(19)
(11)EP 3 362 559 B1

(12)FASCICULE DE BREVET EUROPEEN

(45)Mention de la délivrance du brevet:
06.05.2020  Bulletin  2020/19

(21)Numéro de dépôt: 16795118.5

(22)Date de dépôt:  14.10.2016
(51)Int. Cl.: 
C12N 15/10  (2006.01)
C12N 15/63  (2006.01)
C12N 15/74  (2006.01)
C12P 7/04  (2006.01)
C12N 9/22  (2006.01)
C12N 15/90  (2006.01)
C12R 1/145  (2006.01)
C12P 7/26  (2006.01)
(86)Numéro de dépôt:
PCT/FR2016/052663
(87)Numéro de publication internationale:
WO 2017/064439 (20.04.2017 Gazette  2017/16)

(54)

OUTIL GENETIQUE DE TRANSFORMATION DE BACTERIES CLOSTRIDIUM

GENETISCHES WERKZEUG ZUR TRANSFORMATION VON CLOSTRIDIUM

GENETIC TOOL FOR THE TRANSFORMATION OF CLOSTRIDIUM


(84)Etats contractants désignés:
AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

(30)Priorité: 16.10.2015 FR 1559846

(43)Date de publication de la demande:
22.08.2018  Bulletin  2018/34

(73)Titulaires:
  • IFP Energies nouvelles
    92500 Rueil-Malmaison (FR)
  • Stichting Wageningen Research
    6708 PB Wageningen (NL)

(72)Inventeurs:
  • WASELS, François
    57050 Metz (FR)
  • LOPES FERREIRA, Nicolas
    28210 Croisilles (FR)
  • COLLAS, Florent
    6702 A Wageningen (NL)
  • LOPEZ CONTRERAS, Ana
    3522 Gl Utrecht (NL)

(74)Mandataire: Cabinet Becker et Associés 
25, rue Louis le Grand
75002 Paris
75002 Paris (FR)


(56)Documents cités: : 
  
  • TAO XU ET AL: "Efficient Genome Editing in Clostridium cellulolyticum via CRISPR-Cas9 Nickase", APPLIED AND ENVIRONMENTAL MICROBIOLOGY, AMERICAN SOCIETY FOR MICROBIOLOGY, US, vol. 81, no. 13, 1 juillet 2015 (2015-07-01), pages 4423-4431, XP002741442, ISSN: 1098-5336, DOI: 10.1128/AEM.00873-15 [extrait le 2015-04-24]
  • TAO XU ET AL: "Supplementary Data for Efficient Genome Editing in Clostridium cellulolyticum via CRISPR-Cas9 Nickase", APPLIED AND ENVIRONMENTAL MICROBIOLOGY, AMERICAN SOCIETY FOR MICROBIOLOGY, US, 24 avril 2015 (2015-04-24), pages 1-13, XP002741729, ISSN: 0099-2240, DOI: 10.1128/AEM.00873-15
  • WANG Y ET AL: "Markerless chromosomal gene deletion in Clostridium beijerinckii using CRISPR/Cas9 system", JOURNAL OF BIOTECHNOLOGY, ELSEVIER SCIENCE PUBLISHERS, AMSTERDAM, NL, vol. 200, 20 avril 2015 (2015-04-20), pages 1-5, XP002741440, ISSN: 0168-1656, DOI: 10.1016/J.JBIOTEC.2015.02.005 [extrait le 2015-02-11]
  • CORNILLOT E ET AL: "The genes for butanol and acetone formation in Clostridium acetobutylicum ATCC 824 reside on a large plasmid whose loss leads to degeneration of the strain", JOURNAL OF BACTERIOLOGY, AMERICAN SOCIETY FOR MICROBIOLOGY, US, vol. 179, no. 17, 1 janvier 1997 (1997-01-01), pages 5442-5447, XP002412768, ISSN: 0021-9193
  • FLORENT COLLAS ET AL: "Simultaneous production of isopropanol, butanol, ethanol and 2,3-butanediol by Clostridium acetobutylicum ATCC 824 engineered strains", AMB EXPRESS, vol. 2, no. 1, 1 janvier 2012 (2012-01-01) , page 45, XP055173412, ISSN: 2191-0855, DOI: 10.1080/10408410701364604
  
Il est rappelé que: Dans un délai de neuf mois à compter de la date de publication de la mention de la délivrance de brevet européen, toute personne peut faire opposition au brevet européen délivré, auprès de l'Office européen des brevets. L'opposition doit être formée par écrit et motivée. Elle n'est réputée formée qu'après paiement de la taxe d'opposition. (Art. 99(1) Convention sur le brevet européen).


Description


[0001] La présente description concerne un outil génétique comprenant au moins deux acides nucléiques distincts permettant la transformation par recombinaison homologue d'une bactérie du genre Clostridium, typiquement d'une bactérie solvantogène du genre Clostridium.

ARRIERE-PLAN TECHNOLOGIQUE



[0002] Les bactéries appartenant au genre Clostridium sont des bacilles anaérobies strictes à coloration de gram positive, capables de former des endospores et appartenant au phylum des Firmicutes. Ce genre contient de nombreuses espèces étudiées en raison de leur caractère pathogène ou de leur intérêt industriel et médical. Ainsi, Clostridium tetani, Clostridium botulinum, Clostridium perfringens et Clostridium difficile sont les agents respectivement responsables du tétanos, du botulisme, de gangrènes gazeuses et de colites pseudomembraneuses. Parallèlement, d'autres espèces telles que Clostridium acetobutylicum, Clostridium butyricum et Clostridium beijerinckii, non pathogènes pour l'homme, sont utilisées en fermentation. Enfin, Clostridium novyi et Clostridium sporogenes ont récemment été utilisées dans des études ayant pour but la mise au point de thérapies anticancéreuses. Les espèces de Clostridium dites d'intérêt industriel sont capables de produire des solvants à partir d'une large variété de sucres et substrats allant du glucose à la cellulose. La croissance des bactéries Clostridium productrices de solvants est dite biphasique. Des acides (acétiques et butyriques) sont produits lors de la phase exponentielle de croissance. Puis, lorsque la croissance cellulaire cesse et que les bactéries entrent en phase stationnaire, elles produisent des solvants.

[0003] La majorité des souches solvantogènes de Clostridium produit de l'Acétone, du Butanol et de l'Éthanol comme produits finaux. Ces souches sont désignées « souches ABE ». C'est par exemple le cas des souches ATCC824 de C. acetobutylicum et NCIMB 8052 de C. beijerinckii. D'autres souches sont également capables de réduire l'Acétone en Isopropanol, et sont désignées « souches IBE ». C'est le cas par exemple de la souche DSM 6423 (NRRL B593) de C. beijerinckii qui possède dans son génome un gène adh codant une alcool-déshydrogénase primaire/secondaire qui permet la réduction de l'acétone en isopropanol.

[0004] La production d'isopropanol par C. acetobutylicum ATCC824 est possible après introduction d'un plasmide permettant l'expression du gène adh de C. beijerinckii DSM 6423. Une telle souche génétiquement modifiée possède des performances équivalentes à la souche DSM 6423. Ces performances peuvent être améliorées après surexpression au sein d'une structure opéronique des gènes ctfA, ctfB et adc codant respectivement les CoA-transférases impliquées dans la ré-assimilation d'acides et l'acétoacétate decarboxylase (Collas et al, 2012). L'introduction d'un plasmide contenant ces gènes modifie le profil fermentaire de la souche ATCC824 pour produire un mélange IBE. Cependant, le maintien de cette construction génétique nécessite la présence d'antibiotique dans le milieu de croissance, rendant impossible l'utilisation de cette souche pour des applications industrielles.

[0005] Malgré l'intérêt indéniable des bactéries du genre Clostridium, leur métabolisme est encore peu étudié et/ou modifié du fait des difficultés à obtenir des souches modifiées génétiquement. Les systèmes les plus performants sont basés sur des événements de recombinaison homologue permettant la modification précise du génome de manière stable. Les fréquences de recombinaison homologue observées chez Clostridium étant cependant très faibles, des marqueurs de sélection (e. g. un gène de résistance à un antibiotique) et de contre-sélection (e. g. un gène codant une toxine) se sont avérés nécessaires. Deux outils ont récemment été développés (Al Hinai et al., 2012 ; Cartman et al., 2012), chacun étant basé sur l'utilisation d'un plasmide unique. Bien que novateurs, ces systèmes présentent des inconvénients. Le premier système présente le défaut de laisser au niveau du site de modification une cassette FRT (utilisée lors de l'excision du marqueur de sélection) pouvant altérer le contexte génétique du mutant, et empêchant la réutilisation de l'outil pour réaliser de nombreuses modifications. Ces défauts sont bien connus de l'homme de métier. Le second système, nécessitant deux événements séquentiels de recombinaison homologue, ne peut pas être utilisé pour modifier des régions essentielles du génome. Un outil impliquant l'utilisation séquentielle de deux plasmides, l'un d'entre eux codant la méganucléase I-SceI capable de provoquer des coupures d'ADN double-brin au niveau de sites cibles spécifiques et de favoriser les événements de recombinaison homologues, a ensuite été développé (Zhang et al., 2015). Là aussi, la modification de certains gènes essentiels est rendue impossible par la nécessité de réaliser deux événements de recombinaison homologue séquentiels. La dernière génération d'outils développés à ce jour (Wang et al., 2015 ; Xu et al., 2015) fait appel à la technologie CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) qui fonctionne d'une manière analogue à l'interférence ARN observée chez les eucaryotes (Barrangou et al, 2007). Les outils décrits par Wang et al. et Xu et al., respectivement adaptés à C. beijerinckii et C. cellulolyticum, reposent sur l'utilisation d'un plasmide unique. Xu et al. utilisent une version modifiée de l'enzyme Cas9 créant des coupures simple brin au lieu de coupure double brin. Les deux outils disponibles fondés sur la technologie CRISPR présentent l'inconvénient majeur de limiter significativement la taille de l'acide nucléique d'intérêt (et donc le nombre de séquences codantes ou gènes) susceptible d'être inséré dans le génome bactérien (1,8 kb environ au mieux d'après Xu et al.).

RESUME DE L'INVENTION



[0006] L'objectif de la présente invention est de fournir un outil génétique adapté au genre Clostridium dans son ensemble, en particulier aux bactéries solvantogènes du genre Clostridium, permettant pour la première fois de modifier le génome bactérien afin de permettre l'exploitation des bactéries du genre Clostridium à l'échelle industrielle.

[0007] La description concerne ainsi un outil génétique permettant la transformation par recombinaison homologue d'une bactérie du genre Clostridium, de préférence une bactérie solvantogène du genre Clostridium, caractérisé en ce qu'il comprend au moins deux acides nucléiques distincts. Cet outil est par exemple capable de modifier une région du génome de la bactérie du genre Clostridium incluant une séquence essentielle à la survie bactérienne, ou de permettre l'insertion de grands fragments de séquences d'acide nucléique impossible à l'aide des outils existants.

[0008] Un premier aspect de la description concerne ainsi un outil génétique permettant la transformation par recombinaison homologue d'une bactérie solvantogène du genre Clostridium caractérisé en ce qu'il comprend :
  • un premier acide nucléique codant au moins Cas9, dans lequel la séquence codant Cas9 est placée sous le contrôle d'un promoteur, et
  • au moins un deuxième acide nucléique contenant une matrice de réparation permettant, par un mécanisme de recombinaison homologue, le remplacement d'une portion de l'ADN bactérien ciblée par Cas9 par une séquence d'intérêt,
et en ce que i) au moins l'un desdits acides nucléiques code en outre un ou plusieurs ARN guides (ARNg), ou ii) l'outil génétique comprend en outre un ou plusieurs ARN guides, chaque ARN guide comprenant une structure ARN de fixation à l'enzyme Cas9 et une séquence complémentaire de la portion ciblée de l'ADN bactérien.

[0009] L'invention concerne par ailleurs un procédé pour transformer et/ou modifier génétiquement par recombinaison homologue une bactérie du genre Clostridium, typiquement une bactérie solvantogène du genre Clostridium, caractérisé en ce qu'il comprend une étape d'introduction dans la bactérie d'un outil génétique selon l'invention. L'invention concerne également les bactéries du genre Clostridium ainsi transformée et/ou modifiée génétiquement.

[0010] Les inventeurs décrivent également un kit pour transformer et/ou modifier génétiquement une bactérie du genre Clostridium, ou pour produire au moins un solvant, par exemple un mélange de solvants, à l'aide d'une bactérie du genre Clostridium comprenant les éléments de l'outil génétique selon l'invention, et éventuellement, notamment, un ou plusieurs inducteurs adaptés au(x) promoteur(s) inductible(s) sélectionné(s) utilisé(s) au sein de l'outil.

[0011] Sont également décrites les utilisations de l'outil génétique selon l'invention, du procédé pour transformer et/ou modifier génétiquement par recombinaison homologue une bactérie du genre Clostridium, de la bactérie ainsi transformée et/ou modifiée génétiquement pour permettre la production d'un solvant ou d'un mélange de solvants à l'échelle industrielle, de préférence d'acétone, de butanol, d'éthanol, d'isopropanol ou d'un mélange de ceux-ci, typiquement d'un mélange isopropanol/butanol.

