CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to United States Provisional Application No.
61/409,422, filed November 2, 2010, which is incorporated herein by reference in its entirety.
BACKGROUND
[0002] The luciferase secreted from the deep-sea shrimp
Oplophorus gracilirostris has been shown to possess many interesting characteristics, such as high activity,
high quantum yield, and broad substrate specificity (including, e.g., coelenterazine
as well as various coelenterazine analogs). The bioluminescent reaction of
Oplophorus takes place when the oxidation of coelenterazine (substrate) with molecular oxygen
is catalyzed by
Oplophorus luciferase, resulting in light of maximum intensity at 462 nm and the products CO
2 and coelenteramide (
Shimomura et al., Biochemistry, 17:994 (1978)). Optimum luminescence occurs at pH 9 in the presence of 0.05-0.1 M NaCl at 40°C,
and, due to the unusual resistance of this enzyme to heat, visible luminescence occurs
at temperatures above 50°C when the highly purified enzyme is used or at over 70°C
when partially purified enzyme is used. At pH 8.7, the native luciferase was reported
by Shimomura
et al. (1978) to have a molecular weight of approximately 130 kDa, apparently comprising
four monomers of 31 kDa each; at lower pH, the native luciferase tends to polymerize.
[0003] Later work has shown that the
Oplophorus gracilirostris luciferase is a complex of native 35 kDa and 19 kDa proteins, i.e., a heterotetramer
consisting of two 19 kDa components and two 35 kDa components. Inouye
et al. (2000) reported the molecular cloning of the cDNAs encoding the 35 kDa and 19 kDa
proteins of
Oplophorus luciferase, and the identification of the protein component that catalyzes the luminescence
reaction. The cDNAs encoding the proteins were expressed in bacterial and mammalian
cells, and the 19 kDa protein was identified as the component capable of catalyzing
the luminescent oxidation of coelenterazine (Inouye
et al., 2000).
[0005] The substrate specificity of
Oplophorus luciferase is unexpectedly broad (
Inouye and Shimomura. BBRC, 223:349 (1997)). For instance, bisdeoxycoelenterazine (i.e., coelenterazine-hh), an analog of coelenterazine,
is an excellent substrate for
Oplophorus luciferase comparable to coelenterazine (
Nakamura et al., Tetrahedron Lett., 38:6405 (1997)). Moreover,
Oplophorus luciferase is a secreted enzyme, like the luciferase of the marine ostracod
Cypridina (
Vargula)
hilgendorfii (
Johnson and Shimomura, Meth. Enzyme, 57:331 (1978)), which also uses an imidazopyrazinone-type luciferin to emit light.
SUMMARY
[0006] In an aspect, the disclosure relates to a compound of formula (1a) or (1b):

or
wherein R2 is selected from the group consisting of

or C2-5 straight chain alkyl;
R6 is selected from the group consisting of-H, -OH, -NH2, -OC(O)R or -OCH2OC(O)R;
R8 is selected from the group consisting of

H or lower cycloalkyl;
wherein R3 and R4 are both H or both C1-2 alkyl;
W is -NH2, halo, -OH, -NHC(O)R, -CO2R;
X is -S-, -O- or -NR22-;
Y is-H, -OH, or -OR11;
Z is -CH- or -N-;
each R11 is independently -C(O)R" or -CH2OC(O)R";
R22 is H, CH3 or CH2CH3;
each R is independently C1-7 straight-chain alkyl or C1-7 branched alkyl;
R" is C1-7 straight-chain alkyl or C1-7 branched alkyl;
the dashed bonds indicate the presence of an optional ring, which may be saturated
or unsaturated;
with the proviso that when R2 is

