Field of the Invention
[0001] This invention relates to nucleic acid constructs, vectors comprising such constructs,
methods of preparing the vectors and constructs and their use in prophylaxis or therapy,
in particular therapeutic vaccines. The invention further relates to host cells comprising
the constructs and vectors and to fusion proteins encoded by the constructs as well
as to the fusion proteins per se. The invention further relates to pharmaceutical
formulations comprising the constructs and vectors and to the use of the constructs
and vectors in medicine. The invention relates in particular to DNA vaccines that
are useful in the prophylaxis and treatment of HIV infections, more particularly when
administered by particle mediated delivery.
Background to the Invention
[0002] HIV-1 is the primary cause of the acquired immune deficiency syndrome (AIDS) which
is regarded as one of the world's major health problems. Although extensive research
throughout the world has been conducted to produce a vaccine, such efforts thus far
have not been successful.
[0003] The HIV envelope glycoprotein gp120 is the viral protein that is used for attachment
to the host cell. This attachment is mediated by binding to two surface molecules
of helper T cells and macrophages, known as CD4 and one of the two chemokine receptors
CCR-4 or CXCR-5. The gp120 protein is first expressed as a larger precursor molecule
(gp160), which is then cleaved post-translationally to yield gp120 and gp41. The gp
120 protein is retained on the surface of the virion by linkage to the gp41 molecule,
which is inserted into the viral membrane.
[0004] The gp120 protein is the principal target of neutralizing antibodies, but unfortunately
the most immunogenic regions of the proteins (V3 loop) are also the most variable
parts of the protein. Therefore, the use of gp 120 (or its precursor gp 160) as a
vaccine antigen to elicit neutralizing antibodies is thought to be of limited use
for a broadly protective vaccine. The gp120 protein does also contain epitopes that
are recognized by cytotoxic T lymphocytes (CTL). These effector cells are able to
eliminate virus-infected cells, and therefore constitute a second major antiviral
immune mechanism. In contrast to the target regions of neutralizing antibodies some
CTL epitopes appear to be relatively conserved among different HIV strains. For this
reason gp120 and gp160 may be considered to be useful antigenic components in vaccines
that aim at eliciting cell-mediated immune responses (particularly CTL).
[0005] Non-envelope proteins of HIV-1 have been described and include for example internal
structural proteins such as the products of the gag and pol genes and other non-structural
proteins such as Rev, Nef, Vif and Tat (
Green et al., New England J. Med, 324, 5, 308 et seq (1991) and
Bryant et al. (Ed. Pizzo), Pediatr. Infect. Dis. J., 11, 5, 390 et seq (1992).
[0006] HIV Tat and Nef proteins are early proteins, that is they are expressed early in
infection and in the absence of structural protein.
[0007] The Nef protein is known to cause the removal of CD4, the HIV receptor, from the
cell surface, but the biological importance of this function is debated. Additionally
Nef interacts with the signal pathway of T cells and induces an active state, which
in turn may promote more efficient gene expression. Some HIV isolates have mutations
in this region, which cause them not to encode functional protein and are severely
compromised in their replication and pathogenesis in vivo.
[0008] The Tat gene gives rise to a number of differentially spliced transcripts at different
times during infection. The first exon encodes an 86 amino acid protein which dominates
early in infection. The second exon encodes an additional 14 amino acids, and this
partially spliced form of Tat is found late in infection. Both forms are fully functional
transactivators, but the longer form also contains an RGD motif important for binding
to α
vβ
3 and α
5β
1 integrins. Tat binds to a short-stem loop structure, known as the transactivation
response element (TAR), that is located at the 5' terminus of HIV RNAs, and up-regulates
transcription from the HIV LTR at least 1000-fold. Tat has a role in promoting the
elongation phase of HIV infection and stimulates the production of full-length viral
transcripts. Tat can affect the expression of a number of cellular genes and can activate
the expression of a number of cellular genes including TNF, IL-2 and IL-6, and regulates
expression of p53 and Bcl-2. Tat is produced in excess and is secreted from infected
cells. This extra-cellular Tat can enter other cells and may prime cells for infection
by HIV or accelerate the rate of HIV replication in newly infected cells.
[0011] The gag gene gives rise to the 55-kilodalton (kD) Gag precursor protein, also called
p55, which is expressed from the unspliced viral mRNA. During translation, the N terminus
of p55 is myristoylated, triggering its association with the cytoplasmic aspect of
cell membranes. The membrane-associated Gag polyprotein recruits two copies of the
viral genomic RNA along with other viral and cellular proteins that triggers the budding
of the viral particle from the surface of an infected cell. After budding, p55 is
cleaved by the virally encoded protease (a product of the pol gene) during the process
of viral maturation into four smaller proteins designated MA (matrix [p17]), CA (capsid
[p24]), NC (nucleocapsid [p9]), and p6.(4).
[0012] In addition to the 3 major Gag proteins, all Gag precursors contain several other
regions, which are cleaved out and remain in the virion as peptides of various sizes.
These proteins have different roles e.g. the p2 protein has a proposed role in regulating
activity of the protease and contributes to the correct timing of proteolytic processing.
[0013] The MA polypeptide is derived from the N-terminal, myristoylated end of p55. Most
MA molecules remain attached to the inner surface of the virion lipid bilayer, stabilizing
the particle. A subset of MA is recruited inside the deeper layers of the virion where
it becomes part of the complex which escorts the viral DNA to the nucleus. These MA
molecules facilitate the nuclear transport of the viral genome because a karyophilic
signal on MA is recognized by the cellular nuclear import machinery. This phenomenon
allows HIV to infect non-dividing cells, an unusual property for a retrovirus.
[0014] The p24 (CA) protein forms the conical core of viral particles. Cyclophilin A has
been demonstrated to interact with the p24 region of p55 leading to its incorporation
into HIV particles. The interaction between Gag and cyclophilin A is essential because
the disruption of this interaction by cyclosporin A inhibits viral replication.
[0015] The NC region of Gag is responsible for specifically recognizing the so-called packaging
signal of HIV. The packaging signal consists of four stem loop structures located
near the 5' end of the viral RNA, and is sufficient to mediate the incorporation of
a heterologous RNA into HIV-1 virions. NC binds to the packaging signal through interactions
mediated by two zinc-finger motifs. NC also facilitates reverse transcription.
[0016] The p6 polypeptide region mediates interactions between p55 Gag and the accessory
protein Vpr, leading to the incorporation of Vpr into assembling virions. The p6 region
also contains a so-called late domain which is required for the efficient release
of budding virions from an infected cell.
[0017] The Pol gene encodes two proteins containing the two activities needed by the virus
in early infection, the RT and the integrase protein needed for integration of viral
DNA into cell DNA. The primary product of Pol is cleaved by the virion protease to
yield the amino terminal RT peptide which contains activities necessary for DNA synthesis
(RNA and DNA directed DNA polymerase, ribouclease H) and carboxy terminal integrase
protein. HIV RT is a heterodimer of full-length RT (p66) and a cleavage product (p51)
lacking the carboxy terminal Rnase integrase domain.
[0018] RT is one of the most highly conserved proteins encoded by the retroviral genome.
Two major activities of RT are the DNA Pol and Ribonuclease H. The DNA Pol activity
of RT uses RNA and DNA as templates interchangeably and like all DNA polymerases known
is unable to initiate DNA synthesis de novo, but requires a pre existing molecule
to serve as a primer (RNA).
[0019] The Rnase H activity inherent in all RT proteins plays the essential role early in
replication of removing the RNA genome as DNA synthesis proceeds. It selectively degrades
the RNA from all RNA - DNA hybrid molecules. Structurally the polymerase and ribo
H occupy separate, non-overlapping domains with the Pol covering the amino two thirds
of the Pol.
[0020] The p66 catalytic subunit is folded into 5 distinct subdomains. The amino terminal
23 of these have the portion with RT activity. Carboxy terminal to these is the Rnase
H Domain.
[0021] After infection of the host cell, the retroviral RNA genome is copied into linear
ds DNA by the reverse transcriptase that is present in the infecting particle. The
integrase (reviewed in
Skalka AM '99 Adv in Virus Res 52 271-273) recognises the ends of the viral DNA, trims them and accompanies the viral DNA to
a host chromosomal site to catalyse integration. Many sites in the host DNA can be
targets for integration. Although the integrase is sufficient to catalyse integration
in vitro, it is not the only protein associated with the viral DNA in vivo - the large
protein - viral DNA complex isolated from the infected cells has been denoted the
pre integration complex. This facilitates the acquisition of the host cell genes by
progeny viral genomes.
[0022] The integrase is made up of 3 distinct domains, the N terminal domain, the catalytic
core and the C terminal domain. The catalytic core domain contains all of the requirements
for the chemistry of polynucleotidyl transfer.
[0023] DNA vaccines usually consist of a bacterial plasmid vector into which is inserted
a strong promoter, the gene of interest which encodes an antigenic peptide and a polyadenylation/transcriptional
termination sequence. The gene of interest may encode a full protein or simply an
antigenic peptide sequence relating to the pathogen, tumour or other agent which it
is intended to protect against. The plasmid can be grown in bacteria, such as for
example
E. coli and then isolated and prepared in an appropriate medium, depending upon the intended
route of administration, before being administered to the host. Following administration
the plasmid is taken up by cells of the host, or delivered directly into the host
cells, where the encoded peptide is produced. The plasmid vector will preferably be
made without an origin of replication functional in eukaryotic cells, in order to
prevent plasmid replication in the mammalian host and integration within chromosomal
DNA of the animal concerned.
[0024] There are a number of advantages of DNA vaccination relative to traditional vaccination
techniques. First, it is predicted that because the proteins that are encoded by the
DNA sequence are synthesised in the host, the structure or conformation of the protein
will be similar to the native protein associated with the disease state. It is also
likely that DNA vaccination will offer protection against different strains of a virus,
by generating a cytotoxic T lymphocyte response that recognises epitopes from conserved
proteins. The technology also offers the possibility of combining diverse immunogens
into a single preparation to facilitate simultaneous immunisation in relation to a
number of disease states.
[0026] Doe et al (1994) Eur J immunol, 24: 2369-2376 investigated how variations in glycosylation affected the CD8+ CTL response to gp120
and found that gp120 produced in mammalian CHO cells had a reduced ability to prime
CTL responses when compared with insect or yeast cell-derived envelope proteins unless
N-linked oligosaccharides were removed prior to immunization.
[0027] It has now been discovered that there are benefits to be gained by employing a polynucleotide
encoding a non-glycosylated HIV envelope protein in a vaccine for HIV. Surprisingly,
a DNA vector expressing gp120 without a secretion signal and which is thus not glycosylated
or secreted from the cell is a more effective stimulator of CTL responses than a DNA
vector expressing gp120 with its native secretion signal. Since the secretion signal
is responsible for directing the gp120 to the intracellular site where glycosylation
takes place, gp120 which lacks its native secretion signal is not glycosylated. Moreover,
with the presence of a non-structural HIV protein such as tat in a fusion protein
with the non-glycosylated gp120, CTL responses to the gp120 are augmented. In contrast,
Tat in a fusion protein with normal gp120 prevents secretion but does not result in
an augmented immune response. The non-glycosylated gp120 can also be successfully
expressed in a fusion protein with other HIV antigens, both structural and non-structural.
Summary of the Invention
[0028] The present invention therefore provides novel constructs for use in nucleic acid
or polypeptide vaccines for the prophylaxis and treatment of HIV infections and AIDS.
[0029] In one aspect the invention provides a polynucleotide which comprises a sequence
encoding the HIV envelope protein gp120, wherein the gp-120 is non-glycosylated when
expressed in a mammalian target cell and wherein the gp120 lacks a functional secretion
signal, linked to a sequence encoding HIV RT, HIV Gag and HIV Nef, operably linked
to a heterologous promoter to encode a gp120, RT, Gag and Nef - containing fusion
protein.
[0030] In the following preferred embodiments the fusion protein is selected from:
gp120-RT-Nef-Gag, and
RT-Nef Gag-gp120
[0031] Optionally the Nef sequence for use in the invention is truncated to remove the sequence
encoding the N terminal region i.e. removal of 30-85, preferably 60-85, preferably
the N terminal 65 amino acids (the latter truncation is referred to herein as trNef).
Advantageously the Nef may be modified to remove one or more myristylation sites.
For example the Gly 2 myristylation site may be removed by deletion or substitution.
Alternatively or additionally the Nef may be modified to alter the dileucine motif
of Leu 174 and Leu 175 by deletion or substitution of one or both leucines. The importance
of the dileucine motif in CD4 downregulation is described e.g. in
Bresnahan P.A. et al (1998) Current Biology, 8 (22): 1235-8.
[0032] The RT polynucleotide for use in the invention preferably encodes a mutation to substantially
inactivate any reverse transcription activity. A preferred inactive mutant involves
the substitution of W tryptophan 229 for K lysine. See
WO 03/025003.
[0033] Preferably the Gag for use in the invention does not encode the Gag P6 polypeptide.
Preferred Gag sequences for use in the invention comprise P 17 and/or 24.
[0034] Preferably one or more of the HIV sequences included in the polynucleotide according
to the invention encoding gp120, Nef, Gag or RT is or are codon optimised for mammalian
cells, most preferably such that it/they resemble a highly expressed human gene in
their codon use.
[0035] The fusion may contain further HIV sequences.
[0036] The polynucleotide sequences are preferably codon optimised for mammalian cells,
in line with preferred aspects of the invention.
[0037] HIV envelope proteins such as gp120 expressed in a mammalian cell will normally be
glycosylated. The polynucleotide according to the invention comprises a gp120 encoding
sequence which is adapted to prevent glycosylation in a mammalian target cell, particularly
a human target cell. Glycosylation may be reduced or prevented in a number of different
ways, for example by removal of or mutation of the glycosylation sites or by removing
the native secretion signal. In the polynucleotide construct according to the invention
the gyp120 lacks a functional secretion signal. The secretion signal may vary in length
between HIV isolates, for example it is 30 amino acids long in the W61D isolate described
herein, but may be more or less than that for different isolates. Generally the secretion
signal is clearly delineated and will be removed in its entirety, although this is
not necessarily the case. A sufficient amount of the signal will be removed to prevent
its function of taking the envelope protein to the cellular machinery responsible
for glycosylation. This can be easily tested for.
[0038] The invention preferably relates to HIV-1. It is preferred that the constructs described
herein are derived from an HIV clade B or clade C, particularly clade B.
[0039] Preferably the promoter is the promoter from HCMV IE gene, more particularly wherein
the 5' untranslated region of the HCMV IE gene comprising exon 1 is included as described
in
WO 02/36792.
[0040] In another aspect the invention provides a vector comprising the polynucleotide sequences
described herein. The polynucleotide sequence is preferably DNA and is preferably
contained within a vector which is a double stranded DNA plasmid. Alternative vectors
are described hereinbelow and include in particular adenovirus vectors such as chimp
derived adenovirus vectors Pan 9 or Pan 5, 6 and 7, preferably where these are replication
defective such that they cannot replicate in the target cells.
[0041] In one embodiment the invention provides a fusion protein comprising the HIV envelope
protein gp120, HIV RT, HIV Gag and HIV Nef, wherein the gp120 is non-glycosylated
when expressed in a mammalian target cell and wherein the gp120 lacks a functional
secretion signal.
[0042] In another embodiment the invention provides a fusion protein as defined herein,
expressed from a polynucleotide which is codon optimised for mammalian cells.
[0043] In a further aspect the invention provides pharmaceutical compositions comprising
the nucleotide sequences and vectors and fusion proteins described herein, together
with a pharmaceutically acceptable excipient, diluent, carrier or adjuvant. In a preferred
embodiment the polynucleotide, preferably in the form of a DNA vector and preferably
comprising at least one codon optimised HIV sequence, is present in a composition
comprising a plurality of particles, preferably beads such as gold beads, onto which
the DNA is coated.
[0044] Delivery of polynucleotides according to the invention is preferably carried out
by particle mediated delivery, particularly via a bombardment approach.
[0045] It is envisaged that the vectors according to the invention may be utilised with
immunostimulatory agents, preferably but not necessarily administered at the same
time as the vectors and preferably formulated together in the compositions according
to the invention.
[0046] Immunostimulatory agents for use in the invention include, but this list is by no
means exhaustive and does not preclude other agents: synthetic imidazoquinolines such
as imiquimod [S-26308, R-837], (
Harrison, et al. 'Reduction of recurrent HSV disease using imiquimod alone or combined
with a glycoprotein vaccine', Vaccine 19: 1820-1826, (2001)); and resiquimod [S-28463, R-848] (
Vasilakos, et al.' Adjuvant activites of immune response modifier R-848: Comparison
with CpG ODN', Cellular immunology 204: 64-74 (2000).), Schiff bases of carbonyls and amines that are constitutively expressed on antigen
presenting cell and T-cell surfaces, such as tucaresol (
Rhodes, J. et al. 'Therapeutic potentiation of the immune system by costimulatory
Schiff-base-forming drugs', Nature 377: 71-75 (1995)), cytokine, chemokine and co-stimulatory molecules as either protein or peptide
or DNA, this would include pro-inflammatory cytokines such as GM-CSF, IL-1 alpha,
IL-1 beta, TGF- alpha and TGF - beta, Th1 inducers such as interferon gamma, IL-2,
IL-12, IL-15 and IL-18, Th2 inducers such as IL-4, IL-5, IL-6, IL-10 and IL-13 and
other chemokine and co-stimulatory genes such as MCP-1, MIP-1 alpha, MIP-1 beta, RANTES,
TCA-3, CD80, CD86 and CD40L, other immunostimulatory targeting ligands such as CTLA-4
and L-selectin, apoptosis stimulating proteins and peptides such as Fas, (49), synthetic
lipid based adjuvants, such as vaxfectin, (
Reyes et al., 'Vaxfectin enhances antigen specific antibody titres and maintains Th1
type immune responses to plasmid DNA immunization', Vaccine 19: 3778-3786) squalene, alpha-tocopherol, polysorbate 80, DOPC and cholesterol, endotoxin, [LPS],
