(19)
(11)EP 3 326 641 B1

(12)EUROPEAN PATENT SPECIFICATION

(45)Mention of the grant of the patent:
26.06.2019 Bulletin 2019/26

(21)Application number: 17196250.9

(22)Date of filing:  22.04.2016
(51)International Patent Classification (IPC): 
A61K 38/19(2006.01)
C07K 14/52(2006.01)
A61K 39/00(2006.01)
C12N 15/117(2010.01)
A61K 31/7105(2006.01)
A61K 38/20(2006.01)
C12N 15/113(2010.01)
A61P 35/00(2006.01)

(54)

RNA CONTAINING COMPOSITION FOR TREATMENT OF TUMOR DISEASES

RNA-HALTIGE ZUSAMMENSETZUNG ZUR BEHANDLUNG VON TUMORERKRANKUNGEN

COMPOSITION CONTENANT UN ARN POUR LE TRAITEMENT DE MALADIES TUMORALES


(84)Designated Contracting States:
AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

(30)Priority: 22.04.2015 EP 15001191

(43)Date of publication of application:
30.05.2018 Bulletin 2018/22

(62)Application number of the earlier application in accordance with Art. 76 EPC:
16166757.1 / 3173092

(73)Proprietor: CureVac AG
72076 Tübingen (DE)

(72)Inventors:
  • Fotin-Mleczek, Mariola
    72706 Tübingen (DE)
  • Kowalczyk, Aleksandra
    72706 Tübingen (DE)
  • Heidenreich, Regina
    72076 Tübingen (DE)
  • Baumhof, Patrick
    72706 Tübingen (DE)
  • Probst, Jochen
    72706 Tübingen (DE)
  • Kallen, Karl-Josef
    72706 Tübingen (DE)

(74)Representative: Graf von Stosch, Andreas et al
Graf von Stosch Patentanwaltsgesellschaft mbH Prinzregentenstraße 22
80538 München
80538 München (DE)


(56)References cited: : 
EP-A1- 2 623 121
WO-A1-2012/013326
WO-A2-02/098443
WO-A1-2006/024518
WO-A1-2014/127917
WO-A2-2009/095226
  
  • REGINA HEIDENREICH ET AL: "A novel RNA-based adjuvant combines strong immunostimulatory capacities with a favorable safety profile : RNAdjuvant promotes anti-tumor responses of protein and peptide vaccines", INTERNATIONAL JOURNAL OF CANCER, vol. 137, no. 2, 21 December 2014 (2014-12-21), pages 372-384, XP055462897, US ISSN: 0020-7136, DOI: 10.1002/ijc.29402
  • FOTIN-MLECZEK M ET AL: "Highly potent mRNA based cancer vaccines represent an attractive platform for combination therapies supporting an improved therapeutic effect", JOURNAL OF GENE MEDICINE, JOHN WILEY & SONS, INC, US, vol. 14, no. 6, 1 June 2012 (2012-06-01), pages 428-439, XP002716014, ISSN: 1099-498X, DOI: 10.1002/JGM.2605 [retrieved on 2012-06-27]
  • WILGENHOF S ET AL: "A phase IB study on intravenous synthetic mRNA electroporated dendritic cell immunotherapy in pretreated advanced melanoma patients", ANNALS OF ONCOLOGY, OXFORD UNIVERSITY PRESS, GB, vol. 24, no. 10, 1 October 2013 (2013-10-01), pages 2686-2693, XP009174113, ISSN: 1569-8041
  • SALLY M. AMOS ET AL: "Adoptive immunotherapy combined with intratumoral TLR agonist delivery eradicates established melanoma in mice", CANCER IMMUNOLOGY AND IMMUNOTHERAPY, vol. 60, no. 5, 1 May 2011 (2011-05-01), pages 671-683, XP055285721, BERLIN, DE ISSN: 0340-7004, DOI: 10.1007/s00262-011-0984-8
  • KEVIN VAN DER JEUGHT ET AL: "Intratumoral delivery of mRNA: Overcoming obstacles for effective immunotherapy", ONCOIMMUNOLOGY, vol. 4, no. 5, 3 February 2015 (2015-02-03), page e1005504, XP055463808, DOI: 10.1080/2162402X.2015.1005504
  • A. MARABELLE ET AL: "Intratumoral Immunization: A New Paradigm for Cancer Therapy", CLINICAL CANCER RESEARCH, vol. 20, no. 7, 31 March 2014 (2014-03-31) , pages 1747-1756, XP055463812, US ISSN: 1078-0432, DOI: 10.1158/1078-0432.CCR-13-2116
 
Remarks:
The complete document including Reference Tables and the Sequence Listing can be downloaded from the EPO website
 
Note: Within nine months from the publication of the mention of the grant of the European patent, any person may give notice to the European Patent Office of opposition to the European patent granted. Notice of opposition shall be filed in a written reasoned statement. It shall not be deemed to have been filed until the opposition fee has been paid. (Art. 99(1) European Patent Convention).


Description

Introduction



[0001] The present invention is defined by the attached claims and relates to an RNA containing composition comprising at least one non-coding, immunostimulating RNA for use in the treatment or prophylaxis of tumor and/or cancer diseases, wherein the RNA containing composition is to be applied intratumorally especially by injection into tumor tissue, and wherein the treatment or prophylaxis comprises the administration of a PD-1 inhibitor or a PD-L1 inhibitor, wherein the PD-1 inhibitor is an antagonistic antibody directed against PD-1 and the PD-L1 inhibitor is an antagonistic antibody directed against PD L1. The invention further provides a pharmaceutical composition comprising the RNA containing composition and a kit or kit of parts comprising the RNA containing composition for use in the treatment or prophylaxis of tumor and/or cancer diseases as defined by the claims.

[0002] Cancer, also known as malignant tumor, describes a group of diseases involving abnormal cell growth with the potential to invade or spread to other parts of the body. In 2012, about 14.1 million new cases of cancer occurred globally (not including skin cancer other than melanoma).

[0003] The standard treatments of cancer include chemotherapy, radiation und surgery, wherein these treatments are applied individually or in combination. Other treatments apply cancer immunotherapy which is focused on stimulating the immune system through vaccination or adoptive cellular immunotherapy to elicit an anti-tumor response.

[0004] Some approaches use gene therapy and genetic vaccination for treatment of cancer or other tumor diseases. Gene therapy and genetic vaccination are molecular medicine methods which are based on the introduction of nucleic acids into cells or into tissues of a patient. Subsequently the information coded by the nucleic acids introduced is processed in the organism, i.e. resulting in expression of a therapeutic peptide or protein or expression of an antigen which is coded by the nucleic acids.

[0005] Conventional gene therapeutic methods, including gene therapy and genetic vaccination are based on the use of DNA molecules in order to transfer the desired genetic information into the cell. Various methods have been developed for introducing DNA into cells, such as calcium phosphate transfection, polybrene transfection, protoplast fusion, electroporation, microinjection and lipofection. DNA viruses may likewise be used as a DNA vehicle achieving a very high transfection rate. The use of DNA entails the risk of the DNA being inserted into an intact gene of the host cell's genome by e.g. recombination. In this case the affected gene may be mutated and inactivated or may give rise to misinformation. Another risk of using DNA as a pharmaceutical agent is the risk of inducing pathogenic anti-drug antibodies(anti-DNA antibodies) in the patient, which may result in a (possibly fatal) immune response.

[0006] The use of RNA as a gene therapeutic agent or genetic vaccine is substantially safer, because RNA does not involve the risk of being integrated into the genome inducing an undesired pathogenic induction of anti-drug antibodies.

[0007] Thus RNA expression systems have considerable advantages over DNA expression systems in gene therapy and in genetic vaccination although it is known in the prior art or rather assumed for a long time that the instability of mRNA or of RNA in general may be problem in the application of medical methods based on RNA expression systems.

[0008] The instability of RNA is in particular due to RNA-degrading enzymes (ribonucleases - RNases). There are also many further processes which destabilize RNA, wherein interaction between the RNA and proteins often appears to play a crucial role. Some measures for increasing the stability of RNA have been proposed, so enabling the use thereof as a gene therapy agent or RNA vaccine.

[0009] For solving the problem of ex vivo RNA stability the European patent application EP 1 083 232 A1 describes a method for introducing RNA, in particular mRNA, into cells and organisms, in which the RNA forms a complex with a cationic peptide or protein.

[0010] The application of mRNA is known for the treatment and/or prophylaxis of cancer. For example the international patent application WO 03/051401 A2 describes a pharmaceutical composition comprising at least one mRNA, which contains at least one region that codes for an antigen from a tumor, combined with an aqueous solvent and preferably with a cytokine e.g. GM-CSF. The pharmaceutical composition is proposed to be used for therapy and/or prophylaxis against cancer.

[0011] The international patent application WO 2006/008154 A1 discloses an mRNA mixture for vaccinating against tumor diseases, wherein at least one type of mRNA contains at least one tumor antigen-coding region. At least one other mRNA contains at least one type of an immunogenic protein-coding region.

[0012] Nevertheless there is still a need for an effective treatment of tumor diseases and especially for the treatment of cancer. Therefore it is the object of the underlying invention to provide an approach for effective treatment of tumor diseases wherein tumor tissue and cancer cells are specifically destroyed.

[0013] This object is solved by the subject matter of the claims. Particularly, the object underlying the present invention is solved according to a first aspect by an RNA containing composition for use in the treatment or prophylaxis of tumor and/or cancer diseases as defined by the claims. According to further aspects of the invention the object is solved by a pharmaceutical composition and by a kit or kit of parts for use as defined by the claims.

Definitions:



[0014] For the sake of clarity and readability the following scientific background information and definitions are provided. Any technical features disclosed thereby can be part of each and every embodiment disclosed herein. Additional definitions and explanations can be provided in the context of this disclosure.

[0015] Immune system: The immune system may protect organisms from infection. If a pathogen breaks through a physical barrier of an organism and enters this organism, the innate immune system provides an immediate, but non-specific response. If pathogens evade this innate response, vertebrates possess a second layer of protection, the adaptive immune system. Here, the immune system adapts its response during an infection to improve its recognition of the pathogen. This improved response is then retained after the pathogen has been eliminated, in the form of an immunological memory, and allows the adaptive immune system to mount faster and stronger attacks each time this pathogen is encountered. According to this, the immune system comprises the innate and the adaptive immune system. Each of these two parts contains so called humoral and cellular components.

[0016] Immune response: An immune response may typically either be a specific reaction of the adaptive immune system to a particular antigen (so called specific or adaptive immune response) or an unspecific reaction of the innate immune system (so called unspecific or innate immune response).

[0017] Adaptive immune system: The adaptive immune system is composed of highly specialized, systemic cells and processes that eliminate or prevent pathogenic growth. The adaptive immune response provides the vertebrate immune system with the ability to recognize and remember specific pathogens (to generate immunity), and to mount stronger attacks each time the pathogen is encountered. The system is highly adaptable because of somatic hypermutation (a process of increased frequency of somatic mutations), and V(D)J recombination (an irreversible genetic recombination of antigen receptor gene segments). This mechanism allows a small number of genes to generate a vast number of different antigen receptors, which are then uniquely expressed on each individual lymphocyte. Because the gene rearrangement leads to an irreversible change in the DNA of each cell, all of the progeny (offspring) of that cell will then inherit genes encoding the same receptor specificity, including the Memory B cells and Memory T cells that are the keys to long-lived specific immunity. Immune network theory is a theory of how the adaptive immune system works, that is based on interactions between the variable regions of the receptors of T cells, B cells and of molecules made by T cells and B cells that have variable regions.

[0018] Adaptive immune response: The adaptive immune response is typically understood to be antigen-specific. Antigen specificity allows for the generation of responses that are tailored to specific antigens, pathogens or pathogen-infected cells. The ability to mount these tailored responses is maintained in the body by "memory cells". Should a pathogen infect the body more than once, these specific memory cells are used to quickly eliminate it. In this context, the first step of an adaptive immune response is the activation of naïve antigen-specific T cells or different immune cells able to induce an antigen-specific immune response by antigen-presenting cells. This occurs in the lymphoid tissues and organs through which naïve T cells are constantly passing. Cell types that can serve as antigen-presenting cells are inter alia dendritic cells, macrophages, and B cells. Each of these cells has a distinct function in eliciting immune responses. Dendritic cells take up antigens by phagocytosis and macropinocytosis and are stimulated by contact with e.g. a foreign antigen to migrate to the local lymphoid tissue, where they differentiate into mature dendritic cells. Macrophages ingest particulate antigens such as bacteria and are induced by infectious agents or other appropriate stimuli to express MHC molecules. The unique ability of B cells to bind and internalize soluble protein antigens via their receptors may also be important to induce T cells. Presenting the antigen on MHC molecules leads to activation of T cells which induces their proliferation and differentiation into armed effector T cells. The most important function of effector T cells is the killing of infected cells by CD8+ cytotoxic T cells and the activation of macrophages by Th1 cells which together make up cell-mediated immunity, and the activation of B cells by both Th2 and Th1 cells to produce different classes of antibody, thus driving the humoral immune response. T cells recognize an antigen by their T cell receptors which do not recognize and bind antigen directly, but instead recognize short peptide fragments e.g. of pathogen-derived protein antigens, which are bound to MHC molecules on the surfaces of other cells.

[0019] Cellular immunity/cellular immune response: Cellular immunity relates typically to the activation of macrophages, natural killer cells (NK), antigen-specific cytotoxic T-lymphocytes, and the release of various cytokines in response to an antigen. In a more general way, cellular immunity is not related to antibodies but to the activation of cells of the immune system. A cellular immune response is characterized e.g. by activating antigen-specific cytotoxic T-lymphocytes that are able to induce apoptosis in body cells displaying epitopes of an antigen on their surface, such as virus-infected cells, cells with intracellular bacteria, and cancer cells displaying tumor antigens; activating macrophages and natural killer cells, enabling them to destroy pathogens; and stimulating cells to secrete a variety of cytokines that influence the function of other cells involved in adaptive immune responses and innate immune responses.

[0020] Humoral immunity/humoral immune response: Humoral immunity refers typically to antibody production and the accessory processes that may accompany it. A humoral immune response may be typically characterized, e.g., by Th2 activation and cytokine production, germinal center formation and isotype switching, affinity maturation and memory cell generation. Humoral immunity also typically may refer to the effector functions of antibodies, which include pathogen and toxin neutralization, classical complement activation, and opsonin promotion of phagocytosis and pathogen elimination.

[0021] Innate immune system: The innate immune system, also known as non-specific immune system, comprises the cells and mechanisms that defend the host from infection by other organisms in a non-specific manner. This means that the cells of the innate system recognize and respond to pathogens in a generic way, but unlike the adaptive immune system, it does not confer long-lasting or protective immunity to the host. The innate immune system may be e.g. activated by ligands of pathogen-associated molecular patterns (PAMP) receptors, e.g. Toll-like receptors (TLRs) or other auxiliary substances such as lipopolysaccharides, TNF-alpha, CD40 ligand, or cytokines, monokines, lymphokines, interleukins or chemokines, immunostimulatory nucleic acids, immunostimulatory RNA (isRNA), CpG-DNA, antibacterial agents, or anti-viral agents. Typically a response of the innate immune system includes recruiting immune cells to sites of infection, through the production of chemical factors, including specialized chemical mediators, called cytokines; activation of the complement cascade; identification and removal of foreign substances present in organs, tissues, the blood and lymph, by specialized white blood cells; activation of the adaptive immune system through a process known as antigen presentation; and/or acting as a physical and chemical barrier to infectious agents.

[0022] Adjuvant/adjuvant component: An adjuvant or an adjuvant component in the broadest sense is typically a (e.g. pharmacological or immunological) agent or composition that may modify, e.g. enhance, the efficacy of other agents, such as a drug or vaccine. Conventionally the term refers in the context of the present disclosure to a compound or composition that serves as a carrier or auxiliary substance for immunogens and/or other pharmaceutically active compounds. It is to be interpreted in a broad sense and refers to a broad spectrum of substances that are able to increase the immunogenicity of antigens incorporated into or co-administered with an adjuvant in question. In the context of the present disclosure, an adjuvant will preferably enhance the specific immunogenic effect of the active agents disclosed herein. Typically, "adjuvant" or "adjuvant component" has the same meaning and can be used mutually. Adjuvants may be divided, e.g., into immuno potentiators, antigenic delivery systems or even combinations thereof.

[0023] The term "adjuvant" is typically understood not to comprise agents which confer immunity by themselves. An adjuvant assists the immune system unspecifically to enhance the antigen-specific immune response by e.g. promoting presentation of an antigen to the immune system or induction of an unspecific innate immune response. Furthermore, an adjuvant may preferably e.g. modulate the antigen-specific immune response by e.g. shifting the dominating Th2-based antigen specific response to a more Th1-based antigen specific response or vice versa. Accordingly, an adjuvant may favourably modulate cytokine expression/secretion, antigen presentation, type of immune response etc.

[0024] Immunostimulatory/immunostimulating RNA: An immunostimulatory/immunostimulating RNA (isRNA) in the context of the present disclosure may typically be a RNA that is able to induce an innate immune response itself. It usually does not have an open reading frame and thus does not provide a peptide-antigen or immunogen but elicits an innate immune response e.g. by binding to a specific kind of Toll-like-receptor (TLR) or other suitable receptors. _Therefore immunostimulatory/immunostimulating RNAs are preferably non-coding RNAs. However, of course also mRNAs having an open reading frame and coding for a peptide/protein (e.g. an antigenic function) may induce an innate immune response.

[0025] Antigen: The term "antigen" refers typically to a substance which may be recognized by the immune system and may be capable of triggering an antigen-specific immune response, e.g. by formation of antibodies or antigen-specific T-cells as part of an adaptive immune response. An antigen may be a protein or peptide. In this context, the first step of an adaptive immune response is the activation of naïve antigen-specific T cells by antigen-presenting cells. This occurs in the lymphoid tissues and organs through which naïve T cells are constantly passing. The three cell types that can serve as antigen-presenting cells are dendritic cells, macrophages, and B cells. Each of these cells has a distinct function in eliciting immune responses. Tissue dendritic cells take up antigens by phagocytosis and macropinocytosis and are stimulated by infection to migrate to the local lymphoid tissue, where they differentiate into mature dendritic cells. Macrophages ingest particulate antigens such as bacteria and are induced by infectious agents to express MHC class II molecules. The unique ability of B cells to bind and internalize soluble protein antigens via their receptors may be important to induce T cells. By presenting the antigen on MHC molecules leads to activation of T cells which induces their proliferation and differentiation into armed effector T cells. The most important function of effector T cells is the killing of infected cells by CD8+ cytotoxic T cells and the activation of macrophages by Th1 cells which together make up cell-mediated immunity, and the activation of B cells by both Th2 and Th1 cells to produce different classes of antibody, thus driving the humoral immune response. T cells recognize an antigen by their T cell receptors which does not recognize and bind antigen directly, but instead recognize short peptide fragments e.g. of pathogens' protein antigens, which are bound to MHC molecules on the surfaces of other cells.

[0026] T cells fall into two major classes that have different effector functions. The two classes are distinguished by the expression of the cell-surface proteins CD4 and CD8. These two types of T cells differ in the class of MHC molecule that they recognize. There are two classes of MHC molecules - MHC class I and MHC class II molecules - which differ in their structure and expression pattern on tissues of the body. CD4+ T cells bind to a MHC class II molecule and CD8+ T cells to a MHC class I molecule. MHC class I and MHC class II molecules have distinct distributions among cells that reflect the different effector functions of the T cells that recognize them. MHC class I molecules present peptides of cytosolic and nuclear origin e.g. from pathogens, commonly viruses, to CD8+ T cells, which differentiate into cytotoxic T cells that are specialized to kill any cell that they specifically recognize. Almost all cells express MHC class I molecules, although the level of constitutive expression varies from one cell type to the next. But not only pathogenic peptides from viruses are presented by MHC class I molecules, also self-antigens like tumor antigens are presented by them. MHC class I molecules bind peptides from proteins degraded in the cytosol and transported in the endoplasmic reticulum. The CD8+ T cells that recognize MHC class I:peptide complexes at the surface of infected cells are specialized to kill any cells displaying foreign peptides and so rid the body of cells infected with viruses and other cytosolic pathogens. The main function of CD4+ T cells (CD4+ helper T cells) that recognize MHC class II molecules is to activate other effector cells of the immune system. Thus MHC class II molecules are normally found on B lymphocytes, dendritic cells, and macrophages, cells that participate in immune responses, but not on other tissue cells. Macrophages, for example, are activated to kill the intravesicular pathogens they harbour, and B cells to secrete immunoglobulins against foreign molecules. MHC class II molecules are prevented from binding to peptides in the endoplasmic reticulum and thus MHC class II molecules bind peptides from proteins which are degraded in endosomes. They can capture peptides from pathogens that have entered the vesicular system of macrophages, or from antigens internalized by immature dendritic cells or the immunoglobulin receptors of B cells. Pathogens that accumulate in large numbers inside macrophage and dendritic cell vesicles tend to stimulate the differentiation of Th1 cells, whereas extracellular antigens tend to stimulate the production of Th2 cells. Th1 cells activate the microbicidal properties of macrophages and induce B cells to make IgG antibodies that are very effective of opsonising extracellular pathogens for ingestion by phagocytic cells, whereas Th2 cells initiate the humoral response by activating naive B cells to secrete IgM, and induce the production of weakly opsonising antibodies such as IgG1 and IgG3 (mouse) and IgG2 and IgG4 (human) as well as IgA and IgE (mouse and human).

[0027] Epitope (also called "antigen determinant"): T cell epitopes may comprise fragments preferably having a length of about 6 to about 20 or even more amino acids, e.g. fragments as processed and presented by MHC class I molecules, preferably having a length of about 8 to about 10 amino acids, e.g. 8, 9, or 10, (or even 11, or 12 amino acids), or fragments as processed and presented by MHC class II molecules, preferably having a length of about 13 or more amino acids, e.g. 13, 14, 15, 16, 17, 18, 19, 20 or even more amino acids, wherein these fragments may be selected from any part of the amino acid sequence. These fragments are typically recognized by T cells in form of a complex consisting of the peptide fragment and an MHC molecule. B cell epitopes are typically fragments located on the outer surface of (native) protein or peptide antigens.

[0028] Vaccine: A vaccine is typically understood to be a prophylactic or therapeutic material providing at least one antigen or antigenic function. The antigen or antigenic function may stimulate the body's adaptive immune system to provide an adaptive immune response.

[0029] Antigen-providing mRNA: An antigen-providing mRNA may typically be an mRNA, having at least one open reading frame that can be translated by a cell or an organism provided with that mRNA. The product of this translation is a peptide or protein that may act as an antigen, preferably as an immunogen. The product may also be a fusion protein composed of more than one immunogen, e.g. a fusion protein that consist of two or more epitopes, peptides or proteins, wherein the epitopes, peptides or proteins may be linked by linker sequences.

[0030] Bi-/multicistronic mRNA: An bi-/multicistronic mRNA typically may have two (bicistronic) or more (multicistronic) coding sequences (cds) (also often referred to as open reading frames (ORF)). A coding sequence/an open reading frame in this context is a sequence of several nucleotide triplets (codons) that can be translated into a peptide or protein. Translation of such an mRNA yields two (bicistronic) or more (multicistronic) distinct translation products (provided the coding sequences/ORFs are not identical). For expression in eukaryotes such mRNAs may for example comprise an internal ribosomal entry site (IRES) sequence.

[0031] 5'-CAP-Structure: A 5'-CAP is typically a modified nucleotide (CAP analogue), particularly a guanine nucleotide, added to the 5' end of an mRNA molecule. Preferably, the 5'-CAP is added using a 5'-5'-triphosphate linkage (also named m7GpppN). Further examples of 5'-CAP structures include glyceryl, inverted deoxy abasic residue (moiety), 4',5' methylene nucleotide, 1-(beta-D-erythrofuranosyl) nucleotide, 4'-thio nucleotide, carbocyclic nucleotide, 1,5-anhydrohexitol nucleotide, L-nucleotides, alpha-nucleotide, modified base nucleotide, threo-pentofuranosyl nucleotide, acyclic 3',4'-seco nucleotide, acyclic 3,4-dihydroxybutyl nucleotide, acyclic 3,5 dihydroxypentyl nucleotide, 3'-3'-inverted nucleotide moiety, 3'-3'-inverted abasic moiety, 3'-2'-inverted nucleotide moiety, 3'-2'-inverted abasic moiety, 1,4-butanediol phosphate, 3'-phosphoramidate, hexylphosphate, aminohexyl phosphate, 3'-phosphate, 3'phosphorothioate, phosphorodithioate, or bridging or non-bridging methylphosphonate moiety. These modified 5'-CAP structures may be used in the context of the present disclosure to modify the mRNA sequence of the composition described herein. Further modified 5'-CAP structures which may be used in the context of the present disclosure are CAP1 (additional methylation of the ribose of the adjacent nucleotide of m7GpppN), CAP2 (additional methylation of the ribose of the 2nd nucleotide downstream of the m7GpppN), CAP3 (additional methylation of the ribose of the 3rd nucleotide downstream of the m7GpppN), CAP4 (additional methylation of the ribose of the 4th nucleotide downstream of the m7GpppN), ARCA (anti-reverse CAP analogue), modified ARCA (e.g. phosphothioate modified ARCA), inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.

[0032] In the context of the present disclosure, a 5' cap structure may also be formed in chemical RNA synthesis or RNA in vitro transcription (co-transcriptional capping) using cap analogues, or a cap structure may be formed in vitro using capping enzymes (e.g., commercially available capping kits)

[0033] Cap analogue: A cap analogue refers to a non-polymerizable di-nucleotide that has cap functionality in that it facilitates translation or localization, and/or prevents degradation of the RNA molecule when incorporated at the 5' end of the RNA molecule. Non-polymerizable means that the cap analogue will be incorporated only at the 5'terminus because it does not have a 5' triphosphate and therefore cannot be extended in the 3' direction by a template-dependent RNA polymerase.

[0034] Cap analogues include, but are not limited to, a chemical structure selected from the group consisting of m7GpppG, m7GpppA, m7GpppC; unmethylated cap analogues (e.g., GpppG); dimethylated cap analogue (e.g., m2,7GpppG), trimethylated cap analogue (e.g., m2,2,7GpppG), dimethylated symmetrical cap analogues (e.g., m7Gpppm7G), or anti reverse cap analogues (e.g., ARCA; m7,2'OmeGpppG, m7,2'dGpppG, m7,3'OmeGpppG, m7,3'dGpppG and their tetraphosphate derivatives) (Stepinski et al., 2001. RNA 7(10):1486-95).

[0035] Further cap analogues have been described previously (US 7,074,596, WO 2008/016473, WO 2008/157688, WO 2009/149253, WO 2011/015347, and WO 2013/059475). The synthesis of N7-(4-chlorophenoxyethyl) substituted dinucleotide cap analogues has been described recently (Kore et al. (2013) Bioorg. Med. Chem. 21(15): 4570-4).

[0036] Fragments of proteins: "Fragments" of proteins or peptides in the context of the present disclosure may, typically, comprise a sequence of a protein or peptide as defined herein, which is, with regard to its amino acid sequence (or its encoded nucleic acid molecule), N-terminally and/or C-terminally truncated compared to the amino acid sequence of the original (native) protein (or its encoded nucleic acid molecule). Such truncation may thus occur either on the amino acid level or correspondingly on the nucleic acid level. A sequence identity with respect to such a fragment as defined herein may therefore preferably refer to the entire protein or peptide as defined herein or to the entire (coding) nucleic acid molecule of such a protein or peptide. In the context of antigens such fragment may have a length of about 6 to about 20 or even more amino acids, e.g. fragments as processed and presented by MHC class I molecules, preferably having a length of about 8 to about 10 amino acids, e.g. 8, 9, or 10, (or even 6, 7, 11, or 12 amino acids), or fragments as processed and presented by MHC class II molecules, preferably having a length of about 13 or more amino acids, e.g. 13, 14, 15, 16, 17, 18, 19,20 or even more amino acids, wherein these fragments may be selected from any part of the amino acid sequence. These fragments are typically recognized by T-cells in form of a complex consisting of the peptide fragment and an MHC molecule, i.e. the fragments are typically not recognized in their native form. Fragments of proteins or peptides (e.g. in the context of antigens) may comprise at least one epitope of those proteins or peptides. Furthermore also domains of a protein, like the extracellular domain, the intracellular domain or the transmembrane domain and shortened or truncated versions of a protein may be understood to comprise a fragment of a protein. Preferably, a fragment of a protein comprises a functional fragment of the protein, which means that the fragment exerts the same effect or functionality as the whole protein it is derived from.

[0037] Variants of proteins: "Variants" of proteins or peptides as defined in the context of the present disclosure may be generated, having an amino acid sequence which differs from the original sequence in one or more mutation(s), such as one or more substituted, inserted and/or deleted amino acid(s). Preferably, these fragments and/or variants have the same biological function or specific activity compared to the full-length native protein, e.g. its specific antigenic property. "Variants" of proteins or peptides as defined in the context of the present disclosure may comprise conservative amino acid substitution(s) compared to their native, i.e. non-mutated physiological, sequence. Those amino acid sequences as well as their encoding nucleotide sequences in particular fall under the term variants as defined herein. Substitutions in which amino acids, which originate from the same class, are exchanged for one another are called conservative substitutions. In particular, these are amino acids having aliphatic side chains, positively or negatively charged side chains, aromatic groups in the side chains or amino acids, the side chains of which can enter into hydrogen bridges, e.g. side chains which have a hydroxyl function. This means that e.g. an amino acid having a polar side chain is replaced by another amino acid having a likewise polar side chain, or, for example, an amino acid characterized by a hydrophobic side chain is substituted by another amino acid having a likewise hydrophobic side chain (e.g. serine (threonine) by threonine (serine) or leucine (isoleucine) by isoleucine (leucine)). Insertions and substitutions are possible, in particular, at those sequence positions which cause no modification to the three-dimensional structure or do not affect the binding region. Modifications to a three-dimensional structure by insertion(s) or deletion(s) can easily be determined e.g. using CD spectra (circular dichroism spectra) (Urry, 1985, Absorption, Circular Dichroism and ORD of Polypeptides, in: Modern Physical Methods in Biochemistry, Neuberger et al. (ed.), Elsevier, Amsterdam).

[0038] A "variant" of a protein or peptide may have at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% amino acid identity over a stretch of 10, 20, 30, 50, 75 or 100 amino acids of such protein or peptide. Furthermore, variants of proteins or peptides as defined herein, which may be encoded by a nucleic acid molecule, may also comprise those sequences, wherein nucleotides of the encoding nucleic acid sequence are exchanged according to the degeneration of the genetic code, without leading to an alteration of the respective amino acid sequence of the protein or peptide, i.e. the amino acid sequence or at least part thereof may not differ from the original sequence within the above meaning.

[0039] Preferably, a variant of a protein comprises a functional variant of the protein, which means that the variant exerts the same effect or functionality as the protein it is derived from.

[0040] Identity of a sequence: In order to determine the percentage to which two sequences are identical, e.g. nucleic acid sequences or amino acid sequences as defined herein, preferably the amino acid sequences encoded by a nucleic acid sequence of the polymeric carrier as defined herein or the amino acid sequences themselves, the sequences can be aligned in order to be subsequently compared to one another. Therefore, e.g. a position of a first sequence may be compared with the corresponding position of the second sequence. If a position in the first sequence is occupied by the same component (residue) as is the case at a position in the second sequence, the two sequences are identical at this position. If this is not the case, the sequences differ at this position. If insertions occur in the second sequence in comparison to the first sequence, gaps can be inserted into the first sequence to allow a further alignment. If deletions occur in the second sequence in comparison to the first sequence, gaps can be inserted into the second sequence to allow a further alignment. The percentage to which two sequences are identical is then a function of the number of identical positions divided by the total number of positions including those positions which are only occupied in one sequence. The percentage to which two sequences are identical can be determined using a mathematical algorithm. A preferred, but not limiting, example of a mathematical algorithm which can be used is the algorithm of Karlin et al. (1993), PNAS USA, 90:5873-5877 or Altschul et al. (1997), Nucleic Acids Res., 25:3389-3402. Such an algorithm is integrated in the BLAST program. Sequences which are identical to the sequences of the present disclosure to a certain extent can be identified by this program.

[0041] Monocistronic mRNA: A monocistronic mRNA may typically be an mRNA, that comprises only one coding sequence (open reading frame). A coding sequence/open reading frame in this context is a sequence of several nucleotide triplets (codons) that can be translated into a peptide or protein. Nucleic acid: The term nucleic acid means any DNA or RNA molecule and is used synonymous with polynucleotide. Wherever herein reference is made to a nucleic acid or nucleic acid sequence encoding a particular protein and/or peptide, said nucleic acid or nucleic acid sequence, respectively, preferably also comprises regulatory sequences allowing in a suitable host, e.g. a human being, its expression, i.e. transcription and/or translation of the nucleic acid sequence encoding the particular protein or peptide.

[0042] Peptide: A peptide is a polymer of amino acid monomers. Usually the monomers are linked by peptide bonds. The term "peptide" does not limit the length of the polymer chain of amino acids. In some embodiments disclosed herein a peptide may for example contain less than 50 monomer units. Longer peptides are also called polypeptides, typically having 50 to 600 monomeric units, more specifically 50 to 300 monomeric units.

[0043] Pharmaceutically effective amount: A pharmaceutically effective amount in the context of the present disclosure is typically understood to be an amount that is sufficient to induce an immune response or to trigger the desired therapeutical effect.

[0044] Protein: A protein typically consists of one or more peptides and/or polypeptides folded into 3-dimensional form, facilitating a biological function.

[0045] Poly(C) sequence: A poly(C) sequence is typically a long sequence of cytosine nucleotides, typically about 10 to about 200 cytosine nucleotides, preferably about 10 to about 100 cytosine nucleotides, more preferably about 10 to about 70 cytosine nucleotides or even more, preferably about 20 to about 50, or even about 20 to about 30 cytosine nucleotides. A poly(C) sequence may preferably be located 3' of the coding region comprised by a nucleic acid.

[0046] Poly(A) tail: A poly(A) tail also called "3'-poly(A) tail" or "Poly(A) sequence" is typically a long homopolymeric sequence of adenosine nucleotides of up to about 400 adenosine nucleotides, e.g. from about 25 to about 400, preferably from about 50 to about 400, more preferably from about 50 to about 300, even more preferably from about 50 to about 250, most preferably from about 60 to about 250 adenosine nucleotides, added to the 3' end of an mRNA. In the context of the present disclosure, the poly(A) tail of an mRNA is preferably derived from a DNA template by RNA in vitro transcription. Alternatively, the poly(A) sequence may also be obtained in vitro by common methods of chemical synthesis without being necessarily transcribed from a DNA-progenitor. Moreover, poly(A) sequences, or poly(A) tails may be generated by enzymatic polyadenylation of the RNA.

[0047] Stabilized nucleic acid: A stabilized nucleic acid, typically, exhibits a modification increasing resistance to in vivo degradation (e.g. degradation by an exo- or endo-nuclease) and/or ex vivo degradation (e.g. by the manufacturing process prior to vaccine administration, e.g. in the course of the preparation of the vaccine solution to be administered). Stabilization of RNA can, e.g., be achieved by providing a 5'-CAP-Structure, a poly(A) tail, or any other UTR-modification. It can also be achieved by backbone-modification or modification of the G/C-content or the C-content of the nucleic acid. Various other methods are known in the art and conceivable in the context of the present disclosure.

[0048] Carrier/polymeric carrier: A carrier in the context of the present disclosure may typically be a compound that facilitates transport and/or complexation of another compound. Said carrier may form a complex with said other compound. A polymeric carrier is a carrier that is formed of a polymer.

[0049] Cationic component: The term "cationic component" typically refers to a charged molecule, which is positively charged (cation) at a pH value of typically about 1 to 9, preferably of a pH value of or below 9 (e.g. 5 to 9), of or below 8 (e.g. 5 to 8), of or below 7 (e.g. 5 to 7), most preferably at physiological pH values, e.g. about 7.3 to 7.4. Accordingly, a cationic peptide, protein or polymer according to the present disclosure is positively charged under physiological conditions, particularly under physiological salt conditions of the cell in vivo. A cationic peptide or protein preferably contains a larger number of cationic amino acids, e.g. a larger number of Arg, His, Lys or Orn than other amino acid residues (in particular more cationic amino acids than anionic amino acid residues like Asp or Glu) or contains blocks predominantly formed by cationic amino acid residues. The definition "cationic" may also refer to "polycationic" components.

[0050] Vehicle: A vehicle is an agent, e.g. a carrier, that may typically be used within a pharmaceutical composition or vaccine for facilitating administering of the components of the pharmaceutical composition or vaccine to an individual.

[0051] 3'-untranslated region (3'-UTR): A 3'-UTR is typically the part of an mRNA which is located between the protein coding region (i.e. the open reading frame) and the poly(A) sequence of the mRNA. A 3'-UTR of the mRNA is not translated into an amino acid sequence. The 3'-UTR sequence is generally encoded by the gene which is transcribed into the respective mRNA during the gene expression process. The genomic sequence is first transcribed into pre-mature mRNA, which comprises optional introns. The pre-mature mRNA is then further processed into mature mRNA in a maturation process. This maturation process comprises the steps of 5'-capping, splicing the pre-mature mRNA to excise optional introns and modifications of the 3'-end, such as polyadenylation of the 3'-end of the pre-mature mRNA and optional endo- or exonuclease cleavages etc. In the context of the present disclosure, a 3'-UTR corresponds to the sequence of a mature mRNA which is located 3' to the stop codon of the protein coding region, preferably immediately 3' to the stop codon of the protein coding region, and which extends to the 5'-side of the poly(A) sequence, preferably to the nucleotide immediately 5' to the poly(A) sequence. The term "corresponds to" means that the 3'-UTR sequence may be an RNA sequence, such as in the mRNA sequence used for defining the 3'-UTR sequence, or a DNA sequence which corresponds to such RNA sequence. In the context of the present disclosure, the term "a 3'-UTR of a gene", such as "a 3'-UTR of an albumin gene", is the sequence which corresponds to the 3'-UTR of the mature mRNA derived from this gene, i.e. the mRNA obtained by transcription of the gene and maturation of the pre-mature mRNA. The term "3'-UTR of a gene" encompasses the DNA sequence and the RNA sequence of the 3'-UTR.

[0052] 5'-untranslated region (5'-UTR): A 5'-UTR is typically understood to be a particular section of messenger RNA (mRNA). It is located 5' of the open reading frame of the mRNA. Typically, the 5'-UTR starts with the transcriptional start site and ends one nucleotide before the start codon of the open reading frame. The 5'-UTR may comprise elements for controlling gene expression, also called regulatory elements. Such regulatory elements may be, for example, ribosomal binding sites or a 5'-Terminal Oligopyrimidine Tract. The 5'-UTR may be posttranscriptionally modified, for example by addition of a 5'-CAP. In the context of the present disclosure, a 5'UTR corresponds to the sequence of a mature mRNA which is located between the 5'-CAP and the start codon. Preferably, the 5'-UTR corresponds to the sequence which extends from a nucleotide located 3' to the 5'-CAP, preferably from the nucleotide located immediately 3' to the 5'-CAP, to a nucleotide located 5' to the start codon of the protein coding region, preferably to the nucleotide located immediately 5' to the start codon of the protein coding region. The nucleotide located immediately 3' to the 5'-CAP of a mature mRNA typically corresponds to the transcriptional start site. The term "corresponds to" means that the 5'-UTR sequence may be an RNA sequence, such as in the mRNA sequence used for defining the 5'-UTR sequence, or a DNA sequence which corresponds to such RNA sequence. In the context of the present disclosure, the term "a 5'-UTR of a gene", such as "a 5'-UTR of a TOP gene", is the sequence which corresponds to the 5'-UTR of the mature mRNA derived from this gene, i.e. the mRNA obtained by transcription of the gene and maturation of the pre-mature mRNA. The term "5'-UTR of a gene" encompasses the DNA sequence and the RNA sequence of the 5'-UTR.

[0053] 5' Terminal Oligopyrimidine Tract (TOP): The 5' terminal oligopyrimidine tract (TOP) is typically a stretch of pyrimidine nucleotides located at the 5' terminal region of a nucleic acid molecule, such as the 5' terminal region of certain mRNA molecules or the 5' terminal region of a functional entity, e.g. the transcribed region, of certain genes. The sequence starts with a cytidine, which usually corresponds to the transcriptional start site, and is followed by a stretch of usually about 3 to 30 pyrimidine nucleotides. For example, the TOP may comprise 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or even more nucleotides. The pyrimidine stretch and thus the 5' TOP ends one nucleotide 5' to the first purine nucleotide located downstream of the TOP. mRNA that contains a 5' terminal oligopyrimidine tract is often referred to as TOP mRNA. Accordingly, genes that provide such messenger RNAs are referred to as TOP genes. TOP sequences have, for example, been found in genes and mRNAs encoding peptide elongation factors and ribosomal proteins.

[0054] TOP motif: In the context of the present disclosure, a TOP motif is a nucleic acid sequence which corresponds to a 5' TOP as defined above. Thus, a TOP motif in the context of the present disclosure is preferably a stretch of pyrimidine nucleotides having a length of 3-30 nucleotides. Preferably, the TOP-motif consists of at least 3 pyrimidine nucleotides, preferably at least 4 pyrimidine nucleotides, preferably at least 5 pyrimidine nucleotides, more preferably at least 6 nucleotides, more preferably at least 7 nucleotides, most preferably at least 8 pyrimidine nucleotides, wherein the stretch of pyrimidine nucleotides preferably starts at its 5' end with a cytosine nucleotide. In TOP genes and TOP mRNAs, the TOP-motif preferably starts at its 5' end with the transcriptional start site and ends one nucleotide 5' to the first purine residue in said gene or mRNA. A TOP motif in the sense of the present disclosure is preferably located at the 5'end of a sequence which represents a 5'-UTR or at the 5' end of a sequence which codes for a 5'-UTR. Thus, preferably, a stretch of 3 or more pyrimidine nucleotides is called "TOP motif" in the sense of the present disclosure if this stretch is located at the 5' end of a respective sequence, such as the mRNA described herein, the 5'-UTR element of the mRNA described herein, or the nucleic acid sequence which is derived from the 5'-UTR of a TOP gene as described herein. In other words, a stretch of 3 or more pyrimidine nucleotides which is not located at the 5'-end of a 5'-UTR or a 5'-UTR element but anywhere within a 5'-UTR or a 5'-UTR element is preferably not referred to as "TOP motif".

[0055] TOP gene: TOP genes are typically characterised by the presence of a 5' terminal oligopyrimidine tract. Furthermore, most TOP genes are characterized by a growth-associated translational regulation. However, also TOP genes with a tissue specific translational regulation are known. As defined above, the 5'-UTR of a TOP gene corresponds to the sequence of a 5'-UTR of a mature mRNA derived from a TOP gene, which preferably extends from the nucleotide located 3' to the 5'-CAP to the nucleotide located 5' to the start codon. A 5'-UTR of a TOP gene typically does not comprise any start codons, preferably no upstream AUGs (uAUGs) or upstream open reading frames (uORFs). Therein, upstream AUGs and upstream open reading frames are typically understood to be AUGs and open reading frames that occur 5' of the start codon (AUG) of the open reading frame that should be translated. The 5'-UTRs of TOP genes are generally rather short. The lengths of 5'-UTRs of TOP genes may vary between 20 nucleotides up to 500 nucleotides, and are typically less than about 200 nucleotides, preferably less than about 150 nucleotides, more preferably less than about 100 nucleotides. Exemplary 5'-UTRs of TOP genes in the sense of the present disclosure are the nucleic acid sequences extending from the nucleotide at position 5 to the nucleotide located immediately 5' to the start codon (e.g. the ATG) in the sequences according to SEQ ID Nos. 1-1363, SEQ ID NO. 1395, SEQ ID NO. 1421 and SEQ ID NO. 1422 of the international patent application WO2013/143700 or homologs or variants thereof. In this context a particularly preferred fragment of a 5'UTR of a TOP gene is a 5'-UTR of a TOP gene lacking the 5' TOP motif. The term '5'UTR of a TOP gene' preferably refers to the 5'-UTR of a naturally occurring TOP gene.

[0056] Chemical synthesis of RNA: Chemical synthesis of relatively short fragments of oligonucleotides with defined chemical structure provides a rapid and inexpensive access to custom-made oligonucleotides of any desired sequence. Whereas enzymes synthesize DNA and RNA only in the 5' to 3' direction, chemical oligonucleotide synthesis does not have this limitation, although it is most often carried out in the opposite, i.e. the 3' to 5' direction. Currently, the process is implemented as solid-phase synthesis using the phosphoramidite method and phosphoramidite building blocks derived from protected nucleosides (A, C, G, and U), or chemically modified nucleosides.

[0057] To obtain the desired oligonucleotide, the building blocks are sequentially coupled to the growing oligonucleotide chain on a solid phase in the order required by the sequence of the product in a fully automated process. Upon the completion of the chain assembly, the product is released from the solid phase to the solution, deprotected, and collected. The occurrence of side reactions sets practical limits for the length of synthetic oligonucleotides (up to about 200 nucleotide residues), because the number of errors increases with the length of the oligonucleotide being synthesized. Products are often isolated by HPLC to obtain the desired oligonucleotides in high purity.

[0058] Chemically synthesized oligonucleotides find a variety of applications in molecular biology and medicine. They are most commonly used as antisense oligonucleotides, small interfering RNA, primers for DNA sequencing and amplification, probes for detecting complementary DNA or RNA via molecular hybridization, tools for the targeted introduction of mutations and restriction sites, and for the synthesis of artificial genes.

[0059] RNA In vitro transcription: The terms "RNA in vitro transcription" or "in vitro transcription" relate to a process wherein RNA is synthesized in a cell-free system (in vitro). DNA, particularly plasmid DNA, is used as template for the generation of RNA transcripts. RNA may be obtained by DNA-dependent in vitro transcription of an appropriate DNA template, which according to the present disclosure is preferably a linearized plasmid DNA template. The promoter for controlling in vitro transcription can be any promoter for any DNA-dependent RNA polymerase. Particular examples of DNA-dependent RNA polymerases are the T7, T3, and SP6 RNA polymerases. A DNA template for in vitro RNA transcription may be obtained by cloning of a nucleic acid, in particular cDNA corresponding to the respective RNA to be in vitro transcribed, and introducing it into an appropriate vector for in vitro transcription, for example into plasmid DNA. In a preferred embodiment disclosed herein, the DNA template is linearized with a suitable restriction enzyme, before it is transcribed in vitro. The cDNA may be obtained by reverse transcription of mRNA or chemical synthesis. Moreover, the DNA template for in vitro RNA synthesis may also be obtained by gene synthesis.

[0060] Methods for in vitro transcription are known in the art (see, e.g., Geall et al. (2013) Semin. Immunol. 25(2): 152-159; Brunelle et al. (2013) Methods Enzymol. 530:101-14). Reagents used in said method typically include:
  1. 1) a linearized DNA template with a promoter sequence that has a high binding affinity for its respective RNA polymerase such as bacteriophage-encoded RNA polymerases;
  2. 2) ribonucleoside triphosphates (NTPs) for the four bases (adenine, cytosine, guanine and uracil);
  3. 3) optionally a cap analogue as defined above (e.g. m7G(5')ppp(5')G (m7G));
  4. 4) a DNA-dependent RNA polymerase capable of binding to the promoter sequence within the linearized DNA template (e.g. T7, T3 or SP6 RNA polymerase);
  5. 5) optionally a ribonuclease (RNase) inhibitor to inactivate any contaminating RNase;
  6. 6) optionally a pyrophosphatase to degrade pyrophosphate, which may inhibit transcription;
  7. 7) MgCl2, which supplies Mg2+ ions as a co-factor for the polymerase;
  8. 8) a buffer to maintain a suitable pH value, which can also contain antioxidants (e.g. DTT), and/or polyamines such as spermidine at optimal concentrations.


[0061] RNA, mRNA: RNA is the usual abbreviation for ribonucleic acid. It is a nucleic acid molecule, i.e. a polymer consisting of nucleotide monomers. These nucleotides are usually adenosine monophosphate (AMP), uridine monophosphate (UMP), guanosine monophosphate (GMP) and cytidine monophosphate (CMP) monomers or analogues thereof, which are connected to each other along a so-called backbone. The backbone is formed by phosphodiester bonds between the sugar, i.e. ribose, of a first and a phosphate moiety of a second, adjacent monomer. The specific order of the monomers, i.e. the order of the bases linked to the sugar/phosphate-backbone, is called the RNA sequence. Usually RNA may be obtainable by transcription of a DNA sequence, e.g., inside a cell. In eukaryotic cells, transcription is typically performed inside the nucleus or the mitochondria. In vivo, transcription of DNA usually results in the so-called premature RNA (also called pre-mRNA, precursor mRNA or heterogeneous nuclear RNA) which has to be processed into so-called messenger RNA, usually abbreviated as mRNA. Processing of the premature RNA, e.g. in eukaryotic organisms, comprises a variety of different posttranscriptional modifications such as splicing, 5'-capping, polyadenylation, export from the nucleus or the mitochondria and the like. The sum of these processes is also called maturation of RNA. The mature messenger RNA usually provides the nucleotide sequence that may be translated into an amino acid sequence of a particular peptide or protein. Typically, a mature mRNA comprises a 5'-cap, optionally a 5'UTR, an open reading frame, optionally a 3'UTR and a poly(A) tail.

[0062] In addition to messenger RNA, several non-coding types of RNA exist which may be involved in regulation of transcription and/or translation, and immunostimulation. Within the present disclosure, the term "RNA" further encompasses any type of single stranded (ssRNA) or double stranded RNA (dsRNA) molecule known in the art, such as viral RNA, retroviral RNA and replicon RNA, small interfering RNA (siRNA), antisense RNA (asRNA), circular RNA (circRNA), ribozymes, aptamers, riboswitches, immunostimulating/immunostimulatory RNA, transfer RNA (tRNA), ribosomal RNA (rRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), microRNA (miRNA), and Piwi-interacting RNA (piRNA).

[0063] Fragment of a nucleic acid sequence, particularly an RNA: A fragment of a nucleic acid sequence consists of a continuous stretch of nucleotides corresponding to a continuous stretch of nucleotides in the full-length nucleic acid sequence which is the basis for the nucleic acid sequence of the fragment, which represents at least 20%, preferably at least 30%, more preferably at least 40%, more preferably at least 50%, even more preferably at least 60%, even more preferably at least 70%, even more preferably at least 80%, and most preferably at least 90% of the full-length nucleic acid sequence. Such a fragment, in the sense of the present disclosure, is preferably a functional fragment of the full-length nucleic acid sequence.

[0064] Variant of a nucleic acid sequence, particularly anRNA: A variant of a nucleic acid sequence refers to a variant of nucleic acid sequences which forms the basis of a nucleic acid sequence. For example, a variant nucleic acid sequence may exhibit one or more nucleotide deletions, insertions, additions and/or substitutions compared to the nucleic acid sequence from which the variant is derived. Preferably, a variant of a nucleic acid sequence is at least 40%, preferably at least 50%, more preferably at least 60%, more preferably at least 70%, even more preferably at least 80%, even more preferably at least 90%, most preferably at least 95% identical to the nucleic acid sequence the variant is derived from. Preferably, the variant is a functional variant. A "variant" of a nucleic acid sequence may have at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% nucleotide identity over a stretch of 10, 20, 30, 50, 75 or 100 nucleotide of such nucleic acid sequence.

[0065] Intratumoral administration/application: The term "intratumoral administration/application" refers to the direct delivery of a pharmaceutical composition into or adjacent to a tumor or cancer and/or immediate vicinity of a tumor or cancer. Multiple injections into separate regions of the tumor or cancer are also included. Furthermore, intratumoral administration/application includes delivery of a pharmaceutical composition into one or more metastases.

[0066] Methods for intratumoral delivery of drugs are known in the art (Brincker, 1993. Crit. Rev. Oncol. Hematol. 15(2):91-8; Celikoglu et al., 2008. Cancer Therapy 6, 545-552). For example, the pharmaceutical composition can be administered by conventional needle injection, needle-free jet injection or electroporation or combinations thereof into the tumor or cancer tissue. The pharmaceutical composition can be injected directly into the tumor or cancer (tissue) with great precision using computer tomograpy, ultrasound, gamma camera imaging, positron emission tomography, or magnetic resonance tumor imaging. Further procedures are selected from the group including, but not limited to, direct intratumoral injection by endoscopy, bronchoscopy, cystoscopy, colonoscopy, laparoscope and catheterization.

[0067] Decoy receptors: Decoy receptors recognize certain growth factors or cytokines with high affinity and specificity, but are structurally incapable of signaling or presenting the agonist to signaling receptor complexes. They act as a molecular trap for the agonist and for signaling receptor components. A decoy receptor, or sink receptor, is a receptor that binds a ligand, inhibiting it from binding to its normal receptor. For instance, the receptor VEGFR-1 can prevent vascular endothelial growth factor (VEGF) from binding to the VEGFR-2.

[0068] Dominant negative receptors: Dominant negative receptors are variants of the particular receptor comprising dominant-negative (DN) mutations as leading to mutant polypeptides that disrupt the activity of the wild-type receptor when overexpressed.

Detailed description of claimed and non-claimed embodiments



[0069] The present invention concerns an RNA containing composition comprising at least one non-coding, immunostimulating RNA for use as defined by the claims. Moreover, an RNA containing composition is disclosed herein, which comprises at least one RNA and is particularly provided for use in the treatment or prophylaxis of tumor and/or cancer diseases, wherein the RNA containing composition is preferably applied/administered intratumorally. It is especially preferred that the RNA containing composition is injected directly into tumor tissue. Alternatively, it is especially preferred that the RNA containing composition is injected adjacent to or in close proximity to a tumor tissue and/or metastasis.

[0070] It has been found by the inventors that intratumoral application respectively administration of the RNA containing composition disclosed herein is capable of effectively treating tumor and/or cancer diseases and related disorders. It has been shown that intratumoral application is surprisingly effective in decreasing tumor size. Moreover the application of the RNA containing composition disclosed herein was able to increase survival in animal models.

[0071] The at least one RNA of the RNA containing composition may be selected from the group consisting of chemically modified or unmodified RNA, single-stranded or double-stranded RNA, coding or non-coding RNA, mRNA, oligoribonucleotide, viral RNA, retroviral RNA, replicon RNA, tRNA, rRNA, immunostimulatory RNA, microRNA, siRNA, small nuclear RNA (snRNA), small-hairpin (sh) RNA riboswitch, RNA aptamer, RNA decoy, antisense RNA, a ribozyme, or any combination thereof.

[0072] In specific embodiments the at least one RNA of the RNA containing composition is selected from a coding RNA or a non-coding RNA.

Coding RNA:



[0073] According to a preferred embodiment disclosed herein the at least one RNA of the RNA containing composition comprises at least one coding region encoding at least one peptide or protein. Preferably, the coding RNA is selected from the group consisting of mRNA, viral RNA, retroviral RNA, and replicon RNA.

[0074] In preferred embodiments disclosed herein the at least one RNA of the RNA containing composition codes for at least one cytokine and/or for at least one chemokine and/or for at least one suicide gene product, and/or at least one immunogenic protein or peptide and/or for at least one cell death/apoptosis inducer and/or for at least one angiogenesis inhibitor and/or for at least one heat shock protein and/or for at least one tumor antigen and/or for at least one β-catenin inhibitor and/or for at least one activator of the STING (stimulator of interferon genes) pathway and/or at least one checkpoint modulator and/or at least one antibody, and/or at least one dominant negative receptor, and/or at least one decoy receptor, and/or at least one inhibitor of myeloid derived suppressor cells (MDSCs), and/or at least one IDO pathway inhibitor, and/or at least one protein or peptide that bind inhibitors of apoptosis, or fragments or variants thereof as will be outlined in more detail below.

1. Cytokines



[0075] In a preferred embodiment of the RNA containing composition disclosed herein, the RNA comprises at least one coding region that codes for at least one cytokine, or a fragment or variant thereof.

[0076] Preferably the cytokine is an interleukin (IL). One or more interleukins may be chosen e.g. from the following list: IL-1α, IL-1β, IL-1ra (antagonist), IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10; IL-11, IL-12, IL-13, IL14, IL-15, IL-16, IL-17A, IL-17B, EL-17C, IL-17D, IL-17E, IL-17F, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28A/B, IL-29, IL-30, IL-31, IL-32, IL-33, IL-35. Moreover the cytokine may be one or more cytokines chosen from the TNF family, e.g. chosen from the following list: TNF, especially TNFα, LTα, LTβ, LIGHT, TWEAK, APRIL, BAFF, TL1A, GITRL, OX40L, CD40L (CD154), FASL, CD27L, CD30L, 4-1BBL, TRAIL, RANK ligand. Further examples of preferred cytokines may be chosen from the following list: FLT3 ligand, G-CSF, GM-CSF, IFNα/β/ω, IFNγ, LIF, M-CSF, MIF, OSM, Stem Cell Factor, TGFβ1, TGFβ2, TGFβ3, TSLP ligand.

[0077] Particularly preferred are cytokines chosen from the following list: IL-12, IL-15, IL-2, IFNγ, TNFα, IL-18, IFNα, IL-1β, IL-32, IL-7, IL-21, IL-8, GM-CSF.

[0078] In an especially preferred embodiment disclosed herein, the RNA of the composition disclosed herein codes for Interleukin-12 or CD40L. It has been shown by the inventors, that mRNA coding for this cytokines is especially effective when applied in the approach disclosed herein. Particularly preferred are RNA sequences according to SEQ ID Nos. 1, 3, 4194, 4195, 4196, 4197, 4198, 4199, 4200 encoding IL-12. Furthermore RNA sequences according to SEQ ID Nos. 3898, 3899, 3900, 3901, 3902, 3903, 3904, 10073, encoding CD40L are particularly preferred.

[0079] According to preferred embodiments in the context of the present dislosure, cytokines may be selected from any cytokine selected from the group consisting of 4-1BBL; Apo2L/TRAIL; APRIL; BAFF; CD27L; CD30L; CD40L_(CD154); CXCL8; EL-17C; FasL; FLT3_ligand; G-CSF; GITRL; GM-CSF; IFNalpha; IFNB; IFNG; IFNomega; IL-1_alpha; IL-1_beta; IL-10; IL-11; IL-12; IL-12A; IL-13; IL-14; IL-15; IL-16; IL-17A; IL-17B; IL-17D; IL-17F; IL-18; IL-19; IL-1ra_(antagonist); IL-2; IL-20; IL-21; IL-22; IL-23; IL-24; IL-25; IL-26; IL-27A; IL-27B; IL-28A; IL-28B; IL-29; IL-3; IL-31; IL-32; IL-33; IL-37; IL-4; IL-5; IL-6; IL-7; IL-9; LIF; LIGHT; LTalpha; LTbeta; M-CSF; MIF; OSM; OX40L; RANK_ligand; Stem_Cell_Factor; TGFbeta1; TGFbeta2; TGFbeta3; TL1A; TNF; TWEAK, preferably as disclosed in Table 1. Particularly preferred in this context are the RNA sequences encoding a cytokine according to Table 1.
Table 1: Cytokines:
Gene NameProtein Accession No.Protein Sequence SEQ ID NO:RNA Sequence wild type SEQ ID NO:Optimized RNA Sequence SEQ ID NO:
4-1BBL UniProtKB: P41273 3849 3850 3851, 3852, 3853, 3854, 3855, 3856
APRIL UniProtKB: O75888 3857 3858 3859, 3860, 3861, 3862, 3863, 3864
BAFF UniProtKB: Q5H8V1 3865 3866 3867, 3868, 3869, 3870, 3871, 3872
BAFF UniProtKB: Q9Y275 3873 3874 3875, 3876, 3877, 3878, 3879, 3880
CD27L UniProtKB: P32970 3881 3882 3883, 3884, 3885, 3886, 3887, 3888
CD30L UniProtKB: P32971 3889 3890 3891, 3892, 3893, 3894, 3895, 3896
CD40L_(CD154) UniProtKB: P29965 3897 3898 3899, 3900, 3901, 3902, 3903, 3904
EL-17C UniProtKB: Q9P0M4 3905 3906 3907, 3908, 3909, 3910, 3911, 3912
FLT3_ligand Genbank: AAA90950.1 3913 3914 3915, 3916, 3917, 3918, 3919, 3920
FLT3_ligand UniProtKB: P49771 3921 3922 3923, 3924, 3925, 3926, 3927, 3928
G-CSF UniProtKB: P09919 3929 3930 3931, 3932, 3933, 3934, 3935, 3936
GITRL UniProtKB: Q9UNG2 3937 3938 3939, 3940, 3941, 3942, 3943, 3944
GM-CSF UniProtKB: P04141 3945 3946 3947, 3948, 3949, 3950, 3951, 3952
IFNalpha UniProtKB: G9JKF1 3953 3954 3955, 3956, 3957, 3958, 3959, 3960
IFNalpha UniProtKB: P01562 3961 3962 3963, 3964, 3965, 3966, 3967, 3968
IFNalpha UniProtKB: P01563 3969 3970 3971, 3972, 3973, 3974, 3975, 3976
IFNalpha UniProtKB: P01566 3977 3978 3979, 3980, 3981, 3982, 3983, 3984
IFNalpha UniProtKB: P01567 3985 3986 3987, 3988, 3989, 3990, 3991, 3992
IFNalpha UniProtKB: P01568 3993 3994 3995, 3996, 3997, 3998, 3999, 4000
IFNalpha UniProtKB: P01569 4001 4002 4003, 4004, 4005, 4006, 4007, 4008
IFNalpha UniProtKB: P01570 4009 4010 4011, 4012, 4013, 4014, 4015, 4016
IFNalpha UniProtKB: P01571 4017 4018 4019, 4020, 4021, 4022, 4023, 4024
IFNalpha UniProtKB: P05013 4025 4026 4027, 4028, 4029, 4030, 4031, 4032
IFNalpha UniProtKB: P05014 4033 4034 4035, 4036, 4037, 4038, 4039, 4040
IFNalpha UniProtKB: P05015 4041 4042 4043, 4044, 4045, 4046, 4047, 4048
IFNalpha UniProtKB: P32881 4049 4050 4051, 4052, 4053, 4054, 4055, 4056
IFNalpha UniProtKB: Q14618 4057 4058 4059, 4060, 4061, 4062, 4063, 4064
IFNalpha UniProtKB: Q86UP4 4065 4066 4067, 4068, 4069, 4070, 4071, 4072
IFNB UniProtKB: P01574 4073 4074 4075, 4076, 4077, 4078, 4079, 4080
IFNB UniProtKB: Q15943 4081 4082 4083, 4084, 4085, 4086, 4087, 4088
IFNG UniProtKB: P01579 4089 4090 4091, 4092, 4093, 4094, 4095, 4096
IFNG UniProtKB: Q14609 4097 4098 4099, 4100, 4101, 4102, 4103, 4104
IFNG UniProtKB: Q14610 4105 4106 4107, 4108, 4109, 4110, 4111, 4112
IFNG UniProtKB: Q14611 4113 4114 4115, 4116, 4117, 4118, 4119, 4120
IFNG UniProtKB: Q14612 4121 4122 4123, 4124, 4125, 4126, 4127, 4128
IFNG UniProtKB: Q14613 4129 4130 4131, 4132, 4133, 4134, 4135, 4136
IFNG UniProtKB: Q14614 4137 4138 4139, 4140, 4141, 4142, 4143, 4144
IFNG UniProtKB: Q14615 4145 4146 4147, 4148, 4149, 4150, 4151, 4152
IFNG UniProtKB: Q8NHY9 4153 4154 4155, 4156, 4157, 4158, 4159, 4160
IFNomega UniProtKB: P05000 4161 4162 4163, 4164, 4165, 4166, 4167, 4168
IL-10 UniProtKB: P22301 4169 4170 4171, 4172, 4173, 4174, 4175, 4176
IL-11 UniProtKB: P20809 4177 4178 4179, 4180, 4181, 4182, 4183, 4184
IL-12A UniProtKB: P29459 4185 4186 4187, 4188, 4189, 4190, 4191, 4192
IL-12 UniProtKB: P29460 4193 4194 4195, 4196, 4197, 4198, 4199, 4200
IL-13 UniProtKB: P35225 4201 4202 4203, 4204, 4205, 4206, 4207, 4208
IL-14 UniProtKB: P40222 4209 4210 4211, 4212, 4213, 4214, 4215, 4216
IL-15 UniProtKB: P40933 4217 4218 4219, 4220, 4221, 4222, 4223, 4224
IL-16 UniProtKB: Q14005 4225 4226 4227, 4228, 4229, 4230, 4231, 4232
IL-17A UniProtKB: Q16552 4233 4234 4235, 4236, 4237, 4238, 4239, 4240
IL-17B UniProtKB: Q9NRM6 4241 4242 4243, 4244, 4245, 4246, 4247, 4248
IL-17B UniProtKB: Q9UHF5 4249 4250 4251, 4252, 4253, 4254, 4255, 4256
IL-17D UniProtKB: Q8TAD2 4257 4258 4259, 4260, 4261, 4262, 4263, 4264
IL-17F UniProtKB: F1JZ09 4265 4266 4267, 4268, 4269, 4270, 4271, 4272
IL-17F UniProtKB: Q96PD4 4273 4274 4275, 4276, 4277, 4278, 4279, 4280
IL-18 UniProtKB: A0A024R3E0 4281 4282 4283, 4284, 4285, 4286, 4287, 4288
IL-18 UniProtKB: B0YJ28 4289 4290 4291, 4292, 4293, 4294, 4295, 4296
IL-18 UniProtKB: Q14116 4297 4298 4299, 4300, 4301, 4302, 4303, 4304
IL-19 UniProtKB: Q9UHD0 4305 4306 4307, 4308, 4309, 4310, 4311, 4312
IL-1_alpha UniProtKB: P01583 4313 4314 4315, 4316, 4317, 4318, 4319, 4320
IL-1_beta UniProtKB: P01584 4321 4322 4323, 4324, 4325, 4326, 4327, 4328
IL-1ra_(antagonist) UniProtKB: P18510-2 4329 4330 4331, 4332, 4333, 4334, 4335, 4336
IL-1ra_(antagonist) UniProtKB: P18510-3 4337 4338 4339, 4340, 4341, 4342, 4343, 4344
IL-1ra_(antagonist) UniProtKB: P18510 4345 4346 4347, 4348, 4349, 4350, 4351, 4352
IL-20 UniProtKB: Q9NYY1 4353 4354 4355, 4356, 4357, 4358, 4359, 4360
IL-21 RefSeq: NP_001193935.1 4361 4362 4363, 4364, 4365, 4366, 4367, 4368
IL-21 RefSeq: NP_068575.1 4369 4370 4371, 4372, 4373, 4374, 4375, 4376
IL-22 UniProtKB: Q9GZX6 4377 4378 4379, 4380, 4381, 4382, 4383, 4384
IL-23 UniProtKB: Q9NPF7 4385 4386 4387, 4388, 4389, 4390, 4391, 4392
IL-24 UniProtKB: Q13007 4393 4394 4395, 4396, 4397, 4398, 4399, 4400
IL-24 UniProtKB: Q2YHE6 4401 4402 4403, 4404, 4405, 4406, 4407, 4408
IL-25 UniProtKB: Q969H8 4409 4410 4411, 4412, 4413, 4414, 4415, 4416
IL-25 UniProtKB: Q9H293 4417 4418 4419, 4420, 4421, 4422, 4423, 4424
IL-26 UniProtKB: Q9NPH9 4425 4426 4427, 4428, 4429, 4430, 4431, 4432
IL-27A UniProtKB: Q8NEV9 4433 4434 4435, 4436, 4437, 4438, 4439, 4440
IL-27B UniProtKB: Q14213 4441 4442 4443, 4444, 4445, 4446, 4447, 4448
IL-28A UniProtKB: Q8IZJ0 4449 4450 4451, 4452, 4453, 4454, 4455, 4456
IL-28B UniProtKB: Q8IZI9 4457 4458 4459, 4460, 4461, 4462, 4463, 4464
IL-29 UniProtKB: Q8IU54 4465 4466 4467, 4468, 4469, 4470, 4471, 4472
IL-2 UniProtKB: P60568 4473 4474 4475, 4476, 4477, 4478, 4479, 4480
IL-2 UniProtKB: Q0GK43 4481 4482 4483, 4484, 4485, 4486, 4487, 4488
IL-2 UniProtKB: Q13169 4489 4490 4491, 4492, 4493, 4494, 4495, 4496
IL-2 UniProtKB: Q6NZ91 4497 4498 4499, 4500, 4501, 4502, 4503, 4504
IL-2 UniProtKB: Q6NZ93 4505 4506 4507, 4508, 4509, 4510, 4511, 4512
IL-31 UniProtKB: Q6EBC2 4513 4514 4515, 4516, 4517, 4518, 4519, 4520
IL-32 UniProtKB: P24001 4521 4522 4523, 4524, 4525, 4526, 4527,4528
IL-33 UniProtKB: O95760 4529 4530 4531, 4532, 4533, 4534, 4535, 4536
IL-37 UniProtKB: Q9NZH6 4537 4538 4539, 4540, 4541, 4542, 4543, 4544
IL-3 UniProtKB: P08700 4545 4546 4547, 4548, 4549, 4550, 4551, 4552
IL-3 UniProtKB: Q6NZ78 4553 4554 4555, 4556, 4557, 4558, 4559, 4560
IL-3 UniProtKB: Q6NZ79 4561 4562 4563, 4564, 4565, 4566, 4567, 4568
IL-4 UniProtKB: P05112-2 4569 4570 4571, 4572, 4573, 4574, 4575, 4576
IL-4 UniProtKB: P05112 4577 4578 4579, 4580, 4581, 4582, 4583, 4584
IL-5 UniProtKB: P05113 4585 4586 4587, 4588, 4589, 4590, 4591, 4592
IL-6 UniProtKB: P05231 4593 4594 4595, 4596, 4597, 4598, 4599, 4600
IL-7 UniProtKB: A8K673 4601 4602 4603, 4604, 4605, 4606, 4607, 4608
IL-7 UniProtKB: P13232 4609 4610 4611, 4612, 4613, 4614, 4615, 4616
IL-9 UniProtKB: P15248 4617 4618 4619, 4620, 4621, 4622, 4623, 4624
LIF UniProtKB: P15018 4625 4626 4627, 4628, 4629, 4630, 4631, 4632
LIGHT UniProtKB: O43557 4633 4634 4635, 4636, 4637, 4638, 4639, 4640
LTalpha UniProtKB: B4DVZ8 4641 4642 4643, 4644, 4645, 4646, 4647, 4648
LTalpha UniProtKB: P01374 4649 4650 4651, 4652, 4653, 4654, 4655, 4656
LTalpha UniProtKB: P09960 4657 4658 4659, 4660, 4661, 4662, 4663, 4664
LTalpha UniProtKB: Q5ST95 4665 4666 4667, 4668, 4669, 4670, 4671, 4672
LTalpha UniProtKB: Q5STV3 4673 4674 4675, 4676, 4677, 4678, 4679, 4680
LTalpha UniProtKB: Q6FG55 4681 4682 4683, 4684, 4685, 4686, 4687, 4688
LTbeta UniProtKB: Q06643 4689 4690 4691, 4692, 4693, 4694, 4695, 4696
LTbeta UniProtKB: Q5STB2 4697 4698 4699, 4700, 4701, 4702, 4703, 4704
M-CSF UniProtKB: P09603 4705 4706 4707, 4708, 4709, 4710, 4711, 4712
MIF UniProtKB: A6MUU8 4713 4714 4715, 4716, 4717, 4718, 4719, 4720
MIF UniProtKB: P14174 4721 4722 4723, 4724, 4725, 4726, 4727, 4728
OSM UniProtKB: P13725 4729 4730 4731, 4732, 4733, 4734, 4735, 4736
OX40L UniProtKB: P23510 4737 4738 4739, 4740, 4741, 4742, 4743, 4744
OX40L UniProtKB: P43489 4745 4746 4747, 4748, 4749, 4750, 4751, 4752
RANK_ligand UniProtKB: 014788 4753 4754 4755, 4756, 4757, 4758, 4759, 4760
Stem_Cell_Factor UniProtKB: P21583-2 4761 4762 4763, 4764, 4765, 4766, 4767, 4768
Stem_Cell_Factor UniProtKB: P21583 4769 4770 4771, 4772, 4773, 4774, 4775, 4776
TGFbeta1 UniProtKB: A0A024R0P8 4777 4778 4779, 4780, 4781, 4782, 4783, 4784
TGFbeta1 UniProtKB: P01137 4785 4786 4787, 4788, 4789, 4790, 4791, 4792
TGFbeta2 UniProtKB: P61812 4793 4794 4795, 4796, 4797, 4798, 4799, 4800
TGFbeta3 UniProtKB: A5YM40 4801 4802 4803, 4804, 4805, 4806, 4807, 4808
TGFbeta3 UniProtKB: P10600 4809 4810 4811, 4812, 4813, 4814, 4815, 4816
TL1A UniProtKB: 095150 4817 4818 4819, 4820, 4821, 4822, 4823, 4824
TWEAK UniProtKB: Q4ACW9 4825 4826 4827, 4828, 4829, 4830, 4831, 4832
CXCL8 UniProtKB: P10145 5265 5266 5267, 5268, 5269, 5270, 5271, 5272
Apo2L/TRAIL UniProtKB: P50591 6897 6898 6899, 6900, 6901, 6902, 6903, 6904
FasL UniProtKB: P48023 7321 7322 7323, 7324, 7325, 7326, 7327, 7328
TNF UniProtKB: P01375 7369 7370 7371, 7372, 7373, 7374, 7375, 7376
TNF UniProtKB: Q5STB3 7377 7378 7379, 7380, 7381, 7382, 7383, 7384


[0080] In a more preferred embodiment, the composition disclosed herein comprises at least one RNA, preferably an mRNA comprising at least one coding region encoding at least one cytokine or a fragment or variant thereof, wherein the at least one coding region comprises an RNA sequence being identical or at least 50%, 60%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to the RNA sequences according to the SEQ ID Nos as disclosed in Table 1.

2. Chemokines:



[0081] In a further preferred embodiment of the RNA containing composition disclosed herein, the RNA comprises at least one coding region that codes for at least one chemokine, or a fragment or variant thereof.

[0082] Chemokines are chemotactic cytokines that control the migratory patterns and positioning of immune cells, as reviewed by Griffith et al., 2014. Annu. Rev. Immunol. 32:659-702 (PMID 24655300). Chemokine function is critical for all immune cell movement ranging from the migration required for immune cell development and homeostasis, to that required for the generation of primary and amnestic cellular and humoral immune responses, to the pathologic recruitment of immune cells in disease. Chemokines constitute the largest family of cytokines, consisting of approximately 50 endogenous chemokine ligands in humans and mice.