DESCRIPTION DETAILLEE DE L'INVENTION



[0012] CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) désigne chez les bactéries et les archées des locus de gènes ayant un rôle de défense immunitaire contre les phages et plasmides. Le système CRISPR-Cas9 repose essentiellement sur l'association d'une protéine Cas9 réalisant des coupures double-brins dans le génome cible et d'un ARN guide (ARNg) responsable de la spécificité du site de clivage. Cette capacité à créer des coupures double-brins ciblées dans l'ADN permet de favoriser les événements de recombinaison homologue nécessaires pour introduire des mutations dans le génome des souches d'intérêt. La viabilité cellulaire dépend de l'intégrité du génome. La bactérie devra réparer toute coupure dans son ADN, que ce soit par un mécanisme de jonction d'extrémités non homologues, ou par un mécanisme de recombinaison homologue nécessitant une matrice de réparation. En fournissant à la cellule une telle matrice, il est alors possible de modifier la région correspondant au site de coupure (Figure 2). La capacité de CRISPR à effectuer des coupures double-brin dans des molécules d'ADN a permis son utilisation récente comme outil génétique chez différents organismes, en particulier Streptococcus pyogenes, chez qui il a d'abord été caractérisé, chez E. coli, et au sein de cellules eucaryotes (Jiang et al, 2013 ; Cong et al, 2013 ; Hwang et al, 2013 ; Hsu et al, 2013). Il a dernièrement été utilisé chez Clostridium beijerinckii et Clostridium cellulolyticum à l'aide d'outils génétiques qui n'ont permis qu'une modification limitée du génome bactérien, inexploitable à l'échelle industrielle (Wang et al., 2015 ; Xu et al., 2015).

[0013] Un outil génétique permettant la transformation par recombinaison homologue d'une bactérie du genre Clostridium et comprenant au moins deux acides nucléiques distincts est pour la première fois décrit dans le présent texte. Les inventeurs ont apporté la démonstration que cet outil permet de transformer et/ou modifier génétiquement les bactéries solvantogènes du genre Clostridium, de manière suffisamment efficace pour les rendre notamment exploitables sur le plan industriel, répondant ainsi à un besoin exprimé depuis longtemps.

[0014] Un outil génétique particulier décrit par les inventeurs, permettant la transformation par recombinaison homologue d'une bactérie du genre Clostridium, comprend :
  • un premier acide nucléique codant au moins Cas9, dans lequel la séquence codant Cas9 est placée sous le contrôle d'un promoteur, et
  • au moins un deuxième acide nucléique contenant une matrice de réparation permettant, par un mécanisme de recombinaison homologue, le remplacement d'une portion de l'ADN bactérien ciblée par Cas9 par une séquence d'intérêt,
étant entendu que i) au moins l'un desdits acides nucléiques code en outre un ou plusieurs ARN guides (ARNg) ou que ii) l'outil génétique comprend en outre un ou plusieurs ARN guides. Dans cet outil chaque ARN guide comprend une structure ARN de fixation à l'enzyme Cas9 et une séquence complémentaire de la portion ciblée de l'ADN bactérien.

[0015] Par « bactérie du genre Clostridium », on entend en particulier les espèces de Clostridium dites d'intérêt industriel, typiquement les bactéries solvantogènes du genre Clostridium. L'expression « bactérie du genre Clostridium » englobe les bactéries sauvages ainsi que les souches dérivées de celles-ci modifiées génétiquement dans le but d'améliorer leur performance (par exemple surexprimant les gènes ctfA, ctfB et adc) sans avoir été exposées au Système CRISPR.
Par « espèce de Clostridium d'intérêt industriel » on entend les espèces capables de produire, par fermentation, des solvants à partir d'oses tels que le glucose, le xylose, le fructose ou le mannose, de polyosides tels que la cellulose ou les hémicelluloses, d'acides tels que l'acide butyrique ou l'acide acétique, ou de toute autre source de carbone assimilable et utilisable par les bactéries du genre Clostridium (CO, CO2, et méthanol par exemple). Des exemples de bactéries solvantogènes d'intérêt sont les bactéries du genre Clostridium productrices d'acétone, de butanol, d'éthanol et/ou d'isopropanol, telles que les souches identifiées dans la littérature en tant que « souche ABE » [souches réalisant des fermentations permettant la production d'acétone, de butanol et d'éthanol] et « souche IBE » [souches réalisant des fermentations permettant la production d'isopropanol (par réduction de l'acétone), de butanol et d'éthanol]. Des bactéries solvantogènes du genre Clostridium peuvent être sélectionnées parmi C. acetobutylicum, C. cellulolyticum, C. phytofermentans, C. beijerinckii, C. saccharobutylicum, C. saccharoperbutylacetonicum, C. sporogenes, C. butyricum, C. aurantibutyricum et C. tyrobutyricum, de manière préférée parmi C. acetobutylicum, C. beijerinckii, C. butyricum et C. tyrobutyricum et C. cellulolyticum et de manière encore plus préférée parmi C. acetobutylicum et C. beijerinckii.
Dans un mode de réalisation particulier, la bactérie du genre Clostridium concernée est une « souche ABE », de préférence la souche ATCC824 de C. acetobutylicum ou la souche NCIMB 8052 de C. beijerinckii.
Dans un autre mode de réalisation particulier, la bactérie du genre Clostridium concernée est une « souche IBE », de préférence la souche DSM 6423 (également identifiée en tant que souche NRRL B593) de C. beijerinckii.

[0016] Le système CRISPR contient deux éléments distincts, i.e. i) une endonucléase, dans le cas présent la nucléase associée au système CRISPR (Cas ou « CRISPR associated protein »), Cas9, et ii) un ARN guide. L'ARN guide se présente sous la forme d'un ARN chimérique qui consiste en la combinaison d'un ARN bactérien CRISPR (ARNcr) et d'un ARNtracr (trans-activating ARN CRISPR) (Jinek et al., Science 2012 - cf. figure 3). L'ARNg combine la spécificité de ciblage de l'ARNcr correspondant aux "séquences espaçantes" qui servent de guides aux protéines Cas, et les propriétés conformationnelles de l'ARNtracr en un transcrit unique. Lorsque l'ARNg et la protéine Cas9 sont exprimés simultanément dans la cellule, la séquence génomique cible peut être modifiée ou interrompue de manière permanente. La modification est avantageusement guidée par une matrice de réparation.
Un outil génétique décrit par les inventeurs comprend un premier acide nucléique codant au moins Cas9. Par « Cas9 » on entend une protéine Cas9 (aussi appelée Csn1 ou Csx12) ou un fragment protéique, peptidique ou polypeptidique fonctionnel de celle-ci, i.e. capable d'interagir avec le/les ARN guides et d'exercer l'activité enzymatique (nucléasique) qui lui permet de réaliser la coupure double-brins de l'ADN du génome cible. « Cas9 » peut ainsi désigner une protéine modifiée, par exemple tronquée afin de supprimer les domaines de la protéine non essentiels aux fonctions prédéfinies de la protéine, en particulier les domaines non nécessaires à l'interaction avec le/les ARNg.
La séquence codant Cas9 (la protéine entière ou un fragment de celle-ci) telle qu'utilisée dans le cadre de l'invention peut être obtenue à partir de toute protéine Cas9 connue (Makarova et al., 2011). Des exemples de protéines Cas9 utilisables dans la présente invention incluent, sans y être limités, les protéines Cas9 de Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus mutans, Campylobacter jejuni, Francisella novicida et Neisseria meningitidis. D'autres protéines Cas9 utilisables dans la présente invention sont également décrites dans l'article de Fonfara et al, 2013. Dans un mode de réalisation particulier, la protéine Cas9, ou un fragment protéique, peptidique ou polypeptidique fonctionnel de celle-ci, codée par l'un des acides nucléiques de l'outil génétique selon l'invention comprend, ou consiste en, la séquence d'acides aminés SEQ ID NO : 1, ou toute autre séquence d'acides aminés ayant au moins 50%, de préférence au moins 60%, d'identité avec celle-ci, et contenant au minimum les deux acides aspartiques (« D ») occupant les positions 10 (« D10 ») et 840 (« D840 ») de la séquence d'acides aminés SEQ ID NO : 1.
Dans un mode de réalisation préféré, Cas9 comprend, ou consiste en, la protéine Cas9 (Numéro d'entrée NCBI: WP_010922251.1, SEQ ID NO: 1), codée par le gène cas9 de la souche de Streptococcus pyogenes M1 GAS (Numéro d'entrée NCBI : NC_002737.2 SPy_1046, SEQ ID NO : 2) ou une version de celui-ci ayant subi une optimisation (« version optimisée ») à l'origine d'un transcrit contenant les codons utilisés préférentiellement par les bactéries du genre Clostridium, typiquement les codons riches en bases adénines (« A ») et thymines (« T »), permettant une expression facilitée de la protéine Cas9 au sein de ce genre bactérien. Ces codons optimisés respectent le biais d'usage de codons, bien connu de l'homme de l'art, spécifique à chaque souche bactérienne. Dans les séquences peptidiques décrites dans ce document, les acides aminés sont représentés par leur code à une lettre selon la nomenclature suivante : C : cystéine; D : acide aspartique; E : acide glutamique; F : phénylalanine; G : glycine; H : histidine; I : isoleucine; K : lysine; L : leucine ; M : méthionine ; N : asparagine ; P : proline ; Q : glutamine ; R : arginine ; S : sérine ; T : thréonine ; V : valine ; W : tryptophane et Y : tyrosine.

[0017] Selon un mode de réalisation particulier, le domaine Cas9 est constitué d'une protéine Cas9 entière, de préférence la protéine Cas9 de Streptococcus pyogenes ou d'une version optimisée de celle-ci.

[0018] La séquence codant Cas9 présente au sein de l'un des acides nucléiques de l'outil génétique selon l'invention est placée sous le contrôle d'un promoteur. Ce promoteur peut être un promoteur constitutif ou un promoteur inductible. Dans un mode de réalisation préféré, le promoteur contrôlant l'expression de Cas9 est un promoteur inductible.
Des exemples de promoteurs constitutifs utilisables dans le cadre de la présente invention peuvent être sélectionnés parmi le promoteur du gène thl, du gène ptb, du gène adc, de l'opéron bcs, ou un dérivé de ceux-ci, de préférence un dérivé fonctionnel mais plus court (tronqué) tel que le dérivé « miniPthl » du promoteur du gène thl de C. acetobutylicum (Dong et al., 2012), ou tout autre promoteur, bien connu de l'homme de métier, permettant l'expression d'une protéine au sein de Clostridium.
Des exemples de promoteurs inductibles utilisables dans le cadre de la présente invention peuvent être sélectionnés par exemple parmi un promoteur dont l'expression est contrôlée par le répresseur transcriptionnel TetR, par exemple le promoteur du gène tetA (gène de résistance à la tétracycline originellement présent sur le transposon Tn10 d'E. coli) ; un promoteur dont l'expression est contrôlée par la L-arabinose, par exemple le promoteur du gène ptk (cf. Zhang J. et al., 2015), de préférence en combinaison avec la cassette araR de régulation de l'expression de C. acetobutylicum de façon à construire un système ARAi (cf. Zhang J. et al., 2015) ; un promoteur dont l'expression est contrôlée par la laminaribiose (dimère de glucose β-1,3), par exemple le promoteur du gène celC, de préférence immédiatement suivi du gène répresseur glyR3 et du gène d'intérêt (cf. Meals EB et al. (2015)) ou le promoteur du gène celC (cf. Newcomb M. et al., 2011) ; un promoteur dont l'expression est contrôlée par le lactose, par exemple le promoteur du gène bgaL, de préférence immédiatement suivi du gène AdhE1 (aldehyde/alcohol dehydrogenase) (cf. Banerjee et al., 2014) ; un promoteur dont l'expression est contrôlée par le xylose, par exemple le promoteur du gène xylB (cf. Nariya H et al., 2011) ; et promoteur dont l'expression est contrôlée par l'exposition aux UV, par exemple le promoteur bcn (cf. Dupuy et al., 2005).
Un promoteur dérivé de l'un des promoteurs décrits ci-dessus, de préférence un dérivé fonctionnel mais plus court (tronqué) peut également être avantageusement utilisé dans le contexte de l'invention. D'autres promoteurs inductibles utilisables dans la présente invention sont également décrits par exemple dans les articles de Ransom EM et al. (2015), Currie DH et al. (2013), D'Urzo N et al. (2013) et Hartman AH et al. (2011).

[0019] Un promoteur inductible préféré est un promoteur dérivé de tetA, inductible à l'anhydrotétracycline (aTc) (moins toxique que la tétracycline et capable de lever l'inhibition du répresseur transcriptionnel TetR à plus faible concentration), choisi parmi Pcm-2tetO1 et Pcm-2tetO2/1 (Dong et al., 2012).
Un autre promoteur inductible préféré est un promoteur dérivé de xylB, inductible par le xylose, par exemple le promoteur xylB de Clostridium difficile 630 (Nariya et al., 2011).

[0020] Les promoteurs inductibles tels que décrits dans la présente invention permettent de maîtriser avantageusement l'action de l'enzyme et de faciliter la sélection de transformants ayant subis les modifications génétiques souhaitées.

