[0001] BACKGROUND OF THE INVENTION
[0002] The present invention provides novel bactericidal/permeability-increasing protein
products and stable pharmaceutical compositions containing the same.
[0003] Lipopolysaccharide (LPS), is a major component of the outer membrane of gram-negative
bacteria and consists of serotype-specific O-side-chain polysaccharides linked to
a conserved region of core oligosaccharide and lipid A. Raetz,
Ann. Rev. Biochem., 59:129-170 (1990). LPS is an important mediator in the pathogenesis of grain-negative
septic shock, one of the major causes of death in intensive-care units in the United
States. Morrison,
et al., Ann. Rev. Med. 38:417-432 (1987).
[0004] LPS-binding proteins have been identified in various mammalian tissues. Morrison,
Microb. Pathol., 7:389-398 (1989); Roeder,
et al., Infect., Immun., 57:1054-1058 (1989). Among the most extensively studied of the LPS-binding proteins
is bactericidal/permeability-increasing protein (BPI), a basic protein found in the
azurophilic granules of polymorphonuclear leukocytes. Human BPI protein has been isolated
from polymorphonuclear neutrophils by acid extraction combined with either ion exchange
chromatography [Elsbach,
J. Biol. Chem., 254:11000 (1979)] or
E. coli affinity chromatography [Weiss,
et al., Blood, 69:652 (1987)] and has potent bactericidal activity against a broad spectrum of gram-negative
bacteria.
[0005] While the BPI protein is cytotoxic against many gram-negative bacteria, it has no
reported cytotoxic activity toward gram-positive bacteria, fungi, or mammalian cells.
The amino acid sequence of the entire human BPI protein, as well as the DNA encoding
the protein, have been elucidated in Figure 1 of Gray,
et al., J. Biol. Chem., 264:9505 (1989), incorporated herein by reference (SEQ ID NOs: 1 and 2). The Gray
et al. publication discloses the isolation of human BPI-encoding cDNA from a cDNA library
derived from DMSO-induced cells of the human promyelocytic leukemia HL-60 cell line
(ATTC CCL 240). Multiple PCR amplifications of DNA from a freshly prepared cDNA library
derived from such DMSO-induced HL-60 cells have revealed the existence of human BPI-encoding
cDNAs wherein the codon specifying valine at amino acid position 151 is
either GTC (as set out in SEQ ID No: 1)
or GTG. Moreover, cDNA species employing GTG to specify valine at position 151 have
also been found to specify
either lysine (AAG) for the position 185 amino acid (as in SEQ ID Nos: 1 and 2)
or a glutamic acid residue (GAG) at that position.
[0006] A proteolytic fragment corresponding to the N-terminal portion of human BPI holoprotein
possesses the antibacterial efficacy of the naturally-derived 55 kDa human BPI holoprotein.
In contrast to the N-terminal portion, the C-terminal region of the isolated human
BPI protein displays only slightly detectable anti-bacterial activity. Ooi,
et al., J. Exp. Med., 174:649 (1991). A BPI N-terminal fragment, comprising approximately the first 199 amino
acids of the human BPI holoprotein, has been produced by recombinant means as a 23
kD protein. Gazzano-Santoro
et al., Infect. Immun. 60:4754-4761 (1992).
[0007] The projected clinical use of BPI products for treatment of gram-negative sepsis
in humans has prompted significant efforts to produce large quantities of recombinant
BPI (rBPI) products suitable for incorporation into stable, homogeneous pharmaceutical
preparations. For example, co-owned, co-pending U.S. Patent Application Serial No.
08/072,063 by Grinna discloses novel methods for the purification of recombinant BPI
products expressed in and secreted from genetically transformed mammalian host cells
in culture. Efficacy of the purification processes is therein demonstrated in the
context of products of transformed CHO cells which express DNA encoding the 31 amino
acid "leader" sequence of human BPI and the initial 199 amino terminal residues of
the mature protein (
i.e. corresponding to the amino acids -31 through 199 of SEQ ID NO: 2). Co-owned, co-pending
U.S. Patent Application Serial No. 08/064,693 by Theofan,
et al. is directed to novel, recombinant-produced BPI protein analog products resulting
from the expression of DNA encoding the BPI leader sequence and either 191 or 199
amino terminal residues of human BPI fused to DNA encoding a constant region of an
immunoglobulin heavy chain.
[0008] Efforts to produce pharmaceutical grade BPI products for treatment of gram negative
sepsis in humans have not yielded uniformly satisfactory results. A principal reason
for this is the nature of the amino acid sequence of human BPI and the nature of the
recombinant host cell environment in which the products are produced. As one example,
biologically-active rBPI products comprising the initial 199 residues of BPI [rBPI(1-199)]
produced as secretory products of transfected CHO host cells may be purified in good
yields. However, the isolated BPI products initially include dimeric forms of BPI
as well as cysteine adduct species. Moreover, BPI products may be unstable upon storage
at physiological temperature and pH, resulting in the formation of additional dimeric
and adduct species. Such dimeric and adduct species, while retaining biological activity,
are not preferred for incorporation into pharmaceutical preparations projected for
human use. Dimer formation and the formation of cysteine adducts are the probable
result of the fact that BPI includes three cysteine amino acid residues, all of which
are positioned within the biologically active amino terminal region of BPI,
i.e., at positions 132, 135 and 175. Formation of a single disulfide bond between two
of the three cysteines allows for dimer formation or formation of cysteine adducts
with the remaining free cysteine in the host cell cytoplasm and/or the cell culture
supernatant.
[0009] Even monomeric rBPI products display varying degrees of microheterogeneity in terms
of the number of carboxy terminal residues present in such products. For example,
it is difficult to detect full-length expression product in a medium containing host
cells transformed or transfected with DNA encoding rBPI(1-199). Instead, the expression
products obtained from such cells represent an heterogeneous array of carboxy-terminal
truncated species of the rBPI N-terminal fragment. In fact, the expected full-length
product (1-199) is often not detected as being among the rBPI species present in that
heterogeneous array. Heterogeneity of the carboxy terminal amino acid sequence of
rBPI(1-199) products appears to result from activity of carboxypeptidases in host
cell cytoplasm and/or culture supernatant.
[0010] An additional problem encountered in the preparation of pharmaceutical-grade BPI
products is the formation of macroscopic particles which decrease the homogeneity
of the product, as well as decreasing its activity. A preferred pharmaceutical composition
containing rBPI products according to the invention comprises the combination of a
poloxamer (polyoxypropylene-polyoxyethylene block copolymer) surfactant and a polysorbate
(polyoxyethylene sorbitan fatty acid ester) surfactant. Such combinations are taught
in co-owned, co-pending, concurrently-filed U.S. Patent Application, Serial No. 08/012,360
to have synergistic effects in stabilizing pharmaceutically-active polypeptides against
particle formation. Most preferred is a composition in which the rBPI product is present
in a concentration of 1 mg/ml in citrate buffered saline (0.02 M citrate, 0.15 M NaCl,
pH 5.0) comprising 0.1 % by weight of poloxamer 188 (Pluronic F-68, BASF Wyandotte,
Parsippany, NJ) and 0.002 % by weight of polysorbate 80 (Tween 80, ICI Americas Inc.,
Wilmington, DE).
[0011] There continues to be a need in the art for improved rBPI products suitable for incorporation
into stable homogeneous pharmaceutical preparations. Such products would ideally be
obtainable in large yield from transformed host cells, would retain the bactericidal
and LPS-binding biological activities of BPI, and would be limited in their capacity
to form dimeric species and cysteine adducts, and would be characterized by limited
variation in carboxy termini.
SUMMARY OF THE INVENTION
[0012] The present invention provides novel, biologically-active, recombinant-produced BPI
("rBPI") protein and protein fragment products which are characterized by a resistance
to dimerization and cysteine adduct formation, making such products highly suitable
for pharmaceutical use. Also provided are rBPI products characterized by decreased
molecular heterogeneity at the carboxy terminus. Novel DNA sequences encoding rBPI
products and analog products, plasmid vectors containing the DNA, host cells stably
transformed or transfected with the plasmids, recombinant preparative methods, stable
pharmaceutical compositions and treatment methods are also provided by the invention.
[0013] According to one aspect of the present invention, rBPI protein analogs are provided
which comprise a BPI N-terminal fragment wherein a cysteine at amino acid position
132 or 135 is replaced by another amino acid, preferably a non-polar amino acid such
as serine or alanine. In a preferred embodiment of the invention, the cysteine residue
at position 132 of a polypeptide comprising the first 199 N-terminal residues of BPI
is replaced by an alanine residue in a recombinant product designated "rBPI(1-199)ala
132". Also in a preferred embodiment of the invention, the cysteine at position 135 of
a BPI fragment comprising the first 199 N-terminal BPI residues is replaced by a serine,
resulting in a recombinant product designated "rBPI(1-199)ser
135". Highly preferred is a recombinant product designated "rBPI(1-193)ala
132" which is characterized by decreased heterogeneity in terms of the identity of its
carboxy terminal residue. Also in a preferred embodiment of the invention, a polypeptide
is taught which comprises the first 193 amino-terminal residues of BPI and which has
a stop codon immediately following the codon for leucine at position 193.
[0014] According to another aspect of the invention, DNA sequences are provided which encode
the above-described rBPI protein and protein fragment products, including analog products.
Such DNA sequences may also encode the 31-residue BPI leader sequence and the BPI
polyadenylation signal. Also provided are autonomously-replicating DNA plasmid vectors
which include DNA encoding the above-mentioned products and analogs as well as host
cells which are stably transformed or transfected with that DNA in a manner sufficient
to allow their expression. Transformed or transfected host cells according to the
invention are of manifest utility in methods for the large-scale production of rBPI
protein products of the invention.
[0015] The invention also contemplates rBPI protein analog products in the form of fusion
proteins comprising, at the amino terminal, rBPI protein analog products of the invention
and, at the carboxy terminal, a constant region of an immunoglobulin heavy chain or
an allelic variant thereof. Natural sequence BPI/immunoglobulin fusion proteins are
taught in the co-pending, co-owned U.S. Patent Application Serial No. 08/064,693 by
Theofan,
et al., the disclosures of which are incorporated herein by reference. The invention further
contemplates methods for producing the aforementioned fusion proteins.