[0083] According to preferred embodiments in the context of the present disclosure chemokines may be selected from any chemokine selected from the group consisting of CCL1; CCL11; CCL12; CCL13; CCL14; CCL15; CCL16; CCL17; CCL18; CCL19; CCL2; CCL20; CCL21; CCL22; CCL24; CCL25; CCL26; CCL27; CCL28; CCL3; CCL4; CCL5; CCL6; CCL7; CCL8; CCL9; CX3CL1; CXCL1; CXCL10; CXCL11; CXCL12; CXCL13; CXCL14; CXCL15; CXCL2; CXCL3; CXCL4; CXCL5; CXCL6; CXCL7; CXCL8; CXCL9; XCL1; XCL2, preferably as disclosed in Table 2. Particularly preferred in this context are the RNA sequences encoding a chemokine according to Table 2.
Table 2: Chemokines
Gene NameProtein Accession No.Protein Sequence SEQ ID NO:RNA Sequence wild type SEQ ID NO:RNA Sequence SEQ ID NO:
CCL11 UniProtKB: P51671 4833 4834 4835, 4836, 4837, 4838, 4839, 4840
CCL11 UniProtKB: Q6I9T4 4841 4842 4843, 4844, 4845, 4846, 4847, 4848
CCL12 UniProtKB: Q62401 4849 4850 4851, 4852, 4853, 4854, 4855, 4856
CCL13 UniProtKB: Q99616 4857 4858 4859, 4860, 4861, 4862, 4863, 4864
CCL14 UniProtKB: Q16627 4865 4866 4867, 4868, 4869, 4870, 4871, 4872
CCL15 UniProtKB: Q16663 4873 4874 4875, 4876, 4877, 4878, 4879, 4880
CCL16 UniProtKB: 015467 4881 4882 4883, 4884, 4885, 4886, 4887, 4888
CCL17 UniProtKB: Q92583 4889 4890 4891, 4892, 4893, 4894, 4895, 4896
CCL18 UniProtKB: P55774 4897 4898 4899, 4900, 4901, 4902, 4903, 4904
CCL19 UniProtKB: Q6IBD6 4905 4906 4907, 4908, 4909, 4910, 4911, 4912
CCL19 UniProtKB: Q99731 4913 4914 4915, 4916, 4917, 4918, 4919, 4920
CCL1 UniProtKB: P22362 4921 4922 4923, 4924, 4925, 4926, 4927, 4928
CCL20 UniProtKB: P78556 4929 4930 4931, 4932, 4933, 4934, 4935, 4936
CCL21 UniProtKB: O00585 4937 4938 4939, 4940, 4941, 4942, 4943, 4944
CCL22 UniProtKB: O00626 4945 4946 4947, 4948, 4949, 4950, 4951, 4952
CCL24 UniProtKB: 000175 4953 4954 4955, 4956, 4957, 4958, 4959, 4960
CCL25 UniProtKB: 015444 4961 4962 4963, 4964, 4965, 4966, 4967, 4968
CCL26 UniProtKB: Q9Y258 4969 4970 4971, 4972, 4973, 4974, 4975, 4976
CCL27 UniProtKB: Q5VZ77 4977 4978 4979, 4980, 4981, 4982, 4983, 4984
CCL28 UniProtKB: A0N0Q3 4985 4986 4987, 4988, 4989, 4990, 4991, 4992
CCL28 UniProtKB: Q9NRJ3 4993 4994 4995, 4996, 4997, 4998, 4999, 5000
CCL2 UniProtKB: P13500 5001 5002 5003, 5004, 5005, 5006, 5007, 5008
CCL3 UniProtKB: A0N0R1 5009 5010 5011, 5012, 5013, 5014, 5015, 5016
CCL3 UniProtKB: P10147 5017 5018 5019, 5020, 5021, 5022, 5023, 5024
CCL4 UniProtKB: P13236 5025 5026 5027, 5028, 5029, 5030, 5031, 5032
CCL4 UniProtKB: Q7M4M2 5033 5034 5035, 5036, 5037, 5038, 5039, 5040
CCL5 UniProtKB: D0EI67 5041 5042 5043, 5044, 5045, 5046, 5047, 5048
CCL5 UniProtKB: P13501 5049 5050 5051, 5052, 5053, 5054, 5055, 5056
CCL6 UniProtKB: P27784 5057 5058 5059, 5060, 5061, 5062, 5063, 5064
CCL7 UniProtKB: P80098 5065 5066 5067, 5068, 5069, 5070, 5071, 5072
CCL7 UniProtKB: Q7Z7Q8 5073 5074 5075, 5076, 5077, 5078, 5079, 5080
CCL8 UniProtKB: H0UIC7 5081 5082 5083, 5084, 5085, 5086, 5087, 5088
CCL8 UniProtKB: P80075 5089 5090 5091, 5092, 5093, 5094, 5095, 5096
CCL9 UniProtKB: P51670 5097 5098 5099, 5100, 5101, 5102, 5103, 5104
CX3CL1 UniProtKB: A0N0N7 5105 5106 5107, 5108, 5109, 5110, 5111, 5112
CX3CL1 UniProtKB: P78423 5113 5114 5115, 5116, 5117, 5118, 5119, 5120
CX3CL1 UniProtKB: Q6I9S9 5121 5122 5123, 5124, 5125, 5126, 5127, 5128
CXCL10 UniProtKB: A0A024RDA4 5129 5130 5131, 5132, 5133, 5134, 5135, 5136
CXCL10 UniProtKB: P02778 5137 5138 5139, 5140, 5141, 5142, 5143, 5144
CXCL11 UniProtKB: 014625 5145 5146 5147, 5148, 5149, 5150, 5151, 5152
CXCL12 UniProtKB: P48061 5153 5154 5155, 5156, 5157, 5158, 5159, 5160
CXCL13 UniProtKB: L8E878 5161 5162 5163, 5164, 5165, 5166, 5167, 5168
CXCL13 UniProtKB: O43927 5169 5170 5171, 5172, 5173, 5174, 5175, 5176
CXCL14 UniProtKB: 095715 5177 5178 5179, 5180, 5181, 5182, 5183, 5184
CXCL15 UniProtKB: Q9WVL7 5185 5186 5187, 5188, 5189, 5190, 5191, 5192
CXCL1 UniProtKB: P09341 5193 5194 5195, 5196, 5197, 5198, 5199, 5200
CXCL2 UniProtKB: A0A024RDD9 5201 5202 5203, 5204, 5205, 5206, 5207, 5208
CXCL2 UniProtKB: P19875 5209 5210 5211, 5212, 5213, 5214, 5215, 5216
CXCL3 UniProtKB: P19876 5217 5218 5219, 5220, 5221, 5222, 5223, 5224
CXCL4 UniProtKB: P02776 5225 5226 5227, 5228, 5229, 5230, 5231, 5232
CXCL5 UniProtKB: P42830 5233 5234 5235, 5236, 5237, 5238, 5239, 5240
CXCL5 UniProtKB: Q6I9S7 5241 5242 5243, 5244, 5245, 5246, 5247, 5248
CXCL6 UniProtKB: P80162 5249 5250 5251, 5252, 5253, 5254, 5255, 5256
CXCL7 UniProtKB: P02775 5257 5258 5259, 5260, 5261, 5262, 5263, 5264
CXCL8 UniProtKB: P10145 5265 5266 5267, 5268, 5269, 5270, 5271, 5272
CXCL9 UniProtKB: L8E8X0 5273 5274 5275, 5276, 5277, 5278, 5279, 5280
CXCL9 UniProtKB: Q07325 5281 5282 5283, 5284, 5285, 5286, 5287, 5288
XCL1 UniProtKB: P47992 5289 5290 5291, 5292, 5293, 5294, 5295, 5296
XCL2 UniProtKB: Q9UBD3 5297 5298 5299, 5300, 5301, 5302, 5303, 5304


[0084] In this context particularly preferred are chemokines chosen from the following list: CXCL9, CXCL10, CCL5, XCL1, CCL20, CCL19, CCL21, CCL2, CCL3, CCL16, and CXCL12.

[0085] In a more preferred embodiment, the composition disclosed herein comprises at least one RNA, preferably an mRNA comprising at least one coding region encoding at least one chemokine or a fragment or variant thereof, wherein the at least one coding region comprises an RNA sequence being identical or at least 50%, 60%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to the RNA sequences according to the SEQ ID Nos as disclosed in Table 2.

3. Suicide gene products



[0086] In a further preferred embodiment of the RNA containing composition disclosed herein, the RNA codes for at least one so-called suicide gene product, especially for a suicide enzyme, preferably for a nucleotide metabolizing enzyme. Preferably, the RNA is used in combination with a prodrug which is a substrate of the suicide gene product, especially the suicide enzyme, and which is converted to a cytotoxic compound by the suicide gene product. The appropriate prodrug may be added to the RNA composition disclosed herein or it may be administered separately to the patient.

[0087] One or more preferred suicide enzymes may be chosen from the following list: thymidine kinase, preferably a viral thymidine kinase, more preferrably Herpes simplex virus thymidine kinase, Varicella zoster thymidine kinase; a plant thymidine kinase, preferably a tomato thymidine kinase; cytosine deaminase, preferably bacterial cytosine deaminase or Yeast cytosine deaminase; deoxynucleoside kinase, preferably Drosophila melanogaster deoxynucleoside kinase; deoxycytidine kinase, preferably a mammalian deoxycytidine kinase, purine nucleoside phosphorylase, preferably a bacterial purine nucleoside phosphorylase.

[0088] It is already known that suicide gene therapy is a promising treatment for cancer (Ardiani et al., 2012. Curr. Gene Ther. 12(2):77-91. PMID: 22384805). This approach is based on the successful delivery and expression of the suicide gene in tumor cells. The suicide gene encodes an enzyme with the unique ability to activate an otherwise ineffective prodrug. Following suicide gene expression in transfected cells, an appropriate prodrug is administered and is converted to a cytotoxic compound by the actions of the suicide gene product. As most suicide genes encode enzymes belonging to the class of nucleotide metabolizing enzymes, the general mode of action of activated prodrugs is interference with DNA synthesis that consequently results in induction of apoptosis. The potency of these drugs is maximized in cancer cells due to their greater proliferative rate as compared to normal cells. Because of the prospect to preferentially deliver genes to tumor cells, this strategy has the potential to offer selective tumor killing while sparing normal cells, a feature that standard chemotherapeutic and radiotherapy approaches do not generally afford.

[0089] The following table 3 (Ardiani et al., 2012. Curr. Gene Ther. 12(2):77-91. PMID: 22384805) summarizes preferred nucleotide metabolizing enzymes usable in the approach disclosed herein. The table includes variants and mutants of such enzymes which were generated by protein engineering strategies.
Table 3: Suicide enzymes
EnzymeSource geneNatural substrateProdrugVariants/MutantsDrug inhibi-tors action*
Herpes Simplex Virus Thymidine Kinase (HSVTK) Herpes Simplex Virus 1 (HSV-1) Thymidine Kinase (TK) Thymidine Ganciclovir (GCV), acyclovir (ACV) Mutant 30 1
Mutant 75 1
SR39 1
A168H 1
A167Y 1
Q125N 1, 2
Bacterial Cytosine Deaminase (bCD) Escherichia coli -codA Cytosine 5-Fluorocytosine (5-FC) D314 mutants 1, 2, 4
bCD1525 1, 2, 4
Yeast Cytosine Deaminase (yCD) Saccharomyces cerevisiae -fcyl Cytosine 5-FC yCD triple 1, 2, 4
D92E 1, 2, 4
Drosophila melanogaster Deoxynucleo side Kinase (Dm-dNK) Drosophila melanogaster -dNK All four deoxy-ribonucleosides azidothymidine (AZT), dideoxycytoinse (ddC); CdA; 9-beta-D-arabinofuranosyl-2-fluoroadenine (F-AraA); GCV, 9-beta-D-arabinosylguanine (AraG); 2',3'-didehydro-3'-deoxythymidine (D4T); 2',3'-Dideoxythymidine (ddT) MuD 1, 5
B5 1
B10 1, 3
M88R 1
HDHD-12, HD-16 1, 5
R4.V3 1
Deoxycytidine Kinase (dCK) Homo sapiens -dCK Deoxycytidine 2',2'-difluoro-deoxycytidine (dFdC), AraA, β-L-thymidine (L-dT) AZT cytarabine 5'-monophosphate (AraC) DMMA, DMLA 1, 3
EpTK6 1, 3, 5
Ser-74 1, 3
Purine Nucleoside Phosphorylase (PNP) Escherichia coli -deoD Purine ribonucleosides 9-(6-deoxy-α-L-talofuranosyl)-6-methylpurine (Me(talo)-MeP-R) M64V 1, 4
* Drug inhibitory action. 1: DNA synthesis; 2: Thymidylate synthetase; 3: Ribonucleotide reductase; 4: RNA/protein synthesis; 5: Reverse transcriptase.


[0090] Herpes simplex virus type 1 thymidine kinase (HSVTK, EC 2.7.1.21), a homodimer with a subunit molecular mass of 45 kDa, is responsible for the phosphorylation of thymidine, deoxycytidine, deoxythymidylate (dTMP) as well as various pharmaceutically important pyrimidine and guanosine analogs. Of particular note, HSVTK is responsible for the initial and rate limiting phosphorylation of the antiviral guanosine analogs acyclovir (ACV) and ganciclovir (GCV). Once monophosphorylated these analogs can be further phosphorylated by endogenous enzymes (guanylate kinase and nucleoside diphosphokinase) before being incorporated into nascent DNA to cause double strand destabilization and, subsequently, cell death.

[0091] Moreover, the Varicella zoster virus thymidine kinase (VZV-tk) may be used e.g. in conjunction with the prodrug 6-methoxypurine arabinoside (ara-M) or 1-(2'-deoxy-2-flioro-b-D-arabinofuranosyl)-S-iodouracil (FIAU). Other examples are thymidine kinases of Aleutian disease virus (ADV), respiratory syncytial virus (RSV) and cytomegalovirus (CMV).

[0092] Cytosine deaminase (CD; EC 3.5.4.1) is an enzyme in the pyrimidine salvage pathway that catalyzes the deamination of cytosine to form uracil and ammonia. CD from E. coli (bCD) is a hexamer of 48 kDA subunits with a catalytic metal iron. This enzyme is absent in mammals and uniquely present in fungi and bacteria. It is used in suicide gene therapy because of its ability to deaminate the antifungal drug, 5-fluorocytosine (5FC), to 5-fluorouracil (5FU), a potent anti-neoplastic drug. UPRT (Uracil phosphoribosyltransferase) may be used as potential enhancer.

[0093] Saccharomyces cerevisiae or Yeast cytosine deaminase (yCD, EC 3.5.4.1) is a homodimer of 17.5 kDa subunits and has been shown to be more active towards 5FC than bCD (22-fold lower Km) with a slightly better catalytic efficiency (kcat/Km) toward 5FC relative to its natural substrate cytosine.

[0094] Drosophila melanogaster deoxyribonucleoside kinase (Dm-dNK; EC 2.7.1.145) is a 29 kDa homodimeric, multisubstrate kinase able to phosphorylate all four natural deoxyribonucleosides required for DNA synthesis. In addition to its broad substrate specificity, Dm-dNK exhibits higher catalytic rates toward these natural deoxynucleosides and several nucleoside analogs as compared to mammalian deoxynucleoside kinases. Due to these distinctive characteristics Dm-dNK is a especially preferred enzyme for the suicide gene therapy application disclosed herein.

[0095] Human deoxycytidine kinase (dCK; EC 2.7.1.74) is a 30.5 kDa homodimeric enzyme in the salvage pathway of deoxyribonucleosides and is responsible for activating all natural deoxyribonucleosides, excluding thymidine, as precursors for DNA synthesis. Due to its broad substrate specificity, dCK is able to activate multiple nucleoside analogs effective against different types of cancer. However, wild type dCK is intrinsically a relatively poor catalyst with low turnover rates and prodrug activation is dependent on its expression levels. Indeed, nucleoside analogs that are efficient substrates of dCK, such as cytarabine (AraC), fludarabine (F-AraA), cladribine (CdA), and gemcitabine (dFdC), are effective anti-leukemic agents as lymphoblasts have been shown to have high dCK expression levels whereas cancer cells lacking dCK activity are resistant to these same analogs. Therefore dCK is an especially preferred enzyme for the approach disclosed herein.

[0096] Preferably, the RNA of the RNA containing composition disclosed herein is used in combination with further components which enhance the cytotoxic effect of the treatment. It is especially preferred to use the RNA in combination with RNA coding for connexins and/or with a protein of the connexin family or parts or fragments thereof. Connexins are transmembrane proteins which form gap junctions between cells. They allow transfer of e.g. molecules between neighboring cells thereby enabling the transfer of cytoxic substances.

[0097] Although suicide gene therapy is a fairly new anti-cancer approach, the concept was originally described more than two decades ago in 1986 by Moolten (Moolten, 1986. Cancer Res. 46(10):5276-81). He also proposed the existence of what is currently known as the bystander effect, now widely recognized as a fundamental feature of suicide gene therapy success. By definition the bystander effect is the extension of cytotoxic effects from transfected cells to non-transfected neighboring cells such that complete tumor regression is observed when only a small subpopulation of tumor cells is successfully transfected. This phenomenon is crucial to the overall effectiveness of suicide gene therapy today due to low transfection efficiencies achievable by available delivery systems.

[0098] The bystander effect is thought to occur via two major mechanisms: local and immune-mediated. The local mechanism involves the killing of untransfected nearby cells due to the transfer of toxic materials or suicide enzymes through gap junctions, apoptotic vesicles or through diffusion of soluble toxic metabolites. Gap junctions are important in cell-cell interactions and are responsible for the transfer of ions, nucleotides and small molecules to adjacent cells. The transfer of toxic drugs through gap junctions, however, may not be available in certain types of tumors that down regulate intracellular gap junction communication and display disorganized and non-functional gap junctions. To address this problem, several studies have increased the expression of connexins, the building blocks of gap junctions, and demonstrated that enhanced bystander and cell killing effects were achieved.

[0099] Accumulating evidence from in vivo experiments suggests that the immune-mediated bystander effect plays an important role in tumor regression as well. The presence of inflammatory infiltrates, chemokines, and cytokines have been found elevated in regressing tumors of immune competent animals receiving suicide gene therapy treatment. These cytokines and chemokines further induce the production of immune-regulatory molecules able to stimulate a more robust anti-cancer effect and additionally, because death of transfected cells is through apoptosis, numerous inflammatory signals may be released to evoke a potent immune response. Therefore the combination of the composition disclosed herein with connexins or with RNA coding for connexins is especially preferred, because it strengthens the bystander effect thereby increasing the efficiency of the RNA containing composition disclosed herein.

[0100] According to preferred embodiments in the context of the present disclosure suicide gene products may be selected from any suicide gene product selected from the group consisting of Cytosine_Deaminase_codA; Cytosine_Deaminase_fcy1; Deoxy-cytidine_Kinase_dCK; Deoxynucleoside_Kinase_dNK; Purine_Nucleoside_Phosphorylase_deoD; Thymidine_Kinase_TK, preferably as disclosed in Table 4. Particularly preferred in this context are the RNA sequences encoding a suicide gene product according to Table 4.
Table 4: Suicide Gene Products
Gene NameProtein Accession No.Protein Sequence SEQ ID NO:RNA Sequence wild type SEQ ID NO:RNA Sequence SEQ ID NO:
Cytosine_Deaminase_codA UniProtKB: A0A024KS17 5305 5306 5307, 5308, 5309, 5310, 5311, 5312
Cytosine_Deaminase_codA UniProtKB: A0A0H2V4N7 5313 5314 5315, 5316, 5317, 5318, 5319, 5320
Cytosine_Deaminase_codA UniProtKB: A0A0H2YX33 5321 5322 5323, 5324, 5325, 5326, 5327, 5328
Cytosine_Deaminase_codA UniProtKB: F4NM90 5329 5330 5331, 5332, 5333, 5334, 5335, 5336
Cytosine_Deaminase_codA UniProtKB: H9UNZ4 5337 5338 5339, 5340, 5341, 5342, 5343, 5344
Cytosine_Deaminase_codA UniProtKB: Q1RFJ5 5345 5346 5347, 5348, 5349, 5350, 5351, 5352
Cytosine_Deaminase_codA UniProtKB: Q2VP09 5353 5354 5355, 5356, 5357, 5358, 5359, 5360
Cytosine_Deaminase_codA UniProtKB: Q53ZC8 5361 5362 5363, 5364, 5365, 5366, 5367, 5368
Cytosine_Deaminase_codA UniProtKB: Q6Q8Q1 5369 5370 5371, 5372, 5373, 5374, 5375, 5376
Cytosine_Deaminase_codA UniProtKB: W8ZNH5 5377 5378 5379, 5380, 5381, 5382, 5383, 5384
Cytosine_Deaminase_fcy1 UniProtKB: A0A023ZJG6 5385 5386 5387, 5388, 5389, 5390, 5391, 5392
Cytosine_Deaminase_fcy1 UniProtKB: A0A024XGF7 5393 5394 5395, 5396, 5397, 5398, 5399, 5400
Cytosine_Deaminase_fcy1 UniProtKB: A0A024XUW9 5401 5402 5403, 5404, 5405, 5406, 5407, 5408
Cytosine_Deaminase_fcy1 UniProtKB: A0A0C5ITD0 5409 5410 5411, 5412, 5413, 5414, 5415, 5416
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4WVI5 5417 5418 5419, 5420, 5421, 5422, 5423, 5424
Cytosine_Deaminase_fcy1 UniProtKB: AOAOD4WY08 5425 5426 5427, 5428, 5429, 5430, 5431, 5432
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4WZA2 5433 5434 5435, 5436, 5437, 5438, 5439, 5440
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4WZQ5 5441 5442 5443, 5444, 5445, 5446, 5447, 5448
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4X0R8 5449 5450 5451, 5452, 5453, 5454, 5455, 5456
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4X195 5457 5458 5459, 5460, 5461, 5462, 5463, 5464
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4X2R9 5465 5466 5467, 5468, 5469, 5470, 5471, 5472
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4X3Q1 5473 5474 5475, 5476, 5477, 5478, 5479, 5480
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4X4K1 5481 5482 5483, 5484, 5485, 5486, 5487, 5488
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4X5B7 5489 5490 5491, 5492, 5493, 5494, 5495, 5496
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4X7R4 5497 5498 5499, 5500, 5501, 5502, 5503, 5504
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4X7X4 5505 5506 5507, 5508, 5509, 5510, 5511, 5512
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4XA07 5513 5514 5515, 5516, 5517, 5518, 5519, 5520
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4XA25 5521 5522 5523, 5524, 5525, 5526, 5527, 5528
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4XAV6 5529 5530 5531, 5532,5533, 5534, 5535, 5536
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4XG5 5537 5538 5539, 5540, 5541, 5542, 5543, 5544
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4XDL4 5545 5546 5547, 5548, 5549, 5550, 5551, 5552
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4XG53 5553 5554 5555, 5556, 5557, 5558, 5559, 5560
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4XGH3 5561 5562 5563, 5564, 5565, 5566, 5567, 5568
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4XHD4 5569 5570 5571, 5572, 5573, 5574, 5575, 5576
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4XIK5 5577 5578 5579, 5580, 5581, 5582, 5583, 5584
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4XJR4 5585 5586 5587, 5588, 5589, 5590, 5591, 5592
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4XL36 5593 5594 5595, 5596, 5597, 5598, 5599, 5600
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4XNH2 5601 5602 5603, 5604, 5605, 5606, 5607, 5608
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4XNS1 5609 5610 5611, 5612, 5613, 5614, 5615, 5616
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4XQY5 5617 5618 5619, 5620, 5621, 5622, 5623, 5624
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4XS80 5625 5626 5627, 5628, 5629, 5630, 5631, 5632
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4XS82 5633 5634 5635, 5636, 5637, 5638, 5639, 5640
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4XTC2 5641 5642 5643, 5644, 5645, 5646, 5647, 5648
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4XUZ4 5649 5650 5651, 5652, 5653, 5654, 5655, 5656
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4XW26 5657 5658 5659, 5660, 5661, 5662, 5663, 5664
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4XXD1 5665 5666 5667, 5668, 5669, 5670, 5671, 5672
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4XYH3 5673 5674 5675, 5676, 5677, 5678, 5679, 5680
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4XZT0 5681 5682 5683, 5684, 5685, 5686, 5687, 5688
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4Y164 5689 5690 5691, 5692, 5693, 5694, 5695, 5696
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4Y2A8 5697 5698 5699, 5700, 5701, 5702, 5703, 5704
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4Y3N1 5705 5706 5707, 5708, 5709, 5710, 5711, 5712
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4Y5S3 5713 5714 5715, 5716, 5717, 5718, 5719, 5720
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4Y5Y1 5721 5722 5723, 5724, 5725, 5726, 5727, 5728
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4Y7I2 5729 5730 5731, 5732, 5733, 5734, 5735, 5736
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4Y8S5 5737 5738 5739, 5740, 5741, 5742, 5743, 5744
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4YAR2 5745 5746 5747, 5748, 5749, 5750, 5751, 5752
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4YBY2 5753 5754 5755, 5756, 5757, 5758, 5759, 5760
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4YCB3 5761 5762 5763, 5764, 5765, 5766, 5767, 5768
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4YEC2 5769 5770 5771, 5772, 5773, 5774, 5775, 5776
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4YF30 5777 5778 5779, 5780, 5781, 5782, 5783, 5784
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4YGU2 5785 5786 5787, 5788, 5789, 5790, 5791, 5792
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4YHN3 5793 5794 5795, 5796, 5797, 5798, 5799, 5800
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4YIU4 5801 5802 5803, 5804, 5805, 5806, 5807, 5808
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4YJ74 5809 5810 5811, 5812, 5813, 5814, 5815, 5816
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4YKC5 5817 5818 5819, 5820, 5821, 5822, 5823, 5824
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4YMN8 5825 5826 5827, 5828, 5829, 5830, 5831, 5832
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4YMV6 5833 5834 5835, 5836, 5837, 5838, 5839, 5840
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4YPP6 5841 5842 5843, 5844, 5845, 5846, 5847, 5848
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4YRD4 5849 5850 5851, 5852, 5853, 5854, 5855, 5856
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4YS13 5857 5858 5859, 5860, 5861, 5862, 5863, 5864
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4YTJ7 5865 5866 5867, 5868, 5869, 5870, 5871, 5872
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4YUX9 5873 5874 5875, 5876, 5877, 5878, 5879, 5880
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4YV34 5881 5882 5883, 5884, 5885, 5886, 5887, 5888
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4YXE1 5889 5890 5891, 5892, 5893, 5894, 5895, 5896
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4YYM6 5897 5898 5899, 5900, 5901, 5902, 5903, 5904
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4YZB7 5905 5906 5907, 5908, 5909, 5910, 5911, 5912
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4Z060 5913 5914 5915, 5916, 5917, 5918, 5919, 5920
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4Z1S2 5921 5922 5923, 5924, 5925, 5926, 5927, 5928
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4Z2L6 5929 5930 5931, 5932, 5933, 5934, 5935, 5936
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4Z4A1 5937 5938 5939, 5940, 5941, 5942, 5943, 5944
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4Z552 5945 5946 5947, 5948, 5949, 5950, 5951, 5952
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4Z6N6 5953 5954 5955, 5956, 5957, 5958, 5959, 5960
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4Z800 5961 5962 5963, 5964, 5965, 5966, 5967, 5968
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4Z9V2 5969 5970 5971, 5972, 5973, 5974, 5975, 5976
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4ZB52 5977 5978 5979, 5980, 5981, 5982, 5983, 5984
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4ZCA2 5985 5986 5987, 5988, 5989, 5990, 5991, 5992
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4ZCG3 5993 5994 5995, 5996, 5997, 5998, 5999, 6000
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4ZEM2 6001 6002 6003, 6004, 6005, 6006, 6007, 6008
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4ZFD0 6009 6010 6011, 6012, 6013, 6014, 6015, 6016
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4ZGR1 6017 6018 6019, 6020, 6021, 6022, 6023, 6024
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4ZIM2 6025 6026 6027, 6028, 6029, 6030, 6031, 6032
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4ZJC0 6033 6034 6035, 6036, 6037, 6038, 6039, 6040
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4ZK17 6041 6042 6043, 6044, 6045, 6046, 6047, 6048
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4ZMC8 6049 6050 6051, 6052, 6053, 6054, 6055, 6056
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4ZMX9 6057 6058 6059, 6060, 6061, 6062, 6063, 6064
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4ZP21 6065 6066 6067, 6068, 6069, 6070, 6071, 6072
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4ZQ62 6073 6074 6075, 6076, 6077, 6078, 6079, 6080
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4ZQ92 6081 6082 6083, 6084, 6085, 6086, 6087, 6088
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4ZS31 6089 6090 6091, 6092, 6093, 6094, 6095, 6096
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4ZS87 6097 6098 6099, 6100, 6101, 6102, 6103, 6104
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4ZTS6 6105 6106 6107, 6108, 6109, 6110, 6111, 6112
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4ZUK0 6113 6114 6115, 6116, 6117, 6118, 6119, 6120
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4ZVN6 6121 6122 6123, 6124, 6125, 6126, 6127, 6128
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4ZWP2 6129 6130 6131, 6132, 6133, 6134, 6135, 6136
Cytosine_Deaminase_fcy1 UniProtKB: A0A0D4ZX07 6137 6138 6139, 6140, 6141, 6142, 6143, 6144
Cytosine_Deaminase_fcy1 UniProtKB: Q12178 6145 6146 6147, 6148, 6149, 6150, 6151, 6152
Cytosine_Deaminase_fcy1 UniProtKB: W7PK48 6153 6154 6155, 6156, 6157, 6158, 6159, 6160
Cytosine_Deaminase_fcy1 UniProtKB: W7R647 6161 6162 6163, 6164, 6165, 6166, 6167, 6168
Deoxy-cytidine_Kinase_dCK UniProtKB: P27707 6169 6170 6171, 6172, 6173, 6174, 6175, 6176
Deoxynucleoside_Kinase_dNK UniProtKB: Q540Z9 6177 6178 6179, 6180, 6181, 6182, 6183, 6184
Deoxynucleoside_Kinase_dNK UniProtKB: Q9XZT6 6185 6186 6187, 6188, 6189, 6190, 6191, 6192
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: A0A023Z7B9 6193 6194 6195, 6196, 6197, 6198, 6199, 6200
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: A0A024KMI2 6201 6202 6203, 6204, 6205, 6206, 6207, 6208
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: A0A0E0SRY5 6209 6210 6211, 6212, 6213, 6214, 6215, 6216
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: A0A0E0U7I4 6217 6218 6219, 6220, 6221, 6222, 6223, 6224
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: A0A0E0VFI3 6225 6226 6227, 6228, 6229, 6230, 6231, 6232
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: A0A0E0Y455 6233 6234 6235, 6236, 6237, 6238, 6239, 6240
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: A0A0E1M7E2 6241 6242 6243, 6244, 6245, 6246, 6247, 6248
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: A0A0E3KJD7 6249 6250 6251, 6252, 6253, 6254, 6255, 6256
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: A0A0F6CCW6 6257 6258 6259, 6260, 6261, 6262, 6263, 6264
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: A0A0F6FGI8 6265 6266 6267, 6268, 6269, 6270, 6271, 6272
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: A0A0F6GWR2 6273 6274 6275, 6276, 6277, 6278, 6279, 6280
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: A0A0G2SIK5 6281 6282 6283, 6284, 6285, 6286, 6287, 6288
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: A0A0G3J9R6 6289 6290 6291, 6292, 6293, 6294, 6295, 6296
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: A0A0G3J9Y2 6297 6298 6299, 6300, 6301, 6302, 6303, 6304
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: A0A0G3KD68 6305 6306 6307, 6308, 6309, 6310, 6311, 6312
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: A0A0H2Z6H1 6313 6314 6315, 6316, 6317, 6318, 6319, 6320
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: A0A0H3EQW1 6321 6322 6323, 6324, 6325, 6326, 6327, 6328
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: A0A0H3XF09 6329 6330 6331, 6332, 6333, 6334, 6335, 6336
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: A0A0J9WZC9 6337 6338 6339, 6340, 6341, 6342, 6343, 6344
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: A7ZVS7 6345 6346 6347, 6348, 6349, 6350, 6351, 6352
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: A8A8B3 6353 6354 6355, 6356, 6357, 6358, 6359, 6360
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: B1IS35 6361 6362 6363, 6364, 6365, 6366, 6367, 6368
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: B1LEI9 6369 6370 6371, 6372, 6373, 6374, 6375, 6376
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: B1XFJ4 6377 6378 6379, 6380, 6381, 6382, 6383, 6384
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: B3HEI4 6385 6386 6387, 6388, 6389, 6390, 6391, 6392
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: B5Z4R6 6393 6394 6395, 6396, 6397, 6398, 6399, 6400
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: B6I6N1 6401 6402 6403, 6404, 6405, 6406, 6407, 6408
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: B7LEN0 6409 6410 6411, 6412, 6413, 6414, 6415, 6416
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: B7LXU6 6417 6418 6419, 6420, 6421, 6422, 6423, 6424
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: B7MNJ1 6425 6426 6427, 6428, 6429, 6430, 6431, 6432
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: B7N2V8 6433 6434 6435, 6436, 6437, 6438, 6439, 6440
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: B7NH52 6441 6442 6443, 6444, 6445, 6446, 6447, 6448
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: B7NW64 6449 6450 6451, 6452, 6453, 6454, 6455, 6456
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: B7UR12 6457 6458 6459, 6460, 6461, 6462, 6463, 6464
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: C3SE47 6465 6466 6467, 6468, 6469, 6470, 6471, 6472
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: C4ZT66 6473 6474 6475, 6476, 6477, 6478, 6479, 6480
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: C8TQD7 6481 6482 6483, 6484, 6485, 6486, 6487, 6488
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: C8U157 6489 6490 6491, 6492, 6493, 6494, 6495, 6496
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: C8UN92 6497 6498 6499, 6500, 6501, 6502, 6503, 6504
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: D3GY24 6505 6506 6507, 6508, 6509, 6510, 6511, 6512
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: D3QNE6 6513 6514 6515, 6516, 6517, 6518, 6519, 6520
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: D6I4N2 6521 6522 6523, 6524, 6525, 6526, 6527, 6528
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: D6IHU2 6529 6530 6531, 6532, 6533, 6534, 6535, 6536
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: D6J6A4 6537 6538 6539, 6540, 6541, 6542, 6543, 6544
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: E0J437 6545 6546 6547, 6548, 6549, 6550, 6551, 6552
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: E2QLE4 6553 6554 6555, 6556, 6557, 6558, 6559, 6560
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: E3PFG7 6561 6562 6563, 6564, 6565, 6566, 6567, 6568
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: E8YEH0 6569 6570 6571, 6572, 6573, 6574, 6575, 6576
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: F4NLK2 6577 6578 6579, 6580, 6581, 6582, 6583, 6584
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: F4SEX7 6585 6586 6587, 6588, 6589, 6590, 6591, 6592
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: F4STB8 6593 6594 6595, 6596, 6597, 6598, 6599, 6600
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: F4T9F1 6601 6602 6603, 6604, 6605, 6606, 6607, 6608
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: F4UXB7 6609 6610 6611, 6612, 6613, 6614, 6615, 6616
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: F4VN60 6617 6618 6619, 6620, 6621, 6622, 6623, 6624
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: F4VQF8 6625 6626 6627, 6628, 6629, 6630, 6631, 6632
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: H9V0H4 6633 6634 6635, 6636, 6637, 6638, 6639, 6640
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: J7QV83 6641 6642 6643, 6644, 6645, 6646, 6647, 6648
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: P0ABP8 6649 6650 6651, 6652, 6653, 6654, 6655, 6656
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: Q0T8S9 6657 6658 6659, 6660, 6661, 6662, 6663, 6664
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: Q1R259 6665 6666 6667, 6668, 6669, 6670, 6671, 6672
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: W8ZSE4 6673 6674 6675, 6676, 6677, 6678, 6679, 6680
Purine_Nucleoside_Phosphorylase_deoD UniProtKB: X5FDR9 6681 6682 6683, 6684, 6685, 6686, 6687, 6688
Thymidine_Kinase_TK UniProtKB: B2CPP5 6689 6690 6691, 6692, 6693, 6694, 6695, 6696
Thymidine_Kinase_TK UniProtKB: B2CPP6 6697 6698 6699, 6700, 6701, 6702, 6703, 6704
Thymidine_Kinase_TK UniProtKB: B2CPP7 6705 6706 6707, 6708, 6709, 6710, 6711, 6712
Thymidine_Kinase_TK UniProtKB: B2CPP8 6713 6714 6715, 6716, 6717, 6718, 6719, 6720
Thymidine_Kinase_TK UniProtKB: B2CPP9 6721 6722 6723, 6724, 6725, 6726, 6727, 6728
Thymidine_Kinase_TK UniProtKB: B2CPQ0 6729 6730 6731, 6732, 6733, 6734, 6735, 6736
Thymidine_Kinase_TK UniProtKB: B2CPQ2 6737 6738 6739, 6740, 6741, 6742, 6743, 6744
Thymidine_Kinase_TK UniProtKB: B2CPQ3 6745 6746 6747, 6748, 6749, 6750, 6751, 6752
Thymidine_Kinase_TK UniProtKB: B2CPQ4 6753 6754 6755, 6756, 6757, 6758, 6759, 6760
Thymidine_Kinase_TK UniProtKB: B2CPQ5 6761 6762 6763, 6764, 6765, 6766, 6767, 6768
Thymidine_Kinase_TK UniProtKB: O72346 6769 6770 6771, 6772, 6773, 6774, 6775, 6776
Thymidine_Kinase_TK UniProtKB: P06478 6777 6778 6779, 6780, 6781, 6782, 6783, 6784
Thymidine_Kinase_TK UniProtKB: P08333 6785 6786 6787, 6788, 6789, 6790, 6791, 6792
Thymidine_Kinase_TK UniProtKB: Q9DLP2 6793 6794 6795, 6796, 6797, 6798, 6799, 6800
Thymidine_Kinase_TK UniProtKB: Q9ENS0 6801 6802 6803, 6804, 6805, 6806, 6807, 6808
Thymidine_Kinase_TK UniProtKB: Q9ENS1 6809 6810 6811, 6812, 6813, 6814, 6815, 6816
Thymidine_Kinase_TK UniProtKB: Q9ENS2 6817 6818 6819, 6820, 6821, 6822, 6823, 6824
Thymidine_Kinase_TK UniProtKB: Q9ENS3 6825 6826 6827, 6828, 6829, 6830, 6831, 6832
Thymidine_Kinase_TK UniProtKB: Q9ENS4 6833 6834 6835, 6836, 6837, 6838, 6839, 6840
Thymidine_Kinase_TK UniProtKB: Q9ENS5 6841 6842 6843, 6844, 6845, 6846, 6847, 6848
Thymidine_Kinase_TK UniProtKB: Q9IYZ7 6849 6850 6851, 6852, 6853, 6854, 6855, 6856
Thymidine_Kinase_TK UniProtKB: Q91YZ9 6857 6858 6859, 6860, 6861, 6862, 6863, 6864
Thymidine_Kinase_TK UniProtKB: Q9IZ02 6865 6866 6867, 6868, 6869, 6870, 6871, 6872
Thymidine_Kinase_TK UniProtKB: Q91Z03 6873 6874 6875, 6876, 6877, 6878, 6879, 6880
Thymidine_Kinase_TK UniProtKB: Q91Z07 6881 6882 6883, 6884, 6885, 6886, 6887, 6888
Thymidine_Kinase_TK UniProtKB: Q9QNF7 6889 6890 6891, 6892, 6893, 6894, 6895, 6896


[0101] In a more preferred embodiment, the composition disclosed herein comprises at least one RNA, preferably an mRNA comprising at least one coding region encoding at least one suicide gene product or a fragment or variant thereof, wherein the at least one coding region comprises an RNA sequence being identical or at least 50%, 60%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to the RNA sequences according to the SEQ ID Nos as disclosed in Table 4.

4. Immunogenic proteins or peptides



[0102] Preferably the RNA, preferably mRNA, of the RNA composition disclosed herein codes for at least one immunogenic protein or peptide, especially a protein or peptide of a pathogen, preferably a viral pathogen, or a fragment or variant thereof. By using RNA which codes for an immunogenic protein or peptide which is preferably a pathogenic antigen it is possible to utilize preexisting immunity against such antigens for treatment of tumor and/or cancer diseases. The memory immune response is triggered and the immune system is strengthened for attacking tumor cells.

[0103] This embodiment is based on the recognition that in principle every organism with an immune system exhibits "memory immune responses" against certain foreign molecules (antigens), for example proteins, in particular viral or bacterial proteins. If an organism has already been infected at an earlier point in time with the antigen an immune response against e.g. the viral protein has already been triggered by this infection. The immune system has a "memory" of this response and stores it. As consequence of a reinfection with the antigen the immune response is reactivated. Such reactivation may proceed by administration of an RNA, preferably mRNA coding for the antigen, wherein the preferred intratumoral administration according to the present disclosure is especially effective. By reactivation of the memory immune response against e.g. viral pathogens it is possible to destroy tumor cells effectively.

[0104] Preferred examples of immunogenic proteins or peptides for this embodiment are proteins or peptides of widespread pathogens, i.e. pathogens with which every organism, in particular mammals, preferably humans, has a high probability of being infected at least once in his/her lifetime. These include, for example, any structural or non-structural protein or peptide of:
  • influenza virus type A or B or any other orthomyxovirus (influenza type C),
  • picornaviruses, such as rhinovirus or hepatitis A virus,
  • togaviruses, such as alphavirus or rubivirus, e.g. Sindbis, Semliki-Forest or rubeolavirus (measles virus),
  • rubella virus (German measles virus),
  • coronaviruses, in particular subtypes HCV-229E or HCV-OC43,
  • rhabdoviruses, such as rabies virus,
  • paramyxoviruses, such as mumps virus,
  • reoviruses, such as group A, B or C rotavirus,
  • hepadnaviruses, such as hepatitis B virus,
  • papoviruses, such as human papillomaviruses (HPV) of any serotype, especially from 1 to 75,
  • adenoviruses, in particular type 1 to 47,
  • herpesviruses, such as Herpes simplex virus 1, 2 or 3,
  • cytomegalovirus (CMV), preferably CMVpp65,
  • Epstein Barr virus (EBV),
  • vaccinia viruses and
  • the bacterium Chlamydophila pneumoniae (Chlamydia pneumoniae).


[0105] Further examples of preferred immunogenic proteins or peptides are proteins or peptides of pathogens which only seldom infect an organism. Nevertheless RNA coding for one or more of these proteins or peptides may be effective in the approach disclosed herein. These proteins or peptide include, for example, any structural or non-structural protein or peptide of:
  • Flaviviruses, such as dengue virus type 1 to 4, yellow fever virus, West Nile virus, Japanese encephalitis virus
  • hepatitis C virus,
  • caliciviruses,
  • filoviruses, such as Ebola virus,
  • bornaviruses,
  • bunyaviruses, such as Rift Valley fever virus,
  • arenaviruses, such as LCMV (lymphocytic choriomeningitis virus) or hemorrhagic fever viruses,
  • retroviruses, such as HIV and
  • parvoviruses.


[0106] Preferably, the RNA of the mRNA composition disclosed herein codes for influenza nucleoprotein (NP). It has been shown by the inventors that the use of a composition containing mRNA coding for influenza nucleoprotein is especially effective in reducing tumor size, when applied according to the approach disclosed herein. In this context, an mRNA encoding an Influenza nucleoprotein according to SEQ ID NO. 6 is particularly preferred.

5. Cell death inducers and apoptosis inducers:



[0107] In the broadest sense, an apoptosis inducer or cell death inducer has to be understood as a molecule inducing autophagy, cornification, excitotoxicity, necrosis, Wallerian degeneration, entosis, mitotic catastrophe, necroptosis and pyroptosis (reviewed in Kroemer, G., et al. "Classification of cell death: recommendations of the Nomenclature Committee on Cell Death 2009." Cell Death & Differentiation 16.1 (2009): 3-11.).

[0108] In a further preferred embodiment of the RNA containing composition disclosed herein, the RNA codes for at least one apoptosis inducer, preferably an apoptosis inducer chosen from the group consisting of the Bcl-2 family and tumor suppressor protein p53 and ligands of transmembrane death receptors, especially the TNF (tumor necrosis factor) receptor gene superfamily, pro-apoptic receptor agonists and Beclin-1.

[0109] A particularily preferred apoptosis inducer in the context of the present disclosure is Beclin-1 (derived from the BECN1 gene). It is known in the art that Beclin-1 interacts with Bcl-2, BCL2L2, GOPC and MAP1LC3A to regulate autophagy and cell death.

[0110] Apoptosis provides an important barrier against cancer. However, specific mutations (e.g. mutation of the tumor suppressor gene p53) enable some tumor cells to escape apoptotic death and become more malignant. By using an mRNA coding for at least one apoptosis inducer it is possible to reactivate apoptosis which is an important and effective system of the organism to eliminate cancer cells.

[0111] Preferred examples of apoptosis inducers may be chosen from the following list: Bcl-10, Bax, Bak, Bid, Bad, Bim, Bik, Blk, Cytochrome c, Caspases, especially Caspase 3, Caspase 6, Caspase 7, Caspase 8, Caspase 9, Death domain, especially of Fas, preferably FasL, TNFα, Apo2L/TRAIL, agonist of DR4 and/or DR5, Apo3L, DR4 agonistic antibody, DR5 agonistic antibody, protein kinase R (PKR) (preferably constitutive active PKR), Granzyme B.

[0112] Two signalling pathways initiate apoptosis: the intrinsic pathway acts through intracellular Bcl-2 proteins, the extrinsic pathway through cell-surface pro-apoptotic receptors.

[0113] The intrinsic signaling pathway for programmed cell death involves non-receptor-mediated intracellular signals, inducing activities in the mitochondria that initiate apoptosis. Stimuli for the intrinsic pathway include viral infections or damage to the cell by toxins, free radicals, or radiation. Damage to the cellular DNA can also induce the activation of the intrinsic pathway for programmed cell death. These stimuli induce changes in the inner mitochondrial membrane that result in the loss of transmembrane potential, causing the release of pro-apoptotic proteins into the cytosol. Pro-apoptotic proteins activate caspases that mediate the destruction of the cell through many pathways. These proteins also translocate into the cellular nucleus, inducing DNA fragmentation, a hallmark of apoptosis. The regulation of pro-apoptotic events in the mitochondria occurs through activity of members of the Bcl-2 family of proteins and the tumor suppressor protein p53. Members of the Bcl-2 family of proteins may be pro-apoptotic or anti-apoptotic. The anti-apoptotic proteins are Bcl-2, Bcl-x, Bcl-xL, Bcl-XS, Bcl-w, and BAG. Pro-apoptotic proteins include Bcl-10, Bax, Bak, Bid, Bad, Bim, Bik, and Blk (Elmore, 2007. Toxicol Pathol. 35(4):495-516 (PMID: 17562483)), which are especially preferred for the approach disclosed herein.

[0114] The extrinsic signaling pathway leading to apoptosis involves transmembrane death receptors that are members of the tumor necrosis factor (TNF) receptor gene superfamily. Members of this receptor family bind to extrinsic ligands and transduce intracellular signals that ultimately result in the destruction of the cell. The most well characterized ligands of these receptors to date are FasL, TNFα, Apo2L, and Apo3L. Corresponding receptors are FasR, TNFR1, DR3, and DR4/DR5. Molecules that stimulate the activity of these pro-apoptotic proteins or activate these receptors are currently under evaluation for their therapeutic potential in the treatment of cancer, including hematologic malignancies (Elmore, 2007. Toxicol Pathol. 35(4):495-516 (PMID: 17562483)). These extrinsic ligands are further especially preferred examples for use in the approach disclosed herein.

[0115] New molecular insights have inspired the development of pro-apoptotic receptor agonists (PARAs), including the recombinant human protein apoptosis ligand 2/TNF-related apoptosis-inducing ligand (Apo2L/TRAIL). In addition, agonistic monoclonal antibodies to its signalling receptors DR4 (TRAILR1) and DR5 (TRAILR2) are under development. Mapatumumab is an example of a DR4 agonist antibody. Examples of DR5 agonistic antibodies include Lexatumumab, Apomab, AMG655, CS-1008 and LBY-135 (Ashkenazi, 2008. Nat. Rev. Drug Discov. 7(12):1001-12 (PMID: 18989337)).

[0116] The following table 5 summarizes some preferred apoptosis inducers.
Table 5: Apoptosis inducers
Gene/AgentExample
Intrinsic pathway
Bcl-10  
Bax  
Bak  
Bid  
Bad  
Bim  
Bik  
Blk  
Cytochrome c  
Caspase 3, 6, 7, 8, 9  
Extrinsic pathway
FasL  
TNFα  
Apo2L/TRAIL  
Apo3L  
DR4 agonist antibody Mapatumumab
DR5 agonist antibody Lexatumumab, Apomab, AMG655, CS-1008, LBY-135
Other
Granzyme B  


[0117] According to preferred embodiments in the context of the present disclosure, apoptosis inducers may be selected from any apoptosis inducer selected from the group consisting of Apo2L/TRAIL; Apo3L; Bad; Bak; Bax; Bcl-10; Bid; Bik; Bim; Blk; Caspase_3; Caspase_6; Caspase_7; Caspase_8; Caspase_9; Cytochrome_c; FasL; Granzyme_B; TNF, preferably as disclosed in Table 6. Particularly preferred in this context are the RNA sequences encoding an apoptosis inducer according to Table 6.
Table 6: Apoptosis inducers:
Gene NameProtein Accession No.Protein Sequence SEQ ID NO:RNA Sequence wild type SEQ ID NO:Optimized RNA Sequence SEQ ID NO:
Apo2L/TRAIL UniProtKB: P50591 6897 6898 6899, 6900, 6901, 6902, 6903, 6904
Apo3L UniProtKB: O43508 6905 6906 6907, 6908, 6909, 6910, 6911, 6912
Bad UniProtKB: A0A024R562 6913 6914 6915, 6916, 6917, 6918, 6919, 6920
Bad UniProtKB: Q92934 6921 6922 6923, 6924, 6925, 6926, 6927, 6928
Bak UniProtKB: Q16611 6929 6930 6931, 6932, 6933, 6934, 6935, 6936
Bak UniProtKB: Q8NFF3 6937 6938 6939, 6940, 6941, 6942, 6943, 6944
Bax UniProtKB: A0A0C4MVT1 6945 6946 6947, 6948, 6949, 6950, 6951, 6952
Bax UniProtKB: A0A0C4MW46 6953 6954 6955, 6956, 6957, 6958, 6959, 6960
Bax UniProtKB: A0A0C4MWS3 6961 6962 6963, 6964, 6965, 6966, 6967, 6968
Bax UniProtKB: 16LPK7 6969 6970 6971, 6972, 6973, 6974, 6975, 6976
Bax UniProtKB: K4JQN1 6977 6978 6979, 6980, 6981, 6982, 6983, 6984
Bax UniProtKB: Q07812 6985 6986 6987, 6988, 6989, 6990, 6991, 6992
Bcl-10 UniProtKB: O95999 6993 6994 6995, 6996, 6997, 6998, 6999, 7000
Bid UniProtKB: A8ASI8 7001 7002 7003, 7004, 7005, 7006, 7007, 7008
Bid UniProtKB: B2ZP78 7009 7010 7011, 7012, 7013, 7014, 7015, 7016
Bid UniProtKB: B2ZP79 7017 7018 7019, 7020, 7021, 7022, 7023, 7024
Bid UniProtKB: P55957 7025 7026 7027, 7028, 7029, 7030, 7031, 7032
Bik UniProtKB: A0A024R4X6 7033 7034 7035, 7036, 7037, 7038, 7039, 7040
Bik UniProtKB: Q13323 7041 7042 7043, 7044, 7045, 7046, 7047, 7048
Bim UniProtKB: O43521 7049 7050 7051, 7052, 7053, 7054, 7055, 7056
Blk UniProtKB: P51451 7057 7058 7059, 7060, 7061, 7062, 7063, 7064
Caspase_3 UniProtKB: P42574 7065 7066 7067, 7068, 7069, 7070, 7071, 7072
Caspase_6 UniProtKB: P55212 7073 7074 7075, 7076, 7077, 7078, 7079, 7080
Caspase_7 UniProtKB: P55210 7081 7082 7083, 7084, 7085, 7086, 7087, 7088
Caspase_8 UniProtKB: B5BU46 7089 7090 7091, 7092, 7093, 7094, 7095, 7096
Caspase_8 UniProtKB: B6CGU5 7097 7098 7099, 7100, 7101, 7102, 7103, 7104
Caspase_8 UniProtKB: C3S3G0 7105 7106 7107, 7108, 7109, 7110, 7111, 7112
Caspase_8 UniProtKB: Q14790 7113 7114 7115, 7116, 7117, 7118, 7119, 7120
Caspase_9 UniProtKB: A0A024R8F1 7121 7122 7123, 7124, 7125, 7126, 7127, 7128
Caspase_9 UniProtKB: A0A024R814 7129 7130 7131, 7132, 7133, 7134, 7135, 7136
Caspase_9 UniProtKB: P55211 7137 7138 7139, 7140, 7141, 7142, 7143, 7144
Caspase_9 UniProtKB: Q9H257 7145 7146 7147, 7148, 7149, 7150, 7151, 7152
Cytochrome_c UniProtKB: A0A024R9B7 7153 7154 7155, 7156, 7157, 7158, 7159, 7160
Cytochrome_c UniProtKB: A0A024RAP6 7161 7162 7163, 7164, 7165, 7166, 7167, 7168
Cytochrome_c UniProtKB: A0A024RBN6 7169 7170 7171, 7172, 7173, 7174, 7175, 7176
Cytochrome_c UniProtKB: A0A024RBY9 7177 7178 7179, 7180, 7181, 7182, 7183, 7184
Cytochrome_c UniProtKB: B8XYC5 7185 7186 7187, 7188, 7189, 7190, 7191, 7192
Cytochrome_c UniProtKB: G4XXL9 7193 7194 7195, 7196, 7197, 7198, 7199, 7200
Cytochrome_c UniProtKB: H0UI06 7201 7202 7203, 7204, 7205, 7206, 7207, 7208
Cytochrome_c UniProtKB: H6SG12 7209 7210 7211, 7212, 7213, 7214, 7215, 7216
Cytochrome_c UniProtKB: H6SG13 7217 7218 7219, 7220, 7221, 7222, 7223, 7224
Cytochrome_c UniProtKB: H6SG14 7225 7226 7227, 7228, 7229, 7230, 7231, 7232
Cytochrome_c UniProtKB: H6SG15 7233 7234 7235, 7236, 7237, 7238, 7239, 7240
Cytochrome_c UniProtKB: 095101 7241 7242 7243, 7244, 7245, 7246, 7247, 7248
Cytochrome_c UniProtKB: P08574 7249 7250 7251, 7252, 7253, 7254, 7255, 7256
Cytochrome_c UniProtKB: P99999 7257 7258 7259, 7260, 7261, 7262, 7263, 7264
Cytochrome_c UniProtKB: Q49610 7265 7266 7267, 7268, 7269, 7270, 7271, 7272
Cytochrome_c UniProtKB: Q53XN1 7273 7274 7275, 7276, 7277, 7278, 7279, 7280
Cytochrome_c UniProtKB: Q6FGA0 7281 7282 7283, 7284, 7285, 7286, 7287, 7288
Cytochrome_c UniProtKB: Q6FGI7 7289 7290 7291, 7292, 7293, 7294, 7295, 7296
Cytochrome_c UniProtKB: Q71U45 7297 7298 7299, 7300, 7301, 7302, 7303, 7304
Cytochrome_c UniProtKB: Q86WV2 7305 7306 7307, 7308, 7309, 7310, 7311, 7312
Cytochrome_c UniProtKB: Q9UEG9 7313 7314 7315, 7316, 7317, 7318, 7319, 7320
FasL UniProtKB: P48023 7321 7322 7323, 7324, 7325, 7326, 7327, 7328
Granzyme_B UniProtKB: J3KQ52 7329 7330 7331, 7332, 7333, 7334, 7335, 7336
Granzyme_B UniProtKB: Q67BC3 7337 7338 7339, 7340, 7341, 7342, 7343, 7344
Granzyme_B UniProtKB: Q6XGZ2 7345 7346 7347, 7348, 7349, 7350, 7351, 7352
Granzyme_B UniProtKB: Q6XGZ3 7353 7354 7355, 7356, 7357, 7358, 7359, 7360
Granzyme_B UniProtKB: Q6XGZ4 7361 7362 7363, 7364, 7365, 7366, 7367, 7368
TNF UniProtKB: P01375 7369 7370 7371, 7372, 7373, 7374, 7375, 7376
TNF UniProtKB: Q5STB3 7377 7378 7379, 7380, 7381, 7382, 7383, 7384


[0118] In a more preferred embodiment, the composition disclosed herein comprises at least one RNA, preferably an mRNA comprising at least one coding region encoding at least one apoptosis inducer or cell death inducer or a fragment or variant thereof, wherein the at least one coding region comprises an RNA sequence being identical or at least 50%, 60%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to the RNA sequences according to the SEQ ID Nos as disclosed in Table 6.

6. Angiogenesis inhibitors



[0119] In a further preferred embodiment of the RNA containing composition disclosed herein the at least one RNA, preferably mRNA, codes for at least one angiogenesis modulator or inhibitor, preferably an endogenous angiogenesis inhibitor or a fragment or variant thereof. Tumor growth and survival depend on angiogenesis to provide a path for delivery of oxygen and nutrients to tumor cells. By using RNA coding for at least one angiogenesis inhibitor according to the approach disclosed herein, it is possible to block angiogenesis in a localized manner, namely within the tumor tissue, thereby providing an effective method for stopping tumor growth and decreasing tumor volume. Preferred examples of angiogenesis inhibitors according to the present disclosure may be chosen from the following list: interferon alpha (IFN-α), (interferon beta) IFN-β, interferon gamma (IFN-γ), CXCL9, CXCL10, interleukin 12 (IL-12), platelet factor 4 (PF-4), tumor necrosis factor alpha (TNF-α), soluble fms-like tyrosine kinase 1 (sFLT-1), Fetal Liver Kinase 1 (FLK-1), Angiostatin, Endostatin, Vasostatin, Canstatin, Tumstatin, 16 kD prolacin fragment, tissue inhibitor of metalloproteinases 1 (TIMP-1), tissue inhibitor of metalloproteinases 2 (TIMP-2), tissue inhibitor of metalloproteinases 3 (TIMP-3), thrombospondin 1 (TSP-1), thrombospondin 2 (TSP-2), Maspin, PEX, soluble Tyrosine-protein kinase receptor 1 (sTie1), soluble Angiopoietin-1 receptor 2 (sTie2), Angiopoietin-1, Angiopoietin-2, Antivascular endothelial growth factor receptor 2 (VEGFR2) antibody (e.g. Alacizumab, Ramucirumab), Anti-vascular endothelial growth factor (VEGF) antibody (e.g. Brolucizumab, Ranibizumab, Bevacizumab), and Anti-vascular endothelial growth factor receptor 1 (VEGFR1) antibody (e.g. Icrucumab).

[0120] Without this process of blood vessel recruitment, tumor growth is limited to 1 to 2 mm2, the diffusion limit of oxygen. Already in 1971, Folkman proposed that tumor growth could be arrested by blocking angiogenesis (Folkman, 1972. N. Engl. J. Med. 285(21):1182-6).

[0121] Angiogenesis is a multistep process of new blood vessel formation from preexisting vasculature that includes the activation, proliferation and migration of endothelial cells (ECs), disruption of vascular basement membranes, remodeling of the extracellular matrix of tissues, formation of vascular tubes and networks, recruitment of supporting cells, including smooth muscle cells and pericytes, and connection to the pre-existing vascular network.

[0122] Within a given microenvironment, the angiogenic response results from a balance between pro-angiogenic and anti-angiogenic factors, secreted both by tumor cells and components of the stroma; the prevalence of the former determines the "angiogenic switch", resulting in the activation of angiogenesis followed by tumor outgrowth (Hanahan and Folkman, 1996. Cell 86(3):353-64).

[0123] Gene therapy based strategies of angiogenesis inhibition and especially the approach disclosed herein have several advantages compared with conventional modalities of administration of anti-angiogenic drugs. First of all, since effective suppression of pathological angiogenesis may eventually require chronic treatment, the gene therapy strategy disclosed herein is useful to achieve selective delivery to affected tissues and prolonged expression of the therapeutic agents. Gene therapy in general also represents a method for circumventing the production problems of many recombinant proteins including their stability and solubility; adequate production of anti-angiogenic factors by recombinant engineering methods has been sometimes problematic (e.g. for angiostatin) and may limit their clinical application. Moreover gene transfer usage allows the correct folding of proteic agents and their stability in vivo since they are assembled in their physiologic environment. A particularly attractive feature of the approach disclosed herein is the possibility of targeting gene delivery to selective tissues, namely tumor tissue, thus achieving localized gene expression and high regional drug concentrations without increasing the systemic levels of the therapeutic agents and thereby resulting in an improved therapeutic index.

[0124] Angiogenesis inhibitors are heterogeneous in origin and potency, and their growing list includes proteolysis products of larger molecules with a different function, such as angiostatin, endostatin and vasostatin, modulators of vascular endothelial growth factor activity, such as soluble FLT-1 (sFLT-1), and some cytokines/chemokines with marked anti-endothelial activity, such as IL-12, IFN-α, and CXCL10. The following table 8 (adapted from Persano et al., 2007. Mol. Aspects Med. 28(1):87-114. PMID: 17306361) summarizes the preferred angiogenesis inhibitors which may be used in the approach disclosed herein.

[0125] According to preferred embodiments in the context of the present disclosure, angiogenesis inhibitors may be selected from any endogenous angiogenesis inhibitor selected from the group consisting of Angiopoietin-2; Angiostatin; Canstatin; CXCL10; CXCL4; CXCL9; Endostatin; FLK-1; IFNalpha; IFNB; IFNG; IL-12; PEX; PRL; SERPINB5; sFLT-1; sTie2; TIMP-1; TIMP-2; TIMP-3; TNF; TSP-1; TSP-2; Tumstatin; Vasostatin, preferably as disclosed in Table 7. Particularly preferred in this context are the RNA sequences encoding an angiogenesis inhibitor according to Table 7.
Table 7: Endogenous angiogenesis inhibitors
Gene NameProtein Accession No.Protein Sequence SEQ ID NO:RNA Sequence wild type SEQ ID NO:Optimized RNA Sequence SEQ ID NO:
IFNalpha UniProtKB: G9JKF1 3953 3954 3955, 3956, 3957, 3958, 3959, 3960
IFNalpha UniProtKB: P01562 3961 3962 3963, 3964, 3965, 3966, 3967, 3968
IFNalpha UniProtKB: P01563 3969 3970 3971, 3972, 3973, 3974, 3975, 3976
IFNalpha UniProtKB: P01566 3977 3978 3979, 3980, 3981, 3982, 3983, 3984
IFNalpha UniProtKB: P01567 3985 3986 3987, 3988, 3989, 3990, 3991, 3992
IFNalpha UniProtKB: P01568 3993 3994 3995, 3996, 3997, 3998, 3999, 4000
IFNalpha UniProtKB: P01569 4001 4002 4003, 4004, 4005, 4006,4007, 4008
IFNalpha UniProtKB: P01570 4009 4010 4011, 4012, 4013, 4014, 4015, 4016
IFNalpha UniProtKB: P01571 4017 4018 4019, 4020, 4021, 4022, 4023, 4024
IFNalpha UniProtKB: P05013 4025 4026 4027, 4028, 4029, 4030, 4031, 4032
IFNalpha UniProtKB: P05014 4033 4034 4035, 4036, 4037, 4038, 4039, 4040
IFNalpha UniProtKB: P05015 4041 4042 4043, 4044, 4045, 4046, 4047, 4048
IFNalpha UniProtKB: P32881 4049 4050 4051, 4052, 4053, 4054, 4055, 4056
IFNalpha UniProtKB: Q14618 4057 4058 4059, 4060, 4061, 4062, 4063, 4064
IFNalpha UniProtKB: Q86UP4 4065 4066 4067, 4068, 4069, 4070, 4071, 4072
IFNB UniProtKB: P01574 4073 4074 4075, 4076, 4077, 4078, 4079, 4080
IFNB UniProtKB: Q15943 4081 4082 4083, 4084, 4085, 4086, 4087, 4088
IFNG UniProtKB: P01579 4089 4090 4091, 4092, 4093, 4094, 4095, 4096
IFNG UniProtKB: Q14609 4097 4098 4099, 4100, 4101, 4102, 4103, 4104
IFNG UniProtKB: Q14610 4105 4106 4107, 4108, 4109, 4110, 4111, 4112
IFNG UniProtKB: Q14611 4113 4114 4115, 4116, 4117, 4118, 4119, 4120
IFNG UniProtKB: Q14612 4121 4122 4123, 4124, 4125, 4126, 4127, 4128
IFNG UniProtKB: Q14613 4129 4130 4131, 4132, 4133, 4134, 4135, 4136
IFNG UniProtKB: Q14614 4137 4138 4139, 4140, 4141, 4142, 4143, 4144
IFNG UniProtKB: Q14615 4145 4146 4147, 4148, 4149, 4150, 4151, 4152
IFNG UniProtKB: Q8NHY9 4153 4154 4155, 4156, 4157, 4158, 4159, 4160
IL-12 UniProtKB: P29460 4193 4194 4195, 4196, 4197, 4198, 4199, 4200
CXCL10 UniProtKB: A0A024RDA4 5129 5130 5131, 5132, 5133, 5134, 5135, 5136
CXCL10 UniProtKB: P02778 5137 5138 5139, 5140, 5141, 5142, 5143, 5144
CXCL4 UniProtKB: P02776 5225 5226 5227, 5228, 5229, 5230, 5231, 5232
CXCL9 UniProtKB: L8E8X0 5273 5274 5275, 5276, 5277, 5278, 5279, 5280
CXCL9 UniProtKB: Q07325 5281 5282 5283, 5284, 5285, 5286, 5287, 5288
TNF UniProtKB: P01375 7369 7370 7371, 7372, 7373, 7374, 7375, 7376
TNF UniProtKB: Q5STB3 7377 7378 7379, 7380, 7381, 7382, 7383, 7384
Angiopoietin-2 UniProtKB: B2R6E3 7385 7386 7387, 7388, 7389, 7390, 7391, 7392
Angiopoietin-2 UniProtKB: 015123 7393 7394 7395, 7396, 7397, 7398, 7399, 7400
Angiostatin UniProtKB: A0A0F7G8J1 7401 7402 7403, 7404, 7405, 7406, 7407, 7408
Angiostatin UniProtKB: P00747 7409 7410 7411, 7412, 7413, 7414, 7415, 7416
Angiostatin UniProtKB: Q5TEH5 7417 7418 7419, 7420, 7421, 7422, 7423, 7424
Canstatin UniProtKB: P08572 7425 7426 7427, 7428, 7429, 7430, 7431, 7432
Endostatin Homo_sapiens 7433 7434 7435, 7436, 7437, 7438, 7439, 7440
FLK-1 UniProtKB: P35968 7441 7442 7443, 7444, 7445, 7446, 7447, 7448
PEX UniProtKB: P78562 7449 7450 7451, 7452, 7453, 7454, 7455, 7456
PRL UniProtKB: P01236 7457 7458 7459, 7460, 7461, 7462, 7463, 7464
SERPINB5 UniProtKB: P36952 7465 7466 7467, 7468, 7469, 7470, 7471, 7472
sFLT-1 UniProtKB: H9N1E7 7473 7474 7475, 7476, 7477, 7478, 7479, 7480
sFLT-1 UniProtKB: H9N1E8 7481 7482 7483, 7484, 7485, 7486, 7487, 7488
sFLT-1 UniProtKB: L7RSL3 7489 7490 7491, 7492, 7493, 7494, 7495, 7496
sFLT-1 UniProtKB: P17948 7497 7498 7499, 7500, 7501, 7502, 7503, 7504
sTie2 UniProtKB: B5A953 7505 7506 7507, 7508, 7509, 7510, 7511, 7512
TIMP-1 UniProtKB: P01033 7513 7514 7515, 7516, 7517, 7518, 7519, 7520
TIMP-2 UniProtKB: P16035 7521 7522 7523, 7524, 7525, 7526, 7527, 7528
TIMP-3 UniProtKB: P35625 7529 7530 7531, 7532, 7533, 7534, 7535, 7536
TSP-1 UniProtKB: P07996 7537 7538 7539, 7540, 7541, 7542, 7543, 7544
TSP-2 UniProtKB: P35442 7545 7546 7547, 7548, 7549, 7550, 7551, 7552
Tumstatin UniProtKB: Q01955 7553 7554 7555, 7556, 7557, 7558, 7559, 7560
Vasostatin UniProtKB: P10645 7561 7562 7563, 7564, 7565, 7566, 7567, 7568


[0126] In a more preferred embodiment, the composition disclosed herein comprises at least one RNA, preferably an mRNA comprising at least one coding region encoding at least one angiogenesis inhibitor or a fragment or variant thereof, wherein the at least one coding region comprises an RNA sequence being identical or at least 50%, 60%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to the RNA sequences according to the SEQ ID Nos as disclosed in Table 7.

7. Heat shock proteins



[0127] In a further preferred embodiment of the RNA containing composition disclosed herein, the RNA codes for at least one heat shock protein (HSP) or a fragment or variant thereof. Preferably, the heat shock protein may be chosen from the following list: HSP27, HSP47 (serpin H1), HSP60, HSP70, HSC70, GRP78 (BiP), HSP90, HSP110, GRP94 (gp96), GRP170 (ORP150), PDI/PDIA, CRT/CALR.

[0128] As reviewed by Graner et al. (Graner MW, Lillehei KO, Katsanis E. Endoplasmic reticulum chaperones and their roles in the immunogenicity of cancer vaccines. Front Oncol. 2015 Jan 6; 4:379. doi: 10.3389/fonc.2014.00379) heat shock proteins play essential cellular housekeeping functions and are indispensible during protein synthesis, folding and transport across intracellular membranes as well as protein degradation. HSPs belong to a multiprotein family of chaperons which consists of, but is not limited to, HSP27, HSP47 (serpin H1), HSP60, HSP70, HSC70, GRP78 (BiP), HSP90, HSP110, GRP94 (gp96), GRP170 (ORP150), PDI/PDIA, CRT/CALR. In addition to the intracellular functions as chaperons, HSPs have been shown to play an important extracellular role as simulators of the immune responses particularly in tumor settings. Various literature reports demonstrated that tumor-derived HSP-peptide complexes induce anti-tumor immune responses very efficiently. The molecular mechanism of these observations has been elucidated. HSPs as chaperons have the capacity to bind denatured peptides including the antigenic ones and those complexes are internalized by antigen presenting cells (APCs) which eventually leads to antigen presentation and induction of immunity. In addition to their chaperon function, HSPs have been shown to trigger danger signals in the tumor microenvironment and thus stimulate macrophages and dendritic cells (DCs) to produce proinflammatory cytokines and enhance the induced immune responses.

[0129] According to preferred embodiments in the context of the present disclosure, heat shock proteins may be selected from any heat shock protein selected from the group consisting of calreticulin; GRP170_(ORP150); GRP78_(BiP); GRP94_(gp96); HSC70; HSP110; HSP27; HSP47_(serpin_H1); HSP60; HSP70; HSP90; PDI/PDIA, preferably as disclosed in Table 8. Particularly preferred in this context are the RNA sequences encoding a heat shock protein according to Table 8.
Table 8: Heat shock proteins
Gene NameProtein Accession No.Protein Sequence SEQ ID NO:RNA Sequence wild type SEQ ID NO:Optimized RNA Sequence SEQ ID NO:
calreticulin UniProtKB: B4DHR1 7569 7570 7571, 7572, 7573, 7574, 7575, 7576
calreticulin UniProtKB: B4E2Y9 7577 7578 7579, 7580, 7581, 7582, 7583, 7584
calreticulin UniProtKB: P27797 7585 7586 7587, 7588, 7589, 7590, 7591, 7592
calreticulin UniProtKB: Q96L12 7593 7594 7595, 7596, 7597, 7598, 7599, 7600
GRP170_(ORP150) UniProtKB: Q9Y4L1 7601 7602 7603, 7604, 7605, 7606, 7607, 7608
GRP78_(BiP) UniProtKB: P11021 7609 7610 7611, 7612, 7613, 7614, 7615, 7616
GRP94_(gp96) UniProtKB: P14625 7617 7618 7619, 7620, 7621, 7622, 7623, 7624
HSC70 UniProtKB: P11142 7625 7626 7627, 7628, 7629, 7630, 7631, 7632
HSP110 UniProtKB: Q92598 7633 7634 7635, 7636, 7637, 7638, 7639, 7640
HSP27 UniProtKB: P04792 7641 7642 7643, 7644, 7645, 7646, 7647, 7648
HSP47_(serpin_H1) UniProtKB: P50454 7649 7650 7651, 7652, 7653, 7654, 7655, 7656
HSP60 UniProtKB: AOA024R3X4 7657 7658 7659, 7660, 7661, 7662, 7663, 7664
HSP60 UniProtKB: B3GQS7 7665 7666 7667, 7668, 7669, 7670, 7671, 7672
HSP60 UniProtKB: P10809 7673 7674 7675, 7676, 7677, 7678, 7679, 7680
HSP60 UniProtKB: Q0VDF9 7681 7682 7683, 7684, 7685, 7686, 7687, 7688
HSP70 UniProtKB: P38646 7689 7690 7691, 7692, 7693, 7694, 7695, 7696
HSP90 UniProtKB: P07900 7697 7698 7699, 7700, 7701, 7702, 7703, 7704
HSP90 UniProtKB: P08238 7705 7706 7707, 7708, 7709, 7710, 7711, 7712
PDI/PDIA UniProtKB: P07237 7713 7714 7715, 7716, 7717, 7718, 7719, 7720
PDI/PDIA UniProtKB: Q6YPB0 7721 7722 7723, 7724, 7725, 7726, 7727, 7728
PDI/PDIA UniProtKB: Q71S60 7729 7730 7731, 7732, 7733, 7734, 7735, 7736


[0130] In a more preferred embodiment, the composition disclosed herein comprises at least one RNA, preferably an mRNA comprising at least one coding region encoding at least one heat shock protein or a fragment or variant thereof, wherein the at least one coding region comprises an RNA sequence being identical or at least 50%, 60%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to the RNA sequences according to the SEQ ID Nos as disclosed in Table 8.

8. Tumor antigens



[0131] In a further preferred embodiment of the RNA containing composition disclosed herein, the composition may contain RNA, preferably mRNA, which codes for at least one tumor antigen or a fragment or variant thereof, which are used for vaccination to induce an adaptive immune response as described herein.

[0132] In this context tumor antigens are particularly preferred to be encoded by RNA, preferably mRNA, comprised in the RNA composition disclosed herein. It is particularly preferred that the RNA composition disclosed herein comprises at least one RNA encoding at least one tumor antigen or a fragment or variant thereof.

[0133] Tumor antigens are preferably located on the surface of the (tumor) cell. Tumor antigens may also be selected from proteins, which are overexpressed in tumor cells compared to a normal cell. Furthermore, tumor antigens also includes antigens expressed in cells which are (were) not themselves (or originally not themselves) degenerated but are associated with the supposed tumor. Antigens which are connected with tumor-supplying vessels or (re)formation thereof, in particular those antigens which are associated with neovascularization, e.g. growth factors, such as VEGF, bFGF etc., are also included herein. Antigens connected with a tumor furthermore include antigens from cells or tissues, typically embedding the tumor. Further, some substances (usually proteins or peptides) are expressed in patients suffering (knowingly or not-knowingly) from a cancer disease and they occur in increased concentrations in the body fluids of said patients. These substances are also referred to as "tumor antigens", however they are not antigens in the stringent meaning of an immune response inducing substance. The class of tumor antigens can be divided further into tumor-specific antigens (TSAs) and tumor-associated-antigens (TAAs). TSAs can only be presented by tumor cells and never by normal "healthy" cells. They typically result from a tumor specific mutation. TAAs, which are more common, are usually presented by both tumor and healthy cells. These antigens are recognized and the antigen-presenting cell can be destroyed by cytotoxic T cells. Additionally, tumor antigens can also occur on the surface of the tumor in the form of, e.g., a mutated receptor. In this case, they can be recognized by antibodies.

[0134] Further, tumor associated antigens may be classified as tissue-specific antigens, also called melanocyte-specific antigens, cancer-testis antigens and tumor-specific antigens. Cancer-testis antigens are typically understood to be peptides or proteins of germ-line associated genes which may be activated in a wide variety of tumors. Human cancer-testis antigens may be further subdivided into antigens which are encoded on the X chromosome, so-called CT-X antigens, and those antigens which are not encoded on the X chromosome, the so-called (non-X CT antigens). Cancer-testis antigens which are encoded on the X-chromosome comprises, for example, the family of melanoma antigen genes, the so-called MAGE-family. The genes of the MAGE-family may be characterised by a shared MAGE homology domain (MHD). Each of these antigens, i.e. melanocyte-specific antigens, cancer-testis antigens and tumor-specific antigens, may elicit autologous cellular and humoral immune response. Accordingly, the tumor antigen encoded by the nucleic acid sequence is preferably a melanocyte-specific antigen, a cancer-testis antigen or a tumor-specific antigens, preferably it may be a CT-X antigen, a non-X CT-antigens, a binding partner for a CT-X antigen or a binding partner for a non-X CT-antigen or a tumor-specific antigen , more preferably a CT-X antigen, a binding partner for a non-X CT-antigen or a tumor-specific antigen.

