(19)
(11)EP 2 891 717 B1

(12)EUROPEAN PATENT SPECIFICATION

(45)Mention of the grant of the patent:
29.04.2020 Bulletin 2020/18

(21)Application number: 13833206.9

(22)Date of filing:  02.09.2013
(51)International Patent Classification (IPC): 
C12N 15/113(2010.01)
A61K 48/00(2006.01)
C07H 21/02(2006.01)
A61K 31/713(2006.01)
A61P 43/00(2006.01)
C12N 15/09(2006.01)
(86)International application number:
PCT/JP2013/073569
(87)International publication number:
WO 2014/034934 (06.03.2014 Gazette  2014/10)

(54)

OLIGONUCLEOTIDE

OLIGONUKLEOTID

OLIGONUCLÉOTIDE


(84)Designated Contracting States:
AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

(30)Priority: 31.08.2012 US 201261695566 P
20.05.2013 JP 2013105947

(43)Date of publication of application:
08.07.2015 Bulletin 2015/28

(73)Proprietor: Kyowa Kirin Co., Ltd.
Tokyo 100-0004 (JP)

(72)Inventors:
  • SHINOHARA, Fumikazu
    Tokyo 100-8185 (JP)
  • MAKINO, Asana
    Tokyo 100-8185 (JP)
  • YAMAMOTO, Junichiro
    Tokyo 100-8185 (JP)
  • OASHI, Taiji
    Tokyo 100-8185 (JP)
  • SUZUKI, Michihiko
    Tokyo 100-8185 (JP)
  • SAITO, Jun-ichi
    Tokyo 100-8185 (JP)
  • NAKAJIMA, Takahiro
    Tokyo 100-8185 (JP)
  • NISHIKAWA, Tomoyuki
    Tokyo 100-8185 (JP)
  • NAKOJI, Masayoshi
    Tokyo 100-8185 (JP)
  • TAKAHASHI, Yuichi
    Tokyo 100-8185 (JP)

(74)Representative: Vossius & Partner Patentanwälte Rechtsanwälte mbB 
Siebertstrasse 3
81675 München
81675 München (DE)


(56)References cited: : 
WO-A1-2011/119674
WO-A2-2006/112872
  
  • LIU, J. ET AL.: 'Synthesis of photoactive DNA: incorporation of 8-bromo-2'- deoxyadenosine into synthetic oligodeoxynucleotides.' TETRAHEDRON LETT. vol. 33, no. 30, 1992, pages 4265 - 4268, XP028085721
  • SHIBUTANI, S. ET AL.: 'Translesional synthesis on DNA templates containing 8-oxo-7,8- dihydrodeoxyadenosine.' BIOCHEMISTRY vol. 32, no. 17, 1993, pages 4615 - 4621, XP055223093
  • BERES, J. ET AL.: 'Synthesis, structure, and antitumor and antiviral activities of a series of 5-halouridine cyclic 3',5'-monophosphates.' J. MED. CHEM. vol. 29, no. 4, 1986, pages 488 - 493, XP055223094
  • MICHEL, J. ET AL.: 'Triplex stability of oligodeoxynucleotides containing substituted quinazoline-2,4-(1H,3H)-dione.' TETRAHEDRON vol. 53, no. 25, 1997, pages 8457 - 8478, XP004105778
  • TOR, Y. ET AL.: 'Designing new isomorphic fluorescent nucleobase analogues: the thieno [3,2-d]pyrimidine core.' TETRAHEDRON vol. 63, no. 17, 2007, pages 3608 - 3614, XP005929593
  • SEITZ, H. ET AL.: 'A 5'-uridine amplifies miRNA/ miRNA* asymmetryin Drosophila by promoting RNA- inducedsilencing complex formation.' SILENCE vol. 2, no. 4, 2011, pages 1 - 10, XP055223097
  • FRANK, F. ET AL.: 'Structural basis for 5'- nucleotide base-specific recognition of guide RNA by human AG02.' NATURE vol. 465, 2010, pages 818 - 822, XP055223099
  • PEACOCK, H. ET AL.: 'Chemical modification of siRNA bases to probe and enhance RNA interference.' J. ORG. CHEM. vol. 76, no. 18, 2011, pages 7295 - 7300, XP055087444
  • DELEAVEY, G.F. ET AL.: 'Designing chemically modified oligonucleotides for targeted gene silencing.' CHEM. BIOL. vol. 19, no. 8, 24 August 2012, pages 937 - 954, XP055107150
  • LIMA, W.F. ET AL.: 'Binding and cleavage specificities of human Argonaute2.' J. BIOL. CHEM. vol. 284, no. 38, 2009, pages 26017 - 26028, XP055223101
  
Note: Within nine months from the publication of the mention of the grant of the European patent, any person may give notice to the European Patent Office of opposition to the European patent granted. Notice of opposition shall be filed in a written reasoned statement. It shall not be deemed to have been filed until the opposition fee has been paid. (Art. 99(1) European Patent Convention).


Description

TECHNICAL FIELD



[0001] The present invention relates to an oligonucleotide having a knockdown activity (for example, an RNA interfering activity, or the like) against a target messenger RNA (mRNA), and the like, as further defined in the claims.

BACKGROUND ART



[0002] A small interfering RNA (hereinafter referred to as siRNA) is involved in the RNA interference (hereinafter referred to as RNAi) and is an RNA having a function as a guide for inhibiting the expression of a target gene [Nature, vol. 411, No. 6836, pp. 494-498]. An siRNA can selectively inhibit (knock down) the expression of the protein which a messenger RNA (mRNA) regulates, through cleavage of the mRNA, and therefore, the application thereof to pharmaceuticals is expected (Nature Reviews Cancer, vol. 11, pp. 59-67, 2011).

[0003] An siRNA is generally incorporated into a complex called an RNA induced silencing complex (RISC), and then exhibits its function. A main constituent component of the RISC is a protein called Argonaute 2 (AGO2), and AGO2 binds to an siRNA in the RNAi pathway and cleaves an mRNA (Trends in Biochemical Sciences, vol. 35, No. 7, pp. 368-376, 2010). The siRNA incorporated into the RISC is converted to a single strand of only the antisense strand by cleaving the sense strand, and thereafter binds to a target mRNA complementary to the antisense strand. It is known that the target mRNA is then cleaved by an RNAse domain in the AG02, resulting in inhibiting the expression of the protein (Silence, vol. 1, p. 3, 2010).

[0004] On the other hand, in recent years, three-dimensional structure analysis of hAG02 MID/AMP complex and hAG02 MID/UMP complex (Nature, vol. 465, pp. 818-822, 2010), and a three-dimensional structure analysis for a complex of hAGO2 and an RNA oligonucleotide (Science, vol. 336, p. 25, 2012) have also been reported.

[0005] Further, in recent years, particularly a structural analysis of proteins using an X-ray is actively carried out, and there have been many reports of attempts to elucidate a mode of binding between a protein and a compound targeting the protein at the atomic level on the basis of the obtained structural information and to design a compound which fits the structure (Journal of Postgraduate Medicine, vol. 55, pp. 301-304, 2009).

[0006] However, although a possibility of avoiding an off-target effect (Patent Literature 1) and a possibility of enhancing the activity of an siRNA by improving the affinity for AG02 (Non Patent Literaturel) using an oligonucleotide containing an unnatural nucleotide are suggested, a specific method for improving the affinity for AGO2 and enhancing the knockdown activity is not disclosed.

PRIOR ART


PATENT LITERATURE



[0007] [Patent Literature 1] WO2011/119674

[Non Patent Literature]



[0008] [Non Patent Literature 1] Molecular Therapy- Nucleic Acids vol. 1, p. e5, 2012

DISCLOSURE OF THE INVENTION


PROBLEMS TO BE SOLVED BY THE INVENTION



[0009] An object of the present invention is to provide an oligonucleotide which improves affinity for AG02, and the like.

MEANS FOR SOLVING THE PROBLEMS



[0010] The present invention relates to the following (1) to (23).
  1. (1) An oligonucleotide, comprising a nucleotide residue or a nucleoside residue represented by formula (I) at the 5' end thereof, wherein the nucleotide residue or the nucleoside residue binds to an adjacent nucleotide residue through the oxygen atom at position 3:

    {wherein X1 is an oxygen atom, a sulfur atom, a selenium atom, or NR4 (wherein R4 is a hydrogen atom, optionally substituted lower alkyl, optionally substituted lower alkenyl, optionally substituted lower alkynyl, optionally substituted lower alkanoyl, optionally substituted lower alkylsulfonyl, optionally substituted aralkyl, optionally substituted aryl, optionally substituted aroyl, or optionally substituted aromatic heterocyclic carbonyl),

    R1 is formula (II):



    {wherein Y1 is a nitrogen atom,

    R5 is a hydrogen atom, halogen, cyano, or optionally substituted lower alkenyl,

    R6 is a hydrogen atom, halogen, cyano, carboxy, optionally substituted lower alkyl, optionally substituted lower alkenyl, optionally substituted lower alkynyl, optionally substituted lower alkoxy, optionally substituted lower alkylthio, optionally substituted lower alkanoyl, optionally substituted lower alkoxycarbonyl, optionally substituted aryl, optionally substituted aralkyl, optionally substituted aryloxy, optionally substituted arylthio, optionally substituted aroyl, an optionally substituted aromatic heterocyclic group, optionally substituted aromatic heterocyclic alkyl, optionally substituted aromatic heterocyclicoxy, optionally substituted aromatic heterocyclicthio, optionally substituted aromatic heterocyclic carbonyl, -NR11aR11b (wherein R11a and R11b may be the same or different, and each is a hydrogen atom, optionally substituted lower alkyl, optionally substituted lower alkenyl, optionally substituted lower alkynyl, optionally substituted aryl, optionally substituted aralkyl, optionally substituted aromatic heterocyclic alkyl, optionally substituted lower alkanoyl, optionally substituted lower alkylsulfonyl, optionally substituted aroyl, optionally substituted arylsulfonyl, an optionally substituted aromatic heterocyclic group, optionally substituted aromatic heterocyclic carbonyl, or optionally substituted aromatic heterocyclic sulfonyl), -CONR11cR11d (wherein R11c and R11d may be the same or different, and each is a hydrogen atom, optionally substituted lower alkyl, optionally substituted aryl, or an optionally substituted aromatic heterocyclic group) , -NHCONR11eR11f (wherein R11e and R11f may be the same or different, and each is a hydrogen atom, optionally substituted lower alkyl, optionally substituted aralkyl, optionally substituted aromatic heterocyclic alkyl, optionally substituted aryl, or an optionally substituted aromatic heterocyclic group) , or -NHCO2R11g (wherein R11g is optionally substituted lower alkyl, optionally substituted aralkyl, optionally substituted aromatic heterocyclic alkyl, optionally substituted aryl, or an optionally substituted aromatic heterocyclic group), -N=C-R11h (wherein R11h is a hydrogen atom or optionally substituted lower alkyl), -C=N-R11i (wherein R11i is a hydrogen atom or optionally substituted lower alkyl) , or -N=N-R11j (wherein R11j is a hydrogen atom or optionally substituted lower alkyl),

    R7 is a hydrogen atom, provided that when R5 is a hydrogen atom and R6 is -NR11aR11b, R11a and R11b are not simultaneously hydrogen atoms},

    R2 is a hydrogen atom, hydroxy, halogen, or optionally substituted lower alkoxy,

    R3 is a hydrogen atom or



    (wherein n2 is 1, 2, or 3);

    wherein a "lower alkyl" has 1 to 10 carbon atom(s) ; wherein the lower alkyl moiety of a "lower alkoxy", a "lower alkoxycarbonyl", a "lower alkylthio", or a "lower alkylsulfonyl" has 1 to 10 carbon atom(s);

    wherein a "lower alkenyl" has 2 to 10 carbon atoms; wherein a "lower alkynyl" has 2 to 10 carbon atoms; and wherein a "lower alkanoyl" has 1 to 8 carbon atom(s)}, and

    the oligonucleotide has a length of 10 to 80 bases.

  2. (2) The oligonucleotide according to (1), wherein X1 is an oxygen atom.
  3. (3) The oligonucleotide according to (1) or (2), wherein R5 is optionally substituted lower alkenyl or cyano.
  4. (4) The oligonucleotide according to any one of (1) to (3), wherein R6 is optionally substituted lower alkyl, optionally substituted lower alkenyl, optionally substituted lower alkynyl, optionally substituted aryl, an optionally substituted aromatic heterocyclic group, -NR11aR11b (wherein R11a and R11b have the same meanings as described above, respectively), -N=C-R11h (wherein R11h is a hydrogen atom or optionally substituted lower alkyl), -C=N-R11i (wherein R11i is a hydrogen atom or optionally substituted lower alkyl), or -N=N-R11j (wherein R11j is a hydrogen atom or optionally substituted lower alkyl).
  5. (5) The oligonucleotide according to any one of (1) to (3), wherein R6 is optionally substituted lower alkenyl, optionally substituted aryl, or -NR11aR11b (wherein R11a and R11b have the same meanings as described above, respectively).
  6. (6) The oligonucleotide according to any one of (1) to (3), wherein R6 is -NR11aR11b (wherein R11a and R11b are hydrogen atoms or optionally substituted lower alkyls).
  7. (7) The oligonucleotide according to any one of (1) to (3), wherein R6 is optionally substituted aryl and the substituent is located at the meta or para position of the aryl.
  8. (8) The oligonucleotide according to any one of (1) to (7), wherein R3 is

    (wherein n2 has the same meaning as described above).
  9. (9) The oligonucleotide according to (8), wherein n2 is 1.
  10. (10) The oligonucleotide according to any one of (1) to (9), wherein R2 is a hydrogen atom, hydroxy, a fluorine atom, or methoxy.
  11. (11) The oligonucleotide according to any one of (1) to (9), wherein R2 is hydroxy.
  12. (12) The oligonucleotide according to (1), wherein X1 is an oxygen atom, and R2 is a hydrogen atom, hydroxy, a fluorine atom, or methoxy.
  13. (13) The oligonucleotide according to (12), wherein R1 is formula (IIA):

    (wherein R5A and R6A have the same meanings as R5 and R6 described above, respectively).
  14. (14) The oligonucleotide according to (13), wherein R5A is halogen or cyano.
  15. (15) The oligonucleotide according to any one of (13) to (14), wherein R6A is optionally substituted lower alkyl, optionally substituted lower alkenyl, optionally substituted lower alkynyl, optionally substituted aryl, an optionally substituted aromatic heterocyclic group, or NR11aR11b (wherein R11a and R11b have the same meanings as described above, respectively).
  16. (16) The oligonucleotide according to any one of (13) to (14), wherein R6A is NR11aR11b (wherein R11a and R11b have the same meanings as described above, respectively).
  17. (17) The oligonucleotide according to any one of (13) to (14), wherein R6A is amino, optionally substituted lower alkenyl, or optionally substituted aryl.
  18. (18) The oligonucleotide according to any one of (1) to (17), wherein the oligonucleotide has a length of 20 to 50 bases.
  19. (19) The oligonucleotide according to any one of (1) to (17), wherein the oligonucleotide has a length of 20 to 30 bases.
  20. (20) The oligonucleotide according to any one of (1) to (17), wherein the oligonucleotide has a length of 21 to 25 bases.
  21. (21) The oligonucleotide according to any one of (1) to (20), wherein the oligonucleotide is a double-stranded oligonucleotide.
  22. (22) The oligonucleotide according to any one of (1) to (20), wherein the oligonucleotide is a single-stranded oligonucleotide.
  23. (23) The oligonucleotide according to any one of (1) to (20), wherein the oligonucleotide is a small interfering RNA (siRNA).

EFFECT OF THE INVENTION



[0011] According to the present invention, an oligonucleotide having improved the affinity for AG02 and the like are provided.

BRIEF DESCRIPTION OF DRAWING



[0012] 

[Fig. 1] Fig. 1 is a graph for comparing the levels of luciferase luminescence between an siRNA having 8-Br-dA at the 5' end of the antisense strand and an siRNA having adenosine monophosphate at the 5' end of the antisense strand with respect to luciferase-targeting siRNAs (concentration: 100 pmol/L). The ordinate represents the ratio of luminescence in the case of using each siRNA when the amount of luminescence in a negative control group is taken as 1.

[Fig. 2] Fig. 2 is a graph for comparing the levels of luciferase luminescence between an siRNA having 8-Br-dA at the 5' end of the antisense strand (874-BrdA) and an siRNA having adenosine monophosphate (874-A), guanosine monophosphate (874-G), cytidine monophosphate (874-C), or uridine monophosphate (874-U) at the 5' end of the antisense strand with respect to luciferase-targeting siRNAs. The ordinate represents the ratio of luminescence in the case of using each siRNA when the amount of luminescence in a negative control group is taken as 1. In the abscissa, A, G, C, U, and BrdA denote 874-A, 874-G, 874-C, 874-U, and 874-BrdA, respectively. The results of the test performed by setting the concentration of each siRNA to 3. 2 pmol/L, 16 pmol/L, 80 pmol/L, and 400 pmol/L are shown.

[Fig. 3] Fig. 3 is a graph for comparing the expression levels of GAPDH mRNA between an siRNA having 8-Br-dA at the 5' end of the antisense strand and an siRNA having adenosine monophosphate at the 5' end of the antisense strand with respect to siRNAs targeting D-glyceraldehyde-3-phosphate dehydrogenase (GAPDH, GenBank Accession No. NM_001256799). The ordinate represents the relative expression level of GAPDH mRNA when the GAPDH mRNA level in a negative control group is taken as 1. The abscissa represents respective siRNAs, more specifically, the left side represents siRNAs having adenosine monophosphate at the 5' end of the antisense strand (217-A, 278-A, 516-A, 624-A, 715-A, 816-A, 936-A, 1096-A, and 1134-A), and the right side represents siRNAs having 8-Br-dA at the 5' end of the antisense strand (217-BrdA, 278-BrdA, 516-BrdA, 624-BrdA, 715-BrdA, 816-BrdA, 936-BrdA, 1096-BrdA, and 1134-BrdA).

[Fig. 4] Fig. 4 is a graph showing the knockdown activity of each of siRNAs having adenosine monophosphate (454-A), uridine monophosphate (454-U), 8-Br-dA (454-BrdA), I-37 (6-NO2,7-Me-dQu), I-21 (6-napht-2-yl-dPu), I-34 (6-Me-dU), or I-25 (6-napht-1-yl-dPu) at the 5' end of the antisense strand with respect to luciferase-targeting siRNAs. The ordinate represents the 50% inhibitory concentration (IC50), and the abscissa represents the siRNAs used.

[Fig. 5] Fig. 5 is a graph showing the knockdown activity of each of siRNAs having adenosine monophosphate (454-A), uridine monophosphate (454-U), 8-Br-dA (454-BrdA), I-32 (2'-OMe-6-styryl-dA), or 1-19 (di-Me-thienyl-dU) at the 5' end of the antisense strand with respect to luciferase-targeting siRNAs. The ordinate represents the 50% inhibitory concentration (IC50), and the abscissa represents the siRNAs used.


MODE FOR CARRYING OUT THE INVENTION



[0013] Hereinafter, a compound represented by formula (I) wherein X1 is an oxygen atom, R2 is a hydrogen atom, hydroxy, a fluorine atom, or methoxy refers to Compound (Ia).

[0014] In the definitions of the respective groups in formulae (I), (II), (IIA), and (Ia),
  1. (i) the halogen means each atom of fluorine, chlorine, bromine, and iodine.
  2. (ii) Examples of the lower alkyl and the lower alkyl moieties of the lower alkoxy, the lower alkoxycarbonyl,
    the lower alkylthio, and the lower alkylsulfonyl include linear or branched alkyl having 1 to 10 carbon atom(s). Specific examples thereof include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, isopentyl, neopentyl, hexyl, heptyl, octyl, nonyl, decyl, and the like.
  3. (iii) The alkylene moieties of the aralkyl and the aromatic heterocyclic alkyl have the same meanings as groups in which one hydrogen atom is removed from the lower alkyl described in the above (ii).
  4. (iv) Examples of the lower alkenyl include linear or branched alkenyl having 2 to 10 carbon atoms. Specific examples thereof include vinyl, allyl, 1-propenyl, isopropenyl, methacryl, butenyl, crotyl, pentenyl, hexenyl, heptenyl, octenyl, nonenyl, decenyl, and the like.
  5. (v) Examples of the lower alkynyl include linear or branched alkynyl having 2 to 10 carbon atoms. Specific examples thereof include ethynyl, propargyl, butynyl, pentynyl, hexynyl, heptynyl, octynyl, nonynyl, decynyl, and the like.
  6. (vi) Examples of the lower alkanoyl include linear or branched lower alkanoyl having 1 to 8 carbon atom(s). Specific examples thereof include formyl, acetyl, propionyl, butyryl, isobutyryl, valeryl, isovaleryl, pivaloyl, hexanoyl, heptanoyl, octanoyl, and the like.
  7. (vii) Examples of the aryl and the aryl moieties of the aralkyl, the aroyl, the aryloxy, the arylthio, and the arylsulfonyl include aryl having 6 to 14 carbon atoms. Specific examples thereof include phenyl, naphthyl, indenyl, anthryl, and the like, and preferred examples thereof include phenyl, naphthyl, and the like.
  8. (viii) Examples of the aromatic heterocyclic group and the aromatic heterocyclic group moieties of the aromatic heterocyclic alkyl, the aromatic heterocyclic carbonyl, the aromatic heterocyclicoxy, the aromatic heterocyclicthio, and the aromatic heterocyclic sulfonyl include a 5- or 6-membered monocyclic aromatic heterocyclic group containing at least one atom selected from a nitrogen atom, an oxygen atom, and a sulfur atom, a bicyclic or tricyclic fused-ring aromatic heterocyclic group in which 3- to 8-membered rings are fused and at least one atom selected from a nitrogen atom, an oxygen atom, and a sulfur atom is contained, and the like. Specific examples thereof include pyridyl, pyrazinyl, pyrimidinyl, pyridazinyl, oxopyridazinyl, quinolyl, isoquinolyl, phthalazinyl, quinazolinyl, quinoxalinyl, naphthyridinyl, cinnolinyl, pyrrolyl, pyrazolyl, imidazolyl, triazinyl, triazolyl, tetrazolyl, thienyl, furyl, thiazolyl, isothiazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiadiazolyl, indolyl, isoindolyl, indazolyl, benzofuryl, isobenzofuryl, benzothienyl, benzoimidazolyl, benzotriazolyl, benzothiazolyl, benzoxazolyl, pyrazolopyridyl, pyrazolopyrimidinyl, purinyl, dibenzofuranyl, dibenzoazepinyl, and the like, and preferred examples thereof include pyridyl, pyrrolyl, thienyl, oxazolyl, and the like.
  9. (ix) Examples of the aromatic ring include a benzene ring, a naphthalene ring, an aromatic heterocyclic ring, and the like. The aromatic heterocyclic ring has the same meaning as the one formed by adding a hydrogen atom to the aromatic heterocyclic group described above and the an aromatic heterocyclic group moiety of the aromatic heterocyclic alkyl, the aromatic heterocyclic carbonyl, the aromatic heterocyclicoxy, the aromatic heterocyclicthio, and the aromatic heterocyclic sulfonyl.
  10. (x) The substituents of the optionally substituted lower alkyl, the optionally substituted lower alkenyl, the optionally substituted lower alkynyl, the optionally substituted lower alkoxy, the optionally substituted lower alkoxycarbonyl, the optionally substituted lower alkanoyl,
    the optionally substituted lower alkylthio, and the optionally substituted lower alkylsulfonyl may be the same or different and in number of, for example, 1 to 3, and examples of the substituents include substituents selected from the group consisting of halogen, hydroxy, sulfanyl, nitro, cyano, carboxy, carbamoyl, C3-8 cycloalkyl, an aliphatic heterocyclic group, C1-10 alkoxy, C3-8 cycloalkoxy, C6-14 aryloxy, C7-16 aralkyloxy, C1-8 alkanoyloxy, C7-15 aroyloxy, C1-10 alkylsulfanyl, -NRXRY (wherein RX and RY may be the same or different and are a hydrogen atom, C1-10 alkyl, C3-8 cycloalkyl, C6-14 aryl, an aromatic heterocyclic group, C7-16 aralkyl, C1-8 alkanoyl, C7-15 aroyl, C1-10 alkoxycarbonyl, or C7-16 aralkyloxycarbonyl), C1-8 alkanoyl, C7-15 aroyl, C1-10 alkoxycarbonyl, C6-14 aryloxycarbonyl, C1-10 alkylcarbamoyl, and di-C1-10 alkylcarbamoyl, and the like. The substituents of the optionally substituted lower alkenyl, the optionally substituted lower alkynyl, the optionally substituted lower alkoxy, the optionally substituted lower alkoxycarbonyl, the optionally substituted lower alkanoyl,
    the optionally substituted lower alkylthio, and the optionally substituted lower alkylsulfonyl may be substituents selected from the group consisting of C6-14 aryl and an aromatic heterocyclic group in addition to the above-described substituents.
  11. (xi)The substituents of the optionally substituted aryl, the optionally substituted aralkyl, the optionally substituted aryloxy, the optionally substituted arylthio, the optionally substituted arylsulfonyl, the optionally substituted aroyl, the optionally substituted aromatic heterocyclic group, the optionally substituted aromatic heterocyclic alkyl, the optionally substituted aromatic heterocyclic carbonyl, the optionally substituted aromatic heterocyclicoxy, the optionally substituted aromatic heterocyclicthio, and the optionally substituted aromatic heterocyclic sulfonyl may be the same or different and in number of, for example, 1 to 3, and examples of the substituents include substituents selected from the group consisting of halogen, hydroxy, sulfanyl, nitro, cyano, carboxy, carbamoyl, C1-10 alkyl, trifluoromethyl, C3-8 cycloalkyl, C6-14 aryl, an aliphatic heterocyclic group, an aromatic heterocyclic group, C1-10 alkoxy, C3-8 cycloalkoxy, C6-14 aryloxy, C7-16 aralkyloxy, C1-8 alkanoyloxy, C7-15 aroyloxy, C1-10 alkylsulfanyl, -NRXaRYa (wherein RXa and RYa may be the same or different, and each is a hydrogen atom, C1-10 alkyl, C3-8 cycloalkyl, C6-14 aryl, an aromatic heterocyclic group, C7-16 aralkyl, C1-8 alkanoyl, C7-15 aroyl, C1-10 alkoxycarbonyl, or C7-16 aralkyloxycarbonyl) , C1-8 alkanoyl, C7-15 aroyl, C1-10 alkoxycarbonyl, C6-14 aryloxycarbonyl, C1-10 alkylcarbamoyl, and di -C1-10 alkylcarbamoyl, and the like, and preferred examples thereof, in number of 1, include halogen, hydroxy, sulfanyl, nitro, cyano, carboxy, C1-3 alkyl, trifluoromethyl, C1-3 alkoxy, and the like.


[0015] Examples of the C1-10 alkyl and the C1-10 alkyl moieties of the C1-10 alkoxy, the C1-10 alkylsulfanyl, the C1-10 alkoxycarbonyl, the C1-10 alkylcarbamoyl, and the di-C1-10 alkylcarbamoyl described above include the groups exemplified as the lower alkyl described above. The two C1-10 alkyl moieties of the di-C1-10 alkylcarbamoyl may be the same or different.

[0016] Examples of the C1-8 alkanoyl and the C1-8 alkanoyl moiety of the C1-8 alkanoyloxy include the groups exemplified as the lower alkanoyl described above.

[0017] Examples of the C3-8 cycloalkyl and the C3-8 cycloalkyl moiety of the C3-8 cycloalkoxy include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, and the like.

[0018] Examples of the C6-14 aryl and the aryl moieties of the C6-14 aryloxy, the C7-15 aroyl, the C7-15 aroyloxy, and the C6-14 aryloxycarbonyl include the groups exemplified as the aryl described above.

[0019] Examples of the aryl moieties of the C7-16 aralkyloxy, the C7-16 aralkyl, and the C7-16 aralkyloxycarbonyl include the groups exemplified as the aryl described above. Examples of the alkylene moieties include C1-10 alkylene, and more specifically include groups in which one hydrogen atom is removed from the groups exemplified as the lower alkyl described above.

[0020] Examples of the aliphatic heterocyclic group include a 5- or 6-membered monocyclic aliphatic heterocyclic group containing at least one atom selected from a nitrogen atom, an oxygen atom, and a sulfur atom, a bicyclic or tricyclic fused-ring aliphatic heterocyclic group in which 3- to 8-membered rings are fused and at least one atom selected from a nitrogen atom, an oxygen atom, and a sulfur atom is contained, and the like. Specific examples thereof include aziridinyl, azetidinyl, pyrrolidinyl, piperidino, piperidinyl, azepanyl, 1,2,5,6-tetrahydropyridyl, imidazolidinyl, pyrazolidinyl, piperazinyl, homopiperazinyl, pyrazolinyl, oxiranyl, tetrahydrofuranyl, tetrahydro-2H-pyranyl, 5,6-dihydro-2H-pyranyl, oxazolidinyl, morpholino, morpholinyl, thioxazolidinyl, thiomorpholinyl, 2H-oxazolyl, 2H-thioxazolyl, dihydroindolyl, dihydroisoindolyl, dihydrobenzofuranyl, benzimidazolidinyl, dihydrobenzoxazolyl, dihydrobenzothioxazolyl, benzodioxolinyl, tetrahydroquinolyl, tetrahydroisoquinolyl, dihydro-2H-chromanyl, dihydro-1H-chromanyl, dihydro-2H-thiochromanyl, dihydro-1H-thiochromanyl, tetrahydroquinoxalinyl, tetrahydroquinazolinyl, dihydrobenzodioxanyl, and the like.

[0021] The halogen and the aromatic heterocyclic group have the same meanings as described above, respectively.

[0022] Here, in the above formula (II), it is preferred that R6 is optionally substituted aryl, optionally substituted alkenyl, or -NR11aR11b (wherein R11a and R11b have the same meanings as described above, respectively) .

[0023] Incidentally, in case where the above R6 is substituted aryl, it is preferred that the substituent is located at the meta or para position of the aryl.

[0024] The oligonucleotide of the present invention means a polymer or an oligomer comprising a nucleotide residue or a nucleoside residue.

[0025] The oligonucleotide of the present invention includes both of a single-stranded oligonucleotide and a double-stranded oligonucleotide. In a double-stranded oligonucleotide, the base lengths of the respective oligonucleotide strands may be different. Further, the double-stranded oligonucleotide may contain one or more mismatched base pairs. In addition, a complex formed of three or more oligonucleotide strands is also included in the oligonucleotide of the present invention.

[0026] The oligonucleotide of the present invention preferably has a knockdown activity against an mRNA encoding, for example, a protein involved in a disease. Here, the "having a knockdown activity" as used in the specification means inhibiting the expression of a gene (target gene) encoding a protein or the like, and it is preferred that the oligonucleotide of the present invention has the activity preferably 2 times, more preferably 5 times, further more preferably 10 times higher than that of an siRNA containing a corresponding natural nucleotide at the 5' end of the oligonucleotide.

[0027] Examples of the double-stranded oligonucleotide include a double-stranded DNA such as a structural gene, a double-stranded RNA such as a small molecule RNA including an siRNA and a miRNA, and the like. However, the present invention is not limited thereto.

[0028] Examples of the single-stranded oligonucleotide include an antisense oligonucleotide, a microRNA, an aptamer, an antagomir, a single-stranded RNAi agent (such as an siRNA having a hairpin structure), and the like. However, the present invention is not limited thereto.

[0029] The length of the oligonucleotide of the present invention is 10 to 80 bases, preferably 10 to 50 bases, particularly preferably 20 to 50 bases, and the most preferably 20 to 30 bases.

[0030] In the oligonucleotide of the present invention, in addition to the nucleotide residue or the nucleoside residue at the 5' end, further one or more nucleotide residues may be modified. Such modification may be contained in any site of a base, a sugar, and a phosphate.

[0031] A base-modified nucleotide may be any as long as it is a nucleotide in which a part or the whole of the chemical structure of a base of the nucleotide is modified with an arbitrary substituent or is substituted with an arbitrary atom, and examples thereof include a nucleotide in which an oxygen atom in a base is substituted with a sulfur atom, a nucleotide in which a hydrogen atom in a base is substituted with alkyl having 1 to 10 carbon atoms, a nucleotide in which methyl in a base is substituted with hydrogen or alkyl having 2 to 10 carbon atoms, and a nucleotide in which amino is protected by a protecting group such as an alkyl group having 1 to 10 carbon atoms, alkanoyl having 1 to 8 carbon atoms, or the like.

[0032] A sugar moiety-modified nucleotide may be any as long as it is a nucleotide in which a part or the whole of the chemical structure of a sugar of the nucleotide is modified with an arbitrary substituent or is substituted with an arbitrary atom. And, a 2' -modified nucleotide is preferably used.

[0033] Examples of the 2'-modified nucleotide include a 2'-modified nucleotide in which the 2'-OH of a ribose is substituted with a substituent selected from a hydrogen atom, -OR, -R, -R', -SH, -SR, amino, -NHR, -NR2, N3, cyano, and halogen (wherein R is lower alkyl or aryl, and the lower alkyl, the aryl, and the halogen have the same meanings as described above, respectively). Specific examples thereof include a 2'-modified nucleotide in which the 2'-OH is substituted with a substituent selected from the group consisting of a fluorine atom, methoxy, 2-(methoxy)ethoxy, 3-aminopropoxy, 2-[(N,N-dimethylamino)oxy]ethoxy, 3-(N,N-dimethylamino)propoxy, 2-[2-(N,N-dimethylamino)ethoxy]ethoxy, 2-(methylamino)-2-oxoethoxy, 2-(N-methylcarbamoyl)ethoxy, and 2-cyanoethoxy, and the like.

[0034] A phosphate-modified nucleotide may be any as long as it is a nucleotide in which a part or the whole of the chemical structure of a phosphodiester bond of the nucleotide is modified with an arbitrary substituent or is substituted with an arbitrary atom, and examples thereof include a nucleotide in which a phosphodiester bond is substituted with an alkyl phosphonate bond, and the like.

[0035] As the oligonucleotide which has a knockdown activity against an mRNA encoding a protein involved in a disease, any nucleic acid, for example, An oligonucleotide which contains a base sequence complementary to a partial base sequence of the mRNA of a gene (target gene) encoding a protein or the like and inhibits the expression of the target gene can be used. Specifically, a double-stranded oligonucleotide such as an siRNA (short interference RNA) or a miRNA (micro RNA), a single-stranded oligonucleotide such as an shRNA (short hairpin RNA), an antisense nucleic acid, or a ribozyme may be used. And, a double-stranded oligonucleotide is preferred.

[0036] An oligonucleotide strand containing a base sequence complementary to a partial base sequence of the target gene mRNA is referred to as an antisense strand, and an oligonucleotide containing a base sequence complementary to the base sequence of the antisense strand is referred to as a sense strand. The sense strand refers to an oligonucleotide itself consisting of a partial base sequence of the target gene and the like, namely an oligonucleotide which can form a double strand-forming region by pairing with the antisense strand. In a double-stranded oligonucleotide containing a base sequence complementary to a partial base sequence of the target gene mRNA, the 5' end of the oligonucleotide means the 5' end of the antisense strand.

[0037] In the oligonucleotide of the present invention, a double strand-forming region formed by base pairing between an antisense strand and a sense strand has generally 15 to 27 base pairs, preferably 15 to 25 base pairs, more preferably 15 to 23 base pairs, further more preferably 15 to 21 base pairs, and particularly preferably 15 to 19 base pairs. The double strand-forming region may be any as long as the bases of each of the antisense strand and the sense strand pair with each other, and base pairs may be formed or mismatched. And the base at the 5' end of the antisense strand and the base of the sense strand to be paired therewith preferably form an adenosine-uracil (A-U) base pair or a mismatched base pair.

[0038] The oligonucleotide in either the antisense strand or the sense strand which constitutes a double-stranded oligonucleotide, or both of them which constitute a double-stranded oligonucleotide may have an additional nucleotide which does not form a double strand on the 3' side or the 5' side of the double strand-forming region. Such a region which does not form a double strand is also referred to as a protrusion (overhang).

[0039] As the double-stranded oligonucleotide having a protrusion, for example, a double-stranded oligonucleotide having a protrusion consisting of 1 to 4 bases, generally 1 to 3 bases at the 3' end or the 5' end of at least one strand is used. Also, a double-stranded oligonucleotide having a protrusion consisting of 2 bases is preferably used, and a double-stranded oligonucleotide having a protrusion consisting of dTdT or UU is more preferably used. A protrusion may be present on only the antisense strand, only the sense strand, and both of the antisense strand and the sense strand. And, a double-stranded nucleic acid having a protrusion on both of the antisense strand and the sense strand is preferably used.

[0040] In addition, a sequence which is contiguous with the double strand-forming region and partially or completely matches the base sequence of the target gene mRNA, or a sequence which is contiguous with the double strand-forming region and partially or completely matches the base sequence of the complementary strand of the target gene mRNA may also be used. Further, as the double-stranded oligonucleotide, for example, a nucleic acid molecule which forms a double-stranded oligonucleotide having a protrusion described above resulted from the action of a ribonuclease such as Dicer (WO2005/089287), at least a double-stranded oligonucleotide which does not have a protrusion at the 3' end or the 5' end, or the like can also be used.

