-hydroxybutyryl-phosphate 4-hydroxybutyrate kinase ackA NP_416799.1 Escherichia coli acetate, propionate
          buk1 NP_349675 Clostridium acetobutylicum butyrate
          buk2 Q97II1 Clostridium acetobutylicum butyrate
8B 2.3.1.a 4-hydroxybutyryl-phosphate 4-hydroxybutyryl-CoA phosphotrans-4-hydroxybutyrylase ptb NP_349676 Clostridium acetobutylicum butyryl-phosphate
          ptb AAR19757.1 butyrate-producing bacterium L2-50 butyryl-phosphate
          ptb CAC07932.1 Bacillus megaterium butyryl-phosphate
8B 1.2.1.d 4-hydroxybutyryl-phosphate 4-hydroxybutanal 4-hydroxybutanal dehydrogenase (phosphorylating) asd NP_417891.1 Escherichia coli L-4-aspartyl-phosphate
          proA NP_414778.1 Escherichia coli L-glutamyl-5-phospate
          gapA P0A9B2.2 Escherichia coli Glyceraldehyde-3-phosphate
8B 1.2.1.b 4-hydroxybutyryl-CoA 4-hydroxybutanal 4-hydroxybutyryl-CoA reductase (or 4-hydroxybutanal dehydrogenase) sucD P38947.1 Clostridium kluyveri succinyl-CoA
          sucD NP _904963.1 Porphyromonas gingivalis succinyl-CoA
          Msed_0709 YP_001190808.1 Metallosphaera sedula malonyl-CoA
8B 1.1.1.c 4-hydroxybutyryl-CoA 1,4-butanediol 4-hydroxybutyryl-CoA reductase (alcohol forming) adhE2 AAK09379.1 Clostridium acetobutylicum butanoyl-CoA
          mcr AAS20429.1 Chloroflexus aurantiacus malonyl-CoA
          FAR AAD38039.1 Simmondsia chinensis long chain acyl-CoA
8B 1.1.1.a 4-hydroxybutanal 1,4-butanediol 1,4-butanediol dehydrogenase ADH2 NP_014032.1 Saccharymyces cerevisiae general
          yqhD NP_417484.1 Escherichia coli >C3
          4hbd L21902.1 Clostridium kluyveri DSM 555 Succinate semialdehyde

EXAMPLE VII


BDO Pathways from 4-Aminobutyrate



[0447] This example describes exemplary BDO pathwayd from 4-aminobutyrate.

[0448] Figure 9A depicts exemplary BDO pathways in which 4-aminobutyrate is converted to BDO. Enzymes of such an exemplary BDO pathway are listed in Table 17, along with exemplary genes encoding these enzymes.

[0449] Briefly, 4-aminobutyrate can be converted to 4-aminobutyryl-CoA by 4-aminobutyrate CoA transferase (EC 2.8.3.a), 4-aminobutyryl-CoA hydrolase (EC 3.1.2.a), or 4-aminobutyrate-CoA ligase (or 4-aminobutyryl-CoA synthetase) (EC 6.2.1.a). 4-aminobutyryl-CoA can be converted to 4-oxobutyryl-CoA by 4-aminobutyryl-CoA oxidoreductase (deaminating) (EC 1.4.1.a) or 4-aminobutyryl-CoA transaminase (EC 2.6.1.a). 4-oxobutyryl-CoA can be converted to 4-hydroxybutyryl-CoA by 4-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.a). 4-hydroxybutyryl-CoA can be converted to 1,4-butanediol by 4-hydroxybutyryl-CoA reductase (alcohol forming) (EC 1.1.1.c). Alternatively, 4-hydroxybutyryl-CoA can be converted to 4-hydroxybutanal by 4-hydroxybutyryl-CoA reductase (or 4-hydroxybutanal dehydrogenase) (EC 1.2.1.b). 4-hydroxybutanal can be converted to 1,4-butanediol by 1,4-butanediol dehydrogenase (EC 1.1.1.a).
TABLE 17. BDO pathway from 4-aminobutyrate.
FigureEC classDesired substrateDesired productEnzyme nameGene nameGenBank ID (if available)OrganismKnown Substrates
9A 2.8.3.a 4-aminobutyrate 4-aminobutyryl-CoA 4-aminobutyrate CoA transferase cat1, cat2, cat3 P38946.1, P38942.2, EDK35586.1 Clostridium kluyveri succinate, 4-hydroxybutyrate, butyrate
          gctA, gctB CAA57199.1, CAA57200.1 Acidaminococcus fermentans glutarate
          atoA, atoD P76459.1, P76458.1 Escherichia coli butanoate
9A 3.1.2.a 4-aminobutyrate 4-aminobutyryl-CoA 4-aminobutyryl-CoA hydrolase tesB NP_414986 Escherichia coli adipyl-CoA
          acot12 NP_570103.1 Rattus norvegicus butyryl-CoA
          hibch Q6NVY1.2 Homo sapiens 3-hydroxypropanoyl-CoA
9A 6.2.1.a 4-aminobutyrate 4-aminobutyryl-CoA 4-aminobutyrate-CoA ligase (or 4-aminobutyryl-CoA synthetase) sucCD NP_415256.1, AAC73823.1 Escherichia coli succinate
          phl CAJ15517.1 Penicillium chrysogenum phenyl acetate
          bioW NP_390902.2 Bacillus subtilis 6-carboxyhexanoate
9A 1.4.1.a 4-aminobutyryl-CoA 4-oxobutyryl-CoA 4-aminobutyryl-CoA oxidoreductase (deaminating) lysDH AB052732 Geobacillus stearothermophilus lysine
          lysDH NP_147035.1 Aeropyrum pernix K1 lysine
          ldh P0A393 Bacillus cereus leucine, isoleucine, valine, 2-aminobutanoate
9A 2.6.1.a 4-aminobutyryl-CoA 4-oxobutyryl-CoA 4-aminobutyryl-CoA transaminase gabT P22256.1 Escherichia coli 4-aminobutyryate
          abat P50554.3 Rattus norvegicus 3-amino-2-methylpropionate
          SkyPYD4 ABF58893.1 Saccharomyces kluyveri beta-alanine
9A 1.1.1.a 4-oxobutyryl-CoA 4-hydroxybutyryl -CoA 4-hydroxybutyryl-CoA dehydrogenase ADH2 NP_014032.1 Saccharymyces cerevisiae general
          yqhD NP_417484.1 Escherichia coli >C3
          4hbd L21902.1 Clostridium kluyveri DSM 555 Succinate semi aldehyde
8 1.1.1.c 4-hydroxybutyry 1-CoA 1,4-butanediol 4-hydroxybutyryl-CoA reductase (alcohol forming) adhE2 AAK09379.1 Clostridium acetobutylicum butanoyl-CoA
          mcr AAS20429.1 Chloroflexus aurantiacus malonyl-CoA
          FAR AAD38039.1 Simmondsia chinensis long chain acyl-CoA
8 1.2.1.b 4-hydroxybutyry 1-CoA 4-hydroxybutanal 4-hydroxybutyryl-CoA reductase (or 4-hydroxybutanal dehydrogenase) sucD P38947.1 Clostridium kluyveri Succinyl-CoA
          sucD NP_904963.1 Porphyromonas gingivalis Succinyl-CoA
          Msed_0709 YP_001190808.1 Metallosphaera sedula Malonyl-CoA
8 1.1.1.a 4-hydroxybutana 1 1,4-butanediol 1,4-butanediol dehydrogenase ADH2 NP_014032.1 Saccharymyces cerevisiae general
          yqhD NP_417484.1 Escherichia coli >C3
          4hbd L21902.1 Clostridium kluyveri DSM 555 Succinate semi aldehyde


[0450] Enzymes for another exemplary BDO pathway converting 4-aminobutyrate to BDO is shown in Figure 9A. Enzymes of such an exemplary BDO pathway are listed in Table 18, along with exemplary genes encoding these enzymes.

[0451] Briefly, 4-aminobutyrate can be converted to 4-aminobutyryl-CoA by 4-aminobutyrate CoA transferase (EC 2.8.3.a), 4-aminobutyryl-CoA hydrolase (EC 3.1.2.a) or 4-aminobutyrate-CoA ligase (or 4-aminobutyryl-CoA synthetase) (EC 6.2.1.a). 4-aminobutyryl-CoA can be converted to 4-aminobutan-1-ol by 4-aminobutyryl-CoA reductase (alcohol forming) (EC 1.1.1.c). Alternatively, 4-aminobutyryl-CoA can be converted to 4-aminobutanal by 4-aminobutyryl-CoA reductase (or 4-aminobutanal dehydrogenase) (EC 1.2.1.b), and 4-aminobutanal converted to 4-aminobutan-1-ol by 4-aminobutan-1-ol dehydrogenase (EC 1.1.1.a). 4-aminobutan-1-ol can be converted to 4-hydroxybutanal by 4-aminobutan-1-ol oxidoreductase (deaminating) (EC 1.4.1.a) or 4-aminobutan-1-ol transaminase (EC 2.6.1.a). 4-hydroxybutanal can be converted to 1,4-butanediol by 1,4-butanediol dehydrogenase (EC 1.1.1.a).
TABLE 18. BDO pathway from 4-aminobutyrate.
FigureEC classDesired substrateDesired productEnzyme nameGene nameGenBank ID (if available)OrganismKnown Substrate
9A 2.8.3.a 4-aminobutyrate 4-aminobutyryl-CoA 4-aminobutyrate CoA transferase cat1, cat2, cat3 P38946.1, P38942.2, EDK35586.1 Clostridium kluyveri succinate, 4-hydroxybutyrat e, butyrate
          gctA, gctB CAA57199.1, CAA57200.1 Acidaminococcus fermentans glutarate
          atoA, atoD P76459.1, P76458.1 Escherichia coli butanoate
9A 3.1.2.a 4-aminobutyrate 4-aminobutyryl-CoA 4-aminobutyryl-CoA hydrolase tesB NP_414986 Escherichia coli adipyl-CoA
          acot12 NP_570103.1 Rattus norvegicus butyryl-CoA
          hibch Q6NVY1.2 Homo sapiens 3-hydroxypropan oyl-CoA
9A 6.2.1.a 4-aminobutyrate 4-aminobutyryl-CoA 4-aminobutyrate-CoA ligase (or 4-aminobutyryl-CoA synthetase) sucCD NP_415256.1, AAC73823.1 Escherichia coli succinate
          phl CAJ15517.1 Penicillium chrysogenum phenylacetate
          bioW NP_390902.2 Bacillus subtilis 6-carboxyhexano ate
9A 1.1.1.c 4-aminobutyryl-CoA 4-aminobutan-1-ol 4-aminobutyryl-CoA reductase (alcohol forming) adhE2 AAK09379.1 Clostridium acetobutylicum butanoyl-CoA
          mcr AAS20429.1 Chloroflexus aurantiacus malonyl-CoA
          FAR AAD38039.1 Simmondsia chinensis long chain acyl-CoA
9A 1.2.1.b 4-aminobutyryl-CoA 4-aminobutanal 4-aminobutyryl-CoA reductase (or 4-aminobutanal dehydrogenase) sucD P38947.1 Clostridium kluyveri Succinyl-CoA
          sucD NP_904963.1 Porphyromonas gingivalis Succinyl-CoA
          Msed_0709 YP_001190808.1 Metallosphaera sedula Malonyl-CoA
9A 1.1.1.a 4-aminobutanal 4-aminobutan-1-ol 4-aminobutan-1-ol dehydrogenase ADH2 NP_014032.1 Saccharymyces cerevisiae general
          yqhD NP_417484.1 Escherichia coli >C3
          4hbd L21902.1 Clostridium kluyveri DSM 555 Succinate semi aldehyde
9A 1.4.1.a 4-aminobutan-1-ol 4-hydroxybutanal 4-aminobutan-1-ol oxidoreductase (de aminating) lysDH AB052732 Geobacillus stearothermophilus lysine
          lysDH NP_147035.1 Aeropyrum pernix K1 lysine
          ldh P0A393 Bacillus cereus leucine, isoleucine, valine, 2-aminobutanoat e
9A 2.6.1.a 4-aminobutan-1-ol 4-hydroxybutanal 4-aminobutan-1-ol transaminase gabT P22256.1 Escherichia coli 4-aminobutyryate
          abat P50554.3 Rattus norvegicus 3-amino-2-methylpropion ate
          SkyPYD4 ABF58893.1 Saccharomyces kluyveri beta-alanine
9A 1.1.1.a 4-hydroxybutanal 1,4-butanediol 1,4-butanediol dehydrogenase ADH2 NP_014032.1 Saccharymyces cerevisiae general
          yqhD NP_417484.1 Escherichia coli >C3
          4hbd L21902.1 Clostridium kluyveri DSM 555 Succinate semi aldehyde


[0452] Figure 9B depicts exemplary BDO pathway in which 4-aminobutyrate is converted to BDO. Enzymes of such an exemplary BDO pathway are listed in Table 19, along with exemplary genes encoding these enzymes.

[0453] Briefly, 4-aminobutyrate can be converted to [(4-aminobutanolyl)oxy] phosphonic acid by 4-aminobutyrate kinase (EC 2.7.2.a). [(4-aminobutanolyl)oxy] phosphonic acid can be converted to 4-aminobutanal by 4-aminobutyraldehyde dehydrogenase (phosphorylating) (EC 1.2.1.d). 4-aminobutanal can be converted to 4-aminobutan-1-ol by 4-aminobutan-1-ol dehydrogenase (EC 1.1.1.a). 4-aminobutan-1-ol can be converted to 4-hydroxybutanal by 4-aminobutan-1-ol oxidoreductase (deaminating) (EC 1.4.1.a) or 4-aminobutan-1-ol transaminase (EC 2.6.1.a). Alternatively, [(4-aminobutanolyl)oxy] phosphonic acid can be converted to [(4-oxobutanolyl)oxy] phosphonic acid by [(4-aminobutanolyl)oxy]phosphonic acid oxidoreductase (deaminating) (EC 1.4.1.a) or [(4-aminobutanolyl)oxy]phosphonic acid transaminase (EC 2.6.1.a). [(4-oxobutanolyl)oxy] phosphonic acid can be converted to 4-hydroxybutyryl-phosphate by 4-hydroxybutyryl-phosphate dehydrogenase (EC 1.1.1.a). 4-hydroxybutyryl-phosphate can be converted to 4-hydroxybutanal by 4-hydroxybutyraldehyde dehydrogenase (phosphorylating) (EC 1.2.1.d). 4-hydroxybutanal can be converted to 1,4-butanediol by 1,4-butanediol dehydrogenase (EC 1.1.1.a).
TABLE 19. BDO pathway from 4-aminobutyrate.
FigureEC classDesired substrateDesired productEnzyme nameGene nameGenBank ID (if available)OrganismKnown Substrate
9B 2.7.2.a 4-aminobutyrate [(4-aminobutanoly l)oxy] phosphonic acid 4-aminobutyrate kinase ackA NP_416799.1 Escherichia coli acetate, propionate
          buk1 NP_349675 Clostridium acetobutylicum butyrate
          proB NP_414777.1 Escherichia coli glutamate
9B 1.2.1.d [(4-aminobutanolyl )oxy] phosphonic acid 4-aminobutanal 4-aminobutyralde hyde dehydrogenase (phosphorylatin g) asd NP_417891.1 Escherichia coli L-4-aspartyl-phosphate
          proA NP_414778.1 Escherichia coli L-glutamyl-5-phospate
          gapA P0A9B2.2 Escherichia coli Glyceraldehyde-3-phosphate
9B 1.1.1.a 4-aminobutanal 4-aminobutan-1-ol 4-aminobutan-1-ol dehydrogenase ADH2 NP_014032.1 Saccharymyces cerevisiae general
          yqhD NP_417484.1 Escherichia coli >C3
          4hbd L21902.1 Clostridium kluyveri DSM 555 Succinate semialdehyde
9B 1.4.1.a 4-aminobutan-1-ol 4-hydroxybutana 1 4-aminobutan-1-ol oxidoreductase (deaminating) lysDH AB052732 Geobacillus stearothermophilus lysine
          lysDH NP_147035.1 Aeropyrum pernix K1 lysine
          ldh P0A393 Bacillus cereus leucine, isoleucine, valine, 2-aminobutanoate
9B 2.6.1.a 4-aminobutan-1-ol 4-hydroxybutana 1 4-aminobutan-1-ol transaminase gabT P22256.1 Escherichia coli 4-aminobutyryate
          abat P50554.3 Rattus norvegicus 3-amino-2-methylpropionate
          SkyPYD4 ABF58893.1 Saccharomyces kluyveri beta-alanine
9B 1.4.1.a [(4-aminobutanolyl )oxy] phosphonic acid [(4-oxobutanolyl) oxy] phosphonic acid [(4-aminobutanolyl )oxy]phosphoni c acid oxidoreductase (deaminating) lysDH AB052732 Geobacillus stearothermophilus lysine
          lysDH NP_147035.1 Aeropyrum pernix K1 lysine
          ldh P0A393 Bacillus cereus leucine, isoleucine, valine, 2-aminobutanoate
9B 2.6.1.a [(4-aminobutanolyl )oxy] phosphonic acid [(4-oxobutanolyl) oxy] phosphonic acid [(4-aminobutanolyl )oxy]phosphoni c acid transaminase gabT P22256.1 Escherichia coli 4-aminobutyryate
          SkyPYD4 ABF58893.1 Saccharomyces kluyveri beta-alanine
          serC NP_415427.1 Escherichia coli phosphoserine, phosphohydroxythreonine
9B 1.1.1.a [(4-oxobutanolyl)o xy]phosphonic acid 4-hydroxybutyry l-phosphate 4-hydroxybutyryl-phosphate dehydrogenase ADH2 NP_014032.1 Saccharymyces cerevisiae general
          yqhD NP_417484.1 Escherichia coli >C3
          4hbd L21902.1 Clostridium kluyveri DSM 555 Succinate semialdehyde
9B 1.2.1.d 4-hydroxybutyryl -phosphate 4-hydroxybutana l 4-hydroxybutyral dehyde dehydrogenase (phosphorylatin g) asd NP_417891.1 Escherichia coli L-4-aspartyl-phosphate
          proA NP_414778.1 Escherichia coli L-giutamyl-5-phospate
          gapA P0A9B2.2 Escherichia coli Glyceraldehyde-3-phosphate
9B 1.1.1.a 4-hydroxybutanal 1,4-butanediol 1,4-butanediol dehydrogenase ADH2 NP_014032.1 Saccharymyces cerevisiae general
          yqhD NP_417484.1 Escherichia coli >C3
          4hbd L21902.1 Clostridium kluyveri DSM 555 Succinate semialdehyde


[0454] Figure 9C shows an exemplary pathway through acetoacetate.

