(19)
(11)EP 3 725 371 A1

(12)EUROPEAN PATENT APPLICATION

(43)Date of publication:
21.10.2020 Bulletin 2020/43

(21)Application number: 19170231.5

(22)Date of filing:  18.04.2019
(51)International Patent Classification (IPC): 
A61P 31/00(2006.01)
C12N 15/62(2006.01)
A61K 39/095(2006.01)
A61K 39/104(2006.01)
A61P 35/00(2006.01)
A61K 39/108(2006.01)
A61K 39/112(2006.01)
(84)Designated Contracting States:
AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR
Designated Extension States:
BA ME
Designated Validation States:
KH MA MD TN

(71)Applicant: BiOMVis Srl
53100 Siena (IT)

(72)Inventors:
  • GRANDI, Guido
    20090 Segrate (IT)
  • GRANDI, Alberto
    53100 Siena (IT)
  • FANTAPPIÉ, Laura
    53100 Siena (IT)
  • ZANELLA, Ilaria
    38123 Trento (IT)
  • KÖNIG, Enrico
    38123 Trento (IT)
  • GAGLIARDI, Assunta
    38123 Trento (IT)

(74)Representative: Bianchetti Bracco Minoja S.r.l. 
Via Plinio, 63
20129 Milano
20129 Milano (IT)

  


(54)METHOD FOR THE PRODUCTION OF OUTER MEMBRANE VESICLES AND IMMUNOGENIC COMPOSITIONS THEREOF


(57) The invention relates to gram-negative bacteria carrying gene-inactivating mutations that cause deletion of proteins belonging to the OMV proteome, to Outer Membrane Vesicles (OMVs) produced by such bacteria and immunogenic compositions thereof.


Description


[0001] This invention relates to genetically modified gram-negative bacteria specifically designed to optimize the production of Outer Membrane Vesicles (OMVs), to OMVs produced by such bacteria and immunogenic compositions thereof.

BACKGROUND ART


Bacterial Outer Membrane Vesicles (OMVs)



[0002] All Gram-negative bacteria spontaneously release outer membrane vesicles (OMVs) during growth both in vitro and in vivo. OMVs are closed spheroid particles, 20-300 nm in diameter, generated through a "budding out" of the bacterial outer membrane. Consistent with that, the majority of OMV components are represented by LPS, glycerophospholipids, outer membrane proteins, lipoproteins and periplasmic proteins (A. Kulp and Kuehn M.J. (2010) Annu.Rev.Microbiol. 64, 163-184; T.N. Ellis and Kuehn M.J. (2010) Microbiol.Mol.Biol.Rev. 74, 81-94).

[0003] OMVs represent a distinct secretory pathway with a multitude of functions, including inter and intra species cell-to-cell cross-talk, biofilm formation, genetic transformation, defense against host immune responses and toxin and virulence factor delivery to host cells (A. Kulp and Kuehn M.J. (2010) Annu.Rev.Microbiol. 64, 163-184). OMVs interaction to host cells can occur by endocytosis after binding to host cell receptors or lipid rafts. Alternatively, OMVs have been reported to fuse to host cell membrane, leading to the direct release of their content into the cytoplasm of the host cells (A. Kulp and Kuehn M.J. (2010) Annu.Rev.Microbiol. 64, 163-184; T.N. Ellis and Kuehen M.J. (2010) Micrbiol.Mol.Biol.Rev. 74, 81-94).

OMVs as vaccines



[0004] OMVs purified from several pathogens, including Neisseria, Salmonella, Pseudomonas, Vibrio cholerae Burkholderia, and E. coli, induce potent protective immune responses against the pathogens they derive from (B.S. Collins (2011) Discovery Medicine, 12 7-15), and highly efficacious anti-Neisseria OMV-based vaccines are already available for human use (J. Holst et al. (2009) Vaccine, 27S, B3-B12). Such remarkable protection is attributed to two main properties of OMVs. First, they carry the proper immunogenic and protective antigens, which, in extracellular pathogens, usually reside on the surface and therefore are naturally incorporated in OMVs. Indeed, OMV immunization induces potent antibody responses against the major membrane-associated antigens. However, OMV immunogenicity is not restricted to antibody responses. For instance, mice immunized with Salmonella OMVs develop robust Salmonella-specific B and T cell responses, and OMVs stimulate IFN-γ production by a large proportion of CD4+ T cells from mice previously infected with Salmonella, indicating that OMVs are an abundant source of antigens recognized by Salmonella-specific CD4+ T cells (R.C. Alaniz et al., (2007) J. Immunol. 179, 7692-7701). Second, OMVs possess a strong "built-in" adjuvanticity since they carry many of the bacterial Pathogen-Associated-Molecular Patterns (PAMPs) which, by binding to pathogen recognition receptors (PRRs), play a key role in stimulating innate immunity and in promoting adaptive immune responses. OMV-associated PAMPs include LPS which, in concert with MD-2 and CD14, binds TLR-4, lipoproteins whose acylpeptide derivatives interact with TLR-1/2 and 2/6 heterodimers, and peptidoglycan whose degradation products bind to intracellular NOD1/2 (A. Moshiri et al., Hum. Vaccines.Immunother. (2012) 8, 953-955; T.N. Ellis et al., (2010) Inn.Immun. 78, 3822-3831; M. Kaparakis et al., (2010) Cell.Miocrobiol. 12, 372-385). The engagement of this group of PRRs results in the activation of transcription factors (NF-kB) and the consequent expression of specific cytokines. Interestingly, LPS, lipoproteins and peptidoglycan can work synergistically, thus potentiating the built-in adjuvanticity of OMVs (D.J. Chen et al., (2010) PNAS, 107, 3099-3104).

[0005] OMVs also have the capacity to induce protection at the mucosal level. Protection at the mucosal sites is known to be at least partially mediated by the presence of pathogen-specific IgAs and Th17 cells. In particular, a growing body of evidence suggests that Th17 cells have evolved to mediate protective immunity against a variety of pathogens at different mucosal sites. Interestingly, Th17 cells have recently also been shown to play a crucial role in the generation of vaccine-induced protective responses. For instance, it has been reported that in mice whole cell pertussis vaccines (Pw) induce Th17 cells and neutralization of IL-17 after vaccination reduces protection against a pulmonary challenge with B. pertussis. Similarly, in a CD4+ T cell dependent, antibody-independent model of vaccine-induced protection following S. pneumoniae challenge, treatment with anti-IL-17 antibodies resulted in reduced immunity to pneumococcal colonization compared to the control serum treated mice (Malley R, et al. (2006) Infect Immun., 74:2187-95). Elicitation of IgAs and Th17 cells by OMVs has been well documented and this can explain mechanistically the good protective activities of OMVs against several mucosal pathogens. For instance, immunization with Vibrio cholerae-derived OMVs protects rabbits against Vibrio cholerae oral challenge (Roy N. et al. (2010) Immunol. Clinical Microbiol. 60, 18-27) and Pasteurella multocida-derived and Mannheimia haemolytica-derived OMVs protect mice from oral challenge with P. multocida (Roier S. et al., (2013) Int.J.Med.Microbiol. 303, 247-256). In addition, intranasal immunization with Porphyromonas gingivalis OMVs elicits potent IgA production at both serum and mucosal level and immunization with Escherichia coli-derived OMVs prevent bacteria-induced lethality. Protective effect of Escherichia coli-derived OMVs is primarily mediated by OMV-specific, IFN-γ and IL-17 producing, T cells (Kim OY et al., (2013) J. Immunol. 190, 4092-4102).

[0006] In addition to their "built-in" adjuvanticity, OMVs are becoming a promising vaccine platform for two main reasons.
  1. 1. OMVs are amenable for large scale production - In general, the amount of OMVs released by Gram-negative bacteria when grown under laboratory conditions is too low to allow their exploitation in biotechnological applications. However, two approaches can be used to enhance the yields of OMVs and make them compatible with industrial applications. The first one exploits the addition of mild detergents to the bacterial biomass to promote the vesiculation process and, at the same time, to decrease the level of OMV reactogenicity by removing a substantial amount of LPS (Fredriksen J.H. et al, (1991) NIPH Ann. 14, 67-79). Although this process has been proved to produce safe and effective vaccines against Meningococcal B (Granoff D. (2010), Clin.Infect.Dis. 50, S54-S65; Crum-Cianflone N, Sullivan E. (2016) Meningococcal vaccinations. Infect Dis Ther., 5, 89-112) its main drawback is that the detergent treatment favors bacterial cell lysis with the consequence that the OMV preparations are heavily contaminated with cytoplasmic proteins (Ferrari et al., (2006) Proteomics, 6, 1856-1866). The second approach to enhance OMV production is to insert into the genome of the OMV-producing strain mutations that enhance vesiculation. For instance, in Neisseria meningitidis, a mutation in the gna33 gene, encoding a glucosyltransferase, has been shown to drive the release of several milligrams of vesicles per liter in the culture supernatant (Ferrari et al., (2006) Proteomics, 6, 1856-1866). Similar quantities of vesicles are obtained from Escherichia coli strains carrying deletions in the genes encoding the Tol/Pal system (a protein complex involved in the connection of the inner membrane with the outer membrane) (Bernadac A. et al., (1998) J. Bacteriol. 180, 4872-4878) and in the ompA gene, encoding one of the major outer membrane proteins of E. coli (Fantappiè et al., (2014) Journal of Extracellular Vesicles, 3, 24015). Deletion of the VacJ/Yrb ABC (ATP-binding cassette) transport system, a proposed phospholipid transporter, was also shown to increase OMVs production in two distantly related Gram-negative bacteria, Haemophilus influenzae and Vibrio cholerae (Roier S. et al, (2016) Nat. Commun. 7, 10515). Such quantities make the production process of OMVs highly efficient and inexpensive. A number of other mutations have been described that enhance the production of OMVs in several Gram negative bacteria, including Salmonella and E. coli (Deatherage B.L. et al. (2009) Mol. Microbiol. 72, 1395-1407; McBroom A.J. and Kuehen M.J. (2007) Mol. Microbiol. 63, 545-558). Furthermore, a high-throughput method developed to measure vesiculation values for the whole genome knock out library of E. coli mutant strains (Keio collection (Baba T. et al. (2006) Molecular System Biology DOI: 10.1038/msb4100050)) revealed 171 mutant strains with significant vesiculation phenotypes. Of these, 73 exhibited over-vesiculation phenotypes and 98 showed under-vesiculation phenotypes (Kulp A.J. et al (2015) PLos ONE 10(9): e0139200).
    As far as the purification of OMVs from the culture supernatant is concerned, centrifugation and tangential flow filtration (TFF) are commonly used. The yield of OMV production using centrifugation couple to TFF can easily exceed 100 mg/liter of culture (Berlanda Scorza F. et al., (2012) PlosOne 7, e35616) and therefore the process is perfectly compatible with large scale production.
  2. 2. OMVs can be manipulated in their protein content by genetic engineering. This feature was demonstrated for the first time by Kesty and Kuehn who showed that Yersinia enterocolitica outer membrane protein Ail assembled on OMVs surface when expressed in E. coli, and that the GFP fluorescence protein fused to the "twin arginine transport (Tat)" signal sequence was incorporated in the OMV lumen (N.C. Kesty and Kuhen M.J. (2004) J.Biol.Chem. 279, 2069-2076). Following the observation by Kesty and Kuehn, an increasing number of heterologous proteins have been successfully delivered to OMVs using a variety of strategies. For instance, heterologous antigens have been delivered to the surface of OMVs by fusing them to the β-barrel forming autotransporter AIDA and to hemolysin ClyA, two proteins that naturally compartmentalized into E. coli OMVs (J. Schroeder and Aebischer T. (2009) Vaccine, 27, 6748-6754; D.J. Chen et al., (2010) PNAS, 107, 3099-3104). Recently, heterologous antigens from Group A Streptococcus and Group B Streptococcus were delivered to the lumen of E. coli vesicles by fusing their coding sequences to the leader peptide of E. coli OmpA. Interestingly, when the recombinant vesicles were used to immunize mice, they elicited high titers of functional antibodies against the heterologous antigens, despite their luminal location (Fantappiè et al., (2014) Journal of Extracellular Vesicles, 3, 24015). More recently, we have shown that heterologous antigens can be delivered to the vesicular compartment by expressing them as lipoproteins in the OMV-producing strain (WO2015/144691, WO2006/024954, Fantappie' et. al (2017) Mol.Cell.Proteomics 16:1348-1364). Interestingly, lipoproteins can also serve as chaperones to deliver foreign polypeptides to the OMVs compartment, thus allowing the decoration of vesicles with a variety of polypeptides and their exploitation in different biotechnological applications, including vaccines and immunotherapy.