Beutler, B., 'Endotoxin, 'Toll-like receptor 4, and the afferent limb of innate immunity',
Current Opinion in Microbiology 3: 23-30 (2000)) ; CpG oligo- and di-nucleotides,
Sato, Y. et al., 'Immunostimulatory DNA sequences necessary for effective intradermal
gene immunization', Science 273 (5273): 352-354 (1996).
Hemmi, H. et al., 'A Toll-like receptor recognizes bacterial DNA', Nature 408: 740-745,
(2000) and other potential ligands that trigger Toll receptors to produce appropriate Th1-inducing
cytokines, such as synthetic Mycobacterial lipoproteins, Mycobacterial protein p19,
peptidoglycan, teichoic acid and lipid A.
[0047] A preferred immunostimulatory agent for use with the invention is GM-CSF. This may
be employed in the form of a polynucleotide expressing GM-CSF which is co-administered
with the DNA vaccine of the invention. A DNA plasmid encoding GM-CSF may be present
in a pharmaceutical composition comprising the polynucleotide(s) according to the
invention.
[0048] Certain preferred adjuvants for eliciting a predominantly Th1-type response include,
for example, a Lipid A derivative such as monophosphoryl lipid A, or preferably 3-de-O-acylated
monophosphoryl lipid A. MPL
® adjuvants are available from Corixa Corporation (Seattle, WA;
see, for example,
US Patent Nos. 4,436,727;
4,877,611;
4,866,034 and
4,912,094). CpG-containing oligonucleotides (in which the CpG dinucleotide is unmethylated)
also induce a predominantly Th1 response. Such oligonucleotides are well known and
are described, for example, in
WO 96/02555,
WO 99/33488 and
U.S. Patent Nos. 6,008,200 and
5,856,462. Immunostimulatory DNA sequences are also described, for example, by
Sato et al., Science 273:352, 1996. Another preferred adjuvant comprises a saponin, such as Quil A, or derivatives thereof,
including QS21 and QS7 (Aquila Biopharmaceuticals Inc., Framingham, MA); Escin; Digitonin;
or
Gypsophila or
Chenopodium quinoa saponins.
[0049] According to a further aspect of the invention, a host cell comprising a polynucleotide
sequence according to the invention, or an expression vector according to the invention,
is provided. The host cell may be for example bacterial e.g.
E. coli, mammalian e.g. human, or may be an insect cell. Mammalian cells comprising a vector
according to the present invention may be cultured cells transfected
in vitro or may be cells
transfected in vivo by administration of the vector to the mammal.
[0050] By codon optimisation is meant that the DNA sequence is optimised to resemble the
codon usage of genes in mammalian cells. In particular, the codon usage in the sequence
is optimised to resemble that of highly expressed human genes.
[0051] The DNA code has 4 letters (A, T, C and G) and uses these to spell three letter "codons"
which represent the amino acids the proteins encoded in an organism's genes. The linear
sequence of codons along the DNA molecule is translated into the linear sequence of
amino acids in the protein(s) encoded by those genes. The code is highly degenerate,
with 61 codons coding for the 20 natural amino acids and 3 codons representing "stop"
signals. Thus, most amino acids are coded for by more than one codon - in fact several
are coded for by four or more different codons.
[0052] Where more than one codon is available to code for a given amino acid, it has been
observed that the codon usage patterns of organisms are highly non-random. Different
species show a different bias in their codon selection and, furthermore, utilisation
of codons may be markedly different in a single species between genes which are expressed
at high and low levels. This bias is different in viruses, plants, bacteria and mammalian
cells, and some species show a stronger bias away from a random codon selection than
others. For example, humans and other mammals are less strongly biased than certain
bacteria or viruses. For these reasons, there is a significant probability that a
mammalian gene expressed in
E.
coli or a foreign or recombinant gene expressed in mammalian cells will have an inappropriate
distribution of codons for efficient expression. It is believed that the presence
in a heterologous DNA sequence of clusters of codons or an abundance of codons which
are rarely observed in the host in which expression is to occur, is predictive of
low heterologous expression levels in that host.
[0053] In an embodiment of the present invention there is provided a gp120 polynucleotide
sequence which encodes a non-glycosylated gp120 amino acid sequence, wherein the codon
usage pattern of the polynucleotide sequence resembles that of highly expressed mammalian
genes. Preferably the polynucleotide sequence is a DNA sequence. Desirably the codon
usage pattern of the polynucleotide sequence is typical of highly expressed human
genes.
[0054] In the polynucleotides of the present invention, the codon usage pattern is altered
from that typical of human immunodeficiency viruses to more closely represent the
codon bias of the target organism, e.g. a mammal, especially a human. The "codon usage
coefficient" is a measure of how closely the codon pattern of a given polynucleotide
sequence resembles that of a target species. Codon frequencies can be derived from
literature sources for the highly expressed genes of many species (see e.g.
Nakamura et.al. Nucleic Acids Research 1996, 24:214-215). The codon frequencies for each of the 61 codons (expressed as the number of occurrences
occurrence per 1000 codons of the selected class of genes) are normalised for each
of the twenty natural amino acids, so that the value for the most frequently used
codon for each amino acid is set to 1 and the frequencies for the less common codons
are scaled to lie between zero and 1. Thus each of the 61 codons is assigned a value
of 1 or lower for the highly expressed genes of the target species. In order to calculate
a codon usage coefficient for a specific polynucleotide, relative to the highly expressed
genes of that species, the scaled value for each codon of the specific polynucleotide
are noted and the geometric mean of all these values is taken (by dividing the sum
of the natural logs of these values by the total number of codons and take the anti-log).
The coefficient will have a value between zero and 1 and the higher the coefficient
the more codons in the polynucleotide are frequently used codons. If a polynucleotide
sequence has a codon usage coefficient of 1, all of the codons are "most frequent"
codons for highly expressed genes of the target species.
[0055] According to the present invention, the codon usage pattern of the polynucleotide
will preferably exclude rare codons. Rare codons can be defined as codons representing
<20% or more preferably representing <10% of the codons used for a particular amino
acid in highly expressed genes of the target organism. Alternatively rare codons may
be defined as codons with a relative synonymous codon usage (RSCU) value of <0.3 or
more preferably <0.2 in highly expressed genes of the target organism. An RSCU value
is the observed number of codons divided by the number expected if all codons for
that amino acid were used equally frequently. An appropriate definition of a rare
codon would be apparent to a person skilled in the art.
[0056] A polynucleotide of the present invention will generally have a codon usage coefficient
for highly expressed human genes of greater than 0.3, preferably greater than 0.4,
most preferably greater than 0.5. Preferably also the codon usage coefficient will
be less than 1.0, preferably less than 0.9 and more preferably less than 0.8. Thus
a codon usage coefficient between 0.5 and 0.9 or between 0.5 and 0.8 is most preferred.
Codon usage tables for human can also be found in Genbank.
[0057] In comparison, a highly expressed beta actin gene has a codon usage coefficient of
0.747.
The codon usage table for a homo sapiens is set out below:
[0058] Codon usage for human (highly expressed) genes 1/24/91 (human_high.cod)
| AmAcid |
Codon |
Number |
/1000 |
Fraction |
. . |
| Gly |
GGG |
905.00 |
18.76 |
0.24 |
|
| Gly |
GGA |
525.00 |
10.88 |
0.14 |
|
| Gly |
GGT |
441.00 |
9.14 |
0.12 |
|
| Gly |
GGC |
1867.00 |
38.70 |
0.50 |
|
| |
|
|
|
|
|
| Glu |
GAG |
2420.00 |
50.16 |
0.75 |
|
| Glu |
GAA |
792.00 |
16.42 |
0.25 |
|
| Asp |
GAT |
592.00 |
12.27 |
0.25 |
|
| Asp |
GAC |
1821.00 |
37.75 |
0.75 |
|
| |
|
|
|
|
|
| Val |
GTG |
1866.00 |
38.68 |
0.64 |
|
| Val |
GTA |
134.00 |
2.78 |
0.05 |
|
| Val |
GTT |
198.00 |
4.10 |
0.07 |
|
| Val |
GTC |
728.00 |
15.09 |
0.25 |
|
| |
|
|
|
|
|
| Ala |
GCG |
652.00 |
13.51 |
0.17 |
|
| Ala |
GCA |
488.00 |
10.12 |
0.13 |
|
| Ala |
GCT |
654.00 |
13.56 |
0.17 |
|
| Ala |
GCC |
2057.00 |
42.64 |
0.53 |
|
| |
|
|
|
|
|
| Arg |
AGG |
512.00 |
10.61 |
0.18 |
|
| Arg |
AGA |
298.00 |
6.18 |
0.10 |
|
| Ser |
AGT |
354.00 |
7.34 |
0.10 |
|
| Ser |
AGC |
1171.00 |
24.27 |
0.34 |
|
| |
|
|
|
|
|
| Lys |
AAG |
2117.00 |
43.88 |
0.82 |
|
| Lys |
AAA |
471.00 |
9.76 |
0.18 |
|
| Asn |
AAT |
314.00 |
6.51 |
0.22 |
|
| Asn |
AAC |
1120.00 |
23.22 |
0.78 |
|
| |
|
|
|
|
|
| Met |
ATG |
1077.00 |
22.32 |
1.00 |
|
| Ile |
ATA |
88.00 |
1.82 |
0.05 |
|
| Ile |
ATT |
315.00 |
6.53 |
0.18 |
|
| Ile |
ATC |
1369.00 |
28.38 |
0.77 |
|
| |
|
|
|
|
|
| Thr |
ACG |
405.00 |
8.40 |
0.15 |
|
| Thr |
ACA |
373.00 |
7.73 |
0.14 |
|
| Thr |
ACT |
358.00 |
7.42 |
0.14 |
|
| Thr |
ACC |
1502.00 |
31.13 |
0.57 |
|
| |
|
|
|
|
|
| Trp |
TGG |
652.00 |
13.51 |
1.00 |
|
| End |
TGA |
109.00 |
2.26 |
0.55 |
|
| Cys |
TGT |
325.00 |
6.74 |
0.32 |
|
| Cys |
TGC |
706.00 |
14.63 |
0.68 |
|
| |
|
|
|
|
|
| End |
TAG |
42.00 |
0.87 |
0.21 |
|
| End |
TAA |
46.00 |
0.95 |
0.23 |
|
| Tyr |
TAT |
360.00 |
7.46 |
0.26 |
|
| Tyr |
TAC |
1042.00 |
21.60 |
0.74 |
|
| |
|
|
|
|
|
| Leu |
TTG |
313.00 |
6.49 |
0.06 |
|
| Leu |
TTA |
76.00 |
1.58 |
0.02 |
|
| Phe |
TTT |
336.00 |
6.96 |
0.20 |
|
| Phe |
TTC |
1377.00 |
28.54 |
0.80 |
|
| |
|
|
|
|
|
| Ser |
TCG |
325.00 |
6.74 |
0.09 |
|
| Ser |
TCA |
165.00 |
3.42 |
0.05 |
|
| Ser |
TCT |
450.00 |
9.33 |
0.13 |
|
| Ser |
TCC |
958.00 |
19.86 |
0.28 |
|
| |
|
|
|
|
|
| Arg |
CGG |
611.00 |
12.67 |
0.21 |
|
| Arg |
CGA |
183.00 |
3.79 |
0.06 |
|
| Arg |
CGT |
210.00 |
4.35 |
0.07 |
|
| Arg |
CGC |
1086.00 |
22.51 |
0.37 |
|
| |
|
|
|
|
|
| Gln |
CAG |
2020.00 |
41.87 |
0.88 |
|
| Gln |
CAA |
283.00 |
5.87 |
0.12 |
|
| His |
CAT |
234.00 |
4.85 |
0.21 |
|
| His |
CAC |
870.00 |
18.03 |
0.79 |
|
| |
|
|
|
|
|
| Leu |
CTG |
2884.00 |
59.78 |
0.58 |
|
| Leu |
CTA |
166.00 |
3.44 |
0.03 |
|
| Leu |
CTT |
238.00 |
4.93 |
0.05 |
|
| Leu |
CTC |
1276.00 |
26.45 |
0.26 |
|
| |
|
|
|
|
|
| Pro |
CCG |
482.00 |
9.99 |
0.17 |
|
| Pro |
CCA |
456.00 |
9.45 |
0.16 |
|
| Pro |
CCT |
568.00 |
11.77 |
0.19 |
|
| Pro |
CCC |
1410.00 |
29.23 |
0.48 |
|
[0059] According to a further aspect of the invention, an expression vector is provided
which comprises and is capable of directing the expression of a polynucleotide sequence
according to the first aspect of the invention, in particular wherein the codon usage
pattern of the gyp120 polynucleotide sequence is typical of highly expressed mammalian
genes, preferably highly expressed human genes. The vector may be suitable for driving
expression of heterologous DNA in bacterial insect or mammalian cells, particularly
human cells. In one embodiment, the expression vector is p7313 (see Figure 1).
[0060] Administration of the pharmaceutical composition of the invention may take the form
of one or of more than one individual doses, for example as repeat doses of the same
DNA plasmid, or in a heterologous "prime-boost" vaccination regime, particularly a
therapeutic vaccination regime. A heterologous prime-boost regime uses administration
of different forms of vaccine in the prime and the boost, each of which may itself
include two or more administrations. Preferably but not necessarily the priming and
boosting composition comprise the same antigens or different forms of the same antigens.
The priming composition and the boosting composition will anyway have at least one
antigen in common, although it is not necessarily an identical form of the antigen,
it may be a different form of the same antigen. An example of different forms of the
same antigen is in the case of a polynucleotide encoding a gp120 which lacks a functional
signal sequence and is non-glycosylated in mammalian cells, and a poplypeptide which
is gp120 with its signal sequence and which is glycosylated. A full length and a truncated
version of the same protein, or a mutated and a non-mutated form of the same protein,
may also be considered different forms of the same antigen for the purposes of a prime-boost
format according to the invention.
[0061] In one example of a prime-boost regime the "prime" vaccination may be via particle
mediated DNA delivery of a priming composition which comprises a polynucleotide according
to the present invention, preferably incorporated into a plasmid vector, while the
"boost" administration may be of a boosting composition comprising a recombinant viral
vector comprising the same polynucleotide sequence or a polynucleotide encoding at
least one of the same antigens encoded by the priming composition. Alternatively the
boosting may be carried out with at least one of the same antigens in the form of
the protein in adjuvant. Conversely the priming may be with a priming composition
comprising the viral vector or with a protein formulation typically a protein formulated
in adjuvant, and the boost a DNA vaccine of the present invention.
[0062] A preferred prime-boost format for use with the polynucleotides according to the
present invention is selected from:
Protein prime / live vector boost
Live vector prime / protein boost
Protein prime / DNA plasmid boost
DNA plasmid prime / protein boost
Live vector prime / DNA plasmid boost
DNA plasmid prime / live vector boost
[0063] Preferred live vectors include live virus vectors in particular adenovirus vectors
as described herein.
[0064] Preferably the priming and boosting compositions comprise, in addition to the antigen(s)
a suitable adjuvant, which may be different according to the particular composition.
[0065] Both the priming composition and the boosting composition may be delivered in more
than one dose. Furthermore the initial priming and boosting doses may be followed
up with further doses which may be alternated to result in e. g. a DNA plasmid prime/
protein boost/ further DNA plasmid dose/ further protein dose.
[0066] The invention further provides a process for the production of a polynucleotide as
described herein comprising linking a nucleotide sequence encoding HIV envelope protein
gp120, wherein the gp120 is non-glycosylated when expressed in a mammalian target
cell and wherein gp120 lack a functional secretion signal, and a sequence encoding
HIV Nef, NIV RT and HIV Gag.
[0067] As discussed above, the present invention includes expression vectors that comprise
the nucleotide sequences of the invention. Such expression vectors are routinely constructed
in the art of molecular biology and may for example involve the use of plasmid DNA
and appropriate initiators, promoters, enhancers and other elements, such as for example
polyadenylation signals which may be necessary, and which are positioned in the correct
orientation, in order to allow for protein expression. Other suitable vectors and
how to construct them would be apparent to persons skilled in the art. By way of further
example in this regard we refer to
Sambrook et al. Molecular Cloning: a Laboratory Manual. 2nd Edition. CSH Laboratory
Press.(1989).
[0068] Preferably, a polynucleotide of the invention, or for use in the invention in a vector,
is operably linked to a control sequence which is capable of providing for the expression
of the coding sequence by the host cell, i.e. the vector is an expression vector.
The term "operably linked" refers to a juxtaposition wherein the components described
are in a relationship permitting them to function in their intended manner. A regulatory
sequence, such as a promoter, "operably linked" to a coding sequence is positioned
in such a way that expression of the coding sequence is achieved under conditions
compatible with the regulatory sequence.
[0069] A nucleic acid sequence of the present invention may be administered by means of
specialised delivery vectors useful in gene therapy. Gene therapy approached are discussed
for example by
Verme et al, Nature 1997, 389:239-242. Both viral and non-viral vector systems can be used. The vectors may be, for example,
plasmids, artificial chromosomes (e.g. BAC, PAC, YAC), virus or phage vectors provided
with a origin of replication, optionally a promoter for the expression of the polynucleotide
and optionally a regulator of the promoter. The vectors may contain one or more selectable
marker genes, for example an ampicillin or kanamycin resistance gene in the case of
a bacterial plasmid or a resistance gene for a fungal vector. Vectors may be used
in vitro, for example for the production of DNA or RNA or used to transfect or transform a
host cell, for example, a mammalian host cell e.g. for the production of protein encoded
by the vector. The vectors may also be adapted to be used
in vivo, for example in a method of DNA vaccination or of gene therapy.
[0070] Examples of suitable viral vectors include retroviral, lentiviral, adenoviral, adeno-associated
viral, herpes viral such as herpes simplex viral, alpha-viral, pox viral such as Canarypox
and vaccinia-viral based systems. Gene transfer techniques using these viruses are
known to those skilled in the art. Retrovirus vectors for example may be used to stably
integrate the polynucleotide of the invention into the host genome, although such
recombination is not preferred. Replication-defective adenovirus vectors by contrast
remain episomal and therefore allow transient expression. Vectors capable of driving
expression in insect cells (for example baculovirus vectors), in human cells, yeast
or in bacteria may be employed in order to produce quantities of the HIV protein encoded
by the polynucleotides of the present invention, for example for use as subunit vaccines
or in immunoassays.
[0071] In a preferred embodiment the adenovirus used as a live vector is a replication defective
simian adenovirus. Typically these viruses contain an E1 deletion and can be grown
on cell lines that are transformed with an E1 gene. Preferred Simian adenoviruses
are viruses isolated from Chimpanzee. In particular C68 (also known as Pan 9) (See
US patent No 6083 716) and Pan 5, 6 and Pan 7 (
W0 03/046124) are preferred for use in the present invention. Thus these vectors can be manipulated
to insert a heterologous gene of the invention such that the gene product maybe expressed.
The use, formulation and manufacture of such recombinant adenoviral vectors is set
forth in detail in
WO 03/046142.
[0072] Promoters and other expression regulation signals may be selected to be compatible
with the host cell for which expression is designed. For example, mammalian promoters
include the metallothionein promoter which can be induced in response to heavy metals
such as cadmium, and the β-actin promoter. Viral promoters such as the SV40 large
T antigen promoter, human cytomegalovirus (CMV) immediate early (IE) promoter, rous
sarcoma virus LTR promoter, adenovirus promoter, or a HPV promoter, particularly the
HPV upstream regulatory region (URR) may also be used. All these promoters are well
described and readily available in the art.
[0073] A preferred promoter element is the CMV immediate early promoter devoid of intron
A, but including exon 1. Accordingly there is provided a vector comprising a polynucleotide
of the invention under the control of HCMV IE early promoter. A suitable HCMV IE promoter
is described in
WO 02/36792.
[0074] Non-viral based systems include direct administration of nucleic acids, microsphere
encapsulation technology, poly(lactide-co-glycolide) and liposome-based systems.
[0075] The polynucleotides according to the invention have utility in the production by
expression of the encoded proteins, which expression may take place
in vitro, in vivo or
ex vivo. The nucleotides may therefore be involved in recombinant protein synthesis, for example
to increase yields, or indeed may find use as therapeutic agents in their own right,
utilised in DNA vaccination techniques. Where the polynucleotides of the present invention
are used in the production of the encoded proteins
in vitro or