[0021] Le terme « ARN guide » ou « ARNg » désigne au sens de l'invention une molécule d'ARN capable d'interagir avec « Cas9 » afin de la guider vers une région cible du chromosome bactérien. La spécificité de coupure est déterminée par l'ARNg. Comme expliqué précédemment, chaque ARNg comprend deux régions :
  • une première région (communément appelée région « SDS »), à l'extrémité 5' de l'ARNg, qui est complémentaire de la région chromosomique cible et qui imite l'ARNcr du système CRISPR endogène, et
  • une seconde région (communément appelé région « handle »), à l'extrémité 3' de l'ARNg, qui mime les interactions d'appariement de bases entre l'ARNtracr (« trans-activating crRNA ») et l'ARNcr du système CRISPR endogène et présente une structure double brin en tige et boucle s'achevant en 3' par une séquence essentiellement simple brin. Cette seconde région est essentielle à la fixation de l'ARNg à Cas9.
La première région de l'ARNg (région « SDS ») varie selon la séquence chromosomique ciblée.
La région « SDS » de l'ARNg qui est complémentaire de la région chromosomique cible, comprend au moins 1 nucléotide, de préférence au moins 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35 ou 40 nucléotides, typiquement entre 1 et 40 nucléotides. De préférence, cette région a une longueur de 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 ou 30 nucléotides.
La seconde région de l'ARNg (région « handle ») a une structure en tige et boucle (ou structure en épingle à cheveux). Les régions « handle » des différents ARNg ne dépendent pas de la cible chromosomique choisie.
Selon un mode de réalisation particulier, la région « handle » comprend, ou consiste en, une séquence d'au moins 1 nucléotide, de préférence au moins 1, 50, 100, 200, 500 et 1000 nucléotides, typiquement entre 1 et 1000 nucléotides. De préférence, cette région a une longueur de 40 à 120 nucléotides.
La longueur totale d'un ARNg est en général de 50 à 1000 nucléotides, de préférence de 80 à 200 nucléotides, et de manière plus particulièrement préférée de 90 à 120 nucléotides. Selon un mode de réalisation particulier, un ARNg tel qu'utilisé dans la présente invention a une longueur comprise entre 95 et 110 nucléotides, par exemple une longueur d'environ 100 ou d'environ 110 nucléotides.

[0022] L'homme du métier peut aisément définir la séquence et la structure des ARNg selon la région chromosomique à cibler en utilisant des techniques bien connues (voir par exemple l'article de Di Carlo et al., 2013).
La région/portion/séquence d'ADN ciblée au sein du chromosome bactérien peut correspondre à une portion d'ADN non codante ou à une portion d'ADN codante. Dans un mode de réalisation particulier, la portion ciblée de l'ADN bactérien comprend un ou plusieurs gènes ou portion(s) de gène essentiel(le) à la survie bactérienne ou encore un ou plusieurs gènes ou séquences d'ADN dont l'inactivation permet la sélection des bactéries ayant intégré le/les acides nucléiques d'intérêt.
Des exemples particuliers de portion d'ADN ciblée au sein d'une bactérie du genre Clostridium sont les séquences utilisées dans la partie expérimentale. Il s'agit par exemple des séquences codant les gènes upp (SEQ ID NO : 3) et adhE1 (SEQ ID NO : 4).
La région/portion/séquence d'ADN ciblée est suivie d'une séquence « PAM » (« protospacer adjacent motif ») qui intervient dans la liaison à Cas9.

[0023] La région « SDS » d'un ARNg donné est identique (à 100%) ou identique à 80% au moins, de préférence à 85%, 90%, 95%, 96%, 97%, 98% ou 99% au moins à la région/portion/séquence d'ADN ciblée au sein du chromosome bactérien et est capable de s'hybrider à tout ou partie de la séquence complémentaire de ladite région/portion/séquence, typiquement à une séquence comprenant au moins 1 nucléotide, de préférence au moins 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35 ou 40 nucléotides, typiquement entre 1 et 40 nucléotides, de préférence à une séquence comprenant 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 ou 30 nucléotides.

[0024] Dans le procédé décrit par les inventeurs, un ou plusieurs ARNg peuvent être utilisés simultanément. Ces différents ARNg peuvent cibler des régions chromosomiques identiques ou différentes, de préférence différentes.
Les ARNg peuvent être introduits dans la cellule bactérienne sous la forme de molécules d'ARNg (matures ou précurseurs), sous la forme de précurseurs ou sous la forme d'un ou plusieurs acides nucléiques codant lesdits ARNg. Les ARNg sont de préférence introduits dans la cellule bactérienne sous la forme d'un ou plusieurs acides nucléiques codant lesdits ARNg.
Lorsque le ou les ARNg sont introduits dans la cellule directement sous la forme de molécules d'ARN, ces ARNg (matures ou précurseurs) peuvent contenir des nucléotides modifiés ou des modifications chimiques leur permettant, par exemple, d'augmenter leur résistance aux nucléases et ainsi d'augmenter leur durée de vie dans la cellule. Ils peuvent notamment comprendre au moins un nucléotide modifié ou non naturel tel que, par exemple, un nucléotide comportant une base modifiée, telle que l'inosine, la méthyl-5-désoxycytidine, la diméthylarnino-5-désoxyuridine, la désoxyuridine, la diamino-2,6-purine, la bromo-5-désoxyuridine ou toute autre base modifiée permettant l'hybridation. Les ARNg utilisés dans le cadre de l'invention peuvent également être modifiés au niveau de la liaison internucléotidique comme par exemple les phosphorothioates, les H-phosphonates ou les alkyl-phosphonates, ou au niveau du squelette comme par exemple les alpha-oligonucléotides, les 2'-O-alkyl ribose ou les PNA (Peptid Nucleic Acid) (Egholm et al., 1992).
Les ARNg peuvent être des ARN naturels, synthétiques ou produits par des techniques de recombinaison. Ces ARNg peuvent être préparés par toutes méthodes connues de l'homme du métier telles que, par exemple, la synthèse chimique, la transcription in vivo ou des techniques d'amplification.
Lorsque les ARNg sont introduits dans la cellule bactérienne sous la forme d'un ou plusieurs acides nucléiques, la ou les séquences codant le ou les ARNg sont placées sous le contrôle d'un promoteur d'expression. Ce promoteur peut être constitutif ou inductible.
Lorsque plusieurs ARNg sont utilisés, l'expression de chaque ARNg peut être contrôlée par un promoteur différent. De préférence, le promoteur utilisé est le même pour tous les ARNg. Un même promoteur peut dans un mode de réalisation particulier être utilisé pour permettre l'expression de plusieurs, par exemple de quelques-uns seulement, des ARNg destinés à être exprimés.
Dans un mode de réalisation préféré, le/les promoteurs contrôlant l'expression du/des ARNg est/sont des promoteurs constitutifs.
Des exemples de promoteurs constitutifs utilisables dans le cadre de la présente invention peuvent être sélectionnés parmi le promoteur du gène thl, du gène ptb ou de l'opéron bcs, ou un dérivé de ceux-ci, de préférence miniPthl, ou tout autre promoteur, bien connu de l'homme de métier, permettant la synthèse d'un ARN (codant ou non codant) au sein de Clostridium.
Des exemples de promoteurs inductibles utilisables dans le cadre de la présente invention peuvent être sélectionnés parmi le promoteur du gène tetA, du gène xylA, du gène lacI, ou du gène bgaL, ou un dérivé de ceux-ci, de préférence 2tetO1 ou tetO2/1. Un promoteur inductible préféré est tetO2/1.

[0025] Les promoteurs contrôlant l'expression de Cas9 et du/des ARNg peuvent être identiques ou différents et constitutifs ou inductibles. Dans un mode de réalisation particulier et préféré de l'invention, l'un seulement des promoteurs contrôlant respectivement l'expression de Cas9 ou du/des ARNg est un promoteur inductible.

[0026] Par « acide nucléique », on entend au sens de l'invention, toute molécule d'ADN ou d'ARN naturelle, synthétique, semi-synthétique ou recombinante, éventuellement modifiée chimiquement (i.e. comprenant des bases non naturelles, des nucléotides modifiés comprenant par exemple une liaison modifiée, des bases modifiées et/ou des sucres modifiés), ou optimisée de manière à ce que les codons des transcrits synthétisés à partir des séquences codantes soient les codons les plus fréquemment trouvés chez une bactérie du genre Clostridium en vue de son utilisation chez celle-ci. Comme expliqué précédemment, dans le cas du genre Clostridium, les codons optimisés sont typiquement des codons riches en bases adénines (« A ») et thymines (« T »).
Chacun des acides nucléiques présents au sein de l'outil génétique décrit, typiquement le « premier » acide nucléique et le « deuxième » acide nucléique, consiste en une entité distincte et correspond par exemple i) à une cassette d'expression (ou « construction ») telle qu'un acide nucléique comprenant au moins un promoteur transcriptionnel lié de manière opérationnelle (au sens où l'entend l'homme du métier) à une ou plusieurs séquences (codantes) d'intérêt, typiquement à un opéron comprenant plusieurs séquence codantes d'intérêt dont les produits d'expression concourent à la réalisation d'une fonction d'intérêt au sein de la bactérie, ou tel qu'un acide nucléique comprenant en outre une séquence activatrice et/ou un terminateur de transcription ; ou ii) à un vecteur, circulaire ou linéaire, simple ou double-brins, par exemple un plasmide, un phage, un cosmide, un chromosome artificiel ou synthétique, comprenant une ou plusieurs cassettes d'expression telles que définies ci-dessus. De manière préférée, le vecteur est un plasmide.

[0027] Les cassettes et vecteurs d'expression peuvent être construits par des techniques classiques bien connues de l'homme du métier et peuvent comporter un(e) ou plusieurs promoteurs, origines de réplication bactérienne (séquences ORI), séquences de terminaison, gènes de sélection, par exemple gènes de résistance à un antibiotique, et séquences (« régions flanquées ») permettant l'insertion ciblée de la cassette ou du vecteur. Par ailleurs, ces cassettes et vecteurs d'expression peuvent être intégrées au sein du génome par des techniques bien connues de l'homme du métier.
Des séquences ORI d'intérêt peuvent être choisies parmi pIP404, pAMβ1, repH (origine de réplication chez C. acetobutylicum), ColE1 ou rep (origine de réplication chez E. coli), ou tout autre origine de réplication permettant le maintien du vecteur, typiquement du plasmide, au sein d'une cellule de Clostridium.
Des séquences de terminaison d'intérêt peuvent être choisies parmi celles des gènes adc, thl, de l'opéron bcs, ou de tout autre terminateur, bien connu de l'homme de l'art, permettant l'arrêt de la transcription au sein de Clostridium.
Des gènes de sélection d'intérêt peuvent être choisis parmi ermB, catP, bla, tetA, tetM, et tout autre gène de résistance à l'ampicilline, à l'érythromycine, au chloramphenicol, au thiamphénicol, à la tétracycline ou à tout autre antibiotique pouvant être utilisé pour sélectionner des bactéries du genre Clostridium bien connu de l'homme de l'art.
Un vecteur particulier comprend une ou plusieurs cassettes d'expression, chaque cassette codant un ARNg.
Dans un mode de réalisation particulier, la description concerne un outil génétique comprenant en tant que « premier » acide nucléique tel qu'identifié dans les revendications un vecteur plasmidique dont la séquence est sélectionnée parmi l'une des séquences SEQ ID NO : 5, SEQ ID NO : 6 et SEQ ID NO : 7.

[0028] Dans un mode de réalisation particulier, la description concerne un outil génétique comprenant en tant que « deuxième » ou « énième » acide nucléique un vecteur plasmidique dont la séquence est sélectionnée parmi l'une des séquences SEQ ID NO : 8, SEQ ID NO : 9, SEQ ID NO : 10 et SEQ ID NO : 11.

[0029] La séquence d'intérêt est introduite dans le génome bactérien via un mécanisme de recombinaison homologue guidé par une matrice de réparation sélectionnée (selon la technologie CRISPR). La séquence d'intérêt vient remplacer la portion ciblée au sein du génome bactérien. Le processus de recombinaison permet ainsi la modification ou la délétion total(le) ou partiel(le) de la portion ciblée au sein du génome de la bactérie ou permet l'insertion de fragments (dans un mode de réalisation particulier de grands fragments) d'acide nucléique dans le génome de la bactérie. La matrice de réparation sélectionnée peut en effet comprendre tout ou partie de la séquence ciblée du génome bactérien ou une version plus ou moins modifiée de celle-ci selon la nature de la transformation souhaitée. Tout comme la portion d'ADN ciblée, la matrice peut ainsi elle-même comprendre une ou plusieurs séquences d'acide nucléique ou portions de séquence d'acide nucléique correspondant à des séquences naturelles et/ou synthétiques, codantes et/ou non codantes. La matrice peut par exemple comprendre une ou plusieurs séquences ou portion(s) de séquences correspondant à un gène essentiel à la survie bactérienne, en particulier à la survie des bactéries du genre Clostridium, ou encore à un ou plusieurs gènes ou séquences d'ADN dont l'inactivation permet la sélection des bactéries du genre Clostridium ayant intégré le/les acides nucléiques d'intérêt. La matrice peut également comprendre une ou plusieurs séquences « étrangères », i.e. naturellement absentes du génome des bactéries appartenant au genre Clostridium ou du génome d'espèces particulières dudit genre. La matrice peut aussi comprendre une combinaison de séquences telles que décrites ci-dessus.
Des exemples particuliers de séquences d'intérêt sont les séquences utilisées dans la partie expérimentale. Il s'agit par exemple des séquences upp_del (SEQ ID NO : 12) et upp_stop (SEQ ID NO : 13).
L'outil génétique selon l'invention permet à la matrice de réparation de guider l'incorporation au sein du génome bactérien des bactéries du genre Clostridium d'un acide nucléique d'intérêt, typiquement d'une séquence ou portion de séquence d'ADN comprenant au moins 1 paire de base (pb), de préférence au moins 1, 2, 3, 4, 5, 10, 15, 20, 50, 100, 1 000, 10 000, 100 000 ou 1 000 000 pb, typiquement entre 1 pb et 20 kb ou entre 1 pb et 10 kb, de préférence entre 10 pb et 20 kb ou entre 10 pb et 10 kb, par exemple entre 1pb et 2 kb.