[0041] Further, in the above-described double-stranded oligonucleotide, preferably, at least a sequence of bases (nucleosides) at positions 2 to 17 from the 5' end side to the 3' end side of the antisense strand is a base sequence complementary to a sequence of 16 consecutive bases of the target gene mRNA. More preferably, a sequence of bases at positions 2 to 19 from the 5' end side to the 3' end side of the antisense strand is a base sequence complementary to a sequence of consecutive 18 bases of the target gene mRNA, a sequence of bases at positions 2 to 21 is a base sequence complementary to a sequence of 20 consecutive bases of the target gene mRNA, or a sequence of bases at positions 2 to 25 is a base sequence complementary to a sequence of 24 consecutive bases of the target gene mRNA.

[0042] The base sequence at the 5' end of the antisense strand may be complementary to or mismatch the base sequence of the target gene mRNA.

[0043] Further, when the nucleic acid used in the present invention is an siRNA, preferably 10 to 70%, more preferably 15 to 60%, further more preferably 20 to 50% of the sugar in the nucleic acid is a 2'-modified nucleotide. The 2'-modified nucleotide of the present invention is preferably 2'-cyano, 2'-halogen, 2'-O-cyano, 2'-alkyl, 2'-substituted alkyl, 2'-O-alkyl, 2'-0-substituted alkyl, 2'-O-alkenyl, 2'-O-substituted alkenyl, 2'-Se-alkyl, 2'-Se-substituted alkyl, or the like, more preferably 2'-cyano, 2'-fluoro, 2'-chloro, 2'-bromo, 2'-trifluoromethyl, 2'-O-methyl, 2'-O-ethyl, 2'-O-isopropyl, 2'-O-trifluoromethyl, 2'-O-[2-(methoxy)ethyl], 2'-O-(3-aminopropyl), 2'-O-[2-(N,N-dimethyl)aminooxy]ethyl, 2'-0-[3-(N,N-dimethylamino)propyl], 2'-O-{2-[2-(N,N-dimethylamino)ethoxy]ethyl}, 2'-O-[2-(methylamino)-2-oxoethyl], 2'-Se-methyl, a hydrogen atom, or the like, further preferably 2'-O-methyl, 2'-O-ethyl, 2'-fluoro, a hydrogen atom, or the like, and most preferably 2'-0-methyl and 2'-0-fluoro.

[0044] Compound (Ia) corresponds to a nucleotide or a nucleoside in which the residual part of a nucleotide residue or a nucleoside residue represented by formula (I) becomes hydroxy. Examples of the preferred embodiment of Compound (Ia) include an nucleotide or an nucleoside corresponding to the nucleotide residues or the nucleoside residues represented by formula (I) according to the above (2) to (17), and examples of the more preferred embodiment thereof include an nucleotide or an nucleoside corresponding to the nucleotide residue or the nucleoside residue represented by formula (I) wherein X1 is an oxygen atom, R2 is a hydrogen atom, hydroxy, a fluorine atom, or methoxy according to the above (12) to (17).

[0045] Compound (Ia) can also be obtained as a salt thereof such as an acid addition salt, a metal salt, an ammonium salt, an organic amine addition salt, an amino acid addition salt, or the like.

[0046] Examples of the acid addition salt include an inorganic acid salt such as hydrochloride, sulfate, or phosphate, and an organic acid salt such as acetate, maleate, fumarate, citrate, or methanesulfonate. Examples of the metal salt include an alkali metal salt such as a sodium salt or a potassium salt, an alkaline earth metal salt such as a magnesium salt or a calcium salt, an aluminum salt, a zinc salt, and the like. Examples of the ammonium salt include a salt of ammonium, tetramethylammonium, and the like. Examples of the organic amine addition salt include an addition salt of morpholine, piperidine, and the like. Examples of the amino acid addition salt include an addition salt of lysine, glycine, phenylalanine, and the like.

[0047] Among Compounds (Ia), some compounds can exist as a stereoisomer such as a geometric isomer or an optical isomer, a tautomer, and the like. All possible isomers and mixtures thereof inclusive of these isomers can be used in the present invention.

[0048] Further, Compound (Ia) can exist in the form of an adduct with water or various solvents, and these adducts can also be used in the present invention.

[0049] Examples of the amidite of Compound (Ia) include Compound (B) in the below-described production method for an oligonucleotide, and the like.

[0050] Next, a production method for an oligonucleotide of the present invention as well as for reference compounds disclosed herein is described.

[0051] A general synthetic method for an oligonucleotide comprises, for example, a step such as an amiditation of a nucleotide, an oligomerization (including a step of deprotection or the like), a duplication by annealing (as needed), or the like.

[0052] The oligonucleotide of the present invention and the reference compounds disclosed herein can be produced by, for example, the following production method.

(1) General Example of Oligomerization



[0053] 

[wherein m is an integer of, for example, 9 to 99, Po is a solid-phase support such as CPG (controlled pore glass) or the like, Ra is a protecting group which can be removed by an acid treatment such as trityl, p,p'-dimethoxytrityl, or the like, Rb is a protecting group which can be removed with a fluoride ion such as tert-butyldimethylsilyl or the like, Rc is a protecting group which can be removed by a base treatment such as 2-cyanoethyl or the like, Rd is optionally substituted lower alkyl, and B is a nucleobase (the nucleobase may be protected by one or more protecting groups as needed, and in the case where the number of the protecting groups is 2 or more, the respective protecting groups may be the same or different). In the case where m is 2 or more, B's in number of m+1, Rb's in number of m+1, and Rc's in number of m may be the same or different, respectively, and Ra's in the respective stages may be the same or different. Here, the lower alkyl has the same meaning as described above, and the substituent of the optionally substituted lower alkyl has the same meaning as that of the optionally substituted lower alkyl described above.]

Step 1



[0054] Compound (C) can be produced by reacting Compound (A) with Compound (B) in a solvent in the presence of a reaction accelerator at a temperature between 0 °C and 50 °C for 10 seconds to 30 minutes.

[0055] Examples of the solvent include dichloromethane, acetonitrile, toluene, ethyl acetate, tetrahydrofuran (THF), 1,4-dioxane, N,N-dimethylformamide (DMF), N-methylpyrrolidone (NMP), water, and the like. These can be used alone or as a mixture thereof.

[0056] Examples of the reaction accelerator include 1H-tetrazole, 4,5-dicyanoimidazole, 5-ethylthiotetrazole, 5-benzylthiotetrazole, and the like.

[0057] Compound (A) can be obtained as, for example, a commercially available product.

[0058] Compound (B) can be produced by, for example, the following method.

(wherein Ra, Rb, Rc, Rd, and B have the same meanings as described above, respectively, and X3 is halogen. The halogen has the same meaning as described above.)

[0059] Compound (B) can be produced by reacting Compound (M) with Compound (N) in a solvent in the presence of a base at a temperature between 0 °C and 100 °C for 10 seconds to 24 hours.

[0060] Examples of the solvent include dichloromethane, acetonitrile, toluene, ethyl acetate, THF, 1,4-dioxane, DMF, NMP, and the like. These can be used alone or as a mixture thereof.

[0061] Examples of the base include triethylamine, N,N-diisopropylethylamine, pyridine, and the like. These can be used alone or as a mixture thereof.

[0062] Further, Compound (B) can also be produced by reacting Compound (M) with Compound (O) in a solvent in the presence of a reaction accelerator at a temperature between 0 °C and 100 °C for 10 seconds to 24 hours.

[0063] Examples of the solvent include acetonitrile, THF, and the like. These can be used alone or as a mixture thereof.

[0064] Examples of the reaction accelerator include those described above.

Step 2



[0065] In Step 1, unreacted Compound (A) can be capped by reacting with an acylation reagent in a solvent in the presence of a base at a temperature between 0 °C and 50 °C for 10 seconds to 30 minutes. At this time, the reaction can also be accelerated by adding a suitable additive.

[0066] Examples of the acylation reagent include acetic anhydride.

[0067] Examples of the solvent include dichloromethane, acetonitrile, ethyl acetate, THF, 1,4-dioxane, DMF, and the like. These can be used alone or as a mixture thereof.

[0068] Examples of the base include pyridine, 2, 6-lutidine, and the like.

[0069] Examples of the additive include 4-dimethylaminopyridine, 1-methylimidazole, and the like.

Step 3



[0070] Compound (D) can be produced by reacting Compound (C) with an oxidizing agent in a solvent in the presence of a base at a temperature between 0 °C and 50 °C for 10 seconds to 30 minutes.

[0071] Examples of the oxidizing agent include iodine, an aqueous hydrogen peroxide solution, m-chloroperoxybenzoic acid, peracetic acid, tert-butyl hydroperoxide, and the like. These can be used alone or as a mixture thereof.

[0072] Examples of the base and the solvent include those described in the above Step 2, respectively.

Step 4



[0073] Compound (E) can be produced by reacting Compound (D) with an acid in a solvent at a temperature between 0 °C and 50 °C for 10 seconds to 30 minutes.

[0074] Examples of the acid include dichloroacetic acid, trichloroacetic acid, trifluoroacetic acid, and the like.

[0075] Examples of the solvent include dichloromethane, chloroform, and the like.

[0076] Steps 1 to 4, and the following Steps 5 and 6 can also be performed by using a nucleic acid synthesizer.

(2) General Example of Introduction of Nucleotide Residue (I) at 5' End



[0077] 

(wherein m, X1, R1, R2, Po, Ra, Rb, Rc, and Rd have the same meanings as described above, respectively.)

Step 5



[0078] Step 5 (deprotection of the protecting group Ra of Compound (F)) can be performed in the same manner as the above-described Step 4.

Step 6



[0079] Coupling of Compound (F) in which Ra is deprotected in Step 5 (hereinafter referred to as Compound (Fa)) with Compound (G) can be performed by, for example, the following method.

[0080] It can be produced by reacting Compound (Fa) with 1 equivalent to a large excess amount of Compound G in a solvent in the presence of a reaction accelerator at a temperature between 0 °C and 50 °C for 10 seconds to 30 minutes.

[0081] Examples of the solvent include dichloromethane, acetonitrile, toluene, ethyl acetate, THF, 1,4-dioxane, DMF, NMP, water, and the like. These can be used alone or as a mixture thereof.

[0082] Examples of the reaction accelerator include those described above.

[0083] Compound G can be obtained as, for example, a commercially available product.

Step 7



[0084] Compound (H) can be obtained in the same manner as in the above-described Step 3 (oxidation of a phosphorus atom).

Step 8



[0085] It can be cleaved from the solid phase by treating with a base to an oligonucleotide supported on a solid phase, the oligonucleotide can be cleaved from the solid phase. That is, Compound (J) can be produced by treating Compound (H) with a base in a solvent at a temperature between -80 °C and 200 °C for 10 seconds to 72 hours.

[0086] Examples of the base include ammonia, methylamine, dimethylamine, ethylamine, diethylamine, 1,8-diazabicyclo[5.4.0]-7-undecene (DBU), and the like.

[0087] Examples of the solvent include water, methanol, ethanol, and the like.

[0088] Incidentally, in this step, deprotection of the protecting group for a nitrogen atom contained in B (nucleobase) is also performed simultaneously.

Step 9



[0089] Compound (K) can be produced by reacting Compound (J) with a fluorine reagent in a solvent at a temperature between -80 °C and 200 °C for 10 seconds to 72 hours. At this time, it is also possible to add a base.

[0090] Examples of the fluorine reagent include hydrogen fluoride, triethylamine hydrofluoride, tetrabutylammonium fluoride (TBAF), and the like.

[0091] Examples of the base include triethylamine, N,N-diisopropylethylamine, and the like.

[0092] Examples of the solvent include dichloromethane, chloroform, acetonitrile, toluene, ethyl acetate, THF, 1,4-dioxane, DMF, N,N-dimethylacetamide (DMA), NMP, dimethyl sulfoxide (DMSO), and the like.

Step 10



[0093] Compound (L) can be produced by treating Compound (K) with an acid in a solvent or in a column at a temperature between 0 °C and 50 °C for 5 minutes to 100 hours.

[0094] Examples of the acid include trifluoroacetic acid and the like.

[0095] Examples of the solvent include water, methanol, ethanol, acetonitrile, and the like. These can be used alone or as a mixture thereof.

[0096] Examples of the column include a C18 reverse-phase cartridge column and the like.

(3) General Example of Production of Double-Stranded Oligonucleotide



[0097] After Compound (L) is reacted with an equimolar amount of a single-stranded oligonucleotide in a solvent at a temperature between 30 °C and 120 °C for 10 seconds to 72 hours, the reaction mixture is gradually cooled to room temperature over 10 minutes to 24 hours, whereby a double-stranded oligonucleotide can be produced.

[0098] Examples of the solvent include an acetate buffer, Tris buffer, a citrate buffer, a phosphate buffer, water, and the like. These can be used alone or as a mixture thereof.

[0099] The single-stranded oligonucleotide reacted with Compound (L) is an oligonucleotide complementary to Compound (L), but may contain one or more mismatched base pairs. Further, the base length thereof may be different.

[0100] In the above-described scheme, by variously changing the nucleobases, the reaction conditions in the respective steps, and the like, a desirable oligonucleotide can be obtained. These can be performed according to the method described in, for example,
  1. (i) Tetrahedron, vol. 48 No. 12, pp. 2223-2311 (1992);
  2. (ii) Current Protocols in Nucleic Acids Chemistry, John Wiley & Sons (2000);
  3. (iii) Protocols for Oligonucleotides and Analogs, Human Press (1993);
  4. (iv) Chemistry and Biology of Artificial Nucleic Acids, Wiley-VCH (2012);
  5. (v) Genome Chemistry, Scientific Approach Using Artificial Nucleic Acids, Kodansha Ltd. (2003);
  6. (vi) New Trend of Nucleic Acid Chemistry, Kagaku-Dojin Publishing Company, Inc. (2011); or the like.

(4) General Method for Producing Nucleotide or Nucleoside Corresponding to Nucleotide Residue or Nucleoside Residue Represented by Formula (I) as well as for Producing Reference Nucleotides or Nucleosides Disclosed herein



[0101] Hereinafter, a general method for producing a nucleotide or a nucleoside corresponding to a nucleotide residue or a nucleoside residue represented by formula (I) and for producing reference nucleotides or nucleosides disclosed herein is described. However, the method for producing a nucleotide residue or a nucleoside residue used in the present invention is not limited thereto.

[0102] In the production method described below, in the case where the defined group changes under the conditions for the production method or is not suitable for performing the production method, by using a method for introducing and removing a protecting group conventionally used in organic synthetic chemistry [for example, Protective Groups in Organic Synthesis, fourth edition, T. W. Greene, John Wiley & Sons, Inc. (2006), or the like] or the like, a target compound can be produced. Further, it is also possible to change the order of the reaction steps for introducing a substituent and the like as needed.

Production Method 4-1



[0103] 

(wherein Ra and Rb have the same meanings as described above, respectively.)

Step 1



[0104] Compound (b) can be produced by reacting Compound (a) with a corresponding alkylating agent in a solvent in the presence of a base at a temperature between 0 °C and 150 °C for 10 minutes to 3 days. The reaction can also be accelerated by a suitable activating agent.

[0105] Examples of the solvent include DMF, pyridine, dichloromethane, THF, ethyl acetate, 1, 4-dioxane, NMP, and the like. These can be used alone or as a mixture thereof.

[0106] Examples of the base include pyridine, triethylamine, N-ethyl-N,N-diisopropylamine, 2,6-lutidine, and the like.

[0107] Examples of the alkylating agent include trityl chloride, p,p'-dimethoxytrityl chloride, and the like.

[0108] Examples of the activating agent include 4-dimethylaminopyridine and the like.

[0109] Compound (a) can be synthesized by, for example, a known method [Journal of Medicinal Chemistry, 2004, 47(6), 1987-1996].

Step 2



[0110] Compound (c) can be produced by reacting Compound (b) with a silylating agent in a solvent in the presence of a silver salt and a base at a temperature between 0 °C and 80 °C for 10 minutes to 3 days.

[0111] Examples of the solvent include THF, ethylene glycol dimethyl ether (DME), and the like. These can be used alone or as a mixture thereof.

[0112] Examples of the silver salt include silver nitrate, silver perchlorate, and the like.

[0113] Examples of the base include triethylamine, 1,4-diazabicyclo[2,2,2]octane (DABCO), pyridine, and the like.

[0114] Examples of the silylating agent include tert-butyldimethylsilyl chloride and the like.

Production Method 4-2



[0115] 

(wherein Ra and Rb have the same meanings as described above, respectively, Re is a protecting group which can be removed with a base, for example, acetyl, benzoyl, or the like, and R11a-1 is optionally substituted lower alkyl, optionally substituted lower alkenyl, optionally substituted lower alkynyl, optionally substituted aryl, optionally substituted aralkyl, optionally substituted aromatic heterocyclic alkyl, or an optionally substituted aromatic heterocyclic group in the definition of R11a described above.)

Step 1



[0116] Compound (e) can be produced by reacting Compound (c) with Compound (d) in a solvent or without a solvent in the presence or absence of a base at a temperature between 0 °C and 150 °C for 1 hour to 1 week.

[0117] Examples of the solvent include DMF, pyridine, dichloromethane, THF, ethyl acetate, NMP, acetonitrile, and the like. These can be used alone or as a mixture thereof.

[0118] Examples of the base include triethylamine, N-ethyl-N,N-diisopropylamine, and the like.

Step 2



[0119] Compound (f) can be produced by reacting Compound (e) with a silylating agent in a solvent at a temperature between 0 °C and 100 °C for 10 minutes to 3 hours, and then, by reacting the resulting product with an acylating agent at a temperature between 0 °C and 100 °C for 1 hour to 72 hours, and by further treating the resulting product with water or an alcohol for 1 hour to 24 hours. The reaction can also be accelerated by allowing a suitable activating agent to coexist with the acylating agent.

[0120] Examples of the solvent include pyridine and the like.

[0121] Examples of the silylating agent include trimethylsilyl chloride, trifluoromethanesulfonyl trimethylsilyl, N,O-bis(trimethylsilyl)acetamide, 1,1,1,3,3,3-hexamethyldisilazane, and the like.

[0122] Examples of the acylating agent include acetic anhydride, acetyl chloride, benzoyl chloride, and the like.

[0123] Examples of the alcohol include methanol, ethanol, 1-propanol, and the like.

[0124] Examples of the activating agent include 4-dimethylaminopyridine.

Production Method 4-3



[0125] 

(wherein Ra, Rb, and R11a-1 have the same meanings as described above, respectively, and R11b-1 is optionally substituted lower alkyl, optionally substituted lower alkenyl, optionally substituted lower alkynyl, optionally substituted aryl, optionally substituted aralkyl, optionally substituted aromatic heterocyclic alkyl, or an optionally substituted aromatic heterocyclic group in the definition of R11b described above.)

[0126] Compound (h) can be produced by reacting Compound (c) with Compound (g) in a solvent or without a solvent in the presence or absence of a base at a temperature between 0 °C and 150 °C for 1 hour to 1 week.

[0127] Examples of the solvent include DMF, pyridine, dichloromethane, THF, ethyl acetate, NMP, acetonitrile, and the like. These can be used alone or as a mixture thereof.

[0128] Examples of the base include triethylamine, N-ethyl-N,N-diisopropylamine, and the like.

Production Method 4-4



[0129] 

(wherein Ra and Rb have the same meanings as described above, respectively, R6b is optionally substituted lower alkyl, optionally substituted aryl, or an optionally substituted aromatic heterocyclic group, Xa is an oxygen atom or a sulfur atom, and M is an alkali metal atom. Here, the lower alkyl, the aryl, and the aromatic heterocyclic group have the same meanings as described above, respectively, the substituent of the optionally substituted lower alkyl has the same meaning as the substituent of the optionally substituted lower alkyl described above, and the substituents of the optionally substituted aryl and the optionally substituted aromatic heterocyclic group have the same meanings as the substituents of the optionally substituted aryl and the optionally substituted aromatic heterocyclic group described above, respectively. The alkali metal atom is a lithium atom, a sodium atom, or a potassium atom.)

[0130] Compound (k) can be produced by reacting Compound (c) with Compound (i) in a solvent at a temperature between 0 °C and 100 °C for 10 minutes to 3 days, or by reacting Compound (c) with Compound (j) in a solvent in the presence of a base at a temperature between 0 °C and 120 °C for 10 minutes to 3 days.

[0131] Examples of the solvent include methanol, ethanol, 2-propanol, THF, DME, DMF, NMP, and the like. These can be used alone or as a mixture thereof.

[0132] Examples of the base include sodium hydroxide, potassium hydroxide, sodium carbonate, potassium carbonate, sodium hydride, potassium hydride, tert-butoxy potassium, and the like.

Production Method 4-5



[0133] 

(wherein Ra and Rb have the same meanings as described above, respectively, Ar is optionally substituted aryl or an optionally substituted aromatic heterocyclic group, and Rf is a hydrogen atom or optionally substituted lower alkyl. Here, the lower alkyl, the aryl, and the aromatic heterocyclic group have the same meanings as described above, respectively, the substituent of the optionally substituted lower alkyl has the same meaning as the substituent of the optionally substituted lower alkyl described above, and the substituents of the optionally substituted aryl and the optionally substituted aromatic heterocyclic group have the same meanings as the substituents of the optionally substituted aryl and the optionally substituted aromatic heterocyclic group described above, respectively.)

[0134] Compound (m) can be produced by reacting Compound (c) with Compound (1) in a solvent in the presence of a base and a palladium catalyst at a temperature between 0 °C and 120 °C for 30 minutes to 72 hours. The reaction can also be accelerated by adding a suitable phosphine.

[0135] Compound (1) can be obtained as a commercially available product or according to a known method [for example, Synthesis of Organic Compound VI, organic synthesis using metal, Jikken Kagaku Koza (Encyclopedia of Experimental Chemistry) 18, 5th Ed., p. 97, Maruzen (2005)] or a method according to that.

[0136] Examples of the base include potassium carbonate, potassium phosphate, potassium hydroxide, sodium hydroxide, potassium tert-butoxide, triethylamine, diisopropylethylamine, N-methylmorpholine, pyridine, DBU, and the like.

[0137] Examples of the palladium catalyst include palladium acetate, tris(dibenzylideneacetone)dipalladium, tetrakis(triphenylphosphine)palladium, 1,1'-bis(diphenylphosphino) ferrocenedichloropalladium/dichloromet hane (1:1) adduct, and the like.

[0138] Examples of the solvent include methanol, ethanol, dichloromethane, chloroform, 1,2-dichloroethane, toluene, ethyl acetate, acetonitrile, diethyl ether, THF, DME, dioxane, DMF, DMA, NMP, water, and the like. These can be used alone or as a mixture thereof.

[0139] Examples of the suitable phosphine include 1,2-bis(diphenylphosphino)ethane, 1,3-bis(diphenylphosphino)propane, 4,5'-bis(diphenylphosphino)-9,9'-dimethylxanthene (Xantphos), 2,2'-bis(diphenylphosphino)-1,1'-binaphthyl (BINAP), and the like.

Production Method 4-6



[0140] 

(wherein Ra, Rb, and Rf have the same meanings as described above, respectively. Each of R15a, R15b, and R15c is a hydrogen atom, optionally substituted lower alkyl, aryl, or an aromatic heterocyclic group. Here, the lower alkyl, the aryl, and the aromatic heterocyclic group have the same meanings as described above, respectively, and the substituent of the optionally substituted lower alkyl has the same meaning as the substituent of the optionally substituted lower alkyl described above.)

[0141] Compound (p) can be produced by reacting Compound (c) with Compound (n) in a solvent in the presence of a base and a palladium catalyst at a temperature between 0 °C and 120 °C for 30 minutes to 72 hours. The reaction can also be accelerated by adding a suitable phosphine.

[0142] Compound (n) can be obtained as, for example, a commercially available product.

[0143] Examples of the base include potassium carbonate, potassium phosphate, potassium hydroxide, sodium hydroxide, potassium tert-butoxide, triethylamine, diisopropylethylamine, N-methylmorpholine, pyridine, DBU, and the like.

[0144] Examples of the palladium catalyst include those described above.

[0145] Examples of the solvent include methanol, ethanol, dichloromethane, chloroform, 1,2-dichloroethane, toluene, ethyl acetate, acetonitrile, diethyl ether, THF, DME, dioxane, DMF, DMA, NMP, water, and the like. These can be used alone or as a mixture thereof.

[0146] Further, Compound (p) can also be produced by reacting Compound (c) with Compound (o) in a solvent in the presence of a base and a palladium catalyst at a temperature between 0 °C and 140 °C for 30 minutes to 72 hours.

[0147] Examples of the base include potassium acetate, sodium hydrogen carbonate, potassium carbonate, potassium hydroxide, sodium hydroxide, sodium methoxide, potassium tert-butoxide, triethylamine, diisopropylethylamine, N-methylmorpholine, pyridine, DBU, and the like.

[0148] Examples of the palladium catalyst include those described above.

[0149] Examples of the solvent include dichloromethane, chloroform, 1,2-dichloroethane, toluene, ethyl acetate, acetonitrile, diethyl ether, THF, DME, dioxane, DMF, DMA, NMP, and the like. These can be used alone or as a mixture thereof.

[0150] Examples of the suitable phosphine include 1,2-bis(diphenylphosphino)ethane, 1,3-bis(diphenylphosphino)propane, Xantphos, BINAP, and the like.

Production Method 4-7



[0151] 

(wherein Ra, Rb, and R6b have the same meanings as described above, respectively.)

[0152] Compound (r) can be produced by reacting Compound (c) with Compound (q) in a solvent in the presence of a palladium catalyst at a temperature between 0 °C and 150 °C. The reaction can also be accelerated by adding a suitable additive and/or a suitable phosphine.

[0153] Examples of the solvent include methanol, ethanol, dichloromethane, chloroform, 1,2-dichloroethane, toluene, ethyl acetate, acetonitrile, diethyl ether, THF, DME, dioxane, DMF, DMA, NMP, and the like. These can be used alone or as a mixture thereof.

[0154] Compound (q) can be obtained as, for example, a commercially available product.

[0155] Examples of the palladium catalyst include those described above.

[0156] Examples of the suitable additive include lithium chloride, cesium fluoride, and the like.

[0157] Examples of the suitable phosphine include 1,2-bis(diphenylphosphino)ethane, 1,3-bis(diphenylphosphino)propane, Xantphos, BINAP, and the like.

Production Method 4-8



[0158] 

(wherein Ra, Rb, R11e, and R11d have the same meanings as described above, respectively.)

[0159] Compound (t) can be produced by reacting Compound (c) with Compound (s) in a solvent under a carbon monoxide atmosphere in the presence of a base and a palladium catalyst at a temperature between room temperature and 120 °C for 1 hour to 72 hours. The reaction can also be accelerated by adding a suitable phosphine.

[0160] Examples of the solvent include dichloromethane, chloroform, 1,2-dichloroethane, toluene, ethyl acetate, acetonitrile, diethyl ether, THF, DME, dioxane, DMF, DMA, NMP, and the like. These can be used alone or as a mixture thereof.

[0161] Examples of the base include sodium acetate, potassium acetate, sodium hydrogen carbonate, potassium carbonate, sodium methoxide, potassium tert-butoxide, triethylamine, diisopropylethylamine, N-methylmorpholine, pyridine, DBU, and the like.

[0162] Examples of the palladium catalyst include those described above.

[0163] Examples of the phosphine include 1,2-bis(diphenylphosphino)ethane, 1,3-bis(diphenylphosphino)propane, Xantphos, BINAP, and the like.

Production Method 4-9



[0164] 

(wherein Ra and Rb have the same meanings as described above, respectively, and R6c is optionally substituted lower alkyl, optionally substituted aryl, or an optionally substituted aromatic heterocyclic group. Here, the lower alkyl, the aryl, and the aromatic heterocyclic group have the same meanings as described above, respectively, the substituent of the optionally substituted lower alkyl has the same meaning as the substituent of the optionally substituted lower alkyl described above, and the substituents of the optionally substituted aryl and the optionally substituted aromatic heterocyclic group have the same meanings as the substituents of the optionally substituted aryl and the optionally substituted aromatic heterocyclic group described above, respectively.)

Step 1



[0165] Compound (w) can be produced by reacting Compound (c) with Compound (u) in a solvent under a carbon monoxide atmosphere in the presence of a base and a palladium catalyst at a temperature between room temperature and 120 °C for 1 hour to 72 hours. The reaction can also be accelerated by adding a suitable phosphine.

[0166] Examples of the solvent include methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, tert-butyl alcohol, dichloromethane, chloroform, 1,2-dichloroethane, toluene, ethyl acetate, acetonitrile, diethyl ether, THF, DME, dioxane, DMF, DMA, NMP, and the like. These can be used alone or as a mixture thereof.

[0167] Examples of the base include sodium acetate, potassium acetate, sodium hydrogen carbonate, potassium carbonate, sodium methoxide, potassium tert-butoxide, triethylamine, diisopropylethylamine, N-methylmorpholine, pyridine, DBU, and the like.

[0168] Examples of the palladium catalyst include those described above.

[0169] Examples of the phosphine include 1,2-bis(diphenylphosphino)ethane,
1,3-bis(diphenylphosphino)propane, Xantphos, BINAP, and the like.

Step 2



[0170] Compound (y) can be produced by treating Compound (w) in a solvent in the presence of a base at a temperature between 0 °C and 100 °C for 5 minutes to 72 hours.

[0171] Examples of the base include potassium carbonate, lithium hydroxide, potassium hydroxide, sodium hydroxide, sodium methoxide, and the like.

[0172] Examples of the solvent include a solvent containing water, and examples of the solvent include methanol, ethanol, dichloromethane, chloroform, 1,2-dichloroethane, toluene, ethyl acetate, acetonitrile, diethyl ether, THF, DME, dioxane, DMF, DMA, NMP, pyridine, and the like. These are used by mixing with water or by mixing with one another and then adding water thereto.

Production Method 4-10



[0173] 

(wherein Ra and Rb have the same meanings as described above, respectively, and R6d is optionally substituted lower alkyl, aryl, or an aromatic heterocyclic group. Here, the lower alkyl, the aryl, and the aromatic heterocyclic group have the same meanings as described above, respectively, and the substituent of the optionally substituted lower alkyl has the same meaning as the substituent of the optionally substituted lower alkyl described above.)

[0174] Compound (aa) can be produced by reacting Compound (c) with Compound (z) in a solvent in the presence of a copper salt, a base, and a palladium catalyst at a temperature between room temperature and 150 °C for 1 hour to 72 hours. The reaction can also be accelerated by adding a suitable phosphine.

[0175] Examples of the solvent include dichloromethane, chloroform, 1,2-dichloroethane, toluene, ethyl acetate, acetonitrile, diethyl ether, THF, DME, dioxane, DMF, DMA, NMP, and the like. These can be used alone or as a mixture thereof.

[0176] Examples of the copper salt include copper (I) iodide and the like.

[0177] Examples of the base include sodium acetate, potassium acetate, sodium hydrogen carbonate, potassium carbonate, sodium methoxide, potassium tert-butoxide, triethylamine, diisopropylethylamine, N-methylmorpholine, pyridine, DBU, and the like.

[0178] Examples of the palladium catalyst include those described above.

[0179] Examples of the phosphine include 1,2-bis(diphenylphosphino)ethane, 1,3-bis(diphenylphosphino)propane, Xantphos, BINAP, and the like.

Production Method 4-11



[0180] By using Compound ae obtained by the following method, a nucleoside used as a starting material for the production of the oligonucleotide of the present invention can be obtained according to the above-described production methods 4-2 to 4-10.

(wherein Ra, Rb, and Rc have the same meanings as described above, respectively.)

Step 1



[0181] Compound (ac) can be produced by reacting Compound (ab) with a silylating agent in a solvent at a temperature between 0 °C and 100 °C for 10 minutes to 3 hours, and then, by reacting with an acylating agent at a temperature between 0 °C and 100 °C for 1 hour to 72 hours, and by further treating with water or an alcohol for 1 hour to 24 hours.

[0182] Examples of the solvent include pyridine and the like.

[0183] Examples of the silylating agent include trimethylsilyl chloride, trifluoromethanesulfonyl trimethylsilyl, N,O-bis(trimethylsilyl)acetamide, 1,1,1,3,3,3-hexamethyldisilazane, and the like.

[0184] Examples of the acylating agent include acetic anhydride, acetyl chloride, benzoyl chloride, and the like.

[0185] Examples of the alcohol include methanol, ethanol, 1-propanol, and the like.

[0186] Compound (ab) can be synthesized by, for example, a known method [Tetrahedron, 1970, 26, 4251-4259].

Step 2



[0187] Compound (ad) can be produced by reacting Compound (ac) with a corresponding alkylating agent in a solvent in the presence of a base at a temperature between 0 °C and 150 °C for 10 minutes to 3 days. The reaction can also be accelerated by a suitable activating agent.

[0188] Examples of the solvent include DMF, pyridine, dichloromethane, THF, ethyl acetate, 1,4-dioxane, NMP, and the like. These can be used alone or as a mixture thereof.

[0189] Examples of the base include pyridine, triethylamine, N-ethyl-N,N-diisopropylamine, 2,6-lutidine, and the like.

[0190] Examples of the alkylating agent include trityl chloride, p,p'-dimethoxytrityl chloride, and the like.

[0191] Examples of the activating agent include 4-dimethylaminopyridine and the like.

Step 3



[0192] Compound (ae) can be produced by reacting Compound (ad) with a silylating agent in a solvent in the presence of a silver salt and a base at a temperature between 0 °C and 80 °C for 10 minutes to 3 days.

[0193] Examples of the solvent include THF, DME, and the like. These can be used alone or as a mixture thereof.

[0194] Examples of the silver salt include silver nitrate, silver perchlorate, and the like.

[0195] Examples of the base include triethylamine, DABCO, pyridine, and the like.

[0196] Examples of the silylating agent include tert-butyldimethylsilyl chloride and the like.

Production Method 4-12 (Reference)



[0197] 

(wherein Ra and Rb have the same meanings as described above, respectively.)

Step 1



[0198] Compound (ag) can be produced by reacting Compound (af) with a corresponding alkylating agent in a solvent in the presence of a base at a temperature between 0 °C and 150 °C for 10 minutes to 3 days. The reaction can also be accelerated by a suitable activating agent.

[0199] Examples of the solvent include DMF, pyridine, dichloromethane, THF, ethyl acetate, 1,4-dioxane, NMP, and the like. These can be used alone or as a mixture thereof.

[0200] Examples of the base include pyridine, triethylamine, N-ethyl-N,N-diisopropylamine, 2,6-lutidine, and the like.

[0201] Examples of the alkylating agent include trityl chloride, p,p'-dimethoxytrityl chloride, and the like.

[0202] Examples of the activating agent include 4-dimethylaminopyridine and the like.

[0203] Compound (af) can be synthesized by, for example, a known method [Journal of Medicinal Chemistry, 2004, 50(5), 915-921 and WO2011/51733].

Step 2



[0204] Compound (ah) can be produced by reacting Compound (ag) with a silylating agent in a solvent in the presence of a silver salt and a base at a temperature between 0 °C and 80 °C for 10 minutes to 3 days.

[0205] Examples of the solvent include THF, DME, and the like. These can be used alone or as a mixture thereof.

[0206] Examples of the silver salt include silver nitrate, silver perchlorate, and the like.

[0207] Examples of the base include triethylamine, DABCO, pyridine, and the like.

[0208] Examples of the silylating agent include tert-butyldimethylsilyl chloride and the like.

Production Method 4-13 (Reference)



[0209] 

(wherein Ra, Rb, Rf, and Ar have the same meanings as described above, respectively.)

[0210] Compound (ai) can be produced according to the production method 4-5 using Compound (ah).

Production Method 4-14 (Reference)



[0211] 

(wherein Ra, Rb, Rf, R15a, R15b, and R15c have the same meanings as described above, respectively.)

[0212] Compound (aj) can be produced according to the production method 4-6 using Compound (ah).

Production Method 4-15 (Reference)



[0213] 

(wherein Ra, Rb, and R6b have the same meanings as described above, respectively.)

[0214] Compound (ak) can be produced according to the production method 4-7 using Compound (ah).

Production Method 4-16 (Reference)



[0215] 

(wherein Ra, Rb, and R6d have the same meanings as described above, respectively.)

[0216] Compound (al) can be produced according to the production method 4-10 using Compound (ah).

Production Method 4-17 (Reference)



[0217] 

(wherein Ra, ring A, R16, n1, and Rb have the same meanings as described above, respectively, Rg is a protecting group which can be removed with a fluoride ion, for example, di-tert-butylsilyl or the like, Xa is a leaving group, for example, halogen, an acyloxy group, or the like, and R17, R18, and R19, are each protecting groups which can be deprotected with a base, for example, an acyl group or the like.)

Step 1



[0218] Compound (nb) can be produced by reacting Compound (na) with Compound (naa) in a solvent in the presence of a silylating agent at a temperature between 0 °C and 150 °C for 10 minutes to 1 day, and then, by treating in the presence of a Lewis acid at a temperature between 0 °C and 150 °C for 10 minutes to 1 day.

[0219] Examples of the solvent include acetonitrile, 1,2-dichloroethane, THF, toluene, and the like. These can be used alone or as a mixture thereof.

[0220] Examples of the silylating agent include trimethylsilyl chloride, trifluoromethanesulfonyl trimethylsilyl, N,O-bis(trimethylsilyl)acetamide, 1,1,1,3,3,3-hexamethyldisilazane, and the like.

[0221] Examples of the Lewis acid include trifluoromethanesulfonyl trimethylsilyl, tin tetrachloride, and the like.

