Field
[0002] The present disclosure is directed to methods and compositions for the gene transfer
into renal tissues and, in particular, is directed to methods and compositions for
in vivo or ex vivo gene transfer to renal tissue using gutless adenovirus vector.
BACKGROUND
[0003] Kidney-targeted gene transfer has the potential to revolutionize the treatment of
renal diseases. Transplanted kidneys also provide an ideal setting for
ex vivo gene transfer. Several
in vivo gene transfer methods have been attempted to target certain renal structures, for
example, the HVJ-liposome method and renal perfusion of adenovirus for glomerular
cells, intravenous injection of oligonucleotides (ODNs) for proximal tubule, intra-arterial
injection of adenovirus followed by cold incubation with a vasodilator for interstitial
vasculature of the outer medulla and adenoviral injection into the renal pelvis for
the inner medullary collecting duct. As an
ex vivo gene transfer method targeting the glomerulus, the transfusion of genetically-modified
mesangial cells has been attempted. Implantation of genetically-modified tubular epithelial
cells into the subcapsular region has been employed for
ex vivo transfection to the interstitium.
[0004] However, although gene therapy theoretically has the distinct potential to treat
renal disease at the most fundamental level, its application has been limited by the
availability of an adequate system for long term gene delivery to the kidney. There
still exists a need for improved gene transfer techniques, especially gene transfer
vectors that are capable of mediating effective gene transfer into renal tissues with
low toxicity.
SUMMARY
[0005] One aspect of the present disclosure relates to methods for treating a renal disease
in a mammal. The method comprises the step of infusing the kidney with a gutless adenoviral
vector comprising a polynucleotide encoding a therapeutic agent and a regulatory element
operably linked to the polynucleotide, wherein the gutless adenoviral vector comprises
the nucleotide sequence of SEQ ID NO:13 or SEQ ID NO:15. In a related aspect, the
gutless adenovirus vector is infused through the vena renalis. In another related
aspect, the gutless adenovirus vector is infused through the superior mesenteric artery.
[0006] In another aspect, the method comprises the steps of: administering a therapeutically
effective amount of a gutless adenovirus vector into a segment of a renal blood vessel
in vivo, wherein the gutless adenovirus vector comprises the nucleotide sequence of SEQ ID
NO:13 or SEQ ID NO:15, and is capable of expressing a therapeutic agent. In a related
aspect, the gutless adenovirus vector is administered using a stent.
[0007] Another aspect pertains to a method for improving allograft survival. The method
comprises the steps of: perfusing a kidney harvested from an organ donor with a gutless
adenovirus vector carrying a nucleotide sequence encoding a immune modulator and a
regulatory element operably linked to the nucleotide sequence; and transplanting the
perfused kidney into a subject. In a related aspect, the immune modulator is indoleamine
dioxygenase.
[0008] Another aspect pertains to a gutless adenovirus vector comprising a polynucleotide
encoding a therapeutic protein, a renal tissue specific regulatory element operably
linked to the polynucleotide sequence; and a stuffer comprising the nucleotide sequence
of SEQ ID NO:13 or SEQ ID NO:15.
[0009] Another aspect pertains to a gutless adenovirus vector comprising a polynucleotide
encoding an indoleamine dioxygenase, a regulatory element operably linked to the polynucleotide
sequence; and a stuffer comprising the nucleotide sequence of SEQ ID NO:13 or SEQ
ID NO:15.
[0010] Yet another aspect pertains to a pharmaceutical composition for treating a renal
vascular disease, comprising the gutless adenovirus vector described above and a pharmaceutically
acceptable carrier.
[0011] The invention relates to a gutless adenovirus vector, comprising the nucleotide sequence
of SEQ ID NO:21 or SEQ ID NO:22,wherein said gutless adenovirus vector is capable
of expressing the indoleamine 2,3-dioxygenase encoded by SEQ ID NO:21 or SEQ ID NO:22
in a renal tissue.
BRIEF DESCRIPTION OF THE DRAWINGS
[0012]
Figure 1 is a schematic drawing of an embodiment of the backbone shuttle vector pShuttle-ITR-HPRT.
Figure 2 is a schematic drawing of an embodiment of the full length backbone vector
pTM-final.
Figure 3 is a picture of a Western blot showing hTM expression in HEK 293 cells transfected
with pTM-final (the full size backbone of gutless Ad.hTM). Lanes 1-3: lysate from
control cells; Lanes 4-6, lysate from pTM-final transfected cells.
Figure 4 is a picture of a Western slot blot showing hTM expression in 293FLP cells
(passage number 2 (P2) during viral amplification). Row 1, lane 1-3: TM detection
using 5ul cell lysate of P2. Row 2, lane 1-3: TM detection using 30ul cell lysate
of P2. Row 3, lane 1-3: negative control cells.
Figure 5 is a picture of a Western blot showing hTM expression in rat vena cava infected
with gutless TM virus.
Figure 6 is a picture of a Western bolt showing TM expression in CRE cells at passage
number 1-6 (P1-P6).
Figure 7 is a composite of images showing gutless adenovirus-mediated luciferase expression
in rat tail vein.
Figure 8 is a diagram showing TM expression in livers of non-infected rats (con) and
TM gutless virus infected rats (TM virus).
Figure 9 is a picture of Western blots using a anti-TM antibody (blot 1) and plasma
from animals infected with TM virus (blots 2-4).
Figure 10 is a schematic drawing of an embodiment of the rat IDO expression cassette.
Figure 11 is a schematic drawing of an embodiment of the human IDO expression cassette.
Figure 12 is a schematic drawing of a gutless backbone vector.
Figure 13 is a schematic drawing of an embodiment of the rat gutless IDO backbone
vector.
Figure 14 is a schematic drawing of an embodiment of the human gutless IDO backbone
vector.
Figure 15 is a picture of a Western blot showing gutless adenovirus mediated IDO expression
in transplanted kidney (lane 1 = hIDO control, other lanes as indicated)
Figure 16 is a composite of graphs showing reduction of plasma creatinin levels (panel
A), ED-1 staining (panel B), CD8 staining (panel C) and smooth muscle actin score
(panel D) in kidney tissue infected by gutless adenovirus carrying the IDO gene.
DETAILED DESCRIPTION
[0013] The practice of the present disclosure will employ, unless otherwise indicated, conventional
methods of histology, virology, microbiology, immunology, and molecular biology within
the skill of the art. Such techniques are explained fully in the literature.
[0014] The primary object of the present disclosure is to provide methods for treating renal
diseases and improving kidney allograft survival using gene transfer technologies.
One aspect relates to a method for treating a renal disease by infusing the kidney
in vivo with an effective amount of gutless adenovirus vector carrying a DNA sequence encoding
a therapeutic agent. The virus-mediated expression of the therapeutic agent in renal
tissue ameliorates symptoms of the renal diseases. This local approach eliminates
the need to inject a large quantity of virus into a patient and hence significantly
reduces the viral-related toxicity.
[0015] As used herein, the term "effective amount" means that amount of a drug or pharmaceutical
agent that will elicit the biological or medical response of a tissue, system, animal
or human that is being sought, for instance, by a researcher or clinician. Furthermore,
the term "therapeutically effective amount" means any amount which, as compared to
a corresponding subject who has not received such amount, results in improved treatment,
healing, prevention, or amelioration of a disease, disorder, or side effect, or a
decrease in the rate of advancement of a disease or disorder. The term also includes
within its scope amounts effective to enhance normal physiological function.
The Gutless Adenovirus Vector
[0016] Adenoviruses (Ad) are double-stranded DNA viruses with a linear genome of about 36
kb. The adenovirus genome is complex and contains over 50 open reading frames (ORFs).
These ORFs are overlapping and genes encoding one protein are often embedded within
genes coding for other Ad proteins. Expression of Ad genes is divided into an early
and a late phase. The early genes comprise E1a, E1b, E2a, E2b, E3 and E4, which are
transcribed prior to replication of the viral genome. The late genes (e.g., L1-5)
are transcribed after replication of the viral genome. The products of the late genes
are predominantly components of the virion, as well as proteins involved in the assembly
of virions.
[0017] The genome of an adenovirus can be manipulated such that it encodes and expresses
a gene product of interest but is inactivated in terms of its ability to replicate
in a normal lyric viral life cycle (
Curie DT, Ann N Y Acad Sci 886, 158-171 [1991]). Suitable adenoidal vectors derived from the adenovirus strain Ad type 5 d1324
or other strains of adenovirus (e.g., Ad2, Ad3, Ad7 etc.) are well known to those
skilled in the art. Recombinant adenoviruses are advantageous in that they do not
require dividing cells to be effective gene delivery vehicles and can be used to infect
a wide variety of cell types, including airway epithelium, endothelial cells, muscle
cells and renal cells Additionally, introduced adenoidal DNA (and foreign DNA contained
therein) is not integrated into the genome of a host cell but remains episomal, thereby
avoiding potential problems that can occur as a result of insertional mutagenesis
in situations where introduced DNA becomes integrated into the host genome (e.g.,
retroviral DNA).
[0018] The so-called "gutless" adenovirus vectors contain a minimal amount of adenovirus
DNA (i.e., the inverted terminal repeats and encapsidation signal) and are incapable
of expressing any adenovirus antigens (hence the term "gutless"). The gutless adenovirus
vectors provide the significant advantage of accommodating large inserts of foreign
DNA while completely eliminating the problem of expressing adenoviral genes that result
in an immunological response to viral proteins when a gutless rAd vector is used in
gene therapy. Methods for producing gutless rAd vectors have been described, for example,
in
U.S. Patent No. 5,981,225 to Kochanek et al., and
U.S. Patent Nos. 6,063,622 and
6,451,596 to Chamberlain et al;
Parks et al., PNAS 93:13565 (1996) and
Lieber et al., J. Virol. 70:8944-8960 (1996).
