BACKGROUND OF THE INVENTION
Field of the Invention
[0001] This invention relates to mammals into which foreign DNA has been introduced, thereby
generating transgenic mammals. More specifically, the invention concerns generation
of transgenic mammals that have a decreased platelet count, megakaryocyte leukemia,
or both conditions.
Description of Related Art
[0002] Production of transgenic mammals involves the insertion of novel nucleic acid sequences
into one or more chromosomes of the mammal. The DNA is typically delivered to the
pronucleus of an egg where it is incorporated into the DNA of the embryo. This embryo
is then implanted into a "surrogate host" for the duration of gestation. The offspring
of the surrogate host are evaluated for the presence of the novel nucleic acid sequence(s).
[0003] Expression of the novel DNA sequence(s), or transgene(s), can confer a new phenotype
on the mammal. Depending upon the nucleic acid sequence(s) inserted and the level
of expression in the mammal, the mammal may become more or less susceptible to a particular
disease or series of diseases. Such transgenic mammals are valuable for
in vivo screening and testing of compounds that may be useful in treating or preventing the
disease(s), and/or for developing methods useful in diagnosing the disease.
[0004] Transgenic mammals have been described in the art. Wagner
et al., U.S. Patent No. 4,873,191 teach mammals containing exogenous DNA which has been
introduced by microinjection of the DNA into a mammalian zygote.
[0005] Leder
et al., U.S. Patent No. 4,736,866, teach a transgenic mammal whose germ and somatic cells
contain an activated oncogene sequence introduced into the mammal, or its ancestors,
early in development (the one-cell or fertilized embryo stage). Such transformation
results in the animal having a greater than normal chance of developing neoplasms.
[0006] Evans
et al., U.S. Patent No. 4,870,009, teach production of certain mammalian hormones by insertion
of a DNA construct into fertilized mammalian eggs and implanting the fertilized eggs
into a host mother for gestation. The DNA construct comprises a mammalian metallothionein
gene promoter sequence fused to the DNA sequence encoding the mammalian hormone of
interest. The blood of the transformed mammals then is collected and the hormone of
interest is isolated.
[0007] Noble
et al., WO 91/13150, published September 5, 1991, and Jat
et al.,
Proc. Nat'l. Acad. Sci. USA, 88:5096-5100 [1991], teach production of mice with a DNA construct that contains a mutant
SV40 large T antigen gene (the SV40 tsA58 mutant) linked to a major histocompatibility
complex I promoter (H-2Kb). The specific promoter is used to facilitate expression
of the transgene in a wide variety of tissues, and is induced by certain interferons.
These mice are used as a source for generating transformed cell lines.
[0008] Leder
et al., U.S. Patent No. 5,175,383, describe a male transgenic mouse expressing the int-2
gene in urogenital tissues resulting in benign prostatic hyperplasia or hypertrophy.
[0009] Krimpenfort
et al., U.S. Patent No. 5,175,384, describe a transgenic mouse with a decreased level of
mature T-cells.
[0010] Wagner
et al., U.S. Patent No. 5,175,385, describe a transgenic mouse expressing the human beta-interferon
gene.
[0011] Ravid
et al., Proc. Nat'l. Acad. Sci. USA, 88:1521-1525 [1991], discuss mice containing a transgene construct containing the platelet
factor 4 promoter ("PF4") linked to the beta-galactosidase gene, and Ravid
et al., Mol. Cell Biol.,
11:6116-6127 [1991], teach various domains of the PF4 promoter.
[0012] Palmiter
et al., Nature 316:457-460 [1985], teach the formation of choroid plexus tumors in mice that contain
the DNA sequence for the 72 base-pair repeat SV40 enhancer and large-T antigen. When
the SV40 enhancer element is not included in the DNA construct, other pathologies
are observed as well.
[0013] Brinster
et al., Cell 37:367-79 [1984], teach production of mice with a construct containing the SV40 early
region genes and a metallothionein fusion gene. Several of the mice developed choroid
plexus tumors, and/or thymic hypertrophy.
[0014] Thrombocytopenia, a decreased level of platelets in the blood relative to normal
levels for a given mammalian species, affects the blood clotting ability of afflicted
individuals. One manifestation of this disorder is increased bleeding. In addition,
thrombocytopenia is a common side effect in patients receiving chemotherapy. The only
currently available method for treating the disorder is platelet transfusion, a difficult
and inherently risky procedure.
[0015] Jackson,
Blood Cells,
15:237-253 [1989] describes a rat strain with a reduced platelet number.