EXAMPLE VIII


Exemplary BDO Pathways from Alpha-ketoglutarate



[0455] This example describes exemplary BDO pathways from alpha-ketoglutarate.

[0456] Figure 10 depicts exemplary BDO pathways in which alpha-ketoglutarate is converted to BDO. Enzymes of such an exemplary BDO pathway are listed in Table 20, along with exemplary genes encoding these enzymes.

[0457] Briefly, alpha-ketoglutarate can be converted to alpha-ketoglutaryl-phosphate by alpha-ketoglutarate 5-kinase (EC 2.7.2.a). Alpha-ketoglutaryl-phosphate can be converted to 2,5-dioxopentanoic acid by 2,5-dioxopentanoic semialdehyde dehydrogenase (phosphorylating) (EC 1.2.1.d). 2,5-dioxopentanoic acid can be converted to 5-hydroxy-2-oxopentanoic acid by 2,5-dioxopentanoic acid reductase (EC 1.1.1.a). Alternatively, alpha-ketoglutarate can be converted to alpha-ketoglutaryl-CoA by alpha-ketoglutarate CoA transferase (EC 2.8.3.a), alpha-ketoglutaryl-CoA hydrolase (EC 3.1.2.a) or alpha-ketoglutaryl-CoA ligase (or alpha-ketoglutaryl-CoA synthetase) (EC 6.2.1.a). Alpha-ketoglutaryl-CoA can be converted to 2,5-dioxopentanoic acid by alpha-ketoglutaryl-CoA reductase (or 2,5-dioxopentanoic acid dehydrogenase) (EC 1.2.1.b). 2,5-Dioxopentanoic acid can be converted to 5-hydroxy-2-oxopentanoic acid by 5-hydroxy-2-oxopentanoic acid dehydrogenase. Alternatively, alpha-ketoglutaryl-CoA can be converted to 5-hydroxy-2-oxopentanoic acid by alpha-ketoglutaryl-CoA reductase (alcohol forming) (EC 1.1.1.c). 5-hydroxy-2-oxopentanoic acid can be converted to 4-hydroxybutanal by 5-hydroxy-2-oxopentanoic acid decarboxylase (EC 4.1.1.a). 4-hydroxybutanal can be converted to 1,4-butanediol by 1,4-butanediol dehydrogenase (EC 1.1.1.a). 5-hydroxy-2-oxopentanoic acid can be converted to 4-hydroxybutyryl-CoA by 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation) (EC 1.2.1.c).
TABLE 20. BDO pathway from alpha-ketoglutarate.
FigureEC classDesired substrateDesired productEnzyme nameGene nameGenBank ID (if available)OrganismKnown Substrate
10 2.7.2.a alpha-ketoglutarate alpha-ketoglutaryl-phosphate alpha-ketoglutarate 5-kinase ackA NP_416799.1 Escherichia coli acetate, propionate
          bukl NP_349675 Clostridium acetobutylicum butyrate
          proB NP_414777.1 Escherichia coli glutamate
10 1.2.1.d alpha-ketoglutaryl-phosphate 2,5-dioxopentanoic acid 2,5-dioxopentanoi c semialdehyde dehydrogenas e (phosphorylat ing) proA NP_414778.1 Escherichia coli L-glutamyl-5-phospate
          asd NP_417891.1 Escherichia coli L-4-aspartyl-phosphate
          gapA P0A9B2.2 Escherichia coli Glyceraldehyde-3 -phosphate
10 1.1.1.a 2,5-dioxopentanoic acid 5-hydroxy-2-oxopentanoic acid 2,5-dioxopentanoi c acid reductase ADH2 NP_014032.1 Saccharymyces cerevisiae general
          yqhD NP_417484.1 Escherichia coli >C3
          4hbd L21902.1 Clostridium kluyveri DSM 555 Succinate semialdehyde
10 2.8.3.a alpha-ketoglutarate alpha-ketoglutaryl-CoA alpha-ketoglutarate CoA transferase cat1, cat2, cat3 P38946.1, P38942.2, EDK35586.1 Clostridium kluyveri succinate, 4-hydroxybutyrate, butyrate
          gctA, gctB CAA57199.1, CAA57200.1 Acidaminococcus fermentans glutarate
          atoA, atoD P76459.1, P76458.1 Escherichia coli butanoate
10 3.1.2.a alpha-ketoglutarate alpha-ketoglutaryl-CoA alpha-ketoglutaryl-CoA hydrolase tesB NP_414986 Escherichia coli adipyl-CoA
          acot12 NP_570103.1 Rattus norvegicus butyryl-CoA
          hibch Q6NVY1.2 Homo sapiens 3 -hydroxypropanoyl-CoA
10 6.2.1.a alpha-ketoglutarate alpha-ketoglutaryl-CoA alpha-ketoglutaryl-CoA ligase (or alpha-ketoglutaryl-CoA synthetase) sucCD NP_415256.1, AAC73823.1 Escherichia coli succinate
          phl CAJ15517.1 Penicillium chrysogenum phenylacetate
          bioW NP_390902.2 Bacillus subtilis 6-carboxyhexanoate
10 1.2.1.b alpha-ketoglutaryl-CoA 2,5-dioxopentanoic acid alpha-ketoglutaryl-CoA reductase (or 2,5-dioxopentano ic acid dehydrogenas e) sucD P38947.1 Clostridium kluyveri Succinyl-CoA
          Msed_0709 YP_00119080 8.1 Metallosphaera sedula Malonyl-CoA
          bphG BAA03892.1 Pseudomonas sp Acetaldehyde, Propionaldehyde, Butyraldehyde, Isobutyraldehyde and Formaldehyde
10 1.1.1.a 2,5-dioxopentanoi c acid 5-hydroxy-2-oxopentanoic acid 5-hydroxy-2-oxopentanoic acid dehydrogenas e ADH2 yqhD 4hbd NP_014032.1 NP_417484.1 L21902.1 Saccharymyces cerevisiae Escherichia coli Clostridium kluyveri DSM 555 general >C3 Succinate semialdehyde
10 1.1.1.c alpha-ketoglutaryl-CoA 5-hydroxy-2-oxopentanoic acid alpha-ketoglutaryl-CoA reductase (alcohol forming) adhE2 AAK09379.1 Clostridium acetobutylicum butanoyl-CoA
          mcr AAS20429.1 Chloroflexus aurantiacus malonyl-CoA
          FAR AAD38039.1 Simmondsia chinensis long chain acyl-CoA
10 4.1.1.a 5-hydroxy-2-oxopentanoic acid 4-hydroxybutanal 5-hydroxy-2-oxopentanoic acid decarboxylas e pdc P06672.1 Zymomonas mobilus 2-oxopentanoic acid
          mdlC P20906.2 Pseudomonas putida 2-oxopentanoic acid
          pdcl P06169 Saccharomyces cerevisiae pyruvate
10 1.1.1.a 4-hydroxybutana 1 1,4-butanediol 1,4-butanediol dehydrogenas e ADH2 NP_014032.1 Saccharymyces cerevisiae general
          yqhD NP_417484.1 Escherichia coli >C3
          4hbd L21902.1 Clostridium kluyveri DSM 555 Succinate semialdehyde
10 1.2.1.c 5-hydroxy-2-oxopentanoic acid 4-hydroxybutyryl-CoA 5-hydroxy-2-oxopentanoic acid dehydrogenas e (decarboxylat ion) sucA, sucB, lpd NP_415254.1, NP_415255.1, NP_414658.1 Escherichia coli Alpha-ketoglutarate
          bfmBB, bfmBAA, bfmBAB, bfmBAB, pdhD NP_390283.1, NP_390285.1, NP_390284.1, P21880.1 Bacillus subtilis 2-keto acids derivatives of valine, leucine and isoleucine
          Bckdha, Bckdhb, Dbt, Dld NP_036914.1, NP_062140.1, NP_445764.1, NP_955417.1 Rattus norvegicus 2-keto acids derivatives of valine, leucine and isoleucine

EXAMPLE IX


Exemplary BDO Pathways from Glutamate



[0458] This example describes exemplary BDO pathways from glutamate.

[0459] Figure 11 depicts exemplary BDO pathways in which glutamate is converted to BDO. Enzymes of such an exemplary BDO pathway are listed in Table 21, along with exemplary genes encoding these enzymes.

[0460] Briefly, glutamate can be converted to glutamyl-CoA by glutamate CoA transferase (EC 2.8.3.a), glutamyl-CoA hydrolase (EC 3.1.2.a) or glutamyl-CoA ligase (or glutamyl-CoA synthetase) (EC 6.2.1.a). Alternatively, glutamate can be converted to glutamate-5-phosphate by glutamate 5-kinase (EC 2.7.2.a). Glutamate-5-phosphate can be converted to glutamate-5-semialdehyde by glutamate-5-semialdehyde dehydrogenase (phosphorylating) (EC 1.2.1.d). Glutamyl-CoA can be converted to glutamate-5-semialdehyde by glutamyl-CoA reductase (or glutamate-5-semialdehyde dehydrogenase) (EC 1.2.1.b). Glutamate-5-semialdehyde can be converted to 2-amino-5-hydroxypentanoic acid by glutamate-5-semialdehyde reductase (EC 1.1.1.a). Alternatively, glutamyl-CoA can be converted to 2-amino-5-hydroxypentanoic acid by glutamyl-CoA reductase (alcohol forming) (EC 1.1.1.c). 2-Amino-5-hydroxypentanoic acid can be converted to 5-hydroxy-2-oxopentanoic acid by 2-amino-5-hydroxypentanoic acid oxidoreductase (deaminating) (EC 1.4.1.a) or 2-amino-5-hydroxypentanoic acid transaminase (EC 2.6.1.a). 5-Hydroxy-2-oxopentanoic acid can be converted to 4-hydroxybutanal by 5-hydroxy-2-oxopentanoic acid decarboxylase (EC 4.1.1.a). 4-Hydroxybutanal can be converted to 1,4-butanediol by 1,4-butanediol dehydrogenase (EC 1.1.1.a). Alternatively, 5-hydroxy-2-oxopentanoic acid can be converted to 4-hydroxybutyryl-CoA by 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation) (EC 1.2.1.c).
TABLE 21. BDO pathway from glutamate.
FigureEC classDesired substrateDesired productEnzyme nameGene nameGenBank ID (if available)OrganismKnown Substrate
11 2.8.3.a glutamate glutamyl-CoA glutamate CoA transferase cat1, cat2, cat3 P38946.1, P3 8942.2, EDK35586.1 Clostridium kluyveri succinate, 4-hydroxybutyrate, butyrate
          gctA, gctB CAA57199.1, CAA57200.1 Acidaminococcus fermentans glutarate
          atoA, atoD P76459.1, P76458.1 Escherichia coli butanoate
11 3.1.2.a glutamate glutamyl-CoA glutamyl-CoA hydrolase tesB NP_414986 Escherichia coli adipyl-CoA
          acot12 NP_570103.1 Rattus norvegicus butyryl-CoA
          hibch Q6NVY1.2 Homo sapiens 3-hydroxypropanoyl-CoA
11 6.2.1.a glutamate glutamyl-CoA glutamyl-CoA ligase (or glutamyl-CoA synthetase) sucCD NP_415256.1, AAC73823.1 Escherichia coli succinate
          phl CAJ15517.1 Penicillium chrysogenum phenylacetate
          bioW NP_390902.2 Bacillus subtilis 6-carboxyhexanoate
11 2.7.2.a glutamate glutamate-5-phosphate glutamate 5-kinase ackA NP_416799.1 Escherichia coli acetate, propionate
          buk1 NP_349675 Clostridium acetobutylicum butyrate
          proB NP_414777.1 Escherichia coli glutamate
11 1.2.1.d glutamate-5-phosphate glutamate-5-semialdehyde glutamate-5-semialdehyde dehydrogenase (phosphorylating) proA NP_414778.1 Escherichia coli L-glutamyl-5-phospate
          asd NP_417891.1 Escherichia coli L-4-aspartyl-phosphate
          gapA P0A9B2.2 Escherichia coli Glyceraldehyde-3-phosphate
11 1.2.1.b glutamyl-CoA glutamate-5-semialdehyde glutamyl-CoA reductase (or glutamate-5-semialdehyde dehydrogenase) sucD P38947.1 Clostridium kluyveri Succinyl-CoA
          Msed_0709 YP_001190808.1 Metallosphaera sedula Malonyl-CoA
          bphG BAA03892.1 Pseudomonas sp Acetaldehyde, Propionaldehyde, Butyraldehyde, Isobutyraldehyde and Formaldehyde
11 1.1.1.a glutamate-5-semialdehyde 2-amino-5-hydroxypentan oic acid glutamate-5-semialdehyde reductase ADH2 NP_014032.1 Saccharymyces cerevisiae general
          yqhD NP_417484.1 Escherichia coli >C3
          4hbd L21902.1 Clostridium kluyveri DSM 555 Succinate semialdehyde
11 1.1.1.c glutamyl-CoA 2-amino-5-hydroxypentan oic acid glutamyl-CoA reductase (alcohol forming) adhE2 AAK09379.1 Clostridium acetobutylicum butanoyl-CoA
          mcr AAS20429.1 Chloroflexus aurantiacus malonyl-CoA
          FAR AAD38039.1 Simmondsia chinensis long chain acyl-CoA
11 1.4.1.a 2-amino-5-hydroxypentan oic acid 5-hydroxy-2-oxopentanoic acid 2-amino-5-hydroxypentanoic acid oxidoreductase (deaminating) gdhA P00370 Escherichia coli glutamate
          ldh P0A393 Bacillus cereus leucine, isoleucine, valine, 2-aminobutanoate
          nadX NP_229443.1 Thermotoga maritima aspartate
11 2.6.1.a 2-amino-5-hydroxypentan oic acid 5-hydroxy-2-oxopentanoic acid 2-amino-5-hydroxypentanoic acid transaminase aspC NP_415448.1 Escherichia coli aspartate
          AAT2 P23542.3 Saccharomyces cerevisiae aspartate
          avtA YP_026231.1 Escherichia coli valine, alpha-aminobutyrate
11 4.1.1.a 5-hydroxy-2-oxopentanoic acid 4-hydroxybutana 1 5-hydroxy-2-oxopentanoic acid decarboxylase pdc P06672.1 Zymomonas mobilus 2-oxopentanoic acid
          mdlC P20906.2 Pseudomonas putida 2-oxopentanoic acid
          pdcl P06169 Saccharomyces cerevisiae pyruvate
11 1.1.1.a 4-hydroxybutana l 1,4-butanediol 1,4-butanediol dehydrogenase ADH2 NP_014032.1 Saccharymyces cerevisiae general
          yqhD NP_417484.1 Escherichia coli >C3
          4hbd L21902.1 Clostridium kluyveri DSM 555 Succinate semialdehyde
11 1.2.1.c 5-hydroxy-2-oxopentanoic acid 4-hydroxybutyry 1-CoA 5-hydroxy-2-oxopentanoic acid dehydrogenase (decarboxylation) sucA, sucB, lpd NP_415254.1, NP_415255.1, NP_414658.1 Escherichia coli Alpha-ketoglutarate
          bfmBB, bfmBAA, bfmBAB, bfmBAB, pdhD NP_390283.1, NP_390285.1, NP_390284.1, P21880.1 Bacillus subtilis 2-keto acids derivatives of valine, leucine and isoleucine
          Bckdha, Bckdhb, Dbt, Dld NP_036914.1, NP_062140.1, NP_445764.1, NP_955417.1 Rattus norvegicus 2-keto acids derivatives of valine, leucine and isoleucine

EXAMPLE X


Exemplary BDO from Acetoacetyl-CoA



[0461] This example describes an exemplary BDO pathway from acetoacetyl-CoA.

[0462] Figure 12 depicts exemplary BDO pathways in which acetoacetyl-CoA is converted to BDO. Enzymes of such an exemplary BDO pathway are listed in Table 22, along with exemplary genes encoding these enzymes.