[0135] Particular preferred tumor antigens are selected from the list consisting of 5T4, 707-AP, 9D7, AFP, AlbZIP HPG1, alpha-5-beta-1-integrin, alpha-5-beta-6-integrin, alpha-actinin-4/m, alpha-methylacyl-coenzyme A racemase, ART-4, ARTC1/m, B7H4, BAGE-1, BCL-2, bcr/abl, beta-catenin/m, BING-4, BRCA1/m, BRCA2/m, CA 15-3/CA 27-29, CA 19-9, CA72-4, CA125, calreticulin, CAMEL, CASP-8/m, cathepsin B, cathepsin L, CD19, CD20, CD22, CD25, CDE30, CD33, CD4, CD52, CD55, CD56, CD80, CDC27/m, CDK4/m, CDKN2A/m, CEA, CLCA2, CML28, CML66, COA-1/m, coactosin-like protein, collage XXIII, COX-2, CT-9/BRD6, Cten, cyclin B1, cyclin D1, cyp-B, CYPB1, DAM-10, DAM-6, DEK-CAN, EFTUD2/m, EGFR, ELF2/m, EMMPRIN, EpCam, EphA2, EphA3, ErbB3, ETV6-AML1, EZH2, FGF-5, FN, Frau-1, G250, GAGE-1, GAGE-2, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE7b, GAGE-8, GDEP, GnT-V, gp100, GPC3, GPNMB/m, HAGE, HAST-2, hepsin, Her2/neu, HERV-K-MEL, HLA-A*0201-R17I, HLA-A11/m, HLA-A2/m, HNE, homeobox NKX3.1, HOM-TES-14/SCP-1, HOM-TES-85, HPV-E6, HPV-E7, HSP70-2M, HST-2, hTERT, iCE, IGF-1R, IL-13Ra2, IL-2R, IL-5, immature laminin receptor, kallikrein-2, kallikrein-4, Ki67, KIAA0205, KIAA0205/m, KK-LC-1, K-Ras/m, LAGE-A1, LDLR-FUT, MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A6, MAGE-A9, MAGE-A10, MAGE-A12, MAGE-B1, MAGE-B2, MAGE-B3, MAGE-B4, MAGE-B5, MAGE-B6, MAGE-B10, MAGE-B16, MAGE-B17, MAGE-C1, MAGE-C2, MAGE-C3, MAGE-D1, MAGE-D2, MAGE-D4, MAGE-E1, MAGE-E2, MAGE-F1, MAGE-H1, MAGEL2, mammaglobin A, MART-1/melan-A, MART-2, MART-2/m, matrix protein 22, MC1R, M-CSF, ME1/m, mesothelin, MG50/PXDN, MMP11, MN/CA IX-antigen, MRP-3, MUC-1, MUC-2, MUM-1/m, MUM-2/m, MUM-3/m, myosin class I/m, NA88-A, N-acetylglucosaminyltransferase-V, Neo-PAP, Neo-PAP/m, NFYC/m, NGEP, NMP22, NPM/ALK, N-Ras/m, NSE, NY-ESO-B, NY-ESO-1, OA1, OFA-iLRP, OGT, OGT/m, OS-9, OS-9/m, osteocalcin, osteopontin, p15, p190 minor bcr-abl, p53, p53/m, PAGE-4, PAI-1, PAI-2, PAP, PART-1, PATE, PDEF, Pim-1-Kinase, Pin-1, Pml/PARalpha, POTE, PRAME, PRDX5/m, prostein, proteinase-3, PSA, PSCA, PSGR, PSM, PSMA, PTPRK/m, RAGE-1, RBAF600/m, RHAMM/CD168, RU1, RU2, S-100, SAGE, SART-1, SART-2, SART-3, SCC, SIRT2/m, Sp17, SSX-1, SSX-2/HOM-MEL-40, SSX-4, STAMP-1, STEAP-1, survivin, survivin-2B, SYT-SSX-1, SYT-SSX-2, TA-90, TAG-72, TARP, TEL-AML1, TGFbeta, TGFbetaRII, TGM-4, TPI/m, TRAG-3, TRG, TRP-1, TRP-2/6b, TRP/INT2, TRP-p8, tyrosinase, UPA, VEGFR1, VEGFR-2/FLK-1, and WT1. Such tumor antigens preferably may be selected from the group consisting of p53, CA125, EGFR, Her2/neu, hTERT, PAP, MAGE-A1, MAGE-A3, Mesothelin, MUC-1, GP100, MART-1, Tyrosinase, PSA, PSCA, PSMA, STEAP-1, VEGF, VEGFR1, VEGFR2, Ras, CEA or WT1, and more preferably from PAP, MAGE-A3, WT1, and MUC-1. Such tumor antigens preferably may be selected from the group consisting of MAGE-A1 (e.g. MAGE-A1 according to accession number M77481), MAGE-A2, MAGE-A3, MAGE-A6 (e.g. MAGE-A6 according to accession number NM_005363), MAGE-C1, MAGE-C2, melan-A (e.g. melan-A according to accession number NM_005511), GP100 (e.g. GP100 according to accession number M77348), tyrosinase (e.g. tyrosinase according to accession number NM_000372), surviving (e.g. survivin according to accession number AF077350), CEA (e.g. CEA according to accession number NM_004363), Her-2/neu (e.g. Her-2/neu according to accession number M11730), WT1 (e.g. WT1 according to accession number NM_000378), PRAME (e.g. PRAME according to accession number NM_006115), EGFRI (epidermal growth factor receptor 1) (e.g. EGFRI (epidermal growth factor receptor 1) according to accession number AF288738), MUC1, mucin-1 (e.g. mucin-1 according to accession number NM_002456), SEC61G (e.g. SEC61G according to accession number NM_014302), hTERT (e.g. hTERT accession number NM_198253), 5T4 (e.g. 5T4 according to accession number NM_006670), TRP-2 (e.g. TRP-2 according to accession number NM_001922), STEAP1, PCA, PSA, PSMA, etc.

[0136] According to preferred embodiments in the context of the present disclosure, tumor antigens may be selected from any tumor antigen selected from the group consisting of 1A01_HLA-A/m; 1A02; 5T4; ACRBP; AFP; AKAP4; alpha-actinin-_4/m; alpha-methylacyl-coenzyme_A_racemase; ANDR; ART-4; ARTC1/m; AURKB; B2MG; B3GN5; B4GN1; B7H4; BAGE-1; BASI; BCL-2; bcr/abl; beta-catenin/m; BING-4; BIRC7; BRCA1/m; BY55; calreticulin; CAMEL; CASPA; Caspase_8; cathepsin_B; cathepsin_L; CD1A; CD1B; CD1C; CD1D; CD1E; CD20; CD22; CD276; CD33; CD3E; CD3Z; CD4; CD44_lsoform_l; CD44_lsoform_6; CD52; CD55; CD56; CD80; CD86; CD8A; CDC27/m; CDE30; CDK4/m; CDKN2A/m; CEA; CEAM6; CH3L2; CLCA2; CML28; CML66; COA-1/m; coactosin-like_protein; collagen_XXIII; COX-2; CP1B1; CSAG2; CT-_9/BRD6; CT45A1; CT55; CTAG2_lsoform_LAGE-1A; CTAG2_Isoform_LAGE-1B; CTCFL; Cten; cyclin_B1; cyclin_D1; cyp-B; DAM-10; DEP1A; E7; EFIA2; EFTUD2/m; EGFR; EGLN3; ELF2/m; EMMPRIN; EpCam; EphA2; EphA3; ErbB3; ERBB4; ERG; ETV6; EWS; EZH2; FABP7; FCGR3A_Version_1; FCGR3A_Version_2; FGF5; FGFR2; fibronectin; FOS; FOXP3; FUT1; G250; GAGE-1; GAGE-2; GAGE-3; GAGE-4; GAGE-5; GAGE-6; GAGE7b; GAGE-8_(GAGE-2D); GASR; GnT-V; GPC3; GPNMB/m; GRM3; HAGE; hepsin; Her2/neu; HLA-A2/m; homeobox_NKX3.1; HOM-TES-85; HPG1; HS71A; HS71B; HST-2; hTERT; iCE; IF2B3; IL-10; IL-13Ra2; IL2-RA; IL2-RB; IL2-RG; IL-5; IMP3; ITA5; ITB1; ITB6; kallikrein-2; kallikrein-4; KI20A; KIAA0205; KIF2C; KK-LC-1; LDLR; LGMN; LlRB2; LY6K; MAGA5; MAGA8; MAGAB; MAGE-_B1; MAGE-_E1; MAGE-A1; MAGE-A10; MAGE-A12; MAGE-A2; MAGE-A3; MAGE-A4; MAGE-A6; MAGE-A9; MAGE-B10; MAGE-B16; MAGE-B17; MAGE-B2; MAGE-B3; MAGE-B4; MAGE-B5; MAGE-B6; MAGE-C1; MAGE-C2; MAGE-C3; MAGE-D1; MAGE-D2; MAGE-D4; MAGE-E1_(MAGE1); MAGE-E2; MAGE-F1; MAGE-HI; MAGEL2; mammaglobin_A; MART-1/melan-A; MART-2; MC1_R; M-CSF; mesothelin; MITF; MMP1_1; MMP7; MUC-1; MUM-1/m; MUM-2/m; MYO1A; MYO1B; MYO1C; MYO1D; MYO1E; MYO1F; MYO1G; MYO1H; NA17; NA88-A; Neo-PAP; NFYC/m; NGEP; N-myc; NPM; NRCAM; NSE; NUF2; NY-ESO-1; OA1; OGT; OS-9; osteocalcin; osteopontin; p53; PAGE-4; PAI-1; PAI-2; PAP; PATE; PAX3; PAX5; PD1L1; PDCD1; PDEF; PECA1; PGCB; PGFRB; Pim-1_-Kinase; Pin-1; PLAC1; PMEL; PML; POTE; POTEF; PRAME; PRDX5/m; PRM2; prostein; proteinase-3; PSA; PSB9; PSCA; PSGR; PSM; PTPRC; RAB8A; RAGE-1; RARA; RASH; RASK; RASN; RGS5; RHAMM/CD168; RHOC; RSSA; RU1; RU2; RUNX1; S-100; SAGE; SART-_1; SART-2; SART-3; SEPR; SERPINB5; SIA7F; SIA8A; SIAT9; SIRT2/m; SOX10; SP17; SPNXA; SPXN3; SSX-1; SSX-2; SSX3; SSX-4; ST1A1; STAG2; STAMP-1; STEAP-1; survivin; Survivin-2B; SYCP1; SYT-SSX-1; SYT-SSX-2; TARP; TCRg; TF2AA; TGFbeta1; TGFR2; TGM-4; TIE2; TKTL1; TPI/m; TRGV11; TRGV9; TRPC1; TRP-p8; TSG10; TSPY1; TVC_(TRGV3); TX101; tyrosinase; TYRP1; TYRP2; UPA; VEGFR1; WT1; XAGE1, preferably as disclosed in Table 9. Particularly preferred in this context are the RNA sequences encoding a tumor antigen according to Table 9.
Table 9: Tumor antigens
Gene NameProtein Accession No.Protein Sequence SEQ ID NO:RNA Sequence wild type SEQ ID NO:Optimized RNA Sequence SEQ ID NO:
1A01_HLA-A/m UniProtKB: P30443 398 399 400, 401, 402, 403, 404
1A02 UniProtKB: P01892 405 406 407, 408, 409, 410, 411
5T4 UniProtKB: Q13641 412 413 414, 415, 416, 417, 418
ACRBP UniProtKB: Q8NEB7 419 420 421, 422, 423, 424, 425
AFP UniProtKB: P02771 426 427 428, 429, 430, 431, 432
AKAP4 UniProtKB: Q5JQC9 433 434 435, 436, 437, 438, 439
alpha-actinin-_4/m UniProtKB: B4DSX0 440 441 442, 443, 444, 445, 446
alpha-actinin-_4/m UniProtKB: B4E337 447 448 449, 450, 451, 452, 453
alpha-actinin-_4/m UniProtKB: O43707 454 455 456, 457, 458, 459, 460
alpha-methylacyl-coenzyme_A_racemase UniProtKB: A0A024RE16 461 462 463, 464, 465, 466, 467
alpha-methylacyl-coenzyme_A_racemase UniProtKB: A8KAC3 468 469 470, 471, 472, 473, 474
ANDR UniProtKB: P10275 475 476 477, 478, 479, 480, 481
ART-4 UniProtKB: Q9ULX3 482 483 484, 485, 486, 487, 488
ARTC1/m UniProtKB: P52961 489 490 491, 492, 493, 494, 495
AURKB UniProtKB: Q96GD4 496 497 498, 499, 500, 501, 502
B2MG UniProtKB: P61769 503 504 505, 506, 507, 508, 509
B3GN5 UniProtKB: Q9BYG0 510 511 512, 513, 514, 515, 516
B4GN1 UniProtKB: Q00973 517 518 519, 520, 521, 522, 523
B7H4 UniProtKB: Q7Z7D3 524 525 526, 527, 528, 529, 530
BAGE-1 UniProtKB: Q13072 531 532 533, 534, 535, 536, 537
BASI UniProtKB: P35613 538 539 540, 541, 542, 543, 544
BCL-2 UniProtKB: A9QXG9 545 546 547, 548, 549, 550, 551
bcr/abl UniProtKB: A9UEZ4 552 553 554, 555, 556, 557, 558
bcr/abl UniProtKB: A9UEZ7 559 560 561, 562, 563, 564, 565
bcr/abl UniProtKB: A9UEZ8 566 567 568, 569, 570, 571, 572
bcr/abl UniProtKB: A9UEZ9 573 574 575, 576, 577, 578, 579
bcr/abl UniProtKB: A9UF00 580 581 582, 583, 584, 585, 586
bcr/abl UniProtKB: A9UF01 587 588 589, 590, 591, 592, 593
bcr/abl UniProtKB: A9UF03 594 595 596, 597, 598, 599, 600
bcr/abl UniProtKB: A9UF04 601 602 603, 604, 605, 606, 607
bcr/abl UniProtKB: A9UF05 608 609 610, 611, 612, 613, 614
bcr/abl UniProtKB: A9UF06 615 616 617, 618, 619, 620, 621
bcr/abl UniProtKB: A9UF08 622 623 624, 625, 626, 627, 628
beta-catenin/m UniProtKB: P35222 629 630 631, 632, 633, 634, 635
beta-catenin/m UniProtKB: Q8WYA6 636 637 638, 639, 640, 641, 642
BING-4 UniProtKB: O15213 643 644 645, 646, 647, 648, 649
BIRC7 UniProtKB: Q96CA5 650 651 652, 653, 654, 655, 656
BRCA1/m UniProtKB: A0A024R1V0 657 658 659, 660, 661, 662, 663
BRCA1/m UniProtKB: A0A024R1V7 664 665 666, 667, 668, 669, 670
BRCA1/m UniProtKB: A0A024R1Z8 671 672 673, 674, 675, 676, 677
BRCA1/m UniProtKB: A0A068BFX7 678 679 680, 681, 682, 683, 684
BRCA1/m UniProtKB: C6YB45 685 686 687, 688, 689, 690, 691
BRCA1/m UniProtKB: C6YB47 692 693 694, 695, 696, 697, 698
BRCA1/m UniProtKB: G3XAC3 699 700 701, 702, 703, 704, 705
BY55 UniProtKB: 095971 706 707 708, 709, 710, 711, 712
CAMEL UniProtKB: O95987 713 714 715, 716, 717, 718, 719
CASPA UniProtKB: Q92851-4 720 721 722, 723, 724, 725, 726
cathepsin_B UniProtKB: A0A024R374 727 728 729, 730, 731, 732, 733
cathepsin_B UniProtKB: P07858 734 735 736, 737, 738, 739, 740
cathepsin_L UniProtKB: A0A024R276 741 742 743, 744, 745, 746, 747
cathepsin_L UniProtKB: P07711 748 749 750, 751, 752, 753, 754
cathepsin_L UniProtKB: Q9HBQ7 755 756 757, 758, 759, 760, 761
CD1A UniProtKB: P06126 762 763 764, 765, 766, 767, 768
CD1B UniProtKB: P29016 769 770 771, 772, 773, 774, 775
CD1C UniProtKB: P29017 776 777 778, 779, 780, 781, 782
CD1D UniProtKB: P15813 783 784 785, 786, 787, 788, 789
CD1E UniProtKB: P15812 790 791 792, 793, 794, 795, 796
CD20 UniProtKB: P11836 797 798 799, 800, 801, 802, 803
CD22 UniProtKB: O60926 804 805 806, 807, 808, 809, 810
CD22 UniProtKB: P20273 811 812 813, 814, 815, 816, 817
CD22 UniProtKB: Q0EAF5 818 819 820, 821, 822, 823, 824
CD276 UniProtKB: Q5ZPR3 825 826 827, 828, 829, 830, 831
CD33 UniProtKB: B4DF51 832 833 834, 835, 836, 837, 838
CD33 UniProtKB: P20138 839 840 841, 842, 843, 844, 845
CD33 UniProtKB: Q546G0 846 847 848, 849, 850, 851, 852
CD3E UniProtKB: P07766 853 854 855, 856, 857, 858, 859
CD3Z UniProtKB: P20963 860 861 862, 863, 864, 865, 866
CD44_Isoform_1 UniProtKB: P16070 867 868 869, 870, 871, 872, 873
CD44_Isoform_6 UniProtKB: P16070-6 874 875 876, 877, 878, 879, 880
CD4 UniProtKB: P01730 881 882 883, 884, 885, 886, 887
CD52 UniProtKB: P31358 888 889 890, 891, 892, 893, 894
CD52 UniProtKB: Q6IBD0 895 896 897, 898, 899, 900, 901
CD52 UniProtKB: V9HWN9 902 903 904, 905, 906, 907, 908
CD55 UniProtKB: B1AP15 909 910 911, 912, 913, 914, 915
CD55 UniProtKB: D3DT85 916 917 918, 919, 920, 921, 922
CD55 UniProtKB: D3DT86 923 924 925, 926, 927, 928, 929
CD55 UniProtKB: P08174 930 931 932, 933, 934, 935, 936
CD56 UniProtKB: P13591 937 938 939, 940, 941, 942, 943
CD80 UniProtKB: A0N0P2 944 945 946, 947, 948, 949, 950
CD80 UniProtKB: P33681 951 952 953, 954, 955, 956, 957
CD86 UniProtKB: P42081 958 959 960, 961, 962, 963, 964
CD8A UniProtKB: P01732 965 966 967, 968, 969, 970, 971
CDC27/m UniProtKB: G5EA36 972 973 974, 975, 976, 977, 978
CDC27/m UniProtKB: P30260 979 980 981, 982, 983, 984, 985
CDE30 UniProtKB: P28908 986 987 988, 989, 990, 991, 992
CDK4/m UniProtKB: A0A024RBB6 993 994 995, 996, 997, 998, 999
CDK4/m UniProtKB: P11802 1000 1001 1002, 1003, 1004, 1005, 1006
CDK4/m UniProtKB: Q6LC83 1007 1008 1009, 1010, 1011, 1012, 1013
CDK4/m UniProtKB: Q96BE9 1014 1015 1016, 1017, 1018, 1019, 1020
CDKN2A/m UniProtKB: D1LYX3 1021 1022 1023, 1024, 1025, 1026, 1027
CDKN2A/m UniProtKB: G3XAG3 1028 1029 1030, 1031, 1032, 1033, 1034
CDKN2A/m UniProtKB: K7PML8 1035 1036 1037, 1038, 1039, 1040, 1041
CDKN2A/m UniProtKB: L8E941 1042 1043 1044, 1045, 1046, 1047, 1048
CDKN2A/m UniProtKB: Q8N726 1049 1050 1051, 1052, 1053, 1054, 1055
CEA RefSeq: NP_004354 1056 1057 1058, 1059, 1060, 1061, 1062
CEAM6 UniProtKB: P40199 1063 1064 1065, 1066, 1067, 1068, 1069
CH3L2 UniProtKB: Q15782 1070 1071 1072, 1073, 1074, 1075, 1076
CLCA2 UniProtKB: Q9UQC9 1077 1078 1079, 1080, 1081, 1082, 1083
CML28 UniProtKB: Q9NQT4 1084 1085 1086, 1087, 1088, 1089, 1090
CML66 UniProtKB: Q96RS6 1091 1092 1093, 1094, 1095, 1096, 1097
COA-1/m UniProtKB: Q5T124 1098 1099 1100, 1101, 1102, 1103, 1104
coactosin-like_protein UniProtKB: Q14019 1105 1106 1107, 1108, 1109, 1110, 1111
collagen_XXIII UniProtKB: L8EAS4 1112 1113 1114, 1115, 1116, 1117, 1118
collagen_XXIII UniProtKB: Q86Y22 1119 1120 1121, 1122, 1123, 1124, 1125
COX-2 UniProtKB: Q6ZYK7 1126 1127 1128, 1129, 1130, 1131, 1132
CP1B1 UniProtKB: Q16678 1133 1134 1135, 1136, 1137, 1138, 1139
CSAG2 UniProtKB: Q9Y5P2-2 1140 1141 1142, 1143, 1144, 1145, 1146
CSAG2 UniProtKB: Q9Y5P2 1147 1148 1149, 1150, 1151, 1152, 1153
CT45A1 UniProtKB: Q5HYN5 1154 1155 1156, 1157, 1158, 1159, 1160
CT55 UniProtKB: Q8WUE5 1161 1162 1163, 1164, 1165, 1166, 1167
CT-_9/BRD6 UniProtKB: Q58F21 1168 1169 1170, 1171, 1172, 1173, 1174
CTAG2_Isoform_LAGE-1A UniProtKB: O75638-2 1175 1176 1177, 1178, 1179, 1180, 1181
CTAG2_Isoform_LAGE-1B UniProtKB: O75638 1182 1183 1184, 1185, 1186, 1187, 1188
CTCFL UniProtKB: Q8NI51 1189 1190 1191, 1192, 1193, 1194, 1195
Cten UniProtKB: Q8IZW8 1196 1197 1198, 1199, 1200, 1201, 1202
cyclin_B1 UniProtKB: P14635 1203 1204 1205, 1206, 1207, 1208, 1209
cyclin_D1 UniProtKB: P24385 1210 1211 1212, 1213, 1214, 1215, 1216
cyp-B UniProtKB: P23284 1217 1218 1219, 1220, 1221, 1222, 1223
DAM-10 UniProtKB: P43366 1224 1225 1226, 1227, 1228, 1229, 1230
DEP1A UniProtKB: Q5TB30 1231 1232 1233, 1234, 1235, 1236, 1237
E7 UniProtKB: P03129 1238 1239 1240, 1241, 1242, 1243, 1244
E7 UniProtKB: P06788 1245 1246 1247, 1248, 1249, 1250, 1251
E7 UniProtKB: P17387 1252 1253 1254, 1255, 1256, 1257, 1258
E7 UniProtKB: P06429 1259 1260 1261, 1262, 1263, 1264, 1265
E7 UniProtKB: P27230 1266 1267 1268, 1269, 1270, 1271, 1272
E7 UniProtKB: P24837 1273 1274 1275, 1276, 1277, 1278, 1279
E7 UniProtKB: P21736 1280 1281 1282, 1283, 1284, 1285, 1286
E7 UniProtKB: P26558 1287 1288 1289, 1290, 1291, 1292, 1293
E7 UniProtKB: P36831 1294 1295 1296, 1297, 1298, 1299, 1300
E7 UniProtKB: P36833 1301 1302 1303, 1304, 1305, 1306, 1307
E7 UniProtKB: Q9QCZ1 1308 1309 1310, 1311, 1312, 1313, 1314
E7 UniProtKB: Q81965 1315 1316 1317, 1318, 1319, 1320, 1321
E7 UniProtKB: Q80956 1322 1323 1324, 1325, 1326, 1327, 1328
EF1A2 UniProtKB: Q05639 1329 1330 1331, 1332, 1333, 1334, 1335
EFTUD2/m UniProtKB: Q15029 1336 1337 1338, 1339, 1340, 1341, 1342
EGFR UniProtKB: A0A0B4J1Y5 1343 1344 1345, 1346, 1347, 1348, 1349
EGFR UniProtKB: E7BSV0 1350 1351 1352, 1353, 1354, 1355, 1356
EGFR UniProtKB: L0R6G1 1357 1358 1359, 1360, 1361, 1362, 1363
EGFR UniProtKB: P00533-2 1364 1365 1366, 1367, 1368, 1369, 1370
EGFR UniProtKB: P00533 1371 1372 1373, 1374, 1375, 1376, 1377
EGFR UniProtKB: Q147T7 1378 1379 1380, 1381, 1382, 1383, 1384
EGFR UniProtKB: Q504U8 1385 1386 1387, 1388, 1389, 1390, 1391
EGFR UniProtKB: Q8NDU8 1392 1393 1394, 1395, 1396, 1397, 1398
EGLN3 UniProtKB: Q9H6Z9 1399 1400 1401, 1402, 1403, 1404, 1405
ELF2/m UniProtKB: B7Z720 1406 1407 1408, 1409, 1410, 1411, 1412
EMMPRIN UniProtKB: Q54A51 1413 1414 1415, 1416, 1417, 1418, 1419
EpCam UniProtKB: P16422 1420 1421 1422, 1423, 1424, 1425, 1426
EphA2 UniProtKB: P29317 1427 1428 1429, 1430, 1431, 1432, 1433
EphA3 UniProtKB: P29320 1434 1435 1436, 1437, 1438, 1439, 1440
EphA3 UniProtKB: Q6P4R6 1441 1442 1443, 1444, 1445, 1446, 1447
ErbB3 UniProtKB: B3KWG5 1448 1449 1450, 1451, 1452, 1453, 1454
ErbB3 UniProtKB: B4DGQ7 1455 1456 1457, 1458, 1459, 1460, 1461
ERBB4 UniProtKB: Q15303 1462 1463 1464, 1465, 1466, 1467, 1468
ERG UniProtKB: P11308 1469 1470 1471, 1472, 1473, 1474, 1475
ETV6 UniProtKB: P41212 1476 1477 1478, 1479, 1480, 1481, 1482
EWS UniProtKB: Q01844 1483 1484 1485, 1486, 1487, 1488, 1489
EZH2 UniProtKB: F2YMM1 1490 1491 1492, 1493, 1494, 1495, 1496
EZH2 UniProtKB: G3XAL2 1497 1498 1499, 1500, 1501, 1502, 1503
EZH2 UniProtKB: L0R855 1504 1505 1506, 1507, 1508, 1509, 1510
EZH2 UniProtKB: Q15910 1511 1512 1513, 1514, 1515, 1516, 1517
EZH2 UniProtKB: S4S3R8 1518 1519 1520, 1521, 1522, 1523, 1524
FABP7 UniProtKB: 015540 1525 1526 1527, 1528, 1529, 1530, 1531
FCGR3A_Version_1 UniProtKB: P08637 1532 1533 1534, 1535, 1536, 1537, 1538
FCGR3A_Version_2 CCDS: CCDS1232.1 1539 1540 1541, 1542, 1543, 1544, 1545
FGF5 UniProtKB: P12034 1546 1547 1548, 1549, 1550, 1551, 1552
FGF5 UniProtKB: Q60518 1553 1554 1555, 1556, 1557, 1558, 1559
FGFR2 UniProtKB: P21802 1560 1561 1562, 1563, 1564, 1565, 1566
fibronectin UniProtKB: A0A024R5I6 1567 1568 1569, 1570, 1571, 1572, 1573
fibronectin UniProtKB: A0A024RB01 1574 1575 1576, 1577, 1578, 1579, 1580
fibronectin UniProtKB: A0A024RDT9 1581 1582 1583, 1584, 1585, 1586, 1587
fibronectin UniProtKB: A0A024RDV5 1588 1589 1590, 1591, 1592, 1593, 1594
fibronectin UniProtKB: A6NH44 1595 1596 1597, 1598, 1599, 1600, 1601
fibronectin UniProtKB: A8K6A5 1602 1603 1604, 1605, 1606, 1607, 1608
fibronectin UniProtKB: B2R627 1609 1610 1611, 1612, 1613, 1614, 1615
fibronectin UniProtKB: B3KXM5 1616 1617 1618, 1619, 1620, 1621, 1622
fibronectin UniProtKB: B4DIC5 1623 1624 1625, 1626, 1627, 1628, 1629
fibronectin UniProtKB: B4DN21 1630 1631 1632, 1633, 1634, 1635, 1636
fibronectin UniProtKB: B4DS98 1637 1638 1639, 1640, 1641, 1642, 1643
fibronectin UniProtKB: B4DTH2 1644 1645 1646, 1647, 1648, 1649, 1650
fibronectin UniProtKB: B4DTK1 1651 1652 1653, 1654, 1655, 1656, 1657
fibronectin UniProtKB: B4DU16 1658 1659 1660, 1661, 1662, 1663, 1664
fibronectin UniProtKB: B7Z3W5 1665 1666 1667, 1668, 1669, 1670, 1671
fibronectin UniProtKB: B7Z939 1672 1673 1674, 1675, 1676, 1677, 1678
fibronectin UniProtKB: G5E9X3 1679 1680 1681, 1682, 1683, 1684, 1685
fibronectin UniProtKB: Q9H382 1686 1687 1688, 1689, 1690, 1691, 1692
FOS UniProtKB: P01100 1693 1694 1695, 1696, 1697, 1698, 1699
FOXP3 UniProtKB: Q9BZS1 1700 1701 1702, 1703, 1704, 1705, 1706
FUT1 UniProtKB: P19526 1707 1708 1709, 1710, 1711, 1712, 1713
G250 UniProtKB: Q16790 1714 1715 1716, 1717, 1718, 1719, 1720
GAGE-1 Genbank: AAA82744 1721 1722 1723, 1724, 1725, 1726, 1727
GAGE-2 UniProtKB: Q6NT46 1728 1729 1730, 1731, 1732, 1733, 1734
GAGE-3 UniProtKB: Q13067 1735 1736 1737, 1738, 1739, 1740, 1741
GAGE-4 UniProtKB: Q13068 1742 1743 1744, 1745, 1746, 1747, 1748
GAGE-5 UniProtKB: Q13069 1749 1750 1751, 1752, 1753, 1754, 1755
GAGE-6 UniProtKB: Q13070 1756 1757 1758, 1759, 1760, 1761, 1762
GAGE7b UniProtKB: O76087 1763 1764 1765, 1766, 1767, 1768, 1769
GAGE-8_(GAGE-2D) UniProtKB: Q9UEU5 1770 1771 1772, 1773, 1774, 1775, 1776
GASR UniProtKB: P32239 1777 1778 1779, 1780, 1781, 1782, 1783
GnT-V UniProtKB: Q09328 1784 1785 1786, 1787, 1788, 1789, 1790
GPC3 UniProtKB: I6QTG3 1791 1792 1793, 1794, 1795, 1796, 1797
GPC3 UniProtKB: P51654 1798 1799 1800, 1801, 1802, 1803, 1804
GPC3 UniProtKB: Q8IYG2 1805 1806 1807, 1808, 1809, 1810, 1811
GPNMB/m UniProtKB: A0A024RA55 1812 1813 1814, 1815, 1816, 1817, 1818
GPNMB/m UniProtKB: Q14956 1819 1820 1821, 1822, 1823, 1824, 1825
GPNMB/m UniProtKB: Q8IXJ5 1826 1827 1828, 1829, 1830, 1831, 1832
GPNMB/m UniProtKB: Q96F58 1833 1834 1835, 1836, 1837, 1838, 1839
GRM3 UniProtKB: Q14832 1840 1841 1842, 1843, 1844, 1845, 1846
HAGE UniProtKB: Q9NXZ2 1847 1848 1849, 1850, 1851, 1852, 1853
hepsin UniProtKB: B2ZDQ2 1854 1855 1856, 1857, 1858, 1859, 1860
hepsin UniProtKB: P05981 1861 1862 1863, 1864, 1865, 1866, 1867
Her2/neu UniProtKB: B4DTR1 1868 1869 1870, 1871, 1872, 1873, 1874
Her2/neu UniProtKB: L8E8G2 1875 1876 1877, 1878, 1879, 1880, 1881
Her2/neu UniProtKB: P04626 1882 1883 1884, 1885, 1886, 1887, 1888
Her2/neu UniProtKB: Q9UK79 1889 1890 1891, 1892, 1893, 1894, 1895
HLA-A2/m UniProtKB: Q95387 1896 1897 1898, 1899, 1900, 1901, 1902
HLA-A2/m UniProtKB: Q9MYF8 1903 1904 1905, 1906, 1907, 1908, 1909
homeobox_NKX3.1 UniProtKB: Q99801 1910 1911 1912, 1913, 1914, 1915, 1916
HOM-TES-85 UniProtKB: B2RBQ6 1917 1918 1919, 1920, 1921, 1922, 1923
HOM-TES-85 UniProtKB: Q9P127 1924 1925 1926, 1927, 1928, 1929, 1930
HPG1 Pubmed: 12543784 1931 1932 1933, 1934, 1935, 1936, 1937
HS71A UniProtKB: P0DMV8 1938 1939 1940, 1941, 1942, 1943, 1944
HS71B UniProtKB: P0DMV9 1945 1946 1947, 1948, 1949, 1950, 1951
HST-2 UniProtKB: P10767 1952 1953 1954, 1955, 1956, 1957, 1958
hTERT UniProtKB: O94807 1959 1960 1961, 1962, 1963, 1964, 1965
iCE UniProtKB: O00748 1966 1967 1968, 1969, 1970, 1971, 1972
IF2B3 UniProtKB: O00425 1973 1974 1975, 1976, 1977, 1978, 1979
IL-13Ra2 UniProtKB: Q14627 1980 1981 1982, 1983,1984, 1985, 1986
IL2-RA UniProtKB: P01589 1987 1988 1989, 1990, 1991, 1992, 1993
IL2-RB UniProtKB: P14784 1994 1995 1996, 1997, 1998, 1999, 2000
IL2-RG UniProtKB: P31785 2001 2002 2003, 2004, 2005, 2006, 2007
IMP3 UniProtKB: Q9NV31 2008 2009 2010, 2011, 2012, 2013, 2014
ITA5 UniProtKB: P08648 2015 2016 2017, 2018, 2019, 2020, 2021
ITB1 UniProtKB: P05556 2022 2023 2024, 2025, 2026, 2027, 2028
ITB6 UniProtKB: P18564 2029 2030 2031, 2032, 2033, 2034, 2035
kallikrein-2 UniProtKB: A0A024R4J4 2036 2037 2038, 2039, 2040, 2041, 2042
kallikrein-2 UniProtKB: A0A024R4N3 2043 2044 2045, 2046, 2047, 2048, 2049
kallikrein-2 UniProtKB: B0AZU9 2050 2051 2052, 2053, 2054, 2055, 2056
kallikrein-2 UniProtKB: B4DU77 2057 2058 2059, 2060, 2061, 2062, 2063
kallikrein-2 UniProtKB: P20151 2064 2065 2066, 2067, 2068, 2069, 2070
kallikrein-2 UniProtKB: Q6T774 2071 2072 2073, 2074, 2075, 2076, 2077
kallikrein-2 UniProtKB: Q6T775 2078 2079 2080, 2081, 2082, 2083, 2084
kallikrein-4 UniProtKB: A0A0C4DFQ5 2085 2086 2087, 2088, 2089, 2090, 2091
kallikrein-4 UniProtKB: Q5BQA0 2092 2093 2094, 2095, 2096, 2097, 2098
kallikrein-4 UniProtKB: Q96PT0 2099 2100 2101, 2102, 2103, 2104, 2105
kallikrein-4 UniProtKB: Q96PT1 2106 2107 2108, 2109, 2110, 2111, 2112
kallikrein-4 UniProtKB: Q9Y5K2 2113 2114 2115, 2116, 2117, 2118, 2119
KI20A UniProtKB: O95235 2120 2121 2122, 2123, 2124, 2125, 2126
KIAA0205 UniProtKB: Q92604 2127 2128 2129, 2130, 2131, 2132, 2133
KIF2C UniProtKB: Q99661 2134 2135 2136, 2137, 2138, 2139, 2140
KK-LC-1 UniProtKB: Q5H943 2141 2142 2143, 2144, 2145, 2146, 2147
LDLR UniProtKB: P01130 2148 2149 2150, 2151, 2152, 2153, 2154
LGMN UniProtKB: Q99538 2155 2156 2157, 2158, 2159, 2160, 2161
LIRB2 UniProtKB: Q8N423 2162 2163 2164, 2165, 2166, 2167, 2168
LY6K UniProtKB: Q17RY6 2169 2170 2171, 2172, 2173, 2174, 2175
MAGA5 UniProtKB: P43359 2176 2177 2178, 2179, 2180, 2181, 2182
MAGA8 UniProtKB: P43361 2183 2184 2185, 2186, 2187, 2188, 2189
MAGAB UniProtKB: P43364 2190 2191 2192, 2193, 2194, 2195, 2196
MAGE-A10 UniProtKB: A0A024RC14 2197 2198 2199, 2200, 2201, 2202, 2203
MAGE-A12 UniProtKB: P43365 2204 2205 2206, 2207, 2208, 2209, 2210
MAGE-A1 UniProtKB: P43355 2211 2212 2213, 2214, 2215, 2216, 2217
MAGE-A2 UniProtKB: P43356 2218 2219 2220, 2221, 2222, 2223, 2224
MAGE-A3 UniProtKB: P43357 2225 2226 2227, 2228, 2229, 2230, 2231
MAGE-A4 UniProtKB: A0A024RC12 2232 2233 2234, 2235, 2236, 2237, 2238
MAGE-A4 UniProtKB: P43358 2239 2240 2241, 2242, 2243, 2244, 2245
MAGE-A4 UniProtKB: Q1RN33 2246 2247 2248, 2249, 2250, 2251, 2252
MAGE-A6 UniProtKB: A8K072 2253 2254 2255, 2256, 2257, 2258, 2259
MAGE-A6 UniProtKB: P43360 2260 2261 2262, 2263, 2264, 2265, 2266
MAGE-A6 UniProtKB: Q6FHI5 2267 2268 2269, 2270, 2271, 2272, 2273
MAGE-A9 UniProtKB: P43362 2274 2275 2276, 2277, 2278, 2279, 2280
MAGE-B10 UniProtKB: Q96LZ2 2281 2282 2283, 2284, 2285, 2286, 2287
MAGE-B16 UniProtKB: A2A368 2288 2289 2290, 2291, 2292, 2293, 2294
MAGE-B17 UniProtKB: A8MXT2 2295 2296 2297, 2298, 2299, 2300, 2301
MAGE-_B1 UniProtKB: Q96TG1 2302 2303 2304, 2305, 2306, 2307, 2308
MAGE-B2 UniProtKB: O15479 2309 2310 2311, 2312, 2313, 2314, 2315
MAGE-B3 UniProtKB: O15480 2316 2317 2318, 2319, 2320, 2321, 2322
MAGE-B4 UniProtKB: O15481 2323 2324 2325, 2326, 2327, 2328, 2329
MAGE-B5 UniProtKB: Q9BZ81 2330 2331 2332, 2333, 2334, 2335, 2336
MAGE-B6 UniProtKB: Q8N7X4 2337 2338 2339, 2340, 2341, 2342, 2343
MAGE-C1 UniProtKB: O60732 2344 2345 2346, 2347, 2348, 2349, 2350
MAGE-C2 UniProtKB: Q9UBF1 2351 2352 2353, 2354, 2355, 2356, 2357
MAGE-C3 UniProtKB: Q8TD91 2358 2359 2360, 2361, 2362, 2363, 2364
MAGE-D1 UniProtKB: Q9Y5V3 2365 2366 2367, 2368, 2369, 2370, 2371
MAGE-D2 UniProtKB: Q9UNF1 2372 2373 2374, 2375, 2376, 2377, 2378
MAGE-D4 UniProtKB: Q96JG8 2379 2380 2381, 2382, 2383, 2384, 2385
MAGE-_E1 UniProtKB: Q6IAI7 2386 2387 2388, 2389, 2390, 2391, 2392
MAGE-E1_(MAGE1) UniProtKB: Q9HCI5 2393 2394 2395, 2396, 2397, 2398, 2399
MAGE-E2 UniProtKB: Q8TD90 2400 2401 2402, 2403, 2404, 2405, 2406
MAGE-F1 UniProtKB: Q9HAY2 2407 2408 2409, 2410, 2411, 2412, 2413
MAGE-H1 UniProtKB: Q9H213 2414 2415 2416, 2417, 2418, 2419, 2420
MAGEL2 UniProtKB: Q9UJ55 2421 2422 2423, 2424, 2425, 2426, 2427
mammaglobin_A UniProtKB: Q13296 2428 2429 2430, 2431, 2432, 2433, 2434
mammaglobin_A UniProtKB: Q6NX70 2435 2436 2437, 2438, 2439, 2440, 2441
MART-1/melan-A UniProtKB: Q16655 2442 2443 2444, 2445, 2446, 2447, 2448
MART-2 UniProtKB: Q5VTY9 2449 2450 2451, 2452, 2453, 2454, 2455
MC1_R UniProtKB: Q01726 2456 2457 2458, 2459, 2460, 2461, 2462
MC1_R UniProtKB: Q1JUL4 2463 2464 2465, 2466, 2467, 2468, 2469
MC1_R UniProtKB: Q1JUL6 2470 2471 2472, 2473, 2474, 2475, 2476
MC1_R UniProtKB: Q1JUL8 2477 2478 2479, 2480, 2481, 2482, 2483
MC1_R UniProtKB: Q1JUL9 2484 2485 2486, 2487, 2488, 2489, 2490
MC1_R UniProtKB: Q1JUM0 2491 2492 2493, 2494, 2495, 2496, 2497
MC1_R UniProtKB: Q1JUM2 2498 2499 2500, 2501, 2502, 2503, 2504
MC1_R UniProtKB: Q1JUM3 2505 2506 2507, 2508, 2509, 2510, 2511
MC1_R UniProtKB: Q1JUM4 2512 2513 2514, 2515, 2516, 2517, 2518
MC1_R UniProtKB: Q1JUM5 2519 2520 2521, 2522, 2523, 2524, 2525
MC1_R UniProtKB: Q6UR92 2526 2527 2528, 2529, 2530, 2531, 2532
MC1_R UniProtKB: Q6UR94 2533 2534 2535, 2536, 2537, 2538, 2539
MC1_R UniProtKB: Q6UR95 2540 2541 2542, 2543, 2544, 2545, 2546
MC1_R UniProtKB: Q6UR96 2547 2548 2549, 2550, 2551, 2552, 2553
MC1_R UniProtKB: Q6UR97 2554 2555 2556, 2557, 2558, 2559, 2560
MC1_R UniProtKB: Q6UR98 2561 2562 2563, 2564, 2565, 2566, 2567
MC1_R UniProtKB: Q6UR99 2568 2569 2570, 2571, 2572, 2573, 2574
MC1_R UniProtKB: Q6URA0 2575 2576 2577, 2578, 2579, 2580, 2581
MC1_R UniProtKB: Q86YW1 2582 2583 2584, 2585, 2586, 2587, 2588
MC1_R UniProtKB: V9Q5S2 2589 2590 2591, 2592, 2593, 2594, 2595
MC1_R UniProtKB: V9Q671 2596 2597 2598, 2599, 2600, 2601, 2602
MC1_R UniProtKB: V9Q783 2603 2604 2605, 2606, 2607, 2608, 2609
MC1_R UniProtKB: V9Q7F1 2610 2611 2612, 2613, 2614, 2615, 2616
MC1_R UniProtKB: V9Q8N1 2617 2618 2619, 2620, 2621, 2622, 2623
MC1_R UniProtKB: V9Q977 2624 2625 2626, 2627, 2628, 2629, 2630
MC1_R UniProtKB: V9Q9P5 2631 2632 2633, 2634, 2635, 2636, 2637
MC1_R UniProtKB: V9Q9R8 2638 2639 2640, 2641, 2642, 2643, 2644
MC1_R UniProtKB: V9QAE0 2645 2646 2647, 2648, 2649, 2650, 2651
MC1_R UniProtKB: V9QAR2 2652 2653 2654, 2655, 2656, 2657, 2658
MC1_R UniProtKB: V9QAW3 2659 2660 2661, 2662, 2663, 2664, 2665
MC1_R UniProtKB: V9QB02 2666 2667 2668, 2669, 2670, 2671, 2672
MC1_R UniProtKB: V9QB58 2673 2674 2675, 2676, 2677, 2678, 2679
MC1_R UniProtKB: V9QBY6 2680 2681 2682, 2683, 2684, 2685, 2686
MC1_R UniProtKB: V9QC17 2687 2688 2689, 2690, 2691, 2692, 2693
MC1_R UniProtKB: V9QC66 2694 2695 2696, 2697, 2698, 2699, 2700
MC1_R UniProtKB: V9QCQ4 2701 2702 2703, 2704, 2705, 2706, 2707
MC1_R UniProtKB: V9QDF4 2708 2709 2710, 2711, 2712, 2713, 2714
MC1_R UniProtKB: V9QDN7 2715 2716 2717, 2718, 2719, 2720, 2721
MC1_R UniProtKB: V9QDQ6 2722 2723 2724, 2725, 2726, 2727, 2728
mesothelin UniProtKB: Q13421 2729 2730 2731, 2732, 2733, 2734, 2735
MITF UniProtKB: O75030-8 2736 2737 2738, 2739, 2740, 2741, 2742
MITF UniProtKB: O75030-9 2743 2744 2745, 2746, 2747, 2748, 2749
MITF UniProtKB: O75030 2750 2751 2752, 2753, 2754, 2755, 2756
MMP1_1 UniProtKB: B3KQS8 2757 2758 2759, 2760, 2761, 2762, 2763
MMP7 UniProtKB: P09237 2764 2765 2766, 2767, 2768, 2769, 2770
MUC-1 Genbank: AAA60019 2771 2772 2773, 2774, 2775, 2776, 2777
MUM-1/m RefSeq: NP_116242 2778 2779 2780, 2781, 2782, 2783, 2784
MUM-2/m UniProtKB: Q9Y5R8 2785 2786 2787, 2788, 2789, 2790, 2791
MYO1A UniProtKB: Q9UBC5 2792 2793 2794, 2795, 2796, 2797, 2798
MYO1B UniProtKB: O43795 2799 2800 2801, 2802, 2803, 2804, 2805
MYO1C UniProtKB: O00159 2806 2807 2808, 2809, 2810, 2811, 2812
MYO1D UniProtKB: O94832 2813 2814 2815, 2816, 2817, 2818, 2819
MYO1E UniProtKB: Q12965 2820 2821 2822, 2823, 2824, 2825, 2826
MYO1F UniProtKB: O00160 2827 2828 2829, 2830, 2831, 2832, 2833
MYO1G UniProtKB: B0I1T2 2834 2835 2836, 2837, 2838, 2839, 2840
MYO1H RefSeq: NP_001094891 2841 2842 2843, 2844, 2845, 2846, 2847
NA17 UniProtKB: Q3V5L5 2848 2849 2850, 2851, 2852, 2853, 2854
NA88-A Pubmed: 10790436 2855 2856 2857, 2858, 2859, 2860, 2861
Neo-PAP UniProtKB: Q9BWT3 2862 2863 2864, 2865, 2866, 2867, 2868
NFYC/m UniProtKB: Q13952 2869 2870 2871, 2872, 2873, 2874, 2875
NGEP UniProtKB: Q6IWH7 2876 2877 2878, 2879, 2880, 2881, 2882
NPM UniProtKB: P06748 2883 2884 2885, 2886, 2887, 2888, 2889
NRCAM UniProtKB: Q92823 2890 2891 2892, 2893, 2894, 2895, 2896
NSE UniProtKB: P09104 2897 2898 2899, 2900, 2901, 2902, 2903
NUF2 UniProtKB: Q9BZD4 2904 2905 2906, 2907, 2908, 2909, 2910
NY-ESO-1 UniProtKB: P78358 2911 2912 2913, 2914, 2915, 2916, 2917
OA1 UniProtKB: P51810 2918 2919 2920, 2921, 2922, 2923, 2924
OGT UniProtKB: O15294 2925 2926 2927, 2928, 2929, 2930, 2931
OS-9 UniProtKB: B4DH11 2932 2933 2934, 2935, 2936, 2937, 2938
OS-9 UniProtKB: B4E321 2939 2940 2941, 2942, 2943, 2944, 2945
OS-9 UniProtKB: B7Z8E7 2946 2947 2948, 2949, 2950, 2951, 2952
OS-9 UniProtKB: Q13438 2953 2954 2955, 2956, 2957, 2958, 2959
osteocalcin UniProtKB: P02818 2960 2961 2962, 2963, 2964, 2965, 2966
osteopontin UniProtKB: AOA024RDE2 2967 2968 2969, 2970, 2971, 2972, 2973
osteopontin UniProtKB: AOA024RDE6 2974 2975 2976, 2977, 2978, 2979, 2980
osteopontin UniProtKB: A0A024RDJ0 2981 2982 2983, 2984, 2985, 2986, 2987
osteopontin UniProtKB: B7Z351 2988 2989 2990, 2991, 2992, 2993, 2994
osteopontin UniProtKB: F2YQ21 2995 2996 2997, 2998, 2999, 3000, 3001
osteopontin UniProtKB: P10451 3002 3003 3004, 3005, 3006, 3007, 3008
p53 UniProtKB: P04637 3009 3010 3011, 3012, 3013, 3014, 3015
PAGE-4 UniProtKB: O60829 3016 3017 3018, 3019, 3020, 3021, 3022
PAI-1 UniProtKB: P05121 3023 3024 3025, 3026, 3027, 3028, 3029
PAI-2 UniProtKB: P05120 3030 3031 3032, 3033, 3034, 3035, 3036
PAP UniProtKB: Q06141 3037 3038 3039, 3040, 3041, 3042, 3043
PAP UniProtKB: Q53S56 3044 3045 3046, 3047, 3048, 3049, 3050
PATE UniProtKB: Q8WXA2 3051 3052 3053, 3054, 3055, 3056, 3057
PAX3 UniProtKB: P23760 3058 3059 3060, 3061, 3062, 3063, 3064
PAX5 UniProtKB: Q02548 3065 3066 3067, 3068, 3069, 3070, 3071
PD1L1 UniProtKB: Q9NZQ7 3072 3073 3074, 3075, 3076, 3077, 3078
PDCD1 UniProtKB: Q15116 3079 3080 3081, 3082, 3083, 3084, 3085
PDEF UniProtKB: O95238 3086 3087 3088, 3089, 3090, 3091, 3092
PECA1 UniProtKB: P16284 3093 3094 3095, 3096, 3097, 3098, 3099
PGCB UniProtKB: Q96GW7 3100 3101 3102, 3103, 3104, 3105, 3106
PGFRB UniProtKB: P09619 3107 3108 3109, 3110, 3111, 3112, 3113
Pim-1_-Kinase UniProtKB: A0A024RD25 3114 3115 3116, 3117, 3118, 3119, 3120
Pin-1 UniProtKB: 015428 3121 3122 3123, 3124, 3125, 3126, 3127
Pin-1 UniProtKB: Q13526 3128 3129 3130, 3131, 3132, 3133, 3134
Pin-1 UniProtKB: Q49AR7 3135 3136 3137, 3138, 3139, 3140, 3141
PLAC1 UniProtKB: Q9HBJ0 3142 3143 3144, 3145, 3146, 3147, 3148
PMEL UniProtKB: P40967 3149 3150 3151, 3152, 3153, 3154, 3155
PML UniProtKB: P29590 3156 3157 3158, 3159, 3160, 3161, 3162
POTEF UniProtKB: A5A3EO 3163 3164 3165, 3166, 3167, 3168, 3169
POTE UniProtKB: Q86YR6 3170 3171 3172, 3173, 3174, 3175, 3176
PRAME UniProtKB: A0A024R1E6 3177 3178 3179, 3180, 3181, 3182, 3183
PRAME UniProtKB: P78395 3184 3185 3186, 3187, 3188, 3189, 3190
PRDX5/m UniProtKB: P30044 3191 3192 3193, 3194, 3195, 3196, 3197
PRM2 UniProtKB: P04554 3198 3199 3200, 3201, 3202, 3203, 3204
prostein UniProtKB: Q96JT2 3205 3206 3207, 3208, 3209, 3210, 3211
proteinase-3 UniProtKB: D6CHE9 3212 3213 3214, 3215, 3216, 3217, 3218
proteinase-3 UniProtKB: P24158 3219 3220 3221, 3222, 3223, 3224, 3225
PSA UniProtKB: P55786 3226 3227 3228, 3229, 3230, 3231, 3232
PSB9 UniProtKB: P28065 3233 3234 3235, 3236, 3237, 3238, 3239
PSCA UniProtKB: D3DWI6 3240 3241 3242, 3243, 3244, 3245, 3246
PSCA UniProtKB: O43653 3247 3248 3249, 3250, 3251, 3252, 3253
PSGR UniProtKB: Q9H255 3254 3255 3256, 3257, 3258, 3259, 3260
PSM UniProtKB: Q04609 3261 3262 3263, 3264, 3265, 3266, 3267
PTPRC RefSeq: NP_002829 3268 3269 3270, 3271, 3272, 3273, 3274
RAB8A UniProtKB: P61006 3275 3276 3277, 3278, 3279, 3280, 3281
RAGE-1 UniProtKB: Q9UQ07 3282 3283 3284, 3285, 3286, 3287, 3288
RARA UniProtKB: P10276 3289 3290 3291, 3292, 3293, 3294, 3295
RASH UniProtKB: P01112 3296 3297 3298, 3299, 3300, 3301, 3302
RASK UniProtKB: P01116 3303 3304 3305, 3306, 3307, 3308, 3309
RASN UniProtKB: P01111 3310 3311 3312, 3313, 3314, 3315, 3316
RGS5 UniProtKB: 015539 3317 3318 3319, 3320, 3321, 3322, 3323
RHAMM/CD168 UniProtKB: O75330 3324 3325 3326, 3327, 3328, 3329, 3330
RHOC UniProtKB: P08134 3331 3332 3333, 3334, 3335, 3336, 3337
RSSA UniProtKB: P08865 3338 3339 3340, 3341, 3342, 3343, 3344
RU1 UniProtKB: Q9UHJ3 3345 3346 3347, 3348, 3349, 3350, 3351
RU2 UniProtKB: Q9UHG0 3352 3353 3354, 3355, 3356, 3357, 3358
RUNX1 UniProtKB: Q01196 3359 3360 3361, 3362, 3363, 3364, 3365
S-100 UniProtKB: V9HW39 3366 3367 3368, 3369, 3370, 3371, 3372
SAGE UniProtKB: Q9NXZ1 3373 3374 3375, 3376, 3377, 3378, 3379
SART-_1 UniProtKB: O43290 3380 3381 3382, 3383, 3384, 3385, 3386
SART-2 UniProtKB: Q9UL01 3387 3388 3389, 3390, 3391, 3392, 3393
SART-3 UniProtKB: Q15020 3394 3395 3396, 3397, 3398, 3399, 3400
SEPR UniProtKB: Q12884 3401 3402 3403, 3404, 3405, 3406, 3407
SIA7F UniProtKB: Q969X2 3408 3409 3410, 3411, 3412, 3413, 3414
SIA8A UniProtKB: Q92185 3415 3416 3417, 3418, 3419, 3420, 3421
SIAT9 UniProtKB: Q9UNP4 3422 3423 3424, 3425, 3426, 3427, 3428
SIRT2/m UniProtKB: AOA024R0G8 3429 3430 3431, 3432, 3433, 3434, 3435
SIRT2/m UniProtKB: Q8IXJ6 3436 3437 3438, 3439, 3440, 3441, 3442
SOX10 UniProtKB: P56693 3443 3444 3445, 3446, 3447, 3448, 3449
SP17 UniProtKB: Q15506 3450 3451 3452, 3453, 3454, 3455, 3456
SPNXA UniProtKB: Q9NS26 3457 3458 3459, 3460, 3461, 3462, 3463
SPXN3 UniProtKB: Q5MJ09 3464 3465 3466, 3467, 3468, 3469, 3470
SSX-1 UniProtKB: Q16384 3471 3472 3473, 3474, 3475, 3476, 3477
SSX-2 UniProtKB: Q16385 3478 3479 3480, 3481, 3482, 3483, 3484
SSX3 UniProtKB: Q99909 3485 3486 3487, 3488, 3489, 3490, 3491
SSX-4 UniProtKB: O60224 3492 3493 3494, 3495, 3496, 3497, 3498
ST1A1 UniProtKB: P50225 3499 3500 3501, 3502, 3503, 3504, 3505
STAG 2 UniProtKB: Q8N3U4-2 3506 3507 3508, 3509, 3510, 3511, 3512
STAMP-1 UniProtKB: Q8NFT2 3513 3514 3515, 3516, 3517, 3518, 3519
STEAP-1 UniProtKB: A0A024RA63 3520 3521 3522, 3523, 3524, 3525, 3526
STEAP-1 UniProtKB: Q9UHE8 3527 3528 3529, 3530, 3531, 3532, 3533
Survivin-2B UniProtKB: 015392-2 3534 3535 3536, 3537, 3538, 3539, 3540
survivin UniProtKB: 015392 3541 3542 3543, 3544, 3545, 3546, 3547
SYCP1 UniProtKB: A0A024R0I2 3548 3549 3550, 3551, 3552, 3553, 3554
SYCP1 UniProtKB: B7ZLS9 3555 3556 3557, 3558, 3559, 3560, 3561
SYCP1 UniProtKB: Q15431 3562 3563 3564, 3565, 3566, 3567, 3568
SYCP1 UniProtKB: Q3MHC4 3569 3570 3571, 3572, 3573, 3574, 3575
SYT-SSX-1 UniProtKB: A4PIV7 3576 3577 3578, 3579, 3580, 3581, 3582
SYT-SSX-1 UniProtKB: A4PIV8 3583 3584 3585, 3586, 3587, 3588, 3589
SYT-SSX-2 UniProtKB: A4PIV9 3590 3591 3592, 3593, 3594, 3595, 3596
SYT-SSX-2 UniProtKB: A4PIW0 3597 3598 3599, 3600, 3601, 3602, 3603
TARP UniProtKB: Q0VGM3 3604 3605 3606, 3607, 3608, 3609, 3610
TCRg UniProtKB: A2JGV3 3611 3612 3613, 3614, 3615, 3616, 3617
TF2AA UniProtKB: P52655 3618 3619 3620, 3621, 3622, 3623, 3624
TGFR2 UniProtKB: P37173 3625 3626 3627, 3628, 3629, 3630, 3631
TGM-4 UniProtKB: B2R7D1 3632 3633 3634, 3635, 3636, 3637, 3638
TIE2 UniProtKB: Q02763 3639 3640 3641, 3642, 3643, 3644, 3645
TKTL1 UniProtKB: P51854 3646 3647 3648, 3649, 3650, 3651, 3652
TPI/m UniProtKB: P60174 3653 3654 3655, 3656, 3657, 3658, 3659
TRGV11 UniProtKB: Q99601 3660 3661 3662, 3663, 3664, 3665, 3666
TRGV9 UniProtKB: A4D1X2 3667 3668 3669, 3670, 3671, 3672, 3673
TRGV9 UniProtKB: Q99603 3674 3675 3676, 3677, 3678, 3679, 3680
TRGV9 UniProtKB: Q99604 3681 3682 3683, 3684, 3685, 3686, 3687
TRPC1 UniProtKB: P48995 3688 3689 3690, 3691, 3692, 3693, 3694
TRP-p8 UniProtKB: Q7Z2W7 3695 3696 3697, 3698, 3699, 3700, 3701
TSG10 UniProtKB: Q9BZW7 3702 3703 3704, 3705, 3706, 3707, 3708
TSPY1 UniProtKB: Q01534 3709 3710 3711, 3712, 3713, 3714, 3715
TVC_(TRGV3) Genbank: M13231.1 3716 3717 3718, 3719, 3720, 3721, 3722
TX101 UniProtKB: Q9BY14-2 3723 3724 3725, 3726, 3727, 3728, 3729
tyrosinase UniProtKB: A0A024DBG7 3730 3731 3732, 3733, 3734, 3735, 3736
tyrosinase UniProtKB: L8B082 3737 3738 3739, 3740, 3741, 3742, 3743
tyrosinase UniProtKB: L8B086 3744 3745 3746, 3747, 3748, 3749, 3750
tyrosinase UniProtKB: L8B0B9 3751 3752 3753, 3754, 3755, 3756, 3757
tyrosinase UniProtKB: O75767 3758 3759 3760, 3761, 3762, 3763, 3764
tyrosinase UniProtKB: P14679 3765 3766 3767, 3768, 3769, 3770, 3771
tyrosinase UniProtKB: U3M8N0 3772 3773 3774, 3775, 3776, 3777, 3778
tyrosinase UniProtKB: U3M9D5 3779 3780 3781, 3782, 3783, 3784, 3785
tyrosinase UniProtKB: U3M9J2 3786 3787 3788, 3789, 3790, 3791, 3792
TYRP1 UniProtKB: P17643 3793 3794 3795, 3796, 3797, 3798, 3799
TYRP2 UniProtKB: P40126 3800 3801 3802, 3803, 3804, 3805, 3806
UPA UniProtKB: Q96NZ9 3807 3808 3809, 3810, 3811, 3812, 3813
VEGFR1 UniProtKB: B5A924 3814 3815 3816, 3817, 3818, 3819, 3820
WT1 UniProtKB: A0A0H5AUY0 3821 3822 3823, 3824, 3825, 3826, 3827
WT1 UniProtKB: P19544 3828 3829 3830, 3831, 3832, 3833, 3834
WT1 UniProtKB: Q06250 3835 3836 3837, 3838, 3839, 3840, 3841
XAGE1 UniProtKB: Q9HD64 3842 3843 3844, 3845, 3846, 3847, 3848
IL-10 UniProtKB: P22301 4169 4170 4171, 4172, 4173, 4174, 4175, 4176
IL-5 UniProtKB: P05113 4585 4586 4587, 4588, 4589, 4590, 4591, 4592
M-CSF UniProtKB: P09603 4705 4706 4707, 4708, 4709, 4710, 4711, 4712
TGFbeta1 UniProtKB: P01137 4785 4786 4787, 4788, 4789, 4790, 4791, 4792
Caspase_8 UniProtKB: Q14790 7113 7114 7115, 7116, 7117, 7118, 7119, 7120
SERPINB5 UniProtKB: P36952 7465 7466 7467, 7468, 7469, 7470, 7471, 7472
calreticulin UniProtKB: B4DHR1 7569 7570 7571, 7572, 7573, 7574, 7575, 7576
calreticulin UniProtKB: B4E2Y9 7577 7578 7579, 7580, 7581, 7582, 7583, 7584
calreticulin UniProtKB: P27797 7585 7586 7587, 7588, 7589, 7590, 7591, 7592
calreticulin UniProtKB: Q96L12 7593 7594 7595, 7596, 7597, 7598, 7599, 7600
N-myc UniProtKB: P04198 9987 9988 9989, 9990, 9991, 9992, 9993, 9994


[0137] In a more preferred embodiment, the composition disclosed herein comprises at least one RNA, preferably an mRNA comprising at least one coding region encoding at least one tumor antigen or a fragment or variant thereof, wherein the at least one coding region comprises an RNA sequence being identical or at least 50%, 60%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to the RNA sequences according to the SEQ ID Nos as disclosed in Table 9.

[0138] Furthermore tumor antigens also may encompass idiotypic antigens associated with a cancer or tumor disease, particularly lymphoma or a lymphoma associated disease, wherein said idiotypic antigen is an immunoglobulin idiotype of a lymphoid blood cell or a T cell receptor idiotype of a lymphoid blood cell.

[0139] In a particularly preferred embodiment the RNA composition disclosed herein comprises at least one RNA, wherein the at least one RNA encodes the following antigens:
  • STEAP (Six Transmembrane Epithelial Antigen of the Prostate);
  • PSA (Prostate-Specific Antigen),
  • PSMA (Prostate-Specific Membrane Antigen),
  • PSCA (Prostate Stem Cell Antigen);
  • PAP (Prostatic Acid Phosphatase), and
  • MUC1 (Mucin 1).


[0140] In another particularly preferred embodiment the RNA composition disclosed herein comprises at least one RNA, wherein the at least one RNA encodes the following antigens:
  • 5T4 (Trophoblast glycoprotein, TPBG);
  • Survivin (Baculoviral IAP repeat-containing protein 5; BIRC5),
  • NY-ESO-1 (New York esophageal squamous cell carcinoma 1; CTAG1B),
  • MAGE-C1 (Melanoma antigen family C1);
  • MAGE-C2 (Melanoma antigen family C2), and
  • MUC1 (Mucin 1).

9. β-catenin inhibitors



[0141] In a further preferred embodiment of the RNA containing composition disclosed herein, the RNA, preferably mRNA, codes for at least one β-catenin inhibitor or a fragment or variant thereof. Preferably the RNA encoding the at least one β-catenin inhibitor encodes an inhibitory protein or dominant negative mutant protein of the β-catenin pathway. Particularly preferred β-catenin inhibitors according to the present disclosure comprise TAT-NLS-BLBD-6, axin-1, TCF-4, GSK-3b, DKK-1, Dvl-1 derivatives or fragments thereof.

[0142] As reviewed by Thakur and Mishra (Thakur R, Mishra DP. Pharmacological modulation of beta-catenin and its applications in cancer therapy. J Cell Mol Med. 2013 Apr;17(4):449-56. doi: 10.1111/jcmm.12033) beta-catenin (β-catenin) is a multifunctional protein which plays an important role in physiological homeostasis. It acts both as a transcriptional regulator and an adaptor protein for intracellular adhesion. β-catenin is necessary for the establishment and maintance of epithelial layers and provides a linkage between intracellular junctions and cytoskeletal proteins. β-catenin is regulated by Wnt signaling. In the absence of Wnt downstream signal β-catenin is phosphorylated which leads to its ubiquitination and eventually protein degradation. Various literature reports have linked β-catenin to the malignant transformation of normal cells. For example, Wnt signaling and β-catenin nuclear localization was associated with differentiation of hepatocytes into a tumoral phenotype. Similarly, in lung epithelial and pancreatic cells, activation of β-catenin was sufficient for induction of oncogenic transformation. In addition to being a driving force of malignant transformation, abnormal β-catenin expression and localization has been associated with increased metastatic potential. Recently, it has been shown that β-catenin signaling prevents T cell infiltration and anti-tumor immunity strongly limiting the potential effects of immunotherapies. Since β-catenin plays an important and detrimental role in tumorigenesis, it has been proposed as a putative drug target.

10. STING-pathway activators



[0143] In a further preferred embodiment of the RNA containing composition disclosed herein, the RNA, preferably mRNA, codes for at least one activator of the STING (stimulator of interferon genes) pathway or a fragment or variant thereof. Preferably, the RNA encoding the at least one activator (stimulator) of the STING pathway encodes an activating protein or a constitutively active protein of the STING pathway, preferably DDX41, STING, cGAS, IRF3, TBK1 or STAT6 or a fragment or variant thereof.

[0144] As reviewed by Woo et al. (Woo SR, Corrales L, Gajewski TF. The STING pathway and the T cell-inflamed tumor microenvironment. Trends Immunol. 2015 Mar 7. pii: S1471-4906(15)00019-8. doi: 10.1016/j.it.2015.02.003) and Dubensky et al. (Dubensky TW Jr, Kanne DB, Leong ML. Rationale, progress and development of vaccines utilizing STING-activating cyclic dinucleotide adjuvants. Ther Adv Vaccines. 2013 Nov;1(4):131-43. doi: 10.1177/2051013613501988) the so-called STING pathway (STING - stimulator of interferon genes) is responsible for sensing of cytoplasmic DNA and induction of proinflammatory mediators. After binding of DNA in cytoplasm, STING activates signaling via TANK-binding kinase 1 (TBK-1)/IRF-3 axis which results in production of IFN-β. This pathway was shown to play an important role in sensing of DNA viruses as well as some autoimmune disorders. Recent data have identified STING pathway as absolutely necessary to induce spontaneous T cell priming against tumor antigens in vivo. Tumor DNA was detected within tumor-infiltrating DCs, which led to IFN-β production and T cell activation. Thus, intratumoral application of small molecules STING pathway agonists has demonstrated their efficacy in tumor-bearing animals. Agonists of the STING pathway has been also evaluated as vaccine adjuvants showing potency to induce cellular and humoral immunity in vaccinated hosts.

11. Checkpoint modulators



[0145] In a further preferred embodiment of the RNA containing composition disclosed herein, the RNA, preferably mRNA comprises at least one coding region that codes for at least one checkpoint modulator or a fragment or variant thereof.

[0146] Negative regulatory T cell surface molecules were discovered which are upregulated in activated T cells to dampen their activity, resulting in less effective killing of tumor cells. These inhibitory molecules were termed negative co-stimulatory molecules due to their homology to the T cell co-stimulatory molecule CD28. These proteins, also referred to as immune checkpoint proteins, function in multiple pathways including the attenuation of early activation signals, competition for positive co-stimulation and direct inhibition of antigen presenting cells (Bour-Jordan et al., 2011. Immunol Rev. 241(1):180-205).

[0147] In preferred embodiments disclosed herein, the checkpoint modulator is a modulator of B7-1/CD80, B7-2/CD86, B7-H1/PD-L1, B7-H2, B7-H3, B7-H4, B7-H6, B7-H7/HHLA2, BTLA, CD28, CD28H/IGPR-1, CTLA-4, ICOS, PD-1, PD-L2/B7-DC, PDCD6, VISTA/B7-H5/PD-1H, BTN1A1/Butyrophilin, BTN2A1, BTN2A2/Butyrophilin 2A2, BTN3A1/2, BTN3A2, BTN3A3, BTNL2/Butyrophilin-like 2, BTNL3, BTNL4, BTNL6, BTNL8, BTNL9, BTNL10, CD277/BTN3A1, LAIR1, LAIR2, CD96, CD155/PVR, CRTAM, DNAM-1/CD226, Nectin-2/CD112, Nectin-3, TIGIT, LILRA3/CD85e, LILRA4/CD85g/ILT7, LILRB1/CD85j/ILT2, LILRB2/CD85d/ILT4, LILRB3/CD85a/ILT5, LILRB4/CD85k/ILT3, 4-1BB/TNFRSF9/CD137, 4-1BB Ligand/TNFSF9, BAFF/BLyS/TNFSF13B, BAFF R/TNFRSF13C, CD27/TNFRSF7, CD27 Ligand/TNFSF7, CD30/TNFRSF8, CD30 Ligand/TNFSF8, CD40/TNFRSF5, CD40 Ligand/TNFSF5, DR3/TNFRSF25, GITR/TNFRSF18, GITR Ligand/TNFSF18, HVEM/TNFRSF14, LIGHT/TNFSF14, Lymphotoxin-alpha/TNF-beta, OX40/TNFRSF4, OX40 Ligand/TNFSF4, RELT/TNFRSF19L, TACI/TNFRSF13B, TL1A/TNFSF15, TNF-alpha, TNF RII/TNFRSF1B, 2B4/CD244/SLAMF4, BLAME/SLAMF8, CD2, CD2F-10/SLAMF9, CD48/SLAMF2, CD58/LFA-3, CD84/SLAMF5, CD229/SLAMF3, CRACC/SLAMF7, NTB-A/SLAMF6, SLAM/CD150, TIM-1/KIM-1/HAVCR, TIM-3, TIM-4, CD7, CD96, CD160, CD200, CD300a/LMIR1, CRTAM, DAP12, Dectin-1/CLEC7A, DPPIV/CD26, EphB6, Integrin alpha 4 beta 1, Integrin alpha 4 beta 7/LPAM-1, LAG-3, TIM-1/KIM-1/HAVCR, TIM-4, TSLP R, or any combinations thereof.

[0148] In the context of the present disclosure, a checkpoint modulator is defined herein as a molecule preferably a protein e.g. an antibody, a dominant negative receptor, a decoy receptor, or a ligand or a fragment or variant thereof, which modulates the function of an immune checkpoint protein, e.g. it inhibits or reduces the activity of checkpoint inhibitors (or inhibitory checkpoint molecules) or it stimulates the activity of checkpoint stimulators (or stimulatory checkpoint molecules). Therefore checkpoint modulators as defined herein, influence the activity of checkpoint molecules.

[0149] In this context inhibitory checkpoint molecules are defined as checkpoint inhibitors and can be used synonymously. In addition stimulatory checkpoint molecules are defined as checkpoint stimulators and can be used synonymously.

[0150] Preferable inhibitory checkpoint molecules that may be inhibited by a checkpoint modulator in the context of the present disclosure are PD-1, PD-L1, CTLA-4, PD-L2, LAG3, TIM3/HAVCR2, 2B4, A2aR, B7H3, B7H4, BTLA, CD30, CD160, GAL9, HVEM, IDO1, IDO2, KIR, LAIR1 and VISTA.

[0151] Preferable stimulatory checkpoint molecules that may be stimulated by a checkpoint modulator in the context of the present disclosure are CD2, CD27, CD28, CD40, CD137, CD226, CD276, GITR, ICOS, OX-40 and CD70.

[0152] Preferably, the checkpoint modulator is selected from agonistic antibodies, antagonistic antibodies, ligands, dominant negative receptors, and decoy receptors or combinations thereof.

[0153] Methods for generating and using mRNA-encoded antibodies are known in the art (e.g. WO2008/083949).

[0154] Preferably, the agonistic antibody is chosen from the following list: anti-4-1BB, anti-OX40, anti-GITR, anti-CD28, anti-CD27, anti-CD-40anti-ICOS, anti-TNFRSF25, and anti-LIGHT.

[0155] OX40 is a member of the TNFR-superfamily of receptors, and is expressed on the surface of antigen-activated mammalian CD4+ and CD8+ T lymphocytes. OX40 ligand (OX40L, also known as gp34, ACT-4-L, and CD252) is a protein that specifically interacts with the OX40 receptor. The term OX40L includes the entire OX40 ligand, soluble OX40 ligand, and fusion proteins comprising a functionally active portion of OX40 ligand covalently linked to a second moiety, e.g., a protein domain. Also included within the definition of OX40L are variants which vary in amino acid sequence from naturally occurring OX4L but which retain the ability to specifically bind to the OX40 receptor. Further included within the definition of OX40L are variants which enhance the biological activity of OX40. An OX40 agonist is a molecule which induces or enhances the biological activity of OX40, e.g. signal transduction mediated by OX40. An OX40 agonist is preferably defined herein as a binding molecule capable of specific binding to OX40. Therefore, the OX40 agonist may be any agonist binding to OX40 and capable of stimulating OX40 signaling. In this context, the OX40 agonist may be an agonistic antibody binding to OX40.

[0156] OX40 agonists and anti-OX40 monoclonal antibodies are described in WO1995/021251, WO1995/012673 and WO1995/21915. Particularly preferred is the anti-OX40 antibody 9B12, a murine anti-OX40 monoclonal antibody directed against the extracellular domain of human OX40 (Weinberg et al., 2006. J. Immunother. 29(6):575-585).

[0157] Preferably, the antagonistic antibody is chosen from the list of anti-CTLA4, anti-PD1, anti-PD-L1, anti-Vista, anti-Tim-3, anti-LAG-3, and anti-BTLA.

[0158] Cytotoxic T lymphocyte antigen-4 (CTLA-4) is mainly expressed within the intracellular compartment of T cells. After a potent or long-lasting stimulus to a naive T cell via the T cell receptor (TCR), CTLA-4 is transported to the cell surface and concentrated at the immunological synapse. CTLA-4 then competes with CD28 for CD80/CD86 and down-modulates TCR signaling via effects on Akt signaling. Thus CTLA-4 functions physiologically as a signal dampener (Weber, J. 2010. Semin. Oncol. 37(5):430-9).

[0159] Particularly preferred are the anti-CTLA-4 antibodies ipilimumab (Yervoy®), tremelimumab, and AGEN-1884.

[0160] Members of the PD-1 pathway are all proteins which are associated with PD-1 signaling. On the one hand, these might be proteins which induce PD-1 signaling upstream of PD-1 as e.g. the ligands of PD-1, PD-L1 and PD-L2 and the signal transduction receptor PD-1. On the other hand, these might be signal transduction proteins downstream of PD-1 receptor. Particularly preferred as members of the PD-1 pathway in the context of the present disclosure are PD-1, PD-L1 and PD-L2.

[0161] In the context of the present disclosure, a PD-1 pathway antagonist is preferably defined herein as a compound capable to impair the PD-1 pathway signaling, preferably signaling mediated by the PD-1 receptor. Therefore, the PD-1 pathway antagonist may be any antagonist directed against any member of the PD-1 pathway capable of antagonizing PD-1 pathway signaling. In this context, the antagonist may be an antagonistic antibody as defined herein, targeting any member of the PD-1 pathway, preferably directed against PD-1 receptor, PD-L1 or PD-L2. This antagonistic antibody may also be encoded by a nucleic acid. Also, the PD-1 pathway antagonist may be a fragment of the PD-1 receptor blocking the activity of PD1 ligands. B7-1 or fragments thereof may act as PD1-antagonizing ligands as well. Additionally, a PD-1 pathway antagonist may be a protein comprising (or a nucleic acid coding for) an amino acid sequence capable of binding to PD-1 but preventing PD-1 signaling, e.g. by inhibiting PD-1 and B7-H1 or B7-DL interaction (WO2014127917).

[0162] Particularly preferred are the anti-PD1 antibodies Nivolumab (MDX-1106/BMS-936558/ONO-4538), (Brahmer et al., 2010. J Clin Oncol. 28(19):3167-75; PMID: 20516446); Pidilizumab (CT-011), (Berger et al., 2008. Clin Cancer Res. 14(10):3044-51; PMID: 18483370); Pembrolizumab (MK-3475, SCH 900475); AMP-224, and MEDI0680 (AMP-514)
Particularly preferred are the anti-PD-L1 antibodies MDX-1105/BMS-936559 (Brahmer et al. 2012. N Engl J Med. 366(26):2455-65; PMID: 22658128); atezolizumab (MPDL3280A/RG7446); durvalumab (MEDI4736); and avelumab (MSB0010718).