[0016] Peters
et al., Blood,
76:745-754 [1990] describe an autosomal recessive mutation in mice that confers combined
anemia and thrombocytopenia on afflicted mice.
[0017] Megakaryocyte leukemia is a condition characterized by production of cancerous cells
that have phenotypic traits resembling megakaryocytes. Such leukemia is currently
treated by bone marrow transplants.
[0018] In view of the devastating effects of thrombocytopenia and megakaryocyte leukemia,
there is a need in the art for suitable animals that provide
in vivo model systems for studying the diseases and compounds that can be used to treat and/or
prevent the diseases.
[0019] Accordingly, it is an object of the invention to provide a transgenic mammal that
has a genotype which confers an increased proclivity towards thrombocytopenia and/or
megakaryocyte leukemia as compared to a non-transgenic mammal. Such mammals are useful
in screening compounds for treating these diseases, and for other purposes.
[0020] It is a further object herein to provide methods for preparing, and to prepare transgenic
mammals containing such genotypes.
[0021] Other such objects will readily be apparent to one of ordinary skill in the art.
SUMMARY OF THE INVENTION
[0022] This invention is based on the unexpected discovery that transgenic mice containing
a nucleic acid construct encoding the SV40 early region tsA58 mutant regulated by
the rat PF4 promoter unexpectedly develop varying levels of thrombocytopenia and/or
megakaryocyte leukemia. In accordance with this invention, the mice present a novel
and useful system for screening compounds useful for treating and/or preventing these
diseases.
[0023] In one preferred embodiment of the invention, a mammal containing a transgene and
its progeny are provided.
[0024] In another preferred embodiment, a mouse containing a transgene and its progeny are
provided.
[0025] In still another preferred embodiment, there is provided a method of preparing a
mammal with a decreased platelet level as compared to normal platelet counts for that
species of that mammal which comprises:
(a) introducing into a fertilized embryo a vector comprising nucleic acid encoding
the SV40 early region tsA58 mutant operably linked to a platelet precursor or megakaryocyte
promoter; and
(b) implanting the transformed embryo in a surrogate host. In an additional aspect
of this embodiment of the invention, the offspring can be screened for decreased platelet
counts.
[0026] In yet another preferred embodiment, there is provided a method of preparing mammals
exhibiting megakaryocyte leukemia which comprises:
(a) introducing into an embryo a vector comprising a nucleic acid sequence encoding
the SV40 early region tsA58 mutant operably linked to a platelet precursor or megakaryocyte
promoter; and,
(b) implanting the transformed embryo into a surrogate host. The offspring can be
screened for megakaryoctye leukemia.
[0027] In other preferred embodiments, cell lines derived from certain tissues of the transgenic
mammals such as bone marrow, lymph node and spleen are provided.
BRIEF DESCRIPTION OF THE DRAWINGS
[0028] Figure 1 is a diagramatic representation of the DNA construct integrated into the
genome of transgenic mice. The sequence comprises about 1.1 kb of the Sprague-Dawley
rat PF4 promoter sequence linked to the early region of the tsA58 mutation of SV40
viral genome.
[0029] Figure 2 depicts the nucleic acid sequence of a Sprague-Dawley rat PF4 promoter as
originally sequenced(SEQ ID NO:1).
[0030] Figure 3A depicts platelet counts of founder transgenic mice. Figure 3B shows platelet
counts of F2 mice hemizygous or homozygous for the transgene. Figure 3C shows acetylcholinesterase
activity (a marker for megakaryocytes) versus platelet count in F1 mice.
[0031] Figure 4 depicts a comparison of the Fisher rat (bottom sequence) and Sprague-Dawley
rat (top sequence) PF4 promoter sequences. The sequences have been aligned in a manner
to maximize their homology. The nucleic acid sequence differences are indicated.
DETAILED DESCRIPTION OF THE INVENTION
[0032] The following terms, as defined below, are used to describe the invention:
As used herein, the term "vector" refers to nucleic acid sequence, arranged in
such an order and containing appropriate components such that they are taken up into
cells or can be inserted into cells through microinjection or other techniques. Such
sequences may or may not naturally be present in the cell, either in whole or in part.
Typically, the vector contains a promoter or promoters, a structural gene of interest
that is to be transferred and expressed in the cell or organism (host) transfected
with the vector, and other elements necessary for gene transfer and/or expression
in the host such as sequences enabling the processing and translation of the transcription
sequences, including translation initiation and polyadenylation sequences. In the
present invention, the vector used may be circular or linear, and is preferably linear
for insertion into embryos to generate a transgenic mammal.