or

R8 is not

with the proviso that when R2 is

R8 is

or lower cycloalkyl; and
with the proviso that when R6 is NH2, R2 is ,

or C2-5 alkyl;
or R8 is not

[0008] In an aspect, the disclosure relates to a compound of formula

[0009] In an aspect, the disclosure relates to an isolated polynucleotide encoding an OgLuc
variant polypeptide having at least 60% amino acid sequence identity to SEQ ID NO:
1 comprising at least one amino acid substitution at a position corresponding to an
amino acid in SEQ ID NO: 1 wherein the OgLuc variant polypeptide has enhanced luminescence.
[0010] In an aspect, the disclosure relates to an isolated polynucleotide encoding an OgLuc
variant polypeptide having at least 60% amino acid sequence identity to SEQ ID NO:
1 comprising at least one amino acid substitution at a position corresponding to an
amino acid in SEQ ID NO: 1 wherein the OgLuc variant polypeptide has enhanced luminescence
relative to an OgLuc polypeptide of SEQ ID NO: 3 with the proviso that the polypeptide
encoded by the polynucleotide is not one of those listed in Table 47.
[0011] In an aspect, the disclosure relates to an isolated polynucleotide encoding an OgLuc
variant polypeptide having at least 60% amino acid sequence identity to SEQ ID NO:
1 comprising at least one amino acid substitution at a position corresponding to an
amino acid in SEQ ID NO: 1 wherein the OgLuc variant polypeptide has enhanced luminescence
relative to a polypeptide of SEQ ID NO: 31 with the proviso that the polypeptide encoded
by the polynucleotide is not SEQ ID NO: 3 or 15.
[0012] In an aspect, the disclosure relates to an isolated polynucleotide encoding an OgLuc
variant polypeptide having at least 60% amino acid sequence identity to SEQ ID NO:
1 comprising at least one amino acid substitution at a position corresponding to an
amino acid in SEQ ID NO: 1 wherein the OgLuc variant polypeptide has enhanced luminescence
relative to a polypeptide of SEQ ID NO: 29 with the proviso that the polypeptide encoded
by the polynucleotide is not SEQ ID NO: 3 or 15.
[0013] In an aspect, the disclosure relates to an isolated polynucleotide encoding an OgLuc
variant polypeptide having at least 80% amino acid sequence identity to an OgLuc polypeptide
of SEQ ID NO: 1 comprising amino acid substitutions A4E, Q11R, A33K, V44I, P115E,
Q124K, Y138I, N166R, I90V, F54I, Q18L, F68Y, L72Q, and M75K corresponding to SEQ ID
NO: 1 and the OgLuc variant polypeptide having luciferase activity.
[0014] In an aspect, the disclosure relates to an isolated polynucleotide encoding an OgLuc
variant polypeptide having at least 80% amino acid sequence identity to an OgLuc polypeptide
of SEQ ID NO: 1, wherein the amino acid at position 4 is glutamate, at position 11
is arginine, at position 18 is leucine, at position 33 is lysine, at position 44 is
isoleucine, at position 54 is isoleucine, at position 68 is tyrosine, at position
72 is glutamine, at position 75 is lysine, at position 90 is valine, at position 115
is glutamate, at position 124 is lysine, at position 138 is isoleucine, and at position
166 is arginine corresponding to SEQ ID NO: 1 and the OgLuc variant polypeptide having
luciferase activity.
[0015] In an aspect, the disclosure relates to an isolated polynucleotide encoding an OgLuc
variant polypeptide having at least 80% amino acid sequence identity to an OgLuc polypeptide
of SEQ ID NO: 1 comprising amino acid substitutions A4E, Q11R, A33K, V44I, P115E,
Q124K, Y138I, N166R, Q18L, F54I, L92H, and Y109F corresponding to SEQ ID NO: 1 and
the OgLuc variant polypeptide having luciferase activity.
[0016] In an aspect, the disclosure relates to an isolated polynucleotide encoding an OgLuc
variant polypeptide having at least 80% amino acid sequence identity to an OgLuc polypeptide
of SEQ ID NO: 1 comprising amino acid substitutions A4E, Q11R, A33K, V44I, A54I, F77Y,
I90V, P115E, Q124K, Y1381 and N166R corresponding to SEQ ID NO: 1 and the OgLuc variant
polypeptide having luciferase activity.
[0017] In an aspect, the disclosure relates to an isolated polynucleotide encoding an OgLuc
variant polypeptide having at least 80% amino acid sequence identity to an OgLuc polypeptide
of SEQ ID NO: 1, wherein the amino acid at position 4 is glutamate, at position 11
is arginine, at position 18 is leucine, at position 33 is lysine, at position 44 is
isoleucine, at position 54 is isoleucine, at position 92 is histidine, at position
109 is phenylalanine, at position 115 is glutamate, at position 124 is lysine, at
position 138 is isoleucine, and at position 166 is arginine corresponding to SEQ ID
NO: 1 and the OgLuc variant polypeptide having luciferase activity.
[0018] In an aspect, the disclosure relates to an isolated polynucleotide encoding an OgLuc
variant polypeptide having at least 80% amino acid sequence identity to an OgLuc polypeptide
of SEQ ID NO: 1, wherein the amino acid at position 4 is glutamate, at position 11
is arginine, at position 33 is lysine, at position 44 is isoleucine, at position 54
is isoleucine, at position 77 is tyrosine, at position 90 is valine, at position 115
is glutamate, at position 124 is lysine, at position 138 is isoleucine, and at position
166 is arginine corresponding to SEQ ID NO: 1 and the OgLuc variant polypeptide having
luciferase activity.
[0019] In an aspect, the disclosure relates to an isolated polynucleotide comprising the
polynucleotide encoding the polypeptide of SEQ ID NO: 19.
[0020] In an aspect, the disclosure relates to an isolated polynucleotide comprising the
polynucleotide of SEQ ID NO: 18, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 42, SEQ
ID NO: 88, or SEQ ID NO: 92.
[0021] In an aspect, the disclosure relates to an isolated polynucleotide encoding a decapod
luciferase polypeptide having at least 30% amino acid sequence identity to SEQ ID
NO: 1, the polypeptide comprising a sequence pattern corresponding to the sequence
pattern of Formula (VII) and including no more than 5 differences, wherein differences
include differences from pattern positions 1, 2, 3, 5, 8, 10, 12, 14, 15, 17, or 18
relative to Formula (VII) according to the OgLuc pattern listed in Table 4 as well
as gaps or insertions between any of the pattern positions of Formula (VII) according
to the OgLuc pattern listed in Table 4, wherein the decapod luciferase produces luminescence
in the presence of a coelenterazine.
[0022] In an aspect, the disclosure relates to a synthetic nucleotide sequence encoding
an OgLuc variant polypeptide comprising a fragment of at least 100 nucleotides having
80% or less nucleic acid sequence identity to a parent nucleic acid sequence having
SEQ ID NO: 2 and having 90% or more nucleic acid sequence identity to SEQ ID NO: 22,
SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25 or the complement thereof, wherein
the decreased sequence identity is a result of different codons in the synthetic nucleotide
sequence relative to the codons in the parent nucleic acid sequence, wherein the synthetic
nucleotide sequence encodes a OgLuc variant which has at least 85% amino acid sequence
identity to the corresponding luciferase encoded by the parent nucleic acid sequence,
and wherein the synthetic nucleotide sequence has a reduced number of regulatory sequences
relative to the parent nucleic acid sequence.
[0023] In an aspect, the disclosure relates to a synthetic nucleotide sequence encoding
an OgLuc variant polypeptide comprising a fragment of at least 300 nucleotides having
80% or less nucleic acid sequence identity to a parent nucleic acid sequence having
SEQ ID NO: 14 and having 90% or more nucleic acid sequence identity to SEQ ID NO:
22 or SEQ ID NO: 23 or the complement thereof, wherein the decreased sequence identity
is a result of different codons in the synthetic nucleotide sequence relative to the
codons in the parent nucleic acid sequence, wherein the synthetic nucleotide sequence
encodes a firefly luciferase which has at least 85% amino acid sequence identity to
the corresponding luciferase encoded by the parent nucleic acid sequence, and wherein
the synthetic nucleotide sequence has a reduced number of regulatory sequences relative
to the parent nucleic acid sequence.
[0024] In an aspect, the disclosure relates to a synthetic nucleotide sequence encoding
an OgLuc variant polypeptide comprising a fragment of at least 100 nucleotides having
80% or less nucleic acid sequence identity to a parent nucleic acid sequence having
SEQ ID NO: 18 and having 90% or more nucleic acid sequence identity to SEQ ID NO:
24 or SEQ ID NO: 25 or the complement thereof, wherein the decreased sequence identity
is a result of different codons in the synthetic nucleotide sequence relative to the
codons in the parent nucleic acid sequence, wherein the synthetic nucleotide sequence
encodes a OgLuc variant which has at least 85% amino acid sequence identity to the
corresponding luciferase encoded by the parent nucleic acid sequence, and wherein
the synthetic nucleotide sequence has a reduced number of regulatory sequences relative
to the parent nucleic acid sequence.
[0025] In an aspect, the disclosure relates to a fusion peptide comprising a signal peptide
from
Oplophorus gracilirostris fused to a heterologous protein, wherein said signal peptide is SEQ ID NO: 54, wherein
the fusion peptide is expressed in a cell and secreted from the cell.
[0026] In an aspect, the disclosure relates to a method of generating a polynucleotide encoding
a OgLuc variant polypeptide comprising: (a) using a parental fusion protein construct
comprising a parental OgLuc polypeptide and at least one heterologous polypeptide
to generate a library of variant fusion proteins; and (b) screening the library for
at least one of enhanced luminescence, enhanced enzyme stability or enhanced biocompatibility
relative to the parental fusion protein construct.
[0027] In an aspect, the disclosure relates to a method of generating codon-optimized polynucleotides
encoding a luciferase for use in an organism, comprising: for each amino acid in the
luciferase, randomly selecting a codon from the two most commonly used codons used
in the organism to encode for the amino acid to produce a first codon-optimized polynucleotide.
[0028] Other aspects of the invention will become apparent by consideration of the detailed
description and accompanying drawings.
BRIEF DESCRIPTION OF THE DRAWINGS
[0029]
FIG. 1 shows the chemical structure of native coelenterazine, known bis-coelenterazine
(coelenterazine-hh), and known coelenterazine-h, where R2, R6 and R8 represent the
regions of the molecule where modifications were made.
FIG. 2 shows the chemical structure of novel coelenterazines PBI-3939, PBI-3889, PBI-3945,
PBI-4002, PBI-3841, PBI-3897, PBI-3896, PBI-3925, PBI-3894, PBI-3932, and PBI-3840.
FIG. 3 shows the Km determination of PBI-3939.
FIG. 4 shows the chemical structure of various novel coelenterazines of the present
invention.
FIGS. 5A-G show the luminescence (RLUs) generated from lysed bacterial cells expressing
C1+A4E using native, known, and novel coelenterazine as substrates. FIGS. 5A, 5C-5G
show independent experiments measuring the luminescence in RLUs generated by C1+A4E
with known and novel coelenterazines using native coelenterazine as a comparison.
FIG. 5B shows the fold-decrease in luminescence generated by C1+4AE using the substrates
shown in FIG. 5A compared to native coelenterazine.
FIGS. 6A-D show the luminescence generated from lysed bacterial cells expressing various
OgLuc variants using native coelenterazine ("Coelente"), known coelenterazine-h ("h"),
known coelenterazine-hh ("h,h"), known 2-methyl coelenterazine ("2-me"), known coelenterazine-v
("v"), and novel coelenterazines PBI-3840, PBI-3897, PBI-3889, PBI-3899, PBI-3900,
PBI-3912, PBI-3913, PBI-3925, PBI-3897, PBI-3899, PBI-3889, PBI-3939, PBI-3933, PBI-3932,
PBI-3946, PBI-3897, PBI-3841, PBI-3896, PBI-3925, and PBI-3945 as substrates.
FIG. 7 shows the amino acid substitutions in various OgLuc variants.
FIGS. 8A-B show the luminescence generated from lysed bacterial cells expressing OgLuc
variants listed in FIG. 7 using native coelenterazine ("Coelenterazine"), known coelenterazine-h
("H"), known coelenterazine-hh ("h,h"), and novel coelenterazines PBI-3840, PBI-3925,
PBI-3912, PBI-3889, PBI-3939, PBI-3933, PBI-3932, PBI-3946, PBI-3941, and PBI-3896
as substrates.
FIG. 9 shows the luminescence generated from lysed bacterial cells expressing various
OgLuc variants using native coelenterazine ("Coelenterazine"), known coelenterazine-hh
("h,h"), and novel coelenterazines PBI-3939, PBI-3945, PBI-3840, PBI-3932, PBI-3925,
PBI-9894, and PBI-3896 as substrates.
FIG. 10 shows the amino acid substitutions in various OgLuc variants.
FIG. 11 shows the luminescence generated from lysed bacterial cells expressing OgLuc
variants listed in FIG. 10 using native coelenterazine ("Coelenterazine"), known coelenterazine-hh
("h,h"), and novel coelenterazines PBI-3939, PBI-3945, PBI-3840, PBI-3932, PBI-3925,
PBI-3894, and PBI-3896, as substrates.
FIG. 12 shows the luminescence generated from lysed bacterial cells expressing OgLuc
variants using native coelenterazine ("Coelenterazine"), known coelenterazine-hh ("h,h"),
and novel coelenterazines PBI-3939, PBI-3945, PBI-3889, PBI-3840, PBI-3932, PBI-3925,
PBI-3894, PBI-3896, and PBI-3897 as substrates.
FIG. 13 shows the luminescence generated from lysed bacterial cells expressing OgLuc
variants using native coelenterazine ("Coelenterazine"), known coelenterazine-hh ("H,H"),
and novel coelenterazines PBI-3897, PBI-3896, and PBI-3894 as substrates.
FIG. 14 shows the amino acid substitutions in various OgLuc variants.
FIG. 15 shows the luminescence generated from lysed bacterial cells expressing OgLuc
variants listed in FIG. 14 using native coelenterazine ("Coelenterazine"), known coelenterazine-hh
("h,h"), and novel coelenterazines PBI-3897, PBI-3841, PBI-3896, and PBI-3894 as substrates.
FIG. 16 shows the luminescence generated from lysed bacterial cells expressing OgLuc
variants using native coelenterazine ("Coelenterazine"), known coelenterazine-h ("H"),
known coelenterazine-hh ("HH"), and novel coelenterazines PBI-3841 and PBI-3897 as
substrates.
FIG. 17 shows the luminescence generated from lysed bacterial cells expressing various
OgLuc variants and humanized Renilla luciferase (hRL) using native coelenterazine ("Coel"), known coelenterazine-hh ("h,h"),
and novel coelenterazines PBI-3897 and PBI-3841 as substrates.
FIG. 18 shows the luminescence generated from lysed bacterial cells expressing various
OgLuc variants using native coelenterazine ("Coelenterazine"), known coelenterazine-hh
("h,h"), and novel coelenterazines PBI-3939, PBI-3945, PBI-3889, and PBI-4002 as substrates.
FIG. 19 shows the luminescence generated from lysed bacterial cells expressing various
OgLuc variants using native coelenterazine ("Coelenterazine"), known coelenterazine-h
("H"), known coelenterazine-hh ("h,h"), and novel coelenterazines PBI-3939, PBI-3945,
PBI-3889, and PBI-4002 as substrates.
FIG. 20 shows the amino acid substitutions in various OgLuc variants.
FIG. 21 shows the luminescence generated from lysed bacterial cells expressing OgLuc
variants listed in FIG. 20 using native coelenterazine ("Coelenterazine"), known coelenterazine-h
("H"), known coelenterazine-hh ("h,h"), and novel coelenterazines PBI-3939, PBI-3945,
PBI-4002, PBI-3932, and PBI-3840 as substrates.
FIG. 22 shows the amino acid substitutions in various OgLuc variants.
FIG. 23 shows the luminescence generated from lysed bacterial cells expressing OgLuc
variants listed in FIG. 22 using native coelenterazine ("Coelenterazine"), known coelenterazine-h
("H"), known coelenterazine-hh ("h,h"), and novel coelenterazines PBI-3939, PBI-3945,
PBI-3889, PBI-4002, PBI-3932, and PBI-3840 as substrates.
FIG. 24 shows the luminescence generated from lysed bacterial cells expressing various
OgLuc variants and hRL ("Renilla") using native coelenterazine ("Coelenterazine"),
known coelenterazine-h ("H"), known coelenterazine-hh ("H,H"), and novel coelenterazines
PBI-3939 and PBI-3945 as substrates.
FIG. 25 shows the luminescence generated from lysed bacterial cells expressing various
OgLuc variants and hRL ("Renilla") using native coelenterazine ("Coelenterazine"),
known coelenterazine-hh ("h,h"), and novel coelenterazines PBI-3939, PBI-3945, PBI-3889,
and PBI-4002 as substrates.
FIG. 26 shows the amino acid substitutions in various OgLuc variants.
FIG. 27 shows the luminescence generated from lysed bacterial cells expressing OgLuc
variants listed in FIG. 26 using native coelenterazine ("Coelenterazine"), known coelenterazine-h
("H"), known coelenterazine-hh ("h,h"), and novel coelenterazines PBI-3939, PBI-3945,
PBI-3889, and PBI-4002 as substrates.
FIG. 28 shows the luminescence generated from lysed bacterial cells expressing various
OgLuc variants and hRL ("Renilla") using native coelenterazine ("Coel."), known coelenterazine-h
("H"), known coelenterazine-hh ("H,H"), and novel coelenterazines PBI-3939, PBI-3945,
PBI-3889, and PBI-4002 as substrates.
FIG. 29 shows the luminescence of 9B8 opt and 9B8 opt+K33N in bacterial lysates using
native coelenterazine and PBI-3939 as substrates and the relative specificity of these
variants for PBI-3939 compared to native coelenterazine.
FIGS. 30A-D show mutational analysis at position 166 using native coelenterazine (FIG.
30A), coelenterazine-h (FIG.30B), and PBI-399 (FIG. 30C).
FIG. 31 shows the luminescence of various deletions in the OgLuc variant L27V where
(-) is the machine background.
FIG. 32 shows the normalized luminescence generated from lysed HEK293 cells expressing
hRL ("Renilla") using native coelenterazine as a substrate, firefly luciferase (Luc2)
using luciferin (BRIGHT-GLO™ Assay Reagent) as a substrate, and various OgLuc variants
using novel PBI-3939 as a substrate.
FIG. 33 shows the signal stability of IV and 15C1 in bacterial lysates using the novel
coelenterazine PBI-3945 as a substrate and IV and 9B8 in bacterial lysates using the
novel coelenterazine PBI-3889 as a substrate.
FIGS. 34A-B show the higher activity (FIG. 34A) and signal stability (FIG. 34B) of
the OgLuc variant L27V compared to Firefly (Flue) and Renilla (Rluc) luciferases.
FIG. 35 shows the Vmax (RLU/sec) and Km (µM) values for various OgLuc variants in
bacterial lysates using the novel coelenterazine PBI-3939 as a substrate.
FIG. 36 shows the Vmax (RLU/sec) and Km (µM) values for various OgLuc variants in
bacterial lysates using the novel coelenterazine PBI-3939 as a substrate.
FIG. 37 shows the Vmax (RLU/sec) and Km (µM) values for 9B8 opt and 9B8 opt+K33N both
in bacterial lysates using the novel coelenterazine PBI-3939 as a substrate.
FIG. 38 shows the protein stability at 50°C of various OgLuc variants in bacterial
lysates using native coelenterazine as a substrate as the luminescence at t=0 and
half-life in min
FIGS. 39A-B show the structural integrity (determined by expression, stability, and
solubility as shown by SDS-PAGE analysis) in bacterial lysates of various OgLuc variants
at 25°C (FIG. 39A) and 37°C (FIG. 39B) compared to Renilla (hRL) and firefly luciferase (Luc2).
FIGS. 40A-B show the protein stability at 60°C in bacterial lysates of 9B8 opt and
9B8 opt+K33N using the novel coelenterazine PBI-3939 as a substrate as the natural
log (ln) of the luminescence (in RLU) over time (FIG. 40A) and as the half-life in
hrs (FIG. 40B).
FIG. 41 shows the percent activity of the OgLuc variants 9B8 and L27V at 60°C.
FIGS. 42A-B show the protein stability of the OgLuc variant L27V at various pH (FIG.
42A) and salt concentrations (FIG. 42B).
FIGS. 43A-B shows the gel filtration chromatographic analysis of purified C1+A4E (FIG.
43A) and 9B8 (FIG. 43B).
FIG. 44 shows the gel filtration chromatographic analysis demonstrating that the OgLuc
variant L27V exists in a monomeric form.
FIGS. 45A-B show the protein expression levels of various OgLuc variant-HALOTAG® (HT7)
fusion proteins in undiluted and 1:1 diluted bacterial lysate samples analyzed by
SDS-PAGE (FIG.45A) and the normalized protein expression levels (FIG. 45B).
FIGS. 46A-B show the protein expression (FIG. 46A) and solubility of the OgLuc variants
9B8 opt, V2 and L27V (FIG. 46B).
FIG. 47 shows the normalized luminescence in RLUs generated from lysed HEK293 cells
expressing IV, 9B8, and hRL ("Renilla") using native coelenterazine and the novel
coelenterazine PBI-3939 as substrates.
FIG. 48 shows the normalized luminescence in RLUs generated from lysed HEK293 cells
expressing pF4Ag-Ogluc-9B8-HT7, pF4Ag-Luc2-HT7 and pF4Ag-Renilla-HT7 using PBI-3939,
Luciferin (BRIGHT-GLO™ Assay Reagent), and native coelenterazine, respectively, as
a substrate.
FIG. 49 shows the luminescence generated from lysed HEK293 cells expressing 30 or
100 ng of plasmid DNA encoding either 9B8 opt or 9B8 opt+K33N ("K33N") using the novel
coelenterazine PBI-3939 as a substrate.
FIGS. 50A-E show the luminescence of the OgLuc variant L27V compared to firefly luciferase
(Luc2) in HEK 293 (FIG. 50A) and HeLa cells (non-fusion) (FIG. 50B), the luminescence
of Halo Tag® fusion compared to the OgLuc variant L27V (FIG. 50C) and firefly luciferase
(Luc2) (FIG. 50D), and the protein expression of HaloTag®-OgLuc L27V compared to HaloTag®-Firefly
luciferase (Luc2) in HEK 293 ("HEK") and HeLa cells ("HeLa").
FIG. 51 shows inhibition analysis of the OgLuc variants 9B8 and L27V against a LOPAC
library to determine their susceptibility to off-target interactions.
FIGS. 52A-E show the inhibition analysis of the OgLuc variants 9B8 and L27V by Suramin
and Tyr ag 835 (FIGS. 52A-C) and the chemical structures of Suramin (FIG. 52D) and
Tyr ag 835 (FIG. 52E).
FIG. 53 shows the activity of the OgLuc variants 9B8 and L27V was analyzed in the
presence of BSA to determine resistance to non-specific protein interactions.
FIG. 54 shows the percent activity of the OgLuc variants 9B8 and L27V to determine
reactivity to plastic.
FIG. 55 shows the luminescence generated from lysed HEK293 cells expressing the IV
cAMP transcriptional reporter compared to hRL ("Renilla") using known coelenterazine-h
as a substrate with ("induced") or without ("basal") forskolin treatment and the fold
induction (response) due to forskolin treatment ("fold").
FIG. 56 shows the normalized luminescence generated from lysed HEK293 cells expressing
the 9B8, 9B8 opt, hRL ("Renilla") or firefly luciferase ("Luc2") cAMP transcriptional
reporter using PBI-3939 (for 9B8 and 9B8 opt), native coelenterazine (for hRL) or
luciferin (BRIGHT-GLO™ Assay Reagent; for Luc2) as a substrate with ("+FSK") or without
("-FSK") forskolin treatment and the fold induction (response) due to forskolin treatment
("FOLD").
FIG. 57 shows the luminescence generated from lysed HEK293 cells expressing 9B8 opt
and 9B8 opt+K33N ("K33N") cAMP transcriptional reporters using the novel coelenterazine
PBI-3939 as a substrate with ("Induced") or without ("Basal") forskolin treatment
and the fold induction due to forskolin treatment ("Fold Induction").
FIGS. 58A-C show the luminescence of the OgLuc variants 9B8 and L27V lytic reporter
constructs for multiple pathways in multiple cell types.
FIGS. 59A-C show the luminescence of the OgLuc variant L27V reporter constructs in
various cell lines and with various response elements.
FIGS. 60A-B show the luminescence of the OgLuc variant L27V secretable reporter compared
to Metridia longa luciferase with a CMV promoter (FIG. 60A) or a NFkB response element
(FIG. 60B).
FIGS. 61A-F show the absolute luminescence (FIGS. 61A and 61B), the normalized luminescence
(FIGS. 61C and 61D) and the fold response (FIGS. 61E and 61F) of optimized versions
of L27V (L27V01, L27V02 and L27V03) compared to L27V (L27V00) expressed in HeLa cells.
FIGS. 62A-B show the luminescence of secreted OgLuc variant L27V02 (containing the
IL-6 secretion signal) reporter (FIG. 62A) and L27V02 ("L27V(02)"), L27V02P ("L27V(02)P(01)")
and luc2 ("Flue") reporters (FIG. 62A) expressed in HepG2 cells treated with various
doses of rhTNFα ("TNFα").
FIG. 63 shows the luminescence generated from media and lysate samples of HEK293 cells
expressing the codon optimized variant IV opt with or without the secretion signal
sequence using the novel PBI-3939 as a substrate compared to hRL ("Renilla") with
or without the secretion signal sequence using native coelenterazine as a substrate.
FIGS. 64A-D show the luminescence of the secreted OgLuc variants 9B8, V2 and L27V
reporters expressed in CHO cells (FIGS. 64A and 64B) and HeLa (FIGS. 64C and 64D).
FIGS. 65A-B show a comparison of the luminescence from the secreted OgLuc variants
9B8 and V2 using PBI-3939 as a substrate to that of the secreted luciferase of Metridia longa using Ready-to-Glow™ as a substrate numerically (FIG. 65A) and graphically (FIG.
65B).
FIGS. 66A-B show the fold-increase in luminescence over background generated from
HEK293 cells expressing hRL ("Ren") and 9B8 opt using the coelenterazine derivatives
ENDUREN™ (FIG. 66A) and VIVIREN™ (FIG. 66B) and the novel coelenterazine PBI-3939
(FIG. 66B) as substrates.
FIGS. 67A-D show confocal images of U2OS cells transiently expressing L27V-HaloTag®
fusion (FIG. 67A) or IL6-L27V fusion (FIGS. 67B-D). Scale bars = 20µm.
FIG. 68 shows the luminescence generated from lysed bacterial cells expressing various
OgLuc variants and hRL ("Renilla") in the presence ("Sand") or absence of sandwich
background ("pF4Ag") using native coelenterazine as a substrate.
FIG. 69 shows the fold-decrease in activity of various OgLuc variants and hRL ("Renilla")
due to the presence of the sandwich background using native coelenterazine as a substrate.
FIG. 70 shows the fold-decrease in activity of 9B8 opt and 9B8 opt+K33N in bacterial
lysates due to the presence of the sandwich background using the novel coelenterazine
PBI-3939 as a substrate.
FIG. 71 shows the spectral profile of the OgLuc variant L27V.
FIG. 72 shows the luminescence of two circulated permuted (CP) versions of the OgLuc
variant L27V, CP84 and CP95, either with no linker or with a 5, 10, or 20 amino acid
linker.
FIGS. 73A-G show the luminescence of the various CP-TEV protease L27V constructs expressed
in wheat germ extract (FIGS. 73A-D), E. coli (FIG. 73F-G) and HEK 293 cells (FIG. 73H). FIGS. 73A-D show the basal luminescence
of the various CP-TEV protease L27V constructs prior to TEV addition. FIG. 73E shows
the response of the CP-TEV protease L27V constructs of FIGS. 73A-D.
FIG. 74 shows the fold response of various protein complementation L27V pairs.
FIGS. 75A-C show the luminescence of various protein complementation (PCA) L27V pairs:
one L27V fragment of each pair was fused to either FKBP or FRB using a 1/4 configuration
(FIG. 75A) or a 2/3 configuration (FIG. 75B), and the interaction of FKBP and FRB
monitored in HEK 293 cells. The luminescence of various protein complementation (PCA)
negative controls was also monitored (FIG. 75C).
FIGS. 76A-H show the luminescence of various protein complementation (PCA) L27V pairs:
one L27V fragment of each pair was fused to either FKBP or FRB using a 2/3 configuration
(FIGS. 76A and 76C) or a 1/4 configuration (FIGS. 76B and 76D), and the interaction
of FKBP and FRB monitored in wheat germ extract (FIGS. 76A and 76B) and rabbit reticulocyte
lysate (RRL) (FIGS. 76C and 76D). The luminescence of various protein complementation
(PCA) negative controls was also measured (FIG. 76E) in cell free system. The 1/4
configuration was used in a cell free system (FIG. 76F), HEK293 cells (FIG. 76G) and
in a lytic system (FIG. 76H).
FIGS. 77A-C show the luminescence of various protein complementation L27V pairs treated
with FK506 and rapamycin (FIG. 77A) and the chemical structure of FK506 (FIG. 77A)
and rapamycin (FIG. 77B).
FIG. 78 shows the activity of the OgLuc variant 9B8 cAMP biosensor with forskolin
treatment.
FIGS. 79A-D show the luminescence of circularly permuted (FIGS. 79A and 79C) and straight
split (FIG. 79B and 79D) L27V variants in rabbit reticulocyte lysate (FIGS. 79A-B)
and HEK293 cells (FIGS. 79C-D).
FIGS. 80A-B show the subcellular distribution of the OgLuc variant L27V (FIG. 80A)
and control vector pGEM3ZF (FIG. 80B) in U2OS cells for various exposure times.
FIGS. 81A-C show the subcellular location of the OgLuc variant L27V fused to either
the transcription factor Nrf2 (FIG. 81B) or GPCR (FIG. 81C) compared to an unfused
L27V control (FIG. 81A).
FIGS. 82A-C show the use of the OgLuc variant 9B8 opt to monitor intracellular signaling
pathways using PBI-4377 (FIG. 82A). The 9B8 opt luciferase was fused to either IkB
(FIG. 82B) or ODD (oxygen-dependent degradation domain of Hif-1α) (FIG. 82C), and
fold response to a stimulus (TNFα for IkB and phenanthroline for ODD) was monitored
via luminescence.
FIGS. 83A-C show the monitoring of oxidative stress signal pathways using the OgLuc
variant (FIG. 83A), L27V02 (FIG. 83B), or Renilla luciferase (Rluc) (FIG. 83C).
FIGS. 84A-B show the comparison of the Nrf2-L27V02 sensor (FIG. 84A) and Nrf2(ARE)-Luc2P
reporter (FIG. 84B).
FIGS. 85A-B show the emission spectra of IV-HT7 with and without ligand, using 1 µM
TMR (FIG. 85A) or 10 µM Rhodamine 110 (FIG. 85B) as a ligand for HT7 and coelenterazine-h
as a substrate for IV.
FIG. 86 shows the luminescence generated from lysed bacterial cells expressing 9B8
opt mixed with ("+ caspase") or without ("no caspase") caspase-3 using a pro-coelenterazine
substrate.
FIGS. 87A-C show the luminescence generated from circularly permuted, straight split
L27V variants CP84 and CP103 using PBI-3939 as a substrate with (FIG. 87B) or without
(not shown) rapamycin treatment and the response (FIG. 87C) due to rapamycin treatment.
The concept of the circularly permuted straight split variants is shown in FIG. 87A.
FIG. 88 shows percent remaining activity of the L27V variant after exposure to various
amounts of urea.
FIG. 89 shows the effect of 3M urea on the activity of the L27V variant.
FIGS. 90A-B show the bioluminescence imaging of hormone-induced nuclear receptor (NR)
translocation of OgLuc fusions using PBI-3939 substrate.
FIGS. 91A-B show the bioluminescence imaging of phorbol ester-induced Protein Kinase
C alpha (PKC alpha) translocation of OgLuc fusions using PBI-3939 substrate.
FIGS. 92A-B show the bioluminescence imaging of autophagosomal protein translocation
of OgLuc fusions using PBI-3939 substrate.
DETAILED DESCRIPTION
[0030] Before any embodiments of the invention are explained in detail, it is to be understood
that the invention is not limited in its application to the details of structure,
synthesis, and arrangement of components set forth in the following description or
illustrated in the following drawings. The invention is described with respect to
specific embodiments and techniques, however, the invention is capable of other embodiments
and of being practiced or of being carried out in various ways.
[0031] In the following description of the methods of the invention, process steps are carried
out at room temperature (about 22°C) and atmospheric pressure unless otherwise specified.
It also is specifically understood that any numerical range recited herein includes
all values from the lower value to the upper value. For example, if a concentration
range or beneficial effect range is stated as 1% to 50%, it is intended that values
such as 2% to 40%, 10% to 30%, or 1% to 3%, etc. are expressly enumerated in this
specification. Similarly, if a sequence identity range is given as between, e.g.,
60% to <100%, it is intended that intermediate values such as 65%, 75%, 85%, 90%,
95%, etc. are expressly enumerated in this specification. These are only examples
of what is specifically intended, and all possible numerical values from the lowest
value to the highest value are considered expressly stated in the application.
[0032] Unless expressly specified otherwise, the term "comprising" is used in the context
of the present application to indicate that further members may optionally be present
in addition to the members of the list introduced by "comprising". It is, however,
contemplated as a specific embodiment of the present invention that the term "comprising"
encompasses the possibility of no further members being present, i.e., for the purpose
of this embodiment "comprising" is to be understood as having the meaning of "consisting
of".
[0033] The following detailed description discloses specific and/or preferred variants of
the individual features of the invention. The present invention also contemplates,
as particularly preferred embodiments, those embodiments which are generated by combining
two or more of the specific and/or preferred variants described for two or more of
the features of the present invention.
[0034] Unless expressly specified otherwise, all indications of relative amounts in the
present application are made on a weight/weight basis. Indications of relative amounts
of a component characterized by a generic term are meant to refer to the total amount
of all specific variants or members covered by said generic term. If a certain component
defined by a generic term is specified to be present in a certain relative amount,
and if this component is further characterized to be a specific variant or member
covered by the generic term, it is meant that no other variants or members covered
by the generic term are additionally present such that the total relative amount of
components covered by the generic term exceeds the specified relative amount. More
preferably, no other variants or members covered by the generic term are present at
all.
Overview
[0035] In various aspects, the invention is drawn to novel compounds, novel luciferases,
and combinations thereof. The invention encompasses methods, compositions, and kits
including the novel compounds, novel luciferases, and/or combinations thereof.
[0036] The novel compounds are novel coelenterazines, which can be used as substrates by
proteins that utilize coelenterazines to produce luminescence, including, but not
limited to, luciferases and photoproteins found in various marine organisms such as
cnidarians (e.g.,
Renilla luciferase), jellyfish (e.g., aequorin from the
Aequorea jellyfish) and decapods luciferases (e.g., luciferase complex of
Oplophorus gracilirostris). In various embodiments, the novel coelenterazines of the present invention have
at least one of enhanced physical stability (e.g., enhanced coelenterazine stability),
reduced autoluminescence, and increased biocompatibility with cells (e.g., less toxic
to cells, including heterologous cell types) relative to native coelenterazine.
[0037] The novel luciferases disclosed herein include variants of the active subunit of
a decapod luciferase. The novel luciferases can utilize various coelenterazines as
substrates, including, but not limited to, native and known coelenterazines as well
as the novel coelenterazines of the present invention. The novel luciferases display
at least one of: enhanced luminescence (including increased brightness, enhanced signal
stability and/or signal duration); enhanced enzyme stability (i.e., enhanced enzymatic
activity including enhanced resistance to elevated temperature, changes in pH, inhibitors,
denaturants, and/or detergents); altered substrate specificity (i.e., change in relative
substrate specificity); and enhanced biocompatibility (including at least one of improved
expression in cells, reduced toxicity, and/or cell stress). In various embodiments,
the present invention encompasses novel luciferases that are present in solution as
soluble, active monomers, chemically linked to other molecules (e.g., fusion proteins),
or attached onto a solid surface (e.g., particles, capillaries, or assay tubes or
plates).
[0038] Certain combinations of the novel coelenterazines and the novel luciferases provide
significant technical advantages for bioluminescent assays including enhanced luminescence,
wherein enhanced luminescence may be due to one or more factors including enhanced
signal stability and enhanced coelenterazine stability. Additionally, many of the
novel coelenterazines were designed to be smaller than commercially-available and/or
known coelenterazines. In some cases, the novel luciferases of the present invention
preferentially utilize the novel, smaller coelenterazines over the commercially-available
and/or known larger coelenterazines.
[0039] The invention encompasses combinations of: the novel luciferase variants with the
novel coelenterazines; the novel luciferase variants with known or native coelenterazines;
and the novel coelenterazines with any known or native protein (e.g., luciferases
or photoproteins) that uses coelenterazine as a substrate.
[0040] The term "coelenterazine" refers to naturally-occurring ("native") coelenterazine
as well as analogs thereof, including coelenterazine-n, coelenterazine-f, coelenterazine-h,
coelenterazine-hcp, coelenterazine-cp, coelenterazine-c, coelenterazine-e, coelenterazine-fcp,
bisdeoxycoelenterazine ("coelenterazine-hh"), coelenterazine-i, coelenterazine-icp,
coelenterazine-v, and 2-methyl coelenterazine, in addition to those disclosed in
WO 2003/040100 and
U.S. Application Serial No. 12/056,073 (paragraph [0086]), the disclosures of which are incorporated by reference herein.
The term "coelenterazine" also refers to the novel coelenterazines disclosed herein
(see below). The term "known coelenterazine" refers to a coelenterazine analog known
prior to the present invention.
[0041] The term "OgLuc" refers to a decapod luciferase protein, or a variant of such a protein,
which generates light in the presence of a coelenterazine. The OgLuc protein may,
in its naturally-occurring form, be a monomer or may be a subunit of a protein complex.
The OgLuc used in the exemplary embodiments disclosed herein is the 19 kDa subunit
from the luciferase complex of
Oplophorus gracilirostris, although comparable polypeptides from other decapod species (including other
Oplophorus species) could also be employed and are encompassed within the invention (see
R.D. Dennell, Observations on the luminescence of bathypelagic Crustacea decapoda
of the Bermuda area, Zool. J. Linn, Soc., Lond. 42 (1955), pp. 393-406; see also
Poupin et al, Sept 1999. Inventaire documenté des espècies et bilan des formes les
plus communes de la mer d'Iroise. Rapport Scientifique du Laboratoire d'Oceanographte
de l'Ecole Navale (LOEN), Brest (83pgs), each of which is incorporated by reference herein); examples include, without limitation,
luciferases of the Aristeidae family, including
Plesiopenaeus coruscans; the Pandalidea family, including
Heterocarpus and
Parapandalus richardi, the Solenoceridae family, including
Hymenopenaeus debilis and
Mesopenaeus tropicalis; the Luciferidae family, including
Lucifer typus; the Sergestidae family, including
Sergestes atlanticus, Sergestes arcticus, Sergestes armatus, Sergestes pediformis,
Sergestes cornutus, Sergestes edwardsi, Sergestes henseni, Sergestes pectinatus, Sergestes
sargassi, Sergestes similis, Sergestes vigilax, Sergia challengeri, Sergio grandis,
Sergia lucens, Sergia prehensilis, Sergia potens, Sergia robusta, Sergia scintillans, and
Sergia spiendens; the Pasiphaeidae family, including
Glyphus marsupialis, Leptochela bermudensis, Parapasiphae sulcatifrons, and
Pasiphea tarda; the Oplophoridae family, including
Acanthephyra acanthitelsonis, Acanthephyra acutifrons, Acanthephyra brevirostris,
Acanthephyra cucullata, Acanthephyra curtirostris, Acanthephyra eximia, Acanthephyra
gracilipes, Acanthephyra kingsleyi, Acanthephyra media, Acanthephyra microphthalma,
Acanthephyra pelagica, Acanthephyra prionota, Acanthephyra purpurea, Acanthephyra
sanguinea, Acanthephyra sibogae, Acanthephyra stylorostratis, Ephyrina bifida, Ephyrina
jigueirai, Ephyrina koskynii, Ephyrina ombango, Hymenodora glacialis, Hymenodora gracilis,
Meningodora miccyla, Meningodora mollis, Meningodora vesca, Notostomus gibbosus, Notostomus
auriculatus, Oplophorus gracilirostris, Oplophorus grimaldii, Oplophorus novaezealandiae,
Oplophorus spinicauda, Oplophorus foliaceus, Oplophorus spinosus, Oplophorus typus,
Systellaspis braueri, Systeliaspis cristata, Systellaspis debilis, and
Systellaspis pellucida; and the Thalassocaridae family, including
Chlorotocoides spinicauda, Thalassocaris crinita, and
Thalassocaris lucida.
[0042] The polypeptide sequence of the mature (i.e., with no signal sequence) 19 kDa subunit
of the naturally-occurring form of the
Oplophorus gracilirostris luciferase (i.e., 169 amino acids, residues 28 to 196 of BAB 13776) is given in SEQ
ID NO: 1. In various embodiments, a methionine residue and a valine residue are inserted
at the beginning of the synthetic OgLuc sequence (e.g., as indicated in the C1+A4E
polypeptide sequence, SEQ ID NO: 3) to facilitate cloning and expression in heterologous
systems. Nevertheless, for consistency, the position numbers of the various amino
acid substitutions referred to herein are specified "relative to" SEQ ID NO: 1, i.e.,
the polypeptide sequence of the mature (with no signal sequence), native 19 kDa subunit
of the
Oplophorus gracilirostris luciferase protein complex.
[0043] Specifically, a protein is a decapod luciferase if, upon alignment of its amino acid
sequence with SEQ ID NO: 1, the sequence identity is > 30%, preferably > 40%, and
most preferably > 50%, and the protein can utilize coelenterazine as a substrate to
catalyze the emission of luminescence, and the amino acid sequence beginning at the
position corresponding to position 8 of SEQ ID NO: 1 is:
[GSAIVK]-{FE}-[FYW]-x-[LIVMFSYQ]-x-x-{K}-x-[NHGK]-x-[DE]-x-[LIVMFY]-[LIVMWF]-x-{G}-[LIVMAKRG]
(SEQ ID NO. 330) (VII),
with no more than 5 differences, or more preferably no more than 4, 3, 2, or 1 difference,
or most preferably no differences, wherein the differences occur in positions corresponding
to pattern position 1, 2, 3, 5, 8, 10, 12, 14, 15, 17, or 18 of Formula (VII) according
to Table 4. Differences may also include gaps or insertions between the pattern positions
of Table 4.
[0044] The term "variant" refers to a modified version of a starting polypeptide or polynucleotide
sequence. The term "parental" is a relative term that refers to a starting sequence
which is then modified. The parental sequence is generally used as a reference for
the protein encoded by the resulting modified sequence, e.g., to compare the activity
levels or other properties of the proteins encoded by the parental and the modified
sequences. The starting sequence can be a naturally-occurring (i.e., native or wild-type)
sequence. The starting sequence can also be a variant sequence which is then further
modified. A polypeptide sequence is "modified" when one or more amino acids (which
may be naturally-occurring or synthetic) are substituted, deleted, and/or added at
the beginning, middle, and/or end of the sequence. A polynucleotide sequence is "modified"
when one or more nucleotides are substituted, deleted, and/or added at the beginning,
middle, and/or end of the sequence, but which may or may not alter the amino acid
encoded by the sequence. In some embodiments, the modifications produce a variant
that is a functional fragment of a particular OgLuc or OgLuc variant. A functional
fragment is a fragment which is less than a full-length parental sequence which has
the same functional activity as the full-length parental sequence. Functional activity
is the ability to exhibit luminescence. In some embodiments, the modifications produce
a variant that is a permuted sequence of the parental sequence, such as a circularly
permuted sequence and permuted sequences comprising deletions and/or insertions.
[0045] Several of the OgLuc variants disclosed herein have been assigned shorthand names
to facilitate discussion. The term "C1+A4E" (also referred to as "C1A4E") refers to
a particular OgLuc variant with the amino acid substitutions A4E, Q11R, A33K, V44I,
A54F, P115E, Q124K, Y138I, and N166R relative to SEQ ID NO: 1 (SEQ ID NOs: 2 and 3)
(where the format "
x#
y" indicates a parent amino acid '
x' at a position '#' that is changed to variant amino acid '
y'). Variants of the C1+A4E OgLuc variant which are presented herein contain at least
the amino acid substitutions found in C1+A4E, unless otherwise indicated. The term
"IVY" refers to a variant of the C1+A4E OgLuc variant having additional amino acid
substitutions F54I, 190V, and F77Y relative to SEQ ID NO: 1 (SEQ ID NOs: 8 and 9).
The term "IV" refers to another variant of the C1+A4E OgLuc variant having additional
amino acid substitutions F54I and I90V relative to SEQ ID NO: 1 (SEQ ID NOs: 14 and
15). The term "QC27" refers to yet another variant of the C1+A4E OgLuc variant having
additional amino acid substitutions Q18L, F54I, L92H, and Y109F relative to SEQ ID
NO: 1 (SEQ ID NOs: 4 and 5). The term "QC27-9a" refers to a variant of the QC27 OgLuc
variant with additional amino acid substitutions V21L, F68Y, L72Q, M75K, H92R, and
V158F relative to SEQ ID NO: 1 (SEQ ID NOs: 6 and 7). The term "9B8" refers to a variant
of the IV OgLuc variant with additional amino acid substitutions Q18L, F68Y, L72Q,
and M75K relative to SEQ ID NO: 1 (SEQ ID NOs: 18 and 19). The term "9B8 opt" refers
to the codon optimized version of the 9B8 variant (SEQ ID NO: 24). The term "9B8 opt+K33N"
refers to a variant of the 9B8 opt variant with additional amino acid substitution
K33N relative to SEQ ID NO: 1 (SEQ ID NOs: 42 and 43). The term "9B8 opt+K33N+170G"
refers to a variant of the "9B8 opt+K33N" variant with an additional glycine appended
to the C-terminus of the variant, i.e., 170G relative to SEQ ID NO: 1 (SEQ ID NO:
68 and 69). The terms "L27V+T39T+K43R+Y68D" and "L27V" refers to a variant of the
9B8 opt+K33N" variant with additional amino acid substitutions L27V, T39T, K43R, and
Y68D relative to SEQ ID NO: 1 (SEQ ID NOs: 88 and 89). The terms "T39T+K43R+Y68D"
and "V2" refers to a variant of the "9B8 opt+K33N" variant with additional amino acid
substitutions T39T, K43R, and Y68D relative to SEQ ID NO: 1 (SEQ ID NOs: 92 and 93).
[0046] In general, "enhanced" means that the particular property (e.g., luminescence, signal
stability, biocompatibility, protein stability (e.g., enzyme stability), or protein
expression) is increased relative to that of the reference luciferase plus coelenterazine
combination or luciferase under consideration, where the increase is at least 1%,
at least 5%, at least 10%, at least 20%, at least 25%, at least 50%, at least 75%,
at least 90%, at least 100%, at least 200%, at least 500%, or at least 1000% greater
than the reference luciferase plus coelenterazine combination or luciferase under
consideration.
[0047] The term "luminescence" refers to the light output of the OgLuc variant under appropriate
conditions, e.g., in the presence of a suitable substrate such as a coelenterazine.
The light output may be measured as an instantaneous or near-instantaneous measure
of light output (which is sometimes referred to as "T=0" luminescence or "flash")
at the start of the luminescence reaction, which may be initiated upon addition of
the coelenterazine substrate. The luminescence reaction in various embodiments is
carried out in a solution. In other embodiments, the luminescence reaction is carried
out on a solid support. The solution may contain a lysate, for example from the cells
in a prokaryotic or eukaryotic expression system. In other embodiments, expression
occurs in a cell-free system, or the luciferase protein is secreted into an extracellular
medium, such that, in the latter case, it is not necessary to produce a lysate. In
some embodiments, the reaction is started by injecting appropriate materials, e.g.,
coelenterazine, buffer, etc., into a reaction chamber (e.g., a well of a multiwell
plate such as a 96-well plate) containing the luminescent protein. In still other
embodiments, the OgLuc variant and/or novel coelenterazine are introduced into a host
and measurements of luminescence are made on the host or a portion thereof, which
can include a whole organism or cells, tissues, explants, or extracts thereof. The
reaction chamber may be situated in a reading device which can measure the light output,
e.g., using a luminometer or photomultiplier. The light output or luminescence may
also be measured over time, for example in the same reaction chamber for a period
of seconds, minutes, hours, etc. The light output or luminescence may be reported
as the average over time, the half-life of decay of signal, the sum of the signal
over a period of time, or the peak output. Luminescence may be measured in Relative
Light Units (RLUs).
[0048] The "enhanced luminescence" of an OgLuc variant may be due to one or more of the
following characteristics: enhanced light output (i.e., brightness), enhanced substrate
specificity, enhanced signal stability, and/or enhanced signal duration. Enhanced
signal stability includes an increase in how long the signal from a luciferase continues
to luminesce, for example, as measured by the half-life of decay of the signal in
a time-course. Enhanced luminescence may be determined relative to the comparable
property of a luciferase such as wild-type OgLuc, an OgLuc variant protein,
Renilla luciferase (e.g., hRluc), or firefly luciferase (e.g., Luc2 luciferase from
Photinus pyralis) combined with a native, known, or novel substrate, as shown in the Examples below.
For example, the luminescence of a given OgLuc variant in combination with a particular
coelenterazine (including native, known, or novel coelenterazines) may be compared
to the properties of one of OgLuc variants C1+A4E, IV, or IVY combined with any of
a native, known, or novel coelenterazine disclosed herein, using one or more of the
assays disclosed in the Examples below. In particular, enhanced luminescence may be
determined by measuring the luminescence signal (RLU) resulting from the incubation
of bacterial lysates containing OgLuc variants in question with the substrate, PBI-3939.
Measurements are taken in a reagent which may contain TERGITOL™ to provide Glo-like
kinetics, e.g., in which enzyme inactivation is slowed and the luminescence signal
is stabilized, which is described elsewhere in the application. In some embodiments,
some luciferase variants, e.g., L27V, with certain compounds, e.g., PBI-3939, provide
extended duration of the luminescent emission, or glow-like kinetics, in the absence
of TERGITOL™. The luminescence signal may be compared to that of a reference point
such as the C1+A4E variant with coelenterazine or coelenterazine-h or
Renilla luciferase with native coelenterazine.
[0049] "Enzyme stability" refers to the stability of enzyme activity (i.e., tolerance of
enzymatic activity to reaction conditions). Enhanced enzyme stability refers to enhanced
stability of enzyme activity (i.e., enhanced tolerance to reaction conditions). Enhanced
enzyme stability includes enhanced thermal stability (e.g., stability at elevated
temperatures) and chemical stability (e.g., stability in the presence of inhibitors
or denaturants such as detergents, including, e.g., TRITON™ X-100). Enzyme stability
can be used as a measure of protein stability, particularly under conditions known
to be disruptive of protein structure, such as high temperatures or the presence of
chemical denaturants. In particular, enhanced protein stability may be determined
using thermal analysis as described elsewhere in the application (e.g., in Example
28). The luminescence signal may be compared to the reference point of C1+A4E variant
with coelenterazine or coelenterazine-h or
Renilla luciferase with native coelenterazine.
[0050] "Biocompatibility" refers to the tolerance of a cell (e.g., prokaryotic or eukaryotic)
to a luciferase and/or coelenterazine compound. Biocompatibility of a luciferase and/or
coelenterazine compound is related to the stress it causes on the host cell. For example,
a luciferase that is not tolerated by the cell (i.e., one that stresses a cell) may
not be expressed efficiently within the cell, for example, the luciferase may be expressed
within the cell, but exhibit reduced activity due to the formation of inclusion bodies
by the expressed protein. Biocompatibility of a luciferase is related to the ability
of the cells to tolerate the insertion of the foreign gene, i.e., a transgene containing
the gene encoding the luciferase or fragment thereof, whereby the cells with the transgene
do not exhibit manifestations of stress, including induction of stress response pathways,
reduced rate of growth, and/or reduced viability (e.g., reduced number of living cells,
reduced membrane integrity, or increased rates of apoptosis). Other indications of
cell stress may include changes in gene expression, signaling pathways, and/or regulatory
pathways. Enhanced biocompatibility of an OgLuc variant may be due to factors such
as enhanced protein expression and/or reduced cell stress. Enhanced expression of
luminescence for a particular polynucleotide encoding an OgLuc variant may be determined
relative to luminescence expression levels for a polynucleotide encoding wild-type
OgLuc or an OgLuc variant protein, including codon-optimized polynucleotides, where
luminescence activity can be used as a means to monitor protein expression levels.
[0051] In particular, enhanced biocompatibility of the OgLuc variant, novel coelenterazine
compound and/or a combination thereof, may be determined by measuring cell viability
and/or growth rate of cells. For example, enhanced biocompatibility of the OgLuc variants
may be determined by measuring cell viability and/or growth rate of cells containing
the OgLuc variants compared to cells containing firefly or
Renilla luciferase or no luciferase, in the absence of any coelenterazine compound to determine
how compatible and/or toxic the luciferase is to the cells. Enhanced biocompatibility
of the novel coelenterazine compounds may be determined by measuring cell viability
in the absence of luciferase expression of cells exposed to the novel coelenterazine
compound compared to native or known coelenterazines to determine how compatible and/or
toxic the coelenterazine compound is to the cells. Enhanced biocompatibility of a
combination of an OgLuc variant with a novel coelenterazine compound may be determined
by measuring cell viability and/or growth rate of cells containing the OgLuc variant
and exposed to the novel coelenterazine and compared to cells containing firefly or
Renilla luciferase or no luciferase and exposed to native or known coelenterazines.
[0052] In particular, enhanced biocompatibility may be determined using cell viability analysis
as described elsewhere in the application (e.g., using a CELLTITER-GLO® assay as described
in Example 18 or an apoptosis assay such as one using CASPASE-GLO® technology according
to the manufacturer's instructions) or one known in the art. The effect of an OgLuc
variant on cell viability or apoptosis may be compared to the effect of a reference
luciferase, such as the C1+A4E variant, a firefly luciferase or
Renilla luciferase. The effect of the novel coelenterazine compound on cell viability or
apoptosis may be compared to the effect of native or known coelenterazine compounds
on cell viability or apoptosis.
[0053] Enhanced biocompatibility may also be determined by measuring the effect of the OgLuc
variant and/or novel coelenterazine compound on cell growth or gene expression. For
examples, enhanced biocompatibility of the OgLuc variant may be determined by measuring
the cell number after a period of time or by determining the expression of stress
response genes in a sample of cells that contain the OgLuc variant compared to cells
that contain another luciferase or no luciferase. Enhanced biocompatibility of the
novel coelenterazine compound may be determined by measuring the cell number after
a period of time or by determining the expression of stress response genes in a sample
of cells that are exposed to the novel coelenterazine compound compared to cells exposed
to native or known coelenterazines or no coelenterazines. The effect of the OgLuc
variant on cell growth or gene expression may be compared to a reference luciferase,
such as C1+A4E variant, a firefly luciferase or
Renilla luciferase. The effect of the novel coelenterazine on cell growth or gene expression
may be compared to native or known coelenterazines.
[0054] The identification of robust, stable cell lines expressing an OgLuc variant of the
present invention, either in the cytoplasm or as a secreted form, can be facilitated
by the bright signal of the luciferase and the small size of the OgLuc gene. The relatively
small gene sequence is expected to reduce the likelihood of genetic instability resulting
from the integration of the foreign DNA into a cell's genome. As a result of the increased
brightness of the OgLuc variants and/or the novel coelenterazines of the present invention,
less protein expression, and thereby less DNA needed for transfection, may produce
a given level of brightness compared to other known luciferases such as native OgLuc,
firefly, or
Renilla luciferase, which contributes to an enhanced biocompatibility for the OgLuc variants
and/or novel coelenterazines. Enhanced biocompatibility of the OgLuc variants may
be measured by the amount of DNA or reagents, e.g., transfection chemicals, needed
in transient transfections to generate cells with the same level of luminescence as
cells transfected with other luciferases, e.g., native OgLuc, firefly or
Renilla luciferase. In some embodiments, the amount of OgLuc variant DNA or reagents needed
for transfection is less than the amount needed for another luciferase, e.g., native
OgLuc, firefly, or
Renilla luciferase, to generate transfected cells with the same level of luminescence obtained
with the other luciferase. Enhanced biocompatibility of the OgLuc variants may be
measured by the recovery time of the cells after transfection. In some embodiments,
the amount of time needed for recovery after transfection with the OgLuc variant is
less than the time needed for another luciferase, e.g., native OgLuc, firefly or
Renilla luciferase.
[0055] "Relative substrate specificity" is determined by dividing the luminescence of a
luciferase in the presence of a test coelenterazine substrate by the luminescence
of the luciferase in the presence of a reference coelenterazine substrate. For example,
relative specificity may be determined by dividing the luminescence of a luciferase
with a novel coelenterazine of the present invention by the luminescence of the luciferase
with a different coelenterazine (e.g., native or known coelenterazine, see FIG. 1
for examples, or a different novel coelenterazine of the present invention). The test
coelenterazine substrate and the reference coelenterazine substrate that are compared
are considered a comparison substrate pair for determining relative substrate specificity.
[0056] A "change in relative substrate specificity" is determined by dividing the relative
substrate specificity of a test luciferase using a comparison substrate pair by the
relative substrate specificity of a reference luciferase using the same comparison
substrate pair. For example, a change in relative specificity may be determined by
dividing the relative substrate specificity of a test luciferase with a novel coelenterazine
of the present invention compared to a different coelenterazine (e.g., native or known
coelenterazine or a different novel coelenterazine of the present invention), by the
relative substrate specificity of a reference luciferase with the same novel coelenterazine
of the present invention compared to the same different coelenterazine used for the
test luciferase.
[0057] In some embodiments, the luminescence with one novel coelenterazine is compared to
the luminescence with a different novel coelenterazine. In some embodiments, the luminescence
with one native or known coelenterazine is compared to the luminescence with another
native or known coelenterazine. In still other embodiments, the luminescence with
one native or known coelenterazine is compared to the luminescence with a novel coelenterazine.
[0058] The novel coelenterazines of the present invention include properties such as enhanced
physical stability (e.g., enhanced coelenterazine stability) or reduced autoluminescence.
The physical stability of the coelenterazine refers to how stable the coelenterazine
is in certain conditions such that it maintains the ability to luminesce when used
as a substrate by a luciferase. Luminescence that is not dependent on the activity
of a luciferase or photoprotein is termed autoluminescence, Autoluminescence is the
luminescence of a substance produced by energy released in the form of light during
decay or decomposition. For example, autoluminescence can be caused by spontaneous
oxidation of the luminogenic substrate coelenterazine.
[0059] As used herein, "pure" or "purified" means an object species is the predominant species
present (i.e., on a molar and/or mass basis, it is more abundant than any other individual
species, apart from water, solvents, buffers, or other common components of an aequeous
system in the composition), and, in some embodiments, a purified fraction is a composition
wherein the object species comprises at least about 50% (on a molar basis) of all
macromolecular species present. Generally, a "substantially pure" composition will
comprise more than about 80% of all macromolecular species present in the composition,
in some embodiments more than about 85%, more than about 90%, more than about 95%,
or more than about 99%. In some embodiments, the object species is purified to essential
homogeneity (contaminant species cannot be detected in the composition by conventional
detection methods) wherein the composition consists essentially of a single macromolecular
species.
Coelenterazine Derivatives
[0060] In some embodiments, the present invention provides novel coelenterazine derivatives
of formula (Ia) or (Ib):
wherein R2 is selected from the group consisting of