Optimization of OMVs for vaccine purposes



[0007] As mentioned above, two types of OMV-based vaccines are possible: 1) vaccines based on OMVs purified from the pathogen of interest (this is the case of Menigococcus B vaccines which are constituted by OMVs purified from the same strain against which the vaccine is designed for; 2) vaccines based on OMVs engineered with heterologous antigens and designed to target a species different from the OMV-producing strain. In this latter case, since any OMV-producing strain carries a conspicuous number of endogenous proteins (REFs), such proteins can potentially negatively affect the immune response against the heterologous antigens. Ideally, OMVs should be deprived of as many endogenous proteins as possible in order to "concentrate" the immune response toward the heterologous antigens. Obviously, not all proteins can be eliminated since a number of proteins are strictly necessary for vital biological functions. Previous studies showed that only 303 out of the 4288 genes in E. coli K-12 strain BW25113 could not be deleted and that a large fraction of "dispensable" proteins representing the 93% of the entire E. coli proteome are potentially removable (Baba T. et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Molecular System Biology DOI: 10.1038/msb4100050). Furthermore in an attempt to identify the minimal gene set required for cell viability, different approaches of sequential genome reduction have been used to generate several E. coli strains harboring reduced genomes (Kolisnychenko V. et al. (2002). Genome Res 12, 640-647; Yu B. et al (2002). Nat Biotechnol 20, 1018-1023; Hashimoto M. et al (2005). Mol Microbiol 55, 137-149; Posfai G. et al (2006). Science 312, 1044- 1046;.Mizoguchi H. et al (2007). Biotechnol Appl Biochem 46, 157-167; Kato J. & Hashimoto, M. (2008). Methods Mol Biol 416, 279-293; Hirokawa Y. et al (2013). J Biosci Bioeng 116, 52-58). Using different strategies up to 35% of the E. coli genome was successfully deleted, generating strains containing only the necessary genes to maintain self-replicable cells. Cell morphology, viability and doubling time in LB media were tested, however none of these studies evaluated vesiculation phenotypes of the strains generated.

[0008] However, with the current level of scientific knowledge, it is impossible to predict which proteins belonging to the "dispensable" OMV proteome can be cumulatively eliminated without impairing strain viability or OMV production.

State of the art



[0009] WO2016/184860 discloses fusion proteins comprising a bacterial protein and a tumor antigen, and isolated bacterial outer membrane vesicles containing said fusion proteins, wherein the bacterial protein is selected from Factor H Binding Protein (fHbp), Neisseria heparin binding antigen (NHBA), Maltose Binding Protein (MBP), Outer Membrane Protein-F (ompF) and Aggregatibacter actinomycetemcomitans Factor H binding protein (Aa-fHbp).

[0010] WO2015/144691 discloses outer membrane vesicles isolated from a Gram-negative bacterium, wherein the OMV comprises at least one S. aureus antigen, which can be FhuD2. The same antigen can be lipidated, e.g. with an acylated N-terminus cysteine.

[0011] WO2006/024954 discloses fusion proteins for use as vaccine comprising a bacterial protein and an antigen, and outer membrane vesicles containing them.

[0012] WO2014/106123 discloses bacterial signal peptides/secretion chaperones as N-terminal fusion partners in translational reading frame with recombinant encoded tumor protein antigens, for use in stimulating an immune response.

DISCLOSURE OF THE INVENTION



[0013] The present invention relates to gram-negative bacteria that have been deprived of endogenous proteins naturally present in the OMVs. In particular the inventors have identified gene-inactivating mutations that cause deletion of proteins belonging to the OMV proteome, without impairing the growth capacity of the strains and at the same time maintaining or even increasing their ability to produce vesicles. The OMVs produced by such strains are decorated with heterologous proteins and conveniently used in the preparation of immunogenic compositions or vaccines.
According to a first embodiment, the invention provides the use of a gram-negative bacterium for the preparation of isolated outer membrane vesicles (OMVs), wherein said bacterium:
  1. (a) is genetically modified by inactivation of:

    (a1) the ompA gene
    and

    (a2) one or more of the following genes:
    ybis, ais, eco, glpQ, mltA, proX, ydcL, glnH, efeO, bglX, agp, ygdI yncD, slp, artI, yiaD, ompX, borD, yhiJ, emtA, fecA, nmpC, fhuA, hisJ, lamB, malE, malM, ygiW, cirA, fepA, loiP, yjeI, ecnB, rcsF, phoE, oppA, fkpA, ybaY, tsx, yggE, osmE, ygdR, yceI, bhsA, nlpE, pldA, yghJ, ydeN, ushA, mdoD, treA, bcsC, ftsP, ptrA, fadL, artJ, mlaA

  2. (b) expresses heterologous proteins in the OMVs.
The gram-negative bacterium can be of the genus Escherichia, Pseudomonas, Neisseria or Shigella. E. coli strains are preferably used. The genome of the bacterium of interest is analyzed to identify genes homologous to the 58 genes described above and such genes are inactivated/deleted using standard genome editing techniques, thus obtaining a strain producing OMVs deprived of the endogenous proteins encoded by the inactivated/deleted genes.

[0014] Preferably, the genes which are most represented in the OMVs in terms of expression amount are inactivated. This allows a significant reduction of the risk of undesired immune reactions against endogenous bacterial proteins when the OMVs are administered in immunogenic compositions.

[0015] Accordingly, in a preferred embodiment the bacterium used to produce the OMVs is genetically modified by inactivation of the ompA gene and at least one, preferably at least 5, more preferably at least 10 and yet more preferably all of the following genes, which encode the proteins with the highest expression levels in the OMVs:
amB, malE, ompX, fkpA, malM, fepA, yncD, borD, oppA, glpQ, osmE, ycdO, tsx, ydcL, agp, cirA, fecA, ygiW, artI and hisJ.

[0016] The OMV-producing bacterium can carry other mutation/gene inactivation in addition to the indicated gene mutations/inactivations. However, certain proteins previously reported to be dispensable (Baba T. et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: The Keio collection. Molecular System Biology DOI: 10.1038/msb4100050), are preferably not deleted as their deletion may reduce the strain growth capacity or its vesiculation activity. Accordingly, in a preferred embodiment the bacteria used to produce the OMVs do not carry gene-inactivating mutations at one or more of the following genes:
mdoG, yncE, ompN, lpp, gltI, kpsD, degP, mipA, surA, bamC, nlpD, rlpA, pal, potD, ppiA, bamE, skp, yhcN, cpoB, yfeY, ydgH, yajG, yifL, lpoA, prc, slyB, lpoB, yjhG, dsbC, degQ, yraP, bamB, mlaC.

[0017] It was also surprisingly found that the bacteria according to the invention have a better OMV producing phenotype with respect to the progenitor strains. In particular, the bacteria carrying all of the above identified 58 mutations were found to produce more than three-fold higher amount OMVs compared to the progenitor strain.

[0018] Gene inactivation can be carried out in different manners, including the deletion of the entire coding sequence, the deletion of other portions of the gene, the insertion of stop codons, and even the inactivation of the transcription and translation signals. For example the following methods can be used to inactivate genes: 1) the classical gene knockout protocol according to which mutants are created by inserting selective markers between PCR products derived from the upstream and downstream regions of the target gene. Mutant colonies are isolated in the appropriate selective medium after transformation with linear or circular constructs and the selection marker is subsequently eliminated by counter-selection, leaving a "scarless" chromosomal mutation. 2) the method described by Court and co-workers according to which chromosomal gene mutations can be achieved without the need of selection markers and using synthetic oligonucleotides which anneal to their complementary chromosomal regions during replication and mediate recombination and gene modification (Yu, D., et al., An efficient recombination system for chromosome engineering in Escherichia coli. Proc Natl Acad Sci USA, 2000. 97(11): p. 5978-83). 3) CRISPR/Cas-based methods such as the one proposed by Jiang and co-workers (Jiang, W., et al., RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Nat Biotechnol. 31(3): p. 233-9). However, any other genome editing methods described in the literature and known to those skilled in the art can be applied.

[0019] In one embodiment, gene inactivation is carried out by deleting 28-35 nucleotides located in the proximity of the first 5 % length of the protein coding sequence and by adding an in frame stop codon immediately after the deleted portion of the gene. By doing so it was found that the total genome of an E. coli strain carrying the highest number of gene inactivations (58) is reduced by 1799 base pairs, corresponding to the 0.039% of the genome (number of nucleotides in E. coli BL21(DE3) strain = 4.558.953).

[0020] The strains of the invention are genetically engineered to express heterologous antigen/polypeptide/epitope of bacterial, viral, parasitic and cancer origin on the OMVs. The heterologous antigens can be expressed in the lumen of the OMVs, in the membrane, and can also be exposed on the surface of OMVs. Furthermore, the heterologous antigen expressed in the OMVs can be a fusion protein constituted by a carrier protein and an immunogenic polypeptide. Fusion proteins comprising a bacterial protein and one or more copies of a tumor antigen protein are disclosed in WO2016/184860. Furthermore, the heterologous proteins can be lipidated to enhance their incorporation in the OMVs, as disclosed in EP3312192.

[0021] As used herein the term "heterologous" means that the protein is from a species that is different from the species of bacterium from which the OMV is obtained (the heterologous organism). Typically, the protein is an antigen from a pathogen genus different from the genus of bacterium from which the OMV is obtained. The protein may also be a human protein, and any portion of it, such as a tumor-associated and tumor-specific antigen, polypeptide and epitope.

[0022] In another embodiment of the invention the heterologous polypeptide can be any portion of a human protein that carries a specific amino acid mutation and where such mutation generates an immunogenic CD4+ and/or CD8+ T cell epitope.

[0023] The tumor antigens that can be expressed on the OMVs as such or as suitable fusion proteins include any CD4+ and/or CD8+ T cell neo-epitope generated as a consequence of mutations occurring in cancer cells.