[0222] Compound (na) can be obtained as a commercially available product or, for example, by a known method (Tetrahedron, 2012, vol. 68, pp. 8908-8915) or a method according to that.

Step 2



[0223] Compound (nc) can be produced by reacting Compound (nb) with a base in a solvent or without a solvent at a temperature between room temperature and 50 °C for 1 hour to 4 days.

[0224] Examples of the solvent include methanol, ethanol, THF, DMF, water, and the like. These can be used alone or as a mixture thereof.

[0225] Examples of the base include ammonia, methylamine, sodium hydroxide, sodium methoxide, and the like.

Step 3



[0226] Compound (nd) can be produced by reacting Compound (nc) with, for example, a corresponding silylating agent in a solvent in the presence of a base at a temperature between 0 °C and 80 °C for 10 minutes to 3 days.

[0227] Examples of the solvent include DMF, DMA, NMP, and the like. These can be used alone or as a mixture thereof.

[0228] Examples of the base include imidazole, triethylamine, diisopropylethylamine, and the like.

[0229] Examples of the silylating agent include di-tert-butylsilyl bis(trifluoromethanesulfonate) and the like.

Step 4



[0230] Compound (ne) can be produced by reacting Compound (nd) with, for example, a corresponding silylating agent in a solvent in the presence of a base at a temperature between 0 °C and 80 °C for 10 minutes to 3 days.

[0231] Examples of the solvent include dichloromethane, chloroform, 1,2-dichloroethane, DMF, and the like. These can be used alone or as a mixture thereof.

[0232] Examples of the base include imidazole, triethylamine, diisopropylethylamine, and the like.

[0233] Examples of the silylating agent include tert-butyldimethylsilyl chloride and the like.

Step 5



[0234] Compound (nf) can be produced by treating Compound (ne) with a deprotecting reagent in a solvent in the presence of a base at a temperature between 0 °C and 80 °C for 10 minutes to 3 days.

[0235] Examples of the solvent include dichloromethane, chloroform, 1,2-dichloroethane, diethyl ether, THF, DME, dioxane, and the like. These can be used alone or as a mixture thereof.

[0236] Examples of the base include triethylamine, diisopropylethylamine, pyridine, and the like.

[0237] Examples of the deprotecting reagent include hydrogen fluoride-pyridine and the like.

Step 6



[0238] Compound (ng) can be produced by reacting Compound (nf) with a corresponding alkylating agent in a solvent in the presence of a base at a temperature between 0 °C and 150 °C for 10 minutes to 3 days. The reaction can also be accelerated by a suitable activating agent.

[0239] Examples of the solvent include dichloromethane, chloroform, 1,2-dichloroethane, THF, dioxane, DMF, pyridine, and the like. These can be used alone or as a mixture thereof.

[0240] Examples of the base include triethylamine, diisopropylethylamine, pyridine, and the like.

[0241] Examples of the alkylating agent include trityl chloride, p,p'-dimethoxytrityl chloride, and the like.

[0242] Examples of the activating agent include 4-dimethylaminopyridine and the like.

[0243] The transformation of each group in the compounds included in the above-described respective production methods can also be performed by a known method [for example, Comprehensive Organic Transformations 2nd edition, R. C. Larock, Vch Verlagsgesellscaft Mbh, 1999, or the like] or a method according to those.

[0244] A desired nucleotide or nucleoside can be obtained by performing deprotection and phosphorylation of hydroxy of the product obtained by the above-described respective production methods according to a known method [for example, Journal of Medicinal Chemistry, vol. 55, pp. 1478-1489, 2012, or the like].

[0245] The intermediate and the target compound in the above-described respective production methods can be isolated and purified by a separation and purification method conventionally used in organic synthetic chemistry, for example, filtration, extraction, washing, drying, concentration, recrystallization, various types of chromatography, or the like. Further, the intermediate can also be subjected to the subsequent reaction particularly without further purification.

[0246] The nucleotide or nucleoside above can also be obtained in the form of a salt such as an acid addition salt, a metal salt, an ammonium salt, an organic amine addition salt, an amino acid addition salt, or the like.

[0247] Examples of the acid addition salt include an inorganic acid salt such as hydrochloride, sulfate, or phosphate, and an organic acid salt such as acetate, maleate, fumarate, citrate, or methanesulfonate. Examples of the metal salt include an alkali metal salt such as a sodium salt or a potassium salt, an alkaline earth metal salt such as a magnesium salt or a calcium salt, an aluminum salt, a zinc salt, and the like. Examples of the ammonium salt include a salt of ammonium, tetramethylammonium, or the like. Examples of the organic amine addition salt include an addition salt of morpholine, piperidine, or the like. Examples of the amino acid addition salt include a lysine addition salt, a glycine addition salt, a phenylalanine addition salt, and the like.

[0248] If it is desirable to obtain a salt of the nucleotide or the nucleoside above, when the nucleotide or the nucleoside is obtained in the form of a salt, it may be directly purified. Further, when the nucleotide or the nucleoside is obtained in a free form, the nucleotide or the nucleoside may be dissolved or suspended in a suitable solvent, followed by addition of an acid or a base. Then, the resulting salt may be isolated and purified.

[0249] Among the nucleotides or the nucleosides above, some nucleotides or nucleosides can exist as a stereoisomer such as a geometric isomer or a optical isomer, a tautomer, or the like. All possible isomers inclusive of these stereoisomers and tautomers and mixtures thereof can be used in the present invention.

[0250] Further, the nucleotide or the nucleoside above can exist in the form of an adduct with water or various solvents, and these adducts can also be used in the present invention.

[0251] Specific examples of Compound (Ia) as well as reference compounds disclosed herein are shown in Tables 1 to 7. It should be noted, however, that Compound (Ia) of the present invention and the corresponding nucleotide residue or nucleoside residue represented by formula (I) are not limited to these and the corresponding nucleotide residue or nucleoside residue. The compounds I-2 to I-4 are provided as reference examples.
Table 1
Compound No.structural formula
I-1(8-Br-dA)

I-2(8-oxo-dA)

I=3(8-Br-dU)

I-4(5-F-dU)

I-5 reference example 1

I-6 reference example 2

I-7 reference example 3

Table 2
compound No.structural formula
I-8 reference example 4

I-9 reference example 5

I-10

I-11

I-12

I-13

I-14 reference example 10

Table 3
compound No.structural formula
I-15 reference example 11

I-16 reference example 12

I-17 reference example 13

I-18

Table 4
compound No.structural formula
I-19 reference example 15

I-20

I-21

I-22

I-23 reference example 19

I-24 reference example 20

Table 5
compound No.structural formula
I-25

I-26

I-27

I-28

I-29

I-30

Table 6
compound No.structural formula
I-31 reference example 27

I-32

I-33 reference example 29

I-34 reference example 30

Table 7
compound No.structural formula
I-35 reference example 31

I-36 reference example 32

I-37 reference example 33

I-38



[0252] The oligonucleotide of the present invention can be introduced into a cell by using a carrier for transfection, preferably a cationic carrier such as a cationic liposome. Further, it can also be directly introduced into a cell by a calcium phosphate method, an electroporation method, a microinjection method, and the like.

[0253] For example, an siRNA can selectively inhibit the expression of any protein through cleavage of an mRNA, and therefore, the application thereof to pharmaceuticals is expected. In an oligonucleotide (for example, an siRNA) having a knockdown activity against an mRNA encoding a protein involved in a disease, by substituting a nucleotide residue or a nucleoside residue at the 5' end of the oligonucleotide with a nucleotide residue or a nucleoside residue represented by formula (I), the knockdown activity against a target mRNA is expected.

[0254] Further, as disclosed herein, in an oligonucleotide (for example, an siRNA) having a knockdown activity against an mRNA encoding a protein involved in a disease, by substituting a base residue at the 5' end of the oligonucleotide with a base residue represented by formula (II), the affinity of the oligonucleotide for AGO2 is improved and the oligonucleotide has a higher knockdown activity against a target mRNA. Further, in an oligonucleotide in which a base at the 5' end is guanine or cytosine, by substituting the guanine residue or the cytosine residue at the 5' end of the oligonucleotide with an adenine residue (6-aminopurin-9-yl), a thymine residue (5-methyl-1,2,3,4-tetrahydropyrimidine-2,4-dion-1-yl), an uridine residue (pyrimidin-2,4(1H,3H)-dion-1-yl), or a base residue represented by formula (II), the affinity of the oligonucleotide for AGO2 is improved and the oligonucleotide has a higher knockdown activity against a target mRNA.

[0255] The phosphate moiety at the 5' end or the sugar moiety of the oligonucleotide having a high knockdown activity against a target mRNA obtained as disclosed herein may be the same as or different from that of formula (I).

[0256] In the present invention, examples of the preferred embodiment of base residues represented by formula (II) include base residues represented by formula (II) according to the above (1) to (7), and examples of the more preferred embodiment thereof include base residues represented by formula (IIA) according to the above (14) to (17).

[0257] The oligonucleotide of the present invention and the oligonucleotide having a knockdown activity against a target mRNA improved by the method disclosed herein can be administered alone as it is. However, usually, it is preferably provided in various pharmaceutical formulations. Further, these pharmaceutical formulations are used for animals and humans.

[0258] The pharmaceutical formulations relating to the present invention can contain, as the active ingredient, the oligonucleotide of the present invention alone or as a mixture with any other active ingredient for treatment. Further, these pharmaceutical formulations are prepared by mixing the active ingredient with one or more pharmaceutically acceptable carriers and then produced by any method well known in the technical field of pharmaceutics. Examples of the production method for the pharmaceutical formulation of the present invention include a calcium phosphate method, a DEAE-dextran method, electroporation and microinjection, a virus method, a method using a cationic liposome, and the like (Graham, F. L. and van der Eb, A. J. (1973) Virol. 52, 456; McCutchan, J. H. and Pagano, J. S. (1968) J. Natl. Cancer Inst. 41, 351, Chu, G. et al., (1987) Nucl. Acids Res. 15, 1311, Fraley, R. et al., (1980) J. Biol. Chem. 255, 10431; Capechi, M. R. (1980) Cell, 22, 479, Felgner, P. L. et al., (1987), Proc. Natl. Acad. Sci. USA, 84, 7413).

[0259] Further, a method using a nucleic acid-containing cationic lipid particle or cationic polymer, a nucleic acid-encapsulated lipid particle, and the like is included. In addition, modification of the surface of a lipid particle and the like with a water-soluble polymer such as polyethylene glycol (PEG) is generally performed, and also the above-described nucleic acid-containing cationic lipid particle or cationic polymer, nucleic acid-encapsulated lipid particle, and the like described above can be transformed into a PEG-modified lipid particle.

[0260] As for the administration route, it is preferred to select the most effective administration route in the treatment. Examples of the administration route include oral administration or parenteral administration such as intravenous administration.

[0261] Examples of the dosage form include a tablet, an injection, and the like.

[0262] A suitable dosage form for the oral administration, for example, a tablet or the like, can be produced by using an excipient such as lactose, a disintegrator such as starch, a lubricant such as magnesium stearate, a binder such as hydroxypropyl cellulose, and the like.

[0263] A suitable dosage form for the parenteral administration, for example, an injection, can be produced by using a salt solution, a glucose solution, or a mixed liquid of a salt solution and a glucose solution, and the like.

[0264] The dose and the frequency of administration of the oligonucleotide of the present invention may vary depending upon dosage form, age and body weight of a patient, nature or seriousness of the symptom to be treated, and the like. In general, in the parenteral administration such as intravenous administration a dose of 0.001 to 100 mg, preferably, 0.01 to 10 mg, is administered to an adult once or several times a day. However, these doses and frequencies of administration vary according to the various conditions described above.

[0265] Hereinafter, embodiments of the present invention as well as reference embodiments disclosed herein are described with reference to Examples and Reference Examples. Unless otherwise stated, starting materials and reagents used were obtained as commercially available products, or according to known methods. Incidentally, the present invention is not limited to these Examples and Reference Examples.

Example 1



[0266]  The synthesis of luciferase-targeting siRNAs having 8-bromo-2'-deoxyadenosine monophosphate (8-Br-dA) at the 5' end of each of the antisense strands shown in Table 8 (X contained in the sequence of each of the antisense strands denotes 8-Br-dA) were performed on a scale of 0. 5 µmol using a nucleic acid synthesizer (Ultra Fast Parallel Synthesizer, Sigma Co., Ltd., hereinafter referred to as UFPS). As a solid-phase support, CPG 500 angstrom, rA.rG(tac), SAFC-PROLIGO was used. Each of DMT-2'-O-TBDMS-rA(tac) amidite (SAFC-PROLIGO), DMT-2'-O-TBDMS-rG(tac) amidite (SAFC-PROLIGO), DMT-2'-O-TBDMS-rC(tac) amidite (SAFC-PROLIGO), and DMT-2'-O-TBDMS-rU amidite (SAFC-PROLIGO) was prepared into a 0.1mol/L acetonitrile solution, 8-Br-dA-CE phosphoramidite (Glen ResearchCorporation) was prepared into a 0.1 mol/L acetonitrile solution, Chemical Phosphorylation Reagent II (Glen Research Corporation) was prepared into a 0.06 mol/L acetonitrile solution, and these were used for a condensation reaction. As an activating agent of phosphoramidites, 5-benzylthio-1H-tetrazole (SAFC-PROLIGO) was used, and the condensation time was set to 10 minutes in each case. After synthesis in trityl-off mode, it was immersed in a 28% ammonia solution, and the resulting mixture was allowed to stand at 55 °C for 4 hours . After the reaction mixture was concentrated under the reduced pressure, 31% triethylamine trihydrofluoride was added thereto, and the resulting mixture was allowed to stand at 65 °C for 3 hours. Thereafter, 1-butanol was added thereto to stop the reaction. The resulting product was purified by reverse-phase liquid chromatography (SHISEIDO, CAPSELL PAK C18, SG300, 6.0 mm x 75 mm, 5% acetonitrile/0.1% triethylammonium acetate buffer, gradient by B solution: 50% acetonitrile/water), whereby a target oligonucleotide was obtained.

[0267] The single-stranded oligonucleotide obtained was dissolved in a mixed buffer [100 mmol/L potassium acetate, 30 mmol/L 2-[4-(2-hydroxyethyl)piperazin-1-yl]ethanesulfonic acid (HEPES)-KOH (pH 7.4), and 2 mmol/L magnesium acetate] to give a concentration of 50 µmol/L. Equal amounts of sense and antisense strands were mixed with each other and the resulting mixture was allowed to stand at 80 °C for 10 minutes. The temperature of the mixture was gradually decreased, and the mixture was allowed to stand at 37 °C for 1 hour, whereby a double-stranded oligonucleotide was obtained.
Table 8
 sense strandantisense strand
sequence(5'→3')sequence numbersequence(5'→3')sequence number
239-BrdA UGCAGCGAGAAUAGCUUGUAG 1 XCAAGCUAUUCUCGCUGCACA 2
874-BrdA UAGCUUCUUCGCUAAGAGUAC 3 XCUCUUAGCGAAGAAGCUAAA 4
904-BrdA CAAGUACGACCUAAGCAAUUU 5 XUUGCUUAGGUCGUACUUGUC 6
1084-BrdA AGGCAAGGUGGUGCCCUUUUU 7 XAAGGGCACCACCUUGCCUAC 8

Test Example 1: RNAi Activity of Luciferase-Targeting siRNA



[0268] The RNAi activity of the luciferase-targeting siRNA having 8-Br-dA at the 5' end of the antisense strand obtained in Example 1 was evaluated by using the level of inhibition of luciferase luminescence as an index as described below.

[0269] In a culture dish (Assay plate, 96-well, with Lid, Cat. No. 3917, manufactured by Costar Co., Ltd.), human cervical cancer-derived cell line Hela cells (CCL-2, purchased from ATCC) transfected with a luciferase expression vector (pGL4.50 [luc2/CMV/Hygro] Vector, Promega Corporation) were suspended in RPMI medium (Invitrogen Life Technologies, 11875093) containing 10% fetal bovine serum, and the cell suspension was inoculated into each well at 50 µL/well to give 5000 cells/well.

[0270] An siRNA was diluted with OPTI-MEM (Invitrogen Life Technologies, 31985-070). Lipofectamine RNAiMAX (Invitrogen Life Technologies, 13778-075) was diluted with OPTI-MEM. These prepared dilute liquids were mixed with each other to form an siRNA-lipofectamine RNAiMAX complex. Ten microliter of a solution of the prepared siRNA-Lipofectamine RNAiMAX (Invitrogen Life Technologies, 13778-075) complex was added to each well containing the cell suspension, so that the siRNA was introduced into the Hela cells. The final concentration of the siRNA was set to one level: 100 pmol/L, or the following four levels: 3.2 pmol/L, 16 pmol/L, 80 pmol/L, and 400 pmol/L, and N was set to 6. Further, as a negative control group, cells to which only Lipofectamine RNAiMAX was added were inoculated. Further, for comparison, a test was performed in the same manner also for siRNAs having adenosine monophosphate at a position corresponding to 8-Br-dA of each siRNA (referred to as 239-A, 874-A, 904-A, 1084-A, 1203-A, and 1556-A, respectively, shown in Table 9). Further, a test was performed in the same manner also for siRNAs having guanosine monophosphate, cytidine monophosphate, or uridine monophosphate at a position corresponding to 8-Br-dA of 874-BrdA (referred to as 874-G, 874-C, and 874-U, respectively, shown in Table 10).
Table 9
 sense strandantisense strand
sequence(5'→3')sequence numbersequence(5'→3')sequence number
239-A UGCAGCGAGAAUAGCUUGUAG 1 ACAAGCUAUUCUCGCUGCACA 13
874-A UAGCUUCUUCGCUAAGAGUAC 3 ACUCUUAGCGAAGAAGCUAAA 14
904-A CAAGUACGACCUAAGCAAUUU 5 AUUGCUUAGGUCGUACUUGUC 15
1084-A AGGCAAGGUGGUGCCCUUUUU 7 AAAGGGCACCACCUUGCCUAC 16
1203-A UUAACAACCCCGAGGCUAUAA 9 AUAGCCUCGGGGUUGUUAACG 17
1556-A GACGAGGUGCCUAAAGGAUUG 11 AUCCUUUAGGCACCUCGUCCA 18
Table 10
 sense strandantisense strand
sequence(5'→3')sequence numbersequence(5'→3')sequence number
874-G UAGCUUCUUCGCUAAGAGCAC 19 GCUCUUAGCGAAGAAGCUAAA 20
874-C UAGCUUCUUCGCUAAGAGGAC 21 CCUCUUAGCGAAGAAGCUAAA 22
874-U UAGCUUCUUCGCUAAGAGAAC 23 UCUCUUAGCGAAGAAGCUAAA 24


[0271] The cells after introduction of each of the siRNAs were cultured under the conditions of 37°C and 5% CO2 for 24 hours.

[0272] To the cells after culture, 40 µL of Steady-Glo Luciferase Assay System (Promega E2520), which is a commercially available luciferase assay reagent, was added to each well according to the attached protocol. After the cells were incubated for 10 minutes, the amount of luminescence (cps) per second in each well was measured using ARVO (PerkinElmer) according to the protocol.

[0273] By also performing the measurement of the amount of luminescence in the negative control group simultaneously with the measurement of the amount of luminescence in the luciferase-targeting siRNA treated group, the RNAi effect on each of the siRNA-introduced samples was expressed as a relative ratio when the amount of luminescence in the siRNA-unintroduced group (negative control group) was taken as 1.

[0274] The results of this test are shown in Figs. 1 and 2. Fig. 1 is a graph showing comparison between the siRNA of the present invention and the siRNA having adenosine monophosphate at a position corresponding to 8-Br-dA in the sequence thereof at a final concentration of 100 pmol/L. Fig. 2 is a graph showing comparison between 874-BrdA, which is the siRNA of the present invention, and 874-A, 874-G, 874-C, and 874-U having adenosine monophosphate, guanosine monophosphate, cytidine monophosphate, or uridine monophosphate at a position corresponding to 8-Br-dA in the sequence thereof at final concentrations of 3.2 pmol/L, 16 pmol/L, 80 pmol/L, and 400 pmol/L (in Figs. 1 and 2, the ordinate represents the ratio of the amount of luminescence when the amount of luminescence in the negative control group was taken as 1). Additionally, by the Kruskal-Wallis test, it was determined whether or not there is a significant difference. In the statistical analysis, statistical analysis software SAS (Release 9.2, SAS Institute, Inc.) was used. In Table 11, the results of the significant difference test for comparison between the ratio of inhibition of luminescence by 239-BrdA, 874-BrdA, 904-BrdA, 1084-BrdA, 1203-BrdA, and 1556-BrdA and the ratio of inhibition of luminescence by 239-A, 874-A, 904-A, 1084-A, 1203-A, and 1556-A,respectively, are shown. A p-value of 0.05 or less was obtained in all the cases, and it is found that the ratio of inhibition of luminescence was significantly improved in the case of the siRNA in which adenosine monophosphate was substituted with 8-Br-dA.
Table 11
 239-BrdA874-BrdA904-BrdA1084-BrdA1203-BrdA1556-BrdA
p 0.01 0.004 0.004 0.01 0.02 0.04

Test Example 2: RNAi Activity of Luciferase-Targeting siRNA



[0275] The RNAi activity of the luciferase-targeting siRNA having 8-Br-dA at the 5' end of the antisense strand obtained in Example 1 was evaluated by measuring the inhibitory effect on the expression of Luciferase GL4 mRNA (GenBank Accession No. EU921840) as described below.

[0276] In a culture dish (Multidish 24 wells, Cat. No. 142475, manufactured by Nunc, Inc.), human cervical cancer-derived cell line Hela cells (CCL-2, purchased from ATCC) were suspended in RPMI medium (Invitrogen Life Technologies, 11875093) containing 10% fetal bovine serum, and 500 µL of the resulting cell suspension was inoculated into each well to give 50000 cells/well. Thereto, 100 µL of a solution of an siRNA-Lipofectamine RNAiMAX (Invitrogen Life Technologies, 13778-075) complex mixed in OPTI-MEM (Invitrogen Life Technologies, 31985-070) was added, whereby the siRNA was introduced into the Hela cells. The final concentration of the siRNA was set to the following seven levels: 10000 pmol/L, 2000 pmol/L, 400 pmol/L, 80 pmol/L, 16 pmol/L, 3.2 pmol/L, and 0.64 pmol/L. Further, as a negative control group, cells to which only Lipofectamine RNAiMAX was added were inoculated.

[0277] The cells after introduction of the siRNA were cultured under the conditions of 37°C and 5% CO2 for 24 hours. In order to collect RNA, an RNA extraction kit (RNeasy 74106) of Qiagen, Inc. was used. The cells after culture were washed once with phosphate buffer, and then lysed with RLT buffer (attached to Rneasy) attached to the RNeasy kit and collected. Then, the total RNA was collected according to the instruction attached to the kit. By using the total RNA (1 µg) as a template, a reverse transcription reaction was performed by using Transcriptor First Strand cDNA Synthesis Kit (Roche, 4897030001), whereby a cDNA was prepared. By using this cDNA as a template for the PCR reaction, a GL4 (GenBank Accession No. EU921840) gene and, as a control, D-glyceraldehyde-3-phosphate dehydrogenase (GAPDH, GenBank Accession No. NM_001256799) were subjected to the PCR reaction by the Taqman probe method using ABI 7900HT Fast (Applied Biosystems, Inc. (ABI)), and each level of amplified mRNAs was measured. Then, a semi-quantitative level of mRNA of GL4 was calculated using the level of the amplified mRNA of GAPDH as an internal control. In the measurement of GAPDH, Taqman probe Hs99999905 m1 (Applied Biosystems, Inc. (ABI)) was used. In the measurement of GL4, the probe #20 in the universal probe library (Roche, 04686934001), and as the amplification primers, a DNA having a base sequence represented by SEQ ID NO: 63 (forward primer) and a DNA having a base sequence represented by SEQ ID NO: 64 (reverse primer) were used. Further, in the negative control group, the level of mRNA of GL4 and the level of the amplified mRNA of GAPDH were measured in the same manner, respectively, and a semi-quantitative level of mRNA of GL4 was calculated using the level of amplified mRNA of GAPDH as an internal control.

[0278] The level of the target mRNA in the siRNA-introduced sample was represented as a relative ratio when the level of the mRNA of GL4 in the siRNA-unintroduced group (negative control group) was taken as 1.

[0279] An IC50 value was calculated by the Logit method. A statistical analysis was performed using statistical analysis software SAS (Release 9.2, SAS Institute, Inc.)

[0280] In Table 12, the IC50 values of 874-BrdA, which is the siRNA of the present invention, and 874-A and 874-U, which have adenosine monophosphate or uridine monophosphate at a position corresponding to 8-Br-dA in the sequence thereof as a comparison, are shown.
Table 12
 874-BrdA874-U874-A
IC50(pmol/L) 1.8 3.3 13.3


[0281] From the results of Test Examples 1 and 2, it is found that the siRNA having 8-Br-dA at the 5' end of the antisense strand (874-BrdA) shows a higher knockdown activity against the expression of luciferase than the siRNA having a corresponding natural nucleotide at the 5' end of the antisense strand.

Example 2



[0282] A luciferase-targeting siRNA having 8-oxo-2'-deoxyadenosine monophosphate at the 5' end of the antisense strand shown in Table 13 (referred to as 874-8-oxo-dA, X which is contained in the sequence of the antisense strand denotes 8-oxo-2'-deoxyadenosine monophosphate) was obtained by synthesis in the same manner as in Example 1 using a commercially available 8-oxo-dA-CE phosphoramidite.

Example 3



[0283] An siRNA having 5-bromo-2'-deoxyuridine monophosphate at the 5' end of the antisense strand shown in Table 13 (referred to as 874-5-Br-dU, X which is contained in the sequence of the antisense strand denotes 5-bromo-2'-deoxyuridine monophosphate) was obtained by synthesis in the same manner, as in Example 1 using a commercially available 5-Br-dU-CE phosphoramidite.

Example 4



[0284] siRNAs having 5-fluoro-2'-deoxyuridine monophosphate at the 5' end of the antisense strand shown in Table 13 (referred to as 454-5-F-dU and 1556-5-F-dU, X which is contained in the sequence of each of the antisense strands denotes 5-fluoro-2'-deoxyuridine monophosphate) were obtained by synthesis in the same manner as in Example 1 using a commercially available 5-F-dU-CE phosphoramidite.

MALDI-TOF/MS



[0285] 

454-5-F-dU (antisense strand): theoretical value: 6668.85 (M-H), actual value: 6673.35

1556-5-F-dU (antisense strand): theoretical value: 6669.03 (M-H), actual value: 6671.33

Table 13
 sense strandantisense strand
sequence(5'→3')sequence numbersequence(5'→3')sequence number
874-8-oxo-dA UAGCUUCUUCGCUAAGAGUAC 3 XCUCUUAGCGAAGAAGCUAAA 4
874-5-Br-dU UAGCUUCUUCGCUAAGAGAAC 23 XCUCUUAGCGAAGAAGCUAAA 4
454-5-F-dU GGAUAGCAAGACCGACUAACA 25 XUAGUCGGUCUUGCUAUCCAU 26
1556-5-F-dU GACGAGGUGCCUAAAGGAAUG 27 XUCCUUUAGGCACCUCGUCCA 12

Test Example 3: RNAi Activity of Luciferase-Targeting siRNA



[0286] The RNAi activity of each of the luciferase-targeting siRNAs obtained in Example 4 (Table 13, having 5-F-dU at the position of X) was measured and evaluated in the same manner as in Test Example 2. Each of them was compared with an siRNA having a corresponding natural nucleotide at the 5' end of the antisense strand (Table 14).

[0287] In Table 15, the respective IC50 values are shown.
Table 14
 sense strandantisense strand
sequence (5'→3')sequence numbersequence (5'→3')sequence number
454-U GGAUAGCAAGACCGACUAACA 25 UUAGUCGGUCUUGCUAUCCAU 28
1556-U GACGAGGUGCCUAAAGGAAUG 27 UUCCUUUAGGCACCUCGUCCA 29
Table 15
 KD(Luc assay) IC50(pM)
454-U 85
454-5-F-dU 49
1556-U 300
1556-5-F-dU 132


[0288] From the results of Test Example 3, it is found that the siRNAs having 5-fluoro-2'-deoxyuridine monophosphate at the 5' end of the antisense strand (454-5-F-dU and 1556-5-F-dU) show a higher knockdown activity against the expression of luciferase than the siRNAs having a corresponding natural nucleotide at the 5' end of the antisense strand, respectively.

Example 5



[0289] D-Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)-targeting siRNAs having 8-oxo-2' -deoxyadenosine monophosphate at the 5' end of each of the antisense strands shown in Table 16 (X contained in the sequence of each of the antisense strands denotes 8-oxo-2'-deoxyadenosine monophosphate) were obtained by synthesis in the same manner as in Example 1.
Table 16
 sense strandantisense strand
sequence(5'→3')sequence numbersequence(5'→3')sequence number
217-BrdA GCGCCUGGUCACCAGGGCUGC 30 XGCCCUGGUGACCAGGCGCCC 31
278-BrdA CCCUUCAUUGACCUCAACUAC 32 XGUUGAGGUCAAUGAAGGGGU 33
516-BrdA GAGCCAAAAGGGUCAUCAUCU 34 XUGAUGACCCUUUUGGCUCCC 35
624-BrdA CCUGCACCACCAACUGCUUAG 36 XAGCAGUUGGUGGUGCAGGAG 37
715-BrdA CACUGCCACCCAGAAGACUGU 38 XGUCUUCUGGGUGGCAGUGAU 39
816-BrdA AGGCUGUGGGCAAGGUCAUCC 40 XUGACCUUGCCCACAGCCUUG 41
936-BrdA AUGAUGACAUCAAGAAGGUGG 42 XCCUUCUUGAUGUCAUCAUAU 43
1096-BrdA CAAGCUCAUUUCCUGGUAUGA 44 XUACCAGGAAAUGAGCUUGAC 45
1134-BrdA GCAACAGGGUGGUGGACCUCA 46 XGGUCCACCACCCUGUUGCUG 47

Test Example 4: RNAi Activity of D-Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH)-Targeting siRNA



[0290] The RNAi activity of a GAPDH-targeting siRNA having 8-Br-dA at the 5' end of the antisense strand was evaluated by measuring an inhibitory effect on the expression of mRNA of GAPDH as described below.

[0291] In a culture dish (Multidish 24 wells, Cat. No. 142475, manufactured by Nunc, Inc.), human cervical cancer-derived cell line Hela cells (CCL-2, purchased from ATCC) were suspended in RPMI medium (Invitrogen Life Technologies, 11875093) containing 10% fetal bovine serum, and 500 µL of the resulting cell suspension was inoculated into each well to give 50000 cells/well. Thereto, 100 µL of a solution of an siRNA-Lipofectamine RNAiMAX (Invitrogen Life Technologies, 13778-075) complex mixed in OPTI-MEM (Invitrogen Life Technologies, 31985-070) was added, whereby the siRNA was introduced into the Hela cells. The final concentration of the siRNA was set to one level: 100 pmol/L. Further, as a negative control group, cells to which only Lipofectamine RNAiMAX was added were inoculated.

[0292] The cells after introduction of the siRNA were cultured under the conditions of 37°C and 5% CO2 for 24 hours. In order to collect RNA, an RNA extraction kit (RNeasy 74106) of Qiagen, Inc. was used. The cells after culture were washed once with phosphate buffer, and then lysed with RLT buffer (attached to RNeasy) attached to the RNeasy kit and collected. Then, the total RNA was collected according to the instruction attached to the kit. By using the total RNA (1 µg) as a template, a reverse transcription reaction was performed using Transcriptor First Strand cDNA Synthesis Kit (Roche, 4897030001), whereby the cDNA was prepared. By using this cDNA as a template for a PCR reaction, a GADPH gene and, as a control, a pepytidyl-prolyl cis-trans isomerase B (PPIB) gene (GenBank Accession No. NM_000942) were subjected to a PCR reaction by the Taqman probe method using ABI 7900HT Fast (ABI), and the levels of amplified mRNAs of the respective genes were measured. Then, a semi-quantitative level of mRNA of GAPDH was calculated using the level of the amplified mRNA of PPIB as an internal control. In the measurement of GAPDH, Taqman probe Hs99999905 m1 (Applied Biosystems, Inc. (ABI)) was used. In the measurement of PPIB, Hs01018502 ml (Applied Biosystems, Inc. (ABI)) was used. Further, in the negative control group, the level of the mRNA of GAPDH and the level of the amplified mRNA of PPIB were measured in the same manner, respectively, and a semi-quantitative level of the mRNA of GAPDH was calculated using the level of the amplified mRNA of PPIB as an internal control.

[0293] The level of the target mRNA in the siRNA-introduced sample was represented as a relative ratio when the level of the mRNA of GAPDH in the siRNA-unintroduced group (negative control group) was taken as 1.

[0294] Further, for comparison, a test was performed in the same manner also for siRNAs having adenosine monophosphate at a position corresponding to 8-Br-dA of each siRNA (Table 17).

[0295] The results of this test are shown in Table 18 and Fig. 3.
Table 17
 sense strandantisense strand
sequence(5'→3')sequence numbersequence(5'→3')sequence number
217-A GCGCCUGGUCACCAGGGCUGC 30 AGCCCUGGUGACCAGGCGCCC 48
278-A CCCUUCAUUGACCUCAACUAC 32 AGUUGAGGUCAAUGAAGGGGU 49
516-A GAGCCAAAAGGGUCAUCAUCU 34 AUGAUGACCCUUUUGGCUCCC 50
624-A CCUGCACCACCAACUGCUUAG 36 AAGCAGUUGGUGGUGCAGGAG 51
715-A CACUGCCACCCAGAAGACUGU 38 AGUCUUCUGGGUGGCAGUGAU 52
816-A AGGCUGUGGGCAAGGUCAUCC 40 AUGACCUUGCCCACAGCCUUG 53
936-A AUGAUGACAUCAAGAAGGUGG 42 ACCUUCUUGAUGUCAUCAUAU 54
1096-A CAAGCUCAUUUCCUGGUAUGA 44 AUACCAGGAAAUGAGCUUGAC 55
1134-A GCAACAGGGUGGUGGACCUCA 46 AGGUCCACCACCCUGUUGCUG 56
Table 18
siRNAlevel of target mRNA siRNAlevel of target mRNA
217-BrdA 0.743   816-BrdA 0.291
217-A 1.654   816-A 0.464
278-BrdA 0.189   936-BrdA 0.217
278-A 0.361   936-A 0.602
516-BrdA 0.246   1096-BrdA 0.027
516-A 0.648   1096-A 0.241
624-BrdA 0.273   1134-BrdA 0.067
624-A 0.798   1134-A 0.597
715-BrdA 0.627  
715-A 1.321


[0296] From the results of Test Example 4, it is found that the D-glyceraldehyde-3-phosphate dehydrogenase (GAPDH)-targeting siRNA having 8-Br-dA at the 5' end of the antisense strand shows a higher knockdown activity against the expression of GAPDH than the siRNA having a corresponding natural nucleotide at the 5' end of the antisense strand.

Example 6



[0297] It was synthesized using a D-glyceraldehyde-3-phosphate dehydrogenase (GAPDH)-targeting siRNA having 5-fluoro-2'-deoxyuridine monophosphate at the 5' end of the antisense strand shown in Table 19 (X contained in the sequence of the antisense strand denotes 5-fluoro-2'-deoxyuridine monophosphate) in the same manner as in Example 1.

MALDI-TOF/MS



[0298] 1096-5-F-dU (antisense strand): theoretical value: 6801.03 (M-H), actual value: 6797.74
Table 19
 sense strandantisense strand
sequence(5→3')sequence numbersequen ce (5'→3')sequence number
1096-5-F-dU CAAGCUCAUUUCCUGGUAAGA 57 XUACCAGGAAAUGAGCUUGAC 55
1096-U CAAGCUCAUUUCCUGGUAAGA 57 UUACCAGGAAAUGAGCUUGAC 58
1096-A CAAGCUCAUUUCCUGGUAUGA 59 AUACCAGGAAAUGAGCUUGAC 60
1096-G CAAGCUCAUUUCCUGGUACGA 61 GUACCAGGAAAUGAGCUUGAC 62

Test Example 5: RNAi Activity of D-Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH)-Targeting siRNA



[0299] The activity of the GAPDDH-targeting siRNA obtained in Example 6 was evaluated by measuring an inhibitory effect on the expression of mRNA of GAPDH in the same manner as in Test Example 4.

[0300] The level of the target mRNA in the siRNA-introduced sample was represented as a relative ratio when the level of mRNA of GAPDH in the siRNA-unintroduced group (negative control group) was taken as 1. The level of mRNA of GAPDH was calculated using the level of the amplified mRNA of hypoxanthine phosphoribosyltransferase 1 (HPRT1, GenBank Accession No. NM_000194) as an internal control. In the measurement of HPRT1, Taqman probe Hs99999909_m1 (Applied Biosystems, Inc. (ABI)) was used.

[0301] Further, for comparison, a test was performed in the same manner also for siRNAs having uracil monophosphate, adenosine monophosphate, or guanine monophosphate at the 5' end of the antisense of each siRNA (Table 19).