or C2-5 straight chain alkyl;
R6 is selected from the group consisting of -H, -OH, -NH2, -OC(O)R or -OCH2OC(O)R;
R8 is selected from the group consisting of

H or lower cycloalkyl;
wherein R3 and R4 are both H or both C1-2 alkyl;
W is -NH2, halo, -OH, -NHC(O)R, -CO2R;
X is -S-, -O- or -NR22-;
Y is-H, -OH, or -OR11;
Z is -CH- or -N-;
each R11 is independently -C(O)R" or -CH2OC(O)R";
R22 is H, CH3, or CH2CH3
each R is independently C1-7 straight-chain alkyl or C1-7 branched alkyl;
R" is C1-7 straight-chain alkyl or C1-7 branched alkyl;
the dashed bonds indicate the presence of an optional ring, which may be saturated
or unsaturated;
with the proviso that when R2 is

or

R8 is not

with the proviso that when R2 is

R8 is

or lower cycloalkyl; and
with the proviso that when R6 is NH2, R2 is

or C2-5 alkyl;
or R8 is not

[0061] The term "alkyl", as used herein, pertains to a monovalent moiety obtained by removing
a hydrogen atom from a hydrocarbon compound, and which may be saturated, partially
unsaturated, or fully unsaturated. The alkyl group may be a straight-chain or branched.
An alkyl group may be optionally substituted with, for example, halo. Examples of
straight-chain alkyl groups include, but are not limited to, ethyl, n-propyl, n-butyl,
and n-propyl, n-hexyl and n-heptyl. Examples of unsaturated alkyl groups which have
one or more carbon-carbon double bonds include, but are not limited to, ethenyl (vinyl,-CH=CH
2), 2-propenyl (allyl, -CH-CH=CH
2), and butenyl. Examples of unsaturated alkyl which have one or more carbon-carbon
triple bonds include, but are not limited to, ethynyl and 2-propynyl (propargyl).
Examples of branched alkyl groups included isopropyl, iso-butyl, sec-butyl, t-butyl
and iso-pentyl.
[0062] The term "lower cycloalkyl", as used herein, pertains to a monovalent moiety obtained
by removing a hydrogen atom from a hydrocarbon compound having from 3 to 5 carbon
atoms. Examples of saturated lower cycloalkyl groups include, but are not limited
to, groups such as cyclopropyl, cyclobutyl and cyclopentyl. Examples of unsaturated
lower cycloalkyl groups which have one or more carbon-carbon double bonds include,
but are not limited to, groups such as cyclopropenyl, cyclobutenyl and cyclopentenyl.
[0063] The term "halo", as used herein, pertains to a halogen, such as Cl, F, Br or I.
[0064] In some embodiments, R
2 is

and X is O or S. In other embodiments, R
2 is C
2-5 straight chain alkyl. In certain embodiments, R
8 is

lower cycloalkyl or H. In other embodiments, R
8 is benzyl. In some embodiments, R" is -C(CH
3)
3, - CH(CH
3)
2, -CH
2C(CH
3)
3, or -CH
2CH(CH
3)
2.
[0065] In some embodiments, the present invention provides compounds according to Formula
(IIa) or (IIb);

or

wherein X is O or S, R
6 is H or OH, R
11 is as defined above, and the dashed bonds indicate the presence of an optional ring.
[0066] In some embodiments, the invention provides compounds according to Formula (IIIa)
or (IIIb):

or

wherein R
12 is C
2-5 straight-chain alkyl, furyl or thienyl, R
6 is H or OH, R
11 is as defined above, and the dashed bonds indicate the presence of an optional ring.
[0067] In some embodiments, the invention provides compounds according to Formula (IVa)
or (IVb):

or

wherein X is O or S, R
6 is H or OH, R
18 is H,

or lower cycloalkyl, R
3, R
4 and R
11 are as defined above, and the dashed bonds indicate the presence of an optional ring.
[0068] In some embodiments, the invention provides a compound according to Formula (Va)
or (Vb):

or

wherein R
8 is benzyl, R
11 is as defined above, and the dashed bonds indicate the presence of an optional ring.
[0069] In some embodiments, the present invention provides novel coelenterazine derivatives
of formula (VIa) or (VIb):

or
wherein R2 is selected from the group consisting of

or C2-5 straight chain alkyl;
R6 is selected from the group consisting of -H, -OH, -NH2, -OC(O)R or -OCH2OC(O)R;
R8 is selected from the group consisting of

H or lower cycloalkyl;
wherein R3 and R4 are both H or both C1-2 alkyl;
W is -NH2, halo, -OH, -NHC(O)R, -CO2R;
X is -S-, -0- or -NH-;
Y is -H, -OH, or -OR11;
Z is -CH- or-N-;
each R11 is independently -C(O)R" or -CH2OC(O)R";
each R is independently C1-7 straight-chain alkyl or C1-7 branched alkyl;
R" is C1-7 straight-chain alkyl or C1-7 branched alkyl;
the dashed bonds indicate the presence of an optional ring, which may be saturated
or unsaturated;
with the proviso that when R2 is