[0033] As used herein, the term "promoter" refers to a nucleic acid sequence that regulates
the transcription of its corresponding nucleic acid coding sequence or structural
gene. The term "promoter" in the context of the present invention may include enhancer,
repressor, transcription initiation site(s) and other such elements involved in the
overall functioning of the promoter in regulating transcription of the corresponding
structural gene. Preferred promoters of this invention include those promoters primarily
active in platelet precursor cells, megakaryocytes, and/or megakaryocyte precursor
cells such as, for example, the PF4 promoter (Ravid
et al., 1992,
supra), and the MPL promoter (Wendling
et al.,
Blood 80:246a [1992]).
[0034] As used herein, the term "operably linked" refers to the orientation of the promoter
with respect to the structural gene(s) of interest along the vector. The promoter
is placed in such a position that it is capable of controlling or regulating the expression
of the structural gene(s).
[0035] The terms "platelet precursor promoter" and "megakaryocyte promoter" refer to promoters
that are active, (
i.e., capable of driving expression of the structural genes to which they are operably
linked), primarily in platelet precursor cells and/or megakaryocytes and megakaryocyte
progenitor cells. Such promoters may exhibit minimal acitivity in other tissues or
cell types.
[0036] The term "transgene" refers to a gene that is (1) either not naturally found in the
mammal to be genetically manipulated; (2) is a mutant form of a gene naturally found
in the mammal; (3) is a gene that serves to add additional copies of the same or a
similar gene that is found in the mammal; (4) is a gene directed to be expressed in
an abnormal lineage of cells; or (5) is a silent endogenous gene whose expression
is induced. By "mutant form" is meant a gene that contains one or more nucleotides
in the gene sequence that are different from,
i.e., substitutes for, the wild-type or natural sequence; alternatively, or additionally,
the gene may contain nucleotide insertions or deletions.
[0037] The terms "SV40 tsA58 early region", "SV 40 T antigen", and "tsA58 mutant" refer
to the nucleic acid encoding the simian virus early region genes, where the large
T antigen encoded in the early region nucleic acid sequence contains a mutation, the
tsA58 mutation, resulting in an altered activity as compared to the naturally occurring,
wild-type large T antigen gene, as described by Tegtmeyer,
J. Virol.,
15:613-618 [1975]. As used herein, these terms may be used interchangably to infer either
the large T antigen sequence of the SV40 early region, or the entire early region
sequence.
[0038] The term "mammal" refers to all non-human animals that belong to the class mammalia.
Preferably, the term includes all members of the class mammalia except humans. More
preferably, the term includes all strains of rodents such as rabbits, rats, mice,
and hamsters. Especially preferred for use in the invention are rats, hamsters and
mice. Most preferred are mice, especially those strains that provide high nuclear
yield, good pronuclear visibility, good
in vitro viability, and good reproductive fitness in the adult,
i.e., those considered to be healthy.
[0039] The terms "progeny" and "progeny of the transgenic mammal" refer to any and all offspring
of every generation subsequent to the originally transformed mammals.
[0040] The terms "founder line", "founder mice" and "founders" refer to those mammals that
are the mature product of the embryos to which the transgene was added by microinjection
or by other technique,
i.e., those mammals that grew from the embryos into which DNA was inserted, and that
were implanted into one or more surrogate hosts.
[0041] The term "thrombocytopenia" refers to a decreased platelet count in the blood relative
to a normal platelet count. Such a decrease is meant herein to include any level below
that determined as normal for the particular mammalian species of interest. Thrombocytopenia
may appear at any stage of the mammal's development, and may be temporary or permanent.
Where temporary, the disease may reappear at any time in the lifecycle of the mammal.
Thrombocytopenia may or may not be inherited by the offspring of those mammals affected
with it.
[0042] The terms "megakaryocyte leukemia" and "megakaryocytic leukemia" describe a condition
wherein a cell or cells of the mammal divide in an uncontrolled manner, resulting
in a pathological state. Such cells express markers of the megakaryocyte lineage including,
without limitation, the markers designated as platelet factor 4, von Willebrand factor,
and other proteins immunoreactive with antisera produced against platelets. In addition,
such cells may be morphologically identifiable as megakaryocytes using standard criteria
to identify such cells.