[0163] According to the present disclosure, the at least one RNA of the RNA containing composition disclosed herein encodes at least one antibody or fragments or variants thereof of Table 10. It is particularly preferred that the RNA containing composition comprises at least one RNA encoding the heavy chain of a particular antibody or fragments or variants thereof and at least one further RNA encoding the light chain of the same particular antibody or fragments or variants thereof.
Table 10: Antibodies directed against checkpoint molecules
NameTarget
Urelumab 4-1BB/CD137
PF-05082566 4-1BB/CD137
8H9 B7-H3
Enoblituzumab B7-H3
Ipilimumab CD152/CTLA-4
Ticilimumab (= tremelimumab) CD152/CTLA-4
Tremelimumab CD152/CTLA-4
Varlilumab CD27
Teneliximab CD40
Vorsetuzumab mafodotin CD70
Lirilumab KIR2D
GSK-3174998 OX40
MEDI-6469 OX40
MEDI-6383 OX40
MEDI-0562 OX40
PF-04518600 OX40
RG-7888 OX40
PF-06801591 PD-1
BGBA-317 PD-1
MEDI-0680 PD-1
MK-3475 PD-1
Nivolumab PD-1
PDR-001 PD-1
Pembrolizumab PD-1
Pidilizumab PD-1
REGN-2810 PD-1
SHR-1210 PD-1
TSR-042 PD-1
MDX-1106 PD-1
Merck 3745 PD-1
CT-011 PD-1
MEDI-0680 PD-1
PDR001 PD-1
REGN2810 PD-1
BGB-108 PD-1
BGB-A317 PD-1
AMP-224 PD-1
Atezolizumab PD-L1 (CD274)
Avelumab PD-L1 (CD274)
BMS-936559 PD-L1 (CD274)
Durvalumab PD-L1 (CD274)
MEDI-4736 PD-L1 (CD274)
MPDL33280A PD-L1 (CD274)
YW243.55.S70 PD-L1 (CD274)
MDX-1105 PD-L1 (CD274)
MSB0010718C PD-L1 (CD274)


[0164] In a further preferred embodiment the checkpoint modulator is a decoy receptor (e.g. a soluble receptor). Preferably, the decoy receptor is a soluble PD1 receptor. In a particularly preferred embodiment, the at least one RNA of the RNA containing composition disclosed herein comprises an RNA sequence being identical or at least 50%, 60%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to the RNA sequence according to SEQ ID NO: 389 encoding a soluble PD-1 recptor.

[0165] In a further preferred embodiment of the RNA containing composition disclosed herein, the RNA, preferably an mRNA, codes for at least one ligand which functions as a checkpoint modulator. Preferably, the ligand is CD40 Ligand (CD40L). In a further preferred embodiment of the RNA containing composition disclosed herein, the RNA, preferably an mRNA, codes for at least one ligand which functions as a checkpoint modulator. Preferably, the ligand is CD40 Ligand (CD40L). Most preferably, the at least one RNA of the RNA containing composition disclosed herein comprises an RNA sequence being identical or at least 50%, 60%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to the RNA sequence according to SEQ ID NO: 10073 encoding CD40L.

12. Innate immune activators:



[0166] In this context innate immune activators may be selected from mammalian, in particular human adjuvant proteins, which typically comprise any human protein or peptide, which is capable of eliciting an innate immune response (in a mammal), e.g. as a reaction of the binding of an exogenous TLR ligand to a TLR. More preferably, human adjuvant proteins are selected from the group consisting of proteins which are components and ligands of the signalling networks of the pattern recognition receptors including TLR, NLR and RLH, including TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, TLR11; NOD1, NOD2, NOD3, NOD4, NOD5, NALP1, NALP2, NALP3, NALP4, NALP5, NALP6, NALP6, NALP7, NALP7, NALP8, NALP9, NALP10, NALP11, NALP12, NALP13, NALP14,I IPAF, NAIP, CIITA, RIG-I, MDA5 and LGP2, the signal transducers of TLR signaling including adaptor proteins including e.g. Trif and Cardif; components of the Small-GTPases signalling (RhoA, Ras, Rac1, Cdc42, Rab etc.), components of the PIP signalling (PI3K, Src-Kinases, etc.), components of the MyD88-dependent signalling (MyD88, IRAK1, IRAK2, IRAK4, TIRAP, TRAF6 etc.), components of the MyD88-independent signalling (TICAM1, TICAM2, TRAF6, TBK1, IRF3, TAK1, IRAK1 etc.); the activated kinases including e.g. Akt, MEKK1, MKK1, MKK3, MKK4, MKK6, MKK7, ERK1, ERK2, GSK3, PKC kinases, PKD kinases, GSK3 kinases, JNK, p38MAPK, TAK1, IKK, and TAK1; the activated transcription factors including e.g. NF-κB, c-Fos, c-Jun, c-Myc, CREB, AP-1, Elk-1, ATF2, IRF-3, IRF-7.

[0167] Mammalian, in particular human adjuvant proteins may furthermore be selected from the group consisting of heat shock proteins, such as HSP10, HSP60, HSP65, HSP70, HSP75 and HSP90, gp96, Fibrinogen, Typlll repeat extra domain A of fibronectin; or components of the complement system including C1q, MBL, C1r, C1s, C2b, Bb, D, MASP-1, MASP-2, C4b, C3b, C5a, C3a, C4a, C5b, C6, C7, C8, C9, CR1, CR2, CR3, CR4, C1qR, C1INH, C4bp, MCP, DAF, H, I, P and CD59, or induced target genes including e.g. Beta-Defensin, cell surface proteins; or human adjuvant proteins including trif, flt-3 ligand, Gp96 or fibronectin, etc., or any species homolog of any of the above human adjuvant proteins. Furthermore HGMB1 may be used as adjuvant protein.

[0168] Mammalian, in particular human adjuvant proteins may furthermore comprise cytokines which induce or enhance an innate immune response, including IL-1 alpha, IL1 beta, IL-2, IL-6, IL-7, IL-8, IL-9, IL-12, IL-13, IL-15, IL-16, IL-17, IL-18, IL-21, IL-23, TNFalpha, IFNalpha, IFNbeta, IFNgamma, GM-CSF, G-CSF, M-CSF; chemokines including IL-8, IP-10, MCP-1, MIP-1alpha, RANTES, Eotaxin, CCL21; cytokines which are released from macrophages, including IL-1, IL-6, IL-8, IL-12 and TNF-alpha; as well as IL-1R1 and IL-1 alpha.

[0169] Therefore in this context it particularly preferred that the at least one RNA encodes at least one innate immune activator, preferably an adjuvant protein, more preferably a human adjuvant protein, or a fragment or variant thereof.

[0170] In this context it is particularly preferred that I constitutive active variant of an adjuvant protein is encoded by the at least one RNA, preferably a constitutive active variant of RIG-1 (ΔRIGI).

[0171] In another preferred embodiment the at least one RNA encodes HGMB1 as an innate immune activator, or a fragment or variant thereof.

[0172] According to preferred embodiments in the context of the present disclosure, innate immune activators may be selected from any innate immune activator selected from the group consisting of CD55; Akt; ATF2; C1QBP; C1QC; Cardif; CCL11; CCL2; CCL21; CCL3; CCL5; CD59,Beta-Defensin; Cdc42; CFAD; CFAH; CFAI; CH60; CIITA; c-Jun; c-myc; CO8A; CO8B; CO8G; complement_system_component_C1INH; complement_system_component_C1qR; complement_system_component_C1s; complement_system_component_C4bp; complement_system_component_C6; complement_system_component_C7; complement_system_component_C8; complement_system_component_C9; complement_system_component_CR2; complement_system_component_CR3; complement_system_component_MASP-1; complement_system_component_MASP-2; complement_system_component_MBL; complement_system_component_MCP; CREB3; CREB3L1; CREB3L3; CREB3L4; CREB5; CRTC2; CXCL10; CXCL8; DJB11; DJB13; DJB14; DJC10; DJC12; DJC14; DJC15; DJC16; DJC17; DJC18; DJC22; DJC24; DJC25; DJC27; DJC28; DJC30; DNAJB12; DNAJC11; DNAJC21; DNJA1; DNJA2; DNJA3; DNJA4; DNJB1; DNJB2; DNJB3; DNJB4; DNJB5; DNJB6; DNJB7; DNJB8; DNJB9; DNJC1; DNJC2; DNJC3; DNJC4; DNJC5; DNJC7; DNJC8; DNJC9; Elk-1; ERK1; ERK2; Fibrinogen; fibronectin; FLT3_ligand; FOS; G-CSF; GM-CSF; GRP94_(gp96); GSK3A; GSK3B; HS71A; HS71B; HSC70; HSP10; HSP60; HSP70; HSP75; HSP90; HSP90B1; IFNalpha; IFNB; IFNG; IKK; IL-1; IL-1_alpha; IL-1_beta; IL-12; IL-13; IL-15; IL-16; IL-17A; IL-18; IL-1R1; IL-2; IL-21; IL-23; IL-6; IL-7; IL-9; IRAK1; IRAK2; IRAK4; IRF3; IRF-7; JNK; KPCB; KPCD; KPCD1; KPCD3; KPCE; KPCG; KPCI; KPCL; KPCT; KPCZ; I_IPAF; LGP2; M-CSF; MDA5; MK11; MK12; MK13; MK14; MKK1; MKK3; MKK4; MKK6; MKK7; MSTP104; MyD88; NALP10; NALP11; NALP12; NALP13; NALP2; NALP3; NALP4; NALP5; NALP6; NALP7; NALP8; NALP9; NF-kappaB; NLRP14; NOD1; NOD2; NOD3; PI3K; PKD2; PKN1; PKN2; PKN3; PRKCA; PRKD2; Rab; Rac1; RASH; RASK; RASN; RhoA; RIG-I; Src-Kinases; Surfactant_protein_A; Surfactant_protein_D; TAK1; TBK1; TICAM1; TICAM2; TIRAP; TLR1; TLR10; TLR2; TLR3; TLR4; TLR5; TLR6; TLR7; TLR8; TLR9; TNF; TRAF6, preferably as disclosed in Table 11. Particularly preferred in this context are the RNA sequences encoding a innate immune activator according to Table 11.
Table 11: Innate immune activators (human adjuvant proteins)
Gene NameProtein Accession No.Protein Sequence SEQ ID NO:RNA Sequence wild type SEQ ID NO:Optimized RNA Sequence SEQ ID NO:
CD55 UniProtKB: B1AP15 909 910 911, 912, 913, 914, 915
CD55 UniProtKB: D3DT85 916 917 918, 919, 920, 921, 922
CD55 UniProtKB: D3DT86 923 924 925, 926, 927, 928, 929
CD55 UniProtKB: P08174 930 931 932, 933, 934, 935, 936
fibronectin UniProtKB: A0A024R5I6 1567 1568 1569, 1570, 1571, 1572, 1573
fibronectin UniProtKB: A0A024RB01 1574 1575 1576, 1577, 1578, 1579, 1580
fibronectin UniProtKB: A0A024RDT9 1581 1582 1583, 1584, 1585, 1586, 1587
fibronectin UniProtKB: A0A024RDV5 1588 1589 1590, 1591, 1592, 1593, 1594
fibronectin UniProtKB: A6NH44 1595 1596 1597, 1598, 1599, 1600, 1601
fibronectin UniProtKB: A8K6A5 1602 1603 1604, 1605, 1606, 1607, 1608
fibronectin UniProtKB: B2R627 1609 1610 1611, 1612, 1613, 1614, 1615
fibronectin UniProtKB: B3KXM5 1616 1617 1618, 1619, 1620, 1621, 1622
fibronectin UniProtKB: B4DIC5 1623 1624 1625, 1626, 1627, 1628, 1629
fibronectin UniProtKB: B4DN21 1630 1631 1632, 1633, 1634, 1635, 1636
fibronectin UniProtKB: B4DS98 1637 1638 1639, 1640, 1641, 1642, 1643
fibronectin UniProtKB: B4DTH2 1644 1645 1646, 1647, 1648, 1649, 1650
fibronectin UniProtKB: B4DTK1 1651 1652 1653, 1654, 1655, 1656, 1657
fibronectin UniProtKB: B4DU16 1658 1659 1660, 1661, 1662, 1663, 1664
fibronectin UniProtKB: B7Z3W5 1665 1666 1667, 1668, 1669, 1670, 1671
fibronectin UniProtKB: B7Z939 1672 1673 1674, 1675, 1676, 1677, 1678
fibronectin UniProtKB: G5E9X3 1679 1680 1681, 1682, 1683, 1684, 1685
fibronectin UniProtKB: Q9H382 1686 1687 1688, 1689, 1690, 1691, 1692
FOS UniProtKB: P01100 1693 1694 1695, 1696, 1697, 1698, 1699
HS71A UniProtKB: P0DMV8 1938 1939 1940, 1941, 1942, 1943, 1944
HS71B UniProtKB: P0DMV9 1945 1946 1947, 1948, 1949, 1950, 1951
RASH UniProtKB: P01112 3296 3297 3298, 3299, 3300, 3301, 3302
RASK UniProtKB: P01116 3303 3304 3305, 3306, 3307, 3308, 3309
RASN UniProtKB: P01111 3310 3311 3312, 3313, 3314, 3315, 3316
FLT3_ligand Genbank: AAA90950.1 3913 3914 3915, 3916, 3917, 3918, 3919, 3920
FLT3_ligand UniProtKB: P49771 3921 3922 3923, 3924, 3925, 3926, 3927, 3928
G-CSF UniProtKB: P09919 3929 3930 3931, 3932, 3933, 3934, 3935, 3936
GM-CSF UniProtKB: P04141 3945 3946 3947, 3948, 3949, 3950, 3951, 3952
IFNalpha UniProtKB: G9JKF1 3953 3954 3955, 3956, 3957, 3958, 3959, 3960
IFNalpha UniProtKB: P01562 3961 3962 3963, 3964, 3965, 3966, 3967, 3968
IFNalpha UniProtKB: P01563 3969 3970 3971, 3972, 3973, 3974, 3975, 3976
IFNalpha UniProtKB: P01566 3977 3978 3979, 3980, 3981, 3982, 3983, 3984
IFNalpha UniProtKB: P01567 3985 3986 3987, 3988, 3989, 3990, 3991, 3992
IFNalpha UniProtKB: P01568 3993 3994 3995, 3996, 3997, 3998, 3999, 4000
IFNalpha UniProtKB: P01569 4001 4002 4003, 4004, 4005, 4006, 4007, 4008
IFNalpha UniProtKB: P01570 4009 4010 4011, 4012, 4013, 4014, 4015, 4016
IFNalpha UniProtKB: P01571 4017 4018 4019, 4020, 4021, 4022, 4023, 4024
IFNalpha UniProtKB: P05013 4025 4026 4027, 4028, 4029, 4030, 4031, 4032
IFNalpha UniProtKB: P05014 4033 4034 4035, 4036, 4037, 4038, 4039, 4040
IFNalpha UniProtKB: P05015 4041 4042 4043, 4044, 4045, 4046, 4047, 4048
IFNalpha UniProtKB: P32881 4049 4050 4051, 4052, 4053, 4054, 4055, 4056
IFNalpha UniProtKB: Q14618 4057 4058 4059, 4060, 4061, 4062, 4063, 4064
IFNalpha UniProtKB: Q86UP4 4065 4066 4067, 4068, 4069, 4070, 4071, 4072
IFNB UniProtKB: P01574 4073 4074 4075, 4076, 4077, 4078, 4079, 4080
IFNB UniProtKB: Q15943 4081 4082 4083, 4084, 4085, 4086, 4087, 4088
IFNG UniProtKB: P01579 4089 4090 4091, 4092, 4093, 4094, 4095, 4096
IFNG UniProtKB: Q14609 4097 4098 4099, 4100, 4101, 4102, 4103, 4104
IFNG UniProtKB: Q14610 4105 4106 4107, 4108, 4109, 4110, 4111, 4112
IFNG UniProtKB: Q14611 4113 4114 4115, 4116, 4117, 4118, 4119, 4120
IFNG UniProtKB: Q14612 4121 4122 4123, 4124, 4125, 4126, 4127, 4128
IFNG UniProtKB: Q14613 4129 4130 4131, 4132, 4133, 4134, 4135, 4136
IFNG UniProtKB: Q14614 4137 4138 4139, 4140, 4141, 4142, 4143, 4144
IFNG UniProtKB: Q14615 4145 4146 4147, 4148, 4149, 4150, 4151, 4152
IFNG UniProtKB: Q8NHY9 4153 4154 4155, 4156, 4157, 4158, 4159, 4160
IL-12 UniProtKB: P29460 4193 4194 4195, 4196, 4197, 4198, 4199, 4200
IL-13 UniProtKB: P35225 4201 4202 4203, 4204, 4205, 4206, 4207, 4208
IL-15 UniProtKB: P40933 4217 4218 4219, 4220, 4221, 4222, 4223, 4224
IL-16 UniProtKB: Q14005 4225 4226 4227, 4228, 4229, 4230, 4231, 4232
IL-17A UniProtKB: Q16552 4233 4234 4235, 4236, 4237, 4238, 4239, 4240
IL-18 UniProtKB: A0A024R3E0 4281 4282 4283, 4284, 4285, 4286, 4287, 4288
IL-18 UniProtKB: B0YJ28 4289 4290 4291, 4292, 4293, 4294, 4295, 4296
IL-18 UniProtKB: Q14116 4297 4298 4299, 4300, 4301, 4302, 4303, 4304
IL-1_alpha UniProtKB: P01583 4313 4314 4315, 4316, 4317, 4318, 4319, 4320
IL-1_beta UniProtKB: P01584 4321 4322 4323, 4324, 4325, 4326, 4327, 4328
IL-21 RefSeq: NP_001193935.1 4361 4362 4363, 4364, 4365, 4366, 4367, 4368
IL-21 RefSeq: NP_068575.1 4369 4370 4371, 4372, 4373, 4374, 4375, 4376
IL-23 UniProtKB: Q9NPF7 4385 4386 4387, 4388, 4389, 4390, 4391, 4392
IL-2 UniProtKB: P60568 4473 4474 4475, 4476, 4477, 4478, 4479, 4480
IL-2 UniProtKB: Q0GK43 4481 4482 4483, 4484, 4485, 4486, 4487, 4488
IL-2 UniProtKB: Q13169 4489 4490 4491, 4492, 4493, 4494, 4495, 4496
IL-2 UniProtKB: Q6NZ91 4497 4498 4499, 4500, 4501, 4502, 4503, 4504
IL-2 UniProtKB: Q6NZ93 4505 4506 4507, 4508, 4509, 4510, 4511, 4512
IL-6 UniProtKB: P05231 4593 4594 4595, 4596, 4597, 4598, 4599, 4600
IL-7 UniProtKB: A8K673 4601 4602 4603, 4604, 4605, 4606, 4607, 4608
IL-7 UniProtKB: P13232 4609 4610 4611, 4612, 4613, 4614, 4615, 4616
IL-9 UniProtKB: P15248 4617 4618 4619, 4620, 4621, 4622, 4623, 4624
M-CSF UniProtKB: P09603 4705 4706 4707, 4708, 4709, 4710, 4711, 4712
CCL11 UniProtKB: P51671 4833 4834 4835, 4836, 4837, 4838, 4839, 4840
CCL11 UniProtKB: Q6I9T4 4841 4842 4843, 4844, 4845, 4846, 4847, 4848
CCL21 UniProtKB: O00585 4937 4938 4939, 4940, 4941, 4942, 4943, 4944
CCL2 UniProtKB: P13500 5001 5002 5003, 5004, 5005, 5006, 5007, 5008
CCL3 UniProtKB: A0N0R1 5009 5010 5011, 5012, 5013, 5014, 5015, 5016
CCL3 UniProtKB: P10147 5017 5018 5019, 5020, 5021, 5022, 5023, 5024
CCL5 UniProtKB: D0EI67 5041 5042 5043, 5044, 5045, 5046, 5047, 5048
CCL5 UniProtKB: P13501 5049 5050 5051, 5052, 5053, 5054, 5055, 5056
CXCL10 UniProtKB: A0A024RDA4 5129 5130 5131, 5132, 5133, 5134, 5135, 5136
CXCL10 UniProtKB: P02778 5137 5138 5139, 5140, 5141, 5142, 5143, 5144
CXCL8 UniProtKB: P10145 5265 5266 5267, 5268, 5269, 5270, 5271, 5272
TNF UniProtKB: P01375 7369 7370 7371, 7372, 7373, 7374, 7375, 7376
TNF UniProtKB: Q5STB3 7377 7378 7379, 7380, 7381, 7382, 7383, 7384
GRP94_(gp96) UniProtKB: P14625 7617 7618 7619, 7620, 7621, 7622, 7623, 7624
HSC70 UniProtKB: P11142 7625 7626 7627, 7628, 7629, 7630, 7631, 7632
HSP60 UniProtKB: A0A024R3X4 7657 7658 7659, 7660, 7661, 7662, 7663, 7664
HSP60 UniProtKB: B3GQS7 7665 7666 7667, 7668, 7669, 7670, 7671, 7672
HSP60 UniProtKB: P10809 7673 7674 7675, 7676, 7677, 7678, 7679, 7680
HSP60 UniProtKB: Q0VDF9 7681 7682 7683, 7684, 7685, 7686, 7687, 7688
HSP70 UniProtKB: P38646 7689 7690 7691, 7692, 7693, 7694, 7695, 7696
HSP90 UniProtKB: P07900 7697 7698 7699, 7700, 7701, 7702, 7703, 7704
HSP90 UniProtKB: P08238 7705 7706 7707, 7708, 7709, 7710, 7711, 7712
Akt UniProtKB: B0LPE5 7737 7738 7739, 7740, 7741, 7742, 7743
Akt UniProtKB: P31749 7744 7745 7746, 7747, 7748, 7749, 7750
Akt UniProtKB: P31751 7751 7752 7753, 7754, 7755, 7756, 7757
Akt UniProtKB: Q9Y243 7758 7759 7760, 7761, 7762, 7763, 7764
ATF2 UniProtKB: P15336 7765 7766 7767, 7768, 7769, 7770, 7771
C1QBP UniProtKB: Q07021 7772 7773 7774, 7775, 7776, 7777, 7778
C1QC UniProtKB: P02747 7779 7780 7781, 7782, 7783, 7784, 7785
Cardif UniProtKB: Q7Z434 7786 7787 7788, 7789, 7790, 7791, 7792
CD59,Beta-Defensin UniProtKB: P13987 7793 7794 7795, 7796, 7797, 7798, 7799
CD59,Beta-Defensin UniProtKB: Q6FHM9 7800 7801 7802, 7803, 7804, 7805, 7806
Cdc42 UniProtKB: A0A024RAE4 7807 7808 7809, 7810, 7811, 7812, 7813
Cdc42 UniProtKB: A0A024RAE6 7814 7815 7816, 7817, 7818, 7819, 7820
Cdc42 UniProtKB: P60953 7821 7822 7823, 7824, 7825, 7826, 7827
CFAD UniProtKB: P00746 7828 7829 7830, 7831, 7832, 7833, 7834
CFAH UniProtKB: P08603 7835 7836 7837, 7838, 7839, 7840, 7841
CFAI UniProtKB: P05156 7842 7843 7844, 7845, 7846, 7847, 7848
CH60 RefSeq: NP_002147.2 7849 7850 7851, 7852, 7853, 7854, 7855
CIITA UniProtKB: Q29704 7856 7857 7858, 7859, 7860, 7861, 7862
c-Jun UniProtKB: B3KN68 7863 7864 7865, 7866, 7867, 7868, 7869
c-Jun UniProtKB: B3KNW1 7870 7871 7872, 7873, 7874, 7875, 7876
c-Jun UniProtKB: B3KXW5 7877 7878 7879, 7880, 7881, 7882, 7883
c-Jun UniProtKB: B4DED9 7884 7885 7886, 7887, 7888, 7889, 7890
c-Jun UniProtKB: B4DFU7 7891 7892 7893, 7894, 7895, 7896, 7897
c-Jun UniProtKB: B4DGE1 7898 7899 7900, 7901, 7902, 7903, 7904
c-Jun UniProtKB: B4DJ64 7905 7906 7907, 7908, 7909, 7910, 7911
c-Jun UniProtKB: B4DS36 7912 7913 7914, 7915, 7916, 7917, 7918
c-Jun UniProtKB: B7Z1L7 7919 7920 7921, 7922, 7923, 7924, 7925
c-Jun UniProtKB: G1UI24 7926 7927 7928, 7929, 7930, 7931, 7932
c-Jun UniProtKB: G5E966 7933 7934 7935, 7936, 7937, 7938, 7939
c-Jun UniProtKB: O75843 7940 7941 7942, 7943, 7944, 7945, 7946
c-Jun UniProtKB: P05412 7947 7948 7949, 7950, 7951, 7952, 7953
c-Jun UniProtKB: P53677 7954 7955 7956, 7957, 7958, 7959, 7960
c-Jun UniProtKB: P61966 7961 7962 7963, 7964, 7965, 7966, 7967
c-Jun UniProtKB: Q63HQ0 7968 7969 7970, 7971, 7972, 7973, 7974
c-Jun UniProtKB: Q7Z5Q8 7975 7976 7977, 7978, 7979, 7980, 7981
c-Jun UniProtKB: Q96PC3 7982 7983 7984, 7985, 7986, 7987, 7988
c-Jun UniProtKB: Q9BXS5 7989 7990 7991, 7992, 7993, 7994, 7995
c-Jun UniProtKB: Q9Y6Q5 7996 7997 7998, 7999, 8000, 8001, 8002
CO8A UniProtKB: P07357 8003 8004 8005, 8006, 8007, 8008, 8009
CO8B UniProtKB: P07358 8010 8011 8012, 8013, 8014, 8015, 8016
CO8G UniProtKB: P07360 8017 8018 8019, 8020, 8021, 8022, 8023
complement_system_component_C1INH UniProtKB: P05155 8024 8025 8026, 8027, 8028, 8029, 8030
complement_system_component_C1qR UniProtKB: Q8IXK1 8031 8032 8033, 8034, 8035, 8036, 8037
complement_system_component_C1s UniProtKB: P09871 8038 8039 8040, 8041, 8042, 8043, 8044
complement system_component_C4bp UniProtKB: P04003 8045 8046 8047, 8048, 8049, 8050, 8051
complement_system_component_C6 UniProtKB: P13671 8052 8053 8054, 8055, 8056, 8057, 8058
complement_system_component_C7 UniProtKB: P10643 8059 8060 8061, 8062, 8063, 8064, 8065
complement_system_component_C8 UniProtKB: Q99618 8066 8067 8068, 8069, 8070, 8071, 8072
complement_system_component_C9 UniProtKB: A0A024R035 8073 8074 8075, 8076, 8077, 8078, 8079
complement_system_component_C9 UniProtKB: P02748 8080 8081 8082, 8083, 8084, 8085, 8086
complement_system_component_CR2 UniProtKB: P20023 8087 8088 8089, 8090, 8091, 8092, 8093
complement_system_component_CR3 UniProtKB: D3DSM0 8094 8095 8096, 8097, 8098, 8099, 8100
complement_system_component_CR3 UniProtKB: P05107 8101 8102 8103, 8104, 8105, 8106, 8107
complement_system_component_MASP-1 UniProtKB: P48740 8108 8109 8110, 8111, 8112, 8113, 8114
complement_system_component_MASP-2 UniProtKB: O00187 8115 8116 8117, 8118, 8119, 8120, 8121
complement_system_component_MBL UniProtKB: P11226 8122 8123 8124, 8125, 8126, 8127, 8128
complement_system_component_MCP UniProtKB: P15529 8129 8130 8131, 8132, 8133, 8134, 8135
complement_system_component_MCP UniProtKB: P40121 8136 8137 8138, 8139, 8140, 8141, 8142
CREB3 CCDS: CCDS6588.1 8143 8144 8145, 8146, 8147, 8148, 8149
CREB3L1 UniProtKB: Q96BA8 8150 8151 8152, 8153, 8154, 8155, 8156
CREB3L3 UniProtKB: Q68CJ9 8157 8158 8159, 8160, 8161, 8162, 8163
CREB3L4 UniProtKB: Q8TEY5 8164 8165 8166, 8167, 8168, 8169, 8170
CREB5 UniProtKB: Q02930 8171 8172 8173, 8174, 8175, 8176, 8177
CRTC2 UniProtKB: Q53ET0 8178 8179 8180, 8181, 8182, 8183, 8184
DJB11 UniProtKB: Q9UBS4 8185 8186 8187, 8188, 8189, 8190, 8191
DJB13 UniProtKB: P59910 8192 8193 8194, 8195, 8196, 8197, 8198
DJB14 UniProtKB: Q8TBM8 8199 8200 8201, 8202, 8203, 8204, 8205
DJC10 UniProtKB: Q8IXB1 8206 8207 8208, 8209, 8210, 8211, 8212
DJC12 UniProtKB: Q9UKB3 8213 8214 8215, 8216, 8217, 8218, 8219
DJC14 UniProtKB: Q6Y2X3 8220 8221 8222, 8223, 8224, 8225, 8226
DJC15 UniProtKB: Q9Y5T4 8227 8228 8229, 8230, 8231, 8232, 8233
DJC16 UniProtKB: Q9Y2G8 8234 8235 8236, 8237, 8238, 8239, 8240
DJC17 UniProtKB: Q9NVM6 8241 8242 8243, 8244, 8245, 8246, 8247
DJC18 UniProtKB: Q9H819 8248 8249 8250, 8251, 8252, 8253, 8254
DJC22 UniProtKB: Q8N4W6 8255 8256 8257, 8258, 8259, 8260, 8261
DJC24 UniProtKB: Q6P3W2 8262 8263 8264, 8265, 8266, 8267, 8268
DJC25 UniProtKB: Q9H1X3 8269 8270 8271, 8272, 8273, 8274, 8275
DJC27 UniProtKB: Q9NZQ0 8276 8277 8278, 8279, 8280, 8281, 8282
DJC28 UniProtKB: Q9NX36 8283 8284 8285, 8286, 8287, 8288, 8289
DJC30 UniProtKB: Q96LL9 8290 8291 8292, 8293, 8294, 8295, 8296
DNAJB12 RefSeq: NP_001002762.2 8297 8298 8299, 8300, 8301, 8302, 8303
DNAJC11 UniProtKB: Q9NVH1 8304 8305 8306, 8307, 8308, 8309, 8310
DNAJC21 UniProtKB: Q5F1R6 8311 8312 8313, 8314, 8315, 8316, 8317
DNJA1 UniProtKB: P31689 8318 8319 8320, 8321, 8322, 8323, 8324
DNJA2 UniProtKB: O60884 8325 8326 8327, 8328, 8329, 8330, 8331
DNJA3 UniProtKB: Q96EY1 8332 8333 8334, 8335, 8336, 8337, 8338
DNJA4 UniProtKB: Q8WW22 8339 8340 8341, 8342, 8343, 8344, 8345
DNJB1 UniProtKB: P25685 8346 8347 8348, 8349, 8350, 8351, 8352
DNJB2 UniProtKB: P25686 8353 8354 8355, 8356, 8357, 8358, 8359
DNJB3 UniProtKB: Q8WWF6 8360 8361 8362, 8363, 8364, 8365, 8366
DNJB4 UniProtKB: Q9UDY4 8367 8368 8369, 8370, 8371, 8372, 8373
DNJB5 UniProtKB: O75953 8374 8375 8376, 8377, 8378, 8379, 8380
DNJB6 UniProtKB: O75190 8381 8382 8383, 8384, 8385, 8386, 8387
DNJB7 UniProtKB: Q7Z6W7 8388 8389 8390, 8391, 8392, 8393, 8394
DNJB8 UniProtKB: Q8NHS0 8395 8396 8397, 8398, 8399, 8400, 8401
DNJB9 UniProtKB: Q9UBS3 8402 8403 8404, 8405, 8406, 8407, 8408
DNJC1 UniProtKB: Q96KC8 8409 8410 8411, 8412, 8413, 8414, 8415
DNJC2 UniProtKB: Q99543 8416 8417 8418, 8419, 8420, 8421, 8422
DNJC3 UniProtKB: Q13217 8423 8424 8425, 8426, 8427, 8428, 8429
DNJC4 UniProtKB: Q9NNZ3 8430 8431 8432, 8433, 8434, 8435, 8436
DNJC5 UniProtKB: Q9H3Z4 8437 8438 8439, 8440, 8441, 8442, 8443
DNJC7 UniProtKB: Q99615 8444 8445 8446, 8447, 8448, 8449, 8450
DNJC8 UniProtKB: O75937 8451 8452 8453, 8454, 8455, 8456, 8457
DNJC9 UniProtKB: Q8WXX5 8458 8459 8460, 8461, 8462, 8463, 8464
Elk-1 UniProtKB: P19419 8465 8466 8467, 8468, 8469, 8470, 8471
Elk-1 UniProtKB: Q8N9S0 8472 8473 8474, 8475, 8476, 8477, 8478
ERK1 UniProtKB: P27361 8479 8480 8481, 8482, 8483, 8484, 8485
ERK2 UniProtKB: P28482 8486 8487 8488, 8489, 8490, 8491, 8492
Fibrinogen UniProtKB: A0A024R8B4 8493 8494 8495, 8496, 8497, 8498, 8499
Fibrinogen UniProtKB: A4D1B8 8500 8501 8502, 8503, 8504, 8505, 8506
Fibrinogen UniProtKB: A8K8X4 8507 8508 8509, 8510, 8511, 8512, 8513
Fibrinogen UniProtKB: B4DTN2 8514 8515 8516, 8517, 8518, 8519, 8520
Fibrinogen UniProtKB: B4E1D3 8521 8522 8523, 8524, 8525, 8526, 8527
Fibrinogen UniProtKB: D3DP13 8528 8529 8530, 8531, 8532, 8533, 8534
Fibrinogen UniProtKB: D3DP16 8535 8536 8537, 8538, 8539, 8540, 8541
Fibrinogen UniProtKB: D3DSP9 8542 8543 8544, 8545, 8546, 8547, 8548
Fibrinogen UniProtKB: P02671 8549 8550 8551, 8552, 8553, 8554, 8555
Fibrinogen UniProtKB: P02675 8556 8557 8558, 8559, 8560, 8561, 8562
Fibrinogen UniProtKB: P02679 8563 8564 8565, 8566, 8567, 8568, 8569
Fibrinogen UniProtKB: Q08830 8570 8571 8572, 8573, 8574, 8575, 8576
Fibrinogen UniProtKB: Q14314 8577 8578 8579, 8580, 8581, 8582, 8583
Fibrinogen UniProtKB: Q6UXM4 8584 8585 8586, 8587, 8588, 8589, 8590
Fibrinogen UniProtKB: Q9UE34 8591 8592 8593, 8594, 8595, 8596, 8597
FOS UniProtKB: A0A024RD16 8598 8599 8600, 8601, 8602, 8603, 8604
GSK3A UniProtKB: P49840 8605 8606 8607, 8608, 8609, 8610, 8611
GSK3B UniProtKB: P49841 8612 8613 8614, 8615, 8616, 8617, 8618
HSP10 UniProtKB: P61604 8619 8620 8621, 8622, 8623, 8624, 8625
HSP75 UniProtKB: Q12931 8626 8627 8628, 8629, 8630, 8631, 8632
HSP90B1 UniProtKB: Q5CAQ5 8633 8634 8635, 8636, 8637, 8638, 8639
IKK UniProtKB: 014920 8640 8641 8642, 8643, 8644, 8645, 8646
IKK UniProtKB: Q14164 8647 8648 8649, 8650, 8651, 8652, 8653
IKK UniProtKB: Q9Y6K9 8654 8655 8656, 8657, 8658, 8659, 8660
IL-1 UniProtKB: 043353 8661 8662 8663, 8664, 8665, 8666, 8667
IL-1 UniProtKB: Q8N9C1 8668 8669 8670, 8671, 8672, 8673, 8674
IL-1 UniProtKB: Q8WWZ1 8675 8676 8677, 8678, 8679, 8680, 8681
IL-1 UniProtKB: Q9NZH7 8682 8683 8684, 8685, 8686, 8687, 8688
IL-1 UniProtKB: Q9UBH0 8689 8690 8691, 8692, 8693, 8694, 8695
IL-1 UniProtKB: Q9UHA7 8696 8697 8698, 8699, 8700, 8701, 8702
IL-1R1 UniProtKB: P14778 8703 8704 8705, 8706, 8707, 8708, 8709
IL-1R1 UniProtKB: Q6NWP5 8710 8711 8712, 8713, 8714, 8715, 8716
IL-1R1 UniProtKB: Q6NWP6 8717 8718 8719, 8720, 8721, 8722, 8723
IRAK1 UniProtKB: L8E7M9 8724 8725 8726, 8727, 8728, 8729, 8730
IRAK1 UniProtKB: P51617 8731 8732 8733, 8734, 8735, 8736, 8737
IRAK2 UniProtKB: O43187 8738 8739 8740, 8741, 8742, 8743, 8744
IRAK4 UniProtKB: Q69FE3 8745 8746 8747, 8748, 8749, 8750, 8751
IRAK4 UniProtKB: Q7Z6A7 8752 8753 8754, 8755, 8756, 8757, 8758
IRAK4 UniProtKB: Q7Z6A8 8759 8760 8761, 8762, 8763, 8764, 8765
IRAK4 UniProtKB: Q9NWZ3 8766 8767 8768, 8769, 8770, 8771, 8772
IRF3 UniProtKB: A0A024QZE1 8773 8774 8775, 8776, 8777, 8778, 8779
IRF3 UniProtKB: E2GIM5 8780 8781 8782, 8783, 8784, 8785, 8786
IRF3 UniProtKB: E2GIM6 8787 8788 8789, 8790, 8791, 8792, 8793
IRF3 UniProtKB: E2GIM7 8794 8795 8796, 8797, 8798, 8799, 8800
IRF3 UniProtKB: E2GIM8 8801 8802 8803, 8804, 8805, 8806, 8807
IRF3 UniProtKB: E2GIM9 8808 8809 8810, 8811, 8812, 8813, 8814
IRF3 UniProtKB: Q14653 8815 8816 8817, 8818, 8819, 8820, 8821
IRF3 UniProtKB: Q96GL3 8822 8823 8824, 8825, 8826, 8827, 8828
IRF-7 UniProtKB: Q92985 8829 8830 8831, 8832, 8833, 8834, 8835
JNK UniProtKB: B4DU99 8836 8837 8838, 8839, 8840, 8841, 8842
KPCB UniProtKB: P05771-1 8843 8844 8845, 8846, 8847, 8848, 8849
KPCB UniProtKB: P05771-2 8850 8851 8852, 8853, 8854, 8855, 8856
KPCD1 UniProtKB: Q15139 8857 8858 8859, 8860, 8861, 8862, 8863
KPCD3 UniProtKB: O94806 8864 8865 8866, 8867, 8868, 8869, 8870
KPCD UniProtKB: Q05655 8871 8872 8873, 8874, 8875, 8876, 8877
KPCE UniProtKB: Q02156 8878 8879 8880, 8881, 8882, 8883, 8884
KPCG UniProtKB: P05129 8885 8886 8887, 8888, 8889, 8890, 8891
KPCI UniProtKB: P41743 8892 8893 8894, 8895, 8896, 8897, 8898
KPCL UniProtKB: P24723 8899 8900 8901, 8902, 8903, 8904, 8905
KPCT UniProtKB: Q04759 8906 8907 8908, 8909, 8910, 8911, 8912
KPCZ UniProtKB: Q05513 8913 8914 8915, 8916, 8917, 8918, 8919
LGP2 UniProtKB: A0A024R1Y5 8920 8921 8922, 8923, 8924, 8925, 8926
LGP2 UniProtKB: Q96C10 8927 8928 8929, 8930, 8931, 8932, 8933
I_IPAF UniProtKB: Q9NPP4 8934 8935 8936, 8937, 8938, 8939, 8940
MDA5 UniProtKB: Q9BYX4 8941 8942 8943, 8944, 8945, 8946, 8947
MK11 UniProtKB: Q15759 8948 8949 8950, 8951, 8952, 8953, 8954
MK12 UniProtKB: P53778 8955 8956 8957, 8958, 8959, 8960, 8961
MK13 UniProtKB: O15264 8962 8963 8964, 8965, 8966, 8967, 8968
MK14 UniProtKB: Q16539 8969 8970 8971, 8972, 8973, 8974, 8975
MKK1 UniProtKB: Q02750 8976 8977 8978, 8979, 8980, 8981, 8982
MKK3 UniProtKB: P46734 8983 8984 8985, 8986, 8987, 8988, 8989
MKK4 UniProtKB: P45985 8990 8991 8992, 8993, 8994, 8995, 8996
MKK6 UniProtKB: P52564 8997 8998 8999, 9000, 9001, 9002, 9003
MKK7 UniProtKB: 014733 9004 9005 9006, 9007, 9008, 9009, 9010
MSTP104 UniProtKB: Q7Z4D5 9011 9012 9013, 9014, 9015, 9016, 9017
MyD88 UniProtKB: Q99836 9018 9019 9020, 9021, 9022, 9023, 9024
NALP10 UniProtKB: Q86W26 9025 9026 9027, 9028, 9029, 9030, 9031
NALP11 UniProtKB: P59045 9032 9033 9034, 9035, 9036, 9037, 9038
NALP12 UniProtKB: P59046 9039 9040 9041, 9042, 9043, 9044, 9045
NALP13 UniProtKB: Q86W25 9046 9047 9048, 9049, 9050, 9051, 9052
NALP2 UniProtKB: Q8WY49 9053 9054 9055, 9056, 9057, 9058, 9059
NALP2 UniProtKB: Q9NX02 9060 9061 9062, 9063, 9064, 9065, 9066
NALP3 UniProtKB: Q96P20 9067 9068 9069, 9070, 9071, 9072, 9073
NALP4 UniProtKB: Q96MN2 9074 9075 9076, 9077, 9078, 9079, 9080
NALP5 UniProtKB: P59047 9081 9082 9083, 9084, 9085, 9086, 9087
NALP6 UniProtKB: P59044 9088 9089 9090, 9091, 9092, 9093, 9094
NALP7 UniProtKB: Q8WX94 9095 9096 9097, 9098, 9099, 9100, 9101
NALP8 UniProtKB: Q86W28 9102 9103 9104, 9105, 9106, 9107, 9108
NALP9 UniProtKB: Q7RTR0 9109 9110 9111, 9112, 9113, 9114, 9115
NF-kappaB UniProtKB: A3F768 9116 9117 9118, 9119, 9120, 9121, 9122
NF-kappaB UniProtKB: A3F769 9123 9124 9125, 9126, 9127, 9128, 9129
NLRP14 UniProtKB: Q86UT6 9130 9131 9132, 9133, 9134, 9135, 9136
NLRP14 UniProtKB: Q86W24 9137 9138 9139, 9140, 9141, 9142, 9143
NOD1 UniProtKB: G3XAL1 9144 9145 9146, 9147, 9148, 9149, 9150
NOD1 UniProtKB: Q9Y239 9151 9152 9153, 9154, 9155, 9156, 9157
NOD2 UniProtKB: Q9HC29 9158 9159 9160, 9161, 9162, 9163, 9164
NOD3 UniProtKB: C3VPR7 9165 9166 9167, 9168, 9169, 9170, 9171
NOD3 UniProtKB: H3BLT9 9172 9173 9174, 9175, 9176, 9177, 9178
NOD3 UniProtKB: Q7RTR2 9179 9180 9181, 9182, 9183, 9184, 9185
PI3K UniProtKB: O00329 9186 9187 9188, 9189, 9190, 9191, 9192
PI3K UniProtKB: O00459 9193 9194 9195, 9196, 9197, 9198, 9199
PI3K UniProtKB: P27986 9200 9201 9202, 9203, 9204, 9205, 9206
PI3K UniProtKB: P42336 9207 9208 9209, 9210, 9211, 9212, 9213
PI3K UniProtKB: P42338 9214 9215 9216, 9217, 9218, 9219, 9220
PI3K UniProtKB: P48736 9221 9222 9223, 9224, 9225, 9226, 9227
PI3K UniProtKB: Q5UE93 9228 9229 9230, 9231, 9232, 9233, 9234
PI3K UniProtKB: Q8NEB9 9235 9236 9237, 9238, 9239, 9240, 9241
PI3K UniProtKB: Q8WYR1 9242 9243 9244, 9245, 9246, 9247, 9248
PKD2 UniProtKB: Q13563 9249 9250 9251, 9252, 9253, 9254, 9255
PKN1 UniProtKB: Q16512 9256 9257 9258, 9259, 9260, 9261, 9262
PKN2 UniProtKB: Q16513 9263 9264 9265, 9266, 9267, 9268, 9269
PKN3 UniProtKB: Q6P5Z2 9270 9271 9272, 9273, 9274, 9275, 9276
PRKCA UniProtKB: P17252 9277 9278 9279, 9280, 9281, 9282, 9283
PRKD2 RefSeq: NP_001073349.1 9284 9285 9286, 9287, 9288, 9289, 9290
Rab UniProtKB: P52594 9291 9292 9293, 9294, 9295, 9296, 9297
Rac1 UniProtKB: A4D2P0 9298 9299 9300, 9301, 9302, 9303, 9304
Rac1 UniProtKB: A4D2P1 9305 9306 9307, 9308, 9309, 9310, 9311
Rac1 UniProtKB: A4D2P2 9312 9313 9314, 9315, 9316, 9317, 9318
Rac1 UniProtKB: P63000 9319 9320 9321, 9322, 9323, 9324, 9325
Rac1 UniProtKB: W0UV93 9326 9327 9328, 9329, 9330, 9331, 9332
RhoA UniProtKB: A0A024R324 9333 9334 9335, 9336, 9337, 9338, 9339
RhoA UniProtKB: P61586 9340 9341 9342, 9343, 9344, 9345, 9346
RIG-I UniProtKB: O95786 9347 9348 9349, 9350, 9351, 9352, 9353
RIG-I UniProtKB: Q8IUD6 9354 9355 9356, 9357, 9358, 9359, 9360
Src-Kinases UniProtKB: Q9H5V8 9361 9362 9363, 9364, 9365, 9366, 9367
Surfactant_protein_A UniProtKB: Q8IWL1 9368 9369 9370, 9371, 9372, 9373, 9374
Surfactant_protein_A UniProtKB: Q8IWL2 9375 9376 9377, 9378, 9379, 9380, 9381
Surfactant_protein_D UniProtKB: P35247 9382 9383 9384, 9385, 9386, 9387, 9388
TAK1 UniProtKB: O43318 9389 9390 9391, 9392, 9393, 9394, 9395
TAK1 UniProtKB: P49116 9396 9397 9398, 9399, 9400, 9401, 9402
TBK1 UniProtKB: Q9UHD2 9403 9404 9405, 9406, 9407, 9408, 9409
TICAM1 UniProtKB: Q8IUC6 9410 9411 9412, 9413, 9414, 9415, 9416
TICAM2 UniProtKB: Q86XR7 9417 9418 9419, 9420, 9421, 9422, 9423
TIRAP UniProtKB: A0A024R3M4 9424 9425 9426, 9427, 9428, 9429, 9430
TIRAP UniProtKB: P58753 9431 9432 9433, 9434, 9435, 9436, 9437
TLR10 UniProtKB: A0A024R9W4 9438 9439 9440, 9441, 9442, 9443, 9444
TLR10 UniProtKB: D1CS19 9445 9446 9447, 9448, 9449, 9450, 9451
TLR10 UniProtKB: D1CS20 9452 9453 9454, 9455, 9456, 9457, 9458
TLR10 UniProtKB: D1CS24 9459 9460 9461, 9462, 9463, 9464, 9465
TLR10 UniProtKB: D1CS26 9466 9467 9468, 9469, 9470, 9471, 9472
TLR10 UniProtKB: D1CS27 9473 9474 9475, 9476, 9477, 9478, 9479
TLR10 UniProtKB: D1CS28 9480 9481 9482, 9483, 9484, 9485, 9486
TLR10 UniProtKB: D1CS29 9487 9488 9489, 9490, 9491, 9492, 9493
TLR10 UniProtKB: D1CS30 9494 9495 9496, 9497, 9498, 9499, 9500
TLR10 UniProtKB: Q9BXR5 9501 9502 9503, 9504, 9505, 9506, 9507
TLR1 UniProtKB: D1CS34 9508 9509 9510, 9511, 9512, 9513, 9514
TLR1 UniProtKB: D1CS35 9515 9516 9517, 9518, 9519, 9520, 9521
TLR1 UniProtKB: D1CS36 9522 9523 9524, 9525, 9526, 9527, 9528
TLR1 UniProtKB: D1CS38 9529 9530 9531, 9532, 9533, 9534, 9535
TLR1 UniProtKB: D1CS42 9536 9537 9538, 9539, 9540, 9541, 9542
TLR1 UniProtKB: D1CS43 9543 9544 9545, 9546, 9547, 9548, 9549
TLR1 UniProtKB: D1CS44 9550 9551 9552, 9553, 9554, 9555, 9556
TLR1 UniProtKB: Q15399 9557 9558 9559, 9560, 9561, 9562, 9563
TLR1 UniProtKB: Q5FWG5 9564 9565 9566, 9567, 9568, 9569, 9570
TLR1 UniProtKB: Q6FI64 9571 9572 9573, 9574, 9575, 9576, 9577
TLR2 UniProtKB: 060603 9578 9579 9580, 9581, 9582, 9583, 9584
TLR3 UniProtKB: 015455 9585 9586 9587, 9588, 9589, 9590, 9591
TLR4 UniProtKB: D1CS55 9592 9593 9594, 9595, 9596, 9597, 9598
TLR4 UniProtKB: O00206 9599 9600 9601, 9602, 9603, 9604, 9605
TLR5 UniProtKB: D1CS79 9606 9607 9608, 9609, 9610, 9611, 9612
TLR5 UniProtKB: D1CS82 9613 9614 9615, 9616, 9617, 9618, 9619
TLR5 UniProtKB: D1CS83 9620 9621 9622, 9623, 9624, 9625, 9626
TLR5 UniProtKB: D1CS84 9627 9628 9629, 9630, 9631, 9632, 9633
TLR5 UniProtKB: D1CS85 9634 9635 9636, 9637, 9638, 9639, 9640
TLR5 UniProtKB: D1CS87 9641 9642 9643, 9644, 9645, 9646, 9647
TLR5 UniProtKB: D1CS88 9648 9649 9650, 9651, 9652, 9653, 9654
TLR5 UniProtKB: D1CS89 9655 9656 9657, 9658, 9659, 9660, 9661
TLR5 UniProtKB: D1CS90 9662 9663 9664, 9665, 9666, 9667, 9668
TLR6 UniProtKB: B6CH37 9669 9670 9671, 9672, 9673, 9674, 9675
TLR6 UniProtKB: B6CH42 9676 9677 9678, 9679, 9680, 9681, 9682
TLR6 UniProtKB: B6CH44 9683 9684 9685, 9686, 9687, 9688, 9689
TLR6 UniProtKB: B6CH45 9690 9691 9692, 9693, 9694, 9695, 9696
TLR6 UniProtKB: B6RFS7 9697 9698 9699, 9700, 9701, 9702, 9703
TLR6 UniProtKB: D1CS91 9704 9705 9706, 9707, 9708, 9709, 9710
TLR6 UniProtKB: D1CS92 9711 9712 9713, 9714, 9715, 9716, 9717
TLR6 UniProtKB: D1CS93 9718 9719 9720, 9721, 9722, 9723, 9724
TLR6 UniProtKB: D1CS96 9725 9726 9727, 9728, 9729, 9730, 9731
TLR6 UniProtKB: D1CS97 9732 9733 9734, 9735, 9736, 9737, 9738
TLR6 UniProtKB: D1CS98 9739 9740 9741, 9742, 9743, 9744, 9745
TLR6 UniProtKB: D1CS99 9746 9747 9748, 9749, 9750, 9751, 9752
TLR6 UniProtKB: D1CSA0 9753 9754 9755, 9756, 9757, 9758, 9759
TLR7 UniProtKB: B2R9N9 9760 9761 9762, 9763, 9764, 9765, 9766
TLR7 UniProtKB: D1CS68 9767 9768 9769, 9770, 9771, 9772, 9773
TLR7 UniProtKB: Q9NYK1 9774 9775 9776, 9777, 9778, 9779, 9780
TLR8 UniProtKB: Q495P6 9781 9782 9783, 9784, 9785, 9786, 9787
TLR8 UniProtKB: Q495P7 9788 9789 9790, 9791, 9792, 9793, 9794
TLR8 UniProtKB: Q9NR97 9795 9796 9797, 9798, 9799, 9800, 9801
TLR9 UniProtKB: B6CH46 9802 9803 9804, 9805, 9806, 9807, 9808
TLR9 UniProtKB: D1CS61 9809 9810 9811, 9812, 9813, 9814, 9815
TLR9 UniProtKB: D1CS62 9816 9817 9818, 9819, 9820, 9821, 9822
TLR9 UniProtKB: L0R5D6 9823 9824 9825, 9826, 9827, 9828, 9829
TLR9 UniProtKB: L8E8B9 9830 9831 9832, 9833, 9834, 9835, 9836
TLR9 UniProtKB: Q9NR96 9837 9838 9839, 9840, 9841, 9842, 9843
TRAF6 UniProtKB: Q9Y4K3 9844 9845 9846, 9847, 9848, 9849, 9850
c-myc UniProtKB: A0A0B4J1R1 9851 9852 9853, 9854, 9855, 9856, 9857, 9858
c-myc UniProtKB: P01106 9859 9860 9861, 9862, 9863, 9864, 9865, 9866
c-myc UniProtKB: Q14901 9867 9868 9869, 9870, 9871, 9872, 9873, 9874
c-myc UniProtKB: Q16591 9875 9876 9877, 9878, 9879, 9880, 9881, 9882


[0173] According to the present disclosure, in a more preferred embodiment, the composition disclosed herein comprises at least one RNA, preferably an mRNA, comprising at least one coding region encoding at least one innate immune activator or a fragment or variant thereof, wherein the at least one coding region comprises an RNA sequence being identical or at least 50%, 60%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to the RNA sequences according to the SEQ ID Nos as disclosed in Table 11.

13. Antibodies, decoy receptors and dominant negative receptors:



[0174] According to a preferred embodiment, the at least one RNA of the RNA containing composition disclosed herein encodes at least one antibody and/or at least one dominant negative receptor and/or at least one decoy receptor or a fragment or variant thereof, modulating (e.g. inhibiting) the functionality of a protein or signaling pathway, which is associated with tumor or cancer development. It is particularly preferred that the RNA containing composition comprises at least one RNA encoding the heavy chain of a particular antibody or fragments or variants thereof and at least one further RNA encoding the light chain of the same particular antibody or fragments or variants thereof.

[0175] In this context particularly preferred are the antibodies according to Table 12.
Table 12: Antibodies directed against proteins accociated with tumor or cancer development
NameTarget
3F8 GD2
Abagovomab CA-125 imitation
Abciximab Platelet glycoprotein GPIIb/IIIa
Adecatumumab EpCAM (CD326)
Afutuzumab CD20
Alacizumab pegol VEGFR2
Alemtuzumab CD52
Altumomab pentetate CEA
Amatuximab mesothelin
Anatumomab mafenatox 5T4
Anetumab ravtansine mesothelin
Apolizumab HLA-DR beta
apomab TRAIL-R2 (CD262)
Arcitumomab CEA
Ascrinvacumab ACVRL1
Bavituximab phosphatidylserine
Bectumomab CD22
Belimumab BAFF
Besilesomab CEA
Bevacizumab VEGF-A
Bivatuzumab mertansine CD44v6
Blinatumomab CD19 x CD3
Brentuximab vedotin CD30 (TNFRSF8)
Brontictuzumab NOTCH1
canakinumab IL-1β
Cantuzumab mertansine CanAg
Cantuzumab ravtansine MUC1 (CD227)
Capromab pendetide PSMA
Carlumab MCP-1
Catumaxomab EpCAM x CD3
cBR-doxorubicin immunoconjugate CD174 (Lewis Y)
Cetuximab EGFR (HER1/ERBB1)
Citatuzumab bogatox EpCAM
Cixutumumab IGF-1R
Clivatuzumab tetraxetan MUC1 (CD227)
Codrituzumab glypican 3
Coltuximab ravtansine CD19
Conatumumab TRAIL-R2 (CD262)
Dacetuzumab CD40
Dalotuzumab IGF-1R
Dalotuzumab insulin-like growth factor I receptor
Daratumumab CD38 (cyclic ADP ribose hydrolase)
Demcizumab DLL4
Denintuzumab mafodotin CD19
Denosumab RANKL
Depatuxizumab EGFR (HER1/ERBB1)
Derlotuximab histone complex
Detumomab unknown (B-lymphoma cells)
Dinutuximab B4GALNT1
Drozitumab TRAIL-R2 (CD262)
Duligotumab HER3 (ERBB3)
Duligotuzumab EGFR (HER1/ERBB1)
Dusigitumab ILGF2
Ecromeximab GD3 ganglioside
Edrecolomab EpCAM
Elgemtumab ERBB3
Elotuzumab SLAMF7 (CD319)
Elsilimomab IL-6
Emactuzumab CSF1R
Emibetuzumab HGFR
Emibetuzumab MET
Enavatuzumab TNFRSF12A
Enfortumab vedotin AGS-22M6
Enoticumab DLL4
Ensituximab MUC5AC
Epitumomab cituxetan MUC1 (CD227)
Epratuzumab CD22
Ertumaxomab HER2 (ERBB2/neu) x CD3
Etaracizumab integrin α5β3
Faralimomab IFNA1
Farletuzumab FOLR1 alpha
FBTA CD20 x CD3
Ficlatuzumab HGFR
Figitumumab IGF-1R
Flanvotumab TYRP1(glycoprotein 75)
Fresolimumab TGF-β
Futuximab EGFR (HER1/ERBB1)
Galiximab CD80
Gantiumab IGF-1R
Gemtuzumab ozogamicin CD33
Girentuximab Carbonic anhydrase 9 (CA9/CAIX)
Glembatumumab vedotin GPNMB
glycooptimized trastuzumab-GEX HER2 (ERBB2/neu)
Ibritumomab tiuxetan CD20
Icrucumab VEGFR-1
Igovomab MUC16
IMAB362 Claudin-18 (CLDN18.2)
Imgatuzumab EGFR (HER1/ERBB1)
Indatuximab ravtansine SDC1
Indusatumab vedotin GUCY2C
inebilizumab CD19
Inotuzumab ozogamicin CD22
Intetumumab CD51
Iratumumab CD30 (TNFRSF8)
Isatuximab CD38
Labetuzumab CEA
Lenzilumab CSF2
Lexatumumab TRAIL-R2 (CD262)
Lifastuzumab vedotin NaPi2B
Lilotomab satetraxetan CD37
Lintuzumab CD33
Lorvotuzumab mertansine CD56
Lucatumumab CD40
Lumiliximab CD23 (IgE receptor)
Lumretuzumab ERBB3
Mapatumumab TRAIL-R1 (CD261)
Margetuximab HER2 (ERBB2/neu)
Matuzumab EGFR (HER1/ERBB1)
Mepolizumab IL-5
Milatuzumab CD74
Minretumomab TAG-72
Mirvetuximab soravtansine FOLR1 alpha
Mitumomab GD3 (ganglioside)
Mogamulizumab CCR4
Moxetumomab pasudotox CD22
Nacolomab tafenatox C242 antigen
Naptumomab estafenatox 5T4
Narnatumab RON
Necitumumab EGFR (HER1/ERBB1)
Nesvacumab ANGPT2 (angiopoietin 2)
Nimotuzumab EGFR (HER1/ERBB1)
Nofetumomab merpentan EpCAM
binutuzumab CD20
Ocaratuzumab CD20
Ofatumumab CD20
Olaratumab PDGFRα
Onartuzumab MET
Ontuxizumab CD248 (TEM1)
Oportuzumab monatox EpCAM
Oregovomab CA-125
Otlertuzumab CD37
Panitumumab EGFR (HER1/ERBB1)
Pankomab MUC1 (tumor specific glycosylation)
Parsatuzumab EGFL7
Pasotuxizumab FOLH1
Patritumab HER3 (ERBB3)
Pemtumomab MUC1 (CD227)
Pertuzumab HER2 (ERBB2/neu)
Pinatuzumab vedotin CD22
Pintumomab adenocarcinoma antigen
Polatuzumab vedotin CD79B
Racotumomab NGcGM3
Radretumab EDB (fibronectin extra domain-B)
Ramucirumab VEGFR2
Rilotumumab HGFR
Rituximab CD20
Robatumumab IGF-1R
Sacituzumab govitecan Trop-2 (tumor-associated calcium signal transducer 2/EGP-1)
Samalizumab CD200 (OX-2 membrane glycoprotein)
Satumomab pendetide TAG-72
Seribantumab ERBB3
Seribantumab HER3 (ERBB3)
SGN-CDA CD19
SGN-CDA CD33
Sibrotuzumab FAP
Siltuximab IL-6
Simtuzumab LOXL2
Sofituzumab vedotin CA 125
Solitomab EpCAM
Sonepcizumab S1P (sphingosine-1-phosphate)
Tacatuzumab tetraxetan AFP (alpha-fetoprotein)
Taplitumomab paptox CD19
Tarextumab Notch receptor
Tenatumomab TN-C (tenascin C)
Teprotumumab CD221
Tetulomab CD37
TGN CD28
Tigatuzumab TRAIL-R2 (CD262)
Lebrikizumab IL-13
Tocilizumab IL-6R
Tositumomab CD20
Tovetumab CD140a
Tovetumab PDGFRα
Trastuzumab HER2 (ERBB2/neu)
Trastuzumab emtansine HER2 (ERBB2/neu)
TRBS GD2
Tucotuzumab celmoleukin EpCAM
ublituximab CD20
Ublituximab MS4A1
Ulocuplumab CXCR4
Vandortuzumab vedotin STEAP1
Vantictumab FZD7
Vanucizumab Ang-2 (angiopoietin 2) x VEGF-A
Veltuzumab CD20
Vesencumab NRP1
Volociximab integrin α5β1
Votumumab CTAA16.88
Zalutumumab EGFR (HER1/ERBB1)
Zanolimumab CD4
Zatuximab HER1 (EGFR/ERBB1)


[0176] Preferably, the neutralizing antibody is chosen from the list of anti-IL-10 and anti-TGFbeta. Furthermore, the at least one antibody may preferably chosen from anti-CD73 antibodies or fragments or variants thereof.

[0177] In a further particularly preferred embodiment the at least one antibody is chosen from an antibody directed against CCR5/CD195 or from an antibody directed against its ligand CCL5/RANTES.

[0178] In a particularly preferred embodiment the decoy receptor is a soluble CCR5 (chemokine receptor type 5, also known as CD195).

[0179] In a further particularly preferred embodiment the dominant negative receptor is dominant negative CCR5 (chemokine receptor type 5, also known as CD195).

[0180] Furthermore, the at least one antibody may preferably chosen from anti-CD73 antibodies or fragments or variants thereof.

14. Inhibitors of myeloid derived suppressor cells (MDSCs):



[0181] Myeloid Derived Suppressor Cells (MDSC) are a heterogeneous population of immature myeloid cells that are increased in cancer and related disorders. MDSC are induced by tumor secreted growth factors. MDSC play an important part in suppression of host immune responses through several mechanisms. In addition, MDSC may also contribute to angiogenesis and tumor invasion. Therefore, MDSC inhibition is a strategy for the treatment of cancer and related disorders.

[0182] In the context of the present disclosure, MDSC inhibition can be achieved by direct deactivation of MDSCs (e.g., anti IL-17 antibodies), by blocking differentiation of MDSCs into mature cells (e.g., IL-12), by blocking the cell development of MDSCs or by depletion of MDSCs (e.g., cytotoxic agents). Therefore it is particularly preferred to use anti IL-17 antibodies and IL-12 as inhibitors of MDSCs.

15. IDO pathway inhibitors



[0183] In a further preferred embodiment of the RNA containing composition disclosed herein, the RNA, preferably mRNA, codes for at least one IDO pathway inhibitor. Preferably the RNA encoding the at least one IDO pathway inhibitor encodes an inhibitory protein or dominant negative mutant protein of the IDO pathway.

[0184] As reviewed in Prendergast et al. (Prendergast GC, Smith C, Thomas S, Mandik-Nayak L, Laury-Kleintop L, Metz R, Muller AJ. Indoleamine 2,3-dioxygenase pathways of pathogenic inflammation and immune escape in cancer. Cancer Immunol. Immunother. 2014 Jul;63(7):721-35) indoleamine-pyrrole 2,3-dioxygenase (IDO or INDO EC 1.13.11.52) is an enzyme that in humans is encoded by the IDO1 gene. This enzyme catalyzes the degradation of the essential amino acid L-tryptophan to N-formylkynurenine. IDO is the first and rate-limiting enzyme of tryptophan catabolism through kynurenine pathway, thus causing depletion of tryptophan which can cause halted growth of microbes as well as T cells. IDO is an immunomodulatory enzyme produced by some alternatively activated macrophages and other immunoregulatory cells (also used as an immune subversion strategy by many tumors). The clinical development of IDO inhibitors may produce a novel class of immunomodulators with broad application in the treatment of advanced human cancer.

16. Proteins or peptides that bind inhibitors of apoptosis



[0185] Apoptosis is a tightly regulated cellular process and faulty regulation of apoptosis is a hallmark of human cancers. Targeting key apoptosis regulators with the goal to restore apoptosis in tumor cells has been pursued as a new cancer therapeutic strategy. XIAP, cIAP1, and cIAP2, members of inhibitor of apoptosis (IAP) proteins, are critical regulators of cell death and survival and are attractive targets for new cancer therapy. The SMAC/DIABLO protein is an endogenous antagonist of XIAP, cIAP1, and cIAP2. In the last decade, intense research efforts have resulted in the design and development of several small-molecule SMAC mimetics now in clinical trials for cancer treatment.

[0186] In a further preferred embodiment, the composition disclosed herein comprises at least one RNA comprising at least one coding region that codes for at least one peptide or protein that binds inhibitors of apoptosis proteins (IAPs) and thus sensitize cancer cells to apoptotic death.

[0187] Therefore it is particularly preferred that the at least one RNA of the RNA containing composition disclosed herein encodes at least one protein or peptide that bind inhibitors of apoptosis, such as SMAC mimetics.

[0188] Particularly preferred proteins or peptides that bind IAPs according to the present present disclosure comprise Omi/HtrA2, Smac, Smac derived peptides, Smac/DIABLO, and XAF1 (XIAP-associated factor 1) and fragments or variants thereof.

RNA modifications



[0189] According to one embodiment, the at least one RNA of the composition, encoding at least one of the proteins and/or peptides defined herein, may be in the form of a modified RNA, wherein any modification, as defined herein, may be introduced into the at least one RNA of the composition. Modifications as defined herein preferably lead to a stabilization of the at least one RNA of the composition disclosed herein.

[0190] According to one embodiment, the at least one RNA of the composition disclosed herein may thus be provided as a "stabilized RNA", that is to say as an RNA that is essentially resistant to in vivo degradation (e.g. by an exo- or endo-nuclease). Such stabilization can be effected, for example, by a modified phosphate backbone of the at least one RNA of the composition disclosed herein. A backbone modification in connection with the present disclosure is a modification, in which phosphates of the backbone of the nucleotides contained in the RNA are chemically modified. Nucleotides that may be preferably used in this connection contain e.g. a phosphorothioate-modified phosphate backbone, preferably at least one of the phosphate oxygens contained in the phosphate backbone being replaced by a sulfur atom. Stabilized RNAs may further include, for example: nonionic phosphate analogues, such as, for example, alkyl and aryl phosphonates, in which the charged phosphonate oxygen is replaced by an alkyl or aryl group, or phosphodiesters and alkylphosphotriesters, in which the charged oxygen residue is present in alkylated form. Such backbone modifications typically include, without implying any limitation, modifications from the group consisting of methylphosphonates, phosphoramidates and phosphorothioates (e.g. cytidine-5'-O-(1-thiophosphate)).

[0191] In the following, specific modifications are described, which are preferably capable of "stabilizing" the at least one RNA as defined herein.

Chemical modifications:



[0192] The term "RNA modification" as used herein may refer to chemical modifications comprising backbone modifications as well as sugar modifications or base modifications.

[0193] In this context, a modified RNA as defined herein may contain nucleotide analogues/modifications, e.g. backbone modifications, sugar modifications or base modifications. A backbone modification in connection with the present disclosure is a modification, in which phosphates of the backbone of the nucleotides contained in an RNA as defined herein are chemically modified. A sugar modification in connection with the present disclosure is a chemical modification of the sugar of the nucleotides of the RNA as defined herein. Furthermore, a base modification in connection with the present disclosure is a chemical modification of the base moiety of the nucleotides of the RNA. In this context, nucleotide analogues or modifications are preferably selected from nucleotide analogues, which are applicable for transcription and/or translation.

Sugar Modifications:



[0194] The modified nucleosides and nucleotides, which may be incorporated into a modified RNA as described herein, can be modified in the sugar moiety. For example, the 2' hydroxyl group (OH) can be modified or replaced with a number of different "oxy" or "deoxy" substituents. Examples of "oxy" -2' hydroxyl group modifications include, but are not limited to, alkoxy or aryloxy (-OR, e.g., R = H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or sugar); polyethyleneglycols (PEG), - O(CH2CH2O)nCH2CH2OR; "locked" nucleic acids (LNA) in which the 2' hydroxyl is connected, e.g., by a methylene bridge, to the 4' carbon of the same ribose sugar; and amino groups (-O-amino, wherein the amino group, e.g., NRR, can be alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroaryl amino, ethylene diamine, polyamino) or aminoalkoxy.

[0195] "Deoxy" modifications include hydrogen, amino (e.g. NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diaryl amino, heteroaryl amino, diheteroaryl amino, or amino acid); or the amino group can be attached to the sugar through a linker, wherein the linker comprises one or more of the atoms C, N, and O.

[0196] The sugar group can also contain one or more carbons that possess the opposite stereochemical configuration than that of the corresponding carbon in ribose. Thus, a modified RNA can include nucleotides containing, for instance, arabinose as the sugar.

Backbone Modifications:



[0197] The phosphate backbone may further be modified in the modified nucleosides and nucleotides, which may be incorporated into a modified RNA as described herein. The phosphate groups of the backbone can be modified by replacing one or more of the oxygen atoms with a different substituent. Further, the modified nucleosides and nucleotides can include the full replacement of an unmodified phosphate moiety with a modified phosphate as described herein. Examples of modified phosphate groups include, but are not limited to, phosphorothioate, phosphoroselenates, borano phosphates, borano phosphate esters, hydrogen phosphonates, phosphoroamidates, alkyl or aryl phosphonates and phosphotriesters. Phosphorodithioates have both non-linking oxygens replaced by sulfur. The phosphate linker can also be modified by the replacement of a linking oxygen with nitrogen (bridged phosphoroamidates), sulfur (bridged phosphorothioates) and carbon (bridged methylene-phosphonates).

Base Modifications:



[0198] The modified nucleosides and nucleotides, which may be incorporated into a modified RNA as described herein can further be modified in the nucleobase moiety. Examples of nucleobases found in RNA include, but are not limited to, adenine, guanine, cytosine and uracil. For example, the nucleosides and nucleotides described herein can be chemically modified on the major groove face. In some embodiments, the major groove chemical modifications can include an amino group, a thiol group, an alkyl group, or a halo group.

[0199] In particularly preferred embodiments disclosed herein, the nucleotide analogues/modifications are selected from base modifications, which are preferably selected from 2-amino-6-chloropurineriboside-5'-triphosphate, 2-Aminopurine-riboside-5'-triphosphate; 2-aminoadenosine-5'-triphosphate, 2'-Amino-2'-deoxycytidine-triphosphate, 2-thiocytidine-5'-triphosphate, 2-thiouridine-5'-triphosphate, 2'-Fluorothymidine-5'-triphosphate, 2'-O-Methyl inosine-5'-triphosphate 4-thiouridine-5'-triphosphate, 5-aminoallylcytidine-5'-triphosphate, 5-aminoallyluridine-5'-triphosphate, 5-bromocytidine-5'-triphosphate, 5-bromouridine-5'-triphosphate, 5-Bromo-2'-deoxycytidine-5'-triphosphate, 5-Bromo-2'-deoxyuridine-5'-triphosphate, 5-iodocytidine-5'-triphosphate, 5-lodo-2'-deoxycytidine-5'-triphosphate, 5-iodouridine-5'-triphosphate, 5-Iodo-2'-deoxyuridine-5'-triphosphate, 5-methylcytidine-5'-triphosphate, 5-methyluridine-5'-triphosphate, 5-Propynyl-2'-deoxycytidine-5'-triphosphate, 5-Propynyl-2'-deoxyuridine-5'-triphosphate, 6-azacytidine-5'-triphosphate, 6-azauridine-5'-triphosphate, 6-chloropurineriboside-5'-triphosphate, 7-deazaadenosine-5'-triphosphate, 7-deazaguanosine-5'-triphosphate, 8-azaadenosine-5'-triphosphate, 8-azidoadenosine-5'-triphosphate, benzimidazole-riboside-5'-triphosphate, N1-methyladenosine-5'-triphosphate, N1-methylguanosine-5'-triphosphate, N6-methyladenosine-5'-triphosphate, O6-methylguanosine-5'-triphosphate, pseudouridine-5'-triphosphate, or puromycin-5'-triphosphate, xanthosine-5'-triphosphate. Particular preference is given to nucleotides for base modifications selected from the group of base-modified nucleotides consisting of 5-methylcytidine-5'-triphosphate, 7-deazaguanosine-5'-triphosphate, 5-bromocytidine-5'-triphosphate, and pseudouridine-5'-triphosphate.

[0200] In some embodiments, modified nucleosides include pyridin-4-one ribonucleoside, 5-aza-uridine, 2-thio-5-aza-uridine, 2-thiouridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinomethyluridine, 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine, 1-taurinomethyl-4-thio-uridine, 5-methyl-uridine, 1-methyl-pseudouridine, 4-thio-1-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl- 1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, and 4-methoxy-2-thio-pseudouridine.

[0201] In some embodiments, modified nucleosides include 5-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio- 1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, and 4-methoxy-1-methyl-pseudoisocytidine.

[0202] In other embodiments, modified nucleosides include 2-aminopurine, 2, 6-diaminopurine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyladenosine, N6-methyladenosine, N6-isopentenyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl) adenosine, N6-glycinylcarbamoyladenosine, N6-threonylcarbamoyladenosine, 2-methylthio-N6-threonyl carbamoyladenosine, N6,N6-dimethyladenosine, 7-methyladenine, 2-methylthio-adenine, and 2-methoxy-adenine.

[0203] In other embodiments, modified nucleosides include inosine, 1-methyl-inosine, wyosine, wybutosine, 7-deaza-guanosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1-methylguanosine, N2-methylguanosine, N2,N2-dimethylguanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, and N2,N2-dimethyl-6-thio-guanosine.

[0204] In some embodiments, the nucleotide can be modified on the major groove face and can include replacing hydrogen on C-5 of uracil with a methyl group or a halo group.

[0205] In specific embodiments, a modified nucleoside is 5'-O-(1-thiophosphate)-adenosine, 5'-O-(1-thiophosphate)-cytidine, 5'-O-(1-thiophosphate)-guanosine, 5'-O-(1-thiophosphate)-uridine or 5'-O-(1-thiophosphate)-pseudouridine.

[0206] In further specific embodiments, a modified RNA may comprise nucleoside modifications selected from 6-aza-cytidine, 2-thio-cytidine, α-thio-cytidine, Pseudo-iso-cytidine, 5-aminoallyl-uridine, 5-iodo-uridine, N1-methyl-pseudouridine, 5,6-dihydrouridine, α-thio-uridine, 4-thio-uridine, 6-aza-uridine, 5-hydroxy-uridine, deoxy-thymidine, 5-methyl-uridine, Pyrrolo-cytidine, inosine, α-thio-guanosine, 6-methyl-guanosine, 5-methyl-cytdine, 8-oxo-guanosine, 7-deaza-guanosine, N1-methyladenosine, 2-amino-6-Chloro-purine, N6-methyl-2-amino-purine, Pseudo-iso-cytidine, 6-Chloropurine, N6-methyl-adenosine, α-thio-adenosine, 8-azido-adenosine, 7-deaza-adenosine.

Lipid modification:



[0207] According to a further embodiment, a modified RNA as defined herein can contain a lipid modification. Such a lipid-modified RNA typically comprises an RNA as defined herein. Such a lipid-modified RNA as defined herein typically further comprises at least one linker covalently linked with that RNA, and at least one lipid covalently linked with the respective linker. Alternatively, the lipid-modified RNA comprises at least one RNA as defined herein and at least one (bifunctional) lipid covalently linked (without a linker) with that RNA. According to a third alternative, the lipid-modified RNA comprises an RNA molecule as defined herein, at least one linker covalently linked with that RNA, and at least one lipid covalently linked with the respective linker, and also at least one (bifunctional) lipid covalently linked (without a linker) with that RNA. In this context, it is particularly preferred that the lipid modification is present at the terminal ends of a linear RNA sequence.