[0019] The "inverted terminal repeats (ITRs)" of adenovirus are short elements located at
the 5' and 3' termini of the linear adenoviral genome, respectively and are required
for replication of the viral DNA. The left ITR is located between 1-130 bp in the
Ad genome (also referred to as 0-0.5 mu). The right ITR is located from about 3,7500
bp to the end of the genome (also referred to as 99.5-100 mu). The two ITRs are inverted
repeats of each other. For clarity, the left ITR or 5' end is used to define the 5'
and 3' ends of the ITRs. The 5' end of the left ITR is located at the extreme 5' end
of the linear adenoviral genome; picturing the left ITR as an arrow extending from
the 5' end of the genome, the tail of the 5' ITR is located at mu 0 and the head of
the left ITR is located at about 0.5 mu (further the tail of the left ITR is referred
to as the 5' end of the left ITR and the head of the left ITR is referred to as the
3' end of the left ITR). The tail of the right or 3' ITR is located at mu 100 and
the head of the right ITR is located at about mu 99.5; the head of the right ITR is
referred to as the 5' end of the right ITR and the tail of the right ITR is referred
to as the 3' end of the right ITR. In the linear adenoviral genome, the ITRs face
each other with the head of each ITR pointing inward toward the bulk of the genome.
When arranged in a "tail to tail orientation" the tails of each ITR (which comprise
the 5' end of the left ITR and the 3' end of the right ITR) are located in proximity
to one another while the heads of each ITR are separated and face outward. The "encapsidation
signal" or "packaging sequence" of adenovirus refers to the ψ sequence which comprises
five (AI-AV) packaging signals and is required for encapsidation of the mature linear
genome; the packaging signals are located from about 194 to 358 bp in the Ad genome
(about 0.5-1.0 mµ).
[0020] In one aspect, a viral backbone shuttle vector is used for the construction of gutless
adenovirus vectors. The viral backbone shuttle vector contains a left and a right
inverted terminal repeats of adenovirus, an encapsidation signal (ψ) of adenovirus,
a pBR322 replication origin, a kanamycin resistance gene, and a stuffer sequence,
which is the hypoxanthine phosphoribosyltransferase (HPRT) intron fragment with an
approximately 10 kb (SEQ ID NO: 1). The viral backbone shuttle vector of the present
invention comprises at least 15 contiguous bases of SEQ ID NO: 1, preferably comprises
at least 90 contiguous bases of SEQ ID NO: 1, more preferably comprises at least 300
contiguous bases of SEQ ID NO: 1, and most preferably comprises 3000 or more contiguous
bases of SEQ ID NO: 1. The viral backbone shuttle vector of the present invention
comprises the nucleotide sequence of SEQ ID NO:13 or SEQ ID NO:15.
[0021] The viral backbone shuttle vector contains multiple restriction endonuclease sites
for the insertion of a foreign DNA sequence of interest. In one aspect, the viral
backbone shuttle vector contains seven unique cloning sites where the foreign DNA
sequence can be inserted by molecular cloning techniques that are well known in the
DNA cloning art. The foreign DNA sequence of interest typically comprises cDNA or
genomic fragments that are of interest to transfer into mammalian cells. Foreign DNA
sequence of interest may include any naturally occurring or synthetic DNA sequence.
The foreign DNA may be identical in sequence to naturally-occurring DNA or may be
mutated relative to the naturally occurring sequence. The foreign DNA need not be
characterized as to sequence or function.
[0022] The size of foreign DNA that may be included in the shuttle vector will depend upon
the size of the rest of the vector. If necessary, the stuffer sequence may be removed
to adapt large size foreign DNA fragment. The total size of foreign DNA may vary from
1kb to 35kb. Preferably, the total size of foreign DNA is from 15kb to 35 kb.
[0023] The foreign DNA may contain coding sequence for a protein, an iRNA agent, or an antisense
RNA. The foreign DNA may further contain regulatory elements operably linked to the
coding sequence. The term "operably linked," as used herein, refers to an arrangement
of elements wherein the components so described are configured so as to perform their
usual function. Thus, control elements operably linked to a coding sequence are capable
of effecting the expression of the coding sequence. The control elements need not
be contiguous with the coding sequence, so long as the function to direct the expression
thereof. Thus, for example, intervening untranslated yet transcribed sequences can
be present between a promoter sequence and the coding sequence and the promoter sequence
can still be considered "operably linked" to the coding sequence. Similarly, intervening
untranscribed sequences can be present between an enhancer sequence and the coding
sequence and the enhancer sequence can still be considered "operably linked" to the
coding sequence.
[0024] Examples of regulatory elements include, but are not limited to, transcription factor
binding sites, promoters, enhancers, silencers, ribosome binding sequences, recombination
sites, origins of replication, sequences which regulate RNA stability and polyadenylation
signals. The promoters used may vary in their nature, origin and properties. The choice
of promoter depends in fact on the desired use and on the gene of interest, in particular.
Thus, the promoter may be constitutive or regulated, strong or weak, ubiquitous or
tissue/cell-specific, or even specific of physiological or pathophysiological states
(activity dependent on the state of cell differentiation or the step in the cell cycle).
The promoter may be of eukaryotic, prokaryotic, viral, animal, plant, artificial or
human origin.
Renal Specific Expression
[0025] In one aspect, the therapeutic agent is expressed in a tissue-specific manner either
using a renal-specific regulatory element or using an inducible regulatory element
combined with kidney-specific induction. Examples of renal-specific regulatory element
include, but are not limited to, high-capacity (type 2) Na
+/glucose cotransporter gene (
Sglt2)promoter, Ksp-cadherin promoter, CIC-K1 chloride channel gene promoter, uromodulin
promoter,
Nkcc2lSlc12a1 gene promoter, and the p1 promoter of the parathyroid hormone (PTH)/PTH-related peptide
receptor gene.
[0026] Examples of inducible regulatory elements include, but are not limited to, regulatory
elements that responded to exogenous signals or stresses, such as heat, hormones,
hypoxia, cytokines or metal ions, as well as artificial inducible systems such as
the tetracycline inducible system;, the FK506/rapamycin inducible system, the RU486/mifepristone
inducible system, and the ecdysone inducible system. These systems are briefly described
below.
[0027] Tet-onloff system. The Tet-system is based on two regulatory elements derived from the tetracycline-resistance
operon of the
E.
coli Tn 10 transposon: the tet repressor protein (TetR) and the Tet operator DNA sequence
(tetO) to which TetR binds. The system consists of two components, a "regulator" and
a "reporter" plasmid. The "regulator" plasmid encodes a hybrid protein containing
a mutated Tet repression (tetr) fused to the VP 16 activation domain of herpes simplex
virus. The "reporter" plasmid contains a tet-responsive element (TRE), which controls
the "reporter" gene of choice. The tetr-VP 16 fusion protein can only bind to the
TRE, therefore activate the transcription of the "reporter" gene, in the presence
of tetracycline. The system has been incorporated into a number of viral vectors including
retrovirus, adenovirus (
Gossen and Bujard, PNAS USA 89: 5547-5551, [1992];
Gossen et al., Science 268: 1766-1769, [1995];
Kistner et al., PNAS USA 93: 10933-10938, [1996]).
[0028] Ecdysone system. The Ecdysone system is based on the molting induction system found in
Drosophila, but modified for inducible expression in mammalian cells. The system uses an analog
of the drosophila steroid hormone ecdysone, muristerone A, to activate expression
of the gene of interest via a heterodimeric nuclear receptor. Expression levels have
been reported to exceed 200-fold over basal levels with no effect on mammalian cell
physiology (
No et al., PNAS USA 93: 3346-3351, [1996]).
[0029] Progesterone-system. The progesterone receptor is normally stimulated to bind to a specific DNA sequence
and to activate transcription through an interaction with its hormone ligand. Conversely,
the progesterone antagonist mifepristone (RU486) is able to block hormone-induced
nuclear transport and subsequent DNA binding. A mutant form of the progesterone receptor
that can be stimulated to bind through an interaction with RU486 has been generated.
To generate a specific, regulatable transcription factor, the RU486-binding domain
of the progesterone receptor has been fused to the DNA-binding domain of the yeast
transcription factor GAL4 and the transactivation domain of the HSV protein VP16.
The chimeric factor is inactive in the absence of RU486. The addition of hormone,
however, induces a conformational change in the chimeric protein, and this change
allows binding to a GAL4-binding site and the activation of transcription from promoters
containing the GAL4-binding site (
Wang et al., PNAS USA 93: 8180-8184, [1994];
Wang et al., Nat. Biotech 15: 239-243, [1997]).
[0030] Rapamycin-system. Immunosuppressive agents, such as FK506 and rapamycin, act by binding to specific
cellular proteins and facilitating their dimerization. For example, the binding of
rapamycin to FK506-binding protein (FKBP) results in its heterodimerization with another
rapamycin binding protein FRAP, which can be reversed by removal of the drug. The
ability to bring two proteins together by addition of a drug potentiates the regulation
of a number of biological processes, including transcription. A chimeric DNA-binding
domain has been fused to the FKBP, which enables binding of the fusion protein to
a specific DNA-binding sequence. A transcriptional activation domain also has been
used to FRAP. When these two fusion proteins are co-expressed in the same cell, a
fully functional transcription factor can be formed by heterodimerization mediated
by addition of rapamycin. The dimerized chimeric transcription factor can then bind
to a synthetic promoter sequence containing copies of the synthetic DNA-binding sequence.