[0302] The results of this test are shown in Table 20.
Table 20
siRNAconcentration (pM)level of target mRNAconcentration (pM)level of target mRNA
1096-5-FU 10 0.059 1 0.183
1096-A 10 0.096 1 0.273
1096-U 10 0.059 1 0.238
1096-G 10 0.102 1 0.374


[0303]  From the results of Test Example 5, it is found that the D-glyceraldehyde-3-phosphate dehydrogenase (GAPDH)-targeting siRNA having 5-fluoro-2'-deoxyuridine monophosphate at the 5' end of the antisense strand shows a higher knockdown activity against the expression of GAPDH than the siRNA having a corresponding natural nucleotide at the 5' end of the antisense strand.

Reference Example 1.0: Compound 1-5


Step 1



[0304] Commercially available 6,7-dimethoxyquinazoline-2,4(1H,3H)-dione (220 mg, 0.991 mmol) and 1-O-acetyl-2, 3, 5-tri-O-benzoyl-β-D-ribofuranose (500mg, 0.991 mmol) were dissolved in acetonitrile (5 mL), and N,O-bis(trimethylsilyl)acetamide (0.735 mL, 2.97 mmol) was added thereto, and the mixture was stirred at 60 °C for 20 minutes. After the reaction solution was cooled to room temperature, methanesulfonyl trimethylsilyl (0.627 mL, 3.47 mmol) was added thereto, and the mixture was stirred at 60 °C for 1 hour. After the reaction solution was cooled to room temperature, a saturated aqueous sodium bicarbonate solution was added thereto, and the mixture was extracted with ethyl acetate. The organic layer was washed with saturated brine, and then dried over sodium sulfate. The residue obtained by evaporating the solvent under reduced pressure was purified by column chromatography (heptane/ethyl acetate) to obtain (2R,3R,4R,5R)-2-((benzoyloxy)methyl)-5-(6,7-dimethoxy-2,4-dioxo-3 ,4-dihydroquinazolin-1(2H)-yl)tetrahydrofuran-3,4-diyl dibenzoate (599 mg, yield: 91%).

Step 2



[0305] (2R,3R,4R,5R)-2-((Benzoyloxy)methyl)-5-(6,7-dimethoxy-2,4-dio xo-3,4-dihydroquinazolin-1(2H)-yl)tetrahydrofuran-3,4-diyl dibenzoate (599 mg, 0.899 mmol) obtained in Step 1 was dissolved in methanol (9 mL), and a methylamine/methanol solution (4.58 mL, 44.9 mmol) was added thereto, and the mixture was stirred overnight at room temperature. To the residue obtained by evaporating the solvent under reduced pressure, diethyl ether was added, and the precipitate was collected by filtration to obtain 1-((2R,3R,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)tetrahydrofuran-2 -yl)-6,7-dimethoxyquinazoline-2,4(1H,3H)-dione (312 mg, yield: 98%).
ESI-MS (m/z): 353 (M-1)

Step 3



[0306] 1-((2R,3R,4S,5R)-3,4-Dihydroxy-5-(hydroxymethyl)tetrahydrofur an-2-yl)-6,7-dimethoxyquinazoline-2,4(1H,3H)-dione (310 mg, 0.875 mmol) obtained in Step 2 was suspended in acetone (15 mL), and 2,2-dimethoxypropane (0.536mL, 4.37 mmol) and 4-toluenesulfonic acid monohydrate (183 mg, 0.962 mmol) were added thereto, and the mixture was stirred at room temperature for 2 hours. To the reaction solution was added a saturated aqueous sodium bicarbonate solution, and then, the solvent was evaporated under reduced pressure until the amount of the solvent was decreased to about half, and the resulting residue was purified by column chromatography (chloroform/methanol) to obtain 1-((3aR,4R,6R,6aR)-6-(hydroxymethyl)-2,2-dimethyltetrahydrofuro[3 ,4-d][1,3]dioxol-4-yl)-6,7-dimethoxyquinazoline-2,4(1H,3H)-dione (315 mg, yield: 91%).
ESI-MS (m/z): 395 (M+1)

Step 4



[0307] 1-((3aR,4R,6R,6aR)-6-(Hydroxymethyl)-2,2-dimethyltetrahydrofu ro[3,4-d][1,3]dioxol-4-yl)-6,7-dimethoxyquinazoline-2,4(1H,3H)-di one (310 mg, 0.786 mmol) obtained in Step 3 was dissolved in dichloromethane (8 mL), and 1H-tetrazole (138 mg, 1.97 mmol) and di-tert-butyl diisopropylphosphoramide (0.522 mL, 1.57 mmol) were added thereto, and the mixture was stirred at room temperature for 5 hours. The reaction solution was cooled to 0 °C, and m-chloroperbenzoic acid (452 mg, 1.97 mmol) was added thereto, and the mixture was further stirred at 0 °C for 20 minutes. To the reaction solution was added a saturated aqueous sodium bicarbonate solution, and the mixture was extracted with chloroform and dried over sodium sulfate. The residue obtained by evaporating the solvent under reduced pressure was purified by column chromatography (heptane/ethyl acetate) to obtain di-tert-butyl ((3aR,4R,6R,6aR)-6-(6,7-dimethoxy-2,4-dioxo-3,4-dihydroquinazolin -1(2H)-yl)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)meth yl phosphate (259 mg, yield: 56%).
ESI-MS (m/z): 587 (M+1)

Step 5



[0308] Di-tert-butyl ((3aR,4R,6R,6aR)-6-(6,7-dimethoxy-2,4-dioxo-3,4-dihydroquinazolin -1(2H)-yl)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)meth yl phosphate (77.5 mg, 0.132 mmol) obtained in Step 4 was dissolved in trifluoroacetic acid/water (1:1) (2 mL), and the mixture was stirred at room temperature for 2 hours. After the solvent was evaporated under reduced pressure, acetic acid-triethylamine buffer (pH 6.5) (2 mL) was added thereto, and the solvent was evaporated again under reduced pressure. The resulting residue was dissolved in ethanol, and ethyl acetate was added thereto, and the precipitate was collected by filtration to obtain ((2R,3S,4R,5R)-5-(6,7-dimethoxy-2,4-dioxo-3,4-dihydroquinazolin-1 (2H)-yl)-3,4-dihydroxytetrahydrofuran-2-yl)methyl phosphate (Compound I-5) triethylammonium salt (64.9 mg, yield: 92%).
1H-NMR (D2O, 300 MHz) δ: 7.43 (s, 1H), 6.91 (s, 1H), 6.08 (d, J= 4.0 Hz, 1H), 4.77-4.58 (m, 1H), 4.38 (t, J= 7.3 Hz, 1H), 4.04-4.02 (m, 3H), 3.90 (s, 3H), 3.81 (s, 3H), 3.08 (q, J= 7.3 Hz, 6H), 1.16 (t, J= 7.3 Hz, 9H).
ESI-MS (m/z): 435 (M+1)

Reference Example 1.1: Compound am-1


Step 1



[0309] 1-((2R,3R,4S,5R)-3,4-Dihydroxy-5-(hydroxymethyl)tetrahydrofur an-2-yl)-6,7-dimethoxyquinazoline-2,4(1H,3H)-dione (812 mg, 2.29 mmol) obtained in Step 2 of Reference Example 1.0 was dissolved in DMF (10.0 mL), and to the mixture was added di-tert-butylsilyl bis(trifluoromethanesulfonate) (1.00 mL, 2.75mmol) under ice cooling, and the mixture was stirred under ice cooling for 6 hours. To the reaction mixture was added a saturated aqueous sodium bicarbonate solution, and the mixture was extracted with ethyl acetate. Thereafter, the organic layer was washed with saturated brine and dried over anhydrous magnesium sulfate. The solvent was evaporated under reduced pressure, and the residue was purified by silica gel column chromatography (ethyl acetate/heptane) to obtain 1-((4aR,6R,7R,7aS)-2,2-di-tert-butyl-7-hydroxytetrahydro-4H-furo[ 3,2-d][1,3,2]dioxasilin-6-yl]-6,7-dimethoxyquinazoline-2,4(1H,3H) -dione (1.08 g, 95.0%).
ESI-MS (m/z): 493 (M-1)

Step 2



[0310] 1-((4aR,6R,7R,7aS)-2,2-Di-tert-butyl-7-hydroxytetrahydro-4H-f uro[3,2-d][1,3,2]dioxasilin-6-yl)-6,7-dimethoxyquinazoline-2,4(1H ,3H)-dione (1.73 mg, 3.50 mmol) obtained in Step 1 was dissolved in DMF (18.0 mL), and imidazole (1.19 g, 17.5 mmol) and tert-butyldimethylsilyl chloride (791 mg, 5.25 mmol) were added thereto, and the mixture was stirred at 60 °C for 3 hours. To the reaction mixture was added a saturated aqueous sodium bicarbonate solution, and the mixture was extracted with ethyl acetate. Thereafter, the organic layer was washed with saturated brine and dried over anhydrous magnesium sulfate. The solvent was evaporated under reduced pressure, and the residue was purified by silica gel column chromatography (ethyl acetate/heptane) to obtain 1-((4aR,6R,7R,7aR)-2,2-di-tert-butyl-7-((tert-butyldimethylsilyl) oxy)tetrahydro-4H-furo[3,2-d][1,3,2]dioxasilin-6-yl)-6,7-dimethox yquinazoline-2,4(1H,3H)-dione (1.95 g, 92.0%).
ESI-MS (m/z): 607 (M-1)

Step 3



[0311] 1-((4aR,6R,7R,7aR)-2,2-Di-tert-butyl-7-((tert-butyldimethylsi lyl)oxy)tetrahydro-4H-furo[3,2-d][1,3,2]dioxasilin-6-yl)-6,7-dime thoxyquinazoline-2,4(1H,3H)-dione (500 mg, 0.821 mmol) obtained in Step 2 was dissolved in dichloromethane (8.00 mL), and pyridine (0.531 mL, 6.57 mmol) and hydrogen fluoride-pyridine (0.423 mL, 3.28 mmol) were added thereto under ice cooling, and the mixture was stirred under ice cooling for 1 hour. To the reaction mixture was added a saturated aqueous sodium bicarbonate solution, and the mixture was extracted with ethyl acetate. Thereafter, the organic layer was washed with saturated brine and dried over anhydrous magnesium sulfate. The solvent was evaporated under reduced pressure, and the residue was purified by silica gel column chromatography (ethyl acetate/heptane) to obtain 1-((2R,3R,4R,5R)-3-((tert-butyldimethylsilyl)oxy)-4-hydroxy-5-(hy droxymethyl)tetrahydrofuran-2-yl)-6,7-dimethoxyquinazoline-2,4(1H ,3H)-dione (336 mg, 87.0%).
ESI-MS (m/z): 467 (M-1)

Step 4



[0312] 1-((2R,3R,4R,5R)-3-((Tert-butyldimethylsilyl)oxy)-4-hydroxy-5 -(hydroxymethyl)tetrahydrofuran-2-yl)-6,7-dimethoxyquinazoline-2, 4(1H, 3H) -dione (85.0 mg, 0.181 mmol) obtained in Step 3 was dissolved in pyridine (2.00 mL), and p,p'-dimethoxytrityl chloride (184 mg, 0.544 mmol) and 4-dimethylaminopyridine (4.43 mg, 0.0360 mmol) were added thereto, and the mixture was stirred at room temperature for 1 hour. To the reaction mixture, a saturated aqueous sodium bicarbonate solution was added, and the mixture was extracted with ethyl acetate. Thereafter, the organic layer was washed with saturated brine and dried over anhydrous magnesium sulfate. The solvent was evaporated under reduced pressure, and the residue was purified by silica gel column chromatography (ethyl acetate/heptane) to obtain 1-((2R,3R,4R,5R)-5-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-3-((tert-butyldimethylsilyl)oxy)-4-hydroxytetrahydrofuran-2-yl)-6 ,7-dimethoxyquinazoline-2,4(1H,3H)-dione (138 mg, 99.0%).
ESI-MS (m/z): 769 (M-1)

Step 5



[0313] 1-((2R,3R,4R,5R)-5-((Bis(4-methoxyphenyl)(phenyl)methoxy)meth yl)-3-((tert-butyldimethylsilyl)oxy)-4-hydroxytetrahydrofuran-2-y 1)-6,7-dimethoxyquinazoline-2,4(1H,3H)-dione (74.0 mg, 0.0960 mmol) obtained in Step 4 was dissolved in THF (2.00 mL), and diisopropylamine (0.084 mL, 0.480 mmol) and 2-cyanoethyl chloro(diisopropylamino) phosphinite (0.043 mL, 0.192 mmol) were added thereto under ice cooling, and the mixture was stirred at room temperature for 3 hours. The solvent was evaporated under reduced pressure, and the residue was purified by aminosilica gel column chromatography (ethyl acetate/heptane), and then, further purified by silica gel column chromatography (ethyl acetate/heptane) to obtain (2R,3R,4R,5R)-2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-( (tert-butyldimethylsilyl)oxy)-5-(6,7-dimethoxy-2,4-dioxo-3,4-dihy droquinazolin-1(2H)-yl)tetrahydrofuran-3-yl (2-cyanoethyl) diisopropylphosphoramidite (Compound am-1, 63.0 mg, 67.6%).
1H-NMR (CDCl3, 300 MHz) δ: 7.94 (1H, brs), 7.55 (1H, s), 7.47-7.39 (2H, m), 7.38-7.12 (7H, m), 6.93 (1H, s), 6.81-6.70 (4H, m), 5.92 (1H, d, J= 4.8 Hz), 5.18-5.08 (1H, m), 4.53-4.38 (1H, m), 4.37-4.26 (1H, m), 3.96-3.48 (16H, m), 3.46-3.23 (1H, m), 2.68-2.52 (1H, m), 2.35-2.27 (1H, m), 1.20-1.00 (1H, m), 0.83, 0.81 (9H, 2 s), 0.05, 0.03, -0.10, -0.09 (6H, 4 s).
ESI-MS (m/z): 971 (M+1)

Example 7



[0314] An siRNA having Compound 1-5 as X at the 5' end of the antisense strand of 454-Xu shown in Table 24 below was synthesized in the same manner as in Example 1 using Compound am-1 obtained in Reference Example 1.1.
MALDI-TOF/MS (antisense strand): theoretical value: 6776.96 (M-H), actual value: 6776.21

Reference Example 2.0: Compound 1-6



[0315] ((2R,3S,4R,5R)-5-(6-Chloro-2,4-dioxo-3,4-dihydroquinazolin-1( 2H)-yl)-3,4-dihydroxytetrahydrofuran-2-yl)methyl phosphate (Compound 1-6) was obtained in the same manner as in Reference Example 1.0 using commercially available 6-chloroquinazoline-2,4(1H,3H)-dione.
1H-NMR (D2O, 300 MHz) δ: 7.88 (d, J= 1.8 Hz, 1H), 7.64 (dd, J= 9.2, 2.6 Hz, 1H), 7.58 (d, J= 9.2 Hz, 1H), 6.14 (d, J= 5. 5 Hz, 1H), 4.70-4.68 (m, 1H), 4.37 (t, J= 5.9 Hz, 1H), 4.09-4.02 (m, 3H).
ESI-MS (m/z): 409 (M+1)

Reference Example 2.1: Compound am-2



[0316] (2R,3R,4R,5R)-2-((Bis(4-methoxyphenyl)(phenyl)methoxy)methyl) -4-((tert-butyldimethylsilyl)oxy)-5-(6-chloro-2,4-dioxo-3,4-dihyd roquinazolin-1(2H)-yl)tetrahydrofuran-3-yl (2-cyanoethyl) diisopropylphosphoramidite (Compound am-2) is obtained in the same manner as in Reference Example 1.1 using commercially available 6-chloroquinazoline-2,4(1H,3H)-dione.

Example 8



[0317] An siRNA having Compound 1-6 at the 5' end of the antisense strand is synthesized in the same manner as in Example 1 using Compound am-2 obtained in Reference Example 2.1.

Reference Example 3.0: Compound 1-7



[0318] ((2R,3S,4R,5R)-5-(7-Chloro-2,4-dioxo-3,4-dihydroquinazolin-1( 2H)-yl)-3,4-dihydroxytetrahydrofuran-2-yl)methyl phosphate (Compound 1-7) was obtained in the same manner as in Reference Example 1.0 using commercially available 7-chloroquinazoline-2,4(1H,3H)-dione.
1H-NMR (D2O, 300 MHz) δ: 7.95 (d, J= 8.4 Hz, 1H), 7.61 (s, 1H), 7.30 (d, J= 8.4 Hz, 1H), 5.99 (d, J= 4.4 Hz, 1H), 4.79 (t, J= 5.3 Hz, 1H), 4.38 (t, J= 6.4 Hz, 1H), 4.04-3.92 (m, 3H).
ESI-MS (m/z): 409 (M+1)

Reference Example 3.1: Compound am-3



[0319] (2R,3R,4R,5R)-2-((Bis(4-methoxyphenyl)(phenyl)methoxy)methyl) -4-((tert-butyldimethylsilyl)oxy)-5-(7-chloro-2,4-dioxo-3,4-dihyd roquinazolin-1(2H)-yl)tetrahydrofuran-3-yl (2-cyanoethyl) diisopropylphosphoramidite (Compound am-3) was obtained in the same manner as in Reference Example 1.1 using commercially available 7-chloroquinazoline-2,4(1H,3H)-dione.
1H-NMR (CDCl3, 500 MHz) δ: 8.11 (d, J= 8.5 Hz, 1H), 7.67 (7.63) (d, J= 1.7 Hz, 1H), 7.45-6.76 (m, 14H), 6.02 (m, 1H), 5.12 (5.07) (m, 1H), 4.45 (m, 1H), 4.32 (4.28) (m, 1H), 3.97-3.25 (m, 12H), 2.70-2.23 (m, 2H), 1.21-1.01 (m, 12H), 0.80 (0.82) (s, 9H), 0.03 (0.05) (s, 3H), -0.12 (s, 3H).

Example 9



[0320] An siRNA having Compound 1-7 as X at the 5' end of the antisense strand of 454-Xu shown in Table 24 below was synthesized in the same manner as in Example 1 using Compound am-3 obtained in Reference Example 3.1.
MALDI-TOF/MS (antisense strand): theoretical value: 6751.35 (M-H), actual value: 6751.83

Reference Example 4.0: Compound 1-8



[0321] ((2R,3S,4R,5R)-5-(5-Chloro-2,4-dioxo-3,4-dihydroquinazolin-1( 2H)-yl)-3,4-dihydroxytetrahydrofuran-2-yl)methyl phosphate (Compound 1-8) was obtained in the same manner as in Reference Example 1.0 using commercially available 5-chloroquinazoline-2,4(1H,3H)-dione.
1H-NMR (D2O, 300 MHz) δ: 7.66 (d, J= 4.8 Hz, 2H), 7.40 (t, J= 4.4 Hz, 1H), 6.21 (d, J= 5.5 Hz, 1H), 4.80 (t, J= 5.9 Hz, 1H), 4.45 (t, J= 5.9 Hz, 1H), 4.09 (dd, J= 14.5, 7.1 Hz, 3H).
ESI-MS (m/z): 409 (M+1)

Reference Example 4.1: Compound am-4



[0322] (2R,3R,4R,5R)-2-(Bis(4-methoxyphenyl)(phenyl)methoxy)methyl) -4-((tert-butyldimethylsilyl)oxy)-5-(5-chloro-2,4-dioxo-3,4-dihyd roquinazolin-1(2H)-yl)tetrahydrofuran-3-yl (2-cyanoethyl) diisopropylphosphoramidite (Compound am-4) is obtained in the same manner as in Reference Example 1.1 using commercially available 5-chloroquinazoline-2,4(1H,3H)-dione.

Example 10



[0323] An siRNA having Compound 1-8 at the 5' end of the antisense strand is synthesized in the same manner as in Example 1 using Compound am-4 obtained in Reference Example 4.1.

Reference Example 5.0: Compound 1-9



[0324] (2R,3S,4R,5R)-5-(2,4-Dioxo-3,9-dihydrothieno[3,2-d]pyrimidin-1(2H)-yl)-3,4-dihydroxytetrahydrofuran-2-yl)methyl phosphate (Compound 1-9) triethylammonium salt was obtained in the same manner as in Reference Example 1.0 using commercially available thieno[3,2-d]pyrimidine-2,4 (1H,3H)-dione.
1H-NMR (D2O, 300 MHz) δ: 7.96 (d, J= 5.5 Hz, 1H), 7.45 (d, J= 4.8 Hz, 1H), 6.14 (d, J= 6.2 Hz, 1H), 4.73-4.56 (m, 1H), 4.35 (t, J= 5.7 Hz, 1H), 4.09 (brs, 1H), 4.02 (t, J=4.8 Hz, 2H), 3.07 (q, J= 7.3 Hz, 6H), 1.15 (t, J= 7.3 Hz, 9H).
ESI-MS (m/z): 381 (M+1)

Reference Example 5.1: Compound am-5



[0325] (2R,3R,4R,5R)-2-((Bis(4-methoxyphenyl)(phenyl)methoxy)methyl) -4-((tert-butyldimethylsilyl)oxy)-5-(2,4-dioxo-3,4-dihydrothieno[ 3,2-d]pyrimidin-l(2H)-yl)tetrahydrofuran-3-yl (2-cyanoethyl) diisopropylphosphoramidite (Compound am-5) is obtained in the same manner as in Reference Example 1.1 using commercially available thieno[3,2-d]pyrimidine-2,4(1H,3H)-dione.

Example 11



[0326] An siRNA having Compound 1-9 at the 5' end of the antisense strand is synthesized in the same manner as in Example 1 using Compound am-5 obtained in Reference Example 5.1.

Reference Example 6.0: Compound I-10


Step 1



[0327] (2R,3R,4S,5R)-2-(6-Chloro-9H-purin-9-yl)-5-(hydroxymethyl)tet rahydrofuran-3,4-diol (5.47 g, yield: 72%) was obtained according to the process described in the known method [Journal of Organic Chemistry (J. Org. Chem.), 2002, vol. 67, pp. 6788-6796] using (2R,3R,4R,5R)-2-(acetoxymethyl)-5-(6-chloro-9H-purin-9-yl)tetrahy drofuran-3,4-diyl diacetate (10.9 g, 26.4 mmol) synthesized by the method described in the known method [Journal of Medicinal Chemistry (J. Med. Chem.), 2012, vol. 55, pp. 1478-1489].

[0328] (2R,3R,4S,5R)-2-(6-Chloro-9H-purin-9-yl)-5-(hydroxymethyl)tet rahydrofuran-3,4-diol (5.48 g, 19.1 mmol) was suspended in acetone (200 mL), and 2,2-dimethoxypropane (11.7 mL, 95.5 mmol) and 4-toluenesulfonic acid monohydrate (9.09 g, 47.8 mmol) were added thereto, and the mixture was stirred at room temperature for 2 hours. To the reaction solution was added a saturated aqueous sodium bicarbonate solution, and the solvent was evaporated under reduced pressure until the amount of the solvent was decreased to about half. Chloroform was added thereto, and the mixture was extracted with chloroform and dried over sodium sulfate. Then, the residue obtained by evaporating the solvent under reduced pressure was purified by silica gel column chromatography (heptane/ethyl acetate) to obtain ((3aR,4R,6R,6aR)-6-(6-chloro-9H-purin-9-yl)-2,2-dimethyltetrahydr ofuro[3,4-d][1,3]dioxol-4-yl)methanol (5.17 g, yield: 83%). ESI-MS (m/z): 327 (M+1)

Step 2



[0329] 1,4-Dioxane (2 mL) and water (one drop) were added to ((3aR,4R,6R,6aR)-6-(6-chloro-9H-purin-9-yl)-2,2-dimethyltetrahydr ofuro[3,4-d][1,3]dioxol-4-yl)methanol (150 mg, 0.459 mmol) obtained in Step 1, (E)-styrylboronic acid (136 mg, 0.918 mmol), 1,1'-bis(diphenylphosphino)ferrocene-palladium(II) dichloride-dichloromethane complex (37.5 mg, 0.031 mmol), and cesium carbonate (449 mg, 1.38 mmol), and the mixture was stirred at 80 °C for 3 hours under a nitrogen atmosphere. After the reaction solution was cooled to room temperature, saturated brine was added thereto, and the mixture was extracted with ethyl acetate and dried over sodium sulfate. The residue obtained by evaporating the solvent under reduced pressure was purified by column chromatography (heptane/ethyl acetate) to obtain ((3aR,4R,6R,6aR)-2,2-dimethyl-6-(6-((E)-styryl)-9H-purin-9-yl)tet rahydrofuro[3,4-d][1,3]dioxol-4-yl)methanol (90.1 mg, yield: 50%). ESI-MS (m/z): 395 (M+1)

Step 3



[0330] ((3aR,4R,6R,6aR)-2,2-Dimethyl-6-(6-styryl-9H-purin-9-yl)tetra hydrofuro[3,4-d][1,3]dioxol-4-yl)methanol (90 mg, 0.228 mmol) obtained in Step 2 was dissolved in dichloromethane (2 mL), and 1H-tetrazole (32.0 mg, 0.456 mmol) and di-tert-butyl diisopropylphosphoramide (0.144 mL, 0.456 mmol) were added thereto, and the resulting solution was stirred at 0 °C for 2 hours. To the reaction solution, m-chloroperbenzoic acid (141 mg, 0.612 mmol) was added, and the mixture was stirred at 0 °C for 15 minutes. To the reaction solution were added a saturated aqueous sodium bicarbonate solution and saturated brine, and the mixture was extracted with chloroform and dried over magnesium sulfate. A residue obtained by evaporating the solvent under reduced pressure was purified by column chromatography (heptane/ethyl acetate) to obtain di-tert-butyl ((3aR,4R,6R,6aR)-2,2-dimethyl-6-(6-styryl-9H-purin-9-yl)tetrahydr ofuro[3,4-d][1,3]dioxol-4-yl)methyl phosphate (E/Z geometric isomer mixture, 73.2 mg, yield: 55%).
ESI-MS (m/z): 587 (M+1)

Step 4



[0331] Di-tert-butyl ((3aR,4R,6R,6aR)-2,2-dimethyl-6-(6-styryl-9H-purin-9-yl)tetrahydr ofuro[3,4-d][1,3]dioxol-4-yl)methyl phosphate (73.0 mg, 0.124 mmol) obtained in Step 3 was dissolved in trifluoroacetic acid/water (1:1) (2 mL), and the mixture was stirred at room temperature for 2 hours. To the residue obtained by evaporating the solvent under reduced pressure was added acetic acid-ammonium acetate buffer (pH 5.7), and then, the residue was purified by preparative HPLC (eluent: a 0.01 mmol/L aqueous ammonium acetate solution/methanol) to give the roughly purified product. To the roughly purified product, 2-propanol was added, and the precipitate was collected by filtration to obtain ((2R,3S,4R,5R)-3,4-dihydroxy-5-(6-((E)-styryl)-9H-purin-9-yl)tetr ahydrofuran-2-yl)methyl phosphate (Compound I-10, 21.3 mg, yield: 39%) .
1H-NMR (D2O, 300 MHz) δ: 8.50 (s, 1H), 8.42 (s, 1H), 7.58 (d, J= 15.6 Hz, 1H), 7.19-7.13 (m, 2H), 7.08-6.97 (m, 4H), 5.92 (d, J= 4.9 Hz, 1H), 4.60-4.55 (m, 1H), 4.38-4.34 (m, 1H), 4.28-4.23 (m, 1H), 4.10-3.97 (m, 2H) .
ESI-MS (m/z): 435 (M+1)

Reference Example 6.1: Compound am-6


Step 1



[0332] Trifluoroacetic acid/water (1:1) (2 mL) was added to ((3aR,4R,6R,6aR)-2,2-dimethyl-6-(6-((E)-styryl)-9H-purin-9-yl)tet rahydrofuro[3,4-d][1,3]dioxo-4-yl)methanol (100 mg) obtained in Step 2 of Reference Example 6.0, and the mixture was stirred at room temperature for 2 hours. Then, the solvent was evaporated under reduced pressure to obtain (2R,3S,4R,5R)-2-(hydroxymethyl)-5-(6-((E)styryl)-9H-purin-9-yl)te trahydrofuran-3,4-diol trifluoroacetate.

Step 2



[0333] (2R,3R,4R,5R)-2-((Bis(4-methoxyphenyl)(phenyl)methoxy)methyl) -4-((tert-butyldimethylsilyl)oxy)-5-(6-((E)styryl)-9H-purin-9-yl) tetrahydrofuran-3-yl (2-cyanoethyl) diisopropylphosphoramidite (Compound am-6) is obtained in the same manner as in Reference Example 1.1 using (2R,3S,4R,5R)-2-(hydroxymethyl)-5-6-((E)styryl)-9H-purin-9-yl)tet rahydrofuran-3,4-diol trifluoroacetate obtained in Step 1.

Example 12



[0334] An siRNA having Compound I-10 at the 5' end of the antisense strand is synthesized in the same manner as in Example 1 using Compound am-6 obtained in Reference Example 6.1.

Reference Example 7.0: Compound I-11


Step 1



[0335] (2R,3R,4R,5R)-2-(Acetoxymethyl)-5-(6-chloro-9H-purin-9-yl)tet rahydrofuran-3,4-diyl diacetate (2.00 g, 4.85 mmol) synthesized by the method described in the known method [Journal of Medicinal Chemistry (J. Med. Chem.), 2012, vol. 55, pp. 1478-1489] was dissolved in THF (15 mL), and dimethylamine hydrochloride (1.19 g, 14.5 mmol) and triethylamine (2.70 mL, 19.38 mL) were added thereto, and the mixture was stirred overnight at 60 °C in a sealed tube. To the reaction solution, dimethylamine hydrochloride (1.19 g, 14.5 mmol) and triethylamine (2.70 mL, 19.38 mL) were added, and the mixture was further stirred overnight at 60 °C. To the mixture, water was added, and the mixture was extracted with chloroform and concentrated under reduced pressure to obtain (2R,3R,4R,5R)-2-(acetoxymethyl)-5-(6-(dimethylamino)-9H-purin-9-y 1)tetrahydrofuran-3,4-diyl diacetate (2.2 g, yield: 108%).
ESI-MS (m/z): 422 (M+1)

Step 2



[0336] A 7.0 mol/L ammonia/methanol solution (33.9 mL) was added to (2R,3R,4R,5R)-2-(acetoxymethyl)-5-(6-(dimethylamino)-9H-purin-9-y l)tetrahydrofuran-3,4-diyl diacetate (2.00 g, 4.75 mmol) obtained in Step 1, and the mixture was stirred overnight at room temperature. To the residue obtained by evaporating the solvent under reduced pressure was added an ether/ethyl acetate mixed solution, and the insoluble material was collected by filtration to obtain (2R,3R,4S,5R)-2-(6-(dimethylamino)-9H-purin-9-yl)-5-(hydroxymethy 1)tetrahydrofuran-3,4-diol (1.2 g, yield: 86%).
ESI-MS (m/z): 296 (M+1)

Step 3



[0337] (2R,3R,4S,5R)-2-(6-(Dimethylamino)-9H-purin-9-yl)-5-(hydroxym ethyl)tetrahydrofuran-3,4-diol (1.2 g, 4.06 mmol) obtained in Step 2 was suspended in 0.5 M acetic acid-sodium acetate buffer (pH 4.0) (40 mL), and bromine water (55.8 mL) was added thereto, and the mixture was stirred at room temperature for 4 hours. To the reaction solution, sodium hydrogen sulfate was added until the color of bromine disappeared, and then, the mixture was neutralized with sodium carbonate. The solvent was evaporated under reduced pressure until the amount of the solvent was decreased to about half, and the insoluble material was collected by filtration, washed with water and acetone in order, and then dried under reduced pressure to obtain (2R,3R,4S,5R)-2-(8-bromo-6-(dimethylamino)-9H-purin-9-yl)-5-(hydr oxymethyl)tetrahydrofuran-3,4-diol (1.09 g, yield: 72%).
ESI-MS (m/z): 374 (M+1)

Step 4



[0338] (2R,3R,4S,5R)-2-(8-Bromo-6-(dimethylamino)-9H-purin-9-yl)-5-( hydroxymethyl)tetrahydrofuran-3,4-diol (2.90 g, 7.75 mmol) obtained in Step 3 was suspended in acetone (39 mL), and 2, 2-dimethoxypropane (4.75 mL, 38.8 mmol) and 4-toluenesulfonic acid monohydrate (1.62 g, 38.8 mmol) were added thereto, and the mixture was stirred overnight at room temperature. To the reaction solution were added a saturated aqueous sodium bicarbonate solution and saturated brine, and then, the solvent was evaporated under reduced pressure until the amount of the solvent was decreased to about half. Chloroform was added thereto, and the mixture was extracted with chloroform and dried over sodium sulfate. Thereafter, the mixture was extracted with chloroform and dried over sodium sulfate. The solvent was evaporated under reduced pressure to obtain ((3aR,4R,6R,6aR)-6-(8-bromo-6-(dimethylamino)-9H-purin-9-yl)-2, 2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methanol (1.96 g, yield: 61%) was obtained.
ESI-MS (m/z): 414 (M+1)

Step 5



[0339] ((3aR,4R,6R,6aR)-6-(8-Bromo-6-(dimethylamino)-9H-purin-9-yl)-2,2-dimethyltetrahydrofuro[3,4-d] [1,3]dioxol-4-yl)methanol (200 mg, 0.483 mmol) obtained in Step 4 was dissolved in dichloromethane (2 mL), and 1H-tetrazole (84.6 mg, 1.21 mmol) and di-tert-butyl diisopropylphosphoramide (0.321 mL, 0.966 mmol) were added thereto, and the mixture was stirred at room temperature for 0.5 hours. The reaction solution was cooled to 0 °C, and m-chloroperbenzoic acid (222 mg, 0.966 mmol) was added thereto, and the mixture was further stirred at 0 °C for 15 minutes. To the reaction solution were added a saturated aqueous sodium bicarbonate solution and saturated brine, and the mixture was extracted with chloroform and dried over sodium sulfate. The residue obtained by evaporating the solvent under reduced pressure was purified by column chromatography (heptane/ethyl acetate) to obtain di-tert-butyl ((3aR,4R,6R,6aR)-6-(8-bromo-6-(dimethylamino)-9H-purin-9-yl)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methyl phosphate (209 mg, yield: 71%).
ESI-MS (m/z): 606 (M+1)

Step 6


Di-tert-butyl



[0340] ((3aR,4R,6R,6aR)-6-(8-bromo-6-(dimethylamino)-9H-purin-9-yl)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methyl phosphate (50.0 mg, 0.082 mol)) obtained in Step 5 was dissolved in trifluoroacetic acid/water (1:1) (2 mL), and the mixture was stirred at room temperature for 3 hours. To the residue obtained by evaporating the solvent under reduced pressure, acetic acid-ammonium acetate buffer (pH 5.7) was added, and then, the residue was purified by preparative HPLC (eluent: a 0.01 mmol/L aqueous ammonium acetate solution/methanol) to obtain the roughly purified product. To the roughly purified product, ethanol was added, and the precipitate was collected by filtration to obtain ((2R,3S,4R,5R)-6-(8-bromo-6-(dimethylamino)-9H-purin-9-yl)-3,4-di hydroxytetrahydrofuran-2-yl)methyl phosphate (Compound I-11, 26.2 mg, yield: 70%).
1H-NMR (D2O, 300 MHz) δ: 8.06-7.92 (m, 1H), 5.98-5.93 (m, 1H), 5.15-5.07 (m, 1H), 4.43 (dd, J= 5.9, 5.9 Hz, 1H), 4.09 (dd, J= 9.8, 4.9 Hz, 1H), 3.99-3.91 (m, 1H), 3.90-3.82 (m, 1H), 3.30-3.12 (m, 6H) .
ESI-MS (m/z): 454 (M+1)

Reference Example 7.1: Compound am-7



[0341] (2R,3R,4R,5R)-2-((Bis(4-methoxyphenyl)(phenyl)rnethoxy)methyl) -5-(8-bromo-6-(dimethylamino)-9H-purin-9-yl-4-((tert-butyldimethy lsilyl)oxy)tetrahydrofuran-3-yl (2-cyanoethyl) diisopropylphosphoramidite (Compound am-7) is obtained in the same manner as in Reference Example 1.1 using (2R,3R,4S,5R)-2-(8-bromo-6-(dimethylamino)-9H-purin-9-yl)-5-(hydr oxymethyl)tetrahydrofuran-3,4-diol obtained in Step 3 of Reference Example 7.0.

Example 13



[0342] An siRNA having Compound 1-11 at the 5' end of the antisense strand is synthesized in the same manner as in Example 1 using Compound am-7 obtained in Reference Example 7.1.