[0043] The term "mammalian cell line" refers to cells derived from tissues or tumors of
mammals that are able to survive and/or divide under appropriate culture conditions.
As used herein, this term includes all successive generations of the cells originally
derived from tissues or tumors.
[0044] The term "fertilized mammalian embryo" refers to the early zygote, especially a single
cell, resulting from the fusion of an oocyte and a sperm.
[0045] The terms "surrogate host" and "surrogate mother" may be used interchangably, and
refer to a mammal, preferably a female, that is implanted with a fertilized embryo
into which transgene(s) have been introduced. The surrogate host is typically of the
same or a similar species as the embryo, and is receptive to the embryos by appropriate
treatment with hormones where necessary and/or copulation with a vasectomized male.
As used herein, however, the terms are meant to include also a test tube, dish, and/or
incubator or other suitable instrument that may be used as a receptacle for embryo
maturation and development, either as a substitute for, or in addition to implantation
of the embryo into a mammal of the same or similar species.
A. Preparation of Constructs for Transformation
1. Selection of Transgene
[0046] The transgene of interest is selected for its ability to affect cell cycle control
and regulation, and/or its ability to promote growth and/or division of cells. The
simultaneous use of more than one transgene for insertion into a single embryo is
within the scope of this invention. A gene(s) that alters platelet levels in the mammal
into which it is introduced, and/or in the offspring of such mammals is the preferred
transgene(s) herein. The structural gene may be obtained from any source, including
viral, unicellular prokaryotic or eukaryotic organisms, vertebrate or non-vertebrate
mammals, or plants. If obtained from vertebrate mammals, the structural gene may be
from a homologous source (
i.e., a gene from one mouse implanted into another mouse), or from a non-homologous source
(
i.e., a structural gene from rabbit implanted into a mouse). The transgene may have additional
effects on the phenotype of the transgenic mammal, and these effects may be related
or unrelated to platelet levels. Preferred transgenes for use in the present invention
include
myc,
myb, E2F (Nevins, J.R.,
Science 258:424-429 [1992]),
abl,
ras,
pim.1,
src, E1A (Nevins,
supra), HPVE7 (human papilloma virus E7, Nevins,
supra), and SV40 early region, SV40 large T antigen, SV40 large T antigen tsA58 mutant,
and mutants and fragments thereof. More preferred genes include myc, E2F, SV40 early
region, and the SV40 early region tsA58 mutant. The most preferred gene is SV40 early
region tsA58 mutant.
2. Selection of Promoter
[0047] Promoters useful in practicing this invention are those that are highly regulated
with respect to activity, both temporally and spacially. Thus, the promoters of choice
are those that are active only in particular tissues or cell types, preferably platelets,
platelet precursor cells, and/or megakaryocytes. The source of the promoter may be
from any unicellular prokaryotic or eukaryotic organism, any vertebrate or invertebrate,
or any plant. Where the promoter is obtained from a mammal, the mammal may be homologous
(the same species as the mammal to be transfected) or non-homologous (a different
species). Preferred promoters of this invention are those expressed primarily in platelets
and platelet precursors such as megakaryocytes. Preferred for use in the present invention
are the PF4 promoter, the alpha-IIB integrin promoter (Marguerie
et al.,
7th International Symposium on the Biology of vascular Cells, p. 18, San Diego, CA [1992]),the glycoprotein GPIb promoter (Uzan
et al.,
J. Biol. Chem.,
266:8932-8939 [1991]), the platelet glycoprotein GPIIb promoter (Wenger
et al.,
Biochem.
Biophys.
Res.
Comm.,
166:389-395 [1988]), the promoter of the M2PTP gene (Plutzsky
et al.,
Proc. Nat'l. Acad.
Sci. USA,
89:1123-1127 [1992]) and the MPL promoter (Wendling
et al.,
Blood,
80:246a [1992]), all of which may be obtained from any source. Most preferred is the
rat PF4 promoter.
3. Other Vector Components
[0048] In addition to a promoter and one or more structural genes, the vectors of this invention
preferably contain other elements useful for optimal functioning of the vector in
the mammal into which the vector is inserted. These elements are well known to those
of ordinary skill in the art, and are described, for example in Sambrook
et al., Cold Spring Harbor Laboratory Press, 1989.
4. Construction of Vectors
[0049] Vectors used for transforming mammalian embryos are constructed using methods well
known in the art, including, without limitation, the standard techniques of restriction
endonuclease digestion, ligation, plasmid and DNA and RNA purification, DNA sequencing,
and the like as described, for example in Sambrook, Fritsch, and Maniatis, eds.,
Molecular Cloning: A Laboratory Manual., (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY [1989]).