[0024] Other tumor antigens that can be expressed on the OMVs as such or as suitable fusion proteins include:
(a) the cancer-testis antigens NY-ESO-1, SSX2, SCP1 as well as RAGE, BAGE, GAGE and MAGE family polypeptides, for example, GAGE-1, GAGE-2, MAGE-1, MAGE-2, MAGE-3, MAGE-4, MAGE-5, MAGE-6, and MAGE- 12, which can be used, for example, to address melanoma, lung, head and neck, NSCLC, breast, gastrointestinal, and bladder tumours; (b) mutated antigens, including p53, associated with various solid tumours, e.g., colorectal, lung, head and neck cancer; p21/Ras associated with, e.g., melanoma, pancreatic cancer and colorectal cancer; CDK4, associated with, e.g., melanoma; MUM1 associated with, e.g., melanoma; caspase-8 associated with, e.g., head and neck cancer; CIA 0205 associated with, e.g., bladder cancer; HLA-A2-R1701, beta catenin associated with, e.g., melanoma; TCR associated with, e.g., T-cell non-Hodgkin lymphoma; BCR-abl associated with, e.g., chronic myelogenous leukemia; triosephosphate isomerase; KIA 0205; CDC-27, and LDLR-FUT; (c) over-expressed antigens, including, Galectin 4 associated with, e.g., colorectal cancer; Galectin 9 associated with, e.g., Hodgkin's disease; proteinase 3 associated with, e.g., chronic myelogenous leukemia; WT 1 associated with, e.g., various leukemias; carbonic anhydrase associated with, e.g., renal cancer; aldolase A associated with, e.g., lung cancer; PRAME associated with, e.g., melanoma; HER-2/neu associated with, e.g., breast, colon, lung and ovarian cancer; mammaglobin, alpha- fetoprotein associated with, e.g., hepatoma; KSA associated with, e.g., colorectal cancer; gastrin associated with, e.g., pancreatic and gastric cancer; telomerase catalytic protein, MUC-1 associated with, e.g., breast and ovarian cancer; G-250 associated with, e.g., renal cell carcinoma; p53 associated with, e.g., breast, colon cancer; and carcinoembryonic antigen associated with, e.g., breast cancer, lung cancer, and cancers of the gastrointestinal tract such as colorectal cancer; (d) shared antigens, including melanoma-melanocyte differentiation antigens such as MART-1/Melan A; gplOO; MC1R; melanocyte-stimulating hormone receptor; tyrosinase; tyrosinase related protein- 1/TRP1 and tyrosinase related protein-2/TRP2 associated with, e.g., melanoma; (e) prostate associated antigens including PAP, PSA, PSMA, PSH-P1, PSM-P1, PSM-P2, associated with e.g., prostate cancer; (f) immunoglobulin idiotypes associated with myeloma and B cell lymphomas. In certain embodiments, the one or more TAA can be selected from pi 5, Hom/Mel-40, H-Ras, E2A-PRL, H4-RET, IGH-IGK, MYL-RAR, Epstein Barr virus antigens, EBNA, human papillomavirus (HPV) antigens, including E6 and E7, hepatitis B and C virus antigens, human T-cell lymphotropic virus antigens, TSP-180, pl85erbB2, pl 80erbB-3, c-met, mn- 23H1, TAG-72-4, CA 19-9, CA 72-4, CAM 17.1, NuMa, K-ras, pi 6, TAGE, PSCA, CT7, 43-9F, 5T4, 791 Tgp72, beta-HCG, BCA225, BTAA, CA 125, CA 15-3 (CA 27.29\BCAA), CA 195, CA 242, CA-50, CAM43, CD68\KP1, CO-029, FGF-5, Ga733 (EpCAM), HTgp-175, M344, MA-50, MG7-Ag, MOV18, NB/70K, NY-CO-1, RCAS1, SDCCAG16, TA-90 (Mac-2 binding protein/cyclophilin C-associated protein), TAAL6, TAG72, TLP, TPS.

[0025] The bacterial heterologous proteins that can be used according to the present invention include any antigen, expressed on the OMVs as such or as suitable fusion protein, which induces protective immune responses against the corresponding pathogen. Typical antigens include: the Factor H binding protein (fHbp) and NHBA from Neisseria sp., the pilus subunits and their sub-domains of Streptococcus agalactiae, the extracellular cholesterol depending streptolysin O (Slo-dm) from Streptococcus pyogenes, the SpyCEP from Streptococcus pyogenes, Hla and its mutated forms, such as HlaH35L, from Staphylococcus aureus, Spa and its mutated forms, such as SpaKKAA, from Staphylococcus aureus, the LukE and LukD antigens and other leukocidins, such as PVL, from Staphylococcus aureus, the FhuD2 antigen from Staphylococcus aureus, the CsA1 antigen from Staphylococcus aureus, the Clamping Factor A (ClfA) from Staphylococcus aureus.

[0026] The bacterial vesicles can conveniently be separated from whole bacterial culture by filtration e.g. through a 0.22 µm filter. Bacterial filtrates may be clarified by centrifugation, for example high speed centrifugation (e.g. 200,000 x g for about 2 hours). Another useful process for OMV preparation is described in WO2005/004908 and involves ultrafiltration on crude OMVs, instead of high speed centrifugation. The process may involve a step of ultracentrifugation after the ultrafiltration takes place. A simple process for purifying bacterial vesicles comprises: (i) a first filtration step in which the vesicles are separated from the bacteria based on their different sizes, and (ii) tangential flow filtration using membranes that retain vesicles, thus allowing their concentration.

[0027] In a further embodiment, the invention provides an immunogenic composition comprising a bacterial outer membrane vesicle as herein disclosed, together with pharmaceutical acceptable vehicles and excipients. The composition can contain a mixture of outer membrane vesicles carrying cancer-specific T cell epitopes and such mixture of vesicles can be used as personalized cancer vaccine.

[0028] The composition of the invention is in a suitable administration form and it is preferably in the form of a vaccine. Vaccines according to the invention may either be prophylactic (e.g. to prevent cancer) or therapeutic (e.g. to treat cancer). Pharmaceutical compositions used as vaccines comprise an immunologically effective amount of antigen(s), as well as any other components, as needed. By 'immunologically effective amount', it is meant that the administration of that amount to an individual, either in a single dose or as part of a series, is effective for treatment or prevention. This amount varies depending upon the health and physical condition of the individual to be treated, age, the taxonomic group of individual to be treated (e.g. non-human primate, primate, etc.), the capacity of the individual's immune system. The amount of OMVs in the compositions of the invention may generally be between 10 and 500 µg, preferably between 25 and 200 µg, and more preferably about 50 µg or about 100 µg.

[0029] Compositions of the invention may be prepared in various liquid forms. For example, the compositions may be prepared as injectables, either as solutions or suspensions. The composition may be prepared for pulmonary administration e.g. by an inhaler, using a fine spray. The composition may be prepared for nasal, aural or ocular administration e.g. as spray or drops, and intranasal vesicle vaccines are known in the art. Injectables for intramuscular administration are typical. Injection may be via a needle (e.g. a hypodermic needle), but needle-free injection may alternatively be used.

[0030] The OMVs and the immunogenic compositions according to the invention are conveniently used for the stimulation of an immune response against heterologous antigens in a subject in need thereof. Particularly they can be used for the prevention or treatment of various infectious diseases and of different types of tumor, including but not limited to bronchogenic carcinoma, nasopharyngeal carcinoma, laryngeal carcinoma, small cell and non-small cell lung carcinoma, lung adenocarcinoma, hepatocarcinoma, pancreatic carcinoma, bladder carcinoma, colon carcinoma, breast carcinoma, cervical carcinoma, ovarian carcinoma, prostate cancer or lymphocytic leukaemias.

DESCRIPTION OF THE FIGURES



[0031] 

Figure 1
Amount of OMVs (mg of OMV proteins/L of culture) purified from the culture supernatant of E. coli OMV_MUT derivatives. The bars (mg/l) show the mean of three independent experiments and their standard deviations from all E. coli ompA OMV_MUT strains in consecutive order. The starting point was the hypervesiculating E. coli BL21(DE3) ΔompA strain.

Figure 2
Electrophoretic analysis on 2% agarose gels of PCR products obtained by amplifying portions of the 58 inactivated genes using the chromosomal DNA of E. coli BL21(DE3) and E. coli OMV_MUT57 as templates. The primers used for the amplification are reported in Table 5.

Figure 3
SDS-PAGE of OMVs obtained from E.coli BL21(DE3)ΔompA and the 57 E. coli OMV_MUT derivatives. All purified OMVs were normalised for 20 µg of total protein content and loaded onto Criterion TGX any kD SDS-polyacrylamide gels (Bio-Rad Laboratories, Hercules, CA). The gels were stained with Coomassie brilliant blue.

Figure 4
2-DE gels of OMVs from BL21(DE3) ΔompA (A) and E. coli-OMV_MUT57 (B) strains. OMV proteins were first focused on non-linear immobilized pH 3-10 gradient gels and then separated on house-made 9-16% SDS-polyacrylamide gels. Analytical 2-DE gels were stained with ammoniacal silver nitrate. The figure clearly showed that several protein spots present in BL21(DE3) ΔompA (A) disappear in E. coli-OMV_MUT57 (B).

Figure 5
Schematic representation of plasmid pET-LukE expressing lipidated S. aureus LukE antigen

Figure 6
Schematic representation of plasmid pET-FhuD2 expressing lipidated S. aureus FhuD2 antigen

Figure 7
Schematic representation of plasmid pET-FhuD2-D8-hFAT1-3x, expressing lipidated FhuD2 carrying three copies of D8-hFAT1 epitope at its C-terminus.

Figure 8
SDS-PAGE analysis of OMVs from E. coli OMV_MUT57 expressing LukE, FhuD2 and FhuD2-D8-hFAT1 fusion. 20 µg of OMVs purified from the supernatants of E. coli OMV_MUT57 transformed with plasmids pET-LukE pET-FhuD2 pET-FhuD2-D8-hFAT1-3x and pET vector ("Empty") as control. Arrows indicate the recombinant antigens which accumulate in the OMV preparations.

Figure 9
Schematic representation of plasmid pET-Nm-fHbpvIII expressing lipidated neisserial fHbp carrying three copies of EGFRvIII epitope at its C-terminus.

Figure 10
Flow cytometry analysis of BL21(DE3) ΔompA and E. coli OMV_MUT57 cells expressing heterologous antigens - Surface exposition of FhuD2, FhuD2-hFAT1 and fHbp-EGFRvIII fusion proteins was evaluated on bacterial cells after 2 h induction with 0.1 mM IPTG. Cells were stained with pAb anti-FhuD2 (cells expressing FhuD2), mAb anti-hFAT1 (cells expressing FhuD2-hFAT1) and pAb anti-EGFRvIII (cells expressing fHbp-EGRF-vIII-3x), followed by incubation with FITC secondary antibodies. Fluorescence was measured by flow cytometry. Cells not included in the gates represent the background fluorescence signals obtained incubating the cells with the secondary antibody only.


DETAILED DESCRIPTION OF THE INVENTION


Selection of proteins to be eliminated from the OMVs



[0032] The OMV proteome includes two classes of proteins: periplasmic proteins and outer membrane (OM) proteins. OM proteins can be subdivided in lipoproteins and transmembrane proteins. Several algorithms and database are available that can predict with a high degree of precision such categories of proteins. We used a number of these bioinformatics tools, including PSORT and PFAM, to ultimately select the list of OMV-associated proteins. The list was further filtered by removing those proteins classified as "indispensable" according to the Keio collection (Baba T. et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Molecular System Biology DOI: 10.1038/msb4100050). At the end, a final list of 91 proteins were selected and reported in Table 1. In particular, the list comprises 45 periplasmic proteins, 14 integral membrane proteins and 32 outer membrane lipoproteins. Many of these proteins (and their homologs) have been described to be present the OMVs by using 2DE coupled to mass spectrometry (Fantappie' et. al (2017) Gram negative promiscuous lipoproteins keep surface topology when transplanted from one species to another and can deliver foreign polypeptides to the bacterial surface. Mol. Cell.Proteomics 16:1348-1364).
Table Ibis - list of inactivated genes
Table 1 - list of 91 proteins selected for gene inactivation
Periplasmic proteins agp, artI, artJ, bcsC, bglX, cirA, degP, degQ, dsbC, eco, jkpA, ftsP, glnH, glpQ, gltI, hisJ, skp, kpsD, malE, malM, mdoG, mdoD, oppA, potD, ppiA, prc, proX, ptrA, surA, treA, ushA, cpoB, ybis, efeO, yceI, bhsA, ydeN, ydgH, yggE, ygiW, yhcN, yhjJ, yncE, yraP, mlaC
Outer membrane lipoproteins ais, ecnB, lpp, mltA, emtA, bamC, nlpD, nlpE, osmE, pal, rcsF, rlpA, slp, slyB, bamE, yghJ, mlaA, yajG, ybaY, borD, lpoB, ydcL, yfeY, bamB, yfhG, ygdI, ygdR, loiP, yiaD, yifL, yjeI, lpoA
Integral membrane proteins fadL, fecA, fepA, fhuA, lamB, mipA, nmpC, ompA, ompN, ompX, phoE, pldA, tsx, yncD