Reference Example 8.0: Compound 1-12


Step 1



[0343] Di-tert-butyl ((3aR,4R,6R,6aR)-6-(8-bromo-6-(dimethylamino)-9H-purin-9-yl)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methyl phosphate (100 mg, 0.165 mmol) obtained in Step 5 of Reference Example 7.0 was dissolved in DMF (1.5 mL), and tetraethylammonium cyanide (129 mg, 0.824 mmol) was added thereto, and the mixture was stirred at 100 °C for 2 hours. After the reaction solution was cooled to room temperature, saturated brine was added thereto, and the mixture was extracted with ethyl acetate and dried over sodium sulfate. The residue obtained by evaporating the solvent under reduced pressure was purified by column chromatography (heptane/ethyl acetate) to obtain di-tert-butyl ((3aR,4R,6R,6aR)-6-(8-cyano-6-(dimethylamino)-9H-purin-9-yl)-2,2-dimethyltetrahydrofuro[3,4-d] [1,3]dioxol-4-yl)methyl phosphate (52.6 mg, 58%).
ESI-MS (m/z): 558 (M+1)

Step 2



[0344] Di-tert-butyl ((3aR,4R,6R,6aR)-6-(8-cyano-6-(dimethylamino)-9H-purin-9-yl)-2,2-dimethyltetrahydrofuro[3,4-d] [1,3]dioxol-4-yl)methyl phosphate (80.0 mg, 0.145 mmol) obtained in Step 2 was dissolved in trifluoroacetic acid/water (1:1) (4 mL), and the mixture was stirred at room temperature for 3 hours. The residue obtained by evaporating the solvent under reduced pressure was purified by preparative HPLC (eluent: a 0.01 mmol/L aqueous trifluoroacetic acid solution/acetonitrile) to obtain the roughly purified product. To the roughly purified product, ethanol was added, and the precipitate was collected by filtration to obtain ((2R,3S,4R,5R)-6-(8-cyano-6-(dimethylamino)-9H-purin-9-yl)-3,4-di hydroxytetrahydrofuran-2-yl)methylphosphate (Compound 1-12, 8.4 mg, yield: 15%).
1H-NMR (D2O, 300 MHz) δ: 8.05 (s, 1H), 5.97 (d, J= 5.9 Hz, 1H), 4 . 95-4.53 (m, 1H), 4.37-4.29 (m, 1H), 4.24-4.15 (m, 1H), 4.06-3.93 (m, 2H), 3.66-2.83 (m, 6H).
ESI-MS (m/z): 401 (M+1)

Reference Example 8.1: Compound am-8


Steps 1 to 2



[0345] 8-Bromo-9-((4aR,6R,7R,7aR)-2,2-di-tert-butyl-7-(tert-butyldim ethylsilyloxy)tetrahydro-4H-furo[3,2-d] [1,3,2]dioxasilin-6-yl)-N, N-dimethyl-9H-purin-6-amine was obtained in the same manner as in Steps 1 to 2 of Reference Example 1.1 using (2R,3R,4S,5R)-2-(8-bromo-6-(dimethylamino)-9H-purin-9-yl)-5-(hydr oxymethyl)tetrahydrofuran-3,4-diol obtained in Step 3 of Reference Example 7.0.
ESI-MS (m/z): 628 (M+1)

Step 3



[0346] 8-Bromo-9-((4aR,6R,7R,7aR)-2,2-di-tert-butyl-7-(tert-butyldim ethylsilyloxy)tetrahydro-4H-furo[3,2-d] [1,3,2]dioxasilin-6-yl)-N, N-dimethyl-9H-purin-6-amine (10.0 mg, 0.0160 mmol) obtained in Step 2 was dissolved in DMF (1.00 mL), and sodium cyanide (7,79 mg, 0.159 mmol) and cesium fluoride (7.25 mg, 0.0480 mmol) were added thereto, and the mixture was stirred at 100 °C for 4 hours. To the reaction solution, a saturated aqueous sodium bicarbonate solution was added, and the mixture was extracted with ethyl acetate and dried over sodium sulfate. The residue obtained by evaporating the solvent under reduced pressure was purified by column chromatography (heptane/ethyl acetate) to obtain 9-((4aR,6R,7R,7aR)-2,2-di-tert-butyl-7-((tert-butyldimethylsilyl) oxy)tetrahydro-4H-furo[3,2-d](1,3,2)dioxasilin-6-yl)-6-(dimethyla mino)-9H-purin-8-carbonitrile (8.00 mg, yield: 44.8%) was obtained. ESI-MS (m/z): 575 (M+1)

Steps 4 to 6



[0347] (2R,3R,4R,5R)-2-((Bis(4-methoxyphenyl)(phenyl)methoxy)methyl) -4-((tert-butyldimethylsilyl)oxy)-5-(8-cyano-6-(dimethylamino)-9H -purin-9-yl)tetrahydrofuran-3-yl(2-cyanoethyl) diisopropylphosphoramidite (Compound am-8) is obtained in the same manner as in Steps 3 to 5 of Reference Example 1.1 using 9-((4aR,6R,7R,7aR)-2,2-di-tert-butyl-7-((tert-butyldimethylsilyl) oxy)tetrahydro-4H-furo[3,2-d][1,3,2]dioxasilin-6-yl)-6-(dimethyla mino)-9H-purin-8-carbonitrile obtained in Step 3.

Example 14



[0348] An siRNA having Compound 1-12 at the 5' end of the antisense strand is synthesized in the same manner as in Example 1 using Compound am-8 obtained in Reference Example 8.1.

Reference Example 9.0: Compound 1-13



[0349] ((2R,3S,4R,5R)-5-(6-Iodo-2,4-dioxo-3,4-dihydropyrimidin-1(2H) -yl)-3,4-dihydroxytetrahydrofuran-2-yl)methyl phosphate triethylamine (Compound 1-13) was obtained in the same manner as in Steps 3 to 5 of Reference Example 1.0 using commercially available 1-((2R,3R,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)tetrahydrofuran-2 -yl)-6-iodopyrimidine-2,4(1H,3H)-dione (866 mg, 2.34 mmol). 1H-NMR (D2O, 300 MHz) δ: 6.52 (s, 1H), 5.92 (d, J= 3.3 Hz, 1H), 4.69-4.60 (m, 1H), 4.33 (t, J= 6.8 Hz, 1H), 4.02-3.86 (m, 3H), 3.07 (q, J= 7.3 Hz, 6H), 1.15 (t, J= 7.3 Hz, 9H).
ESI-MS (m/z): 451 (M+1)

Reference Example 9.1: Compound am-9



[0350] (2R,3R,4R,5R)-2-((Bis(4-methoxyphenyl)(phenyl)methoxy)methyl) -4-((tert-butyldimethylsilyl)oxy)-5-(6-iodo-2,4-dioxo-3,4-dihydro pyrimidin-1(2H)-yl)tetrahydrofuran-3-yl(2-cyanoethyl) diisopropylphosphoramidite (Compound am-9) is obtained in the same manner as in Reference Example 1.1 using commercially available 1-((2R,3R,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)tetrahydrofuran-2 -yl)-6-iodopyrimidine-2,4(1H,3H)-dione.

Example 15



[0351]  An siRNA having Compound I-13 at the 5' end of the antisense strand is synthesized in the same manner as in Example 1 using Compound am-9 obtained in Reference Example 9.1.

Reference Example 10.0: Compound I-14


Step 1



[0352] 5-Bromo-1-((3aR, 4R,6R,6aR)-6-(hydroxymethyl)-2,2-dimethyltetr ahydrofuro[3,4-d][1,3]dioxol-4-yl)pyrimidine-2,4(1H,3H)-dione (2.58 g, yield: 69%) was obtained in the same manner as in Step 3 of Reference Example 1.0 using commercially available 5-bromo-1-((2R,3R,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)tetrahydr ofuran-2-yl)pyrimidine-2,4(1H,3H)-dione (3.34 g, 10.3 mmol). ESI-MS (m/z): 363 (M+1)

Step 2



[0353] 5-Bromo-1-((3aR,4R,6R,6aR)-6-(hydroxymethyl)-2,2-dimethyltetr ahydrofuro[3,4-d][1,3]dioxol-4-yl)pyrimidine-2,4(1H,3H)-dione (200 mg, 0.551 mmol) obtained in Step 1 and tetrakis(triphenylphosphine)palladium (63.6 mg, 0.055 mmol) were dissolved in 1,4-dioxane, and tributyl(2-pyridyl)tin (0.62 mL, 1.93 mmol) was added thereto, and the mixture was stirred overnight at 110 °C. After the reaction mixture was cooled to room temperature, a saturated aqueous sodium bicarbonate solution was added thereto, and the mixture was filtered through Presep (registered trademark, diatomaceous earth, Granular Type M, 4.5 g/25 mL), and then, the solvent was evaporated under reduced pressure. The residue obtained was purified by column chromatography (chloroform/methanol) to obtain 1-((3aR,4R,6R,6aR)-6-(hydroxymethyl)-2,2-dimethyltetrahydrofuro[3 ,4-d][1,3]dioxol-4-yl)-5-(pyridin-2-yl)pyrimidine-2,4(1H,3H)-dion e (45.2 mg, yield: 23%).
ESI-MS (m/z): 362 (M+1)

Steps 3 to 4



[0354] ((2R,3S,4R,5R)-5-(2,4-Dioxo-5-(pyridin-2-yl)-3,4-dihydropyrim idin-1(2H)-yl)-3,4-dihydroxytetrahydrofuran-2-yl)methyl phosphate (Compound 1-14) was obtained in the same manner as in Steps 4 to 5 of Reference Example 1.0 using 1-((3aR,4R,6R,6aR)-6-(hydroxymethyl)-2,2-dimethyltetrahydrofuro[3 ,4-d][1,3]dioxol-4-yl)-5-(pyridin-2-yl)pyrimidine-2,4(1H,3H)-dion e obtained in Step 2.
1H-NMR (D2O, 300 MHz) δ: 8.66 (s, 1H), 8.56 (d, J= 5.5 Hz, 1H), 8.40 (t, J= 7.9 Hz, 1H), 8.20 (d, J= 8.4 Hz, 1H), 7.77 (t, J= 6.8 Hz, 1H), 5.92 (d, J= 4.0 Hz, 1H), 4.35 (t, J= 4.2 Hz, 1H), 4.27-4.26 (m, 2H), 4.15 (dd, J= 12.1, 2.6 Hz, 1H), 4.04 (dd, J= 13.0, 5.7 Hz, 1H).
ESI-MS (m/z): 402 (M+1)

Reference Example 10.1: Compound am-10


Step 1



[0355] 1-((2R,3R,4S,5R)-3,4-Dihydroxy-5-(hydroxymethyl)tetrahydrofur an-2-yl)-5-(pyridin-2-yl)pyrimidine-2,4(1H, 3H)-dione is obtained in the same manner as in Step 1 of Reference Example 6.1 using 1-((3aR,4R,6R,6aR)-6-(hydroxymethyl)-2,2-dimethyltetrahydrofuro[3 ,4-d][1,3]dioxol-4-yl)-5-(pyridin-2-yl)pyrimidine-2,4(1H,3H)-dion e obtained in Step 2 of Reference Example 10.0.

Step 2



[0356] (2R,3R,4R,5R)-2-((Bis(4-methoxyphenyl)(phenyl)methoxy)methyl) -4-((tert-butyldimethylsilyl)oxy)-5-(2,4-dioxo-5-(pyridin-2-yl)-3 ,4-dihydropyrimidin-1(2H)-yl)tetrahydrofuran-3-yl (2-cyanoethyl) diisopropylphosphoramidite (Compound am-10) is obtained in the same manner as in Reference Example 1.1 using 1-((2R,3R,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)tetrahydrofuran-2 -yl)-5-(pyridin-2-yl)pyrimidine-2,4(1H,3H)-dione.

Example 16



[0357] An siRNA having Compound 1-14 at the 5' end of the antisense strand is synthesized in the same manner as in Example 1 using Compound am-10 obtained in Reference Example 10.1.

Reference Example 11.0: Compound 1-15



[0358] ((2R,3S,4R,5R)-3,4-Dihydroxy-5-(5-(oxazol-2-yl)-2,4-dioxo-3,4 -dihydropyrimidin-1(2H)-yl)tetrahydrofuran-2-yl)methyl phosphate (Compound I-15) was obtained in the same manner as in Steps 2 to 4 of Reference Example 10.0 using 2-(tri-n-butylstannyl)oxazole. 1H-NMR (D2O, 300 MHz) δ: 8.52(s, 1H), 7.84(s, 1H), 7.19(s, 1H), 5.93(d, J= 4.9 Hz, 1H), 4.36(t, J= 4.9 Hz, 1H), 4.28-4.24(m, 2H), 4.11(dq, J= 11.7, 2.0 Hz, 1H), 4.03(dq, J= 11.7, 2.6 Hz, 1H).
ESI-MS (m/z): 392 (M+1)

Reference Example 11.1: Compound am-11



[0359] (2R,3R,4R,5R)-2-((Bis(4-methoxyphenyl)(phenyl)methoxy)methyl) -4-((tert-butyldimethylsilyl)oxy)-5-(5-(oxazol-2-yl)-2,4-dioxo-3, 4-dihydropyrimidin-1(2H)-yl)tetrahydrofuran-3-yl (2-cyanoethyl) diisopropylphosphoramidite (Compound am-11) is obtained in the same manner as in Reference Example 10.1 using 1-((3aR,4R,6R,6aR)-6-(hydroxymethyl)-2,2-dimethyltetrahydrofuro[3 ,4-d][1,3]dioxol-4-yl)-5-(oxazol-2-yl)pyrimidine-2,4(1H,3H)-dione synthesized in the same manner as in Step 2 of Reference Example 10.0 using 2-(tri-n-butylstannyl)oxazole.

Example 17



[0360] An siRNA having Compound I-15 at the 5' end of the antisense strand is synthesized in the same manner as in Example 1 using Compound am-11 obtained in Reference Example 11.1.

Reference Example 12.0: Compound 1-16


Step 1



[0361] (2R,3R,4R,5R)-2-((Benzoyloxy)methyl)-5-(5-iodo-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)tetrahydrofuran-3,4-diyl dibenzoate was obtained in the same manner as in Step 1 of Reference Example 1.0 using commercially available 5-iodopyrimidine-2,4(1H,3H)-dione.
ESI-MS (m/z): 683 (M+1)

Step 2



[0362] 1,4-Dioxane (3 mL) was added to (2R,3R,4R,5R)-2-((benzoyloxy)methyl)-5-(5-iodo-2,4-dioxo-3,4-dihy dropyrimidin-1(2H)-yl)tetrahydrofuran-3,4-diyl dibenzoate (200 mg, 0.293 mmol) obtained in Step 1, (4-methoxyphenyl)boronic acid (134.0 mg, 0.879 mmol), 1,1'-bis(diphenylphosphino) ferrocene-palladium(II) dichloride-dichloromethane complex (23.9 mg, 0.029 mmol), and a 2 M aqueous cesium carbonate solution (0.6 mL), and the mixture was stirred at 120 °C for 1 hour. After the reaction solution was cooled to room temperature, a saturated aqueous sodium bicarbonate solution was added thereto, and the mixture was filtered through Presep (registered trademark, diatomaceous earth, Granular Type M, 4.5 g/25mL), and then, the solvent was evaporated under reduced pressure. The residue obtained was purified by column chromatography (chloroform/methanol) to obtain (2R,3R,4R,5R)-2-((benzoyloxy)methyl)-5-(5-(4-methoxyphenyl)-2,4-d ioxo-3,4-dihydropyrimidin-1(2H)-yl)tetrahydrofuran-3,4-diyl dibenzoate (118 mg, yield: 61%) was obtained.
ESI-MS (m/z): 663 (M+1)

Step 3



[0363] ((2R,3S,4R,5R)-3,4.-Dihydroxy-5-(5-(4-methoxyphenyl)-2,4-dioxo -3,4-dihydropyrimidin-1(2H)-yl)tetrahydrofuran-2-yl)methyl phosphate (Compound 1-16) was obtained in the same manner as in Steps 2 to 5 of Reference Example 1.0 using (2R,3R,4R,5R)-2-((benzoyloxy)methyl)-5-(5-(4-methoxyphenyl)-2,4-d ioxo-3,4-dihydropyrimidin-1(2H)-yl)tetrahydrofuran-3,4-diyl dibenzoate obtained in Step 2.
1H-NMR (D2O, 300 MHz) δ: 7.77 (s, 1H), 7.42 (d, J= 8.8 Hz, 2H), 7.01 (d, J= 8.8 Hz, 2H), 5.97 (d, J= 5.5 Hz, 1H), 4.39 (t, J= 5.9 Hz, 1H), 4.27 (t, J= 4.4 Hz, 1H), 4.22-4.21 (m, 1H), 4.04-4.02 (m, 2H), 3.81 (s, 3H).
ESI-MS (m/z): 431 (M+1)

Reference Example 12,1: Compound am-12



[0364] (2R,3R,4R,5R)-2-((Bis(4-methoxyphenyl)(phenyl)methoxy)methyl) -4-((tert-butyldimethylsilyl)oxy)-5-(5-(4-methoxyphenyl)-2,4-diox o-3,4-dihydropyrimidin-1(2H)-yl)tetrahydrofuran-3-yl (2-cyanoethyl) diisopropylphosphoramidite (Compound am-12) is obtained in the same manner as in Reference Example 1.1 using (2R,3R,4R,5R)-2-((benzoyloxy)methyl)-5-(5-(4-methoxyphenyl)-2,4-d ioxo-3,4-dihydropyrimidin-1(2H)-yl)tetrahydrofuran-3,4-diyl dibenzoate obtained in Step 2 of Reference Example 12.0.

Example 18



[0365] An siRNA having Compound 1-16 at the 5' end of the antisense strand is synthesized in the same manner as in Example 1 using Compound am-12 obtained in Reference Example 12.1.

Reference Example 13.0: Compound 1-17


Step 1



[0366] Di-tert-butyl ((3aR,4R,6R,6aR)-6-(5-bromo-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methyl phosphate was obtained in the same manner as in Step 4 of Reference Example 1.0 using 5-bromo-1-((3aR,4R,6R,6aR)-6-(hydroxymethyl)-2,2-dimethyltetrahyd rofuro[3,4-d][1,3]dioxol-4-yl)pyrimidine-2,4(1H,3H)-dione obtained in Step 1 of Reference Example 10.0.
ESI-MS (m/z): 555 (M+1)

Step 2



[0367] Di-tert-butyl ((3aR,4R,6R,6aR)-6-(5-bromo-2,4-dioxo-3,4-dihydropyrirnidin-1(2H)-yl)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methyl phosphate (200 mg, 0.360 mmol) obtained in Step 1 was dissolved in DMF (7mL), and sodium cyanide (88.0mg, 1.801 mmol) was added thereto, and the mixture was stirred overnight at room temperature. To the reaction solution was added a saturated aqueous sodium bicarbonate solution, and the mixture was extracted with ethyl acetate and dried over sodium sulfate. The residue obtained by evaporating the solvent under reduced pressure was purified by column chromatography (heptane/ethyl acetate) to obtain di-tert-butyl ((3aR,4R,6R,6aR)-6-(6-cyano-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methyl phosphate (150 mg, yield: 83%).
ESI-MS (m/z): 502 (M+1)

Step 3



[0368] ((2R,3S,4R,5R)-5-(6-Cyano-2,4-dioxo-3,4-dihydropyrimidin-1(2H )-yl)-3,4-dihydroxytetrahydrofuran-2-yl)methyl phosphate (Compound I-17) was obtained in the same manner as in Step 5 of Reference Example 1.0 using di-tert-butyl ((3aR,4R,6R,6aR)-6-(6-cyano-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-2,2-dimethyltetrahydrofuro[3,4-d] [1,3]dioxol-4-yl)methyl phosphate obtained in Step 2.
1H-NMR (D2O, 300 MHz) δ: 6.51 (d, J= 0.7 Hz, 1H), 5.81 (d, J= 4.0 Hz, 1H), 4.28 (t, J= 6.2 Hz, 1H), 4.01-3.95 (m, 4H).
ESI-MS (m/z): 350 (M+1)

Reference Example 13.1: Compound am-13


Steps 1 to 2



[0369] 5-Bromo-1-((4aR,6R,7R,7aR)-2,2-di-tert-butyl-7-((tert-butyldi methylsilyl)oxy)tetrahydro-4H-furo[3,2-d][1,3,2]dioxasilin-6-yl)p yrimidine-2, 4 (1H, 3H) -dione was obtained in the same manner as in Steps 1 to 2 of Reference Example 1.1 using commercially available 5-bromo-1-((2R,3R,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)tetrahydr ofuran-2-yl)pyrimidine-2,4(1H,3H)-dione.
ESI-MS (m/z): 577 (M+1)

Step 3



[0370] 3-((4aR,6R,7R,7aR)-2,2-Di-tert-butyl-7-((tert-butyldimethylsi lyl)6xy)tetrahydro-4H-furo[3,2-d] [1,3,2]dioxasilin-6-yl)-2,6-diox o-1,2,3,6-tetrahydropyrimidine-4-carbonitrile was obtained in the same manner as in Step 2 of Reference Example 13.0 using 5-bromo-1-((4aR,6R,7R,7aR)-2,2-di-tert-butyl-7-((tert-butyldimeth ylsilyl)oxy)tetrahydro-4H-furo[3,2-d][1,3,2]dioxasilin-6-yl)pyrim idine-2,4(1H,3H)-dione obtained in Step 2.
ESI-MS (m/z): 524 (M+1)

Step 4



[0371] (2R,3R,4R,5R)-2-((Bis(4-methoxyphenyl)(phenyl)methoxy) methyl) -4-((tert-butyldimethylsilyl)oxy)-5-(6-cyano-2,4-dioxo-3,4-dihydr opyrimidin-1(2H)-yl)tetrahydrofuran-3-yl(2-cyanoethyl) diisopropylphosphoramidite (Compound am-13) was obtained in the same manner as in Steps 3 to 5 of Reference Example 1.1 using 3-(4aR,6R,7R,7aR)-2,2-di-tert-butyl-7-((tert-butyldimethylsilyl) oxy)tetrahydro-4H-furo[3,2-d][1,3,2]dioxasilin-6-yl)-2,6-dioxo-1, 2,3,6-tetrahydropyrimidine-4-carbonitrile obtained in Step 3. 1H-NMR (CDCl3, 500 MHz) δ: 7.47-6.78 (m, 13H), 6.27 (6.26) (s, 1H), 5.84 (m, 1H), 4.95 (4.89) (m, 1H), 4.35-4.19 (m, 2H), 3.96-3.27 (m, 12H), 2.31 (2.59) (m, 2H), 1.19-1.06 (m, 12H), 0.87 (0.88) (s, 9H), 0.06 (0.08) (s, 3H), 0.01 (s, 3H).

Example 19



[0372] An siRNA having Compound 1-17 as X at the 5' end of the antisense strand of 454-Xu shown in Table 24 below was synthesized in the same manner as in Example 1 using Compound am-13 obtained in Reference Example 13.1.
MALDI-TOF/MS (antisense strand): theoretical value: 6691.86 (M-H), actual value: 6691.25

Reference Example 14.0: Compound I-18


Step 1



[0373] ((3aR,9R,6R,5aR)-2,2-Dimethyl-6-(6-((E)-styryl)-9H-purin-9-yl )tetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methanol (249 mg, 0.631 mmol) obtained in Step 2 of Reference Example 6.0 was dissolved in chloroform (6.00 mL), and imidazole (86 mg, 1.26 mmol) and tert-butyldimethylsilyl chloride (105 mg, 0.694 mmol) were added thereto under ice cooling, and the mixture was stirred at room temperature for 3 hours. Thereafter, imidazole (86 mg, 1.26 mmol) and tert-butyldimethylsilyl chloride (105 mg, 0.694 mmol) were added thereto under ice cooling, and the mixture was further stirred at room temperature for 1 hour. The residue obtained by evaporating the solvent under reduced pressure was purified by column chromatography (heptane/ethyl acetate) to obtain 9-((3aR,4R,6R,6aR)-6-((tert-butyldimethylsilyloxy)methyl)-2,2-dim ethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)-6-((E)-styryl)-9H-pur ine (310 mg, 97.0%).
ESI-MS (m/z): 509 (M+1)

Step 2



[0374] 9-((3aR,4R,6R,6aR)-6-((Tert-butyldimethylsilyloxy)methyl)-2,2 -dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)-6-((E)-styryl)-9H -purine (200 mg, 0.393 mmol) obtained in Step 1 was dissolved in THF (3.00 mL), and lithium diisopropylamide (0.393 mL, 0.786 mmol) was added thereto at -78 °C. After stirring the mixture for 30 minutes, the solution obtained by dissolving 1,2-dibromo-1,1,2,2-tetrachloroethane (384 mg, 1.18 mmol) in THF (2.00 mL) was added thereto at -78 °C. Thereafter, the temperature of the mixture was raised to room temperature over 1 hour while stirring. To the reaction mixture, a saturated aqueous sodium bicarbonate solution was added, and the mixture was extracted with ethyl acetate and dried over anhydrous sodium sulfate. The residue obtained by evaporating the solvent under reduced pressure was purified by column chromatography (heptane/ethyl acetate) to obtain 8-bromo-9-((3aR,4R,6R,6aR)-6-((tert-butyldimethylsilyloxy)methyl) -2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)-6-((E)-styryl )-9H-purine (198 mg, 86.0%).
ESI-MS (m/z): 587 (M+1)

Step 3



[0375] 8-Bromo-9-((3aR,4R,6R,6aR)-6-((tert-butyldimethylsilyloxy)met hyl)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)-6-((E)-st yryl)-9H-purine (198 mg, 0.337 mmol) obtained in Step 2 was dissolved in trifluoroacetic acid/water (1:1) (2 mL), and the mixture was stirred at room temperature for 2 hours. The residue obtained by evaporating the solvent under reduced pressure was purified by column chromatography (heptane/ethyl acetate) to obtain (2R,3R,4S,5R)-2-(8-bromo-6-(E)-styryl)-9H-purin-9-yl)-5-(hydroxy methyl)tetrahydrofuran-3,4-diol (140 mg, 96.0%).
ESI-MS (m/z): 433 (M+1)

Step 4



[0376] ((3aR,4R,6R,6aR)-6-(8-Bromo-6-((E)-styryl)-9H-purin-9-yl)-2,2 -dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl) methanol (66.0 mg, 43.2%) was obtained in the same manner as in Step 3 of Reference Example 1.0 using (2R,3R,4S,5R)-2-(8-bromo-6-((E)-styryl)-9H-purin-9-yl)-5-(hydroxy methyl)tetrahydrofuran-3,4-diol (140 mg, 0.323 mmol) obtained in Step 3.
ESI-MS (m/z): 473 (M+1)

Steps 5 to 6



[0377] ((2R,3S,4R,5R)-5-(8-Bromo-6-((E)-styryl)-9H-purin-9-yl)-3,4-d ihydroxytetrahydrofuran-2-yl)methyl phosphate (Compound 1-18, 68.5 mg, 75.0%) was obtained in the same manner as in Steps 3 to 4 of Reference Example 6.0 using ((3aR,4R,6R,6aR)-6-(8-bromo-6-((E)-styryl)-9H-purin-9-yl)-2,2-dim ethyltetrahydrofuro[3,4-d][1,3],dioxol-4-yl)methanol (65.0 mg, 0.137 mmol) obtained in Step 4.
1H-NMR (D2O, 400 MHz) δ: 8.45 (1H, s), 7.54 (1H, d, J=15.6Hz), 7.24-7.17 (2H, m), 7.11-7.00 (3H, m), 6.95 (1H, d, J= 15.6 Hz), 5.96 (1H, d, J= 4.9 Hz), 5.18 (1H, dd, J= 5.4, 5.4 Hz), 4.54 (1H, dd, J= 5.4, 5.4 Hz), 4.19-4.13 (1H, m), 4.12-3.95 (2H, m).
ESI-MS (m/z): 513 (M+1)

Reference Example 14.1: Compound am-14



[0378] 3-((2R,3R,4R,5R)-2-((Bis(4-methoxyphenyl)(phenyl)methoxy)meth yl)-5-(8-bromo-6-((E)-styryl)-9H-purin-9-yl)-4-(tert-butyldimethy lsilyloxy)tetrahydrofuran-3-yl (2-cyanoethyl) diisopropylphosphoramidite (Compound am-14) is obtained in the same manner as in Reference Example 1.1 using (2R,3R,4S,5R)-2-(8-bromo-6-((E)-styryl)-9H-purin-9-yl)-5-(hydroxy methyl)tetrahydrofuran-3,4-diol obtained in Step 3 of Reference Example 14.0.

Example 20



[0379] An siRNA having Compound 1-18 at the 5' end of the antisense strand is synthesized in the same manner as in Example 1 using Compound am-14 obtained in Reference Example 14.1.

Reference Example 15.0: Compound 1-19



[0380] ((2R,3S,4R,5R)-5-(5,6-Dimethyl-2,4-dioxo-3,4-dihydrothieno[2, 3-d]pyrimidin-1(2H)-yl)-3,4-dihydroxytetrahydrofuran-2-yl)methyl phosphate (Compound 1-19) triethylammonium salt was obtained in the same manner as in Reference Example 1.0 using commercially available 5,6-dimethylthieno[2,3-d]pyrimidine-2,4(1H,3H)-dione.
1H-NMR (D2O, 300 MHz) δ: 6.10 (d, J= 5.5 Hz, 1H), 4.75-4.73 (m, 1H), 4.40 (t, J= 5.7 Hz, 1H), 4.24-4.14 (m, 3H), 2.32 (s, 3H), 2.31 (s, 3H) .
ESI-MS (m/z): 411 (M+1)

Reference Example 15.1: Compound am-15



[0381] (2R,3R,4R,5R)-2-((Bis(4-methoxyphenyl)(phenyl)methoxy)methyl) -4-(tert-butyldimethylsilyloxy)-5-(5,6-dimethyl-2,4-dioxo-3,4-dih ydrothieno[2,3-d]pyrimidin-1(2H)-yl)tetrahydrofuran-3-yl 2-cyanoethyl diisopropylphosphoramidite (Compound am-15) was obtained in the same manner as in Reference Example 1.1 using commercially available 5,6-dimethylthieno[2,3-d]pyrimidine-2,4(1H,3H)-dione.
1H-NMR (CDCl3, 500MHz) δ: 7.62 (s, 1H), 7.50-6.78 (m, 13H), 5.98 (m, 1H), 4.92 (m, 1H), 4.34-4.25 (m, 2H), 4.00-3.34 (m, 12H), 2.29 (2.64) (m, 2H), 2.35 (s, 3H), 2.13 (s, 3H), 1.23-1.03 (m, 12H), 0.83 (0.84) (s, 9H), 0.02 (d, J= 6.0 Hz, 3H), -0.10 (d, J= 5.0 Hz, 3H) .

Example 21



[0382] An siRNA (referred to as di-Me-thienyl-dU) having Compound 1-19 as X at the 5' end of the antisense strand of 454-Xu shown in Table 24 below was synthesized in the same manner as in Example 1 using Compound am-15 obtained in Reference Example 15.1.
MALDI-TOF/MS (antisense strand): theoretical value: 6750.99 (M-H), actual value: 6754.34

Reference Example 16.0: Compound 1-20


Step 1



[0383] ((3aR,4R,6R,6aR)-6-(6-(3-Isopropylphenyl)-9H-purin-9-yl)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methanol (167 mg, 133%) was obtained in the same manner as in Step 2 of Reference Example 6.0 using ((3aR,4R,6R,6aR)-6-(6-chloro-9H-purin-9-yl)-2,2-dimethyltetrahydr ofuro[3,4-d][1,3]dioxol-4-yl)methanol (100 mg, 0.306 mmol) obtained in Step 1 of Reference Example 6.0 and 3-isopropylphenylboronic acid (100 mg, 0.612 mmol).
ESI-MS (m/z): 411 (M+1)

Step 2



[0384] Di-tert-butyl ((3aR,4R,6R,6aR)-6-(6-(3-isopropylphenyl)-9H-purin-9-yl)-2,2-dime thyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methyl phosphate (96.2 mg, 52.0%) was obtained in the same manner as in Step 3 of Reference Example 6.0 using ((3aR,4R,6R,6aR)-6-(6-(3-isopropylphenyl)-9H-purin-9-yl)-2,2-dime thyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methanol (126 mg, 0.307 mmol) obtained in Step 1.
ESI-MS (m/z): 603 (M+1)

Step 3



[0385] Di-tert-butyl ((3aR,4R,6R,6aR)-6-(6-(3-isopropylphenyl)-9H-purin-9-yl)-2,2-dime thyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methyl phosphate (96.0 mg, 0.159 mmol) obtained in Step 1 was dissolved in trifluoroacetic acid/water (1:1) (2mL), and the mixture was stirred at room temperature for 3 hours. The residue obtained by evaporating the solvent under reduced pressure was purified by preparative HPLC (eluent: 0.01 mmol/L acetic acid-triethylamine buffer (pH 6.5)/acetonitrile) to obtain ((2R,3S,4R,5R)-3,4-dihydroxy-5-(6-(3-isopropylphenyl)-9H-purin-9-yl)tetrahydrofuran-2-yl)methyl phosphate (Compound 1-20) triethylammonium salt (70.0 mg, 80.0%).
1H-NMR (D2O, 300 MHz) δ: 8.72 (2H, d, J=7.0Hz), 7.97 (1H, s), 7.92-7.83 (1H, m), 7.43-7.33 (2H, m), 6.14 (1H, d, J= 5.5 Hz), 4.73-4.64 (14H, m), 4.44-4.38 (1H, m), 4.32-4.25 (1H, m), 4.08-3.93 (2H, m), 3.06 (11H, q, J= 7.3 Hz), 2.94-2.81 (1H, m), 1.20-1.08 (22H, m).
ESI-MS (m/z): 451 (M+1)

Reference Example 16.1: Compound am-16



[0386] (2R,3R,4R,5R)-2-((Bis(4-methoxyphenyl)(phenyl)methoxy)methyl) -4-(tert-butyldimethylsilyloxy)-5-(6-(3-isopropylphenyl)-9H-purin -9-yl)tetrahydrofuran-3-yl 2-cyanoethyl diisopropylphosphoramidite (Compound am-16) is obtained in the same manner as in Reference Example 6.1 using ((3aR,4R,6R,6aR)-6-(6-(3-isopropylphenyl)-9H-purin-9-yl)-2,2-dime thyltetrahydrofuro[3,4-d] [1,3]dioxol-4-yl)methanol obtained in Step 1 of Reference Example 16.0.

Example 22



[0387] An siRNA having Compound 1-20 at the 5' end of the antisense strand is synthesized in the same manner as in Example 1 using Compound am-16 obtained in Reference Example 16.1.

Reference Example 17.0: Compound 1-21


Step 1



[0388] ((3aR,4R,6R,6aR)-2,2-Dimethyl-6-(6-(naphthalen-2-yl)-9H-purin -9-yl)tetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methanol (147 mg, 114%) was obtained in the same manner as in Step 2 of Reference Example 6.0 using
((3aR,4R,6R,6aR)-6-(6-chloro-9H-purin-9-yl)-2,2-dimethyltetrahydr ofuro[3,4-d][1,3]dioxol-4-yl)methanol (100 mg, 0.306 mmol) obtained in Step 1 of Reference Example 6.0 and 2-naphthaleneboronic acid (105 mg, 0.612 mmol).
ESI-MS (m/z): 419 (M+1)

Step 2



[0389] Di-tert-butyl ((3aR,4R,6R,6aR)-2,2-dimethyl-6-(6-(naphthalen-2-yl)-9H-purin-9-y l)tetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methyl phosphate (90.0 mg, 48.2%) was obtained in the same manner as in Step 3 of Reference Example 6.0 using ((3aR,4R,6R,6aR)-2,2-dimethyl-6-(6-(naphthalen-2-yl)-9H-purin-9-y 1)tetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methanol (128 mg, 0.306 mmol) obtained in Step 1.
ESI-MS (m/z): 611 (M+1)

Step 3



[0390] ((2R,3S,4R,5R)-3,4-Dihydroxy-5-(6-(naphthalen-2-yl)-9H-purin-9-yl)tetrahydrofuran-2-yl)methyl phosphate (Compound I-21) triethylammonium salt (20.0mg, 29.6%) was obtained in the same manner as in Step 5 of Reference Example 1.0 using di-tert-butyl ((3aR,4R,6R,6aR)-2,2-dimethyl-6-(6-(naphthalen-2-yl)-9H-purin-9-y l)tetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methyl phosphate (77.0 mg, 0.126 mmol) obtained in Step 2.
1H-NMR (D2O, 400 MHz) δ: 8.30 (1H, s), 8.05 (1H, s), 7.80 (1H, s), 7.55-7.40 (1H, m), 7.27-6.92 (5H, m), 5.73 (1H, s), 4.52-4.18 (3H, m), 4.15-3.92 (2H, m), 3.06-2.96 (6H, m), 1.16-1.04 (9H, m). ESI-MS (m/z): 459 (M+1)

Reference Example 17.1: Compound am-17


Steps 1 to 2



[0391] 6-Chloro-9-((4aR, 6R,7R,7aS)-2,2-di-tert-butyl-7-(tert-butyldi methylsilyloxy)tetrahydro-4H-furo[3,2-d][1,3,2]dioxasilin-6-yl)-9 H-purine was obtained in the same manner as in Steps 1 to 2 of Reference Example 1.1 using commercially available (2R,3R,4S,5R)-2-(6-chloro-9H-purin-9-yl)-5-(hydroxymethyl)tetrahy drofuran-3,4-diol.
ESI-MS (m/z): 541 (M+1)

Step 3



[0392] 9-((4aR,6R,7R,7aS)-2,2-Di-tert-butyl-7-(tert-butyldimethylsil yloxy)tetrahydro-4H-furo[3,2-d][1,3,2]dioxasilin-6-yl)-6-(naphtha len-2-yl)-9H-purine was obtained in the same manner as in Step 1 of Reference Example 17.0 using 6-chloro-9-((4aR,6R,7R,7aS)-2,2-di-tert-butyl-7-(tert-butyldimeth ylsilyloxy)tetrahydro-4H-furo[3,2-d] [1,3,2]dioxasilin-6-yl)-9H-pu rine obtained in Step 2.
ESI-MS (m/z): 633 (M+1)

Steps 4 to 6



[0393] (2R,3R,4R,5R)-2-((Bis(4-methoxyphenyl)(phenyl)methoxy)methyl) -4-(tert-butyldimethylsilyloxy)-5-(6-(naphthalen-2-yl)-9H-purin-9 -yl)tetrahydrofuran-3-yl 2-cyanoethyl diisopropylphosphoramidite (Compound am-17) was obtained in the same manner as in Steps 3 to 5 of Reference Example 1.1 using 9-((4aR,6R,7R,7aS)-2,2-di-tert-butyl-7- (tert-butyldimethylsilylox y)tetrahydro-4H-furo[3,2-d][1,3,2]dioxasilin-6-yl)-6-(naphthalen-2-yl)-9H-purine obtained in Step 3.
1H-NMR (CDCl3, 500 MHz) δ: 9.43 (m, 1H), 8.96 (m, 1H), 8.88 (m, 1H), 8.40 (m, 1H), 8.08 (m, 1H), 8.02 (m, 1H), 7. 91 (m, 1H), 7.59-7.52 (m, 2H), 7.52-6.81 (m, 13H), 6.19 (6.13) (m, 1H), 5.11 (m, 1H), 4.50-4.38 (m, 2H), 4.02-3.32 (m, 12H), 2.67 (2.32) (m, 2H), 1.23-1.05 (m, 12H), 0.76 (0.77) (s, 9H), -0.03 (0.00) (s, 3H), -0.19 (-0.17) (s, 3H).