This system has been successfully integrated into adenoviral vectors. Long-term regulatable
gene expression has been achieved in both mice and baboons (
Magari et al., J. Clin. Invest. 100: 2865-2872, [1997];
Ye et al., Science 283:88-91, [1999]).
[0031] In one aspect, a kidney tissue is infected with a gutless virus containing an inducible
regulatory element. The infected tissue is then exposed to an inducing agent, such
as tetracycline or rapamycin, or an inducing condition such as local heating or hypoxia,
to induce expression of the therapeutic agent. The inducible system thus allows kidney
specific expression of the therapeutic agent and minimizes the side effect of the
therapeutic agent. In addition, the level and duration of the therapeutic agent expression
may also be controlled by the dose of the inducing agent and the frequency of inducing
agent administration. In one aspect, the coding sequence of the therapeutic agent
is controlled by the tet-on system and the expression of the therapeutic agent can
be induced by an oral dose of tetracycline.
The Renal Diseases
[0032] The renal disease can be any disease or disorder that affects the function of the
kidneys and for which a therapeutic gene or genes have been identified. Examples of
the renal diseases include, but are not limited to, glomerulonephritis, renal vein
thrombosis, diabetic nephropathy, ischemia/reperfusion injury (shock kidneys), hypertension,
proteinuric kidney diseases (post glomerulonephritis), ischemic nephropathy, obstruction
nephropathy, atheroembolic renal disease, chronic nephritis, congenital nephrotic
syndrome, interstitial nephritis, lupus nephritis, membranoproliferative glomerulonephritis,
membranous nephropathy, minimal change disease, necrotizing glomerulonephritis, nephropathy
- IgA, nephrosis (nephrotic syndrome), post-streptococcal GN, reflux nephropathy,
renal artery embolism, renal artery stenosis, and renal underperfusion.
The Therapeutic Agents
[0033] The therapeutic agent can be any molecule that is, when expressed in a renal tissue
or in the proximity of a renal tissue, capable of ameliorating symptoms of a renal
disease. The therapeutic agents include, but are not limited to, proteins, iRNA agents
and antisense RNA. The term "expression," as used herein, refers to the process of
transcription of mRNA from a coding sequence and/or translation of mRNA into a polypeptide.
[0034] The term "iRNA agent," as used herein, refers to small nucleic acid molecules used
for RNA interference (RNAi), such as short interfering RNA (siRNA), double-stranded
RNA (dsRNA), microRNA (miRNA) and short hairpin RNA (shRNA) molecules. The iRNA agents
can be unmodified or chemically-modified nucleic acid molecules. The iRNA agents can
be chemically synthesized or expressed from a vector or enzymatically synthesized.
The use of a chemically-modified iRNA agent can improve one or more properties of
an iRNA agent through increased resistance to degradation, increased specificity to
target moieties, improved cellular uptake, and the like.
[0035] The term "antisense RNA," as used herein, refers to a nucleotide sequence that comprises
a sequence substantially complementary to the whole or a part of an mRNA molecule
and is capable of binding to the mRNA.
Protein As a Therapeutic Agent
[0036] In one aspect the therapeutic agent is a protein or peptide capable of ameliorates
symptoms of the renal disease. For example, the therapeutic agent can be thrombomodulin
for treating renal vein thrombosis (RVT) or an antibody that binds specifically to
a target molecule which is involved in a renal disease (e.g., an inflammatory cytokine
which has been found to be associated with the chronic kidney disease (CKD)).
[0037] The term "antibody", as used herein, is defined as an immunoglobulin that has specific
binding sites to combine with an antigen. The term "antibody" is used in the broadest
possible sense and may include but is not limited to an antibody, a recombinant antibody,
a genetically engineered antibody, a chimeric antibody, a monospecific antibody, a
bispecific antibody, a multispecific antibody, a chimeric antibody, a heteroantibody,
a monoclonal antibody, a polyclonal antibody, a camelized antibody, a deimmunized
antibody, a humanized antibody and an anti-idiotypic antibody. The term "antibody"
may also include but is not limited to an antibody fragment such as at least a portion
of an intact antibody, for instance, the antigen binding variable region. Examples
of antibody fragments include Fv, Fab, Fab', F(ab'), F(ab')
2, Fv fragment, diabody, linear antibody, single-chain antibody molecule, multispecific
antibody, and/or other antigen binding sequences of an antibody.
[0038] Examples of the therapeutic protein include, but are not limited to, thrombomodulin
(TM), cytokines such as IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10,
IL-11, IL-12, IL-13, IL-14, IL-15 and other interleukins; hematopoetic growth factors
such as erythropoietin; colony stimulating factors such as G-CSF, GM-CSF, M-CSF, SCF
and thrombopoietin; growth factors such as BNDF, BMP, GGRP, EGF, FGF, GDNF, GGF, HGF,
IGF-1, IGF-2; KGF, myotrophin, NGF, OSM, PDGF, somatotrophin, TGF-α, TGF-β, and VEGF;
antiviral cytokines such as interferons, antiviral proteins induced by interferons,
TNF-α, and TNF-β; proteins involved in immune responses such as antibodies, CTLA4,
hemagglutinin, MHC proteins, VLA-4, and kallikrein-kininogen-kinin system; ligands
such as CD4; growth factor receptors including EGFR, PDGFR, FGFR, and NGFR, GTP-binding
regulatory proteins, interleukin receptors, ion channel receptors, leukotriene receptor
antagonists, lipoprotein receptors, steroid receptors, T-cell receptors, thyroid hormone
receptors, TNF receptors; tissue plasminogen activator; transmembrane receptors; transmembrane
transporting systems, such as calcium pump, proton pump, Na/Ca exchanger, MRP1, MRP2,
P170, LRP, and cMOAT; transferrin; and tumor suppressor gene products such as APC,
brca1, brca2, DCC, MCC, MTS1, NF1, NF2, nm23, p53 and Rb, and variants thereof.
[0039] A "variants" of a polypeptide is a polypeptide that differs from a native polypeptide
in one or more substitutions, deletions, additions and/or insertions, such that the
bioactivity of the native polypeptide is not substantially diminished or enhanced.
In other words, the bioactivity of a variant may be enhanced or diminished by, less
than 50%, and preferably less than 20%, relative to the native protein. Preferred
variants include those in which one or more portions, such as an N-terminal leader
sequence or transmembrane domain, have been removed. Other preferred variants include
variants in which a small portion (e.g., 1-30 amino acids, preferably 5-15 amino acids)
has been removed from the - and/or C-terminal of the mature protein.
[0040] Preferably, a variant contains conservative substitutions. A "conservative substitution"
is one in which an amino acid is substituted for another amino acid that has similar
properties, such that one skilled in the art of peptide chemistry would expect the
secondary structure and hydropathic nature of the polypeptide to be substantially
unchanged. Amino acid substitutions may generally be made on the basis of similarity
in polarity, charge, solubility, hydrophobicity, hydrophilicity and/or the amphipathic
nature of the residues. For example, negatively charged amino acids include aspartic
acid and glutamic acid; positively charged amino acids include lysine and arginine;
and amino acids with uncharged polar head groups having similar hydrophilicity values
include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine;
and serine, threonine, phenylalanine and tyrosine. A variant may also, or alternatively,
contain nonconservative changes. In a preferred aspect, variant polypeptides differ
from a native sequence by substitution, deletion or addition of five amino acids or
fewer. Variants may also (or alternatively) be modified by, for example, the deletion
or addition of amino acids that have minimal influence on the bioactivity, secondary
structure and hydropathic nature of the polypeptide.
[0041] A variant preferably exhibits at least about 70%, more preferably at least about
90% and most preferably at least about 95% sequence homology to the original polypeptide.
[0042] The term "variant' also includes a polypeptides that is modified from the original
polypeptides by either natural processes, such as posttranslational processing, or
by chemical modification techniques which are well known in the art. Such modifications
are well described in basic texts and in more detailed monographs, as well as in a
voluminous research literature. Modifications can occur anywhere in a polypeptide,
including the peptide backbone, the amino acid side-chains and the amino or carboxyl
termini. It will be appreciated that the same type of modification may be present
in the same or varying degrees at several sites in a given polypeptide. Also, a given
polypeptide may contain many types of modifications. Polypeptides may be branched,
for example, as a result of ubiquitination, and they may be cyclic, with or without
branching. Cyclic, branched, and branched cyclic polypeptides may result from posttranslation
natural processes or may be made by synthetic methods. Modifications include acetylation,
acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment
of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent
attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol,
cross-linking, cyclization, disulfide bond formation, demethylation, formation of
covalent cross links, formation of cysteine, formation of pyroglutamate, formulation,
gammacarboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination,
methylation, myristoylation, oxidation, pegylation, proteolytic processing, phosphorylation,
prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition
of amino acids to proteins such as arginylation, and ubiquitination.
[0043] In one aspect, the therapeutic protein is a native TM or a TM variant for the treatment
of renal vein thrombosis (RVT). RVT has numerous etiologies, it occurs most commonly
in patients with nephrotic syndrome (i.e., > 3 g/d protein loss in the urine, hypoalbuminemia,
hypercholesterolemia, edema). The syndrome is responsible for a hypercoagulable state.