ex vivo, cells, for example in cell culture, will be modified to include the polynucleotide
to be expressed. Such cells include transient, or preferably stable mammalian cell
lines. Particular examples of cells which may be modified by insertion of vectors
encoding for a polypeptide according to the invention include mammalian HEK293T, CHO,
HeLa, 293 and COS cells. Preferably the cell line selected will be one which is stable.
Expression may be achieved in transformed oocytes. A polypeptide may be expressed
from a polynucleotide of the present invention, in cells of a transgenic non-human
animal, preferably a mouse. A transgenic non-human animal expressing a polypeptide
from a polynucleotide of the invention is included within the scope of the invention.
[0076] Preferably, expression vectors for use in DNA vaccines, vaccine compositions and
immunotherapeutics will be plasmid vectors or live viral vectors.
[0077] DNA vaccines may be administered in the form of "nakedDNA", for example in a liquid
formulation administered using a syringe or high pressure jet, or DNA formulated with
liposomes or an irritant transfection enhancer, or by particle mediated DNA delivery
(PMDD or particle mediated imunotherapeutic delivery PMID) as described in more detail
herein. All of these delivery systems are well known in the art. The vector may be
introduced to a mammal for example by means of a viral vector delivery system.
[0078] The compositions of the present invention can be delivered by a number of routes
such as intramuscularly, subcutaneously, intraperitonally, intravenously or mucosally.
[0079] The invention further provides an intradermal delivery device comprising a pharmaceutical
composition described herein.
[0080] In a preferred embodiment, the composition is delivered intradermally. In particular,
the composition is delivered by means of a gene gun particularly using particle bombardment
administration techniques which involve coating the vector on to beads (eg gold beads)
which are then administered under high pressure into the epidermis. This is described,
for example,in
Haynes et al, J Biotechnology 44: 37-42 (1996).
[0081] Numerous methods of carrying out a particle bombardment approach are known, see for
example
WO 91/07487. In one illustrative example, gas-driven particle acceleration can be achieved with
devices such as those manufactured by Powderject Pharmaceuticals PLC (Oxford, UK)
and Powderject Vaccines Inc. (Madison, WI), some examples of which are described in
U.S. Patent Nos. 5,846,796;
6,010,478;
5,865,796;
5,584,807; and
EP Patent No. 0500 799. This approach offers a needle-free delivery approach wherein a dry powder formulation
of microscopic particles, such as polynucleotide, are accelerated to high speed within
a helium gas jet generated by a hand held device, propelling the particles into a
target tissue of interest, typically the skin. The particles are preferably gold beads
of a 0.4 - 4.0 µm, more preferably 0.6 - 2.0 µm diameter and the DNA conjugate coated
onto these and then encased in a cartridge or cassette for placing into the delivery
device.
[0082] In a related embodiment, other devices and methods that may be useful for gas-driven
needle-less injection of compositions of the present invention include those provided
by Bioject, Inc. (Portland, OR), some examples of which are described in
U.S. Patent Nos. 4,790,824;
5,064,413;
5,312,335;
5,383,851;
5,399,163;
5,520,639 and
5,993,412.
[0083] The vectors which comprise the nucleotide sequences encoding antigenic peptides are
administered in such amount as will be prophylactically or therapeutically effective.
The quantity to be administered, is generally in the range of one picogram to 1 milligram,
preferably 1 picogram to 10 micrograms for particle-mediated delivery, and 100 nanograms
to 10 milligrams for other routes of nucleotide per dose. The exact quantity may vary
considerably depending on the weight of the patient being immunised and the route
of administration.
[0084] It is possible for the immunogen component comprising the nucleotide sequence encoding
the antigenic peptide, to be administered on a one off basis or to be administered
repeatedly, for example, between 1 and 7 times, preferably between 1 and 4 times,
at intervals between about 1 day and about 18 months. Further administrations may
also be given as necessary to maintain immune responses for the lifetime of the patient.
However, this treatment regime will be significantly varied depending upon the size
of the patient concerned, the amount of nucleotide sequence administered, the route
of administration, and other factors which would be apparent to a skilled medical
practitioner. The patient may receive one or more other anti HIV retroviral drugs
as part of their overall treatment regime. Additionally the nucleic acid immunogen
may be administered with an adjuvant.
[0085] The adjuvant component specified herein can similarly be administered via a variety
of different administration routes, such as for example, via the oral, nasal, pulmonary,
intramuscular, subcutaneous, intradermal or topical routes. Preferably, the adjuvant
component is administered via the intradermal or topical route, most preferably by
a topical route. This administration may take place between about 14 days prior to
and about 14 days post administration of the nucleotide sequence, preferably between
about 1 day prior to and about 3 days post administration of the nucleotide sequence.
[0086] The adjuvant component is, in one embodiment, administered substantially simultaneously
with the administration of the nucleotide sequence. By "substantially simultaneous"
what is meant is that administration of the adjuvant component is preferably at the
same time as administration of the nucleotide sequence, or if not, it is at least
within a few hours either side of nucleotide sequence administration. In the most
preferred treatment protocol, the adjuvant component will be administered substantially
simultaneously with administration of the nucleotide sequence. Obviously, this protocol
can be varied as necessary, in accordance with the type of variables referred to above.
It is preferred that the adjuvant is a 1H - imidazo [4,5c] quinoline - 4 - amine derivative
such as imiquimod. Typically imiquimod will be presented as a topical cream formulation
and will be administered according to the above protocol.
[0087] Once again, depending upon such variables, the dose of administration of the derivative
will also vary, but may, for example, range between about 0.1 mg per kg to about 100
mg per kg, where "per kg" refers to the body weight of the mammal concerned. This
administration of the 1H-imidazo[4,5-c]quinolin-4-amine derivative would preferably
be repeated with each subsequent or booster administration of the nucleotide sequence.
Most preferably, the administration dose will be between about 1 mg per kg to about
50 mg per kg. In the case of a "prime-boost" scheme as described herein, the imiquimod
or other 1H-imidazo[4,5-c]quinolin-4-amine derivative may be administered with either
the prime or the boost or with both the prime and the boost.
[0088] While it is possible for the adjuvant component to comprise only 1H-imidazo[4,5-c]quinolin-4-amine
derivatives to be administered in the raw chemical state, it is preferable for administration
to be in the form of a pharmaceutical formulation. That is, the adjuvant component
will preferably comprise the 1H-imidazo[4,5-c]quinolin-4-amine combined with one or
more pharmaceutically acceptable carriers, and optionally other therapeutic ingredients.
The carrier(s) must be "acceptable" in the sense of being compatible with other ingredients
within the formulation, and not deleterious to the recipient thereof. The nature of
the formulations will naturally vary according to the intended administration route,
and may be prepared by methods well known in the pharmaceutical art. All methods include
the step of bringing into association a 1H-imidazo[4,5-c]quinolin-4-amine derivative
with an appropriate carrier or carriers. In general, the formulations are prepared
by uniformly and intimately bringing into association the derivative with liquid carriers
or finely divided solid carriers, or both, and then, if necessary, shaping the product
into the desired formulation. Formulations of the present invention suitable for oral
administration may be presented as discrete units such as capsules, cachets or tablets
each containing a pre-determined amount of the active ingredient; as a powder or granules;
as a solution or a suspension in an aqueous liquid or a non-aqueous liquid; or as
an oil-in-water liquid emulsion or a water-in-oil emulsion. The active ingredient
may also be presented as a bolus, electuary or paste.
[0089] A tablet may be made by compression or moulding, optionally with one or more accessory
ingredients. Compressed tablets may be prepared by compressing in a suitable machine
the active ingredient in a free-flowing form such as a powder or granules, optionally
mixed with a binder, lubricant, inert diluent, lubricating, surface active or dispersing
agent. Moulded tablets may be made by moulding in a suitable machine a mixture of
the powdered compound moistened with an inert liquid diluent.
[0090] The tablets may optionally be coated or scored and may be formulated so as to provide
slow or controlled release of the active ingredient.
[0091] Formulations for injection via, for example, the intramuscular, intraperitoneal,
intradermal,or subcutaneous administration routes include aqueous and non-aqueous
sterile injection solutions which may contain antioxidants, buffers, bacteriostats
and solutes which render the formulation isotonic with the blood of the intended recipient;
and aqueous and non-aqueous sterile suspensions which may include suspending agents
and thickening agents. The formulations may be presented in unit-dose or multi-dose
containers, for example, sealed ampoules and vials, and may be stored in a freeze-dried
(lyophilised) condition requiring only the addition of the sterile liquid carrier,
for example, water for injections, immediately prior to use. Extemporaneous injection
solutions and suspensions maybe prepared from sterile powders, granules and tablets
of the kind previously described. Formulations suitable for pulmonary administration
via the buccal or nasal cavity are presented such that particles containing the active
ingredient, desirably having a diameter in the range of 0.5 to 7 microns, are delivered
into the bronchial tree of the recipient. Possibilities for such formulations are
that they are in the form of finely comminuted powders which may conveniently be presented
either in a piercable capsule, suitably of, for example, gelatine, for use in an inhalation
device, or alternatively, as a self-propelling formulation comprising active ingredient,
a suitable liquid propellant and optionally, other ingredients such as surfactant
and/or a solid diluent. Self-propelling formulations may also be employed wherein
the active ingredient is dispensed in the form of droplets of a solution or suspension.
Such self-propelling formulations are analogous to those known in the art and may
be prepared by established procedures. They are suitably provided with either a manually-operable
or automatically functioning valve having the desired spray characteristics; advantageously
the valve is of a metered type delivering a fixed volume, for example, 50 to 100 µL,
upon each operation thereof.
[0092] In a further possibility, the adjuvant component may be in the form of a solution
for use in an atomiser or nebuliser whereby an accelerated airstream or ultrasonic
agitation is employed to produce a find droplet mist for inhalation.
[0093] Formulations suitable for intranasal administration generally include presentations
similar to those described above for pulmonary administration, although it is preferred
for such formulations to have a particle diameter in the range of about 10 to about
200 microns, to enable retention within the nasal cavity. This may be achieved by,
as appropriate, use of a powder of a suitable particle size, or choice of an appropriate
valve. Other suitable formulations include coarse powders having a particle diameter
in the range of about 20 to about 500 microns, for administration by rapid inhalation
through the nasal passage from a container held close up to the nose, and nasal drops
comprising about 0.2 to 5% w/w of the active ingredient in aqueous or oily solutions.
In one embodiment of the invention, it is possible for the vector which comprises
the nucleotide sequence encoding the antigenic peptide to be administered within the
same formulation as the 1H-imidazo[4,5-c]quinolin-4-amine derivative. Hence in this
embodiment, the immunogenic and the adjuvant component are found within the same formulation.
[0094] In one embodiment the adjuvant component is prepared in a form suitable for biolistic
administration, and is administered via that route substantially simultaneously with
administration of the nucleotide sequence. For preparation of formulations suitable
for use in this manner, it may be necessary for the 1H-imidazo[4,5-c]quinolin-4-amine
derivative to be lyophilised and adhered onto, for example, particles such as gold
beads which are suited for biolistic administration.
[0095] In an alternative embodiment, the adjuvant component may be administered as a dry
powder, via high pressure gas propulsion.
[0096] Even if not formulated together, it may be appropriate for the adjuvant component
to be administered at or about the same administration site as the nucleotide sequence.
[0098] Suitable techniques for introducing the naked polynucleotide or vector into a patient
also include topical application with an appropriate vehicle. The nucleic acid may
be administered topically to the skin, or to mucosal surfaces for example by intranasal,
oral, intravaginal or intrarectal administration. The naked polynucleotide or vector
may be present together with a pharmaceutically acceptable excipient, such as phosphate
buffered saline (PBS). DNA uptake may be further facilitated by use of facilitating
agents such as bupivacaine, either separately or included in the DNA formulation.
Other methods of administering the nucleic acid directly to a recipient include ultrasound,
electrical stimulation, electroporation and microseeding which is described in
US 5,697,901.
[0099] Uptake of nucleic acid constructs may be enhanced by several known transfection techniques,
for example those including the use of transfection agents. Examples of these agents
include cationic agents, for example calcium phosphate and DEAE-Dextran and lipofectants,
for example lipofectam and transfectam. The dosage of the nucleic acid to be administered
can be altered.
[0100] A nucleic acid sequence of the present invention may also be administered by means
of specialised delivery vectors useful in gene therapy. Gene therapy approaches are
discussed for example by
Verme et al, Nature 1997, 389:239-242. Both viral and non-viral vector systems can be used and are described above. Viral
and non-viral delivery systems may be combined where it is desirable to provide booster
injections after an initial vaccination, for example an initial "prime" DNA vaccination
using a non-viral vector such as a plasmid followed by one or more "boost" vaccinations
using a viral vector or non-viral based system. Similarly the invention contemplates
prime boost systems with the polynucleotide of the invention, followed by boosting
with protein in adjuvant or vice versa.
[0101] A nucleic acid sequence of the present invention may also be administered by means
of transformed cells. Such cells include cells harvested from a subj ect. The naked
polynucleotide or vector of the present invention can be introduced into such cells
in vitro and the transformed cells can later be returned to the subject. The polynucleotide
of the invention may integrate into nucleic acid already present in a cell by homologous
recombination events. A transformed cell may, if desired, be grown up
in vitro and one or more of the resultant cells may be used in the present invention. Cells
can be provided at an appropriate site in a patient by known surgical or microsurgical
techniques (e.g. grafting, micro-injection, etc.)
[0102] The pharmaceutical compositions of the present invention may include adjuvant compounds
as detailed above, or other substances which may serve to increase the immune response
induced by the protein which is encoded by the DNA. These may be encoded by the DNA,
either separately from or as a fusion with the antigen, or may be included as non-DNA
elements of the formulation. Examples of adjuvant-type substances which may be included
in the formulations of the present invention include ubiquitin, lysosomal associated
membrane protein (LAMP), hepatitis B virus core antigen, FLT3-ligand (a cytokine important
in the generation of professional antigen presenting cells, particularly dentritic
cells) and other cytokines such as IFN-γ and GMCSF. Other preferred adjuvants include
imiquimod and resimquimod and tucarasol, imiquimod being particularly preferred.
[0103] In a particular embodiment of the invention there is provided the use of a nucleic
acid molecule as herein described for the treatment or prophylaxis of HIV infection,
administered with imiquimod. The imiquimod is preferably administered topically, whereas
the nucleic acid molecule is preferably administered by means of particle mediated
delivery.
[0104] The present invention will now be described by reference to the following examples,
references to Tat being provided by way of comparison and do not form part of the
claimed invention.
EXAMPLES
Example 1: Plasmid Construction
1.1 Construction of gp120 containing plasmid
[0105] Recombinant gp120 glycoprotein described in the following examples is a synthetic
form of the gp120 envelope protein of HIV-1 isolate W61D.
Codon Optimised (pgp120c):
[0106] The gene sequence was based on the gp120 sequence from the HIV-1 isolate W61D. This
has a Codon Usage Coefficient of 0.297. Optimisation was performed using SynGene 2d,
resulting in a CUC of 0.749 (
Ertl, PF., Thomsen, LL. Technical issues in construction of nucleic acid vaccines.
(2003) Methods 31(3); 199-206. SynGene uses a mathematical method for codon optimisation based on the relative
frequencies of use. Briefly, codons are assigned value ranges according to their frequencies,
so that more frequent codons have wider ranges, and placed in ascending frequency
order. The value ranges are expressed as >=0.000, >=0.0??, >=0.??? And so on. A random
number is generated between 0 and 0.99999. This is then used to select a codon, which
will be the codon allocated the range within which the random number falls. To exclude
rare codons the value 0.1 is added to the random number, so that it falls in the range
0.1-1.09999.
[0107] The gp120 sequence was split into 40 overlapping oligonucleotides, PCR assembled
and recovered using the end primers. The gene was cloned into vector p7313-ie (shown
in Figure 1) as aNotI-BamHI fragment and sequenced. Restriction fragments from three
initial clones were combined to generate a single correct clone. The amino acid sequence
and codon optimised DNA sequence are given in Figure 2.
1.2 Generation of Nef/Tat containing plasmids
Nef/Tat (pNTm and ptrNTm)
[0108] The gene for the Nef/Tat fusion protein was provided in plasmid pRIT15244 (Figure
3). The plasmid pRIT 15244 is identical to pRIT 14913 described below except that
the His tail has been deleted.
General
[0109] The Nef gene from the Bru/Lai isolate (
Cell 40: 9-17, 1985) was selected for the constructs since this gene is among those that are most closely
related to the consensus Nef.
[0110] The starting material for the Bru/Lai Nef gene was a 1170bp DNA fragment cloned on
the mammalian expression vector pcDNA3 (pcDNA3/Nef).
[0111] The Tat gene originates from the BH10 molecular clone. This gene was received as
an HTLV III cDNA clone named pCV and described in
Science, 229, p69-73, 1985. This
tat gene bears mutations in the active site region (Lys41→Ala) and in RGD motif (Arg78→Lys
and Asp80→Glu) (
Virology 235: 48-64, 1997).
[0112] The mutant
tat gene was received as a cDNA fragment subcloned between the EcoRI and HindIII sites
within a CMV expression plasmid (pCMVLys41/KGE)
Construction of vector pRIT14597 (encoding Nef-His protein).
[0113] The
nef gene was amplified by PCR from the pcDNA3/Nef plasmid with primers 01 and 02.