[0463] Briefly, acetoacetyl-CoA can be converted to 3-hydroxybutyryl-CoA by 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.a). 3-Hydroxybutyryl-CoA can be converted to crotonoyl-CoA by 3-hydroxybutyryl-CoA dehydratase (EC 4.2.1.a). Crotonoyl-CoA can be converted to vinylacetyl-CoA by vinylacetyl-CoA Δ-isomerase (EC 5.3.3.3). Vinylacetyl-CoA can be converted to 4-hydroxybutyryl-CoA by 4-hydroxybutyryl-CoA dehydratase (EC 4.2.1.a). 4-Hydroxybutyryl-CoA can be converted to 1,4-butanediol by 4-hydroxybutyryl-CoA reductase (alcohol forming) (EC 1.1.1.c). Alternatively, 4-hydroxybutyryl-CoA can be converted to 4-hydroxybutanal by 4-hydroxybutyryl-CoA reductase (or 4-hydroxybutanal dehydrogenase) (EC 1.2.1.b). 4-Hydroxybutanal can be converted to 1,4-butanediol by 1,4-butanediol dehydrogenase (EC 1.1.1.a).
TABLE 22. BDO pathway from acetoacetyl-CoA.
FigureEC classDesired substrateDesired productEnzyme nameGene nameGenBank ID (if available)OrganismKnown Substrate
12 1.1.1.a acetoacetyl-CoA 3-hydroxybutyryl -CoA 3-hydroxybutyryl-CoA dehydrogenase hbd NP_349314.1 Clostridium acetobutylicum 3-hydroxybutyryl-CoA
          hbd AAM14586.1 Clostridium beijerinckii 3-hydroxybutyryl-CoA
          Msed_1423 YP_001191505 Metallosphaera sedula presumed 3-hydroxybutyryl-CoA
12 4.2.1.a 3-hydroxybutyryl-CoA crotonoyl-CoA 3-hydroxybutyryl-CoA dehydratase crt NP_349318.1 Clostridium acetobutylicum 3-hydroxybutyryl-CoA
          maoC NP_415905.1 Escherichia coli 3-hydroxybutyryl-CoA
          paaF NP_415911.1 Escherichia coli 3-hydroxyadipyl-CoA
12 5.3.3.3 crotonoyl-CoA vinylacetyl-CoA vinylacetyl-CoA Δ-isomerase abfD YP_001396399.1 Clostridium kluyveri DSM 555 4-hydroxybutyryl-CoA
          abfD P55792 Clostridium aminobutyricum 4-hydroxybutyryl-CoA
          abfD YP_001928843 Porphyromonas gingivalis ATCC 33277 4-hydroxybutyryl-CoA
12 4.2.1.a vinylacetyl-CoA 4-hydroxybutyryl -CoA 4-hydroxybutyryl-CoA dehydratase abfD YP_ 001396399.1 Clostridium kluyveri DSM 555 4-hydroxybutyryl-CoA
          abfD P55792 Clostridium aminobutyricum 4-hydroxybutyryl-CoA
          abfD YP_001928843 Porphyromonas gingivalis ATCC 33277 4-hydroxybutyryl-CoA
12 1.1.1.c 4-hydroxybutyryl-CoA 1,4-butanediol 4-hydroxybutyryl-CoA reductase (alcohol forming) adhE2 AAK09379.1 Clostridium acetobutylicum butanoyl-CoA
          mcr AAS20429.1 Chloroflexus aurantiacus malonyl-CoA
          FAR AAD38039.1 Simmondsia chinensis long chain acyl-CoA
12 1.2.1.b 4-hydroxybutyryl-CoA 4-hydroxybutanal 4-hydroxybutyryl-CoA reductase (or 4-hydroxybutanal dehydrogenase) sucD P38947.1 Clostridium kluyveri Succinyl-CoA
          sucD NP_904963.1 Porphyromonas gingivalis Succinyl-CoA
          Msed_0709 YP_001190808.1 Metallosphaera sedula Malonyl-CoA
12 1.1.1.a 4-hydroxybutanal 1,4-butanediol 1,4-butanediol dehydrogenase ADH2 NP_014032.1 Saccharymyces cerevisiae general
          yqhD NP_417484.1 Escherichia coli >C3
          4hbd L21902.1 Clostridium kluyveri DSM 555 Succinate semialdehyde

EXAMPLE XI


Exemplary BDO Pathway from Homoserine



[0464] This example describes an exemplary BDO pathway from homoserine.

[0465] Figure 13 depicts exemplary BDO pathways in which homoserine is converted to BDO. Enzymes of such an exemplary BDO pathway are listed in Table 23, along with exemplary genes encoding these enzymes.

[0466] Briefly, homoserine can be converted to 4-hydroxybut-2-enoate by homoserine deaminase (EC 4.3.1.a). Alternatively, homoserine can be converted to homoserine-CoA by homoserine CoA transferase (EC 2.8.3.a), homoserine-CoA hydrolase (EC 3.1.2.a) or homoserine-CoA ligase (or homoserine-CoA synthetase) (EC 6.2.1.a). Homoserine-CoA can be converted to 4-hydroxybut-2-enoyl-CoA by homoserine-CoA deaminase (EC 4.3.1.a). 4-Hydroxybut-2-enoate can be converted to 4-hydroxybut-2-enoyl-CoA by 4-hydroxybut-2-enoyl-CoA transferase (EC 2.8.3.a), 4-hydroxybut-2-enoyl-CoA hydrolase (EC 3.1.2.a), or 4-hydroxybut-2-enoyl-CoA ligase (or 4-hydroxybut-2-enoyl-CoA synthetase) (EC 6.2.1.a). Alternatively, 4-hydroxybut-2-enoate can be converted to 4-hydroxybutyrate by 4-hydroxybut-2-enoate reductase (EC 1.3.1.a). 4-Hydroxybutyrate can be converted to 4-hydroxybutyryl-coA by 4-hydroxybutyryl-CoA transferase (EC 2.8.3.a), 4-hydroxybutyryl-CoA hydrolase (EC 3.1.2.a), or 4-hydroxybutyryl-CoA ligase (or 4-hydroxybutyryl-CoA synthetase) (EC 6.2.1.a). 4-Hydroxybut-2-enoyl-CoA can be converted to 4-hydroxybutyryl-CoA by 4-hydroxybut-2-enoyl-CoA reductase (EC 1.3.1.a). 4-Hydroxybutyryl-CoA can be converted to 1,4-butanediol by 4-hydroxybutyryl-CoA reductase (alcohol forming) (EC 1.1.1.c). Alternatively, 4-hydroxybutyryl-CoA can be converted to 4-hydroxybutanal by 4-hydroxybutyryl-CoA reductase (or 4-hydroxybutanal dehydrogenase) (EC 1.2.1.b). 4-Hydroxybutanal can be converted to 1,4-butanediol by 1,4-butanediol dehydrogenase (EC 1.1.1.a).
TABLE 23. BDO pathway from homoserine.
FigureEC classDesired substrateDesired productEnzyme nameGene nameGenBank ID (if available)OrganismKnown Substrate
13 4.3.1.a homo serine 4-hydroxybut-2-enoate homo serine deaminase aspA NP_418562 Escherichia coli aspartate
          aspA P44324.1 Haemophilus influenzae aspartate
          aspA P07346 Pseudomonas fluorescens aspartate
13 2.8.3.a homo serine homoserine-CoA homoserine CoA transferase cat1, cat2, cat3 P38946.1, P38942.2, EDK35586.1 Clostridium kluyveri succinate, 4-hydroxybutyrate, butyrate
          gctA, gctB CAA57199.1, CAA57200.1 Acidaminococcus fermentans glutarate
          atoA, atoD P76459.1, P76458.1 Escherichia coli butanoate
13 3.1.2.a homo serine homoserine-CoA homoserine-CoA hydrolase tesB NP_414986 Escherichia coli adipyl-CoA
          acot12 NP_570103.1 Rattus norvegicus butyryl-CoA
          hibch Q6NVY1.2 Homo sapiens 3-hydroxypropanoy 1-CoA
13 6.2.1.a homo serine homoserine-CoA homoserine-CoA ligase (or homoserine-CoA synthetase) sucCD NP_415256.1, AAC73823.1 Escherichia coli succinate
          phl CAJ15517.1 Penicillium chrysogenum phenyl acetate
          bioW NP_390902.2 Bacillus subtilis 6-carboxyhexanoat e
13 4.3.1.a homoserine-CoA 4-hydroxybut-2-enoyl-CoA homoserine-CoA deaminase acll CAG29274.1 Clostridium propionicum beta-alanyl-CoA
          acl2 CAG29275.1 Clostridium propionicum beta-alanyl-CoA
          MXAN_438 5 YP_632558.1 Myxococcus xanthus beta-alanyl-CoA
13 2.8.3.a 4-hydroxybut-2-enoate 4-hydroxybut-2-enoyl-CoA 4-hydroxybut-2-enoyl-CoA transferase cat1, cat2, cat3 P38946.1, P38942.2, EDK35586.1 Clostridium kluyveri succinate, 4-hydroxybutyrate, butyrate
          gctA, gctB CAA57199.1, CAA57200.1 Acidaminococcus fermentans glutarate
          atoA, atoD P76459.1, P76458.1 Escherichia coli butanoate
13 3.1.2.a 4-hydroxybut-2-enoate 4-hydroxybut-2-enoyl-CoA 4-hydroxybut-2-enoyl-CoA hydrolase tesB NP_414986 Escherichia coli adipyl-CoA
          acot12 NP_570103.1 Rattus norvegicus butyryl-CoA
          hibch Q6NVY1.2 Homo sapiens 3-hydroxypropanoy 1-CoA
13 6.2.1.a 4-hydroxybut-2-enoate 4-hydroxybut-2-enoyl-CoA 4-hydroxybut-2-enoyl-CoA ligase (or 4-hydroxybut-2-enoyl-CoA synthetase) sucCD NP_415256.1, AAC73823.1 Escherichia coli succinate
          phl CAJ15517.1 Penicillium chrysogenum phenyl acetate
          bioW NP_390902.2 Bacillus subtilis 6-carboxyhexanoat e
13 1.3.1.a 4-hydroxybut-2-enoate 4-hydroxybutyrate 4-hydroxybut-2-enoate reductase enr CAA71086.1 Clostridium tyrobutyricum  
          enr CAA76083.1 Clostridium kluyveri  
          enr YP_430895.1 Moorella thermoacetica  
13 2.8.3.a 4-hydroxybutyrate 4-hydroxybutyryl-coA 4-hydroxybutyryl-CoA transferase cat1, cat2, cat3 P38946.1, P38942.2, EDK35586.1 Clostridium kluyveri succinate, 4-hydroxybutyrate, butyrate
          gctA, gctB CAA57199.1, CAA57200.1 Acidaminococcus fermentans glutarate
          atoA, atoD P76459.1, P76458.1 Escherichia coli butanoate
13 3.1.2.a 4-hydroxybutyrate 4-hydroxybutyryl-coA 4-hydroxybutyryl-CoA hydrolase tesB NP_414986 Escherichia coli adipyl-CoA
          acot12 NP_570103.1 Rattus norvegicus butyryl-CoA
          hibch Q6NVY1.2 Homo sapiens 3-hydroxypropano yl-CoA
13 6.2.1.a 4-hydroxybutyrate 4-hydroxybutyryl-coA 4-hydroxybutyryl-CoA ligase (or 4-hydroxybutyryl-CoA synthetase) sucCD NP_415256.1, AAC73823.1 Escherichia coli succinate
          phl CAJ15517.1 Penicillium chrysogenum phenyl acetate
          bioW NP_390902.2 Bacillus subtilis 6-carboxyhexanoat e
13 1.3.1.a 4-hydroxybut-2-enoyl-CoA 4-hydroxybutyryl-CoA 4-hydroxybut-2-enoyl-CoA reductase bcd, etfA, etfB NP_349317.1, NP_349315.1, NP_349316.1 Clostridium acetobutylicum  
          TER Q5EU90.1 Euglena gracilis  
          TDE0597 NP_971211.1 Treponema denticola  
8 1.1.1.c 4-hydroxybutyryl-CoA 1,4-butanediol 4-hydroxybutyryl-CoA reductase (alcohol forming) adhE2 AAK09379.1 Clostridium acetobutylicum butanoyl-CoA
          mcr AAS20429.1 Chloroflexus aurantiacus malonyl-CoA
          FAR AAD38039.1 Simmondsia chinensis long chain acyl-CoA
8 1.2.1.b 4-hydroxybutyryl-CoA 4-hydroxybutanal 4-hydroxybutyryl-CoA reductase (or 4-hydroxybutanal dehydrogenase) sucD P38947.1 Clostridium kluyveri Succinyl-CoA
          sucD NP_904963.1 Porphyromonas gingivalis Succinyl-CoA
          Msed_0709 YP_001190808.1 Metallosphaera sedula Malonyl-CoA
8 1.1.1.a 4-hydroxybutanal 1,4-butanediol 1,4-butanediol dehydrogenase ADH2 NP_014032.1 Saccharymyces cerevisiae general
          yqhD NP_417484.1 Escherichia coli >C3
          4hbd L21902.1 Clostridium kluyveri DSM 555 Succinate semialdehyde

EXAMPLE XII


BDO Producing Strains Expressing Succinyl-CoA Synthetase



[0467] This example desribes increased production of BDO in BDO producing strains expressing succinyl-CoA synthetase.

[0468] As discussed above, succinate can be a precursor for production of BDO by conversion to succinyl-CoA (see also WO2008/115840, WO 2009/023493, U.S. publication 2009/0047719, U.S. publication 2009/0075351). Therefore, the host strain was genetically modified to overexpress the E. coli sucCD genes, which encode succinyl-CoA synthetase. The nucleotide sequence of the E. coli sucCD operon is shown in Figure 14A, and the amino acid sequences for the encoded succinyl-CoA synthetase subunits are shown in Figures 14B and 14C. Briefly, the E. coli sucCD genes were cloned by PCR from E. coli chromosomal DNA and introduced into multicopy plasmids pZS13, pZA13, and pZE33 behind the PA1lacO-1 promoter (Lutz and Bujard, Nucleic Acids Res. 25:1203-1210 (1997)) using standard molecular biology procedures.

[0469] The E. coli sucCD genes, which encode the succinyl-CoA synthetase, were overexpressed. The results showed that introducing into the strains sucCD to express succinyl-CoA synthetase improved BDO production in various strains compared to either native levels of expression or expression of cat1, which is a succinyl-CoA/acetyl-CoA transferase. Thus, BDO production was improved by overexpressing the native E. coli sucCD genes encoding succinyl-CoA synthetase.

EXAMPLE XIII


Expression of Heterologous Genes Encoding BDO Pathway Enzymes



[0470] This example describes the expression of various non-native pathway enzymes to provide improved production of BDO.

[0471] Alpha-ketoglutarate decarboxylase. The Mycobacterium bovis sucA gene encoding alpha-ketoglutarate decarboxylase was expressed in host strains. Overexpression of M. bovis sucA improved BDO production (see also WO2008/115840, WO 2009/023493, U.S. publication 2009/0047719, U.S. publication 2009/0075351). The nucleotide and amino acid sequences of M. bovis sucA and the encoded alpha-ketoglutarate decarboxylase are shown in Figure 15.

[0472] To construct the M. bovis sucA expressing strains, fragments of the sucA gene encoding the alpha-ketoglutarate decarboxylase were amplified from the genomic DNA of Mycobacterium bovis BCG (ATCC 19015; American Type Culture Collection, Manassas VA) using primers shown below. The full-length gene was assembled by ligation reaction of the four amplified DNA fragments, and cloned into expression vectors pZS13 and pZE23 behind the PA1lacO-1 promoter (Lutz and Bujard, Nucleic Acids Res. 25:1203-1210 (1997)). The nucleotide sequence of the assembled gene was verified by DNA sequencing.

Primers for fragment 1:

5'-ATGTACCGCAAGTTCCGC-3' (SEQ ID NO:3)

5'-CAATTTGCCGATGCCCAG-3' (SEQ ID NO:4)

Primers for fragment 2:

5'-GCTGACCACTGAAGACTTTG-3' (SEQ ID NO:5)

5'-GATCAGGGCTTCGGTGTAG-3' (SEQ ID NO:6)

Primers for fragment 3:

5'-TTGGTGCGGGCCAAGCAGGATCTGCTC-3' (SEQ ID NO:7)

5'-TCAGCCGAACGCCTCGTCGAGGATCTCCTG-3' (SEQ ID NO:8)

Primers for fragment 4:

5'-TGGCCAACATAAGTTCACCATTCGGGCAAAAC-3' (SEQ ID NO:9)

5'-TCTCTTCAACCAGCCATTCGTTTTGCCCG-3' (SEQ ID NO:10)



[0473] Functional expression of the alpha-ketoglutarate decarboxylase was demonstrated using both in vitro and in vivo assays. The SucA enzyme activity was measured by following a previously reported method (Tian et al., Proc. Natl. Acad. Sci. USA 102:10670-10675 (2005)). The reaction mixture contained 50 mM potassium phosphate buffer, pH 7.0, 0.2 mM thiamine pyrophosphate, 1 mM MgCl2, 0.8 mM ferricyanide, 1 mM alpha-ketoglutarate and cell crude lysate. The enzyme activity was monitored by the reduction of ferricyanide at 430 nm. The in vivo function of the SucA enzyme was verified using E. coli whole-cell culture. Single colonies of E. coli MG1655 lacIq transformed with plasmids encoding the SucA enzyme and the 4-hydroxybutyrate dehydrogenase (4Hbd) was inoculated into 5 mL of LB medium containing appropriate antibiotics. The cells were cultured at 37°C overnight aerobically. A 200 uL of this overnight culture was introduced into 8 mL of M9 minimal medium (6.78 g/L Na2HPO4, 3.0 g/L KH2PO4, 0.5 g/L NaCl, 1.0 g/L NH4Cl, 1 mM MgSO4, 0.1 mM CaCl2) supplemented with 20 g/L glucose, 100 mM 3-(N-morpholino)propanesulfonic acid (MOPS) to improve the buffering capacity, 10 µg/mL thiamine, and the appropriate antibiotics. Microaerobic conditions were established by initially flushing capped anaerobic bottles with nitrogen for 5 minutes, then piercing the septum with a 23G needle following inoculation. The needle was kept in the bottle during growth to allow a small amount of air to enter the bottles. The protein expression was induced with 0.2 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) when the culture reached mid-log growth phase. As controls, E. coli MG1655 lacIq strains transformed with only the plasmid encoding the 4-hydroxybutyrate dehydrogenase and only the empty vectors were cultured under the same condition (see Table 23). The accumulation of 4-hydroxybutyrate (4HB) in the culture medium was monitored using LCMS method. Only the E. coli strain expressing the Mycobacterium alpha-ketoglutarate decarboxylase produced significant amount of 4HB (see Figure 16).
Table 24. Three strains containing various plasmid controls and encoding sucA and 4-hydroxybutyrate dehydrogenase.
 HostpZE13pZA33
1 MG1655 laclq vector vector
2 MG1655 laclq vector 4hbd
3 MG1655 laclq sucA 4hbd


[0474] A separate experiment demonstrated that the alpha-ketoglutarate decarboxylase pathway functions independently of the reductive TCA cycle. E. coli strain ECKh-401 (ΔadhE ΔldhA ΔpflB ΔlpdA::K.p.lpdA322 Δmdh ΔarcA) was used as the host strain (see Table 25). All the three constructs contained the gene encoding 4HB dehydrogenase (4Hbd). Construct 1 also contained the gene encoding the alpha-ketoglutarate decarboxylase (sucA). Construct 2 contained the genes encoding the succinyl-CoA synthetase (sucCD) and the CoA-dependent succinate semialdehyde dehydrogenase (sucD), which are required for the synthesis of 4HB via the reductive TCA cycle. Construct 3 contains all the genes from 1 and 2. The three E. coli strains were cultured under the same conditions as described above except the second culture was under the micro-aerobic condition. By expressing the SucA enzyme, construct 3 produced more 4HB than construct 2, which relies on the reductive TCA cycle for 4HB synthesis (see Figure 17).