[0016] Also within the scope of the present invention are DNA sequences encoding biologically-active
rBPI protein fragment products having from about 176 to about 198 of the N-terminal
amino acids of BPI. These DNAs allow for production of BPI products in eukaryotic
host cells, such as CHO cells, wherein the products display less heterogeneity in
terms of the carboxy terminal residues present. Presently preferred are DNAs encoding
193 N-terminal residues of BPI (
e.g., DNAs encoding the thirty-one amino acid leader sequence of BPI, the initial 193
N-terminal amino acids, and one or more stop codons). Most preferred are such DNAs
which additionally encode proteins wherein the cysteine at either position 132 or
135 is replaced (
e.g, rBPI(1-193)ala
132).
[0017] Finally, the present invention also provides stable, homogeneous pharmaceutical compositions
comprising the rBPI protein products of the invention in pharmaceutically acceptable
diluents, adjuvants, and carriers. Such pharmaceutical compositions are resistant
to the formation of rBPI product particles. Such compositions are useful in the treatment
of gram-negative bacterial infection and the sequelae thereof, including endotoxin-related
shock and one or more conditions associated therewith, such as disseminated intravascular
coagulation, anemia, thrombocytopenia, leukopenia, adult respiratory distress syndrome,
renal failure, hypotension, fever, and metabolic acidosis.
[0018] Numerous additional aspects and advantages of the invention will become apparent
to those skilled in the art upon considering the following detailed description of
the invention which describes presently preferred embodiments thereof.
BRIEF DESCRIPTION OF THE DRAWING
[0019]
Figure 1 represents results of SDS-PAGE analysis of rBPI(1-199) products.
Figure 2 represents results of SDS-PAGE analysis of rBPI(1-193) and rBPI(1-199)ala132 products.
Figure 3 depicts results of cation exchange HPLC analysis of rBPI(1-199) products.
Figure 4 shows results of cation exchange HPLC analysis of rBPI(1-199)ala132 products.
Figure 5 represents results of reverse phase HPLC run on rBPI(1-199) products.
Figure 6 represents results of reverse phase HPLC run on rBPI(1-199)ala132 products.
Figure 7 presents results of turbidity studies on pharmaceutical compositions containing
rBPI products with and without poloxamer/polysorbate surfactant ingredients at pH
7.0 and 57°C.
DETAILED DESCRIPTION
[0020] The following detailed description relates to the manufacture and properties of various
rBPI product preparations which comprise an amino acid substitution at a cysteine
residue and/or highly uniform carboxy termini. More specifically, Example 1 relates
to an exemplary means by which base substitutions are introduced in the nucleotide
sequence encoding an exemplary N-terminal fragment of the BPI protein and to the incorporation
of such mutated sequences into plasmid vectors. Example 2 addresses the incorporation
of vectors of Example 1 into appropriate host cells and further describes the expression
of recombinant BPI protein polypeptide products of the invention. Example 3 relates
to construction of DNAs encoding cysteine replacement analog products of the invention
and the use thereof in
in vitro transcription/translation procedures. Example 4 relates to properties of rBPI product
polypeptides of the invention.
EXAMPLE 1
Construction Of Vectors Containing BPI Cysteine Replacement Analogs
[0021] A.
Construction Of Plasmids pING4519 And pING4520
[0022] The expression vector, pING4503, was used as a source of DNA encoding a recombinant
expression product designated rBPI(1-199),
i.e., encoding a polypeptide having the 31-residue signal sequence and the first 199 amino
acids of the N-terminus of the mature human BPI, as set out in SEQ ID NOs: 1 and 2
except that valine at position 151 is specified by GTG rather than GTC and residue
185 is glutamic acid (specified by GAG) rather than lysine (specified by AAG).
[0023] Plasmid pING45O3 has been described in co-pending, co-owned United States Patent
Application Serial No. 08/064,693 by Theofan,
et al. which is incorporated herein by reference with respect to the background of the
invention. Briefly, the construction of pING45O3 is based on plasmid pING2237N which
contains the mouse immunoglobulin heavy chain enhancer element, the LTR enhancer-promoter
element from Abelson murine leukemia virus (A-MuLv) DNA, the SV40 19S/16S splice junction
at the 5' end of the gene to be expressed, and the human genomic gamma-1 polyadenylation
site at the 3' end of the gene to be expressed. Plasmid pING2237N also has a mouse
dihydrofolate reductase (DHFR) selectable marker. The DNA encoding rBPI(1-199), including
30 bp of the natural 5' untranslated region and bases encoding the 31 amino acid signal
sequence, as well as 199 N-terminal amino acids of BPI, is inserted between unique
SalI and
SstII restriction sites in pING45O3.
[0024] Two vectors, pING4519 and pING4520, were constructed based on pING45O3 for expression
of rBPI(1-199) cysteine replacement analogs in which one of the three naturally-occurring
cysteine residues of BPI was replaced with another amino acid. A
PvuII site (CAGCTG) which occurs only once in the DNA encoding rBPI(1-199), and which
is located between cysteine 132 and cysteine 135, was utilized in these constructions.
Because several additional
PvuII sites exist in pING45O3, it was first necessary to isolate the
SalI-
SstII fragment which contained the insert encoding rBPI(1-199) from pING4503 by digesting
with
SalI and
SstII. The purified
SalI-
SstII rBPI(1-199) insert was then digested with
PvuII, resulting in an approximately 529 bp
SalI-
PvuII fragment and an approximately 209 bp
PvuII-
SstII fragment, each of which was purified separately.
[0025] Plasmid pING4519 is identical to pING4503 except that pING4519 contains a DNA insert
encoding an rBPI(1-199) in which a codon for alanine is substituted for the codon
specifying the native cysteine at position 132. As noted above, the recombinant product
resulting from host cell expression and secretory processing of such an insert is
referred to as "rBPI(1-199)ala
132". In order to generate pING4519, BPI DNA sequences were PCR amplified from pING45O3
using the primers BPI-6: AAGCTTGTCGACCAGGCCTTGAGGT (SEQ ID NO: 3), which incorporated
a
SalI restriction site at the 5' end of the 30 bp BPI untranslated region, and BPI-14:
CTGGAGGCGGTGATGGTG (SEQ ID NO: 4), which incorporated one half of the
PvuII site and the base substitutions necessary to code for alanine at position 132.
PCR amplification was accomplished using the GeneAmp PCR kit (Perkin Elmer Cetus,
Norwalk, CT) according to the manufacturer's instructions. The resulting PCR fragment
was digested with
SalI, resulting in an approximately 529 bp
SalI-blunt fragment which was then used in a three-piece ligation, together with the
approximately 209 bp
PvuII-
SstII fragment described above and the large fragment resulting from
SalI and
SstII digestion of pING4503, to generate pING4519.
[0026] Plasmid pING4520 is identical to pING4519 with the exception that pING4520 contains
a DNA insert encoding an rBPI(1-199) analog in which a serine codon is substituted
for the codon specifying the native cysteine at position 135. As noted above, the
recombinant product resulting from host cell expression of such an insert is designated
"rBPI(1-199) ser
135". In order to generate pING4520, BPI DNA sequences were PCR amplified from pING4513,
a plasmid essentially similar to pING4503 except that the selection marker is
gpt instead of DHFR and the cDNA insert encodes the signal sequence and full-length BPI
(456 residues) instead of only the rBPI(1-199) portion.
[0027] Amplification by PCR was accomplished using primer BPI-15: CTCCAGCAGCCACATCAAC (SEQ
ID NO: 5), wherein the 5' end incorporates one half of a mutated
PvuII site (wherein "CTG" is changed to "CTC") and the base substitutions necessary to
code for seine at position 135; and primer BPI-7: GAACTTGGTTGTCAGTCG (SEQ ID NO: 6),
representing rBPI-encoding sequences located downstream of the region encoding BPI
residue 199. This PCR fragment was digested with
BstBI, which cuts downstream of the cysteine 135 mutagenesis site, and the resulting
approximately 100 bp blunt-
BstBI fragment was gel purified. A three piece ligation was then performed with the 529
bp
SalI-
PvuII BPI restriction fragment described above, the 100 bp blunt-
BstBI fragment, and a large fragment resulting from
BstBI-
SalI digestion of pING4503, to generate pING4520.
B. Construction Of Plasmid pING4530
[0028] Another vector, pING4530, was constructed which contained the alanine-for- cysteine
replacement as in pING4519, but which contained the
gpt selectable marker (allowing for mycophenolic acid resistance) instead of the DHFR
marker carried over from pING4503 to pING4519. To construct pING4530, a 1629 bp
SalI-
DraII restriction fragment was isolated from pING4519. This fragment included all of
the rBPI(1-199)ala
132 coding region as well as an additional approximately 895 bp vector sequence at the
3' end of the coding region. This fragment was ligated to the large (approximately
7230 bp)
DraIII-
SalI vector fragment isolated from pING4513 to generate pING4530.
C. Construction Of Plasmid pING4533
[0029] Plasmid pING4533 was constructed for expression of rBPI(1-199)ala
132, wherein the codon specifying the fifth amino acid of the BPI signal sequence, methionine
(ATG), at position -27 was placed in the context of the consensus Kozak translation
initiation sequence GCCACCRCCATGG (SEQ ID NO: 7) [Kozak,
Nucl. Acid. Res., 15:8125 (1987)], and in which the DNA sequence encoding the first 4 amino acids of the
BPI signal was removed. This was accomplished by PCR amplification of BPI sequences
from a plasmid containing the full length human BPI cDNA [in pGEM-7zf(+)] using the
PCR primer BPI-23: ACTGTCGACGCCACCATGGCCAGGGGC (SEQ ID NO: 8), incorporating a
SalI restriction site and the nucleotides GCCACC in front of the ATG (methionine) at
position -27 of the BPI signal, and the primer BPI-2: CCGCGGCTCGAGCTATATTTTGGTCAT
(SEQ ID NO: 9), corresponding to the 3' end of the rBPI(1-199) coding sequence.
[0030] The approximately 700 bp PCR amplified DNA was digested with
SalI and
EcoRI and the resulting 270 bp fragment, including approximately the first one-third
of the BPI(1-199) coding sequence, was purified. This
SalI-
EcoRI fragment was ligated to 2 other fragments: (1) a 420 bp
EcoRI-
SstII fragment from pING4519, encoding the remainder of BPI(1-199) wherein alanine replaces
cysteine at position 132; and (2) an approximately 8000 bp
SstII-
SalI vector fragment from pING4502 (a vector essentially similar to pING4503 except that
it does not include the 30 bp 5' untranslated sequence and has a
gpt marker rather than DHFR), to generate pING4533 which contains a
gpt marker.