[0030] Dans un mode de réalisation particulier, la séquence d'ADN d'intérêt code au moins un produit d'intérêt, de préférence un produit favorisant la production de solvant, typiquement au moins une protéine d'intérêt, par exemple une enzyme ; une protéine membranaire tel qu'un transporteur ; un facteur de transcription ; ou une combinaison de ceux-ci.

[0031] Dans un mode de réalisation préféré, la séquence d'ADN d'intérêt favorise la production de solvant et est typiquement sélectionnée parmi une séquence codant pour i) une enzyme, de préférence une enzyme impliquée dans la conversion des aldéhydes en alcool, par exemple sélectionnée parmi une séquence codant pour une alcool déshydrogénase (par exemple une séquence sélectionnée parmi adh, adhE, adhE1, adhE2, bdhA, et bdhB), une séquence codant pour une transférase (par exemple une séquence sélectionnée parmi ctfA, ctfB, atoA et atoB), une séquence codant pour une décarboxylase (par exemple adc), une séquence codant pour une hydrogénase (par exemple une séquence sélectionnée parmi etfA, etfB et hydA), et une combinaison de celles-ci, ii) une protéine membranaire, par exemple une séquence codant pour une phosphotransférase (par exemple une séquence sélectionnée parmi glcG, bglC, cbe4532, cbe4533, cbe4982, cbe4983, cbe0751), et iii) un facteur de transcription (par exemple une séquence sélectionnée parmi sigE, sigF, sigG, sigH, sigK).

[0032] La présente description concerne par ailleurs un procédé pour transformer et/ou modifier génétiquement par recombinaison homologue une bactérie du genre Clostridium, de préférence une bactérie solvantogène du genre Clostridium. Ce procédé comprend une étape d'introduction dans la bactérie d'un outil génétique selon l'invention tel que décrit dans la présente demande. Le procédé peut comprendre en outre une étape d'obtention de la bactérie transformée, i.e. de la bactérie présentant la ou les recombinaisons/optimisations recherchées.

[0033] Un procédé particulier permettant de transformer et/ou modifier génétiquement par recombinaison homologue une bactérie solvantogène du genre Clostridium, comprend, dans l'ordre, les étapes suivantes :
  1. a) l'introduction dans la bactérie d'un outil génétique selon l'invention tel que décrit dans la présente demande comprenant au moins un promoteur inductible, et
  2. b) l'induction de l'expression du promoteur inductible permettant de modifier génétiquement la bactérie.


[0034] L'introduction dans la bactérie des éléments (acides nucléiques ou ARNg) de l'outil génétique décrit par les inventeurs est réalisée par toute méthode, directe ou indirecte, connue de l'homme du métier, par exemple par transformation, conjugaison, microinjection, transfection, electroporation, etc., de préférence par transformation (Lütke-Eversloh, 2014).

[0035] L'étape d'induction lorsqu'elle est nécessaire peut être mise en œuvre par toute méthode connue de l'homme du métier après introduction dans la bactérie cible de l'outil génétique décrit par les inventeurs. Elle est par exemple réalisée par mise en contact de la bactérie avec une substance adéquate, présente en quantité suffisante ou par exposition à la lumière UV. Cette substance permet de lever l'inhibition d'expression liée au promoteur inductible sélectionné. Lorsque le promoteur sélectionné est un promoteur inductible à l'anhydrotétracycline (aTc), choisi parmi Pcm-2tetO1 et Pcm-tetO2/1, l'aTc est de préférence utilisée à une concentration comprise entre environ 1 ng/ml et environ 5000 ng/ml, de préférence entre environ 100 ng par ml et environ 500 ng/ml ou entre environ 200 ng par ml et environ 300 ng/ml, par exemple environ 250 ng/ml.

[0036] Dans un mode de réalisation particulier, le procédé comprend une ou plusieurs étapes additionnelles, postérieures à l'étape b) lorsqu'elle est présente, d'introduction d'un énième, par exemple troisième, quatrième, cinquième, etc., acide nucléique codant i) une matrice de réparation distincte de celle(s) déjà introduite(s) et ii) un ou plusieurs ARN guides permettant leur intégration dans une zone ciblée du génome de la bactérie, chaque étape additionnelle étant de préférence avantageusement précédée d'une étape d'élimination de l'acide nucléique codant la matrice de réparation préalablement introduite, la cellule bactérienne étant alors considérée comme « curée » dudit acide nucléique, et de préférence d'une étape d'élimination du/des ARNs guides ou séquences codant le/les ARNs guides préalablement introduits.

[0037] De manière particulièrement avantageuse et contrairement aux outils disponibles dans l'art antérieur, l'outil génétique décrit par les inventeurs permet l'introduction de séquences d'intérêt de petites tailles aussi bien que de grandes tailles, en une étape, i.e. à l'aide d'un seul acide nucléique (typiquement le « deuxième » acide nucléique tel que décrit dans le présent texte) ou en plusieurs étapes, i.e. à l'aide de plusieurs acides nucléiques (typiquement le « deuxième » et le ou les « énième » acides nucléiques tels que décrits dans le présent texte), de préférence en une étape.
Dans mode de réalisation particulier, ce « énième » acide nucléique permet de supprimer la portion ciblée de l'ADN bactérien ou de la remplacer par une séquence plus courte (par exemple par une séquence délétée d'au moins une paire de bases) et/ou non fonctionnelle. Dans un mode de réalisation particulier préféré, le « deuxième » ou « énième » acide nucléique permet avantageusement d'introduire dans le génome bactérien un acide nucléique d'intérêt comprenant au moins une paire de base, et jusqu'à 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 ou 13 kb.

[0038] Les acides nucléiques d'intérêt peuvent être insérés dans le chromosome bactérien au niveau de régions identiques ou différentes selon les ARNg utilisés, et si cela s'avère utile dans une portion du génome bactérien comprenant un gène essentiel à la survie bactérienne, par exemple l'un des gènes gyrA, pfkA, hydA, crt, thl, hbd, ou tout autre gène connu de l'homme du métier comme essentiel à la survie d'une bactérie du genre Clostridium, et/ou dans un gène ou une séquence ADN dont l'inactivation permet la sélection des bactéries ayant intégré le/les acides nucléiques d'intérêt, par exemple le gène upp.
Grâce à l'outil génétique et au procédé décrits par les inventeurs, il est à présent possible de modifier efficacement (fréquence de recombinaison homologue performante), substantiellement (incorporation possible au sein du génome de la bactérie d'un acide nucléique d'intérêt de grande taille) et de manière stable (le maintien des bactéries transformées en contact avec des antibiotiques n'est pas nécessaire), les bactéries du genre Clostridium de manière à obtenir des bactéries transformées d'intérêt, par exemple des variants améliorés présentant une différence génotypique ou phénotypique par rapport à la bactérie dont elle est issue, typiquement des bactéries exploitables sur le plan industriel, par exemple des bactéries utilisables dans la production de solvants ou biocarburants.

[0039] Un autre objet décrit par les inventeurs concerne une bactérie du genre Clostridium, typiquement une bactérie solvantogène du genre Clostridium, transformée à l'aide du procédé et/ou de l'outil génétique selon l'invention. Une telle bactérie exprime le ou les acides nucléiques d'intérêt introduits dans son génome par recombinaison homologue à l'aide de la matrice de réparation. Une telle bactérie peut comprendre tout ou partie de l'outil génétique décrit par les inventeurs, typiquement Cas9 ou un acide nucléique codant Cas9.
Une bactérie du genre Clostridium particulière selon l'invention, par exemple une bactérie ATCC824, transformée à l'aide du procédé et de l'outil génétique selon l'invention, ne contient plus le mégaplasmide pSOL.
Dans un mode de réalisation particulier, la bactérie du genre Clostridium transformée à l'aide du procédé et de l'outil génétique décrits par les inventeurs, n'est en mesure de produire un ou plusieurs solvants que grâce à l'expression du ou des acides nucléiques d'intérêt introduits volontairement dans son génome.

[0040] La description concerne aussi un kit (trousse) pour transformer et/ou modifier génétiquement une bactérie du genre Clostridium comprenant tout ou partie des éléments de l'outil génétique tels que décrits dans le présent texte, typiquement i) un premier acide nucléique codant Cas9, dans lequel la séquence codant Cas9 est placée sous le contrôle d'un promoteur, et ii) au moins un deuxième acide nucléique codant une matrice de réparation permettant, par un mécanisme de recombinaison homologue, le remplacement d'une portion de l'ADN bactérien ciblée par Cas9 par une séquence d'intérêt, et éventuellement un ou plusieurs inducteurs adaptés au(x) promoteur(s) inductible(s) sélectionné(s) éventuellement utilisé(s) au sein de l'outil.
Un kit particulier permet l'expression d'une protéine Cas9 comprenant une étiquette (ou « tag »).
Les kits selon l'invention peuvent en outre comprendre un ou plusieurs consommables tels qu'un milieu de culture, au moins une bactérie compétente du genre Clostridium (i.e. conditionnée en vue de la transformation), au moins un ARNg, une protéine Cas9, une ou plusieurs molécules de sélection, ou encore une notice explicative.
La description concerne typiquement un kit pour la mise en œuvre du procédé de transformation décrit dans le présent texte ou pour la production de solvant(s) (au moins un solvant) à l'aide d'une bactérie du genre Clostridium.

[0041] La description concerne aussi les utilisations possibles de l'outil génétique, ou du procédé, ou du kit décrit par les inventeurs pour transformer et/ou modifier génétiquement une bactérie du genre Clostridium, typiquement une bactérie solvantogène du genre Clostridium, par exemple pour générer des variants améliorés d'une bactérie du genre Clostridium.
La description concerne enfin les utilisations possibles de l'outil génétique, du procédé, du kit ou d'une bactérie du genre Clostridium transformée comme décrit dans le présent texte, en particulier pour permettre la production de solvants ou biocarburants, ou de mélanges de ceux-ci, typiquement à l'échelle industrielle. Des solvants susceptibles d'être produits sont typiquement l'acétone, le butanol, l'éthanol, l'isopropanol ou un mélange de ceux-ci, typiquement un mélange éthanol/isopropanol, butanol/isopropanol, ou éthanol/butanol, de préférence un mélange isopropanol/butanol.
Dans un mode de réalisation particulier, le ratio du mélange éthanol/isopropanol est au moins égal à 1/4. Ce ratio est de préférence compris entre 1/3 et 1, et est de manière encore plus préférée égal à 1. Dans un mode de réalisation particulier, le ratio du mélange éthanol/butanol est au moins égal à 1/4. Ce ratio est de préférence compris entre 1/3 et 1, et est de manière encore plus préférée égal à 1.
Dans un mode de réalisation particulier, le ratio du mélange isopropanol/butanol est au moins égal à 1/4. Ce ratio est de préférence compris entre 1/3 et 1, et est de manière encore plus préférée égal à 1.

[0042] L'utilisation de bactéries transformées permet typiquement la production par an à l'échelle industrielle d'au moins 100 tonnes d'acétone, d'au moins 100 tonnes d'éthanol, d'au moins 1000 tonnes d'isopropanol, d'au moins 1800 tonnes de butanol, ou d'au moins 40 000 tonnes d'un mélange de ceux-ci.

[0043] Les exemples et figures ci-après ont pour but d'illustrer plus pleinement l'invention sans pour autant en limiter la portée.

FIGURES



[0044] 

Figure 1 : Métabolisme des souches de Clostridium solvantogènes. Les souches ABE produisent de l'acétone, de l'éthanol et du butanol alors que les souches IBE possèdent le gène adh convertissant l'acétone en isopropanol. Modifié de Lee et al., 2012.

Figure 2 : Mode d'action de CRISPR. Mali et al.

Figure 3 : Utilisation de CRISPR-Cas9 pour l'édition de génome. La coupure double brins est réalisée par la nucléase Cas9, dirigée par le gRNA. La réparation de cette coupure par recombinaison homologue permet d'introduire dans le génome les modifications contenues dans la matrice de réparation. Figure modifiée depuis Ann Ran et al., 2013.

Figure 4 : Plasmides de ciblage de upp. pIP404, origine de réplication chez C. acetobutylicum. ColE1, origine de réplication chez E. coli. catP, gène de la chloramphénicol acétyltransférase (gène de résistance au chloramphénicol/thiamphénicol). CDS, coding sequence.

Figure 5 : Plasmide de ciblage de pSOL. pIP404, origine de réplication chez C. acetobutylicum. ColE1, origine de réplication chez E. coli. catP, gène de la chloramphénicol acétyltransférase (gène de résistance au chloramphénicol/thiamphénicol). CDS, coding sequence.