[0475] Further support for the contribution of alpha-ketoglutarate decarboxylase to production of 4HB and BDO was provided by flux analysis experiments. Cultures of ECKh-432, which contains both sucCD-sucD and sucA on the chromosome, were grown in M9 minimal medium containing a mixture of 1-13C-glucose (60%) and U-13C-glucose (40%). The biomass was harvested, the protein isolated and hydrolyzed to amino acids, and the label distribution of the amino acids analyzed by gas chromatography-mass spectrometry (GCMS) as described previously (Fischer and Sauer, Eur. J. Biochem. 270:880-891 (2003)). In addition, the label distribution of the secreted 4HB and BDO was analyzed by GCMS as described in WO2008115840 A2. This data was used to calculate the intracellular flux distribution using established methods (Suthers et al., Metab. Eng. 9:387-405 (2007)). The results indicated that between 56% and 84% of the alpha-ketoglutarate was channeled through alpha-ketoglutarate decarboxylase into the BDO pathway. The remainder was oxidized by alpha-ketoglutarate dehydrogenase, which then entered BDO via the succinyl-CoA route.

[0476] These results demonstrate 4-hydroxybutyrate producing strains that contain the sucA gene from Mycobacterium bovis BCG expressed on a plasmid. When the plasmid encoding this gene is not present, 4-hydroxybutyrate production is negligible when sucD (CoA-dependant succinate semialdehyde dehydrogenase) is not expressed. The M. bovis gene is a close homolog of the Mycobacterium tuberculosis gene whose enzyme product has been previously characterized (Tian et al., supra, 2005).

[0477] Succinate semialdehyde dehydrogenase (CoA-dependent), 4-hydroxybutyrate dehydrogenase, and 4-hydroxybutyryl-CoA/acetyl-CoA transferase. The genes from Porphyromonas gingivalis W83 can be effective components of the pathway for 1,4-butanediol production (see also WO2008/115840, WO 2009/023493, U.S. publication 2009/0047719, U.S. publication 2009/0075351). The nucleotide sequence of CoA-dependent succinate semialdehyde dehydrogenase (sucD) from Porphyromonas gingivalis is shown in Figure 18A, and the encoded amino acid sequence is shown in Figure 18B. The nucleotide sequence of 4-hydroxybutyrate dehydrogenase (4hbd) from Porphymonas gingivalis is shown in Figure 19A, and the encoded amino acid seqence is shown in Figure 19B. The nucleotide sequence of 4-hydroxybutyrate CoA transferase (cat2) from Porphyromonas gingivalis is shown in Figure 20A, and the encoded amino acid sequence is shown in Figure 20B.

[0478] Briefly, the genes from Porphyromonas gingivalis W83 encoding succinate semialdehyde dehydrogenase (CoA-dependent) and 4-hydroxybutyrate dehydrogenase, and in some cases additionally 4-hydroxybutyryl-CoA/acetyl-CoA, were cloned by PCR from P. gingivalis chromosomal DNA and introduced into multicopy plasmids pZS13, pZA13, and pZE33 behind the PA1lacO-1 promoter (Lutz and Bujard, Nucleic Acids Res. 25:1203-1210 (1997)) using standard molecular biology procedures. These plasmids were then introduced into host strains.

[0479] The Porphyromonas gingivalis W83 genes were introduced into production strains as described above. Some strains included only succinate semialdehyde dehydrogenase (CoA-dependant) and 4-hydroxybutyrate dehydrogenase without 4-hydroxybutyryl-CoA/acetyl-CoA transferase.

[0480] Butyrate kinase and phosphotransbutyrylase. Butyrate kinase (BK) and phosphotransbutyrylase (PTB) enzymes can be utlized to produce 4-hydroxybutyryl-CoA (see also WO2008/115840, WO 2009/023493, U.S. publication 2009/0047719, U.S. publication 2009/0075351). In particular, the Clostridium acetobutylicum genes, buk1 and ptb, can be utilized as part of a functional BDO pathway.

[0481] Initial experiments involved the cloning and expression of the native C. acetobutylicum PTB (020) and BK (021) genes in E. coli. Where required, the start codon and stop codon for each gene were modified to "ATG" and "TAA," respectively, for more optimal expression in E. coli. The C. acetobutylicum gene sequences (020N and 021N) and their corresponding translated peptide sequences are shown in Figures 21 and 22.

[0482] The PTB and BK genes exist in C. acetobutylicum as an operon, with the PTB (020) gene expressed first. The two genes are connected by the sequence "atta aagttaagtg gaggaatgtt aac" (SEQ ID NO:11) that includes a re-initiation ribosomal binding site for the downstream BK (021) gene. The two genes in this context were fused to lac-controlled promoters in expression vectors for expression in E. coli (Lutz and Bujard, Nucleic Acids Res. 25:1203-1210 (1997)).

[0483] Expression of the two proteins from these vector constructs was found to be low in comparison with other exogenously expressed genes due to the high incidence of codons in the C. acetobutylicum genes that occur only rarely in E. coli. Therefore new 020 and 021 genes were predicted that changed rare codons for alternates that are more highly represented in E. coli gene sequences. This method of codon optimization followed algorithms described previously (Sivaraman et al., Nucleic Acids Res. 36:e16(2008)). This method predicts codon replacements in context with their frequency of occurrence when flanked by certain codons on either side. Alternative gene sequences for 020 (Figure 23) and 021 (Figure 24) were determined in which increasing numbers of rare codons were replaced by more prevalent codons (A<B<C<D) based on their incidence in the neighboring codon context. No changes in actual peptide sequence compared to the native 020 and 021 peptide sequences were introduced in these predicted sequences.

[0484] The improvement in expression of the BK and PTB proteins resulting from codon optimization is shown in Figure 25A. Expression of the native gene sequences is shown in lane 2, while expression of the 020B-021B and 020C-021C is shown in lanes 3 and 4, respectively. Higher levels of protein expression in the codon-optimized operons 020B-021B (2021B) and 020C-021C (2021C) also resulted in increased activity compared to the native operon (2021n) in equivalently-expressed E. coli crude extracts (Figure 25B).

[0485] The codon optimized operons were expressed on a plasmid in strain ECKh-432 (ΔadhE ΔldhA ΔpflB ΔlpdA::K.p.lpdA322 Δmdh ΔarcA gltAR163L fimD:: E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd fimD:: M. bovis sucA, C. kluyveri 4hbd) along with the C. acetobutylicum aldehyde dehydrogenase to provide a complete BDO pathway. Cells were cultured in M9 minimal medium containing 20 g/L glucose, using a 23G needle to maintain microaerobic conditions as described above. The resulting conversion of glucose to the final product BDO was measured. Also measured was the accumulation of gamma-butyrylactone (GBL), which is a spontaneously rearranged molecule derived from 4Hb-CoA, the immediate product of the PTB-BK enzyme pair. Figure 26 shows that expression of the native 2021n operon resulted in comparable BDO levels to an alternative enzyme function, Cat2 (034), that is capable of converting 4HB and free CoA to 4HB-CoA. GBL levels of 034 were significantly higher than 2021n, suggesting that the former enzyme has more activity than PTB-BK expressed from the native genes. However levels of both BDO and GBL were higher than either 034 or 2021n when the codon-optimized variants 2021B and 2021C were expressed, indicating that codon optimization of the genes for PTB and BK significantly increases their contributions to BDO synthesis in E. coli.

[0486] These results demonstrate that butyrate kinase (BK) and phosphotransbutyrylase (PTB) enzymes can be employed to convert 4-hydroxybutyrate to 4-hydroxybutyryl-CoA. This eliminates the need for a transferase enzyme such as 4-hydoxybutyryl-CoA/Acetyl-CoA transferase, which would generate one mole of acetate per mol of 4-hydroxybutyryl-CoA produced. The enzymes from Clostridium acetobutylicum are present in a number of engineered strains for BDO production.

[0487] 4-hydroxybutyryl-CoA reductase. The Clostridium beijerinckii ald gene can be utilized as part of a functional BDO pathway (see also WO2008/115840, WO 2009/023493, U.S. publication 2009/0047719, U.S. publication 2009/0075351). The Clostridium beijerinckii ald can also be utilized to lower ethanol production in BDO producing strains. Additionally, a specific codon-optimized ald variant (GNM0025B) was found to improve BDO production.

[0488] The native C. beijerinckii ald gene (025n) and the predicted protein sequence of the enzyme are shown in Figure 27. As was seen for the Clostridium acetobutylicum PTB and BK genes, expression of the native C. beijerinckii ald gene was very low in E. coli. Therefore, four codon-optimized variants for this gene were predicted. Figures 28A-28D show alternative gene sequences for 025, in which increasing numbers of rare codons are replaced by more prevalent codons (A<B<C<D) based on their incidence in the neighboring codon context (25A, P=0.05; 25B, P=0.1; 25C, P=0.15; 25D, P=1). No changes in actual peptide sequence compared to the native 025 peptide sequence were introduced in these predictions. Codon optimization significantly increased expression of the C. beijerinckii ald (see Figure 29), which resulted in significantly higher conversion of glucose to BDO in cells expressing the entire BDO pathway (Figure 30A).

[0489] The native and codon-optimized genes were expressed on a plasmid along with P. gingivalis Cat2, in the host strain ECKh-432 (ΔadhE ΔldhA ΔpflB ΔlpdA::K.p.lpdA322 Δmdh ΔarcA gltAR163L ΔackA fimD:: E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd fimD:: M. bovis sucA, C. kluyveri 4hbd), thus containing a complete BDO pathway. Cells were cultured microaerobically in M9 minimal medium containing 20 g/L glucose as described above. The relative production of BDO and ethanol by the C. beijerinckii Aid enzyme (expressed from codon-optimized variant gene 025B) was compared with the C. acetobutylicum AdhE2 enzyme (see Figure 30B). The C. acetobutylicum AdhE2 enzyme (002C) produced nearly 4 times more ethanol than BDO. In comparison, the C. beijerinckii Aid (025B) (in conjunction with an endogenous ADH activity) produced equivalent amounts of BDO, yet the ratio of BDO to ethanol production was reversed for this enzyme compared to 002C. This suggests that the C. beijerinckii Aid is more specific for 4HB-CoA over acetyl-coA than the C. acetobutylicum AdhE2, and therefore the former is the preferred enzyme for inclusion in the BDO pathway.

[0490] The Clostridium beijerinckii ald gene (Toth et al., Appl. Environ. Microbiol. 65:4973-4980 (1999)) was tested as a candidate for catalyzing the conversion of 4-hydroxybutyryl-CoA to 4-hydroxybutanal. Over fifty aldehyde dehydrogenases were screened for their ability to catalyze the conversion of 4-hydroxybutyryl-CoA to 4-hydroxybutyraldehyde. The C. beijerinckii ald gene was chosen for implementation into BDO-producing strains due to the preference of this enzyme for 4-hydroxybutyryl-CoA as a substrate as opposed to acetyl-CoA. This is important because most other enzymes with aldehyde dehydrogenase functionality (for example, adhE2 from C. acetobutylicum (Fontaine et al., J Bacteriol. 184:821-830 (2002)) preferentially convert acetyl-CoA to acetaldehyde, which in turn is converted to ethanol. Utilization of the C. beijerinckii gene lowers the amount of ethanol produced as a byproduct in BDO-producing organisms. Also, a codon-optimized version of this gene expresses very well in E. coli (Sivaraman et al., Nucleic Acids Res. 36:e16 (2008)).

[0491] 4-hydroxybutanal reductase. 4-hydroxybutanal reductase activity of adh1 from Geobacillus thermoglucosidasius (M10EXG) was utilized. This led to improved BDO production by increasing 4-hydroxybutanal reductase activity over endogenous levels.

[0492] Multiple alcohol dehydrogenases were screened for their ability to catalyze the reduction of 4-hydroxybutanal to BDO. Most alcohol dehydrogenases with high activity on butyraldehyde exhibited far lower activity on 4-hydroxybutyraldehyde. One notable exception is the adh1 gene from Geobacillus thermoglucosidasius M10EXG (Jeon et al., J. Biotechnol. 135:127-133 (2008)) (GNM0084), which exhibits high activity on both 4-hydroxybutanal and butanal.

[0493] The native gene sequence and encoded protein sequence if the adhl gene from Geobacillus thermoglucosidasius are shown in Figure 31. The G. thermoglucosidasius ald1 gene was expressed in E. coli.

[0494] The Adh1 enzyme (084) expressed very well from its native gene in E. coli (see Figure 32A). In ADH enzyme assays, the E. coli expressed enzyme showed very high reductive activity when butyraldehyde or 4HB-aldehyde were used as the substrates (see Figure 32B). The Km values determined for these substrates were 1.2 mM and 4.0 mM, respectively. These activity values showed that the Adh1 enzyme was the most active on reduction of 4HB-aldehyde of all the candidates tested.

[0495] The 084 enzyme was tested for its ability to boost BDO production when coupled with the C. beijerinckii ald. The 084 gene was inserted behind the C. beijerinckii ald variant 025B gene to create a synthetic operon that results in coupled expression of both genes. Similar constructs linked 025B with other ADH candidate genes, and the effect of including each ADH with 025B on BDO production was tested. The host strain used was ECKh-459 (ΔadhE ldhA ΔpflB ΔlpdA::fnr-pflB6-K.p.lpdA322 Δmdh ΔarcA gltAR163L fimD:: E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd fimD:: M. bovis sucA, C. kluyveri 4hbd fimD:: C. acetobutylicum buk1, C. acetobutylicum ptb), which contains the remainder of the BDO pathway on the chromosome. The 084 ADH expressed in conjunction with 025B showed the highest amount of BDO (right arrow in Figure 33) when compared with 025B only (left arrow in Figure 33) and in conjunction with endogenous ADH functions. It also produced more BDO than did other ADH enzymes when paired with 025B, indicated as follows: 026A-C, codon-optimized variants of Clostridium acetobutylicum butanol dehydrogenase; 050, Zymomonas mobilis alcohol dehydrogenase I; 052, Citrobacter freundii 1,3-propanediol dehydrogenase; 053, Lactobacillus brevis 1,3-propanediol dehydrogenase; 057, Bacteroides fragilis lactaldehyde reductase; 058, E. coli 1,3-propanediol dehydrogenase; 071, Bacillus subtilis 168 alpha-ketoglutarate semialdehyde dehydrogenase. The constructs labeled "PT51acO" are those in which the genes are driven by the PT5lacO promoter. In all other cases, the PA1lacO-1 promoter was used. This shows that inclusion of the 084 ADH in the BDO pathway increased BDO production.

EXAMPLE XIV


BDO Producing Strains Expressing Pyruvate Dehydrogenase



[0496] This example describes the utilization of pyruvate dehydrogenase (PDH) to enhance BDO production. Heterologous expression of the Klebsiella pneumonia lpdA gene was used to enhance BDO production.

[0497] Computationally, the NADH-generating conversion of pyruvate to acetyl-CoA is required to reach the maximum theoretical yield of 1,4-butanediol (see also WO2008/115840, WO 2009/023493, U.S. publication 2009/0047719, U.S. publication 2009/0075351; WO 2008/018930; Kim et al., Appl. Environ. Microbiol. 73:1766-1771 (2007); Kim et al., J. Bacteriol. 190:3851-3858 (2008); Menzel et al., J. Biotechnol. 56:135-142 (1997)). Lack of PDH activity was shown to reduce the maximum anaerobic theoretical yield of BDO by 11% if phosphoenolpyruvate carboxykinase (PEPCK) activity cannot be attained and by 3% if PEPCK activity can be attained. More importantly, however, absence of PDH activity in the OptKnock strain #439, described in WO 2009/023493 and U.S. publication 2009/0047719, which has the knockout of ADHEr, ASPT, LDH_D, MDH and PFLi, would reduce the maximum anaerobic yield of BDO by 54% or by 43% if PEPCK activity is absent or present, respectively. In the presence of an external electron acceptor, lack of PDH activity would reduce the maximum yield of the knockout strain by 10% or by 3% assuming that PEPCK activity is absent or present, respectively.

[0498] PDH is one of the most complicated enzymes of central metabolism and is comprised of 24 copies of pyruvate decarboxylase (E1) and 12 molecules of dihydrolipoyl dehydrogenase (E3), which bind to the outside of the dihydrolipoyl transacetylase (E2) core. PDH is inhibited by high NADH/NAD, ATP/ADP, and Acetyl-CoA/CoA ratios. The enzyme naturally exhibits very low activity under oxygen-limited or anaerobic conditions in organisms such as E. coli due in large part to the NADH sensitivity of E3, encoded by lpdA. To this end, an NADH-insensitive version of the lpdA gene from Klebsiella pneumonia was cloned and expressed to increase the activity of PDH under conditions where the NADH/NAD ratio is expected to be high.

[0499] Replacement of the native lpdA. The pyruvate dehydrogenase operon of Klebsiella pneumoniae is between 78 and 95% identical at the nucleotide level to the equivalent operon of E. coli. It was shown previously that K. pneumoniae has the ability to grow anaerobically in presence of glycerol (Menzel et al., J. Biotechnol. 56:135-142 (1997); Menzel et al., Biotechnol. Bioeng. 60:617-626 (1998)). It has also been shown that two mutations in the lpdA gene of the operon of E. coli would increase its ability to grow anaerobically (Kim et al.. Appl. Environ. Microbiol. 73:1766-1771 (2007); Kim et al., J. Bacteriol. 190:3851-3858 (2008)). The lpdA gene of K. pneumonia was amplified by PCR using genomic DNA (ATCC700721D) as template and the primers KP-lpdA-Bam (5'-acacgcggatccaacgtcccgg-3')(SEQ ID NO:12) and KP-lpdA-Nhe (5'-agcggctccgctagccgcttatg-3')(SEQ ID NO:13). The resulting fragment was cloned into the vector pCR-BluntII-TOPO (Invitrogen; Carlsbad CA), leading to plasmid pCR-KP-lpdA.