G/C content optimization:



[0208] According to an especially preferred embodiment, the RNA of the composition disclosed herein is modified. Preferably the RNA is stabilized by modifying and preferably increasing the G (guanosine)/C (cytosine) content of the RNA of the coding region thereof. Therein, the G/C content of the RNA of the coding region is increased compared to the G/C content of the coding region of its particular wild type coding sequence, i.e. the unmodified RNA. However, the encoded amino acid sequence of the RNA is preferably not modified compared to the encoded amino acid sequence of the particular wild type/unmodified RNA.

[0209] The modification of the G/C-content of the RNA of the composition disclosed herein is based on the fact that RNA sequences having an increased G (guanosine)/C (cytosine) content are more stable than RNA sequences having an increased A (adenosine)/U (uracil) content. The codons of a coding sequence or a whole RNA might therefore be varied compared to the wild type coding sequence or RNA, such that they include an increased amount of G/C nucleotides while the translated amino acid sequence is retained. In respect to the fact that several codons code for one and the same amino acid (so-called degeneration of the genetic code), the most favourable codons for the stability can be determined (so-called alternative codon usage). Depending on the amino acid to be encoded by the at least one RNA, there are various possibilities for modification of the RNA sequence, compared to its wild-type sequence. In the case of amino acids which are encoded by codons, which contain exclusively G or C nucleotides, no modification of the codon is necessary. Thus, the codons for Pro (CCC or CCG), Arg (CGC or CGG), Ala (GCC or GCG) and Gly (GGC or GGG) require no modification, since no A or U is present. In contrast, codons which contain A and/or U nucleotides can be modified by substitution of other codons, which code for the same amino acids but contain no A and/or U. Examples of these are: the codons for Pro can be modified from CCU or CCA to CCC or CCG; the codons for Arg can be modified from CGU or CGA or AGA or AGG to CGC or CGG; the codons for Ala can be modified from GCU or GCA to GCC or GCG; the codons for Gly can be modified from GGU or GGA to GGC or GGG. In other cases, although A or U nucleotides cannot be eliminated from the codons, it is however possible to decrease the A and U content by using codons which contain a lower content of A and/or U nucleotides. Examples of these are: the codons for Phe can be modified from UUU to UUC; the codons for Leu can be modified from UUA, UUG, CUU or CUA to CUC or CUG; the codons for Ser can be modified from UCU or UCA or AGU to UCC, UCG or AGC; the codon for Tyr can be modified from UAU to UAC; the codon for Cys can be modified from UGU to UGC; the codon for His can be modified from CAU to CAC; the codon for Gln can be modified from CAA to CAG; the codons for lie can be modified from AUU or AUA to AUC; the codons for Thr can be modified from ACU or ACA to ACC or ACG; the codon for Asn can be modified from AAU to AAC; the codon for Lys can be modified from AAA to AAG; the codons for Val can be modified from GUU or GUA to GUC or GUG; the codon for Asp can be modified from GAU to GAC; the codon for Glu can be modified from GAA to GAG; the stop codon UAA can be modified to UAG or UGA. In the case of the codons for Met (AUG) and Trp (UGG), on the other hand, there is no possibility of sequence modification. The substitutions listed above can be used either individually or in all possible combinations to increase the G/C content of the at least one mRNA of the composition disclosed herein compared to its particular wild-type mRNA (i.e. the original sequence). Thus, for example, all codons for Thr occurring in the wild-type sequence can be modified to ACC (or ACG). Preferably, however, for example, combinations of the above substitution possibilities are used:

substitution of all codons coding for Thr in the original sequence (wild-type mRNA) to ACC (or ACG) and

substitution of all codons originally coding for Ser to UCC (or UCG or AGC); substitution of all codons coding for lie in the original sequence to AUC and

substitution of all codons originally coding for Lys to AAG and

substitution of all codons originally coding for Tyr to UAC; substitution of all codons coding for Val in the original sequence to GUC (or GUG) and

substitution of all codons originally coding for Glu to GAG and

substitution of all codons originally coding for Ala to GCC (or GCG) and

substitution of all codons originally coding for Arg to CGC (or CGG); substitution of all codons coding for Val in the original sequence to GUC (or GUG) and

substitution of all codons originally coding for Glu to GAG and

substitution of all codons originally coding for Ala to GCC (or GCG) and

substitution of all codons originally coding for Gly to GGC (or GGG) and

substitution of all codons originally coding for Asn to AAC; substitution of all codons coding for Val in the original sequence to GUC (or GUG) and

substitution of all codons originally coding for Phe to UUC and

substitution of all codons originally coding for Cys to UGC and

substitution of all codons originally coding for Leu to CUG (or CUC) and

substitution of all codons originally coding for Gln to CAG and

substitution of all codons originally coding for Pro to CCC (or CCG); etc.



[0210] Preferably, the G/C content of the coding region of the at least one RNA described herein is increased by at least 7%, more preferably by at least 15%, particularly preferably by at least 20%, compared to the G/C content of the coding region of the wild type RNA. According to a specific embodiment at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, more preferably at least 70 %, even more preferably at least 80% and most preferably at least 90%, 95% or even 100% of the substitutable codons in the region coding for a protein or peptide as defined herein or its fragment or variant thereof or the whole sequence of the wild type RNA sequence or coding sequence are substituted, thereby increasing the G/C content of said sequence. In this context, it is particularly preferable to increase the G/C content of the at least one RNA of the composition disclosed herein to the maximum (i.e. 100% of the substitutable codons), in particular in the coding region, compared to the wild type sequence.

[0211] A further preferred modification of the coding sequence of the at least one RNA of the composition is based on the finding that the translation efficiency is also determined by a different frequency in the occurrence of tRNAs in cells. Thus, if so-called "rare codons" are present in the at least one coding region of the at least one RNA of the composition disclosed herein to an increased extent, the corresponding modified at least one RNA sequence is translated to a significantly poorer degree than in the case where codons coding for relatively "frequent" tRNAs are present. In the modified at least one RNA of the composition disclosed herein, the region which codes for one of the above defined peptides or proteins is modified compared to the corresponding region of the wild-type RNA such that at least one codon of the wild-type sequence, which codes for a tRNA which is relatively rare in the cell, is exchanged for a codon, which codes for a tRNA which is relatively frequent in the cell and carries the same amino acid as the relatively rare tRNA. By this modification, the sequence of the at least one coding region of the at least one RNA of the composition disclosed herein is modified such that codons for which frequently occurring tRNAs are available are inserted. In other words, by this modification all codons of the wild-type sequence which code for a tRNA which is relatively rare in the cell can in each case be exchanged for a codon which codes for a tRNA which is relatively frequent in the cell and which, in each case, carries the same amino acid as the relatively rare tRNA. Which tRNAs occur relatively frequently in the cell and which, in contrast, occur relatively rarely is known to a person skilled in the art; cf. e.g. Akashi, Curr. Opin. Genet. Dev. 2001, 11(6): 660-666. The codons which use for the particular amino acid the tRNA which occurs the most frequently, e.g. the Gly codon, which uses the tRNA, which occurs the most frequently in the (human) cell, are particularly preferred. It is particularly preferable to link the sequential G/C content which is increased, in particular maximized, in the modified at least one RNA of the composition disclosed herein, with the "frequent" codons without modifying the amino acid sequence of the protein encoded by the coding region of the RNA. This preferred embodiment allows provision of a particularly efficiently translated and stabilized (modified) at least one RNA of the composition disclosed herein. The determination of a modified at least one RNA of the composition as described above (increased G/C content; exchange of tRNAs) can be carried out using the computer program explained in WO 02/098443. Using this computer program, the nucleotide sequence of any desired coding RNA can be modified with the aid of the genetic code or the degenerative nature thereof such that a maximum G/C content results, in combination with the use of codons which code for tRNAs occurring as frequently as possible in the cell, the amino acid sequence coded by the modified at least one RNA preferably not being modified compared to the non-modified sequence. Alternatively, it is also possible to modify only the G/C content or only the codon usage compared to the original sequence. The source code in Visual Basic 6.0 (development environment used: Microsoft Visual Studio Enterprise 6.0 with Servicepack 3) is also described in WO 02/098443. In a further preferred embodiment, the A/U content in the environment of the ribosome binding site of the at least one RNA of the composition disclosed herein is increased compared to the A/U content in the environment of the ribosome binding site of its particular wild-type RNA. This modification (an increased A/U content around the ribosome binding site) increases the efficiency of ribosome binding to the at least one RNA. An effective binding of the ribosomes to the ribosome binding site (Kozak sequence: GCCGCCACCAUGG (SEQ ID NO: 10.071), the AUG forms the start codon) in turn has the effect of an efficient translation of the at least one RNA. According to a further embodiment, the at least one RNA of the composition disclosed herein may be modified with respect to potentially destabilizing sequence elements. Particularly, the coding region and/or the 5' and/or 3' untranslated region of this RNA may be modified compared to the particular wild-type RNA such that it contains no destabilizing sequence elements, the coded amino acid sequence of the modified at least one RNA preferably not being modified compared to its particular wild-type RNA. It is known that, for example, in sequences of eukaryotic RNAs destabilizing sequence elements (DSE) occur, to which signal proteins bind and regulate enzymatic degradation of RNA in vivo. For further stabilization of the modified at least one RNA, optionally in the region which encodes for a protein or peptide as defined herein, one or more such modifications compared to the corresponding region of the wild-type RNA can therefore be carried out, so that no or substantially no destabilizing sequence elements are contained there. According to the present disclosure, DSE present in the untranslated regions (3'- and/or 5'-UTR) can also be eliminated from the at least one RNA of the composition disclosed herein by such modifications. Such destabilizing sequences are e.g. AU-rich sequences (AURES), which occur in 3'-UTR sections of numerous unstable RNAs (Caput et al., Proc. Natl. Acad. Sci. USA 1986, 83: 1670 to 1674). The at least one RNA of the composition disclosed herein is therefore preferably modified compared to the wild-type RNA such that the at least one RNA contains no such destabilizing sequences. This also applies to those sequence motifs which are recognized by possible endonucleases, e.g. the sequence GAACAAG, which is contained in the 3'-UTR segment of the gene which codes for the transferrin receptor (Binder et al., EMBO J. 1994, 13: 1969 to 1980). These sequence motifs are also preferably removed in the at least one RNA of the composition disclosed herein.

Adaptation to human codon usage:



[0212] A further preferred modification of the at least one RNA of the composition disclosed herein is based on the finding that codons coding for the same amino acid occur in different frequencies. In the modified at least one RNA of the composition disclosed herein, the region which codes for one of the above defined peptides or proteins (coding sequence) is preferably modified compared to the corresponding region of the wild-type RNA such that the frequency of the codons coding for the same amino acid corresponds to the naturally occurring frequency of that codon present in the human coding usage as e.g. shown in Table 13.

[0213] This means, for example, that for the amino acid Alanine (Ala) present in the amino acid sequence of the encoded protein, the wild type coding sequence is adapted in a way that the codon "GCC" is used with a frequency of 0.40, the codon "GCT" is used with a frequency of 0.28, the codon "GCA" is used with a frequency of 0.22 and the codon "GCG" is used with a frequency of 0.10 etc. (see Table 13).
Table 13: Human codon usage table (most frequent codon marked with an asterisk)
Amino acidcodonfraction/1000
Ala GCG 0.10 7.4
Ala GCA 0.22 15.8
Ala GCT 0.28 18.5
Ala GCC* 0.40 27.7
Cys TGT 0.42 10.6
Cys TGC* 0.58 12.6
Asp GAT 0.44 21.8
Asp GAC* 0.56 25.1
Glu GAG* 0.59 39.6
Glu GAA 0.41 29.0
Phe TTT 0.43 17.6
Phe TTC* 0.57 20.3
Gly GGG 0.23 16.5
Gly GGA 0.26 16.5
Gly GGT 0.18 10.8
Gly GGC* 0.33 22.2
His CAT 0.41 10.9
His CAC* 0.59 15.1
Ile ATA 0.14 7.5
Ile ATT 0.35 16.0
Ile ATC* 0.52 20.8
Lys AAG* 0.60 31.9
Lys AAA 0.40 24.4
Leu TTG 0.12 12.9
Leu TTA 0.06 7.7
Leu CTG* 0.43 39.6
Leu CTA 0.07 7.2
Leu CTT 0.12 13.2
Leu CTC 0.20 19.6
Met ATG* 1 22.0
Asn AAT 0.44 17.0
Asn AAC* 0.56 19.1
Pro CCG 0.11 6.9
Pro CCA 0.27 16.9
Pro CCT 0.29 17.5
Pro CCC* 0.33 19.8
Gln CAG* 0.73 34.2
Gln CAA 0.27 12.3
Arg AGG 0.22 12.0
Arg AGA* 0.21 12.1
Arg CGG 0.19 11.4
Arg CGA 0.10 6.2
Arg CGT 0.09 4.5
Arg CGC 0.19 10.4
Ser AGT 0.14 12.1
Ser AGC* 0.25 19.5
Ser TCG 0.06 4.4
Ser TCA 0.15 12.2
Ser TCT 0.18 15.2
Ser TCC 0.23 17.7
Thr ACG 0.12 6.1
Thr ACA 0.27 15.1
Thr ACT 0.23 13.1
Thr ACC* 0.38 18.9
Val GTG* 0.48 28.1
Val GTA 0.10 7.1
Val GTT 0.17 11.0
Val GTC 0.25 14.5
Trp TGG* 1 13.2
Tyr TAT 0.42 12.2
Tyr TAC* 0.58 15.3
Stop TGA* 0.61 1.6
Stop TAG 0.17 0.8
Stop TAA 0.22 1.0

Codon-optimization:



[0214] According to a particularly preferred embodiment it is preferred, that all codons of the wild-type sequence of the coding region of the at least one RNA of the composition disclosed herein which code for a tRNA which is relatively rare in the cell is in each case exchanged for a codon which codes for a tRNA which is relatively frequent in the cell and which, in each case, carries the same amino acid as the relatively rare tRNA. Therefore it is particularly preferred that the most frequent codons are used for each encoded amino acid (see Table 13, most frequent codons are marked with asterisks).

[0215] This means, for example, that for the amino acid Alanine (Ala) present in the amino acid sequence of the encoded peptide or protein, the wild type coding sequence is adapted in a way that the most frequent human codon "GCC" is always used for said amino acid, or for the amino acid Cysteine (Cys), the wild type sequence is adapted in a way that the most frequent human codon "TGC" is always used for said amino acid etc.

C-enrichment:



[0216] According to another embodiment, the at least one RNA of the composition disclosed herein may be modified by increasing the C content of the RNA, preferably of the coding region of the at least one RNA.

[0217] In a particularly preferred embodiment, the C content of the coding region of the at least one RNA of the composition disclosed herein is modified, particularly increased, compared to the C content of the coding region of its particular wild-type RNA, i.e. the unmodified mRNA. The amino acid sequence encoded by the at least one RNA is preferably not modified as compared to the amino acid sequence encoded by the particular wild-type RNA

[0218] In a preferred embodiment, the modified RNA is modified such that at least 10%, 20%, 30%, 40%, 50%, 60%, 70% or 80%, or at least 90% of the theoretically maximal cytosine-content or even a maximal cytosine-content is achieved.

[0219] In further preferred embodiments, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or even 100% of the codons of the target RNA wild type sequence, which are "cytosine content optimizable" are replaced by codons with a higher cytosine-content as present in the wild type sequence.

[0220] In a further preferred embodiment, some of the codons of the wild type coding sequence may additionally be modified such that a codon for a relatively rare tRNA in the cell is exchanged by a codon for a relatively frequent tRNA in the cell, provided that the substituted codon for a relatively frequent tRNA carries the same amino acid as the relatively rare tRNA of the original wild type codon. Preferably, all of the codons for a relatively rare tRNA are replaced by a codon for a relatively frequent tRNA in the cell, except codons encoding amino acids, which are exclusively encoded by codons not containing any cytosine, or except for glutamine (Gln), which is encoded by two codons each containing the same number of cytosines.

[0221] In a further preferred embodiment, the modified target RNA is modified such that at least 80%, or at least 90% of the theoretically maximal cytosine-content or even a maximal cytosine-content is achieved by means of codons, which code for relatively frequent tRNAs in the cell, wherein the amino acid sequence remains unchanged.

[0222] Due to the naturally occurring degeneracy of the genetic code, more than one codon may encode a particular amino acid. Accordingly, 18 out of 20 naturally occurring amino acids are encoded by more than 1 codon (with Tryp and Met being an exception), e.g. by 2 codons (e.g. Cys, Asp, Glu), by three codons (e.g. Ile), by 4 codons (e.g. Al, Gly, Pro) or by 6 codons (e.g. Leu, Arg, Ser). However, not all codons encoding the same amino acid are utilized equally frequent under in vivo conditions. Depending on each single organism, a typical codon usage profile is established.

[0223] The term "cytosine content-optimizable codon" as used within the context of the present disclosure refers to codons, which exhibit a lower amount of cytosines than other codons coding for the same amino acid. Accordingly, any wild type codon, which may be replaced by another codon coding for the same amino acid and exhibiting a higher number of cytosines within that codon, is considered to be cytosine-optimizable (C-optimizable). Any such substitution of a C-optimizable wild type codon by the specific C-optimized codon within a wild type coding region increases its overall C-content and reflects a C-enriched modified RNA sequence. A C-maximized RNA sequence contains C-optimized codons for all potentially C-optimizable codons. Accordingly, 100% or all of the theoretically replaceable C-optimizable codons are under such conditions actually replaced by C-optimized codons over the entire length of the coding region.

[0224] In this context, cytosine-content optimizable codons are codons, which contain a lower number of cytosines than other codons coding for the same amino acid.

[0225] Any of the codons GCG, GCA, GCU codes for the amino acid Ala, which may be exchanged by the codon GCC encoding the same amino acid, and/or
the codon UGU that codes for Cys may be exchanged by the codon UGC encoding the same amino acid, and/or
the codon GAU which codes for Asp may be exchanged by the codon GAC encoding the same amino acid, and/or
the codon that UUU that codes for Phe may be exchanged for the codon UUC encoding the same amino acid, and/or
any of the codons GGG, GGA, GGU that code Gly may be exchanged by the codon GGC encoding the same amino acid, and/or
the codon CAU that codes for His may be exchanged by the codon CAC encoding the same amino acid, and/or
any of the codons AUA, AUU that code for Ile may be exchanged by the codon AUC, and/or any of the codons UUG, UUA, CUG, CUA, CUU coding for Leu may be exchanged by the codon CUC encoding the same amino acid, and/or
the codon AAU that codes for Asn may be exchanged by the codon AAC encoding the same amino acid, and/or
any of the codons CCG, CCA, CCU coding for Pro may be exchanged by the codon CCC encoding the same amino acid, and/or
any of the codons AGG, AGA, CGG, CGA, CGU coding for Arg may be exchanged by the codon CGC encoding the same amino acid, and/or
any of the codons AGU, AGC, UCG, UCA, UCU coding for Ser may be exchanged by the codon UCC encoding the same amino acid, and/or
any of the codons ACG, ACA, ACU coding for Thr may be exchanged by the codon ACC encoding the same amino acid, and/or
any of the codons GUG, GUA, GUU coding for Val may be exchanged by the codon GUC encoding the same amino acid, and/or
the codon UAU coding for Tyr may be exchanged by the codon UAC encoding the same amino acid.

[0226] In any of the above instances, the number of cytosines is increased by 1 per exchanged codon. Exchange of all non C-optimized codons (corresponding to C-optimizable codons) of the coding region results in a C-maximized coding sequence. In the context of the present disclosure, at least 70% of the non C-optimized codons are replaced by C-optimized codons of the wild type sequence are replaced by C-optimized codons, preferably at least 80%, more preferably at least 90% within the coding region.

[0227] It may be preferred that for some amino acids the percentage of C-optimizable codons replaced by C-optimized codons is less than 70%, while for other amino acids the percentage of replaced codons is higher than 70% to meet the overall percentage of C-optimization of at least 70% of all C-optimizable wild type codons of the coding region.

[0228] Preferably, in the C-optimized RNAs disclosed herein, at least 50% of the C-optimizable wild type codons for any given amino acid are replaced by C-optimized codons, e.g. any modified C-enriched RNA preferably contains at least 50% C-optimized codons at C-optimizable wild type codon positions coding for any single of the above mentioned amino acids Ala, Cys, Asp, Phe, Gly, His, Ile, Leu, Asn, Pro, Arg, Ser, Thr, Val and Tyr, preferably at least 60%.

[0229] In this context codons coding for amino acids, which are not cytosine content-optimizable and which are, however, encoded by at least two codons, may be used without any further selection process. However, the codon of the wild type sequence that codes for a relatively rare tRNA in the cell, e.g. a human cell, may be exchanged for a codon that codes for a relatively frequent tRNA in the cell, whereby both code for the same amino acid. Accordingly, the relatively rare codon GAA coding for Glu may be exchanged by the relative frequent codon GAG coding for the same amino acid, and/or the relatively rare codon AAA coding for Lys may be exchanged by the relative frequent codon AAG coding for the same amino acid, and/or
the relatively rare codon CAA coding for Gln is exchanged for the relative frequent codon CAG encoding the same amino acid.

[0230] In this context, the amino acids Met (AUG) and Trp (UGG), which are encoded by only one codon each, remain unchanged. Stop codons are not cytosine-content optimized, however, the relatively rare stop codons amber, ochre (UAA, UAG) may be exchanged by the relatively frequent stop codon opal (UGA).

[0231] The substitutions listed above may obviously be used individually but also in all possible combinations in order to optimize the cytosine-content of the modified RNA compared to the wild type RNA sequence.

[0232] Accordingly, the region of the modified RNA coding for the peptide or protein may be changed compared to the coding region of the wild type RNA in such a way that an amino acid encoded by at least two or more codons, of which one comprises one additional cytosine, such a codon may be exchanged by the C-optimized codon comprising one additional cytosine, whereby the amino acid is unaltered compared to the wild type sequence.

[0233] Substitutions, additions or eliminations of bases are preferably carried out using a DNA matrix for preparation of the nucleic acid molecule by techniques of the well known site directed mutagenesis or with an oligonucleotide ligation. In such a process, for preparation of the at least one RNA as defined herein a corresponding DNA molecule may be transcribed in vitro. This DNA matrix preferably comprises a suitable promoter, e.g. a T7 or SP6 promoter, for in vitro transcription, which is followed by the desired nucleotide sequence for the at least one RNA to be prepared and a termination signal for in vitro transcription. The DNA molecule, which forms the matrix of the at least one RNA of interest, may be prepared by fermentative proliferation and subsequent isolation as part of a plasmid which can be replicated in bacteria. Plasmids which may be mentioned as suitable in the context of the present disclosure are e.g. the plasmids pT7Ts (GenBank accession number U26404; Lai et al., Development 1995, 121: 2349 to 2360), pGEM® series, e.g. pGEM®-1 (GenBank accession number X65300; from Promega) and pSP64 (GenBank accession number X65327); cf. also Mezei and Storts, Purification of PCR Products, in: Griffin and Griffin (ed.), PCR Technology: Current Innovation, CRC Press, Boca Raton, FL, 2001.

Fragments and variants



[0234] In the context of the present disclosure, additionally to the here disclosed peptides and proteins, which show a certain degree of identity of sequence, are incorporated. Therefore fragments and variants of the proteins and peptides as defineded herein are disclosed herewith in the context of the present disclosure.

[0235] Furthermore fragments and variants of nucleic acids as defined herein are therefore disclosed herewith in the context of the present disclosure.

Mono-Bi-Multicistronic. Self cleaving peptides etc:



[0236] The coding region of the at least oneRNA of the composition disclosed herein may occur as a mono-, di-, or even multicistronic RNA, i.e. an RNA sequence which carries the coding sequences of one, two or more proteins or peptides. Such coding sequences of the di-, or even multicistronic RNAs may be separated by at least one internal ribosome entry site (IRES) sequence. Thus, the at least one RNA disclosed herein may further comprise one or more internal ribosome entry site (IRES) sequences or IRES-motifs, which may separate several open reading frames, especially if the RNA encodes for two or more peptides or proteins (bi- or multicistronic RNA). For example, the internal ribosome entry site sequence may be derived from EMCV (encephalomyocarditis virus) or from FMDV (Foot and mouth disease virus). Furthermore self-cleaving signal peptides may be used which induce the cleavage of the resulting polypeptide which comprises several proteins or peptides, e.g. a self-cleaving signal peptide sequence derived from F2A peptide from FMDV.

Combinations of different coding sequences



[0237] In a preferred embodiment, the composition disclosed herein comprises at least one, two, three, four, five, six, seven, eight, nine, ten or more RNAs, each comprising at least one, two, three, four, five, six, seven, eight, nine, ten or more coding regions encoding at least one or more cytokine as defined above and/or at least one or more chemokine as defined above, and/or at least one or more suicide gene product as definded above, and/or at least one or more immunogenic peptide or protein as defined above, and/or at least one or more apoptosis inducer as defined above, and/or at least one or more angiogenesis inhibitor as defined above, and/or at least one or more heat shock protein as defined above, and/or at least one or more tumor antigen as defined above, and/or at least one or more β-catenin inhibitor as defined above, and/or at least one or more STING pathway activator as defined above, and/or at least one or more checkpoint modulator as defined above, and/or at least one or more innate immune activator, and/or at least one or more antibody as defined above, and/or at least one dominant negative receptor and/or at least one or more decoy receptor, and/or at least one or more inhibitor of myeloid derived suppressor cells (MDSCs), and/or at least one or more IDO pathway inhibitor, and/or at least one or more protein or peptide that bind apoptosis inhibitors as defined above, or variants orfragments thereof.

Untranslated regions (UTRs)



[0238] By a further embodiment, the at least one RNA of the composition disclosed herein preferably comprises at least one of the following structural elements: a 5'- and/or 3'- untranslated region element (UTR element), particularly a 5'-UTR element which comprises or consists of a nucleic acid sequence which is derived from the 5'-UTR of a TOP gene or from a fragment, homolog or a variant thereof, or a 5'- and/or 3'-UTR element which may be derivable from a gene that provides a stable mRNA or from a homolog, fragment or variant thereof; a histone stem-loop structure, preferably a histone stem-loop in its 3' untranslated region; a 5'-CAP structure; a poly-A tail (poly(A) sequence); or a poly(C) sequence.

[0239] In a preferred embodiment, the at least one RNA comprises at least one 5'- or 3'-UTR element. In this context, an UTR element comprises or consists of a nucleic acid sequence which is derived from the 5'- or 3'-UTR of any naturally occurring gene or which is derived from a fragment, a homolog or a variant of the 5'- or 3'-UTR of a gene. Preferably, the 5'- or 3'-UTR element used according to the present disclosure is heterologous to the coding region of the RNA of the composition disclosed herein. Even if 5'- or 3'-UTR elements derived from naturally occurring genes are preferred, also synthetically engineered UTR elements may be used in the context of the present disclosure.

[0240] In a particularly preferred embodiment, the at least one RNA comprises at least one 5'-untranslated region element (5'-UTR element) which comprises or consists of a nucleic acid sequence which is derived from the 5'-UTR of a TOP gene or which is derived from a fragment, homolog or variant of the 5'-UTR of a TOP gene.

[0241] It is particularly preferred that the 5'-UTR element does not comprise a TOP-motif or a 5'-TOP, as defined above.

[0242] In some embodiments, the nucleic acid sequence of the 5'-UTR element which is derived from a 5'-UTR of a TOP gene terminates at its 3'-end with a nucleotide located at position 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 upstream of the start codon (e.g. A(U/T)G) of the gene or mRNA it is derived from. Thus, the 5'-UTR element does not comprise any part of the protein coding region. Thus, preferably, the only protein coding part of mRNA of the composition disclosed herein is provided by the coding region.

[0243] The nucleic acid sequence, which is derived from the 5'-UTR of a TOP gene is preferably derived from a eukaryotic TOP gene, preferably a plant or animal TOP gene, more preferably a chordate TOP gene, even more preferably a vertebrate TOP gene, most preferably a mammalian TOP gene, such as a human TOP gene.

[0244] For example, the 5'-UTR element is preferably selected from 5'-UTR elements comprising or consisting of a nucleic acid sequence which is derived from a nucleic acid sequence selected from the group consisting of SEQ ID Nos. 1-1363, SEQ ID NO. 1395, SEQ ID NO. 1421 and SEQ ID NO. 1422 of the patent application WO2013/143700, from the homologs of SEQ ID Nos. 1-1363, SEQ ID NO. 1395, SEQ ID NO. 1421 and SEQ ID NO. 1422 of the patent application WO2013/143700, from a variant thereof, or preferably from a corresponding RNA sequence. The term "homologs of SEQ ID Nos. 1-1363, SEQ ID NO. 1395, SEQ ID NO. 1421 and SEQ ID NO. 1422 of the patent application WO2013/143700" refers to sequences of other species than homo sapiens, which are homologous to the sequences according to SEQ ID Nos. 1-1363, SEQ ID NO. 1395, SEQ ID NO. 1421 and SEQ ID NO. 1422 of the patent application WO2013/143700.

[0245] In a preferred embodiment, the 5'-UTR element comprises or consists of a nucleic acid sequence which is derived from a nucleic acid sequence extending from nucleotide position 5 (i.e. the nucleotide that is located at position 5 in the sequence) to the nucleotide position immediately 5' to the start codon (located at the 3' end of the sequences), e.g. the nucleotide position immediately 5' to the ATG sequence, of a nucleic acid sequence selected from SEQ ID Nos. 1-1363, SEQ ID NO. 1395, SEQ ID NO. 1421 and SEQ ID NO. 1422 of the patent application WO2013/143700, from the homologs of SEQ ID Nos. 1-1363, SEQ ID NO. 1395, SEQ ID NO. 1421 and SEQ ID NO. 1422 of the patent application WO2013/143700 from a variant thereof, or a corresponding RNA sequence. It is particularly preferred that the 5'-UTR element is derived from a nucleic acid sequence extending from the nucleotide position immediately 3' to the 5'-TOP to the nucleotide position immediately 5' to the start codon (located at the 3' end of the sequences), e.g. the nucleotide position immediately 5' to the ATG sequence, of a nucleic acid sequence selected from SEQ ID Nos. 1-1363, SEQ ID NO. 1395, SEQ ID NO. 1421 and SEQ ID NO. 1422 of the patent application WO2013/143700, from the homologs of SEQ ID Nos. 1-1363, SEQ ID NO. 1395, SEQ ID NO. 1421 and SEQ ID NO. 1422 of the patent application WO2013/143700, from a variant thereof, or a corresponding RNA sequence.

[0246] In a particularly preferred embodiment, the 5'-UTR element comprises or consists of a nucleic acid sequence which is derived from a 5'-UTR of a TOP gene encoding a ribosomal protein or from a variant of a 5'-UTR of a TOP gene encoding a ribosomal protein. For example, the 5'-UTR element comprises or consists of a nucleic acid sequence which is derived from a 5'-UTR of a nucleic acid sequence according to any of SEQ ID NOs: 67, 170, 193, 244, 259, 554, 650, 675, 700, 721, 913,1016, 1063, 1120, 1138, and 1284-1360 of the patent application WO2013/143700, a corresponding RNA sequence, a homolog thereof, or a variant thereof as described herein, preferably lacking the 5'-TOP motif. As described above, the sequence extending from position 5 to the nucleotide immediately 5' to the ATG (which is located at the 3'end of the sequences) corresponds to the 5'-UTR of said sequences.

[0247] Preferably, the 5'-UTR element comprises or consists of a nucleic acid sequence which is derived from a 5'-UTR of a TOP gene encoding a ribosomal large protein (RPL) or from a homolog or variant of a 5'-UTR of a TOP gene encoding a ribosomal large protein (RPL). For example, the 5'-UTR element comprises or consists of a nucleic acid sequence which is derived from a 5'-UTR of a nucleic acid sequence according to any of SEQ ID NOs: 67, 259, 1284-1318, 1344, 1346, 1348-1354, 1357, 1358, 1421 and 1422 of the patent application WO2013/143700, a corresponding RNA sequence, a homolog thereof, or a variant thereof as described herein, preferably lacking the 5'-TOP motif.

[0248] In a particularly preferred embodiment, the 5'-UTR element comprises or consists of a nucleic acid sequence which is derived from the 5'-UTR of a ribosomal protein Large 32 gene, preferably from a vertebrate ribosomal protein Large 32 (L32) gene, more preferably from a mammalian ribosomal protein Large 32 (L32) gene, most preferably from a human ribosomal protein Large 32 (L32) gene, or from a variant of the 5'-UTR of a ribosomal protein Large 32 gene, preferably from a vertebrate ribosomal protein Large 32 (L32) gene, more preferably from a mammalian ribosomal protein Large 32 (L32) gene, most preferably from a human ribosomal protein Large 32 (L32) gene, wherein preferably the 5'-UTR element does not comprise the 5'-TOP of said gene.

[0249] A preferred sequence for a 5'-UTR element corresponds to SEQ ID No. 1368 of the patent application WO2013/143700.

[0250] Accordingly, in a particularly preferred embodiment, the 5'-UTR element comprises or consists of a nucleic acid sequence which has an identity of at least about 20%, preferably of at least about 40%, preferably of at least about 50%, preferably of at least about 60%, preferably of at least about 70%, more preferably of at least about 80%, more preferably of at least about 90%, even more preferably of at least about 95%, even more preferably of at least about 99% to the nucleic acid sequence as mentioned above (according to SEQ ID NO. 10.051 (5'-UTR of human ribosomal protein Large 32 lacking the 5' terminal oligopyrimidine tract: GGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATC; corresponding to SEQ ID No. 1368 of the patent application WO2013/143700)) or preferably to a corresponding RNA sequence, or wherein the at least one 5'UTR element comprises or consists of a fragment of a nucleic acid sequence which has an identity of at least about 40%, preferably of at least about 50%, preferably of at least about 60%, preferably of at least about 70%, more preferably of at least about 80%, more preferably of at least about 90%, even more preferably of at least about 95%, even more preferably of at least about 99% to the nucleic acid sequence according to SEQ ID NO. 10.052 or more preferably to a corresponding RNA sequence, wherein, preferably, the fragment is as described above, i.e. being a continuous stretch of nucleotides representing at least 20% etc. of the full-length 5'-UTR.

[0251] Preferably, the fragment exhibits a length of at least about 20 nucleotides or more, preferably of at least about 30 nucleotides or more, more preferably of at least about 40 nucleotides or more. Preferably, the fragment is a functional fragment as described herein.

[0252] In some embodiments, the mRNA of the composition disclosed herein comprises a 5'-UTR element which comprises or consists of a nucleic acid sequence which is derived from the 5'-UTR of a vertebrate TOP gene, such as a mammalian, e.g. a human TOP gene, selected from RPSA, RPS2, RPS3, RPS3A, RPS4, RPS5, RPS6, RPS7, RPS8, RPS9, RPS10, RPS11, RPS12, RPS13, RPS14, RPS15, RPS15A, RPS16, RPS17, RPS18, RPS19, RPS20, RPS21, RPS23, RPS24, RPS25, RPS26, RPS27, RPS27A, RPS28, RPS29, RPS30, RPL3, RPL4, RPL5, RPL6, RPL7, RPL7A, RPL8, RPL9, RPL10, RPL10A, RPL11, RPL12, RPL13, RPL13A, RPL14, RPL15, RPL17, RPL18, RPL18A, RPL19, RPL21, RPL22, RPL23, RPL23A, RPL24, RPL26, RPL27, RPL27A, RPL28, RPL29, RPL30, RPL31, RPL32, RPL34, RPL35, RPL35A, RPL36, RPL36A, RPL37, RPL37A, RPL38, RPL39, RPL40, RPL41, RPLP0, RPLP1, RPLP2, RPLP3, RPLP0, RPLP1, RPLP2, EEF1A1, EEF1B2, EEF1D, EEF1G, EEF2, EIF3E, EIF3F, EIF3H, EIF2S3, EIF3C, EIF3K, EIF3EIP, EIF4A2, PABPC1, HNRNPA1, TPT1, TUBB1, UBA52, NPM1, ATP5G2, GNB2L1, NME2, UQCRB, or from a homolog or variant thereof, wherein preferably the 5'-UTR element does not comprise a TOP-motif or the 5'-TOP of said genes, and wherein optionally the 5'-UTR element starts at its 5'-end with a nucleotide located at position 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 downstream of the 5' terminal oligopyrimidine tract (TOP) and wherein further optionally the 5'-UTR element which is derived from a 5'-UTR of a TOP gene terminates at its 3'-end with a nucleotide located at position 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 upstream of the start codon (A(U/T)G) of the gene it is derived from.

[0253] In further particularly preferred embodiments, the 5'-UTR element comprises or consists of a nucleic acid sequence which is derived from the 5'-UTR of a ribosomal protein Large 32 gene (RPL32), a ribosomal protein Large 35 gene (RPL35), a ribosomal protein Large 21 gene (RPL21), an ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle (ATP5A1) gene, an hydroxysteroid (17-beta) dehydrogenase 4 gene (HSD17B4), an androgen-induced 1 gene (AIG1), cytochrome c oxidase subunit VIc gene (COX6C), or a N-acylsphingosine amidohydrolase (acid ceramidase) 1 gene (ASAH1) or from a variant thereof, preferably from a vertebrate ribosomal protein Large 32 gene (RPL32), a vertebrate ribosomal protein Large 35 gene (RPL35), a vertebrate ribosomal protein Large 21 gene (RPL21), a vertebrate ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle (ATP5A1) gene, a vertebrate hydroxysteroid (17-beta) dehydrogenase 4 gene (HSD17B4), a vertebrate androgen-induced 1 gene (AIG1), a vertebrate cytochrome c oxidase subunit VIc gene (COX6C), or a vertebrate N-acylsphingosine amidohydrolase (acid ceramidase) 1 gene (ASAH1) or from a variant thereof, more preferably from a mammalian ribosomal protein Large 32 gene (RPL32), a ribosomal protein Large 35 gene (RPL35), a ribosomal protein Large 21 gene (RPL21), a mammalian ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle (ATP5A1) gene, a mammalian hydroxysteroid (17-beta) dehydrogenase 4 gene (HSD17B4), a mammalian androgen-induced 1 gene (AIG1), a mammalian cyto-chrome c oxidase subunit VIc gene (COX6C), or a mammalian N-acylsphingosine amidohydrolase (acid ceramidase) 1 gene (ASAH1) or from a variant thereof, most preferably from a human ribosomal protein Large 32 gene (RPL32), a human ribosomal protein Large 35 gene (RPL35), a human ribosomal protein Large 21 gene (RPL21), a human ATP syn-thase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle (ATP5A1) gene, a human hydroxysteroid (17-beta) dehydrogenase 4 gene (HSD17B4), a human androgen-induced 1 gene (AIG1), a human cytochrome c oxidase subunit VIc gene (COX6C), or a human N-acylsphingosine amidohydrolase (acid ceramidase) 1 gene (ASAH1) or from a variant thereof, wherein preferably the 5'-UTR element does not comprise the 5'-TOP of said gene.

[0254] In this context particularly preferred are 5'-UTR elements comprising a nucleic acid sequence according to SEQ ID Nos. 10.051-10.054.

[0255] Accordingly, in a particularly preferred embodiment, the 5'-UTR element comprises or consists of a nucleic acid sequence which has an identity of at least about 40%, preferably of at least about 50%, preferably of at least about 60%, preferably of at least about 70%, more preferably of at least about 80%, more preferably of at least about 90%, even more preferably of at least about 95%, even more preferably of at least about 99% to the nucleic acid sequence according to SEQ ID No. 1368, or SEQ ID NOs 1412-1420 of the patent application WO2013/143700, or a corresponding RNA sequence, or wherein the at least one 5'-UTR element comprises or consists of a fragment of a nucleic acid sequence which has an identity of at least about 20%, preferably of at least about 40%, preferably of at least about 50%, preferably of at least about 60%, preferably of at least about 70%, more preferably of at least about 80%, more preferably of at least about 90%, even more preferably of at least about 95%, even more preferably of at least about 99% to the nucleic acid sequence according to SEQ ID No. 1368, or SEQ ID NOs 1412-1420 of the patent application WO2013/143700, wherein, preferably, the fragment is as described above, i.e. being a continuous stretch of nucleotides representing at least 20% etc. of the full-length 5'-UTR. Preferably, the fragment exhibits a length of at least about 20 nucleotides or more, preferably of at least about 30 nucleotides or more, more preferably of at least about 40 nucleotides or more. Preferably, the fragment is a functional fragment as described herein.

[0256] Accordingly, in a particularly preferred embodiment, the 5'-UTR element comprises or consists of a nucleic acid sequence which has an identity of at least about 20%, preferably of at least about 40%, preferably of at least about 50%, preferably of at least about 60%, preferably of at least about 70%, more preferably of at least about 80%, more preferably of at least about 90%, even more preferably of at least about 95%, even more preferably of at least about 99% to the nucleic acid sequence according to SEQ ID No. 10.053 (5'-UTR of ATP5A1 lacking the 5' terminal oligopyrimidine tract:
GCGGCTCGGCCATTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCG-GAGTAACTGCAAAG; corresponding to SEQ ID No. 1414 of the patent application WO2013/143700 (5'-UTR of ATP5A1 lacking the 5' terminal oligopyrimidine tract) or preferably to a corresponding RNA sequence, or wherein the at least one 5'UTR element comprises or consists of a fragment of a nucleic acid sequence which has an identity of at least about 40%, preferably of at least about 50%, preferably of at least about 60%, preferably of at least about 70%, more preferably of at least about 80%, more preferably of at least about 90%, even more preferably of at least about 95%, even more preferably of at least about 99% to the nucleic acid sequence according to SEQ ID NO. 26 (of the patent application WO2013/143700) or more preferably to a corresponding RNA sequence, wherein, preferably, the fragment is as described above, i.e. being a continuous stretch of nucleotides representing at least 20% etc. of the full-length 5'-UTR. Preferably, the fragment exhibits a length of at least about 20 nucleotides or more, preferably of at least about 30 nucleotides or more, more preferably of at least about 40 nucleotides or more. Preferably, the fragment is a functional fragment as described herein.

[0257] In a further preferred embodiment, the at least one RNA of the composition disclosed herein further comprises at least one 3'-UTR element which comprises or consists of a nucleic acid sequence derived from the 3'-UTR of a chordate gene, preferably a vertebrate gene, more preferably a mammalian gene, most preferably a human gene, or from a variant of the 3'-UTR of a chordate gene, preferably a vertebrate gene, more preferably a mammalian gene, most preferably a human gene.

[0258] The term '3'-UTR element' refers to a nucleic acid sequence which comprises or consists of a nucleic acid sequence that is derived from a 3'-UTR or from a variant of a 3'-UTR. A 3'-UTR element in the sense of the present disclosure may represent the 3'-UTR of an mRNA. Thus, in the sense of the present disclosure, preferably, a 3'-UTR element may be the 3'-UTR of an mRNA, preferably of an artificial mRNA, or it may be the transcription template for a 3'-UTR of an mRNA. Thus, a 3'-UTR element preferably is a nucleic acid sequence which corresponds to the 3'-UTR of an mRNA, preferably to the 3'-UTR of an artificial mRNA, such as an mRNA obtained by transcription of a genetically engineered vector construct. Preferably, the 3'-UTR element fulfils the function of a 3'-UTR or encodes a sequence which fulfils the function of a 3'-UTR.

[0259] Preferably, the mRNA disclosed herein comprises a 3'-UTR element which may be derivable from a gene that relates to an mRNA with an enhanced half-life (that provides a stable mRNA), for example a 3'-UTR element as defined and described below. Preferably, the 3'-UTR element, is a nucleic acid sequence derived from a 3'-UTR of a gene, which preferably encodes a stable mRNA, or from a homolog, a fragment or a variant of said gene

[0260] In a particularly preferred embodiment, the 3'-UTR element comprises or consists of a nucleic acid sequence which is derived from a 3'-UTR of a gene selected from the group consisting of an albumin gene, an α-globin gene, a β-gtobin gene, a tyrosine hydroxylase gene, a lipoxygenase gene, and a collagen alpha gene, such as a collagen alpha 1(I) gene, or from a variant of a 3'-UTR of a gene selected from the group consisting of an albumin gene, an α-globin gene, a β-gtobin gene, a tyrosine hydroxylase gene, a lipoxygenase gene, and a collagen alpha gene, such as a collagen alpha 1(I) gene according to SEQ ID No. 1369-1390 of the patent application WO2013/143700.In a particularly preferred embodiment, the 3'-UTR element comprises or consists of a nucleic acid sequence which is derived from a 3'-UTR of an albumin gene, preferably a vertebrate albumin gene, more preferably a mammalian albumin gene, most preferably a human albumin gene, most preferably a human albumin gene according to SEQ ID NO. 10063 (according SEQ ID No: 1369 of the patent application WO2013/143700). The mRNA sequence may comprise or consist of a nucleic acid sequence which is derived from the 3'-UTR of the human albumin gene according to GenBank Accession number NM_000477.5, or from a fragment or variant thereof.

[0261] In this context it is particularly preferred that the mRNA of the composition disclosed herein comprises a 3'-UTR element comprising a corresponding RNA sequence derived from the nucleic acids according to SEQ ID No. 1369-1390 of the patent application WO2013/143700 or a fragment, homolog or variant thereof.

[0262] Most preferably the 3'-UTR element comprises the nucleic acid sequence derived from a fragment of the human albumin gene (albumin7 3'UTR) according to SEQ ID NO. 10065 (according to SEQ ID No: 1376 of the patent application WO2013/143700).

[0263] In this context, it is particularly preferred that the 3'-UTR element of the at least one RNA of the composition disclosed herein comprises or consists of a corresponding RNA sequence of the nucleic acid sequence according to SEQ ID NO. 10066.

[0264] In another particularly preferred embodiment, the 3'-UTR element comprises or consists of a nucleic acid sequence which is derived from a 3'-UTR of an α-globin gene, preferably a vertebrate α- or β-globin gene, more preferably a mammalian α- or β-gtobin gene, most preferably a human α- or β-globin gene according to SEQ ID NO. 10055 (corresponding to SEQ ID No. 1370 of the patent application WO2013/143700 (3'-UTR of Homo sapiens hemoglobin, alpha 1 (HBA1))), or according to SEQ ID NO. 10057 (corresponding to SEQ ID No. 1371 of the patent application WO2013/143700 (3'-UTR of Homo sapiens hemoglobin, alpha 2 (HBA2))), and/or according to SEQ ID NO. 10059 (corresponding to SEQ ID No. 1372 of the patent application WO2013/143700 (3'-UTR of Homo sapiens hemoglobin, beta (HBB)).

[0265] For example, the 3'-UTR element may comprise or consist of the center, α-complex-binding portion of the 3'-UTR of an α-globin gene, according to SEQ ID NO. 10061 (corresponding to SEQ ID No. 1393 of the patent application WO2013/143700).

[0266] In this context, it is particularly preferred that the 3'-UTR element of the RNA of the composition disclosed herein comprises or consists of a corresponding RNA sequence of the nucleic acid sequence according to SEQ ID NO. 10062, according to the above or a homolog, a fragment or variant thereof.

[0267] The term 'a nucleic acid sequence which is derived from the 3'-UTR of a [...] gene' preferably refers to a nucleic acid sequence which is based on the 3'-UTR sequence of a [...] gene or on a part thereof, such as on the 3'-UTR of an albumin gene, an α-globin gene, a β-globin gene, a tyrosine hydroxylase gene, a lipoxygenase gene, or a collagen alpha gene, such as a collagen alpha 1(I) gene, preferably of an albumin gene or on a part thereof. This term includes sequences corresponding to the entire 3'-UTR sequence, i.e. the full length 3'-UTR sequence of a gene, and sequences corresponding to a fragment of the 3'-UTR sequence of a gene, such as an albumin gene, α-globin gene, β-globin gene, tyrosine hydroxylase gene, lipoxygenase gene, or collagen alpha gene, such as a collagen alpha 1(I) gene, preferably of an albumin gene.

[0268] The term 'a nucleic acid sequence which is derived from a variant of the 3'-UTR of a [...] gene' preferably refers to a nucleic acid sequence which is based on a variant of the 3'-UTR sequence of a gene, such as on a variant of the 3'-UTR of an albumin gene, an α-globin gene, a β-gtobin gene, a tyrosine hydroxylase gene, a lipoxygenase gene, or a collagen alpha gene, such as a collagen alpha 1(I) gene, or on a part thereof as described above. This term includes sequences corresponding to the entire sequence of the variant of the 3'-UTR of a gene, i.e. the full length variant 3'-UTR sequence of a gene, and sequences corresponding to a fragment of the variant 3'-UTR sequence of a gene. A fragment in this context preferably consists of a continuous stretch of nucleotides corresponding to a continuous stretch of nucleotides in the full-length variant 3'-UTR, which represents at least 20%, preferably at least 30%, more preferably at least 40%, more preferably at least 50%, even more preferably at least 60%, even more preferably at least 70%, even more preferably at least 80%, and most preferably at least 90% of the full-length variant 3'-UTR. Such a fragment of a variant, in the sense of the present disclosure, is preferably a functional fragment of a variant as described herein.

[0269] Preferably, the at least one 5'-UTR element and the at least one 3'-UTR element act synergistically to increase protein production from the RNA of the composition as described above.

Histone stem loop:



[0270] In a particularly preferred embodiment, the at least oneRNA of the composition disclosed herein comprises a histone stem-loop sequence/structure. Such histone stem-loop sequences are preferably selected from histone stem-loop sequences as disclosed in WO 2012/019780.

[0271] A histone stem-loop sequence, suitable to be used within the present disclosure, is preferably selected from at least one of the following formulae (I) or (II):

formula (I) (stem-loop sequence without stem bordering elements):

formula (II) (stem-loop sequence with stem bordering elements):

wherein:

stem1 or stem2 bordering elements N1-6
is a consecutive sequence of 1 to 6, preferably of 2 to 6, more preferably of 2 to 5, even more preferably of 3 to 5, most preferably of 4 to 5 or 5 N, wherein each N is independently from another selected from a nucleotide selected from A, U, T, G and C, or a nucleotide analogue thereof;
stem1 [N0-2GN3-5]
is reverse complementary or partially reverse complementary with element stem2, and is a consecutive sequence between of 5 to 7 nucleotides;
wherein N0-2 is a consecutive sequence of 0 to 2, preferably of 0 to 1, more preferably of 1 N, wherein each N is independently from another selected from a nucleotide selected from A, U, T, G and C or a nucleotide analogue thereof;
wherein N3-5 is a consecutive sequence of 3 to 5, preferably of 4 to 5, more preferably of 4 N, wherein each N is independently from another selected from a nucleotide selected from A, U, T, G and C or a nucleotide analogue thereof, and
wherein G is guanosine or an analogue thereof, and may be optionally replaced by a cytidine or an analogue thereof, provided that its complementary nucleotide cytidine in stem2 is replaced by guanosine;
loop sequence [N0-4(U/T)N0-4]
is located between elements stem1 and stem2, and is a consecutive sequence of 3 to 5 nucleotides, more preferably of 4 nucleotides;
wherein each N0-4 is independent from another a consecutive sequence of 0 to 4, preferably of 1 to 3, more preferably of 1 to 2 N, wherein each N is independently from another selected from a nucleotide selected from A, U, T, G and C or a nucleotide analogue thereof; and
wherein U/T represents uridine, or optionally thymidine;
stem2 [N3-5CN0-2]
is reverse complementary or partially reverse complementary with element stem1, and is a consecutive sequence between of 5 to 7 nucleotides;
wherein N3-5 is a consecutive sequence of 3 to 5, preferably of 4 to 5, more preferably of 4 N, wherein each N is independently from another selected from a nucleotide selected from A, U, T, G and C or a nucleotide analogue thereof;
wherein N1-2 is a consecutive sequence of 0 to 2, preferably of 0 to 1, more preferably of 1 N, wherein each N is independently from another selected from a nucleotide selected from A, U, T, G or C or a nucleotide analogue thereof; and
wherein C is cytidine or an analogue thereof, and may be optionally replaced by a guanosine or an analogue thereof provided that its complementary nucleoside guanosine in stem1 is replaced by cytidine;
wherein stem1 and stem2 are capable of base pairing with each other forming a reverse complementary sequence, wherein base pairing may occur between stem1 and stem2, e.g. by Watson-Crick base pairing of nucleotides A and U/T or G and C or by non-Watson-Crick base pairing e.g. wobble base pairing, reverse Watson-Crick base pairing, Hoogsteen base pairing, reverse Hoogsteen base pairing or are capable of base pairing with each other forming a partially reverse complementary sequence, wherein an incomplete base pairing may occur between stem1 and stem2, on the basis that one or more bases in one stem do not have a complementary base in the reverse complementary sequence of the other stem.



[0272] According to a further preferred embodiment of the first aspect of the present disclosure, the mRNA sequence may comprise at least one histone stem-loop sequence according to at least one of the following specific formulae (Ia) or (IIa):

formula (Ia) (stem-loop sequence without stem bordering elements):

formula (IIa) (stem-loop sequence with stem bordering elements):

wherein N, C, G, T and U are as defined above.



[0273] According to a further more particularly preferred embodiment of the first aspect, the at least one RNA may comprise at least one histone stem-loop sequence according to at least one of the following specific formulae (Ib) or (IIb):

formula (Ib) (stem-loop sequence without stem bordering elements):

formula (IIb) (stem-loop sequence with stem bordering elements):

wherein N, C, G, T and U are as defined above.



[0274] A particular preferred histone stem-loop sequence is the sequence according to SEQ ID No: 8.

[0275] More preferably the stem-loop sequence is the corresponding RNA sequence of the nucleic acid sequence according to SEQ ID NO: 9

Poly(A)



[0276] In a particularly preferred embodiment, the at least one RNA of the composition disclosed herein comprises additionally to the coding region encoding at least one peptide or protein as described above or a fragment or variant thereof, a poly(A) sequence, also called poly-A tail, preferably at the 3' terminus of the RNA. When present, such a poly(A) sequence comprises a sequence of about 25 to about 400 adenosine nucleotides, preferably a sequence of about 50 to about 400 adenosine nucleotides, more preferably a sequence of about 50 to about 300 adenosine nucleotides, even more preferably a sequence of about 50 to about 250 adenosine nucleotides, most preferably a sequence of about 60 to about 250 adenosine nucleotides. In this context the term "about" refers to a deviation of ± 10% of the value(s) it is attached to. This poly(A) sequence is preferably located 3' of the coding region comprised in the RNA disclosed herein.

[0277] Preferably, the poly(A) sequence in at least one RNA of the composition is derived from a DNA template by RNA in vitro transcription. Alternatively, the poly(A) sequence may also be obtained in vitro by common methods of chemical-synthesis without being necessarily transcribed from a DNA-progenitor. Moreover, poly(A) sequences, or poly(A) tails may be generated by enzymatic polyadenylation of the at least one RNA using commercially available polyadenylation kits and corresponding protocols known in the art.

[0278] Alternatively, the at least one RNA of the composition disclosed herein optionally comprises a polyadenylation signal, which is defined herein as a signal, which conveys polyadenylation to a (transcribed) RNA by specific protein factors (e.g. cleavage and polyadenylation specificity factor (CPSF), cleavage stimulation factor (CstF), cleavage factors I and II (CF I and CF II), poly(A) polymerase (PAP)). In this context, a consensus polyadenylation signal is preferred comprising the NN(U/T)ANA consensus sequence. In a particularly preferred aspect, the polyadenylation signal comprises one of the following sequences: AA(U/T)AAA or A(U/T)(U/T)AAA (wherein uridine is usually present in RNA and thymidine is usually present in DNA).

Poly(C)



[0279] According to a further preferred embodiment, the RNA of the composition disclosed herein can be modified by a sequence of at least 10 cytosines, preferably at least 20 cytosines, more preferably at least 30 cytosines (so-called "poly(C) sequence"). Particularly, the RNA may contain a poly(C) sequence of typically about 10 to 200 cytosine nucleotides, preferably about 10 to 100 cytosine nucleotides, more preferably about 10 to 70 cytosine nucleotides or even more preferably about 20 to 50 or even 20 to 30 cytosine nucleotides. This poly(C) sequence is preferably located 3' of the coding region, more preferably 3' of an optional poly(A) sequence comprised in the RNA disclosed herein.

5'-Cap



[0280] According to another preferred embodiment disclosed herein, a modified RNA molecule as defined herein, can be modified by the addition of a so-called "5' cap" structure, which preferably stabilizes the RNA as described herein. A 5'-cap is an entity, typically a modified nucleotide entity, which generally "caps" the 5'-end of a mature mRNA. A 5'-cap may typically be formed by a modified nucleotide, particularly by a derivative of a guanine nucleotide. Preferably, the 5'-cap is linked to the 5'-terminus via a 5'-5'-triphosphate linkage. A 5'-cap may be methylated, e.g. m7GpppN, wherein N is the terminal 5' nucleotide of the nucleic acid carrying the 5'-cap, typically the 5'-end of an mRNA. m7GpppN is the 5'-cap structure, which naturally occurs in mRNA transcribed by polymerase II and is therefore preferably not considered as modification comprised in a modified RNA in this context. Accordingly, a modified RNA as disclosed herein may comprise a m7GpppN as 5'-cap, but additionally the modified RNA typically comprises at least one further modification as defined herein.

[0281] Further examples of 5'cap structures include glyceryl, inverted deoxy abasic residue (moiety), 4',5' methylene nucleotide, 1-(beta-D-erythrofuranosyl) nucleotide, 4'-thio nucleotide, carbocyclic nucleotide, 1,5-anhydrohexitol nucleotide, L-nucleotides, alpha-nucleotide, modified base nucleotide, threo-pentofuranosyl nucleotide, acyclic 3',4'-seco nucleotide, acyclic 3,4-dihydroxybutyl nucleotide, acyclic 3,5 dihydroxypentyl nucleotide, 3'-3'-inverted nucleotide moiety, 3'-3'-inverted abasic moiety, 3'-2'-inverted nucleotide moiety, 3'-2'-inverted abasic moiety, 1,4-butanediol phosphate, 3'-phosphoramidate, hexylphosphate, aminohexyl phosphate, 3'-phosphate, 3'phosphorothioate, phosphorodithioate, or bridging or non-bridging methylphosphonate moiety. These modified 5'-cap structures are regarded as at least one modification in this context.

[0282] Particularly preferred modified 5'-cap structures are cap1 (methylation of the ribose of the adjacent nucleotide of m7G), cap2 (additional methylation of the ribose of the 2nd nucleotide downstream of the m7G), cap3 (additional methylation of the ribose of the 3rd nucleotide downstream of the m7G), cap4 (methylation of the ribose of the 4th nucleotide downstream of the m7G), ARCA (anti-reverse cap analogue, modified ARCA (e.g. phosphothioate modified ARCA), inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.

Secretory signal sequence:



[0283] According to another particularly preferred embodiment, the at least one RNA of the composition may additionally or alternatively encode a secretory signal peptide. Such secretory signal sequences are peptide stretches, which typically exhibit a length of about 15 to 30 amino acids and are preferably located at the N-terminus of the encoded peptide, without being limited thereto. Secretory signal sequences as defined herein preferably allow the transport of the encoded peptide or protein as encoded by the at least one coding sequence of the at least one RNA of the composition into a defined cellular compartiment, preferably the cell surface, the endoplasmic reticulum (ER) or the endosomal-lysosomal compartiment. Examples of secretory signal sequences as defined herein include, without being limited thereto, secretory signal sequences of classical or non-classical MHC-molecules (e.g. signal sequences of MHC I and II molecules, e.g. of the MHC class I molecule HLA-A*0201), secretory signal sequences of cytokines or immunoglobulines as defined herein, secretory signal sequences of the invariant chain of immunoglobulines or antibodies as defined herein, signal sequences of Lamp1, Tapasin, Erp57, Calretikulin, Calnexin, and further membrane associated proteins or of proteins associated with the endoplasmic reticulum (ER) or the endosomal-lysosomal compartiment.

[0284] Any of the above modifications regarding the coding sequence and/or regarding the RNA as defined above may be applied to the coding sequence and/or the RNA of the composition disclosed herein, and further to any RNA as used in the context of the present disclosure and may be, if suitable or necessary, be combined with each other in any combination, provided, these combinations of modifications do not interfere with each other in the respective at least one RNA. A person skilled in the art will be able to take his choice accordingly.

Production of mRNA and RNA



[0285] The RNA may be prepared using any method known in the art, including synthetic methods (chemical synthesis of RNA) such as e.g. solid phase synthesis, as well as in vitro methods, such as RNA in vitro transcription reactions.

Combinations:



[0286] According to the present disclosure, it is particularly preferred to combine RNA encoded peptides or proteins. In this context particularly preferred are the following combinations:
  • RNA, preferably mRNA coding for at least one cytokine + RNA, preferably mRNA coding for at least one chemokine
  • RNA, preferably mRNA coding for at least one cytokine + RNA, preferably mRNA coding for at at least one suicide gene product
  • RNA, preferably mRNA coding for at least one cytokine + RNA, preferably mRNA coding for at least one immunogenic protein or peptide
  • RNA, preferably mRNA coding for at least one cytokine + RNA, preferably mRNA coding for at least one apoptosis inducer
  • RNA, preferably mRNA coding for at least one cytokine + RNA, preferably mRNA coding for at least one angiogenesis inhibitor
  • RNA, preferably mRNA coding for at least one cytokine + RNA, preferably mRNA coding for at least one heat shock protein
  • RNA, preferably mRNA coding for at least one cytokine + RNA, preferably mRNA coding for at least one tumor antigen
  • RNA, preferably mRNA coding for at least one cytokine + RNA, preferably mRNA coding for at least one β-catenin inhibitor
  • RNA, preferably mRNA coding for at least one cytokine + RNA, preferably mRNA coding for at least one activator of the STING pathway
  • RNA, preferably mRNA coding for at least one cytokine + RNA, preferably mRNA coding for at least one checkpoint modulator
  • RNA, preferably mRNA coding for at least one cytokine + RNA, preferably mRNA coding for at least one innate immune activator
  • RNA, preferably mRNA coding for at least one cytokine + RNA, preferably mRNA coding for at least one antibody
  • RNA, preferably mRNA coding for at least one cytokine + RNA, preferably mRNA coding for at least one decoy receptor
  • RNA, preferably mRNA coding for at least one cytokine + RNA, preferably mRNA coding for at least one inhibitor of myeloid derived suppressor cells (MDSCs)
  • RNA, preferably mRNA coding for at least one cytokine + RNA, preferably mRNA coding for at least one IDO pathway inhibitor
  • RNA, preferably mRNA coding for at least one cytokine + RNA, preferably mRNA coding for at least one protein or peptide that bind inhibitors of apoptosis.


[0287] Furthermore, particularly preferred are the following embodiments:
  • RNA, preferably mRNA coding for IL-2 and/or RNA, preferably mRNA coding for IL-12 + mRNA coding for thymidine kinase (approach: cytokines + suicide gene product)
  • RNA, preferably mRNA coding for IL-2 and/or RNA, preferably mRNA coding for IL-12
  • RNA, preferably mRNA coding for IL-12 and/or RNA, preferably mRNA coding for CD40L
  • RNA, preferably mRNA coding for IL-15 and/or RNA, preferably mRNA coding for IL-12
  • RNA, preferably mRNA coding for IL-2 + RNA, preferably mRNA coding for Influenza NP protein
  • RNA, preferably mRNA coding for IL-2 and/or RNA, preferably mRNA coding for IL-12 + RNA, preferably mRNA coding for cytochrome c/caspase 3 (cytokines + apoptosis induction)
  • RNA, preferably mRNA coding for CD40L + RNA, preferably mRNA coding for IL-12 + RNA, preferably mRNA coding for ΔRIGI


[0288] It has to be understood that the RNA molecules of the composition disclosed herein may code for one or more different peptides or proteins (e.g. cytokines, chemokines, suicide gene products, immunogenic proteins or peptides, apoptosis inducers, angiogenesis inhibitors, heat shock proteins, tumor antigens, β-catenin inhibitors, activators of the STING pathway, checkpoint modulators, innate immune activators, antibodies, dominant negative receptors and decoy receptors, inhibitors of myeloid derived suppressor cells (MDSCs), IDO pathway inhibitors, and proteins or peptides that bind inhibitors of apoptosis.as described above. Several RNA sequences may be combined in one RNA containing composition as disclosed herein. Moreover it is possible that the RNA sequence or sequences of the composition disclosed herein code for variants or fragments of the wild type protein sequence or for one or more parts or fragments of the wild type protein sequence or variants thereof.

Non coding RNA



[0289] According to the present disclosure, the at least one RNA of the RNA containing composition disclosed herein may comprise at least one non-coding RNA, which is preferably selected from the group consisting of small interfering RNA (siRNA), antisense RNA (asRNA), circular RNA (circRNA), ribozymes, aptamers, riboswitches, immunostimulating/immunostimulatory RNA RNA, transfer RNA (tRNA), ribosomal RNA (rRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), microRNA (miRNA), and Piwi-interacting RNA (piRNA). According to the invention as defined by the attached claims, the RNA containing composition comprises at least one non-coding, immunostimulating RNA.

Immunostimulatory/immunostimulating RNA (isRNA):



[0290] According to claimed and non-claimed embodiments, the at least one RNA of the RNA containing composition disclosed herein is an immunostimulatory/immunostimulating RNA, which preferably elicits an innate immune response. Such an immunostimulatory RNA may be any (double-stranded or single-stranded) RNA, e.g. a coding RNA, as defined herein. In a preferred embodiment, the immunostimulatory RNA is a non-coding RNA. Preferably, the immunostimulatory RNA may be a single-stranded, a double-stranded or a partially double-stranded RNA, more preferably a single-stranded RNA, and/or a circular or linear RNA, more preferably a linear RNA. More preferably, the immunostimulatory RNA may be a (linear) single-stranded RNA. Even more preferably, the immunostimulatory RNA may be a (long) (linear) single-stranded) non-coding RNA. In this context, it is particular preferred that the isRNA carries a triphosphate at its 5'-end which is the case for in vitro transcribed RNA. An immunostimulatory RNA may also occur as a short RNA oligonucleotide as defined herein.

[0291] An immunostimulatory RNA as used herein may furthermore be selected from any class of RNA molecules, found in nature or being prepared synthetically, and which can induce an innate immune response and may support an adaptive immune response induced by an antigen. In this context, an immune response may occur in various ways. A substantial factor for a suitable (adaptive) immune response is the stimulation of different T cell sub-populations. T-lymphocytes are typically divided into two sub-populations, the T-helper 1 (Th1) cells and the T-helper 2 (Th2) cells, with which the immune system is capable of destroying intracellular (Th1) and extracellular (Th2) pathogens (e.g. antigens). The two Th cell populations differ in the pattern of the effector proteins (cytokines) produced by them. Thus, Th1 cells assist the cellular immune response by activation of macrophages and cytotoxic T cells. Th2 cells, on the other hand, promote the humoral immune response by stimulation of B-cells for conversion into plasma cells and by formation of antibodies (e.g. against antigens). The Th1/Th2 ratio is therefore of great importance in the induction and maintenance of an adaptive immune response. In connection with the present disclosure, the Th1/Th2 ratio of the (adaptive) immune response is preferably shifted in the direction towards the cellular response (Th1 response) and a cellular immune response is thereby induced. According to one example, the innate immune system which may support an adaptive immune response may be activated by ligands of Toll-like receptors (TLRs). TLRs are a family of highly conserved pattern recognition receptor (PRR) polypeptides that recognize pathogen-associated molecular patterns (PAMPs) and play a critical role in innate immunity in mammals. Currently at least thirteen family members, designated TLR1 -TLR13 (Toll-like receptors: TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, TLR11, TLR12 or TLR13), have been identified. Furthermore, a number of specific TLR ligands have been identified. Furthermore, it has been reported that ligands for certain TLRs include certain nucleic acid molecules and that certain types of RNA are immunostimulatory in a sequence-independent or sequence-dependent manner, wherein these various immunostimulatory RNAs may e.g. stimulate TLR3, TLR7, or TLR8, or intracellular receptors such as RIG-I, MDA-5, etc.

[0292] Preferably, an immunostimulatory nucleic acid, preferably an immunostimulatory RNA (isRNA), as used herein, may comprise any RNA sequence known to be immunostimulatory, including, without being limited thereto, RNA sequences representing and/or encoding ligands of TLRs, preferably selected from human family members TLR1 - TLR10 or murine family members TLR1 - TLR13, more preferably selected from (human) family members TLR1 - TLR10, even more preferably from TLR7 and TLR8, ligands for intracellular receptors for RNA (such as RIG-I or MDA-5, etc.) (see e.g. Meylan, E., Tschopp, J. (2006). Toll-like receptors and RNA helicases: two parallel ways to trigger antiviral responses. Mol. Cell 22, 561-569), or any other immunostimulatory RNA sequence. Furthermore, (classes of) immunostimulatory RNA molecules, used as a further compound of the vaccine disclosed herein, may include any other RNA capable of eliciting an immune response. Without being limited thereto, such an immunostimulatory RNA may include ribosomal RNA (rRNA), transfer RNA (tRNA), messenger RNA (mRNA), and viral RNA (vRNA). Such an immunostimulatory RNA may comprise a length of 1000 to 5000, of 500 to 5000, of 5 to 5000, or of 5 to 1000, 5 to 500, 5 to 250, of 5 to 100, of 5 to 50 or of 5 to 30 nucleotides.

[0293] An immunostimulatory RNA as used herein may furthermore be selected from any class of RNA molecules, found in nature or being prepared synthetically, and which can induce an innate immune response and may support an adaptive immune response induced by an antigen. In this context, an immune response may occur in various ways. A substantial factor for a suitable (adaptive) immune response is the stimulation of different T-cell sub-populations. T-lymphocytes are typically divided into two sub-populations, the T-helper 1 (Th1) cells and the T-helper 2 (Th2) cells, with which the immune system is capable of destroying intracellular (Th1) and extracellular (Th2) pathogens (e.g. antigens). The two Th cell populations differ in the pattern of the effector proteins (cytokines) produced by them. Thus, Th1 cells assist the cellular immune response by activation of macrophages and cytotoxic T-cells. Th2 cells, on the other hand, promote the humoral immune response by stimulation of B-cells for conversion into plasma cells and by formation of antibodies (e.g. against antigens). The Th1/Th2 ratio is therefore of great importance in the induction and maintenance of an adaptive immune response. In connection with the present disclosure, the Th1/Th2 ratio of the (adaptive) immune response is preferably shifted in the direction towards the cellular response (Th1 response) and a cellular immune response is thereby induced. According to one example, the innate immune system which may support an adaptive immune response, may be activated by ligands of Toll-like receptors (TLRs). TLRs are a family of highly conserved pattern recognition receptor (PRR) polypeptides that recognize pathogen-associated molecular patterns (PAMPs) and play a critical role in innate immunity in mammals. Currently at least thirteen family members, designated TLR1 -TLR13 (Toll-like receptors: TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, TLR11, TLR12 or TLR13), have been identified. Furthermore, a number of specific TLR ligands have been identified. It was e.g. found that unmethylated bacterial DNA and synthetic analogs thereof (CpG DNA) are ligands for TLR9 (Hemmi H et al. (2000) Nature 408:740-5; Bauer S et al. (2001) Proc NatlAcadSci USA 98, 9237-42). Furthermore, it has been reported that ligands for certain TLRs include certain nucleic acid molecules and that certain types of RNA are immunostimulatory in a sequence-independent or sequence-dependent manner, wherein these various immunostimulatory RNAs may e.g. stimulate TLR3, TLR7, orTLR8, or intracellular receptors such as RIG-I, MDA-5, etc. E.g. Lipford et al. determined certain G,U-containing oligoribonucleotides as immunostimulatory by acting via TLR7 and TLR8 (see WO 03/086280). The immunostimulatory G,U-containing oligoribonucleotides described by Lipford et al. were believed to be derivable from RNA sources including ribosomal RNA, transfer RNA, messenger RNA, and viral RNA.

[0294] According to a particularly preferred embodiment, such immunostimulatory nucleic acid sequences is preferably RNA preferably consisting of or comprising a nucleic acid of the following formula (III) or (IV):

        GlXmGn ,     (formula (III))

wherein:

G is guanosine, uracil or an analogue of guanosine or uracil;

X is guanosine, uracil, adenosine, thymidine, cytosine or an analogue of the above-mentioned nucleotides;

l is an integer from 1 to 40,

wherein

when l = 1 G is guanosine or an analogue thereof,

when l > 1 at least 50% of the nucleotides are guanosine or an analogue thereof;

m is an integer and is at least 3;

wherein

when m = 3 X is uracil or an analogue thereof,
when m > 3 at least 3 successive uracils or analogues of uracil occur;

n is an integer from 1 to 40,

wherein

when n = 1 G is guanosine or an analogue thereof,

when n > 1 at least 50% of the nucleotides are guanosine or an analogue thereof.



        ClXmCn ,     (formula (IV))

wherein:

C is cytosine, uracil or an analogue of cytosine or uracil;

X is guanosine, uracil, adenosine, thymidine, cytosine or an analogue of the above-mentioned nucleotides;

l is an integer from 1 to 40,

wherein

when l = 1 C is cytosine or an analogue thereof,

when l > 1 at least 50% of the nucleotides are cytosine or an analogue thereof;

m is an integer and is at least 3;

wherein

when m = 3 X is uracil or an analogue thereof,

when m > 3 at least 3 successive uracils or analogues of uracil occur;

n is an integer from 1 to 40,

wherein

when n = 1 C is cytosine or an analogue thereof,

when n > 1 at least 50% of the nucleotides are cytosine or an analogue thereof.



[0295] The nucleic acids of formula (II) or (III), which may be used as immunostimulatory RNA may be relatively short nucleic acid molecules with a typical length of approximately from 5 to 100 (but may also be longer than 100 nucleotides for specific embodiments, e.g. up to 200 nucleotides), from 5 to 90 or from 5 to 80 nucleotides, preferably a length of approximately from 5 to 70, more preferably a length of approximately from 8 to 60 and, more preferably a length of approximately from 15 to 60 nucleotides, more preferably from 20 to 60, most preferably from 30 to 60 nucleotides. If the nucleic acid of the nucleic acid cargo complex has a maximum length of e.g. 100 nucleotides, m will typically be <=98. The number of nucleotides G in the nucleic acid of formula (III) is determined by l or n. l and n, independently of one another, are each an integer from 1 to 40, wherein when l or n = 1 G is guanosine or an analogue thereof, and when l or n > 1 at least 50% of the nucleotides are guanosine or an analogue thereof. For example, without implying any limitation, when l or n = 4 Gl or Gn can be, for example, a GUGU, GGUU, UGUG, UUGG, GUUG, GGGU, GGUG, GUGG, UGGG or GGGG, etc.; when l or n = 5 Gl or Gn can be, for example, a GGGUU, GGUGU, GUGGU, UGGGU, UGGUG, UGUGG, UUGGG, GUGUG, GGGGU, GGGUG, GGUGG, GUGGG, UGGGG, or GGGGG, etc.; etc. A nucleotide adjacent to Xm in the nucleic acid of formula (III) is preferably not a uracil. Similarly, the number of nucleotides C in the nucleic acid of formula (IV) is determined by l or n. l and n, independently of one another, are each an integer from 1 to 40, wherein when l or n = 1 C is cytosine or an analogue thereof, and when l or n > 1 at least 50% of the nucleotides are cytosine or an analogue thereof. For example, without implying any limitation, when l or n = 4, Cl or Cn can be, for example, a CUCU, CCUU, UCUC, UUCC, CUUC, CCCU, CCUC, CUCC, UCCC or CCCC, etc.; when l or n = 5 Cl or Cn can be, for example, a CCCUU, CCUCU, CUCCU, UCCCU, UCCUC, UCUCC, UUCCC, CUCUC, CCCCU, CCCUC, CCUCC, CUCCC, UCCCC, or CCCCC, etc.; etc. A nucleotide adjacent to Xm in the nucleic acid of formula (III) is preferably not a uracil. Preferably, for formula (II), when l or n > 1, at least 60%, 70%, 80%, 90% or even 100% of the nucleotides are guanosine or an analogue thereof, as defined above. The remaining nucleotides to 100% (when guanosine constitutes less than 100% of the nucleotides) in the flanking sequences G1 and/orGn are uracil or an analogue thereof, as defined hereinbefore. Also preferably, l and n, independently of one another, are each an integer from 2 to 30, more preferably an integer from 2 to 20 and yet more preferably an integer from 2 to 15. The lower limit of l or n can be varied if necessary and is at least 1, preferably at least 2, more preferably at least 3, 4, 5, 6, 7, 8, 9 or 10. This definition applies correspondingly to formula (III).