[0050] A preferred vector for use in the invention is plasmid 4C, illustrated in Figure
1, and deposited in the ATCC, as noted below.
B. Production of Transgenic Mammals
[0051] The specific lines of any mammalian species used to practice this invention are selected
for general good health, good embryo yields, good pronuclear visibility in the embryos,
and good reproductive fitness. For example, when transgenic mice are to be produced,
lines such as C57/BL6 x DBA2 F1 cross, or FVB lines are used (obtained commercially
from Charles River Labs).
[0052] The age of the mammals that are used to obtain embryos and to serve as surrogate
hosts is a function of the species used, but is readily determined by one of ordinary
skill in the art. For example, when mice are used, pre-puberal females are preferred,
as they yield more embryos and respond better to hormone injections.
[0053] Similarly, the male mammal to be used as a stud will normally be selected by age
of sexual maturity, among other criteria.
[0054] Administration of hormones or other chemical compounds may be necessary to prepare
the female for egg production, mating, and/or reimplantation of embryos. The type
of hormones/cofactors and the quantity used, as well as the timing of administration
of the hormones will vary for each species of mammal. Such considerations will be
readily apparent to one of ordinary skill in the art
[0055] Typically, a primed female (
i.e., one that is producing eggs that can be fertilized) is mated with a stud male, and
the resulting fertilized embryos are then removed for introduction of the transgene(s).
Alternatively, eggs and sperm may be obtained from suitable females and males and
used for
in vitro fertilization to produce an embryo suitable for introduction of the transgene.
[0056] Normally, fertilized embryos are incubated in suitable media until the pronuclei
appear. At about this time, exogenous nucleic acid comprising the transgene of interest
is introduced into the female or male pronucleus. In some species such as mice, the
male pronucleus is preferred.
[0057] Introduction of nucleic acid may be accomplished by any means known in the art such
as, for example, microinjection. Following introduction of the nucleic acid into the
embryo, the embryo may be incubated
in vitro for varying amounts of time, or reimplanted into the surrogate host, or both.
In vitro incubation to maturity is within the scope of this invention. One common method is
to incubate the embryos
in vitro for 1-7 days and then reimplant them into the surrogate host.
[0058] Reimplantation is accomplished using standard methods. Usually, the surrogate host
is anesthetized, and the embryos are inserted into the oviduct. The number of embryos
implanted into a particular host will vary, but will usually be comparable to the
number of offspring the species naturally produces.
[0059] Transgenic offspring of the surrogate host may be screened for the presence of the
transgene by any suitable method. Screening is often accomplished by Southern or Northern
analysis, using a probe that is complementary to at least a portion of the transgene.
Western blot analysis using an antibody against the protein encoded by the transgene
may be employed as an alternative or additional method for screening. Typically, the
tissues or cells believed to express the transgene at the highest levels are tested,
although any tissues or cell types may be used for this analysis.
[0060] Alternative or additional methods for evaluating the presence of the transgene include,
without limitation, suitable biochemical assays such as enzyme and/or immunological
assays, histological stains for particular markers or enzyme activities, and the like.
Blood count data is useful for evaluation of thrombocytopenia.
[0061] Progeny of the transgenic mammals may be obtained by mating the transgenic mammal
with a suitable partner, or by
in vitro fertilization of eggs and/or sperm obtained from the transgenic mammal. Where
in vitro fertilization is used, the fertilized embryo may be implanted into a surrogate host
or incubated
in vitro, or both. Where mating is used to produce transgenic progeny, the transgenic mammal
may be backcrossed to a parental line. Using either method, the progeny may be evaluated
for the presence of the transgene using methods described above, or other appropriate
methods.
[0062] The transformed mammals, their progeny, and cell lines of the present invention provide
several important uses that will be readily apparent to one of ordinary skill in the
art. The mammals and cell lines are particularly useful in screening compounds that
have potential as prophylactic or therapeutic treatments for thrombocytopenia and/or
megakaryocyte leukemia.
[0063] In the case of transgenic mammals, screening of candidate compounds is conducted
by administering the compound(s) to be tested to the mammal, over a range of doses,
and evaluating the mammal's physiological reponse to the compound(s) over time. Administration
may be oral, or by suitable injection, depending on the chemical nature of the compound
being evaluated. In some cases, it may be appropriate to administer the compound in
conjunction with co-factors that would enhance the efficacy of the compound.