[0500] The chromosomal gene replacement was performed using a non-replicative plasmid and the sacB gene from Bacillus subtilis as a means of counterselection (Gay et al., J. Bacteriol. 153:1424-1431 (1983)). The vector used is pRE118 (ATCC87693) deleted of the oriT and IS sequences, which is 3.6 kb in size and carrrying the kanamycin resistance gene. The sequence was confirmed, and the vector was called pRE118-V2 (see Figure 34).

[0501] The E. coli fragments flanking the lpdA gene were amplified by PCR using the combination of primers: EC-aceF-Pst (5'-aagccgttgctgcagctcttgagc-3')(SEQ ID NO:14) + EC-aceF-Bam2 (5'-atctccggcggtcggatccgtcg-3')(SEQ ID NO:15) and EC-yacH-Nhe (5'-aaagcggctagccacgccgc-3')(SEQ ID NO:16) + EC-yacH-Kpn (5'-attacacgaggtacccaacg-3')(SEQ ID NO:17). A BamHI-XbaI fragment containing the lpdA gene of K. pneumonia was isolated from plasmid pCR-KP-lpdA and was then ligated to the above E. coli fragments digested with PstI +BamHI and NheI-KpnI respectively, and the pRE118-V2 plasmid digested with KpnI and PstI. The resulting plasmid (called pRE118-M2.1 lpdA yac) was subjected to Site Directed Mutagenesis (SDM) using the combination of primers KP-lpdA-HisTyr-F (5'-atgctggcgtacaaaggtgtcc-3')(SEQ ID NO:18) and (5'-ggacacctttgtacgccagcat-3')(SEQ ID NO:19) for the mutation of the His 322 residue to a Tyr residue or primers KP-lpdA-GluLys-F (5'-atcgcctacactaaaccagaagtgg-3')(SEQ ID NO:20) and KP-lpdA-GluLys-R (5'-ccacttctggtttagtgtaggcgat-3')(SEQ ID NO:21) for the mutation of the residue Glu 354 to Lys residue. PCR was performed with the Polymerase Pfu Turbo (Stratagene; San Diego CA). The sequence of the entire fragment as well as the presence of only the desired mutations was verified. The resulting plasmid was introduced into electro competent cells of E. coli ΔadhE::Frt-ΔldhA::Frt by transformation. The first integration event in the chromosome was selected on LB agar plates containing Kanamycin (25 or 50 mg/L). Correct insertions were verified by PCR using 2 primers, one located outside the region of insertion and one in the kanamycin gene (5'-aggcagttccataggatggc-3')(SEQ ID NO:22). Clones with the correct insertion were selected for resolution. They were sub-cultured twice in plain liquid LB at the desired temperature and serial dilutions were plated on LB-no salt-sucrose 10% plates. Clones that grew on sucrose containing plates were screened for the loss of the kanamycin resistance gene on LB-low salt agar medium and the lpdA gene replacement was verified by PCR and sequencing of the encompassing region. Sequence of the insertion region was verified, and is as described below. One clone (named 4-4-P1) with mutation Glu354Lys was selected. This clone was then transduced with P1 lysate of E. coli ΔPflB::Frt leading to strain ECKh-138 (ΔadhE ΔldhA ΔpflB ΔlpdA::K.p.lpdA322).

[0502] The sequence of the ECKh-138 region encompassing the aceF and lpdA genes is shown in Figure 35. The K. pneumonia lpdA gene is underlined, and the codon changed in the Glu354Lys mutant shaded. The protein sequence comparison of the native E. coli lpdA and the mutant K. pneumonia lpdA is shown in Figure 36.

[0503] To evaluate the benefit of using K. pneumoniae lpdA in a BDO production strain, the host strains AB3 and ECKh-138 were transformed with plasmids expressing the entire BDO pathway from strong, inducible promoters. Specifically, E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd were expressed on the medium copy plasmid pZA33, and P. gingivalis Cat2 and C. acetobutylicum AdhE2 were expressed on the high copy plasmid pZE13. These plasmids have been described in the literature (Lutz and H. Bujard, Nucleic Acids Res 25:1203-1210 (1997)), and their use for BDO pathway expression is described in Example XIII and WO2008/115840.

[0504] Cells were grown anaerobically at 37°C in M9 minimal medium (6.78 g/L Na2HPO4, 3.0 g/L KH2PO4, 0.5 g/L NaCl, 1.0 g/L NH4Cl, 1 mM MgSO4, 0.1 mM CaCl2) supplemented with 20 g/L glucose, 100 mM 3-(N-morpholino)propanesulfonic acid (MOPS) to improve the buffering capacity, 10 µg/mL thiamine, and the appropriate antibiotics. Microaerobic conditions were established by initially flushing capped anaerobic bottles with nitrogen for 5 minutes, then piercing the septum with a 23G needle following inoculation. The needle was kept in the bottle during growth to allow a small amount of air to enter the bottles. 0.25 mM IPTG was added when OD600 reached approximately 0.2 to induce the pathway genes, and samples taken for analysis every 24 hours following induction. The culture supernatants were analyzed for BDO, 4HB, and other by-products as described in Example II and in WO2008/115840. BDO and 4HB production in ECKh-138 was significantly higher after 48 hours than in AB3 or the host used in previous work, MG1655 ΔldhA (Figure 37).

[0505] PDH promoter replacement. It was previously shown that the replacement of the pdhR repressor by a transcriptional fusion containing the Fnr binding site, one of the pflB promoters, and its ribosome binding site (RBS), thus leading to expression of the aceEF-lpd operon by an anaerobic promoter, should increase pdh activity anaerobically (Zhou et al., Biotechnol. Lett. 30:335-342 (2008)). A fusion containing the Fnr binding site, the pflB-p6 promoter and an RBS binding site were constructed by overlapping PCR. Two fragments were amplified, one using the primers aceE-upstream-RC (5'-tgacatgtaacacctaccttctgtgcctgtgccagtggttgctgtgatatagaag-3')(SEQ ID NO:23) and pflBp6-Up-Nde (5'- ataataatacatatgaaccatgcgagttacgggcctataagccaggcg-3')(SEQ ID NO:24) and the other using primers aceE-EcoRV-EC (5'- agtttttcgatatctgcatcagacaccggcacattgaaacgg-3')(SEQ ID NO:25) and aceE-upstream (5'- ctggcacaggcacagaaggtaggtgttacatgtcagaacgtttacacaatgacgtggatc-3')(SEQ ID NO:26). The tw fragments were assembled by overlapping PCR, and the final DNA fragment was digested with the restriction enzymes NdeI and BamHI. This fragment was subsequently introduced upstream of the aceE gene of the E. coli operon using pRE118-V2 as described above. The replacement was done in strains ECKh-138 and ECKh-422. The nucleotide sequence encompassing the 5' region of the aceE gene was verified and is shown in Figure 37. Figure 37 shows the nucleotide sequence of 5' end of the aceE gene fused to the pflB-p6 promoter and ribosome binding site (RBS). The 5' italicized sequence shows the start of the aroP gene, which is transcribed in the opposite direction from the pdh operon. The 3' italicized sequence shows the start of the aceE gene. In upper case: pflB RBS. Underlined: FNR binding site. In bold: pflB-p6 promoter sequence.

[0506] lpdA promoter replacement. The promoter region containing the fnr binding site, the pflB-p6 promoter and the RBS of the pflB gene was amplified by PCR using chromosomal DNA template and primers aceF-pflBp6-fwd (5'- agacaaatcggttgccgtttgttaagccaggcgagatatgatctatatc-3')(SEQ ID NO:27) and lpdA-RBS-B-rev (5'-gagttttgatttcagtactcatcatgtaacacctaccttcttgctgtgatatag-3')(SEQ ID NO:28). Plasmid 2-4a was amplified by PCR using primers B-RBS-lpdA fwd (5'-ctatatcacagcaagaaggtaggtgttacatgatgagtactgaaatcaaaactc-3')(SEQ ID NO:29) and pflBp6-aceF-rev (5'- gatatagatcatatctcgcctggcttaacaaacggcaaccgatttgtct-3')(SEQ ID NO:30). The two resulting fragments were assembled using the BPS cloning kit (BPS Bioscience; San Diego CA). The resulting construct was sequenced verified and introduced into strain ECKh-439 using the pRE118-V2 method described above. The nucleotide sequence encompassing the aceF-lpdA region in the resulting strain ECKh-456 is shown in Figure 39.

[0507] The host strain ECKh-439 (ΔadhE ΔldhA ΔpflB ΔlpdA::K.p.lpdA322 Δmdh ΔarcA gltAR163L ackA fimD:: E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd fimD:: M. bovis sucA, C. kluyveri 4hbd), the construction of which is described below, and the pdhR and lpdA promoter replacement derivatives ECKh-455 and ECKh-456, were tested for BDO production. The strains were transformed with pZS13 containing P. gingivalis Cat2 and C. beijerinckii Aid to provide a complete BDO pathway. Cells were cultured in M9 minimal medium supplemented with 20 g/L glucose as described above. 48 hours after induction with 0.2 mM IPTG, the concentrations of BDO, 4HB, and pyruvate were as shown in Figure 40. The promoter replacement strains produce slightly more BDO than the isogenic parent.

[0508] These results demonstrated that expression of pyruvate dehydrogenase increased production of BDO in BDO producing strains.

EXAMPLE XV


BDO Producing Strains Expressing Citrate Synthase and Aconitase



[0509] This example describes increasing activity of citrate synthase and aconitase to increase production of BDO. An R163L mutation into gltA was found to improve BDO production. Additionally, an arcA knockout was used to improve BDO production.

[0510] Computationally, it was determined that flux through citrate synthase (CS) and aconitase (ACONT) is required to reach the maximum theoretical yield of 1,4-butanediol (see also WO2008/115840, WO 2009/023493, U.S. publication 2009/0047719, U.S. publication 2009/0075351). Lack of CS or ACONT activity would reduce the maximum theoretical yield by 14% under anaerobic conditions. In the presence of an external electron acceptor, the maximum yield is reduced by 9% or by 6% without flux through CS or ACONT assuming the absence or presence of PEPCK activity, respectively. As with pyruvate dehydrogenase (PDH), the importance of CS and ACONT is greatly amplified in the knockout strain background in which ADHEr, ASPT, LDH D, MDH and PFLi are knocked out (design #439)(see WO 2009/023493 and U.S. publication 2009/0047719.

[0511] The minimal OptKnock strain design described in WO 2009/023493 and U.S. publication 2009/0047719 had one additional deletion beyond ECKh-138, the mdh gene, encoding malate dehydrogenase. Deletion of this gene is intended to prevent flux to succinate via the reductive TCA cycle. The mdh deletion was performed using the λ red homologeous recombination method (Datsenko and Wanner, Proc. Natl. Acad. Sci. USA 97:6640-6645 (2000)). The following oligonucleotides were used to PCR amplify the chloramphenicol resistance gene (CAT) flanked by FRT sites from pKD3:





[0512] Underlined regions indicate homology to pKD3 plasmid and bold sequence refers to sequence homology upstream and downstream of the mdh ORF. After purification, the PCR product was electroporated into ECKh-138 electrocompetent cells that had been transformed with pRedET (tet) and prepared according to the manufacturer's instructions (www.genebridges.com/gb/pdf/K001%20Q%20E%20BAC%20Modification%20Kit-version2.6-2007-screen.pdf). The PCR product was designed so that it integrated into the ECKh-138 genome at a region upstream of the mdh gene, as shown in Figure 41.

[0513] Recombinants were selected for chloramphenicol resistance and streak purified. Loss of the mdh gene and insertion of CAT was verified by diagnostic PCR. To remove the CAT gene, a temperature sensitive plasmid pCP20 containing a FLP recombinase (Datsenko and Wanner, Proc. Natl. Acad. Sci. USA 97:6640-6645 (2000)) was transformed into the cell at 30°C and selected for ampicillin resistance (AMP). Transformants were grown nonselectively at 42°C overnight to thermally induce FLP synthesis and to cause lose of the plasmid. The culture was then streak purified, and individual colonies were tested for loss of all antibiotic resistances. The majority lost the FRT-flanked resistance gene and the FLP helper plasmid simultaneously. There was also a "FRT" scar leftover. The resulting strain was named ECKh-172.

[0514] CS and ACONT are not highly active or highly expressed under anaerobic conditions. To this end, the arcA gene, which encodes for a global regulator of the TCA cycle, was deleted. ArcA works during microaerobic conditions to induce the expression of gene products that allow the activity of central metabolism enzymes that are sensitive to low oxygen levels, aceE, pflB and adhE. It was shown that microaerobically, a deletion in arcA/arcB increases the specific activities of ldh, icd, gltA, mdh, and gdh genes (Salmon et al., J. Biol. Chem. 280:15084-15096 (2005); Shalel-Levanon et al., Biotechnol. Bioeng. 92(2):147-159 (2005). The upstream and downstream regions of the arcA gene of E. coli MG1655 were amplified by PCR using primers ArcA-up-EcoRI (5'-ataataatagaattcgtttgctacctaaattgccaactaaatcgaaacagg -3')(SEQ ID NO:33) with ArcA-up-KpnI (5'-tattattatggtaccaatatcatgcagcaaacggtgcaacattgccg -3')(SEQ ID NO:34) and ArcA-down-EcoRI (5'-tgatctggaagaattcatcggctttaccaccgtcaaaaaaaacggcg -3')(SEQ ID NO:35) with ArcA-down-PstI (5'-ataaaaccctgcagcggaaacgaagttttatccatttttggttacctg -3')(SEQ ID NO:36), respectively. These fragments were subsequently digested with the restriction enzymes EcoRI and KpnI (upstream fragment) and EcoRI and PstI (downstream). They were then ligated into the pRE118-V2 plasmid digested with PstI and KpnI, leading to plasmid pRE118-ΔarcA. The sequence of plasmid pRE118-ΔarcA was verified. pRE118-ΔarcA was introduced into electrocompetent cells of E. coli strain ECKh-172 (ΔadhE ΔldhA ΔpflB ΔlpdA::K.p.lpdA322 Δmdh). After integration and resolution on LB-no salt-sucrose plates as described above, the deletion of the arcA gene in the chromosome of the resulting strain ECKh-401 was verified by sequencing and is shown in Figure 42.

[0515] The gltA gene of E. coli encodes for a citrate synthase. It was previously shown that this gene is inhibited allosterically by NADH, and the amino acids involved in this inhibition have been identified (Pereira et al., J. Biol. Chem. 269(1):412-417 (1994); Stokell et al., J. Biol. Chem. 278(37):35435-35443 (2003)). The gltA gene of E. coli MG1655 was amplified by PCR using primers gltA-up (5'- ggaagagaggctggtacccagaagccacagcagga-3')(SEQ ID NO:37) and gltA-PstI (5'-gtaatcactgcgtaagcgccatgccccggcgttaattc -3')(SEQ ID NO:38). The amplified fragment was cloned into pRE118-V2 after digestion with KpnI and PstI. The resulting plasmid was called pRE118-gltA. This plasmid was then subjected to site directed mutagensis (SDM) using primers R163L-f (5'- attgccgcgttcctcctgctgtcga-3')(SEQ ID NO:39) and R163L-r (5'-cgacagcaggaggaacgcggcaat -3')(SEQ ID NO:40) to change the residue Arg 163 to a Lys residue. The sequence of the entire fragment was verified by sequencing. A variation of the λ red homologeous recombination method (Datsenko and Wanner, Proc. Natl. Acad. Sci. USA 97:6640-6645 (2000)) was used to replace the native gltA gene with the R163L mutant allele without leaving a Frt scar. The general recombination procedure is the same as used to make the mdh deletion described above. First, the strain ECKh-172 was made streptomycin resistant by introducing an rpsL null mutation using the λ red homologeous recombination method. Next, a recombination was done to replace the entire wild-type gltA coding region in this strain with a cassette comprised of a kanamycin resistance gene (kanR) and a wild-type copy of the E. coli rpsL gene. When introduced into an E. coli strain harboring an rpsL null mutation, the cassette causes the cells to change from resistance to the drug streptomycin to streptomycin sensitivity. DNA fragments were then introduced that included each of the mutant versions of the gltA gene along with appropriate homologous ends, and resulting colony growth was tested in the presence of streptomycin. This selected for strains in which the kanR/rpsL cassette had been replaced by the mutant gltA gene. Insertion of the mutant gene in the correct locus was confirmed by PCR and DNA sequencing analyses. The resulting strain was called ECKh-422, and has the genotype ΔadhE ΔldhA ΔpflB ΔlpdA::K.p.lpdA322 Δmdh ΔarcA gltAR163L. The region encompassing the mutated gltA gene of strain ECKh-422 was verified by sequencing, as shown in Figure 43.

[0516] Crude extracts of the strains ECKh-401 and the gltAR163L mutant ECKh-422 were then evaluated for citrate synthase activity. Cells were harvested by centrifugation at 4,500 rpm (Beckman-Coulter, Allegera X-15R; Fullerton CA) for 10 min. The pellets were resuspended in 0.3 mL BugBuster (Novagen/EMD; San Diego CA) reagent with benzonase and lysozyme, and lysis proceeded for 15 minutes at room temperature with gentle shaking. Cell-free lysate was obtained by centrifugation at 14,000 rpm (Eppendorf centrifuge 5402; Hamburg Germany) for 30 min at 4°C. Cell protein in the sample was determined using the method of Bradford (Bradford, Anal. Biochem. 72:248-254 (1976)).