Figure 6 : carte du vecteur pEC500E-miniPthl-Cas9. pAMβ1, origine de réplication chez C. acetobutylicum. rep, origine de réplication chez E. coli. bla, gène de la β-lactamase (résistance à l'ampicilline). ermB, méthylase (résistance à l'érythromycine). CDS, coding sequence.

Figure 7 : séquençage de la zone ciblée par cas9 chez la souche sauvage et chez le transformant obtenu. NC_003030, séquence de Clostridium acetobutylicum ATCC824 (GenBank) ; crRNA, site reconnu par l'ARNg ; PAM, protospacer adjacent motif, intervenant dans la fixation de Cas9. CDS, coding sequence. SEQ ID NO : 22 correspond au fragment de NC_003030 apparaissant sur la Figure 7 and SEQ ID NO : 23 correspond aux fragments apparaissant sur la Figure 7 des séquences identifiées respectivement comme « matrice de réparation upp_stop », « ATCC824 » et « ATCC824 upp- ».

Figure 8 : Résultats d'amplification.

  1. A : catP_fwd x catP_rev (taille attendue : 709pb)
  2. B : RH_ctfB_R x V-CTFA-CAC2707_R (taille attendue : 351pb)
1 : Marqueur 2-Log (NEB). 2 : H 2 0, témoin négatif. 3 : ATCC824 non transformé. 4 : ATCC824 transformé avec pEC500E-miniPthl-cas9. 5 & 6 : ATCC824 transformé avec pEC500E-miniPthl-cas9 et pEC750C (2 transformants indépendants). 7 & 8 :ATCC824 transformé avec pEC500E-miniPthl-cas9 et pEC750C-gRNA_adhE (2 transformants indépendants).

Figure 9 : Détection de l'activité α-amylase des souches dérivées d'ATCC824. 1 : ATCC824 ;
2 : ATCC824 transformé avec pEC500E et pEC750C ; 3 : ATCC824 transformé avec pEC500E-miniPthl-cas9 et pEC750C ; 4 : ATCC824 transformé avec pEC500E et pEC750C-gRNA_adhE ; 5 : ATCC824 transformé avec pEC500E-miniPthl-cas9 et pEC750C-gRNA_adhE

Figure 10 : Bilans fermentaires de la souche sauvage et d'un transformant (deux réplicats techniques).

Figure 11 : A/B. Plasmides d'expression inductible de cas9. repH, origine de réplication chez C. acetobutylicum. ColE1, origine de réplication chez E. coli. ermB, méthylase (résistance à l'érythromycine). tetR, gène codant le répresseur transcriptionnel TetR. CDS, coding sequence.

Figure 12 : Effet de l'induction sur l'expression à partir des promoteurs Pcm-2tetO1 et Pcm-tetO2/1. Les promoteurs ont été placés en aval du gène gusA, et l'activité GusA a été mesurée dans des cellules de C. acetobutylicum ATCC824, en absence ou en présence de 100ng/mL d'aTc. Modifié de Dong et al., 2012.

Figure 13 : Effet de la concentration en aTc sur la viabilité de transformants contenant pEC750C-gRNA_upp.

Figure 14 : Génération de mutants résistants au 5-FU. Des dilutions en série de cultures liquides sont déposées sur différents milieux. Seuls les transformants dans lesquels des événements de recombinaison homologue ont permis l'insertion de la matrice de réparation sont capables de pousser sur 2YTG + 5-FU. Les flèches blanches désignent les colonies sélectionnées pour les expérimentations suivantes. ND, non dilué.

Figure 15 : Analyse des transformants upp_del par PCR.

  1. A. Organisation génétique autour du gène upp. Les sequences codantes sont signalisées par des flèches. Le rectangle gris indique la région absente de la matrice upp_del. Les primers utilisés sont représentés par des triangles. CDS, séquence codante. PAM, protospacer adjacent motif, intervenant dans la fixation de Cas9.
  2. B. Résultats de l'amplification. M : Marqueur 2-Log (NEB). 1 : H 2 0, témoin négatif. 2 : ATCC824 non transformé.
3 : ATCC824 transformé avec pFW0001-Pcm-2tetO1-cas9 et pEC750CgRNA_upp-upp_del avant exposition à l'aTc. 4 & 5 : ATCC824 transformé avec pFW0001-Pcm-2tetO1-cas9 et pEC750CgRNA_upp-upp_del avant exposition à l'aTc, isolé sur 2YTG+5-FU (2 transformants indépendants).

Figure 16 : séquençage de la zone ciblée par cas9 chez les colonies isolées sur 2YTG+5-FU. NC_003030, séquence de Clostridium acetobutylicum ATCC824 (GenBank); crRNA, site reconnu par l'ARNg ; PAM, protospacer adjacent motif, intervenant dans la fixation de Cas9. CDS, coding sequence. SEQ ID NO : 24 correspond au fragment de la séquence génomique de la souche ATCC824 apparaissant sur la Figure 16 and SEQ ID NO : 25 correspond aux fragments apparaissant sur la Figure 16 des séquences identifiées respectivement comme « matrice upp_stop », « clone pFW0001-Pcm-2tetO1-cas9 - pEC750C-gRNA_upp-upp_stop1 » et « clone pFW0001-Pcm-tetO2/1-cas9 - pEC750C-gRNA_upp-upp_stop1 » et «clone pFW0001-Pcm-tetO2/1-cas9 - pEC750C-gRNA_upp-upp_stop2 ».

Figure 17 : Plasmide pEC750C-gRNA_upp-Δupp::ipa8. pIP404, origine de réplication chez C. acetobutylicum. ColE1, origine de réplication chez E. coli. acétyltransférase (gène de résistance au chloramphénicol/thiamphénicol). CDS, coding sequence. RHA/LHA : séquences flanquantes du gène upp (ca_c2879)

Figure 18 : Résultats d'amplification avec les amorces CA_C2877 et CA_C2882. M, marqueur de taille 2-log (NEB). P, pEC750C-gRNA_upp-Δupp::ipa8 ; WT, ATCC 824.

Figure 19 : Production de solvants par ATCC 824 et par les mutants upp_del et Δupp::ipa8. Les barres d'erreurs représentent l'écart-type d'expérimentations réalisées en duplicat. Les données obtenues pour upp_del et Δupp::ipa8 sont les moyennes obtenues pour deux mutants biologiquement indépendants dans chaque cas.

Figure 20 : Mesure de l'activité endoglucanase sur milieu gélosé de différentes souches exprimant les endoglucanase CelA (pWUR3) CelD (pWUR 4) et de la souche contrôle exprimant le plasmide vide. Ces différentes souches sont mises à incuber pendant 48h sur des boites de Pétri contenant 0,2% CMC. Un halo d'hydrolyse révélé par une coloration au rouge Congo caractérise l'activité endoglucanase de chaque souche. Aucun halo n'est détectable sur la souche contrôle alors qu'il est clairement visible dans les souches exprimant les endoglucanases CelA ou CelD.

Figure 21 : Plasmide pSEC500E_X_Cas9. pAMB1, origine de réplication chez C. beijerinckii ; PxylB, promoteur xylB ; ColEl origin, origine de réplication chez E. coli ; AmpR, gène de résistance à l'ampicilline ; PermB, promoteur du gène ermB ; ermB, gène de résistance à l'érythromycine ; 2 micron ori, origine de réplication chez la levure ; URA3, marqueur d'auxotrophie.

Figure 22 : Plasmide pS_celAS1. HS1 et HS2, séquences d'homologie ; aad9, gène de résistance à la spectinomycine ; pCB102, origine de réplication chez C. beijerinckii ; ColE1 origin, origine de réplication chez E. coli. PeglA, promoteur du gène eglA.

Figure 23 : Sélection des souches recombinantes C. beijerinckii NCIMB8052 (pEC500E_Xcas9, pS_celAS1) sur milieu gélosé CGM contenant des concentrations croissantes de xylose.

Figure 24 : Contrôle par PCR de la souche NCIMB8052 et de la souche NCIMB8052 ayant intégrée le gène celA. M, GeneRuler 1kb DNA Ladder (ThermoFisher).


EXEMPLES



[0045] Les inventeurs ont testé l'outil génétique décrit et revendiqué dans le présent texte sur deux cibles : les gènes upp et adhE.

Inactivation du gène upp



[0046] La première cible choisie permet de valider la technique de modification génétique conçue, par un screening simple. Le gène upp code une uracile phosphoribosyltransférase. Cette enzyme permet la formation d'uracile monophosphate (UMP) à partir d'uracile, mais également la formation de 5-fluorouracile monophosphate (5-FUMP), à partir de 5-fluorouracile (5-FU). Le 5-FUMP est un composé toxique pour la cellule qui bloque la synthèse d'ARN. De ce fait, une bactérie contenant dans son génome le gène upp ne pourra pas croître sur un milieu contenant du 5-FU, au contraire d'une souche n'exprimant pas ce gène.
Cibler ce gène permet de déterminer de façon simple et rapide, par simple observation phénotypique, si la stratégie de modification est efficace. Trois plasmides permettant de cibler upp ont été construits (cf. Figure 4 + SEQ ID NO : 9, 10 et 11). Tous trois contiennent le même ARNg ciblant le gène, et deux d'entre eux contiennent également des matrices de réparation différentes permettant de montrer les capacités de l'outil pour réaliser des délétions ou des mutations ponctuelles :
  • La matrice upp_del (SEQ ID NO : 12) contient deux fragments de 500 nucléotides (nt) situés à 150nt de part et d'autre du site de coupure déterminé par l'ARNg. L'utilisation de cette matrice pour réparer la coupure provoque une délétion de 300nt à l'intérieur de la séquence codante du gène upp de sorte que ce dernier codera alors une protéine inactive.
  • La matrice upp_stop (SEQ ID NO : 13)contient deux fragments de 650nt situés de part et d'autre du site de coupure, modifiés au niveau du site de reconnaissance de l'ARNg par la présence de mutations non-sens (induisant le replacement d'un codon codant un acide aminé par un codon stop) de telle manière que Cas9 ne puisse plus cibler le gène qui codera une protéine incomplète et inactive.

Perte du plasmide pSOL



[0047] La deuxième cible choisie présente un intérêt dans le processus de fermentation: l'ensemble des gènes impliqués dans la solvantogénèse, en particulier adhE, est localisé sur le mégaplasmide pSOL, et il a été montré que sa perte abolit la production d'acétone et de butanol. Après avoir supprimé ces voies fermentaires à l'aide du plasmide de ciblage de pSOL (cf. Figure 5), il est possible de réintroduire les gènes d'intérêt directement dans le génome. Afin d'obtenir une souche ne contenant plus pSOL, un plasmide permettant de cibler adhE a été construit. Les inventeurs ont démontré que pSOL ne contient pas de fonctions essentielles pour la cellule de sorte que la cellule pourra survivre sans sa présence.

Expression constitutive de cas9 dans C. acetobutylicum ATCC824



[0048] La stratégie choisie nécessite l'utilisation concomitante de deux plasmides :
  • le vecteur d'expression de la nucléase de manière constitutive, dérivé du plasmide pEC500E : pEC500E-miniPthl-Cas9 (cf. figure 6 + SEQ ID NO : 5) ;
  • l'un des vecteurs de ciblage, qui déterminent le site de coupure de la nucléase et permettent éventuellement la réparation de la coupure, dérivés de pEC750C :
    • pEC750C-gRNA_upp (SEQ ID NO : 9), contenant l'ARNg ciblant upp ;
    • pEC750C-gRNA_upp-upp_del (SEQ ID NO : 10), contenant l'ARNg ciblant upp et la matrice upp_del ;
    • pEC750C-gRNA_upp-upp_stop (SEQ ID NO : 11), contenant l'ARNg ciblant upp et la matrice upp_stop ;
    • pEC750C-gRNA_adhE (SEQ ID NO : 8), contenant l'ARNg ciblant adhE.


[0049] Le vecteur d'expression pEC500E-miniPthl-Cas9 a été introduit dans la souche ATCC824, ainsi qu'un plasmide de contrôle correspondant à un vecteur vide (pEC500E). Les deux souches obtenues ont ensuite été transformées avec les vecteurs de ciblage, dérivés du vecteur pEC750C, servant de contrôle. Les résultats de cette deuxième étape de transformation sont indiqués ci-dessous dans le tableau 1.
Tableau 1 : résultats de transformations. ++, nombreux transformants obtenus (entre 102 et 103 colonies obtenues/transformation) ; -, pas de transformants obtenus.
 pEC750CpEC750C-gRNA_upppEC750 _upp-upp_delpEC750C-gRNA_upp-upp_stoppEC750C-gRNA_adhE
pEC500E ++ ++ ++ ++ ++
pEC500E-miniPthl cas9 ++ - - + ++


[0050] Les résultats de transformation obtenus indiquent que Cas9 est fonctionnel. En effet, lorsque la nucléase est exprimée et que le gène upp est ciblé par l'ARNg, aucun transformant n'est obtenu, en raison de la coupure provoquée dans l'ADN génomique et de l'incapacité de la bactérie à réaliser la réparation du génome (transformation avec pEC500E-miniPthl-cas9 et pEC750C-gRNA_upp) en l'absence de matrice de réparation.

Ciblage de upp



[0051] Les résultats obtenus lorsque les vecteurs de ciblage sont introduits dans la souche contenant pEC500E montrent que le génome de la souche ATCC824 ne contient pas d'homologue de cas9, puisque des transformants sont obtenus avec chaque vecteur de ciblage.