D. Construction Of Plasmids pING4221, pING4222, And pING4223
[0031] Vectors similar to pING4533 were constructed having an insert which contained the
optimized Kozak translation initiation site corresponding to methionyl residue -27
of the signal sequence, and an alanine-for-cysteine replacement at position 132. However,
the BPI fragment coding sequence terminated at residue 193 in these constructions.
As noted above, the recombinant product resulting from host cell expression of this
DNA is referred to as "rBPI(1-193)ala
132". Vectors containing these inserts were made by first digesting pING4533 with
SalI, which cuts at the 5' end of the BPI DNA insert, and
AlwNI, which leaves a three bp 3'-overhang at residue 192. The resulting approximately
700 bp fragment was then purified. This fragment was re-ligated into the large fragment
resulting from pING4533 digestion with
SstII-
SalI, along with two annealed complementary oligonucleotides, BPI-30: CTGTAGCTCGAGCCGC
(SEQ ID NO: 10) and BPI-31: GGCTCGAGCTACAGAGT (SEQ ID NO: 11). This replaced the region
between the
AlwNI and
SstII sites with the codon for residue 193 (leucine), a stop codon, and an
XhoI restriction site 5' to the
SstII site and resulted in regeneration of both the
AlwNI and the
SstII sites and placement of the stop codon, TAG, immediately after the codon (CTG) for
amino acid 193 (leucine). The resultant plasmid was designated pING4223 and had the
gpt marker. Similar constructions were made exactly as described for pING4223 except
that different
SstII-
SalI vector fragments were used to generate vectors with different selection markers.
For example, pING4221 is identical to pING4223 except that it contains the
his marker (conferring resistance to histidinol) instead of
gpt and pING4222 is identical to pING4223 except that it contains the DHFR marker instead
of
gpt.
E. Construction Of Plasmids pING4537, pING4143, pING4146, pING4150, And pING4154
[0032] A series of vectors was constructed which contained an insert encoding rBPl(1-193)ala
132 , the optimized Kozak translation initiation site, and different selection markers
essentially identical to those described with respect to pING4221, pING4222 and pING4223
except that the human genomic gamma-1 heavy chain polyadenylation and transcription
termination region at the 3' end of the
SstII site was replaced with a human light chain polyadenylation sequence followed by
mouse light chain (kappa) genomic transcription termination sequences. In collateral
gene expression studies, the light chain polyadenylation signal and transcription
termination region appeared to be responsible for 2.5-5 fold increases in BPI expression
levels in Sp2/0 and CHO-K1 cells.
[0033] The aforementioned vectors were constructed by first constructing pING4537, a vector
similar to pING4533 which contains the rBPI(1-199)ala
132 insert. However, pING4537 includes the human light chain polyadenylation sequences
instead of the human heavy chain sequence. The mouse kappa 3' sequences were obtained
from pING3170, an expression vector which encodes a human light chain cDNA and includes
a mouse genomic light chain 3' transcription termination sequence. This was accomplished
by digesting with
SstI, which cuts 35 bp upstream of the mouse light chain stop codon, treating with T4
DNA polymerase to make the end blunt, then cutting with
BamHI, and purifying an approximately 1350 bp fragment which includes the mouse kappa
3' sequences. The resulting fragment consists of approximately 250 bp of the 3' portion
of the human light chain constant region cDNA and the polyadenylation signal followed
by a
BamHI linker as described in the construct called Δ8 in Lui
et al., J. Immunol. 139: 3521, (1987). The remainder of the approximately 1350 bp fragment consists of a
BglII-
BamHI mouse kappa 3' genomic fragment [fragment "D" of Xu
et al., J. Biol. Chem. 261:3838, (1986)] which supplies transcription termination sequences. This fragment was
used in a 3-piece ligation with two fragments from pING4533: a 3044 bp fragment which
includes all of BPI insert and pan of vector obtained by digestion with
SstII, T4 polymerase treatment, and
NotI digestion (which includes all of BPI insert and part of vector), and an approximately
4574 bp
BamHI-
NotI fragment. The resulting vector, pING4537, is identical to pING4533 with the exception
of the above-noted differences in the genomic 3' untranslated region.
[0034] Additional vectors containing the kappa 3' untranslated sequences were constructed
using pING4537 as the source of the kappa 3' fragment. The kappa 3' untranslated sequences
were isolated by digestion of pING4537 with
XhoI (a unique site which occurs immediately after the BPI stop codon) and
BamHI. The resulting approximately 1360 bp
XhoI-
BamHI fragment was used in a series of 3-piece ligations to generate the following four
vectors, all of which have inserts encoding rBPI(1-193)ala
132 and which have the optimized Kozak translation initiation site at residue -27 of
the signal: (1) pING4143 (
gpt marker), obtained by ligating a pING4223 4574 bp
BamHI-
NotI fragment (
gpt marker), a pING4223
NotI-
XhoI BPI insert-containing fragment of approximately 3019 bp, and the pING4537
XhoI-
BamHI fragment; (2) pING4146 (DHFR marker), obtained by ligating a pING4222 approximately
4159 bp
BamHI-
NotI fragment (DHFR marker), a pING4223
NotI-
XhoI BPI insert-containing fragment of approximately 3019 bp, and the pING4537
XhoI-
BamHI fragment; (3) pING4150 (
his marker), obtained by ligating a pING4221
his-containing approximately 4772 bp
BamHI-
NotI fragment, a pING4222
NotI-
XhoI BPI insert-containing fragment, and the pING4537
XhoI-
BamHI fragment; and (4) pING4154 (
neo marker), obtained by ligating a pING3174
neo-containing approximately 4042 bp
BamHI-
BsaI fragment, a pING4221
BsaI-
XhoI BPI insert-containing fragment of approximately 3883 bp and the pING4537
XhoI-
BamHI fragment. Plasmid pING3174 contains an insert encoding antibody heavy chain DNA
and has a
neo marker. The
neo gene and its flanking sequences were obtained from the pSv2
neo plasmid reported by Southern
et al., J. Mol. Appl. Genet., 1:327 (1982).
F. Construction Of Plasmids pING4144 And pING4151
[0035] Two plasmids were constructed, pING4144 and pING4151, which were identical to pING4143
and pING4150, respectively, except that expression of rBPI coding sequences was under
control of the human cytomegalovirus (hCMV) immediate early enhancer/promoter instead
of the Abelson murine leukemia virus (A-MuLv) LTR promoter. Therefore, both pING4144
and pING4151 contained the mutation of the cysteine at position 132 to alanine, the
optimized Kozak translation initiation sequence, and the human light chain poly-A/mouse
kappa genomic transcription termination region. The region between nucleotides 879
and 1708 of the original vectors (pING4143 and pING4150) was replaced with a region
of the hCMV enhancer/promoter corresponding to nucleotides -598 through +174 as shown
in Figure 3 of Boshart
et al., Cell 41:521 (1985), incorporated herein by reference. To introduce the hCMV promoter region
into BPI expression vectors, plasmid pING4538 was first constructed by replacing the
approximately 1117 bp
EcoRI-
SalI/A-MuLv promoter-containing fragment of pING4222 with an approximately 1054 bp
EcoRI-
SalI/hCMV promoter-containing fragment from plasmid pING2250 which contains the hCMV
promoter driving expression of an antibody light chain insert. To construct pING4144,
three fragments were ligated together: (1) the approximately 2955 bp rBPI(1-193)-containing
NotI-
XhoI fragment from pING4538; (2) the approximately 1360 bp
XhoI-
BamHI fragment from pING4537; and (3) the approximately 4770 bp
BamHI-
NotI fragment containing the
his gene from pING4221.
G. Construction Of Plasmids pING4145, pING4148 And pING4152
[0036] Plasmids pING4145, pING4148 and pING4152 were constructed and were identical to pING4143,
pING4146, and pING4150, respectively, except that they contained the wild-type (natural
sequence) cysteine at position 132 instead of an alanine substitution. Thus, all three
contained the rBPI(1-193) insert, the optimized Kozak translation initiation sequence
and the human light chain Poly A/mouse kappa genomic transcription termination region.
These three plasmids were constructed as follows. To construct pING4145, three fragments
were ligated together: (1) the approximately 3000 bp
NotI-
XhoI BPI(1-193) containing fragment from pING4140 (pING4140 is identical to pING4221
except that it contains the wild-type cysteine at Position 132); (2) the approximately
1360 bp
XhoI-
BamHI fragment from pING4537; and (3) the approximately 4570 bp
BamHI-
NotI fragment containing the
gpt gene from pING4223. To construct pING4148, three fragments were ligated together:
(1) the
NotI-
XhoI fragment from pING4140; (2) the
XhoI-
BamHI fragment from pING4537; and (3) the approximately 4150 bp
BamHI-
NotI fragment containing the DHFR gene from pING4222. To construct pING4152, three fragments
were ligated together: (1) the approximately 3000 bp
NotI-
XhoI fragment from pING4142 (pING4142 is identical to pING4223 except that it contains
the wild-type cysteine at 132); (2) the
XhoI-
BamHI fragment from pING4537; and (3) the approximately 4770 bp
BamHI-
NotI fragment containing the
his gene from pING4221.
EXAMPLE 2
Transfection Of Cells For Expression Of The rBPI Cysteine Replacement Analogs
[0038] Mammalian cells are preferred hosts for production of rBPI protein analogs according
to the invention because such cells allow for proper secretion, folding, and post-translational
modification of expressed proteins. Presently preferred mammalian host cells for production
of analogs of the invention include cells of fibroblast and lymphoid origin, such
as: CHO-K1 cells (ATCC CCL61); CHO-DG44 cells, a dihydrofolate reductase deficient
[DHFR
-] mutant of CHO Toronto obtained from Dr. Lawrence Chasm, Columbia University; CHO-DXB-11,
a DHFR
- mutant of CHO-K1 obtained from Dr. Lawrence Chasm; Vero cells (ATCC CRL81); Baby
Hamster Kidney (BHK) cells (ATCC CCL10); Sp2/O-Ag14 hybridoma cells (ATCC CRL1581);
and NSO myeloma (ECACC No. 85110503).