or

R8 is not

with the proviso that when R2 is

R8 is

or lower cycloalkyl; and
with the proviso that when R6 is NH2, R2 is

or C2-5 alkyl;
or R8 is not

Isomers, Salts and Protected Forms
[0071] Certain compounds may exist in one or more particular geometric, optical, enantiomeric,
diasteriomeric, epimeric, stereoisomeric, tautomeric, conformational, or anomeric
forms, including but not limited to, cis- and trans-forms; E- and Z-forms; c-, t-,
and r- forms; endo and exo-forms; R-, S-, and meso-forms; D- and L-forms; d- and l-forms;
(+) and (-) forms; keto-, enol-, and enolate- forms; syn- and anti-forms; synclinal-
and anticlinal-forms; α- and β-forms; axial and equatorial forms; boat-, chair-, twist-,
envelope-, and half-chair forms; and combinations thereof, hereinafter collectively
referred to as "isomers" (or "isomeric forms").
[0072] Note that, except as discussed below for tautomeric forms, specifically excluded
from the term "isomers", as used herein, are structural (or constitutional) isomers
(i.e., isomers which differ in the connections between atoms rather than merely by
the position of atoms in space). For example, a reference to a methoxy group, -OCH
3, is not to be construed as a reference to its structural isomer, a hydroxymethyl
group, -CH
2OH. Similarly, a reference to ortho-chlorophenyl is not to be construed as a reference
to its structural isomer, meta-chlorophenyl. However, a reference to a class of structures
may well include structurally isomeric forms falling within that class (e.g., C
1-7 alkyl includes n-propyl and iso-propyl; butyl includes n-, iso-, sec-, and tert-butyl;
methoxyphenyl includes ortho-, meta-, and paramethoxyphenyl).
[0073] Note that specifically included in the term "isomer" are compounds with one or more
isotopic substitutions. For example, H may be in any isotopic form, including
1H,
2H (D), and
3H (T); C may be in any isotopic form, including
12C,
13C, and
14C; O may be in any isotopic form, including
16O and
18O; and the like.
[0074] Unless otherwise specified, a reference to a particular compound includes all such
isomeric forms, including (wholly or partially) racemic and other mixtures thereof.
Methods for the preparation (e.g., asymmetric synthesis) and separation (e.g., fractional
crystallization and chromatographic means) of such isomeric forms are either known
in the art or are readily obtained by adapting the methods taught herein, or known
methods, in a known manner.
[0075] Unless otherwise specified, a reference to a particular compound also includes ionic,
salt, solvate, and protected forms of thereof, for example, as discussed below. It
may be convenient or desirable to prepare, purify, and/or handle a corresponding salt
of the active compound, for example, a pharmaceutically-acceptable salt. Examples
of pharmaceutically acceptable salts are discussed in
Berge et al., J. Pharm. Sci., 66:1-19 (1977).
[0076] For example, if the compound is anionic, or has a functional group which may be anionic
(e.g., -COOH may be -COO-), then a salt may be formed with a suitable cation. Examples
of suitable inorganic cations include, but are not limited to, alkali metal ions such
as Na
+ and K
+, alkaline earth cations such as Ca
2+ and Mg
2+, and other cations such as Al
3+. Examples of suitable organic cations include, but are not limited to, ammonium ion
(i.e., NH
4+) and substituted ammonium ions (e.g., NH
3R
+, NH
2R
2+, NHR
3+, NR
4+). Examples of some suitable substituted ammonium ions are those derived from: ethylamine,
diethylamine, dicyclohexylamine, triethylamine, butylamine, ethylenediamine, ethanolamine,
diethanolamine, piperazine, benzylamine, phenylbenzylamine, choline, meglumine, and
tromethamine, as well as amino acids, such as lysine and arginine. An example of a
common quaternary ammonium ion is N(CH
3)
4+.
[0077] If the compound is cationic, or has a functional group which may be cationic (e.g.,
- NH
2 may be -NH
3+), then a salt may be formed with a suitable anion. Examples of suitable inorganic
anions include, but are not limited to, those derived from the following inorganic
acids: hydrochloric, hydrobromic, hydroiodic, sulfuric, sulfurous, nitric, nitrous,
phosphoric, and phosphorous. Examples of suitable organic anions include, but are
not limited to, those derived from the following organic acids: acetic, propionic,
succinic, glycolic, stearic, palmitic, lactic, malic, pamoic, tartaric, citric, gluconic,
ascorbic, maleic, hydroxymaleic, phenylacetic, glutamic, aspartic, benzoic, cinnamic,
pyruvic, salicyclic, sulfanilic, 2-acetyoxybenzoic, fumaric, phenylsulfonic, toluenesulfonic,
methanesulfonic, ethanesulfonic, ethane disulfonic, oxalic, pantothenic, isethionic,
valeric, lactobionic, and gluconic. Examples of suitable polymeric anions include,
but are not limited to, those derived from the following polymeric acids: tannic acid,
carboxymethyl cellulose.
[0078] It may be convenient or desirable to prepare, purify, and/or handle a corresponding
solvate of the active compound. The term "solvate" is used herein in the conventional
sense to refer to a complex of solute (e.g., active compound, salt of active compound)
and solvent. If the solvent is water, the solvate may be conveniently referred to
as a hydrate, for example, a monohydrate, a di-hydrate, a tri-hydrate, etc.
[0079] It may be convenient or desirable to prepare, purify, and/or handle the active compound
in a chemically protected form. The term "chemically protected form", as used herein,
pertains to a compound in which one or more reactive functional groups are protected
from undesirable chemical reactions, that is, are in the form of a protected or protecting
group (also known as a masked or masking group or a blocked or blocking group). By
protecting a reactive functional group, reactions involving other unprotected reactive
functional groups can be performed, without affecting the protected group; the protecting
group may be removed, usually in a subsequent step, without substantially affecting
the remainder of the molecule. See, for example,
Protective Groups in Organic Synthesis (T. Green and P. Wuts, Wiley, 1999).
[0080] For example, a hydroxy group may be protected as an ether (-OR) or an ester (-OC(=O)R),
for example, as: a t-butyl ether; a benzyl, benzhydryl (diphenylmethyl), or trityl
(triphenylmethyl) ether; a trimethylsilyl or t-butyldimethylsilyl ether; or an acetyl
ester (-OC(=O)CH
3, -OAc). For example, an aldehyde or ketone group may be protected as an acetal or
ketal, respectively, in which the carbonyl group (>C=O) is converted to a diether
(>C(OR)
2), by reaction with, for example, a primary alcohol. The aldehyde or ketone group
is readily regenerated by hydrolysis using a large excess of water in the presence
of acid. For example, an amine group may be protected, for example, as an amide or
a urethane, for example, as: a methyl amide (-NHCO-CH
3); a benzyloxy amide (-NHCO-OCH
2C
6H
5, -NHCbz); as a t-butoxy amide (-NHCO-OC(CH
3)
3, -NH-Boc); a 2-biphenyl-2-propoxy amide (-NHCO-OC(CH
3)2C
6H
4C
6H
5, - NH-Bpoc), as a 9-fluorenylmethoxy amide (-NH-Fmoc), as a 6-nitroveratryloxy amide
(-NH-Nvoc), as a 2-trimethylsilylethyloxy amide (-NH-Teoc), as a 2,2,2-trichloroethyloxy
amide (-NH-Troc), as an allyloxy amide (-NH-Alloc), as a 2(-phenylsulphonyl)ethyloxy
amide (-NH-Psec); or, in suitable cases, as an N-oxide.
[0081] For example, a carboxylic acid group may be protected as an ester for example, as:
an C
1-7 alkyl ester (e.g., a methyl ester; a t-butyl ester); a C
1-7 haloalkyl ester (e.g., a C
1-7 trihaloalkylester); a triC
1-7 alkylsilyl-C
1-7 alkyl ester; or a C
5-20 aryl-C
1-7 alkyl ester (e.g., a benzyl ester; a nitrobenzyl ester); or as an amide, for example,
as a methyl amide.
[0082] For example, a thiol group may be protected as a thioether (-SR), for example, as:
a benzyl thioether; an acetamidomethyl ether (-S-CH
2NHC(=O)CH
3).
Synthesis of Coelenterazine Derivatives
[0083] Coelenterazine derivatives according to the present invention may be synthesized
according those methods detailed in Examples 1-16.
Mutant Oplophorus Luciferases
[0084] In embodiments of the present invention, various techniques as described herein were
used to identify sites for amino acid substitution to produce an improved synthetic
OgLuc polypeptide. Additional techniques were used to optimize codons of the polynucleotides
encoding the various polypeptides in order to enhance expression of the polypeptides.
It was found that making one or more amino acid substitutions, either alone or in
various combinations, produced synthetic OgLuc-type polypeptides having enhanced luminescence
(e.g., enhanced brightness, enhanced signal stability, enhanced enzyme stability,
and/or change in relative substrate specificity). Furthermore, including one or more
codon-optimizing substitutions in the polynucleotides which encode for the various
synthetic OgLuc variant polypeptides produced enhanced expression of the polypeptides
in various eukaryotic and prokaryotic expression systems. One embodiment of the present
invention is a polynucleotide that encodes a synthetic OgLuc variant polypeptide which
is soluble and active in the monomeric form when expressed in prokaryotic and/or eukaryotic
cells.
[0085] The OgLuc variants of the present invention may be coupled to any protein of interest
or molecule of interest. In some embodiments, the variants are fusion proteins, for
example some variants are coupled to a HaloTag® polypeptide attached at either the
N-terminus or the C-terminus. Unless otherwise noted, the variants that are HaloTag®
fusions include 'HT7' as part of the name, e.g., 'IVY-HT7'. In some embodiments, a
signal sequence (e.g., the naturally-occurring
Oplophorus gracilirostris signal sequence) is attached to the N-terminus of the fusion protein to facilitate
the secretion of the fusion protein from the cell. Signal sequences, other than the
naturally-occuring signal sequence of OgLuc luciferase, are known in the art to facilitate
protein secretion in mammalian cells or other cell types. Signal sequences, in combination
with membrane anchoring sequences, may be used to position or display OgLuc variants
on the outer surface of the cellular membrane. Other methods, known in the art may
also be used to position OgLuc variants to the membrane or other locations within
the cell.
[0086] In some embodiments, the invention provides a modified decapod luciferase which has
enhanced luminescence relative to a corresponding parental variant decapod luciferase.
For example, the parental, variant OgLuc is C1+A4E, IVY, IV, QC27, QC27-9a, 9B8, 9B8
opt+K33N, 9B8 opt+K33N+170G, V2 or "L27V". In another embodiment, the invention provides
a modified decapod luciferase which utilizes a novel coelenterazine. In one embodiment,
the modified decapod luciferase has a change in relative specificity for native, known
or novel coelenterazines. In one embodiment, the modified decapod luciferase has a
change in relative specificity relative to a corresponding parental, variant decapod
luciferase.
[0087] In some embodiments, the corresponding parental, variant decapod luciferase is a
decapod species, including various species from families within the decapod order
including, without limitation, luciferases of the Aristeidae family, including
Plesiopenaeus coruscans; the Pandalidea family, including
Heterocarpus and
Parapandalus richardi, the Solenoceridae family, including
Hymenopenaeus debilis and
Mesopenaeus tropicalis; the Luciferidae family, including
Lucifer typus; the Sergestidae family, including
Sergestes atlanticus, Sergestes arcticus, Sergestes armatus, Sergestes pediformis,
Sergestes cornutus, Sergestes edwardsi, Sergestes henseni, Sergestes pectinatus, Sergestes
sargassi, Sergestes similis, Sergestes vigilax, Sergia challengeri, Sergia grandis,
Sergia lucens, Sergia prehensilis, Sergia potens, Sergia robusta, Sergia scintillans, and
Sergia splendens; the Pasiphaeidae family, including
Gtyphus marsupialis, Leptochela bermudensis, Parapasiphae sulcatifrons, and
Pasiphea tarda; the Oplophoridae family, including
Acanthephyra acanthitelsonis, Acanthephyra acutifrons, Acanthephyra brevirostris,
Acanthephyra cucullata, Acanthephyra curtirostris, Acanthephyra eximia, Acanthephyra
gracilipes, Acanthephyra kingsleyi, Acanthephyra media, Acanthephyra microphthalma,
Acanthephyra pelagica, Acanthephyra prionota, Acanthephyra purpurea, Acanthephyra
sanguinea, Acanthephyra sibogae, Acanthephyra stylorostratis, Ephyrina bifida, Ephyrina
figueirai, Ephyrina koskynii, Ephyrina ombango, Hymenodora glacialis, Hymenodora gracilis,
Meningodora miccyla, Meningodora mollis, Meningodora vesca, Notostomus gibbosus, Notostomus
auriculatus, Oplophorus gracilirostris, Oplophorus grimaldii, Oplophorus novaezealandiae,
Oplophorus spinicauda, Oplophorus foliaceus, Oplophorus spinosus, Oplophorus typus,
Systellaspis braueri, Systellaspis cristata, Systellaspis debilis, and
Systellaspis pellucida; and the Thalassocaridae family, including
Chlorotocoides spinicauda, Thalassocaris crinita, and
Thalassocaris lucida. In certain embodiments, the modified luciferase has increased luminescence emission,
e.g., at least 1.3-fold, at least 2-fold, or at least 4-fold, in a prokaryotic cell
and/or a eukaryotic cell relative to the corresponding wild-type luciferase. In some
embodiments, one or more properties of the modified decapod luciferase is compared
to comparable properties of a luciferase from another species, e.g., a firefly luciferase
or a
Renilla luciferase.
[0088] In some embodiments, the OgLuc variant has at least 60%, e.g., at least 65%, 70%,
75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%, or 100%, amino acid sequence identity
to SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 27, 35, 37,39, 41, 43, 45, 47,
49, 51, 53, 56, 58, 60, 62, 64, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93,
or 95. In some embodiments, the OgLuc variant, or a functional fragment thereof, has
no more than 5 differences, or more preferably, no more than 4, 3, 2, or 1 difference,
or most preferably no differences, wherein the differences occur in positions corresponding
to pattern position 1, 2, 3, 5, 8, 10, 12, 14, 15, 17, or 18 of Formula (VII) according
to Table 4. Differences may also include gaps or insertions between the pattern positions
of Table 4.
[0089] In some embodiments, the OgLuc variant of the invention has one or more heterologous
amino acid sequences at the N-terminus, C-terminus, or both (a fusion polypeptide
such as one with an epitope or fusion tag), which optionally directly or indirectly
interact with a molecule of interest. In some embodiments, the presence of the heterologous
sequence(s) does not substantially alter the luminescence of the OgLuc variant either
before or after the interaction with the molecule of interest. In some embodiments,
the heterologous amino acid sequence is an epitope tag. In some embodiments, the heterologous
amino acid sequence is one which, during or after interaction with a molecule of interest,
undergoes a conformational change, which in turn alters the activity of the OgLuc
variant e.g., an OgLuc variant with such an amino acid sequence is useful to detect
allosteric interactions. The OgLuc variant or a fusion with the OgLuc variant or a
fragment thereof may be employed as a reporter.
[0090] In some embodiments, a fragment of an OgLuc variant of the invention is fused to
a heterologous amino acid sequence, the fusion thereby forming a beta-barrel, which
fusion protein is capable of generating luminescence from a naturally-occurring coelenterazine
or an analog thereof including the various known coelenterazines discussed herein,
or a novel coelenterazine of the present invention.
[0091] Also provided is a polynucleotide encoding an OgLuc variant of the invention or a
fusion thereof, an isolated host cell having the polynucleotide or the OgLuc variant
or a fusion thereof, and methods of using the polynucleotide, OgLuc variant or a fusion
thereof or host cell of the invention.
[0092] The term "identity," in the context of two or more nucleic acids or polypeptide sequences,
refers to two or more sequences or subsequences that are the same or have a specified
percentage of amino acid residues or nucleotides that are the same when compared and
aligned for maximum correspondence over a comparison window or designated region as
measured using any number of sequence comparison algorithms or by manual alignment
and visual inspection. Methods of alignment of sequence for comparison are well-known
in the art. Optimal alignment of sequences for comparison can be conducted by the
algorithm of
Smith et al., (J. Mol. Biol. 147:195-197 (1981)), by the homology alignment algorithm of
Needleman and Wunsch, (J Mol. Biol., 48:443-453 (1970)), by the search for similarity method of
Pearson and Lipman, (Proc. Natl. Acad. Sci. USA, 85:2444-2448 (1988)), by computerized implementations of algorithms e.g., FASTA, SSEARCH, GGSEARCH (available
at the University of Virginia FASTA server by William R. Pearson http://fasta.bioch.virginia.edu/fasta_www2/fasta_intro.shtml),
the Clustal series of programs (
Chenna et al., Nucl. Acids Res. 31(13):3497-3500 (2003); available examples at http://www.ebi.ac.uk or http://www.ch.embnet.org), or other
sequence analysis software. It is known in the art that generating alignments with
maximum correspondence between polypeptide sequences with significant sequence alterations
(e.g., altered domain order, missing/added domains, repeated domains, shuffled domains,
circular permutation) may involve the use of specialized methods, such as the ABA
method (
Raphael et al., Genome Res. 14(11):2336-2346 (2004)), other suitable methods, or performing the alignment with two concatenated identical
copies of the polypeptide sequences.
[0093] The term "nucleic acid molecule," "polynucleotide" or "nucleic acid sequence" as
used herein, refers to nucleic acid, including DNA or RNA, that comprises coding sequences
necessary for the production of a polypeptide or protein precursor. The encoded polypeptide
may be a full-length polypeptide, a fragment thereof (less than full-length), or a
fusion of either the full-length polypeptide or fragment thereof with another polypeptide,
yielding a fusion polypeptide.
[0094] A polynucleotide encoding a protein or polypeptide means a nucleic acid sequence
comprising the coding region of a gene, or in other words, the nucleic acid sequence
encoding a gene product. The coding region may be present in a cDNA, genomic DNA or
RNA form. When present in a DNA form, the oligonucleotide may be single stranded (e.g.,
the sense strand) or double stranded. Suitable control elements such as enhancers/promoters,
splice junctions, polyadenylation signals, etc. may be placed in close proximity to
the coding region of the gene if needed to permit proper initiation of transcription
and/or correct processing of the primary RNA transcript. Other control or regulatory
elements include, but are not limited to, transcription factor binding sites, splicing
signals, polyadenylation signals, termination signals and enhancer elements.
[0095] By "peptide," "protein" and "polypeptide" is meant amino acid chains of varying lengths,
regardless of post-translational modification (e.g., glycosylation or phosphorylation).
The nucleic acid molecules of the invention encode a variant of a man made (i.e.,
synthetic) variant protein or polypeptide fragment thereof, which has an amino acid
sequence that is at least 60%, e.g., at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%,
97%, 98%, 99%, or 100%, amino acid sequence identity to the amino acid sequence of
the parental protein from which it is derived, where the parental protein can be a
naturally-occurring (native or wild-type) sequence or a variant sequence which is
subsequently modified further. The term "fusion polypeptide" or "fusion protein" refers
to a chimeric protein containing a reference protein (e.g., OgLuc variant) joined
at the N- and/or C-terminus to one or more heterologous sequences (e.g., a non-OgLuc
polypeptide). The heterologous sequence can include, but is not limited to, reporter
proteins such as the HALOTAG® fusion protein (Promega Corp.), FIAsH (fluorescein arsenical
helix binder), and ReAsH (red arsenical helix binder) (e.g., LUMIO™ tag recognition
sequence (Invitrogen)), chloramphenicol acetyltransferase (CAT), β-galactosidase (β-Gal),
lactamase (P-gal), neomycin resistance (Neo), GUS, galactopyranoside, green fluorescent
protein (GFP), luciferase (e.g., a
Renilla reniformis luciferase, a firefly luciferase (e.g.,
Photinus pyralis or
Photuris pennsylvanica)
, or a click beetle luciferase (e.g.,
Pyrophorus plagiophthalamus or Pyrearinus termitilluminans) or a glowworm luciferase (e.g.,
Phrixothrix hirtus)
, xylosidase, thymidine kinase, arabinosidase and SNAP-tag, CLIP-tag, ACP-tag and MCP-tag
(New England Biolabs). In one embodiment, a chimeric protein contains an OgLuc variant
joined at the N-terminus to a HALOTAG® fusion protein (Promega Corp.). In another
embodiment, a chimeric protein contains an OgLuc variant joined at the C-terminus
to a HALOTAG® fusion protein.
[0096] Nucleic acids are known to contain different types of "mutations", which refers to
an alteration in the sequence of a nucleotide at a particular base position relative
to the wild-type sequence. Mutations may also refer to insertion or deletion of one
or more bases so that the nucleic acid sequence differs from a reference, e.g., a
wild-type sequence, or replacement with a stop codon. A "substitution" refers to a
change in an amino acid at a particular position in a sequence, e.g., a change from
A to E at position 4.
[0097] The term "vector" refers to nucleic acid molecules into which fragments of DNA may
be inserted or cloned and can be used to transfer DNA segment(s) into a cell and capable
of replication in a cell. Vectors may be derived from plasmids, bacteriophages, viruses,
cosmids, and the like.
[0098] The term "wild-type" or "native" as used herein, refers to a gene or gene product
that has the characteristics of that gene or gene product isolated from a naturally
occurring source. A wild-type gene is that which is most frequently observed in a
population and is thus arbitrarily designated the "wild-type" form of the gene. In
contrast, the term "mutant" refers to a gene or gene product that displays modifications
in sequence and/or functional properties (i.e., altered characteristics) when compared
to the wild-type gene or gene product. It is noted that naturally occurring mutants
can be isolated; these are identified by the fact that they have altered characteristics
when compared to the wild-type gene or gene product.
Exemplary Polynucleotides and Proteins
[0099] The invention includes an OgLuc variant or protein fragments thereof, e.g., those
with deletions, for instance a deletion of 1 to about 5 residues, and chimeras (fusions)
thereof (see
U.S. Patent Publication No. 2009/0253131 and WIPO Publication No.
WO 2007/120522, the disclosures of which are incorporated by reference herein) having at least one
amino acid substitution relative to a wild-type OgLuc, which substitution results
in the OgLuc variant having enhanced stability, enhanced luminescence, e.g., increased
luminescence emission, greater stability of the luminescence kinetics, and/or altered
luminescence color. The sequences of an OgLuc variant are substantially the same as
the amino acid sequence of a corresponding wild-type OgLuc. A polypeptide or peptide
having substantially the same sequence means that an amino acid sequence is largely,
but is not entirely, the same and retains the functional activity of the sequence
to which it is related. In general, two amino acid sequences are substantially the
same if they are at least 60%, e.g., at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%,
97%, 98%, or 99%, but less than 100%, amino acid sequence identity. In some embodiments,
the OgLuc variant is encoded by a recombinant polynucleotide. In some embodiments,
the OgLuc variant, or a functional fragment thereof, has no more than 5 differences,
or more preferably no more than 4, 3, 2, or 1 difference, or most preferably no differences,
wherein the differences occur in positions corresponding to pattern position 1, 2,
3, 5, 8, 10, 12, 14, 15, 17, or 18 of Formula (VII) according to Table 4. Differences
may also include gaps, insertions, or permutations between the pattern positions of
Table 4.
[0100] The OgLuc variant proteins or fusion proteins of the invention may be prepared by
recombinant methods or by solid phase chemical peptide synthesis methods. Such methods
are known in the art.
Methods of Use and Kits
[0101] The compounds and proteins of the invention may be used in any way that luciferases
and luciferase substrates, e.g., coelenterazines, have been used. For example, they
may be used in a bioluminogenic method which employs an analog of coelenterazine to
detect one or more molecules in a sample, e.g., an enzyme, a cofactor for an enzymatic
reaction, an enzyme substrate, an enzyme inhibitor, an enzyme activator, or OH radicals,
or one or more conditions, e.g., redox conditions. The sample may include an animal
(e.g., a vertebrate), a plant, a fungus, physiological fluid (e.g., blood, plasma,
urine, mucous secretions and the like), a cell, a cell lysate, a cell supernatant,
or a purified fraction of a cell (e.g., a subcellular fraction). The presence, amount,
spectral distribution, emission kinetics, or specific activity of such a molecule
may be detected or quantified. The molecule may be detected or quantified in solution,
including multiphasic solutions (e.g., emulsions or suspensions), or on solid supports
(e.g., particles, capillaries, or assay vessels). In some embodiments the OgLuc variant
can be used in luminescence-based assays to detect an enzyme of interest, e.g., CYP450
enzyme, MAO A or B enzyme, a caspase, etc. The novel coelenterazines could be used
with photoproteins such as aequorin, obelin, or iPhotina. In some embodiment, the
OgLuc variant can be used as an energy donor to another molecule (e.g., to a fluorophore,
a chromophore, or a nanoparticle).
[0102] The invention also provides a polynucleotide encoding a transcriptional reporter.
In some embodiments, the OgLuc variant or fragment thereof could be operably linked
to transcription regulatory sequences, e.g., one or more enhancer, a promoter, a transcription
termination sequence or a combination thereof, to form an expression cassette. For
example, the OgLuc variant could be operably linked to a minimal promoter and a cAMP-response
element (CRE).
[0103] The proteins of the invention may be used as biosensors, e.g., an OgLuc variant,
which, in the presence of another molecule (e.g, one or more molecules of interest),
or under certain conditions, has one or more altered activities. Upon interacting
with a molecule of interest or being subject to certain conditions, the biosensor
undergoes a conformational change or is chemically altered which causes an alteration
of the enzyme activity or luminescence, e.g., specific activity, spectral distribution,
or emission kinetics. For example, the OgLuc variant of the present invention, for
example a circularly permuted variant, can comprise an interaction domain for a molecule
of interest. Alternatively, for example, the OgLuc variant may be coupled to an energy
acceptor, for example a fluorescent protein, and comprise an interaction domain that
alters the efficiency of energy transfer from the enzyme to the energy acceptor. For
example, the biosensor could be generated to detect proteases, kinases, a ligand,
a binding protein such as an antibody, cyclic nucleotides such as cAMP or cGMP, or
a metal such as calcium, by insertion of a suitable sensor region into the OgLuc variant
sequence. One or more sensor region can be inserted at the C-terminus, the N-terminus,
and/or at one or more suitable location in the polypeptide sequence, where the sensor
region comprises one or more amino acids. In the case of a circularly-permuted OgLuc
variant, the sensor region may be inserted between the N- and C-termini of the parent
OgLuc variant. In addition, one or all of the inserted sensor regions may include
linker amino acids to couple the sensor to the remainder of the OgLuc variant polypeptide.
Examples of luciferase biosensors are disclosed in
U.S. Pat. Appl. Publ. Nos. 2005/0153310 and
2009/0305280 and
PCT Publ. No. WO 2007/120522 A2, each of which is incorporated by reference herein.
[0104] In various embodiments, the OgLuc variants disclosed herein may be used to transfer
energy to an energy acceptor, for example in Bioluminescence Resonance Energy Transfer
(BRET) analysis. For example, the OgLuc variants used in BRET analysis can be used
to determine if two molecules are capable of binding each other or co-localize in
a cell. For example, an OgLuc variant can be used as a bioluminescence donor molecule
which is combined with a molecule or protein of interest to create a first fusion
protein. In various embodiments, the first fusion protein contains an OgLuc variant
and a protein of interest. In various embodiments, the first fusion proteins containing
the OgLuc variant can be used in BRET analysis to detect protein/protein interaction
in systems including but not limited to cell lysates, intact cells, and living animals.
In various embodiments, HALOTAG® can be used as a fluorescent acceptor molecule. In
some embodiments, HALOTAG® can be fused to a second protein of interest or to an OgLuc
variant. For example, an OgLuc variant can be fused to HALOTAG®, expressed in cells
or animals, and labeled with a fluorescent HALOTAG® ligand such as HALOTAG® TMR ligand.
The fusion can subsequently be excited to fluoresce in the presence of a cell-permeant
OgLuc substrate. In some embodiments, BRET may be performed using OgLuc variants in
combination with fluorescent proteins, including but not limited to Green Fluorescent
Protein (GFP) or Red Fluorescent Protein (RFP) or fluorescent labels including fluorescein,
rhodamine green, Oregon green, or Alexa 488, to name a few non-limiting examples.
[0105] In various embodiments, the OgLuc variants and/or the novel coelenterazines of the
present invention may be used in protein complementation assays (PCA) to detect the
interaction of two biomolecules, e.g., polypeptides. For example, an OgLuc variant
of the present invention can be separated into two fragments at a site(s) tolerant
to separation and each fragment of the separated OgLuc variant can be fused to one
of a pair of polypeptides of interest believed to interact, e.g., FKBP and FRB. If
the two polypeptides of interest do in fact interact, the OgLuc fragments then come
into close proximity with each other to reconstitute the functional, active OgLuc
variant. In some embodiments, the activity of the reconstituted OgLuc variant can
then be detected and measured using a native or known coelenterazine or a novel coelenterazine
of the present invention. In some embodiments, the split OgLuc variant can be used
in a more general complementation system similar to lac-Z (
Langley et al., PNAS 72:1254-1257 (1975)) or ribonuclease S (
Levit and Berger, J. Biol. Chem. 251:1333 -1339 (1976)). In some embodiments, an OgLuc variant fragment (designated "A") known to complement
with another OgLuc variant fragment ("B") can be fused to a target protein, and the
resulting fusion can be monitored via luminescence in a cell or cell lysate containing
fragment B. In some embodiments, the source of fragment B could be the same cell (e.g.,
if the gene for fragment B is integrated into the genome of the cell or is contained
on another plasmid within the cell) or it could be a lysate or purified protein derived
from another cell. In some embodiments, this same fusion protein (fragment A) could
be captured or immobilized using a fusion between fragment B and a polypeptide such
as HALOTAG® capable of attachment to a solid support. In some embodiments, luminescence
can be used to demonstrate successful capture or to quantify the amount of material
captured.
[0106] In various embodiments, the OgLuc variants and/or the novel coelenterazines of the
present invention may be used to quantify coelenterazine. In some embodiments, a coelenterazine
(e.g., a native or known coelenterazine, or a novel coelenterazine of the present
invention) can be used as a probe of a specific biochemical activity, e.g., apoptosis
and drug metabolism. In some embodiments, the coelenterazine concentration is coupled
to a specific enzyme activity by a "pro-coelenterazine" or "pro-substrate" that can
be acted on by the specific enzyme of interest. In some embodiments, the pro-coelenterazine
is a molecule that cannot support luminescence directly when combined with luciferase,
but can be converted into coelenterazine through catalytic processing by a specific
enzyme of interest. In some embodiments, the approach can be used for enzymes such
as those used in drug metabolism, e.g., cytochrome P450 enzymes, monoamine oxidase,
and glutathione S-transferase; and apoptosis, e.g., caspases. For example, coelenterazine
(e.g., a native or known coelenterazine, or a novel coelenterazine of the present
invention) can be modified to contain a cleavable group, such as 6'-O-methyl. In some
embodiments, when incubated with a specific cytochrome P450 enzyme, the 6'O-methyl
is cleaved, and the pro-coelenterazine converted to coelenterazine which can be detected
with an OgLuc variant of the present invention. In some embodiments, the pro-coelenterazine
can be combined with other components necessary to support luminescence, e.g., luminescent
protein such as an OgLuc variant of the present invention, to provide a single reagent
and a homogeneous assay. For example, when the reagent is added to a sample, luminescence
is generated as pro-coelenterazine is converted to coelenterazine. In various embodiments,
similar assays can be developed for other enzymes, small molecules, or other cellular
processes that can be linked to the generation of coelenterazines from pro-coelenterazines.
[0107] In various embodiments, the OgLuc variants and/or the novel coelenterazines of the
present invention may be used as genetic transcriptional reporter systems. In some
embodiments, the OgLuc variants can be multiplexed with a luciferase that emits light
at a different wavelength, e.g., red click beetle luciferase (CHROMA-LUC™; Promega
Corp.). For example, if an OgLuc variant of the present invention is used as a functional
reporter, then the red CHROMA-LUC™ luciferase could be used to control for non-specific
effects on genetic regulation or to normalize for transfection efficiency, In some
embodiments, luminescence generated from the OgLuc variant (approximately 460 nm)
and red CHROMA-LUC™ (approximately 610 nm) can be easily resolved using a luminometer
with wavelength-discriminating filters, enabling the measurement of both signals from
the same sample. In another example, an OgLuc variant of the present invention could
be used as a transcriptional reporter and paired with a luciferase that emits light
at a different wavelength contained in an assay reagent. For example, an OgLuc variant
of the present invention could be used as transcriptional reporter and paired with
either aequorin or a cAMP circularly-permuted firefly luciferase biosensor, or both
simultaneously, to detect multiple pathways in a single sample. In such a system,
for example, aequorin could be used for the detection and/or measurement of calcium,
the biosensor for the detection and/or measurement of cAMP, and an OgLuc variant for
monitoring of downstream gene expression. In another example, an OgLuc variant may
be used with one or more additional luciferases, where the luminescence of each luciferase
may be separately measured through the use of selective enzyme inhibitors. For example,
the luminescence of a first luciferase may be measured upon addition of appropriate
substrates and buffers, followed by measurement of a second luciferase upon a subsequent
addition of appropriate substrates and buffers and one or more inhibitors selective
for the first luciferase. In another example, the luciferase contained in an assay
reagent may be used for measuring a specific aspect of cellular physiology, for example
ATP to estimate cell viability, or caspase activity to estimate cellular apoptosis.
[0108] In various embodiments, the OgLuc variants of the present invention may be used as
reporters in difficult to transfect cell lines or perhaps even in non-dividing primary
cells, e.g., stem cells or HepG2 cells. Due to their high signal intensity, the OgLuc
variants of the present invention will enable detectable luminescence when transfection
efficiency is low. In some embodiments, the OgLuc variants can be used as reporters
in cells that are especially sensitive to conditions associated with transfection,
e.g., which are sensitive to elevated DNA concentrations or the addition of transfection
reagent. Thus, in various embodiments, due to the enhanced luminescence of the OgLuc
variants of the present invention, an adequate level of luminescence can be achieved
using lower DNA concentrations, less transfection reagent, and/or shorter post-transfection
times prior to beginning an assay so that there is a reduced toxicity burden on sensitive
cells. In various embodiments, the enhanced luminescence of the OgLuc variants will
also allow for a signal to be detected at much later time points. In still other embodiments,
the OgLuc variants could be used as reporters for single-copy native promoters.
[0109] In various embodiments, the OgLuc variants of the present invention may be used as
fusion tags for a target protein of interest as a way to monitor intracellular levels
of the target protein. In some embodiments, the OgLuc variants can be used to monitor
specific proteins involved in stress response pathways (e.g., DNA damage, oxidative
stress, inflammation) in cells as a way to probe the role various types of stimuli
may play in these pathways. In some embodiments, the OgLuc variants can also be used
as a means to monitor cellular trafficking of a target protein. For example, the OgLuc
variants can also be fused to viral genomes (e.g., HIV, HCV) so that titer levels,
i.e., infectivity, can be monitored in cells following treatment with potential antiviral
agents. In some embodiments, the variants can also be fused to green fluorescent protein
(GFP) or HALOTAG® (in addition to a target protein) for fluorescence activated cell
sorting (FACS) to identify high expression clones.
[0110] In various embodiments, identification of robust, stable cell lines expressing an
OgLuc variant of the present invention, either in the cytoplasm or as a secreted form,
can be facilitated by the enhanced signal of the OgLuc variant and the small size
of the OgLuc gene. The relatively small gene sequence should reduce the likelihood
of genetic instability resulting from the integration of the foreign DNA into a cell's
genome.
[0111] In various embodiments, the OgLuc variants of the present invention can be integrated
into a variety of different immunoassay concepts. For example, an OgLuc variant can
be fused to a primary or secondary antibody to provide a method of detection for a
particular analyte. As another example, an OgLuc variant can be fused to protein A
or protein G, and the fusion could then be used to detect a specific antibody bound
to a particular analyte. As another example, an OgLuc variant can be fused to streptavidin
and used to detect a specific biotinylated antibody bound to a particular analyte.
As yet another example, complementary fragments of an OgLuc variant can be fused to
primary and secondary antibodies, where the primary antibody recognizes a particular
analyte, and the secondary antibody recognizes the primary antibody. In some embodiments,
the OgLuc variant activity would be reconstituted in the presence of analyte. As still
another example, an OgLuc variant can be conjugated to an analyte (e.g., prostaglandins)
and used in a competitive sandwich ELISA format. The OgLuc variant conjugated to an
analyte may also be used to detect antibodies capable of binding the analyte, where
the binding activity allows the OgLuc variant to be selectively linked to the antibody.
An example using Renilla luciferase for quantitatively measuring patient antibody
titers to an antigenic target is the Luciferase Immunoprecipitation System (
Burbelo et al., Expert Review of Vaccines 9(6):567-578 (2010))
[0112] In various embodiments, the OgLuc variants and novel substrates of the present invention
can be used for detecting luminescence in live cells. In some embodiments, an OgLuc
variant can be expressed in cells (as a reporter or otherwise), and the cells treated
with a coelenterazine, e.g., a novel coelenterazine such as PBI-3939, which will permeate
cells in culture, react with the OgLuc variant and generate luminescence. In addition
to being cell permeant, PBI-3939 shows comparable biocompatibility to native coelenterazine
in terms of cell viability. In some embodiments, a version of PBI-3939 containing
chemical modifications known to increase the stability of native coelenterazine in
media can be synthesized and used for more robust, live cell OgLuc variant-based reporter
assays. In still other embodiments, a sample (including cells, tissues, animals, etc.)
containing an OgLuc variant and/or a novel coelenterazine of the present invention
may be assayed using various microscopy and imaging techniques. In still other embodiments,
a secretable OgLuc variant is expressed in cells as part of a live-cell reporter system.
[0113] In various embodiments, the OgLuc variants and/or novel coelenterazines disclosed
herein may be provided as part of a kit. The kit may include one or more OgLuc variants
as disclosed herein (in the form of a polypeptide, a polynucleotide, or both) and/or
a coelenterazine, along with suitable reagents and instructions to enable a user to
perform assays such as those disclosed herein. The coelenterazine may be any of the
native, known, or novel coelenterazines disclosed herein. The kit may also include
one or more buffers, such as those disclosed herein.
Vectors and Host Cells Encoding the Modified Luciferase or Fusions Thereof
[0114] Once a desirable nucleic acid molecule encoding an OgLuc variant or a fragment thereof,
such as one with luminescence activity or which may be complemented by another molecule
to result in luminescence activity, or a fusion thereof with luminescence activity,
is prepared, an expression cassette encoding the OgLuc variant or a fragment thereof,
e.g., one for complementation, or a fusion thereof with luminescence activity, may
be prepared. For example, a nucleic acid molecule comprising a nucleic acid sequence
encoding an OgLuc variant is optionally operably linked to transcription regulatory
sequences, e.g., one or more enhancers, a promoter, a transcription termination sequence
or a combination thereof, to form an expression cassette. The nucleic acid molecule
or expression cassette may be introduced to a vector, e.g., a plasmid or viral vector,
which optionally includes a selectable marker gene, and the vector introduced to a
cell of interest, for example, a prokaryotic cell such as
E. coli, Streptomyces spp.,
Bacillus spp.,
Staphylococcus spp. and the like, as well as eukaryotic cells including a plant (dicot or monocot),
fungus (including yeast, e.g.,
Pichia, Saccharomyces or
Schizosaccharomyces), or a mammalian cell, lysates thereof, or to an
in vitro transcription/translation mixture. Mammalian cells include but are not limited to
bovine, caprine, ovine, canine, feline, non-human primate, e.g., simian, and human
cells. Mammalian cell lines include, but are not limited to, CHO, COS, HEK293, HeLa,
CV-1, SH-SY5Y, and NIH 3T3 cells, although numerous other cell lines can also be used
as well.
[0115] The expression of an encoded OgLuc variant may be controlled by any promoter capable
of expression in prokaryotic cells or eukaryotic cells including synthetic promoters.
Prokaryotic promoters include, but are not limited to, SP6, T7, T5,
tac, bla, trp, gal, lac or maltose promoters, including any fragment that has promoter activity. Eukaryotic
promoters include, but are not limited to, constitutive promoters, e.g., viral promoters
such as CMV, SV40 and RSV promoters, as well as regulatable promoters, e.g., an inducible
or repressible promoter such as the tet promoter, the hsp70 promoter and a synthetic
promoter regulated by CRE, including any fragment that has promoter activity. The
expression of an encoded OgLuc variant may also be controlled by post-transcriptional
processes, such as by regulation of RNA processing or regulation of translation, for
example by RNAi, miRNA, shRNA, siRNA, or by RNA or protein degradation. The nucleic
acid molecule, expression cassette and/or vector of the invention may be introduced
to a cell by any method including, but not limited to, calcium-mediated transformation,
electroporation, microinjection, lipofection, and the like.
Optimized Sequences, and Vectors and Host Cells Encoding the OgLuc Variants
[0116] Also provided is an isolated nucleic acid molecule (polynucleotide) comprising a
nucleic acid sequence encoding an OgLuc variant of the invention, a functional fragment
thereof or a fusion protein thereof. In some embodiments, the isolated nucleic acid
molecule comprises a nucleic acid sequence which is optimized for expression in at
least one selected host. Optimized sequences include sequences which are codon optimized,
i.e., codons which are employed more frequently in one organism relative to another
organism, e.g., a distantly related organism, as well as modifications to add or modify
Kozak sequences and/or introns, and/or to remove undesirable sequences, for instance,
potential transcription factor binding sites. Such optimized sequences can provide
enhanced expression, e.g., increased levels of protein expression, when introduced
into a host cell. Examples of optimized sequences are disclosed in
U.S. Pat. No. 7,728,118 and
U.S. Pat. Appl. Publ. Nos. 2008/0070299,
2008/0090291, and
2006/0068395, each of which is incorporated by reference herein.
[0117] In some embodiments, the polynucleotide includes a nucleic acid sequence encoding an
OgLuc variant of the invention, which nucleic acid sequence is optimized for expression
in a mammalian host cell. In some embodiments, an optimized polynucleotide no longer
hybridizes to the corresponding non-optimized sequence, e.g., does not hybridize to
the non-optimized sequence under medium or high stringency conditions. The term "stringency"
is used in reference to the conditions of temperature, ionic strength, and the presence
of other compounds, under which nucleic acid hybridizations are conducted. With "high
stringency" conditions, nucleic acid base pairing will occur only between nucleic
acid fragments that have a high frequency of complementary base sequences. Thus, conditions
of "medium" or "low" stringency are often used when it is desired that nucleic acids
that are not completely complementary to one another be hybridized or annealed together.
The art knows well that numerous equivalent conditions can be employed to comprise
medium or low stringency conditions.
[0118] In some embodiments, the polynucleotide has less than 90%, e.g., less than 80%, nucleic
acid sequence identity to the corresponding non-optimized sequence and optionally
encodes a polypeptide having at least 60%, e.g., at least 65%, 70%, 75%, 80%, 85%,
90%, 95%, 96%, 97%, 98%, 99%, or 100%, amino acid sequence identity with the polypeptide
encoded by the non-optimized sequence. Constructs, e.g., expression cassettes, and
vectors comprising the isolated nucleic acid molecule, e.g., with optimized nucleic
acid sequence, as well as kits comprising the isolated nucleic acid molecule, construct
or vector are also provided.
[0119] A nucleic acid molecule comprising a nucleic acid sequence encoding an OgLuc variant
of the invention, a fragment thereof or a fusion thereof is optionally optimized for
expression in a particular host cell and also optionally operably linked to transcription
regulatory sequences, e.g., one or more enhancers, a promoter, a transcription termination
sequence or a combination thereof, to form an expression cassette.
[0120] In some embodiments, a nucleic acid sequence encoding an OgLuc variant of the invention,
a fragment thereof or a fusion thereof is optimized by replacing codons, e.g., at
least 25% of the codons in a parental OgLuc sequence with codons which are preferentially
employed in a particular (selected) cell. Preferred codons have a relatively high
codon usage frequency in a selected cell, and preferably their introduction results
in the introduction of relatively few transcription factor binding sites for transcription
factors present in the selected host cell, and relatively few other undesirable structural
attributes. Examples of undesirable structural attributes include, but not limited
to, restriction enzyme sites, eukaryotic sequence elements, vertebrate promoter modules
and transcription factor binding sites, response elements,
E. coli sequence elements, mRNA secondary structure. Thus, the optimized nucleic acid product
may have an improved level of expression due to improved codon usage frequency, and
a reduced risk of inappropriate transcriptional behavior due to a reduced number of
undesirable transcription regulatory sequences.
[0121] An isolated and optimized nucleic acid molecule may have a codon composition that
differs from that of the corresponding wild-type nucleic acid sequence at more than
30%, 35%, 40% or more than 45%, e.g., 50%, 55%, 60% or more of the codons. Exemplary
codons for use in the invention are those which are employed more frequently than
at least one other codon for the same amino acid in a particular organism and, in
some embodiments, are also not low-usage codons in that organism and are not low-usage
codons in the organism used to clone or screen for the expression of the nucleic acid
molecule. Moreover, codons for certain amino acids (i.e., those amino acids that have
three or more codons), may include two or more codons that are employed more frequently
than the other (non-preferred) codon(s). The presence of codons in the nucleic acid
molecule that are employed more frequently in one organism than in another organism
results in a nucleic acid molecule which, when introduced into the cells of the organism
that employs those codons more frequently, is expressed in those cells at a level
that is greater than the expression of the wild-type or parent nucleic acid sequence
in those cells.
[0122] In some embodiments of the invention, the codons that are different are those employed
more frequently in a mammal, while in still other embodiments, the codons that are
different are those employed more frequently in a plant. Preferred codons for different
organisms are known to the art, e.g., see http://www.kazusa.or.jp./codon/. A particular
type of mammal, e.g., a human, may have a different set of preferred codons than another
type of mammal. Likewise, a particular type of plant may have a different set of preferred
codons than another type of plant. In one embodiment of the invention, the majority
of the codons that differ are ones that are preferred codons in a desired host cell.
Preferred codons for organisms including mammals (e.g., humans) and plants are known
to the art (e.g.,
Wada et al., Nucl. Acids Res., 18:2367 (1990);
Murray et al., Nucl. Acids Res., 17:477 (1989)).
EXAMPLES
Reference Example 1 - Synthesis of α-Aminonitrile (Compound 1):
[0123]