Example 23



[0394] An siRNA (referred to as 6-napht-2-yl-dPu) having Compound 1-21 as X at the 5' end of the antisense strand of 454-Xa shown in Table 24 below was synthesized in the same manner as in Example 1 using Compound am-17 obtained in Reference Example 17.1.
MALDI-TOF/MS (antisense strand): theoretical value: 6801.03 (M-H), actual value: 6805.40

Reference Example 18.0: Compound 1-22


Step 1



[0395] ((3aR,4R,6R,6aR)-6-(6-(3-Formylphenyl)-9H-purin-9-yl)-2,2-dim ethyltetrahydrofuro[3,9-d][1,3]dioxol-4-yl)methanol (216 mg, 89%) was obtained in the same manner as in Step 2 of Reference Example 6.0 using
((3aR,4R,6R,6aR)-6-(6-chloro-9H-purin-9-yl)-2,2-dimethyltetrahydr ofuro[3,4-d][1,3]dioxol-4-yl)methanol (200 mg, 0.612 mmol) obtained in Step 1 of Reference Example 6.0 and 3-formylphenylboronic acid (184 mg, 1.22 mmol).
ESI-MS (m/z): 397 (M+1)

Step 2



[0396] Di-tert-butyl ((3aR,4R,6R,6aR)-6-(6-(3-formylphenyl)-9H-purin-9-yl)-2,2-dimethy ltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methyl phosphate (35.0 mg, 11.0%) was obtained in the same manner as in Step 3 of Reference Example 6.0 using ((3aR,4R,6R,6aR)-6-(6-(3-formylphenyl)-9H-purin-9-yl)-2,2-dimethy ltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methanol (215 mg, 0.542 mmol) obtained in Step 1.
ESI-MS (m/z): 589 (M+1)

Step 3



[0397] ((2R,3S,4R,5R)-3,4-Dihydroxy-5-(6-(3-formylphenyl)-9H-purin-9 -yl)tetrahydrofuran-2-yl)methyl phosphate (Compound 1-22, 20.0 mg, 29.6%) was obtained in the same manner as in Step 5 of Reference Example 1.0 using di-tert-butyl ((3aR,4R,6R,6aR)-6-(6-(3-formylphenyl)-9H-purin-9-yl)-2,2-dimethy ltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methyl phosphate (33.0 mg, 0.0560 mmol) obtained in Step 1.
1H-NMR (D2O, 300 MHz) δ: 9.93 (1H, s), 8.88 (1H, s), 8.76 (1H, s), 8.67-8.60 (1H, m), 8.47-8.40 (1H, m), 8.06-7.99 (1H, m), 7.74-7.66 (1H, m), 6.20 (1H, d, J= 5.5 Hz), 4.76-4.68 (2H, m), 4.46-4.41 (1H, m), 4.34-4.29 (1H, m), 4.12-4.00 (2H, m).
ESI-MS (m/z): 437 (M+1)

Reference Example 18.1: Compound am-18



[0398] (2R,3R,4R,5R)-2-((Bis(4-methoxyphenyl)(phenyl)methoxy)methyl) -4-(tert-butyldimethylsilyloxy)-5-(6-(3-formylphenyl)-9H-purin-9-yl)tetrahydrofuran-3-yl 2-cyanoethyl diisopropylphosphoramidite (Compound am-18) is obtained in the same manner as in Reference Example 6.1 using ((3aR,4R,6R,6aR)-6-(6-(3-formylphenyl)-9H-purin-9-yl)-2,2-dimethy ltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methanol obtained in Step 1 of Reference Example 18.0.

Example 24



[0399] An siRNA having Compound 1-22 at the 5' end of the antisense strand is synthesized in the same manner as in Example 1 using Compound am-18 obtained in Reference Example 18.1.

Reference Example 19.0: Compound 1-23



[0400] ((2R,3S,4R,5R)-3,4-Dihydroxy-5-(6-nitro-2,4-dioxo-3,4-dihydro quinazolin-1(2H)-yl)tetrahydrofuran-2-yl)methyl phosphate (Compound I-23) triethylammonium salt was obtained in the same manner as in Reference Example 1.0 using commercially available 6-nitro-1H-quinazoline-2,9-dione.
1H-NMR (D2O, 300 MHz) δ: 8.82 (d, J= 2.9 Hz, 1H), 8.49 (dd, J= 9.3, 2.4 Hz, 1H), 7.89 (d, J= 9.5 Hz, 1H), 6.27 (d, J= 5.9 Hz, 1H), 4.73 (t, J= 6.2 Hz, 1H), 4.42 (t, J=5.9 Hz, 1H), 4.09-4.04 (m, 3H), 3.08 (q, J= 7.3 Hz, 6H), 1.16 (t, J= 7.3 Hz, 9H).
ESI-MS (m/z): 420 (M+1)

Reference Example 19.1: Compound am-19



[0401] (2R,3R,4R,5R)-2-((Bis(4-methoxyphenyl)(phenyl)methoxy)methyl) -4-(tert-butyldimethylsilyloxy)-5-(6-nitro-2,4-dioxo-3,4-dihydroq uinazolin-1(2H)-yl)tetrahydrofuran-3-yl 2-cyanoethyl diisopropylphosphoramidite (Compound am-19) is obtained in the same manner as in Reference Example 1.1 using commercially available 6-nitro-1H-quinazoline-2,4-dione.

Example 25



[0402] An siRNA having Compound I-23 at the 5' end of the antisense strand is synthesized in the same manner as in Example 1 using Compound am-19 obtained in Reference Example 19.1.

Reference Example 20.0: Compound I-24


Steps 1 to 4



[0403] Di-tert-butyl ((3aR,4R,6R,5aR)-6-(5,6-dimethyl-2,4-dioxo-3,4-dihydropyrimidin-1 (2H)-yl)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methyl phosphate was obtained in the same manner as in Steps 1 to 4 of Reference Example 1 using commercially available 5,6-dimethylpyrimidine-2,4(1H,3H)-dione.
ESI-MS (m/z): 505 (M+1)

Step 5



[0404] Di-tert-butyl ((3aR,4R,6R,6aR)-6-(5,6-dimethyl-2,4-dioxo-3,4-dihydropyrimidin-1 (2H)-yl)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methyl phosphate (200 mg, 0.396 mmol) obtained in Step 4 was dissolved in 1,4-dioxane (4.00 mL), and selenium dioxide (440 mg, 3.96 mmol) was added thereto, and the mixture was stirred overnight under reflux. The reaction solution was filtered through Celite, and the residue obtained by evaporating the solvent under reduced pressure was purified by column chromatography (heptane/ethyl acetate) to obtain di-tert-butyl ((3aR,4R,6R,6aR)-6-(6-(hydroxymethyl)-5-methyl 2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-2,2-dimethyltetrahydrofu ro[3,4-d][1,3]dioxol-9-yl)methyl phosphate (38.6 mg, yield: 19%) was obtained.
ESI-MS (m/z): 521 (M+1)

Step 6



[0405] Di-tert-butyl ((3aR,4R,6R,6aR)-6-(6-(hydroxymethyl)-5-methyl 2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-2,2-dimethyltetrahydrofu ro[3,4-d][1,3]dioxol-4-yl)methyl phosphate (38.6 mg, 0.074 mmol) obtained in Step 5 was dissolved in acetonitrile (1.00 mL), and pyridine (0.06 mL, 0.742 mmol) and Dess-Martin periodinane (62.9 mg, 0.148 mmol) were added thereto, and the mixture was stirred overnight at 60 °C. After the reaction solution was cooled to room temperature, a saturated aqueous sodium bicarbonate solution was added thereto, and the mixture was filtered through Presep (registered trademark, diatomaceous earth, Granular Type M, 4.5 g/25 mL), and the solvent was evaporated under reduced pressure. The residue obtained was purified by preparative thin-layer chromatography (hexane/ethyl acetate = 20/80) to obtain di-tert-butyl
((3aR,4R,6R,6aR)-6-(6-(hydroxymethyl)-5-methyl-2,4-dioxo-3,4-dihy dropyrimidin-1(2H)-yl)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]diox ol-4-yl)methyl phosphate (32.8 mg, yield: 85%).
ESI-MS (m/z): 519 (M+1)

Step 7



[0406] Di-tert-butyl ((3aR,4R,6R,6aR)-6-(6-(hydroxymethyl)-5-methyl-2,4-dioxo-3,4-dihy dropyrimidin-1(2H)-yl)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]diox ol-4-yl)methyl phosphate (46.0 mg, 0.089 mmol) obtained in Step 6 was dissolved in THF (1.00 mL), and hydroxylamine hydrochloride (30.8 mg, 0.444 mmol) was added thereto, and the mixture was stirred at 60 °C for 2 hours. After the reaction solution was cooled to room temperature, a saturated aqueous sodium bicarbonate solution was added thereto, and the mixture was filtered through Presep (registered trademark, diatomaceous earth, Granular Type M, 4.5 g/25 mL), and the solvent was evaporated under reduced pressure. The residue was purified by preparative thin-layer chromatography (chloroform/methanol = 90/10) to obtain di-tert-butyl ((3aR,4R,6R,6aR)-6-(6-((E)-(hydroxyimino)methyl)-5-methyl 2,4-dioxo-3,9-dihydropyrimidin-1(2H)-yl)-2,2-dimethyltetrahydrofu ro[3,4-d][1,3]dioxol-4-yl)methylphosphate (33.7 mg, yield: 71%) was obtained.
ESI-MS (m/z): 534 (M+1)

Step 8



[0407] Triphenylphosphine oxide (1.76 mg, 0.006 mmol) was dissolved in ethyl acetate (1.00 mL), and oxalyl chloride (0.017 mL, 0.19 mmol) was added thereto, and the mixture was stirred at room temperature for 5 minutes to prepare a reaction mixture. Di-tert-butyl ((3aR,4R,6R,6aR)-6-(6-((E)-(hydroxyimino)methyl)-5-methyl-2,4-dio xo-3,4-dihydropyrimidin-1(2H)-yl)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methyl phosphate (33.7 mg, 0.063 mmol) obtained in Step 7 was dissolved in ethyl acetate (1.00 mL), and the reaction solution was gradually added thereto, and the mixture was stirred overnight at room temperature. The residue obtained by evaporating the solvent was dissolved in trifluoroacetic acid/water (1:1) (2 mL), and the mixture was stirred at room temperature for 2 hours. After the solvent was evaporated under reduced pressure, acetic acid-triethylamine buffer (pH 6.5) (2 mL) was added thereto, and the solvent was evaporated again under reduced pressure. The resulting residue was dissolved in ethanol, and ethyl acetate was added thereto, and the precipitate was collected by filtration to obtain ((2R,3S,4R,5R)-5-(6-cyano-5-methyl-2,4-dioxo-3,4-dihydropyrimidin -1(2H)-yl)-3,4-dihydroxytetrahydrofuran-2-yl)methyl phosphate (Compound I-24) triethylammonium salt (1.6 mg (two batches), yield: 74%) was obtained.
1H-NMR (D2O, 300 MHz) δ: 5.96 (d, J= 4.0 Hz, 1H), 4.41 (t, J= 6.4 Hz, 1H), 4.19-4.06 (m, 3H), 3.21 (q, J= 7.2 Hz, 6H), 2.19 (s, 3H), 1.28 (t, J= 7.5 Hz, 9H) .
ESI-MS (m/z): 404 (M+1)

Reference Example 20.1: Compound am-20


Step 1



[0408] (2R,3R,4R,5R)-2-(Benzoyloxymethyl)-5-(6-(hydroxymethyl)-5-met hyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)tetrahydrofuran-3,4-d iyl benzoate was obtained in the same manner as in Step 5 of Reference Example 20.0 using (2R,3R,4R,5R)-2-(benzoyloxymethyl)-5-(5,6-dimethyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)tetrahydrofuran-3,4-diyl benzoate obtained in Step 1 of Reference Example 20.0.
ESI-MS (m/z): 601 (M+1)

Step 2



[0409] (2R,3R,4R,5R)-2-(Benzoyloxymethyl)-5-(6-formyl-5-methyl-2,4-d ioxo-3,4-dihydropyrimidin-1(2H)-yl)tetrahydrofuran-3,4-diyl benzoate was obtained in the same manner as in Step 6 of Reference Example 20.0 using (2R,3R,4R,5R)-2-(benzoyloxymethyl)-5-(6-hydroxymethyl)-5-methyl-2 ,4-dioxo-3,9-dihydropyrimidin-1(2H)-yl)tetrahydrofuran-3,4-diyl benzoate obtained in Step 1.
ESI-MS (m/z): 599 (M+1)

Step 3



[0410] (2R,3R,4R,5R)-2-(Benzoyloxymethyl)-5-(6-((E)-(hydroxyimino)me thyl)-5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)tetrahydro furan-3,4-diyl benzoate was obtained in the same manner as in Step 7 of Reference Example 20.0 using (2R,3R,4R,5R)-2-(benzoyloxymethyl)-5-(6-formyl-5-methyl-2,4-dioxo -3,4-dihydropyrimidin-1(2H)-yl)tetrahydrofuran-3,4-diyl benzoate obtained in Step 2.
ESI-MS (m/z): 614 (M+1)

Step 4



[0411] Triphenylphosphine oxide (11.0 mg, 0.039 mmol) was dissolved in ethyl acetate (5.00 mL), and oxalyl chloride (0.104 mL, 1.183 mmol) was added thereto, and the mixture was stirred at room temperature for 5 minutes to obtain a reaction mixture solution. (2R,3R,4R,5R)-2-(Benzoyloxymethyl)-5-(6-((E)-(hydroxyimino)methyl )-5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)tetrahydrofura n-3,4-diyl benzoate (242 mg, 0.394 mmol) obtained in Step 3 was dissolved in ethyl acetate (5.00 mL), and the reaction solution was gradually added thereto, and the mixture was stirred at room temperature for 2 hours. The residue obtained by evaporating the solvent under reduced pressure was purified by column chromatography (heptane/ethyl acetate) to obtain (2R,3R,4R,5R)-2-(benzoyloxymethyl)-5-(6-cyano-5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)tetrahydrofuran-3,4-diyl benzoate (207 mg, yield: 88%) was obtained.
ESI-MS (m/z): 596 (M+1)

Step 5



[0412] 3-((2R,3R,4S,5R)-3,4-Dihydroxy-5-(hydroxymethyl)tetrahydrofur an-2-yl)-5-methyl-2,6-dioxo-1,2,3,6-tetrahydropyrimidine-4-carbon itrile was obtained in the same manner as in Step 2 of Reference Example 1.0 using (2R,3R,4R,5R)-2-(benzoyloxymethyl)-5-(6-cyano-5-methyl-2,4-dioxo-3,9-dihydropyrimidin-1(2H)-yl)tetrahydrofuran-3,9-diyl benzoate obtained in Step 4.
ESI-MS (m/z): 284 (M+1)

Steps 6 to 10



[0413] (2R,3R,4S,5R)-2-((Bis(4-methoxyphenyl)(phenyl)methoxy)methyl) -4-(tert-butyldimethylsilyloxy)-5-(6-cyano-5-methyl-2,4-dioxo-3,4 -dihydropyrimidin-1(2H)-yl)tetrahydrofuran-3-yl 2-cyanoethyl diisopropylphosphoramidite (Compound am-20) is obtained in the same manner as in Steps 1 to 5 of Reference Example 1.1 using 3-((2R,3R,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)tetrahydrofuran-2 -yl)-5-methyl-2,6-dioxo-1,2,3,6-tetrahydropyrimidine-4-carbonitri le obtained in Step 5.

Example 26



[0414] An siRNA having Compound 1-24 at the 5' end of the antisense strand is synthesized in the same manner as in Example 1 using Compound am-20 obtained in Reference Example 20.1.

Reference Example 21.0: Compound I-25


Step 1



[0415] ((3aR,4R,6R,6aR)-2,2-Dimethyl-6-(6-(naphthalen-1-yl)-9H-purin -9-yl)tetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methanol (150 mg, 117%) was obtained in the same manner as in Step 2 of Reference Example 6.0 using
((3aR,4R,6R,6aR)-6-(6-chloro-9H-purin-9-yl)-2,2-dimethyltetrahydr ofuro[3,4-d][1,3]dioxol-4-yl)methanol (100 mg, 0.306 mmol) obtained in Step 1 of Reference Example 6.0 and naphthalen-1-yl boronic acid (105 mg, 0.612 mmol).
ESI-MS (m/z): 419 (M+1)

Step 2



[0416] Di-tert-butyl ((3aR,4R,6R,6aR)-2,2-dimethyl-6-(6-(naphthalen-1-yl)-9H-purin-9-y l)tetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methyl phosphate (70.0 mg, 37.5%) was obtained in the same manner as in Step 3 of Reference Example 6.0 using ((3aR,4R,6R,6aR)-2,2-dimethyl-6-(6-(naphthylen-1-yl)-9H-purin-9-y l)tetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methanol (128 mg, 0.306 mmol) obtained in Step 1.
ESI-MS (m/z): 611 (M+1)

Step 3



[0417] ((2R,3S,4R,5R)-3,4-Dihydroxy-5-(6-(naphthalen-1-yl)-9H-purin-9-yl)tetrahydrofuran-2-yl)methyl phosphate (Compound 1-25) triethylammonium salt (10.8mg, 15.3%) was obtained in the same manner as in Step 3 of Reference Example 16.0 using di-tert-butyl ((3aR,4R,6R,6aR)-2,2-dimethyl-6-(6-(naphthalen-1-yl)-9H-purin-9-y l)tetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methyl phosphate (77.0 mg, 0.126 mmol) obtained in Step 2.
1H-NMR (D2O, 300 MHz) δ: 8.87 (1H, s), 8.60 (1H, s), 8.07-7.84 (2H, m), 7.73-7.60 (2H, m), 7.58-7.40 (2H, m), 7.38-7.28 (1H, m), 6.21 (1H, d, J= 5.5 Hz), 4.75-4.66 (1H, m), 4.45-4.38 (1H, m), 4.35-4.28 (1H, m), 4.10-3.98 (2H, m), 3.05 (6H, q, J = 7.3 Hz), 1.13 (9H, t, J = 7.3 Hz) .
ESI-MS (m/z): 459 (M+1)

Reference Example 21.1: Compound am-21


Step 1



[0418] 9-((4aR,6R,7R,7aS)-2,2-Di-tert-butyl-7-(tert-butyldimethylsil yloxy)tetrahydro-4H-furo[3,2-d][1,3,2]dioxasilin-6-yl)-6-(naphtha len-1-yl)-9H-purine was obtained in the same manner as in Step 1 of Reference Example 21.0 using 6-chloro-9-((4aR,6R,7R,7aS)-2,2-di-tert-butyl-7-(tert-butyldimeth ylsilyloxy)tetrahydro-4H-furo[3,2-d][1,3,2]dioxasilin-6-yl)-9H-pu rine obtained in Step 2 of Reference Example 17.1.
ESI-MS (m/z): 633 (M+1)

Steps 2 to 4



[0419] (2R,3R,4R,5R)-2-((Bis(4-methoxyphenyl)(phenyl)methoxy)methyl) -4-(tert-butyldimethylsilyloxy)-5-(6-(naphthalen-1-yl)-9H-purin-9 -yl)tetrahydrofuran-3-yl 2-cyanoethyl diisopropylphosphoramidite (Compound am-21) was obtained in the same manner as in Steps 3 to 5 of Reference Example 1.1 using 9-((4aR,6R,7R,7aS)-2,2-di-tert-butyl-7-(tert-butyldimethylsilylox y)tetrahydro-4H-furo[3,2-d][1,3,2]dioxasilin-6-yl)-6-(naphthalen-1-yl)-9H-purine obtained in Step 1.
1H-NMR (CDCl3, 500 MHz) δ: 9.04 (m, 1H), 8.34 (m, 1H), 8.20 (m, 1H), 8.04-7.91 (m, 2H), 7.93 (m, 1H), 7.64 (m, 1H), 7.54-7.45 (m, 4H), 7.39-6.79 (m, 11H), 6.21 (6.15) (m, 1H), 5.16 (m, 1H), 4.51-4.39 (m, 2H), 4.04-3.32 (m, 12H), 2.68 (2.32) (m, 2H), 1.25-1.06 (m, 12H), 0.76 (0.77) (s, 9H), -0.01 (0.01) (s, 3H), -0.16 (-0.15) (s, 3H).

Example 27



[0420] An siRNA (6-napht-1-yl-dPu) having Compound 1-25 as X at the 5' end of the antisense strand of 454-Xa shown in Table 24 below was synthesized in the same manner as in Example 1 using Compound am-21 obtained in Reference Example 21.1.
MALDI-TOF/MS (antisense strand): theoretical value: 6801.03 (M-H), actual value: 6800.94

Reference Example 22.0: Compound 1-26


Step 1



[0421] ((3aR,4R,6R,6aR)-6-(6-(Biphenyl-3-yl)-9H-purin-9-yl)-2,2-dime thyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methanol (130 mg, 95%) was obtained in the same manner as in Step 2 of Reference Example 6.0 using ((3aR,4R,6R,6aR)-6-(6-chloro-9H-purin-9-yl)-2,2-dimethyltetrahydr ofuro[3,4-d][1,3]dioxol-4-yl)methanol (100 mg, 0.306 mmol) obtained in Step 1 of Reference Example 6.0 and (1,1'-biphenyl)-3-yl boronic acid (121 mg, 0.612 mmol).
ESI-MS (m/z): 445 (M+1)

Step 2



[0422] Di-tert-butyl (3aR,4R,6R,6aR)-6-(6-(biphenyl-3-yl)-9H-purin-9-yl)-2,2-dimethyl tetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methyl phosphate (107 mg, 59.8%) was obtained in the same manner as in Step 3 of Reference Example 6.0 using ((3aR,4R,6R,6aR)-6-(6-(biphenyl-3-yl)-9H-purin-9-yl)-2,2-dimethyl tetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methanol (125 mg, 0.281 mmol) obtained in Step 1.
ESI-MS (m/z): 637 (M+1)

Step 3



[0423] ((2R,3S,4R,5R)-5-(6-(Biphenyl-3-yl)-9H-purin-9-yl)-3,4-dihydr oxytetrahydrofuran-2-yl)methyl phosphate (Compound 1-26) (47.0 mg, 61.8%) was obtained in the same manner as in Step 5 of Reference Example 1.0 using di-tert-butyl ((3aR,4R,6R,6aR)-6-(6-(biphenyl-3-yl)-9H-purin-9-yl)-2,2-dimethyl tetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methyl phosphate (100 mg, 0.157 mmol) obtained in Step 2.
1H-NMR (DMSO-d6, 300 MHz) δ: 9.14 (1H, s), 9.06 (1H, s), 8.89 (1H, s), 8.82 (1H, d, J = 7.7 Hz), 7.89 (1H, d, J = 7.7 Hz), 7.79-7.68 (3H, m), 7.58-7.50 (2H, m), 7.47-7.40 (1H, m), 6.15 (1H, d, J = 5.5 Hz), 4.72-4.65 (1H, m), 4.27-4.22 (1H, m), 4.20-3.98 (3H, m) .
ESI-MS (m/z): 485 (M+1)

Reference Example 22.1: Compound am-22


Step 1



[0424] 6-(Biphenyl-3-yl)-9-((4aR,6R,7R,7aR)-2,2-di-tert-butyl-7-(ter t-butyldimethylsilyloxy)tetrahydro-4H-furo[3,2-d][1,3,2]dioxasili n-6-yl)-9H-purine is obtained in the same manner as in Step 1 of Reference Example 22.0 using 6-chloro-9-((4aR,6R,7R,7aS)-2,2-di-tert-butyl-7-(tert-butyldimeth ylsilyloxy)tetrahydro-4H-furo[3,2-d][1,3,2]dioxasilin-6-yl)-9H-pu rine obtained in Step 2 of Reference Example 17.1.

Steps 2 to 4



[0425] (2R,3R,4R,5R)-5-(6-(biphenyl-3-yl)-9H-purin-9-yl)-2-((bis(4-m ethoxyphenyl)(phenyl)methoxy)methyl)-4-(tert-butyldimethylsilylox y)tetrahydrofuran-3-yl 2-cyanoethyl diisopropylphosphoramidite (Compound am-22) is obtained in the same manner as in Steps 3 to 5 of Reference Example 1.1 using 6-(biphenyl-3-yl)-9-((4aR,6R,7R,7aR)-2,2-di-tert-butyl-7-(tert-bu tyldimethylsilyloxy)tetrahydro-4H-furo[3,2-d][1,3,2]dioxasilin-6-yl)-9H-purine obtained in Step 1.

Example 28



[0426] An siRNA having Compound 1-26 at the 5' end of the antisense strand is synthesized in the same manner as in Example 1 using Compound am-22 obtained in Reference Example 22.1.

Reference Example 23.0: Compound 1-27


Step 1



[0427] (3aR,4R,6R,6aR)-6-(6-(3-Aminophenyl)-9H-purin-9-yl)-2,2-dime thyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methanol (77.2 mg, 65.8%) was obtained in the same manner as in Step 2 of Reference Example 6.0 using ((3aR,4R,6R,6aR)-6-(6-chloro-9H-purin-9-yl)-2,2-dimethyltetrahydr ofuro[3,4-d][1,3]dioxol-4-yl)methanol (100 mg, 0.306 mmol) obtained in Step 1 of Reference Example 6.0 and (3-aminophenyl)boronic acid (84 mg, 0.612 mmol).
ESI-MS (m/z): 384 (M+1)

Step 2



[0428] Di-tert-butyl ((3aR,4R,6R,6aR)-6-(6-(3-aminophenyl)-9H-purin-9-yl)-2,2-dimethyl tetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methyl phosphate (38.4 mg, 33.2%) was obtained in the same manner as in Step 3 of Reference Example 6.0 using ((3aR,4R,6R,6aR)-6-(6-(3-aminophenyl)-9H-purin-9-yl)-2,2-dimethyl tetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methanol (77.0 mg, 0.201 mmol) obtained in Step 1.
ESI-MS (m/z): 576 (M+1)

Step 3



[0429] ((2R,3S,4R,5R)-5-(6-(3-Aminophenyl)-9H-purin-9-yl)-3,4-dihydr oxytetrahydrofuran-2-yl)methyl phosphate (Compound 1-27) (13.0 mg, 43.3%) was obtained in the same manner as in Step 5 of Reference Example 1.0 using di-tert-butyl ((3aR,4R,6R,6aR)-6-(6-(3-aminophenyl)-9H-purin-9-yl)-2,2-dimethyl tetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methyl phosphate (38.0 mg, 0.0660 mmol) obtained in Step 2.
1H-NMR (D2O, 300 MHz) δ: 8.82 (1H, s), 8.73 (1H, s), 8.22-8.15 (2H, m), 7.66-7.58 (1H, m), 7.55-7.48 (1H, m), 6.16 (1H, d, J = 5.5 Hz), 4.72-4.65 (1H, m), 4.45-4.38 (1H, m), 4.35-4.26 (1H, m), 4.14-3.98 (2H, m).
ESI-MS (m/z): 424 (M+1)

Reference Example 23.1: Compound am-23


Step 1



[0430] 6-(3-Aminophenyl)-9-((4aR,6R,7R,7aR)-2,2-di-tert-butyl-7-(ter t-butyldimethylsilyloxy)tetrahydro-4H-furo[3,2-d][1,3,2]dioxasili n-6-yl)-9H-purine is obtained in the same manner as in Step 1 of Reference Example 23.0 using 6-chloro-9-((4aR,6R,7R,7aS)-2,2-di-tert-butyl-7-(tert-butyldimeth ylsilyloxy)tetrahydro-4H-furo[3,2-d] [1,3,2]dioxasilin-6-yl)-9H-pu rine obtained in Step 2 of Reference Example 17.1.

Steps 2 to 4



[0431] (2R,3R,4R,5R)-5-(6-(3-Aminophenyl)-9H-purin-9-yl)-2-((bis(4-m ethoxyphenyl) (phenyl)methoxy)methyl)-4-(tert-butyldimethylsilylox y)tetrahydrofuran-3-yl 2-cyanoethyl diisopropylphosphoramidite (Compound am-23) is obtained in the same manner as in Steps 3 to 5 of Reference Example 1.1 using 9-((4aR,6R,7R,7aS)-2,2-di-tert-butyl-7-(tert-butyldimethylsilylox y)tetrahydro-4H-furo[3,2-d][1,3,2]dioxasilin-6-yl)-6-(3-aminophen yl)-9H-purine obtained in Step 1.

Example 29



[0432] An siRNA having Compound 1-27 at the 5' end of the antisense strand is synthesized in the same manner as in Example 1 using Compound am-23 obtained in Reference Example 23.1.

Reference Example 24.0: Compound 1-28


Step 1



[0433] ((3aR,4R,6R,6aR)-2,2-Dimethyl-6-(6-(3-morpholinophenyl)-9H-pu rin-9-yl)tetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methanol (127 mg, 92%) was obtained in the same manner as in Step 2 of Reference Example 6.0 using ((3aR,4R,6R,6aR)-6-(6-chloro-9H-purin-9-yl)-2,2-dimethyltetrahydr ofuro[3,4-d][1,3]dioxol-4-yl)methanol (100 mg, 0.306 mmol) obtained in Step 1 of Reference Example 6.0 and (3-morpholinophenyl)boronic acid (127 mg, 0.612 mmol).
ESI-MS (m/z): 454 (M+1)

Step 2



[0434] Di-tert-butyl ((3aR,4R,6R,6aR)-2,2-dimethyl-6-(6-(3-morpholinophenyl)-9H-purin-9-yl)tetrahydrofuro[3,4-d][1,3]dioxol-4-yl)m methyl phosphate (65.0 mg, 38.0%) was obtained in the same manner as in Step 3 of Reference Example 6.0 using ((3aR,4R,6R,6aR)-2,2-dimethyl-6-(6-(3-morpholinophenyl)-9H-purin-9-yl)tetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methanol (120 mg, 0.265 mmol) obtained in Step 1.
ESI-MS (m/z): 646 (M+1)

Step 3



[0435] ((2R,3S,4R,5R)-3,4-Dihydroxy-5-(6-(3-morpholinophenyl)-9H-pur in-9-yl)tetrahydrofuran-2-yl)methyl phosphate (Compound 1-28) triethylammonium salt (9.00 mg, 15.5%) was obtained in the same manner as in Step 3 of Reference Example 16.0 using di-tert-butyl ((3aR,4R,6R,6aR)-2,2-dimethyl-6-(6-(3-morpholinophenyl)-9H-purin-9-yl)tetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methyl phosphate (63.0 mg, 0.0980 mmol) obtained in Step 2.
1H-NMR (D2O, 300 MHz) δ: 8.83 (1H, s), 8.72 (1H, s), 7.85-7.75 (2H, m), 7.52-7.44 (1H, m), 7.28-7.20 (1H, m), 6.21-6.19 (1H, m), 4.76-4.68 (1H, m), 4.45-4.40 (1H, m), 4.34-4.28 (1H, m), 4.06 (2H, s), 3.88-3.80 (4H, m), 3.23-3.15 (4H, m), 3.08 (6H, q, J = 7.3 Hz), 1.16 (9H, t, J = 7.3 Hz).
ESI-MS (m/z): 494 (M+1)

Reference Example 24.1: Compound am-24


Step 1



[0436] 9-((4aR,6R,7R,7aS)-2,2-Di-tert-butyl-7-(tert-butyldimethylsil yloxy)tetrahydro-4H-furo[3,2-d][1,3,2]dioxasilin-6-yl)-6-(3-morph olinophenyl)-9H-purine is obtained in the same manner as in Step 1 of Reference Example 24.0 using 6-chloro-9-((4aR,6R,7R,7aS)-2,2-di-tert-butyl-7-(tert-butyldimeth ylsilyloxy)tetrahydro-4H-furo[3,2-d][1,3,2]dioxasilin-6-yl)-9H-pu rine obtained in Step 2 of Reference Example 17.1.

Steps 2 to 4



[0437] (2R,3R,4R,5R)-2-((Bis(4-methoxyphenyl)(phenyl)methoxy)methyl) -4-(tert-butyldimethylsilyloxy)-5-(6-(3-morpholinophenyl)-9H-puri n-9-yl)tetrahydrofuran-3-yl 2-cyanoethyl diisopropylphosphoramidite (Compound am-24) is obtained in the same manner as in Steps 3 to 5 of Reference Example 1.1 using 9-((4aR,6R,7R,7aS)-2,2-di-tert-butyl-7-(tert-butyldimethylsilylox y)tetrahydro-4H-furo[3,2-d][1,3,2]dioxasilin-6-yl)-6-(3-morpholin ophenyl)-9H-purine obtained in Step 1.

Example 30



[0438] An siRNA having Compound 1-28 at the 5' end of the antisense strand is synthesized in the same manner as in Example 1 using Compound am-24 obtained in Reference Example 24.1.

Reference Example 25.0: Compound 1-29


Step 1



[0439] ((3aR,4R,6R,6aR)-6-(6-(3-(Benzyloxy)phenyl)-9H-purin-9-yl)-2, 2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methanol (180 mg, 130%) was obtained in the same manner as in Step 2 of Reference Example 6.0 using ((3aR,4R,6R,6aR)-6-(6-chloro-9H-purin-9-yl)-2,2-dimethyltetrahydr ofuro[3,4-d][1,3]dioxol-4-yl)methanol (100 mg, 0.306 mmol) obtained in Step 1 of Reference Example 6.0 and (3-(benzyloxy)phenyl)boronic acid (140 mg, 0.612 mmol).
ESI-MS (m/z): 475 (M+1)

Step 2



[0440] Di-tert-butyl ((3aR,4R,6R,6aR)-6-(6-(3-(benzyloxy)phenyl)-9H-purin-9-yl)-2,2-di methyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methyl phosphate (95.0 mg, 48.3%) was obtained in the same manner as in Step 3 of Reference Example 6.0 using ((3aR,4R,6R,6aR)-6-(6-(3-(benzyloxy)phenyl)-9H-purin-9-yl)-2,2-di methyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methanol(140 mg, 0.295 mmol) obtained in Step 1.
ESI-MS (m/z): 667 (M+1)

Step 3



[0441] ((2R,3S,4R,5R)-5-(6-(3-(Benzyloxy)phenyl)-9H-purin-9-yl)-3,4-dihydroxytetrahydrofuran-2-yl)methyl phosphate (Compound 1-29) triethylammonium salt (32.0 mg, 36.5%) was obtained in the same manner as in Step 3 of Reference Example 16.0 using di-tert-butyl ((3aR,4R,6R,6aR)-6-(6-(3-(benzyloxy)phenyl)-9H-purin-9-yl)-2,2-di methyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methyl phosphate (95.0 mg, 0.142 mmol) obtained in Step 2.
1H-NMR (D2O, 400 MHz) δ: 8.63 (1H, s), 8.59 (1H, s), 7.67-7.55 (2H, m), 7.30-7.16 (6H, m), 6.94-6.88 (1H, m), 6.06 (1H, d, J = 5.9 Hz), 4.88 (2H, s), 4.71-4.62 (1H, m), 4.39-4.34 (1H, m), 4.28-4.22 (1H, m), 4.06-3.95 (2H, m), 3.14-2.95 (6H, q, J = 7.3 Hz), 1.12 (9H, t, J = 7.3 Hz).
ESI-MS (m/z): 515 (M+1)

Reference Example 25.1: Compound am-25


Step 1



[0442] 6-(3-(Benzyloky)phenyl)-9-((4aR,6R,7R,7aR)-2,2-di-tert-butyl-7-(tert-butyldimethylsilyloxy)tetrahydro-4H-furo[3,2-d][1,3,2]dio xasilin-6-yl)-9H-purine is obtained in the same manner as in Step 1 of Reference Example 25.0 using 6-chloro-9-((4aR,6R,7R,7aS)-2,2-di-tert-butyl-7-(tert-butyldimeth ylsilyloxy)tetrahydro-4H-furo[3,2-d][1,3,2]dioxasilin-6-yl)-9H-pu rine obtained in Step 2 of Reference Example 17.1.