[0052] Un transformant contenant pEC500E-miniPthl-cas9 et pEC750C-gRNA_upp-upp_stop a ensuite été repiqué à plusieurs reprises sur un milieu non sélectif afin qu'il perde les plasmides qu'il contenait. Une fois les colonies curées de leurs plasmides et sensibles aux antibiotiques, le gène upp (SEQ ID NO : 3) a été séquencé (cf. figure 7).

[0053] Les modifications désirées sont bien présentes. L'outil génétique CRISPR-Cas9 comprenant l'introduction de deux plasmides et l'expression du gène cas9 par un promoteur fort et constitutif est donc bien fonctionnel.

Ciblage de adhE



[0054] Des transformants sont obtenus lors des transformations de la souche sauvage avec les plasmides pEC500E-miniPthl-cas9 et pEC750C_gRNA_adhE. Puisque cas9 est actif, ce résultat indique qu'une coupure dans le mégaplasmide pSOL n'affecte pas la viabilité d'ATCC824.

[0055] Afin de confirmer l'éventuelle perte de pSOL, différents tests ont été réalisés :

- Détection par PCR d'un gène présent sur le pSOL : ctfB



[0056] La PCR catP_fwd x catP_rev permet de détecter le gène de résistance au thiamphénicol, présent sur les plasmides pEC750C. Sa détection confirme que les vecteurs de ciblage sont présents.

[0057] La PCR RH_ctfB_R x V-CTFA-CAC2707_R permet de détecter une partie du gène ctfB, présent sur le mégaplasmide pSOL, et permet de savoir si ce dernier est présent dans la cellule.

[0058] L'amplification semble montrer que le mégaplasmide pSOL n'est plus présent chez les clones transformés avec pEC500E-miniPthl-cas9 et pEC750C-gRNA_adhE (cf. figure 8).

- Détection d'une activité enzymatique codée par un gène présent sur le pSOL



[0059] Parmi les gènes contenus sur le mégaplasmide pSOL, amyP code une enzyme extracellulaire à activité α -amylase. Cette activité peut être détectée sur un milieu solide contenant de l'amidon et du glucose (Sabathé et al., 2002). Des dilutions de cultures liquides ont été déposées sur une boîte de gélose contenant 0,2% de glucose et 2% d'amidon et incubées 72h à 37°C. L'activité α-amylase est ensuite révélée par une coloration à l'iode. Les halos clairs autours des spots de bactéries indiquent la présence d'une activité α-amylase. L'absence d'activité autour de ATCC824 contenant pEC500E-miniPthl-cas9 et pEC750C-gRNA_adhE indique que le gène amyP n'est pas exprimé dans cette souche, confirmant que le mégaplasmide n'est plus présent (cf. Figure 9).

- Bilan fermentaire



[0060] La souche sauvage ATCC824 ainsi qu'un transformant ont été cultivés pendant 24h dans un milieu GAPES afin d'établir les bilans fermentaires des deux souches. Le bilan fermentaire obtenu montre une diminution de la production d'éthanol ainsi qu'une abolition de la production de butanol et d'acétate en raison de l'absence des gènes adhE, adhE1 et adc (présents sur le mégaplasmide pSOL) chez le transformant (cf. Figure 10).

[0061] Cas9 est donc capable d'agir sur le chromosome ou sur le plasmide naturel de la souche ATCC824 ce qui permet d'élargir son action au chromosome et à tout matériel génétique extra-chromosomique présent dans la souche (plasmide bactériophage, etc.).

Expression inductible de cas9 dans C. acetobutylicum ATCC824



[0062] Afin de permettre les événements de recombinaison homologue entre le génome et les matrices de réparation, il faut augmenter le nombre de cellules dans lesquelles la nucléase est active (jusqu'à 103 lorsque la souche ATCC824 contenant pEC500E-miniPthl-cas9 est transformée avec un vecteur de ciblage). Dans ce but, un système dans lequel l'expression de la nucléase est contrôlée est nécessaire. Deux vecteurs dans lesquels le gène cas9 est placé sous le contrôle d'un promoteur inductible à l'anhydrotétracycline ont été construits, dérivés du vecteur pFW0001 :
  • pFW0001-Pcm-2tetO1-cas9 (cf. Figure 11A + SEQ ID NO:6);
  • pFW0001-Pcm-tetO2/1-cas9 (cf. Figure 11B + SEQ ID NO:7);
Les promoteurs contrôlant l'expression de cas9 contiennent des séquences opératrices, tetO1 et tetO2, sur lesquelles se fixe le répresseur transcriptionnel TetR. Cette répression est levée par la présence d'anhydrotétracycline (aTc). Ce système permet une expression contrôlée, avec peu de fuites. En présence d'aTc, la synthèse est plus importante à partir du promoteur Pcm-2tetO1 (cf. Figure 12).

Transformation de C. acetobutylicum ATCC824 :



[0063] Les vecteurs d'expression ainsi que le vecteur vide pFW0001 ont été introduits dans ATCC824. Par la suite, les plasmides suivants ont été introduits dans chaque type de transformant (cf. tableau 2) :
  • pEC750C-gRNA_upp, contenant l'ARNg ciblant upp ;
  • pEC750C-gRNA_upp-upp_del, contenant l'ARNg ciblant upp et la matrice upp_del ;
  • pEC750C-gRNA_upp-upp_stop, contenant l'ARNg ciblant upp et la matrice upp_stop ;
Les colonies transformées ont été étalées sur différents milieux solides, à des dilutions différentes :
  • 2YTG + érythromycine pour vérifier la viabilité cellulaire, dilution d'un facteur 106 ;
  • 2YTG + érythromycine + thiamphénicol pour sélectionner les transformants ;
  • 2YTG + érythromycine + thiamphénicol + aTc (200ng/mL) pour sélectionner les transformants en présence de l'inducteur.
Tableau 2 : nombre de colonies obtenues sur chaque type de milieu pour chaque transformation. ery, érythromycine. thiam, thiamphénicol. aTc, anhydrotétracycline. Entre parenthèses, facteurs de dilutions. ND, non dilué. -, non testé.
 pEC750CpEC750C-gRNA_upppEC750C-gRNA-upp-upp_delpEC750C-gRNA_upp-upp_stop
 ery (10-8)ery thiam (ND)ery thiam aTc (ND)ery (10-4)ery thiam (ND)ery thiam aTc (ND)ery (10-6)ery thiam (ND)ery thiam aTc (ND)ery (10-6)ery thiam {ND}ery thiam aTc (ND)
pFW0001 78 26 - 126 83 - 87 12 - 61 13 -
pFW0001-Pcm-2tetO1-cas9 229 129 3 157 27 0 232 5 0 169 7 0
pF-W0001-Pcm-tetO2/1 - cas9 210 400 3 367 130 0 227 21 0 177 18 0


[0064] On observe un effet toxique de l'aTc, puisque peu de transformants sont obtenus lorsqu'il est présent, même lorsque le vecteur de ciblage vide (pEC750C, contrôle) est utilisé. Conformément à ce qui est attendu, aucun transformant n'est obtenu lorsqu'un pEC750C contenant la cassette gRNA_upp est introduite dans une cellule exprimant cas9, sur un milieu contenant de l'aTc. En revanche, de nombreux transformants sont obtenus pour chaque combinaison de plasmides sur milieu sans aTc, indiquant que cas9 n'est pas exprimée.

Expression de cas9 en présence d'aTc :



[0065] Les différents transformants obtenus sur boîtes contenant de l'érythromycine et du thiamphénicol ont été repiqués sur le même type de milieu, puis utilisés pour ensemencer des précultures liquides contenant les deux antibiotiques. Ces précultures ont ensuite été utilisées pour ensemencer d'autres cultures liquides contenant des concentrations variables d'aTc afin de déterminer si le système est fonctionnel.

Induction de cas9 :



[0066] Trois transformants ont été utilisés pour analyser la capacité d'induction de l'expression de cas9 en présence d'aTc :

ATCC824 contenant pFW0001 et pEC750C-gRNA_upp ;

ATCC824 contenant pFW0001-Pcm-2tetO1-cas9 et pEC750C-gRNA_upp ;

ATCC824 contenant pFW0001-Pcm-tetO2/1-cas9 et pEC750C-gRNA_upp ;

Des milieux liquides contenant de l'érythromycine, du thiamphénicol et des concentrations croissantes d'aTc ont été ensemencés à partir de précultures liquides de ces transformants (cf. figure 13). La capacité de croissance des cellules est évaluée par mesure des densités optiques après 72h de culture. Le transformant n'exprimant pas la nucléase n'est pas ou peu affecté par la présence d'aTc. En revanche, même à des faibles concentrations d'aTc, le transformant contenant le plasmide exprimant cas9 via le promoteur Pcm-2tetO1 (pFW0001-Pcm-2tetO1-cas9) et le plasmide contenant uniquement le gRNA (pEC750C-gRNA_upp) présentent un important retard de croissance. Le transformant contenant le plasmide exprimant cas9 via le promoteur Pcm-tetO2/1 (pFW0001-Pcm-tetO2/1-cas9) et le plasmide contenant uniquement le gRNA (pEC750C-gRNA_upp) n'est pas affecté à de faibles concentrations d'aTc. Cependant, à
partir de 150 ng/mL un fort retard de croissance est observée, et aucune croissance n'est observée à 300ng/mL. Le promoteur Pcm-tetO2/1 semble donc permettre une meilleure répression de l'expression que Pcm-2tetO1 en absence d'inducteur.

Génération de mutants



[0067] Des cultures liquides des transformants contenant les plasmides de ciblage permettant la réparation des cassures double brin ont également été réalisées, en absence ou en présence (100ng/mL) d'aTc. Les transformants utilisés contenaient l'une des douze combinaisons de plasmides apparaissant dans le tableau 3.
Tableau 3 : Combinaisons de plasmides présents dans les transformants.
Plasmide d'expression Plasmides de ciblage
pFW0001   pEC750C
pFW0001-Pcm-2tetO1-cas9 x pEC750C-gRNA_upp
pFW0001-Pcm-tetO2/1-cas9   pEC750C-gRNA_upp-upp_del
    pEC750C-gRNA_upp-upp_stop


[0068] Après 72h de culture, des aliquots ont été déposés sur différents milieux solides:
  • 2YTG contenant du thiamphénicol et de l'érythromycine ;
  • 2YTG contenant du thiamphénicol, de l'érythromycine, et 100ng/mL d'aTc ;
  • 2YTG contenant du 5-fluorouracile.
Seuls les transformants dans lesquels des événements de recombinaison homologue ont permis l'insertion de la matrice de réparation sont capables de pousser sur 2YTG + 5-FU (cf. figure 14).

Analyse des transformants upp_del :



[0069] Les clones isolés sur 2YTG + 5-FU ont été analysés par PCR (cf. figure 15).
La PCR catP_fwd x catP_rev permet de détecter le gène de résistance au thiamphénicol, présent sur les plasmides pEC750C. Sa détection confirme que les vecteurs de ciblage sont présents.
La PCR LHA_upp_fwd x RHA_upp_rev permet d'amplifier le gène upp ainsi que les régions flanquantes. Les amorces apparaissant ci-dessous ont servi à la construction de la matrice de réparation upp_del (cf. figure 15 + SEQ ID N0 : 14-21) :
Tableau n°4 :
NomSéquence (5'-3')
catP_fwd GTGGGCAAGTTGAAAAATTCAC
catP_rev TTAACTATTTATCAATTCCTGCAATTCG
RH_ctfB_R CTTGAGACTTTGCCGTGAGGG
V_ctfA_CAC2707_R TAGTTGGAATGGGCGCTAGT
LHA_upp_fwd ATGAAGATAGCAATAGGTAGTGATCATGC
RHA_upp_rev ACGCTTATATTATCAATATTATTTAGCTTTATAG
upp_matrice_fwd TGTCCAACCTTAGCAGCAGG
upp_matrice_rev GTAGAAGAAGTAGCAATGCTAATGGC


[0070] La PCR upp_matrice_fwd x upp_matrice_rev permet d'amplifier un fragment interne du gène upp, absent de la matrice de réparation upp_del.
Les résultats obtenus confirment la délétion à l'intérieur du gène upp dans les transformants analysés.

Analyse des mutants upp_stop :



[0071] Le gène upp a été séquencé chez trois clones isolés sur 2YTG+5-FU après exposition à l'aTc (cf. Figure 16) :
  • Un contenant le plasmide exprimant cas9 via le promoteur Pcm-2tetO1 (pFW0001-Pcm-2tetO1-cas9) et le plasmide contenant le gRNA ainsi que la matrice de réparation upp_stop (pEC750CgRNA_upp-upp_stop) ;
  • Deux contenant le plasmide exprimant cas9 via le promoteur Pcm-tetO2/1 (pFW0001-Pcm-tetO2/1-cas9) et le plasmide contenant le gRNA ainsi que la matrice de réparation upp_stop (pEC750CgRNA_upp-upp_stop).


[0072] La stratégie visant à développer un système de modification génétique par l'utilisation du gène cas9 sous contrôle d'un promoteur inductible et du gRNA présent dans un second plasmide est donc fonctionnelle. Par rapport à l'utilisation du promoteur constitutif miniPthl, l'induction du gène cas9 permet de maîtriser l'action de l'enzyme et de faciliter la sélection de transformants ayant subis les modifications souhaitées.