[0039] Transfection of mammalian cells may be accomplished by a variety of methods. A common
approach involves calcium phosphate precipitation of expression vector DNA which is
subsequently taken up by host cells. Another common approach, electroporation, causes
cells to take up DNA through membrane pores created by the generation of a strong
electric field [(Sambrook
et al., Molecular Cloning, A Laboratory Manual, Cold Spring Laboratory Harbor Press, 16.30-16.31 (1989)]. Selection for transfected
cells is facilitated by incorporation in the expression vector of a gene whose product
allows the transfected cells to survive and grow under selective conditions. A number
of such genes have been identified. These include, among others: (1)
neo, a prokaryotic gene which encodes resistance to the aminoglycoside antibiotic G418;
(2)
E. coli guanine phoshporibosyl transferase (
gpt), which encodes resistance to mycophenolic acid (MPA) in the presence of xanthine,
[Mulligan
et al., Proc. Nat. Acad. Sci. USA, 78:2072-2076 (1981)]; (3) dihydrofolate reductase (DHFR), which allows for growth of
DHFR
- cells in the absence of nucleosides and gene amplification in the presence of increasing
concentration of methotrexate; (4) the
hisD gene of
Salmonella typhimurium which allows growth in the presence of histidinol [Hartman
et al., Proc Nat. Acad. Sci. USA, 85:8047-8051, (1988)]; (5) the
trpB gene of
E. coli [Hartman
et al., Proc. Nat. Acad. Sci. USA, 85:8047-8051, (1988)], which allows growth in the presence of indole (without tryptophan);
and (6) the glutamine synthetase gene, which allows growth in media lacking glutamine.
The availability of these selective markers, either alone or in various combinations,
provides flexibility in the generation of mammalian cell lines which express recombinant
products at high levels.
A. Transfection Of CHO-K1 Cells With pING4533
[0040] Plasmid pING4533 contains gene sequences encoding rBPI(1-199)ala
132 fused to the A-MuLv promoter, the optimized Kozak translation initiation sequence,
the human gamma-1 heavy chain 3' untranslated region, and the
gpt marker for selection of MPA-resistant cells.
[0041] The CHO-K1 cell line is maintained in Ham's F12 medium plus 10% fetal bovine serum
(FBS) supplemented with glutamine/penicillin/streptomycin (Irvine Scientific, Irvine,
CA). The cells were transfected by electroporation with 40 µg of pING4533 DNA which
was first digested with
NotI, extracted with phenol-chloroform and ethanol precipitated. Following electroporation,
the cells were allowed to recover for 24 hours in non-selective Ham's F12 medium.
The cells were then trypsinized, resuspended at a concentration of 5 X 10
4 cells/ml in Ham's F12 medium supplemented with MPA (25 µg/ml) and xanthine (250 µg/ml)
and then plated at 10
4 cells/well in 96-well plates. Untransfected CHO-K1 cells are unable to grow in this
medium due to the inhibition of pyrimidine synthesis by MPA.
[0042] At 2 weeks, colonies consisting of transfected cells were observed in the 96-well
plates. Supernatants from wells containing single colonies were analyzed for the presence
of BPI-reactive protein by anti-BPI ELISA using rBPI(1-199) as a standard. In this
assay, Immulon-II 96-well plates (Dynatech, Chantilly, VA) were pre-coated with affinity
purified rabbit anti-rBPI(1-199) antiserum. Supernatant samples were added and detection
was carried out using affinity purified, biotinylated rabbit anti-rBPI(1-199) antiserum
and peroxidase-labeled avidin.
[0043] Approximately 800 colonies were screened in this manner. Thirty-one colonies having
the highest production were transferred to 24-well plates for productivity assessment.
Cells were grown to confluence in a 24-well plate in Ham's F12 medium supplemented
with 10% FBS. Once the cells reached confluence, the Ham's F12 medium was removed
and 1 ml of HB-CHO serum free medium (Irvine Scientific) plus 40 µl of sterile S-sepharose
beads (Pharmacia, Piscataway, NJ) was added as in co-owned, co-pending U.S. Patent
Application, Serial No. 08/072,063 by Grinna. The cells were then incubated for 7
days after which the S-sepharose beads were removed and washed with 0.1 M NaCl in
10 mM Tris buffer (pH7.5). The product was eluted from the beads by addition of 1.0
M NaCl in Tris buffer and quantitated by ELISA as described above. The top-producing
transformant, designated A153, secreted approximately 3 µg/ml in this assay and was
adapted to growth in Excell 301 serum-free medium (JRH Scientific, Lenexa, KS). The
adapted cells were grown in 1.5 L fermenters in Excell 301 medium in the presence
of S-sepharose beads. Productivity was assessed at 120-140 hours by C4 HPLC analysis
of product eluted from S-sepharose beads (50 ml aliquots). The productivity was 15-25
µg/L at these stages of the fermentation.
B. Transfection Of CHO-DG44 Cells With pING4222
[0044] Plasmid pING4222 contains DNA encoding the rBPI(1-193)ala
132 analog fused to the A-MuLv promoter, optimized Kozak initiation sequence, human gamma-1
heavy chain 3' untranslated region, and the mouse DHFR gene for selection of transfected
cells in a nucleoside-free medium.
[0045] The cell line, CHO DG44, was maintained in Ham's F12 medium plus 10% FBS with glutamine/penicillin/streptomycin.
The cells were transfected with linearized pING4222 DNA (40 µg digested with
PvuI, phenol-chloroform extracted, ethanol precipitated) using the calcium phosphate
method of Wigler,
et al. Cell, 11:223 (1977). Following calcium phosphate treatment, the cells were plated in 96-well
plates at approximately 10
4 cells/well and transfectants were obtained by growth in selective medium consisting
of αMEM medium lacking nucleosides (Irvine Scientific) and supplemented with dialyzed
FBS (100 ml serum dialyzed vs 4L cold 0.15M NaCl using 6000-8000 MW cutoff, 16 hours,
4°C). Untransfected CHO-DG44 cells are unable to grow in this medium due to the DHFR
mutation and the lack of nucleosides in the medium supplemented with dialyzed serum.
[0046] At 2 weeks, each well contained approximately 2-3 colonies. The supernatants from
wells of a 96-well plate were analyzed for the presence of rBPI(1-193) ala
132 by ELISA as in Section A. Twenty-four highest-producing clones were expanded into
24-well plates in selective αMEM medium supplemented with 0.05 µM methotrexate to
induce gene amplification of the rBPI analog-encoding DNA. On observation of growth,
cells were transferred to a new 24-well plate and productivity was assessed from S-sepharose
eluates as described in section A for the pING4533/CHO-K1 transfectants. The five
highest-producing clones were combined and subcloned by limiting dilution in 96-well
plates. The supernatant wells containing single colonies were assayed for levels of
rBPI(1-193)ala
132 by ELISA. Twenty highest-producing subclones were next expanded into 24-well plates
and subjected to further amplification in the presence of 0.4 µM methotrexate and
the levels of product expression for the amplified cells was determined by ELISA.
The top producers, Clones 4, 75, and 80, secreted 25-37 µg/ml at 7 days in a 24- well
plate containing S-sepharose.
C. Transfection Of Sp2/O Cells With pING4223 And pING4221
[0047] A strategy adopted in an attempt to achieve optimal expression of desired rBPI products
involved transfection of cells having a first expression plasmid with a first marker,
screening for the highest producers, and then transfecting the same cells with a second
expression plasmid having a different marker. This strategy is described below using
Sp2/O cells.
[0048] Plasmid pING4223 contains DNA encoding rBPI(1-193)ala
132 BPI fused to the A-MuLv promoter, optimized Kozak translation initiation sequence,
human gamma-1 heavy chain 3' untranslated sequences, and the
gpt marker for selection of MPA-resistant cells.
[0049] The Sp2/O cell line was maintained in DMEM medium supplemented with 10% FBS with
glutamine/penicillin/streptomycin. The Sp2/0 cells were transfected by electroporation
with 40 µg of pING4223 DNA which had been digested with
NotI, extracted with phenol-chloroform and ethanol precipitated. Following electroporation,
the cells were allowed to recover for 48 hours in non-selective DMEM medium. The cells
were then centrifuged and resuspended at a concentration of 5 X 10
4 cells/ml in DMEM medium supplemented with MPA (6 µg/ml) and xanthine (250 µg/ml)
and plated at 10
4 cells/well in 96-well plates. Untransfected Sp2/O cells are unable to grow in this
medium due to the inhibition of pyrimidine synthesis by the MPA. At 1.5-2 weeks, colonies
consisting of transfected cells were observed in the 96-well plates. Supernatants
from wells containing single colonies were analyzed for the presence of product-reactive
protein by ELISA. The highest producers were transferred to a 24-well plate and productivity
was assessed in extinct 24-well cultures for cells grown in the presence and absence
of 10
-7 M dexamethasone, which causes an increase in expression by the A-MuLv promoter as
a result of interactions with the glucocorticoid receptor. The best producer, Clone
2X3, secreted approximately 3 µg/ml and 7 µg/ml in the absence and presence of dexamethasone,
respectively.
[0050] Clone 2X3 was next transfected by electroporation with pING4221, which contains the
his gene for selection of transfectants. Following recovery for 48 hours in DMEM plus
10% FBS medium, the cells were plated in 96-well plates at approximately 10
4 cells/well in DMEM/FBS supplemented with 6 µg/ml MPA, 250 µg/ml xanthine and 8 mM
histidinol. Untransfected cells were unable to grow in the presence of the histidinol
and MPA. At 1.5-2 weeks, transfected cells were observed in the 96-well plates. Supernatants
from wells containing single colonies were analyzed for the presence of rBPI-reactive
protein by ELISA.
[0051] The highest producers were transferred to a 24-well plate. Productivity was assessed
as extinct 24-well cultures for cells grown in the presence and absence of 10
-7 M dexamethasone. The best producer, Clone 2X3-130, secreted approximately 15 µg/ml
and 30 µg/ml in the absence and presence of dexamethasone, respectively. This isolate
was next subcloned by limiting dilution in 96-well plates. Wells containing single
colonies were screened by ELISA and the best producers were expanded and retested
in 24 well cultures in the presence and absence of 10
-7 M dexamethasone. The highest producing subclone, No. 25, secreted approximately 16
µg/ml and 33 µg/ml in the absence and presence of dexamethasone, respectively.