[0296] According to a particularly preferred embodiment, a nucleic acid according to any of formulas (III) or (IV) above, which may be used as immunostimulatory RNA, may be selected from a sequence consisting or comprising any of the following sequences SEQ ID NOs 298 - 381.
or from a sequence having at least 60%, 70%, 80%, 90%, or even 95% sequence identity with any of these sequences
According to a further particularly preferred embodiment, such immunostimulatory nucleic acid sequences particularly isRNA consist of or comprise a nucleic acid of formula (V) or (VI):

        (NuGlXmGnNv)a ,     (formula (V))

wherein:

G is guanosine (guanine), uridine (uracil) or an analogue of guanosine (guanine) or uridine (uracil), preferably guanosine (guanine) or an analogue thereof;

X is guanosine (guanine), uridine (uracil), adenosine (adenine), thymidine (thymine), cytidine (cytosine), or an analogue of these nucleotides (nucleosides), preferably uridine (uracil) or an analogue thereof;

N is a nucleic acid sequence having a length of about 4 to 50, preferably of about 4 to 40, more preferably of about 4 to 30 or 4 to 20 nucleic acids, each N independently being selected from guanosine (guanine), uridine (uracil), adenosine (adenine), thymidine (thymine), cytidine (cytosine) or an analogue of these nucleotides (nucleosides);

a is an integer from 1 to 20, preferably from 1 to 15, most preferably from 1 to 10;

l is an integer from 1 to 40,

wherein when l = 1, G is guanosine (guanine) or an analogue thereof,
when l > 1, at least 50% of these nucleotides (nucleosides) are guanosine (guanine) or an analogue thereof;

m is an integer and is at least 3;

wherein when m = 3, X is uridine (uracil) or an analogue thereof, and
when m > 3, at least 3 successive uridines (uracils) or analogues of uridine (uracil) occur;

n is an integer from 1 to 40,

wherein when n = 1, G is guanosine (guanine) or an analogue thereof,
when n > 1, at least 50% of these nucleotides (nucleosides) are guanosine (guanine) or an analogue thereof;

u,v may be independently from each other an integer from 0 to 50,

preferably wherein when u = 0, v ≥ 1, or
when v = 0, u ≥ 1;

wherein the nucleic acid molecule of formula (IV) has a length of at least 50 nucleotides, preferably of at least 100 nucleotides, more preferably of at least 150 nucleotides, even more preferably of at least 200 nucleotides and most preferably of at least 250 nucleotides.



        (NuClXmCnNv)a ,     (formula (VI))

wherein:

C is cytidine (cytosine), uridine (uracil) or an analogue of cytidine (cytosine) or uridine (uracil), preferably cytidine (cytosine) or an analogue thereof;

X is guanosine (guanine), uridine (uracil), adenosine (adenine), thymidine (thymine), cytidine (cytosine) or an analogue of the above-mentioned nucleotides (nucleosides), preferably uridine (uracil) or an analogue thereof;

N is each a nucleic acid sequence having independent from each other a length of about 4 to 50, preferably of about 4 to 40, more preferably of about 4 to 30 or 4 to 20 nucleic acids, each N independently being selected from guanosine (guanine), uridine (uracil), adenosine (adenine), thymidine (thymine), cytidine (cytosine) or an analogue of these nucleotides (nucleosides);

a is an integer from 1 to 20, preferably from 1 to 15, most preferably from 1 to 10;

l is an integer from 1 to 40,

wherein when l = 1, C is cytidine (cytosine) or an analogue thereof,
when l > 1, at least 50% of these nucleotides (nucleosides) are cytidine (cytosine) or an analogue thereof;

m is an integer and is at least 3;

wherein when m = 3, X is uridine (uracil) or an analogue thereof,
when m > 3, at least 3 successive uridines (uracils) or analogues of uridine (uracil) occur;

n is an integer from 1 to 40,

wherein when n = 1, C is cytidine (cytosine) or an analogue thereof,
when n > 1, at least 50% of these nucleotides (nucleosides) are cytidine (cytosine) or an analogue thereof.

u, v may be independently from each other an integer from 0 to 50,

preferably wherein when u = 0, v ≥ 1, or
when v = 0, u ≥ 1;

wherein the nucleic acid molecule of formula (V) has a length of at least 50 nucleotides, preferably of at least 100 nucleotides, more preferably of at least 150 nucleotides, even more preferably of at least 200 nucleotides and most preferably of at least 250 nucleotides.



[0297] For formula (VI), any of the definitions given above for elements N (i.e. Nu and Nv) and X (Xm), particularly the core structure as defined above, as well as for integers a, l, m, n, u and v, similarly apply to elements of formula (VI) correspondingly, wherein in formula (VI) the core structure is defined by ClXmCn. The definition of bordering elements Nu and Nv is identical to the definitions given above for Nu and Nv.

[0298] According to a very particularly preferred embodiment, the nucleic acid molecule, preferably immunostimulating RNA according to formula (V) may be selected from e.g. any of the sequences according to SEQ ID NOs 382-395 or from a sequence having at least 60%, 70%, 80%, 90%, or even 95% sequence identity with any of these sequences.

[0299] In this context particularly preferred are immunostimulating RNAs according to SEQ ID NOs 5, 394 and 10072.

R2025:

R3630:



[0300] According to another very particularly preferred embodiment, the nucleic acid molecule according to formula (VI) may be selected from e.g. any of the sequences according to SEQ ID NO 396 or 397, or from a sequence having at least 60%, 70%, 80%, 90%, or even 95% sequence identity with any of these sequences.

[0301] All modifications disclosed in the context of coding RNA may also be applied in the context of non-coding RNA if applicable.

Combination of coding and non-coding RNA



[0302] In particularly preferred embodiments the RNA containing composition disclosed herein comprises at least one RNA encoding at least one peptide or protein and at least one non-coding RNA as defined above, preferably at least one immunostimulating RNA.

[0303] Particularly preferred are the following embodiments:
  • Immostimulating RNA preferably according to SEQ ID Nos 5, 394, or 10072 + RNA, preferably mRNA coding for at least one cytokine, preferably IL-2, IL-12, IL-15 or CD40L
  • Immostimulating RNA preferably according to SEQ ID Nos 5, 394, or 10072 + RNA, preferably mRNA coding for at least one chemokine
  • Immostimulating RNA preferably according to SEQ ID Nos 5, 394, or 10072 + RNA, preferably mRNA coding for at least one suicide gene product, preferably Herpes simplex virus thymidine kinase
  • Immostimulating RNA preferably according to SEQ ID Nos 5, 394, or 10072 + RNA, preferably mRNA coding for at least one immunogenic protein or peptide, preferably Influenza NP protein
  • Immostimulating RNA preferably according to SEQ ID Nos 5, 394, or 10072 + RNA, preferably mRNA coding for at least one apoptosis inducer, preferably cytochrome c or caspase 3
  • Immostimulating RNA preferably according to SEQ ID Nos 5, 394, or 10072 + RNA, preferably mRNA coding for at least one angiogenesis inducer
  • Immostimulating RNA preferably according to SEQ ID Nos 5, 394, or 10072 + RNA, preferably mRNA coding for at least one heat shock protein
  • Immostimulating RNA preferably according to SEQ ID Nos 5, 394, or 10072 + RNA, preferably mRNA coding for at least one tumor antigen
  • Immostimulating RNA preferably according to SEQ ID Nos 5, 394, or 10072 + RNA, preferably mRNA coding for at least one β-catenin inhibitor
  • Immostimulating RNA preferably according to SEQ ID Nos 5, 394, or 10072 + RNA, preferably mRNA coding for at least one activator of the STING pathway
  • Immostimulating RNA preferably according to SEQ ID Nos 5, 394, or 10072 + RNA, preferably mRNA coding for at least one checkpoint modulator, preferably an antibody directed against PD-1, PD-L1 or CTLA4
  • Immostimulating RNA preferably according to SEQ ID Nos 5, 394, or 10072 + RNA, preferably mRNA coding for at least one innate immune activator, preferably a constitutive active variant of RIG-1
  • Immostimulating RNA preferably according to SEQ ID Nos 5, 394, or 10072 + RNA, preferably mRNA coding for at least one antibody
  • Immostimulating RNA preferably according to SEQ ID Nos 5, 394, or 10072 + RNA, preferably mRNA coding for at least one decoy receptor, preferably a soluble PD-1 receptor
  • Immostimulating RNA preferably according to SEQ ID Nos 5, 394, or 10072 + RNA, preferably mRNA coding for at least one inhibitor of myeloid derived suppressor cells (MDSCs)
  • Immostimulating RNA preferably according to SEQ ID Nos 5, 394, or 10072 + RNA, preferably mRNA coding for at least one IDO pathway inhibitor
  • Immostimulating RNA preferably according to SEQ ID Nos XY or YY + RNA, preferably mRNA coding for at least one protein or peptide that bind inhibitors of apoptosis.


[0304] More particularly preferred are the following embodiments:
  • Immostimulating RNA preferably according SEQ ID Nos 5, 394, or 10072 + RNA, preferably mRNA coding for at least one cytokine, preferably IL-2, IL-12, IL-15 or CD40L + RNA, preferably mRNA coding for at least one immunogenic protein or peptide, preferably Influenza NP protein
  • Immostimulating RNA preferably according to SEQ ID Nos 5, 394, or 10072 + RNA, preferably mRNA coding for at least one cytokine, preferably IL-2, IL-12, IL-15 or CD40L + RNA, preferably mRNA coding for at least one innate immune activator, preferably a constitutive active variant of RIG-1
  • Immostimulating RNA preferably according to SEQ ID Nos 5, 394, or 10072 + RNA, preferably mRNA coding for at least one cytokine, preferably IL-2, IL-12, or IL-15, + RNA, preferably mRNA coding for at least one further cytokine, preferably CD40L.

Formulation and Complexation



[0305] The at least one RNA of the composition disclosed herein may be administered naked without being associated with any further vehicle, carrier, transfection or complexation agent.

[0306] In a preferred embodiment, the RNA of the composition disclosed herein is formulated together with further compounds for increasing the transfection efficiency and/or the immunostimulatory properties of the RNA. Such compounds are termed herein carriers, vehicles, transfection or complexation agents. Preferably, the RNA is formulated together with one or more cationic or polycationic compounds, preferably with cationic or polycationic polymers, cationic or polycationic peptides or proteins, cationic or polycationic polysaccharides, cationic or polycationic lipids and/or with a polymeric carrier. Such cationic or polycationic polymers, cationic or polycationic peptides or proteins, cationic or polycationic polysaccharides, cationic or polycationic lipids or polymeric carriers are useful as carriers, vehicles, transfection or complexation agents of nucleic acids in the context of the present disclosure. Accordingly, in a further embodiment disclosed herein, it is preferred that the at least one RNA or any other nucleic acid comprised in the composition disclosed herein is associated with or complexed with a cationic or polycationic compound or a polymeric carrier, optionally in a weight ratio selected from a range of about 6:1 (w/w) to about 0.25:1 (w/w), more preferably from about 5:1 (w/w) to about 0.5:1 (w/w), even more preferably of about 4:1 (w/w) to about 1:1 (w/w) or of about 3:1 (w/w) to about 1:1 (w/w), and most preferably a ratio of about 3:1 (w/w) to about 2:1 (w/w) of RNA or nucleic acid to cationic or polycationic compound and/or with a polymeric carrier; or optionally in a nitrogen/phosphate ratio of RNA or nucleic acid to cationic or polycationic compound and/or polymeric carrier in the range of about 0.1-10, preferably in a range of about 0.3-4 or 0.3-1, and most preferably in a range of about 0.5-1 or 0.7-1, and even most preferably in a range of about 0.3-0.9 or 0.5-0.9.

[0307] The ratio of the at least one RNA as described above, and the cationic or polycationic compound, may be calculated on the basis of the nitrogen/phosphate ratio (N/P-ratio) of all these components. In the context of the present disclosure, an N/P-ratio is preferably in the range of about 0.01-4, 0.01-2, 0.1-2 or 0.1-1.5 regarding the ratio of nucleic acids: cationic or polycationic peptide contained in the vaccine disclosed herein, and most preferably in the range of about 0.1-1. Such an N/P ratio is preferably designed to provide good transfection properties in vivo and transport into and through cell membranes. Preferably, for this purpose, cationic or polycationic compound and/or polymeric carriers as used herein, are based on peptide sequences.

[0308] Cationic or polycationic compounds, being particularly preferred agents in this context include protamine, nucleoline, spermine or spermidine, or other cationic peptides or proteins, such as poly-L-lysine (PLL), poly-arginine, basic polypeptides, cell penetrating peptides (CPPs), including HIV-binding peptides, HIV-1 Tat (HIV), Tat-derived peptides, Penetratin, VP22 derived or analog peptides, HSV VP22 (Herpes simplex), MAP, KALA or protein transduction domains (PTDs), PpT620, proline-rich peptides, arginine-rich peptides, lysine-rich peptides, MPG-peptide(s), Pep-1, L-oligomers, Calcitonin peptide(s), Antennapedia-derived peptides (particularly from Drosophila antennapedia), pAntp, plsl, FGF, Lactoferrin, Transportan, Buforin-2, Bac715-24, SynB, SynB(1), pVEC, hCT-derived peptides, SAP, or histones.

[0309] In this context protamine is particularly preferred.

[0310] Additionally, preferred cationic or polycationic proteins or peptides may be selected from the following proteins or peptides having the following total formula (VII):

        (Arg)l;(Lys)m;(His)n;(Orn)o;(Xaa)x,     (formula (VII)

wherein l + m + n+o + x = 8-15, and l, m, n or o independently of each other may be any number selected from 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15, provided that the overall content of Arg, Lys, His and Orn represents at least 50% of all amino acids of the oligopeptide; and Xaa may be any amino acid selected from native (= naturally occurring) or non-native amino acids except of Arg, Lys, His or Orn; and x may be any number selected from 0, 1, 2, 3 or 4, provided, that the overall content of Xaa does not exceed 50 % of all amino acids of the oligopeptide. Particularly preferred cationic peptides in this context are e.g. Arg7, Arg8, Arg9, H3R9, R9H3, H3R9H3, YSSR9SSY, (RKH)4, Y(RKH)2R, etc. In this context, reference is made to the disclosure of WO 2009/030481.

[0311] A polymeric carrier used according to the present disclosure might be a polymeric carrier formed by disulfide-crosslinked cationic components.

[0312] According to a further particularly preferred embodiment, cationic or polycationic peptides or proteins of the polymeric carrier, having the empirical sum formula (VII) as shown above and which comprise or are additionally modified to comprise at least one -SH moeity, may be, without being restricted thereto, selected from the subgroup consisting of generic formulas Arg7 (also termed as R7), Arg9 (also termed R9), Arg12 (also termed as R12).

[0313] According to a one further particularly preferred embodiment, the cationic or polycationic peptide or protein of the polymeric carrier, when defined according to formula {(Arg)l;(Lys)m;(His)n;(Orn)o;(Xaa)x} (formula (VII)) as shown above and which comprise or are additionally modified to comprise at least one -SH moeity, may be, without being restricted thereto, selected from subformula (Vila):

        {(Arg)l;(Lys)m;(His)n;(Orn)o;(Xaa')x (Cys)y}     formula (Vila)

wherein (Arg)l;(Lys)m;(His)n;(Orn)o; and x are as defined herein, Xaa' is any amino acid selected from native (= naturally occurring) or non-native amino acids except of Arg, Lys, His, Orn or Cys and y is any number selected from 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21-30, 31-40, 41-50, 51-60, 61-70, 71-80 and 81-90, provided that the overall content of Arg (Arginine), Lys (Lysine), His (Histidine) and Orn (Ornithine) represents at least 10% of all amino acids of the oligopeptide.

[0314] This embodiment may apply to situations, wherein the cationic or polycationic peptide or protein of the polymeric carrier, e.g. when defined according to empirical formula (Arg)l;(Lys)m;(His)n;(Orn)o;(Xaa)x (formula (VII)) as shown above, comprises or has been modified with at least one cysteine as -SH moiety in the above meaning such that the cationic or polycationic peptide as cationic component carries at least one cysteine, which is capable to form a disulfide bond with other components of the polymeric carrier.

[0315] Exemplary examples may comprise any of the following sequences:
Cys(Arg7), Cys(Arg8), Cys(Arg9), Cys(Arg10), Cys(Arg11), Cys(Arg12), Cys(Argl3), Cys(Arg14), Cys(Arg15), Cys(Arg16), Cys(Arg17), Cys(Arg18), Cys(Arg19), Cys(Arg20).

[0316] According to another particularly preferred embodiment, the cationic or polycationic peptide or protein of the polymeric carrier, when defined according to formula {(Arg)l;(Lys)m;(His)n;(Orn)o;(Xaa)x} (formula (VII)) as shown above, may be, without being restricted thereto, selected from subformula (Vllb):

        Cys1 {(Arg)l;(Lys)m;(His)n;(Orn)o;(Xaa)x} Cys2     (formula (VIIb))

wherein empirical formula {(Arg)l;(Lys)m;(His)n;(Orn)o;(Xaa)x} (formula (VII)) is as defined herein and forms a core of an amino acid sequence according to (semiempirical) formula (I) and wherein Cys1 and Cys2 are Cysteines proximal to, or terminal to (Arg)l;(Lys)m;(His)n;(Orn)o;(Xaa)x. Exemplary examples may comprise any of the above sequences flanked by two Cys and following sequences: Cys(Arg7)Cys, Cys(Arg8)Cys, Cys(Arg9)Cys, Cys(Arg10)Cys, Cys(Arg11)Cys, Cys(Arg12)Cys, Cys(Arg13)Cys, Cys(Arg14)Cys, Cys(Arg15)Cys, Cys(Arg16)Cys, Cys(Arg17)Cys, Cys(Arg18)Cys, Cys(Arg19)Cys, Cys(Arg20)Cys (SEQ ID NOs: 10-23):

[0317] This embodiment may apply to situations, wherein the cationic or polycationic peptide or protein of the polymeric carrier, e.g. when defined according to empirical formula (Arg)l;(Lys)m;(His)n;(Orn)o;(Xaa)x (formula (VII)) as shown above, has been modified with at least two cysteines as-SH moieties in the above meaning such that the cationic or polycationic peptide of the polymeric carrier cargo complex disclosed herein as cationic component carries at least two (terminal) cysteines, which are capable to form a disulfide bond with other components of the polymeric carrier.

[0318] In a preferred embodiment, the polymeric carrier is formed by, comprises or consists of the peptide CysArg12Cys (SEQ ID NO: 15) or CysArg12 (CRRRRRRRRRRRR).

[0319] According to a second alternative, at least one cationic (or polycationic) component of the polymeric carrier may be selected from e.g. any (non-peptidic) cationic or polycationic polymer suitable in this context, provided that this (non-peptidic) cationic or polycationic polymer exhibits or is modified to exhibit at least one -SH-moiety, which provide for a disulfide bond linking the cationic or polycationic polymer with another component of the polymeric carrier as defined herein. Thus, likewise as defined herein, the polymeric carrier may comprise the same or different cationic or polycationic polymers.

[0320] In the specific case that the cationic component of the polymeric carrier comprises a (non-peptidic) cationic or polycationic polymer the cationic properties of the (non-peptidic) cationic or polycationic polymer may be determined upon its content of cationic charges when compared to the overall charges of the components of the cationic polymer. Preferably, the content of cationic charges in the cationic polymer at a (physiological) pH as defined herein is at least 10%, 20%, or 30%, preferably at least 40%, more preferably at least 50%, 60% or 70%, but also preferably at least 80%, 90%, or even 95%, 96%, 97%, 98%, 99% or 100%, most preferably at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100%, or may be in the range of about 10% to 90%, more preferably in the range of about 30% to 100%, even preferably in the range of about 50% to 100%, e.g. 50, 60, 70, 80%, 90% or 100%, or in a range formed by any two of the afore mentioned values, provided, that the content of all charges, e.g. positive and negative charges at a (physiological) pH as defined herein, in the entire cationic polymer is 100%.

[0321] Preferably, the (non-peptidic) cationic component of the polymeric carrier represents a cationic or polycationic polymer, typically exhibiting a molecular weight of about 0.1 or 0.5 kDa to about 100 kDa, preferably of about 1 kDa to about 75 kDa, more preferably of about 5 kDa to about 50 kDa, even more preferably of about 5 kDa to about 30 kDa, or a molecular weight of about 10 kDa to about 50 kDa, even more preferably of about 10 kDa to about 30 kDa. Additionally, the (non-peptidic) cationic or polycationic polymer typically exhibits at least one -SH-moiety, which is capable to form a disulfide linkage upon condensation with either other cationic components or other components of the polymeric carrier as defined herein.

[0322] In the above context, the (non-peptidic) cationic component of the polymeric carrier may be selected from acrylates, modified acrylates, such as pDMAEMA (poly(dimethylaminoethyl methylacrylate)), chitosanes, aziridines or 2-ethyl-2-oxazoline (forming oligo ethylenimines or modifed oligoethylenimines), polymers obtained by reaction of bisacrylates with amines forming oligo beta aminoesters or poly amido amines, or other polymers like polyesters, polycarbonates, etc. Each molecule of these (non-peptidic) cationic or polycationic polymers typically exhibits at least one -SH-moiety, wherein these at least one -SH-moiety may be introduced into the (non-peptidic) cationic or polycationic polymer by chemical modifications, e.g. using imonothiolan, 3-thio propionic acid or introduction of -SH-moieties containing amino acids, such as cysteine or any further (modified) amino acid. Such -SH-moieties are preferably as already defined above.

[0323] The disulfide-crosslinked cationic components may be the same or different from each other. The polymeric carrier can also contain further components. It is also particularly preferred that the polymeric carrier used according to the present disclosure comprises mixtures of cationic peptides, proteins or polymers and optionally further components as defined herein, which are crosslinked by disulfide bonds as described herein. In this context, reference is made to the disclosure of WO 2012/013326.

[0324] In this context the cationic components, which form basis for the polymeric carrier by disulfide-crosslinkage, are typically selected from any suitable cationic or polycationic peptide, protein or polymer suitable for this purpose, particular any cationic or polycationic peptide, protein or polymer capable to complex an RNA or a nucleic acid as defined according to the present disclosure, and thereby preferably condensing the RNA or the nucleic acid. The cationic or polycationic peptide, protein or polymer, is preferably a linear molecule, however, branched cationic or polycationic peptides, proteins or polymers may also be used.

[0325] Every disulfide-crosslinking cationic or polycationic protein, peptide or polymer of the polymeric carrier, which may be used to complex the RNA of the composition disclosed herein or any further nucleic acid comprised in the composition disclosed herein contains at least one -SH moiety, most preferably at least one cysteine residue or any further chemical group exhibiting an -SH moiety, capable to form a disulfide linkage upon condensation with at least one further cationic or polycationic protein, peptide or polymer as cationic component of the polymeric carrier as mentioned herein.

[0326] As defined above, the polymeric carrier, which may be used to complex the RNA of the composition disclosed herein or any further nucleic acid comprised in the composition disclosed herein may be formed by disulfide-crosslinked cationic (or polycationic) components.

[0327] Nucleic acids complexed with such polymeric carriers are also termed herein as "polymeric carrier cargo complexes".

[0328] In this context it is particularly preferred that the immunostimulating RNA used in the context of the present disclosure is complexed with a polymeric carrier as defined above. Preferably, the immunostimulating RNA, (e.g. comprising an RNA sequence according to any of formulae III-VI), most preferably comprising an RNA sequence according to SEQ ID NOs. 5, 394, or 10072, is complexed with a polymeric carrier comprising or formed by disulfide-crosslinked peptides according to formula VII, Vila or Vllb, preferably a polymeric carrier formed by Cys(Arg12)Cys or Cys(Arg12). Such a particularly preferred embodiment is termed herein also as "RNAdjuvant".

[0329] In a further particular embodiment, the polymeric carrier which may be used to complex the RNA or any further nucleic acid comprised in the composition disclosed herein may be selected from a polymeric carrier molecule according to generic formula (VIII):

        L-P1-S-[S-P2-S]n-S-P3-L     formula (VIII)

wherein,
P1 and P3
are different or identical to each other and represent a linear or branched hydrophilic polymer chain, each P1 and P3 exhibiting at least one -SH-moiety, capable to form a disulfide linkage upon condensation with component P2, or alternatively with (AA), (AA)x, or [(AA)x]z if such components are used as a linker between P1 and P2 or P3 and P2 and/or with further components (e.g. (AA), (AA)x, [(AA)x]z or L), the linear or branched hydrophilic polymer chain selected independent from each other from polyethylene glycol (PEG), poly-N-(2-hydroxypropyl)methacrylamide, poly-2-(methacryloyloxy)ethyl phosphorylcholines, poly(hydroxyalkyl L-asparagine), poly(2-(methacryloyloxy)ethyl phosphorylcholine), hydroxyethylstarch or poly(hydroxyalkyl L-glutamine), wherein the hydrophilic polymer chain exhibits a molecular weight of about 1 kDa to about 100 kDa, preferably of about 2 kDa to about 25 kDa; or more preferably of about 2 kDa to about 10 kDa, e.g. about 5 kDa to about 25 kDa or 5 kDa to about 10 kDa;
P2
is a cationic or polycationic peptide or protein, e.g. as defined above for the polymeric carrier formed by disulfide-crosslinked cationic components, and preferably having a length of about 3 to about 100 amino acids, more preferably having a length of about 3 to about 50 amino acids, even more preferably having a length of about 3 to about 25 amino acids, e.g. a length of about 3 to 10, 5 to 15, 10 to 20 or 15 to 25 amino acids, more preferably a length of about 5 to about 20 and even more preferably a length of about 10 to about 20; or
is a cationic or polycationic polymer, e.g. as defined above for the polymeric carrier formed by disulfide-crosslinked cationic components, typically having a molecular weight of about 0.5 kDa to about 30 kDa, including a molecular weight of about 1 kDa to about 20 kDa, even more preferably of about 1.5 kDa to about 10 kDa, or having a molecular weight of about 0.5 kDa to about 100 kDa, including a molecular weight of about 10 kDa to about 50 kDa, even more preferably of about 10 kDa to about 30 kDa;
each P2 exhibiting at least two -SH-moieties, capable to form a disulfide linkage upon condensation with further components P2 or component(s) P1 and/or P3 or alternatively with further components (e.g. (AA), (AA)x, or [(AA)x]z);
-S-S-
is a (reversible) disulfide bond (the brackets are omitted for better readability), wherein S preferably represents sulphur or a -SH carrying moiety, which has formed a (reversible) disulfide bond. The (reversible) disulfide bond is preferably formed by condensation of-SH-moieties of either components P1 and P2, P2 and P2, or P2 and P3, or optionally of further components as defined herein (e.g. L, (AA), (AA)x, [(AA)x]z, etc); The -SH-moiety may be part of the structure of these components or added by a modification as defined below;
L
is an optional ligand, which may be present or not, and may be selected independent from the other from RGD, Transferrin, Folate, a signal peptide or signal sequence, a localization signal or sequence, a nuclear localization signal or sequence (NLS), an antibody, a cell penetrating peptide, (e.g. TAT or KALA), a ligand of a receptor (e.g. cytokines, hormones, growth factors etc), small molecules (e.g. carbohydrates like mannose or galactose or synthetic ligands), small molecule agonists, inhibitors or antagonists of receptors (e.g. RGD peptidomimetic analogues), or any further protein as defined herein, etc.;
n
is an integer, typically selected from a range of about 1 to 50, preferably from a range of about 1, 2 or 3 to 30, more preferably from a range of about 1, 2, 3, 4, or 5 to 25, or a range of about 1, 2, 3, 4, or 5 to 20, or a range of about 1, 2, 3, 4, or 5 to 15, or a range of about 1, 2, 3, 4, or 5 to 10, including e.g. a range of about 4 to 9, 4 to 10, 3 to 20, 4 to 20, 5 to 20, or 10 to 20, or a range of about 3 to 15, 4 to 15, 5 to 15, or 10 to 15, or a range of about 6 to 11 or 7 to 10. Most preferably, n is in a range of about 1, 2, 3, 4, or 5 to 10, more preferably in a range of about 1, 2, 3, or 4 to 9, in a range of about 1, 2, 3, or 4 to 8, or in a range of about 1, 2, or 3 to 7.


[0330] In this context, reference is made to the disclosure of WO 2011/026641 and WO 2012/116811. Each of hydrophilic polymers P1 and P3 typically exhibits at least one -SH-moiety, wherein the at least one -SH-moiety is capable to form a disulfide linkage upon reaction with component P2 or with component (AA) or (AA)x, if used as linker between P1 and P2 or P3 and P2 as defined below and optionally with a further component, e.g. L and/or (AA) or (AA)x, e.g. if two or more -SH-moieties are contained. The following subformulae "P1-S-S-P2" and "P2-S-S-P3" within the generic formula above, wherein any of S, P1 and P3 are as defined herein, typically represent a situation, wherein one -SH-moiety of hydrophilic polymers P1 and P3 was condensed with one -SH-moiety of component P2 of the generic formula above, wherein both sulphurs of these -SH-moieties form a disulfide bond -S-S-. These -SH-moieties are typically provided by each of the hydrophilic polymers P1 and P3, e.g. via an internal cysteine or any further (modified) amino acid or compound which carries a -SH moiety. Accordingly, the subformulae "P1-S-S-P2" and "P2-S-S-P3" may also be written as "P1-Cys-Cys-P2" and "P2-Cys-Cys-P3", if the -SH- moiety is provided by a cysteine, wherein the term Cys-Cys represents two cysteines coupled via a disulfide bond, not via a peptide bond. In this case, the term "-S-S-" in these formulae may also be written as "-S-Cys", as "-Cys-S" or as "-Cys-Cys-". In this context, the term "-Cys-Cys-" does not represent a peptide bond but a linkage of two cysteines via their -SH-moieties to form a disulfide bond. Accordingly, the term "-Cys-Cys-" also may be understood generally as "-(Cys-S)-(S-Cys)-", wherein in this specific case S indicates the sulphur of the -SH-moiety of cysteine. Likewise, the terms "-S-Cys" and "-Cys-S" indicate a disulfide bond between a -SH containing moiety and a cysteine, which may also be written as "-S-(S-Cys)" and "-(Cys-S)-S". Alternatively, the hydrophilic polymers P1 and P3 may be modified with a -SH moiety, preferably via a chemical reaction with a compound carrying a -SH moiety, such that each of the hydrophilic polymers P1 and P3 carries at least one such -SH moiety. Such a compound carrying a -SH moiety may be e.g. an (additional) cysteine or any further (modified) amino acid, which carries a -SH moiety. Such a compound may also be any non-amino compound or moiety, which contains or allows to introduce a -SH moiety into hydrophilic polymers P1 and P3 as defined herein. Such non-amino compounds may be attached to the hydrophilic polymers P1 and P3 of the polymeric carrier via chemical reactions or binding of compounds, e.g. by binding of a 3-thio propionic acid or thioimolane, by amide formation (e.g. carboxylic acids, sulphonic acids, amines, etc), by Michael addition (e.g maleinimide moieties, unsatured carbonyls, etc), by click chemistry (e.g. azides or alkines), by alkene/alkine methatesis (e.g. alkenes or alkines), imine or hydrozone formation (aldehydes or ketons, hydrazins, hydroxylamins, amines), complexation reactions (avidin, biotin, protein G) or components which allow Sn-type substitution reactions (e.g halogenalkans, thiols, alcohols, amines, hydrazines, hydrazides, sulphonic acid esters, oxyphosphonium salts) or other chemical moieties which can be utilized in the attachment of further components. A particularly preferred PEG derivate in this context is alpha-Methoxy-omega-mercapto poly(ethylene glycol). In each case, the SH-moiety, e.g. of a cysteine or of any further (modified) amino acid or compound, may be present at the terminal ends or internally at any position of hydrophilic polymers P1 and P3. As defined herein, each of hydrophilic polymers P1 and P3 typically exhibits at least one -SH-moiety preferably at one terminal end, but may also contain two or even more -SH-moieties, which may be used to additionally attach further components as defined herein, preferably further functional peptides or proteins e.g. a ligand, an amino acid component (AA) or (AA)x, antibodies, cell penetrating peptides or enhancer peptides (e.g. TAT, KALA), etc.

[0331] As defined above, ligands (L), may be optionally used in the polymeric carrier molecule according to generic formula (VIII), e.g. for direction of the carrier polymer and its entire "cargo" (the adjuvant component and/or the antigen of the composition or vaccine composition disclosed herein) into specific cells. They may be selected independent from the other from RGD, Transferrin, Folate, a signal peptide or signal sequence, a localization signal or sequence, a nuclear localization signal or sequence (NLS), an antibody, a cell penetrating peptide (CPP), (e.g. TAT, KALA), a ligand of a receptor (e.g. cytokines, hormones, growth factors etc), small molecules (e.g. carbohydrates like mannose or galactose or synthetic ligands), small molecule agonists, inhibitors or antagonists of receptors (e.g. RGD peptidomimetic analogues) or any such molecule as further defined below, etc. Particularly preferred are cell penetrating peptides (CPPs), which induce a pH-mediated conformational change in the endosome and lead to an improved release of the polymeric carrier (in complex with a nucleic acid) from the endosome by insertion into the lipid layer of the liposome. Such called CPPs or cationic peptides for transportation, may include, without being limited thereto protamine, nucleoline, spermine or spermidine, poly-L-lysine (PLL), basic polypeptides, poly-arginine, chimeric CPPs, such as Transportan, or MPG peptides, HIV-binding peptides, Tat, HIV-1 Tat (HIV), Tat-derived peptides, oligoarginines, members of the penetratin family, e.g. Penetratin, Antennapedia-derived peptides (particularly from Drosophila antennapedia), pAntp, plsl, etc., antimicrobial-derived CPPs e.g. Buforin-2, Bac715-24, SynB, SynB(1), pVEC, hCT-derived peptides, SAP, MAP, PpTG20, Proline-rich peptides, Loligomers, Arginine-rich peptides, Calcitonin-peptides, FGF, Lactoferrin, , poly-L-Lysine, poly-Arginine, histones, VP22 derived or analog peptides, Pestivirus Erns, HSV, VP22 (Herpes simplex), MAP, KALA or protein transduction domains (PTDs, PpT620, prolin-rich peptides, arginine-rich peptides, lysine-rich peptides, Pep-1, L-oligomers, Calcitonin peptide(s), etc. Particularly preferred in this context is mannose as ligand to target antigen presenting cells which carries on their cell membrane mannose receptors. In a further preferred aspect of the first embodiment of the present disclosure, galactose as optional ligand can be used to target hepatocytes. Such ligands may be attached to component P1 and/or P3 by reversible disulfide bonds as defined below or by any other possible chemical attachement, e.g. by amide formation (e.g. carboxylic acids, sulphonic acids, amines, etc), by Michael addition (e.g. maleinimide moieties, α, β unsatured carbonyls, etc), by click chemistry (e.g. azides or alkines), by alkene/alkine methatesis (e.g. alkenes or alkines), imine or hydrozone formation (aldehydes or ketons, hydrazins, hydroxylamins, amines), complexation reactions (avidin, biotin, protein G) or components which allow Sn-type substitution reactions (e.g halogenalkans, thiols, alcohols, amines, hydrazines, hydrazides, sulphonic acid esters, oxyphosphonium salts) or other chemical moieties which can be utilized in the attachment of further components.

[0332] In the context of formula (VIII) disclosed herein, components P1 and P3 represent a linear or branched hydrophilic polymer chain, containing at least one -SH-moiety, each P1 and P3 independently selected from each other, e.g. from polyethylene glycol (PEG), poly-N-(2-hydroxypropyl)methacrylamide, poly-2-(methacryloyloxy)ethyl phosphorylcholines, poly(hydroxyalkyl L-asparagine) or poly(hydroxyalkyl L-glutamine). P1 and P3 may be identical or different to each other. Preferably, each of hydrophilic polymers P1 and P3 exhibits a molecular weight of about 1 kDa to about 100 kDa, preferably of about 1 kDa to about 75 kDa, more preferably of about 5 kDa to about 50 kDa, even more preferably of about 5 kDa to about 25 kDa. Additionally, each of hydrophilic polymers P1 and P3 typically exhibits at least one -SH-moiety, wherein the at least one -SH-moiety is capable to form a disulfide linkage upon reaction with component P2 or with component (AA) or (AA)x, if used as linker between P1 and P2 or P3 and P2 as defined below and optionally with a further component, e.g. L and/or (AA) or (AA)x, e.g. if two or more -SH-moieties are contained. The following subformulae "P1-S-S-P2" and "P2-S-S-P3" within generic formula (VII) above (the brackets are omitted for better readability), wherein any of S, P1 and P3 are as defined herein, typically represent a situation, wherein one-SH-moiety of hydrophilic polymers P1 and P3 was condensed with one -SH-moiety of component P2 of generic formula (VII) above, wherein both sulphurs of these -SH-moieties form a disulfide bond -S-S- as defined herein in formula (VII). These -SH-moieties are typically provided by each of the hydrophilic polymers P1 and P3, e.g. via an internal cysteine or any further (modified) amino acid or compound which carries a -SH moiety. Accordingly, the subformulae "P1-S-S-P2" and "P2-S-S-P3" may also be written as "P1-Cys-Cys-P2" and "P2-Cys-Cys-P3", if the -SH- moiety is provided by a cysteine, wherein the term Cys-Cys represents two cysteines coupled via a disulfide bond, not via a peptide bond. In this case, the term "-S-S-" in these formulae may also be written as "-S-Cys", as "-Cys-S" or as "-Cys-Cys-". In this context, the term "-Cys-Cys-" does not represent a peptide bond but a linkage of two cysteines via their -SH-moieties to form a disulfide bond. Accordingly, the term "-Cys-Cys-" also may be understood generally as "-(Cys-S)-(S-Cys)-", wherein in this specific case S indicates the sulphur of the -SH-moiety of cysteine. Likewise, the terms "-S-Cys" and "-Cys-S" indicate a disulfide bond between a -SH containing moiety and a cysteine, which may also be written as "-S-(S-Cys)" and "-(Cys-S)-S". Alternatively, the hydrophilic polymers P1 and P3 may be modified with a -SH moiety, preferably via a chemical reaction with a compound carrying a -SH moiety, such that each of the hydrophilic polymers P1 and P3 carries at least one such -SH moiety. Such a compound carrying a - SH moiety may be e.g. an (additional) cysteine or any further (modified) amino acid, which carries a -SH moiety. Such a compound may also be any non-amino compound or moiety, which contains or allows to introduce a -SH moiety into hydrophilic polymers P1 and P3 as defined herein. Such non-amino compounds may be attached to the hydrophilic polymers P1 and P3 of formula (VII) of the polymeric carrier disclosed herein via chemical reactions or binding of compounds, e.g. by binding of a 3-thio propionic acid or thioimolane, by amide formation (e.g. carboxylic acids, sulphonic acids, amines, etc), by Michael addition (e.g maleinimide moieties, α, β unsatured carbonyls, etc), by click chemistry (e.g. azides or alkines), by alkene/alkine methatesis (e.g. alkenes or alkines), imine or hydrozone formation (aldehydes or ketons, hydrazins, hydroxylamins, amines), complexation reactions (avidin, biotin, protein G) or components which allow Sn-type substitution reactions (e.g halogenalkans, thiols, alcohols, amines, hydrazines, hydrazides, sulphonic acid esters, oxyphosphonium salts) or other chemical moieties which can be utilized in the attachment of further components. A particularly preferred PEG derivate in this context is alpha-Methoxy-omega-mercapto poly(ethylene glycol). In each case, the SH-moiety, e.g. of a cysteine or of any further (modified) amino acid or compound, may be present at the terminal ends or internally at any position of hydrophilic polymers P1 and P3. As defined herein, each of hydrophilic polymers P1 and P3 typically exhibits at least one -SH-moiety preferably at one terminal end, but may also contain two or even more -SH-moieties, which may be used to additionally attach further components as defined herein, preferably further functional peptides or proteins e.g. a ligand, an amino acid component (AA) or (AA)x, antibodies, cell penetrating peptides or enhancer peptides (e.g. TAT, KALA), etc.

[0333] According to one preferred alternative, such further functional peptides or proteins may comprise so called cell penetrating peptides (CPPs) or cationic peptides for transportation. Particularly preferred are CPPs, which induce a pH-mediated conformational change in the endosome and lead to an improved release of the polymeric carrier disclosed herein (in complex with a nucleic acid) from the endosome by insertion into the lipid layer of the liposome. Such called cell penetrating peptides (CPPs) or cationic peptides for transportation, may include, without being limited thereto protamine, nucleoline, spermine or spermidine, poly-L-lysine (PLL), basic polypeptides, poly-arginine, chimeric CPPs, such as Transportan, or MPG peptides, HIV-binding peptides, Tat, HIV-1 Tat (HIV), Tat-derived peptides, oligoarginines, members of the penetratin family, e.g. Penetratin, Antennapedia-derived peptides (particularly from Drosophila antennapedia), pAntp, plsl, etc., antimicrobial-derived CPPs e.g. Buforin-2, Bac715-24, SynB, SynB(1), pVEC, hCT-derived peptides, SAP, MAP, PpTG20, Proline-rich peptides, Loligomers, Arginine-rich peptides, Calcitonin-peptides, FGF, Lactoferrin, , poly-L-Lysine, poly-Arginine, histones, VP22 derived or analog peptides, Pestivirus Erns, HSV, VP22 (Herpes simplex), MAP, KALA or protein transduction domains (PTDs, PpT620, prolin-rich peptides, arginine-rich peptides, lysine-rich peptides, Pep-1, L-oligomers, Calcitonin peptide(s), etc.

[0334] According to a further preferred embodiment disclosed herein, each of hydrophilic polymers P1 and P3 of formula (VIII) of the polymeric carrier used according to the present disclosure may also contain at least one further functional moiety, which allows attaching further components as defined herein, e.g. a ligand as defined above, or functionalities which allow the attachment of further components, e.g. by amide formation (e.g. carboxylic acids, sulphonic acids, amines, etc), by Michael addition (e.g maleinimide moieties, unsatured carbonyls, etc), by click chemistry (e.g. azides or alkines), by alkene/alkine methatesis (e.g. alkenes or alkines), imine or hydrozone formation (aldehydes or ketons, hydrazins, hydroxylamins, amines), complexation reactions (avidin, biotin, protein G) or components which allow Sn-type substitution reactions (e.g halogenalkans, thiols, alcohols, amines, hydrazines, hydrazides, sulphonic acid esters, oxyphosphonium salts) or other chemical moieties which can be utilized in the attachment of further components. Further functional moieties may comprise an amino acid component (AA) as defined herein or (AA)x., wherein (AA) is preferably an amino component as defined above. In the above context, x is preferably an integer and may be selected from a range of about 1 to 100, preferably from a range of about 1 to 50, more preferably 1 to 30, and even more preferably selected from a number comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15-30, e.g. from a range of about 1 to 30, from a range of about 1 to 15, or from a number comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15, or may be selected from a range formed by any two of the afore mentioned values. Most preferably, x is 1. Such an amino acid component (AA) or (AA)x may be contained in every part of the polymeric carrier according to formula (VIII) above and therefore may be attached to all components of the polymeric carrier according to formula (VII). It is particularly preferred that amino acid component (AA) or (AA)x is present as a ligand or part of the repetitive component [S-P2-S]n within formula (VIII) of the polymeric carrier.

[0335] In the context of the entire formula (VIII) of the polymeric carrier may be preferably defined as follows:

        L-P1-S-[Cys-P2-Cys]n-S-P3-L

wherein L, P1, P2, P3 and n are as defined herein, S is sulphur and each Cys provides for one -SH-moiety for the disulfide bond.

[0336] According to a particular embodiment, the polymeric carrier according to formula (VII) as defined above, may comprise at least one amino acid component (AA) or (AA)x, as defined above. Such an amino acid component (AA) or (AA)x may be contained in every part of the polymeric carrier according to formula (VIII) above and therefore may be attached to all components of the polymeric carrier according to formula (VIII). It is particularly preferred that amino acid component (AA) or (AA)x is present as a ligand or part of the repetitive component [S-P2-S]n within formula (VIII) of the polymeric carrier. The amino acid component (AA) or (AA)x preferably contains or is flanked (e.g. terminally) by at least one -SH containing moiety, which allows introducing this component (AA) or (AA)x via a disulfide bond into the polymeric carrier according to formula (VIII) as defined herein. Such a -SH-containing moiety may be any-SH containing moiety (or, of course, one sulphur of a disulfide bond), e.g. a cysteine residue. In the specific case that the -SH containing moiety represents a cysteine, the amino acid component (AA)x may also be read as -Cys-(AA)x- or -Cys-(AA)x-Cys- wherein Cys represents Cysteine and provides for the necessary -SH-moiety for a disulfide bond. The -SH containing moiety may be also introduced into the amino acid component (AA)x using any of modifications or reactions as shown above for components P1, P2 or P3. In the specific case that the amino acid component (AA)x is linked to two components of the polymeric carrier according to formula (VIII) it is preferred that (AA) or (AA)x contains at least two -SH-moieties, e.g. at least two Cysteines, preferably at its terminal ends. This is particularly preferred if (AA) or (AA)x is part of the repetitive component [S-P2-S]n. Alternatively, the amino acid component (AA) or (AA)x is introduced into the polymeric carrier according to formula (VIII) as defined herein via any chemical possible addition reaction. Therefore the amino acid component (AA) or (AA)x contains at least one further functional moiety, which allows attaching same to a further component as defined herein, e.g. component P1 or P3, P2, L, or a further amino acid component (AA) or (AA)x, etc. Such functional moieties may be selected from functionalities which allow the attachment of further components, e.g. functionalities as defined herein, e.g. by amide formation (e.g. carboxylic acids, sulphonic acids, amines, etc), by Michael addition (e.g maleinimide moieties, α, β unsatured carbonyls, etc), by click chemistry (e.g. azides or alkines), by alkene/alkine methatesis (e.g. alkenes or alkines), imine or hydrozone formation (aldehydes or ketons, hydrazins, hydroxylamins, amines), complexation reactions (avidin, biotin, protein G) or components which allow Sn-type substitution reactions (e.g halogenalkans, thiols, alcohols, amines, hydrazines, hydrazides, sulphonic acid esters, oxyphosphonium salts) or other chemical moieties which can be utilized in the attachment of further components.

[0337] The amino acid component (AA) or (AA)x in the polymeric carrier of formula (VIII) may also occur as a mixed repetitive amino acid component [(AA)x]z, wherein the number of amino acid components (AA) or (AA)x is further defined by integer z. In this context, z may be selected from a range of about 1 to 30, preferably from a range of about 1 to 15, more preferably 1 to 10 or 1 to 5 and even more preferably selected from a number selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15, or may be selected from a range formed by any two of the afore mentioned values.

[0338] According to a specific and particularly preferred alternative, the amino acid component (AA) or (AA)x, preferably written as S-(AA)x-S or [S-(AA)x-S] may be used to modify component P2, particularly the content of component S-P2-S in repetitive component [S-P2-S]n of the polymeric carrier of formula (VIII) above. This may be represented in the context of the entire polymeric carrier according to formula (VIII) e.g. by following formula (VIIIa):

        L-P1-S-{[S-P2-S]a[S-(AA)x-S]b}-S-P3-L,

wherein x, S, L, AA, P1, P2 and P3 are preferably as defined herein. In formula (Villa) above, any of the single components [S-P2-S] and [S-(AA)x-S] may occur in any order in the subformula {[S-P2-S]a[S-(AA)x-S]b}. The numbers of single components (S-P2-S] and [S-(AA)x-S] in the subformula {[S-P2-S]a[S-(AA)x-S]b} are determined by integers a and b, wherein a + b = n. n is an integer and is defined as above for formula (VIII).

a is an integer, typically selected independent from integer b from a range of about 1 to 50, preferably from a range of about 1, 2 or 3 to 30, more preferably from a range of about 1, 2, 3, 4, or 5 to 25, or a range of about 1, 2, 3, 4, or 5 to 20, or a range of about 1, 2, 3, 4, or 5 to 15, or a range of about 1, 2, 3, 4, or 5 to 10, including e.g. a range of about 3 to 20, 4 to 20, 5 to 20, or 10 to 20, or a range of about 3 to 15, 4 to 15, 5 to 15, or 10 to 15, or a range of about 6 to 11 or 7 to 10. Most preferably, a is in a range of about 1, 2, 3, 4, or 5 to 10, more preferably in a range of about 1, 2, 3, or 4 to 9, in a range of about 1, 2, 3, or 4 to 8, or in a range of about 1, 2, or 3 to 7.

b is an integer, typically selected independent from integer a from a range of about 0 to 50 or 1 to 50, preferably from a range of about 0, 1, 2 or 3 to 30, more preferably from a range of about 0, 1, 2, 3,4, or 5 to 25, or a range of about 0, 1, 2, 3, 4, or 5 to 20, or a range of about 0, 1, 2, 3, 4, or 5 to 15, or a range of about 0, 1, 2, 3, 4, or 5 to 10, including e.g. a range of about 3 to 20, 4 to 20, 5 to 20, or 10 to 20, or a range of about 3 to 15,4 to 15, 5 to 15, or 10 to 15, or a range of about 6 to 11 or 7 to 10. Most preferably, b is in a range of about 1, 2, 3, 4, or 5 to 10, more preferably in a range of about 1, 2, 3, or 4 to 9, in a range of about 1, 2, 3, or 4 to 8, or in a range of about 1, 2, or 3 to 7.



[0339] In this context it is particularly preferred that the RNA, preferably mRNA, of the composition disclosed herein is complexed at least partially with a cationic or polycationic compound and/or a polymeric carrier, preferably cationic proteins or peptides. In this context, reference is made to the disclosure of WO 2010/037539 and WO 2012/113513. Partially means that only a part of the RNA is complexed with a cationic compound and that the rest of the RNA is (comprised in the composition disclosed herein) in uncomplexed form ("free"). Preferably, the ratio of complexed RNA to: free RNA (in the composition disclosed herein) is selected from a range of about 5:1 (w/w) to about 1:10 (w/w), more preferably from a range of about 4:1 (w/w) to about 1:8 (w/w), even more preferably from a range of about 3:1 (w/w) to about 1:5 (w/w) or 1:3 (w/w), and most preferably the ratio of complexed RNA to free RNA in the composition disclosed herein is selected from a ratio of about 1:1 (w/w).

[0340] The so called "(adjuvant) component", which may be used to together with the RNA, preferably mRNA in the composition disclosed herein, is preferably prepared according to a first step by complexing the at least one (m)RNA of the (adjuvant) component with a cationic or polycationic compound and/or with a polymeric carrier, preferably as defined herein, in a specific ratio to form a stable complex. In this context, it is highly preferable, that no free cationic or polycationic compound or polymeric carrier or only a neglectably small amount thereof remains in the (adjuvant) component after complexing the (m)RNA. Accordingly, the ratio of the (m)RNA and the cationic or polycationic compound and/or the polymeric carrier in the (adjuvant) component is typically selected in a range that the (m)RNA is entirely complexed and no free cationic or polycationic compound or polymeric carrier or only a neglectably small amount thereof remains in the composition. Preferably the ratio of the (adjuvant) component, i.e. the ratio of the (m)RNA to the cationic or polycationic compound and/or the polymeric carrier, preferably as defined herein, is selected from a range of about 6:1 (w/w) to about 0,25:1 (w/w), more preferably from about 5:1 (w/w) to about 0,5:1 (w/w), even more preferably of about 4:1 (w/w) to about 1:1 (w/w) or of about 3:1 (w/w) to about 1:1 (w/w), and most preferably a ratio of about 3:1 (w/w) to about 2:1 (w/w). Alternatively, the ratio of the (m)RNA to the cationic or polycationic compound and/or the polymeric carrier, preferably as defined herein, in the (adjuvant) component, may also be calculated on the basis of the nitrogen/phosphate ratio (N/P-ratio) of the entire complex. In the context of the present disclosure, an N/P-ratio is preferably in the range of about 0.1-10, preferably in a range of about 0.3-4 and most preferably in a range of about 0.5-2 or 0.7-2 regarding the ratio of RNA: cationic or polycationic compound and/or polymeric carrier, preferably as defined herein, in the complex, and most preferably in the range of about 0.7-1.5, preferably provided the cationic or polycationic compound in the complex is a cationic or polycationic cationic or polycationic protein or peptide and/or the polymeric carrier is as defined herein. Such ratios, particularly weight and/or N/P ratios may also be applied to ratios of the at least one RNA as defined herein to a cationic or polycationic polymer or a polymeric carrier as defined herein used to complex the at least one RNA.

[0341] In this context, the N/P ratio is a measure of the ionic charge of the cationic (side chain) component of the cationic or polycationic compound or. In particular, if the cationic properties of the cationic compound are generated by nitrogens (e.g. of the amino acid side chains), the N/P ratio expresses the ratio of basic nitrogen atoms to phosphate residues in the nucleotide backbone, considering that (side chain) nitrogen atoms in the cationic compound contribute to positive charges and phosphate of the phosphate backbone of the nucleic acid contribute to the negative charge. The N/P-ratio is defined as the nitrogen/phosphate ratio (N/P-ratio) of the entire complex of nucleic acid and cationic or polycationic compound. This is typically illustrative for the content/amount of cationic compounds and characteristic for the content/amount of nucleic acids bound or complexed. It may be calculated on the basis that, for example, 1 µg RNA typically contains about 3 nmol phosphate residues, provided that RNA exhibits a statistical distribution of bases. Additionally, 1 nmol peptide typically contains about x nmol nitrogen residues, dependent on the molecular weight and the number of its (cationic) amino acids.

[0342] According to a particularly preferred embodiment, the composition disclosed herein comprises a polymeric carrier cargo complex comprising or consisting of
  1. a) as a carrier a polymeric carrier formed by disulfide-crosslinked cationic components preferably as defined above, more preferably according to formula VII, Vila, Vllb or VIII, and
  2. b) as a cargo at least one nucleic acid molecule, preferably an immunostimulating RNA, most preferably an RNA comprising an RNA sequence according to SEQ ID NOs. 5, 394, or 10072,
preferably for use as a medicament, more preferably for use as an immunostimulating agent or adjuvant, preferably for the treatment of cancer or tumor diseases, wherein the polymeric carrier cargo complex is preferably administered intratumorally.

[0343] In a preferred embodiment, the RNA containing composition disclosed herein comprises a polymeric carrier cargo complex, comprising:
  1. a) as a carrier a polymeric carrier formed by disulfide-crosslinked cationic components, preferably as defined above, more preferably according to formula VII, VIIa, Vllb or VIII, and
  2. b) as a cargo at least one first nucleic acid molecule, preferably an immunostimulating RNA, most preferably an RNA comprising an RNA sequence according to SEQ ID NOs. 5, 394, or 10072,
for use as an immunostimulating agent or as an adjuvant,
and at least one second nucleic acid molecule, preferably an RNA and more preferably an mRNA encoding at least one protein or a peptide most preferably as disclosed above for coding RNA, and wherein the composition disclosed herein is preferably administered intratumorally.

[0344] In a preferred embodiment, the present disclosure relates to a polymeric carrier cargo complex, comprising:

a) as a carrier a polymeric carrier formed by disulfide-crosslinked cationic components, preferably as defined above, more preferably according to formula VII, VIIa, Vllb or VIII, and

a) b) as a cargo at least one first nucleic acid molecule, preferably an immunostimulating RNA, most preferably an RNA comprising an RNA sequence according to SEQ ID NOs. 5, 394, or 10072,

for use as an immunostimulating agent or as an adjuvant,
wherein the polymeric carrier cargo complex is administered in combination with at least one second nucleic acid molecule, preferably an RNA and more preferably an mRNA encoding at least one protein or a peptide most preferably as disclosed above for coding RNA, and
wherein the polymeric carrier cargo complex and the second nucleic acid molecule are preferably administered intratumorally.

[0345] Such preferred combinations of at least one first nucleic acid, preferably an immunostimulating RNA and at least one second nucleic acid, preferably an RNA, and more preferably an mRNA encoding at least one protein or peptide are disclosed above in the context of "combinations of coding and non-coding RNA".

[0346] As used herein, the term "first nucleic acid molecule" refers to a nucleic molecule, which is used as a cargo in the polymeric carrier cargo complex and is thus associated with the polymeric carrier. The term "second nucleic acid molecule", as used herein, typically refers to a nucleic acid, which is not part of the polymeric carrier cargo complex and which encodes at least one peptide or protein.

[0347] In the context of the present disclosure, immunostimulating agents or adjuvants are understood as compounds, which are preferably efficient in inducing an innate immune response, particularly in inducing the anti-viral cytokine IFN-alpha.

[0348] Adjuvants or immunostimulating agents usually act via their capability to induce an innate immune response. The innate immune system forms the dominant system of host defense in most organisms and comprises barriers such as humoral and chemical barriers including, e.g., inflammation, the complement system and cellular barriers. The innate immune system is typically based on a small number of receptors, called pattern recognition receptors. They recognize conserved molecular patterns that distinguish foreign organisms, like viruses, bacteria, fungi and parasites, from cells of the host. Such pathogen-associated molecular patterns (PAMP) include viral nucleic acids, components of bacterial and fungal walls, flagellar proteins, and more. The first family of pattern recognition receptors (PAMP receptors) studied in detail was the Toll-like receptor (TLR) family. TLRs are transmembrane proteins which recognize ligands of the extracellular milieu or of the lumen of endosomes. Following ligand-binding they transduce the signal via cytoplasmic adaptor proteins which leads to triggering of a host-defence response and entailing production of antimicrobial peptides, proinflammatory chemokines and cytokines, antiviral cytokines, etc. (see e.g. Meylan, E., J. Tschopp, et al. (2006), Nature 442(7098): 39-44). Further relevant components of the immune system include e.g. the endosomal TLRs, cytoplasmic receptors, Type I interferons and cytoplasmic receptors. Therefore, the immunostimulating agents or adjuvants are defined herein preferably as inducers of an innate immune response, which activate pattern recognition receptors (PAMP receptors). Hereby, a cascade of signals is elicited, which e.g. may result in the release of cytokines (e.g. IFN-alpha) supporting the innate immune response. Accordingly, it is preferably a feature of an immunostimulating agent or adjuvant to bind to such receptors and activate such PAMP receptors. Ideally, such as an agent or adjuvant additionally supports the adaptive immune response by e.g. shifting the immune response such that the preferred class of Th cells is activated. Depending on the disease or disorder to be treated a shift to a Th1-based immune response may be preferred or, in other cases, a shift to a Th2 immune response may be preferred. Furthermore, adjuvants are usually defined as compounds that can increase and/or modulate the intrinsic immunogenicity of an antigen. The term "immunostimulating agent" is typically understood not to include agents as e.g. antigens (of whatever chemical structure), which elicit an adaptive/cytotoxic immune response, e.g. a "humoral" or "cellular" immune response, in other words elicit immune reponses (and confer immunity by themselves) which are characterized by a specific response to structural properties of an antigen recognized to be foreign by immune competent cells. Rather "immunostimulating agent"is typically understood to mean agents/compounds/complexes which do not trigger any adaptive immune response by themselves, but which may exlusively enhance such an adaptive immune reponse in an unspecific way, by e.g. activating "PAMP" receptors and thereby triggering the release of cytokines which support the actual adaptive immune response. Accordingly, any immunostimulation by agents (e.g. antigens) which evoke an adaptive immune response by themselves (conferring immunity by themselves directly or indirectly) is typically disclaimed by the phrase "immunostimulating agent".

[0349] The term "adjuvant" is also understood not to comprise agents which confer immunity by themselves. Accordingly, adjuvants do not by themselves confer immunity, but assist the immune system in various ways to enhance the antigen-specific immune response by e.g. promoting presentation of an antigen to the immune system. Hereby, an adjuvant may preferably e.g. modulate the antigen-specific immune response by e.g. shifting the dominating Th2-based antigen specific response to a more Th1-based antigen specific response or vice versa. Accordingly, the terms "immunostimulating agent" and "adjuvant" in the context of the present disclosure are typically understood to mean agents, compounds or complexes which do not confer immunity by themselves, but exclusively support the immune reponse in an unspecific way (in contrast to an antigen-specific immune response) by effects, which modulate the antigen-specific (adaptive cellular and/or humoral immune response) by unspecific measures, e.g. cytokine expression/secretion, improved antigen presentation, shifting the nature of the arms of the immune response etc. Accordingly, any agents evoking by themselves immunity are typically disclaimed by the terms "adjuvant" or "immunostimulating agent".

[0350] The use of the polymeric carrier cargo complex optionally in combination with a second nucleic acid molecule, preferably an RNA, allows provision of a more efficient and/or safer medicament.

[0351] Advantageously, the polymeric carrier cargo complex is suited for in vivo delivery of nucleic acids, in particular for compacting and stabilizing a nucleic acid for the purposes of nucleic acid transfection, such as exhibiting one or more reduced negative side effects of high-molecular weight polymers as discussed above, such as poor biodegradability or high toxicity, agglomeration, low transfection activity in vivo, etc. The polymeric carrier cargo complex also provides for improved nucleic acid transfer in vivo, particularly via intratumoral routes, including serum stability, salt stability, efficiency of uptake, reduced complement activation, nucleic acid release, etc. Such a polymeric carrier cargo complex furthermore may support induction and maintenance of an adaptive immune response by initiating or boosting a parallel innate immune response. It has been found that an improved adaptive immune response can further be obtained, in particular when the polymeric carrier cargo complex is administered in combination with a second nucleic acid molecule, preferably an RNA, encoding a protein or peptide, or when the polymeric carrier cargo complex is co-formulated in a pharmaceutical composition with a second nucleic acid molecule, preferably an RNA, encoding a protein or peptide, preferably an antigenic peptide or protein. It has proven as particularly beneficial in this respect to administer the composition disclosed herein comprising the polymeric carrier cargo complex optionally in combination with the second nucleic acid molecule as defined herein via an intratumoral route. Additionally, the polymeric carrier cargo complex may exhibit improved storage stability, particularly during lyophilisation.

[0352] In particular embodiments, the polymeric carrier cargo complex as defined above enhances the immune response against a protein or peptide, which is encoded by a second nucleic acid molecule, preferably an RNA, more preferably an mRNA, that is administered in combination with the polymeric carrier cargo complex, preferably via an intratumoral route of administration.

[0353] The polymeric carrier cargo complex and/or the second nucleic acid molecule encoding a peptide or protein are preferably provided together with a pharmaceutically acceptable carrier and/or vehicle. In the context of the present disclosure, a pharmaceutically acceptable carrier typically includes the liquid or non-liquid material, which is mixed with the polymeric carrier cargo complex and/or the second nucleic acid molecule. If the polymeric carrier cargo complex and/or the second nucleic acid molecule are provided in liquid form, the carrier will typically be pyrogen-free water; isotonic saline or buffered aqueous solutions, e.g phosphate, citrate etc. buffered solutions. Ringer or Ringer-Lactate solution is particularly preferred as a liquid basis.

[0354] The phrase "administered in combination" as used herein refers to a situation, where the polymeric carrier cargo complex is administered to a subject before, concomittantly or after the administration of the second nucleic acid molecule encoding a protein or peptide to the same subject. Preferably, the time interval between the administration of the polymeric carrier cargo complex and the at least one second nucleic acid molecule, preferably an RNA, encoding a protein or peptide is less than about 48 hours, more preferably less than about 24 hours, 12 hours, 6 hours, 4 hours, 2 hours, 1 hour, most preferably less than about 30 minutes, 15 minutes or 5 minutes. In a particularly preferred embodiment, the phrase "administered in combination" refers to concomitant administration of the polymeric carrier cargo complex and the at least one second nucleic acid molecule, i.e. the simultaneous administration of both components or the administration of both components within a time frame that typically comprises less than 5 minutes. The phrase "administered in combination" does not only refer to a situation, where the pharmaceutical carrier cargo complex is in physical contact with the at least one second nucleic acid molecule or formulated together with said second nucleic acid molecule. The phrase "administered in combination" as used herein comprises also the separate administration of the polymeric carrier cargo complex and the second nucleic acid molecule (e.g. by two separate injections), as long as the time interval between the two administrations does not exceed the interval as defined above. Alternatively, the polymeric carrier cargo complex and the second nucleic acid molecule may be administered in combination by mixing the polymeric carrier cargo complex and the second nucleic acid molecule prior to administration and administering the mixture to a subject. When the polymeric carrier cargo complex is formulated together with the second nucleic acid molecule or when a composition as defined herein is used, the polymeric carrier cargo complex and the second nucleic acid molecule may further, independently from each other, administered in combination via any of the administration routes as described herein.

[0355] The polymeric carrier cargo complex comprises as a cargo at least one nucleic acid molecule. In the context of the present disclosure, such a nucleic acid molecule may be any suitable nucleic acid, selected e.g. from any (single-stranded or double-stranded) DNA, preferably, without being limited thereto, e.g. genomic DNA, single-stranded DNA molecules, double-stranded DNA molecules, coding DNA, DNA primers, DNA probes, immunostimulatory/immunostimulating DNA, a (short) DNA oligonucleotide ((short) oligodesoxyribonucleotides), viral DNA, or may be selected e.g. from any PNA (peptide nucleic acid) or may be selected e.g. from any (single-stranded or double-stranded) RNA, preferably, without being limited thereto, a (short) RNA oligonucleotide ((short) oligoribonucleotide), a coding RNA, a messenger RNA (mRNA), a viral RNA, replicons, an immunostimulatory/immunostimulating RNA, a small interfering RNA (siRNA), an antisense RNA, a micro RNA, a small nuclear RNA (snRNA), a small-hairpin (sh) RNA or riboswitches, ribozymes or aptamers; etc. The nucleic acid molecule of the polymeric carrier cargo complex may also be a ribosomal RNA (rRNA), a transfer RNA (tRNA), a messenger RNA (mRNA), or a viral RNA (vRNA). Preferably, the nucleic acid molecule of the polymeric carrier cargo complex is an RNA. More preferably, the nucleic acid molecule of the polymeric carrier cargo complex is a (linear) single-stranded RNA, even more preferably an mRNA or an immunostimulatory/immunostimulating RNA.

[0356] Furthermore, the nucleic acid of the polymeric carrier cargo complex may be a single- or a double-stranded nucleic acid molecule or a partially double-stranded or partially single stranded nucleic acid, which are at least partially self complementary (both of these partially double-stranded or partially single stranded nucleic acid molecules are typically formed by a longer and a shorter single-stranded nucleic acid molecule or by two single stranded nucleic acid molecules, which are about equal in length, wherein one single-stranded nucleic acid molecule is in part complementary to the other single-stranded nucleic acid molecule and both thus form a double-stranded nucleic acid molecule in this region, i.e. a partially double-stranded or partially single stranded nucleic acid molecule. Preferably, the nucleic acid molecule may be a single-stranded nucleic acid molecule. Furthermore, the nucleic acid molecule may be a circular or linear nucleic acid molecule, preferably a linear nucleic acid molecule.

[0357] According to one alternative, the nucleic acid molecule of the polymeric carrier cargo complex disclosed herein may be a coding nucleic acid, e.g. a DNA or RNA. Moreover, the polymeric carrier cargo complex may be administered in combination with at least one second nucleic acid molecule, which encodes a protein or a peptide.

[0358] According to one embodiment, the at least one first nucleic acid molecule and the at least one second nucleic acid molecule are both coding nucleic acid molecules. Preferably, the at least one first and the at least one second nucleic acid molecule each encode a different peptide or protein. In one embodiment, the first nucleic acid molecule has a sequence, which is distinct from the sequence of the second nucleic acid molecule, which is administered in combination with the polymeric carrier cargo complex. Alternatively, the first nucleic acid molecule and the second nucleic acid molecule may comprise the same sequence or be identical.

[0359] In the case of the at least one first nucleic acid molecule and/or of the second nucleic acid molecule, such a coding DNA or RNA may be any DNA or RNA as defined herein. Preferably, such a coding DNA or RNA may be a single- or a double-stranded DNA or RNA, more preferably a single-stranded DNA or RNA, and/or a circular or linear DNA or RNA, more preferably a linear DNA or RNA. Furthermore such a coding DNA or RNA may be a genomic DNA, a viral RNA or DNA, a replicon, a plasmid DNA or an mRNA. Even more preferably, the coding DNA or RNA may be a (linear) single-stranded DNA or RNA. Most preferably, the nucleic acid molecule according to the present disclosure may be a linear single-stranded messenger RNA (mRNA). Such an mRNA may occur as a mono-, di-, or even multicistronic RNA, i.e. an RNA which carries the coding sequences of one, two or more proteins or peptides. Such coding sequences in di-, or even multicistronic mRNA may be separated by at least one IRES sequence, e.g. as defined herein.

[0360] In a preferred embodiment, the at least one second nucleic acid molecule encodes a therapeutically active protein or an antigen as defined herein, preferably as disclosed in the context of "coding RNA". In a particularly preferred embodiment, the at least one second nucleic acid molecule, which is administered in combination with the polymeric carrier cargo complex, encodes a peptide or a protein, which is capable of eliciting an immune response, preferably an adaptive immune response, after administration, especially intratumoral administration, to a host. Alternatively, the at least one second nucleic acid molecule encodes at least one therapeutically active peptide or protein, preferably selected from the group consisting of cytokines, chemokines, suicide gene products, immunogenic proteins or peptides, apoptosis inducers, angiogenesis inhibitors, heat shock proteins, tumor antigens, β-catenin inhibitors, activators of the STING pathway, checkpoint modulators, innate immune activators, antibodies, dominant negative receptors and decoy receptors, inhibitors of myeloid derived suppressor cells (MDSCs), IDO pathway inhibitors, and proteins or peptides that bind inhibitors of apoptosis.

[0361] In a particular embodiment, the first nucleic acid molecule of the herein defined polymeric carrier cargo complex and/or the second nucleic acid molecule administered in combination with the polymeric carrier cargo complex may contain backbone modifications, sugar modifications or base modifications. A backbone modification in connection with the present disclosure is a modification in which phosphates of the backbone of the nucleotides contained in the nucleic acid molecule of the polymeric carrier cargo complex disclosed herein are chemically modified. A sugar modification in connection with the present disclosure is a chemical modification of the sugar of the nucleotides of the first nucleic acid molecule of the polymeric carrier cargo complex disclosed herein and/or of the second nucleic acid molecule administered in combination with the polymeric carrier cargo complex. Furthermore, a base modification in connection with the present disclosure is a chemical modification of the base moiety of the nucleotides of the nucleic acid molecule of the polymeric carrier cargo complex disclosed herein and/or of the second nucleic acid molecule administered in combination with the polymeric carrier cargo complex. Such modifications are disclosed above in the context of "RNA modifications".

[0362] According to a further embodiment, the first nucleic acid molecule of the herein defined polymeric carrier cargo complex and/or the second nucleic acid molecule administered in combination with the polymeric carrier cargo complex can contain a lipid modification. Such a lipid-modified nucleic acid typically comprises a nucleic acid as defined herein. Such a lipid-modified first nucleic acid molecule of the polymeric carrier cargo complex or a lipid-modified second nucleic acid molecule administered in combination with the polymeric carrier cargo complex typically further comprises at least one linker covalently linked with that nucleic acid molecule, and at least one lipid covalently linked with the respective linker. Alternatively, the lipid-modified nucleic acid molecule comprises at least one nucleic acid molecule as defined herein and at least one (bifunctional) lipid covalently linked (without a linker) with that nucleic acid molecule. According to a third alternative, the lipid-modified nucleic acid molecule comprises a nucleic acid molecule as defined herein, at least one linker covalently linked with that nucleic acid molecule, and at least one lipid covalently linked with the respective linker, and also at least one (bifunctional) lipid covalently linked (without a linker) with that nucleic acid molecule.

[0363] According to a further preferred embodiment, the at least one RNA of the composition disclosed herein is complexed with lipids to form one or more liposomes, lipoplexes, or lipid nanoparticles. Therefore, in one embodiment, the composition disclosed herein comprises liposomes, lipoplexes, and/or lipid nanoparticles comprising the at least one RNA.

[0364] Lipid-based formulations have been increasingly recognized as one of the most promising delivery systems for RNA due to their biocompatibility and their ease of large-scale production. Cationic lipids have been widely studied as synthetic materials for delivery of RNA. After mixing together, nucleic acids are condensed by cationic lipids to form lipid/nucleic acid complexes known as lipoplexes. These lipid complexes are able to protect genetic material from the action of nucleases and deliver it into cells by interacting with the negatively charged cell membrane. Lipoplexes can be prepared by directly mixing positively charged lipids at physiological pH with negatively charged nucleic acids.

[0365] Conventional liposomes consist of a lipid bilayer that can be composed of cationic, anionic, or neutral (phospho)lipids and cholesterol, which encloses an aqueous core. Both the lipid bilayer and the aqueous space can incorporate hydrophobic or hydrophilic compounds, respectively. Liposome characteristics and behaviour in vivo can be modified by addition of a hydrophilic polymer coating, e.g. polyethylene glycol (PEG), to the liposome surface to confer steric stabilization. Furthermore, liposomes can be used for specific targeting by attaching ligands (e.g., antibodies, peptides, and carbohydrates) to its surface or to the terminal end of the attached PEG chains (Front Pharmacol. 2015 Dec 1;6:286).

[0366] Liposomes are colloidal lipid-based and surfactant-based delivery systems composed of a phospholipid bilayer surrounding an aqueous compartment. They may present as spherical vesicles and can range in size from 20 nm to a few microns. Cationic lipid-based liposomes are able to complex with negatively charged nucleic acids via electrostatic interactions, resulting in complexes that offer biocompatibility, low toxicity, and the possibility of the large-scale production required for in vivo clinical applications. Liposomes can fuse with the plasma membrane for uptake; once inside the cell, the liposomes are processed via the endocytic pathway and the genetic material is then released from the endosome/carrier into the cytoplasm. Liposomes have long been perceived as drug delivery vehicles because of their superior biocompatibility, given that liposomes are basically analogs of biological membranes, and can be prepared from both natural and synthetic phospholipids (Int J Nanomedicine. 2014; 9: 1833-1843).

[0367] Cationic liposomes have been traditionally the most commonly used non-viral delivery systems for oligonucleotides, including plasmid DNA, antisense oligos, and siRNA/small hairpin RNA-shRNA). Cationic lipids, such as DOTAP, (1,2-dioleoyl-3-trimethylammonium-propane) and DOTMA (N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethyl-ammonium methyl sulfate) can form complexes or lipoplexes with negatively charged nucleic acids to form nanoparticles by electrostatic interaction, providing high in vitro transfection efficiency . Furthermore, neutral lipid-based nanoliposomes for RNA delivery as e.g. neutral 1,2-dioleoyl-sn-glycero-3-phosphatidylcholine (DOPC)-based nanoliposomes were developed. (Adv Drug Deliv Rev. 2014 Feb; 66: 110-116.).

[0368] Therefore, in one embodiment the at least one RNA of the composition disclosed herein is complexed with cationic lipids and/or neutral lipids and thereby forms liposomes, lipid nanoparticles, lipoplexes or neutral lipid-based nanoliposomes.

[0369] Preferred cationic or polycationic compounds, which can be used as transfection or complexation agent may include cationic polysaccharides, for example chitosan, polybrene, cationic polymers, e.g. polyethyleneimine (PEI), cationic lipids, e.g. DOTMA: [1-(2,3-sioleyloxy)propyl)]-N,N,N-trimethylammonium chloride, DMRIE, di-C14-amidine, DOTIM, SAINT, DC-Chol, BGTC, CTAP, DOPC, DODAP, DOPE: Dioleyl phosphatidylethanol-amine, DOSPA, DODAB, DOIC, DMEPC, DOGS: Dioctadecylamidoglicylspermin, DIMRI: Dimyristo-oxypropyl dimethyl hydroxyethyl ammonium bromide, DOTAP: dioleoyloxy-3-(trimethylammonio)propane, DC-6-14: O,O-ditetradecanoyl-N-(α-trimethylammonioacetyl)diethanolamine chloride, CLIP1: rac-[(2,3-dioctadecyloxypropyl)(2-hydroxyethyl)]-dimethylammonium chloride, CLIP6: rac-[2(2,3-dihexadecyloxypropyl-oxymethyloxy)ethyl]trimethylammonium, CLIP9: rac-[2(2,3-dihexadecyloxypropyl-oxysuccinyloxy)ethyl]-trimethylammonium, oligofectamine, or cationic or polycationic polymers, e.g. modified polyaminoacids, such as β-aminoacid-polymers or reversed polyamides, etc., modified polyethylenes, such as PVP (poly(N-ethyl-4-vinylpyridinium bromide)), etc., modified acrylates, such as pDMAEMA (poly(dimethylaminoethyl methylacrylate)), etc., modified amidoamines such as pAMAM (poly(amidoamine)), etc., modified polybetaaminoester (PBAE), such as diamine end modified 1,4 butanediol diacrylate-co-5-amino-1-pentanol polymers, etc., dendrimers, such as polypropylamine dendrimers or pAMAM based dendrimers, etc., polyimine(s), such as PEI: poly(ethyleneimine), poly(propyleneimine), etc., polyallylamine, sugar backbone based polymers, such as cyclodextrin based polymers, dextran based polymers, chitosan, etc., silan backbone based polymers, such as PMOXA-PDMS copolymers, etc., blockpolymers consisting of a combination of one or more cationic blocks (e.g. selected from a cationic polymer as mentioned above) and of one or more hydrophilic or hydrophobic blocks (e.g. polyethyleneglycole); etc.