The excessive urinary protein loss is associated with decreased antithrombin III,
a relative excess of fibrinogen, and changes in other clotting factors; all lead to
a propensity to clot. Numerous studies have demonstrated a direct relationship between
nephrotic syndrome and both arterial and venous thromboses. Why the renal vein is
susceptible to thrombosis is unclear. The renal vein also may contain thrombus after
invasion by renal cell cancer. Other less common causes include renal transplantation,
Behçet syndrome, hypercoagulable states, and antiphospholipid antibody syndrome.
[0044] Thrombomodulin (TM) is an integral membrane glycoprotein expressed on the surface
of endothelial cells (
Sadler et al., Trhomb Haemost., 78:392-95 [1997]). It is a high affinity thrombin receptor that converts thrombin into a protein
C activator. Activated protein C then functions as an anticoagulant by inactivating
two regulatory proteins of the clotting system, namely factors Va and VI [I]a (
Esmon et al., Faseb J., 9:946-55 [1995]). The latter two proteins are essential for the function of two of the coagulation
proteases, namely factors IXa and Xa. TM thus plays an active role in blood clot formation
in vivo and can function as a direct or indirect anticoagulant.
[0045] TM and several other proteins or enzymes have been shown to reduce the process of
intimal hyperplasia, whose evolution is the causes of late graft failure. For instance,
Nitric oxide synthase, an enzyme expressed by endothelial cells has been shown in
animal models to inhibit intimal hyperplasia, especially the inducible enzyme (iNOS)
(
Salmaa et al., Lancet, 353:1729-34 [1999];
Palmer et al., Nature, 327:524-26 [1987];
Kubes et al., PNAS USA., 88:4651-5 [1991]).
[0046] The term "native thrombomodulin" refers to both the natural protein and soluble peptides
having the same characteristic biological activity of membrane-bound or detergent
solubilized (natural) thrombomodulin. These soluble peptides are also referred to
as "wild-type" or "non-mutant" analog peptides. Biological activity is the ability
to act as a receptor for thrombin, increase the activation of protein C, or other
biological activity associated with native thrombomodulin. Oxidation resistant TM
analogs are these soluble peptides that in addition to being soluble contain a specific
artificially induced mutation in their amino acid sequence.
siRNA As the Therapeutic Agent
[0047] In another aspect, short interfering RNAs (siRNA) are used as a therapeutic agent
to inhibit a disease-related gene expression. For example, elevated levels of transforming
growth factor-β
1 (TGF-β
1) and platelet-derived growth factor (PDGF) have been associated with the development
of glomerular injury. Therefore, inhibition of the expression of TGF-β
1 and/or PDGF in kidney tissues may be used to prevent or reduce glomerular injury.
[0048] siRNAs are dsRNAs having 19-25 nucleotides. siRNAs can be produced endogenously by
degradation of longer dsRNA molecules by an RNase III-related nuclease called Dicer.
siRNAs can also be introduced into a cell exogenously or by transcription of an expression
construct. Once formed, the siRNAs assemble with protein components into endoribonuclease-containing
complexes known as RNA-induced silencing complexes (RISCs). An ATP-generated unwinding
of the siRNA activates the RISCs, which in turn target the complementary mRNA transcript
by Watson-Crick base-pairing, thereby cleaving and destroying the mRNA. Cleavage of
the mRNA takes place near the middle of the region bound by the siRNA strand. This
sequence specific mRNA degradation results in gene silencing.
[0049] siRNAs can be expressed
in vivo from adenovirus vectors. This approach can be used to stably express siRNAs in kidney
tissues. In one embodiment, siRNA expression vectors are engineered to drive siRNA
transcription from polymerase III (pol III) transcription units. Pol III transcription
units are suitable for hairpin siRNA expression, since they deploy a short AT rich
transcription termination site that leads to the addition of 2 bp overhangs (UU) to
hairpin siRNAs--a feature that is helpful for siRNA function. Any 3' dinucleotide
overhang, such as UU, can be used for siRNAs. In some cases, G residues in the overhang
may be avoided because of the potential for the siRNA to be cleaved by RNase at single-stranded
G residues.
[0050] With regard to the siRNA sequence itself, it has been found that siRNAs with 30-50%
GC content can be more active than those with a higher G/C content in certain cases.
Moreover, since a 4-6 nucleotide poly(T) tract may act as a termination signal for
RNA pol III, stretches of>4 Ts or As in the target sequence may be avoided in certain
cases when designing sequences to be expressed from an RNA pol III promoter. In addition,
some regions of mRNA may be either highly structured or bound by regulatory proteins.
Thus, it may be helpful to select siRNA target sites at different positions along
the length of the gene sequence. Finally, the potential target sites can be compared
to the appropriate genome database. Any target sequences with more than 16-17 contiguous
base pairs of homology to other coding sequences may be eliminated from consideration
in certain cases.
[0051] The siRNA targets can be selected by scanning an mRNA sequence for AA dinucleotides
and recording the 19 nucleotides immediately downstream of the AA. Other methods can
also been used to select the siRNA targets. In one example, the selection of the siRNA
target sequence is purely empirically determined (see e.g.,
Sui et al., Proc. Natl. Acad. Sci. USA 99: 5515-5520, 2002), as long as the target sequence starts with GG and does not share significant sequence
homology with other genes as analyzed by BLAST search. In another example, a more
elaborate method is employed to select the siRNA target sequences. This procedure
exploits an observation that any accessible site in endogenous mRNA can be targeted
for degradation by synthetic oligodeoxyribonucleotide/RNase H method (
Lee et al., Nature Biotechnology 20:500-505, 2002).
[0052] siRNA can be designed to have two inverted repeats separated by a short spacer sequence
and end with a string of Ts that serve as a transcription termination site. This design
produces an RNA transcript that is predicted to fold into a short hairpin siRNA. The
selection of siRNA target sequence, the length of the inverted repeats that encode
the stem of a putative hairpin, the order of the inverted repeats, the length and
composition of the spacer sequence that encodes the loop of the hairpin, and the presence
or absence of 5'-overhangs, can vary to achieve desirable results.
[0053] In another aspect the hairpin siRNA expression cassette is constructed to contain
the sense strand of the target, followed by a short spacer, the antisense strand of
the target, and 5-6 Ts as transcription terminator. The order of the sense and antisense
strands within the siRNA expression constructs can be altered without affecting the
gene silencing activities of the hairpin siRNA. In certain instances, the reversal
of the order may cause partial reduction in gene silencing activities.
[0054] The length of nucleotide sequence being used as the stem of siRNA expression cassette
can range, for instance, from 19 to 29. The loop size can range from 3 to 23 nucleotides.
Other lengths and/or loop sizes can also be used.
Route of Administration
[0055] The gutless adenovirus may be introduced into the kidney by intravenous, intrarterial,
or retrograde infusion. In one aspect, the virus is infused through the vene renalis.
In another aspect, the virus is infused through the superior mesenteric artery. In
yet another aspect, the virus is infused through a retrograde catheter into the pyelic
cavity. Since only a relatively small amount of virus is needed for the kidney infusion,
the virus-related toxicity is reduced. In yet another aspect, the kidney is perfused
with the virus, i.e., the virus enters the kidney through the vene renalis or the
superior mesenteric artery, and is collected through the superior mesenteric artery
or vene renalis. Since the leftover virus does not enter the blood circulation, a
large amount of virus may be used for the perfusion. In addition, a close-circuit
perfusion allows constant exposure to virus over an extended period of time (e.g.,
10-60 minutes) and hence significantly increases the number of infected cells.
[0056] In another aspect, the virus is administered into a segment of a renal blood vessel
in vivo. In a related aspect, the gutless adenovirus vector is administered using a stent.
The viral vector is embedded in the stent and is released only at a treatment site.
Since the viral infection is restricted at the treatment site and the surrounding
area, only a small amount of the virus is needed and the virus-related toxicity is
reduced.
[0057] Another aspect relates to a method for improving allograft survival. The method comprises
the steps of perfusing a kidney harvested from an organ donor with a gutless adenovirus
vector carrying a nucleotide sequence encoding an immune modulator and a regulatory
element operably linked to the nucleotide sequence; and transplanting the perfused
kidney into a subject. The term "immune modulator," as used herein, refers to a polypeptide
or a polynucleotide capable of modulating an immune response and improving allograft
survival.
[0058] The immune modulator is indoleamine dioxygenase (IDO). IDO is an enzyme that is expressed
in the placenta and plays an important role in foeto-maternal tolerance. IDO metabolizes
the amino acid tryptophan. The function of T cells, the most important cell-type involved
in organ transplant rejection, is dependent on tryptophan. In addition, the metabolites
of tryptophan (kynurenines) are toxic to T-cells. It has been shown that over-expression
of IDO in renal tissues protects against renal transplant damage.
[0059] Typically, kidneys must be preserved prior to transplantation to obtain proper pathology
assessment of the suitability of the organ for transplantation. Lack of proper preservation
leads to degradation of organ function due to thrombosis (blood clotting), ischemia
(lack of oxygen), or ischemia followed by reperfusion (the restoration of blood flow
upon transplantation). These events bring about inflammation, cell death, and eventually
failure of the organ. Kidney preservation is a process in which the renal artery is
connected to a kidney perfusion machine in order to simulate the normal process by
which nutrients are supplied to the kidney. A solution is continuously perfused through
a closed circuit which includes the kidney, which is typically maintained at a low
temperature (e.g., 5°C) to reduce the cell metabolic rate and oxygen consumption.