Steps 2 to 4



[0443] (2R,3R,4R,5R)-5-(6-(3-(Benzyloxy)phenyl-9H-purin-9-yl)-2-((bi s(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-(tert-butyldimethylsi lyloxy)tetrahydrofuran-3-yl 2-cyanoethyl diisopropylphosphoramidite (Compound am-25) is obtained in the same manner as in Steps 3 to 5 of Reference Example 1.1 using 6-(3-(benzyloxy)phenyl)-9-((4aR,6R,7R,7aR)-2,2-di-tert-butyl-7-(t ert-butyldimethylsilyloxy)tetrahydro-4H-furo[3,2-d][1,3,2]dioxasi lin-6-yl)-9H-purine obtained in Step 1.

Example 31



[0444] An siRNA having Compound 1-29 at the 5' end of the antisense strand is synthesized in the same manner as in Example 1 using Compound am-25 obtained in Reference Example 25.1.

Reference Example 26.0: Compound 1-30


Step 1



[0445] ((3aR,4R,6R,6aR)-6-(6-(3-(Methoxycarbonyl)phenyl)-9H-purin-9-yl)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methanol (160 mg, 123%) was obtained in the same manner as in Step 2 of Reference Example 6.0 using ((3aR,4R,6R,6aR)-6-(6-chloro-9H-purin-9-yl)-2,2-dimethyltetrahydr ofuro[3,4-d][1,3]dioxol-4-yl)methanol (100 mg, 0.306 mmol) obtained in Step 1 of Reference Example 6.0 and (3-(methoxycarbonyl)phenyl)boronic acid (110 mg, 0.612 mmol). ESI-MS (m/z): 427 (M+1)

Step 2



[0446] Di-tert-butyl ((3aR,4R,6R,6aR)-6-(6-(3-(methoxycarbonyl)phenyl)-9H-purin-9-yl)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methylphosphate (100 mg, 53.0%) was obtained in the same manner as in Step 3 of Reference Example 6.0 using ((3aR,4R,6R,6aR)-6-(6-(3-(methoxycarbonyl)phenyl)-9H-purin-9-yl)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methanol (130 mg, 0.305 mmol) obtained in Step 1.
ESI-MS (m/z): 619 (M+1)

Step 3



[0447] ((2R,3S,4R,5R)-5-(6-(3-(Methoxycarbonyl)phenyl)-9H-purin-9-yl )-3,4-dihydroxytetrahydrofuran-2-yl)methyl phosphate (45.0 mg, 87.0%) was obtained in the same manner as in Step 5 of Reference Example 1.0 using di-tert-butyl ((3aR,4R,6R,6aR)-6-(6-(3-(methoxycarbonyl)phenyl)-9H-purin-9-yl)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methyl phosphate (68.7 mg, 0.111 mmol) obtained in Step 2.
ESI-MS (m/z): 467 (M+1)

Step 4



[0448] ((2R,3S,4R,5R)-5-(6-(3-(Methoxycarbonyl)phenyl)-9H-purin-9-yl )-3,4-dihydroxytetrahydrofuran-2-yl)methyl phosphate (20.0 mg, 0.0430 mmol) obtained in Step 3 was dissolved in a 1 N aqueous sodium hydroxide solution (2 mL), and the mixture was stirred at room temperature for 2 hours. Acetic acid-triethylamine buffer (pH 6.5) was added thereto, and the residue obtained by evaporating the solvent under reduced pressure was purified by preparative HPLC (eluent: a 0.01 mmol/L aqueous ammonium acetate solution/methanol) to obtain ((2R,3S,4R,5R)-5-(6-(3-(carboxy)phenyl)-9H-purin-9-yl)-3,4-dihydr oxytetrahydrofuran-2-yl)methyl phosphate (Compound 1-30) triethylammonium salt (10.0 mg, 42.1%) was obtained.
1H-NMR (D2O, 300MHz) δ: 8.88-8.53 (3H, m), 8.34-8.22 (1H,m), 8.03-7.92 (1H, m), 7.60-7.48 (1H, m), 6.22-6.15 (1H, m), 4.76-4.65 (1H, m), 4.47-4.42 (1H, m), 4.35-4.30 (1H, m), 4.15-4.00 (2H, m), 3.09 (6H, q, J = 7.2 Hz), 1.16 (9H, t, J = 7.3 Hz).
ESI-MS (m/z): 453 (M+1)

Reference Example 26.1: Compound am-26


Step 1



[0449] 9-((4aR,6R,7R,7aS)-2,2-Di-tert-butyl-7-(tert-butyldimethylsil yloxy)tetrahydro-4H-furo[3,2-d][1,3,2]dioxasilin-6-yl)-6-(3-metho xycarbonyl)-9H-purine is obtained in the same manner as in Step 1 of Reference Example 26.0 using 6-chloro-9-((4aR,6R,7R,7aS)-2,2-di-tert-butyl-7-(tert-butyldimeth ylsilyloxy)tetrahydro-4H-furo[3,2-d][1,3,2]dioxasilin-6-yl)-9H-pu rine obtained in Step 2 of Reference Example 17.1.

Step 2



[0450] 9-((4aR,6R,7R,7aS)-2,2-Di-tert-butyl-7-(tert-butyldimethylsil yloxy)tetrahydro-4H-furo[3,2-d][1,3,2]dioxasilin-6-yl)-6-(3-carbo xyl)-9H-purine is obtained in the same manner as in Step 4 of Reference Example 26.0 using 9-((4aR,6R,7R,7aS)-2,2-di-tert-butyl-7-(tert-butyldimethylsilylox y)tetrahydro-4H-furo[3,2-d][1,3,2]dioxasilin-6-yl)-6-(3-methoxyca rbonyl)-9H-purine obtained in Step 1.

Steps 3 to 5



[0451] (2R,3R,9R,5R)-2-((Bis(4-methoxyphenyl)(phenyl)methoxy)methyl) -4-(tert-butyldimethylsilyloxy)-5-(6-(3-carboxylphenyl)-9H-purin-9-yl)tetrahydrofuran-3-yl 2-cyanoethyl diisopropylphosphoramidite (Compound am-26) is obtained in the same manner as in Steps 3 to 5 of Reference Example 1.1 using 9-((4aR,6R,7R,7aS)-2,2-di-tert-butyl-7-(tert-butyldimethylsilylox y)tetrahydro-4H-furo[3,2-d][1,3,2]dioxasilin-6-yl)-6-(3-carboxyl) -9H-purine obtained in Step 2.

Example 32



[0452] An siRNA having Compound 1-30 at the 5' end of the antisense strand is synthesized in the same manner as in Example 1 using Compound am-26 obtained in Reference Example 26.1.

Reference Example 27.0: Compound 1-31


Step 1



[0453] 1-((3aR,9R,6R,5aR)-6-(Hydroxymethyl)-2,2-dimethyltetrahydrofu ro[3,4-d][1,3]dioxol-4-yl)-5-styrylpyrimidine-2,4(1H,3H)-dione (43.8 mg, 41%) was obtained in the same manner as in Step 2 of Reference Example 6.0 using 5-bromo-1-((2R,3R,4S,5R)-3,9-dihydroxy-5-(hydroxymethyl)tetrahydr ofuran-2-yl)pyrimidine-2,4(1H,3H)-dione (100 mg, 0.275 mmol) obtained in Step 1 of Reference Example 10.0.
ESI-MS (m/z): 385 (M-1)

Step 2



[0454] 1-((3aR,4R,6R,6aR)-6-(Hydroxymethyl)-2,2-dimethyltetrahydrofu ro[3,4-d][1,3]dioxol-4-yl)-5-styrylpyrimidine-2,4(1H, 3H)-dione (16.3 mg, 0.042 mmol) obtained in Step 1 was dissolved in dichloromethane (2 mL), and 1H-tetrazole (7.39 mg, 0.105 mmol) and di-tert-butyl diisopropylphosphoramide (0.028 mL, 0.084 mmol) were added thereto, and the mixture was stirred at room temperature for 2 hours. After the reaction solution was cooled to 0 °C, (2R,8aS)-(+)-(camphorylsulfonyl)oxaziridine (19.4 mg, 0.084 mmol) was added thereto, and the mixture was further stirred at 0 °C for 30 minutes. After the reaction solution was cooled to room temperature, a saturated aqueous sodium bicarbonate solution was added thereto, and the mixture was filtered through Presep (registered trademark, diatomaceous earth, Granular Type M, 4.5 g/25 mL), and then, the solvent was evaporated under reduced pressure. The residue was purified by column chromatography (heptane/ethyl acetate) to obtain di-tert-butyl ((3aR,4R,6R,6aR)-6-(2,4-dioxo-5-styryl-3,4-dihydropyrimidin-1(2H) -yl)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methyl phosphate (10.0 mg, 41%).
ESI-MS (m/z): 577 (M-1)

Step 3



[0455] ((2R,3S,4R,5R)-5-(2,4-Dioxo-5-styryl-3,4-dihydropyrimidin-1(2 H)-yl)-3,4-dihydroxytetrahydrofuran-2-yl)methyl phosphate (Compound 1-31) triethylammonium salt (9.30 mg, 102%) was obtained in the same manner as in Step 5 of Reference Example 1.0 using di-tert-butyl ((3aR,4R,6R,6aR)-6-(2,4-dioxo-5-styryl-3,4-dihydropyrimidin-1(2H) -yl)-2,2-dimethyltetrahydrofuro[3,4-d][1/3]dioxol-4-yl)methyl phosphate (10.0 mg, 0.017 mmol) obtained in Step 2.
1H-NMR (D2O, 300 MHz) δ: 7.96 (s, 1H), 7.49 (d, J = 7.3Hz, 2H), 7.37-7.19 (m, 3H), 6.88 (d, J = 16.5 Hz, 1H), 5.91 (d, J = 5.1 Hz, 1H), 4.32 (t, J = 5.1 Hz, 1H), 4.26 (t, J = 4.8 Hz, 1H), 4.21-4.20 (m, 1H), 4.11-3.99 (m, 2H), 3.09 (q, J = 7.3 Hz, 6H), 1.16 (t, J = 7.3 Hz, 9H) . ESI-MS (m/z): 425 (M-1)

Reference Example 27.1: Compound am-27


Step 1



[0456] 1-((4aR,6R,7R,7aR)-2,2-Di-tert-butyl-7-((tert-butyldimethylsi lyl)oxy)tetrahydro-4H-furo[3,2-d][1,3,2]dioxasilin-6-yl)-5-styryl pyrimidine-2,4(1H,3H)-dione is obtained in the same manner as in Step 1 of Reference Example 27.0 using 5-bromo-1-((4aR,6R,7R,7aR)-2,2-di-tert-butyl-7-((tert-butyldimeth ylsilyl)oxy)tetrahydro-4H-furo[3,2-d][1,3,2]dioxasilin-6-yl)pyrim idine-2, 4 (1H, 3H) -dione obtained in Step 2 of Reference Example 13.1.

Step 2



[0457] (2R,3R,4R,5R)-2-((Bis(4-methoxyphenyl) (phenyl)methoxy)methyl) -4-((tert-butyldimethylsilyl)oxy)-5-(2,4-dioxo-5-styryl-3,4-dihyd ropyrimidin-1(2H)-yl)tetrahydrofuran-3-yl (2-cyanoethyl) diisopropylphosphoramidite is obtained in the same manner as in Steps 3 to 5 of Reference Example 1.1 using 1-((4aR,6R,7R,7aR)-2,2-di-tert-butyl-7-((tert-butyldimethylsilyl) oxy)tetrahydro-4H-furo[3,2-d][1,3,2]dioxasilin-6-yl)-5-styrylpyri midine-2, 4(1H,3H)-dione obtained in Step 1.

Example 33



[0458] An siRNA having Compound 1-31 at the 5' end of the antisense strand is synthesized in the same manner as in Example 1 using Compound am-27 obtained in Reference Example 27.1.

Reference Example 28.1: Compound am-28


Step 1



[0459] Commercially available (2R,3R,4S,5R)-2-(6-chloro-9H-purin-9-yl)-5-(hydroxymethyl)tetrahy drofuran-3,4-diol (5.00 g, 17.4 mmol) was dissolved in pyridine (42 mL), and 1,3-dichloro-1,1,3,3-tetraisopropyldisiloxane (6.70 ml, 20.9 mmol) was added thereto, and the mixture was stirred at room temperature for 2 hours. To the reaction solution, water was added, and the mixture was extracted with ethyl acetate. The organic layer was washed with saturated brine and dried over sodium sulfate. The residue obtained by evaporating the solvent under reduced pressure was purified by column chromatography (hexane/ethyl acetate) to obtain (6aR,8R,9R,9aS)-8-(6-chloro-9H-purin-9-yl)-2,2,4,4-tetraisopropyl tetrahydro-6H-furo[3,2-f][1,3,5,2,4]trioxadisilocin-9-ol (8.64 g, yield: 94%).
ESI-MS (m/z): 530 (M+1)

Step 2



[0460] (6aR,8R,9R,9aS)-2,2,4,4-Tetraisopropyl-8-(6-((E)-styryl)-9H-p urin-9-yl)tetrahydro-6H-furo[3,2-f][1,3,5,2,4]trioxadisilocin-9-o 1 (4.77 g, yield: 65%) was obtained in the same manner as in Step 2 of Reference Example 6.0 using (6aR,8R,9R,9aS)-8-(6-chloro-9H-purin-9-yl)-2,2,4,4-tetraisopropyl tetrahydro-6H-furo[3,2-f][1,3,5,2,4]trioxadisilocin-9-ol (6.50 g, 12.3 mmol) obtained in Step 1.
ESI-MS (m/z): 598 (M+1)

Step 3



[0461] (6aR,8R,9R,9aS)-2,2,4,4-Tetraisopropyl-8-(6-((E)-styryl)-9H-p urin-9-yl)tetrahydro-6H-furo[3,2-f][1,3,5,2,4]trioxadisilocin-9-o 1 (4.50 g, 7.54 mmol) obtained in Step 2 was dissolved in N,N-dimethylformamide (50 mL), and 60% sodium hydride (302 mg, 7.54 mmol) and methyl iodide (0.471 mL, 7.54 mmol) were added thereto at 0 °C, and the mixture was stirred at room temperature for 2 hours. To the reaction solution, water was added, and the mixture was extracted with ethyl acetate. The organic layer was washed with saturated brine and dried over sodium sulfate. The residue obtained by evaporating the solvent under reduced pressure was purified by column chromatography (hexane/ethyl acetate) to obtain 6-((E)-styryl)-9-((6aR,8R,9R,9aR)-2,2,4,4-tetraisopropyl-9-methox ytetrahydro-6H-furo[3,2-f][1,3,5,2,4]trioxadisilocin-8-yl)-9H-pur ine (2.09 g, yield: 45%).
ESI-MS (m/z): 612 (M+1)

Step 4



[0462] 6-((E)-styryl)-9-((6aR,8R,9R,9aR)-2,2,4,4-Tetraisopropyl-9-me thoxytetrahydro-6H-furo[3,2-f][1,3,5,2,4]trioxadisilocin-8-yl)-9H -purine (569 mg, 0.931 mmol) obtained in Step 3 was dissolved in tetrahydrofuran (10 mL), and acetic acid (0.117 mL, 2.049 mmol) and a solution of tetrabutylammonium fluoride in tetrahydrofuran (1 mol/L, 2.05 ml, 2.05 mmol) were added thereto, and the mixture was stirred at room temperature for 30 minutes. The reaction solution was concentrated under reduced pressure, and the residue was purified by column chromatography (chloroform/methanol) to obtain (2R,3S,4R,5R)-2-(hydroxymethyl)-4-methoxy-5-(6-((E)styryl)-9H-pur in-9-yl)tetrahydrofuran-3-ol (341 mf, yield: 99%).
1H-NMR (CDCl3, 500 MHz) δ: 8.90 (s, 1H), 8.43 (d, J= 16.7 Hz, 1H), 8.13 (s, 1H), 7.68-7.75 (m, 3H), 7.37-7.47 (m, 3H), 6.17 (dd, J=2.2, 11.9 Hz, 1H), 5.95 (d, J= 7.0 Hz, 1H), 4.77 (dd, J= 4.7, 7.4 Hz 1H), 4.61 (d, J= 4.4 Hz, 1H)), 4.39-4.41 (m, 1H), 3.99-4.02 (m, 1H), 3.78-3.83 (m, 1H), 3.37 (s, 3H), 2.67 (s, 1H).
ESI-MS (m/z): 369 (M+1)

Step 5



[0463] (2R,3R,4R,5R)-2-((Bis(4-methoxyphenyl) (phenyl)methoxy)methyl) -4-methoxy-5-(6-((E)styryl)-9H-purin-9-yl)tetrahydrofuran-3-yl (2-cyanoethyl) diisopropylphosphoramidite (Compound am-28) was obtained in the same manner as in Reference Example 1.1 using ((2R,3S,4R,5R)-2-(hydroxymethyl)-4-methoxy-5-(6-((E)styryl)-9H-pu rin-9-yl)tetrahydrofuran-3-ol obtained in Step 4. This Compound was used in the subsequent Step without purification.

Example 34



[0464] An siRNA (referred to as 2'-OMe-6-styryl-dA) having Compound 1-32 as X at the 5' end of the antisense strand of 454-Xa shown in Table 24 below was synthesized in the same manner as in Example 1 using Compound am-28 obtained in Reference Example 28.1.
ESI-MS (m/z): theoretical value: 6792.04 actual value: 6792.18

Reference Example 29.0: Compound 1-33



[0465] ((2R,3S,4R,5R)-3,4-Dihydroxy-5-(5-methyl-2,4-dioxo-3,4-dihydr opyrimidin-1(2H)-yl)tetrahydrofuran-2-yl)methyl phosphate (Compound 1-33) was obtained in the same manner as in Reference Example 1.0 using commercially available 5-methylpyrimidine-2,4(1H,3H)-dione.
1H-NMR (D2O, 300 MHz) δ: 7.67 (s, 1H), 5.86 (d, J = 5.5 Hz, 1H), 4.23 (dt, J = 12.8, 4. 9 Hz, 2H), 4.13 (dt, J = 6.0, 2.6 Hz, 1H), 4.02-3.89 (m, 2H), 1.80 (s, 3H).
ESI-MS (m/z): 337 (M-1)

Reference Example 29.1: Compound am-29


Step 1



[0466] (2R,3R,4R,5R)-2-((Bis(4-methoxyphenyl)(phenyl)methoxy)methyl) -4-((tert-butyldimethylsilyl)oxy)-5-(5-methyl-2,4-dioxo-3,4-dihyd ropyrimidin-1(2H)-yl)tetrahydrofuran-3-yl (2-cyanoethyl) diisopropylphosphoramidite is obtained in the same manner as in Reference Example 1.1 using commercially available 5-methylpyrimidine-2,4(1H, 3H)-dione.

Example 35



[0467] An siRNA having Compound 1-33 at the 5' end of the antisense strand is synthesized in the same manner as in Example 1 using Compound am-29 obtained in Reference Example 29.1.

Reference Example 30.0: Compound 1-34



[0468] ((2R,3S,4R,5R)-3,4-Dihydroxy-5-(6-methyl-2,4-dioxo-3,4-dihydr opyrimidin-1(2H)-yl)tetrahydrofuran-2-yl)methyl phosphate (Compound 1-34) was obtained in the same manner as in Reference Example 1.0 using commercially available 6-methylpyrimidine-2,4(1H,3H)-dione.
1H-NMR (D2O, 300 MHz) δ: 5.63 (s, 1H), 5.56 (d, J = 2.9 Hz, 1H), 4.31 (t, J = 6.6 Hz, 1H), 4.05-3.90 (m, 4H), 2.27 (s, 3H), 1.95 (s, 1H) . ESI-MS (m/z): 337 (M-1)

Reference Example 30.1: Compound am-30



[0469] (2R,3R,4R,5R)-2-((Bis(4-methoxyphenyl)(phenyl)methoxy)methyl) -4-((tert-butyldimethylsilyl)oxy)-5-(6-methyl-2,4-dioxo-3,4-dihyd ropyrimidin-1(2H)-yl)tetrahydrofuran-3-yl (2-cyanoethyl) diisopropylphosphoramidite (Compound am-30) was obtained in the same manner as in Reference Example 1.1 using commercially available 6-methylpyrimidine-2,4(1H,3H)-dione.
1H-NMR (CDCl3, 500 MHz) δ: 7.80 (m, 1H), 7.48-6.78 (m, 13H), 5.55 (s, 1H), 5.50 (m, 1H), 5.10 (m, 1H), 4.31-4.18 (m, 2H), 3.93-3.22 (m, 12H), 2.66-2.28 (m, 5H), 1.18-1.05 (m, 12H), 0.87 (0.86) (s, 9H), 0.07 (0.06) (s, 3H), 0.00 (-0.01) (s, 3H).

Example 36



[0470] An siRNA (referred to as 6-Me-dU) having Compound 1-34 as X at the 5' end of the antisense strand of 454-Xu shown in Table 24 below was synthesized in the same manner as in Example 1 using Compound am-30 obtained in Reference Example 30.1.
MALDI-TOF/MS (antisense strand): theoretical value: 6680.87 (M-H), actual value: 6681.08

Reference Example 31.0: Compound 1-35


Step 1



[0471] (2R,3R,4R,5R)-2-(Benzoyloxymethyl)-5-(7-chloro-6-nitro-2,4-di oxo-3,4-dihydroquinazolin-1(2H)-yl)tetrahydrofuran-3,4-diyl dibenzoate (0.292 g, 34%) was obtained in the same manner as in Step 1 of Reference Example 1.0 using 7-chloro-6-nitroquinazoline-2, 4(1H,3H)-dione (0.626 g, 1.24 mmol) synthesized according to the method described in the known method (Organic Process Research & Development, 2001, vol. 5, pp. 426-433).
ESI-MS (m/z): 684 (M-1)

Step 2



[0472] 7-Chloro-1-(2R,3R,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)tetra hydrofuran-2-yl)-6-nitroquinazoline-2,4(1H,3H)-dione (1.26 g, 77%) was obtained in the same manner as in Step 2 of Reference Example 7.0 using
(2R,3R,4R,5R)-2-(benzoyloxymethyl)-5-(7-chloro-6-nitro-2,4-dioxo-3,4-dihydroquinazolin-1(2H)-yl)tetrahydrofuran-3,4-diyl dibenzoate (3.00 g, 4.37 mmol) obtained in Step 1.
ESI-MS (m/z): 372 (M-1)

Step 3



[0473] Di-tert-butyl ((3aR,4R,6R,6aR)-6-(7-chloro-6-nitro-2,4-dioxo-3,4-dihydroquinazo lin-1(2H)-yl)-2,2-dimethyltetrahydrofuro[3,4-d] [1,3]dioxol-4-yl)m ethyl phosphate was obtained in the same manner as in Steps 3 to 4 of Reference Example 7.0 using 7-chloro-1-(2R,3R,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)tetrahydr ofuran-2-yl)-6-nitroquinazoline-2,4(1H,3H)-dione obtained in Step 2.
ESI-MS (m/z): 604 (M-1)

Step 4



[0474] ((2R,3S,4R,5R)-5-(7-Chloro-6-nitro-2,4-dioxo-3,4-dihydroquina zolin-1(2H)-yl)-3,4-dihydroxytetrahydrofuran-2-yl)methyl phosphate (Compound 1-35) triethylammonium salt (20.0 mg, 67%) was obtained in the same manner as in Step 5 of Reference Example 1.0 using di-tert-butyl ((3aR,4R,6R,6aR)-6-(7-chloro-6-nitro-2,4-dioxo-3,4-dihydroquinazo lin-1(2H)-yl)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)m ethyl phosphate (32.5 mg, 0.054 mmol) obtained in Step 3.
1H-NMR (D2O, 300 MHz) δ : 8.67 (s, 1H), 7.87 (s, 1H), 6.08 (d, J = 4.8 Hz, 1H), 4.77 (dd, J = 6.6, 4.8 Hz, 1H) , 4.42 (t, J = 6.4 Hz, 1H), 4. 08-3. 99 (m, 4H), 3.09 (q, J = 7.3 Hz, 6H), 1.17 (t, J = 7.3 Hz, 9H). ESI-MS (m/z): 452 (M-1)

Reference Example 31.1: Compound am-31


Step 1



[0475] 7-Chloro-1-((4aR,6R,7R,7aR)-2,2-di-tert-butyl-7-((tert-butyld imethylsilyl)oxy)tetrahydro-4H-furo[3,2-d][1,3,2]dioxasilin-6-yl) -6-nitroquinazoline)-2,4(1H,3H)-dione is obtained in the same manner as in Steps 1 to 2 of Reference Example 1.1 using 7-chloro-1-(2R,3R,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)tetrahydr ofuran-2-yl)-6-nitroquinazoline-2,4(1H,3H)-dione obtained in Step 2 of Reference Example 31.0.

Step 2



[0476] ((2R,3R,4R,5R)-2-((Bis(4-methoxyphenyl)(phenyl)methoxy)methyl )-4-((tert-butyldimethylsilyl)oxy)-5-(7-chloro-6-nitro-2, 4-dioxo-3,4-dihydroquinazolin-1(2H)-yl)tetrahydrofuran-3-yl (2-cyanoethyl) diisopropylphosphoramidite (Compound am-31) is obtained in the same manner as in Steps 3 to 5 of Reference Example 1.1 using 7-chloro-1-((4aR,6R,7R,7aR)-2,2-di-tert-butyl-7-((tert-butyldimet hylsilyl)oxy)tetrahydro-4H-furo[3,2-d][1,3,2]dioxasilin-6-yl)-6-n itroquinazoline)-2,4(1H,3H)-dione obtained in Step 1 of Reference Example 31.1.

Example 37



[0477] An siRNA having Compound I-35 at the 5' end of the antisense strand is synthesized in the same manner as in Example 1 using Compound am-31 obtained in Reference Example 31.1.

Reference Example 32.0 : Compound I-36


Step 1



[0478] Di-tert-butyl ((3aR,4R,6R,6aR)-6-(7-chloro-6-nitro-2,4-dioxo-3,4-dihydroquinazo lin-1(2H)-yl)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)m ethyl phosphate (20.0 mg, 0.033 mmol) obtained in Step 3 of Reference Example 10.0 was dissolved in THF (1 mL), and a dimethylamine/THF solution (1 mL, 2.00 mmol) was added thereto, and the mixture was stirred at room temperature for 30 minutes. After the solvent was evaporated under reduced pressure, the residue was purified by preparative thin-layer chromatography (heptane/ethyl acetate = 25/75) to obtain di-tert-butyl ((3aR,4R,6R,6aR)-6-(7-(dimethylamino)-6-nitro-2,4-dioxo-3,4-dihyd roquinazolin-1(2H)-yl)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]diox ol-4-yl)methyl (14.4 mg, 71%).
ESI-MS (m/z): 613 (M-1)

Step 2



[0479] ((2R,3S,4R,5R)-5-(7-(Dimethylamino)-6-nitro-2,4-dioxo-3,4-dih ydroquinazolin-1(2H)-yl)-3,4-dihydroxytetrahydrofuran-2-yl) methyl phosphate (Compound 1-36) triethylammonium salt (12.5 mg, 62%) was obtained in the same manner as in Step 5 of Reference Example 1.0 using di-tert-butyl
((3aR,4R,6R,6aR)-6-(7-(dimethylamino)-6-nitro-2,4-dioxo-3,4-dihyd roquinazolin-1(2H)-yl)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]diox ol-4-yl)methyl (22.0 mg, 0.036 mmol) obtained in Step 1.
ESI-MS (m/z): 461 (M-1)
1H-NMR (D2O, 300 MHz) δ : 8.46 (s, 1H), 6.75 (s, 1H), 6.05 (d, J = 4.4 Hz, 1H), 4.79 (dd, J = 6.6, 4.0 Hz, 1H), 4.38 (t, J = 7.0 Hz, 1H), 4.11-3.98 (m, 4H), 3.09 (q, J = 7.3 Hz, 6H), 2.92 (s, 6H), 1.17 (t, J = 7.3 Hz, 9H).

Reference Example 32.1: Compound am-32


Step 1



[0480] 1-((4aR,6R,7R,7aR)-2,2-Di-tert-butyl-7-((tert-butyldimethylsi lyl)oxy)tetrahydro-4H-furo[3,2-d][1,3,2]dioxasilin-6-yl)-7-(dimet hylamino)-6-nitroquinazoline)-2,4(1H,3H)-dione is obtained in the same manner as in Step 1 of Reference Example 32.0 using 7-chloro-1-((4aR,6R,7R,7aR)-2,2-di-tert-butyl-7-((tert-butyldimet hylsilyl)oxy)tetrahydro-4H-furo[3,2-d][1,3,2]dioxasilin-6-nitroqu inazoline)-2,4(1H,3H)-dione obtained in Step 1 of Reference Example 31.1.

Step 2



[0481] ((2R,3R,4R,5R)-2-((Bis(4-methoxyphenyl)(phenyl)methoxy)methyl )-4-((tert-butyldimethylsilyl)oxy)-5-(7-(dimethylamino)-6-nitro-2 ,4-dioxo-3,4-dihydroquinazolin-1(2H)-yl)tetrahydrofuran-3-yl (2-cyanoethyl) diisopropylphosphoramidite (Compound am-32) is obtained in the same manner as in Steps 3 to 5 of Reference Example 1.1 using 1-((4aR,6R,7R,7aR)-2,2-di-tert-butyl-7-((tert-butyldimethylsilyl) oxy)tetrahydro-4H-furo[3,2-d][1,3,2]dioxasilin-6-yl)-7-(dimethyla mino)-6-nitroquinazoline)-2,4(1H,3H)-dione obtained in Step 1.

Example 38



[0482] An siRNA having Compound 1-36 at the 5' end of the antisense strand is synthesized in the same manner as in Example 1 using Compound am-32 obtained in Reference Example 32.1.

Reference Example 33.0 : Compound 1-37


Step 1



[0483] 1-(2R,3R,4S,5R)-3,4-Dihydroxy-5-(hydroxymethyl)tetrahydrofura n-2-yl)-7-(methylamino)-6-nitroquinazoline 2,4(1H,3H)-dione (110 mg, 71%) was obtained in the same manner as in Step 2 of Reference Example 1.0 using (2R,3R,4R,5R)-2-(benzoyloxymethyl)-5-(7-chloro-6-nitro-2,4-dioxo-3,4-dihydroquinazolin-1(2H)-yl)tetrahydrofuran-3,4-diyl dibenzoate (292 mg, 0.426 mmol) obtained in Step 1 of Reference Example 31.0.
ESI-MS (m/z): 367 (M-1)

Step 2



[0484] ((2R,3S,4R,5R)-3,4-Dihydroxy-5-(7-(methylamino)-6-nitro-2,4-d ioxo-3, 4-dihydroquinazolin-1(2H)-yl)tetrahydrofuran-2-yl)methyl phosphate (Compound I-37) triethylammonium salt was obtained in the same manner as in Steps 3 to 5 of Reference Example 1.0 using 1-(2R,3R,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl) tetrahydrofuran-2-yl)-7-(methylamino)-6-nitroquinazoline-2,4(1H,3H)-dione obtained in Step 1.
ESI-MS (m/z): 447 (M-1)
1H-NMR (D2O, 300 MHz) δ : 8.67 (s, 1H), 6.48 (s, 1H), 6.02 (d, J = 4.0 Hz, 1H), 4.78 (dd, J = 6. 6, 4.0 Hz, 1H), 4.37 (t, J = 7.0 Hz, 1H), 4.12 (dt, J = 13.9, 5.6 Hz, 1H), 4.03-3.97 (m, 2H), 2.97 (s, 3H) (Amine and amide protons are not observed.).

Reference Example 33.1: Compound am-33



[0485] (2R,3R,4R,5R)-2-((Bis(4-methoxyphenyl)(phenyl)methoxy)methyl) -4-((tert-butyldimethylsilyl)oxy)-5-(7-(methylamino)-6-nitro-2,4-dioxo-3,4-dihydroquinazolin-1(2H)-yl)tetrahydrofuran-3-yl (2-cyanoethyl) diisopropylphosphoramidite (Compound am-33) was obtained in the same manner as in Reference Example 1.1 using 1-(2R,3R,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)tetrahydrofuran-2-yl-7-(methylamino)-6-nitroquinazoline-2,4(1H,3H)-dione obtained in Step 1 of Reference Example 33.0.
1H-NMR (CDCl3, 500 MHz) δ : 9.03 (s, 1H), 8.40 (m, 1H), 7.88 (m, 1H), 7.48-6.73 (m, 13H), 6.64 (s, 1H), 5.88 (m, 1H), 5.13 (5.16) (m,1H), 4.50-4.29 (m, 2 H), 3.93-3. 25 (m, 12H), 3.00 (2.96) (d, J= 5.1 Hz, 3H), 2.60 (2.32) (m, 2H), 1.20-1.05 (m, 12H), 0.85 (0.82) (s, 9H), 0.07 (0.05) (s, 3H), -0.05 (-0.06) (s, 3H).

Example 39



[0486] An siRNA (referred to as 6-NO2,7-Me-dQu) having Compound 1-37 as X at the 5' end of the antisense strand of 454-Xu shown in Table 24 below was synthesized in the same manner as in Example 1 using Compound am-33 obtained in Reference Example 33.1.
MALDI-TOF/MS (antisense strand): theoretical value: 6790.94 (M-H), actual value: 6794.76

Reference Example 34.0 : Compound 1-38


Step 1



[0487] ((3aR,4R,6R,6aR)-6-(6-(3-Chlorostyryl)-9H-purin-9-yl)-2,2-dim ethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methanol (118 mg, 90%) was obtained in the same manner as in Step 2 of Reference Example 6.0 using
((3aR,4R,6R,6aR)-6-(6-chloro-9H-purin-9-yl)-2,2-dimethyltetrahydr ofuro[3,4-d][1,3]dioxol-4-yl)methanol (100 mg, 0.306 mmol) obtained in Step 1 of Reference Example 6.0 and (E)-2-(3-chlorostyryl)-4,4,5,5-tetramethyl-dioxaborolane 1,3,2-(81.0 mg, 0.306 mmol).
ESI-MS (m/z): 429 (M+1)

Step 2



[0488] Di-tert-butyl ((3aR,4R,6R,6aR)-6-(6-(3-chlorostyryl)-9H-purin-9-yl)-2,2-dimethy ltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methyl phosphate (107 mg, 59.8%) was obtained in the same manner as in Step 3 of Reference Example 6.0 using ((3aR,4R,6R,6aR)-6-(6-(3-chlorostyryl)-9H-purin-9-yl)-2,2-dimethy ltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methanol (115 mg, 0.268 mmol) obtained in Step 1.
ESI-MS (m/z): 621 (M+1)

Step 3



[0489] ((2R,3S,4R,5R)-5-(6-(3-Chlorostyryl)-9H-purin-9-yl)-3,4-dihyd roxytetrahydrofuran-2-yl)methyl phosphate (Compound I-38) triethylammonium salt (28.0mg, 25.4%) was obtained in the same manner as in Step 5 of Reference Example 1.0 using di-tert-butyl ((3aR,4R,6R,6aR)-6-(6-(3-chlorostyryl)-9H-purin-9-yl)-2,2-dimethy ltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methyl phosphate (120 mg, 0.193 mmol) obtained in Step 2.
1H-NMR (D2O, 400 MHz) δ : 8.45 (1H, s), 8.34 (1H, s), 7.32-7.20 (1H, m), 6.86-6.70 (3H, m), 6.64-6.50 (2H, m), 5.92-5.85 (1H, m), 4.60-4.54 (1H, m), 4.38-4.32 (1H, m), 4.28-4.20 (1H, m), 4.10-3.92 (2H, m), 3.04 (6H, q, J = 7.5 Hz), 1.11 (9H, t, J = 127.8 Hz).
ESI-MS (m/z): 469 (M+1)

Reference Example 34.1: Compound am-34


Step 1



[0490] 6-(3-Chlorostyryl)-9-((4aR,6R,7R,7aR)-2,2-di-tert-butyl-7-(te rt-butyldimethylsilyloxy)tetrahydro-4H-furo[3,2-d][1,3,2]dioxasil in-6-yl)-9H-purine is obtained in the same manner as in Step 1 of Reference Example 22.0 using 6-chloro-9-((4aR,6R,7R,7aS)-2,2-di-tert-butyl-7-(tert-butyldimeth ylsilyloxy)tetrahydro-4H-furo[3,2-d][1,3,2]dioxasilin-6-yl)-9H-pu rine obtained in Step 2 of Reference Example 17.1.

Steps 2 to 4



[0491] (2R,3R,4R,5R)-2-((Bis(4-methoxyphenyl)(phenyl)methoxy)methyl) -4-(tert-butyldimethylsilyloxy)-5-(6-(3-chlorostyryl)-9H-purin-9-yl)tetrahydrofuran-3-yl 2-cyanoethyl diisopropylphosphoramidite (Compound am-34) is obtained in the same manner as in Steps 3 to 5 of Reference Example 1.1 using 6-(3-chlorostyryl)-9-((4aR,6R,7R,7aR)-2,2-di-tert-butyl-7-(tert-b utyldimethylsilyloxy)tetrahydro-4H-furo[3,2-d] [1,3,2]dioxasilin-6 -yl)-9H-purine obtained in Step 1.

Example 40



[0492] An siRNA having Compound 1-38 at the 5' end of the antisense strand is synthesized in the same manner as in Example 1 using Compound am-34 obtained in Reference Example 34.1.