D. Transfection Of Sv2/0 Cells With pING4143 And pING4150
[0052] Plasmid pING4143 contains DNA encoding rBPI(1-193)ala
132 fused to the A-MuLv promoter, optimized Kozak translation initiation sequence, and
mouse kappa light chain 3' untranslated sequences along with the
gpt gene for selection of MPA-resistant cells. The Sp2/0 cells were transfected by electroporation
with 40 µg of pING4143 DNA that was first digested with
NotI, phenol-chloroform extracted, and ethanol precipitated. Following electroporation,
the cells were allowed to recover for 48 hours in non-selective DMEM medium. The cells
were then centrifuged and resuspended at a concentration of 5 X 10
4 cells/ml in DMEM medium supplemented with MPA (6 µg/ml) and xanthine (250 µg/ml)
and plated at approximately 10
4 cells/well in 96-well plates.
[0053] At approximately 2 weeks, colonies consisting of transfected cells were observed
in the 96-well plates. Supernatants from wells containing single colonies were analyzed
for the presence of BPI-reactive protein by ELISA. The highest producers were transferred
to a 24-well plate. Productivity was assessed as extinct 24-well cultures for cells
grown in the presence and absence of 10
-7 M dexamethasone. The best producer, Clone 134, secreted approximately 12 µg/ml and
approximately 28 µg/ml in the absence and presence of dexamethasone, respectively.
[0054] Clone 134 was transfected by electroporation with the vector, pING4150, which contains
DNA encoding rBPI(1-193)ala
132 fused to the A-MuLv promoter and mouse light chain 3' untranslated region with the
his gene for selection of transfectants. Prior to electroporation, the vector was first
digested, and phenol-chloroform-extracted and ethanol precipitated. Following recovery
for 48 hours in DMEM plus 10% FBS medium, the cells were plated in 96-well plates
at approximately 10
4 cells/well in DMEM/FBS supplemented with 6 µg/ml MPA plus 250 µg/ml xanthine and
8mM histidinol. Untransfected cells are unable to grow in the presence of MPA and
histidinol. At approximately 2 weeks, colonies consisting of transfected cells were
observed in the 96-well plates. Supernatants from wells containing single colonies
were analyzed for the presence of BPI-reactive protein by ELISA. The highest producers
were transferred to a 24-well plate. Productivity was assessed as extinct 24 well
cultures for cells grown in the presence and absence of 10
-7 M dexamethasone. The highest producer, Clone 134-11, was re-designated C1770. Clone
C1770 secreted 36 µg/ml without dexamethasone and greater than 42 µg/ml in the presence
of dexamethasone. This clone (c1770) was deposited with the American Type Culture
Collection, 12301 Parklawn Drive, Rockville, MD 20852 as Accession No. HB 11247.
E. Transfection Of CHO-K1 Cells With pING4143
[0055] The CHO-K1 cell line was transfected with pING4143 DNA in the manner described in
Section A for transfection of CHO-K1 cells with pING4533. At approximately 2 weeks,
supernatants from approximately 800 wells containing single colonies were analyzed
for the presence of BPI-reactive protein by ELISA. The top producers were transferred
to 24-well plates. The top producers, secreting approximately 9-13 µg/ml, may next
be adapted to serum-free medium in preparation for growth in fermenters. These may
also be re-transfected with a vector, such as pING4150 or pING4154 with
his or
neo as selective markers, respectively, to provide a cell line which produces even higher
levels of rBPI product.
F. Transfection Of CHO-K1 Cells With pING4144
[0056] Plasmid pING4144 is similar to pING4143 except that it contains the human cytomegalovirus
(hCMV) promoter instead of the A-MuLv promoter. The CRO-K1 cell line was transfected
with pING4144 DNA in the manner described above in Section A. At approximately 2 weeks,
supernatants from approximately 200 wells containing single colonies were analyzed
for the presence of BPI-reactive protein by ELISA. The top producers were transferred
to 24-well plates and rBPI expression determined in 24-well plates containing sodium
butyrate. The top producer (clone 174) secreted approximately 3-5 µg/ml without butyrate
and approximately 15-18 µg/ml in the presence of 5mM butyrate in this assay. This
clone, re-designated clone C1771, was deposited with the American Type Culture Collection,
12301 Parklawn Drive, Rockville, MD 20852 as ATCC accession No. CRL 11246. Top producers
may next be adapted to serum-free medium in preparation for growth in fermenters.
These may also be re-transfected with a vector, such as pING4151 or pING4155, containing
the rBPI gene under control of the hCMV promoter, but with
his or
neo as selective markers, respectively, to provide a cell line which produces even higher
levels of BPI.
G. Transfection Of NSO Cells With pING4143
[0057] NS0 cells were transfected with pING4143 DNA by electroporation. At approximately
3 weeks, colonies consisting of transfected cells were observed in the 96-well plates.
Supernatants from wells containing single colonies were analyzed for the presence
of BPI-reactive protein by ELISA. The highest producers were transferred to a 24-well
plate. Productivity was assessed as extinct 24-well cultures. The highest producers
secreted a 15-16 µg/ml. The highest producers may be retransfected with a vector,
such as pING4150, as described above to yield even higher producers.
H. Transfection Of NS0 Cells With pING4232
[0058] NS0 cells were transfected by electroporation with pING4132, which contains DNA encoding
rBPI(1-193)ala
132 fused to the optimal Kozak translation initiation sequence cloned into the vector
pEE13 [Bebbington,
et al. Biotechnology,
10: 169-175 (1992)]. Vector pEE13 contains the glutamine synthetase gene for selection
of transfectants which are able to grow in medium lacking glutamine. At approximately
three weeks, colonies consisting of transfected cells were observed in 96-well plates.
Supernatants from wells containing single colonies were analyzed by ELISA. The highest
producers were transferred to a 24-well plate. Productivity was assessed as extinct
24-well cultures. The highest producers, secreting 7-15 µg in extinct 24 well-cultures,
may next be subjected to amplification in the presence of various concentrations of
methionine sulfoximine.
I. Transfection Of Sp2/0 Cells with pING4145
[0059] Plasmid pING4145 contains DNA encoding rBPI(1-193)ala
132 fused to the A-MuLv promoter, optimized Kozak translation initiation sequence, mouse
kappa light chain 3' untranslated sequences, and a
gpt gene for selection of MPA-resistant cells. The Sp2/0 cells were transfected by electroporation
with 40 µg of pING4145 DNA that was first digested with
NotI, phenol-chloroform extracted, and ethanol precipitated. Following electroporation,
the cells were allowed to recover for 48 hours in non-selective DMEM medium, centrifuged,
and resuspended at a concentration of 5 x 10
4 cells/ml in DMEM medium supplemented with MPA (6 µg/ml) and xanthine (250 µg/ml).
The cells may then be plated at approximately 10
4 cells/well in 96-well plates. At approximately 2 weeks, colonies consisting of transfected
cells are observed in the 96-well plates. Supernatants from wells containing single
colonies may then be analyzed for the presence of BPI-reactive protein by ELISA. The
highest producers are transferred to a 24-well plate and productivity is assessed
as extinct 24-well cultures for cells grown in the presence and absence of 10
-7 M dexamethasone.
[0060] In order to maximize the expression of BPI, the highest producing Sp2/0 transfectant
may be transfected by electroporation with a vector which contains gene sequences
encoding rBPI(1-193)ala
132 fused to the A-MuLv promoter and mouse light chain 3' untranslated region with the
his gene for selection of transfectants.
J. Transfection Of CHO-K1 Cells with pING4145
[0061] The CHO-K1 cell line was transfected with pING4145 DNA in the manner described above
in Section A. At approximately 2 weeks, supernatants from approximately 500-800 wells
containing single colonies may be analyzed for the presence of BPI-reactive protein
by ELISA. The top producers are transferred to 24-well plates and BPI expression determined
in 24-well plates containing S-sepharose. The top producers are next adapted to serum-free
medium in preparation for growth in fermenters. These may also be re-transfected with
a vector containing a different selective marker to provide a cell line which produces
even higher levels of rBPI product.
K. Expression of rBPI Products from Insect Cells
[0062] Another eukaryotic system in which rBPI products may be expressed is insect cells
which have been infected with a recombinant baculovirus containing DNA encoding an
rBPI product. Systems for generating recombinant virus and for achieving expression
of recombinant products therefrom are commercially available (Invitrogen, San Diego,
CA). DNA encoding rBPI(1-199), including the 31 amino acid signal sequence, was cloned
into an
NheI site in a pBlueBac transfer vector (invitrogen). Sf9 insect cells (BRL; ATCC CRL
1711) were co-transfected with this vector and with wild type AcMNPV (
Auzographa californica multiple nuclear polyhidrosis virus, Invitrogen). Recombinant viral plaques were
then identified, purified, and used to generate high-titer recombinant viral stocks
as described in protocols available from BRL.
[0063] The recombinant-produced baculovirus was used to infect further Sf9 cells. To do
this, 8 separate 60 mm dishes of Sf9 cells were infected with the baculovirus. Each
of the 8 dishes was sampled at different times during the day by collecting medium
from a dish of infected cells. Upon collection, the medium was centrifuged at 1000
rpm for 10 minutes and the supernatant was stored at 4°C. Cells were then rinsed once
with 4 ml PBS and lysed with 100 µl/dish NP40 lysis buffer (1% NP40, 150 mM NaCl,
50 mM Tris-HCl, pH 8.0) by incubating on ice for 30 minutes. Cells were then collected
into an Eppendorf tube with a cell scraper. Cell lysates were then spun in a microfuge
for 2 minutes. The lysate supernatant was transferred to a new tube and stored at
-20°C. Media samples from each daily time point were analyzed for BPI content by ELISA
and lysates were analyzed by Western using an anti-BPI antibody.
[0064] No rBPI product was detectable in the media by ELISA on days 1-4 post-infection.
However, on days 5-6 post-infection, a peak of 200-500 ng/ml rBPI product was detected
in media samples. Western analysis of the lysates showed a. BPI-reactive band of approximately
23 Kd at day 2 post-infection. That band showed increasing intensity through day 6.
[0065] Table II, below, summarizes the transfections detailed in Sections A-J above.