[0064] In screening cell lines for compounds useful in treating thrombocytopenia and/or
megakaryocytic leukemia, the compound is added to the cell culture medium at the appropriate
time, and the cellular response to the compound is evaluated over time using the appropriate
biochemical and/or histological assays In some cases, it may be appropriate to apply
the compound of interest to the culture medium in conjunction with co-factors that
would enhance the efficacy of the compound.
[0065] The invention will be more fully understood by reference to the following examples.
They should not be construed in any way as limiting the scope of the present invention.
EXAMPLES
A. Platelet Factor 4 (PF4) Promoter Cloning
[0066] An ∼1.1 kb fragment of the 5' region of the platelet factor 4 ("PF4") gene from a
Sprague-Dawley genomic DNA library was cloned by polymerase chain reaction (PCR) amplification
using the complementary oligonucleotides (SEQ ID No: 2) GCTTGAATTCCTTTACTCTGCG for
the 5' (distal end) and (SEQ ID No.: 3) GGAATTCAAGCTTGATATCCAAGGGCTACCTCGG for the
3' (proximal end). The resulting DNA fragment was digested with
EcoRI restriction endonuclease and the overlapping end of the DNA was made blunt with
the Klenow fragment of DNA polymerase using standard methods. This fragment was cloned
into the vector pBluescript II KS+ (Stratagene, La Jolla, CA) by digesting the pBluescript
vector with the restriction endonuclease
EcoRV and ligating the insert and the vector with DNA ligase. The resulting clones were
isolated and transformed into
E. coli DH5α cells for plasmid amplification. Plasmid was purified from the cells using the
standard alkaline lysis method. This clone was designated plasmid "4A". More than
20 differences between the published sequence from Fisher rat (Ravid
et al.[1991],
supra; SEQ ID No.: 5) and the sequenced clone (SEQ ID No.: 4) are identified. These differences
are identified in Figure 4.
B. tsA58 SV40 Cloning
[0067] A DNA fragment generated by
KpnI and
BamHI restriction enzyme digestion containing the wild-type SV40 virus early region was
ligated into the pBluescript II KS+ vector previously digested with the restriction
endonucleases
KpnI and
BamHI. This ligated vector containing the SV40 insert was then digested with
HpaI, removing a DNA fragment of ∼1.1 kb from position 3733 to 2666 of the SV40 early
region. The same fragment from an SV40 clone containing the tsA58 mutation (Alanine
to Valine at position 3505) described by Tegtmeyer,
supra, was ligated into the vector. The resulting vector was transformed into
E.coli DH5α cells for plasmid amplification. The desired plasmid was isolated from these
cells and was designated plasmid "4B".
C. PF4/tsA58 SV40 Fusion Gene
[0068] The 4A clone described above was digested with restriction enzymes
EcoRV and
SpeI, and the ∼1.1 kb fragment of the PF4 promoter containing fragment was isolated using
standard methodology. The overlapping end of this promoter fragment was blunted with
the Klenow fragment of DNA polymerase using standard techniques. Clone 4B was linearized
at position 5187 with the restriction enzyme
AvrII, blunted with the Klenow fragment of DNA polymerase, and the PF4 promoter containing
fragment was ligated into the site so that the direction of transcription of the PF4
promoter was the same as for the SV40 early region structural gene. The PF4 promoter
containing sequence is shown in Figure 2. This clone was designated plasmid "4C".
The resulting fusion gene was isolated from vector sequences with restriction enzymes
NotI and
EcoRI and injected into fertilized mouse embryos. Plasmid 4C is deposited at the ATCC
in transformed
E. coli DH5α cells and is available under the accession number ATCC 69182.
D. Preparation of Embryos and Microinjection
[0069] Pregnant mare's serum ("PMS"), supplying Follicle Stimulating Hormone ("FSH") was
administered to female mice of the strain BDF2 (Charles River Labs) about three days
prior to the day of microinjection. PMS (obtained from Sigma Chemicals) was prepared
as a 50 I.U./ml solution in Phosphate Buffered Saline and injected interperitoneally
at 0.1 ml (5 I.U.) per animal. Human Chorionic Gonadotropin ("HCG"), supplying Luteinizing
Hormone ("LH") was administered 45-48 hours after the PMS injections. HCG was also
prepared as a 50 I.U./ml solution in PBS and injected IP (intraperitoneally) at 0.1
ml per animal. Females were placed with stud males of the same strain immediately
after HCG injections. After mating, the females were examined for a vaginal copulation
plug. The appearance of an opaque white plug indicated a successful mating.