[0033] ompA (wt: SEQ ID NO:1; mutated: SEQ ID NO:59); ybis (wt: SEQ ID NO:2; mutated: SEQ ID NO:60), ais (wt: SEQ ID NO:3; mutated: SEQ ID NO:61), eco (wt: SEQ ID NO:4; mutated: SEQ ID NO:62), glpQ (wt: SEQ ID NO:5 mutated: SEQ ID NO:63), mltA (wt: SEQ ID NO:6 mutated: SEQ ID NO:64), proX (wt: SEQ ID NO:7 mutated: SEQ ID NO:65), ydcL (wt: SEQ ID NO:8 mutated: SEQ ID NO:66), glnH (wt: SEQ ID NO:9 mutated: SEQ ID NO:67), efeO (wt: SEQ ID NO:10 mutated: SEQ ID NO:68), bglX (wt: SEQ ID NO:11 mutated: SEQ ID NO:69), agp (wt: SEQ ID NO:12; mutated: SEQ ID NO:70), ygdI (wt: SEQ ID NO:13; mutated: SEQ ID NO:71), yncD (wt: SEQ ID NO:14; mutated: SEQ ID NO:72), slp (wt: SEQ ID NO:15; mutated: SEQ ID NO:73), artI (wt: SEQ ID NO:16; mutated: SEQ ID NO:74), yiaD (wt: SEQ ID NO:17; mutated: SEQ ID NO:75), ompX (wt: SEQ ID NO:18; mutated: SEQ ID NO:76), borD (wt: SEQ ID NO:19; mutated: SEQ ID NO:77), yhiJ (wt: SEQ ID NO:20; mutated: SEQ ID NO:78), emtA (wt: SEQ ID NO:21; mutated: SEQ ID NO:79), fecA (wt: SEQ ID NO:22; mutated: SEQ ID NO:80), nmpC (wt: SEQ ID NO:23; mutated: SEQ ID NO:81), fhuA (wt: SEQ ID NO:24; mutated: SEQ ID NO:82), hisJ (wt: SEQ ID NO:25; mutated: SEQ ID NO:83), lamB (wt: SEQ ID NO:26; mutated: SEQ ID NO:84), malE (wt: SEQ ID NO:27; mutated: SEQ ID NO:85), malM (wt: SEQ ID NO:28; mutated: SEQ ID NO:86), ygiW (wt: SEQ ID NO:29; mutated: SEQ ID NO:87), cirA (wt: SEQ ID NO:30; mutated: SEQ ID NO:88), fepA (wt: SEQ ID NO:31; mutated: SEQ ID NO:89), loiP (wt: SEQ ID NO:32; mutated: SEQ ID NO:90), yjeI (wt: SEQ ID NO:33; mutated: SEQ ID NO:91), ecnB (wt: SEQ ID NO:34; mutated: SEQ ID NO:92), rcsF (wt: SEQ ID NO:35; mutated: SEQ ID NO:93), phoE (wt: SEQ ID NO:36; mutated: SEQ ID NO:94), oppA (wt: SEQ ID NO:37; mutated: SEQ ID NO:95), jkpA (wt: SEQ ID NO:38; mutated: SEQ ID NO:96), ybaY (wt: SEQ ID NO:39; mutated: SEQ ID NO:97), tsx (wt: SEQ ID NO:40; mutated SEQ ID NO:98), yggE (wt: SEQ ID NO:41; mutated: SEQ ID NO:99), osmE (wt: SEQ ID NO:42; mutated: SEQ ID NO:100), ygdR (wt: SEQ ID NO:43; mutated: SEQ ID NO:101), yceI (wt: SEQ ID NO:44; mutated: SEQ ID NO:102), bhsA (wt: SEQ ID NO:45; mutated: SEQ ID NO:103), nlpE (wt: SEQ ID NO:46; mutated: SEQ ID NO:104), pldA (wt: SEQ ID NO:47; mutated: SEQ ID NO:105), yghJ (wt: SEQ ID NO:48; mutated: SEQ ID NO:106), ydeN (wt: SEQ ID NO:49; mutated: SEQ ID NO:107), ushA (wt: SEQ ID NO:50; mutated: SEQ ID NO:108), mdoD (wt: SEQ ID NO:51; mutated: SEQ ID NO:109), treA (wt: SEQ ID NO:52; mutated: SEQ ID NO:110), bcsC (wt: SEQ ID NO:53; mutated: SEQ ID NO:111), ftsP (wt: SEQ ID NO:54; mutated: SEQ ID NO:112), ptrA (wt: SEQ ID NO:55; mutated: SEQ ID NO:113), fadL (wt: SEQ ID NO:56; mutated: SEQ ID NO:114), artJ (wt: SEQ ID NO:57; mutated: SEQ ID NO:115), mlaA (wt: SEQ ID NO:58; mutated: SEQ ID NO:116)

Inactivation of selected OMV proteins



[0034] There are three main protocols for the manipulation of chromosomal DNA in E. coli, all utilizing phage recombinase-mediated homologous recombination (recombineering), using either the Rac prophage system [Zhang, Y., et al., A new logic for DNA engineering using recombination in Escherichia coli. Nat Genet, 1998. 20(2): p. 123-8; Datta, S., N. Costantino, and D.L. Court, A set of recombineering plasmids for gram-negative bacteria. Gene, 2006. 379: p. 109-15) or the bacteriophage λ Red proteins, Exo, Beta, and Gam (Murphy, K.C., Use of bacteriophage lambda recombination functions to promote gene replacement in Escherichia coli. J Bacteriol, 1998. 180(8): p. 2063-71; Muyrers, J.P., et al., Rapid modification of bacterial artificial chromosomes by ET-recombination. Nucleic Acids Res, 1999. 27(6): p. 1555-7; Ellis, H.M., et al., High efficiency mutagenesis, repair, and engineering of chromosomal DNA using single-stranded oligonucleotides. Proc Natl Acad Sci USA, 2001. 98(12): p. 6742-6).

[0035] According to the first protocol, gene knockout mutants are created by inserting antibiotic resistance markers (or other selection markers) between double-stranded DNA (ds-DNA) PCR products derived from the upstream and downstream regions of the target gene. Mutant colonies are isolated in the appropriate selective medium after transformation with linear or circular constructs and, when necessary, the selection marker is subsequently eliminated by counter-selection, leaving a "scarless" chromosomal mutation.

[0036] The second protocol was described by Court and co-workers who demonstrated that chromosomal gene mutations can be achieved without the need of selection markers and using synthetic single stranded DNAs (ss-DNAs) or ds-DNAs, which anneal to their complementary chromosomal regions during replication and mediate recombination and gene modification (Yu, D., et al., An efficient recombination system for chromosome engineering in Escherichia coli. Proc Natl Acad Sci USA, 2000. 97(11): p. 5978-83; Yu, D., et al., Recombineering with overlapping single-stranded DNA oligonucleotides: testing a recombination intermediate. Proc Natl Acad Sci USA, 2003. 100(12): p. 7207-12).

[0037] The third approach, proposed for the first time by Jiang and co-workers (Jiang, W., et al., RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Nat Biotechnol. 31(3): p. 233-9), makes use of the CRISPR/Cas9 technology (Doudna, J.A. and E. Charpentier, Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science, 2014. 346(6213): p. 1258096; Sternberg, S.H. and J.A. Doudna, Expanding the Biologist's Toolkit with CRISPR-Cas9. Mol Cell, 2015. 58(4): p. 568-74; Singh, V., D. Braddick, and P.K. Dhar, Exploring the potential of genome editing CRISPR-Cas9 technology. Gene, 2017. 599: p. 1-18. Briefly, the strain to be modified is first genetically manipulated to express the Cas9 nuclease and the λ Red machinery, and subsequently the strain is co-transformed with (i) a plasmid (pCRISPR) encoding the guide RNA, which anneals with the chromosomal region to be modified and promotes a site-specific DNA cleavage by the Cas9, and (ii) a donor DNA (PCR-derived or chemically synthesized) partially homologous to the cleaved extremities, which promotes the repair of the double stranded break through λ Red-mediated recombination thereby introducing the desired mutation.

[0038] The "classical" gene KO method, which involves the use of PCR products flaking a selective marker, is usually very efficient to obtain large deletions but is more laborious. The Court's approach is theoretically the simplest one since only a synthetic oligonucleotide carrying the desired mutation is needed. By following the detailed procedure described by Sawitzke J. and co-workers (Sawitzke J. et al. (2013) Recombineering: highly efficient in vivo genetic engineering using single-strand oligos. Methods Enzymol. 533:157-77) good gene inactivation efficiencies can be obtained. However the method might require the screening of several colonies (recommended from 40 to 100) to identify the one carrying the desired mutations. Finally, the CRISPR/ Cas9-based methods are extremely efficient but requires the preparation of recombinant plasmids expressing the guide RNA and the synthesis of "donor" oligonucleotides. Both have to be properly selected to guarantee consistent mutagenesis efficiencies.

[0039] By using any of these approaches, which those skilled in the art can apply following published protocols, the progressive inactivation of the 91 genes was attempted following the order reported in Figure 1 and in Table 2. In particular, the strategy was to inactivate the selected gene by creating deletions of approximately 30 bp followed by the in-frame insertion of a stop codon. Obviously, any other strategy for gene inactivation and known to those skilled in the art can be applied.