TABLE II
Host Cell |
Transfected With |
CHO-DG44 |
pING4222 |
CHO-K1 |
pING4533, pING4143, pING4144, pING4145 |
NSO |
pING4143, pING4232 |
SP2/O |
pING4223 followed by pING4221, |
pING4143 followed by pING4150, |
pING4145 |
EXAMPLE 3
Construction Of Plasmids For in vitro Transcription And Translation Of rBPI (1-199)ala132 And rBPI (1-199)Ser135
[0066] In vitro transcription/translation studies were conducted using plasmid pIC127 as a source
of DNA encoding rBPI (1-199). Construction of pIC127 was carried out as follows. DNA
encoding rBPI (1-199), including the 31-amino acid signal sequence, was PCR amplified
from a plasmid containing full-length cDNA encoding BPI in pGEM-72f(+). The amplification
was done such that a
SalI site was incorporated at the 5' end and
XhoI and
SstII sites were incorporated at the 3' end of the rBPI-encoding sequence by using the
primers BPI-3: GTCGACGCATGCGAGAGAACATGGC (SEQ ID NO: 12) and BPI-2: CCGCGGCTCGAGCTATATTTTGGTCAT
(SEQ ID NO: 9). The resulting PCR amplified fragment was blunt-end cloned into the
SmaI site of the multiple cloning region of plasmid pT7T3 18u (Pharmacia LKB Technology,
Piscataway NJ) in order to generate pIC102.
[0067] The pIC102 insert encoding rBPI (1-199) and the 31-amino acid signal were then excised
by digestion of the plasmid with
BamHI and
Asp718I. A
BamHI site flanks the
SalI site in pIC102 and an
Asp718I site flanks the
SstII site in pIC102. The ends of the excised fragment were made blunt with T4 DNA polymerase
and the blunt fragment was then cloned into plasmid pGEM1 (ProMega, Madison, WI) which
had first been digested with
PstI and
EcoRI and blunted with T4 DNA polymerase. The resulting construction was designated pIC124
and has the rBPI (1-199)-encoding insert oriented such that its 5' end is adjacent
to the Sp6 promoter in pGEM1.
[0068] The 31-amino acid signal sequence in the pIC124 insert was then excised by removing
the region between two
HincII sites in pIC124 to create pIC127. The excised region was replaced with a linker
which restored the initiation codon (ATG) and the sequence encoding the first amino
acid of BPI. Two fragments were isolated from pIC124 digestion with
HincII and
SstII: (1) the
HincII -
SstII fragment containing the rBPI (1-199) coding region excluding the codon for the
first amino acid; and (2) the
SstII -
HincII fragment comprising the remainder of the plasmid. The first codon in the BPI coding
sequence and a codon for methionine in front of the BPI sequence were inserted through
use of linker formed from two complementary annealed oligonucleotides, BPI-28: GACGCCACCATGGTC
(SEQ ID NO: 13) and BPI-29: GACCATGGTGGCGTC (SEQ ID NO: 14). Those two oligonucleotides
were ligated together with the
HincII-
SstII and
SstII-
HincII fragments from pIC124 to form pIC127.
[0069] Two plasmids, pML101 and pML102, were constructed using pIC127 for
in vitro transcription/translation of rBPI(1-199)ala
132 and rBPI(1-199)ser
135. To do this, pIC127 was digested with
SstII and
EcoRI and the large
SstII-
EcoRI fragment was purified. To construct pmL101, which contains an rBPI(1-199)ala
132 insert, the
EcoRI-
SstII fragment from pING4519 was ligated to the
SstII-
EcoRI fragment from PIC127. To construct pML102, which contains the rBPI (1-199) Ser
135 insert, the
EcoRI-
sstII fragment from pING4520 was ligated to the
sstII-
EcoRI fragment from pIC127.
[0070] rBPI(1-199), rBPI(1-199)ser
135, and BPI(1-199)ala
132 were expressed
in vitro from plasmids pIC127, pML101, and pML102 using the TNT SP6 coupled Reticulocyte Lysate
System from ProMega (Madison, WI.). That system allows
in vitro coupled transcription and translation of cloned genes using a eukaryotic translation
system. Each coupled transcription/translation was carried out using the manufacturer's
protocols with 2 µg of plasmid DNA in a total volume of 25 µl, including
35S-methionine to generate labeled protein. The labeled protein products were added
in 5 µl aliquots to a 20 µl urea sample buffer and heated at 95°C for 3 minutes. Aliquots
(10µl) of each sample were run on a 15% SDS-Polyacrylamide gel either with or without
DTT (50mM). After fixing and drying the gel, the labeled protein bands were visualized
by autoradiography. Results of the autoradiography demonstrate that cDNA encoding
rBPI(1-199), rBPI(1-199)ala
132, and rBPI(1-199)cys
135 expressed protein products of the expected size of approximately 23 Kd for a BPI
N-terminal fragment. Moreover, all three expression products, rBPI(1-199), rBPI(1-199)ala
132, and rBPI(1-199)cys
135, were capable of generating higher molecular weight species of the size expected
for BPI(1-199) dimers, as well as larger species, all of which disappeared upon reduction
with DTT. It is thought that the expression of dimeric species in the rBPI(1-199)cys
135 and rBPI(1-199)ala
132 products may be the result of using a cell-free
in vitro transcription/translation system. Such a system does not allow proper post-translational
processing, folding, etc. which would normally occur in cellular translation. Thus,
it may be that proper disulfide linkages do not always form in the
in vitro system, leading to formation of dimer in some cases.
[0071] Labeled proteins generated in the above-described
in vitro expression system were next tested for LPS binding activity. Wells of microtiter
plates were coated with LPS from
Salmonella minnesota R7 (Rd mutant) (5 mg/ml in methanol stock culture) in 0.1 M Na
2CO
3/20mM EDTA (ethylenediamine tetraacetic acid) at pH 9.4 (a total of 2 µg LPS in a
50 µl well). Following overnight incubation at 4°C, the wells were rinsed with water
and dried at 37°C. The wells were then blocked with 215 µl Dulbecco's-PBS/0.1 % BSA
for 3 hours at 37°C. The blocking solution was then discarded and the wells were washed
with PBS/0.2 % Tween-20. The rBPI samples were then added (2 µl of the translation
reactant) to a 50 µl total volume in PBS/0.2% Tween. Following overnight incubation
at 4°C, the wells were washed 3 times with PBS/0.2% Tween and the amount of labeled
protein remaining in each well was determined by liquid scintillation counting. The
results demonstrated that approximately equivalent LPS binding took place for all
three BPI species referred to above. rBPI(1-199) displayed binding of 48,690 cpm;
rBPI(1-199)ala
132 displayed binding of 59,911 cpm; and rBPI(1-199)cys
135 displayed binding of 52,537 cpm. each of the aforementioned values represents the
average of triplicate determinations. The average binding of the control (no DNA)
was 5,395 cpm.
EXAMPLE 4
Product Characterization
A. Physical Characterization
[0072] Characterization of rBPI products was accomplished using reverse phase (C4) HPLC,
cation exchange (MA7C) HPLC, SDS-PAGE, and electrospray ionization mass spectrometry
(ESI-MS). The rBPI products to be characterized were purified from roller bottles
or from a 10 Liter fermenter harvest by either a single-step purification procedure
or by a multi-step procedure. The single-step procedure was essentially that disclosed
in co-pending, co-owned U.S. Patent Application Serial No. 08/072,063 by Grinna, incorporated
herein by reference, with the addition of a second wash step. In brief, S-sepharose
beads were added to a growth medium containing rBPI products. The S-sepharose was
then removed from the medium and washed with 20mM sodium acetate and 100mM sodium
chloride at pH4.0. A second wash was performed with 20mM sodium acetate and 700mM
sodium chloride at pH4.0. The purified rBPI products were eluted with 20mM sodium
acetate and 1000mM sodium chloride at pH4.0.
[0073] The multi-step purification procedure involved the purification of pooled batches
of rBPI products which had first been purified separately as described above. After
purification of each of twenty individual rBPI product batches by the single-step
method, the batches were pooled and repurified by first diluting the salt concentration
of the pooled batches to 200mM. The pooled sample was then loaded onto an S-sepharose
column and was washed at pH4.0 with 20mM sodium acetate, and 200mM sodium chloride
followed by 700mM sodium chloride. The rBPI products were eluted using 20mM sodium
acetate and 1000mM sodium chloride at pH4.0. The purified rBPI products were then
analyzed to determine their physical characteristics.
1. SDS-PAGE Analysis of rBPI Products
[0074] SDS-PAGE analysis of rBPI products was carried out using 14% polyacrylamide gels
and a tris-glycine buffer system under reducing and non-reducing conditions. Protein
bands were stained with either Coomassie Blue or silver stain for visualization.
[0075] As shown in Figure 1, non-reduced rBPI(1-199) appeared as a major band at approximately
23 kD and a minor band at approximately 40 kD. The major band was identified as rBPI(1-199)
by comparison with simultaneously-run standards and the minor band was identified
as a dimeric form of rBPI(1-199) by immunostaining. Upon addition of a 1/20 volume
of 0.4 M dithiothreitol (DDT) to a separate sample of rBPI(1-199), SDS-PAGE revealed
a single, well-defined band corresponding to the 23 kD monomeric species of rBPI(1-199)
identified under non-reducing conditions as described above.
[0076] SDS-PAGE analysis of the rBPI(1-199)ala
132 product revealed a single band which migrated with the single 23 kD rBPI(1-199) band
under reducing conditions. Under non-reduced conditions, rBPI(1-199)ala
132 migrated with thte faster-migrating of the two closely-spaced bands seen for rBPI(1-199)
(corresponding to the 23 kD band). These results, shown in Figure 2, indicate that
rBPI(1-199)ala
132 exists in essentially monomeric form after purification. Thus, rBPI products in which
a cysteine residue is replaced by alanine display significant resistance to dimer
formation.
2. Cation Exchange HPLC Analysis of rBPI Products
[0077] Cation exchange HPLC using an MA7C column was also employed to measure the dimer
content of rBPI products. A Bio-Rad MA7C cartridge (4.6 x 30mm, Bio-Rad Catalog No.