During the perfusion process, the perfusion pressure, flow, and vascular resistance,
as well as the organ's chemistries, including base excess, oxygen saturation, calcium,
potassium, hematocrit, pO
2, pH, and bicarbonate, are monitored closely to prevent tissue damage. The adenovirus
vectors can be added to the perfusion solution and infect the kidney tissue during
the perfusion period. Kidney perfusion solutions are commercially available. In one
embodiment, the kidney perfusion solution is Lactated Ringer's solution.
[0060] In one aspect, the regulatory element is a constitutive promoter, such as CMV or
RSV promoter. In another embodiment, the gutless adenovirus contains the nucleotide
sequence of SEQ ID NO:25 or SEQ ID NO:26.
[0061] In another embodiment, the gutless adenovirus is suspended in the perfusion solution
to a final concentration of 10
9-10
12 particles/ml and perfused for a period of 10-120 minutes.
[0062] Another aspect pertains to a gutless adenovirus vector comprising a polynucleotide
encoding a therapeutic agent, a renal-specific regulatory element or inducible regulatory
element operably linked to the polynucleotide sequence; and a stuffer comprising the
nucleotide sequence of SEQ ID NO:13 or SEQ ID NO:15.
[0063] The renal-specific regulatory element is selected from the group consisting of high-capacity
(type 2) Na
+/glucose cotransporter gene (
Sglt2) promoter, Ksp-cadherin promoter, C1C-K1 chloride channel gene promoter, uromodulin
promoter,
Nkcc2/
Slc12a1 gene promoter, and the p1 promoter of the parathyroid hormone (PTH)/PTH-related peptide
receptor gene.
[0064] In another aspect, the inducible regulatory element is selected from the group consisting
of heat inducible regulatory elements, hormone inducible regulatory elements, hypoxia
inducible regulatory elements, cytokine inducible regulatory elements, metal ion inducible
regulatory elements, and artificial inducible regulatory elements.
[0065] Yet another aspect pertains to a pharmaceutical composition for treating a renal
vascular disease, comprising the gutless adenovirus vector described above and a pharmaceutically
acceptable carrier. As used herein, a "pharmaceutically acceptable carrier" is intended
to include any and all solvents, solubilizers, stabilizers, absorbents, bases, buffering
agents, controlled release vehicles, diluents, emulsifying agents, humectants, dispersion
media, antibacterial or antifungal agents, and the like, compatible with pharmaceutical
administration. The use of such media and agents for pharmaceutically active substances
is well-known in the art. Except insofar as any conventional media or agent is incompatible
with the active compound, use thereof in the compositions is contemplated. Supplementary
agents can also be incorporated into the compositions.
[0066] The pharmaceutical composition is formulated to be compatible with its intended route
of administration. Solutions or suspensions used for parenteral application can include
the following components: a sterile diluent such as water for injection, saline solution,
fixed oils, polyethylene glycols, glycerine; propylene glycol or other synthetic solvents;
antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such
as ascorbic acid or sodium bisulfate; chelating agents such as ethylenediaminetetraacetic
acid; buffers such as acetates, citrates or phosphates and agents for the adjustment
of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or
bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can
be enclosed in ampoules, disposable syringes or multiple dose vials made of glass
or plastic.
[0067] In all cases, the injectable composition should be sterile and should be fluid to
the extent that easy syringability exists. It must be stable under the conditions
of manufacture and storage and must be preserved against the contaminating action
of microorganisms such as bacteria and fungi. The proper fluidity can be maintained,
for example, by the use of a coating such as lecithin, by the maintenance of the required
particle size in the case of dispersion and by the use of surfactants. Prevention
of the action of microorganisms can be achieved by various antibacterial and antifungal
agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and
the like.
[0068] It is especially advantageous to formulate parenteral compositions in dosage unit
form for ease of administration and uniformity of dosage. Dosage unit form as used
herein includes physically discrete units suited as unitary dosages for the subject
to be treated; each unit containing a predetermined quantity of active compound calculated
to produce the desired therapeutic effect in association with the required pharmaceutical
carrier. The specification for the dosage unit forms of the invention are dictated
by and directly dependent on the unique characteristics of the active compound and
the particular therapeutic effect to be achieved, and the limitations inherent in
the art of compounding such an active compound for the treatment of individuals.
EXAMPLE 1. Construction of Gutless Viral Backbone Shuttle Vector pShuttle-ITR-HPRT
1.1 Creation of pShuttle-ITR
[0069] An embodiment of a gutless viral backbone shuttle vector pshuttle-ITR-HPRT is shown
in Figure 1. Sequence portion containing R-ITR, PBR322 ori, Kan, L-ITR, and encapsidation
signal was obtained from the pAdEasy® system from STRATEGENE®. At bp 3667 of the original
pShuttle sequence, there is a BamHI site just beyond the R-ITR. PCR primers were designed
to include the BamHI site and then were to create an EcoRI site at the end of the
R-ITR. The R-ITR was PCR replicated and then digested with BamHI and EcoRI to create
sticky ends. The viral backbone was then cut with both BamHI and EcoRI. The BamHI
cut the backbone at bp 3667 and there was also an EcoRI site inside the MCS at bp
377. The backbone portion of the plasmid was then gel purified and the PCR replicated
R-ITR was recloned into position. This essentially puts the L-ITR, encapsidation signal,
MCS, and R-ITR all in close proximity to each other.
1.2 Creation of pShuttle-ITR-HPRT
[0070] Insertion of the HPRT introns was a two step cloning process. First, the viral backbone
pShuttle-ITR was digested with EcoRI and Xbal, both enzyme sites are in the MCS. The
HPRT source was also digested with EcoRI and Xbal yielding a 7477 bp fragment that
was cloned into the EcoRI/XbaI digested viral backbone. Then the HPRT source was digested
with only XbaI yielding a 2715 bp fragment. One of the XbaI sites in this cut is the
same XbaI site that was cut from the EcoRI/XbaI double digest in step 1. The viral
backbone was cut with only XbaI and the 2715 bp fragment was inserted.
[0071] Overall, from the HPRT source, the HPRT stuffer sequence is inserted into the viral
backbone in reverse orientation, hence intron 5, then 4, then 3. The 2715 bp fragment
was inserted and checked to follow the original source sequence. The new plasmid is
designated as pShuttle-ITR-HPRT (SEQ ID NO:1).
EXAMPLE 2. Construction and Preparation of Gutless Viral Shuttle Vector Carrying Human
Thrombomodulin or lacZ Gene (Illustrative)
2(a) Construction and preparation of gutless viral shuttle vector carrying human thrombomodulin
gene
2(a)-1 Creation of pCMV-hTM
[0072] The insertion of hTM into the gutless adenovirus backbone first required the creation
of a CMV-hTM expression cassette. The intermediate vector used was pcDNA3.1/Zeo(+)
(Invitrogen). A CMV promoter is available commercially and a CMV promoter was cloned
into the multiple cloning sites (MCS) at the Xbal/EcoRV restriction enzyme site locations.
The CMV from ps5 was removed using XbaI/EcoRV. pcDNA3.1/Zeo(+) was cleaved inside
the MCS using both XbaI and EcoRV as well. The CMV promoter was then ligated. Due
to the location of the enzyme sites in the MCS, the CMV promoter (SEQ ID NO:4) was
inserted in a backwards orientation relative to the pcDNA3.1/Zeo (+) plasmid. The
amino acid sequence of human thrombomodulin (SEQ ID NO: 2) and the DNA sequence encoding
human thrombomodulin (SEQ ID NO: 3) have been reported (
Suzuki et al. EMBO J. 6:1891-1897, [1987]). The human TM cDNA (SEQ ID NO:5) was obtained from Dr. Sadler (
Dittman et al., Biochemistry, 26(14):4350-4357 [1987]) which the sequence was also submitted to ATCC and to GenBank. The human TM gene
was removed from the plasmid using EcoRI and inserted into pcDNA3.1/Zeo(+), also in
the reverse orientation to pcDNA3.1/Zeo(+) downstream of the inserted CMV promoter.
2(a)-2 Creation of pShuttle-ITR-HPRT-CMV-TM
[0073] The expression cassette in pCMV-hTM was removed by digesting with PmeI. The gutless
adenovirus backbone pshuttle-ITR-HPRT was linearized using SmaI which cuts the plasmid
at bp 381. The CMV-hTM cassette was ligated to the gutless virus in the forwards orientation.
Sequence of the expression cassette (from PmeI site to PmeI site) is shown in SEQ
ID NO:6. The new plasmid is designated as pShuttle-ITR-HPRT-CMV-TM.
2(a)-3 Creation of pTMadap
[0074] The following linker containing a BstEII and SfiI site was inserted into the BstEII
and Bsu36I sites of pShuttle-ITR-HPRT-CMV-TM, resulting in the vector pTMadap (SEQ
ID NO:7).