Remplacement du gène upp par l'opéron ipa8



[0073] La modification apportée consiste en l'insertion au sein du génome de C. acetobutylicum ATCC 824 de l'opéron ipa8 contenant le gène adh de C. beijerinckii DSM6423 (permettant la conversion d'acétone en isopropanol) et les gènes adc, ctfA, ctfB de la souche ATCC 824 (permettant la ré-assimilation des acides produits et la formation d'acétone) sous contrôle du promoteur constitutif du gène thl. Cet opéron de 3614 pb est inséré à la place du gène upp.

[0074] Une matrice de réparation constituée de l'opéron flanqué des séquences de 1 kb situées de part et d'autre du gène upp a été insérée dans le plasmide pEC750-gRNA_upp pour obtenir le plasmide pEC750C-gRNA_upp-Δupp::ipa8 (cf. Figure 17 et SEQ ID NO : 26).

[0075] Ce plasmide a été introduit dans des cellules compétentes d'ATCC 824 contenant le plasmide pFW0001-Pcm-tetO2/1-cas9. L'induction de l'expression de cas9 a été effectuée sur milieu 2YTG contenant du thiamphénicol, de l'érythromycine, et l'inducteur aTc.

[0076] Les colonies obtenues ont été analysées par PCR avec le couple d'amorces CA_C2877 et CA_C2882 qui permet l'amplification d'un produit de 2720 pb chez la souche ATCC 824 :

CA_C2877 : 5'-CTTTTTAAAAAAGTTAAATAAGGAAGG-3' (SEQ ID NO : 27);

CA_C2882 : 5'-GTTTAACTTAAGTTACAGAAAAGCTAGG-3' (SEQ ID NO : 28)

Les résultats de PCR conduites sur les différents contrôles et sur 4 colonies indépendantes obtenues après induction confirment le remplacement du gène upp par l'opéron ipa8 (Figure 18).

[0077] Des fermentations ont été conduites dans du milieu GAPES (Gapes et al, 1996) pendant 72h à 34°C et 150 rpm sur les mutants obtenus, ainsi que sur la souche WT et des mutants Δupp utilisés comme contrôles. Les surnageants de fermentations ont été analysés par HPLC en utilisant une solution de propanol à 0,5 g/L comme standard interne. Les concentrations en carbohydrates ont été quantifiées sur colonne Aminex®HXP-87P (Biorad, 300 mm X 7.8 mm) équipée d'un réfracteur différentiel (Varian 350 RI). La température de colonne était de 80°C et l'éluent consistait en de l'acide sulfurique à un débit de 0,4 mL/min (Spectra System RI 150).
Les résultats obtenus montrent que les mutants Δupp::ipa8 sont capables de réduire l'acétone en isopropanol, au contraire de la souche WT ou d'un mutant Δupp (Figure 19).

Insertion du gène celA dans le génome de Clostridium beijerinckii NCIMB8052



[0078] La modification apportée consiste en l'insertion au sein du génome de C. beijerinckii NCIMB8052 du gène celA de Neocallismatix patriciarum sous contrôle du promoteur eglA de Clostridium saccharobutylicum NCP262. Ce gène code une enzyme capable de dégrader un substrat cellulosique nommé CMC (carboxymethyl cellulose). Le gène et son promoteur, d'une taille de 1667 pb, sont insérés après le gène hbd, et permettent à la souche de dégrader le composé CMC (Figure 20, Lopez-contreras et al, 2001).
Pour réaliser cette insertion, deux plasmides ont été utilisés :
  • le plasmide pEC500E_X_cas9 : exprimant le gène cas9 sous contrôle du promoteur inductible xylB de Clostridium difficile 630 (Nariya et al, 2011) (cf. Figure 21 et SEQ ID NO : 29).
  • le plasmide pS_XR_celAS1 exprimant un ARN guide sous le contrôle du promoteur xylB et ciblant le gène hbd de C. beijerinckii NCIMB8052. Le plasmide contient également une matrice de réparation constituée du gène celA sous contrôle du promoteur egl2, flanqué de deux régions d'homologie de 1001 et 1017 paires de base situées de part et d'autre de la région ciblée par l'ARN guide. (cf. Figure 22 et SEQ ID NO : 30).


[0079] Ces deux plasmides ont été introduits séquentiellement dans NCIMB8052. L'induction de l'expression de cas9 a été effectuée sur milieu CGM (Extrait de levure 6,25 g/L ; MgSO4, 7H2O 0,5 g/L ; KH2HPO4 0,95 g/L ; K2HPO4 0,95 g/L ; MnSO4, 7H2O 0,013 g/L ; FeSO4, 7H2O 0,013 g/L ; NaCl 1,25 g/L ; (NH4)2SO4 2,5 g/L ; Asparagine 2,5 g/L) contenant de la spectinomycine et de l'erythromycine ainsi que des concentrations croissantes d'inducteur xylose (Figure 24).
Les colonies obtenues après induction sur milieu CGM contenant 6% xylose ont été analysées par PCR avec le couple d'amorces Cbei_325_F et Cbei_325_R qui permet l'amplification d'un produit de 2070 paires de base chez la souche NCIMB8052 et de 3718 paires de base en cas d'intégration du gène celA :
Cbei_325_F (celA) 5' - AGATAATTATGAAGTTAATCCTTAG - 3' (SEQ ID NO : 31)
Cbei_326_R (celA) 5' - CATTTGCTTTCAGGTCTTCTTTTGCTG -3'(SEQ ID NO : 32)
Les résultats de PCR conduites sur la souche contrôle et sur une colonie indépendante obtenue après induction confirment l'insertion du gène celA dans NCIMB8052 (Figure 25).

REFERENCES



[0080] 

SEQUENCE LISTING



[0081] 

<110> IFP Energies Nouvelles

<120> OUTIL GENETIQUE DE TRANSFORMATION DE BACTERIES CLOSTRIDIUM

<130> B2115PC00

<160> 32

<170> PatentIn version 3.5

<210> 1
<211> 1368
<212> PRT
<213> Streptococcus pyogenes

<400> 1











<210> 2
<211> 4107
<212> DNA
<213> Streptococcus pyogenes

<400> 2







<210> 3
<211> 630
<212> DNA
<213> clostridium

<400> 3

<210> 4
<211> 2589
<212> DNA
<213> clostridium

<400> 4





<210> 5
<211> 10469
<212> DNA
<213> Artificial Sequence

<220>
<223> plasmide

<400> 5











<210> 6
<211> 8876
<212> DNA
<213> Artificial Sequence

<220>
<223> plasmide

<400> 6











<210> 7
<211> 8874
<212> DNA
<213> Artificial Sequence

<220>
<223> plasmide

<400> 7











<210> 8
<211> 4938
<212> DNA
<213> Artificial Sequence

<220>
<223> plasmide

<400> 8







<210> 9
<211> 4938
<212> DNA
<213> Artificial Sequence

<220>
<223> plasmide

<400> 9







<210> 10
<211> 5911
<212> DNA
<213> Artificial Sequence

<220>
<223> plasmide

<400> 10







<210> 11
<211> 6217
<212> DNA
<213> Artificial Sequence

<220>
<223> plasmide

<400> 11







<210> 12
<211> 1002
<212> DNA
<213> Artificial Sequence

<220>
<223> upp_del

<400> 12

<210> 13
<211> 1306
<212> DNA
<213> Artificial Sequence

<220>
<223> upp_stop

<400> 13



<210> 14
<211> 22
<212> DNA
<213> Artificial Sequence

<220>
<223> amorce

<400> 14
gtgggcaagt tgaaaaattc ac   22

<210> 15
<211> 28
<212> DNA
<213> Artificial Sequence

<220>
<223> amorce

<400> 15
ttaactattt atcaattcct gcaattcg   28

<210> 16
<211> 21
<212> DNA
<213> Artificial Sequence

<220>
<223> amorce

<400> 16
cttgagactt tgccgtgagg g   21

<210> 17
<211> 20
<212> DNA
<213> Artificial Sequence

<220>
<223> amorce

<400> 17
tagttggaat gggcgctagt   20

<210> 18
<211> 29
<212> DNA
<213> Artificial Sequence

<220>
<223> amorce

<400> 18
atgaagatag caataggtag tgatcatgc   29

<210> 19
<211> 34
<212> DNA
<213> Artificial Sequence

<220>
<223> amorce

<400> 19
acgcttatat tatcaatatt atttagcttt atag   34

<210> 20
<211> 20
<212> DNA
<213> Artificial Sequence

<220>
<223> amorce

<400> 20
tgtccaacct tagcagcagg   20

<210> 21
<211> 26
<212> DNA
<213> Artificial Sequence

<220>
<223> amorce

<400> 21
gtagaagaag tagcaatgct aatggc   26

<210> 22
<211> 62
<212> DNA
<213> Clostridium acetobutylicum

<400> 22

<210> 23
<211> 62
<212> DNA
<213> Artificial Sequence

<220>
<223> fragment upp_stop fig7

<400> 23

<210> 24
<211> 86
<212> DNA
<213> Clostridium acetobutylicum

<400> 24

<210> 25
<211> 86
<212> DNA
<213> Artificial Sequence

<220>
<223> fragment upp_stop fig16

<400> 25

<210> 26
<211> 10537
<212> DNA
<213> Artificial Sequence

<220>
<223> plasmide

<400> 26













<210> 27
<211> 27
<212> DNA
<213> Artificial Sequence

<220>
<223> amorce

<400> 27
ctttttaaaa aagttaaata aggaagg   27

<210> 28
<211> 28
<212> DNA
<213> Artificial Sequence

<220>
<223> amorce

<400> 28
gtttaactta agttacagaa aagctagg   28

<210> 29
<211> 12849
<212> DNA
<213> Artificial Sequence

<220>
<223> plasmide

<400> 29













<210> 30
<211> 9367
<212> DNA
<213> Artificial Sequence

<220>
<223> plasmide

<400> 30









<210> 31
<211> 25
<212> DNA
<213> Artificial Sequence

<220>
<223> amorce

<400> 31
agataattat gaagttaatc cttag   25

<210> 32
<211> 27
<212> DNA
<213> Artificial Sequence

<220>
<223> amorce

<400> 32
catttgcttt caggtcttct tttgctg   27




Revendications

1. Outil génétique permettant la transformation par recombinaison homologue d'une bactérie solvantogène du genre Clostridium caractérisé en ce qu'il comprend :

- un premier acide nucléique codant au moins Cas9, dans lequel la séquence codant Cas9 est placée sous le contrôle d'un promoteur, et

- au moins un deuxième acide nucléique contenant une matrice de réparation permettant, par un mécanisme de recombinaison homologue, le remplacement d'une portion de l'ADN bactérien ciblée par Cas9 par une séquence d'intérêt,

en ce que i) au moins l'un desdits acides nucléiques code en outre un ou plusieurs ARN guides (ARNg) ou ii) l'outil génétique comprend en outre un ou plusieurs ARN guides, chaque ARN guide comprenant une structure ARN de fixation à l'enzyme Cas9 et une séquence complémentaire de la portion ciblée de l'ADN bactérien, ladite séquence complémentaire comprenant au moins 10 nucléotides, en ce que Cas9 provoque la coupure double-brins de l'ADN bactérien, en ce que l'ADN bactérien est l'ADN d'une bactérie solvantogène du genre Clostridium, et en ce que chacun des premier et deuxième acides nucléiques présents au sein de l'outil appartient à un vecteur distinct.
 
2. Outil selon la revendication 1, caractérisé en ce que la séquence codant le ou lesdits ARN guides est précédée d'un promoteur et en ce que ledit promoteur ou le promoteur contrôlant Cas9 est un promoteur inductible.
 
3. Outil selon la revendication 1 ou 2, caractérisé en ce que la portion ciblée de l'ADN bactérien comprend un gène essentiel ou une portion de gène essentielle à la survie bactérienne.
 
4. Outil selon l'une des revendications 1 à 3, caractérisé en ce que la bactérie solvantogène du genre Clostridium est sélectionnée parmi C. acetobutylicum, C. cellulolyticum, C. phytofermentans, C. beijerinckii, C. saccharobutylicum, C. saccharoperbutylacetonicum, C. sporogenes, C. butyricum, C. aurantibutyricum et C. tyrobutyricum.
 
5. Outil selon la revendication 4, caractérisé en ce que lorsque la bactérie solvantogène est C. acetobutylicum ladite bactérie C. acetobutylicum est la souche ATCC824, et lorsque la bactérie solvantogène est C. beijerinckii ladite bactérie C. beijerinckii est la souche DSM 6423.
 
6. Outil selon l'une des revendications 1 à 5, caractérisé en ce que la protéine Cas9 comprend la séquence SEQ ID NO : 1.
 
7. Outil selon l'une des revendications 1 à 6, caractérisé en ce que le promoteur de Cas9 est un promoteur inductible.
 
8. Outil selon l'une des revendications 1 à 7, caractérisé en ce que la séquence d'ADN d'intérêt code au moins un produit favorisant la production de solvant, typiquement au moins une enzyme impliquée dans la conversion des aldéhydes en alcool, une protéine membranaire, un facteur de transcription, ou une combinaison de ceux-ci.
 
9. Outil selon l'une des revendications 1 à 8, caractérisé en ce que le vecteur est un plasmide.
 
10. Procédé pour transformer par recombinaison homologue une bactérie solvantogène du genre Clostridium, caractérisé en ce qu'il comprend une étape d'introduction dans la bactérie d'un outil génétique selon l'une des revendications 1 à 9.
 