125-00556) equilibrated with 40% buffer B (20mM MES, 1M NaCl, pH 5.5) at 1.0ml/min
was used. The rBPI(1-199) product was analyzed by diluting a 1 ml sample to 100 µg/ml
and 200 µl of the diluted sample was injected onto the column. The rBPI was eluted
with a gradient of 40% to 100% buffer B over 6 minutes. Buffer A comprised 20mM MES
at pH5.5. Absorbance was monitored at 229 nm.
[0078] Analysis of rBPI(1-199) revealed two peaks. A first peak eluted with a retention
time of approximately 3 minutes as shown in Figure 3. A second, smaller peak eluted
at approximately 6 minutes. The first peak, shown in Figure 3, represents rBPI(1-199)
monomer and the second peak in Figure 3 represents rBPI(1-199) dimer as determined
by comparisons with the retention times of purified monomer and dimer standards. The
second (dimer) peak did not appear when samples were reduced with DTT prior to being
injected on the column.
[0079] Identical procedures were used to determine the elution pattern of rBPI(1-199)ala
132. As shown in Figure 4, rBPI(1-199)ala
132 elutes as a single peak with a retention time corresponding to that observed for
the rBPI(1-199) monomer peak. There was no evidence of dimer in the rBPI(1-199)ala
132 sample.
3. Reverse Phase (C4) HPLC and Electrospray-ionization Mass Spectrometry Analysis of
rBPI Products
[0080] Microheterogeneity of rBPI products was revealed by reverse phase HPLC and electrospray-ionization
mass spectrometry (ESI-MS). For the HPLC analysis, a Brownlee BU-300 C4 column was
equilibrated with 37% Mobile Phase B (80% acetonitrile/.065% TFA) at a flow rate of
0.5 ml/mm. Samples (1 ml each) of rBPI(1-199) were diluted to 100 µg/ml and 50 µl
of the sample was injected. The column was washed with 37% Mobile Phase B for 2.5
minutes and then eluted using a gradient from 37% to 50% Mobile Phase B over 20 minutes.
Mobile Phase A was 5% acetonitrile/0.1 % TFA and absorbance was monitored at 220 nm.
[0081] The results of reverse phase HPLC analysis of rBPI(1-199) products are shown in Figure
5. rBPI(1-199) products elute as a second (major) peak with a partially-resolved first
(minor) peak on the leading edge of the second peak. Upon reduction with DTT only
one peak, corresponding to the second peak, elutes from the column.
[0082] Identical procedures were used to analyze rBPI(1-199)ala
132 products. As shown in Figure 6, rBPI(1-199)ala
132 eluted as a single peak corresponding to the second (major) peak referred to above.
[0083] The eluates corresponding to the first and second HPLC peaks described above from
three separate batches of rBPI(1-199) were isolated and analyzed to determine their
content by ESI-MS. Analysis of the eluate which produced the second (major) peak from
the rBPI(1-199) run revealed a slightly lower mass than would be expected for a 199-amino
acid protein. These data indicate that the most abundant mass found in the second
peak eluate corresponded to a 1-193 rBPI protein fragment. However, other species,
ranging in size from 1-198 to 1-194, are also present. Analysis of the eluate producing
the single peak obtained from HPLC on rBPI(1-199)ala
132 revealed results similar to those obtained from the eluate which produced the second
(major) peak above. These results are consistent with peptide mapping data which reveal
truncated carboxy termini in rBPI(1-199) products.
[0084] When the same analysis was performed on rBPI(1-193) products, significantly reduced
C-terminal heterogeneity was observed. The ESI-MS data obtained from rBPI(1-193) products
revealed that approximately 85% of the protein contains either the first 191, 193,
or 193 (+ an N-terminal alanine) amino acids of the BPI N-terminal. The results are
shown in Table III.
TABLE III
Electrospray-Ionization Mass Spectrometry Results for rBPI(1-193) and rBPI(1-199)
HPLC Monomer Peaks |
Expected rBPI Product |
Approximate Molecular Mass |
Predicted Amino Acid Residues |
Approximate Relative Intensity* |
rBPI(1-199) |
21407 |
1-193 |
50.9% |
21606 |
1-195 |
28.9% |
21505 |
1-194 |
20.1% |
21738 |
1-196 |
< 10% |
21846 |
1-197 |
< 10% |
21966 |
1-198 |
< 10% |
rBPI(1-193) |
21408 |
1-193 |
36.2% |
21193 |
1-191 |
34.1% |
21293 |
1-192 |
<10% |
21477 |
1-193 + N-terminal alanine |
14.5% |
20924 |
1-189 |
15.2% |
*Only species detected as being present in amounts greater than 10% were quantitated.
These species were then normalized to 100%. |
[0085] These data demonstrate that, while the rBPI(1-199)-encoding DNA produced no full-length
(
i.e. amino acids 1-199 of the BPI N-terminal) protein, the rBPI (1-193)-encoding DNA
produced significant amounts of the rBPI(1-193) protein. Based upon these and other
data, it appears that significant reductions in heterogeneity and significant increases
in production of the intended protein (
i.e. that for which the DNA insert codes may be obtained), while maintaining optimal
bactericidal and LPS-binding activity, by using truncated forms of the rBPI-encoding
DNA. It is expected that truncation of the DNA to be expressed will produce significant
reductions in heterogeneity of the expression product to the extent that the DNA to
be expressed is not truncated beyond the cysteine at amino acid residue 175. Expression
products of truncated forms of DNA encoding rBPI proteins which have in the range
of the first 176 amino acids of the BPI N-terminal to the first 193 amino acids of
the BPI N-terminal are also expected to retain full bactericidal and LPS-binding activity.
[0086] The ESI-MS data also revealed the presence of microheterogeneity at the amino terminal
of rBPI products. Forms of the rBPI product having an alanine residue at the amino
terminus were found and confirmed by sequencing of tryptic peptides.
[0087] As shown in Figure 5, the ESI-MS study of the eluate which produced the first (minor)
reverse phase HPLC peak revealed proteins having a mass distribution similar to those
which formed the second (major) peak except that each mass value was higher by approximately
119-120 Daltons. These data suggest that the eluate producing the first (minor) HPLC
peak described above contains a disulfide-linked cysteine adduct, as this would account
for the uniform shift of the mass values.
[0088] To test the hypothesis that the first (minor) reverse phase HPLC peak produced by
rBPI(1-199) represents cysteine adducts, rBPI(1-199) was exposed to Ellman's reagent
(dithionitrobenzenoic acid, DTNB) which binds to free sulfhydryl groups in roughly
molar equivalents. Such treatment demonstrated that there is less than one mole of
free sulfhydryl per mole of rBPI(1-199). Given the presence of three cysteine residues
in BPI (at positions 132, 135 and 175), these results support the notion that there
is either an intramolecular disulfide link in the rBPI products or that two of the
sulfhydryl groups are sterically unavailable. rBPI(1-199)ala
132 showed no reactivity with Ellman's reagent.
4. Storage Stability of rBPI(1-199) Products
[0089] Samples of rBPI(1-199) (1mg/ml) in a buffer comprising 20mM sodium citrate, 0.15
M Sodium Chloride buffer, 0.1% poloxamer, and 0.002% polysorbate 80 at pH5.0 were
analyzed to determine their storage stability over an 8-week period at the recommended
storage temperature of 2°-8°C and at higher temperatures of 22°C and 37°C.
[0090] The results for storage at 2°-8°C, presented in Table IV, show an increase in the
presence of dimer (from 1% to 4%), but no significant increase in cysteine adduct
or particle formation in the sample.
[0091] However, storage at the increased temperatures of 22°C and 37°C show that the presence
of dimer and particles in the sample increased dramatically and the amount of cysteine
adduct increased moderately. These results are shown in Table V. Additionally, when
rBPI(1-193)ala
132 is stored at 22°C to 37°C, no dimer was detected after storage for two weeks. Under
similar conditions, rBPI(1-199) displays significant increases.
5. Turbidity of rBPI Product Pharmaceutical Compositions
[0092] Experiments were done to determine the turbidity of various rBPI-containing pharmaceutical
compositions. In this context, turbidity refers to the tendency of pharmaceutical
compositions to engage in unfolding (
i.e., loss of tertiary protein structure) and/or particle formation (interactions between
individual proteins to form large (> 10 µm) particles). The pharmaceutical compositions
tested contained either rBPI(1-199), rBPI(1-199)ala
132, or rBPI(1-193)ala
132 in either a citrate buffer (20 mM sodium citrate/150 mM sodium chloride, pH 5.0)
or a citrate buffer containing 0.1 % poloxamer 188 (a poloxamer surfactant comprised
of polyoxypropylene-polyoxyethylene block copolymer) and 0.002% polysorbate 80 (a
polysorbate surfactant comprising polyoxyethylene sorbitan fatty acid ester). As mentioned
above, use of a combination poloxamer/polysorbate surfactant system stabilizes pharmaceutical
compositions as taught in co-owned, co-pending U.S. Patent Application Serial No.
, filed on February 1,1993 [Attorney Docket No. 27129/31162] by McGregor
et al., incorporated herein by reference.
[0093] Samples were analyzed to determine their resistance to turbidity over time at increasing
temperature and at either pH 7.0 or pH 5.0. Prior to analysis, all samples were diluted
to a concentration of 0.1 mg/ml in either 50 mM potassium phosphate or 20 mM citrate
buffer at pH 7.0. Turbidity measurements were obtained by placing samples in quartz
cuvettes for use in a Shimadzu UV-160 UV-Vis spectrophotometer (Shimadzu, Pleasanton,
CA) equipped with a temperature-controlled cuvette holder attached to a recirculating
water bath. Upon equilibrating the cuvette holder at the desired temperature (57°C,
65°C, or 85°C, see below), absorbance at 280 nm was measured to confirm that samples
had been diluted to the proper concentration. Following this, the absorbance of samples
at 350 nm was measured every 2 minutes for 1 hour to determine the change in absorbance
over time.
[0094] Results are presented in Figure 7; wherein "formulated" refers to the rBPI product
in citrate buffer containing the poloxamer/polysorbate combination referred to above,
and "unformulated" refers to rBPI compounds in citrate buffer alone. A lower rate
of change in turbidity (
i.e., a lower rate of increase in absorbance over time) indicates increased stability
against unfolding and the formation of particles. As shown in Figure 7, the addition
of the aforementioned combination of surfactants resulted in increased stability (resistance
to particle formation and unfolding) of all compositions tested. Moreover, the rBPI(1-199)ala
132 and rBPI(1-193)ala
132 exhibited greatly improved resistance to unfolding and particle formation relative
to wild-type compositions--regardless of whether the surfactant combination was present.