Additional pharmaceutically active compounds:



[0370] Furthermore the composition disclosed herein may comprise at least one additional pharmaceutically active component/compound. Alternatively or in addition to that, the at least one additional pharmaceutically active component/compound may be co-administered concomitant to the composition disclosed herein. Therefore, the at least one additional pharmaceutically active component/compound may be administered in combination with the at least one RNA of the compostion disclosed herein or with the RNA containing composition according to the present disclosure.

[0371] The phrases "administered in combination", co-administration or "concomitant administration" as used herein refers to a situation, where the composition disclosed herein or an ingredient thereof is administered to a subject before, concomittantly or after the administration of a further pharmaceutically active component to the same subject. The time interval between the administration of the composition disclosed herein or an ingredient thereof and the at least one second pharmaceutically active component depends on the nature and biological effect of the particular pharmaceutically active compononent and can be determined by a physician. Preferably, the time interval is less than about 48 hours, more preferably less than about 24 hours, 12 hours, 6 hours, 4 hours, 2 hours, 1 hour, most preferably less than about 30 minutes, 15 minutes or 5 minutes. In a particularly preferred embodiment, the phrase "administered in combination" refers to concomitant administration of the composition disclosed herein or an ingredient thereof and the at least one second pharmaceutically active component, i.e. the simultaneous administration of both compounds or the administration of both compounds within a time frame that typically comprises less than 5 minutes. The phrase "administered in combination" does not only refer to a situation, where the composition disclosed herein or an ingredient thereof is in physical contact with the at least one second pharmaceutically active component or formulated together with said second pharmaceutically active component. The phrase "administered in combination" as used herein comprises also the separate administration of the composition disclosed herein or an ingredient thereof and the second pharmaceutically active component (e.g. by two separate injections).

[0372] Alternatively, the composition disclosed herein or an ingredient thereof and the second pharmaceutically active component may be administered in combination by mixing the composition disclosed herein or an ingredient thereof and the second pharmaceutically active component prior to administration and administering the mixture to a subject. When the composition disclosed herein or an ingredient thereof is formulated together with the second pharmaceutically active component or when a composition as defined herein is used, the composition disclosed herein or an ingredient thereof and the second pharmaceutically active component may further, independently from each other, administered in combination via any of the administration routes as described herein.

[0373] A pharmaceutically active component/compound in this connection is a compound that has a therapeutic effect to heal, ameliorate or prevent a particular indication or disease, namely a tumor or cancer disease. Such compounds include, without implying any limitation, peptides or proteins, preferably as defined herein, nucleic acids, preferably as defined herein, (therapeutically active) low molecular weight organic or inorganic compounds (molecular weight less than 5000, preferably less than 1000), sugars, antigens or antibodies, preferably as defined herein, therapeutic agents already known in the prior art, antigenic cells, antigenic cellular fragments, cellular fractions, cell wall components (e.g. polysaccharides), modified, attenuated or de-activated (e.g. chemically or by irradiation) pathogens (virus, bacteria etc.), adjuvants, etc.

[0374] In a preferred embodiment, the composition disclosed herein additionally comprises at least one further pharmaceutically active component/compound, wherein the at least one additional pharmaceutically active component is selected from cytokines, chemokines, suicide gene products, immunogenic proteins or peptides, apoptosis inducers, angiogenesis inhibitors, heat shock proteins, tumor antigens, β-catenin inhibitors, activators of the STING pathway, checkpoint modulators, innate immune activators, antibodies, dominant negative receptors and decoy receptors, inhibitors of myeloid derived suppressor cells (MDSCs), IDO pathway inhibitors, proteins or peptides that bind inhibitors of apoptosis, anti-bacterial agents, anti-viral agents, adjuvants, chemotherapeutic agents and kinase inhibitors.

[0375] Alternatively, or in addition to that, the at least one additional pharmaceutically active component may be co-administered concomitant to the at least one RNA of the RNA containing composition or the composition disclosed herein or may be used in combination with the at least one RNA of the RNA containing composition or the composition disclosed herein.

[0376] In this context protein-based cytokines, chemokines, suicide gene products, immunogenic proteins or peptides, apoptosis inducers, angiogenesis inhibitors, heat shock proteins, tumor antigens, β-catenin inhibitors, activators of the STING pathway, checkpoint modulators, innate immune activators, antibodies, dominant negative receptors and decoy receptors, inhibitors of myeloid derived suppressor cells (MDSCs), IDO pathway inhibitors, and proteins or peptides that bind inhibitors of apoptosis or fragments and variants thereof as disclosed above in the context of "coding RNA" may be used as additional pharmaceutically active component. Alternatively, nucleic acids encoding these proteins or fragments or variants thereof may be used as additional pharmaceutically active component.

1. Cytokines:



[0377] In this context protein-based cytokines, or fragments and variants thereof as disclosed above in the context of "coding RNA" may be used as additional pharmaceutically active component. Alternatively, nucleic acids encoding these proteins or fragments or variants thereof may be used as additional pharmaceutically active component.

[0378] Preferably the cytokine is an interleukin (IL). One or more interleukins may be chosen e.g. from the following list: IL-1α, IL-1β, IL-1ra (antagonist), IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10; IL-11, IL-12, IL-13, IL14, IL-15, IL-16, IL-17A, IL-17B, EL-17C, IL-17D, IL-17E, IL-17F, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28A/B, IL-29, IL-30, IL-31, IL-32, IL-33, IL-35. Moreover the cytokine may be one or more cytokines chosen from the TNF family, e.g. chosen from the following list: TNF, especially TNFα, LTα, LTβ, LIGHT, TWEAK, APRIL, BAFF, TL1A, GITRL, OX40L, CD40L (CD154), FASL, CD27L, CD30L, 4-1BBL, TRAIL, RANK ligand. Further examples of preferred cytokines may be chosen from the following list: FLT3 ligand, G-CSF, GM-CSF, IFNα/β/ω, IFNγ, LIF, M-CSF, MIF, OSM, Stem Cell Factor, TGFβ1, TGFβ2, TGFβ3, TSLP ligand.

[0379] Particularly preferred are cytokines chosen from the following list: IL-12, IL-15, IL-2, IFNγ, TNFα, IL-18, IFNα, IL-1β, IL-32, IL-7, IL-21, IL-8, GM-CSF.

[0380] In this context particularly preferred are cytokines as disclosed in Table 1 above.

[0381] In a particularly preferred embodiment, the at least one RNA of the RNA containing composition is an immunostimulating RNA, preferably according to SEQ ID NOs. 5, 394, or 10072, and is combined with at least one cytokine as defined above, preferably IL-2, IL-12, CD40L or IL-15 or a fragment or variant thereof.

1. Chemokines



[0382] In this context protein-based chemokines, or fragments and variants thereof as disclosed above in the context of "coding RNA" may be used as additional pharmaceutically active component. Alternatively, nucleic acids encoding these proteins or fragments or variants thereof may be used as additional pharmaceutically active component.

[0383] Preferred chemokines may be chosen from the following list: CXCL1, CXCL2, CXCL3, CXCL4, CXCL5, CXCL6, CXCL7, CXCL8, CXCL9, CXCL10, CXCL11, CXCL12, CXCL13, CXCL14, CXCL15, CXCL16, CCL1, CCL2, CCL3, CCL4, CCL5, CCL6, CCL7, CCL8, CCL9/10, CCL11, CCL12, CCL13, CCL14, CCL15, CCL16, CCL17, CCL18, CCL19, CCL20, CCL21, CCL22, CCL23, CCL24, CCL25, CCL26, CCL27, CCL28, XCL1, XCL2, CX3CL1. In this context particularly preferred are chemokines as disclosed in Table 2 above.

[0384] In a particularly preferred embodiment, the at least one RNA of the RNA containing composition is an immunostimulating RNA, preferably according to SEQ ID NOs. 5, 394, or 10072 and is combined with at least one chemokine as defined above or a fragment or variant thereof.

2. Suicide enzymes



[0385] In this context protein-based suicide enzymes, or fragments and variants thereof as disclosed above in the context of "coding RNA" may be used as additional pharmaceutically active component. Alternatively, nucleic acids encoding these proteins or fragments or variants thereof may be used as additional pharmaceutically active component.

[0386] The suicide enzyme is preferably a nucleotide metabolizing enzyme. Preferably the suicide enzyme is used in combination with a prodrug which is a substrate of the suicide enzyme, and which is converted to a cytotoxic compound by the suicide enzyme. One or more preferred suicide enzymes may be chosen from the following list: thymidine kinase, preferably a viral thymidine kinase, more preferrably Herpes simplex virus thymidine kinase, Varicella zoster thymidine kinase; a plant thymidine kinase, preferably a tomato thymidine kinase; cytosine deaminase, preferably bacterial cytosine deaminase or Yeast cytosine deaminase; deoxynucleoside kinase, preferably Drosophila melanogaster deoxynucleoside kinase; deoxycytidine kinase, preferably a mammalian deoxycytidine kinase, purine nucleoside phosphorylase, preferably a bacterial purine nucleoside phosphorylase. In this context particularly preferred are suicide enzymes (suicide gene products) as disclosed in Table 3 and 4 above.

[0387] In a particularly preferred embodiment, the at least one RNA of the RNA containing composition is an immunostimulating RNA, preferably according to SEQ ID NOs. 5, 394, or 10072 and is combined with at least one suicide enzyme as defined above or a fragment or variant thereof.

3. Immunogenic proteins or peptides



[0388] In this context protein-based immunogenic proteins or peptides, or fragments and variants thereof as disclosed above in the context of "coding RNA" may be used as additional pharmaceutically active component. Alternatively, nucleic acids encoding these proteins or peptides or fragments or variants thereof may be used as additional pharmaceutically active component.

[0389] The immunogenic protein or peptide is preferably a pathogenic antigen to utilize preexisting immunity against such antigens for treatment of tumor and/or cancer diseases. The memory immune response is triggered and the immune system is strengthened for attacking tumor cells.

[0390] Preferred examples of immunogenic proteins or peptides for this embodiment are proteins or peptides of widespread pathogens, i.e. pathogens with which every organism, in particular mammals, preferably humans, has a high probability of being infected at least once in his/her lifetime. These include, for example, any structural or non-structural protein or peptide of:
  • influenza virus type A or B or any other orthomyxovirus (influenza type C),
  • picornaviruses, such as rhinovirus or hepatitis A virus,
  • togaviruses, such as alphavirus or rubivirus, e.g. Sindbis, Semliki-Forest or rubeolavirus (measles virus),
  • rubella virus (German measles virus),
  • coronaviruses, in particular subtypes HCV-229E or HCV-OC43,
  • rhabdoviruses, such as rabies virus,
  • paramyxoviruses, such as mumps virus,
  • reoviruses, such as group A, B or C rotavirus,
  • hepadnaviruses, such as hepatitis B virus,
  • papoviruses, such as human papillomaviruses (HPV) of any serotype, especially from 1 to 75,
  • adenoviruses, in particular type 1 to 47,
  • herpesviruses, such as Herpes simplex virus 1, 2 or 3,
  • cytomegalovirus (CMV), preferably CMVpp65,
  • Epstein Barr virus (EBV),
  • vaccinia viruses and
  • the bacterium Chlamydophila pneumoniae (Chlamydia pneumoniae).


[0391] Further examples of preferred immunogenic proteins or peptides are proteins or peptides of pathogens which only seldom infect an organism. These proteins or peptide include, for example, any structural or non-structural protein or peptide of:
  • Flaviviruses, such as dengue virus type 1 to 4, yellow fever virus, West Nile virus, Japanese encephalitis virus
  • hepatitis C virus,
  • caliciviruses,
  • filoviruses, such as Ebola virus,
  • bornaviruses,
  • bunyaviruses, such as Rift Valley fever virus,
  • arenaviruses, such as LCMV (lymphocytic choriomeningitis virus) or hemorrhagic fever viruses,
  • retroviruses, such as HIV and
  • parvoviruses.


[0392] In a particularly preferred embodiment, the at least one RNA of the RNA containing composition is an immunostimulating RNA, preferably according to SEQ ID NOs. 5, 394, or 10072 and is combined with at least one immunogenic protein or peptide as defined above, preferably influenza nucleoprotein (NP) or a fragment or variant thereof.

4. Apoptosis inducers:



[0393] In this context protein-based apoptosis inducers, or fragments and variants thereof as disclosed above in the context of "coding RNA" may be used as additional pharmaceutically active component.

[0394] Alternatively, nucleic acids encoding these proteins or peptides or fragments or variants thereof may be used as additional pharmaceutically active component.

[0395] Preferably, an apoptosis inducer is chosen from the group consisting of the Bcl-2 family and tumor suppressor protein p53 and ligands of transmembrane death receptors, especially the TNF (tumor necrosis factor) receptor gene superfamily, pro-apoptic receptor agonists and Beclin-1.

[0396] A particularily preferred apoptosis inducer in the context of the present disclosure is Beclin-1 (derived from the BECN1 gene).

[0397] Further preferred examples of apoptosis inducers may be chosen from the following list: Bcl-10, Bax, Bak, Bid, Bad, Bim, Bik, Blk, Cytochrome c, Caspases, especially Caspase 3, Caspase 6, Caspase 7, Caspase 8, Caspase 9, Death domain, especially of Fas, preferably FasL, TNFα, Apo2L/TRAIL, agonist of DR4 and/or DR5, Apo3L, DR4 agonistic antibody, DR5 agonistic antibody, protein kinase R (PKR) (preferably constitutive active PKR), Granzyme B.

[0398] In this context particularly preferred are apoptosis inducers as disclosed in Table 5 and 6 above.

[0399] In a particularly preferred embodiment, the at least one RNA of the RNA containing composition is an immunostimulating RNA, preferably according to SEQ ID NOs. 5, 394, or 10072 and is combined with at least one apoptosis inducer as defined above, or a fragment or variant thereof.

5. Angiogenesis inhibitors



[0400] In this context protein-based angiogenesis inducers, or fragments and variants thereof as disclosed above in the context of "coding RNA" may be used as additional pharmaceutically active component. Alternatively, nucleic acids encoding these proteins or peptides or fragments or variants thereof may be used as additional pharmaceutically active component.

[0401] Preferred examples of angiogenesis inhibitors according to the present disclosure may be chosen from the following list: interferon alpha (IFN-α), (interferon beta) IFN-β, interferon gamma (IFN-γ), CXCL9, CXCL10, interleukin 12 (IL-12), platelet factor 4 (PF-4), tumor necrosis factor alpha (TNF-α), soluble fms-like tyrosine kinase 1 (sFLT-1), Fetal Liver Kinase 1 (FLK-1), Angiostatin, Endostatin, Vasostatin, Canstatin, Tumstatin, 16 kD prolacin fragment, tissue inhibitor of metalloproteinases 1 (TIMP-1), tissue inhibitor of metalloproteinases 2 (TIMP-2), tissue inhibitor of metalloproteinases 3 (TIMP-3), thrombospondin 1 (TSP-1), thrombospondin 2 (TSP-2), Maspin, PEX, soluble Tyrosine-protein kinase receptor 1 (sTie1), soluble Angiopoietin-1 receptor 2 (sTie2), Angiopoietin-1, Angiopoietin-2, Antivascular endothelial growth factor receptor 2 (VEGFR2) antibody (e.g. Alacizumab, Ramucirumab), Anti-vascular endothelial growth factor (VEGF) antibody (e.g. Brolucizumab, Ranibizumab, Bevacizumab), and Anti-vascular endothelial growth factor receptor 1 (VEGFR1) antibody (e.g. Icrucumab).

[0402] In this context particularly preferred are angiogenesis inhibitors as disclosed in Table 7 above.

[0403] In a particularly preferred embodiment, the at least one RNA of the RNA containing composition is an immunostimulating RNA, preferably according to SEQ ID NOs. 5, 394, or 10072 and is combined with at least one angiogenesis inhibitor as defined above, or a fragment or variant thereof.

6. Heat shock proteins:



[0404] In this context protein-based heat-shock proteins, or fragments and variants thereof as disclosed above in the context of "coding RNA" may be used as additional pharmaceutically active component. Alternatively, nucleic acids encoding these proteins or peptides or fragments or variants thereof may be used as additional pharmaceutically active component.

[0405] Preferably, the heat shock protein may be chosen from the following list: HSP27, HSP47 (serpin H1), HSP60, HSP70, HSC70, GRP78 (BiP), HSP90, HSP110, GRP94 (gp96), GRP170 (ORP150), PDI/PDIA, CRT/CALR.

[0406] In this context particularly preferred are heat shock proteins as disclosed in Table 8 above.

[0407] In a particularly preferred embodiment, the at least one RNA of the RNA containing composition is an immunostimulating RNA, preferably according to SEQ ID NOs. 5, 394, or 10072 and is combined with at least one heat shock protein as defined above, or a fragment or variant thereof.

7. Tumour antigens:



[0408] In this context protein-based tumor antigens, or fragments and variants thereof as disclosed above in the context of "coding RNA" may be used as additional pharmaceutically active component. Alternatively, nucleic acids encoding these proteins or peptides or fragments or variants thereof may be used as additional pharmaceutically active component.

[0409] In this context particularly preferred are tumor antignes as disclosed in Table 9 above.

[0410] In a particularly preferred embodiment, the at least one RNA of the RNA containing composition is an immunostimulating RNA, preferably according to SEQ ID NOs. 5, 394, or 10072 and is combined with at least one tumor antigen as defined above, or a fragment or variant thereof.

8. β-catenin inhibitors:



[0411] In this context protein-based β-catenin inhibitors, or fragments and variants thereof as disclosed above in the context of "coding RNA" may be used as additional pharmaceutically active component. Alternatively, nucleic acids encoding these proteins or peptides or fragments or variants thereof may be used as additional pharmaceutically active component.

[0412] Particular preferred β-catenin inhibitors according to the present disclosure comprise TAT-NLS-BLBD-6, axin-1, TCF-4, GSK-3b, DKK-1, Dvl-1 derivatives or fragments thereof.

Chemical β-catenin inhibitors:



[0413] According to the present disclosure, the at least one additional active pharmaceutical ingredient which may be contained in the composition disclosed herein, and/or which may be co-administered, or which may be combined with the composition disclosed herein may be a chemical β-catenin inhibitors. Chemical β-catenin inhibitors are known in the art that may be administered according to the present disclosure. Preferably the chemical β-catenin inhibitor is chosen from the following list: PKF118-310, CGP049090, PKF115-584, PKF222-815, PKF118-744, ICG001, CCT036477, XAV939, acyl hydrazones (HQBA), molecules with 2,3,6-trisubstituted pyrido[2,3,-b]pyrazine core skeletons, carnosic acid, CCT031374, iCRT-3,5,14, NC043, Ibuprofin, aspirin.

[0414] The following table 13 summarizes examples of small molecular inhibitors of β-catenin signaling which are particularly preferred in this context.
Table 13: β-catenin inhibitors
InhibitorTargetReference
PKF118-310, CGP049090, PKF115-584, PKF222-815 and PKF118-744 beta-catenin-TCF interaction Lepourcelet et al., 2004. Cancer Cell 5:91-102
ICG001 beta-catenin-CBP interaction Emami et al., 2004. Proc Natl Acad Sci USA 101:12682-7
CCT036477 beta-catenin-TCF interaction Ewan et al., 2010. Cancer Res. 70:5963-73
XAV939 Tankyrase Huang et al., 2009. Nature 461:614-20
acyl hydrazones (HQBA) Iron chelators Song et al., 2011. Cancer Res. 71:7628-39; Coombs et al., 2012. Oncogene 31:213-25
molecules with 2,3,6-trisubstituted pyrido[2,3,-b] pyrazine core skeletons beta-catenin Gong et al., 2011. Bioorg Med Chem. 19:5639-47
carnosic acid beta-catenin/BCL9 de la Roche et al., Nat Commun. 3:680
CCT031374 beta-catenin Thorne et al., 2010. Nat Chem Biol. 6:829-36
iCRT-3,5,14, NC043 beta-catenin-TCF interaction Wang et al., 2011. Cell Res. 21:730-40; Gonsalves et al., 2011. Proc Natl Acad Sci USA 108:5954-63
Ibuprofin, aspirin Cox2 Inhibitors Greenspan et al., 2011. Cancer Prev Res. 4:161-71


[0415] In a particularly preferred embodiment, the at least one RNA of the RNA containing composition is an immunostimulating RNA, preferably according to SEQ ID NOs. 5, 394, or 10072 and is combined with at least one β-catenin inhibitor as defined above, or a fragment or variant thereof.

9. Activators of the STING pathway



[0416] In this context protein-based activators of the STING pathway, or fragments and variants thereof as disclosed above in the context of "coding RNA" may be used as additional pharmaceutically active component. Alternatively, nucleic acids encoding these proteins or peptides or fragments or variants thereof may be used as additional pharmaceutically active component. Preferably, the at least one activator (stimulator) of the STING pathway is chosen from an activating protein or a constitutively active protein of the STING pathway, preferably DDX41, STING, cGAS, IRF3, TBK1 or STAT6 or a fragment or variant thereof.

Chemical STING-pathway activators:



[0417] In a further preferred embodiment the optional additional pharmaceutically active component may be selected from chemical activators of the STING pathway which are preferably selected from cyclic dinucleotides and xanthenone analogs.

[0418] Table 14 shows examples of chemical STING agonists. Further examples of STING agonists are disclosed in WO2014189805.
Table 14: Activators of STING pathway
Class of STING activatorexamples
cyclic dinucleotides 3'3'-cGAMP, 2'3'-cGAMP, 2'2'-cGAMP, c-di-APM, c-di-GMP, c-di-IMP, c-di-UMP
xanthenone analogs DMXAA, 5,6-dimethylxanthenone-4-acetic acid


[0419] In a particularly preferred embodiment, the at least one RNA of the RNA containing composition is an immunostimulating RNA, preferably according to SEQ ID NOs. 5, 394, or 10072 and is combined with at least one STING pathway activator as defined above, or a fragment or variant thereof.

10. Checkpoint modulators



[0420] In this context protein-based checkpoint modulators, or fragments and variants thereof as disclosed above in the context of "coding RNA" may be used as additional pharmaceutically active component. Alternatively, nucleic acids encoding these proteins or peptides or fragments or variants thereof may be used as additional pharmaceutically active component.

[0421] In preferred embodiments disclosed herein the checkpoint modulator is a modulator of B7-1/CD80, B7-2/CD86, B7-H1/PD-L1, B7-H2, B7-H3, B7-H4, B7-H6, B7-H7/HHLA2, BTLA, CD28, CD28H/IGPR-1, CTLA-4, ICOS, PD-1, PD-L2/B7-DC, PDCD6, VISTA/B7-H5/PD-1H, BTN1A1/Butyrophilin, BTN2A1, BTN2A2/Butyrophilin 2A2, BTN3A1/2, BTN3A2, BTN3A3, BTNL2/Butyrophilin-like 2, BTNL3, BTNL4, BTNL6, BTNL8, BTNL9, BTNL10, CD277/BTN3A1, LAIR1, LAIR2, CD96, CD155/PVR, CRTAM, DNAM-1/CD226, Nectin-2/CD112, Nectin-3, TIGIT, LILRA3/CD85e, LILRA4/CD85g/ILT7, LILRBl/CD85j/ILT2, LILRB2/CD85d/ILT4, LILRB3/CD85a/ILT5, LILRB4/CD85k/ILT3, 4-1BB/TNFRSF9/CD137, 4-1BB Ligand/TNFSF9, BAFF/BLyS/TNFSF13B, BAFF R/TNFRSF13C, CD27/TNFRSF7, CD27 Ligand/TNFSF7, CD30/TNFRSF8, CD30 Ligand/TNFSF8, CD40/TNFRSF5, CD40 Ligand/TNFSF5, DR3/TNFRSF25, GITR/TNFRSF18, GITR Ligand/TNFSF18, HVEM/TNFRSF14, LIGHT/TNFSF14, Lymphotoxin-alpha/TNF-beta, OX40/TNFRSF4, OX40 Ligand/TNFSF4, RELT/TNFRSF19L, TACI/TNFRSF13B, TL1A/TNFSF15, TNF-alpha, TNF RII/TNFRSF1B, 2B4/CD244/SLAMF4, BLAME/SLAMF8, CD2, CD2F-10/SLAMF9, CD48/SLAMF2, CD58/LFA-3, CD84/SLAMF5, CD229/SLAMF3, CRACC/SLAMF7, NTB-A/SLAMF6, SLAM/CD150, TIM-1/KIM-1/HAVCR, TIM-3, TIM-4, CD7, CD96, CD160, CD200, CD300a/LMIR1, CRTAM, DAP12, Dectin-1/CLEC7A, DPPIV/CD26, EphB6, Integrin alpha 4 beta 1, Integrin alpha 4 beta 7/LPAM-1, LAG-3, TIM-l/KIM-1/HAVCR, TIM-4, TSLP R, or any combinations thereof.

[0422] Preferably, the checkpoint modulator is selected from agonistic antibodies, antagonistic antibodies, ligands, dominant negative receptors and decoy receptors or combinations thereof.

[0423] Preferably, the agonistic antibody is chosen from the following list: anti-4-1BB, anti-OX40, anti-GITR, anti-CD28, anti-CD27, anti-CD-40anti-ICOS, anti-TNFRSF25, and anti-LIGHT.

[0424] Preferably, the antagonistic antibody is chosen from the list of anti-CTLA4, anti-PD1, anti-PD-Ll, anti-Vista, anti-Tim-3, anti-LAG-3, and anti-BTLA.

[0425] Particularly preferred are the anti-CTLA-4 antibodies ipilimumab (Yervoy®), tremelimumab, and AGEN-1884.

[0426] Particularly preferred are the anti-PDl antibodies Nivolumab (MDX-1106/BMS-936558/ONO-4538), (Brahmer et al., 2010. J Clin Oncol. 28(19):3167-75; PMID: 20516446); Pidilizumab (CT-011), (Berger et al., 2008. Clin Cancer Res. 14(10):3044-51; PMID: 18483370); Pembrolizumab (MK-3475, SCH 900475); AMP-224, and MEDI0680 (AMP-514).

[0427] Particularly preferred are the anti-PD-Ll antibodies MDX-1105/BMS-936559 (Brahmer et al. 2012. N Engl J Med. 366(26):2455-65; PMID: 22658128); atezolizumab (MPDL3280A/RG7446);durvalumab (MEDI4736); and avelumab (MSB0010718).

[0428] According to the present disclosure, checkpoint modulators according to Table 15 are particularly preferred:
Table 15: Antibodies directed against immune checkpoint proteins
NameTarget
Urelumab 4-1BB/CD137
PF-05082566 4-1BB/CD137
8H9 B7-H3
Enoblituzumab B7-H3
Ipilimumab CD152/CTLA-4
Ticilimumab (= tremelimumab) CD152/CTLA-4
Tremelimumab CD152/CTLA-4
Varlilumab CD27
Teneliximab CD40
Vorsetuzumab mafodotin CD70
Lirilumab KIR2D
GSK-3174998 OX40
MEDI-6469 OX40
MEDI-6383 OX40
MEDI-0562 OX40
PF-04518600 OX40
RG-7888 OX40
PF-06801591 PD-1
BGBA-317 PD-1
MEDI-0680 PD-1
MK-3475 PD-1
Nivolumab PD-1
PDR-001 PD-1
Pembrolizumab PD-1
Pidilizumab PD-1
REGN-2810 PD-1
SHR-1210 PD-1
TSR-042 PD-1
MDX-1106 PD-1
Merck 3745 PD-1
CT- 011 PD-1
MEDI-0680 PD-1
PDR001 PD-1
REGN2810 PD-1
BGB-108 PD-1
BGB-A317 PD-1
AMP-224 PD-1
Atezolizumab PD-L1 (CD274)
Avelumab PD-L1 (CD274)
BMS-936559 PD-L1 (CD274)
Durvalumab PD-L1 (CD274)
MEDI-4736 PD-L1 (CD274)
MPDL33280A PD-L1 (CD274)
YW243.55.S70 PD-L1 (CD274)
MDX-1105 PD-L1 (CD274)
MSB0010718C PD-L1 (CD274)


[0429] In a further preferred embodiment the checkpoint modulator is a decoy receptor (e.g. a soluble receptor). Preferably, the decoy receptor is a soluble PD1 receptor. In a particularly preferred embodiment the RNA sequence encoding a soluble PD1 receptor comprises an RNA sequence according to SEQ ID NO: 389

[0430] In a further preferred embodiment the checkpoint modulator is a ligand of an immune checkpoint protein. Preferably, the ligand is CD40 Ligand (CD40L).

[0431] In a particularly preferred embodiment, the at least one RNA of the RNA containing composition is an immunostimulating RNA, preferably according to SEQ ID NOs. 5, 394, or 10072 and is combined with at least one checkpoint modulator as defined above, preferably selected from an anti-CTLA4 antibody, an anti-PD1 antibody, an anti PD-L1 antibody, a CD40 ligand, or a soluble PD1 receptor, or a fragment or variant thereof.

11. Innate immune activators



[0432] In this context protein-based innate immune activators or fragments and variants thereof as disclosed above in the context of "coding RNA" may be used as additional pharmaceutically active component. Alternatively, nucleic acids encoding these proteins or peptides or fragments or variants thereof may be used as additional pharmaceutically active component.

[0433] In this context innate immune activators may be selected from mammalian, in particular human adjuvant proteins, which typically comprise any human protein or peptide, which is capable of eliciting an innate immune response (in a mammal), e.g. as a reaction of the binding of an exogenous TLR ligand to a TLR. More preferably, human adjuvant proteins are selected from the group consisting of proteins which are components and ligands of the signalling networks of the pattern recognition receptors including TLR, NLR and RLH, including TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, TLR11; NOD1, NOD2, NOD3, NOD4, NOD5, NALP1, NALP2, NALP3, NALP4, NALP5, NALP6, NALP6, NALP7, NALP7, NALP8, NALP9, NALP10, NALP11, NALP12, NALP13, NALP14,I IPAF, NAIP, CIITA, RIG-I, MDA5 and LGP2, the signal transducers of TLR signaling including adaptor proteins including e.g. Trif and Cardif; components of the Small-GTPases signalling (RhoA, Ras, Rac1, Cdc42, Rab etc.), components of the PIP signalling (PI3K, Src-Kinases, etc.), components of the MyD88-dependent signalling (MyD88, IRAK1, IRAK2, IRAK4, TIRAP, TRAF6 etc.), components of the MyD88-independent signalling (TICAM1, TICAM2, TRAF6, TBK1, IRF3, TAK1, IRAK1 etc.); the activated kinases including e.g. Akt, MEKK1, MKK1, MKK3, MKK4, MKK6, MKK7, ERK1, ERK2, GSK3, PKC kinases, PKD kinases, GSK3 kinases, JNK, p38MAPK, TAK1, IKK, and TAK1; the activated transcription factors including e.g. NF-κB, c-Fos, c-Jun, c-Myc, CREB, AP-1, Elk-1, ATF2, IRF-3, IRF-7.

[0434] Mammalian, in particular human adjuvant proteins may furthermore be selected from the group consisting of heat shock proteins, such as HSP10, HSP60, HSP65, HSP70, HSP75 and HSP90, gp96, Fibrinogen, TypIII repeat extra domain A of fibronectin; or components of the complement system including C1q, MBL, C1r, C1s, C2b, Bb, D, MASP-1, MASP-2, C4b, C3b, C5a, C3a, C4a, C5b, C6, C7, C8, C9, CR1, CR2, CR3, CR4, C1qR, C1INH, C4bp, MCP, DAF, H, I, P and CD59, or induced target genes including e.g. Beta-Defensin, cell surface proteins; or human adjuvant proteins including trif, flt-3 ligand, Gp96 or fibronectin, etc., or any species homolog of any of the above human adjuvant proteins. Furthermore HGMB1 may be used as adjuvant protein.

[0435] Mammalian, in particular human adjuvant proteins may furthermore comprise cytokines which induce or enhance an innate immune response, including IL-1 alpha, IL1 beta, IL-2, IL-6, IL-7, IL-8, IL-9, IL-12, IL-13, IL-15, IL-16, IL-17, IL-18, IL-21, IL-23, TNFalpha, IFNalpha, IFNbeta, IFNgamma, GM-CSF, G-CSF, M-CSF; chemokines including IL-8, IP-10, MCP-1, MIP-1alpha, RANTES, Eotaxin, CCL21; cytokines which are released from macrophages, including IL-1, IL-6, IL-8, IL-12 and TNF-alpha; as well as IL-1R1 and IL-1 alpha.

[0436] Therefore in this context it particularly preferred that the at least innate immune activator, is preferably an adjuvant protein, more preferably a human adjuvant protein, or a fragment or variant thereof.

[0437] In this context it is particularly preferred that I constitutive active variant of an adjuvant protein is used as innate immune activator, preferably a constitutive active variant of RIG-1 (ΔRIGI).

[0438] In another preferred embodiment the at least one innate immune activator is HGMB1, or a fragment or variant thereof.

[0439] In this context particularly preferred are innate immune activators as disclosed in Table 11 above.

[0440] In a particularly preferred embodiment, the at least one RNA of the RNA containing composition is an immunostimulating RNA, preferably according to SEQ ID NOs. 5, 394, or 10072 and is combined with at least one innate immune activator as defined above, or a fragment or variant thereof.

12. Antibodies, decoy receptors and dominant negative receptors



[0441] In this context protein-based antibodies, decoy receptors, or dominant negative recptors or fragments and variants thereof as disclosed above in the context of "coding RNA" may be used as additional pharmaceutically active component. Alternatively, nucleic acids encoding these proteins or peptides or fragments or variants thereof may be used as additional pharmaceutically active component.

[0442] According to the present disclosure, antibodies according to Table 16 are particularly preferred:
Table 16: Antibodies directed against proteins accociated with tumor or cancer development
NameTarget
3F8 GD2
Abagovomab CA-125 imitation
Abciximab Platelet glycoprotein GPIIb/IIIa
Adecatumumab EpCAM (CD326)
Afutuzumab CD20
Alacizumab pegol VEGFR2
Alemtuzumab CD52
Altumomab pentetate CEA
Amatuximab mesothelin
Anatumomab mafenatox 5T4
Anetumab ravtansine mesothelin
Apolizumab HLA-DR beta
apomab TRAIL-R2 (CD262)
Arcitumomab CEA
Ascrinvacumab ACVRL1
Bavituximab phosphatidylserine
Bectumomab CD22
Belimumab BAFF
Besilesomab CEA
Bevacizumab VEGF-A
Bivatuzumab mertansine CD44v6
Blinatumomab CD19 x CD3
Brentuximab vedotin CD30 (TNFRSF8)
Brontictuzumab NOTCH1
canakinumab IL-1β
Cantuzumab mertansine CanAg
Cantuzumab ravtansine MUC1 (CD227)
Capromab pendetide PSMA
Carlumab MCP-1
Catumaxomab EpCAM x CD3
cBR-doxorubicin immunoconjugate CD174 (Lewis Y)
Cetuximab EGFR (HER1/ERBB1)
Citatuzumab bogatox EpCAM
Cixutumumab IGF-1R
Clivatuzumab tetraxetan MUC1 (CD227)
Codrituzumab glypican 3
Coltuximab ravtansine CD19
Conatumumab TRAIL-R2 (CD262)
Dacetuzumab CD40
Dalotuzumab IGF-1R
Dalotuzumab insulin-like growth factor I receptor
Daratumumab CD38 (cyclic ADP ribose hydrolase)
Demcizumab DLL4
Denintuzumab mafodotin CD19
Denosumab RANKL
Depatuxizumab EGFR (HER1/ERBB1)
Derlotuximab histone complex
Detumomab unknown (B-lymphoma cells)
Dinutuximab B4GALNT1
Drozitumab TRAIL-R2 (CD262)
Duligotumab HER3 (ERBB3)
Duligotuzumab EGFR (HER1/ERBB1)
Dusigitumab ILGF2
Ecromeximab GD3 ganglioside
Edrecolomab EpCAM
Elgemtumab ERBB3
Elotuzumab SLAMF7 (CD319)
Elsilimomab IL-6
Emactuzumab CSF1R
Emibetuzumab HGFR
Emibetuzumab MET
Enavatuzumab TNFRSF12A
Enfortumab vedotin AGS-22M6
Enoticumab DLL4
Ensituximab MUC5AC
Epitumomab cituxetan MUC1 (CD227)
Epratuzumab CD22
Ertumaxomab HER2 (ERBB2/neu) x CD3
Etaracizumab integrin α5β3
Faralimomab IFNA1
Farletuzumab FOLR1 alpha
FBTA CD20 x CD3
Ficlatuzumab HGFR
Figitumumab IGF-1R
Flanvotumab TYRP1(glycoprotein 75)
Fresolimumab TGF-β
Futuximab EGFR (HER1/ERBB1)
Galiximab CD80
Gantiumab IGF-1R
Gemtuzumab ozogamicin CD33
Girentuximab Carbonic anhydrase 9 (CA9/CAIX)
Glembatumumab vedotin GPNMB
glycooptimized trastuzumab-GEX HER2 (ERBB2/neu)
Ibritumomab tiuxetan CD20
Icrucumab VEGFR-1
Igovomab MUC16
IMAB362 Claudin-18 (CLDN18.2)
Imgatuzumab EGFR (HER1/ERBB1)
Indatuximab ravtansine SDC1
Indusatumab vedotin GUCY2C
inebilizumab CD19
Inotuzumab ozogamicin CD22
Intetumumab CD51
Iratumumab CD30 (TNFRSF8)
Isatuximab CD38
Labetuzumab CEA
Lenzilumab CSF2
Lexatumumab TRAIL-R2 (CD262)
Lifastuzumab vedotin NaPi2B
Lilotomab satetraxetan CD37
Lintuzumab CD33
Lorvotuzumab mertansine CD56
Lucatumumab CD40
Lumiliximab CD23 (IgE receptor)
Lumretuzumab ERBB3
Mapatumumab TRAIL-R1 (CD261)
Margetuximab HER2 (ERBB2/neu)
Matuzumab EGFR (HER1/ERBB1)
Mepolizumab IL-5
Milatuzumab CD74
Minretumomab TAG-72
Mirvetuximab soravtansine FOLR1 alpha
Mitumomab GD3 (ganglioside)
Mogamulizumab CCR4
Moxetumomab pasudotox CD22
Nacolomab tafenatox C242 antigen
Naptumomab estafenatox 5T4
Narnatumab RON
Necitumumab EGFR (HER1/ERBB1)
Nesvacumab ANGPT2 (angiopoietin 2)
Nimotuzumab EGFR (HER1/ERBB1)
Nofetumomab merpentan EpCAM
binutuzumab CD20
Ocaratuzumab CD20
Ofatumumab CD20
Olaratumab PDGFRα
Onartuzumab MET
Ontuxizumab CD248 (TEM1)
Oportuzumab monatox EpCAM
Oregovomab CA-125
Otlertuzumab CD37
Panitumumab EGFR (HER1/ERBB1)
Pankomab MUC1 (tumor specific glycosylation)
Parsatuzumab EGFL7
Pasotuxizumab FOLH1
Patritumab HER3 (ERBB3)
Pemtumomab MUC1 (CD227)
Pertuzumab HER2 (ERBB2/neu)
Pinatuzumab vedotin CD22
Pintumomab adenocarcinoma antigen
Polatuzumab vedotin CD79B
Racotumomab NGcGM3
Radretumab EDB (fibronectin extra domain-B)
Ramucirumab VEGFR2
Rilotumumab HGFR
Rituximab CD20
Robatumumab IGF-1R
Sacituzumab govitecan Trop-2 (tumor-associated calcium signal transducer 2/EGP-1)
Samalizumab CD200 (OX-2 membrane glycoprotein)
Satumomab pendetide TAG-72
Seribantumab ERBB3
Seribantumab HER3 (ERBB3)
SGN-CDA CD19
SGN-CDA CD33
Sibrotuzumab FAP
Siltuximab IL-6
Simtuzumab LOXL2
Sofituzumab vedotin CA 125
Solitomab EpCAM
Sonepcizumab S1P (sphingosine-1-phosphate)
Tacatuzumab tetraxetan AFP (alpha-fetoprotein)
Taplitumomab paptox CD19
Tarextumab Notch receptor
Tenatumomab TN-C (tenascin C)
Teprotumumab CD221
Tetulomab CD37
TGN CD28
Tigatuzumab TRAIL-R2 (CD262)
Lebrikizumab IL-13
Tocilizumab IL-6R
Tositumomab CD20
Tovetumab CD140a
Tovetumab PDGFRα
Trastuzumab HER2 (ERBB2/neu)
Trastuzumab emtansine HER2 (ERBB2/neu)
TRBS GD2
Tucotuzumab celmoleukin EpCAM
ublituximab CD20
Ublituximab MS4A1
Ulocuplumab CXCR4
Vandortuzumab vedotin STEAP1
Vantictumab FZD7
Vanucizumab Ang-2 (angiopoietin 2) x VEGF-A
Veltuzumab CD20
Vesencumab NRP1
Volociximab integrin α5β1
Votumumab CTAA16.88
Zalutumumab EGFR (HER1/ERBB1)
Zanolimumab CD4
Zatuximab HER1 (EGFR/ERBB1)


[0443] Preferably, the neutralizing antibody is chosen from the list of anti-IL-10 and anti-TGFbeta.

[0444] In a particularly preferred embodiment, the at least one RNA of the RNA containing composition is an immunostimulating RNA, preferably according to SEQ ID NOs. 5, 394, or 10072 and is combined with at least one antibody, preferably anti-CD73 antibody or at least one decoy receptor as defined above, or a fragment or variant thereof.

[0445] Furthermore, the at least one antibody may preferably chosen from anti-CD73 antibodies or fragments or variants thereof.

[0446] In a further particularly preferred embodiment the at least one antibody is chosen from an antibody directed against CCR5/CD195 or from an antibody directed against its ligand CCL5/RANTES or fragments or variants thereof.

[0447] In a particularly preferred embodiment the decoy receptor is a soluble CCR5 (chemokine receptor type 5, also known as CD195).

[0448] In a particularly preferred embodiment the dominant negative receptor is dominant negative CCR5 (chemokine receptor type 5, also known as CD195).

13. Inhibitors of myeloid derived suppressor cells (MDSCs)



[0449] In this context protein-based inhibitors of myeloid derived suppressor cells (MDSCs), or fragments and variants thereof as disclosed above in the context of "coding RNA" may be used as additional pharmaceutically active component. Alternatively, nucleic acids encoding these proteins or peptides or fragments or variants thereof may be used as additional pharmaceutically active component.

[0450] It is particularly preferred to use anti IL-17 antibodies and IL-12 as inhibitors of MDSCs.

[0451] In the context of the present disclosure, MDSC inhibition can be achieved by direct deactivation of MDSCs (e.g., chemical NO inhibitors (PDE-5 inhibitors, NO-aspirins, L-NAME), Arginase inhibitors (PDE-5 inhibitors, COX2 inhibitors, NOHA, L-NAME), ROS inhibitors(synthetic Triterpenoids)), by blocking differentiation of MDSCs into mature cells (e.g., ATRA, Vitamin A, Vitamin D3, CpG), by blocking the cell development of MDSCs (e.g. bisphosphorates (zolodronic acid), modulators of cell signaling (JAK2/STAT3 inhibitors, Multi-Kinase inhibitors, VEGF inhibitors)), or by depletion of MDSCs (e.g., cytotoxic agents (gemcitabine, cisplatin, paclitaxel, 5-fluorouracil) or HSP 90 inhibitors (17-DMAG)). Therefore these compounds may also be used as additional pharmaceutically active compound.

[0452] In a particularly preferred embodiment, the at least one RNA of the RNA containing composition is an immunostimulating RNA, preferably according to SEQ ID NOs. 5, 394, or 10072 and is combined with at least one inhibitor of MDSCs as defined above, or a fragment or variant thereof.

14. IDO pathway inhibitors



[0453] In this context protein-based IDO pathway inhibitors, or fragments and variants thereof as disclosed above in the context of "coding RNA" may be used as additional pharmaceutically active component. Alternatively, nucleic acids encoding these proteins or peptides or fragments or variants thereof may be used as additional pharmaceutically active component.

Chemical IDO pathway inhibitor:



[0454] In a further preferred embodiment the additional pharmaceutically active component may be selected from an IDO pathway inhibitor, which is preferably selected from small molecule inhibitor. Preferably the IDO pathway inhibitor is chosen from the following list: Indoximod (the D isomer of 1-methyl-tryptophan) and NLG919).

[0455] In a particularly preferred embodiment, the at least one RNA of the RNA containing composition is an immunostimulating RNA, preferably according to SEQ ID NOs. 5, 394, or 10072 and is combined with at least one IDO pathway inhibitor as defined above, or a fragment or variant thereof.

15. Proteins or peptides that bind inhibitors of apoptosis



[0456] Apoptosis is a tightly regulated cellular process and faulty regulation of apoptosis is a hallmark of human cancers. Targeting key apoptosis regulators with the goal to restore apoptosis in tumor cells has been pursued as a new cancer therapeutic strategy. XIAP, cIAP1, and cIAP2, members of inhibitor of apoptosis (IAP) proteins, are critical regulators of cell death and survival and are attractive targets for new cancer therapy. The SMAC/DIABLO protein is an endogenous antagonist of XIAP, cIAP1, and cIAP2. In the last decade, intense research efforts have resulted in the design and development of several small-molecule SMAC mimetics now in clinical trials for cancer treatment.

[0457] In a further preferred embodiment, the composition disclosed herein comprises at least one molecule that binds inhibitors of apoptosis proteins (IAPs) and thus sensitize cancer cells to apoptotic death.

[0458] Therefore it is particularly preferred that the the RNA containing composition disclosed herein comprises at least one molecule that binds inhibitors of apoptosis, such as SMAC mimetics. Particularly preferred proteins or peptides that bind IAPs according to the present disclosure comprise Omi/HtrA2, Smac, Smac derived peptides, Smac/DIABLO, and XAF1 (XIAP-associated factor 1) and fragments or variants thereof.

[0459] In this context proteins or peptides that bind inhibitors of apoptosis, or fragments and variants thereof as disclosed above in the context of "coding RNA" may be used as additional pharmaceutically active component. Alternatively, nucleic acids encoding these proteins or peptides or fragments or variants thereof may be used as additional pharmaceutically active component. Therefore it is particularly preferred that the additional pharmaceutically active component is selected from proteins or peptides that bind inhibitors of apoptosis, such as SMAC mimetics. Furthermore it is particularly preferred that such SMAC mimetics used as additional pharmaceutically active component are small molecules inhibiting inhibitors of apoptosis.

[0460] In a particularly preferred embodiment, the at least one RNA of the RNA containing composition is an immunostimulating RNA, preferably according to SEQ ID NOs. 5, 394, or 10072 and is combined with at least one proteins or peptides that bind inhibitors of apoptosis as defined above, or a fragment or variant thereof.

16. Anti-bacterial agent:



[0461] According to the present disclosure, the at least one additional pharmaceutically active component which may be contained in the composition disclosed herein, and/or which may be co-administered, may be an anti-bacterial agent. In this context, any anti-bacterial agents known to one of skill in the art may be used in combination with the components of the composition as defined herein. Nonlimiting examples of anti-bacterial agents include Amikacin, Amoxicillin, Amoxicillin-clavulanic acid, Amphothericin-B, Ampicillin, Ampicllin-sulbactam, Apramycin, Azithromycin, Aztreonam, Bacitracin, Benzylpenicillin, Caspofungin, Cefaclor, Cefadroxil, Cefalexin, Cefalothin, Cefazolin, Cefdinir, Cefepime, Cefixime, Cefmenoxime, Cefoperazone, Cefoperazone-sulbactam, Cefotaxime, Cefoxitin, Cefbirome, Cefpodoxime, Cefpodoxime-clavulanic acid, Cefpodoxime-sulbactam, Cefbrozil, Cefquinome, Ceftazidime, Ceftibutin, Ceftiofur, Ceftobiprole, Ceftriaxon, Cefuroxime, Chloramphenicole, Florfenicole, Ciprofloxacin, Clarithromycin, Clinafloxacin, Clindamycin, Cloxacillin, Colistin, Cotrimoxazol (Trimthoprim/sulphamethoxazole), Dalbavancin, Dalfopristin/Quinopristin, Daptomycin, Dibekacin, Dicloxacillin, Doripenem, Doxycycline, Enrofloxacin, Ertapenem, Erythromycin, Flucloxacillin, Fluconazol, Flucytosin, Fosfomycin, Fusidic acid, Garenoxacin, Gatifloxacin, Gemifloxacin, Gentamicin, Imipenem, Itraconazole, Kanamycin, Ketoconazole, Levofloxacin, Lincomycin, Linezolid, Loracarbef, Mecillnam (amdinocillin), Meropenem, Metronidazole, Meziocillin, Mezlocillin- sulbactam, Minocycline, Moxifloxacin, Mupirocin, Nalidixic acid, Neomycin, Netilmicin, Nitrofurantoin, Norfloxacin, Ofloxacin, Oxacillin, Pefloxacin, Penicillin V, Piperacillin, Piperacillin-sulbactam, Piperacillin-tazobactam, Rifampicin, Roxythromycin, Sparfloxacin, Spectinomycin, Spiramycin, Streptomycin, Sulbactam, Sulfamethoxazole, Teicoplanin, Telavancin, Telithromycin, Temocillin, Tetracyklin, Ticarcillin, Ticarcillin-clavulanic acid, Tigecycline, Tobramycin, Trimethoprim, Trovafloxacin, Tylosin, Vancomycin, Virginiamycin, and Voriconazole.

17. Anti-viral agents:



[0462] According to the present disclosure, the at least one additional pharmaceutically active component/compound, which may be contained in the composition disclosed herein, and/or which may be co-administered, may be an anti-viral agent, preferably, but not limited to, nucleoside analogs (e.g., zidovudine, acyclovir, gangcyclovir, vidarabine, idoxuridine, trifluridine, and ribavirin), foscarnet, amantadine, peramivir, rimantadine, saquinavir, indinavir, ritonavir, alpha-interferons and other interferons, AZT, t-705, zanamivir (Relenza®), and oseltamivir (Tamiflu®). Other anti-viral agents include influenza virus vaccines, e.g., Fluarix® (Glaxo SmithKline), FluMist® (Medlmmune Vaccines), Fluvirin® (Chiron Corporation), Flulaval® (GlaxoSmithKline), Afluria® (CSL Biotherapies Inc.), Agriflu® (Novartis) or Fluzone® (Aventis Pasteur).

18. Drugs:



[0463] In some embodiments, the additional pharmaceutically active component/compound may include at least one drug. The term "drug" is intended to include any substance that, when introduced or absorbed into the body of a living organism, alters normal bodily or cellular function. Some nonlimiting examples of suitable drugs, including combinations and alternative forms of the drugs such as alternative salt forms, free acid form, free base forms, pro-drugs and hydrates, include: analgesics/antipyretics (e.g., aspirin, acetaminophen, ibuprofen, naproxen sodium, buprenorphine, propoxyphene hydrochloride, propoxyphene napsylate, meperidine hydrochloride, hydromorphone hydrochloride, morphine, oxycodone, codeine, dihydrocodeine bitartrate, pentazocine, hydrocodone bitartrate, levorphanol, diflunisal, trolamine salicylate, nalbuphine hydrochloride, mefenamic acid, butorphanol, choline salicylate, butalbital, phenyltoloxamine citrate, diphenhydramine citrate, methotrimeprazine, cinnamedrine hydrochloride, and meprobamate); antiasthmatics (e.g., ketotifen and traxanox); antibiotics (e.g., neomycin, streptomycin, chloramphenicol, cephalosporin, ampicillin, penicillin, tetracycline, and ciprofloxacin); antidepressants (e.g., nefopam, oxypertine, doxepin, amoxapine, trazodone, amitriptyline, maprotiline, phenelzine, desipramine, nortriptyline, tranylcypromine, fluoxetine, imipramine, imipramine pamoate, isocarboxazid, trimipramine, and protriptyline); antidiabetics (e.g., biguanides and sulfonylurea derivatives); antifungal agents (e.g., griseofulvin, ketoconazole, itraconazole, amphotericin B, nystatin, and candicidin); antihypertensive agents (e.g., propanolol, propafenone, oxyprenolol, nifedipine, reserpine, trimethaphan, phenoxybenzamine, pargyline hydrochloride, deserpidine, diazoxide, guanethidine monosulfate, minoxidil, rescinnamine, sodium nitroprusside, rauwolfia serpentine, alseroxylon, and phentolamine); anti-inflammatories (e.g., (non-steroidal) indomethacin, ketoprofen, flurbiprofen, naproxen, ibuprofen, ramifenazone, piroxicam, (steroidal) cortisone, dexamethasone, fluazacort, deflazacort, celecoxib, rofecoxib, hydrocortisone, prednisolone, and prednisone); antineoplastics (e.g., cyclophosphamide, actinomycin, bleomycin, dactinomycin, daunorubicin, doxorubicin, epirubicin, mitomycin, methotrexate, fluorouracil, gemcitabine, carboplatin, carmustine (BCNU), methyl-CCNU, cisplatin, etoposide, camptothecin and derivatives thereof, phenesterine, paclitaxel and derivatives thereof, docetaxel and derivatives thereof, vinblastine, vincristine, goserelin, leuprolide, tamoxifen, interferon alfa, retinoic acid (ATRA), nitrogen mustard alkylating agents, and piposulfan); antianxiety agents (e.g., lorazepam, buspirone, prazepam, chlordiazepoxide, oxazepam, clorazepate dipotassium, diazepam, hydroxyzine pamoate, hydroxyzine hydrochloride, alprazolam, droperidol, halazepam, chlormezanone, and dantrolene); immunosuppressive agents (e.g., cyclosporine, azathioprine, mizoribine, and FK506 (tacrolimus)); antimigraine agents (e.g., ergotamine, propanolol, isometheptene mucate, and dichloralphenazone); sedatives/hypnotics (e.g., barbiturates such as pentobarbital, pentobarbital, and secobarbital; and benzodiazapines such as flurazepam hydrochloride, triazolam, and midazolam); antianginal agents (e.g., beta-adrenergic blockers; calcium channel blockers such as nifedipine, and diltiazem; and nitrates such as nitroglycerin, isosorbide dinitrate, pentearythritol tetranitrate, and erythrityl tetranitrate); antipsychotic agents (e.g., haloperidol, loxapine succinate, loxapine hydrochloride, thioridazine, thioridazine hydrochloride, thiothixene, fluphenazine, fluphenazine decanoate, fluphenazine enanthate, trifluoperazine, chlorpromazine, perphenazine, lithium citrate, and prochlorperazine); antimanic agents (e.g., lithium carbonate); antiarrhythmics (e.g., bretylium tosylate, esmolol, verapamil, amiodarone, encamide, digoxin, digitoxin, mexiletine, disopyramide phosphate, procainamide, quinidine sulfate, quinidine gluconate, quinidine polygalacturonate, flecamide acetate, tocamide, and lidocaine); antiarthritic agents (e.g., phenylbutazone, sulindac, penicillanine, salsalate, piroxicam, azathioprine, indomethacin, meclofenamate, gold sodium thiomalate, ketoprofen, auranofin, aurothioglucose, and tolmetin sodium); antigout agents (e.g., colchicine, and allopurinol); anticoagulants (e.g., heparin, heparin sodium, and warfarin sodium); thrombolytic agents (e.g., urokinase, streptokinase, and alteplase); antifibrinolytic agents (e.g., aminocaproic acid); hemorheologic agents (e.g., pentoxifylline); antiplatelet agents (e.g., aspirin); anticonvulsants (e.g., valproic acid, divalproex sodium, phenyloin, phenyloin sodium, clonazepam, primidone, phenobarbital, carbamazepine, amobarbital sodium, methsuximide, metharbital, mephobarbital, mephenyloin, phensuximide, paramethadione, ethotoin, phenacemide, secobarbital sodium, clorazepate dipotassium, and trimethadione); antiparkinson agents (e.g., ethosuximide); antihistamines/antipruritics (e.g., hydroxyzine, diphenhydramine, chlorpheniramine, brompheniramine maleate, cyproheptadine hydrochloride, terfenadine, clemastine fumarate, triprolidine, carbinoxamine, diphenylpyraline, phenindamine, azatadine, tripelennamine, dexchlorpheniramine maleate, methdilazine, and); agents useful for calcium regulation (e.g., calcitonin, and parathyroid hormone); antibacterial agents (e.g., amikacin sulfate, aztreonam, chloramphenicol, chloramphenicol palmitate, ciprofloxacin, clindamycin, clindamycin palmitate, clindamycin phosphate, metronidazole, metronidazole hydrochloride, gentamicin sulfate, lincomycin hydrochloride, tobramycin sulfate, vancomycin hydrochloride, polymyxin B sulfate, colistimethate sodium, and colistin sulfate); antiviral agents (e.g., interferon alpha, beta or gamma, zidovudine, amantadine hydrochloride, ribavirin, and acyclovir); antimicrobials (e.g., cephalosporins such as cefazolin sodium, cephradine, cefaclor, cephapirin sodium, ceftizoxime sodium, cefoperazone sodium, cefotetan disodium, cefuroxime axetil, cefotaxime sodium, cefadroxil monohydrate, cephalexin, cephalothin sodium, cephalexin hydrochloride monohydrate, cefamandole nafate, cefoxitin sodium, cefonicid sodium, ceforanide, ceftriaxone sodium, ceftazidime, cefadroxil, cephradine, and cefuroxime sodium; penicillins such as ampicillin, amoxicillin, penicillin G benzathine, cyclacillin, ampicillin sodium, penicillin G potassium, penicillin V potassium, piperacillin sodium, oxacillin sodium, bacampicillin hydrochloride, cloxacillin sodium, ticarcillin disodium, azlocillin sodium, carbenicillin indanyl sodium, penicillin G procaine, methicillin sodium, and nafcillin sodium; macrolides such as, azithromycin, clarithromycin, and erythromycins such as erythromycin ethylsuccinate, erythromycin, erythromycin estolate, erythromycin lactobionate, erythromycin stearate, and erythromycin ethylsuccinate; and tetracyclines such as tetracycline hydrochloride, doxycycline hyclate, and minocycline hydrochloride); anti-infectives (e.g., GM-CSF); bronchodilators (e.g., sympathomimetics such as epinephrine hydrochloride, metaproterenol sulfate, terbutaline sulfate, isoetharine, isoetharine mesylate, isoetharine hydrochloride, albuterol sulfate, albuterol, bitolterolmesylate, isoproterenol hydrochloride, terbutaline sulfate, epinephrine bitartrate, metaproterenol sulfate, epinephrine, and epinephrine bitartrate; anticholinergic agents such as ipratropium bromide; xanthines such as aminophylline, dyphylline, metaproterenol sulfate, and theophylline; mast cell stabilizers such as cromolyn sodium; inhalant corticosteroids such as beclomethasone dipropionate (BDP), and beclomethasone dipropionate monohydrate; salbutamol; ipratropium bromide; budesonide; salmeterol; xinafoate; triamcinolone; nedocromil sodium; flunisolide; fluticasone propionate; steroidal compounds and hormones (e.g., androgens such as danazol, testosterone cypionate, fluoxymesterone, ethyltestosterone, testosterone enathate, methyltestosterone; estrogens such as estradiol, estropipate, and conjugated estrogens; progestins such as methoxyprogesterone acetate, and norethindrone acetate; corticosteroids such as triamcinolone, betamethasone, betamethasone sodium phosphate, dexamethasone, dexamethasone sodium phosphate, dexamethasone acetate, prednisone, methylprednisolone acetate suspension, triamcinolone acetonide, methylprednisolone, prednisolone sodium phosphate, methylprednisolone sodium succinate, hydrocortisone sodium succinate, triamcinolone hexacetonide, hydrocortisone, hydrocortisone cypionate, prednisolone, fludrocortisone acetate, paramethasone acetate, prednisolone tebutate, prednisolone acetate, prednisolone sodium phosphate, and thyroid hormones such as levothyroxine sodium); hypoglycemic agents (e.g., human insulin, purified beef insulin, purified pork insulin, glyburide, metformin, chlorpropamide, glipizide, tolbutamide, and tolazamide); hypolipidemic agents (e.g., clofibrate, dextrothyroxine sodium, probucol, pravastitin, atorvastatin, lovastatin, and niacin); proteins (e.g., DNase, alginase, superoxide dismutase, and lipase); nucleic acids (e.g., anti-sense nucleic acids); agents useful for erythropoiesis stimulation (e.g., erythropoietin); antiulcer/antireflux agents (e.g., famotidine, cimetidine, and ranitidine hydrochloride); antinauseants/antiemetics (e.g., meclizine hydrochloride, nabilone, prochlorperazine, dimenhydrinate, promethazine hydrochloride, thiethylperazine, and scopolamine); as well as other drugs useful in the compositions and methods described herein include mitotane, halonitrosoureas, anthrocyclines, ellipticine, ceftriaxone, ketoconazole, ceftazidime, oxaprozin, valacyclovir, urofollitropin, famciclovir, flutamide, enalapril, itraconazole, buspirone, gabapentin, fosinopril, tramadol, acarbose, lorazepam, follitropin, omeprazole, fluoxetine, lisinopril, tramadol, levofloxacin, zafirlukast, interferon, growth hormone, interleukin, erythropoietin, granulocyte stimulating factor, nizatidine, bupropion, perindopril, erbumine, adenosine, alendronate, alprostadil, benazepril, betaxolol, bleomycin sulfate, dexfenfluramine, diltiazem, fentanyl, flecamide, gemcitabine, glatiramer acetate, granisetron, lamivudine, mangafodipir trisodium, mesalamine, metoprolol fumarate, metronidazole, miglitol, moexipril, monteleukast, octreotide acetate, olopatadine, paricalcitol, somatropin, sumatriptan succinate, tacrine, verapamil, nabumetone, trovafloxacin, dolasetron, zidovudine, finasteride, tobramycin, isradipine, tolcapone, enoxaparin, fluconazole, lansoprazole, terbinafine, pamidronate, didanosine, diclofenac, cisapride, venlafaxine, troglitazone, fluvastatin, losartan, imiglucerase, donepezil, olanzapine, valsartan, fexofenadine, calcitonin, and ipratropium bromide. In some embodiments, the drug may be water soluble. In some embodiments, the drug may not be water soluble

19. Combination with standard therapy



[0464] According to the present disclosure, the at least one additional pharmaceutically active component/compound which may be contained in the composition disclosed herein, and/or which may be co-administered, may be selected from any standard therapy used for the treatment of the particular tumor or cancer disease, e.g any chemotherapy, checkpoint modulator, kinase inhibitor etc.

Adjuvants and further components:



[0465] According to the present disclosure, the at least one additional pharmaceutically active component/compound which may be contained in the composition disclosed herein, and/or which may be co-administered may be an adjuvant. According to a specific embodiment, the composition disclosed herein may comprise an adjuvant. In this context, an adjuvant may be understood as any compound, which is suitable to initiate or increase an immune response of the innate immune system, i.e. a non-specific immune response. With other words, when administered, the composition disclosed herein preferably elicits an innate immune response due to the adjuvant, optionally contained therein. Preferably, such an adjuvant may be selected from an adjuvant known to a skilled person and suitable for the present case, i.e. supporting the induction of an innate immune response in a mammal.

[0466] Particularly preferred as adjuvants suitable for depot and delivery are cationic or polycationic compounds as defined above for the RNA of the composition disclosed herein as vehicle, transfection or complexation agent.

[0467] Furthermore, the composition disclosed herein may comprise one or more additional adjuvants which are suitable to initiate or increase an immune response of the innate immune system, i.e. a non-specific immune response, particularly by binding to pathogen-associated molecular patterns (PAMPs). With other words, when administered, the pharmaceutical composition preferably elicits an innate immune response due to the adjuvant, optionally contained therein. Preferably, such an adjuvant may be selected from an adjuvant known to a skilled person and suitable for the present case, i.e. supporting the induction of an innate immune response in a mammal.

[0468] Also such an adjuvant may be selected from any adjuvant known to a skilled person and suitable for the present case, i.e. supporting the induction of an innate immune response in a mammal and/or suitable for depot and delivery of the components of the composition disclosed herein. Preferred as adjuvants suitable for depot and delivery are cationic or polycationic compounds as defined above. Likewise, the adjuvant may be selected from the group consisting of, e.g., cationic or polycationic compounds as defined above, from chitosan, TDM, MDP, muramyl dipeptide, pluronics, alum solution, aluminium hydroxide, ADJUMER™ (polyphosphazene); aluminium phosphate gel; glucans from algae; algammulin; aluminium hydroxide gel (alum); highly protein-adsorbing aluminium hydroxide gel; low viscosity aluminium hydroxide gel; AF or SPT (emulsion of squalane (5%), Tween 80 (0.2%), Pluronic L121 (1.25%), phosphate-buffered saline, pH 7.4); AVRIDINE™ (propanediamine); BAY R1005™ ((N-(2-deoxy-2-L-leucylaminob-D-glucopyranosyl)-N-octadecyl-dodecanoyl-amide hydroacetate); CALCITRIOL™ (1-alpha,25-dihydroxy-vitamin D3); calcium phosphate gel; CAP™ (calcium phosphate nanoparticles); cholera holotoxin, cholera-toxin-Al-protein-A-D-fragment fusion protein, sub-unit B of the cholera toxin; CRL 1005 (block copolymer P1205); cytokine-containing liposomes; DDA (dimethyldioctadecylammonium bromide); DHEA (dehydroepiandrosterone); DMPC (dimyristoylphosphatidylcholine); DMPG (dimyristoylphosphatidylglycerol); DOC/alum complex (deoxycholic acid sodium salt); Freund's complete adjuvant; Freund's incomplete adjuvant; gamma inulin; Gerbu adjuvant (mixture of: i) N-acetylglucosaminyl-(P1-4)-N-acetylmuramyl-L-alanyl-D35 glutamine (GMDP), ii) dimethyldioctadecylammonium chloride (DDA), iii) zinc-L-proline salt complex (ZnPro-8); GM-CSF); GMDP (N-acetylglucosaminyl-(b1-4)-N-acetylmuramyl-L47 alanyl-D-isoglutamine); imiquimod (1-(2-methypropyl)-1H-imidazo[4,5-c]quinoline-4-amine); ImmTher™ (N-acetylglucosaminyl-N-acetylmuramyl-L-Ala-D-isoGlu-L-Ala-glycerol dipalmitate); DRVs (immunoliposomes prepared from dehydration-rehydration vesicles); interferongamma; interleukin-1beta; interleukin-2; interleukin-7; interleukin-12; ISCOMS™; ISCOPREP 7.0.3.™; liposomes; LOXORIBINE™ (7-allyl-8-oxoguanosine); LT 5 oral adjuvant (E.coli labile enterotoxin-protoxin); microspheres and microparticles of any composition; MF59™; (squalenewater emulsion); MONTANIDE ISA 51™ (purified incomplete Freund's adjuvant); MONTANIDE ISA 720™ (metabolisable oil adjuvant); MPL™ (3-Q-desacyl-4'-monophosphoryl lipid A); MTP-PE and MTP-PE liposomes ((N-acetyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1,2-dipalmitoyl-sn-glycero-3-(hydroxyphosphoryloxy))-ethylamide, monosodium salt); MURAMETIDE™ (Nac-Mur-L-Ala-D-Gln-OCH3); MURAPALMITINE™ and DMURAPALMITINE™ (Nac-Mur-L-Thr-D-isoGln-sn-glyceroldipalmitoyl); NAGO (neuraminidase- galactose oxidase); nanospheres or nanoparticles of any composition; NISVs (non-ionic surfactant vesicles); PLEURAN™ (β-glucan); PLGA, PGA and PLA (homo- and co-polymers of lactic acid and glycolic acid; microspheres/nanospheres); PLURONIC L121™; PMMA (polymethylmethacrylate); PODDS™ (proteinoid microspheres); polyethylene carbamate derivatives; poly-rA: poly-rU (polyadenylic acid-polyuridylic acid complex); polysorbate 80 (Tween 80); protein cochleates (Avanti Polar Lipids, Inc., Alabaster, AL); STIMULON™ (QS-21); Quil-A (Quil-A saponin); S-28463 (4-amino-otec-dimethyl-2-ethoxymethyl-1H-imidazo[4,5-c]quinoline-1-ethanol); SAF-1™ ("Syntex adjuvant formulation"); Sendai proteoliposomes and Sendai containing lipid matrices; Span-85 (sorbitan trioleate); Specol (emulsion of Marcol 52, Span 85 and Tween 85); squalene or Robane® (2,6,10,15,19,23-hexamethyltetracosan and 2,6,10,15,19,23-hexamethyl-2,6,10,14,18,22-tetracosahexane); stearyltyrosine (octadecyltyrosine hydrochloride); Theramid® (N-acetylglucosaminyl-N-acetylmuramyl-L-Ala-D-isoGlu-L-Aladipalmitoxypropylamide); Theronyl-MDP (Termurtide™ or [thr 1]-MDP; N-acetylmuramyl-Lthreonyl-D-isoglutamine); Ty particles (Ty-VLPs or virus-like particles); Walter-Reed liposomes (liposomes containing lipid A adsorbed on aluminium hydroxide), and lipopeptides, including Pam3Cys, in particular aluminium salts, such as Adju-phos, Alhydrogel, Rehydragel; emulsions, including CFA, SAF, IFA, MF59, Provax, TiterMax, Montanide, Vaxfectin; copolymers, including Optivax (CRL1005), L121, Poloaxmer4010), etc.; liposomes, including Stealth, cochleates, including BIORAL; plant derived adjuvants, including QS21, Quil A, Iscomatrix, ISCOM; adjuvants suitable for costimulation including Tomatine, biopolymers, including PLG, PMM, Inulin, microbe derived adjuvants, including Romurtide, DETOX, MPL, CWS, Mannose, CpG nucleic acid sequences, CpG7909, ligands of human TLR 1-10, ligands of murine TLR 1-13, ISS-1018, 35 IC31, Imidazoquinolines, Ampligen, Ribi529, IMOxine, IRIVs, VLPs, cholera toxin, heat-labile toxin, Pam3Cys, Flagellin, GPI anchor, LNFPIII/Lewis X, antimicrobial peptides, UC-1V150, RSV fusion protein, cdiGMP; and adjuvants suitable as antagonists including CGRP neuropeptide.

[0469] Particularly preferred, an adjuvant may be selected from adjuvants, which support induction of a Th1-immune response or maturation of naïve T-cells, such as GM-CSF, IL-12, IFNg, any RNA as defined herein, preferably an immunostimulatory RNA, CpG DNA, etc.

[0470] It is possible that the composition disclosed herein contains besides the at least one RNA as described above further components which are selected from the group comprising: further antigens or further antigen-providing nucleic acids; a further immunotherapeutic agent; one or more auxiliary substances; or any further compound, which is known to be immunostimulating due to its binding affinity (as ligands) to human Toll-like receptors; and/or an adjuvant nucleic acid, preferably an immunostimulatory RNA (isRNA).

[0471] The composition disclosed herein can additionally contain one or more auxiliary substances in order to increase its immunogenicity or immunostimulatory capacity, if desired. A synergistic action of the at least one RNA as defined herein and of an auxiliary substance, which may be optionally contained in the composition disclosed herein, is preferably achieved thereby. Depending on the various types of auxiliary substances, various mechanisms can come into consideration in this respect. For example, compounds that permit the maturation of dendritic cells (DCs), for example lipopolysaccharides, TNF-alpha or CD40 ligand, form a first class of suitable auxiliary substances. In general, it is possible to use as auxiliary substance any agent that influences the immune system in the manner of a "danger signal" (LPS, GP96, etc.) or cytokines, such as GM-CFS, which allow an immune response to be enhanced and/or influenced in a targeted manner. Particularly preferred auxiliary substances are cytokines, such as monokines, lymphokines, interleukins or chemokines, that further promote the innate immune response, such as IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31, IL-32, IL-33, IFN-alpha, IFN-beta, IFN-gamma, GM-CSF, G-CSF, M-CSF, LT-beta or TNF-alpha, growth factors, such as hGH.

[0472] The composition disclosed herein may contain any further compound, which is known to be immunostimulating due to its binding affinity (as ligands) to human Toll-like receptors TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, or due to its binding affinity (as ligands) to murine Toll-like receptors TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, TLR11, TLR12 or TLR13.

[0473] Further additives which may be included in the composition disclosed herein are emulsifiers, such as, for example, Tween; wetting agents, such as, for example, sodium lauryl sulfate; colouring agents; taste-imparting agents, pharmaceutical carriers; tablet-forming agents; stabilizers; antioxidants; preservatives.

Pharmaceutical composition:



[0474] In a further aspect, the present disclosure also concerns a pharmaceutical composition, comprising the RNA containing composition as defined herein and a pharmaceutically acceptable carrier and/or vehicle. Preferably the pharmaceutical composition is prepared for intratumoral application, preferably by injection into tumor tissue. Sterile injectable forms of the pharmaceutical composition disclosed herein may be aqueous or oleaginous suspension. These suspensions may be formulated according to techniques known in the art using suitable dispersing or wetting agents and suspending agents.

[0475] A pharmaceutically acceptable carrier typically includes the liquid or non-liquid basis of a composition comprising the components of the composition disclosed herein. If the composition is provided in liquid form, the carrier will typically be pyrogen-free water; isotonic saline or buffered (aqueous) solutions, e.g. phosphate, citrate etc. buffered solutions. The injection buffer may be hypertonic, isotonic or hypotonic with reference to the specific reference medium, i.e. the buffer may have a higher, identical or lower salt content with reference to the specific reference medium, wherein preferably such concentrations of the afore mentioned salts may be used, which do not lead to damage of cells due to osmosis or other concentration effects. Reference media are e.g. liquids occurring in "in vivo" methods, such as blood, lymph, cytosolic liquids, or other body liquids, or e.g. liquids, which may be used as reference media in "in vitro" methods, such as common buffers or liquids. Such common buffers or liquids are known to a skilled person. Ringer-Lactate solution is particularly preferred as a liquid basis.

[0476] However, one or more compatible solid or liquid fillers or diluents or encapsulating compounds, which are suitable for administration to a patient to be treated, may be used as well for the pharmaceutical composition disclosed herein. The term "compatible" as used here means that these constituents of the pharmaceutical composition disclosed herein are capable of being mixed with the components of the pharmaceutical composition in such a manner that no interaction occurs which would substantially reduce the pharmaceutical effectiveness of the pharmaceutical composition under typical use conditions.

Administration:



[0477] The composition disclosed herein or the pharmaceutical composition disclosed herein may be administered by conventional needle injection or needle-free jet injection into the tumor tissue. In a preferred embodiment the composition disclosed herein or the pharmaceutical composition disclosed herein is administered by jet injection. Jet injection refers to a needle-free injection method, wherein a fluid comprising the composition disclosed herein and, optionally, further suitable excipients is forced through an orifice, thus generating an ultra-fine liquid stream of high pressure that is capable of penetrating mammalian skin. In principle, the liquid stream forms a hole in the skin, through which the liquid stream is pushed into the target tissue, namely the tumor tissue. According to the present disclosure, jet injection may be used for intratumoral application of the composition disclosed herein.

[0478] The composition disclosed herein may be administered by conventional needle injection or needle-free jet injection adjacent to and/or in close proximity to the tumor tissue. In a preferred embodiment the pharmaceutical composition disclosed herein is administered by jet injection adjacent to and/or in close proximity to the tumor tissue. Jet injection refers to a needle-free injection method, wherein a fluid comprising the composition disclosed herein and, optionally, further suitable excipients is forced through an orifice, thus generating an ultra-fine liquid stream of high pressure that is capable of penetrating mammalian skin. In principle, the liquid stream forms a hole in the skin, through which the liquid stream is pushed into the target tissue, namely the tumor tissue. According to the present disclosure, jet injection may be used for intratumoral application (adjacent to and/or in close proximity to the tumor tissue), particularily for injection of the composition disclosed herein.

[0479] In other embodiments, the composition disclosed herein or the pharmaceutical composition disclosed herein may be administered orally, parenterally, by inhalation spray, topically, rectally, nasally, buccally, vaginally or via an implanted reservoir. The term parenteral as used herein includes subcutaneous, intravenous, intramuscular, intraarticular, intranodal, intrasynovial, intrasternal, intrathecal, intrahepatic, intralesional, intracranial, transdermal, intradermal, intrapulmonal, intraperitoneal, intracardial, intraarterial, and sublingual injection or infusion techniques.

[0480] Further particularly preferred administration routes are intradermal and intramuscular injection.

[0481] Despite, the pharmaceutical composition disclosed herein may comprise further components for facilitating administration and uptake of components of the pharmaceutical composition. Such further components may be an appropriate carrier or vehicle, additional adjuvants for supporting any immune response, antibacterial and/or antiviral agents.

[0482] A further component of the pharmaceutical composition disclosed herein may be an immunotherapeutic agent that can be selected from immunoglobulins, preferably IgGs, monoclonal or polyclonal antibodies, polyclonal serum or sera, etc. Preferably, such a further immunotherapeutic agent may be provided as a peptide/protein or may be encoded by a nucleic acid, preferably by a DNA or an RNA, more preferably an mRNA.