11. Procédé selon la revendication 10, caractérisé en ce qu'il comprend les étapes suivantes :

a) l'introduction dans la bactérie d'un outil génétique selon l'une des revendications 1 à 8 comprenant au moins un promoteur inductible, et

b) l'induction de l'expression du promoteur inductible permettant de modifier génétiquement la bactérie.


 
12. Procédé selon la revendication 10 ou 11, caractérisé en ce qu'il comprend une ou plusieurs étapes additionnelles, postérieures à l'étape b) lorsqu'elle est présente, d'introduction d'un énième acide nucléique codant i) une matrice de réparation distincte de celle(s) déjà introduite(s) et ii) un ou plusieurs ARN guides permettant leur intégration dans une zone ciblée du génome de la bactérie, chaque étape additionnelle étant précédée d'une étape d'élimination de l'acide nucléique codant la matrice de réparation préalablement introduite, et de préférence d'élimination du/des ARNs guides ou séquences codant le/les ARNs guides préalablement introduits.
 
13. Bactérie solvantogène du genre Clostridium transformée à l'aide du procédé selon l'une des revendications 10 à 12.
 
14. Kit pour transformer une bactérie du genre Clostridium ou pour produire au moins un solvant à l'aide d'une bactérie du genre Clostridium comprenant les éléments de l'outil génétique tels que décrits dans l'une des revendications 1 à 9 et éventuellement un ou plusieurs inducteurs adaptés au(x) promoteur(s) inductible(s) sélectionné(s) utilisé(s) au sein de l'outil.
 
15. Utilisation de l'outil génétique selon l'une des revendications 1 à 9, du procédé selon l'une des revendications 10 à 12, ou d'une bactérie transformée selon la revendication 13, pour permettre la production d'un solvant ou d'un mélange de solvants à l'échelle industrielle, de préférence d'acétone, de butanol, d'éthanol, d'isopropanol ou d'un mélange de ceux-ci, typiquement d'un mélange isopropanol/butanol.
 


Ansprüche

1. Genetisches Werkzeug, das die Transformation eines lösemittelproduzierenden Bakteriums der Gattung Clostridium mittels homologer Rekombination erlaubt, dadurch gekennzeichnet, dass es umfasst:

- eine erste Nukleinsäure, die wenigstens Cas9 codiert, wobei die Cas9-codierende Sequenz unter der Kontrolle eines Promotors steht, und

- wenigstens eine zweite Nukleinsäure, die ein Repair-Template enthält, das mithilfe eines homologen Rekombinationsmechanismus das Ersetzen eines Abschnitts der Cas9-gerichteten bakteriellen DNA durch eine Sequenz von Interesse erlaubt,

dass i) wenigstens eine der besagten Nukleinsäuren außerdem eine oder mehrere guide-RNAs (gRNAs) codiert oder ii) das genetische Werkzeug außerdem ein oder mehrere guide-RNAs umfasst, wobei jede guide-RNA eine Cas9-Enzym-bindende RNA-Struktur und eine komplementäre Sequenz des gerichteten Abschnitts der bakteriellen DNA umfasst, wobei besagte komplementäre Sequenz wenigstens 10 Nukleotide umfasst,
dass Cas9 das Schneiden der doppelsträngigen bakteriellen DNA bewirkt, dass die bakterielle DNA eine DNA eines lösemittelproduzierenden Bakteriums der Gattung Clostridium ist und dass jede der ersten und zweiten Nukleinsäuren, die im Werkzeug vorhanden sind, zu einem unterschiedlichen Vektor gehört.
 
2. Werkzeug gemäß Anspruch 1, dadurch gekennzeichnet, dass der Sequenz, die eine oder mehrere besagte guide-RNAs codiert, ein Promotor vorausgeht und dass besagter Promotor oder der Cas9-kontrollierende Promotor ein induzierbarer Promotor ist.
 
3. Werkzeug gemäß Anspruch 1 oder 2, dadurch gekennzeichnet, dass der gerichtete Abschnitt der bakteriellen DNA ein für das Überleben des Bakteriums essentielles Gen oder einen Abschnitt eines essentiellen Gens umfasst.
 
4. Werkzeug gemäß einem der Ansprüche 1 bis 3, dadurch gekennzeichnet, dass das lösemittelproduzierende Bakterium der Gattung Clostridium aus C. acetobutylicum, C. cellulolyticum, C. phytofermentans, C. beijerinckii, C. saccharobutylicum, C. saccharoperbutylacetonicum, C. sporongenes, C. butyricum, C. aurantibutyricum und C. tyrobutyricum ausgewählt ist.
 
5. Werkzeug gemäß Anspruch 4, dadurch gekennzeichnet, dass, wenn das lösemittelproduzierende Bakterium C. acetobutylicum ist, besagtes Bakterium C. acetobutylicum Stamm ATCC824 ist, und wenn das lösemittelproduzierende Bakterium C. beijerinckii ist, besagtes Bakterium C. beijerinckii Stamm DSM 6423 ist.
 
6. Werkzeug gemäß einem der Ansprüche 1 bis 5, dadurch gekennzeichnet, dass das Cas9-Protein die Sequenz SEQ ID NO: 1 umfasst.
 
7. Werkzeug gemäß einem der Ansprüche 1 bis 6, dadurch gekennzeichnet, dass der Cas9-Promotor ein induzierbarer Promotor ist.
 
8. Werkzeug gemäß einem der Ansprüche 1 bis 7, dadurch gekennzeichnet, dass die DNA-Sequenz von Interesse wenigstens ein Produkt codiert, das die Produktion des Lösemittels fördert, üblicherweise wenigstens ein Enzym, das an der Umwandlung von Aldehyden in Alkohol beteiligt ist, ein Membranprotein, einen Transkriptionsfaktor oder eine Kombination davon.
 
9. Werkzeug gemäß einem der Ansprüche 1 bis 8, dadurch gekennzeichnet, dass der Vektor ein Plasmid ist.
 
10. Verfahren zur Transformation eines lösemittelproduzierenden Bakteriums der Gattung Clostridium mittels homologer Rekombination, dadurch gekennzeichnet, dass es einen Schritt der Einführung in das Bakterium eines genetischen Werkzeuges gemäß einem der Ansprüche 1 bis 9 umfasst.
 
11. Verfahren gemäß Anspruch 10, dadurch gekennzeichnet, dass es die folgenden Schritte umfasst:

a) Einführung in das Bakterium eines genetischen Werkzeuges gemäß einem der Ansprüche 1 bis 8, das wenigstens einen induzierbaren Promotor umfasst, und

b) Induktion der Expression des induzierbaren Promotors zur genetischen Veränderung des Bakteriums.


 
12. Verfahren gemäß Anspruch 10 oder 11, dadurch gekennzeichnet, dass es nach Schritt b), sofern vorhanden, einen oder mehrere zusätzliche Schritte der Einführung einer weiteren Nukleinsäure umfasst, codierend i) ein Repair-Template, das sich von dem oder den bereits eingeführten Repair-Templates unterscheidet, und ii) ein oder mehrere guide-RNAs, die ihre Integration in eine gerichtete Zone des bakteriellen Genoms erlauben, wobei jedem zusätzlichen Schritt ein Schritt der Entfernung der Nukleinsäure, die das zuvor eingeführte Repair-Template codiert, und vorzugsweise der Entfernung der guide-RNA oder guide-RNAs oder Sequenzen vorausgeht, die die zuvor eingeführte guide-RNA oder eingeführten guide-RNAs codieren.
 
13. Lösemittelproduzierendes Bakterium der Gattung Clostridium, transformiert mithilfe des Verfahrens gemäß einem der Ansprüche 10 bis 12.
 
14. Kit zur Transformation eines Bakteriums der Gattung Clostridium oder zur Produktion wenigstens eines Lösemittels mithilfe eines Bakteriums der Gattung Clostridium, umfassend die Elemente des genetischen Werkzeuges wie in einem der Ansprüche 1 bis 9 beschrieben und gegebenenfalls ein oder mehrere Induktoren, die für den oder die im Werkzeug verwendeten ausgewählten induzierbaren Promotoren geeignet sind.
 
15. Verwendung des genetischen Werkzeuges gemäß einem der Ansprüche 1 bis 9, des Verfahrens gemäß einem der Ansprüche 10 bis 12 oder eines Bakteriums, transformiert gemäß Anspruch 13, um die Produktion eines Lösemittels oder einer Mischung von Lösemitteln in industriellem Maßstab, vorzugsweise Aceton, Butanol, Ethanol, Isopropanol oder einer Mischung davon, üblicherweise einer Isopropanol/Butanol-Mischung zu erlauben.
 


Claims

1. A genetic tool allowing the transformation by homologous recombination of a solvent-forming bacterium of the genus Clostridium, characterized in that it comprises:

- a first nucleic acid encoding at least Cas9, wherein the sequence encoding Cas9 is placed under the control of a promoter, and

- at least one second nucleic acid containing a repair matrix allowing, by a homologous recombination mechanism, the replacement of a portion of the bacterial DNA targeted by Cas9 by a sequence of interest,

in that i) at least one of said nucleic acids further encodes one or more guide RNAs (gRNAs) or ii) the genetic tool further comprises one or more guide RNAs, each guide RNA comprising a Cas9 enzyme binding RNA structure and a sequence complementary to the targeted portion of the bacterial DNA, said complementary sequence comprising at least 10 nucleotides,
in that Cas9 causes double-stranded cleavage of the bacterial DNA, in that the bacterial DNA is the DNA of a solvent-forming bacterium of the genus Clostridium, and
in that each of the first and second nucleic acids present in the tool belongs to a distinct vector.
 
2. The tool as claimed in claim 1, characterized in that the sequence encoding the said guide RNA(s) is preceded by a promoter and in that the said promoter or the promoter controlling Cas9 is an inducible promoter.
 
3. The tool as claimed in claim 1 or 2, characterized in that the targeted portion of the bacterial DNA comprises an essential gene or gene portion essential for bacterial survival.
 
4. The tool as claimed in one of claims 1 to 3, characterized in that the solvent-forming bacterium of the genus Clostridium is selected from C. acetobutylicum, C. cellulolyticum, C. phytofermentans, C. beijerinckii, C. saccharobutylicum, C. saccharoperbutylacetonicum, C. sporogenes, C. butyricum, C. aurantibutyricum and C. tyrobutyricum.
 
5. The tool as claimed in claim 4, characterized in that when the solvent-forming bacterium is C. acetobutylicum said C. acetobutylicum bacterium is strain ATCC824, and when the solvent-forming bacterium is C. beijerinckii said C. beijerinckii bacterium is strain DSM 6423.
 
6. The tool as claimed in one of claims 1 to 5, characterized in that the Cas9 protein comprises the sequence SEQ ID NO: 1.
 
7. The tool as claimed in one of claims 1 to 6, characterized in that the Cas9 promoter is an inducible promoter.
 
8. The tool as claimed in one of claims 1 to 7, characterized in that the DNA sequence of interest encodes at least one solvent-producing product, typically at least one enzyme involved in the conversion of aldehydes to alcohol, a membrane protein, a transcription factor, or a combination thereof.
 
9. The tool as claimed in one of claims 1 to 8, characterized in that the vector is a plasmid.
 
10. A process for transforming by homologous recombination a solvent-forming bacterium of the genus Clostridium, characterized in that it comprises a step of introducing into the bacterium a genetic tool as claimed in one of claims 1 to 9.
 
11. The process as claimed in claim 10, characterized in that it comprises the following steps:

a) introduction into the bacterium of a genetic tool as claimed in one of claims 1 to 8 comprising at least one inducible promoter, and

b)induction of the expression of the inducible promoter enabling the bacterium to be genetically modified.


 
12. The process as claimed in claim 10 or 11, characterized in that it comprises one or more additional steps, subsequent to step b) when it is present, of introduction of an nth nucleic acid encoding i) a repair matrix distinct from the one(s) already introduced and ii) one or more guide RNAs allowing their integration into a targeted zone of the genome of the bacterium, each additional step being preceded by a step of removal of the nucleic acid encoding the previously introduced repair matrix, and preferably of removal of the guide RNA(s) or sequences encoding the previously introduced guide RNA(s).
 
13. A solvent-forming bacterium of the genus Clostridium transformed by the process as claimed in one of claims 10 to 12.
 
14. A kit for transforming a bacterium of the genus Clostridium or for producing at least one solvent using a bacterium of the genus Clostridium comprising the elements of the genetic tool as described in one of claims 1 to 9 and optionally one or more inductors adapted to the selected inducible promoter(s) used within the tool.
 
15. Use of the genetic tool as claimed in one of claims 1 to 9, of the process as claimed in one of claims 10 to 12, or of a transformed bacterium as claimed in claim 13, for the production of a solvent or solvent mixture on an industrial scale, preferably acetone, butanol, ethanol, isopropanol or a mixture thereof, typically an isopropanol/butanol mixture.
 




Dessins











































































RÉFÉRENCES CITÉES DANS LA DESCRIPTION



Cette liste de références citées par le demandeur vise uniquement à aider le lecteur et ne fait pas partie du document de brevet européen. Même si le plus grand soin a été accordé à sa conception, des erreurs ou des omissions ne peuvent être exclues et l'OEB décline toute responsabilité à cet égard.

Littérature non-brevet citée dans la description