[0517] Citrate synthase activity was determined by following the formation of free coenzyme A (HS-CoA), which is released from the reaction of acetyl-CoA with oxaloacetate. The free thiol group of HS-CoA reacts with 5,5'-dithiobis-(2-nitrobenzoic acid) (DTNB) to form 5-thio-2-nitrobenzoic acid (TNB). The concentration of TNB is then monitored spectrophotometrically by measuring the absorbance at 410 nm (maximum at 412 nm). The assay mixture contained 100 mM Tris/HCl buffer (pH 7.5), 20 mM acetyl-CoA, 10 mM DTNB, and 20 mM oxaloacetate. For the evaluation of NADH inhibition, 0.4 mM NADH was also added to the reaction. The assay was started by adding 5 microliters of the cell extract, and the rate of reaction was measured by following the absorbance change over time. A unit of specific activity is defined as the µmol of product converted per minute per mg protein.

[0518] Figure 44 shows the citrate synthase activity of wild type gltA gene product and the R163L mutant. The assay was performed in the absence or presence of 0.4 mM NADH.

[0519] Strains ECKh-401 and ECKh-422 were transformed with plasmids expressing the entire BDO pathway. E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, and M. bovis sucA were expressed on the low copy plasmid pZS13, and P. gingivalis Cat2 and C. acetobutylicum AdhE2 were expressed on the medium copy plasmid pZE23. Cultures of these strains were grown microaerobically in M9 minimal medium supplemented with 20 g/L glucose and the appropriate antibiotics as described above. The 4HB and BDO concentrations at 48 hours post-induction averaged from duplicate cultures are shown in Figure 45. Both are higher in ECKh-422 than in ECKh-401, demonstrating that the enhanced citrate synthase activity due to the gltA mutation results in increased flux to the BDO pathway.

[0520] The host strain modifications described in this section were intended to redirect carbon flux through the oxidative TCA cycle, which is consistent with the OptKnock strain design described in WO 2009/023493 and U.S. publication 2009/0047719. To demonstrate that flux was indeed routed through this pathway, 13C flux analysis was performed using the strain ECKh-432, which is a version of ECKh-422 in which the upstream pathway is integrated into the chromosome (as described in Example XVII). To complete the BDO pathway, P. gingivalis Cat2 and C. beijerinckii Aid were expressed from pZS13. Four parallel cultures were grown in M9 minimal medium (6.78 g/L Na2HPO4, 3.0 g/L KH2PO4, 0.5 g/L NaCl, 1.0 g/L NH4Cl, 1 mM MgSO4, 0.1 mM CaCl2) containing 4 g/L total glucose of four different labeling ratios (1-13C, only the first carbon atom in the glucose molecule is labeled with 13C; uniform-13C, all carbon atoms are 13C):
  1. 1. 80 mol% unlabeled, 20 mol% uniform-13C
  2. 2. 10 mol% unlabeled, 90 mol% uniform-13C
  3. 3. 90 mol% 1-13C, 10 mol% uniform-13C
  4. 4. 40 mol% 1-13C, 60 mol% uniform-13C


[0521] Parallel unlabeled cultures were grown in duplicate, from which frequent samples were taken to evaluate growth rate, glucose uptake rate, and product formation rates. In late exponential phase, the labeled cultures were harvested, the protein isolated and hydrolyzed to amino acids, and the label distribution of the amino acids analyzed by gas chromatography-mass spectrometry (GCMS) as described previously (Fischer and Sauer, Eur. J. Biochem. 270:880-891 (2003)). In addition, the label distribution of the secreted 4HB and BDO in the broth from the labeled cultures was analyzed by GCMS as described in WO2008115840. This data was collectively used to calculate the intracellular flux distribution using established methods (Suthers et al., Metab. Eng. 9:387-405 (2007)). The resulting central metabolic fluxes and associated 95% confidence intervals are shown in Figure 46. Values are molar fluxes normalized to a glucose uptake rate of 1 mmol/hr. The result indicates that carbon flux is routed through citrate synthase in the oxidative direction, and that most of the carbon enters the BDO pathway rather than completing the TCA cycle. Furthermore, it confirms there is essentially no flux between malate and oxaloacetate due to the mdh deletion in this strain.

[0522] The advantage of using a knockout strain such as strains designed using OptKnock for BDO production (see WO 2009/023493 and U.S. publication 2009/0047719) can be observed by comparing typical fermentation profiles of ECKh-422 with that of the original strain ECKh-138, in which BDO is produced from succinate via the reductive TCA cycle (see Figure 47). Fermentations were performed with 1L initial culture volume in 2L Biostat B+ bioreactors (Sartorius; Cedex France) using M9 minimal medium supplemented with 20 g/L glucose. The temperature was controlled at 37°C, and the pH was controlled at 7.0 using 2 M NH4OH or Na2CO3. Cells were grown aerobically to an OD600 of approximately 10, at which time the cultures were induced with 0.2 mM IPTG. One hour following induction, the air flow rate was reduced to 0.02 standard liters per minute for microaerobic conditions. The agitation rate was set at 700 rpm. Concentrated glucose was fed to maintain glucose concentration in the vessel between 0.5 and 10 g/L. Both strains were transformed with plasmids bearing the entire BDO pathway, as in the examples above. In ECKh-138, acetate, pyruvate, and 4HB dominate the fermentation, while with ECKh-422 BDO is the major product.

EXAMPLE XVI


BDO Strains Expression Phosphoenolpyruvate Carboxykinase



[0523] This example describes the utilization of phosphoenolpyruvate carboxykinase (PEPCK) to enhance BDO production. The Haemophilus influenza PEPCK gene was used for heterologous expression.

[0524] Computationally, it was demonstrated that the ATP-generating conversion of oxaloacetate to phosphoenolpyruvate is required to reach the maximum theoretical yield of 1,4-butanediol (see also WO2008/115840, WO 2009/023493, U.S. publication 2009/0047719, U.S. publication 2009/0075351). Lack of PEPCK activity was shown to reduce the maximum theoretical yield of BDO by 12% assuming anaerobic conditions and by 3% assuming an external electron acceptor such as nitrate or oxygen is present.

[0525] In organisms such as E. coli, PEPCK operates in the gluconeogenic and ATP-consuming direction from oxaloacetate towards phosphoenolpyruvate. It has been hypothesized that kinetic limitations of PEPCK of E. coli prevent it from effectively catalyzing the formation of oxaloacetate from PEP. PEP carboxylase (PPC), which does not generate ATP but is required for efficient growth, is naturally utilized by E. coli to form oxaloacetate from phosphoenolpyruvate. Therefore, three non native PEPCK enzymes (Table 26) were tested for their ability to complement growth of a PPC mutant strain of E. coli in glucose minimal media.
Table 26. Sources of phosphoenolpyruvate carboxykinase sequences.
PEPCK Source StrainAccession Number, GenBank Reference Sequence
Haemophilus influenza NC_ 000907.1
Actinobacillus succinogenes YP_ 001343536.1
Mannheimia succiniciproducens YP_ 089485.1


[0526] Growth complementation studies involved plasmid based expression of the candidate genes in Δppc mutant E.coli JW3978 obtained from the Keio collection (Baba et al., Molecular Systems Biology 2:2006.0008 (2006)). The genes were cloned behind the PA1lacO-1 promoter in the expression vectors pZA23 (medium copy) and pZE13 (high copy). These plasmids have been described previously (Lutz and Bujard, Nucleic Acids Res. 25:1203-1210 (1997)), and their use in expression BDO pathway genes has been described previously in WO2008115840.

[0527] Pre-cultures were grown aerobically in M9 minimal media with 4g/L glucose. All pre-cultures were supplemented with aspartate (2mM) to provide the Δppc mutants with a source for generating TCA cycle intermediates independent of PEPCK expression. M9 minimal media was also used in the test conditions with 4g/L glucose, but no aspartate was added and IPTG was added to 0.5 mM. Table 27 shows the results of the growth complementation studies.
Table 27. Complementation of Appc mutants with PEPCK from H. influenzae, A. succinogenes and M. succinoproducens when expressed from vectors pZA23 or pZE13.
PEPCK Source StrainVectorTime (h)OD600
H.influenzae pZA23BB 40 0.950
Δppc Control pZA23BB 40 0.038
A.succinogenes pZA23BB 40 0.055
M. succinoproducens pZA23BB 40 0.214
A.succinogenes pZE13BB 40 0.041
M. succinoproducens pZE13BB 40 0.024
Δppc Control pZE13BB 40 0.042


[0528] Haemophilus influenza PEPCK was found to complement growth in Δppc mutant E. coli best among the genes that were tested in the plasmid based screening. This gene was then integrated into the PPC locus of wild-type E. coli (MG1655) using the SacB counter selection method with pRE118-V2 discussed above (Gay et al., J. Bacteriol. 153:1424-1431 (1983)). PEPCK was integrated retaining the E. coli native PPC promoter, but utilizing the non-native PEPCK terminator. The sequence of this region following replacement of ppc by H. influenzae pepck is shown in Figure 48. The pepck coding region is underlined.

[0529] Techniques for adaptive evolution were applied to improve the growth rate of the E. coli mutant (Δppc::H. inf pepCK). M9 minimal media with 4 g/L glucose and 50mM sodium bicarbonate was used to culture and evolve this strain in an anaerobic environment. The high sodium bicarbonate concentration was used to drive the equilibrium of the PEPCK reaction toward oxaloacetate formation. To maintain exponential growth, the culture was diluted 2-fold whenever an OD600 of 0.5 was achieved. After about 100 generations over 3 weeks of adaptive evolution, anaerobic growth rates improved from about 8h to that of wild type, about 2h. Following evolution, individual colonies were isolated, and growth in anaerobic bottles was compared to that of the initial mutant and wild-type strain (see Figure 49). M9 medium with 4 g/L glucose and 50 mM sodium bicarbonate was used.

[0530] The ppc/pepck gene replacement procedure described above was then repeated, this time using the BDO-producing strains ECKh-432 (ΔadhE ΔldhA ΔpflB ΔlpdA::K.p.lpdA322 Δmdh ΔarcA gltAR163L ΔackA fimD:: E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd fimD:: M. bovis sucA, C. kluyveri 4hbd) and ECKh-439 as the hosts. These strains contain the TCA cycle enhancements discussed above as well as the upstream pathway integrated in the chromosome. ECKh-439 is a derivative of ECKh-432 that has the ackA gene deleted, which encodes acetate kinase. This deletion was performed using the sacB counterselection method described above.

[0531] The Δppc::H. inf pepCK derivative of ECKh-439, called ECKh-453, was run in a fermentation. The downstream BDO pathway was supplied by pZS13 containing P. gingivalis Cat2 and C. beijerinckii Ald. This was performed with 1L initial culture volume in 2L Biostat B+ bioreactors (Sartorius) using M9 minimal medium supplemented with 20 g/L glucose and 50 mM NaHCO3. The temperature was controlled at 37°C, and the pH was controlled at 7.0 using 2 M NH4OH or Na2CO3. Cells were grown aerobically to an OD600 of approximately 2, at which time the cultures were induced with 0.2 mM IPTG. One hour following induction, the air flow rate was reduced to 0.01 standard liters per minute for microaerobic conditions. The agitation rate was initially set at 700 rpm. The aeration rate was gradually increased throughout the fermentation as the culture density increased. Concentrated glucose solution was fed to maintain glucose concentration in the vessel between 0.5 and 10 g/L. The product profile is shown in Figure 50. The observed phenotype, in which BDO and acetate are produced in approximately a one-to-one molar ratio, is highly similar to that predicted in WO 2009/023493 for design #439 (ADHEr, ASPT, LDH_D, MDH, PFLi). The deletion targeting the ASPT reaction was deemed unnecessary as the natural flux through aspartate ammonia-lyase is low.

[0532] A key feature of OptKnock strains is that production of the metabolite of interest is generally coupled to growth, and further, that, production should occur during exponential growth as well as in stationary phase. The growth coupling potential of ECKh-432 and ECKh-453 was evaluated by growth in microaerobic bottles with frequent sampling during the exponential phase. M9 medium containing 4 g/L glucose and either 10 mM NaHCO3 (for ECKh-432) or 50 mM NaHCO3 (for ECKh-453) was used, and 0.2 mM IPTG was included from inoculation. 18G needles were used for microaerobic growth of ECKh-432, while both 18G and 27G needles were tested for ECKh-453. The higher gauge needles result in less aeration. As shown in Figure 51, ECKh-432 does not begin producing BDO until 5 g/L glucose has been consumed, corresponding to the onset of stationary phase. ECKh-453 produces BDO more evenly throughout the experiment. In addition, growth coupling improves as the aeration of the culture is reduced.

EXAMPLE XVII


Integration of BDO Pathway Encoding Genes at Specific Integration Sites



[0533] This example describes integration of various BDO pathway genes into the fimD locus to provide more efficient expression and stability.

[0534] The entire upstream BDO pathway, leading to 4HB, has been integrated into the E. coli chromosome at the fimD locus. The succinate branch of the upstream pathway was integrated into the E. coli chromosome using the λ red homologeous recombination method (Datsenko and Wanner, Proc. Natl. Acad. Sci. USA 97:6640-6645 (2000)). The recipient E. coli strain was ECKh-422 (ΔadhE ΔldhA ΔpflB ΔlpdA::K.p.lpdA322 Δmdh ΔarcA gltAR163L). A polycistronic DNA fragment containing a promoter, the sucCD gene, the sucD gene and the 4hbd gene and a terminator sequence was inserted into the AflIII site of the pKD3 plasmid. The following primers were used to amplify the operon together with the chloramphenicol marker from the plasmid. The underlined sequences are homologeous to the target insertion site.





[0535] Following DpnI treatment and DNA electrophoresis, the purified PCR product was used to transform E. coli strain harboring plasmid pKD46. The candidate strain was selected on plates containing chloramphenicol. Genomic DNA of the candidate strain was purified. The insertion sequence was amplified and confirmed by DNA sequencing. The chloramphenicol-resistant marker was removed from chromosome by flipase. The nucleotide sequence of the region after insertion and marker removal is shown in Figure 52.

[0536] The alpha-ketoglutarate branch of the upstream pathway was integrated into the chromosome by homologeous recombination. The plasmid used in this modification was derived from vector pRE118-V2, as referenced in Example XIV, which contains a kanamycin-resistant gene, a gene encoding the levansucrase (sacB) and a R6K conditional replication ori. The integration plasmid also contained a polycistronic sequence with a promoter, the sucA gene, the C. kluyveri 4hbd gene, and a terminator being inserted between two 1.5-kb DNA fragments that are homologeous to the flanking regions of the target insertion site. The resulting plasmid was used to transform E. coli strain. The integration candidate was selected on plates containing kanamycin. The correct integration site was verified by PCR. To resolve the antibiotic marker from the chromosome, the cells were selected for growth on medium containing sucrose. The final strain was verified by PCR and DNA sequencing. The nucleotide sequence of the chromosomal region after insertion and marker removal is shown in Figure 53.

[0537] The resulting upstream pathway integration strain ECKh-432 was transformed with a plasmid harboring the downstream pathway genes. The construct was able to produce BDO from glucose in minimal medium (see Figure 54).

EXAMPLE XVIII


Use of a Non-Phosphotransferase Sucrose Uptake System to Reduce Pyruvate Byproduct Formation



[0538] This example describes the utilization of a non-phosphotransferase (PTS) sucrose uptake system to reduce pyruvate as a byproduct in the conversion of sucrose to BDO.

[0539] Strains engineered for the utilization of sucrose via a phosphotransferase (PTS) system produce significant amounts of pyruvate as a byproduct. Therefore, the use of a non-PTS sucrose system can be used to decrease pyruvate formation because the import of sucrose would not be accompanied by the conversion of phosphoenolpyruvate (PEP) to pyruvate. This will increase the PEP pool and the flux to oxaloacetate through PPC or PEPCK.

[0540] Insertion of a non-PTS sucrose operon into the rrnC region was performed. To generate a PCR product containing the non-PTS sucrose genes flanked by regions of homology to the rrnC region, two oligos were used to PCR amplify the csc genes from Machl™ (Invitrogen, Carlsbad, CA). This strain is a descendent of W strain which is an E. coli strain known to be able to catabolize sucrose (Orencio-Trejo et al., Biotechnology Biofuels 1:8 (2008)). The sequence was derived from E. coli W strain KO11 (accession AY314757) (Shukla et al., Biotechnol. Lett. 26:689-693 (2004)) and includes genes encoding a sucrose permease (cscB), D-fructokinase (cscK), sucrose hydrolase (cscA), and a LacI-related sucrose-specific repressor (cscR). The first 53 amino acids of cscR was effectively removed by the placement of the AS primer. The sequences of the oligos were: rrnC 23S del S -CSC 5'-TGT GAG TGA AAG TCA CCT GCC TTA ATA TCT CAA AAC TCA TCT TCG GGT GAC GAA ATA TGG CGT GAC TCG ATA C-3' (SEQ ID NO:43) and rrnC 23S del AS -CSC 5'-TCT GTA TCA GGC TGA AAA TCT TCT CTC ATC CGC CAA AAC AGC TTC GGC GTT AAG ATG CGC GCT CAA GGA C-3' (SEQ ID NO:44). Underlined regions indicate homology to the csc operon, and bold sequence refers to sequence homology upstream and downstream of the rrnC region. The sequence of the entire PCR product is shown in Figure 55.

[0541] After purification, the PCR product was electroporated into MG1655 electrocompetent cells which had been transformed with pRedET (tet) and prepared according to manufacturer's instructions (www.genebridges.com/gb/pdf/K001%20Q%20E%20BAC%20Modification%20Kit-version2.6-2007-screen.pdf). The PCR product was designed so that it integrated into genome into the rrnC region of the chromosome. It effectively deleted 191 nucleotides upstream of rrlC (23S rRNA), all of the rrlC rRNA gene and 3 nucleotides downstream of rrlC and replaced it with the sucrose operon, as shown in Figure 56.

[0542] Transformants were grown on M9 minimal salts medium with 0.4% sucrose and individual colonies tested for presence of the sucrose operon by diagnostic PCR. The entire rrnC::crcAKB region was transferred into the BDO host strain ECKh-432 by P1 transduction (Sambrook et al., Molecular Cloning: A Laboratory Manual, Third Ed., Cold Spring Harbor Laboratory, New York (2001), resulting in ECKh-463 (ΔadhE ΔldhA ΔpflB ΔlpdA::K.p.lpdA322 Δmdh ΔarcA gltAR163L fimD:: E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd fimD:: M. bovis sucA, C. kluyveri 4hbd rrnC::cscAKB). Recombinants were selected by growth on sucrose and verified by diagnostic PCR.