5'-gtaacactgg cccaggaggc ctttctggtg acccc-3' (SEQ ID NO:8)
3'-tgacc gggtcctccg gaaagaccac tggggatt-5' (SEQ ID NO:9)
Creation of pTMadap -stuffer1
[0075] Based on the published sequence HSU71148 of the human X chromosome region q28 the
following PCR primers were synthesized:
Forward: 5' TAGTTCCTTCTGCCTGGAATAC 3' (SEQ ID NO: 10)
Reverse: 5' CAAGTCACAAGGATGGACTACA 3' (SEQ ID NO: 11)
[0076] Amplification of a human DNA sample resulted in the amplification of a 18524bp DNA
fragment (stuffer 1, SEQ ID NO: 12). Stuffer 1 was cut with the restriction enzymes
BstEII and SfiI and the resulting fragment of approximately 18371 bp was inserted
into the BsteII and SfiI sites of pTMadap, resulting in pTMadap-stuffer1.
2(a)- 4 Creation of pTMadap-stuffer1-short
[0077] To reduce the size of the stuffer1 fragment in pTMadap-stuffer1, pTMadap-stuffer1
was digested with SanDI and BstEII and the resulting DNA ends were modified by a fill-in
reaction with Klenow. Re-ligation resulted in the 25207 bp vector pTMadap-stufferlshort.
The sequence of stuffer1-short fragment is shown in SEQ ID NO:13.
2(a)-5 Creation of pTMadap-stuffer1-short-stuffer2
[0078] The plasmid p2-2 (SEQ ID NO: 14, obtained from GenBank) was cut with NotI and the
resulting fragment of approximately 5954 bp (stuffer 2, SEQ ID NO: 15) was inserted
into the NotI site ofpTMadap-stufferlshort, resulting in pTMadap-stuffer1-short-stuffer2.
2(a)-6 Removal of PacI site from pTMadap-stuffer1 short-stuffer2
[0079] Plasmid pTMadap-stuffer1-short-stuffer2 was cut with AclI and BsiW1. The resulting
28790 bp fragment was isolated from gel. pShuttle-ITR-HPRT (SEQ ID NO:1) was cut with
AclI and Acc65I. The resulting 1966 bp fragment was ligated into the isolated 28790
bp fragment, resulting in the full length backbone vector pTM-final (Figure 2 and
SEQ ID NO: 16).
2(b) Construction and preparation of gutless viral shuttle vector carrying LacZ gene
[0080] The insertion of LacZ also required creation of an intermediate vector to create
the expression cassette. pcDNA3.1/Zeo (+) was again used. First, a portion of the
vector from the end of the MCS, restriction enzyme site Apal, to the beginning of
the SV40 poly A, restriction site Nael, was removed and the vector relegated to itself.
Then the LacZ gene was inserted into the vector MCS using NotI/Xbal. The expression
cassette, containing CMV promoter, LacZ gene, and SV40 poly A, was removed using Nrul/Sall
retraction enzymes and blunt-end cloned into the gutless adenovirus at the Smal restriction
enzyme site.
EXAMPLE 3. Preparation of Gutless Adenovirus Carrying Human Thrombomodulin Gene (gutless
Ad.hTM) (ILLUSTRATIVE)
[0081] The gutless Ad.hTM was prepared according to the following protocol:
- 1. Linearize pTM-final by digestion with PacI. The completeness of the digestion is
confirmed by electrophoresis using a small aliquot of the digestion product. It's
not necessary to gel purify the digested pTM-final for transfection described in step
2).
- 2. Transfect 293FLP cells grown in a 60mm dish at about 80% confluence with about
5µg of PacI-digested pTM-final using lipofectamine. 293FLP cells are 293 cells engineered
to express the flp gene product, which recognizes the FRS flanking the encapsidation
signal and cleaves out the encapsidation signal thereby not allowing helper-viral
DNA to be packaged. (Beauchamp et al., Molecular Therapy, 3(5):809-815 [2001]; Umana et al., Nature Biotechnology, 19:582-585 [2001]).
- 3. Twenty-four hours after the transfection, infect the cells with helpervirus H10
in 2% DMEM-F12 at a multiplicity of infection (MOI) of 10.
- 4. Remove the cells from the plate (preferably with a cell scraper) after the appearance
of cytopathic effect (CPE), place the cells in a sterile 15ml tube, and lyse the cells
by three freeze-and-thaw cycles. Precipitate the cell debris by spinning the lysate
for 5 minutes at 4000 rpm and harvest the supernatant. The supernantant is designated
as P0 (passage number 0) supemantant.
- 5. Infect 293FLP cells in two T75 flask at 80% confluency with 4 ml of P0 supernatant
and with the helpervirus at MOI of 1.
- 6. Continue passaging virus in the manner described in steps 4 and 5 until passage
6 and confirm that helpervirus is added at an MOI of 1 at each passage.
- 7. Add the P6 supernatant to 8 T500 flasks containing 293FLP cells at 80% confluency
and infect the cells with the helpervirus at a MOI of 1.
- 8. Following CPE, harvest the cells into 500ml sterile tubes. Centrifuge the cell
suspension at 4500 rpm, 4°C for 10 minutes.
- 9. Resuspend the cell pellet in 2% DMEM-F12 (the pellet can be stored at - 80°C at
this stage).
- 10. Freeze-thaw the resuspended cell pellet three times. Spin down the cell debris
by centrifugation at 4000 rpm, 4°C for 10 minutes.
- 11. Transfer the supernatant, which contains the released virus, to a fresh sterile
culture tube and subject the supernatant to a second round of centrifugation to further
remove cell debris.
- 12. Transfer the supernatant to a fresh sterile tube. The virus is ready for CsCl-purification.
- 13. To purify the virus, ultra-clear SW41 (Beckman) tubes were prepared by soaking
in Ultra Pure Water, then 70% ETOH. Cotton swabs (one swab for each tube) were used
to completely dry out the tube, and two tubes were used per sample.
- 14. Preparation of the first gradient: 2.5 mL CsCl - Density 1.25, and 2.5 mL CsCl
- Density 1.40. Place the 1.25 density CsCl into the Beckman tubes first. Underlay slowly the high density, 1.40 CsCl using a sterile pasteur
pipette, and overlay an equal amount (in mL) of CVL, about 4.25 ml/tube. Samples were
centrifuged in a SW41 rotor with speed: 35,000 rpm at 20° C for 1 hour and with acceleration:
1 and deceleration: 4. The lower opalescent band was collected using 1 or 3 mL syringe
with green cap needles.
[0082] Preparation of second gradient: CsCl was prepared to density 1.33 g/ml. Two fresh
ultra-clear tubes were placed 8 mL of CsCl and overlay the band just recovered after
the first spin. (To equilibrate the tubes, measure before the volume of the recovered
band and divide equally in the 2 tubes). Samples were centrifuged at the conditions
above for 18 hours. The opalescent band was recovered and collected in a sterile eppendorf
tube. (From this moment, keep the tube always on ice). Samples were dialyze with dialysis
buffer: (1) 10X Dialysis Buffer: 100 mM Tris - pH 7.4, 10 mM MgCl
2; (2) 1X Dialysis Buffer (2 Liters): 400 mL Glycerol,200 mL 10X Dialysis Buffer 140
mL, and Ultra Pure Water. The dialyzed samples were immediately stored at -70 C.
(c) Determination of virus titer
[0083] BioRad protein estimation kit was used with 1:5 diluting, and placing 1 ml in each
disposable cuvette. Standards were set up at 0, 1, 2, 5 10, and 15 µg/ml. (BSA is
fine). Sample cuvettes were prepared using 1-10 µl of sample, depending on estimate
of titer. (Sample OD must be within the linear range of the standard line.) OD was
taken at 595λ and formula of the line was calculated from standards. The protein concentration
of the samples was calculated using this formula. The following formula was used to
convert protein concentration to titer: [12.956 + 224.15 (µg/ml)] x 10
8.
EXAMPLE 4. Expression of Human Thrombomodulin (hTM) in vitro (ILLUSTRATIVE)
(A) Expression of hTM in HEK 293 cells transfected with pTM-final
[0084] HEK 293 cells were cultured in a 6 well cluster and transfected with 1µg of of pTM-final.
After 24 hours, the cells were washed with PBS and lysed in 125 µl RIPA buffer with
protease inbitors Protein samples (16µl) were separated on 7.5% polyacrylamide/ SDS
gel and transferred to nitrocellulose membrane. Primary antibody TM (c-17) (1:2000,
Santa Cruz) and secondary antibody Polyclonal Rabbit Anti-Goat Immunoglobulins/HRP
(1:4000, DakoCytomation) was used to detect the proteins. As shown in Figure 3, hTM
expression was detectable in cells transfected with pTM-final.
[0085] The RIPA buffer was prepared according the following recipe: mixing 100 µl Igepal
ca-630, 50 mg sodium deoxycholate, 500 µl 20 % SDS, 10 mM β-mercapto ethanol, and
1 ml 10x PBS, and add water to a final volume of 10 ml at room temperature. A cocktail
of protease inhibitors containing 11.5 µl PMSF (from 34.8 mg/ml in isopropanol, 64
µl Benzamidine (from 15.6 mg/ml stock), 100 µl sodium orthovanadate (100 mM), 5 µl
pepstadine (from 1 mg/ml stock), 1 µl leupeptine (from 5 mg/ml stock), and 1 µl aprotin
(from 5 mg/ml stock) was added to the RIPA buffer immediately before use.