[0040] In total 57 E. coli BL21(DE3) ΔompA derivatives were obtained, named E. coli OMV_MUT1 throughout 57, whose genotypes are reported in Table 3. In essence, the 58 strains carry a progressive number of mutations, E. coli OMV_MUT1 having the inactivation of one gene (ybis) (in addition to ompA inactivation) and E. coli OMV_MUT57, having 57 mutations (in addition to ompA). It was found that when 33 out of the 91 attempted deletions added up to some of the 58-gene mutations here reported, the growth of the mutant strains was reduced (Table 4). These 33 mutations were thus classified as non-compatible (Fig. 1). The correctness of the introduced mutations in each strain was verified by sequencing analysis of PCR products obtained using the primers reported in Table 5. Briefly, the PCR reaction was carried out mixing the appropriate primer couples, bacterial cells from a colony picked from an LB agar plate and the 2x GoTaq Master Mix. The PCR was run with one step of initial denaturation (3 min at 95°C), 30 cycles of denaturation (30 sec at 95°C), annealing (30 sec at 60°C) and elongation (30 sec at 72°C), and a final elongation step (5 min at 72°C). Figure 2 shows the electrophoretic analysis on 2% agarose gels of all 58 PCR products obtained from E. coli BL21(DE3)ΔompA and E. coli OMV_MUT57 strain. As shown in the figure, each amplification product from E. coli OMV_MUT57 had a smaller molecular weight with respect to the electrophoretic mobility of the corresponding fragment amplified from the chromosomal DNA of E. coli BL21(DE3) ΔompA. All amplified products from all mutated genes were sequenced and the analysis confirmed the deletion of a 30 bp fragment and the insertion of a stop codon (TAA) in each gene.
Table 2 - List of genes subjected gene deletion attempts in chronological order
ompA, ybis, ais, eco, glpQ, mdoG, mltA, proX, ydcL, glnH, efeO, bglX, agp, ygdI, yncD, yncE, slp, artI, yiaD, ompX, borD, yhjJ, emtA, fecA, nmpC, ompN, lpp, fhuA, gltI, hisJ, lamB, malE, malM, ygiW, cirA, fepA, loiP, kpsD, degP, yjeI, mipA, ecnB, surA, bamC, nlpD, rcsF, rlpA, phoE, pal, potD, oppA, fkpA, ppiA, ybaY, bamE, tsx, yggE, skp, osmE, yhcN, ygdR, yceI, cpoB, bhsA, yfeY, ydgH, yajG, yifL, lpoA, nlpE, pldA, yghJ, ydeN, prc, slyB, lpoB, yfhG, ushA, mdoD, treA, bcsC, ftsP, ptrA, dsbC, fadL, degQ, artJ, yraP, bamB, mlaC, mlaA
Table 3 - List of mutant strains
Namegenotype
E. coli OMV_MUT1 ompA, ybis
E. coli OMV_MUT2 ompA, ybis, ais
E. coli OMV_MUT3 ompA, ybis, ais, eco
E. coli OMV_MUT4 ompA ybis ais eco glpQ
E. coli OMV_MUT5 ompA ybis ais eco glpQ mltA
E. coli OMV_MUT6 ompA ybis ais eco glpQ mltA proX
E. coli OMV_MUT7 ompA ybis ais eco glpQ mltA proX ydcL
E. coli OMV_MUT8 ompA ybis ais eco glpQ mltA proX ydcL glnH
E. coli OMV_MUT9 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO
E. coli OMV_MUT10 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX
E. coli OMV_MUT11 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp
E. coli OMV_MUT12 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI
E. coli OMV_MUT13 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD
E. coli OMV_MUT14 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp
E. coli OMV_MUT15 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI
E. coli OMV_MUT16 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD
E. coli OMV_MUT17 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdl yncD slp artI yiaD ompX
E. coli OMV_MUT18 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD
E. coli OMV_MUT19 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ
E. coli OMV_MUT20 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA
E. coli OMV_MUT21 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA
E. coli OMV_MUT22 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC
E. coli OMV_MUT23 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA
E. coli OMV_MUT24 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ
E. coli OMV_MUT25 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB
E. coli OMV_MUT26 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE
E. coli OMV_MUT27 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM
E. coli OMV_MUT28 ompA ybi ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW
E. coli OMV_MUT29 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA
E. coli OMV_MUT30 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA, fepA
E. coli OMV_MUT31 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA, fepA loiP
E. coli OMV_MUT32 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjeI
E. coli OMV_MUT33 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjeI ecnB
E. coli OMV_MUT34 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA, fepA loiP yjeI ecnB rcsF
E. coli OMV_MUT35 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjeI ecnB rcsF phoE
E. coli OMV_MUT36 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglx agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjeI ecnB rcsF phoE oppA
E. coli OMV_MUT37 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygi W cirA fepA loiP yjeI ecnB rcsF phoE oppA fkpA
E. coli OMV_MUT38 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjeI ecnB rcsF phoE oppA, fkpA ybaY
E. coli OMV_MUT39 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjeI ecnB rcsF phoE oppA fkpA ybaY tsx
E. coli OMV_MUT40 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjeI ecnB rcsF phoE oppA fkpA ybaY tsx yggE
E. coli OMV_MUT41 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjeI ecnB rcsF phoE oppA fkpA ybaY tsx yggE osmE
E. coli OMV_MUT42 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artl yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjeI ecnB rcsF phoE oppA fkpA ybaY tsx yggE osmE ygdR
E. coli OMV_MUT43 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjeI ecnB rcsF phoE oppA fkpA ybaY tsx yggE osmE ygdR yceI
E. coli OMV_MUT44 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjeI ecnB rcsF phoE oppA fkpA ybaY tsx yggE osmE ygdR yceI bhsA
E. coli OMV_MUT45 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjeI ecnB rcsF phoE oppA fkpA ybaY tsx yggE osmE ygdR yceI bhsA nlpE
E. coli OMV_MUT46 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjeI ecnB rcsF phoE oppA fkpA ybaY tsx yggE osmE ygdR yceI bhsA nlpE pldA
E. coli OMV_MUT47 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjel ecnB rcsF phoE oppA fkpA ybaY tsx yggE osmE ygdR yceI bhsA nlpE pldA yghJ
E. coli OMV_MUT48 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artl yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjel ecnB rcsF phoE oppA fkpa ybaY tsx yggE osmE ygdR yceI bhsA nlpE pldA yghJ ydeN
E. coli OMV_MUT49 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdl yncD slp artl yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjel ecnB rcsF phoE oppA fkpA ybaY tsx yggE osmE ygdR yceI bhsA nlpE pldA yghJ ydeN ushA
E. coli OMV_MUT50 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdl yncD slp artl yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW W cirA fepA loiP yjel ecnB rcsF phoE oppA fkpA ybaY tsx yggE osmE ygdR yceI bhsA nlpE pldA yghJ ydeN ushA mdoD
E. coli OMV_MUT51 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdl yncD slp artl yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjel ecnB rcsF phoE oppA fkpA ybaY tsx yggE osmE ygdR yceI bhsA nlpE pldA yghJ ydeN ushA mdoD treA
E. coli OMV_MUT52 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdl yncD slp artl yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjel ecnB rcsF phoE oppA fkpA ybaY tsx yggE osmE ygdR yceI bhsA nlpE pldA yghJ ydeN ushA mdoD treA bcsC
E. coli OMV_MUT53 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjel ecnB rcsF phoE oppA fkpA ybaY tsx yggE osmE ygdR yceI bhsA nlpE pldA yghJ ydeN ushA mdoD treA bcsC ftsP
E. coli OMV_MUT54 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdl yncD slp artl yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjel ecnB rcsF phoE oppA fkpA ybaY tsx yggE osmE ygdR yceI bhsA nlpE pldA yghJ ydeN ushA mdoD treA bcsC ftsP ptrA
E. coli OMV_MUT55 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdl yncD slp artl yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjel ecnB rcsF phoE oppA fkpA ybaY tsx yggE osmE ygdR yceI bhsA nlpE pldA yghJ ydeN ushA mdoD treA bcsC ftsP ptrA fadL
E. coli OMV_MUT56 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdl yncD slp artl yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjel ecnB rcsF phoE oppA fkpA ybaY tsx yggE osmE ygdR yceI bhsA nlpE pldA yghJ ydeN ushA mdoD treA bcsC ftsP ptrA fadL artJ
E. coli OMV_MUT57 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdl yncD slp artl yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjel ecnB rcsF phoE oppA fkpA ybaY tsx yggE osmE ygdR yceI bhsA nlpE pldA yghJ ydeN ushA mdoD treA bcsC fisP ptrA fadL artJ mlaA
Table 4 - List of genes whose inactivation may affect viability (chronological order)
mdoG, yncE, ompN, lpp, gltI, kpsD, degP, mipA, surA, bamC, nlpD, rlpA, pal, potD, ppiA, bamE, skp, yhcN, cpoB, yfeY, ydgH, yajG, yifL, lpoA, prc, slyB, lpoB, yfhG, dsbC, degQ, yraP, bamB, mlaC
Table 5 - Primers used for the analysis of gene mutations
Ybis F tctcaacccaatggcctgcca (SEQ ID NO:117)
R ctccagcggctgagtgttac (SEQ ID NO: 118)
Ais F Actggcgctcgctgcaattgc (SEQ ID NO:119)
R actggcgctcgctgcaattgc (SEQ ID NO:120)
Eco F acctgcagtattgtttgccgc (SEQ ID NO:121)
R ttcccgccgagacgatgcaa (SEQ ID NO:122)
glpQ F ctgcaaaaacgcaacggaggc (SEQ ID NO:123)
R agataatccgctccctgcgca (SEQ ID NO:124)
mdoG F tgcgttggttgagtgctgcag (SEQ ID NO:125)
R gtcttcagattgttccagtacgc (SEQ ID NO:126)
mltA F gaaaggacgttgggtaaagtacc (SEQ ID NO:127)
R cagacgcggtgacgaattacg (SEQ ID NO:128)
proX F acttttgctgccgatctgccg (SEQ ID NO:129)
R ttcacggcggtgaaggttgca (SEQ ID NO:130)
ydcL F cggcttattggctctgtctgg (SEQ ID NO:131)
R cgacggtttcggtaccggata (SEQ ID NO:132)
glnH F tgcggtttcttctcatgccgc (SEQ ID NO:133)
R gcgccagatcgacgtttttgg (SEQ ID NO:134)
efeO F cattaacttccgccgtaacgca (SEQ ID NO:135)
R cactccagcgccttctggct (SEQ ID NO:136)
bglX F taggaatcgcggtgagtctggc (SEQ ID NO:137)
R -gccccaacctgaccgtctttg (SEQ ID NO:138)
agp F cgcaactgtggcagggatagt (SEQ ID NO:139)
R cacttcgagcacgccaccttt (SEQ ID NO:140)
ygdI F gactgccgcaattatttctgcct (SEQ ID NO:141)
R ctgatccagttcgaccatctctt (SEQ ID NO:142)
yncD F tccgtccgacagaccgttttg (SEQ ID NO:143)
R aaaccaggcacgctggtcagt (SEQ ID NO:144)
yncE F caagagcgtaacgatgattacgc (SEQ ID NO:145)
R cgtaggcacctttacctaccg (SEQ ID NO:146)
slp F ggtgcactcatcctcagcctt (SEQ ID NO:147)
R cagcgatttctaacaacgtatccg (SEQ ID NO:148)
artI F tctttccgccacagctgccga (SEQ ID NO:149)
R acggcttctacgcgacggaatt (SEQ ID NO:150)
yiaD F agtggtgctctggcggtatct (SEQ ID NO:151)
R atgtaataacccacgccgccg (SEQ ID NO:152)
ompX F gcatgtctttcagcactggcc (SEQ ID NO:153)
R gcagtacggcttttctcggtg (SEQ ID NO:154)
borD F ctgccgctctggcaatgctta (SEQ ID NO:155)
R ccgagcaatccatttacgaatgt (SEQ ID NO:156)
yhjJ F gcggtttgctgatgatggcca (SEQ ID NO:157)
R gcgtgactgtaaccgctctgt (SEQ ID NO:158)
emtA F catgactatacgaacccgccg (SEQ ID NO:159)
R cacgtccggaggttgaagctt (SEQ ID NO:160)
fecA F ctcgttcgactcatagctgaacacaac (SEQ ID NO:161)
R cgtccagcagttgttgcaggcc (SEQ ID NO:162)
nmpC F ggcaatttctgctgtagctgca (SEQ ID NO:163)
R gaccgaaaccagtcagttgatc (SEQ ID NO:164)
ompN F taattcctgccctgctcgcc (SEQ ID NO:165)
R tgtattcccattgaccgtagcca (SEQ ID NO:166)
lpp F gcgttcgatgcttctttgagcg (SEQ ID NO:167)
R acgcgtgacgcagtagcggtaaac (SEQ ID NO:168)
fhuA F gcgcgttccaaaactgctcag (SEQ ID NO:169)
R gtgccggtagctgactgtcg (SEQ ID NO:170)
gltI F ctcacaacgggtatccatgcg (SEQ ID NO:171)
R ctgaagattcacggtgaccgac (SEQ ID NO:172)
hisJ F ctggtgctatcgctctctctg (SEQ ID NO:173)
R cgcatccagcggattttcgac (SEQ ID NO:174)
lamB F tgtctgctcaggcaatggctg (SEQ ID NO:175)
R ggccacgttagtgtcgaaatag (SEQ ID NO:176)
malE F cgcatcctcgcattatccgca (SEQ ID NO:177)
R gccgcaacctgtgggaatttc (SEQ ID NO:178)
malM F agcgcgcctggaattagcctt (SEQ ID NO:179)
R agttcgccaatgtttgccggg (SEQ ID NO:180)
ygiW F taatcgcagtaatggccctgtg (SEQ ID NO:181)
R gaacacgtagagatcgtcagaga (SEQ ID NO:182)
cirA F gggctgtgtttgtccgctatttc (SEQ ID NO:183)
R cgtcagttgtacgccaggcac (SEQ ID NO:184)
fepA F cattccctggccttgttggtc (SEQ ID NO:185)
R tggcatggtacggatgatctc (SEQ ID NO:186)
loiP F tggcaacggtactgaccggtt (SEQ ID NO:187)
R tgttgcctagcgcattggcaata (SEQ ID NO:188)
kpsD F tactgattgccgcctgtcacg (SEQ ID NO:189)
R cgctggtgccgttgaaaagttg (SEQ ID NO:190)
degP F gcgttatctgttaatcgagact (SEQ ID NO:191)
R ccttctacgttaatgctgaccac (SEQ ID NO:192)
yjeI F caacgaattgagtgctgccgg (SEQ ID NO:193)
R ccataaatcacgttaccgcccatt (SEQ ID NO:194)
mipA F cgtagcgcacgctgaaggtaa (SEQ ID NO:195)
R gtaaagcggcgaccagtaagc (SEQ ID NO:196)
ecnB F tctcccgcgctgccagctaat (SEQ ID NO:197)
R cacgcgtggtgttgcaggcag (SEQ ID NO:198)
surA F ccacgtaatccgcagtgcgg (SEQ ID NO:199)
R gttgctgccttgcctgagcag (SEQ ID NO:200)
bamC F ctggcaaaggttgcgggtgtt (SEQ ID NO:201)
R atgtccagcgccttaccgaca (SEQ ID NO:202)
nlpD F gcccaaaattcaccgttcgcc (SEQ ID NO:203)
R ggctgctgtaccggctgaatt (SEQ ID NO:204)
rcsF F aatatcattcaggacgggcgctt (SEQ ID NO:205)
R ttcggttttgcaggctccgct (SEQ ID NO:206)
rlpA F atctgcatcgcggcaggaatg (SEQ ID NO:207)
R cgagacggatcctgcacgatt (SEQ ID NO:208)
phoE F aagagcactctggcattagtggt (SEQ ID NO:209)
R ccataaccagtcagttgatcgttaa (SEQ ID NO:210)
pal F caggtcaaattccctgcctgg (SEQ ID NO:211)
R ttcgcatccataccagtgccg (SEQ ID NO:212)
potD F tgatggttattgccagccagctt (SEQ ID NO:213)
R ccggtttctttggtgaactgttc (SEQ ID NO:214)
oppA F agagaagtttagtagcagctggc (SEQ ID NO:215)
R tcgctgaccagtaagccttcaaa (SEQ ID NO:216)
fkpA F acaatggccgttgccctgcat (SEQ ID NO:217)
R tcctgaacaccagcgatcagc (SEQ ID NO:218)
ppiA F gatggctgctgttttcgctcttt (SEQ ID NO:219)
R aagccaggaatgacgcggtga (SEQ ID NO:220)
ybaY F gttggcggcttgcgcagataa (SEQ ID NO:221)
R tgacggtgcatcggctaacg (SEQ ID NO:222)
bamE F tggcatgacgcaacaacaagttg (SEQ ID NO:223)
R gttaccactcagcgcaggtttg (SEQ ID NO:224)
tsx F acattactggcagccggtgc (SEQ ID NO:225)
R cataaccatagaagtcgaaccag (SEQ ID NO:226)
yggE F aagcttgcctccagaggtcct (SEQ ID NO:227)
R gcaagagtggcaatgtctggc (SEQ ID NO:228)
skp F aggcgatcaatataagatcgccg (SEQ ID NO:229)
R accggttttctgcgctacctg (SEQ ID NO:230)
osmE F gaacaagaatatggcaggaattctg (SEQ ID NO:231)
R caggatgtaggtctggcaagta (SEQ ID NO:232)
yhcN F ccactgttgctgcattaagcgta (SEQ ID NO:233)
R caccgctacgagcttcagtaat (SEQ ID NO:234)
ygdR F aacagactattatcataggtgagcc (SEQ ID NO:235)
R cttgctgatcgtgataactcacc (SEQ ID NO:236)
yceI F tcgcgtccctgatgttctctg (SEQ ID NO:237)
R gtgattagtatcgacgctggtg (SEQ ID NO:238)
cpoB F gtcgtgcggtactggtttact (SEQ ID NO:239)
R tcagaaagttgttgctggagttg (SEQ ID NO:240)
bhsA F aacgtaaaaaccctcatcgctgc (SEQ ID NO:241)
R gtaatacggaaagattttgcgccc (SEQ ID NO:242)
yfeY F tgcactccaagcaacgttattga (SEQ ID NO:243)
R tgcagtggtgtggacgccgt (SEQ ID NO:244)
ydgH F agcttaagaacaccctcctgg (SEQ ID NO:245)
R gtcgacaacataaaaagaggcgg (SEQ ID NO:246)
yajG F cgttagttgctctgtttatgcttg (SEQ ID NO:247)
R ggaggcggtcagggtaacg (SEQ ID NO:248)
yifL F cgccttctcctgcgatgatag (SEQ ID NO:249)
R ccgtggattgcgtttgcgtct (SEQ ID NO:250)
lpoA F cgtttgaaagccgcgcgttgt (SEQ ID NO:251)
R cccggttttaccttctttcacca (SEQ ID NO:252)
nlpE R caggctggcatcgaaagcaca (SEQ ID NO:253)
F gcatcggtttcagttcggcag (SEQ ID NO:254)
pldA F ggactctgcagggctggttgt (SEQ ID NO:255)
R cgctggtttgggtgtaaatgagg (SEQ ID NO:256)
yghJ F gcggctattttgagcgcaacc (SEQ ID NO:257)
R caggatcaggtatcggttctggc (SEQ ID NO:258)
ydeN F ctggcatctggtatggctgca (SEQ ID NO:259)
R gggtcaaaagatcccttatcaaaagg (SEQ ID NO:260)
prc F cgcgtgctgatcaaattccgg (SEQ ID NO:261)
R tcgcgaactgttcaacatcgctt (SEQ ID NO:262)
slyB F gtcggttgtgttaataacgacacc (SEQ ID NO:263)
R gttccgccaccaacagtattcc (SEQ ID NO:264)
lpoB F gcgcacaaagtcagactttatct (SEQ ID NO:265)
R cgggatcgtcggcaccgag (SEQ ID NO:266)
yfhG F cattgctgggttgcgtgcaga (SEQ ID NO:267)
R gcgactgcgcaggcattaaac (SEQ ID NO:268)
ushA F ggcgtggcgttagcgctgtta (SEQ ID NO:269)
R cagccgcaacctctttgcggat (SEQ ID NO:270)
mdoD F ccagaaggactcactttcaggtatgg (SEQ ID NO:271)
R gtttgcgctaagtcgtgcgcc (SEQ ID NO:272)
treA F gcagctagtgcgatcctgaacta (SEQ ID NO:273)
R cggctgtggtgttaccggtgt (SEQ ID NO:274)
bcsC F ccctgtttggacaaggctggg (SEQ ID NO:275)
R tcgcttcgcctaaccgaacttgc (SEQ ID NO:276)
ftsP F ggggaacactttcctgcacgg (SEQ ID NO:277)
R taaacagcggttgcccacggc (SEQ ID NO:278)
ptrA F gggcacccttaagtcaggcag (SEQ ID NO:279)
R gatcttccagcgacccaacgg (SEQ ID NO:280)
dsbC F ctttgttagcggcgttttcagg (SEQ ID NO:281)
R agccgtgccgctaacgtcata (SEQ ID NO:282)
fadL F cctacacttcgcgctcctgtt (SEQ ID NO:283)
R tgcgccttcccctgaataagc (SEQ ID NO:284)
degQ F tcattcaggtacgagagcagg (SEQ ID NO:285)
R ttccttccacccgtacgctca (SEQ ID NO:286)
artJ F gacagacgggagttccatcatg (SEQ ID NO:287)
R cattctgcctgcatttgtttgcacaag (SEQ ID NO:288)
yraP F tgggtaccaaagccgcaactg (SEQ ID NO:289)
R ttggcaccgtctacgcccata (SEQ ID NO:290)
bamB F tactgctgccaggactgctttc (SEQ ID NO:291)
R gtccgctgcatagacaacgttgt (SEQ ID NO:292)
mlaC F cagctgctgcgccaggtaataa (SEQ ID NO:293)
R gcggttgctcattcttcaggc (SEQ ID NO:294)
mlaA F agcttcgcctgtcggcgctt (SEQ ID NO:295)
R caaaccgttacgcgccggttg (SEQ ID NO:296)