[0114] The integrative vector PHIL-D2 (INVITROGEN) was used. This vector was modified in
such a way that expression of heterologous protein starts immediately after the native
ATG codon of the AOX1 gene and will produce recombinant protein with a tail of one
glycine and six histidines residues. This PHIL-D2-MOD vector was constructed by cloning
an oligonucleotide linker between the adjacent AsuII and EcoRI sites of PHIL-D2 vector.
In addition to the His tail, this linker carries NcoI, SpeI and XbaI restriction sites
between which
nef, tat and
nef-tat fusion were inserted.
[0115] The nef PCR fragment obtained and the integrative PHIL-D2-MOD vector were both restricted
by NcoI and SpeI, purified on agarose gel and ligated to create the integrative plasmid
pRIT14597.
Construction of vector pRIT14913 (encoding fusion Nef-Tat mutant-His).
[0116] To construct pRIT14913, the
tat mutant gene was amplified by PCR from the pCMVLys41/KGE plasmid with primers 03 and
04.

[0117] The PCR fragment obtained and the plasmid pRIT14597 (expressing Nef-His protein)
were both digested by SpeI restriction enzyme, purified on agarose gel and ligated
to create the integrative plasmid pRIT14913.
1.3 Generation of PMID vectors for gp120 and Nef/Tat:
[0118] gp120: Codon-optimised gp120 was provided as described above.
Nef/Tat (pNTm and ptrNTm):
[0119] The gene for the Nef/Tat fusion protein was provided in plasmid pRIT15244 described
above. The Tat in this plasmid contains three mutations to inactivate the transactivation
function. The fusion contains full length Nef which has an immune modulatory function
(Collins and Baltimore (1999)) that may be abrogated by N-terminal truncation. Therefore
constructs were generated for both full length Nef/mutant Tat(pNTm) and truncated
Nef/mutant Tat(ptrNTm), in which the first 65 amino acids of Nef were removed. These
sequences were PCR amplified from pRIT15244 using primers:

[0120] The genes were cloned into vector p7313-ie as NotI-BamHI fragments and sequenced.
PNTm and ptrNTm and the Nef/Tat and truncated Nef/Tat sequences are shown in Figures
4 and 5.
Dual expression vectors: (pRIX1 and pRIX2)
[0121] The Nef/Tat and trNef/Tat expression cassettes were excised as ClaI-XmnI restriction
fragments, and ligated into the ClaI and blunted Sse8387 I sites of the vector containing
the codon optimised gp120 (pgp120c) to provide single plasmids for expression of both
proteins (pRIX1 and pRIX2 respectively).
Composition of plasmid p7313-ie (Figure 1)
[0122] The plasmid was constructed by replacing the beta-lactamase gene containing Eam1105I
- Pst1 fragment of pUC19 (available from Amersham Pharmacia Biotech UK Ltd., Amersham
Place, Little Chalfont, Bucks, HP7 9NA) with an EcoRI fragment of pUC4K (Amersham-Pharmacia)
containing the Kanamycin resistance gene, following blunt ending of both fragments
using T4 DNA polymerase. The human Cytomegalovirus IE1 promoter /enhancer, Intron
A, was derived from plasmid JW4303 obtained from Dr Harriet Robinson, University of
Massachusetts, and inserted into the Sal1 site of pUC19 as a XhoI -Sal1 fragment,
incorporating the bovine growth hormone polyadenylation signal. Deletion of the 5'SalI-BanI
fragment from the promoter generated the minimal promoter used in the vector (
WO00/23592 - Powderject Vaccines Inc.). HBV Surface antigen 3'UTR was derived from Hepatitis
B Virus, serotype adw, in the vector pAM6 (
Moriarty et al., Proc.Natl.Acad.Sci. USA, 78, 2606-10,1981). pAM6 (pBR322 based vector) was obtained from the American Type Culture Collection,
catalogue number ATCC 45020. The 3'UTR was inserted 5' to the polyadenylation signal
as a 1.4kb BamHI fragment, blunt ended for insertion to remove the BamHI sites. In
a series of steps (including digestion with
Bgl II, Klenow polymerase treatment, digestion with
BstX I, digestion with
Nco I, treatment with mung bean nuclease to remove overhang and further digestion with
BstX I)
, modifications were made to the region between the 3'untranslated enhancer region
of the HBV S gene and bGHpA signal to remove all open reading frames of greater than
5 codons between the X gene promoter and the bGHpA signal. This resulted in deletion
of sequence encoding the translatable portion of the X protein (9 amino acids) and
the X gene start codon. The bovine growth hormone polyadenylation signal was substituted
with the rabbit beta globin polyadenylation signal. The 5'non-coding and coding sequences
of the S antigen were excised and replaced with an oligonucleotide linker to provide
multiple cloning sites as shown to produce plasmid p7313-PL.