[0070] Successfully mated females were sacrificed by cervical dislocation, and both oviducts
were rapidly removed and placed in M2 medium (Hogan
et al., eds.,
Manipulating the Mouse Embryo: A Laboratory Manual, Cold Spring Harbor Laboratory Press, pp 249-257 [1986]). The oviducts were transferred
individually from M2 medium to PBS containing 300 µg/ml hyaluronidase (Sigma Corp.,
St. Louis, MO.) in a round bottom dissection slide. The embryos were teased out of
the oviduct and allowed to settle at the bottom of the slide as the cumulus cells
detached from the embryos. When the cumulus masses were disaggregated (about 5 minutes)
the embryos were transferred through two washes of M2 medium and the fertilized embryos
were separated from unfertilized and abnormal embryos. The fertilized embryos were
then transferred through 5% CO₂ equilibrated M16 medium (Hogan
et al.,
supra), placed in equilibrated microdrop dishes containing M16 medium under paraffin oil
and returned to the incubator.
E. Injection Procedure
[0071] Fertilized embryos were selected in M16 medium and incubated about 5 hours at 37°C
until the pronuclei appeared. Embryos were then transferred into M2 medium in a shallow
depression slide under paraffin oil and placed under the microscope. The pronuclei
were easily visible under 200X magnification. Using suction on the holding pipet,
a single embryo was selected and rotated such that the male pronucleus was away from
the holding pipet. Approximately 200 picoliter of solution containing the DNA construct
at about 1 microgram per ml was injected into the one of the pronuclei, preferably
the male pronucleus. Following the injection, the embryos were returned to incubation
for 18 hours and reimplanted the next day into foster pseudopregnant females (prepared
as described below and in Hogan
et al.,
supra, pp. 132-145).
F. Reimplantation
[0072] Reimplantations were performed on anaesthetized mice of strain C57/BL6 x DBA2 F1
cross using a dissecting microscope. A pseudo-pregnant female mouse was anaesthetized
with 0.017-0.020 ml/g body weight of avertin, injected IP. The mouse was placed under
the dissecting microscope and the incision area was disinfected with 70% ethanol.
The ovary was exteriorized and the bursal sac that surrounds the ovary and the oviduct
was carefully pulled open. The ovary and oviduct were separated to expose the opening
of the oviduct (termed the infindibulum). Surviving embryos were then removed from
the incubator and loaded into the reimplantation pipet. The tip of the pipet was inserted
several millimeters into the infindibulum and gentle pressure was used to deliver
the embryos into the oviduct. About 10 to 20 embryos were implanted per mouse, resulting
in a litter size of 5 to 12. The ovary then was returned to the peritoneum, and the
body wall and then the skin were sutured.
G. Identification of Transgenic Mice
[0073] Of 109 mice born after embryo injections, 20 contained the transgene as assayed by
specific PCR amplification using the oligonucleotides described in Section A above.
These results were confirmed by Southern analysis (Sambrook
et al., [1989]) using a DNA probe generated from the oligonucleotides used for PCR analysis.
These transgenic mice are termed the founder mice. Two of these mice died unexpectedly
after tail biopsies, having bled profusely. The remaining 18 mice were bled by tail
vein nick and the blood samples were placed into a tube containing EDTA powder.
H. Analysis of Blood Cell Content
[0074] Blood cell content of each transgenic founder mouse was analyzed using a Sysmex TM
Cell analyzer (TOA Medical Electronics, Kobe, Japan). Twenty microliters of blood
obtained from each mouse was added to manufacturer's diluent for analysis. Platelet
counts, white blood cell counts, red blood cell counts, and mean platelet volume were
all obtained on that instrument. All blood cell parameters were within the range observed
for the control (nontransgenic) littermate mice, except for the platelet counts. Normal
platelet counts for mice are 800,000-1,200,000 cells per microliter of blood. Platelet
counts of the transgenic mice are shown in Figure 3A. As is apparent, founder mice
PS14, PS27, PS77, PS81, and PS102 had platelet levels that were 5-25% of the controls;
founder mice PS2, PS7, PS64, PS71, and PS95 had platelet levels that were 25-60% of
the controls; and mice PS22, PS24, PS25, PS28, PS29, PS32, PS43, and PS61 had platelet
levels that were comparable to the levels of the control mice. Thus, the majority
of the transgenic mice had thrombocytopenia.