Quantification of the OMVs released in the culture supernatant by each mutant strain



[0041] To establish the amount of OMVs released by each mutant, each strain was grown in triplicate in 200 ml LB medium (starting OD600 = 0.05) and, when the cultures had reached an OD600 = 1, OMVs were collected from culture supernatants by filtration through a 0.22 µm pore size filter (Millipore) followed by high-speed centrifugation (200,000 x g for 2 hours). Pellets containing OMVs were finally resuspended in 1x PBS and quantified by using nanodrop (Thermo Fisher). Figure 1 shows the amount of OMVs purified from each mutant as average of the three independent experiments. As shown, all mutants released an amount of OMVs superior to the 10 mg/L produced by progenitor strain BL21(DE3)ΔompA. In particular, the OMVs productivity varies from 15 mg/L to 35 mg/L in the case of E. coli OMV_MUT57.

[0042] To evaluate the quality of the OMVs, 20 µg of each OMV preparation were added to sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) Laemli buffer and heated at 100°C for 5 minutes. Proteins were separated by 4-12% or 10% SDS-PAGE (Invitrogen), run in MES buffer (Invitrogen) and finally stained with Coomassie Blue. As shown in figure 3, in all OMV preparations no high molecular weight bands were visible, and this is a typical indication that no major cell lysis has occurred during the growth of the strains. In addition, a progressive disappearance of some protein bands is evident, in line with the increasing number of inactivated genes.

Gene inactivation results in the reduction of OMV protein content



[0043] Since the inactivated genes encode proteins belonging to the periplasmic and outer membrane compartment, the successful inactivation of each gene should result in the progressive reduction of OMV protein content. The disappearance of proteins from the OMV compartment can be appreciated by comparing the total protein content of the OMVs purified from the different mutants and run on the SDS-PAGE shown in Figure 3. To further demonstrate the elimination of proteins from OMVs as a consequence of gene inactivation the proteome profile of OMVs from BL21(DE3)ΔompA and E. coli OMV_MUT57 was analyzed by 2D electrophoresis. OMV samples were resuspended in a 2-DE buffer containing 7 M Urea, 2 M Thiourea, 4% (w/v) CHAPS, 1% (w/v) DTE, and 2% (v/v) TritonX100. 500 µg of proteins were diluted in 350 µl of denaturation buffer and 0.2% or 2% (v/v) IPG-buffer (pH 3-10; GE Healthcare, Uppsala, Sweden). 2-DE was performed as previously reported (Fantappie' et. al (2017) Mol.Cell.Proteomics 16:1348-1364). The first dimension (IEF, IsoElectricFocusing) was run using the Ettan™ IPGphor unit (GE Healthcare) and non-linear wide-range IPG (Immobilized pH gradient) strips (pH 3-10; 18 cm; GE Healthcare) were rehydrated, at 16°C, with protein samples in the strip holders for 1h at 0 V and overnight at 30 V. Successively, proteins were focused applying the following voltage steps as previously described (Fantappie' et. al (2017) Mol.Cell.Proteomics 16:1348-1364). After IEF, strips were equilibrated for 12 minutes in reducing buffer (6 M urea, 30% (v/v) glycerol, 2% (w/v) SDS, 0.05 M Tris-HCl pH 6.8, 2% (w/v) DTE), and then for further 5 min in an alkylating buffer (6 M urea, 30% (v/v) glycerol, 2% (w/v) SDS, 0.05 M Tris-HCl pH 6.8, 2.5% (w/v) iodoacetamide, and bromophenol blue in trace). Focused strips were placed on house-made 9-16% polyacrylamide linear gradient gels (18 cm x 20 cm x 1.5 mm) and proteins were separated at 10°C setting 40 mA/gel constant current. Gels were stained with MS-compatible silver staining.

[0044] In Figure 4, representative silver stained 2-DE gels of OMVs from BL21(DE3)ΔompA (A) and from E. coli OMV_MUT57 (B) are shown. From Figure 4 it can be easily appreciated that a substantial number of spots disappeared from the 2D map of OMVs from E. coli OMV_MUT57.