[0483] The pharmaceutical composition disclosed herein typically comprises a "safe and effective amount" of the components of the pharmaceutical composition disclosed herein, particularly of the RNA molecule(s) as defined herein. As used herein, a "safe and effective amount" means an amount of the RNA molecule(s) as defined herein as such that is sufficient to significantly induce a positive modification of the tumor or cancer disease. At the same time, however, a "safe and effective amount" is small enough to avoid serious side-effects and to permit a sensible relationship between advantage and risk. The determination of these limits typically lies within the scope of sensible medical judgment.

[0484] The pharmaceutical composition disclosed herein may be used for human and also for veterinary medical purposes, preferably for human medical purposes, as a pharmaceutical composition in general.

Vaccine:



[0485] According to another particularly preferred aspect, the compostion disclosed herein or the pharmaceutical composition disclosed herein may be provided or used as a vaccine. Typically, such a vaccine is as defined above for pharmaceutical compositions. Additionally, such a vaccine typically contains the at least one RNA as defined herein or the composition disclosed herein comprising a plurality of RNAs. Preferably, the at least one RNA encodes at least one tumor antigen or at least one immune activator as defined above. The vaccine disclosed herein may also comprise a pharmaceutically acceptable carrier, adjuvant, and/or vehicle as defined herein for the pharmaceutical composition disclosed herein. In the specific context of the vaccine, the choice of a pharmaceutically acceptable carrier is determined in principle by the manner in which the vaccine disclosed herein is administered. The vaccine disclosed herein may be administered locally into tumor tissue.

[0486] The vaccine disclosed herein can additionally contain one or more auxiliary substances in order to increase its immunogenicity or immunostimulatory capacity, if desired. Particularly preferred are adjuvants as auxiliary substances or additives as defined for the pharmaceutical composition.

Kit or kit of parts:



[0487] In a further aspect, the present disclosure relates to a kit or kit of parts comprising the RNA containing composition as described above, or comprising the pharmaceutical composition as described above, or the components thereof and optionally technical instructions with information on the administration and dosage of the components.

[0488] Besides the components of the RNA containing composition disclosed herein, the kit may additionally contain a pharmaceutically acceptable vehicle, an adjuvant and at least one further component e.g. an additional pharmaceutically active component/compound as defined herein, as well as means for administration and technical instructions. The components of the composition and possibly further components may be provided in lyophilized form. In a preferred embodiment, prior to use of the kit, the provided vehicle is then added to the lyophilized components in a predetermined amount as written e.g. in the provided technical instructions.

Medical indication:



[0489] The present disclosure furthermore provides several applications and uses of the RNA containing composition disclosed herein, or the pharmaceutical composition, or the vaccine, or the kit or kit of parts as defined herein. As a main aspect of the present disclosure, the composition or the pharmaceutical composition or the kit or kit of parts may be used as a medicament, namely for treatment of tumor or cancer diseases. In this context, the treatment is preferably done by intratumoral application, especially by injection into tumor tissue. According to another aspect, the present disclosure is directed to the second medical use of the RNA containing composition or the pharmaceutical composition, or the vaccine, or the kit or kit of parts as described above, wherein these subject matters are used for preparation of a medicament particularly for intratumoral application (administration) for treatment of tumor or cancer diseases.

[0490] Preferably, diseases as mentioned herein are selected from tumor or cancer diseases which preferably include e.g. Acute lymphoblastic leukemia, Acute myeloid leukemia, Adrenocortical carcinoma, AIDS-related cancers, AIDS-related lymphoma, Anal cancer, Appendix cancer, Astrocytoma, Basal cell carcinoma, Bile duct cancer, Bladder cancer, Bone cancer, Osteosarcoma/Malignant fibrous histiocytoma, Brainstem glioma, Brain tumor, cerebellar astrocytoma, cerebral astrocytoma/malignant glioma, ependymoma, medulloblastoma, supratentorial primitive neuroectodermal tumors, visual pathway and hypothalamic glioma, Breast cancer, Bronchial adenomas/carcinoids, Burkitt lymphoma, childhood Carcinoid tumor, gastrointestinal Carcinoid tumor, Carcinoma of unknown primary, primary Central nervous system lymphoma, childhood Cerebellar astrocytoma, childhood Cerebral astrocytoma/Malignant glioma, Cervical cancer, Childhood cancers, Chronic lymphocytic leukemia, Chronic myelogenous leukemia, Chronic myeloproliferative disorders, Colon Cancer, Cutaneous T-cell lymphoma, Desmoplastic small round cell tumor, Endometrial cancer, Ependymoma, Esophageal cancer, Ewing's sarcoma in the Ewing family of tumors, Childhood Extracranial germ cell tumor, Extragonadal Germ cell tumor, Extrahepatic bile duct cancer, Intraocular melanoma, Retinoblastoma, Gallbladder cancer, Gastric (Stomach) cancer, Gastrointestinal Carcinoid Tumor, Gastrointestinal stromal tumor (GIST), extracranial, extragonadal, or ovarian Germ cell tumor, Gestational trophoblastic tumor, Glioma of the brain stem, Childhood Cerebral Astrocytoma, Childhood Visual Pathway and Hypothalamic Glioma, Gastric carcinoid, Hairy cell leukemia, Head and neck cancer, Heart cancer, Hepatocellular (liver) cancer, Hodgkin lymphoma, Hypopharyngeal cancer, childhood Hypothalamic and visual pathway glioma, Intraocular Melanoma, Islet Cell Carcinoma (Endocrine Pancreas), Kaposi sarcoma, Kidney cancer (renal cell cancer), Laryngeal Cancer, Leukemias, acute lymphoblastic Leukemia, acute myeloid Leukemia, chronic lymphocytic Leukemia, chronic myelogenous Leukemia, hairy cell Leukemia, Lip and Oral Cavity Cancer, Liposarcoma, Liver Cancer, Non-Small Cell Lung Cancer, Small Cell Lung Cancer, Lymphomas, AIDS-related Lymphoma, Burkitt Lymphoma, cutaneous T-Cell Lymphoma, Hodgkin Lymphoma, Non-Hodgkin Lymphomas, Primary Central Nervous System Lymphoma, Waldenström Macroglobulinemia, Malignant Fibrous Histiocytoma of Bone/Osteosarcoma, Childhood Medulloblastoma, Melanoma, Intraocular (Eye) Melanoma, Merkel Cell Carcinoma, Adult Malignant Mesothelioma, Childhood Mesothelioma, Metastatic Squamous Neck Cancer with Occult Primary, Mouth Cancer, Childhood Multiple Endocrine Neoplasia Syndrome, Multiple Myeloma/Plasma Cell Neoplasm, Mycosis Fungoides, Myelodysplastic Syndromes, Myelodysplastic/Myeloproliferative Diseases, Chronic Myelogenous Leukemia, Adult Acute Myeloid Leukemia, Childhood Acute Myeloid Leukemia, Multiple Myeloma (Cancer of the Bone-Marrow), Chronic Myeloproliferative Disorders, Nasal cavity and paranasal sinus cancer, Nasopharyngeal carcinoma, Neuroblastoma, Oral Cancer, Oropharyngeal cancer, Osteosarcoma/malignant fibrous histiocytoma of bone, Ovarian cancer, Ovarian epithelial cancer (Surface epithelial-stromal tumor), Ovarian germ cell tumor, Ovarian low malignant potential tumor, Pancreatic cancer, islet cell Pancreatic cancer, Paranasal sinus and nasal cavity cancer, Parathyroid cancer, Penile cancer, Pharyngeal cancer, Pheochromocytoma, Pineal astrocytoma, Pineal germinoma, childhood Pineoblastoma and supratentorial primitive neuroectodermal tumors, Pituitary adenoma, Plasma cell neoplasia/Multiple myeloma, Pleuropulmonary blastoma, Primary central nervous system lymphoma, Prostate cancer, Rectal cancer, Renal cell carcinoma (kidney cancer), Cancer of the Renal pelvis and ureter, Retinoblastoma, childhood Rhabdomyosarcoma, Salivary gland cancer, Sarcoma of the Ewing family of tumors, Kaposi Sarcoma, soft tissue Sarcoma, uterine Sarcoma, Sezary syndrome, Skin cancer (nonmelanoma), Skin cancer (melanoma), Merkel cell Skin carcinoma, Small intestine cancer, Squamous cell carcinoma, metastatic Squamous neck cancer with occult primary, childhood Supratentorial primitive neuroectodermal tumor, Testicular cancer, Throat cancer, childhood Thymoma, Thymoma and Thymic carcinoma, Thyroid cancer, childhood Thyroid cancer, Transitional cell cancer of the renal pelvis and ureter, gestational Trophoblastic tumor, Urethral cancer, endometrial Uterine cancer, Uterine sarcoma, Vaginal cancer, childhood Visual pathway and hypothalamic glioma, Vulvar cancer, Waldenström macroglobulinemia, and childhood Wilms tumor (kidney cancer).

[0491] Especially preferred examples of tumors or cancers that are suitable for intratumoral administration are prostate cancer, lung cancer, breast cancer, brain cancer, head and neck cancer, thyroid cancer, colon cancer, stomach cancer, liver cancer, pancreas cancer, ovary cancer, skin cancer, urinary bladder, uterus and cervix.

[0492] According to a specific embodiment, the medicament may be administered to the patient as a single dose or as several doses. In certain embodiments, the medicament may be administered to a patient as a single dose followed by a second dose later and optionally even a third, fourth (or more) dose subsequent thereto etc.

[0493] Preferably, the composition disclosed herein is provided in an amount of at least 40 µg RNA per dose. More specifically, the amount of the mRNA comprised in a single dose is typically at least 200 µg, preferably from 200 µg to 1.000 µg, more preferably from 300 µg to 850 µg, even more preferably from 300 µg to 700 µg.

Treatment with additional (pharmaceutical) compounds:



[0494] In a particularly preferred embodiment the subject receiving the composition disclosed herein, or the pharmaceutical composition or vaccine may be a patient with cancer or tumor who receives or received standard treatments of cancer. Preferably, the patient has achieved partial response or stable disease after having received standard treatments. According to the invention as defined by the attached claims, the RNA containing composition, the pharmaceutical composition and the kit or kit of parts as defined in the claims are provided for use in the treatment or prophylaxis of tumor and/or cancer diseases, wherein the RNA containing composition is to be applied intratumorally especially by injection into tumor tissue, and wherein the treatment or prophylaxis comprises the administration of a PD-1 inhibitor or a PD-L1 inhibitor, wherein the PD-1 inhibitor is an antagonistic antibody directed against PD-1 and the PD-L1 inhibitor is an antagonistic antibody directed against PD-L1.

[0495] The standard treatments of cancer include chemotherapy, radiation, chemoradiation and surgery dependent on the particular cancer or tumor type to be treated, wherein these treatments are applied individually or in combination.

[0496] In some embodiments the subject receiving the composition, pharmaceutical composition or vaccine as disclosed herein may be a patient with cancer or tumor, who received or receives chemotherapy (e.g. first-line or second-line chemotherapy), radiotherapy, chemoradiation (combination of chemotherapy and radiotherapy), kinase inhibitors, antibody therapy and/or checkpoint modulators (e.g. CTLA4 inhibitors, PD1 pathway inhibitors), or a patient, who has achieved partial response or stable disease after having received one or more of the treatments specified above.

[0497] In other embodiments the subject receiving the composition, pharmaceutical composition or vaccine as disclosed herein may be a patient with cancer or tumor, who received or receives an additional pharmaceutically active component/compound as defined above. Preferably, the subject is a patient, who has achieved partial response or stable disease after having received one or more of the treatments specified above.

[0498] According to a further aspect, the present disclosure refers to a method of treatment of tumor or cancer diseases, wherein the RNA containing composition as described above, or the pharmaceutical composition as described above, or the vaccine as described above, or the kit or kit of parts as described above is preferably applied intratumorally, especially by injection into tumor tissue. With respect to further features of the method for treatment it is referred to the description above.

Preferred intratumoral applications:



[0499] In this context it is particularly preferred that the intratumoral application of the RNA containing composition or the pharmaceutical composition or the vaccine as defined above is combined with the application of different agents/pharmaceutically active components/compounds. Particularly preferred are antibodies (e.g. check point modulators as e.g. anti-CTLA4, anti-OX40, anti-PD1 or anti-PD-L1) or ligands (e.g. CD40L).

[0500] In preferred embodiments the following combinations are particularly preferred:
  • RNAdjuvant (i.t.) + anti-CTLA4 as protein (i.p./i.v.)
  • RNAdjuvant (i.t.) + anti-CTLA4 as protein (i.t.)
  • RNAdjuvant (i.t.) + anti-PD1 as protein (i.p./i.v.)
  • RNAdjuvant (i.t.) + anti-PD1 as protein (i.t.)
  • RNAdjuvant (i.t.) + anti-PD-L1 as protein (i.p./i.v.)
  • RNAdjuvant (i.t.) + anti-PD-L1 as protein (i.t.)
  • RNAdjuvant (i.t.) + CD40L (i.t.) as protein or encoded by a nucleic acid preferably an RNA, more preferably an mRNA
  • RNAdjuvant (i.t.) + mRNA encoding IL-12 + mRNA encoding soluble PD-1 receptor + anti-CD73 (i.p./i.v.)
  • RNAdjuvant (i.t.) + mRNA encoding IL-12 + mRNA encoding soluble PD-1 receptor + anti-CD137 (i.p./i.v.)
  • RNadjuvant (i.t.)
(i.t. = intratumoral, i.p. = intraperitoneal, i.v. = intravenous)

[0501] In the present disclosure, if not otherwise indicated, different features of alternatives and embodiments may be combined with each other, where suitable. Furthermore, the term "comprising" shall not be narrowly construed as being limited to "consisting of" only, if not specifically mentioned. Rather, in the context of the present disclosure, "consisting of" is an embodiment specifically contemplated by the inventors to fall under the scope of "comprising", wherever "comprising" is used herein.

[0502] Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.

[0503] The examples and figures shown in the following are merely illustrative and shall describe the present invention in a further way. These figures and examples shall not be construed to limit the present invention thereto.

Short description of the figures:



[0504] 
Figure 1:
shows survival proportions of mice bearing E.G7-OVA tumors after intratumoral treatment with mRNA encoding IL-12 (IL-12 mRNA) or with recombinant IL-12 protein (rIL-12 protein). The experiment was performed as described in Example 1. Kaplan-Meier survival curves are presented.
Figure 2:
shows that intratumoral treatment of mice with a combination of IL-12 mRNA (R2763, SEQ ID NO: 1) and the polymeric carrier cargo complex (R2391, RNAdjuvant®, prepared as described in methods) led to a significantly decreased tumor volume compared to control groups. The experiment was performed as described in Example 2. Figure 2 shows the mean tumor volume at day 21 after tumor challenge (the last day when all animals were alive). Statistical analysis was performed in GraphPad Prism version 5.04 using Mann Whitney test.
Figure 3:
shows survival proportions of mice bearing CT26 tumors after intratumoral treatment with a combination of IL-12 mRNA and the polymeric carrier cargo complex ("RNAdjuvant") as described in Example 2 and in legend of figure 2. Kaplan-Meier survival curves are presented. Statistical analysis was performed in GraphPad Prism version 5.04 using Log-rank test.
Figure 4:
shows survival proportions of mice bearing CT26 tumors after intratumoral treatment with mRNA encoding the influenza nucleoprotein. The experiment was performed as described in Example 3. Kaplan-Meier survival curves are presented.
Figure 5:
Panel (A) shows an analysis of the median tumor growth of mice bearing CT26 tumors after intratumoral treatment with mRNA encoding IL-12, RNAdjuvant, and mRNA encoding soluble PD-1. Respective combinations of these compounds, including control groups, were tested as indicated in the figure. The experiment was performed as described in Example 4.
Panel (B) shows survival proportions of mice bearing CT26 tumors after intratumoral treatment with mRNA encoding IL-12, RNAdjuvant, and mRNA encoding soluble PD-1. Respective combinations of these compounds, including control groups, were tested as indicated in the figure. The experiment was performed as described in Example 4. Kaplan-Meier survival curves are presented.
Figure 6:
shows survival proportions of mice bearing CT26 tumors after intratumoral treatment with mRNA encoding IL-12, RNAdjuvant, mRNA encoding soluble PD-1 and intraperitoneal treatment of an anti-CD73 antibody. Respective combinations of these compounds, including control groups, were tested as indicated in the figure. The experiment was performed as described in Example 5. Kaplan-Meier survival curves are presented.
Figure 7:
shows survival proportions of mice bearing CT26 tumors after intratumoral treatment with mRNA encoding IL-12, RNAdjuvant, mRNA encoding soluble PD-1 and intraperitoneal treatment of an anti-CD173 antibody. Respective combinations of these compounds, including control groups, were tested as indicated in the figure. The experiment was performed as described in Example 6. Kaplan-Meier survival curves are presented.
Figure 8:
shows survival proportions of mice bearing CT26 tumors after intratumoral treatment with RNAdjuvant and intraperitoneal treatment of an anti-PD-1 antibody. Respective combinations of these compounds, including control groups, were tested as indicated in the figure. The experiment was performed as described in Example 7. Kaplan-Meier survival curves are presented.
Figure 9:
shows survival proportions of mice bearing CT26 tumors after intratumoral treatment with mRNA encoding IL-12, RNAdjuvant, mRNA encoding CD40L compared to intratumoral treatment with mRNA encoding IL-12 alone. Respective combinations of these compounds, including control groups, were tested as indicated in the figure. The experiment was performed as described in Example 8. Kaplan-Meier survival curves are presented.
Figure 10:
shows the mRNA sequence R3571 encoding murine CD40L (MmCD40L) according to SEQ ID NO. 10.073

Examples:


Methods: Preparation of the RNA


1. Preparation of DNA and RNA constructs



[0505] For the present examples DNA sequences encoding the indicated RNAs (see Table 17) were prepared and used for subsequent RNA in vitro transcription reactions.
Table 17: RNA constructs
RNADescription5'-UTR3'-UTRSEQ ID NO.
R1328 Murine IL-12 encoding mRNA (MmIL-12(GC))-sc-Flag) - Muag (3'-UTR of alpha globin)-A64-C30 SEQ ID NO: 1
R491 mRNA encoding Photinus pyralis luciferase (pPLuc (GC)) (irrelevant mRNA) - Muag (3'-UTR of alpha globin)-A64-C30 SEQ ID NO: 2
R2763 Murine IL-12 encoding mRNA (MmIL-12 (GC)) 5'-TOP-UTR derived from the ribosomal protein 32L albumin-3'-UTR-A64-C30-histone stem-loop SEQ ID NO: 3
R2244 Luciferase encoding mRNA (PpLuc(GC)) 5'-TOP-UTR derived from the ribosomal protein 32L albumin-3'-UTR-A64-C30-histone stem-loop SEQ ID NO: 4
R2025 R2391 Non-coding immunostimulatory RNA (RNAdjuvant) (SEQ ID NO. 118 of WO2009095226)     SEQ ID NO: 5
R2650 R2651 mRNA coding for the influenza nucleoprotein (H1N1(PR8)-NP(GC)) 5'-TOP-UTR derived from the ribosomal protein 32L albumin-3'-UTR-A64-C30-histone stem-loop SEQ ID NO: 6
R3971 mRNA encoding solPD-1 5'-TOP-UTR derived from the ribosomal protein 32L albumin-3'-UTR-A64-C30-histone stem-loop SEQ ID NO: 389
R3571 mRNA encoding murine CD40L (MmCD40L) 5'-TOP-UTR derived from the ribosomal protein 32L albumin-3'-UTR-A64-C30-histone stem-loop SEQ ID NO: 10.073


[0506] The constructs of MmIL-12(GC), Influenza NP (GC), solPD-1 and PpLuc(GC)) were prepared by introducing a 5'-TOP-UTR derived from the ribosomal protein 32L, modifying the wild type coding sequence by introducing a GC-optimized sequence for stabilization, followed by a stabilizing sequence derived from the albumin-3'-UTR, a stretch of 64 adenosines (poly(A)-sequence), a stretch of 30 cytosines (poly(C)-sequence), and a histone stem loop. Most DNA sequences were prepared by modifying the wild type encoding DNA sequences by introducing a GC-optimized sequence for stabilization, using an in silico algorithm that increase the GC content of the respective coding sequence compared to the wild type coding sequence (in Table 12 indicated as "GC").

[0507] For the present example a DNA sequence encoding the non-coding immunostimulatory RNA (isRNA) R2025 was prepared and used for subsequent RNA in vitro transcription reactions.

2. RNA In vitro transcription



[0508] The respective DNA plasmids prepared according to section 1 above were transcribed in vitro using T7 polymerase. The RNA in vitro transcription reactions of the IL-12, the NP, PpLuc, CD40L and soluble PD-1 encoding constructs were performed in the presence of a CAP analog (m7GpppG). The isRNA R2025 was prepared without CAP analog. Subsequently, the RNA was purified using PureMessenger® (CureVac, Tübingen, Germany; WO2008/077592A1).

3. Preparation of the polymeric cargo complex ("RNAdjuvant")



[0509] The following cationic peptide as cationic component of the polymeric carrier was used (Cys-Arg12-Cys or CR12C) according to SEQ ID NO: 7.

[0510] For synthesis of the polymeric carrier cargo complexes an RNA molecule having the RNA sequence R2025 as defined in section 1 above was mixed with the cationic CR12C peptide component as defined above. The specified amount of the RNA was mixed with the respective cationic component in mass ratios as indicated below, thereby forming a complex. If polymerizing cationic components were used according to the present disclosure, polymerization of the cationic components took place simultaneously to complexation of the nucleic acid cargo. Afterwards, the resulting solution was adjusted with water to a final volume of 50 µl and incubated for 30 minutes at room temperature. Further details are described in WO2012013326.

[0511] The mass ratio of peptide:RNA was 1:3.7. The polymeric carrier cargo complex is formed by the disulfide-crosslinked cationic peptide CR12C as carrier and the immunostimulatory R2025 as nucleic acid cargo. This polymeric carrier cargo complex R2025/CR12C (designated R2391) was used as adjuvant in the following examples (referred to as "RNAdjuvant").

4. Preparation of the vaccine formulation coding for the influenza nucleoprotein (H1N1(PR8)-NP(GC)) (R2651)



[0512] The mRNA (R2650) was complexed with protamine by addition of protamine to the mRNA in the ratio (1:2) (w/w) (adjuvant component). After incubation for 10 min, the same amount of free mRNA used as antigen-providing mRNA was added. This vaccine formulation is termed herein R2651 (according to WO2010037539). The vaccine was administered in Ringer's Lactate solution.

5. Preparation of the RNA for administration



[0513] The naked (that is, non-formulated) PpLuc mRNA (R2244, R491)), IL-12 mRNA (R2763, R1328), soluble PD-1 mRNA (R3971), CD40L mRNA (R3571) were administered in Ringer's Lactate (RiLa) solution. The co-formulation of naked mRNAs and the polymeric carrier cargo complex "RNAdjuvant" (R2391) were also administered in Ringer's Lactate (RiLa) after mixing of both components directly before injection.

Example 1: Intratumoral application of mRNA coding for IL-12



[0514] 5 female C57BL/6 mice per treatment group were inoculated with 106 cells E.G7-OVA cells 5 days before the first treatment. For each treatment group 5 established (about 100 mm3) subcutaneously implanted EG.7-OVA tumors were treated. Tumors were treated with 16 µg mRNA coding for MmIL-12 (MmIL-12(GC))-sc-Flag) (R1328) or 0.5 µg MmIL-12 protein on d 0, 2, 4, 21, 23 and 25 with 50 µg (1 µg/µl). As control mice were treated with an irrelevant mRNA (pPLuc) (R491).

[0515] Study day 0 is defined as the first day of treatment. Tumor growth was monitored frequently (every 2-3 days). Mice with a volume of >3 cm3 were killed.

Results of example 1



[0516] Figure 1 shows that the intratumoral treatment with the mRNA-encoded IL-12 (IL-12 mRNA) resulted in a significant increase in survival compared to the control group. Furthermore an increased survival could be observed compared to the intratumoral application of recombinant IL-12 protein (rIL-12 protein).

Example 2: Intratumoral treatment with mRNA encoding IL-12 in combination with an immunostimulating RNA (RNAdjuvant®) (comparative example)



[0517] The following table 18 summarizes the RNA constructs used for the example 2.
Table 18: RNA constructs for example 2
RNADescriptionFigureSEQ ID NO.
R2763 Murine IL-12 encoding mRNA 1 SEQ ID NO. 1
R2244 Luciferase encoding mRNA (PpLuc) 2 SEQ ID NO. 2
R2025 Non-coding immunostimulatory RNA 3 SEQ ID NO. 3


[0518] Balb/c mice (n = 6 or 7, see table 14) were injected subcutaneously (s.c.) with 1x106 CT26 cells (colon carcinoma cell line) per mouse (in a volume of 100 µl PBS) on the right flank on day 0 of the experiment. At day 9 after tumor challenge, mice were sorted according to the tumor size to obtain groups with a mean tumor volume of approximately 60 mm3. Intratumoral (i.t.) therapy started at day 9 and continued for additional 4 injections every 3-4 days. Mice were injected with a combination of mRNA-encoded IL-12 (25 µg of R2763) + RNAdjuvant® (25 µg of R2391) (group A). To control for local inflammation due to RNA application or the injection procedure, mice were injected with control mRNA coding for luciferase (PpLuc, R2244, group B) or buffer (RiLa, group C), respectively. Untreated mice served as additional control (group D).

[0519] Tumor growth was monitored by measuring the tumor size in three dimensions using a calliper. Tumor volume was calculated according to the following formula:



[0520] On day 9, 11, 14, 17 and 21 of the experiment mice were injected intratumorally (i.t.) with RNA according to the table 19 below. The volume for intratumoral injection was 50 µl.
Table 19: Animal groups
GroupStrain sexNumber of miceRNADose per mouseRoute, volume
A BALB/c Female 7 R2763, R2391 25 µg of each RNA i.t., 50 µl
B BALB/c Female 7 R2244 50 µg i.t., 50 µl
C BALB/c Female 6 RiLa --- i.t., 50 µl
D BALB/c Female 6 --- --- ---

Results of Example 2



[0521] Figure 2 shows that the intratumoral treatment with the combination of mRNA-encoded IL-12 (R2763) and RNAdjuvant® (R2391) resulted in a statistically significant decrease in tumor volume at day 21 after tumor challenge compared to all control groups.

[0522] Figure 3 shows that the intratumoral treatment with the combination of mRNA-encoded IL-12 (R2763) and RNAdjuvant® (R2391) resulted in a statistically significant increase in survival compared to all three control groups (group A vs. group B * p=0.0104, group A vs. group C ** p=0.0035, group A vs. Group D * p==0.0263).

Example 3: Vaccination of mice with mRNA encoding the influenza nucleoprotein (NP) and subsequent intratumoral treatment with NP-encoding mRNA (comparative example)



[0523] The objective of this experiment was to test whether a pre-existing immune response can be harnessed against an established tumor. To this end, mice were first vaccinated with RNActive (vaccine formulation complexed with protamine) encoding the influenza nucleoprotein (NP) (R2651) which induces a high level of anti-NP CD8+ T cell responses, then challenged with CT26 tumor cells followed by intratumoral treatment with naked RNA encoding NP (R2650).

[0524] 27 Balb/c mice were vaccinated intradermally (i.d.) with 40 µg of H1N1(PR8)-NP(GC) RNActive (R2651) (2 x 50 µl) or Ringer-Lactate buffer (RiLa) as control on day 0, day 7 and day 16 of the experiment. On day 14 all mice were challenged subcutaneously (s.c.) with 1 x 106 CT26 cells per mouse (in a volume of 100 µl PBS) on the right flank. On day 22, mice were assigned to the different groups as shown in Table 20.

[0525] On day 23, seven days after the second boost, intratumoral (i.t.) application of 50 µg naked H1N1(PR8)-NP(GC) mRNA (R2650) started (only group C) and continued for additional four injections (at day 25, day 28, day 31 and day 35). The volume for intratumoral injection was 50 µl. A detailed treatment schedule is shown in Table 21.

[0526] Tumor growth was monitored by measuring the tumor size in three dimensions using a calliper. Tumor volume was calculated according to the following formula:

Table 20: Animal groups
GroupStrain sexNumber of micemRNA i.d.mRNA i.t.
A BALB/c Female 9 RiLa ---
B BALB/c Female 9 R2651 (40 µg) ---
C BALB/c Female 9 R2651 (40 µg) R2650 (50 µg)
Table 21: Vaccination schedule
DayTreatment
0 i.d. vaccination all groups
7 i.d. vaccination all groups
14 Tumor challenge of all groups (1x106 CT26 cells/mouse)
16 i.d. vaccination all groups
23 i.t. vaccination group C
25, 28, 31, 35 i.t. vaccination group C

Results of Example 3



[0527] Figure 4 shows that pre-existent immunity (induced in this model by the NP vaccination) increased the median survival time (MST) of mice which received intratumoral application of NP-encoded mRNA compared to mice which were treated with buffer only (MST=28 vs. MST=21, respectively).

Example 4: Intratumoral treatment with an immunostimulating RNA ("RNAdjuvant") and an mRNA encoding soluble PD-1 and and an mRNA encoding IL-12 (comparative example)



[0528] Table 22 summarizes the treatment as used in the present example. RNAdjuvant and the mRNA constructs encoding IL-12 and soluble PD-1 were administered intratumorally (i.t.). In CT26 tumor challenged mice, survival rates and median tumor growth were analyzed.
Table 22: Groups, treatment and RNA dilution
GroupNr. of micei.t. treatment (25µg for each component)Vaccination schedule
A 10 IL-12 + RNAdjuvant + soluble PD-1 2X week
B 10 IL-12 2X week
C 10 RNAdjuvant 2X week
D 10 RiLa 2Xweek

Tumor challenge and administration of the composition disclosed herein:



[0529] 60 Balb/c mice were challenged subcutaneously with 1x106 CT26 cells per mouse (volume in 100µl PBS) on the right flank on day 0 of the experiment. On day 8 mice were sorted according to tumor size. According to tumor size, the first vaccination took place on day 8 or 9 (tumors should have a size of about 40-50mm3). Mice were vaccinated with different combinations of mRNAs and RNAdjuvant according to the table above. Six vaccinations took place. Volume for intratumoral injection was 50µl.

[0530] Mice were injected according to the indicated scheme shown in Table 22. Median tumor growth was determined according to example 3. The results of the experiment are shown in Figure 5, wherein Figure 5A shows the effect of the composition disclosed herein on tumor growth, and Figure 5B shows the effect of the composition disclosed herein on survival.

Results:



[0531] The results in Figure 5A show that the composition disclosed herein comprising an mRNA encoding IL-12 and mRNA encoding soluble PD-1 in combination with RNAdjuvant (group "A" according to Table 22) strongly decreased the median tumor volume compared to the other treatments (groups B-D according to Table 22). In addition, the results in Figure 5B show that the composition disclosed herein comprising an mRNA encoding IL-12 and mRNA encoding soluble PD-1 in combination with RNAdjuvant (group "A" according to Table 22) strongly increased the survival of tumor challenged mice compared to the other treatments (groups B-D according to Table 22).

Example 5: Intratumoral treatment with mRNA encoding IL-12 in combination with an immunostimulating RNA ("RNAdjuvant") and mRNA encoding sol PD-1 and anti-CD73 antibody (comparative example)



[0532] Table 23 summarizes the treatment as used in the present example. In addition to RNAdjuvant and mRNA constructs encoding IL-12 and soluble PD-1 (administered intratumorally (i.t.)), an anti CD73 antibody (BioXCell) was co-administered intraperitoreally (i.p.). In CT26 tumor challenged mice, survival rates were analyzed.
Table 23: Groups, treatment and RNA dilution
GroupNr. of micei.t. treatment (25µg for each component)i.p. treatmentVaccination schedule
A 10 IL-12 + RNAdjuvant + soluble PD-1 a-CD73 2X week
B 10 IL-12 + RNAdjuvant + soluble PD-1 Rat IgG2a 2X week
C 10 RiLa a-CD73 2X week
D 10 RiLa Rat IgG2a 2X week

Tumor challenge and administration of the composition disclosed herein:



[0533] The tumor challenge was performed according to the previous experiments (see Example 4). Mice were injected according to the indicated scheme shown in Table 23.
The results of the experiment are shown in Figure 6.

Results:



[0534] Figure 6 shows that the intratumoral treatment with mRNA-encoded IL-12 (R2763), mRNA encoded sol-PD-1 (R3971) and RNAdjuvant® (R2391) in combination with an i.p. administration of anti CD73 antibody (Group "A" according to Table 23) resulted in a statistically significant increase in survival compared to the relevant control group that only received an anti CD73 antibody (Group "C" according to Table 23) and in an increase in survival rates compared to the the treatment with IL-12 + RNAdjuvant + soluble PD-1 and a control antibody (Rat IgG2a, BioXCell) (Group "B" according to Table 23).

Example 6: Intratumoral treatment with mRNA encoding IL-12 in combination with an immunostimulating RNA ("RNAdjuvant") and an anti-CD137 antibody (comparative example)



[0535] Table 24 summarizes the treatment as used in the present example. In addition to RNAdjuvant and the mRNA constructs encoding IL-12 and soluble PD-1 (administered intratumorally (i.t.)), an anti CD137 antibody (BioXCell) was co-administered intraperitoreally (i.p.). In CT26 tumor challenged mice, survival rates were analyzed.
Table 24: Groups, treatment and RNA dilution
GroupNr. of micei.t. treatment (25µg)i.p. treatmentVaccination schedule
A 10 IL-12 + RNAdjuvant + soluble PD-1 a-CD137 2X week
B 10 IL-12 + RNAdjuvant + soluble PD-1 Rat IgG2a 2X week
C 10 RiLa a-CD137 2X week
D 10 RiLa Rat IgG2a 2X week

Tumor challenge and administration of the composition disclosed herein:



[0536] The tumor challenge was performed according to the previous experiments (see Example 4). Mice were injected according to the indicated scheme shown in Table 24.
The results of the experiment are shown in Figure 7.

Results:



[0537] Figure 7 shows that the intratumoral treatment with mRNA-encoded IL-12 (R2763) sol-PD-1 (R3971) and RNAdjuvant® (R2391) in combination with an i.p. administration of anti CD-137 antibody (Group "A" according to Table 24) resulted in a significant increase in survival compared to the relevant control group that only received the antibody anti CD-137 (Group "C" according to Table 24) and in an increase in survival rates compared to the the treatment with IL-12 + RNAdjuvant + soluble PD-1 and a control antibody (Rat IgG2a, BioXCell) (Group "B" according to Table 24).

Example 7: Treatment with an immunostimulating RNA ("RNAdjuvant") in combination with a checkpoint inhibitor anti PD-1 antibody



[0538] Table 25 summarizes the treatment as used in the present example. In addition to RNAdjuvant (administered i.t.), a checkpoint inhibitor anti PD-1 (BioXCell) was administered i.p. In CT26 tumor challenged mice, survival rates were analyzed.
Table 25: Groups, treatment and RNA dilution /antibody dilution
GroupConstructAntibodyAmount of RNA (µg)Vaccination schedule
A RiLa (i.t.) ---   2X week
B RNAdjuvant (i.t.) Control Ab (i.p.)(100µg) 25 2X week
C RNAdjuvant (i.t.) Anti-PD-1 (i.p.) (200µg) 25 2X week
D RiLa (i.t.) Anti-PD-1 (i.p.) (200µg) --- 2X week

Tumor challenge and administration of the inventive composition:



[0539] The tumor challenge was performed according to the previous experiments (see Example 4). Mice were injected according to the indicated scheme shown in Table 25.
The results of the experiment are shown in Figure 8.

Results:



[0540] Figure 8 shows that the intratumoral (i.t.) treatment with RNAdjuvant® (R2391) in combination with an i.p. administration of anti PD-1 antibody (Group "C" according to Table 25) resulted in an increase in survival compared to the relevant control group that only received the checkpoint inhibitor anti PD-1 antibody (Group "D" according to Table 25) and in an increase in survival rates compared to the treatment with RNAdjuvant and a control antibody (anti hamster IgG, BioXCell) (Group "B" according to Table 25).

Example 8: Intratumoral treatment with an immunostimulating RNA ("RNAdjuvant") and an mRNA encoding CD40 ligand (CD40L) and an mRNA encoding IL-12 (comparative example)



[0541] Table 26 summarizes the treatment as used in the present example. RNAdjuvant and the mRNA constructs encoding IL-12 and murine CD40L were administered intratumorally (i.t.). In CT26 tumor challenged mice, survival rates were analyzed.
Table 26: Groups, treatment and RNA dilution
GroupNr. of micei.t. treatment (25µg per RNA)Vaccination schedule
A 8 IL-12 + RNAdjuvant + CD40L 2X week
B 8 IL-12 2X week
C 8 RiLa 2X week

Tumor challenge and administration of the composition disclosed herein:



[0542] The tumor challenge was performed according to the previous experiments (see Example 4).

[0543] Mice were injected according to the indicated scheme shown in Table 26.
The results of the experiment are shown in Figure 9.

Results:



[0544] The results in Figure 9 show that the composition disclosed herein comprising an mRNA encoding IL-12 and an mRNA encoding CD40L in combination with RNAdjuvant (group "A" according to table 26) strongly increased the median survival of tumor challenged mice compared to the other treatments (groups B-C according to table 26).

Items



[0545] 
  1. 1. RNA containing composition comprising at least one RNA for use in the treatment or prophylaxis of tumor and/or cancer diseases.
  2. 2. The RNA containing composition of item 1, wherein the RNA containing composition is to be applied intratumorally, especially by injection into tumor tissue.
  3. 3. The RNA containing composition of item 1 or 2, wherein the at least one RNA is selected from the group consisting of coding RNA and non-coding RNA.
  4. 4. The RNA containing composition of item 3, wherein the coding RNA comprises at least one coding region encoding at least one peptide or protein and is preferably selected from the group consisting of mRNA, viral RNA, retroviral RNA, and replicon RNA.
  5. 5. The RNA containing composition of item 4, wherein the coding RNA is mRNA.
  6. 6. The RNA containing composition of item 4 or 5, wherein the at least one peptide or protein is selected or derived from the group consisting of cytokines, chemokines, suicide gene products, immunogenic proteins or peptides, apoptosis inducers, angiogenesis inhibitors, heat shock proteins, tumor antigens, β-catenin inhibitors, activators of the STING pathway, checkpoint modulators, innate immune activators, antibodies, dominant negative receptors and decoy receptors, inhibitors of myeloid derived suppressor cells (MDSCs), IDO pathway inhibitors, and proteins or peptides that bind inhibitors of apoptosis.
  7. 7. The RNA containing composition of item 6, wherein the cytokine is an interleukin, preferably chosen from the following list: IL-1α, IL-1β, IL-1ra, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL14, IL-15, IL-16, IL-17A, IL-17B, IL-17C, IL-17D, IL-17E, IL-17F, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28A/B, IL-29, IL-30, IL-31, IL-32, IL-33, IL-35.
  8. 8. The RNA containing composition of item 6 or 7, wherein the interleukin is interleukin-12 (IL-12).
  9. 9. The RNA containing composition of item 6, wherein the cytokine is a member of the TNF family, preferably chosen from the following list: TNF, especially TNFα, LTα, LTβ, LIGHT, TWEAK, APRIL, BAFF, TL1A, GITRL, OX40L, CD40L, FASL, CD27L, CD30L, 4-1BBL, TRAIL, RANK ligand.
  10. 10. The RNA containing composition of item 6, wherein the cytokine is chosen from the following list: FLT3 ligand, G-CSF, GM-CSF, IFNα/β/ω, IFNγ, LIF, M-CSF, MIF, OSM, Stem Cell Factor, TGFβ1, TGFβ2, TGFβ3, TSLP ligand.
  11. 11. The RNA containing composition of item 6, wherein the chemokine is chosen from the following list: CXCL1, CXCL2, CXCL3, CXCL4, CXCL5, CXCL6, CXCL7, CXCL8, CXCL9, CXCL10, CXCL11, CXCL12, CXCL13, CXCL14, CXCL15, CXCL16, CCL1, CCL2, CCL3, CCL4, CCL5, CCL6, CCL7, CCL8, CCL9/10, CCL11, CCL12, CCL13, CCL14, CCL15, CCL16, CCL17, CCL18, CCL19, CCL20, CCL21, CCL22, CCL23, CCL24, CCL25, CCL26, CCL27, CCL28, XCL1, XCL2, CX3CL1.
  12. 12. The RNA containing composition of item 6, wherein the suicide gene product is a suicide enzyme, preferably a nucleotide metabolizing enzyme.
  13. 13. The RNA containing composition of item 12, wherein the nucleotide metabolizing enzyme is chosen from the following list: thymidine kinase, preferably Herpes simplex virus thymidine kinase, cytosine deaminase, preferably bacterial cytosine deaminase or Yeast cytosine deaminase, deoxynucleoside kinase, preferably Drosophila melanogaster deoxynucleoside kinase, deoxycytidine kinase, preferably a mammalian deoxycytidine kinase, purine nucleoside phosphorylase, preferably a bacterial purine nucleoside phosphorylase.
  14. 14. The RNA containing composition of one of items 6, 12 or 13, wherein the at least one RNA encoding at least one suicide gene product is used in combination with a prodrug which is a substrate of the suicide gene product.
  15. 15. The RNA containing composition of one of items 6, 12 to 14, wherein the at least one RNA codes for at least one connexin and at least one suicide gene product.
  16. 16. The RNA containing composition of one of items 6, 12 to 14, wherein the RNA composition comprises at least one RNA encoding at least one suicide gene product and wherein the RNA composition is used in combination with a further RNA coding for at least one connexin and/or with a protein of the connexin family or parts or fragments thereof.
  17. 17. The RNA containing composition of item 6, wherein the immunogenic protein or peptide is a protein or peptide of a pathogen, more preferably of a viral or bacterial pathogen.
  18. 18. The RNA containing composition of item 17, wherein the immunogenic protein or peptide is at least one protein or peptide of one virus or bacterium of the following list: influenza virus type A or B or any other orthomyxovirus (influenza type C), picornaviruses, such as rhinovirus or hepatitis A virus, togaviruses, such as alphavirus or rubivirus, e.g. Sindbis, Semliki-Forest or rubeolavirus, rubella virus, coronaviruses, in particular subtypes HCV-229E or HCV-OC43, rhabdoviruses, such as rabies virus, paramyxoviruses, such as mumps virus, reoviruses, such as group A, B or C rotavirus, hepadnaviruses, such as hepatitis B virus, papoviruses, such as human papillomaviruses of any serotype, adenoviruses, in particular type 1 to 47, herpesviruses, such as Herpes simplex virus 1, 2 or 3, cytomegalovirus, preferably CMVpp65, Epstein Barr virus, vacciniaviruses, the bacterium Chlamydophila pneumoniae, Flaviviruses, such as dengue virus type 1 to 4, yellow fever virus, West Nile virus, Japanese encephalitis virus, hepatitis C virus, caliciviruses, filoviruses, such as Ebola virus, bornaviruses, bunyaviruses, such as Rift Valley fever virus, arenaviruses, such as lymphocytic choriomeningitis virus or hemorrhagic fever viruses, retroviruses, such as HIV, parvoviruses.
  19. 19. The RNA containing composition of item 17 or 18, wherein the immunogenic peptide or protein is derived from influenza nucleoprotein.
  20. 20. The RNA containing composition of item 6, wherein the apoptosis inducer is chosen from the group consisting of the Bcl-2 family, tumor suppressor protein p53, ligands of transmembrane death receptors, especially the TNF receptor gene superfamily, pro-apoptic receptor agonists and Beclin-1.
  21. 21. The RNA containing composition of item 6 or 20, wherein the apoptosis inducer is chosen from the following list: Bcl-10, Bax, Bak, Bid, Bad, Bim, Bik, Blk, Cytochrome c, Caspases, especially Caspase 3, Caspase 6, Caspase 7, Caspase 8, Caspase 9, Death domain, especially Fas, preferably FasL, TNFα, Apo2L/TRAIL, agonist of DR4 and/or DR5, Apo3L, DR4 agonistic antibody, DR5 agonistic antibody, protein kinase R (PKR), Granzyme B.
  22. 22. The RNA containing composition of item 6, wherein the angiogenesis inhibitor is chosen from the following list: IFN-α, IFN-β, IFN-γ, CXCL9, CXCL10, IL-12, PF-4, TNF-α, sFLT-1, FLK-1, Angiostatin, Endostatin, Vasostatin, Canstatin, Tumstatin, 16 kD prolacin fragment, TIMP-1, TIMP-2, TIMP-3, TSP-1, TSP-2, Maspin, PEX, sTie1, sTie2, Angiopoietin-1, Angiopoietin-2, Anti-VEGFR2 antibody, Anti-VEGF antibody and Anti-VEGFR1 antibody.
  23. 23. The RNA containing composition of item 6, wherein the heat shock protein is chosen from the following list: HSP27, HSP47, HSP60, HSP70, HSC70, GRP78, HSP90, HSP110, GRP94, GRP170, PDI/PDIA, CRT/CALR.
  24. 24. The RNA containing composition of item 6, wherein the tumor antigen is chosen from the following list: 1AO1_HLA-A/m; 1A02; 5T4; ACRBP; AFP; AKAP4; alpha-actinin-_4/m; alpha-methylacyl-coenzyme_A_racemase; ANDR; ART-4; ARTC1/m; AURKB; B2MG; B3GN5; B4GN1; B7H4; BAGE-1; BASI; BCL-2; bcr/abl; beta-catenin/m; BING-4; BIRC7; BRCA1/m; BY55; calreticulin; CAMEL; CASPA; Caspase_8; cathepsin_B; cathepsin_L; CD1A; CD1B; CD1C; CD1D; CD1E; CD20; CD22; CD276; CD33; CD3E; CD3Z; CD4; CD44_Isoform_1; CD44_Isoform_6; CD52; CD55; CD56; CD80; CD86; CD8A; CDC27/m; CDE30; CDK4/m; CDKN2A/m; CEA; CEAM6; CH3L2; CLCA2; CML28; CML66; COA-1/m; coactosin-like_protein; collagen_XXIII; COX-2; CP1B1; CSAG2; CT-_9/BRD6; CT45A1; CT55; CTAG2_Isoform_LAGE-1A; CTAG2_Isoform_LAGE-1B; CTCFL; Cten; cyclin_B1; cyclin_D1; cyp-B; DAM-10; DEP1A; E7; EF1A2; EFTUD2/m; EGFR; EGLN3; ELF2/m; EMMPRIN; EpCam; EphA2; EphA3; ErbB3; ERBB4; ERG; ETV6; EWS; EZH2; FABP7; FCGR3A_Version_1; FCGR3A_Version_2; FGF5; FGFR2; fibronectin; FOS; FOXP3; FUT1; G250; GAGE-1; GAGE-2; GAGE-3; GAGE-4; GAGE-5; GAGE-6; GAGE7b; GAGE-8_(GAGE-2D); GASR; GnT-V; GPC3; GPNMB/m; GRM3; HAGE; hepsin; Her2/neu; HLA-A2/m; homeobox_NKX3.1; HOM-TES-85; HPG1; HS71A; HS71B; HST-2; hTERT; iCE; IF2B3; IL-10; IL-13Ra2; IL2-RA; IL2-RB; IL2-RG; IL-5; IMP3; ITA5; ITB1; ITB6; kallikrein-2; kallikrein-4; KI20A; KIAA0205; KIF2C; KK-LC-1; LDLR; LGMN; LIRB2; LY6K; MAGA5; MAGA8; MAGAB; MAGE-_B1; MAGE-_E1; MAGE-A1; MAGE-A10; MAGE-A12; MAGE-A2; MAGE-A3; MAGE-A4; MAGE-A6; MAGE-A9; MAGE-B10; MAGE-B16; MAGE-B17; MAGE-B2; MAGE-B3; MAGE-B4; MAGE-B5; MAGE-B6; MAGE-C1; MAGE-C2; MAGE-C3; MAGE-D1; MAGE-D2; MAGE-D4; MAGE-E1_(MAGE1); MAGE-E2; MAGE-F1; MAGE-HI; MAGEL2; mammaglobin_A; MART-1/melan-A; MART-2; MC1_R; M-CSF; mesothelin; MITF; MMP1_1; MMP7; MUC-1; MUM-1/m; MUM-2/m; MYO1A; MYO1B; MYO1C; MYO1D; MYO1E; MYO1F; MYO1G; MYO1H; NA17; NA88-A; Neo-PAP; NFYC/m; NGEP; N-myc; NPM; NRCAM; NSE; NUF2; NY-ESO-1; OA1; OGT; OS-9; osteocalcin; osteopontin; p53; PAGE-4; PAI-1; PAI-2; PAP; PATE; PAX3; PAX5; PD1L1; PDCD1; PDEF; PECA1; PGCB; PGFRB; Pim-1_-Kinase; Pin-1; PLAC1; PMEL; PML; POTE; POTEF; PRAME; PRDX5/m; PRM2; prostein; proteinase-3; PSA; PSB9; PSCA; PSGR; PSM; PTPRC; RAB8A; RAGE-1; RARA; RASH; RASK; RASN; RGS5; RHAMM/CD168; RHOC; RSSA; RU1; RU2; RUNX1; S-100; SAGE; SART-_1; SART-2; SART-3; SEPR; SERPINB5; SIA7F; SIA8A; SIAT9; SIRT2/m; SOX10; SP17; SPNXA; SPXN3; SSX-1; SSX-2; SSX3; SSX-4; ST1A1; STAG2; STAMP-1; STEAP-1; survivin; Survivin-2B; SYCP1; SYT-SSX-1; SYT-SSX-2; TARP; TCRg; TF2AA; TGFbeta1; TGFR2; TGM-4; TIE2; TKTL1; TPI/m; TRGV11; TRGV9; TRPC1; TRP-p8; TSG10; TSPY1; TVC_(TRGV3); TX101; tyrosinase; TYRP1; TYRP2; UPA; VEGFR1; WT1; XAGE1.
  25. 25. The RNA containing composition of item 6, wherein the β-catenin inhibitor is chosen from the following list: TAT-NLS-BLBD-6, axin-1, TCF-4, GSK-3b, DKK-1, Dvl-1.
  26. 26. The RNA containing composition of item 6, wherein the activator of the STING (stimulator of interferon genes) pathway is an activating protein or a constitutively active protein of the STING pathway, preferably of DDX41, STING, cGAS, IRF3, TBK1, or STAT6.
  27. 27. The RNA containing composition of item 6, wherein the checkpoint modulator is a modulator of B7-1/CD80, B7-2/CD86, B7-H1/PD-L1, B7-H2, B7-H3, B7-H4, B7-H6, B7-H7/HHLA2, BTLA, CD28, CD28H/IGPR-1, CTLA-4, ICOS, PD-1, PD-L2/B7-DC, PDCD6, VISTA/B7-H5/PD-1H, BTN1A1/Butyrophilin, BTN2A1, BTN2A2/Butyrophilin 2A2, BTN3A1/2, BTN3A2, BTN3A3, BTNL2/Butyrophilin-like 2, BTNL3, BTNL4, BTNL6, BTNL8, BTNL9, BTNL10, CD277/BTN3A1, LAIR1, LAIR2, CD96, CD155/PVR, CRTAM, DNAM-1/CD226, Nectin-2/CD112, Nectin-3, TIGIT, LILRA3/CD85e, LILRA4/CD85g/ILT7, LILRB1/CD85j/ILT2, LILRB2/CD85d/ILT4, LILRB3/CD85a/ILT5, LILRB4/CD85k/ILT3, 4-1BB/TNFRSF9/CD137, 4-1BB Ligand/TNFSF9, BAFF/BLyS/TNFSF13B, BAFF R/TNFRSF13C, CD27/TNFRSF7, CD27 Ligand/TNFSF7, CD30/TNFRSF8, CD30 Ligand/TNFSF8, CD40/TNFRSF5, CD40 Ligand/TNFSF5, DR3/TNFRSF25, GITR/TNFRSF18, GITR Ligand/TNFSF18, HVEM/TNFRSF14, LIGHT/TNFSF14, Lymphotoxin-alpha/TNF-beta, OX40/TNFRSF4, OX40 Ligand/TNFSF4, RELT/TNFRSF19L, TACI/TNFRSF13B, TL1A/TNFSF15, TNF-alpha, TNF RII/TNFRSF1B, 2B4/CD244/SLAMF4, BLAME/SLAMF8, CD2, CD2F-10/SLAMF9, CD48/SLAMF2, CD58/LFA-3, CD84/SLAMF5, CD229/SLAMF3, CRACC/SLAMF7, NTB-A/SLAMF6, SLAM/CD150, TIM-1/KIM-1/HAVCR, TIM-3, TIM-4, CD7, CD96, CD160, CD200, CD300a/LMIR1, CRTAM, DAP12, Dectin-1/CLEC7A, DPPIV/CD26, EphB6, Integrin alpha 4 beta 1, Integrin alpha 4 beta 7/LPAM-1, LAG-3, TIM-1/KIM-1/HAVCR, TIM-4, TSLP R, or any combinations thereof.
  28. 28. The RNA containing composition of item 6 or 27, wherein the checkpoint modulator is selected from the group consisting of an agonistic antibody, an antagonistic antibody, a dominant negative receptor, a decoy receptor and a ligand.
  29. 29. The RNA containing composition of item 28, wherein the antagonistic antibody is directed against PD-1, PD-L1 or CTLA-4.
  30. 30. The RNA containing composition of item 28, wherein the agonistic antibody is directed against OX-40.
  31. 31. The RNA containing composition of item 28, wherein the decoy receptor is a soluble PD-1 receptor.
  32. 32. The RNA containing composition of item 6, wherein the antibody, is an agonistic antibody, an antagonistic antibody, or a neutralizing antibody.
  33. 33. The RNA containing composition of item 6 or 32, wherein the antibody is directed against a tumor antigen or a tumor associated antigen.
  34. 34. The RNA containing composition of one of items 3-33, wherein the G/C content of the coding region of the coding RNA, preferably mRNA is increased compared with the G/C content of the coding region of the wild type RNA, and wherein the coded amino acid sequence of said G/C-enriched RNA is preferably not being modified compared with the encoded amino acid sequence of the wild type RNA.
  35. 35. The RNA containing composition of one of items 3-34, wherein the coding RNA, preferably mRNA comprises additionally a 5'-UTR element and/or a 3'-UTR element.
  36. 36. The RNA containing composition of one of items 3-35, wherein the coding RNA, preferably mRNA comprises additionally at least one histone stem-loop.
  37. 37. The RNA containing composition of one of items 3-36, wherein the coding RNA, preferably mRNA comprises additionally a 5'-CAP structure and/or a poly(A) sequence and/or a poly(C) sequence.
  38. 38. The RNA containing composition of item 3, wherein the non-coding RNA is selected from the group consisting of small interfering RNA (siRNA), antisense RNA (asRNA), circular RNA (circRNA), ribozymes, aptamers, riboswitches, immunostimulating RNA, transfer RNA (tRNA), ribosomal RNA (rRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), microRNA (miRNA), and Piwi-interacting RNA (piRNA).
  39. 39. The RNA containing composition of item 38, wherein the immunostimulating RNA comprises at least one RNA sequence according to formula (III) (GlXmGn), formula (IV) (ClXmCn), formula (V) (NuGlXmGnNv)a, and/or formula (VI) (NuClXmCnNv)a).
  40. 40. The RNA containing composition of item 38 or 39, wherein the immunostimulating RNA comprises at least one RNA sequence according to SEQ ID NO. 5, 394 and 10072.
  41. 41. The RNA containing composition of any of the preceding items, wherein the at least one RNA is complexed with one or more cationic or polycationic compounds, preferably with cationic or polycationic polymers, cationic or polycationic peptides or proteins, e.g. protamine, cationic or polycationic polysaccharides and/or cationic or polycationic lipids.
  42. 42. The RNA containing composition of item 41, wherein the cationic or polycationic compound is a polymeric carrier.
  43. 43. The RNA containing composition of item 42, wherein the polymeric carrier is formed by disulfide-crosslinked cationic components, preferably disulfide-crosslinked cationic peptides, preferably comprising peptides according to formula VII, VIIa and/or Vllb and/or a compound according to formula (VIII) (L-P1-S-[S-P2-S]n-S-P3-L).
  44. 44. The RNA containing composition of items 41-43, wherein the N/P ratio of the at least one RNA to the one or more cationic or polycationic compounds, preferably cationic or polycationic peptides or proteins is in the range of about 0.1 to 10, including a range of about 0.3 to 4, of about 0.5 to 2, of about 0.7 to 2 and of about 0.7 to 1.5.
  45. 45. The RNA containing composition of any of the preceding items wherein the RNA containing composition comprises at least one RNA, which is complexed with one or more cationic or polycationic compounds, and at least one free RNA, preferably coding RNA, more preferably mRNA.
  46. 46. The RNA containing composition of any of the preceding items, wherein the at least one mRNA is complexed with one or more lipids and thereby forming liposomes, lipid nanoparticles and/or lipoplexes.
  47. 47. The RNA containing composition of any of the preceding items, wherein the RNA containing composition comprises a polymeric carrier cargo complex, formed by a polymeric carrier, preferably comprising disulfide-crosslinked cationic peptides, preferably Cys-Arg12, and/or Cys-Arg12-Cys, and an immunostimulating RNA, preferably the RNA sequence according to SEQ ID NO: 5, 394 or 10072.
  48. 48. Pharmaceutical composition comprising the RNA containing composition as defined according to items 1 to 47 and a pharmaceutically acceptable carrier and/or vehicle.
  49. 49. The pharmaceutical composition of item 48, prepared for injection into tumor tissue.
  50. 50. Kit or kit of parts comprising the RNA containing composition as defined according to items 1 to 47, or the pharmaceutical composition as defined according to item 48 or 49, and optionally technical instructions with information on the administration and dosage for administration.
  51. 51. The RNA containing composition as defined according to one of items 1 to 47, or the pharmaceutical composition as defined according to item 48 or 49, or the kit or kit of parts as defined according to item 50 for use as a medicament.
  52. 52. The RNA containing composition as defined according to items 1 to 47, or the pharmaceutical composition as defined according to item 48 or 49, or the kit or kit of parts as defined according to item 50 for use in the treatment or prophylaxis of tumor and/or cancer diseases preferably by intratumoral application, especially by injection into tumor tissue.
  53. 53. Use of the RNA containing composition as defined according to items 1 to 47, or the pharmaceutical composition as defined according to item 48 or 49, or the kit or kit of parts as defined according to item 50 for the treatment or prophylaxis of tumor and/or cancer diseases, preferably by intratumoral application, especially by injection into tumor tissue.
  54. 54. The use of item 53, wherein the treatment or prophylaxis comprises the administration of at least one additional pharmaceutically active compound.
  55. 55. The use of item 54, wherein the at least one additonal pharmaceutically active compound is selected from the group consisting of cytokines, chemokines, suicide gene products, immunogenic proteins or peptides, apoptosis inducers, angiogenesis inhibitors, heat shock proteins, tumor antigens, β-catenin inhibitors, activators of the STING pathway, checkpoint modulators, innate immune activators, antibodies, dominant negative receptors and decoy receptors, inhibitors of myeloid derived suppressor cells (MDSCs), IDO pathway inhibitors, proteins or peptides that bind inhibitors of apoptosis, anti-bacterial agents, anti-viral agents, drugs, adjuvants, chemotherapeutic agents and kinase inhibitors.
  56. 56. The use of item 54 or 55, wherein the treatment further comprises radiation therapy and/or surgery.
  57. 57. The use of item 55, wherein the checkpoint modulator is selected from a modulator as defined in item 27.
  58. 58. The use of item 57, wherein the checkpoint modulator is selected from a PD-1 inhibitor, a PD-L1 inhibitor, a CTLA-4 inhibitor, a LAG3 inhibitor, a TIM3 inhibitor, an OX-40 stimulator, a 4-1BB stimulator, a CD40L stimulator, a CD28 stimulator, a GITR stimulator.
  59. 59. The use of item 58, wherein the PD-1 inhibitor is an antagonistic antibody directed against PD-1 and the PD-L1 inhibitor is an antagonistic antibody directed against PD-L1.
  60. 60. The use of item 54, wherein the antibody is selected from an antibody directed against CD73 and/or CD137.
  61. 61. Use of the RNA containing composition as defined according to one of items 1 to 47, or the pharmaceutical composition as defined according to item 48 or 49, or the kit or kit of parts as defined according to item 50 for preparation of a medicament for treatment of tumor and/or cancer diseases, preferably by intratumoral application, especially by injection into tumor tissue.
  62. 62. Method of treatment of tumor and/or cancer diseases with the RNA containing composition as defined according to one of items 1 to 47, or the pharmaceutical composition as defined according to item 48 or 49, or the kit or kit of parts as defined according to item 50, preferably by intratumoral application, especially by injection into tumor tissue.



Claims

1. RNA containing composition comprising at least one non-coding, immunostimulating RNA for use in the treatment or prophylaxis of tumor and/or cancer diseases,
wherein the RNA containing composition is to be applied intratumorally especially by injection into tumor tissue, and
wherein the treatment or prophylaxis comprises the administration of a PD-1 inhibitor or a PD-L1 inhibitor, wherein the PD-1 inhibitor is an antagonistic antibody directed against PD-1 and the PD-L1 inhibitor is an antagonistic antibody directed against PD-L1.
 
2. The RNA containing composition for use of claim 1, wherein the immunostimulating RNA comprises at least one RNA sequence according to formula (III) (GlXmGn), formula (IV) (ClXmCn), formula (V) (NuGlXmGnNv)a, and/or formula (VI) (NuClXmCnNv)a).
 
3. The RNA containing composition for use of claim 1 or 2, wherein the immunostimulating RNA comprises at least one RNA sequence according to SEQ ID NO. 5, 394 and 10072.
 
4. The RNA containing composition for use of any of the preceding claims, wherein the at least one RNA is complexed with one or more cationic or polycationic compounds, preferably with cationic or polycationic polymers, cationic or polycationic peptides or proteins, e.g. protamine, cationic or polycationic polysaccharides and/or cationic or polycationic lipids.
 
5. The RNA containing composition for use of claim 4, wherein the cationic or polycationic compound is a polymeric carrier.
 
6. The RNA containing composition for use of claim 5, wherein the polymeric carrier is formed by disulfide-crosslinked cationic components, preferably disulfide-crosslinked cationic peptides, preferably comprising peptides according to formula VII, VIIa and/or VIIb and/or a compound according to formula (VIII) (L-P1-S-[S-P2-S]n-S-P3-L).
 
7. The RNA containing composition for use of claims 4 to 6, wherein the N/P ratio of the at least one RNA to the one or more cationic or polycationic compounds, preferably cationic or polycationic peptides or proteins is in the range of about 0.1 to 10, including a range of about 0.3 to 4, of about 0.5 to 2, of about 0.7 to 2 and of about 0.7 to 1.5.
 
8. The RNA containing composition for use of any of the preceding claims wherein the RNA containing composition comprises at least one RNA, which is complexed with one or more cationic or polycationic compounds, and at least one free RNA, preferably coding RNA, more preferably mRNA.
 
9. The RNA containing composition for use of any of the preceding claims, wherein the at least one mRNA is complexed with one or more lipids and thereby forming liposomes, lipid nanoparticles and/or lipoplexes.
 
10. The RNA containing composition for use of any of the preceding claims, wherein the RNA containing composition comprises a polymeric carrier cargo complex, formed by a polymeric carrier, preferably comprising disulfide-crosslinked cationic peptides, preferably Cys-Arg12, and/or Cys-Arg12-Cys, and an immunostimulating RNA, preferably the RNA sequence according to SEQ ID NO: 5, 394 or 10072.
 
11. Pharmaceutical composition comprising the RNA containing composition as defined according to claims 1 to 10 and a pharmaceutically acceptable carrier and/or vehicle for use in the treatment or prophylaxis of tumor and/or cancer diseases,
wherein the pharmaceutical composition is to be applied intratumorally especially by injection into tumor tissue,
wherein the treatment or prophylaxis comprises the administration of a PD-1 inhibitor or a PD-L1 inhibitor, wherein the PD-1 inhibitor is an antagonistic antibody directed against PD-1 and the PD-L1 inhibitor is an antagonistic antibody directed against PD-L1.
 
12. Kit or kit of parts comprising the RNA containing composition as defined according to claims 1 to 10, or the pharmaceutical composition as defined according to claim 11, and optionally technical instructions with information on the administration and dosage for administration, for use in the treatment or prophylaxis of tumor and/or cancer diseases,
wherein the RNA containing composition or the pharmaceutical composition is to be applied intratumorally especially by injection into tumor tissue,
wherein the treatment or prophylaxis comprises the administration of a PD-1 inhibitor or a PD-L1 inhibitor, wherein the PD-1 inhibitor is an antagonistic antibody directed against PD-1 and the PD-L1 inhibitor is an antagonistic antibody directed against PD-L1.
 
13. The RNA containing composition for use of any of claims 1 to 10, the pharmaceutical composition for use of claim 11, or the kit or kit of parts for use of claim 12, wherein the treatment further comprises radiation therapy and/or surgery.
 


Ansprüche

1. RNA enthaltende Zusammensetzung, umfassend mindestens eine nicht-kodierende, immunstimulierende RNA zur Verwendung bei der Behandlung oder Prophylaxe von Tumor- und/oder Krebserkrankungen,
wobei die RNA enthaltende Zusammensetzung intratumoral, insbesondere durch Injektion in Tumorgewebe, zu verabreichen ist, und
wobei die Behandlung oder Prophylaxe die Verabreichung eines PD-1-Inhibitors oder eines PD-L1-Inhibitors umfasst, wobei der PD-1-Inhibitor ein antagonistischer Antikörper gegen PD-1 und der PD-L1 -Inhibitor ein antagonistischer Antikörper gegen PD-L1 ist.
 
2. RNA enthaltende Zusammensetzung zur Verwendung nach Anspruch 1, wobei die immunstimulierende RNA mindestens eine RNA-Sequenz gemäß Formel (III) (GlXmGn), Formel (IV) (ClXmCn), Formel (V) (NuGlXmGnNv)a und/oder Formel (VI) (NuClXmCnNv)a) umfasst.
 
3. RNA enthaltende Zusammensetzung zur Verwendung nach Anspruch 1 oder 2, wobei die immunstimulierende RNA mindestens eine RNA-Sequenz gemäß SEQ ID NO. 5, 394 und 10072 umfasst.
 
4. RNA enthaltende Zusammensetzung zur Verwendung nach einem der vorstehenden Ansprüche, wobei die mindestens eine RNA mit einer oder mehreren kationischen oder polykationischen Verbindungen, bevorzugt mit kationischen oder polykationischen Polymeren, kationischen oder polykationischen Peptiden oder Proteinen, z.B. Protamin, kationischen oder polykationischen Polysacchariden und/oder kationischen oder polykationischen Lipiden komplexiert ist.
 
5. RNA enthaltende Zusammensetzung zur Verwendung nach Anspruch 4, wobei die kationische oder polykationische Verbindung ein polymerer Träger ist.
 
6. RNA enthaltende Zusammensetzung zur Verwendung nach Anspruch 5, wobei der polymere Träger gebildet ist durch disulfidvernetzte kationische Komponenten, bevorzugt disulfidvernetzte kationische Peptide, bevorzugt umfassend Peptide nach Formel VII, VIIa und/oder VIIb und/oder eine Verbindung nach Formel (VIII) (L-P1-S-[S-P2-S]n-S-P3-L).
 
7. RNA enthaltende Zusammensetzung zur Verwendung nach den Ansprüchen 4 bis 6, wobei das N/P-Verhältnis der mindestens einen RNA zu einer oder mehreren kationischen oder polykationischen Verbindungen, bevorzugt kationischen oder polykationischen Peptiden oder Proteinen, im Bereich von etwa 0,1 bis 10 liegt, einschließlich eines Bereichs von etwa 0,3 bis 4, von etwa 0,5 bis 2, von etwa 0,7 bis 2 und von etwa 0,7 bis 1,5.
 
8. RNA enthaltende Zusammensetzung zur Verwendung nach einem der vorstehenden Ansprüche, wobei die RNA enthaltende Zusammensetzung mindestens eine RNA, die mit einer oder mehreren kationischen oder polykationischen Verbindungen komplexiert ist, und mindestens eine freie RNA, bevorzugt kodierende RNA, bevorzugter mRNA, umfasst.
 
9. RNA enthaltende Zusammensetzung zur Verwendung nach einem der vorstehenden Ansprüche, wobei die mindestens eine mRNA mit einem oder mehreren Lipiden komplexiert ist und dadurch Liposomen, Lipid-Nanopartikel und/oder Lipoplexe bildet.
 
10. RNA enthaltende Zusammensetzung zur Verwendung nach einem der vorstehenden Ansprüche, wobei die RNA enthaltende Zusammensetzung einen polymeren Trägerladungskomplex umfasst, der durch einen polymeren Träger gebildet ist, der bevorzugter disulfidvernetzte kationische Peptide, bevorzugt Cys-Arg12 und/oder Cys-Arg12-Cys, und eine immunstimulierende RNA, bevorzugt die RNA-Sequenz gemäß SEQ ID NO: 5, 394 oder 10072 umfasst.
 
11. Pharmazeutische Zusammensetzung, umfassend die RNA enthaltende Zusammensetzung wie nach einem der Ansprüche 1 bis 10 definiert und einen pharmazeutisch verträglichen Träger und/oder Vehikel zur Verwendung bei der Behandlung oder Prophylaxe von Tumor- und/oder Krebserkrankungen,
wobei die pharmazeutische Zusammensetzung intratumoral, insbesondere durch Injektion in Tumorgewebe, zu verabreichen ist,
wobei die Behandlung oder Prophylaxe die Verabreichung eines PD-1-Inhibitors oder eines PD-L1-Inhibitors umfasst, wobei der PD-1-Inhibitor ein antagonistischer Antikörper gegen PD-1 und der PD-L1-Inhibitor ein antagonistischer Antikörper gegen PD-L1 ist.
 
12. Kit oder Kit von Teilen, umfassend die RNA enthaltende Zusammensetzung nach Anspruch 1 bis 10 oder die pharmazeutische Zusammensetzung wie nach Anspruch 11 definiert und optional technische Anweisungen mit Informationen über die Verabreichung und zu verabreichende Dosierung zur Verwendung bei der Behandlung oder Prophylaxe von Tumor- und/oder Krebserkrankungen,
wobei die RNA enthaltende Zusammensetzung oder die pharmazeutische Zusammensetzung intratumoral zu verabreichen ist, insbesondere durch Injektion in Tumorgewebe,
wobei die Behandlung oder Prophylaxe die Verabreichung eines PD-1-Inhibitors oder eines PD-L1-Inhibitors umfasst, wobei der PD-1-Inhibitor ein antagonistischer Antikörper gegen PD-1 und der PD-L1-Inhibitor ein antagonistischer Antikörper gegen PD-L1 ist.
 
13. RNA enthaltende Zusammensetzung zur Verwendung nach einem der Ansprüche 1 bis 10, die pharmazeutische Zusammensetzung zur Verwendung nach Anspruch 11 oder der Kit oder der Kit von Teilen zur Verwendung nach Anspruch 12, wobei die Behandlung ferner eine Strahlentherapie und/oder Operation umfasst.
 


Revendications

1. Composition contenant de l'ARN comprenant au moins un ARN immunostimulant non codant destinée à être utilisée dans le traitement ou la prophylaxie de maladies tumorales et/ou cancéreuses,
où la composition contenant de l'ARN est à appliquer de manière intratumorale en particulier par injection dans un tissu tumoral, et
où le traitement ou la prophylaxie comprend l'administration d'un inhibiteur de PD-1 ou d'un inhibiteur de PD-L1, où l'inhibiteur de PD-1 est un anticorps antagoniste dirigé contre PD-1 et l'inhibiteur de PD-L1 est un anticorps antagoniste dirigé contre PD-L1.
 
2. Composition contenant de l'ARN destinée à être utilisée selon la revendication 1, où l'ARN immunostimulant comprend au moins une séquence d'ARN selon la formule (III) (GlXmGn), la formule (IV) (ClXmCn), la formule (V) (NuGlXmGnNv)a et/ou la formule (VI) (NuClXmCnNv)a).
 
3. Composition contenant de l'ARN destinée à être utilisée selon la revendication 1 ou 2, où l'ARN immunostimulant comprend au moins une séquence d'ARN selon SEQ ID NO. 5, 394 et 10072.
 
4. Composition contenant de l'ARN destinée à être utilisée selon l'une quelconque des revendications précédentes, où le au moins un ARN est complexé avec un ou plusieurs composés cationiques ou polycationiques, de préférence avec des polymères cationiques ou polycationiques, des peptides ou des protéines cationiques ou polycationiques, par exemple la protamine, des polysaccharides cationiques ou polycationiques et/ou des lipides cationiques ou polycationiques.
 
5. Composition contenant de l'ARN destinée à être utilisée selon la revendication 4, où le composé cationique ou polycationique est un vecteur polymérique.
 
6. Composition contenant de l'ARN destinée à être utilisée selon la revendication 5, où le vecteur polymérique est formé par des composants cationiques liés entre eux par disulfure, de préférence des peptides cationiques liés entre eux par disulfure, de préférence comprenant des peptides selon la formule VII, VIIa et/ou VIIb et/ou un composé selon la formule (VIII) (L-P1-S-[S-P2-S]n-S-P3-L).
 
7. Composition contenant de l'ARN destinée à être utilisée selon les revendications 4 à 6, où le rapport N/P du au moins un ARN aux un ou plusieurs composés cationiques ou polycationiques, de préférence des peptides ou protéines cationiques ou polycationiques est dans la plage d'environ 0,1 à 10, incluant une plage d'environ 0,3 à 4, d'environ 0,5 à 2, d'environ 0,7 à 2 et d'environ 0,7 à 1,5.
 
8. Composition contenant de l'ARN destinée à être utilisée selon l'une quelconque des revendications précédentes où la composition contenant de l'ARN comprend au moins un ARN, qui est complexé avec un ou plusieurs composés cationiques ou polycationiques, et au moins un ARN libre, de préférence un ARN codant, de préférence encore un ARNm.
 
9. Composition contenant de l'ARN destinée à être utilisée selon l'une quelconque des revendications précédentes, où le au moins un ARNm est complexé avec un ou plusieurs lipides et forme ainsi des liposomes, des nanoparticules lipidiques et/ou des lipoplexes.
 
10. Composition contenant de l'ARN destinée à être utilisée selon l'une quelconque des revendications précédentes, où la composition contenant de l'ARN comprend un complexe vecteur polymérique charge, formé par un vecteur polymérique, de préférence comprenant des peptides cationiques liés entre eux par disulfure, de préférence Cys-Arg12, et/ou Cys-Arg12-CyS, et un ARN immunostimulant, de préférence la séquence d'ARN selon SEQ ID NO: 5, 394 ou 10072.
 
11. Composition pharmaceutique comprenant la composition contenant de l'ARN telle que définie selon les revendications 1 à 10 et un vecteur et/ou véhicule pharmaceutiquement acceptable destinée à être utilisée dans le traitement ou la prophylaxie de maladies tumorales et/ou cancéreuses,
où la composition pharmaceutique est à appliquer de manière intratumorale en particulier par injection dans un tissu tumoral,
où le traitement ou la prophylaxie comprend l'administration d'un inhibiteur de PD-1 ou d'un inhibiteur de PD-L1, où l'inhibiteur de PD-1 est un anticorps antagoniste dirigé contre PD-1 et l'inhibiteur de PD-L1 est un anticorps antagoniste dirigé contre PD-L1.
 
12. Kit ou kit de parties comprenant la composition contenant de l'ARN telle que définie selon les revendications 1 à 10, ou la composition pharmaceutique telle que définie selon la revendication 11, et éventuellement des instructions techniques avec des informations sur l'administration et le dosage pour l'administration, destiné à être utilisé dans le traitement ou la prophylaxie de maladies tumorales et/ou cancéreuses,
où la composition contenant de l'ARN ou la composition pharmaceutique est à appliquer de manière intratumorale en particulier par injection dans un tissu tumoral,
où le traitement ou la prophylaxie comprend l'administration d'un inhibiteur de PD-1 ou d'un inhibiteur de PD-L1, où l'inhibiteur de PD-1 est un anticorps antagoniste dirigé contre PD-1 et l'inhibiteur de PD-L1 est un anticorps antagoniste dirigé contre PD-L1.
 
13. Composition contenant de l'ARN destinée à être utilisée selon l'une quelconque des revendications 1 à 10, composition pharmaceutique destinée à être utilisée selon la revendication 11, ou kit ou kit de parties destiné à être utilisé selon la revendication 12, où le traitement comprend en outre une radiothérapie et/ou une chirurgie.
 




Drawing



































Cited references

REFERENCES CITED IN THE DESCRIPTION



This list of references cited by the applicant is for the reader's convenience only. It does not form part of the European patent document. Even though great care has been taken in compiling the references, errors or omissions cannot be excluded and the EPO disclaims all liability in this regard.

Patent documents cited in the description




Non-patent literature cited in the description