I. Production of F1 Generation Mice
[0075] To determine whether the platelet phenotype was directly correlated with the presence
and activity of the transgene construct, both hemizygous and homozygous F1 generation
transgenic mice were derived from all lines except PS28, PS43, and PS61. The F1 generation
was prepared by backcrossing each line to the C57/BL6 xDBA2 F1 cross mouse line.
[0076] A RNA/DNA hybridization assay (Hunt
et al.,
Blood 80: 904-911 [1992]) was performed on DNA obtained from tail tissue of each mouse. This
assay used both SV40 T antigen and mouse stem cell factor (SCF) RNA probes. The ratio
between the T antigen signal and the SCF signal was used to determine the zygosity
of the mice. Blood analysis was obtained for each mouse using the Sysmex TM system
as described above.
[0077] To assay the level of megakaryocytes in the transgenic F1 population, bone marrow
cells were obtained from lines PS2, PS7, PS14, PS22, PS25, PS29, PS32, and PS77. The
bone marrow cells were obtained by flushing marrow from the longbones of the hind
legs using Levine's CATCH buffer (Levine, A. and Fedorko, M.
J. Cell Biol.,
69:159 [1976]). These cells were stained for acetylcholinesterase, a marker for megakaryocytes
(Burstein et al.,
J. Cell.
Physiol.,
122:159-165 [1985]) and with May-Gruenwald Giesma stain. The results are shown in Figure
3C. As is apparent, there is a trend towards an inverse correlation between platelet
count in the blood and megakaryocyte cell count in the bone marrow.
[0078] In addition, the spleens from these mice were dispersed and stained for acetylcholinesterase
activity, and line PS14 was observed to contain about four times the number of acetylcholinesterase
positive staining cells as observed in the control mice.
[0079] Examination of peripheral blood smears from lines PS2, PS7, PS14, and PS77 indicated
reduced platelet levels as compared to controls, and also revealed the presence of
large agranular platelets. Bone marrow smears from the same lines indicated an abnormal
shape and size of the megakaryocytes.
J. Production of F2 Generation Mice
[0080] To examine the effect of gene dosage on the platelet phenotype, hemizygous F1 mice
were bred together and mice homozygous for the transgene were identified for lines
PS2, PS7, PS22, and PS29. Platelet counts were obtained for these mice. The platelet
counts are shown in Figure 3B where the solid boxes indicate hemizygosity for the
transgene, and hatched boxes indicate homozygosity for the transgene. With the exception
of line PS22, the homozygous mice exhibited a more severe platelet defciency phenotype
than did the hemizygous mice.
K. Identification of Megakaryocyte Leukemia
[0081] The cause of death of various transgenic mice was determined. Tissues from the PS22
line founder mouse were fixed and sectioned, and the presence of leukemic cells was
observed in liver, intestine, and spleen; many of the cells tested stained positive
with a polyclonal antibody directed against mouse platelets, and the nuclei of the
leukemic cells were immunoreactive for an antibody to SV40 T antigen.
[0082] In addition, mice of lines PS14, PS24, and PS71 died before eight months of age.
Necropsy of these animals revealed grossly enlarged spleens and mottled livers, suggesting
a leukemic pathology.
L. Production of Cell Lines
[0083] Transgenic mice are examined for a moribund appearance, indicating imminent death.
When such features as ruffled fur, decreased activity level, swollen abdomen, and/or
a palpable spleen are observed, the mice are euthanized and the spleen, bone marrow,
and lymph node tissues are removed. The tissues are immediately dispersed into suitable
media such as RPMI 1640 containing a serum supplement such as fetal calf serum at
5-25% (v/v), and appropriate growth factors including, without limitation, interleukin
3 and/or stem cell factor at appropriate levels. Incubation of the cells is at 33°C,
37°C or 39°C. The culture medium is changed regularly. After suitable time has elapsed
for the cells to separate, the cells are assayed for the presence of megakaryocyte
and/or platelet markers such as acetylcholinesterase (for megakaryocytes).
DEPOSITS
[0084] Plasmid 4C containing the Sprague-Dawley rat PF4 promoter linked to SV40 early region
tsA58 mutant was deposited in
E. coli host cells, under the terms of the Budapest Treaty, with DH5α the American Type Culture
Collection ("ATCC"), 12301 Parklawn Drive, Rockville, MD 20852, on January 7, 1993.
Samples of these cells are available to one skilled in the art under the accession
number ATCC 69182.