[0045] In order to detect the statistically significant quantitative and qualitative differences, image analysis was performed on three different spot maps from three OMVs preparations using the ImageMaster 2D Platinum v.6.0 software (GE Healthcare). Quantitative differences were considered significant only when the ratio of mean percentage relative volume (%V= V single spot/V total spots), between the two sample sets, was at least ± 2 fold and satisfied statistical analysis with two-tailed Student's t-test score less than 0.05. As shown in Table 6 and Table 7 a considerable number of proteins spots emerged as significantly different in either quantitative or qualitative terms between the two OMVs preparations. The tables also report the names of the proteins as identified by Mass Spectrometry analysis, performed as already described (Fantappie' et. al (2017) Mol.Cell.Proteomics 16:1348-1364) using an Ultraflex III MALDI-TOF/TOF mass spectrometer (Bruker Daltonics, Billerica, MA), equipped with a 200 Hz smartbeam™ I laser. Mass spectra were acquired in reflector positive mode with a laser frequency set to 100 Hz and protein identification was carried out in SwissProt database using the on-line available Mascot software (Matrix Science Ltd., London, UK, http://www.matrixscience.com).
Table 6: MS identified protein spots that significantly change in abundance between E. coli ΔOmpA and E. coli-OMV _MUT57
Spot N.Protein descriptionUniProt nameaMascot search resultsMean % V ± SD × 10-4 bFold change ΔOmpA/MUT57T-teste
ScoreN. of matched peptidesSequence coverage (%)BL21(DE3)Δ0mpAE. coli OMV_MUT57
583 Outer membrane protein TolC TOLC_ECOLI 253 20/30 44 3515±261 11613±1819 -3.30 0,001582012
617 Periplasmic pH-dependent serine endoprotease DegQ DEGQ_ECOLI 169 10/10 30 1399±206 3800±260 -2.15 0,001102484
622 Outer membrane protein TolC TOLC_ECOLI 102 8/13 22 7511±368 99±78 7.55 0,039899155
654 Chaperone SurA SURA_ECOLI 139 10/13 27 635±45 3408±420 -5.37 0,000342421
655 Chaperone SurA SURA_ECOLI 98 7/9 17 330±129 2551±149 -7.73 4,09376E-05
658 Chaperone SurA SURA_ECOLI 99 6/6 14 145±45 2512±348 -17.31 0,000308088
659 Chaperone SurA SURA_ECOLI 343 34/60 65 5517±498 11507±828 -2.08 0,000427214
762 Bifunctional polyhydroxybutyrate synthase/ABC transporter periplasmic binding protein SURA_ECOLI 134 9/13 37 226±33 588±61 -2.60 0,000819979
783 Minor capsid protein E WP_024748468.1 204 16/27 48 2976±388 622±76 4.78 0,000499047
843 Outer membrane protein assembly factor BamC BAMC_ECOLI 165 13/21 47 1063±260 6852±1497 -6.45 0,002729187
874 Sulfate-binding protein SUBI_ECOLI 97 6/7 14 749±59 1854±94 -2.47 6,71282E-05
878 Outer membrane protein assembly factor BamC BAMC_ECOLI 100 9/20 40 3732±501 11443±536 -3.07 5,36343E-05
970 ABC transporter periplasmic-binding protein YphF YPHF_ECOLI 100 7/13 33 226±46 725±156 -3.20 0,006016959
991 ABC transporter periplasmic-binding protein YtfQ YTFQ_ECOLI 81 8/24 23 1351±232 4170±133 -3.09 5,31535E-05
1028 Glutamate/aspartate import solute-binding protein GLTI_ECOLI 221 18/31 69 1564±383 5611±2600 -3.59 0,055956672
1031 Glutamate/aspartate import solute-binding protein GLTI_ECOLI 170 14/18 38 1464±149 4543±1278 -3.10 0,014344153
1076 Lysine/arginine/ornithine-binding periplasmic protein ARGT_ECOLI 145 10/18 41 1944±418 5045±637 -2.59 0,00213518
1104 Outer membrane protein assembly factor BamD BAMD_ECOLI 124 9/13 31 288±100 1727±628 -5.99 0,017244485
1124 MltA-interacting protein MIPA_ECOLI 99 8/11 35 1693±584 7607±2039 -4.49 0,008470313
1135 Probable phospholipid-binding protein MlaC MLAC_ECOLI 162 12/24 45 497±74 224±144 2.22 0,043301085
1177 Class B acid phosphatase APHA_ECOLI 70 4/5 13 224±21 1210±3 -5.41 1,34924E-07
1182 Class B acid phosphatase APHA_ECOLI 70 4/5 14 129±17 1363±35 -10.58 6,92073E-07
1321 Outer-membrane lipoprotein carrier protein LOLA_ECOLI 167 10/12 49 1515±100 3242±896 -2.14 0,029400485
1322 Lipopolysaccharide export system protein LptA LPTA_ECOLI 126 8/15 37 2409±139 4937±388 -2.05 0,000445675
1358 Major outer membrane prolipoprotein Lpp LPP_ECOLI 69 5/11 48 404±16 1434±348 -3.55 0,006870082
1379 Thioesterase 1/protease 1/lysophospholipase L1 TESA_ECOLI 92 5/6 29 495±24 1097±111 -2.21 0,000778907
1381 Outer membrane protein YfaZ YFAZ_ECOLI 91 7/16 51 584±71 3423±524 -5.86 0,00074402
a) UniProt entry name.
b) Each value represents the mean±SD of individually computed %V in spot maps from OMVs of BL21(DE3)ΔompA and from OMVs of E. coli OMV_MUT57.
c) Only protein spots showing both statistical reliability according two-tailed T-test (p≤0.05) and, at least, 2 fold change in abundance are listed as significant differences.
Table 7: MS identified protein spots detected in OMVs from E. coli ΔOmpA and not in OMVs from E. coli-OMV_MUT57
Spot N.Protein descriptionUniProt nameaMascot search resultsMean %V ± SD x 10-4b
ScoreN. of matched peptidesSequence coverage (%)BL21(DE3)ΔompAE. coli OMV_MUT57
128 Cellulose synthase operon protein C BCSC_ECOLI 161 15/19 18 999±216 -
190 Protease 3 PTRA_ECOLI 316 29/34 27 2401±453 -
253 Ferrienterobactin receptor FEPA_ECOLI 318 34/67 56 10761±1466 -
258 Maltoporin LAMB_ECOLI 214 20/29 47 14837±7060 -
264 Ferrienterobactin receptor FEPA_ECOLI 104 13/29 21 1183±336 -
265 Ferrienterobactin receptor FEPA_ECOLI 319 27/36 46 3287±594 -
273 Periplasmic beta-glucosidase BGLX_ECOLI 100 8/10 13 827±110 -
274 Periplasmic beta-glucosidase BGLX_ECOLI 155 13/17 20 3334±259 -
284 Ferrienterobactin receptor FEPA_ECOLI 144 12/16 21 1429±280 -
317 Fe(3+) dicitrate transport protein FecA FECA_ECOLI 144 10/10 15 785±371 -
319 Tail-specific protease PRC_ECOLI 186 16/18 20 2739±247 -
320 Fe(3+) dicitrate transport protein FecA FECA_ECOLI 318 32/48 50 4054±823 -
321 Fe(3+) dicitrate transport protein FecA FECA_ECOLI 112 10/14 13 487±218 -
323 Ferrichrome outer membrane transporter/phage receptor FHUA_ECOLI 111 9/12 16 742±243 -
325 Ferrienterobactin receptor Ferrichrome outer FEPA_ECOLI 191 23/52 43 2413±852 -
membrane transporter/phage receptor FHUA_ECOLI 121 17/52 28
331 Probable TonB-dependent receptor YNCD_ECOLI 109 13/34 24 8452±500 -
YncD Ferrichrome outer membrane transporter/phage receptor FHUA_ECOLI 79 11/34 18
332 Ferrichrome-iron receptor FHUA_ECOLI 136 10/11 18 1264±352 -
394 Colicin I receptor CIRA_ECOLI 290 28/40 42 3503±889 -
395 Colicin I receptor CIRA_ECOLI 106 8/8 13 1893±630 -
514 Uncharacterized sulfatase YdeN YDEN_ECOLI 140 10/13 26 2505±185 -
517 Uncharacterized sulfatase YDEN_ECOLI 93 9/22 23 1827±587 -
YdeN Protein UshA USHA_ECOLI 86 9/22 20
519 Periplasmic trehalase TREA_ECOLI 131 10/14 22 724±244 -
520 Periplasmic oligopeptide-binding protein OPPA_ECOLI 103 8/12 19 198±57 -
524 Periplasmic oligopeptide-binding protein OPPA_ECOLI 182 14/21 34 1509±315 -
526 Periplasmic oligopeptide-binding protein OPPA_ECOLI 194 21/50 43 5891±554 -
527 Periplasmic oligopeptide-binding protein OPPA_ECOLI 168 14/24 31 344±24 -
529 Polysialic acid transport protein KpsD KPSD1_ECOLX 110 8/10 15 123±111 -
535 Glucans biosynthesis protein D OPGD_ECOLI 125 8/8 16 150±27 -
536 Glucans biosynthesis protein D OPGD_ECOLI 255 23/41 53 1640±159 -
541 Glucans biosynthesis protein D OPGD_ECOLI 116 9/8 16 78±7 -
589 Protein YhjJ YHJJ_ECOLI 235 19/27 45 2507±539 -
651 Maltoporin LAMB_ECOLI 196 21/47 60 13889±2535 -
652 Maltoporin LAMB_ECOLI 128 10/17 31 814±353 -
660 Maltoporin LAMB_ECOLI 110 11/19 28 1338±402 -
662 Maltoporin LAMB_ECOLI 190 22/49 51 2346±119 -
688 Glucose- 1 -phosphatase AGP_ECOLI 75 6/11 18 1397±469 -
690 Glucose- 1 -phosphatase AGP_ECOLI 138 17/37 34 4007±578 -
695 Deferrochelatase/peroxidase EfeB EFEB_ECOLI 109 7/8 15 328±76 -
752 Glycerophosphoryl diester phosphodiesterase GLPQ_ECOLI 141 14/29 37 6232±1129 -
757 Glycerophosphoryl diester phosphodiesterase GLPQ_ECOLI 154 12/18 34 1471±548 -
766 Maltose-binding periplasmic protein MALE_ECOLI 229 23/54 56 17912±3142 -
771 Maltose-binding periplasmic protein MALE_ECOLI 149 11/18 36 6318±1352 -
777 Maltose-binding periplasmic protein MALE_ECOLI 62 4/5 13 1323±908 -
778 Maltose-binding periplasmic protein MALE_ECOLI 128 10/17 26 1742±1093 -
779 Maltose-binding periplasmic protein MALE_ECOLI 104 7/9 18 2209±1168 -
806 Iron uptake system component EfeO EFEO_ECOLI 199 13/16 35 6455±730 -
895 Maltose operon periplasmic protein MALM_ECOLI 133 10/15 28 17803±3060 -
927 Uncharacterized protein YggE YGGE_ECOLI 107 8/11 22 340±20 -
969 FKBP-type peptidyl-prolyl cis-trans isomerase FkpA FKBA_ECOLI 123 8/11 20 1849±406 -
975 FKBP-type peptidyl-prolyl cis-trans isomerase FkpA FKBA_ECO57 154 10/15 44 2269±488 -
985 FKBP-type peptidyl-prolyl cis-trans isomerase FkpA FKBA_ECOLI 233 18/36 61 12068±3760 -
988 Probable L,D-transpeptidaseYbiS YBIS_ECOLI 154 12/20 49 4323±166 -
989 FKBP-type peptidyl-prolyl cis-trans isomerase FkpA FKBA_ECOLI 199 7/8 21 5716±801 -
992 Glutamate/aspartate import solute-binding protein GLTI_ECOLI 100 6/7 21 424±50 -
998 Phospholipase Al PA1_ECOLI 101 9/21 39 2198±446 -
1017 Histidine-binding periplasmic protein HISJ_ECOLI 286 24/48 86 4447±1143 -
1067 Nucleoside-specific channel-forming protein tsx TSX_ECOLI 101 10/30 31 6298±3313 -
1091 Putative ABC transporter arginine-binding protein 2 ARTI_ECOLI 292 22/39 70 4637±144 -
1115 ABC transporter arginine-binding protein 1 ARTJ_ECOLI 232 14/17 59 3102±301 -
1125 Metalloprotease LoiP LOIP_ECOLI 175 13/18 38 1530±162 -
1136 Glutamine-binding periplasmic protein GLNH_ECOLI 208 20/46 67 4330±493 -
1144 Lipoprotein NlpE NLPE_ECOLI 66 8/26 42 2099±317 -
1153 Probable phospholipid-binding lipoprotein MlaA MLAA_ECOLI 108 9/13 21 2138±426 -
1250 Uncharacterized lipoprotein YdcL YDCL_ECOLI 183 17/27 66 5619±564 -
1275 Protein YceI YCEI_ECOLI 148 8/11 48 1728±458 -
1307 Outer membrane protein X OMPX_ECOLI 180 12/28 56 2560±2232 -
1308 Outer membrane protein X OMPX_ECOLI 151 11/33 54 8131±1583 -
1378 Outer membrane protein slp SLP_ECOLI 85 7/17 45 574±79 -
1408 Ecotin ECOT_ECOLI 156 13/26 45 3757±118 -
1412 Osmotically-inducible putative lipoprotein OsmE OSME_ECOLI 67 5/11 37 6520±970 -
1417 Outer membrane protein X OMPX_ECOLI 186 12/25 54 13979±5761 -
1483 Protein YgiW YGIW_ECOLI 87 6/18 49 4883±414 -
1591 Lipoprotein bor, partial WP_033556683.1 108 5/9 92 8198±1436 -
2007 Long-chain fatty acid transport protein FADL_ECOLI 130 13/35 32 4436±895 -
2010 Glycine betaine/prolinebetaine-binding periplasmic protein PROXECOLI 124 10/23 43 4210±484 -
a) UniProt entry name.
b) Each value represents the mean±SD of individually computed %V in spot maps from OMVs of BL21(DE3)ΔompA and from OMVs of E. coli OMV_MUT57.