Similar results were obtained at pH 5.0 and 65°C, at pH 5.0 and 75°C and at 85°C,
respectively.
[0095] Overall, compositions with the surfactant combination and/or the cysteine deletion
showed greatly increased stability over time and through increases in temperature
as compared to compositions with no surfactant and/or having the wild type BPI(1-199)
N-terminal construction.
B. In Vitro Activity Characterizations
[0096] In Vitro activity of rBPI(1-199)ala
132 products was determined by binding of the products to LPS, by the LAL inhibition
assay, and by the bactericidal potency of the products.
1. Binding Of rBPI(1-199)ala132 To LPS
[0097] Samples (20µg to 60µg each) of
E. coli (Stain 0111-B4) or
S. minnesota (Rd mutant) lipopolysaccharide (Sigma Chemical, St. Louis, Mo) were used to determine
the ability rBPI(1-199)ala
132 products to bind LPS.
[0098] The LPS samples were size fractionated by SDS-PAGE and silver stained for visualization
or electrotransferred to a nitrocellulose membrane (BA25, Schleicher and Schuell,
Keene, N.M.) with appropriate pre-stain standards. The LPS blots were processed by
soaking the membrane in 50mM Tris, 0.2M NaCl (TBS), and 30mg/ml bovine serum albumin
(BSA) at pH 7.4 for 30 minutes at 37°C. Membranes were then incubated in a solution
containing 2-4 µg of purified or partially purified rBPI(1-199)ala
132 or a control protein (either rBPI(1-199) or rBPI holoprotein) for 12-18 hours at
21°C to 42°C. After incubation, the membranes were then washed with TBS-BSA. The solution
was changed at least three times over a 30 minute period. The washed membranes were
then incubated for 3 hours in a 1:1000 dilution of rabbit anti-rBPI(1-199) in TBS
containing 1mg/ml BSA. Membranes were next washed at least three times and were developed
using the Chemiluminescent Detection System (Tropix Systems, Bedford, MA) according
to the manufacturers instructions, using 5x PBS and 0.25% gelatin (Bio-Rad) in place
of I-block.
[0099] The results demonstrated that rBPI(1-199)ala
132 binds to LPS fixed to nitrocellulose as well or better than rBPI(1-199).
2. E. coli Growth Inhibition Assay
[0100] The
E. coli broth growth inhibition assay was conducted to determine the bactericidal potency
of rBPI products by treating
E. coli with rBPI(1-199) or rBPI(1-199)ala
132 analogs and monitoring the inhibition of broth growth as a measure of bactericidal
activity. A "rough' strain of
E. coli with short-chain LPS, designated J5 (a rough UDP-4-epimerase-less mutant of
E. coli strain 0111:B4), was used in the assay. Cells were grown in a triethanolamine-buffered
mineral salts medium (Simon,
et al. Proc. Nat. Acad Sci, 51:877 (1964)) which rendered
E. coli especially sensitive to BPI. The cells were washed and resuspended in 0.9% NaCl to
a density of about 5 X 10
8cells/ml.
[0101] Approximately 5x10
6 to 1x10
7 E. coli cells were incubated for 30-60 minutes with either rBPI(1-199) or with rBPI(1-199)ala
132 analogs at a concentration of 5 µg/ml with a buffered solution (10% Hanks Balanced
Salts, 40mM Tris-Hcl, pH 7.5. 0.1% casamino acids) in a volume of 200-400 ml. In addition,
the assay was run separately with either rBPI(1-199) or rBPI(1-199)ala
132 analog and 100mM MgCl
2. Following incubation, the cells were diluted with 10 volumes of nutrient broth supplemented
with 0.9% Nacl. Broth growth was then monitored for several hours.
[0102] The results demonstrated that rBPI(1-199)ala
132 analogs possess bactericidal activity as potent or more potent than rBPI(1-199).
The bactericidal activity of both rBPI(1-199)ala
132 analogs and that of rBPI(1-199) were reduced, as expected, by MgCl
2.
3. LAL Inhibition Assay
[0103] The LAL inhibition assay was used to determine the ability of rBPI(1-193)ala
132 to bind LPS. An LAL inhibition assay is described in Gazzano-Saritoro,
Infect. Immun.,
60: 4754-4761 (1992). Results of the LAL assay demonstrate that rBPI(1-193)ala
132 has an IC-50 value of 10, which is equal to that for rBPI(1-199). These data indicate
that the analog competes as well as the wild-type rBPI product for binding to LPS.
C. Efficacy Of rBPI(1-199)ala132 In An Animal Model Of Lethal Endotoxemia
[0104] An animal model of endotoxemia was used to evaluate the comparative effectiveness
of rBPI(1-199)ala
132 and rBPI(1-199) against endotoxic shock.
[0105] Male ICR mice received intravenous injections of 800µg/kg actinomycin-D and either
0.5 µg/kg or 1.0 µg/kg of an endotoxin (
E. coli, Strain 0111:B4). Immediately following the injection of endotoxin, the mice received
an intravenous injection (0.5mg/kg or 5.0mg/kg) of either rBPI(1-199) or rBPI(1-199)ala
132. Buffered vehicle was used as a control. Deaths were then recorded over a 7-day period.
The results are presented below in Table VI.
TABLE VI
|
BPI Dose |
# Dead/Total |
% Mortality |
Buffer only |
0 |
14/15 |
93 |
rBPI23 |
0.5 mg/kg |
7/15 |
47 |
5.0 mg/kg |
8/15 |
53 |
rBPI23-cys |
0.5 mg/kg |
14/15 |
93 |
5.0 mg/kg |
8/16 |
50 |
[0106] As seen in Table VI, both rBPI(1-199)ala
132 and rBPI(1-199) provided significant protection against the lethal effects of the
endotoxin. Although the present invention has been presented in terms of its preferred
embodiments, the skilled artisan realizes that numerous modifications and substitutions
are within the scope of the present teaching. For example, substitution of the cysteine
at position 132 or 135 of the BPI N-terminal fragment with non-polar amino acids other
than alanine or serine is contemplated by the invention. Thus, the scope of the appended
claims and any future amendments thereto.
[0107] Further features of the invention are included as follows:
1. A polypeptide analog of bactericidal/permeability-increasing protein or biologically-active
fragment thereof wherein a cysteine residue at position 132 or at position 135 is
replaced by a different amino acid.
2. The polypeptide analog of paragraph 1 wherein the amino acid replacing said cysteine
residue is a non-polar amino acid selected from the group consisting of alanine and
serine.
3. The polypeptide analog of paragraph 1 wherein the cysteine residue at position
132 is replaced by alanine.
4. The polypeptide analog of paragraph 1 wherein the cysteine residue at position
135 is replaced by serine.
5. The polypeptide analog according to paragraphs 1, 2, 3 or 4 comprising, except
for the cysteine replacement at either position 132 or 135, from 176 to 199 of the
amino terminal residues of bactericidal/permeability-increasing protein.
6. The polypeptide analog according to paragraph 5 comprising the initial 193 amino
terminal amino acid residues of bactericidal/permeability-increasing protein.
7. A DNA encoding a polypeptide analog of bactericidal/permeability-increasing protein
or a biologically active fragment thereof wherein a cysteine residue at position 132
or at position 135 is replaced by a different amino acid.
8. The DNA of paragraph 7 encoding the thirty-one amino acid leader sequence and the
first 193 N-terminal residues of bactericidal/permeability-increasing protein and
having a stop codon immediately following the codon for the leucine reside at position
193.
9. The DNA of paragraph 7 encoding the thirty-one amino acid leader sequence and the
first 199 N-terminal residues of bactericidal/permeability-increasing protein and
having a stop codon immediately following the codon for the isoleucine at position
199.
10. An autonomously replicating DNA vector comprising a DNA according to paragraph
7.
11. A host cell stably transformed or transfected with DNA according to paragraph
7 in a manner allowing expression in said host cell of said polypeptide analog.
12. A eukaryotic host cell according to paragraph 11.
13. A host cell according to paragraph 12 selected from the group consisting of ATCC
CRL 11246 and ATCC HB11247.
14. A method for producing polypeptide analogs of bactericidal/permeability- increasing
protein and biologically active fragments thereof comprising growing a host cell according
to paragraph 11 in a suitable culture medium and isolating said analog from said host
cell or said culture medium.
15. A hybrid fusion protein comprising, at its amino terminal, an analog polypeptide
according to paragraph 1 and, at its carboxyl terminal, at least one constant domain
of an immunoglobulin heavy chain or an allelic variation thereof.
16. A DNA encoding a hybrid fusion protein according to paragraph 15.
17. An autonomously replicating DNA vector comprising a DNA according to paragraph
16.
18. A host cell stably transformed or transfected with a DNA according to paragraph
16 in a manner allowing expression in said host cell of said fusion polypeptide.
19. A method for producing hybrid fusion protein according to paragraph 15 comprising
growing a host cell according to paragraph 18 in a suitable culture medium and isolating
said analog from said host cell or said culture medium.
20. A pharmaceutical composition comprising an analog polypeptide according to paragraph
1 and a pharmaceutically-acceptable diluent, adjuvant or carrier.
21. A pharmaceutical composition comprising a hybrid fusion protein according to paragraph
15 and a pharmaceutically acceptable diluent, adjuvant or carrier.
22. A method of treating bacterial infection or the sequelae thereof comprising administering
an effective amount of the pharmaceutical composition of paragraphs 20 or 21.
23. A DNA encoding biologically active fragment of bactericidal/permeability-increasing
protein having a leucine residue at position 193 as its carboxy terminal residue.
24. The DNA according to paragraph 23 encoding the thirty-one amino acid leader sequence
and first 193 N-terminal amino acids of bactericidal/permeability-increasing protein
and having a stop codon immediately following the codon for the leucine residue at
position 193.
25. An autonomously replicating DNA vector comprising a DNA according to paragraph
23.
26. A host cell stably transformed or transfected with a DNA according to paragraph
23 in a manner allowing expression in said host cell.
27. A method for producing a biologically active bactericidal/permeability-increasing
protein fragment comprising growing a host cell stably transformed or transfected
with DNA according to paragraph 23 in a suitable culture medium and isolating said
fragment from said host cell or said culture medium.