[0123] This polylinker was further extended by insertion of an additional oligonucleotide
linker between the KpnI and SalI sites:

[0124] The ColE1 cer sequence was obtained from a subclone from plasmid pDAH212 from David
Hodgeson (Warwick University) and amplified by PCR using primers to place EcoRI restriction
sites at the ends of the sequence. The cer sequence was then inserted into the EcoRI
site of p7313-PL to produce plasmid p7313-PLc. The sequence of the amplified cer was
verified against the Genbank entry M11411.
The HBV 3'UTR sequence between the promoter and polyadenylation signal was removed
by PCR amplification of the polyadenylation signal using primers:
sense: CCATGGATCCGATCTTTTTCCCTCTGCC [SEQ ID NO: 10]
antisense: GTTAGGGTGAAAAGCTTCCGAGTGAGAGACAC [SEQ ID NO: 11]
The resulting product was cut with BamHI and XmnI and used to replace the corresponding
fragment containing both the polyadenylation signal and the 3'UTR. The Intron A sequence
was removed from the plasmid by PCR amplification of the CMV promoter/enhancer using
primers:
sense: GCTAGCCTGCAGGCTGACCGCCCAACGAC [SEQ ID NO: 12]
antisense: GTTCTCCATCGCGGCCGCACTCTTGGCACGGGG [SEQ ID NO: 13]
[0125] The resulting product was cut with Sse8387 I and NotI, and inserted back into the
Sse8387 I and NotI sites of the parental vector.
Example 2: Modification of pg120 and Nef/Tat(mut) expression vectors
[0126] gp120 constructs were modified to reduce secretion of the protein.
Generation of constructs:
gp120 without a secretion signal (dsgp120, pRix 12 - see Figure 2 and 6)
[0127] The gp120 gene was PCR amplified from pgp120c using the following primers:
5' 120ds: 5'GAATTCGCGGCCGCCATGGCCGAGCAGCTGTGGGTCACC [SEQ ID NO:14]