[0543] ECKh-463 was transformed with pZS13 containing P. gingivalis Cat2 and C. beijerinckii Aid to provide a complete BDO pathway. Cells were cultured in M9 minimal medium (6.78 g/L Na2HPO4, 3.0 g/L KH2PO4, 0.5 g/L NaCl, 1.0 g/L NH4Cl, 1 mM MgSO4, 0.1 mM CaCl2) supplemented with 10 g/L sucrose. 0.2 mM IPTG was present in the culture from the start. Anaerobic conditions were maintained using a bottle with 23G needle. As a control, ECKh-432 containing the same plasmid was cultured on the same medium, except with 10 g/L glucose instead of sucrose. Figure 57 shows average product concentration, normalized to culture OD600, after 48 hours of growth. The data is for 6 replicate cultures of each strain. This demonstrates that BDO production from ECKh-463 on sucrose is similar to that of the parent strain on sucrose.

EXAMPLE XIX


Summary of BDO Producing Strains



[0544] This example describes various BDO producting strains.

[0545] Table 28 summarizes various BDO producing strains disclosed above in Examples XII-XVIII.
Table 28. Summary of various BDO production strains.
Strain #Host Strain #Host chromosomeHost DescriptionPlasmid-based
         
1   ΔldhA Single deletion derivative of E. coli MG1655 E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, P. gingivalis Cat2, C. acetobutylicum AdhE2
2 AB3 ΔadhE ΔldhA ΔpflB Succinate producing strain; derivative of E. coli MG1655 E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, P. gingivalis Cat2, C. acetobutylicum AdhE2
3 ECKh-138 ΔadhE ΔldhA ΔpflB ΔlpdA::K.p.lpdA322 Improvement of lpdA to increase pyruvate dehydrogenase flux E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, P. gingivalis Cat2, C. acetobutylicum AdhE2
4 ECKh-138 ΔadhE ΔldhA ΔpflB ΔlpdA::K.p.lpdA322   E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, C. acetobutylicum bukl, C. acetobutylicum ptb, C. acetobutylicum AdhE2
5 ECKh-401 ΔadhE ΔldhA ΔpflB ΔlpdA::K.p.lpdA322 Δmdh ΔarcA Deletions in mdh and arcA to direct flux through oxidative TCA cycle E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, P. gingivalis Cat2, C. acetobutylicum AdhE2
6 ECKh-401 ΔadhE ΔldhA ΔpflB ΔlpdA::K.p.lpdA322 Δmdh ΔarcA   M. bovis sucA, E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, P. gingivalis Cat2, C. acetobutylicum AdhE2
7 ECKh-422 ΔadhE ΔldhA ΔpflB ΔlpdA::K.p.lpdA322 Δmdh ΔarcA gltAR163L Mutation in citrate synthase to improve anaerobic activity E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, P. gingivalis Cat2, C. acetobutylicum AdhE2
8 ECKh-422 ΔadhE ΔldhA ΔpflB ΔlpdA::K.p.lpdA322 Δmdh ΔarcA gltAR163L   M. bovis sucA, E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, P. gingivalis Cat2, C. acetobutylicum AdhE2
9 ECKh-422 ΔadhE ΔldhA ΔpflB ΔlpdA::K.p.lpdA322 Δmdh ΔarcA gltAR163L   M. bovis sucA, E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, P. gingivalis Cat2, C. beijerinckii Ald
10 ECKh-426 ΔadhE ΔldhA ΔpflB ΔlpdA::K.p.lpdA322 Δmdh ΔarcA gltAR163L fimD:: E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd Succinate branch of upstream pathway integrated into ECKh-422 P. gingivalis Cat2, C. beijerinckii Ald
11 ECKh-432 ΔadhE ΔldhA ΔpflB ΔlpdA::K.p.lpdA322 Δmdh ΔarcA gltAR163L fimD:: E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd fimD:: M. bovis sucA, C. kluyveri 4hbd Succinate and alpha-ketoglutarate upstream pathway branches integrated into ECKh-422 P. gingivalis Cat2, C. beijerinckii Ald
12 ECKh-432 ΔadhE ΔldhA ΔpflB ΔlpdA::K.p.lpdA322 Δmdh ΔarcA gltAR163L fimD:: E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd fimD:: M. bovis sucA, C. kluyveri 4hbd   C. acetobutylicum bukl, C. acetobutylicum ptb, C. beijerinckii Ald
13 ECKh-439 ΔadhE ΔldhA ΔpflB ΔlpdA::K.p.lpdA322 Δmdh ΔarcA gltAR163L ΔackA fimD:: E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd fimD:: M. bovis sucA, C. kluyveri 4hbd Acetate kinase deletion of ECKh-432 P. gingivalis Cat2, C. beijerinckii Ald
14 ECKh-453 ΔadhE ΔldhA ΔpflB ΔlpdA::K.p.lpdA322 Δmdh ΔarcA gltAR163L ΔackA Δppc::H.i.ppck fimD:: E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd fimD:: M. bovis sucA, C. kluyveri 4hbd Acetate kinase deletion and PPC/PEPCK replacement of ECKh-432 P. gingivalis Cat2, C. beijerinckii Ald
15 ECKh-456 ΔadhE ΔldhA ΔpflB ΔlpdA::fnr-pflB6-K.p.lpdA322 Δmdh ΔarcA gltAR163L fimD:: E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd fimD:: M. bovis sucA, C. kluyveri 4hbd Replacement of lpdA promoter with anaerobic promoter in ECKh-432 P. gingivalis Cat2, C. beijerinckii Ald
16 ECKh-455 ΔadhE ΔldhA ΔpflB ΔlpdA:: K.p.lpdA322 ΔpdhR:: fnr-pflB6 Δmdh ΔarcA gltAR163L fimD:: E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd fimD:: M. bovis sucA, C. kluyveri 4hbd Replacement of pdhR and aceEF promoter with anaerobic promoter in ECKh-432 P. gingivalis Cat2, C. beijerinckii Ald
17 ECKh-459 ΔadhE ΔldhA ΔpflB ΔlpdA:: K.p.lpdA322 Δmdh ΔarcA gltAR163L fimD:: E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd fimD:: M. bovis sucA, C. kluyveri 4hbd fimD:: C. acetobutylicum bukl, C. acetobutylicum ptb Integration of BK/PTB into ECKh-432 C. beijerinckii Ald
18 ECKh-459 ΔadhE ΔldhA ΔpflB ΔlpdA:: K.p.lpdA322 Δmdh ΔarcA gltAR163L fimD:: E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd fimD:: M. bovis sucA, C. kluyveri 4hbd fimD:: C. acetobutylicum bukl, C. acetobutylicum ptb   C. beijerinckii Ald, G. thermoglucosidasius adhl
19 ECKh-463 ΔadhE ΔldhA ΔpflB ΔlpdA::K.p.lpdA322 Δmdh ΔarcA gltAR163L fimD:: E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd fimD:: M. bovis sucA, C. kluyveri 4hbd rrnC::cscAKB Non-PTS sucrose genes inserted into ECKh-432 P. gingivalis Cat2, C. beijerinckii Ald
20 ECKh-463 ΔadhE ΔldhA ΔpflB ΔlpdA::K.p.lpdA322 Δmdh ΔarcA gltAR163L fimD:: E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd fimD:: M. bovis sucA, C. kluyveri 4hbd rrnC::cscAKB   C. acetobutylicum bukl, C. acetobutylicum ptb, C. beijerinckii Ald


[0546] The strains summarized in Table 28 are as follows. Strain 1: Single deletion derivative of E. coli MG1655, with deletion of endogenous ldhA; plasmid expression of E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, P. gingivalis Cat2, C. acetobutylicum AdhE2. Strain 2: Host strain AB3, a succinate producing strain, derivative of E. coli MG1655, with deletions of endogenous adhE ldhA pflB; plasmid expression of E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, P. gingivalis Cat2, C. acetobutylicum AdhE2.

[0547] Strain 3: Host strain ECKh-138, deletion of endogenous adhE, ldhA, pflB, deletion of endogenous lpdA and chromosomal insertion of Klebsiella pneumoniae lpdA with a Glu354Lys mutation at the lpdA locus; plasmid expression of E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, P. gingivalis Cat2, C. acetobutylicum AdhE2; strain provides improvement of lpdA to increase pyruvate dehydrogenase flux. Strain 4: Host strain ECKh-138, deletion of endogenous adhE, ldhA, pflB, and lpdA, chromosomal insertion of Klebsiella pneumoniae lpdA with a Glu354Lys mutation; plasmid expression E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, C. acetobutylicum buk1, C. acetobutylicum ptb, C. acetobutylicum AdhE2.

[0548] Strain 5: Host strain ECKh-401, deletion of endogenous adhE, ldhA, pflB, deletion of endogenous lpdA and chromosomal insertion of Klebsiella pneumoniae lpdA with a Glu354Lys mutation at the lpdA locus, deletion of endogenous mdh and arcA; plasmid expression of E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, P. gingivalis Cat2, C. acetobutylicum AdhE2; strain has deletions in mdh and arcA to direct flux through oxidative TCA cycle. Strain 6: host strain ECKh-401, deletion of endogenous adhE, ldhA, pflB, deletion of endogenous lpdA and chromosomal insertion of Klebsiella pneumoniae lpdA with a Glu354Lys mutation at the lpdA locus, deletion of endogenous mdh and arcA; plasmid expression of M. bovis sucA, E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, P. gingivalis Cat2, C. acetobutylicum AdhE2.

[0549] Strain 7: Host strain ECKh-422, deletion of endogenous adhE, ldhA, pflB, deletion of endogenous lpdA and chromosomal insertion of Klebsiella pneumoniae lpdA with a Glu354Lys mutation at the lpdA locus, deletion of endogenous mdh and arcA, chromosomal replacement of gltA with gltA Arg163Leu mutant; plasmid expression of E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, P. gingivalis Cat2, C. acetobutylicum AdhE2; strain has mutation in citrate synthase to improve anaerobic activity. Strain 8: strain ECKh-422, deletion of endogenous adhE, ldhA, pflB, deletion of endogenous lpdA and chromosomal insertion of Klebsiella pneumoniae lpdA with a Glu354Lys mutation at the lpdA locus, deletion of endogenous mdh and arcA, chromosomal replacement of gltA with gltA Arg163Leu mutant; plasmid expression of M. bovis sucA, E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, P. gingivalis Cat2, C. acetobutylicum AdhE2. Strain 9: host strain ECKh-422, deletion of endogenous adhE, ldhA, pflB, deletion of endogenous lpdA and chromosomal insertion of Klebsiella pneumoniae lpdA with a Glu354Lys mutation at the lpdA locus, deletion of endogenous mdh and arcA, chromosomal replacement of gltA with gltA Arg163Leu mutant; plasmid expression of M. bovis sucA, E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, P. gingivalis Cat2, C. beijerinckii Ald.

[0550] Strain 10: host strain ECKh-426, deletion of endogenous adhE, ldhA, pflB, deletion of endogenous lpdA and chromosomal insertion of Klebsiella pneumoniae lpdA with a Glu354Lys mutation at the lpdA locus, deletion of endogenous mdh and arcA, chromosomal replacement of gltA with gltA Arg163Leu mutant, chromosomal insertion at the fimD locus of E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd; plasmid expression of P. gingivalis Cat2, C. beijerinckii Ald; strain has succinate branch of upstream pathway integrated into strain ECKh-422 at the fimD locus. Strain 11: host strain ECKh-432, deletion of endogenous adhE, ldhA, pflB, deletion of endogenous lpdA and chromosomal insertion of Klebsiella pneumoniae lpdA with a Glu354Lys mutation at the lpdA locus, deletion of endogenous mdh and arcA, chromosomal replacement of gltA with gltA Arg163Leu mutant, chromosomal insertion at the fimD locus of E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, chromosomal insertion at the fimD locus of M. bovis sucA, C. kluyveri 4hbd; plasmid expression of P. gingivalis Cat2, C. beijerinckii Ald; strain has succinate and alpha-ketoglutarate upstream pathway branches integrated into ECKh-422. Strain 12: host strain ECKh-432, deletion of endogenous adhE, ldhA, pflB, deletion of endogenous lpdA and chromosomal insertion of Klebsiella pneumoniae lpdA with a Glu354Lys mutation at the lpdA locus, deletion of endogenous mdh and arcA, chromosomal replacement of gltA with gltA Arg163Leu mutant, chromosomal insertion at the fimD locus of E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, chromosomal insertion at the fimD locus of M. bovis sucA, C. kluyveri 4hbd; plasmid expression of C. acetobutylicum buk1, C. acetobutylicum ptb, C. beijerinckii Ald.

[0551] Strain 13: host strain ECKh-439, deletion of endogenous adhE, ldhA, pflB, deletion of endogenous lpdA and chromosomal insertion of Klebsiella pneumoniae lpdA with a Glu354Lys mutation at the lpdA locus, deletion of endogenous mdh and arcA, chromosomal replacement of gltA with gltA Arg163Leu mutant, deletion of endogenous ackA, chromosomal insertion at the fimD locus of E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, chromosomal insertion at the fimD locus of M. bovis sucA, C. kluyveri 4hbd; plasmid expression of P. gingivalis Cat2, C. beijerinckii Ald; strain has acetate kinase deletion in strain ECKh-432. Strain 14: host strain ECKh-453, deletion of endogenous adhE, ldhA, pflB, deletion of endogenous lpdA and chromosomal insertion of Klebsiella pneumoniae lpdA with a Glu354Lys mutation at the lpdA locus, deletion of endogenous mdh and arcA, chromosomal replacement of gltA with gltA Arg163Leu mutant, deletion of endogenous ackA, deletion of endogenous ppc and insertion of Haemophilus influenza ppck at the ppc locus, chromosomal insertion at the fimD locus of E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, chromosomal insertion at the fimD locus of M. bovis sucA, C. kluyveri 4hbd; plasmid expression of P. gingivalis Cat2, C. beijerinckii Ald; strain has acetate kinase deletion and PPC/PEPCK replacement in strain ECKh-432.

[0552] Strain 15: host strain ECKh-456, deletion of endogenous adhE, ldhA, pflB, deletion of endogenous lpdA and chromosomal insertion of Klebsiella pneumoniae lpdA with a Glu354Lys mutation at the lpdA locus, deletion of endogenous mdh and arcA, chromosomal replacement of gltA with gltA Arg163Leu mutant, chromosomal insertion at the fimD locus of E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, chromosomal insertion at the fimD locus of M. bovis sucA, C. kluyveri 4hbd, replacement of lpdA promoter with fnr binding site, pflB-p6 promoter and RBS of pflB; plasmid expression of P. gingivalis Cat2, C. beijerinckii Ald; strain has replacement of lpdA promoter with anaerobic promoter in strain ECKh-432. Strain 16: host strain ECKh-455, deletion of endogenous adhE, ldhA, pflB, deletion of endogenous lpdA and chromosomal insertion of Klebsiella pneumoniae lpdA with a Glu354Lys mutation at the lpdA locus, deletion of endogenous mdh and arcA, chromosomal replacement of gltA with gltA Arg163Leu mutant, chromosomal insertion at the fimD locus of E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, chromosomal insertion at the fimD locus of M. bovis sucA, C. kluyveri 4hbdI, replacement of pdhR and aceEF promoter with fnr binding site, pflB-p6 promoter and RBS of pflB; plasmid expression of P. gingivalis Cat2, C. beijerinckii Ald; strain has replacement of pdhR and aceEF promoter with anaerobic promoter in ECKh-432.

[0553] Strain 17: host strain ECKh-459, deletion of endogenous adhE, ldhA, pflB, deletion of endogenous lpdA and chromosomal insertion of Klebsiella pneumoniae lpdA with a Glu354Lys mutation at the lpdA locus, deletion of endogenous mdh and arcA, chromosomal replacement of gltA with gltA Arg163Leu mutant, chromosomal insertion at the fimD locus of E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, chromosomal insertion at the fimD locus of M. bovis sucA, C. kluyveri 4hbd, chromosomal insertion at the fimD locus of C. acetobutylicum buk1, C. acetobutylicum ptb; plasmid expression of C. beijerinckii Ald; strain has integration of BK/PTB into strain ECKh-432. Strain 18: host strain ECKh-459, deletion of endogenous adhE, ldhA, pflB, deletion of endogenous lpdA and chromosomal insertion of Klebsiella pneumoniae lpdA with a Glu354Lys mutation at the lpdA locus, deletion of endogenous mdh and arcA, chromosomal replacement of gltA with gltA Arg163Leu mutant, chromosomal insertion at the fimD locus of E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, chromosomal insertion at the fimD locus of M. bovis sucA, C. kluyveri 4hbd, chromosomal insertion at the fimD locus of C. acetobutylicum buk1, C. acetobutylicum ptb; plasmid expression of C. beijerinckii Ald, G. thermoglucosidasius adhl.

[0554] Strain 19: host strain ECKh-463, deletion of endogenous adhE, ldhA, pflB, deletion of endogenous lpdA and chromosomal insertion of Klebsiella pneumoniae lpdA with a Glu354Lys mutation at the lpdA locus, deletion of endogenous mdh and arcA, chromosomal replacement of gltA with gltA Arg163Leu mutant, chromosomal insertion at the fimD locus of E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, chromosomal insertion at the fimD locus of M. bovis sucA, C. kluyveri 4hbd, insertion at the rrnC locus of non-PTS sucrose operon genes sucrose permease (cscB), D-fructokinase (cscK), sucrose hydrolase (cscA), and a LacI-related sucrose-specific repressor (cscR); plasmid expression of P. gingivalis Cat2, C. beijerinckii Ald; strain has non-PTS sucrose genes inserted into strain ECKh-432. Strain 20: host strain ECKh-463 deletion of endogenous adhE, ldhA, pflB, deletion of endogenous lpdA and chromosomal insertion of Klebsiella pneumoniae lpdA with a Glu354Lys mutation at the lpdA locus, deletion of endogenous mdh and arcA, chromosomal replacement of gltA with gltA Arg163Leu mutant, chromosomal insertion at the fimD locus of E. coli sucCD, P. gingivalis sucD, P. gingivalis 4hbd, chromosomal insertion at the fimD locus of M. bovis sucA, C. kluyveri 4hbd, insertion at the rrnC locus of non-PTS sucrose operon; plasmid expression of C. acetobutylicum buk1, C. acetobutylicum ptb, C. beijerinckii Ald.