(B) Expression of hTM in P2 lysate of 293FLP cells
[0086] The P2 lysate was generated as described in Example 3. After CPE was observed, 293FLP
cells were detached from the bottom of the culture flask by repeated tapping of the
flask. 1 ml of the total of 10 ml of cell suspension was used for the detection of
TM expression. The cells in the 1ml cell suspension were collected by centrifugation
for 10 min at 300xg and lysed in 250µl RIPA buffer. 7ul of 5x loading buffer was added
to 35µl of the lysed cells and the resulting solution was immersed in boiling water
for 3 minutes. 5 and 30 ul of boiled cell lysate were diluted with 250 ul TBS (137mM
sodium chloride, 10mum Tris, pH is 7.4 at +25°C) and transferred to a nitrocellulose
membrane using a slotblot device (Bio-Dot SF, Biorad). Primary antibody (goat anti-hTM
(c-17) 1:2000 dilution, Santa Cruz) and secondary antibody (polyclonal rabbit anti-goat
immunoglobulins/HRP, 1:4000 dilution, DakoCytomation)) were used to detect the proteins.
As shown in Figure 4, hTM was detectable in the P2 lysate.
[0087] The 5x loading buffer was prepared by mixing 20.0 ml 30% SDS, 11.5 ml 2M sucrose,
6.5 ml 2M Tris-HCL pH 6.8, 2.0 ml beta-mercaptoethanol and bromophenolblue. The RIPA
buffer was prepared as described in Example 4(A). A cocktail of protease inhibitors
containing 11, 5 µl PMSF (from 34, 8 mg/ml in isopropanol, 64 µl Benzamidine (from
15, 6 mg/ml stock), 100 µl sodium orthovanadate (100 mM), 5 µl pepstadine (from 1
mg/ml stock), 1 µl leupeptine (from 5 mg/ml stock), and 1 µl aprotin (from 5 mg/ml
stock) was added to the RIPA buffer immediately before use.
(C) Expression of TM in virus infected vena cava
[0088] Vena cava was excised from rats and cut into six segments of approximately 3mm long.
The segments were incubated for 30 minutes in medium containing gutless luc or TM
virus. After incubation, the segments were washed three times and transferred to a
24-well plate containing DMEM. The segments were incubated overnight in an atmosphere
of 95%O
2 and 5%CO
2 with gentle shaking. After 24 hours of incubation the segments were frozen. The frozen
sections were thawed in lysis buffer and loaded onto a 7.5% SDS acrylamide gel. After
blotting, the blot was probed with an antibody against human TM.
[0089] The Western blot clearly shows that within 24 hours TM expression can be detected
(Figure 5).
[0090] As a control, the same HUVEC cells will be infected the gutless adenovirus expressing
LacZ. These cells will subsequently be stained with X-gal to look for blue cells.
This will demonstrate the viability of the gutless adenovirus backbone itself.
(D) TM expression in HEK 293 cells infected with TM gutless virus passage 1-6
[0091] The TM-vector backbone was released by digestion with PacI. 293CRE cells were cultured
in a 60mm dish at 80% confluency. Cells were transfected with 5µg of PacI digested
TM-vector backbone. After 24 hours, 2% DMEM-F12 containing helper virus with a MOI
of 10 was added. Following CPE, cells were removed from the dish and medium and cells
were collected a in a sterile 15ml tube. Cells went through three freeze/ thaw cycles
and the resulting suspension was centrifuged for 5 minutes at 4000 rpm. The cleared
lysate was collected and name P=0.
[0092] 4 ml of P=0 supernatant was added to 2 T75 dish containing 293CRE cells at 80% confluence.
Cells were subsequently infected with helpervirus at MOI of 1. Following CPE, cells
were removed from the dish and medium and cells were collected a in a sterile 15 ml
tube. Cells went through three freeze/ thaw cycles and the resulting suspension was
centrifuged for 5 minutes at 4000 rpm. The cleared lysate was collected and name P=1.
This procedure was repeated until P=6.
[0093] HEK 293 cells were cultured in a 6 well cluster and transfected with 200 µl of TM
gutless virus of passage 1-6. After 24 hours, the cells were washed with PBS and lysed
in 125µl RIPA buffer. Protein samples (16µl) were separated on a 7.5% polyacrylamide/
SDS gel and transferred to nitrocellulose membrane. Primary antibody TM (c-17) (1:2000,
Santa Cruz) and secondary antibody Polyclonal Rabbit Anti-Goat Immunoglobulins/HRP
(1:4000, DakoCytomation) were used to detect the proteins. As shown in Figure 6, TM
expression is higher in cells infected with virus of higher passage numbers , indicating
successful amplification of TM gutless virus in 293CRE cells.
[0094] The RIPA buffer (10 ml) was prepared as follows: 100 µl Igepal ca-630, 50 mg sodium
deoxycholate, 500 µl 20 % SDS, 10 mM β-mercapto ethanol, 1 ml 10x PBS, add water to
make up 10 ml. Immediately before use, the following protease inhibitors were added
to the RIPA buffer: 115 µl PMSF (from 34,8 mg/ml in isopropanol), 64 µl Benzamidine
(from 15,6 mg/ml stock), 100 µl sodium orthovanadate (100 mM), 5 µl pepstatin (from
1 mg/ml stock), 1 µl leupeptin (from 5 mg/ml stock), 1 µl aprotin (from 5 mg/ml stock).
EXAMPLE 5. Composition of The Complete Viral Delivery System (CVDS)
[0095] The Complete Viral Delivery System composes of 1: 1 mixture of Ham's F12 medium and
DMEM, an effective amount of a gutless virus vector carrying a polynucleotide encoding
a thrombomodulin protein or a variant of a thrombomodulin protein, and an a cellular
oxygen carrier. Preferred oxygen carrier includes: unmodified or chemically modified
hemoglobin in the range of 3 g/dl to 10 g/dl and perfluorochemical emulsions. The
CVDS may optionally contain 1 mM L-glutamine (Sigma), 1.5 g/L sodium bicarbonate (Sigma),
1X antibiotic-antimycotic (GIBCO® 15240). The CVDM maintains tissue viability during
the viral treatment of blood vessel.
EXAMPLE 6. Ex vivo Treatment of Cardiovascular Disease (FOR REFERENCE)
[0096] A vein segment is harvested from the leg and is stored in Ham's F12 medium. Gutless
adenovirus suspended in CVDM is then injected into the isolated vein segment and incubated
for 10 to 40 minutes depending on the desired level of transfection. The infection
may be performed under pressure to enhance efficiency.
[0097] After the incubation, the vein segment is washed several times to eliminate all viral
particles that have not entered the endothelial cells of the vein segment, and is
then grafted into the desired treatment site. The thorough rinse avoids the spread
of the viral vector to other organs of the body following
in situ grafting, and any systemic immune response to the viral vector.
EXAMPLE 7. In vivo treatment for Peripheral Vascular Disease (FOR REFERENCE)
[0098] In this application, the vein in the leg is treated following evacuation of the clot.
A catheter is inserted in the leg vein and both the proximal and distal balloons are
inflated to isolate the vein segment to be transfected. The segment is evacuated of
all blood, rinsed with physiologic saline. The segment is then filled with the CVDS
described above, under pressure. The isolated vein segment is exposed to the CVDS
for a period of 10 to 45 minutes, depending upon the desired transfection efficiency.
EXAMPLE 8. In vivo expression of TM by intravenous infusion of viral vectors (ILLUSTRATIVE)
Material and methods
[0099] Infection with gutless TM virus: 3 male Wistar rats weighing approximately 300 grams
were intravenously injected in the tail vein with a low dose of gutless TM virus (approximately
2x10
10 viral particles) in a total volume of 500 ul of sucrose buffer. After three weeks,
the animals were sacrificed and liver tissue and blood plasma was collected and immediately
frozen in liquid nitrogen.
[0100] TM expression in the liver was determined by western blotting. Approximately 500mg
of liver tissue was homogenized in 2 ml of RIPA buffer. Liver protein samples (20
µg) were separated on a 7.5% polyacrylamide/ SDS gel and transferred to nitrocellulose
membrane. Primary antibody TM (c-17) (1:2000, Santa Cruz) and secondary antibody Polyclonal
Rabbit Anti-Goat Immunoglobulins/HRP (1:4000, DakoCytomation) were used to detect
the proteins.
[0101] Detection of rat Anti-TM antibodies in the plasma of TM infected rats: HEK 293 cells
were cultured in a 6 well cluster. 3 wells were infected with 100 µl of TM gutless
virus (approximately 4x 10
9 virus particles) and 3 wells received no virus. After 24 hours, non-infected and
TM infected cells were washed with PBS and lysed in 125µl RIPA buffer. Protein samples
(16µl) were separated on a 7.5% polyacrylamide/ SDS gel and transferred to nitrocellulose
membrane. Blots containing protein from both TM expressing cells and non-infected
cells were incubated with primary antibody TM (c-17) (1:2000, Santa Cruz) or plasma
from TM infected rats (1:20, 1:100 and 1:1000 dilution). Detection of primary antibodies
was performed using Polyclonal Rabbit Anti-Goat Immunoglobulins/HRP (1:4000, DakoCytomation)
and Polyclonal Rabbit Anti-Rat Immunoglobulins/HRP (1:4000, DakoCytomation), respectively.
RIPA buffer was prepared as described in Example 4.
[0102] TM expression in the liver: No adverse effects of the injection of gutless TM virus
could be detected. Animals displayed normal growth characteristics and did not suffer
from excessive bleeding. Three weeks after injection, animals were sacrificed and
no internal bleeding could be detected. Liver TM expression was evaluated using western-blot.
TM expression was elevated two-fold above background levels, indicating modest over-expression
of TM gutless virus in the liver three weeks after infection (Figure 8).