[0128] Fragments were amplified using PWO DNA polymerase (Roche) and the cycle:

[0129] The products were cut with NotI and BamHI and cloned into p7313-ie to give pRix12
(Figure 6).
Results
[0130] In 293T cells the vector pRIX12, which lacks the secretion signal, makes a good amount
of a 60kDa non-glycosylated protein that is not secreted.
Example 3: Construction of vectors for expression of gp120 and Nef/Tat(mut) from a single plasmid
Vector construction:
[0131] The gp120 Nef/Tat(m) constructs were generated by PCR stitching the gp120 and Nef/Tat(m)
or trNef/Tat(m) orfs.
[0132] 5' and 3' Gp120, 5' and 3' Nef/Tat(m) and 5'trNef/Tat were amplified from pRix1.
3'trNef/Tat(m) was amplified from pNTm. The following primers were used:
3'120: (antisense to): GCCAAGCGCCGCGTCGTGCAGAGA [SEQ ID NO: 16] 5'120/NT:
GCCAAGCGCCGCGTCGTGCAGAGAATGGGTGGCAAGTGGTCAAAAAGT [SEQ ID NO:17]
3'NT (antisense to): GGGGAGCCGACAGGCCCGAAGGAA [SEQ ID NO: 18]
5'NT/120: GGGGAGCCGACAGGCCCGAAGGAAATGAAGGTCAAGGAGACCAGAAAG [SEQ ID NO: 19]
5'120/trN: GCCAAGCGCCGCGTCGTGCAGAGAATGGTGGGTTTTCCAGTCAC [SEQ ID NO: 20]
5'trNef: GAATTCGCGGCCGCCATGGTGGGTTTTCCAGTCACACC [SEQID NO: 21]
L01:

L02:

[0133] Fragments were amplified using PWO DNA polymerase (Roche) and the cycle:

[0134] Primer L1 was used as the 3' primer for 3'gp120. However there were problems using
this primer when stitching Nef/Tat or trNef/T to the 5' end of gp120 so primer L2
was used instead.
[0135] The stitched gp120-N/Tm and gp120-trN/Tm fragments were cut with Not1 and BamHI and
cloned into similarly cut p7313-ie. Due to the use of primer L2 rather than L1 the
N/Tm-gp120 and trN/Tm-gp120 fragments lacked a BamHI site, so these were cut with
NotI and AccI, and cloned into similarly cut pgp120c. All inserts were fully verified
by sequencing. The plasmids were designated pRix6 (gp120c NefTat
m), pRix11 (gp120c trNefTat
m), pRix7 (NefTatm gp120c) and pRix8 (trNefTat
mgp120) (Figures 23-26).
Example 4: Construction of vectors to invesigate the effects of glycosylation and secretion, inclusion of Tat and inclusion of Gag (p17/24) and Nef and RT on gp120 and gp120 fusions
[0136] Vectors were constructed as shown in Figures 33 and 34 (schematic).
pRix 28 and pRix29 (Figures 7 and 8)
[0137] pRix28 and 29 containing ds gp120c NefTat
m and ds gp120c trNefTat were generated by transferring the AccI-BamHI fragments from
pRix6 (2315bp) and pRix11 (2123bp) into similarly cut pRix12 (ds gp120c).
pRix30 and pRix31 (Figure 27 and Figure 9)
[0138] To generate glycosylated and non-glycosylated fusion vectors of gp120c Nef without
Tat, the NotI-KpnI fragment was transferred from pRix11 (1580bp) or pRix29 (1496bp)
into similarly cut pRix15, a vector containing Tat/trNef.
(pRix15) - Tat(mut)trNef
[0139] The genes for Tat and trNefwere PCR amplified from pNTm using the following primers:
5'Tat: 5'GAATTCGCGGCCGCCATGGAGCCAGTAGATCCTAGAC [SEQ ID NO: 24]
3'Tat: 5'TTCCTTCGGGCCTGTCGGC [SEQ ID NO: 25]
5'trTN: GCCGACAGGCCCGAAGGAAATGGTGGGTTTTCCAGTCACAC [SEQ ID NO: 26]
3'Nef: GAATTCGGATCCTTAGCAGTTCTTGAAGTACTCCGG [SEQ ID NO: 27]
[0140] The individual genes were gel purified and then PCR stitched to give TmtrN using
the end primers. The fusion was then digested with NotI and BamHI and cloned into
p7313-ie.
pRix32 (Figure 28)
[0141] To generate the fusion containing p 17/24, gp 120 was PCR amplified from pgp 1 20c
using primers U1 and 3'120, p17/24-Nef was amplified from p73i-GN2 using primers 5'120G
and 3'Nef, and the two were PCR stitched using U1 and 3'Nef. p73I-GN2 contained a
synthetic codon optimised sequence of p17/p24 based on the sequence of HXB2 (GenBank
entry K03455) and designed using SynGene and assembled from overlapping oligonucleotides
as described for codon optimised gp120 above, fused to HXB2 Nef, which had been obtained
from plasmid pHXBΔPr (
B.Maschera, E Furfine and E.D. Blair 1995 J.Virol 69 5431-5436) by PCR. Since the HXB2 nef gene in this plasmid contains a premature termination
codon two overlapping PCRs were used to repair the codon (TGA [stop] to TGG [Trp]).
The position of the repaired codon is underlined in the sequence. The p17/p24/Nef
gene was inserted into the NotI and BamHI sites of plasmid p7313ie. The coding sequence
and map is given in Figure 10. A * marks the p24/trNef junction.
[0142] Primers:

3'120: TCTCTGCACGACGCGGCGCTTGGC [SEQ ID NO: 29]5'120G: GCCAAGCGCCGCGTCGTGGAGAGAATGGGTGCCCGAGCTTCGGTAC
[SEQ ID NO: 30]
3'Nef: GAATTCGGATCCTTAGCAGTTCTTGAAGTACTCCGG [SEQ ID NO: 31]
[0143] Initial cycle:

Using pfx polymerase with 1x enhancer.
[0144] Stitch:

Using Vent polymerase in standard conditions + 2mM MgCl
2.
[0145] The product was cut with NotI and BamHI and cloned into p7313-ie.
[0146] On sequencing the construct was found to have a error in the signal peptide, which
was corrected by transferring the 2560bp BstEII - KpnI fragment containing the back
of gp120 to the front of Nef into pRix30.
pRix 33 (Figure 11), pRix34 (Figure 29), and pRix35 (Figure 12)
[0147] The 2560bp BstEII - KpnI fragment containing the back of gp120 to the front of Nef
was transferred to pRix31, pRix11 and pRix29 to make vectors pRix 33 (Figure 11),
34 and 35 (Figure 12) respectively.
[0148] pRix39 (gp120 codon optimised minus secretion signal - p17/24 gag - Nef-Tat - Figure 13) and pRix40-47 (Constructs pRix 40-47 contain non-glycosylated gp120, gag-p 17/24, Nef and Tat(m)
fusions with mutations in the miristoylation site and/or dileucine motif of Nef)
[0149] A fragment containing gag p17/24 was PCR amplified from vector pRix35 using primers:
5'120G: GCCAAGCGCCGCGTCGTGGAGAGAATGGGTGCCCGAGCTTCGGTAC [SEQ ID NO: 32]
and
p24AS: CAACACTCTGGCTTTGTGTCC [SEQ ID NO: 33]
[0150] Full length Nef was PCR amplified from pNTm using primers:
5'p24-N: GGACACAAAGCCAGAGTGTTGATGGGCAAGTGGTCAAAAAGTAG [SEQ ID NO: 34]
and
3'Nef: GAATTCGGATCCTTAGCAGTTCTTGAAGTACTCCGG [SEQ ID NO: 35]
[0151] The two fragments were PCR stitched together using the end primers (5'120G and 3'Nef).
The product was cut with SalI and KpnI, and the 423bp fragment containing part of
p24 and Nef was used to replace the corresponding fragment in pRix35 to make pRix39
(Figure 13).
[0152] pRix40 (Figure 14) was similarly constructed except primer 5'p24-N was replaced with
primer:
5'p24-Ndm:

[0153] This primer deletes the one G to destroy the miristoylation site at the start of
Nef.
pRix41-44, 46 and 47 (Figures 15 to 20)
[0154] Mutations to the dileucine motif in Nef (L174L175) were made by PCR:
[0155] To insert the mutations, the portion of Nef 5' to the LL motif was PCR amplified
using the 5'Nef primer and asNefLL
5'Nef GAATTCGCGGCCGCCATGGGTGGCAAGTGGTCAAAAAG [SEQ ID NO: 37]
asNefLL (Antisense to)

[0156] Mutations to L174, L175 or both 174 and 175 were generated using forward primers
sNefL1 (L174A)

sNefL2 (L175A)

SnefLL (LL174/5AA)

and the 3'NT primer:
3'NT (antisense to):GGGGAGCCGACAGGCCCGAAGGAA [SEQ ID NO: 42]
to amplify the 3' portion of Nef. The 5' and each of the 3' products were PCR stitched
using the 5'Nef and 3'NT primers. These were cut with KpnI and SpeI and inserted into
similarly cut pRix39 to generate pRix41 (L174A), pRix42 (L175A), and pRix43 (LL174/175A)
in the absence of the myristoylation site mutation, or into pRix40 to generate pRix44
(mLL174/175AA) pRix46 (mL174A) and pRix47 (mL175A) with the myristoylation site mutation.
pRix58 (Figure 21)
[0157] The gp 120 fragment without signal sequence was PCR amplified from pgp120c using
the primers:
5' ds120 : GAATTCGCGGCCGCCATGGCCGAGCAGCTGTGGGTCACC [SEQ ID NO: 43]
3'120: (antisense to): GCCAAGCGCCGCGTCGTGCAGAGA [SEQ ID NO: 44]
the 5' end of RT (codon optimised and containing the W229K inactivating mutation)
was PCR amplified from pt-rng (Figure 32 - see also
WO 03/025003) using a 5' primer to insert a sequence homologous to 3'120, and a primer within
RT
120RTf: GCCAAGCGCCGCGTCGTGCAGAGAATGGGCCCCATCAGTCCCATC [SEQ ID NO: 45]
RT3SR1: CGTCACGATGTTCACCTCCAGGCC [SEQ ID NO: 46]
[0158] The two products were PCR stitched using the end primers, and cut with NotI and NheI.
The fragment was gel purified and used to replace the NotI -NheI fragment from pT-rng.
[0159] pRix59 (Figure 22): the 3'Gag fragment was PCR amplified from pT-rng using a primer 5' to the MunI site
in p24 and a 3' primer encoding the start of dsgp120, covering the position of the
BstEII site near the 5' end:
GagMunf
GTGGCCCGAGAGCTGCATCCG [SEQ ID NO: 47]

[0160] The product was cut with MunI and BstEII, and inserted into the 7113bp fragment from
MunI-BstEII cut pRix54.
pRix48 and 49 (Figures 30 and 31)
[0161] The plasmids pRix 48 and 49 are equivalent to pRix39 and 41 except that they contain
glycosylated gp120. To generate pRix48 and pRix49, the NotI - SalI fragments of pRix39
and pRix41 were replaced with the equivalent fragment from pRix32.
Results
[0162] Expression data is shown in Figures 33 and 35.
[0163] 293T cell monolayers in 24 well plates were transfected with 1µg of each DNA indicated
using Lipofectamine 2000 following the manufacturer's supplied protocol. After 24
hours the cells were detached and separated from the culture medium by centrifugation.
Samples equivalent to 1x10
4 cells or 12µl of medium were examined by PAGE and Western blot.
[0164] The gp 120c construct gave a highly glycosylated well secreted protein. Addition
of c-terminal Nef/Tat fusions (pRix 6 and pRix11) resulted in a reduction of the intracellular
protein levels and loss of secretion. Removal of the secretion signal from gp120c
(pRix12) gave a non-glycosylated non-secreted form of the protein.
[0165] As expected, fusion constructs with no secretion signal pRix28, 29, 31, 33 and 35,
made non-glycosylated intracellular proteins in similar amounts, though expression
from pRix35 was somewhat reduced. Surprisingly, when the secretion signal was present
in constructs pRix30, 32 and 34, only pRix34 failed to be secreted. It appears that
the presence of Tat in the fusion inhibits secretion of the protein. The initial pRix32.1
construct had a point mutation resulting in poor expression. This was corrected in
pRix32.7, which showed greatly improved expression.
[0166] For pRix40-47 the western blot in Figure 35 shows the expression of the dsgp120/Gag/Nef/Tat
fusions with mutations in Nef in 293T cells 24hours post transfection with the plasmids
indicated. Total cell extracts equivalent to ∼1x10
4 cells were loaded onto the gel. The blot was probed with an anti-nef antiserum.
[0167] For pRix48-49 the western blot in Figure 35 shows the expression of the gp120/Gag/Nef/Tat
fusions with glycosylated gp120 in 293T cells 24hours post transfection with the plasmids
shown. Total cell extracts equivalent to ∼1x10
4 cells were loaded onto the gel. The blot was probed with an anti-nef antiserum.
[0168] Similarly, expression data (anti-Nef) for the quadrivalent fusion proteins containing
RT, Nef, Gag and dsgp120, compared to expression of the RT,Nef,Gag fusion alone, is
shown in Figure 35.
Refs:
Example 5: Preparation of plasmid-coated 'gold slurry' for 'gene gun' DNA cartridges
[0172] Plasmid DNA (approximately 1µg/µl), eg. 100 ug, and 2µm gold particles, eg. 50 mg,
(PowderJect), were suspended in 0.05M spermidine, eg. 100 ul, (Sigma). The DNA was
precipitated on to the gold particles by addition of 1M CaCl
2, eg. 100ul (American Pharmaceutical Partners, Inc., USA). The DNA/gold complex was
incubated for 10 minutes at room temperature, washed 3 times in absolute ethanol,
eg. 3 x 1 ml, (previously dried on molecular sieve 3A (BDH)). Samples were resuspended
in absolute ethanol containing 0.05mg/ml of polyvinylpyrrolidone ( PVP, Sigma), and
split into three equal aliquots in 1.5 ml microfuge tubes, (Eppendorf). The aliquots
were for analysis of (a) 'gold slurry', (b) eluate- plasmid eluted from (a) and (c)
for preparation of gold/ plasmid coated Tefzel cartridges for the 'gene gun', (see
Example 3 below). For preparation of samples (a) and (b), the tubes containing plasmid
DNA / 'gold slurry' in ethanol / PVP were spun for 2 minutes at top speed in an Eppendorf
5418 microfuge, the supernatant was removed and the 'gold slurry' dried for 10 minutes
at room temperature. Sample (a) was resuspended to 0.5 - 1.0 ug / ul of plasmid DNA
in TE pH 8.0, assuming approx. 50 % coating. For elution, sample (b) was resuspended
to 0.5 -1.0 ug / ul of plasmid DNA in TE pH 8.0 and incubated at 37
0C for 30 minutes, shaking vigorously, and then spun for 2 minutes at top speed in
an Eppendorf 5418 microfuge and the supernatant, eluate, was removed and stored at
- 20
0C. The exact DNA concentration eluted was determined by spectrophotometric quantitation
using a Genequant II (Pharmacia Biotech).
Example 6: Preparation of Cartridges for DNA immunisation
[0173] Preparation of cartridges for the Accell gene transfer device was as previously described
(
Eisenbraun et al DNA and Cell Biology, 1993 Vol 12 No 9 pp 791-797; Pertner et al). Briefly, plasmid DNA was coated onto 2 µm gold particles (DeGussa
Corp., South Plainfield, N.J., USA) and loaded into Tefzel tubing, which was subsequently
cut into 1.27 cm lengths to serve as cartridges and stored desiccated at 4°C until
use. In a typical vaccination, each cartridge contained 0.5 mg gold coated with a
total of 0.5 µg DNA/cartridge.
Example 7: PMID immunisations including using gp120-Nef-Tat triple fusion lacking gp120 secretion signal
[0174] Protocol: For PMID immunisations (DNA) cartridges were prepared for using standard methods
as described in Examples 5 and 6. A DNA loading rate of 2, which will give approximately
0.5 µg DNA/cartridge was used and each immunisation consisted of two shots. Balb/c
mice were given a primary immunisation of DNA (using PMID). The mice were boosted
28 days later with DNA (using PMID). Mice were culled 7 days later and serum and spleens
were collected. The splenocytes were harvested by teasing out the spleen cells and
erythrocytes were lysed. The splenocytes were washed and counted. Specialised ELIspot
plates (coated with interferon-gamma capture antibody and blocked) were used. Splenocytes
were transferred to these plates and incubated overnight at 37°C/5% CO
2 in the presence of a gp120 peptide, RT peptide or Gag peptide. The splenocytes were
lysed and the plate developed using standard procedures to demonstrate the number
of interferon-gamma secreting cells present. Serum was analysed by ELISA assay to
detect for specific antibodies. Results are shown in Figures 36-38.
Conclusion
[0175] Unexpectedly, the cellular immune response of mice immunised with dsgp120 (gp 120
lacking secretion signal) expressing constructs was approximately double that of mice
immunised with gp120 constructs (see Figure 36 and 37). This was consistent with the
observation that in
in vitro transfection studies the expression of dsgp120 had remained largely cell associated,
whereas gp120 had been excreted.
[0176] Inclusion of Tat (mutated Tat) in the dsgp120 constructs increased the cellular immune
response to twice that of the dsgp120 constucts without Tat (Figures 36 and 37). Tat
on its own did not affect the immune response to gp120, but acted synergistically
with dsgp120 to optimise the cellular response.
[0177] The inclusion of other HIV antigens in the constructs produced a balanced cellular
response to all the different antigens included and thus broadened the immune response
compared to the gp 120 only vectors (Figure 38).