[0555] In addition to the BDO producing strains disclosed herein, including those disclosed in Table 28, it is understood that additional modifications can be incorporated that further increase production of BDO and/or decrease undesirable byproducts. For example, a BDO producing strain, or a strain of Table 28, can incorporate additional knockouts to further increase the production of BDO or decrease an undesirable byproduct. Exemplary knockouts have been described previously (see U.S. publication 2009/0047719). Such knockout strains include, but are not limited to, one ore more genes selected from ADHEr, NADH6; ADHEr, PPCK; ADHEr, SUCD4; ADHEr, ATPS4r; ADHEr, FUM; ADHEr, MDH; ADHEr, PFLi, PPCK; ADHEr, PFLi, SUCD4; ADHEr, ACKr, NADH6; ADHEr, NADH6, PFLi; ADHEr, ASPT, MDH; ADHEr, NADH6, PPCK; ADHEr, PPCK, THD2; ADHEr, ATPS4r, PPCK; ADHEr, MDH, THD2; ADHEr, FUM, PFLi; ADHEr, PPCK, SUCD4; ADHEr, GLCpts, PPCK; ADHEr, GLUDy, MDH; ADHEr, GLUDy, PPCK; ADHEr, FUM, PPCK; ADHEr, MDH, PPCK; ADHEr, FUM, GLUDy; ADHEr, FUM, HEX1; ADHEr, HEX1, PFLi; ADHEr, HEX1, THD2; ADHEr, FRD2, LDH_D, MDH; ADHEr, FRD2, LDH_D, ME2; ADHEr, MDH, PGL, THD2; ADHEr, G6PDHy, MDH, THD2; ADHEr, PFLi, PPCK, THD2; ADHEr, ACKr, AKGD, ATPS4r; ADHEr, GLCpts, PFLi, PPCK; ADHEr, ACKr, ATPS4r, SUCOAS; ADHEr, GLUDy, PFLi, PPCK; ADHEr, ME2, PFLi, SUCD4; ADHEr, GLUDy, PFLi, SUCD4; ADHEr, ATPS4r, LDH_D, SUCD4; ADHEr, FUM, HEX1, PFLi; ADHEr, MDH, NADH6, THD2; ADHEr, ATPS4r, MDH, NADH6; ADHEr, ATPS4r, FUM, NADH6; ADHEr, ASPT, MDH, NADH6; ADHEr, ASPT, MDH, THD2; ADHEr, ATPS4r, GLCpts, SUCD4; ADHEr, ATPS4r, GLUDy, MDH; ADHEr, ATPS4r, MDH, PPCK; ADHEr, ATPS4r, FUM, PPCK; ADHEr, ASPT, GLCpts, MDH; ADHEr, ASPT, GLUDy, MDH; ADHEr, ME2, SUCD4, THD2; ADHEr, FUM, PPCK, THD2; ADHEr, MDH, PPCK, THD2; ADHEr, GLUDy, MDH, THD2; ADHEr, HEX1, PFLi, THD2; ADHEr, ATPS4r, G6PDHy, MDH; ADHEr, ATPS4r, MDH, PGL; ADHEr, ACKr, FRD2, LDH_D; ADHEr, ACKr, LDH_D, SUCD4; ADHEr, ATPS4r, FUM, GLUDy; ADHEr, ATPS4r, FUM, HEX1; ADHEr, ATPS4r, MDH, THD2; ADHEr, ATPS4r, FRD2, LDH_D; ADHEr, ATPS4r, MDH, PGDH; ADHEr, GLCpts, PPCK, THD2; ADHEr, GLUDy, PPCK, THD2; ADHEr, FUM, HEX1, THD2; ADHEr, ATPS4r, ME2, THD2; ADHEr, FUM, ME2, THD2; ADHEr, GLCpts, GLUDy, PPCK; ADHEr, ME2, PGL, THD2; ADHEr, G6PDHy, ME2, THD2; ADHEr, ATPS4r, FRD2, LDH_D, ME2; ADHEr, ATPS4r, FRD2, LDH_D, MDH; ADHEr, ASPT, LDH D, MDH, PFLi; ADHEr, ATPS4r, GLCpts, NADH6, PFLi; ADHEr, ATPS4r, MDH, NADH6, PGL; ADHEr, ATPS4r, G6PDHy, MDH, NADH6; ADHEr, ACKr, FUM, GLUDy, LDH_D; ADHEr, ACKr, GLUDy, LDH_D, SUCD4; ADHEr, ATPS4r, G6PDHy, MDH, THD2; ADHEr, ATPS4r, MDH, PGL, THD2; ADHEr, ASPT, G6PDHy, MDH, PYK; ADHEr, ASPT, MDH, PGL, PYK; ADHEr, ASPT, LDH_D, MDH, SUCOAS; ADHEr, ASPT, FUM, LDH_D, MDH; ADHEr, ASPT, LDH_D, MALS, MDH; ADHEr, ASPT, ICL, LDH_D, MDH; ADHEr, FRD2, GLUDy, LDH_D, PPCK; ADHEr, FRD2, LDH_D, PPCK, THD2; ADHEr, ACKr, ATPS4r, LDH D, SUCD4; ADHEr, ACKr, ACS, PPC, PPCK; ADHEr, GLUDy, LDH_D, PPC, PPCK; ADHEr, LDH_D, PPC, PPCK, THD2; ADHEr, ASPT, ATPS4r, GLCpts, MDH; ADHEr, G6PDHy, MDH, NADH6, THD2; ADHEr, MDH, NADH6, PGL, THD2; ADHEr, ATPS4r, G6PDHy, GLCpts, MDH; ADHEr, ATPS4r, GLCpts, MDH, PGL; ADHEr, ACKr, LDH_D, MDH, SUCD4.

[0556] Table 29 shows the reactions of corresponding genes to be knocked out of a host organism such as E. coli. The corresponding metabolite corresponding to abbreviations in Table 29 are shown in Table 30.
Table 29. Corresponding genes to be knocked out to prevent a particular reaction from occurring in E. coli.
Reaction AbbreviationReaction Stoichiometry*Genes Encoding the Enzyme(s) Catalyzing Each Reaction&
ACKr [c] : ac + atp <==> actp + adp (b3115 or b2296 or b1849)
ACS [c] : ac + atp + coa --> accoa + amp + ppi b4069
ACt6 ac[p] + h[p] <==> ac[c] + h[c] Non-gene associated
ADHEr [c] : etoh + nad <==> acald + h + nadh (b0356 or b1478 or b1241)
[c] : acald + coa + nad <==> accoa + h + nadh (b1241 or b0351)
AKGD [c] : akg + coa + nad --> co2 + nadh + succoa (b0116 and b0726 and b0727 )
ASNS2 [c] : asp-L + atp + nh4 --> amp + asn-L + h + ppi b3744
ASPT [c] : asp-L --> fum + nh4 b4139
ATPS4r adp[c] + (4) h[p] + pi[c] <==> atp[c] + (3) h[c] + h2o[c] (((b3736 and b3737 and b3738) and (b3731 and b3732 and b3733 and b3734 and b3735) ) or ((b3736 and b3737 and b3738) and (b3731 and b3732 and b3733 and b3734 and b3735) and b3739))
CBMK2 [c] : atp + co2 + nh4 <==> adp + cbp + (2) h (b0521 or b0323 or b2874 )
EDA [c] : 2ddg6p --> g3p + pyr b1850
ENO [c] : 2pg <==> h2o + pep b2779
FBA [c] : fdp <==> dhap + g3p (b2097 or b2925 or b1773)
FBP [c] : fdp + h2o --> f6p + pi (b4232 or b3925)
FDH2 for[p] + (2) h[c] + q8[c] --> co2[c] + h[p] + q8h2[c] for[p] + (2) h[c] + mqn8[c] --> co2[c] + h[p] + mql8[c] ((b3892 and b3893 and b3894) or (b1474 and b1475 and b1476))
FRD2 [c] : fum + mql8 --> mqn8 + succ [c] : 2dmmql8 + fum --> 2dmmq8 + succ (b4151 and b4152 and b4153 and b4154)
FTHFD [c] 10fthf + h2o --> for + h + thf b1232
FUM [c] : fum + h2o <==> mal-L (b1612 or b4122 or b1611 )
G5SD [c] : glu5p + h + nadph --> glu5sa + nadp + pi b0243
G6PDHy [c] : g6p + nadp <==> 6pgl + h + nadph b1852
GLCpts glc-D[p] + pep[c] --> g6p[c] + pyr[c] ((b2417 and b1101 and b2415 and b2416) or (b1817 and b1818 and b1819 and b2415 and b2416) or (b2417 and b1621 and b2415 and b2416))
GLU5K [c] : atp + glu-L --> adp + glu5p b0242
GLUDy [c] : glu-L + h2o + nadp <==> akg + h + nadph + nh4 b1761
GLYCL [c] : gly + nad + thf --> co2 + mlthf + nadh + nh4 (b2904 and b2903 and b2905 and b0116)
HEX1 [c] : atp + glc-D --> adp + g6p + h b2388
ICL [c] : icit --> glx + succ b4015
LDH D [c] lac-D + nad <==> h + nadh + pyr (b2133 or b1380)
MALS [c] : accoa + glx + h2o --> coa + h + mal-L (b4014 or b2976)
MDH [c] : mal-L + nad <==> h + nadh + oaa b3236
ME2 [c] : mal-L + nadp --> co2 + nadph + pyr b2463
MTHFC [c] : h2o + methf <==> 10fthf + h b0529
NADH12 [c] : h + mqn8 + nadh --> mql8 + nad [c] : h + nadh + q8 --> nad + q8h2 [c] : 2dmmq8 + h + nadh --> 2dmmql8 + nad b1109
NADH6 (4) h[c] + nadh[c] + q8[c] --> (3) h[p] + nad[c] + q8h2[c] (4) h[c] + mqn8[c] + nadh[c] --> (3) h[p] + mql8[c] + nad[c] 2dmmq8[c] + (4) h[c] + nadh[c] --> 2dmmql8[c] + (3) h[p] + nad[c] (b2276 and b2277 and b2278 and b2279 and b2280 and b2281 and b2282 and b2283 and b2284 and b2285 and b2286 and b2287 and b2288)
PFK [c] : atp + f6p --> adp + fdp + h (b3916 or b1723)
PFLi [c] : coa + pyr --> accoa + for (((b0902 and b0903) and b2579) or (b0902 and b0903) or (b0902 and b3114) or (b3951 and b3952))
PGDH [c] : 6pgc + nadp --> co2 + nadph + ru5p-D b2029
PGI [c] : g6p <==> f6p b4025
PGL [c] : 6pgl + h2o --> 6pgc + h b0767
PGM [c] 2pg <==> 3pg (b3612 or b4395 or b0755)
PPC [c] : co2 + h2o + pep --> h + oaa + pi b3956
PPCK [c] : atp + oaa --> adp + co2 + pep b3403
PRO1z [c] : fad + pro-L --> 1pyr5c + fadh2 + h b1014
PYK [c] : adp + h + pep --> atp + pyr b 1854 or b1676)
PYRt2 h[p] + pyr[p] <==> h[c] + pyr[c] Non-gene associated
RPE [c] : ru5p-D <==> xu5p-D (b4301 or b3386)
SO4t2 so4[e] <==> so4[p] (b0241 or b0929 or b1377 or b2215)
SUCD4 [c] : q8 + succ --> fum + q8h2 (b0721 and b0722 and b0723 and b0724)
SUCOAS [c] : atp + coa + succ <==> adp + pi + succoa (b0728 and b0729)
SULabc atp[c] + h2o[c] + so4[p] --> adp[c] + h[c] + pi[c] + so4[c] ((b2422 and b2425 and b2424 and b2423) or (b0763 and b0764 and b0765) or (b2422 and b2424 and b2423 and b3917))
TAL [c] : g3p + s7p <==> e4p + f6p (b2464 or b0008)
THD2 (2) h[p] + nadh[c] + nadp[c] --> (2) h[c] + nad[c] + nadph[c] (b1602 and b1603)
THD5 [c] : nad + nadph --> nadh + nadp (b3962 or (b1602 and b1603))
TPI [c] : dhap <==> g3p b3919
Table 30. Metabolite names corresponding to abbreviations used in Table 29.
Metabolite AbbreviationMetabolite Name
10fthf 10-Formyltetrahydrofolate
1pyr5c 1-Pyrroline-5-carboxylate
2ddg6p 2-Dehydro-3-deoxy-D-gluconate 6-phosphate
2dmmq8 2-Demethylmenaquinone 8
2dmmq18 2-Demethylmenaquinol 8
2pg D-Glycerate 2-phosphate
3pg 3-Phospho-D-glycerate
6pgc 6-Phospho-D-gluconate
6pgl 6-phospho-D-glucono-1,5-lactone
ac Acetate
acald Acetaldehyde
accoa Acetyl-CoA
actp Acetyl phosphate
adp ADP
akg 2-Oxoglutarate
amp AMP
asn-L L-Asparagine
asp-L L-Aspartate
atp ATP
cbp Carbamoyl phosphate
co2 CO2
coa Coenzyme A
dhap Dihydroxyacetone phosphate
e4p D-Erythrose 4-phosphate
etoh Ethanol
f6p D-Fructose 6-phosphate
fad Flavin adenine dinucleotide oxidized
fadh2 Flavin adenine dinucleotide reduced
fdp D-Fructose 1,6-bisphosphate
for Formate
fum Fumarate
g3p Glyceraldehyde 3-phosphate
g6p D-Glucose 6-phosphate
glc-D D-Glucose
glu5p L-Glutamate 5-phosphate
glu5sa L-Glutamate 5-semialdehyde
slu-L L-Glutamate
glx Glyoxylate
gly Glycine
h H+
h2o H2O
icit Isocitrate
lac-D D-Lactate
mal-L L-Malate
methf 5,10-Methenyltetrahydrofolate
mlthf 5,10-Methylenetetrahydrofolate
mql8 Menaquinol 8
mqn8 Menaquinone 8
nad Nicotinamide adenine dinucleotide
nadh Nicotinamide adenine dinucleotide - reduced
nadp Nicotinamide adenine dinucleotide phosphate
nadph Nicotinamide adenine dinucleotide phosphate - reduced
nh4 Ammonium
oaa Oxaloacetate
pep Phosphoenolpyruvate
pi Phosphate
ppi Diphosphate
pro-L L-Proline
pyr Pyruvate
q8 Ubiquinone-8
q8h2 Ubiquinol-8
ru5p-D D-Ribulose 5-phosphate
s7p Sedoheptulose 7-phosphate
so4 Sulfate
succ Succinate
succoa Succinyl-CoA
thf 5,6,7,8-Tetrahydrofolate
xu5p-D D-Xylulose 5-phosphate

EXAMPLE XX


Exemplary Pathways for Producing BDO



[0557] This example describes exemplary pathways to produce 4-hydroxybutanal (4-HBal) and/or BDO using a carboxylic acid reductase as a BDO pathway enzyme.

[0558] An exemplary pathway for production of BDO includes use of an NAD+ or NADP+ aryl-aldehyde dehydrogenase (E.C.: 1.2.1.29 and 1.2.1.30) to convert 4-hydroxybutyrate to 4-hydroxybutanal and an alcohol dehydrogenase to convert 4-hydroxybutanal to 1,4-butanediol. 4-Hydroxybutyrate can be derived from the tricarboxylic acid cycle intermediates succinyl-CoA and/or alpha-ketoglutarate as shown in Figure 58.

[0559] Aryl-Aldehyde Dehydrogenase (or Carboxylic Acid Reductase). An aryl-aldehyde dehydrogenase, or equivalently a carboxylic acid reductase, can be found in Nocardia iowensis. Carboxylic acid reductase catalyzes the magnesium, ATP and NADPH-dependent reduction of carboxylic acids to their corresponding aldehydes (Venkitasubramanian et al., J. Biol. Chem. 282:478-485 (2007)) and is capable of catalyzing the conversion of 4-hydroxybutyrate to 4-hydroxybutanal. This enzyme, encoded by car, was cloned and functionally expressed in E. coli (Venkitasubramanian et al., J. Biol. Chem. 282:478-485 (2007)). Expression of the npt gene product improved activity of the enzyme via post-transcriptional modification. The npt gene encodes a specific phosphopantetheine transferase (PPTase) that converts the inactive apo-enzyme to the active holo-enzyme. The natural substrate of this enzyme is vanillic acid, and the enzyme exhibits broad acceptance of aromatic and aliphatic substrates (Venkitasubramanian et al., in Biocatalysis in the Pharmaceutical and Biotechnology Industires, ed. R.N. Patel, Chapter 15, pp. 425-440, CRC Press LLC, Boca Raton, FL. (2006)).
Gene nameGI No.Accession No.Organism
car 40796035 AAR91681.1 Nocardia iowensis (sp. NRRL 5646)
npt 114848891 ABI83656.1 Nocardia iowensis (sp. NRRL 5646)


[0560] Additional car and npt genes can be identified based on sequence homology.
Gene nameGI No.Accession No.Organism
fadD9 121638475 YP_978699.1 Mycobacterium bovis BCG
BCG_2812c 121638674 YP_978898.1 Mycobacterium bovis BCG
nfa20150 54023983 YP_118225.1 Nocardia farcinica IFM 10152
nfa40540 54026024 YP_120266.1 Nocardia farcinica IFM 10152
SGR_6790 182440583 YP_001828302.1 Streptomyces griseus subsp. griseus NBRC 13350
SGR_665 182434458 YP_001822177.1 Streptomyces griseus subsp. g