Test Example 6:



[0493] The affinity of the luciferase-targeting siRNAs introduced an unnatural nucleotide residue at the 5' end of the antisense strand obtained in Examples 1 to 4 for AGO2 was evaluated by measuring the competition with the 5' end of an oligo DNA immobilized on the surface of a substrate which immobilizes the affinity of the siRNA and an AGO2-MID domain using Biacore T100 and T200 systems (GE Healthcare Sciences (GE) Company) as described below.

(1) Preparation of Sample



[0494] A running buffer stock solution (HBS-EP+ 10X, GE Company, BR-1006-69) was diluted to 10-fold with pure water, followed by filtration through a filter, and then HPS-EP+ (10 mM HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid), 150 mM NaCl, 3 mM EDTA, 0.05% (v/v) Surfactant P20, pH 7.4) was prepared and used as a running buffer.

[0495] To HBS-EP+, dithiothreitol (DTT) was added to give a final concentration of 2 mM, and the siRNA solution was diluted to 200 nM, 100 nM, 50 nM, and 25 nM, and each of the diluted siRNA solutions was mixed with an equal amount of a 5 µg/mL AGO2-MID domain solution obtained by dilution in the same manner, whereby 2.5 µg/mL AGO2-MID domain solutions containing the siRNA at 100 nM, 50 nM, 25 nM, and 12.5 nM, respectively, were prepared.

(2) Measurement Method


(2-1) Immobilization of Biotinylated Oligo



[0496] A biotinylated single-stranded DNA (dT(16)-Biotin) was immobilized on a chip (Series S Sensor Chip SA, GE Company, BR-1005-31) . The flow rate was set to a constant rate of 10 µL/min, and the biotinylated single-stranded DNA solution diluted to 100 nM with HBS-EP+ was used to immobilize on Fc2 or Fc4 according to the following program. At the same time, a blank immobilization operation was performed on Fc1 and Fc3.
  1. 1. 1 M NaCl/50 mM NaOH, 60 seconds (INJECT command), 3 times
  2. 2. Running buffer (WASH command)
  3. 3. Running buffer 120 seconds (INJECT command)
  4. 4. Aim for Immobilized Level was set to 750 RU and immobilized(LIGAND INJECT command)
  5. 5. 1 M NaCl/50 mM NaOH/50% isopropyl alcohol (WASH command)


[0497] In the immobilized cells, an immobilization level of about 700 RU was confirmed.

(2-2) Competition Experiments on Oligonucleotide (siRNA)



[0498] A competition experiment by the siRNA was performed using the chip immobilized the biotinylated single-stranded DNA thereon. The flow rate is set to 30 µL/minute throughout the experiment, and one cycle is performed as follows: binding for 60 seconds, dissociation for 5 seconds, and regeneration 1 M NaCl for 5 seconds.

[0499] In order to stabilize the machine, the first 10 cycles are performed by adding only HBS-EP+, and thereafter, the measurement is performed for each siRNA in the order of HBS-EP+ (BLANK) , a 2.5 µg/mL AGO2-MID domain solution (CONTROL), and 2.5 µ/mL AGO2-MID domain solutions (Sample) containing the siRNA at 100 nM, 50 nM, 25 nM, and 12.5 nM, respectively. In the analysis, the binding level of the graph obtained by subtracting the graph for blank immobilization from the graph for the immobilized cell is used, and the residual binding ratio (%) is calculated according to the formula: ([Sample]-[BLANK]) / ([CONTROL] - [BLANK] ) x 100, and the inhibition ratio (%) is calculated according to 100 - (residual binding ratio).

[0500] Further, for comparison, siRNAs having a corresponding natural nucleotide at the 5' end of the antisense strand of each of the siRNAs were also tested in the same manner.

[0501] In Table 21, the respective inhibition ratios (%) are shown.
Table 21
 inhibition rate (%) (50 nM AGO2-MID domain solutions)
874-A 21.33
874-8-Br-dA 75.67
874-8-oxo-dA 31.77
874-U 38.94
874-5-Br-dU 45.07
454-5-U 60.59
454-5-F-dU 66.67
1556-5-U 51.43
1556-5-F-d U 57.63


[0502] From the results of Test Example 6, it was revealed that the luciferase-targeting siRNAs (874-8-Br-dA, 874-8-oxo-dA, 874-5-Br-dU, 454-5-F-dU, and 1556-5-F-dU) introduced an unnatural nucleotide residue at the 5' end of the antisense strand obtained in Examples 1 to 4 have a higher inhibition ratio (%) than the siRNAs (874-A and 874-U) having adenosine monophosphate or uridine monophosphate, which is a corresponding natural nucleotide, at the 5' end thereof, and therefore have a higher affinity for AGO2.

Test Example 7: Biacore of Nucleotide (Monomer)



[0503] The affinity of 8-Br-dA (Compound 1-1) and 5-fluoro-2'-deoxyuridine monophosphate (Compound 1-4), which are unnatural nucleotides at the 5' end of the siRNAs obtained in Examples land 4, respectively, for AGO2 was evaluated by measuring the affinity between each of the siRNAs and an AGO2-MID domain with respect to competition with the 5' end of an oligo DNA immobilized on the surface of a substrate which immobilizes the affinity of the siRNA and an AGO2-MID domain using Biacore T100 and T200 systems (GE Company) as described below.

(1) Preparation of Sample



[0504] HBS-EP+ 10X was diluted to 10-fold with pure water, and DTT was added thereto to give a final concentration of 2 mM, followed by filtration through a filter to prepare an HBS-EP+ 2 mM DTT aqueous solution. To this solution, dimethyl sulfoxide (DMSO) was added to give a final concentration of 1%, whereby a running buffer was prepared.

[0505] A monomer solution dissolved in DMSO or distilled water was diluted to 200 µM, 40 µM, 8 µM, and 1.6 µM/(2% DMSO, HBS-EP+, 2 mM DTT), and each of the diluted solutions was mixed with an equal amount of a 5 µg/mL AGO2-MID domain solution diluted with the HBS-EP+ 2 mM DTT solution, whereby 2.5 µg/mL AGO2-MID domain solutions containing the monomer at 100 µM, 20 µM, 4 µM, and 0.8 µM, respectively, were prepared as the HBS-EP+, 2 mM DTT, 1% DMSO solution.

(2) Competition Experiment on Nucleotide (Monomer)



[0506] A competition experiment by the siRNA was performed using a chip immobilized dT(16)-Biotin oligo thereon in the same manner as in Test Example 6. The flow rate is set to 30 µL/minute throughout the experiment, and one cycle is performed as follows: binding for 60 seconds, dissociation for 5 seconds, and regeneration 1 M NaCl for 5 seconds.

[0507] In order to stabilize the machine, the first 10 cycles are performed by adding only HBS-EP+, and thereafter, the measurement is performed for each monomer in the order of HBS-EP+ (BLANK) , a 2.5 µg/mL AGO2-MID domain solution (CONTROL), and 2.5 µg/mL AGO2-MID domain solutions (Sample) containing the monomer at 100 µM, 20 µM, 4 µM, and 0.8 µM, respectively, and a 2.5 µg/mL AGO2-MID domain solution (CONTROL).

[0508] In the analysis, the binding level of the graph obtained by subtracting the graph for blank immobilization from the graph for the immobilized cell is used, and the residual binding ratio (%) is calculated according to ([Sample]-[BLANK]) / ([CONTROL]-[BLANK]) x 100, and the inhibition ratio (%) is calculated according to 100-(residual binding ratio).

[0509] In Table 22, the inhibition ratios (%) of 8-Br-dA (Compound I-1) and 5-fluoro-2'-deoxyuridine monophosphate (Compound 1-4), and for comparison thereof, the inhibition ratios (%) of adenosine monophosphate (AMP) and uridine monophosphate (UMP) are shown.
Table 22
 inhibition rate (%) (100 µM AGO2-MID domain solutions)
compound I-1 68.6
compound I-4 42.7
AMP 27.1
UMP 35.9


[0510] From the results of Test Example 7, it was revealed that 8-Br-dA and 5-fluoro-2'-deoxyuridine monophosphate, which are unnatural nucleotides introduced at the 5' end of the antisense strands of the siRNAs of the present invention, have a higher inhibition ratio (%) than adenosine monophosphate or uridine monophosphate, which is a natural nucleotide, and therefore have a higher affinity for AGO2.

Test Example 8: Biacore of Monomer



[0511] The affinity of Compounds 1-5 to 1-31, and 1-33 to 1-38, which are unnatural nucleotides at the 5' end of the siRNAs obtained in Examples 7 to 33, and 35 to 40 for AGO2 was evaluated in the same manner as in Test Example 7.

[0512] The respective inhibition ratios (%) determined are shown in Table 23.
Table 23
 inhibition rate(%) (100 µM AGO2-MID domain sdufons)
compound I-5 87.4
compound I-6 70.0
compound I-7 71,7
compound I-8 77.1
compound I-9 70.9
compound I-10 73.5
compound I-11 60.9
compound I-12 74.2
compound I-13 63.4
compound I-14 63.3
compound I-15 73.0
compound I-16 65.6
compound I-17 86.0
compound I-18 94.8
compound I-19 89.7
compound I-20 76.9
compound I-21 78.2
compound I-22 91.6
compound I-23 85.2
compound I-24 88.4
compound I-25 35.9
compound I-26 82.4
compound I-27 92.4
compound I-28 77.0
compound I-29 compound I-30 77.9
compound I-31 compound I-33 73.6
compound I-34 31.8
compound I-35 88.0
compound I-36 91.6
compound I-37 92.3
compound I-38 78.9


[0513]  From the results of Test Example 8, it was revealed that all Compounds 1-5 to 1-31, and 1-33 to 1-38, which are unnatural nucleotides at the 5' end of the siRNAs obtained in Examples 7 to 33, and 35 to 40 have a high inhibition ratio (%), and therefore have a high affinity for AGO2. Accordingly, the siRNAs obtained in Examples 7 to 33, and 35 to 40 are oligonucleotides having an improved affinity for AGO2, and therefore are expected to be oligonucleotides having a high knockdown activity against a target mRNA.

Test Example 9: Knockdown Activity of Luciferase-Targeting siRNA



[0514] The activity of an siRNA having each compound at the 5' end of the antisense strand obtained in Example 39, 23, 36, or 27 was measured and evaluated in the same manner as in Test Example 1 except that the number of cells per well was set to 7500, the final concentration of the siRNA was set to the following five levels: 10000 pmol/L, 1000 pmol/L, 100 pmol/L, 10 pmol/L, and 1 pmol/L, and N was set to 5. The knockdown activity of each of siRNAs having 1-37 (6-NO2,7-Me-dQu), 1-21 (6-napht-2-yl-dPu), 1-34 (6-Me-dU), or 1-25 (6-napht-1-yl-dPu) at the 5' end of the antisense strand is shown in Fig. 4.

[0515] Incidentally, an siRNA having 8-Br-dA as X at the 5' end of the antisense strand of 454-Xa in Table 24 (referred to as 454-BrdA) was synthesized in the same manner as in Example 1 using 8-Br-dA, and the activity of the siRNA was measured and evaluated. Further, also for an siRNA having a natural nucleotide which contains adenosine monophosphate or uridine monophosphate, at the 5' end of the antisense strand (referred to as 454-A or 454-U), the activity of the siRNA was measured and evaluated in the same manner.

[0516] From the results of Test Example 9, it is found that the siRNA having a high affinity base analog for Ago2 at the 5' end of the antisense strand shows a higher knockdown activity than the siRNA having a natural nucleotide at the 5' end of the antisense strand.

Test Example 10: Knockdown Activity of Luciferase-Targeting siRNA



[0517] The activity of an siRNA having each compound at the 5' end of the antisense strand obtained in Example 34 and 21 was measured and evaluated in the same manner as in Test Example 1 except that the number of cells per well was set to 7500, the final concentration of the siRNA was set to the following five levels: 10000 pmol/L, 1000 pmol/L, 100 pmol/L, 10 pmol/L, and 1 pmol/L, and N was set to 5. The knockdown activity of siRNAs having I-32 (2'-OMe-6-styryl-dA) or I-19 (di-Me-thienyl-dU) at the 5' end of the antisense strand is shown in Fig. 5.

[0518] From the results of Test Example 10, it is found that the siRNA having a high affinity base analog for Ago2 at the 5' end of the antisense strand shows a higher knockdown activity than the siRNA having a corresponding natural nucleotide at the 5' end of the antisense strand.
Table 24
 sense strandantisense strand
sequence(5'→3')sequence numbersequence(5'→3')sequence number
454-U GGAUAGCAAGACCGACUAACA 25 UUAGUCGGUCUUGCUAUCCAU 28
454-A GGAUAGCAAGACCGACUAUCA 65 AUAGUCGGUCUUGCUAUCCAU 66
454-Xu GGAUAGCAAGACCGACUAACA 25 XUAGUCGGUCUUGCUAUCCAU 26
454-Xa GGAUAGCAAGACCGACUAUCA 65 XUAGUCGGUCUUGCUAUCCAU 26


[0519] From the results of the above Test Examples 9 and 10, by applying the siRNA having an improved activity according to the present invention to pharmaceuticals, the dose can be expected to be reduced as compared with the case where a natural siRNA is used.

INDUSTRIAL APPLICABILITY



[0520] According to the present invention, an oligonucleotide having an improved affinity for AGO2 and the like are provided, as defined in the claims.

[Sequence Listing]



[0521] 1000P12280 Sequence Listing.txt

SEQUENCE LISTING



[0522] 

<110> KYOWA HAKKO KIRIN CO., LTD.

<120> oligonucleotide

<130> Y1382 EP

<140> EP 13 83 3206.9
<141> 2013-09-02

<150> US61695566
<151> 2012-08-31

<150> JP2013105947
<151> 2013-05-20

<160> 66

<210> 1
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 239-BrdA sense

<400> 1
ugcagcgaga auagcuugua g 21

<210> 2
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 239-BrdA antisense

<400> 2
ncaagcuauu cucgcugcac a 21

<210> 3
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 874-BrdA sense

<400> 3
uagcuucuuc gcuaagagua c 21

<210> 4
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 874-BrdA antisense

<400> 4
ncucuuagcg aagaagcuaa a 21

<210> 5
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 904-BrdA sense

<400> 5
caaguacgac cuaagcaauu u 21

<210> 6
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 904-BrdA antisense

<400> 6
nuugcuagg ucguacuugu c 21

<210> 7
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 1084-BrdA sense

<400> 7
aggcaaggug gugcccuuuu u 21

<210> 8
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 1084-BrdA antisense

<400> 8
naagggcacc accuugccua c 21

<210> 9
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 1203-BrdA sense

<400> 9
uuaacaaccc cgaggcuaua a 21

<210> 10
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 1203-BrdA antisense

<400> 10
nuagccucgg gguuguuaac g 21

<210> 11
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 1556-BrdA sense

<400> 11
gacgaggugc cuaaaggauu g 21

<210> 12
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 1556-BrdA antisense

<400> 12
nuccuuuagg caccucgucc a 21

<210> 13
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 239-A antisense

<400> 13
acaagcuauu cucgcugcac a 21

<210> 14
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 874-A antisense

<400> 14
acucuuagcg aagaagcuaa a 21

<210> 15
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 904-A antisense

<400> 15
auugcuuagg ucguacuugu c 21

<210> 16
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 1084-A antisense

<400> 16
aaagggcacc accuugccua c 21

<210> 17
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 1203-A antisense

<400> 17
auagccucgg gguuguuaac g 21

<210> 18
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 1556-A antisense

<400> 18
auccuuuagg caccucgucc a 21

<210> 19
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 874-G sense

<400> 19
uagcuucuuc gcuaagagca c 21

<210> 20
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 874-G antisense

<400> 20
gcucuuagcg aagaagcuaa a 21

<210> 21
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 874-C sense

<400> 21
uagcuucuuc gcuaagagga c 21

<210> 22
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 874-C antisense

<400> 22
ccucuuagcg aagaagcuaa a 21

<210> 23
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 874-U sense

<400> 23
uagcuucuuc gcuaagagaa c 21

<210> 24
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 874-U antisense

<400> 24
ucucuuagcg aagaagcuaa a 21

<210> 25
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 454-5-F-dU sense

<400> 25
ggauagcaag accgacuaac a 21

<210> 26
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 454-5-F-dU antisense

<400> 26
nuagucgguc uugcuaucca u 21

<210> 27
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 1556-5-F-dU sense

<400> 27
gacgaggugc cuaaaggaau g 21

<210> 28
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 454-U antisense

<400> 28
uuagucgguc uugcuaucca u 21

<210> 29
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 1556-U antisense

<400> 29
uuccuuuagg caccucgucc a 21

<210> 30
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 217-BrdA sense

<400> 30
gcgccugguc accagggcug c 21

<210> 31
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 217-BrdA antisense

<400> 31
ngcccuggug accaggcgcc c 21

<210> 32
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 278-BrdA sense

<400> 32
cccuucauug accucaacua c 21

<210> 33
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 278-BrdA antisense

<400> 33
nguugagguc aaugaagggg u 21

<210> 34
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 516-BrdA sense

<400> 34
gagccaaaag ggucaucauc u 21

<210> 35
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 516-BrdA antisense

<400> 35
nugaugaccc uuuuggcucc c 21

<210> 36
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 624-BrdA sense

<400> 36
ccugcaccac caacugcuua g 21

<210> 37
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 624-BrdA antisense

<400> 37
nagcaguugg uggugcagga g 21

<210> 38
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 715-BrdA sense

<400> 38
cacugccacc cagaagacug u 21

<210> 39
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 715-BrdA antisense

<400> 39
ngucuucugg guggcaguga u 21

<210> 40
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 816-BrdA sense

<400> 40
aggcuguggg caaggucauc c 21

<210> 41
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 816-BrdA antisense

<400> 41
nugaccuugc ccacagccuu g 21

<210> 42
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 936-BrdA sense

<400> 42
augaugacau caagaaggug g 21

<210> 43
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 936-BrdA antisense

<400> 43
nccuucuuga ugucaucaua u 21

<210> 44
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 1096-BrdA sense

<400> 44
caagcucauu uccugguaug a 21

<210> 45
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 1096-BrdA antisense

<400> 45
nuaccaggaa augagcuuga c 21

<210> 46
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 1134-BrdA sense

<400> 46
gcaacagggu gguggaccuc a 21

<210> 47
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 1134-BrdA antisense

<400> 47
ngguccacca cccuguugcu g 21

<210> 48
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 217-A antisense

<400> 48
agcccuggug accaggcgcc c 21

<210> 49
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 278-A antisense

<400> 49
aguugagguc aaugaagggg u 21

<210> 50
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 516-A antisense

<400> 50
augaugaccc uuuuggcucc c 21

<210> 51
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 624-A antisense

<400> 51
aagcaguugg uggugcagga g 21

<210> 52
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 715-A antisense

<400> 52
agucuucugg guggcaguga u 21

<210> 53
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 816-A antisense

<400> 53
augaccuugc ccacagccuu g 21

<210> 54
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 936-A antisense

<400> 54
accuucuuga ugucaucaua u 21

<210> 55
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 1096-A antisense

<400> 55
auaccaggaa augagcuuga c 21

<210> 56
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 1134-A antisense

<400> 56
agguccacca cccuguugcu g 21

<210> 57
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 1096-5-F-dU sense

<400> 57
caagcucauu uccugguaag a 21

<210> 58
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 1096-U antisense

<400> 58
uuaccaggaa augagcuuga c 21

<210> 59
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 1096-A sense

<400> 59
caagcucauu uccugguaug a 21

<210> 60
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 1096-A antisense

<400> 60
auaccaggaa augagcuuga c 21

<210> 61
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 1096-G sense

<400> 61
caagcucauu uccugguacg a 21

<210> 62
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 1096-G antisense

<400> 62
guaccaggaa augagcuuga c 21

<210> 63
<211> 20
<212> DNA
<213> Artificial Sequence

<220>
<223> forward primer

<400> 63
catgaccgag aaggagatcg 20

<210> 64
<211> 19
<212> DNA
<213> Artificial Sequence

<220>
<223> reverse primer

<400> 64
cagcttcttg gcggttgta 19

<210> 65
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 454-A sense

<400> 65
ggauagcaag accgacuauc a 21

<210> 66
<211> 21
<212> RNA
<213> Artificial Sequence

<220>
<223> 454-A antisense

<400> 66
auagucgguc uugcuaucca u 21




Claims

1. An oligonucleotide, comprising a nucleotide residue or a nucleoside residue represented by formula (I) at the 5' end thereof, wherein the nucleotide residue or the nucleoside residue binds to an adjacent nucleotide residue through the oxygen atom at position 3:

{wherein X1 is an oxygen atom, a sulfur atom, a selenium atom, or NR4

(wherein R4 is a hydrogen atom, optionally substituted lower alkyl, optionally substituted lower alkenyl, optionally substituted lower alkynyl, optionally substituted lower alkanoyl, optionally substituted lower alkylsulfonyl, optionally substituted aralkyl, optionally substituted aryl, optionally substituted aroyl, or optionally substituted aromatic heterocyclic carbonyl),

R1 is formula (II):



wherein Y1 is a nitrogen atom,

R5 is a hydrogen atom, halogen, cyano, or optionally substituted lower alkenyl,

R6 is a hydrogen atom, halogen, cyano, carboxy, optionally substituted lower alkyl, optionally substituted lower alkenyl, optionally substituted lower alkynyl, optionally substituted lower alkoxy, optionally substituted lower alkylthio, optionally substituted lower alkanoyl, optionally substituted lower alkoxycarbonyl, optionally substituted aryl, optionally substituted aralkyl, optionally substituted aryloxy, optionally substituted arylthio, optionally substituted aroyl, an optionally substituted aromatic heterocyclic group, optionally substituted aromatic heterocyclic alkyl, optionally substituted aromatic heterocyclicoxy, optionally substituted aromatic heterocyclicthio, optionally substituted aromatic heterocyclic carbonyl, -NR11aR11b (wherein R11a and R11b may be the same or different, and each is a hydrogen atom, optionally substituted lower alkyl, optionally substituted lower alkenyl, optionally substituted lower alkynyl, optionally substituted aryl, optionally substituted aralkyl, optionally substituted aromatic heterocyclic alkyl, optionally substituted lower alkanoyl, optionally substituted lower alkylsulfonyl, ' optionally substituted aroyl, optionally substituted arylsulfonyl, an optionally substituted aromatic heterocyclic group, optionally substituted aromatic heterocyclic carbonyl, or optionally substituted aromatic heterocyclic sulfonyl) , -CONR11cR11d (wherein R11c and R11d may be the same or different, and each is a hydrogen atom, optionally substituted lower alkyl, optionally substituted aryl, or an optionally substituted aromatic heterocyclic group) , -NHCONR11eR11f (wherein R11e and R11f may be the same or different, and each is a hydrogen atom, optionally substituted lower alkyl, optionally substituted aralkyl, optionally substituted aromatic heterocyclic alkyl, optionally substituted aryl, or an optionally substituted aromatic heterocyclic group) , or -NHCO2R11g (wherein R11g is optionally substituted lower alkyl, optionally substituted aralkyl, optionally substituted aromatic heterocyclic alkyl, optionally substituted aryl, or an optionally substituted aromatic heterocyclic group), -N=C-R11h (wherein R11h is a hydrogen atom or optionally substituted lower alkyl), -C=N-R11i (wherein R11i is a hydrogen atom or optionally substituted lower alkyl), or -N=N-R11j (wherein R11j is a hydrogen atom or optionally substituted lower alkyl),

R7 is a hydrogen atom, provided that when R5 is a hydrogen atom and R6 is -NR11aR11b, R11a and R11b are not simultaneously hydrogen atoms},

R2 is a hydrogen atom, hydroxy, halogen, or optionally substituted lower alkoxy,

R3 is a hydrogen atom or



(wherein n2 is 1, 2, or 3);

wherein a "lower alkyl" has 1 to 10 carbon atom(s) ; wherein the lower alkyl moiety of a "lower alkoxy", a "lower alkoxycarbonyl", a "lower alkylthio", or a "lower alkylsulfonyl" has 1 to 10 carbon atom(s);

wherein a "lower alkenyl" has 2 to 10 carbon atoms; wherein a "lower alkynyl" has 2 to 10 carbon atoms; and wherein a "lower alkanoyl" has 1 to 8 carbon atom(s)}, and

the oligonucleotide has a length of 10 to 80 bases.


 
2. The oligonucleotide according to claim 1, wherein X1 is an oxygen atom.
 
3. The oligonucleotide according to claim 1 or 2, wherein R3 is

wherein n2 has the same meaning as defined in claim 1.
 
4. The oligonucleotide according to any one of claims 1 to 3, wherein R2 is a hydrogen atom, hydroxy, a fluorine atom, or methoxy.
 
5. The oligonucleotide according to any one of claims 1 to 4, wherein the oligonucleotide has a length of 20 to 50 bases.
 
6. The oligonucleotide according to any one of claims 1 to 5, wherein the oligonucleotide is a small interfering RNA (siRNA).
 


Ansprüche

1. Ein Oligonukleotid, umfassend einen Nukleotidrest oder einen Nukleosidrest dargestellt durch Formel (I) am 5'-Ende davon, wobei der Nukleotidrest oder der Nukleosidrest an einen benachbarten Nukleotidrest über das Sauerstoffatom an Position 3 bindet:

{wobei X1 ein Sauerstoffatom, ein Schwefelatom, ein Selenatom oder NR4 darstellt

(wobei R4 ein Wasserstoffatom, gegebenenfalls substituiertes Niederalkyl, gegebenenfalls substituiertes Niederalkenyl, gegebenenfalls substituiertes Niederalkinyl, gegebenenfalls substituiertes Niederalkanoyl, gegebenenfalls substituiertes Niederalkylsulfonyl, gegebenenfalls substituiertes Aralkyl, gegebenenfalls substituiertes Aryl, gegebenenfalls substituiertes Aroyl oder gegebenenfalls substituiertes aromatisches heterocyclisches Carbonyl darstellt),

R1 für Formel (II) steht:



wobei Y1 ein Stickstoffatom darstellt,

R5 ein Wasserstoffatom, Halogen, Cyano oder gegebenenfalls substituiertes Niederalkenyl darstellt,

R6 ein Wasserstoffatom, Halogen, Cyano, Carboxy, gegebenenfalls substituiertes Niederalkyl, gegebenenfalls substituiertes Niederalkenyl, gegebenenfalls substituiertes Niederalkinyl, gegebenenfalls substituiertes Niederalkoxy, gegebenenfalls substituiertes Niederalkylthio, gegebenenfalls substituiertes Niederalkanoyl, gegebenenfalls substituiertes Niederalkoxycarbonyl, gegebenenfalls substituiertes Aryl, gegebenenfalls substituiertes Aralkyl, gegebenenfalls substituiertes Aryloxy, gegebenenfalls substituiertes Arylthio, gegebenenfalls substituiertes Aroyl, eine gegebenenfalls substituierte aromatische heterocyclische Gruppe, gegebenenfalls substituiertes aromatisches heterocyclisches Alkyl, gegebenenfalls substituiertes aromatisches heterocyclisches Oxy, gegebenenfalls substituiertes aromatisches heterocyclisches Thio, gegebenenfalls substituiertes aromatisches heterocyclisches Carbonyl, -NR11aR11b (wobei R11a und R11b gleich oder verschieden sein können, und jeweils ein Wasserstoffatom, gegebenenfalls substituiertes Niederalkyl, gegebenenfalls substituiertes Niederalkenyl, gegebenenfalls substituiertes Niederalkinyl, gegebenenfalls substituiertes Aryl, gegebenenfalls substituiertes Aralkyl, gegebenenfalls substituiertes aromatisches heterocyclisches Alkyl, gegebenenfalls substituiertes Niederalkanoyl, gegebenenfalls substituiertes Niederalkylsulfonyl, gegebenenfalls substituiertes Aroyl, gegebenenfalls substituiertes Arylsulfonyl, eine gegebenenfalls substituierte aromatische heterocyclische Gruppe, gegebenenfalls substituiertes aromatisches heterocyclisches Carbonyl oder gegebenenfalls substituiertes aromatisches heterocyclisches Sulfonyl darstellen), -CONR11cR11d (wobei R11c and R11d gleich oder verschieden sein können und jeweils ein Wasserstoffatom, gegebenenfalls substituiertes Niederalkyl, gegebenenfalls substituiertes Aryl oder eine gegebenenfalls substituierte aromatische heterocyclische Gruppe darstellen), -NHCONR11eR11f (wobei R11e und R11f gleich oder verschieden sein können und jeweils ein Wasserstoffatom, gegebenenfalls substituiertes Niederalkyl, gegebenenfalls substituiertes Aralkyl, gegebenenfalls substituiertes aromatisches heterocyclisches Alkyl, gegebenenfalls substituiertes Aryl oder eine gegebenenfalls substituierte aromatische heterocyclische Gruppe darstellen) oder -NHCO2R11g (wobei R11g gegebenenfalls substituiertes Niederalkyl, gegebenenfalls substituiertes Aralkyl, gegebenenfalls substituiertes aromatisches heterocyclisches Alkyl, gegebenenfalls substituiertes Aryl oder eine gegebenenfalls substituierte aromatische heterocyclische Gruppe darstellt), -N=C-R11h (wobei R11h ein Wasserstoffatom oder gegebenenfalls substituiertes Niederalkyl darstellt), -C=N-R11i (wobei R11i ein Wasserstoffatom oder gegebenenfalls substituiertes Niederalkyl darstellt) oder -N=N-R11j (wobei R11j ein Wasserstoffatom oder gegebenenfalls substituiertes Niederalkyl darstellt),

R7 ein Wasserstoffatom darstellt, mit der Maßgabe, dass, wenn R5 ein Wasserstoffatom darstellt und R6 für -NR11aR11b steht, R11a und R11b nicht gleichzeitig Wasserstoffatome darstellen},

R2 ein Wasserstoffatom, Hydroxy, Halogen oder gegebenenfalls substituiertes Niederlkoxy darstellt,

R3 ein Wasserstoffatom darstellt oder



(wobei n2 für 1, 2 oder 3 steht);

wobei ein "Niederalkyl" 1 bis 10 Kohlenstoffatom(e) aufweist; wobei die Niederalkyleinheit eines "Niederalkoxy", eines "Niederalkoxycarbonyl", eines "Niederalkylthio" oder eines "Niederalkylsulfonyl" 1 bis 10 Kohlenstoffatom(e) aufweist; wobei ein "Niederalkenyl" 2 bis 10 Kohlenstoffatome aufweist; wobei ein "Niederalkinyl" 2 bis 10 Kohlenstoffatome aufweist; und wobei ein "Niederalkanoyl" 1 bis 8 Kohlenstoffatom(e) aufweist} und

das Oligonukleotid eine Länge von 10 bis 80 Basen aufweist.


 
2. Das Oligonukleotid gemäß Anspruch 1, wobei X1 ein Sauerstoffatom ist.
 
3. Das Oligonukleotid gemäß Anspruch 1 oder 2, wobei R3

darstellt, wobei n2 die gleiche Bedeutung wie in Anspruch 1 definiert hat.
 
4. Das Oligonukleotid gemäß einem der Ansprüche 1 bis 3, wobei R2 ein Wasserstoffatom, Hydroxy, ein Fluoratom oder Methoxy darstellt.
 
5. Das Oligonukleotid gemäß einem der Ansprüche 1 bis 4, wobei das Oligonukleotid eine Länge von 20 bis 50 Basen aufweist.
 
6. Das Oligonukleotid gemäß einem der Ansprüche 1 bis 5, wobei das Oligonukleotid eine small interfering RNA (siRNA) ist.
 


Revendications

1. Oligonucléotide comprenant un résidu de nucléotide ou un résidu de nucléoside représenté par la formule (I) à son extrémité 5', dans lequel le résidu de nucléotide ou le résidu de nucléoside se lie à un résidu de nucléotide adjacent par l'intermédiaire de l'atome d'oxygène à la position 3 :

{dans laquelle X1 est un atome d'oxygène, un atome de soufre, un atome de sélénium, ou NR4 (où R4 est un atome d'hydrogène, un radical alkyle inférieur éventuellement substitué, alcényle inférieur éventuellement substitué, alcynyle inférieur éventuellement substitué, alcanoyle inférieur éventuellement substitué, alkylsulfonyle inférieur éventuellement substitué, aralkyle éventuellement substitué, aryle éventuellement substitué, aroyle éventuellement substitué, ou un carbonyle hétérocyclique aromatique éventuellement substitué),

R1 est de formule (II) :



dans laquelle Y1 est un atome d'azote,

R5 est un atome d'hydrogène, un halogène, un radical cyano ou alcényle inférieur éventuellement substitué,

R6 est un atome d'hydrogène, un halogène, un radical cyano, carboxy, alkyle inférieur éventuellement substitué, alcényle inférieur éventuellement substitué, alcynyle inférieur éventuellement substitué, alcoxy inférieur éventuellement substitué, alkylthio inférieur éventuellement substitué, alcanoyle inférieur éventuellement substitué, alcoxycarbonyle inférieur éventuellement substitué, aryle éventuellement substitué, aralkyle éventuellement substitué, aryloxy éventuellement substitué, arylthio éventuellement substitué, aroyle éventuellement substitué, hétérocyclique aromatique éventuellement substitué, hétérocycloalkyle aromatique éventuellement substitué, hétérocycloxy aromatique éventuellement substitué, hétérocyclothio aromatique éventuellement substitué, hétérocyclocarbonyle aromatique éventuellement substitué, -NR11aR11b (où chacun de R11a et R11b, qui peuvent être identiques ou différents, est un atome d'hydrogène, un radical alkyle inférieur éventuellement substitué, alcényle inférieur éventuellement substitué, alcynyle inférieur éventuellement substitué, aryle éventuellement substitué, aralkyle éventuellement substitué, hétérocycloalkyle aromatique éventuellement substitué, alcanoyle inférieur éventuellement substitué, alkylsulfonyle inférieur éventuellement substitué, aroyle éventuellement substitué, arylsulfonyle éventuellement substitué, hétérocyclique aromatique éventuellement substitué, hétérocyclocarbonyle aromatique éventuellement substitué, ou hétérocyclosulfonyle aromatique éventuellement substitué), -CONR11cR11d (où chacun de R11c et R11d, qui peuvent être identiques ou différents, est un atome d'hydrogène ou un radical alkyle inférieur éventuellement substitué, aryle éventuellement substitué, ou hétérocyclique aromatique éventuellement substitué), -NHCONR11eR11f (où chacun de R11e et R11f, qui peuvent être identiques ou différents, est un atome d'hydrogène, un radical alkyle inférieur éventuellement substitué, aralkyle éventuellement substitué, hétérocycloalkyle aromatique éventuellement substitué, aryle éventuellement substitué, ou hétérocyclique aromatique éventuellement substitué), ou -NHCO2R11g (où R11g est un radical alkyle inférieur éventuellement substitué, aralkyle éventuellement substitué, hétérocycloalkyle aromatique éventuellement substitué, aryle éventuellement substitué, ou hétérocyclique aromatique éventuellement substitué), -N=C-R11h (où R11h est un atome d'hydrogène ou un radical alkyle inférieur éventuellement substitué), -C=N-R11i (où R11i est un atome d'hydrogène ou un radical alkyle inférieur éventuellement substitué), ou -N=N-R11j (où R11j est un atome d'hydrogène ou un radical alkyle inférieur éventuellement substitué),

R7 est un atome d'hydrogène, sous réserve que, lorsque R5 est un atome d'hydrogène et R6 est -NR11aR11b, R11a et R11b ne soient pas simultanément des atomes d'hydrogène},

R2 est un atome d'hydrogène, un radical hydroxy, un halogène ou alcoxy inférieur éventuellement substitué,

R3 est un atome d'hydrogène ou



(où n2 vaut 1, 2 ou 3) ;

où un "alkyle inférieur" a 1 à 10 atomes de carbone ; où le fragment alkyle inférieur d'un "alcoxy inférieur", d'un "alcoxycarbonyle inférieur", d'un "alkylthio inférieur" ou d'un "alkylsulfonyle inférieur" a 1 à 10 atomes de carbone ; un "alcényle inférieur" a 2 à 10 atomes de carbone ; un "alcynyle inférieur" a 2 à 10 atomes de carbone ; et un "alcanoyle inférieur" a 1 à 8 atomes de carbone}, et

l'oligonucléotide a une longueur de 10 à 80 bases.


 
2. Oligonucléotide selon la revendication 1, dans lequel X1 est un atome d'oxygène.
 
3. Oligonucléotide selon la revendication 1 ou 2, dans lequel R3 est

où n2 a la même signification que celle définie dans la revendication 1.
 
4. Oligonucléotide selon l'une quelconque des revendications 1 à 3, dans lequel R2 est un atome d'hydrogène, un radical hydroxy, un atome de fluor, ou méthoxy.
 
5. Oligonucléotide selon l'une quelconque des revendications 1 à 4, lequel oligonucléotide a une longueur de 20 à 50 bases.
 
6. Oligonucléotide selon l'une quelconque des revendications 1 à 5, lequel oligonucléotide est un petit ARN interférant (ARNsi).
 




Drawing

















Cited references

REFERENCES CITED IN THE DESCRIPTION



This list of references cited by the applicant is for the reader's convenience only. It does not form part of the European patent document. Even though great care has been taken in compiling the references, errors or omissions cannot be excluded and the EPO disclaims all liability in this regard.

Patent documents cited in the description




Non-patent literature cited in the description