Heterologous antigens efficiently accumulate in the OMVs deprived of endogenous proteins



[0046] As already pointed out one important property of OMVs it that they can be manipulated in their protein content by genetic engineering. This feature was demonstrated for the first time by Kesty and Kuehn (N.C. Kesty and Kuhen M.J. (2004) J.Biol.Chem. 279, 2069-2076) and subsequently an increasing number of heterologous proteins have been successfully delivered to OMVs using a variety of strategies. For instance, heterologous antigens from Group A Streptococcus and Group B Streptococcus were delivered to the lumen of E. coli vesicles by fusing their coding sequences to the leader peptide of E. coli OmpA. (Fantappiè et al., (2014) Journal of Extracellular Vesicles, 3, 24015). More recently, we have shown that heterologous antigens can be delivered to the vesicular compartment by expressing them as lipoproteins in the OMV-producing strain (WO2015/144691, WO2006/024954, Fantappie' et. al (2017) Mol.Cell.Proteomics 16:1348-1364). Interestingly, lipoproteins can also serve as chaperones to deliver foreign polypeptides to the OMVs compartment, thus allowing the decoration of vesicles with a variety of polypeptides and their exploitation in different biotechnological applications, including vaccines and immunotherapy.

[0047] Therefore, it is important to demonstrate that the elimination of endogenous proteins has not affected the capacity of OMVs to be decorated with foreign antigens. To this aim three heterologous proteins, S. aureus LukE, FhuD2 and FhuD2-hFAT1 (WO2006/024954) were selected and their expression profile was analyzed in E. coli OMV_MUT57, the strain that carries all 58 gene inactivations. LukE is a S. aureus (Alonzo et al., (2013) PLoS Pathog.;9:e1003143; Reyes-Robles et al., (2013) Cell Host Microbe. Oct 16;14(4):453-9, Alonzo & Torres, (2014) Microbiol Mol Biol Rev. 2014 Jun;78(2):199-230), FhuD2 is a S. aureus antigen used vaccine studies (Bagnoli F. et al. (2015) Proc Natl Acad Sci USA 112:3680-5). FhuD2-FAT1 is a fusion constituted by FhuD2 and an immunogenic epitope of FAT1 protein found overexpressed in most colon cancers (Pileri et al. (2016) Br J Cancer 115:40-51). The construction of the plasmids pET_LukE, pET-FhuD2 and pET-FhuD2-D8-hFAT1-x3, encoding the LukE, FhuD2 and FhuD2-FAT1 fusion, respectively have been already described (WO2006/024954). The maps of the three plasmids is schematically reported in Figure 5, Figure 6 and Figure 7. The three plasmids were used to transform E. coli OMV_MUT57, yielding strains OMV_MUT57 (pET-LukE), OMV_MUT57 (pET-fhUD2), OMV_MUT57 (pET-fhUD2 hFAT1-3x). Proteins expression, OMV purification and analysis were carried out as described in previous sections. As shown in Figure 8, all three heterologous proteins accumulated in the OMV compartment of E. coli OMV_MUT57 with extremely high efficiency.

Heterologous antigens expressed as lipoproteins in E. coli OMV_MUT57 accumulate on the surface of OMVs with high efficiency



[0048] We have recently found that a number of heterologous proteins expressed in E. coli BL21(DE3)ΔompA as fusions to a lipoprotein leader sequence are lipidated and reach the outer membrane. More surprisingly, we discovered that some of these lipidated heterologous proteins not only reach the outer membrane but are also exposed on the surface of the cells and of OMVs. This is for example the case of fHbp from Neisseria meningitidis and of fHbp carrying passenger polypeptides fused at its C-terminus (Fantappie' et. al (2017) Mol.Cell.Proteomics 16:1348-1364; Grandi A. et al. (2017) Frontiers in Oncology, 7:253. doi: 10.3389/fonc.2017.00253). Also, fhuD2 from S. aureus and of FhuD2 carrying passenger polypeptides fused to its C-terminus were also transported to the surface of E. coli BL21(DE3)ΔompA (WO2006/024954). We tested whether the gene inactivations had somehow influenced the surface localization of lipidated heterologous proteins. To this aim the surface localization of three heterologous lipoproteins, FhuD2 and FhuD2-D8-hFAT1 described in the previous section, and fHbp-vIII was analyzed in E. coli OMV_MUT57. fHbp-vIII is a fusion protein constituted by the neisserial fHbp and the vIII variant peptide from EGFR receptor expressed in several tumors. The construction of fHbpvIII fusion has been described (Grandi A. et al. (2017) Frontiers in Oncology, 7:253. doi: 10.3389/fonc.2017.00253) and the map of the plasmid encoding the fusion is schematically reported in Figure 9. The three plasmids encoding lipidated FhuD2, FhuD2-hFAT1 and fHbp-vIII were used to transform E. coli OMV_MUT57 and E. coli BL21(DE3)ΔompA and single colonies of each transformation were used to inoculate 20 ml of LB cultures. The cultures were grown until the OD600 = 0.5 (2.5 x 108 CFU/mL) and expression of the proteins was induced by addition of 0.1mM IPTG and further incubation for 2 hours. Cells from 1 ml of each culture were harvested by centrifugation at 10,000 X g for 5 minutes at 4°C and resuspended in PBS + 1% BSA dilution buffer in order to obtain 2x107 CFU/ml cells. 50 µl were then dispensed in a round bottom 96 well plate. Primary antibodies against proteins of interest (EGFRvIII peptide, FhuD2 and D8-hFAT1) were diluted at 10 µg/ml and 5 µl of each dilution were added in the wells containing bacteria suspension and incubated 1 h on ice. Each well was then washed twice with 200 µl PBS + 1% BSA buffer. 20 µl of commercial FITC labeled secondary antibody diluted 1:200 in dilution buffer were added in each wells and incubated 1 h on ice. Each well was then washed twice with 200 µl PBS + 1% BSA buffer and the plate was centrifuged at 4,000 xg for 5 min. Samples were then resuspended in 2% formaldehyde solution, incubated 15 min at 4°C and then centrifuged at 4,000xg for 5 min. Samples were resuspended in 130 µl of PBS and data were acquired by using BD FACS Canto II. As shown in Figure 10, All three proteins were confirmed to be surface exposed in a fraction of E. coli BL21(DE3)ΔompA cells expressing the three antigens. Interestingly, the three proteins were also surface exposed in E. coli OMV_MUT57 but to a much higher level, as judged by the fact that almost all cells became positive to the antibody staining. This is a particularly useful property of E. coli OMV_MUT57 since many biotechnological applications, including vaccines, require the surface expression of heterologous proteins.














































































































































































































































Claims

1. The use of a gram-negative bacterium for the preparation of isolated outer membrane vesicles (OMVs), wherein said bacterium:

(a) is genetically modified by inactivation of:

(a1) the ompA gene
and

(a2) one or more of the following genes:
ybis, ais, eco, glpQ, mltA, proX, ydcL, glnH, efeO, bglX, agp, ygdI, yncD, slp, artI, yiaD, ompX, borD, yhiJ, emtA, fecA, nmpC, fhuA, hisJ, lamB, malE, malM, ygiW, cirA, fepA, loiP, yjeI, ecnB, rcsF, phoE, oppA, jkpA, ybaY, tsx, yggE, osmE, ygdR, yceI, bhsA, nlpE, pldA, yghJ, ydeN, ushA, mdoD, treA, bcsC, ftsP, ptra, fadL, artJ, mlaA;

(b) expresses heterologous proteins in the OMVs.


 
2. The use of a bacterium according to claim 1, wherein at least one, preferably at least 5, more preferably at least 10 and even more preferably all of the following genes are inactivated in addition to the ompA gene:
amB, malE, ompX, fkpA, malM, fepA, yncD, borD, oppA, glpQ, osmE, ycdO, tsx, ydcL, agp, cirA, fecA, ygiW, artI and hisJ.
 
3. The use of a bacterium according to claims 1-2, wherein the following genes do not carry gene-inactivating mutations:
mdoG, yncE, ompN, Ipp, gltI, kpsD, degP, mipA, surA, bamC, nlpD, rlpA, pal, potD, ppiA, bamE, skp, yhcN, cpoB, yfeY, ydgH, yajG, yifL, lpoA, prc, slyB, lpoB, yfhG, dsbC, degQ, yraP, bamB, mlaC.
 
4. The use of a bacterium according to claims 1-3, which is of the genus Escherichia, Pseudomonas, Neisseria or Shigella.
 
5. The use of a bacterium according to claim 4, which is E. coli.
 
6. The use of a bacterium according to claims 1-5, wherein the genes are inactivated by one of the following methods: point mutations which create a stop codon in the reading frame; deletions of one or multiple nucleotides which impair protein functions; complete deletion of the gene; or inactivation of the transcription and translation signals.
 
7. The use of a bacterium according to claim 1, wherein said heterologous proteins are localized in the lumen of OMVs or associated to the OMV membrane.
 
8. The use of a bacterium according to claim 7, wherein said heterologous proteins are bacterial, viral, parasitic or cancer proteins.
 
9. An outer membrane vesicle (OMV) isolated from a gram-negative bacterium as defined in claim 1.
 
10. An isolated outer membrane vesicle according to claim 9, carrying heterologous proteins which are localized in the lumen of the OMV or associated to the OMV membrane and which are bacterial, viral, parasitic or cancer proteins.
 
11. An isolated outer membrane vesicle according to claim 9, wherein the gram-negative bacterium is Escherichia coli.
 
12. An immunogenic composition comprising an outer membrane vesicle according to claims 9-11, optionally in combination with pharmaceutically acceptable adjuvants and excipients.
 
13. An outer membrane vesicle according to claims 9-11 or an immunogenic composition according to claim 12, for use in the stimulation of an immune response in a subject in need thereof.
 
14. An outer membrane vesicle or an immunogenic composition for use according to claim 11, wherein said subject is affected by an infectious or tumoral disease.
 
15. A method for preparing bacterial outer membrane vesicles (OMVs) which comprises:

i) culturing a mutant strain of a gram-negative bacterium as defined in claims 1-8 in conditions suitable for vesiculation;

ii) separating the OMVs from the culture medium;
and optionally

iii) purifying the isolated OMVs.


 
16. A method according to claim 15, wherein the OMVs are separated from the culture medium by filtration.
 
17. A method according to claim 16, wherein the OMVs are purified by centrifugation or ultrafiltration.
 




Drawing


































Search report












Search report




Cited references

REFERENCES CITED IN THE DESCRIPTION



This list of references cited by the applicant is for the reader's convenience only. It does not form part of the European patent document. Even though great care has been taken in compiling the references, errors or omissions cannot be excluded and the EPO disclaims all liability in this regard.

Patent documents cited in the description




Non-patent literature cited in the description