[0124] A flask was charged with sodium bisulfite (71.4 mmol) and 17 mL of water. To this,
a solution of aldehyde (69.3 mmol) in 14 mL of tetrahydrofuran (THF) was added dropwise
at a rate that kept the internal temperature below 60°C. The resulting suspension
was stirred at ambient temperature for 40 min, and ammonium hydroxide solution (4.85
mL) added over 2 min. The resulting solution was magnetically stirred while being
heated in an oil bath at 60°C for 1 hr and then left at ambient temperature overnight.
The solution was cooled in an ice/saltwater bath until the internal temperature measured
below 5°C. To this, a solution of sodium cyanide (71.4 mmol) in 14 mL of water was
added dropwise over 30 min. The resulting mixture was stirred at approximately 10°C
for 20 min, 30°C for 2 hrs, and at ambient temperature for 18 hrs. The reaction mixture
was extracted into three 200 mL portions of diethyl ether, and the combined extracts
dried over anhydrous sodium sulfate. The mixture was filtered, and the solution cooled
in an ice bath for 20 min. To the stirred solution, hydrogen chloride gas was added
until precipitation ceased, and the suspension stirred for 1 hr. The solid was isolated
by filtration and rinsed with three 50 mL portions of diethyl ether. The material
was dried under vacuum, and 6.4 g (47.5 mmol) of a white solid was obtained (69%).
Procedure was adapted from:
Freifelder and Hasbrouck, "Synthesis of Primary 1,2-Diamines by Hydrogenation of alpha-Aminonitriles,"
Journal of the American Chemical Society, 82(3):696-698 (1960).
Reference Example 2 - Synthesis of 2-oxo-2-phenylacetaldehyde oxime (Compound 2):
[0125]

[0126] A flask was charged with potassium tert-butoxide (58 mmol) and 63 mL of tert-butyl
alcohol. The mixture was stirred until a solution was formed, and a solution of the
appropriate benzophenone (50 mmol) in 35 mL of tert-butyl alcohol added dropwise over
15 min. The reaction mixture was stirred for 1 hr, and the neat isoamyl nitrite (75
mmol) added over five min. The reaction mixture was monitored for completion and then
diluted with 100 mL of heptanes. The resulting solid (38 mmol) was collected via suction
filtration and dried to a constant weight under vacuum. Procedure was adapted from:
Hagedorn et al., Chem. Ber., 98:193 (1965).
Reference Example 3 - Synthesis of Pyrazine derivatives (Compound 3)
[0127]

[0128] A 3-neck flask was fitted with a thermometer, septum, and argon line. To this, aminonitrile
(47.5 mmol), dry pyridine (190 mL), and oxime (61.75 mmol) was added. The mixture
was well stirred for 15 min, and tetra-chloro(bis-pyridyl)titanium complex (94.9 mmol)
added in five portions over 35 min making sure the internal temperature remained below
40°C. After the addition was complete, the reaction mixture was stirred overnight
at ambient temperature. The reaction mixture was slowly added to a solution of sodium
bicarbonate (21.75 g in 174 mL water) in small portions. The resulting mixture was
well stirred for 15 min and 80 g of celite was added. The suspension was stirred for
30 min and filtered through a Buchner funnel. The filtrate was removed to a separatory
funnel, and the filter cake was suspended in 400 mL of methanol. The mixture was stirred
for 30 min and filtered again. This process was repeated a total of four times. The
methanolic filtrates were combined and concentrated, and the residue dissolved in
200 mL of ethyl acetate (EtOAc). The solution was added to the separatory funnel containing
the original filtrate, and the mixture further extracted with three 100 mL portions
of EtOAc. The combined extracts were washed with two 100 mL portions of saturated
sodium carbonate and two 100 mL portions of brine solution. The organic solvent was
evaporated, and the crude pyazine-oxide obtained as a brown oil. The material was
dissolved in 3 mL of methanol, and 89 mL of dichloromethane (DCM) was added. To this
solution, zinc dust (80.7 mmol) was added, and the mixture cooled in an ice bath until
an internal temperature of 15°C was reached. The mixture was treated with glacial
acetic acid (3 mL) and warmed to an internal temperature of 30°C in an oil bath for
40 min. The reaction mixture was cooled to room temperature and filtered through a
pad of celite. The filter cake was rinsed with DCM, and the combined filtrates washed
with an aqueous solution of saturated sodium bicarbonate. The crude product was purified
by chromatography over silica gel using a heptane/EtOAc gradient. This gave 2.9 g
(29%) of the pyrazine as a brown solid. Procedure was adapted from:
Kishi et al., "The structure confirmation of the light-emitting moiety of bioluminescent
jellyfish." Tetrahedron Lett., 13(27):2747 (1972).
Reference Example 4 - Synthesis of Coelenterazines
Method A: (the following compounds can be synthesized by Method A: compounds PBI-3840, PBI-3886,
PBI-3857, PBI-3887, PBI-3913, PBI-3894, PBI-3896, PBI-3897, PBI-3841 and PBI-3842)
[0129]

[0130] A flask was charged with pyrazine (8.25 mmol), pyruvic acid (14.0 mmol), camphor
sulfonic acid (0.8 mmol), and anhydrous 2-methyl THF (150 mL). The flask was equipped
with a condenser and soxhlet extractor charged with 4-angstrom molecular sieves, and
the reaction mixture heated in an oil bath at 110°C for 18 hrs. The sieves were replaced
with fresh ones, and reflux continued for 24 hrs. The reaction mixture was filtered
and concentrated, and the residue dissolved in EtOAc (200 mL). This solution was washed
with three 25 mL portions of saturated sodium bicarbonate solution, 100 mL of 0.1
M sodium acetate buffer, pH 5, and 100 mL of brine solution. The solution was dried
over magnesium sulfate, filtered, and concentrated to give 2.3 g (6.2 mmol, 75%) of
the crude enamine/acid. This material was dissolved in anhydrous THF (30 mL), and
the solution cooled in an ice/water bath for 10 min. To this, the carbodiimide (9.0
mmol) and neat diisopropylethyl amine (14.9 mmol) was added. The cold bath was removed
after 10 min, and the reaction mixture stirred at ambient temperature for 3 hrs. To
the reaction mixture, 50 mL of 0.1 M sodium acetate buffer, pH 5 was added, and the
mixture well stirred for 10 min. The biphasic mixture was extracted with three 100
mL portions of EtOAc, and the combined extracts washed with brine solution. The organic
solution was concentrated, and the residue purified by chromatography over silica
gel using a DCM/methanol gradient. This gave 336 mg (0.94 mmol, 16%) of the dehydrocoelenterazine
as a red solid. This material was suspended in 10 mL of methanol, and the mixture
cooled in an ice bath. To this, sodium borohydride (100 mg, 2.6 mmol) was added in
three portions over 1 hr. The reaction mixture was stirred for an additional 30 min,
and neat glacial acetic acid added drop wise until a pH of 5 was reached. The solution
was concentrated, and the residue triturated with 15 mL of water. The solid was isolated
via suction filtration and dried under vacuum for several hours to give 318 mg (94%)
of the crude coelenterazine as a yellow solid. Procedure was adapted from:
Kakoi and Inoue, Chem. Lett. 11(3):299-300 (1980).
Method B: (the following compounds can be synthesized by method B: compounds PBI-3882, PBI-3932,
PBI-3881)
[0131]

Method C: Synthesis of novel coelenterazines (the following compounds can be synthesized by
method C: PBI-3939, PBI-3945, PBI-3889, PBI-4002)
[0134] Synthesis of 2-amino-3-benzyl-5-phenylpyrozine. A round bottomed flask was charged with 5 g (33.5 mmol) of 2-isonitrosoacetophenone,
6.7 g (36.8 mmol) of 2-amino-3-phenylpropanenitrile hydrochloride and 100 mL of dry
pyridine. The mixture was cooled to -20°C and 4.6 mL (40.0 mmol) of TiCl
4 was added dropwise. The reaction was kept at -20°C for 30 min and heated to 80°C
for 2.5 hrs. The solvent was evaporated, and the residue taken up in 1 L of DCM. This
solution was washed with saturated NaHCO
3 and brine. All volatiles were evaporated, and the residue redissolved in ethanol
(400 mL). Raney Ni (2.0 g, aqueous suspension) was added, and the reaction allowed
to stir for 5 days under 1 atm of hydrogen. The mixture was passed through celite,
and volatiles removed. The residue was chromatographed on silica gel (heptanes/DCM)
to give 2.5 g (29%) of 2-amino-3-benzyl-5-phenylpyrazine.
[0135] Synthesis of 2-amino-3-phenylpropanenitrile hydrochloride. A round bottomed flask was charged with 65 g (0.624 mol) of sodium hydrogensulfite
and 150 mL of water. A solution of 75 g (0.624 mol) of phenylacetaldehyde in 150 mL
of THF was added dropwise. After stirring for 20 min, 37 mL of 14 M ammonium hydroxide
was added in one portion, and the mixture heated to 60°C for 60 min. After cooling
to 0°C, the mix was diluted with 150 mL of water, and a solution of sodium cyanide
(27.5 g, 0.560 mol) in 100 mL of water added dropwise keeping internal temperature
below 10°C. Upon addition, the mixture was heated to 30°C for 2 hrs arid extracted
with ether. After drying with sodium sulfate, all volatiles were evaporated, and the
residue dissolved in 3.5 L of ether and treated with 400 mL of 3.3 M ethanolic HCl.
The resulting precipitate was filtered and dried in vacuum to give 55 g (60%) of product.
[0136] Synthesis of 3-(furan-2-yl)-2-oxopropanoic acid. To a 100 mL flask, 3-(furan-2-yl)-2-oxopropanoate (940 mg) along with 23 mL cold
6N NaOH was added. The insoluble mixture was stirred in a 90°C bath for 5 min until
dissolved. Cold 1N HCl was added until solution was acidic (approx 120 mL). Solution
was extracted 2 x 50 mL EtOAc. Combined organic layers were washed with 40 mL brine
and dried with Na
2SO
4. Solution was evaporated to yield 540 mg brown solid. Solid was further purified
by reversed-phase high-performance liquid chromatography (HPLC) ramping from 97% aqueous
trifluoroacetic acid (TFA) to acetonitrile (ACN).
[0137] Synthesis of ethyl 3-(furan-2-yl)-2-oxopropanoate. To a 500 mL flask containing the mixture of isomers (E/Z)-ethyl 2-formamido-3-(furan-2-yl)acrylate
(5.0 g), a chilled solution of 220 mL 1.4M (5%) HCl in 50/50 ethanol/water was added.
After 5 hrs, the reaction was partitioned between 200 mL of EtOAc and 30 mL brine.
The aqueous layer was extracted 2 x 50 mL EtOAc. Combined organic layers were washed
with 1 x 50 mL water, and 1 x 50 mL brine and dried over Na
2SO
4. Organic layers were co-evaporated with 26 g celite and eluted over 80 g silica gold
ramping from heptane to EtOAc. The appropriate combined fractions were evaporated
to yield 2.1 g.
[0138] Synthesis of (E/
Z)-ethyl 2-formamido-3-(furan-2-yl)acrylate. To a 500 mL flask, 50 mL diethyl ether, Cu
2O (320 mg), and furyl aldehyde (5.2 mL) was added. The flasked was cooled in an ice
bath, and ethyl 2-isocyanoacetate (5.3 mL) added. After 1.5 hrs, potassium tert-butoxide
(5 g) was added to the reaction. After 4 hrs, the heterogeneous reaction was filtered.
60 mL 30% citric acid and 20 mL EtOAc was added and stirred for 10 min. Aqueous layer
was extracted with 50 mL EtOAc. Combined organic layers were dried over anhydrous
sodium sulfate. EtOAc layers were co-evaporated with 24 g celite and eluted over 80
g silica gold ramping from heptane to EtOAc. Yellow syrup was used without further
purification.
[0139] Synthesis of 2-oxo-3-(thiophen-2-yl)propanoic acid. To a 250 mL flask, (E/Z)-5-(thiophen-2-ylmethylene)imidazolidine-2,4-dione (5.0 g)
and 100 mL of cold 6N NaOH were added. The mixture was heated to 100°C for 1 hr. Concentrated
HCl was added to the cooled solution until acidic (pH=1). The mixture was extracted
8 x 50 mL diethylether. The combined ether layers were washed with 50 mL brine, dried
over Na
2SO
4 and evaporated to yield 3.36 g solid. Sample was further purified by recrystalization
with α,α,α-trifluorotoluene to yield 1.63 g.
[0140] Synthesis of (E/
Z)-5-(thiophen-2-ylmethylene)imidazolidine-2,4-dione. To a 250 mL flask, hydantoin (9.8 g) and thiophene-2-carbaldehyde (10 g) were added.
To the mixture was dripped piperidine (9.6 mL). The mixture was heated to 100°C for
1 hr and then poured into 300 mL of 1N HCl. The solid was filtered, washed with water
and dried in vacuo to yield 4.9 g solid.

[0141] Steps 1- To a microwave vial (10 mL), the appropriate phenylpyrazin-2-amine (100 mg), the
appropriate pyruvic acid (2 Equivalents), DCM (1 mL), and 1,1,1-trifluoroethanol (1
mL) were heated with stirring for 30 min at 80°C. Reaction was co-adsorbed on 2 grams
of celite, and solvents removed in vacuo. The celite was loaded on 24 g of spherical
silica gel and eluted with a ramp of heptanes to ethylacetate. Appropriate fractions
were combined and evaporated.
[0142] Step 2 - The material isolated in step 1 dissolved in THF (0.5 mL) was chilled in an ice
bath. Acetic anhydride (25 µL), dimethylaminopyridine (8.5 mg), and triethylamine
(25 µL) were added. After 2 hrs, the majority of THF was removed in vacuo. The product
was precipitated with an aqueous solution of 30% citric acid (2 mL). The solid was
washed with water (2 mL) and then dissolved in 3 mL DCM. The DCM was washed 1 x 2
mL water followed by 1 x 2 mL brine. The DCM layer was co-adsorbed on 2 grams of celite,
and solvent removed in vacuo. The celite was loaded on 12 g of spherical silica gel
and eluted with a ramp of heptanes to DCM. Appropriate fractions were combined and
evaporated.
[0143] Step 3 - The material from step 2 dissolved in DCM (1 mL) was chilled in an ice bath. To
the solution, methanol (0.5 mL) and sodium borohydride solution in diglyme (325 µL
of 0.5 M) were added. After 2 hrs, acetic acid (10 µL) was added, and the solution
quickly partitioned between an aqueous solution of 30% citric acid (1 mL) and DCM
(2 mL). The DCM layer was co-adsorbed on 1 gram of celite, and solvent removed in
vacuo. The celite was loaded on 4 g of spherical silica gel and eluted with a ramp
of DCM to EtOAc. Appropriate fractions were combined and evaporated.
[0144] Step 4 (only if R" = OAc) - The material in step 3 was dissolved in THF (200 µL) and chilled
in an ice bath. 1 equivalent of 1.35 M potassium methoxide in THF was added to the
solution. After 30 min, the reaction was partitioned between DCM (1 mL) and 30% citric
acid (1 mL). The DCM layer was co-adsorbed on 0.5 g celite, and solvent removed in
vacuo. The celite was loaded on 4 g of spherical silica gel and eluted with a ramp
of DCM to EtOAc. Appropriate fractions were combined and evaporated.
[0145] Method D: (the following compounds can be synthesized by method D: compounds PBI-3899, PBI-3900,
PBI-3925, PBI-3933, PBI-3946) - In general, an aminopyrazine was condensed with 2
equivalents of a 2-oxoacid under an atmosphere of hydrogen in the presence of palladium
catalyst. The alpha-amino acid produced was purified and subsequently activated for
intramolecular condensation giving rise to the corresponding imidazopyrazinone.

Example 5 - Synthesis of 8-benzyl-6-(4-hydroxyphenyl)-2-propylimidazol[1,2-a]pyrazin-3(7H)-one
[0146] 2-((3-benzyl-5-(4-hydroxyphenyl)pyrazin-2-yl)amino)pentanoic acid. 4-(5-amino-6-benzylpyrazin-2-yl)phenol (100 mg, 0.36 mmol) was mixed with 2-Oxovaleric
acid (84 mg, 0.72 mmol) in ethanol (20 mL). Pd/C (10% Palladium in active carbon,
40 mg) was added, and the reaction mixture heated to 65°C. Air was bubbled out by
N
2 gas, and a hydrogen balloon applied to the reaction flask. The reaction was continuously
stirred for 4 hrs. After cooling down, it was filtered, and the resulting solution
purified by flash chromatography (eluting solvent: 50% EtOAc in heptanes) to give
the product as a yellow powder (70 mg, 52%).
1H NMR (300 MHz, CD
2Cl
2, δ): 8.31 (s, 1H), 7.82 (d, 2H, J = 9.0Hz), 7.31 (m, 5H), 6.92 (d, 2H, J = 9.0Hz),
5.34 (s, 2H), 4.20 (m, 1H), 1.10 (m, 2H), 0.98 (m, 2H), 0.87 (t, 3H); MS (ESI) m/z
378.3 (M+1).
[0147] 8-benzyl-6-(4-hydroxyphenyl)-2-propylimidazo[1,2-a]pyrazin-3(7H)-one. 2-((3-benzyl-5-(4-hydroxyphenyl)pyrazin-2-yl)amino)pentanoic acid (49 mg, 0.13 mmol)
was dissolved in DCM (10 mL). Pyridine (0.5 mL) was added followed by N,N'-Dicyclohexylcarbodiimide
(54 mg, 0.26 mmol). The reaction mixture was slowly stirred at room temperature for
1 hr. The solvent was evaporated, and the residue purified by flash chromatography
(eluting solvent: EtOAc to DCM to 10% methanol in DCM) to give the product as a yellow
powder (40 mg, 86%).
1H NMR (300 MHz, CD
3OD, δ): 7.35 (m, 8H), 6.88 (d, J = 9.0Hz, 2H), 4.40 (s, 2H), 2.81 (t, J = 7.5Hz, 2H),
1.81 (m, 2H), 1.02 (t, J = 7.5Hz, 3H); MS (ESI) m/z 359.0.
Example 6 - Synthesis of 8-benzyl-2-butyl-6-(4-hydroxyphenyl)imidazol[1,2-a]pyrazin-3(7H)-one
[0148] 2-((3-benzyl-5-(4-hydroxyphenyl)pyrazin-2-yl)amino)hexanoic acid. 4-(5-amino-6-benzylpyrazin-2-yl)phenol (200 mg, 0.72 mmol) was mixed with 2-Ketohexanoic
acid sodium salt (220 mg, 1.44 mmol) in ethanol (20 mL). Pd/C (10% Palladium in active
carbon, 100 mg) was added with a few drops of acetic acid, and the reaction mixture
heated to 65°C. Air was bubbled out by N
2 gas, and a hydrogen balloon applied to the reaction flask. The reaction was continuously
stirred for 4 hrs. After cooling down, it was filtered and the resulting solution
was purified by flash chromatography (eluting solvent: 50% EtOAc in heptanes) to give
the product as a yellow powder (130 mg, 46%). MS (ESI): m/z 392.2 (M+1).
[0149] 8-benzyl-2-butyl-6-(4-hydroxyphenyl)imidazo[1,2-a]pyrazin-3(7H)-one. 2-((3-benzyl-5-(4-hydroxyphenyl)pyrazin-2-yl)amino)hexanoic acid (130 mg, 0.33 mmol)
was dissolved in DCM (10 mL). Pyridine (0.5 mL) was added followed by N,N'-Dicyclohexylcarbodiimide
(137 mg, 0.67 mmol). The reaction mixture was slowly stirred at room temperature for
I hr. The solvent was evaporated, and the residue purified by flash chromatography
(eluting solvent: EtOAc to DCM to 10% methanol in DCM) to give the product as a yellow
powder (110 mg, 89%).
1H NMR (300 MHz, CD
3OD, δ): 7.30 (m, 8H), 6.88 (d, 2H), 4.40 (s, 2H), 2.84 (t, 2H), 1.77 (m, 2H), 1.51
(m, 2H), 0.89 (m, 3H); MS (ESI) m/z 374.3 (M + 1).
Example 7 - Synthesis of 8-benzyl-2-ethyl-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one
(PBI-3925)
[0150] 2-((3-benzyl-5-phenylpyrazin-2-yl)amino)butanoic acid. 3-benzyl-5-phenylpyrazin-2-amine (200 mg, 0.77 mmol) was mixed with 2-Oxobutyric
acid (157 mg, 1.54 mmol) in ethanol (20 mL). Pd/C (10% Palladium in active carbon,
100 mg) was added, and the reaction mixture heated to 65°C. Air was bubbled out by
N
2 gas, and a hydrogen balloon applied to the reaction flask. The reaction was continuously
stirred for 4 hrs. After cooling down, it was filtered, and the resulting solution
purified by flash chromatography (eluting solvent: 50% EtOAc in heptanes) to give
the product as a yellow powder (90 mg, 34%).
1H NMR (300 MHz, CD
2Cl
2, δ): 7.72 (s, 1H), 7.32-7.48 (m, 10H), 4.46 (s, 2H), 4.20 (m, 2H), 2.25 (q, 2H),
0.99 (t, 3H); MS (ESI): m/z 348.3 (M+1).
[0151] 2-((3-benzyl-5-phenylpyrazin-2-yl)amino)butanoic acid was dissolved in DCM (10 mL).
Pyridine (0.5 mL) was added followed by N,N'-Dicyclohexylcarbodiimide (137 mg, 0.67
mmol). The reaction mixture was slowly stirred at room temperature for 1 hr. The solvent
was evaporated, and the residue purified by flash chromatography (eluting solvent:
EtOAc to DCM to 10% methanol in DCM) to give the product as a yellow powder (110 mg,
89%).
1H NMR (300 MHz, CD
3OD, δ): 7.26 (m, 3H), 6.84-7.07 (m, 8H), 4.03 (s, 2H), 2.47 (q, J = 9.0Hz, 2H), 0.96
(t, J = 9.0Hz, 3H); MS (ESI): m/z 330.2 (M+1).
Example 8 - Synthesis of 8-benzyl-6-phenyl-2-(3,3,3-tritluoropropyl)imidazo[1,2-a]pyrazin-3(7H)-one
[0152]

[0153] 5,5,5-trifluoro-2-oxopentanoic acid. Ethyl 4,4,4-trifluorobutyrate (1 g, 5.88 mmol) and diethyl oxalate (3.87 g, 26.5
mmol) was dissolved in ethanol. Sodium ethoxide (21% in ethanol, 2.09 g) was added
to the solution, and the reaction mixture stirred for 0.5 hrs. Solvent was distilled,
and the residue extracted with EtOAc/water. The organic layers were collected and
dried over sodium sulfate. After filtration, solvent was removed to give a clear liquid.
MS (ESI): m/z 269.1 (M-1). The liquid was then dissolved in 3N HCl (20 mL), and the
reaction mixture refluxed for 4 hrs. After cooling down, the reaction mixture was
extracted with EtOAc. The organic layers were collected and dried over sodium sulfate.
After filtration, solvent was removed, and the residue used directly in the next step.
MS (ESI): m/z 169.7 (M-1).
[0154] 5,5,5-trifluoro-2-((3-benzyl-5-phenylpyrazin-2-yl)amino)butanoic acid. 3-benzyl-5-phenylpyrazin-2-amine (240 mg, 0.92 mmol) was mixed with 5,5,5-trifluoro-2-oxopentanoic
acid (150 mg, 0.88 mmol) in ethanol (20 mL). Pd/C (10% Palladium in active carbon,
100 mg) was added, and the reaction mixture heated to 65°C. Air was bubbled out by
N
2 gas, and a hydrogen balloon applied to the reaction flask. The reaction was continuously
stirred for 4 hrs. After cooling down, it was filtered, and the resulting solution
purified by flash chromatography (eluting solvent: 50% EtOAc in heptanes) to give
the product as a yellow powder (200 mg, 54%).
1H NMR (300 MHz, CD
2Cl
2, δ): 11.45 (s, 1H), 10.20 (s, 1H), 7.94 (s, 1H), 7.34 (m, 10H), 5.34 (s, 2H), 3.96-4.23
(m, 2H), 3.02-3.28 (m, 2H); FNMR: -76.3; MS (ESI): m/z 416.1 (M+1).
[0155] Coelenterazine (R1 =
H, R2 =
-CH2CH2CF3). 5,5,5-trifluoro-2-((3-benzy)-5-phenylpyrazin-2-yl)amino)butanoic acid (100 mg, 0.24
mmol) was dissolved in DCM (10 mL). Pyridine (0.5 mL) was added followed by N,N'-Dicyclohexylcarbodiimide
(100 mg, 0.48 mmol). The reaction mixture was slowly stirred at room temperature for
1 hr. The solvent was evaporated, and the residue purified by flash chromatography
(eluting solvent: EtOAc to DCM to 10% methanol in DCM) to give the product as a yellow
powder (80 mg, 87%).
1H NMR (300 MHz, CD
2Cl
2, δ): 7.36 (m, 11H), 3.43 (s, 2H), 1.60-1.92 (m, 4H); FNMR: 67.4 (t, J = 18Hz); MS
(ESI): m/z 398.2 (M+1).
Example 9 - Synthesis of 8-benzyl-2-(furan-2-ylmethyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one
(PBI-3939)
[0156]