[0103] To detect TM antibodies in the plasma of rats infected with the gutless TM virus,
four western blots were made. Each blot contains a protein sample from human cells
expressing TM (positive control) and a sample from the same cells that do not produce
TM (negative control). Blot 1 was probed with a commercial antibody against TM (Figure
9, blot 1), indicating the presence of human TM only in the positive control lane.
Blots 2,3 and 4 were probed with plasma from animals infected with TM virus in the
dilution 1:20, 1:100 and 1:1000, respectively. Although some immunoreactivity is observed,
the plasma of rats did not lead to the specific detection of TM in the positive control
lane. Therefore, the plasma of these rats do not contain detectable levels of rat
IgG antibodies against human TM.
[0104] Conclusion: Intravenous administration of low dose gutless TM virus into rat tail
vein resulted in modest expression of TM in the liver of the recipient rats three
weeks after injection. The viral injection did not result in the production of IgG
antibodies against TM.
EXAMPLE 9. Adenovirus-Mediated in vivo Gene Transfer To Vena Cava
[0105] Inbred male Brown Norway rats (BN / rijHsd, Harlan, Netherlands) with an age of 11
weeks were used. Animals were housed in a light and temperature controlled environment
and fed standard rodent chow and water
ad libitum. Rats were anaesthetized with isoflurane (3% in O
2). The vene cava with the branches was exposed by a mid-line incision. The vene cava
was clamped just below the vene renalis of the left kidney. All accessible sidebranches
of the vena cava in the region between the vena renalis and the bifurcation were also
clamped. The virus particles were administered through an insulin syringe (29-gauge
needle) with a volume of 290ul containing 2 x 10
11 virus particles. After injection of the viral solution, the syringe with needle was
not removed from the vena cava but remained in place during the following incubation
period of 20 minutes. Subsequently, the clamps on the sidebranches of the vene cava
were removed. The transfected segment of vena cava was washed by making a puncture
with a needle 25-gauge needle just below the clamp near the vena renalis. The expelled
blood containing excess virus was absorbed with a cotton bud. After bleeding a volume
of approximately 0.5 ml, the bleeding was stopped by applying a pressure on the puncture
site with a cottonswab. Subsequently, the clamp near the vene renalis was released
and the abdomen was sutured. For post- operative pain relief, the rats received buprenorphin
(temgesic®) 10 µg/kg subcutaneously. The rats were allowed to recover with access
to water and food
ad libitum.
[0106] Two days after the transfection procedure, rats were anaesthetized with isoflurane
(3% in O
2). The vene cava was exposed by a mid-line incision and clamped just below the vena
renalis of the left kidney. The abdomen was temporarily closed during the incubation
time of 2 hours. Subsequently, the abdomen was reopened and blood was collected from
the aorta. The vena cava was harvested from the bifurcation till above the clamp.
The vene cava was opened longitudinally and the thrombus was removed and placed in
saline for size evaluation. The results of the experiment were summarized in Table
I.
Table I. Vena cava thrombus in the experimental animals
| Group |
Thrombus size in individual animals |
| sucrose |
1623.98 |
| |
1507.23 |
| |
239.84 |
| |
398.25 |
| |
107.97 |
| |
32.24 |
| |
85.40 |
| |
|
| gfp virus |
97.00 |
| |
107.13 |
| |
158.93 |
| |
0.00 |
| |
89.04 |
| |
87.63 |
| |
1281.56 |
| |
137.13 |
| |
|
| TM virus |
0.00 |
| |
280.04 |
| |
0.00 |
| |
0.00 |
| |
140.21 |
| |
60.65 |
| |
0.00 |
| |
108.69 |
EXAMPLE 10. Adenovirus-Mediated Gene Transfer To Kidney via Intravenous Infusion
[0107] This example describes the procedure for slowly infusing a recombinant adenovirus
into the renal circulation. Male Sprague-Dawley rats (100-150 g) were injected intramuscularly
with 20,000 units of penicillin, anesthetized with ketamine (70 mg/kg, ip) and xylazine
(7 mg/kg, ip) and underwent surgical exposure of the right kidney, the aorta and the
right renal blood vessels. The right renal blood flow was interrupted by clamping
the aorta above and below the right renal artery and the superior mesenteric artery
(SMA). This setting selectively excluded the right kidney without interrupting the
blood circulation through the left kidney and allowed infusion of virus into the right
kidney through the SMA. A 27-gauge winged infusion needle was inserted into the SMA
and fixed in place with a microaneurism clamp. 1.5 ml of recombinant adenovirus in
phosphate buffered saline (PBS) containing 5 units of heparin/ml were slowly infused
into the right kidney with a Razel A-99 syringe pump at a flow rate of 0.1 ml/min.
The right kidney was packed with ice during the infusion to minimize ischemic damage.
Renal circulation was reestablished at the end of infusion. The abdominal cavity was
closed with sutures. The animal was placed on a warm pad to recover from the anesthesia
and was returned to its cage after recovery.
EXAMPLE 11. Adenovirus-Mediated Gene Transfer to Kidney via Balloon Catheter
[0108] In this application, a catheter is inserted in a vein near or in the kidney. Both
the proximal and distal balloons are inflated to isolate the vein segment to be transfected.
The segment is evacuated of all blood, rinsed with physiologic saline. The segment
is then filled with the CVDS described above, under pressure. The isolated vein segment
is exposed to the CVDS for a period of 10 to 45 minutes, depending upon the desired
transfection efficiency.
EXAMPLE 12. In vivo Treatment With Virus Containing Stent
[0109] In this application, a virus-coated stent is placed at a treatment site in or near
the kidney. Alternatively, the virus may be embedded in the stent and is releases
gradually through a time-releasing mechanism well-known to one skilled in the art.
EXAMPLE 13. Construction of gutless adenovirus vectors carrying the IDO gene
[0110] Rat and human IDO cDNA were amplified by RT-PCR using the following set of primers:
Forward primer (containing a FseI restriction site):
5'-TATTTATTGGCCGGCCGCGTTAAGATACATTGATGAG-3' (SEQ ID NO:17)
[0111] Reverse primer (containing a SbfI restriction site):
5'-TATTTATTCCTGCAGGTCGTAGGTCAAGGTAGTAGA-3' (SEQ ID NO:18).
[0112] The amplified rat IDO cDNA (SEQ ID NO:19) and human IDO cDNA (SEQ ID NO:20) were
cloned into expression plasmids pAdTrackCMV-rIDO and pAdTrackCMV-hIDO, respectively.
[0113] Expression cassettes comprising a CMV promoter, IDO cDNA and polyadenylation signal
were constructed using PCR. PCR primers were equipped with additional restriction
enzyme sites to facilitate cloning into the gutless backbone vector.
[0114] Forward primer (containing a FseI restriction site):
tatttattggccggcCGCGTTAAGATACATTGATGAG (SEQ ID NO: 17)
[0115] Reverse primer (containing a SbfI restriction site):
tatttattcctgcaggTCGTAGGTCAAGGTAGTAGA (SEQ ID NO: 18)
[0116] The resulting PCR fragments were cloned into pGEM-T-EASY for sequencing and cloning.
Sequencing confirmed the presence of rat IDO expression cassette (Figure 10, SEQ ID
NO:21) and human IDO expression cassette (Figure 11, SEQ ID NO:22).
[0117] The gutless backbone (SEQ ID NO:23, Figure 12) was cut with SbfI and FseI to release
the TM expression cassette. The backbone was subsequently dephosphorylated to prevent
vector self-ligation. Rat and human IDO expression cassettes were released from pGEM-T-Easy
by digestion with Fsel and SbfI and ligated into the FseI and SbfI sites of the gutless
backbone. The resulting constructs prIDO-final (Figure 13, SEQ ID NO:24) and phIDO-final
(Figure 14, SEQ ID NO:25) were cloned in E-coli DH5α. DNA midipreps were generated
for the production of high quality plasmid DNA. Gutless adenovirus containing rat
IDO or human IDO was produced using the procedure described in Example 3.
EXAMPLE 14. Perfusion of Kidney Transplant with gutless adenovirus vectors carrying
the IDO gene
[0118] The experiment was carried out in Fisher-Lewis kidney transplantation model. Gutless
adenoviruses carrying the IDO gene (Ad.TIDO) or luciferase gene (Ad.TL) were surface-modified
with cyclic arginine-glycine-aspartic acid (RGD) peptides through a bifunctional poly(ethyleneglycol)
linker for integrin alpha(v)beta(3) specific delivery. The resulting RGD modified
viruses were designated RGD-Ad.TIDO and Ad.TL. The transplanted kidneys were incubated
with either RGD-AdTTDO (n=6) or RGD-AdTL (n=5) at 4°C for 20 min with saline. The
transplanted animals were sacrificed at day 7. The transplanted kidneys were isolated
and subjected to Western blot and immunohistological examination.
[0119] As shown in Figure 15, IDO expression was detected in the kidneys infected with RGD-AdTIDO
but not in kidneys infected with RGD-AdTL. Figures 16A-16D shows that, comparing to
kidneys perfused with saline or control virus (RGD-AdTL), kidneys infected with RGD-AdTIDO
showed reduced plasma creatinin levels (Figure 16A). Kidneys infected with RGD-AdTIDO
also showed reduced tissue damage, as evidenced by the reduced ED-1 staining (Figure
16B), reduced macrophage influx (Figure 16C, CD-8 staining for T-lymphocytes), and
reduced fibrotic response (Figure 16D, staining for smooth muscle actin).
SEQUENCE LISTING