[0157] 8-benzyl-2-(furan-2-ylmethyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one: Synthesized from method C using 3-(furan-2-yl)-2-oxopropanoic acid and 3-benzyl-5-phenylpyrazin-2-amine
as starting materials.
1H NMR (300 MHz, dmso) δ 8.88 (s, 1H), 8.02 (d,
J = 7.9, 2H), 7.61 - 7.38 (m, 6H), 7.37 - 7.14 (m, 3H), 6.38 (s, 1H), 6.26 (d,
J = 3.2, 1H), 4.64 (s, 3H), 4.40 (s, 3H); exact mass calculated for C
24H
20N
3O
2+ m/
z+ 382.16, found
mlz+ 382.
Example 10 - Synthesis of 8-benzyl-6-phenyl-2-(thiophen-2-ylmethyl)imidazo[1,2-a]pyrazin-3(7H)-one
(PBI-3889)
[0158]

[0159] 8-benzyl-6-phenyl-2-(thiophen-2-ylmethyl)imidazo[1,2-a]pyrazin-3(7H) -one: Synthesized from method C using 2-oxo-3-(thiophen-2-yl)propanoic acid and 3-benzyl-5-phenylpyrazin-2-amine
as starting materials.
1H NMR (300 MHz, dmso) δ 8.85 (s, 1H), 7.99 (d,
J = 6.8, 2H), 7.63 - 7.02 (m, 10H), 6.94 (dd,
J = 3.5, 5.1, 1H), 4.62 (s, 2H), 4.58 (s, 2H), 2.69 (contaminate); exact mass calculated
for C
24H
20N
3OS
+ m/
z+ 398.13, found
mlz+ 398.
Example 11 - Synthesis of 8-cyclopropyl-2-(4-hydroxybenzyl)-6-phenylimidazo[1,2-a]pyraxin-3(7H)-one
(PBI-3897)
[0160]

[0161] 8-cyclopropyl-2-(4-hydroxybenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one: Synthesized using method A with 3-cyclopropyl-5-phenylpyrazin-2-amine and 3-(4-hydroxyphenyl)-2-oxopropanoic
acid as starting materials. Exact mass calculated for C
22H
18N
3O
2- m/
z- 356.14, found
mlz- 356.
Example 12 - Synthesis of 8-benzyl-2-methyl-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one (PBI-3932)
[0162]

[0163] 8-benzyl-2-methyl-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one: Synthesized using method B with 1,1-dimethoxypropan-2-one and 3-benzyl-5-phenylpyrazin-2-amine
as starting materials. Exact mass calculated for C
20H
18N
3O
+ mlz+ 316.14, found
mlz+ 316
.
Example 13 - Synthesis of 2-(4-hydroxybenzyl)-8-methyl-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one
(PBI-3896)
[0164]

[0165] 2-(4-hydroxybenzyl)-8-methyl-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one: Synthesized using method A with 3-methyl-5-phenylpyrazin-2-amine and 3-(4-hydroxyphenyl)-2-oxopropanoic
acid as starting materials.
1H NMR (300 MHz, dmso) δ 8.84 (s, 1H), 8.00 (d,
J = 7.6, 2H), 7.47 (dd,
J = 8.6, 16.2, 3H), 7.17 (d,
J = 7.3, 2H), 6.69 (d,
J = 8.4, 2H), 6.26 (s, 4H), 4.17 (s, 2H), 2.86 (s, 3H), 2.48 (s, 1H).
Example 14 - Synthesis of 8-benzyl-2-(4-hydroxybenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one
(PBI-3840)
[0166]

[0167] 8-benzyl-2-(4-hydroxybenzyl)-6-phenylimidozo[1,2-a]pyrazin-3(7H)-one: Synthesized using method A with 3-(4-hydroxyphenyl)-2-oxopropanoic acid and 3-benzyl-5-phenylpyrazin-2-amine
as starting materials, Exact mass calculated for C
26H
22N
3O
2+ mlz+ 408.17, found
mlz+ 408.
Example 15 - Synthesis of Protected Coelenterazine (Stabilized) (PBI-4377)
[0168] To a mixture of PBI-3939, potassium carbonate (1.1 equiv) and potassium iodide (1.1
equiv) in dimethylformamide (DMF), under an argon atmosphere, was added one equivalent
of chloromethyl pivalate at room temperature. Reaction progress was monitored by thin
layer chromatography, and upon completion, the reaction mixture was cooled in an ice
bath for several minutes before addition of a volume of water equal to the reaction
volume. The resulting mixture was extracted with a suitable organic solvent (e.g.,
EtOAc), and the extract was concentrated to give the crude product. The material was
further purified by chromatography over silica gel.
Example 16 - Synthesis of 8-benzyl-2-((1-methyl-1H-imidazol-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one
(PBI-4525), 8-benzyl-6-(4-hydroxyphenyl)-2-((1-methyl-1H-imidazol-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one
(PBI-4540) and 2-((1H-imidazol-2-yl)methyl)-8-benzyl-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one
(PBI-4541)
[0169]

[0170] To a flask containing 10 mmol of 2-methyl imidazole derivative 1 or 2 under an argon
atmosphere, 20 mL of dry THF was added, and the solution was cooled in a dry ice/acetone
bath to approximately -78°C. To the cold mixture, 9.3 mmol of a solution of n-butyllithium
(2.46 M in Hexanes) was added dropwise over several minutes. The resulting solution
was stirred at approximately -78°C for 30 min, and 6.7 mmol of compound 3 was added
via syringe. The reaction mixture was stirred for 3 hrs and quenched with the addition
of 20 mL saturated ammonium chloride solution and 20 mL of saturated sodium bicarbonate
solution. The cold bath was removed, and after warming to room temperature, the mixture
was extracted with 3 x 100 mL of EtOAc. The combined extracts were dried (MgSO
4), concentrated in vacuo, and the crude compounds 4 or 5 were purified by column chromatography
using silica gel (EtOAc/Heptane).
[0171] A microwave vial was charged with 100 mg (1 eq) of compound 6 or 7 and 2 equivalents
of compound 8 or 9. To the mixture, 4.5 mL of ethanol and 0.25 mL of concentrated
HCl was added. The reaction mixture was heated in a microwave at 100°C for 1.5 hr.
The resulting mixture was added to 50 mL of EtOAc and washed sequentially with 20
mL of saturated sodium bicarbonate solution and 20 mL of brine. The organic phase
was concentrated in vacuo, and the residue purified by column chromatography using
silica gel (methanol/dichloromethane) to give compounds 10-12.
Example 17 - Stability and Auto-Luminescence Characterization of Novel Coelenterazines
[0172] The stability and auto-luminescence characterization of the novel coelenterazines
PBI-3939, PBI-3889, PBI-3945, PBI-4002, or PBI-3896 were determined. Higher stability
and less auto-luminescence is an attractive technical feature in a substrate/reagent.
[0173] To determine stability, 20 µM of novel coelenterazines PBI-3939, PBI-3889, PBI-3945,
PBI-4002, or PBI-3896, 30 µM native coelenterazine, or 22 µM of known coelenterazine-h
or known coelenterazine-hh, were placed in a reporter reagent buffer containing 50
mM CDTA, 150 mM KCl, 50 mM DTT, 35 mM thiourea, 1% TERGITOL® NP-9 (v/v), and 0.1%
MAZU® DF 204. Replicate samples were incubated at room temperature (i.e., 22-24°C)
for various lengths of time and then transferred to -70°C. After all the samples were
collected and frozen, they were thawed and mixed with 10 µL of bacterial cell lysate
containing the OgLuc variant IV in 40 µL of DMEM without phenol red + 0.1% PRIONEX®.
The luminescence of the sample was read at 5 min after IV addition.
[0174] "T
90" indicates the amount of time for the luminescent signal to decay by 10% (i.e., loss
in activity by 10%) at ambient temperature, i.e., 22°C. The rate of decay of the luminescent
signal ("T
90") was determined from the slope of the linear fit of the data plotted as In RLU vs.
time, which was calculated from the following equation: t = In (A/A
0) ÷ (-k), where A = intensity at time t, A
0 = intensity at time 0, and k = the rate of decay. As shown in Table 1, the T
90 values for known coelenterazines-h and -hh, novel coelenterazines PBI-3939, PBI-3889,
PBI-3945, PBI-4002, and PBI-3896 were higher than for native coelenterazine, indicating
that these coelenterazines were more stable compounds than native coelenterazine.
[0175] To determine the auto-luminescence characterization, HEK293 cells were grown overnight
at 15,000 cells per well in DMEM + 10% FBS + pyruvate. Media was removed and replaced
with 20 µM each of the novel coelenterazines shown in FIG. 2, i.e., PBI-3939, PBI-3889,
PBI-3945, PBI-4002, PBI-3841, PBI-3897, PBI-3896, PBI-3925, PBI-3894, PBI-3932, and
PBI-3840, native coelenterazine and known coelenterazines, coelenterazine-h and coelenterazine-hh,
diluted into CO
2 independent media plus 10% FBS. Luminescence was measured shortly after substrate
addition on the GLOMAX® Luminometer (1 sec/well). Background luminescence was 154±15
RLU. Table 1 shows the auto-luminescence characterization normalized to native coelenterazine
("Autolum (norm to coel)"). While coelenterazine-h had more auto-luminescence than
native coelenterazine, all of the other coelenterazines tested had less auto-luminescence.
Table 1: Stability Experiments and Autoluminescence Characterization of IV with Various
Coelenterazines.
| Substrate ID |
Stability (pH 8) (T90 in hrs) |
Autolum (norm to coel) |
| Coel |
1.7 |
1 |
| Coel h |
2.1 |
1.2 |
| Coel hh |
2.0 |
0.3 |
| 3939 |
4.1 |
0.2 |
| 3889 |
2.9 |
0.2 |
| 3945 |
3.3 |
0.5 |
| 4002 |
3.5 |
0.6 |
| 3841 |
|
0.1 |
| 3897 |
|
0.1 |
| 3896 |
2.8 |
0.1 |
| 3894 |
|
0.2 |
| 3932 |
|
0.1 |
| 3840 |
|
0.2 |
| 3925 |
|
0.2 |
Example 18 - Toxicity of Novel Coelenterazines
[0176] The toxicity of the novel coelenterazines were investigated in HEK293 cells. HEK293
cells were grown overnight at 15,000/well in DMEM + 10% FBS + pyruvate. The media
was removed and replaced with the novel coelenterazine compounds (or DMSO control)
diluted into CO
2 independent media plus 10% FBS. Cell viability was measured 24 hrs after compound
addition using CELLTITER-GLO® assay reagent (Promega Corp.) according to the manufacturer's
instructions, and luminescence was measured on the GLOMAX® Luminometer (1 sec/well).
Table 2 shows the toxicity of the native coelenterazine, known coelenterazine-h and
coelenterazine-hh, and the novel coelenterazines PBI-3939, PBI-3889, PBI-3841, PBI-3897,
PBI-3945, PBI-4002, and PBI-3840 in HEK293 cells. With the exception of PBI-3840,
the novel coelenterazines had at least the same toxicity as coelenterazine-hh. Some
of the novel coelenterazines had the same toxicity as native coelenterazine and coelenterazine-h.
Table 2: Toxicity of Various Coelenterazines in HEK293 Cells Based on CELLTITER-GLO®
| Substrate |
Viability (normalized to vehicle (DMSO) control) (%) |
| Native coelenterazine |
100 |
| Coelenterazine h |
100 |
| Coelenterazine hh |
87 |
| PBI-3939 |
89 |
| PBI-3889 |
90 |
| PBI-3841 |
100 |
| PBI-3897 |
100 |
| PBI-3945 |
100 |
| PBI-4002 |
100 |
| PBI-3840 |
60 |
Example 19 - Km of PBI-3939
[0177] To determine the Km of PBI-3939, the OgLuc variant L27V (described in Example 26)
was purified via HALOTAG® fusion using the HALOTAG® Protein Purification System according
to the manufacturer's instructions and diluted in DMEM without Phenol Red and 0.1%
PRIONEX®. 50 µL assay buffer (100 mM MES pH 6, 35 mM Thiourea, 0.5% TERGITOL® NP-9
(v/v), 1 mM CDTA, 2 mM DTT and 150 mM KCl) with varying amounts of PBI-3939 was added
to 50 µL diluted enzyme (approximately 20 pM final enzyme concentration), and luminescence
measured at 3 min at 22°C. As the data in FIG. 3 demonstrates, the Km of PBI-3939
is approximately 10 µM.
Example 20 - Characterization of compounds PBI-4525, PBI-4540 and PBI-4541
[0178] Compounds PBI-4525, PBI-4540 and PBI-4541 were screened for their ability to detect
luminescence. For analysis, 20 µM of each compound was added to assay buffer (100
mM MES pH 6, 35 mM Thiourea, 0.5% TERGITOL® NP-9 (v/v), 1 mM CDTA, 2 mM DTT and 150
mM KCI) which was adjusted to pH 7 with 100 mM HEPES pH 7 to create an assay reagent.
The assay reagent was then mixed with 36 pM purified L27V02 enzyme (described in Example
25B), in DMEM without Phenol Red and 0.1% PRIONEX®. As a control, assay buffer with
20 µM PBI-3939 or PBI-4528 was used. Luminescence was measured as previously described
3 min after the assay reagent was added to the enzyme mixture. Table 3 demonstrates
that compounds PBI-4525, PBI-4540 and PBI-4541 can be used to detect luminescence
from a coelenterazine-utilizing luciferase.
Table 3
| cmpd |
RLU |
+/- |
| 4525 |
20,655 |
1,006 |
| 4528 |
202,080 |
5,688 |
| 3939 |
9,808,880 |
307,565 |
| 4540 |
909 |
7 |
| 4541 |
5,676 |
80 |
Example 21 - OgLuc Pattern Sequence
[0179] Enzyme families, including different classes of luciferases, can be recognized by
having common three-dimensional structures and defined catalytic activity. Because
enzyme families share evolutionary histories with other enzyme families, they will
also exhibit similarities in their three-dimensional structures. Through various means
of structural and functional analysis, the inventors have determined that OgLuc, as
a representative of decapod luciferases, has a strikingly similar three-dimensional
structure to Fatty Acid Binding Proteins (FABPs), indicating commonality of evolutionary
history. Thus, decapod luciferase may be defined as having a characteristic three-dimensional
structure similar to FABPs and utilizing coelenterazine as a substrate to catalyze
the emission of luminescence. Other luciferases, e.g., firefly luciferase,
Renilla luciferase, bacterial luciferase, and so forth, have clearly distinct three-dimensional
structures, indicating that they belong to different enzyme families and do not share
evolutionary histories. Dinoflagellate luciferase has a three-dimensional structure
exhibiting some similarities to FABPs, suggesting a shared evolutionary history, but
does not utilize coelenterazine as a substrate, and thus does not belong to the same
enzyme family as decapod luciferases.
[0180] Because amino acid sequences are not as well conserved as three-dimensional structures,
defining enzyme families based only on sequence comparisons can be difficult. For
example, even though FABPs all have a characteristic barrel-shaped three-dimensional
shape, comparisons of their amino acid sequences often reveal very low levels of sequence
identity. Nonetheless, sequence identity can be used to demonstrate commonality of
three-dimensional structures. Two proteins will have analogous three-dimensional structures
if their amino acid sequences can be aligned to reveal > 30% sequence identity, preferably
> 40% sequence identity, and most preferably > 50% sequence identity (
Chothia and Lesk, EMBO J 5(4):823-826 (1986);
Tramontano, Genomics, 4:402-405 (2003)). Thus, a protein is a decapod luciferase if, upon alignment of its amino acid sequence
with the sequence of OgLuc, the sequence identity is > 30%, preferably > 40%, and
most preferably > 50%, and the protein can utilize coelenterazine as a substrate to
catalyze the emission of luminescence.
[0181] Because of structural constraints necessary to sustain the characteristic three-dimensional
structure of an enzyme family, some portions of the amino acid sequences in an enzyme
family exhibit greater amounts of conservation (i.e., a greater level of sequence
identity). Thus, these conserved regions can serve as further evidence of a common
three-dimensional structure shared between two proteins. A conserved sequence pattern,
also called a signature, motif, or fingerprint, can be generated by manual or computational
methods that are known in the art. Patterns can be found in public databases such
as PROSITE (http://expasy.org/prosite;
Sigrist et al., Nucleic Acids Res. 38(suppl 1):D161-D166 (2010)).
[0182] For example, a pattern of conserved amino acids can be found upon examination of
a large number of known FABPs. PROSITE (Release 20.67, of 05-Oct-2010) contains an
FABP pattern (accession number PS00214, created Apr-1990, data updated Apr-2006).
This FABP pattern spans 18 amino acid positions and is defined as:
[GSAlVK]-{FE}-[FYW]-x-[LIVMF]-x-x-{K}-x-[NHG]-[FY]-[DE]-x-[LIVMFY]-[LIVM]-{N}-{G}-[LIVMAKR]
(SEQ ID NO: 329) (VI),
where:
- the standard IUPAC one-letter codes for the amino acids are used.
- the symbol 'x' is used for a position where any amino acid is accepted.
- alternative amino acids at a site are indicated by listing the amino acids between
square parentheses '[]' (for example: [ALT] represents the possibility of an Ala,
Leu, or Thr at the position).
- the absence of particular amino acids at a site is indicated by curly brackets '{}'
(for example: {AM} represents any amino acid at a position except Ala and Met).
- each sequence position (or element in the pattern) is separated from its neighbor
by'-'.
- each sequence position is referred to as a "pattern position", for example the [GSAIVK]
would be considered pattern position 1 of Formula (VI), {FE} is considered pattern
position 2 of Formula (VI), etc.
[0183] Although a conserved sequence pattern results from a common underlying three-dimensional
structure, some changes to the sequence pattern may be allowed without disruption
to the three-dimensional structure. For example, for some members of the FABP family,
differences are found at four sites in the PROSITE pattern. These additional members
of the FABP family include five proteins listed in PROSITE as false negative hits,
i.e., FABP protein family members not picked up by the FABP pattern (UniProt database
accession numbers FBP12_HUMAN, FABP1_FASGI, FABP2_FASHE, FABPL_SCHBI, RET5_BOVIN)
and one protein known to have an FABP fold (Protein Data Bank accession number 2A02).
Although OgLuc shares a closely similar three-dimensional structure with FABPs, the
sequence patterns of the native and variant amino acid sequences also differ slightly,
having differences at 5 positions from the PROSITE pattern. In various embodiments,
the pattern in OgLuc begins at a position corresponding to position 8 of SEQ ID NO:
1. An amino acid substitution, deletion, or insertion the sequence pattern is counted
as a difference.
[0184] Combining the sequence information from these additional FABPs and the OgLuc variants,
an improved sequence pattern can be derived:
[GSAIVK]-{FE)-[FYW]-x-[LIVMFSYQI-x-x-{K}-x-[NFIGK]-x-[DE]-x-[LIVMFY]-[LIVMWF]-x-{G}-[LIVMAKRG]
(SEQ ID NO: 330) (VII).
[0185] The sequence information used to derive this pattern is shown in Table 4. Column
1 identifies the pattern position (listed N- to C-terminus; pattern length is 18 amino
acids), and column 6 identifies the corresponding sequence position in OgLuc (numbering
according to SEQ ID NO: 1). Column 2 shows the PROSITE FABP pattern (Formula (VI))
element for each pattern position. Column 3 lists amino acids present in six FABP
family members that are not represented by the PROSITE FABP pattern. Column 4 lists
amino acids present in OgLuc (SEQ ID NO: 1) or OgLuc variants that are not represented
by the PROSITE pattern. Column 5 lists the improved pattern ("OgLuc pattern") (Formula
(VII)) created by merging pattern information from columns 2, 3, and 4. Column 7 lists
the amino acids in OgLuc (SEQ ID NO: 1) corresponding to the PROSITE FABP pattern
positions. Column 8 lists the amino acids found in dinoflagellate luciferase sequences
(8 different species) at positions corresponding to the improved pattern (GenBank
accession numbers 2021262A, AAA68491, AAC36472, AAV35379, AAV35380, AAL40676, AAL40677,
AAV35378, AAV35377, AAV35381, and Protein Data Bank accession number 1 VPR).
[0186] The improved pattern (Formula (VII)) serves as an indication (i.e., a fingerprint)
of the three-dimensional protein structure shared between FABPs and OgLuc. However,
strict agreement with this pattern is not needed to indicate commonality of the three-dimensional
structure. From the examples given here, a common three-dimensional structure may
exist even with as many as 5 changes in the pattern. Also, for example, although the
dinoflagellate luciferase has a similar three-dimensional structure to FABPs and OgLuc,
it has 4 differences from the improved pattern.
[0187] Thus, although a protein may be recognized as being a decapod luciferase based on
sequence similarity and utilization of coelenterazine for luminescence, it can be
further recognized by also having the improved sequence pattern. Specifically, a protein
is a decapod luciferase if, upon alignment of its amino acid sequence with SEQ ID
NO: 1 or variants thereof, the sequence identity is > 30%, preferably > 40%, and most
preferably > 50%, and the protein can utilize coelenterazine as a substrate to catalyze
the emission of luminescence, and the amino acid sequence beginning at the position
corresponding to position 8 of SEQ ID NO: 1 is:
[GSAIVK]-{FE}-[FYW]-x-[LIVMFSYQ]-x-x-{K}-x-[NHGK]-x-[DE]-x-[LIVMFY]-[LIVMWF]-x-{G}-[LIVMAKRG]
(SEQ ID NO: 330) (VII),
[0188] with no more than 5 differences, or more preferably no more than 4, 3, 2, or 1 difference,
or most preferably no differences, wherein the differences occur in positions corresponding
to pattern position 1, 2, 3, 5, 8, 10, 12, 14, 15, 17, or 18 of Formula (VII) according
to Table 4. Differences may also include gaps or insertions between the pattern positions
of Table 4.
Table 4: Protein sequence patterns
| Pattern position |
PROSITE FABP pattern PS00214 |
Other FABPs |
OgLuc wt & variants |
OgLuc pattern |
OgLuc position |
OgLuc wt sequence |
Dinofl. Luc |
| 1 |
[GSAIVK] (SEQ ID NO: 427) |
|
|
[GSAIVK] (SEQ ID NO: 579) |
8 |
G |
G |
| 2 |
{FE} |
|
|
{FE} |
9 |
D |
R |
| 3 |
[FYW] |
|
|
[FYW] |
10 |
W |
W |
| 4 |
x |
|
|
x |
11 |
Q |
I |
| 5 |
[LIVMF] (SEQ ID NO: 590) |
SY |
Q |
[LIVMFSYQ] (SEQ ID NO: 591) |
12 |
Q |
T |
| 6 |
x |
|
|
x |
13 |
T |
[VI] |
| 7 |
x |
|
|
x |
14 |
A |
S |
| 8 |
{K} |
|
|
{K} |
15 |
G |
G |
| 9 |
x |
|
|
x |
16 |
Y |
G |
| 10 |
[NHG] |
K |
|
(NHGK] (SEQ ID NO: 580) |
17 |
N |
Q |
| 11 |
[FY] |
SILM (SEQ ID NO: 581) |
{FY} |
x |
18 |
Q |
[AVTK] (SEQ ID NO: 582) |
| 12 |
[DE] |
|
|
[DE] |
19 |
D |
[AE] |
| 13 |
x |
|
|
x |
20 |
Q |
F |
| 14 |
[LIVMFY] (SEQ ID NO: 583) |
|
|
[LIVMFY] (SEQ ID NO: 584) |
21 |
V |
I |
| 15 |
[LIVM] (SEQ ID NO: 585) |
W |
F |
[LIVMWF] (SEQ ID NO: 586) |
22 |
L |
K |
| 16 |
{K} |
|
K |
x |
23 |
E |
[EKTQ] (SEQ ID NO: 587) |
| 17 |
{G} |
|
|
{G} |
24 |
Q |
[AV] |
| 18 |
[LIVMAKR] (SEQ ID NO: 586) |
|
G |
[LIVMAKRG] (SEQ ID NO: 589) |
25 |
G |
[VI] |
Example 22 - Generation of OgLuc Variants
Experimental Details
[0190] Further variants of a starting OgLuc variant having specific mutations were generated
using the oligo-based site-directed mutagenesis kit QuikChange Site-Directed Mutagenesis
Kit (
Stratagene; Kunkel, PNAS USA, 82(2):488 (1985)), according to the manufacturer's instructions.
[0191] The resulting variants were constructed in the context of pF1K FLEXI® vector for
T7 promoter-based expression (Promega Corp.). Alternatively, the resulting variants
were constructed in the context of pF4Ag vector (a version of the commercially-available
pF4A (Promega Corp.), which contained T7 and CMV promoters modified to contain an
E. coli ribosome-binding site with or without a C-terminal HALOTAG® (Promega Corp.; referred
herein as "HT7") (
Ohana et al., Protein Expression and Purification, 68:110-120 (2009)) to generate a fusion protein. For example; to obtain C1+A4E variants, NNK saturation
mutagenesis experiments were performed in a pFIK vector background. The C1+A4E library
was generated in a pF4Ag vector background with no HT7. The QC27, QC27-9a, and IVY
libraries were generated in a pF4Ag vector background with a C-terminal HT7. The IV-based
variants were generated in a pF4Ag vector background without HT7. The resulting vectors
were used to transform KRX
E. coli using techniques known in the art.
[0192] Generated OgLuc variants are named for the amino acid substitutions identified in
the variant and/or for the
E. coli clone that contained the variant, e.g., FIG. 6A shows, among other results, that
E. coli clone 16C5 has the substitution Q20R.
Screening Details
[0193] Resulting libraries were expressed in
E. coli and primarily screened with a robotic system for OgLuc variants having increased
light output (i.e., increased luminescence, increased brightness, or increased light
emission) or a change in relative specificity compared to the corresponding starting
OgLuc variant. The robotic primary screen was conducted as follows: individual colonies
from the generated library were used to inoculate minimal media in 96-well plates
and grown at 37°C for 17 to 20 hrs ("M1 culture"). The M1 culture was diluted 1:20
with fresh minimal media and grown at 37°C for 17 - 20 hrs ("M2 culture"). The M2
culture was diluted 1:20 into induction media and grown 17-20 hrs at 25°C with walk-away
induction, i.e., autoinduction (
Schagat et al., "KRX Autoinduction Protocol: A Convenient Method for Protein Expression."
Promega Notes, 98:16-18 (2008)). The induction media contained rhamnose and glucose when novel coelenterazines
PBI-3841, PBI-3842, PBI-3857, PBI-3880, PBI-3881, PBI-3886, PBI-3887, PBI-3897, PBI-3896,
or PBI-3894 were used as substrates in the primary screen. The induction media did
not contain rhamnose or glucose when native coelenterazine, known coelenterazine-h,
or novel coelenterazines PBI-3840, PBI-3889, PBI-3899, or PBI-3900 were used as substrates
in the primary screen. The use of the different induction media was determined based
on the luminescence generated between C1+A4E and the novel coelenterazines, i.e.,
the induction media containing rhamnose and glucose were used with novel coelenterazines
that generated less luminescence with C1+A4E compared to the other novel coelenterazines
with C1+A4E.
[0194] Ten µL of induced cells were lysed using 60 µL lysis buffer containing 300 mM HEPES
pH 8.0, 300 mM thiourea, 0.3X Passive Lysis Buffer ("PLB"; Promega Corp. Cat. No.
E194A), 0.3 mg/mL lysozyme, and 0.003 U/µL RQ1 DNase and measured for luminescence
with 50 µL assay buffer containing 150 mM KCl, 1 mM CDTA, 10 mM DTT, 0.5% TERGITOL®
NP-9 (v/v), and 20 µM of a native, known, or novel coelenterazine as a substrate.
Luminescence measurements for each variant were taken 3 min after reagent addition
and relative luminescence unit (RLU) values were normalized to an average of 8 control
wells of the corresponding starting OgLuc variant for each plate. Assay was completed
on a TECAN® robotic system.
[0195] OgLuc variants of interest were sequenced using standard sequencing techniques known
in the art to identify any additional amino acid substitutions in each such variant.
A secondary screen using a non-robotic (manual) system was performed on the variant
clones of interest. The manual screen was conducted as follows: Variant clones were
grown, in triplicate, in 96-well plates and expressed and assayed as described for
the automated assay except the assay buffer was added manually with a multichannel
pipette. For each variant, luminescence was measured, averaged, and normalized to
the corresponding starting OgLuc variant. Luminescence measurements were made using
a TECAN® INFINITE® F500 luminometer.
Determining Change in Relative Specificity
[0196] Relative substrate specificity was determined by dividing the luminescence of a luciferase
in the presence of a test coelenterazine substrate by the luminescence of the luciferase
in the presence of a reference coelenterazine substrate. For example, relative specificity
was determined by dividing the luminescence of a luciferase with a novel coelenterazine
of the present invention by the luminescence of the luciferase with a different coelenterazine
(e.g., native or known coelenterazine, or a different novel coelenterazine of the
present invention). The test coelenterazine substrate and the reference coelenterazine
substrate that were compared were considered a comparison substrate pair for determining
relative substrate specificity.
[0197] A change in relative substrate specificity was determined by dividing the relative
substrate specificity of a test luciferase using a comparison substrate pair by the
relative substrate specificity of a reference luciferase using the same comparison
substrate pair. For example, a change in relative specificity was determined by dividing
the relative substrate specificity of a test luciferase with a novel coelenterazine
of the present invention compared to a different coelenterazine (e.g., native or known
coelenterazine or a different novel coelenterazine of the present invention), by the
relative substrate specificity of a reference luciferase with the same novel coelenterazine
of the present invention compared to the same different coelenterazine used for the
test luciferase.
[0198] The luminescence with one novel coelenterazine was compared to the luminescence with
a different novel coelenterazine. The luminescence with one native or known coelenterazine
was compared to the luminescence with another native or known coelenterazine. The
luminescence with one native or known coelenterazine was compared to the luminescence
with a novel coelenterazine.
[0199] An increase in luminescence (RLUs) for the OgLuc variant compared to the corresponding
starting OgLuc template for novel coelenterazine and a decrease or no change in luminescence
for a reference coelenterazine was indicative of a change in relative specificity.
A decrease in luminescence of an OgLuc variant for both the novel and reference coelenterazines
compared to the corresponding starting OgLuc, but the luminescence of the OgLuc variant
with the novel coelenterazine decreasing more, was also indicative of a change in
relative specificity. An increase in luminescence of the OgLuc variant compared to
the corresponding starting OgLuc for the novel and reference coelenterazines indicated
an improvement in activity/stability/expression. If the luminescence of the OgLuc
variant with both the novel and the reference coelenterazines increased, but the increase
in luminescence with the novel coelenterazine was greater, it indicated an increase
in relative specificity and an improvement in activity/stability/expression of the
OgLuc variant.
A. C1+A4E Variants
[0200] C1+A4E (SEQ ID NOs: 2 and 3), previously described in
U.S. Serial Application No. 12/773,002 (
U.S. Published Application No. 2010/0281552), was used as a primary starting sequence (i.e., the parental sequence) for generating
additional, synthetic OgLuc variants. C1+A4E has the following amino acid substitutions:
A4E, Q11R, A33K, V441, A54F, P115E, Q124K, Y138I, and N166R, relative to SEQ ID NO:
1. Luminescence of C1+A4E containing bacterial lysates, using the novel coelenterazines
described in Examples 1-14 (see FIG. 4 for examples) as substrates, was measured as
described previously and compared to the luminescence using native and known coelenterazines
as substrates (FIGS. 5A-G). FIG. 5A shows the luminescence of C1+A4E using native
coelenterazine ("coelenterazine"), known PBI-3880, and novel coelenterazines PBI-3842,
PBI-3857, PBI-3881, PBI-3882, PBI-3886, and PBI-3887 as substrates. The luminescence
measurements using known and novel coelenterazines were normalized to the luminescence
of C1+A4E using native coelenterazine and the fold-decrease compared to native coelenterazine
(FIG. 5B). FIGS. 5C-E show the luminescence of C1
+A4E using native coelenterazine and novel coelenterazines PB1-3945, PBI-3894, and
PBI-4002, respectively. FIG. 5F shows the luminescence of C1+A4E using native coelenterazine
and novel coelenterazines PBI-3840, PBI-3897, PBI-3889, PBI-3899, and PBI-3900. FIG.
5G shows the luminescence of C1
+A4E using native coelenterazine, known coelenterazine PBI-3912 and novel coelenterazines
PBI-3913, PBI-3925, PBI-3939, PBI-3933, PBI-3932, PBI-3946, PBI-3841, and PBI-3896.
The data indicates the C1
+A4E variant can use each of the novel coelenterazines as substrates.
[0201] C1
+A4E variants were generated that had at least the amino acid substitutions identified
in C1+A4E, unless otherwise indicated. A library (Library 1) of 4400 variant clones
of C1+A4E was generated by random mutagenesis as described previously and screened
as described previously for improvement in relative specificity change and/or activity
change, e.g., brightness. The variants were primarily screened with native coelenterazine,
known coelenterazine-h, known PBI-3880, and novel coelenterazines PBI-3840, PBI-3841,
PBI-3842, PBI-3857, PBI-3881, PBI-3886, PBI-3887, PBI-3889, PBI-3897, and PBI-3900
as substrates. In addition, half of the variants were screened with novel coelenterazines
PBI-3896 and PBI-3894 as substrates. Plates containing variants having known mutations
of interest identified from screening previous novel compounds were selected. Variants
that showed improvement (either relative specificity change or activity change) for
one or more of the novel coelenterazines tested in the primary screen were isolated,
sequenced, and screened in a secondary screen.
[0202] In the secondary manual screen, the variants were tested with known coelenterazines
PBI-3912, coelenterazine-h, coelenterazine-hh, 2-methyl coelenterazine, and coelenterazine
v; and novel coelenterazines PBI-3840, PBI-3897, PBI-3889, PBI-3899, PBI-3900, PBI-3925,
PBI-3944, PBI-3932, PBI-3945, PBI-3913, and PBI-3896 as substrates. FIGS. 6A-D summarize
the average luminescence normalized to C1
+A4E for the variants ("Clone"). FIGS. 6A-D summarize the substitutions in these variants
("AA sequence"), which had at least one of the following additional amino acid substitutions:
A14V, G15R, Q18L, Q20R, L22I, E23K, L27V, L27M, K33N, T39I, E49K, F54S, F54I, D55G,
I56V, V58I, V58L, I59T, S66T, G67S, F68S, L72Q, M75K, I76N, F77T, F77C, K89E, 190V,
I90T, L92H, H93R, M106K, Y109F, P113T, I117F, T126R, V127A, L136M, D139G, P145L, S148T,
C164S, or A169V.
[0203] Amino acid substitutions at position 54, 92, and 109 were of interest as substitutions
at these positions provided greater light output or improved relative specificity,
i.e., specificity away from native coelenterazine and towards at least one novel coelenterazine,
as shown in FIGS. 6A-C. The amino acid substitution F54I in clone 29H7 provided greater
light output with native coelenterazine and several of the novel coelenterazines.
The amino acid substitution Q18L in clone 40H11, the amino acid substitution L92H
in clone 04A12, and the amino acid substitution Y109F in clone 43F9 provided improved
relative specificity.
[0204] Table 5 lists C1
+A4E variants with an additional amino acid substitution at position 77, 92, or 109
("AA change"), generated as described previously. These variants were analyzed for
increased light output as described previously, i.e., screened for variants that were
at least 1.3x brighter than C1+A4E, using native coelenterazine, known coelenterazine-hh,
and novel coelenterazines PBI-3939, PBI-3894, PBI-3896, PBI-3897, PBI-3932, or PBI-3925
as a substrate. The following additional substitutions yielded a variant that was
at least 1.3x brighter than C1+A4E: L92G, L92Q, L92S, L92A, L92M, L92H, L92Y, F77W,
F77Y, F77S, F77T, F77V,, F77A, F77G, F77C, F77D, F77M, and Y109F. As shown in Table
5, L92H, F77W and F77A substitutions had the most dramatic improvements with PBI-3897,
PBI-3896, and PBI-3932.
Table 5: Site Saturation of Positions 77, 92 and 109
| AA Change |
native |
hh |
PBI-3939 |
PBI-3894 |
PBI-3896 |
PBI-3897 |
PBI-3932 |
PBI-3925 |
| L92G |
2.2 |
|
|
|
|
|
|
|
| L92Q |
2 |
1.8 |
1.6 |
1.3 |
1.4 |
2.8 |
1.4 |
3.4 |
| L92S |
2.9 |
|
|
|
1.5 |
2.9 |
2.7 |
6 |
| L92A |
2.5 |
1.3 |
|
|
|
|
|
|
| L92M |
|
1.3 |
|
|
|
|
|
|
| L92H |
|
|
|
2.2 |
21 |
9.1 |
3.4 |
5.9 |
| L92Y |
|
|
|
|
|
|
|
2.5 |
| F77W |
1.4 |
|
1.4 |
1.4 |
8.3 |
3.2 |
1.7 |
2.3 |
| F77Y |
|
|
|
|
1.6 |
1.3 |
4.9 |
6.5 |
| F77S |
|
|
|
|
|
|
2.6 |
|
| F77T |
|
|
|
|
|
|
2.3 |
|
| F77V |
|
|
|
|
|
|
2.3 |
|
| F77A |
|
|
|
|
|
|
7.9 |
2.5 |
| F77G |
|
|
|
|
|
|
3.1 |
|
| F77C |
|
|
|
|
|
2.3 |
2.3 |
|
| F77D |
|
|
|
|
|
|
1.5 |
|
| F77M |
|
|
|
|
|
|
1.5 |
1.6 |
| Y109F |
|
|
|
|
1.34 |
14 |
|
|
[0205] Additional C1+A4E variants (Group A) were generated by site-directed mutagenesis
as described previously to have an additional substitution in at least one of the
following amino acid positions relative to SEQ ID NO: 1: 18, 20, 54, 59, 72, 77, 89,
92, 109, 113, 127, 136, or 164. These amino acid positions were chosen because, based
on the primary and secondary screens of Library 1, substitutions at these positions
had increased total light output compared to C1+A4E using at least one of the following
as a substrate: novel coelenterazines PBI-3841, PBI-3896, PBI-3897, PBI-3894, PBI-3925,
or PBI-3932, or known coelenterazines 2-methyl coelenterazine or PBI-3912. FIG. 7
lists the variants ("Clone") and the additional amino acid substitutions contained
in each variant. Variant clones were assayed in triplicate as described for the secondary
manual screen as described previously and normalized to C1+A4E. FIGS. 8A-B and 9 show
the normalized average luminescence of the variants listed in FIG. 7 with various
coelenterazines as substrates. FIGS. 8A-B and 9 show variants with either large increases
in luminescence for the listed novel compounds compared to C1+A4E or no change or
a decrease in luminescence for the known coelenterazine compared to C1+A4E. Clone
QC27, which has additional amino acid substitutions Q18L, F54I, L92H, and Y109F, had
a 561.32-fold-increase in luminescence with PBI-3896, a 392.98-fold-increase with
PBI-3894, and a 283.85-fold-increase with PBI-3896 compared to C1+A4E. This data shows
that Q18L, L92H, and Y109F can be combined with each other and with additional substitutions
to result in variants with improved relative specificity.
[0206] Other substitutions of interest identified from Library 1 were combined to generate
additional variants (Group B) (FIG. 10). Additional amino acid substitutions were
made in at least one of the following amino acid positions relative to SEQ ID NO:
1: 18, 20, 54, 71, 77, 90, 92, 109, or 127. These substitutions showed improvement
with at least one of the following novel coelenterazines as a substrate: PBI-3841,
PBI-3896, PBI-3897, PBI-3894, PBI-3925, or PBI-3932. These variants were assayed as
described for Group A variants using native coelenterazine, known coelenterazine-hh,
and novel coelenterazines PBI-3939, PBI-3945, PBI-3840, PBI-3932, PBI-3925, PBI-3894,
and PBI-3896. Variant clones were assayed in triplicate as described for the secondary
manual screen as described previously and normalized to C1+A4E. FIG. 11 shows the
normalized average luminescence of the variants listed in FIG. 10 with the various
coelenterazines as substrates. FIG. 11 shows variants with either large increases
in luminescence for the listed novel coelenterazines compared to C1+A4E or no change
or a decrease in luminescence for the native and known coelenterazine compared to
C1+A4E.
[0207] Additional variants were generated with the additional amino acid substitution I90V
and/or Y109F (Group C) and compared to variants generated from Group A or B (see FIG.
12). Clones containing variants with an I90.V substitution ("I90V"), a Y109F substitution
("YI09F"), or both substitutions ("LE2") were compared to clones QC #27, QC#2 E7,
QC#2 F4, and QC#1 A11 using assays as described for Group A recombinants with native
coelenterazine, known coelenterazine-hh, and novel coelenterazines PBI-3939, PBI-3945,.
PBI-3889, PBI-3840, PBI-3925, PBI-3932, PBI-3894, PBI-3896, and PBI-3897 as substrates
(FIG. 12). Variant clones were assayed in triplicate as described for the secondary
manual screen as previously described and normalized to C1+A4E (FIG. 12). FIG. 12
shows variants with either large increases in luminescence for the listed novel coelenterazines
compared to C1+A4E and no change or a decrease in luminescence for the native or known
coelenterazine compared to C1+A4E. FIG. 12 shows that I90V provided greater light
output for native coelenterazine and several of the novel substrates.
B. QC27 Variants
[0208] The variant QC27 (SEQ ID NOs: 4 and 5) from A, which has additional amino acid substitutions
Q18L, F54I, L92H, and Y109F, was cloned into a pF4A modified vector as described previously
to create a C-terminal HT7 (Promega Corp.) fusion protein ("QC27-HT7") (SEQ ID NOs:
44 and 45). 4400 variants of QC27-HT7 (Library 2) were generated by random mutagenesis
as described previously, and primarily screened for increased relative specificity
change as described previously using native coelenterazine and novel coelenterazines
PBI-3896 and PBI-3897 as substrates. Variant clones were selected, sequenced, and
assayed in a secondary manual screen as described previously using native coelenterazine,
known coelenterazine-hh, and novel coelenterazines PBI-3897, PBI-3896, and PBI-3894
as substrates.
[0209] FIG. 13 lists the additional amino acid substitutions ("Sequence") identified in
these variants ("Sample"), and the luminescence of the variants using native coelenterazine,
known coelenterazine-hh, and novel coelenterazines PBI-3897, PBI-3896, and PBI-3894
as substrates in the secondary screen normalized to the corresponding starting QC27-HT7.
The variants in FIG. 14, had at least one of the following additional amino acid substitutions:
F1I, R11Q, L18I, L18Q, V21L, V21M, L22F, F31I, Q32H, V45E, L46Q, S47P, G48R, E49D,
G51E, D55E, G67S, F68Y, F68L, Q69H, L72Q, E74K, E74I, M75K, I76F, I76V, H86R, I90T,
H92Q, H92R, T96A, V98F, I99V, I99T, V102M, M106I, F109Y, L142V, V158I, T159S, L168F,
or G170R (the G170R is located in the linker region between HT7 and the OgLuc variant).
[0210] The amino acid substitutions F68Y in variant 24B12, L72Q in variant 29C4, and M75K
in variant 3H11 each provided greater light output for native coelenterazine and several
of the novel substrates. The amino acid substitutions V21L in variant 25A11 and H92R
in variant 1B6 provided improved relative specificity. Both of these substitutions
were cases where luminescence signals were down using the novel coelenterazines as
substrates, but were down more using native and known coelenterazines as substrates.
[0211] Additional QC27-HT7 variants were generated to have specific amino acid substitutions
(FIG. 14) using site-directed mutagenesis as described previously. Additional substitutions
were made in at least one of the following amino acid positions relative to SEQ ID
NO: 1: 21, 68, 72, 75, 76, 90, 92, and 158, as these positions showed improvement
in relative specificity change as shown in FIG. 14. FIG. 15 shows the luminescence
of the QC27-HT7 variants using native coelenterazine, known coelenterazine-hh, and
novel coelenterazines PBI-3897, PBI-3841, PBI-3896, and PBI-3894 as substrates normalized
to the corresponding starting QC27-HT7. As seen in FIG. 15, combining the three amino
acid substitutions F68Y, L72Q, and M75K with V158I, as for example in variant QC27#1,
provided greater light output for each coelenterazine tested.
C. QC27-9a Variants
[0212] The variant QC27-9a (SEQ ID NOs: 6 and 7) from B, a QC27-HT7 fusion protein with
additional amino acid substitutions V21L, H29R, F68Y, L72Q, M75K, and V158I, was used
as a starting sequence to generate a library. 4400 variants of QC27-9a (Library 3)
were generated by random mutagenesis as described previously and screened for increased
relative specificity change using native coelenterazine and novel coelenterazines
PBI-3841 and PBI-3897. Variant clones were selected, sequenced, and assayed in a secondary
manual screen as described previously using native coelenterazine, known coelenterazine-hh,
known coelenterazine-h, and novel coelenterazines PBI-3841 and PBI-3897 as substrates.
FIG. 16 lists the additional substitutions ("AA change") identified in the variants
("Sample"), and the average luminescence of the variants using native coelenterazine,
known coelenterazine-hh, known coelenterazine-h, and novel coelenterazines PBI-3841
and PBI-3897 as substrates in the secondary screen normalized to the corresponding
starting QC27-9a. The increase in relative specificity represents cases where there
was a decrease in luminescence for the variant with the novel, native, and known coelenterazines
compared to the starting template, but luminescence with the native and known coelenterazines
decreased more. For example, the variant 30D12 with the amino acid substitution L22F
had an approximately three-fold loss in activity with the novel coelenterazines PBI-3841
and PBI-3897. However, with native coelenterazine, known coelenterazine-h, and known
coelenterazine-hh, the luminescence of the variant 30D12 was down by ten-fold or more.
[0213] FIG. 17 shows a comparison of the luminescence of C1+A4E, QC27-HT7 and QC27-9a compared
to humanized
Renilla luciferase (referred herein as "hRL") (SEQ ID NOs: 30 and 31) using native coelenterazine,
known coelenterazine-hh, and novel coelenterazines PBI-3841 and PBI-3897 as substrates.
Although the reaction of QC27-9a with PBI-3897 was brighter than QC27-9a with PBI-3841
(see FIG. 17), the evolution trend, i.e., magnitude of improvement in luminescence,
was greatest for PBI-3841 (Table 6). Combining the improvement in luminescence (440-fold)
with the decrease in luminescence for native coelenterazine (800-fold) indicated a
change in relative specificity (350,000-fold) of QC27-9a using PBI-3841 compared to
native coelenterazine.
Table 6: The Change in Relative Specificity of the OgLuc Variants for PBI-3897 and
PBI-3841 Compared to Native Coelenterazine and coelenterazine-hh.
| Compound |
Evolution trend: C1A4E to QC27 #9a |
Change in relative specificity (novel coelenterazine/native coelenterazine) |
| coelenterazine |
DOWN 800X |
|
| coelenterazine-hh |
DOWN 300X |
|
| PBI-3897 |
UP 100X |
80,000X |
| PBI-3841 |
UP 440X |
350,000X |
D. IVY Variants
[0214] IVY (SEQ ID NOs: 8 and 9), a C1
+A4E variant with additional amino acid substitutions F54I, I90V, and F77Y, was cloned
into a pF4A modified vector as described previously to create a C-terminal HT7 fusion
protein ("IVY-HT7"). 4400 variants of IVY-HT7 (Library 4) were generated by random
mutagenesis and screened for increased light output (i.e., increased brightness) and
increased relative specificity using native coelenterazine, known coelenterazine-hh,
and novel coelenterazines PBI-3840, PBI-3889, PBI-3925, PBI-3932, and PBI-3945 as
substrates. Variant clones were selected, sequenced, and assayed in triplicate in
a secondary screen as described previously using native coelenterazine, known coelenterazine-hh,
and novel coelenterazines PBI-3889, PBI-3939, PBI-3945, and PBI-4002 as substrates.
FIGS. 18 and 19 lists the additional substitutions ("AA change") identified in the
variants ("Sample") and the average luminescence of the variants normalized to IVY-HT7
using native coelenterazine, known coelenterazine-hh, and novel coelenterazines PBI-3889,
PBI-3939, PBI-3945, and PBI-4002 as substrates in the secondary screen. FIG. 18 lists
those variants chosen based on performance with PBI-3945 (Group A), which had at least
one of the following amino acid substitutions: Q18H, D19N, Q20P, Q32P, K33N, V38I,
V38F, K43N, I44F, E49G, I60V, Q69H, I76N, Y77N, Y94F, G95S, G95D, F110I, V119M, K124M,
L149I, or R152S. FIG. 19 lists those variants chosen based on performance with PBI-3889
(Group B), which had at least one of the following amino acid substitutions: F6Y,
Q18L, L27V, S28Y, Q32L, K33N, V36E, P40T, Q42H, N50K, G51R, H86L, N135D, or I155T.
[0215] Additional IVY-HT7 variants were generated to have additional specific amino acid
substitutions using site-directed mutagenesis as described previously. FIG. 20 lists
variants with at least one of the following additional amino acid positions relative
to SEQ ID NO: 1: 19, 20, 27, 32, 38, 43, 49, 58, 77, 95, 110, and 149, as these substitutions
were identified in the variants of FIG. 18, which showed specificity towards PBI-3945
and PBI-4002. FIG. 21 shows the luminescence of the variants listed in FIG. 20 normalized
to IVY-HT7 using native coelenterazine, known coelenterazine-h, known coelenterazine-hh,
and novel coelenterazines PBI-3939, PBI-3945, PBI-4002, PBI-3932 and PBI-3840 as substrates.
None of the variants showed an improvement over IVY-HT7, but there were instances,
such as variant C5.19 (SEQ ID NOs: 12 and 13) where luminescence with native or a
known coelenterazine decreased about 3-4 logs, but luminescence with PBI-3945 and
PBI-4002 decreased only two-fold. Variant C5.19 has additional amino acid substitutions
L27V, V38I, and L149I.
[0216] FIG. 22 lists variants with at least one of the following additional amino acid positions
relative to SEQ ID NO: 1: 6, 18, 27, 28, 33, 34, 36, 40, 50, 51, 135, and 155, as
these substitutions were identified in the variants of FIG. 19, which showed specificity
towards PBI-3889 and PBI-3939. FIG. 23 shows the luminescence of the variants listed
in FIG. 21 using native coelenterazine, known coelenterazine-h, known coelenterazine-hh,
and novel coelenterazines PBI-3939, PBI-3945, PBI-3889, PBI-4002, PBI-3932, and PBI-3840
as substrates normalized to IVY-HT7. Luminescence decreased for each of the variants
compared to IVY-HT7. Variant C1.3 (SEQ ID NOs: 10 and 11) had about 2000-fold more
luminescence with PBI-3939 than with native or known coelenterazine. Variant CI.3
has additional amino acid substitutions F6Y, K33N, N135D, and I155T.
[0217] The best IVY-HT7 variants for relative specificity change compared to hRL and IVY-HT7
were C5.19, which had the best luminescence with PBI-3945, and C1.3, which had the
best luminescence with PBI-3889. FIG. 24 shows the luminescence of hRL, IVY-HT7, C5.19
(a C-terminal HT7 fusion), and C1.3 (a C-terminal HT7 fusion) with native coelenterazine,
known coelenterazine-h, known coelenterazine-hh, and novel coelenterazines PBI-3939
and PBI-3945.
E. IV Variants
[0218] IV (SEQ ID NOs: 14 and 15), a C1
+A4E variant with additional amino acid substitutions F54I and I90V, was generated
as previously described. To determine the brightest variant for use as a transcriptional
reporter, luminescence was measured as described previously provided for C1+A4E (SEQ
ID NOs: 2 and 3), IVY (SEQ ID NOs: 8 and 9), and IV (SEQ ID NOs: 14 and 15) using
native coelenterazine, known coelenterazine-hh, and novel coelenterazines PBI-3939,
PBI-3945, PBI-3889, and PBI-4002 as substrates. hRL was used as a control. As seen
in FIG. 25, IV was brighter than both CI+A4E and IVY. The amino acid substitution
F54I in IV provided greater light output for native coelenterazine and several of
the novel substrates. All three variants were brighter than hRL with the tested coelenterazines.
[0219] The data from A, B and D (i.e., screenings of the libraries generated from C1+A4E,
IVY, and QC27 as the starting sequences) were reviewed to determine those additional
amino acid substitutions with increased light output (i.e., increased brightness)
with a variety of coelenterazines. IV variants were generated as described previously
to have additional substitutions which had reduced specificity for native coelenterazine
by two- to ten-fold. As listed in FIG. 26, the IV variants ("clone") had an additional
amino acid substitution ("Sequence") of at least one of the following amino acid substitutions:
F1I, E4K, Q18L, L27V, K33N, V38I, F68Y, M70V, L72Q, M75K, or V102E.
[0220] Sixteen plates of variant clones for all combinations of amino acid substitutions
were primarily screened and assayed using the automated robot method described previously
with native coelenterazine, known coelenterazine-h, known coelenterazine-hh, and novel
coelenterazines PBI-3889 and PBI-3945 as substrates. Variants with improved luminescence
were selected, sequenced, and assayed in triplicate using the manual screen as described
previously. Luminescence was measured using native coelenterazine, known coelenterazine-h,
known coelenterazine-hh, and novel coelenterazines PBI-3889, PBI-3939, PBI-3945, and
PBI-4002 as substrates. Corresponding starting sequences IV and hRL were used as controls.
[0221] FIG. 26 lists the variants, and the additional amino acid substitutions identified
in the variants. FIG. 27 shows the average luminescence of the variants in the secondary
screen normalized to IV. Variant 8A3 (SEQ ID NOs: 26 and 27), which has additional
amino acid substitutions F1I, L27V, and V38I, had improved relative specificity with
novel coelenterazines, but was not brighter than IV. Variant 8F2 (SEQ ID NOs: 46 and
47), which has additional amino acid substitution L27V, offered improved relative
specificity and brightness with 3 of the 4 novel coelenterazines used. Variant 9B8
(SEQ ID NOs: 18 and 19), which has additional amino acid substitutions Q18L, F68Y,
L72Q, and M75K, was brighter for all substrates and offered some relative specificity
advantage over native coelenterazine as well. Variant 9F6 (SEQ ID NOs: 20 and 21),
which has additional amino acid substitutions Q18L, L27V, V38I, F68Y, L72Q, and M75K,
showed similar improvements as was seen with 8F2. Variant 15C1 (SEQ ID NOs: 16 and
17), which has additional amino acid substitutions E4K, K33N, F68Y, L72Q, and M75K,
was brighter for all novel coelenterazines, but did not have any improved relative
specificity benefit. The amino acid substitution Q18L in variant 1D6 provided improved
relative specificity, i.e., away from native coelenterazine and towards novel substrates,
in the context of IV. In general, the amino acid substitution L27V provided improved
relative specificity in the context of IV.
[0222] FIG. 28 shows the luminescence of the 8A3, 9B8, 9F6, and 15C1 variants in the secondary
screen using native coelenterazine, known coelenterazine-hh, known coelenterazine-h,
and novel coelenterazines PBI-3939, PBI-3945, PBI-3889, and PBI-4002 as substrates
compared to IV and hRL. Variant 8A3 had 2 logs decrease in brightness with native
coelenterazine compared to IV. Variant 9F6 had 1 log decrease in brightness with native
coelenterazine compared to IV. Variant 15C1 with PBI-3945 was the brightest, but the
signal half-life was short (see Example 27).
F. 9B8 Variants
[0223] The 9B8 variant from E was further modified to generate additional variants with
increased light emission and/or improved relative specificity for PBI-3939. Amino
acid substitution L72Q appeared to be a beneficial amino acid substitution for increased
light emission (i.e., brightness) as this substitution was identified in the variants
9B8, 9F6, and 15C1, all of which showed improved light emission. To determine if other
amino acid substitutions at position 72 would provide similar increases in brightness,
additional variants of 9B8 were generated as described previously by saturating position
72 with alternative residues. Four replicates of
E. coli lysates were prepared and analyzed for brightness as described previously using PBI-3939
as a substrate except the assay buffer contained 10 mM CDTA, 150 mM KCI, 10 mM DTT,
100 mM HEPES, pH 7.0, 35 mM thiourea, and 0.5% TERGITOL® NP-9 (v/v). Table 7 lists
9B8 variants ("Variant") with similar or improved luminescence compared to 9B8 as
indicated by luminescence normalized to 9B8 ("RLU (normalized to 9B8)"), i.e., fold
improvement. The amino acid substitutions of A, G, N, R, and M at position 72 provided
at least the same brightness benefit as amino acid Q, i.e., 1-fold.
Table 7: Variants with Similar Luminescence Compared to Variant 9B8.
| Variant |
RLU (normalized to 9B8) |
| 9B8 + Q72A |
1.1 |
| 9B8 + Q72G |
1 |
| 9B8 + Q72N |
1 |
| 9B8 + Q72R |
1 |
| 9B8 + Q72M |
1 |
[0224] Additional variants with improved relative specificity to novel PBI-3939 were generated
as described previously by saturating amino acid positions 18, 68, 72, 75, and 90
in variant 9B8.
E. coli lysates were prepared and analyzed for brightness as described previously using native
coelenterazine and novel PBI-3939 as substrates. Relative specificity was determined
from the ratio of the luminescence of the variant with PBI-3939 to the luminescence
of the variant with native coelenterazine, normalized to the ratio of corresponding
luminescence of 9B8. Table 8 lists 9B8 variants ("Variant") with at least 1.1X fold-increase
in relative specificity for PBI-3939. The results demonstrate that at least one additional
change at each of the sites provided improved relative specificity for PBI-3939 versus
native coelenterazine. 9B8 variants with amino acid substitutions K, D, F, G, Y, W,
and H at position 18 had the highest fold improvement in relative specificity.
Table 8: Variants with Improved Relative Specificity for PBI-3939
| Variant |
Relative specificity |
| (PBI-3939 RLU/native coelenterazine RLU; normalized to 9B8) |
| 9B8 + L18K |
40.7 |
| 9B8 + L18D |
25.8 |
| 9B8 + L18F |
25.6 |
| 9B8 + L18G |
18.2 |
| 9B8 + L18Y |
17.8 |
| 9B8 + L18W |
11.2 |
| 9B8 + L18H |
9.1 |
| 9B8 + L18R |
3.5 |
| 9B8 + L18M |
3.4 |
| 9B8 + L18N |
2.9 |
| 9B8 + L18P |
2.6 |
| 9B8 + L18S |
2.3 |
| 9B8 + Y68W |
1.1 |
| 9B8 + Q72W |
6.1 |
| 9B8 + Q72Y |
2.5 |
| 9B8 + Q72F |
2.2 |
| 9B8 + Q72V |
2.2 |
| 9B8 + Q72I |
2.1 |
| 9B8 + Q72T |
1.9 |
| 9B8 + Q72N |
1.8 |
| 9B8 + Q72R |
1.7 |
| 9B8 + Q72P |
1.6 |
| 9B8 + Q72G |
1.5 |
| 9B8 + Q72A |
1.4 |
| 9B8 + Q72M |
1.3 |
| 9B8 + Q72C |
1.3 |
| 9B8 + Q72H |
1.2 |
| 9B8 + Q72S |
1.2 |
| 9B8 + M75F |
1.2 |
| 9B8 + V90R |
2.4 |
| 9B8 + V90Y |
1.6 |
| 9B8 + V90D |
1.4 |
| 9B8 + V90P |
1.4 |
| 9B8 + V90K |
1.3 |
| 9B8 + V90Q |
1.2 |
G 9B8 + K33N Variants
[0225] An additional variant, 9B8 opt+K33N (SEQ ID NOs: 42 and 43) was generated to investigate
the benefits of amino acid substitution K33N for brightness, relative specificity,
and thermal stability. 9B8 opt+K33N was examined and compared to 9B8 opt (described
in Example 25A) in various applications.
[0226] E. coli lysates containing the variant 9B8 opt or 9B8 opt+K33N were prepared and analyzed
as described previously except the assay buffer contained 0.1% TERGlTOL® NP-9 (v/v).
Luminescence generated from the lysates was measured using the novel PBI-3939 and
native coelenterazine as substrates. The relative specificity of the variants for
PBI-3939 and native coelenterazine was calculated as described previously. 9B8 opt+K33N
("K33N") had greater light output (RLU) and a higher relative specificity for PBI-3939
than native coelenterazine compared to 9B8 opt (FIG. 29), indicating that the K33N
substitution provided greater light output and improved relative specificity.
[0227] A new OgLuc library was created using 9B8opt+K33N as a starting template. The random
library was created using DIVERSIFY® PCR Random Mutagenesis Kit (ClonTech; Catalog
# 630703). Condition 5 (as listed in the user manual) was used to generate additional
variants, and the average mutation rate was calculated to be 2.6 mutations per gene
by compiling sequence data from 83 randomly selected clones. This PCR library was
cloned into the pF4Ag-based, non-fusion vector background described previously and
the sandwich background, i.e., Id-OgLuc-HT7 (described in Example 45). Variants in
the pF4Ag-base non-fusion vector background are designated with (NF). Variants in
the sandwich vector background are designated with (F). In order to clone the PCR
product into both vectors, an amino acid, i.e., a glycine, was appended to the variant
sequence in pF4Ag, generating a new position 170 in the OgLuc variant ("170G"). The
170G is present in the sandwich construct, but in this case is considered part of
the linker between OgLuc and HT7. For each library, 4,400
E. coli clones were assayed as described previously with the following exceptions. The lysis
buffer contained 300 mM MES pH 6.0 instead of HEPES, and 0.5% TERGITOL® NP-9 (v/v),
but did not contain thiourea. The assay buffer contained 100 mM MES pH 6.0 instead
of HEPES, and 35 mM thiourea. The assay volumes were as follows: 10 µL cells, 40 µL
lysis buffer, and 50 µL assay buffer.
[0228] The PCR library in the pF4Ag-based non-fusion background was screened for additional
variants with increased luminescence compared to 9B8 opt+K33N+170G (SEQ ID NOs: 68
and 69). Selected variants were then assayed in HEK293 and NIH3T3 cells. For each
cell type, 15,000 cells were plated and grown overnight at 37°C. The next day, the
cells were transfected as described in Example 25 with 10 ng pGL4.13 (Promega Corp.)
as a transfection control and 100 ng of the OgLuc test DNA. The media was removed,
and the cells were lysed with 100 µL of lysis buffer as described in Example 25 except
the lysis buffer contained 100 mM MES pH 6.0 instead of HEPES, and luminescence measured
using a GLOMAX® Luminometer. For each sample, 10 µL of lysate was assayed with 50
µL of lysis buffer containing 20 µM PBI-3939. For the transfection control, 10 µL
of lysate was assayed with 50 µL of BRIGHT-GLO™ Assay Reagent.
[0229] Table 9 shows the fold-increase in luminescence of variants in
E. coli, HEK293, and NIH3T3 cells and the amino acid substitutions found in the variants.
The variants 27A5 (NF) (SEQ ID NOs: 70 and 71), 23D4 (NF) (SEQ ID NOs: 72 and 73)
and 24C2 (NF) (SEQ ID NOs: 74 and 75) had at least 1.3 fold-increase in luminescence
in
E. coli and HEK293 cells.
Table 9: Increase in Luminescence Generated by OgLuc Variants Compared to 9B8 opt+K33N+170G
in E. coli, HEK293 and NIH3T3 Cells
| Sample |
Sequence |
Fold over 9B8 opt+K33N + 170G |
| E. coli |
HEK293 |
NIH3T3 |
| 27A5 (NF) |
T39T, 170G |
1.3 |
1.5 |
1.3 |
| 23D4 (NF) |
G26G, M106L, R112R, 170G |
1.5 |
1.6 |
1.2 |
| 24C2 (NF) |
R11Q, T39T, 170G |
1.5 |
1.5 |
1.1 |
[0230] Based on the above data, further combination variants were designed and generated
(see Table 10) in the context of the pF4Ag-based non-fusion vector background without
the 170G. The variants were analyzed in
E. coli, HEK293 and NIH3T3 cells as described above and compared to 9B8 opt+K33N. The variants
were also examined for luminescence with native coelenterazine. Table 10 shows the
fold-increase in luminescence of the variants in
E. coli, HEK293, and NIH3T3 cells, and the amino acid substitutions found in the variants
("Sample"). The variants were named by adding the additional amino acid substitutions
in the variant to the prefix "9B8 opt+K33N." Table 11 shows the relative specificity
of the different variants for PBI-3939 compared to native coelenterazine in
E. coli, NIH3T3, and HEK293 cells. As shown in Table 10, the variant 9B8 opt+K33N+T39T+K43R+Y68D
("V2"; SEQ ID NOs: 92 and 93) had improved luminescence in
E. coli and a slight improvement in luminescence in NIH3T3 cells. The variant 9B8 opt+K33N+L27V+K43R+Y68D
("L27V, K43R, Y68D") had a neutral improvement in luminescence (Table 10) and 5X fold-increase
in relative specificity over 9B8 opt+K33N (Table 11) in the three cell types examined.
Table 10: Increase in Luminescence Generated by OgLuc Combination Variants Compared
to 9B8 opt+K33N in E. coli, NIH3T3 and HEK293 Cells
| Sample |
Fold over 9B8 opt +K33N |
| E. coli |
NIH3T3 |
HEK293 |
| T39T |
1.8 |
1.1 |
1.1 |
| K43R |
1.2 |
1.1 |
1.1 |
| T39T, K43R |
1.3 |
0.9 |
1.1 |
| Y68D |
1.0 |
1.0 |
1.2 |
| K43R, Y68D |
1.2 |
1.2 |
1.2 |
| T39T, K43R, Y68D ("V2") |
1.8 |
1.1 |
1.3 |
| L27V |
0.9 |
0.7 |
0.8 |
| L27V, K43R |
0.7 |
0.6 |
0.6 |
| L27V, K43R, Y68D |
1.2 |
0.8 |
0.9 |
| L27V, Y68D |
1.2 |
0.8 |
0.7 |
| S66N, K43R |
0.9 |
1.1 |
1.1 |
| L27V, K43R, S66N |
1.0 |
0.6 |
0.7 |
| 9B8 opt + K33N |
1.0 |
1.0 |
1.0 |
Table 11: Change in Relative Specificity of OgLuc Combination Variants for PBI-3939
Compared to Native Coelenterazine in E. coli, NIH3T3 and HEK293 Cells
| Sample |
Fold over Native Coelenterazine |
| E. coli |
NIH3T3 |
HEK293 |
| T39T |
18.2 |
18 |
20 |
| K43R |
29.5 |
31 |
32 |
| T39T, K43R |
29.4 |
30 |
32 |
| Y68D |
11.4 |
10 |
12 |
| K43R, Y68D |
18.6 |
19 |
21 |
| T39T, K43R, Y68D ("V2") |
18.5 |
18 |
21 |
| L27V |
85.2 |
85 |
97 |
| L27V, K43R |
120.1 |
131 |
147 |
| L27V, K43R, Y68D |
98.3 |
98 |
101 |
| L27V, Y68D |
59.9 |
61 |
64 |
| S66N, K43R |
22.9 |
23 |
25 |
| L27V, K43R, S66N |
100.4 |
97 |
106 |
| 9B8 opt + K33N |
19.0 |
19 |
19 |
[0231] Additional OgLuc variants were generated from 9B8 opt+K33N to contain at least one
of the following additional amino acid substitutions relative to SEQ ID NO: 4: L27V,
T39T, K43R, Y68D, or S66N (see "Sample" in Table 12 for the amino acid substitutions
in the variants). The variants were named by adding the additional amino acid substitutions
in the variant after the prefix "9B8 opt+K33N." These additional variants and the
variants 9B8 opt+K33N+L27V+Y68D ("L27V, Y68D"), 9B8 opt+K33N+L27V+K43R+Y68D ("L27V,
K43R, Y68D"), 9B8 opt+K33N+L27V+K43R+S66N ("L27V, K43R, S66N"), and 9B8 opt+K33N+T39T+K43R+Y68D
("T39T, K43R, Y68D"; also known as "V2") from above, were examined for brightness,
relative specificity, signal stability and thermal stability. The variants were compared
to the variants 9B8 opt ("9B8") and 9B8 opt+K33N ("K33N").
[0232] E. coli lysates containing the variants were prepared and analyzed as described previously.
Luminescence generated from the lysates was measured using the novel PBI-3939 and
native coelenterazine as substrates. The luminescence of the variants was normalized
to the luminescence generated by 9B8 opt (Table 12). The relative specificity of the
variants for PBI-3939 and native coelenterazine was calculated by dividing the luminescence
of the variants using PBI-3939 as a substrate with the luminescence of the variants
using native coelenterazine as a substrate (Table 12). This data indicates that the
amino acid substitution L27V lowers specificity for native coelenterazine.
Table 12: Increase in Luminescence Generated by OgLuc Variants Compared to 9B8 and
Change in Specificity of OgLuc Variants for PBI-3939 Compared to Native Coelenterazine
in Bacterial Lysates
| Sample |
Fold over 9B8 |
Fold over coelenterazine |
| 9B8 |
1.0 |
7 |
| K33N |
1.1 |
21 |
| T39T, Y68D |
0.9 |
12 |
| T39T, L27V, K43R |
1.2 |
149 |
| L27V, T39T, K43R, Y68D |
1.8 |
110 |
| T39T, K43R, Y68D |
1.6 |
21 |
| L27V, T39T, K43R, S66N |
1.3 |
114 |
| L27V, K43R, Y68D |
1.3 |
110 |
| L27V, Y68D |
1.0 |
63 |
| L27V, K43R, S66N |
1.1 |
114 |
H. V2 Variants
[0233] A set of additional variants were designed using V2 (9B8opt with the additional amino
acid substitutions K33N+T39T+K43R+Y68D) as a template. The substitutions shown in
Table 13 were designed based on either 1) the known diversity according to the structure-based
alignment of 28 fatty acid binding proteins (1VYF, IFDQ, 2A0A, 1O8V, 1BWY, 2ANS, 1VIV,
1PMP, 1FTP, 2HNX, 1JJJ, 1CBR, 2CBS, 1LPJ, 1KQW, 2RCQ, 1EII, 1CRB, 1IFC, 2PYI, 2JU3,
1MVG, 2QO4, 1P6P, 2FT9, 1MDC, 1OIU, 1EIO; See
U.S. Published Application No. 2010/0281552), or 2) the probing of alternative residues at positions previously identified to
play a role in substrate specificity. Changes listed under "Consensus" in Table 13
relate to residues identified in at least 50% of the aligned, above-mentioned fatty
acid binding proteins. Changes listed under "Predominant Minority" relate to residues
identified in many of the fatty acid binding proteins mentioned above, but found in
fewer than 50% of the aligned sequences. Changes listed under "Other" relate to residues
were identified less frequently than the predominant minority residue at a given position
in the aligned sequences. Finally, changes listed under "Specificity" relate to positions
suspected to be involved in determining a variant's specificity for coelenterazine
or a coelenterazine analog. For example, the designed specificity changes at position
27 (leucine residue in the parental sequence, i.e., V2) were changed to other hydrophobic
residues or amino acids representing alternative chemistries (e.g., other hydrophobic
residues containing rings, residues containing uncharged polar side chains, or residues
containing charged side chains); and the designed specificity changes at position
40 (proline in the parental sequence), were to a sampling of different chemistries
(chemistries (e.g., other hydrophobic residues containing rings, residues containing
uncharged polar side chains, or residues containing charged side chains); note that
glycine, glutamine, isoleucine, and leucine are identified at this position the aligned
fatty acid binding proteins).
Table 13
| Consensus |
Predominant minority |
Other |
Specificity |
| 9 |
T |
9 |
K |
9 |
R |
27 A, I, M, G, D |
| 14 |
S |
10 |
Y |
40 |
G |
40 T, S, F, D, Y |
| 16 |
E |
23 |
R |
|
|
|
| 22 |
M |
32 |
I |
|
|
|
| 23 |
K |
63 |
T |
|
|
|
| 24 |
A |
87 |
T |
|
|
|
| 25 |
L |
100 |
Y |
|
|
|
| 32 |
R |
111 |
N, D |
|
|
|
| 35 |
A |
118 |
I |
|
|
|
| 39 |
K |
134 |
K |
|
|
|
| 46 |
Q |
142 |
K, W |
|
|
|
| 57 |
F |
147 |
N |
|
|
|
| 63 |
S |
149 |
M |
|
|
|
| 87 |
N |
152 |
E |
|
|
|
| 97 |
E |
162 |
Q |
|
|
|
| 98 |
F |
|
|
|
|
|
| 100 |
E |
|
|
|
|
|
| 102 |
T |
|
|
|
|
|
| 110 |
D |
|
|
|
|
|
| 113 |
K |
|
|
|
|
|
| 118 |
V |
|
|
|
|
|
| 125 |
L |
|
|
|
|
|
| 126 |
V |
|
|
|
|
|
| 129 |
Q |
|
|
|
|
|
| 130 |
K |
|
|
|
|
|
| 142 |
E |
|
|
|
|
|
| 146 |
G |
|
|
|
|
|
| 147 |
D |
|
|
|
|
|
| 150 |
V |
|
|
|
|
|
| 152 |
T |
|
|
|
|
|
| 165 |
K |
|
|
|
|
|
[0234] The variants were constructed using standard site-directed mutagenesis protocols
(see previous examples), and the resulting plasmids transformed into
E. coli for analysis. Cultures were grown per standard walk away induction in minimal media
as described previously. To 10 µL of the cultured, transformed
E. coli cells, 40 µL of lysis buffer (100 mM MES pH 6.0, 0.3X PLB, 0.3 mg/mL Lysozyme, 0.003
U/µL RQ1 DNasel and 0.25% TERGITOL® NP-9 (v/v)) was added followed by the additional
of an equal volume (50 µL) of assay reagent (1 mM CDTA, 150 mM KCl, 2 mM DTT, 20 µM
PBI-3939 or native coelenterazine, 100 mM MES pH 6.0, 35 mM thiourea, and 0.5% TERGITOL® NP-9
(v/v)). Luminescence was measured on a GLOMAX® 96 Microplate Luminometer (Promega
Corp.).
[0235] Table 14 summarizes the different amino acid substitutions identified in the analysis.
The data is presented as normalized to the parental clone (V2) with regards to the
luminescence measured for both PBI-3939 and native coelenterazine. The relative change
in specificity to PBI-3939 with respect to native coelenterazine is also shown.
Table 14
| Substitution |
PBI-3939 NORMALIZED |
COELENTERAZINE NORMALIZED |
RELATIVE CHANGE IN SPECIFICITY FOR PBI-3939 |
| 10 |
Y |
0.7 |
0.2 |
3.5 |
| 14 |
S |
1.3 |
1.2 |
1.1 |
| 16 |
E |
0.5 |
0.2 |
2.5 |
| 23 |
K |
1.3 |
4 |
0.3 |
| 24 |
A |
0.4 |
0.2 |
2.0 |
| 25 |
L |
0.0001 |
0.000023 |
4. 3 |
| 27 |
A |
0.8 |
0.1 |
8.0 |
| 27 |
D |
0.006 |
0.001 |
6.0 |
| 27 |
G |
0.088 |
0.005 |
17.6 |
| 27 |
I |
0.2 |
0.024 |
8.3 |
| 21 |
H |
2.2 |
0.9 |
2.4 |
| 40 |
I |
0.0017 |
0.0002 |
8.5 |
| 40 |
L |
0.0007 |
0.0001 |
7.0 |
| 40 |
Q |
0.0001 |
0.000026 |
3.8 |
| 87 |
H |
1.2 |
1.5 |
0.8 |
| 87 |
T |
1.3 |
1.6 |
0.8 |
| 97 |
E |
0.014 |
0.01 |
1.4 |
| 100 |
I |
0.002 |
0.002 |
1.0 |
| 102 |
T |
1.1 |
1.1 |
1.0 |
| 111 |
H |
0.6 |
0.6 |
1.0 |
| 113 |
K |
1.2 |
0.6 |
2.0 |
| 125 |
L |
0.6 |
0.4 |
1.5 |
| 129 |
Q |
0.0003 |
0.0001 |
3.0 |
| 130 |
K |
1.1 |
0.9 |
1.2 |
| 142 |
E |
0.9 |
0.3 |
3.0 |
| 142 |
K |
0.9 |
0.3 |
3.0 |
| 142 |
W |
0.8 |
0.4 |
2.0 |
| 146 |
G |
0.9 |
0.8 |
1.1 |
| 147 |
N |
0.4 |
0.4 |
1.0 |
| 149 |
M |
0.7 |
0.4 |
1.8 |
| 150 |
V |
0.9 |
0.4 |
2.3 |
| 152 |
E |
0.9 |
0.5 |
1.8 |
| 152 |
T |
0.9 |
0.3 |
3.0 |
I. L27V Variants
[0236] Using the OgLuc variant L27V as a starting template, i.e., starting sequence or parental
sequence, additional variants were made in which some of the amino acids (Table 15)
in the L27V variant were reverted to the amino acids found in the native OgLuc luciferase
of SEQ ID NO: 1. The variants were constructed by site-directed mutagenesis as previously
described. The variants were then screened as previously described for relative activity
with either native coelenterazine or PBI-3939. Luminescence was measured on a TECAN®
INFINITE® F500 5 min after substrate/assay reagent (as described in H) was added and
normalized to the L27V variant starting template. SDS-PAGE analysis of the lysates
indicates comparable expression levels (data not shown).
[0237] Table 15 shows the relative activities of the L27V variants with native coelenterazine
or PBI-3939. Relative activities <1 indicate the reversion is detrimental compared
to the residue at that site in the L27V variant. Relative activities >1 indicate the
reversion is favorable for activity compared to the residue at that site in the L27V
variant. Some additional data on these mutants indicated the following: 166K, 54F,
54A and L27V were tested for thermal stability. The T
1/2 60°C for 166K, 54F, and 54A were 87, 74, and 33%, respectively, indicating these
substitutions cause a reduction in thermal stability. The Km values for these same
4 variants were the following: for native coelenterazine, L27V was 16 µM, 54A was
23 µM, 54F was 40 µM, and 166K was 21 µM; for PBI-3939, L27V was 18 µM, 54A was 62
µM, 54F was 163 µM, and 166K was 23 µM. This indicates higher substrate affinity for
L27V, particularly for the position 54 substitutions.
Table 15
| Native coelenterazine (50 mM) |
PBI-3939 (50 mM) |
| AA substitution |
Relative activity (5 min) |
AA substitution |
Relative activity (5 min) |
| 72L |
0.2 |
72L |
0.6 |
| 4A |
1.0 |
4A |
1.0 |
| 124Q |
1.6 |
124Q |
1.0 |
| 43K |
1.9 |
43K |
1.1 |
| 115P |
0.6 |
115P |
0.9 |
| 166N |
2 |
166N |
2.0 |
| 75M |
1.1 |
75M |
1.2 |
| 54F |
0.1 |
54F |
0.4 |
| 68F |
0.5 |
68F |
0.9 |
| 33A |
1.7 |
33A |
1.0 |
| 138Y |
1.0 |
138Y |
1.0 |
| 54A |
0.6 |
54A |
1.6 |
| 90I |
0.8 |
90I |
0.6 |
| 33K |
4.2 |
33K |
0.8 |
| 44V |
0.7 |
44V |
1 |
| 166K |
2.1 |
166K |
2 |
| 11Q |
1.6 |
11Q |
1.3 |
| 166F |
0.3 |
166F |
0.4 |
| 18Q |
4.1 |
18Q |
0.6 |
Example 23 - Mutational Analysis of Position 166
[0238] A. To assess the effect of different amino acids at position 166 on the luciferase
activity, the arginine (R) residue at position 166 was substituted to each of the
other 19 amino acids using site-directed mutagenesis as previously described in the
context of a pF4Ag vector (i.e., in the context of the wild-type OgLuc sequence SEQ
ID NO: 1). These position 166 variants were then expressed in
E. coli as previously described.
[0239] To create lysates, 50 µL 0.5X FASTBREAK™ Cell Lysis Reagent (Promega Corp.) was added
to 950 µl of induced cultures, and the mixtures incubated for 30 min at 22°C. For
the analysis, 50 µL of lysate was assayed in 50 µL of assay reagent (as previously
described in Example 22H) with either 100 µM PBI-3939, 30 µM native coelenterazine,
or 22 µM coelenterazine-h). Luminescence was measured as previously described (FIGS.
30A-C). FIGS. 30A-C show the relative activity of the N166 mutants. Western analysis
confirmed comparable expression of all variants (data not shown).
[0240] B. The specific single amino acid substitutions, L27V, A33N, K43R, M75K, T39T, L72Q
and F68D were assessed in the wild-type OgLuc or N166R background. The single amino
acid substitutions were generated via site-directed mutagenesis as previously described,
expressed in
E. coli as previously described, and luminescence measured using the assay reagent (previously
described in Example 22H) with 22 µM native coelenterazine (FIG. 30D). Western analysis
confirmed comparable expression of all variants (data not shown).
Example 24 - Deletion Variants
[0241] Deletions to the L27V variant were made as follows:
Table 16
| Deletion # |
Deletion Made |
| 27 |
Residues 1-27 and Val -1 |
| 52 |
Residues 1-52 and Val -1 |
| 64 |
Residues 1-64 and Val -1 |
| 84 |
Residues 1-84 and Val -1 |
| 19 |
Residues 65-83 |
| 23 |
Residues 65-87 |
| 23A1 |
Residues 65-87 + G64D |
[0242] The N-terminus of the OgLuc variant L27V is methionine, valine and phenylalanine,
i.e., MVF. For numbering purposes, the phenylalanine was considered the first amino
acid. "Val-1" indicates that the Valine in "MVF" was deleted. The methionine of "MVF"
was included in these deletions. The L27 deletion variants were cloned in the pF4Ag
vector and expressed in
E. coli KRX cells as previously described. Inductions and lysate preparations were performed
as described Lysates were analyzed using the assay reagent (previously described;
100 µM PBI-3939), and luminescence measured as previously described (FIG. 31). The
data demonstrates that smaller fragments of the OgLuc variants can also generate luminescence.
Example 25 - Codon Optimization of OgLuc Variants
A. IV and 9B8
[0243] The IV and 9B8 OgLuc variants were used as templates for codon optimization. The
goals, as understood by those skilled in the art, were two-fold: 1) to remove known
transcription factor binding sites, or other regulatory sequences, e.g., promoter
modules, splice donor/acceptor sites, splice silencers, Kozak sequences, and poly-A
signals, that could potentially interfere with the regulation or expression of the
OgLuc variants, and 2) to alter the DNA sequence (via silent mutations that do not
alter protein sequence) to eliminate rarely used codons, and favor the most commonly
used codons in cells of
E. coli, human, other mammalian, or other eukaryotic organisms (
Wada et al., Nucleic Acids Res., 18:2367 (1990)).
[0244] Two different optimized sequences for IV and 9B8, referred to as opt (aka optA) and
optB, were designed for each variant. The first optimized sequence, i.e., opt/optA
for each variant, was designed by identifying the two best, i.e., most common, human
codons for each site (see Table 17) and then randomly picking one of the two for incorporation
at each site. For the optB versions, the previous, codon-usage, optimized version,
i.e., opt/optA, was used as a starting template, and each codon replaced with the
other of the two best human codons identified for this codon-optimization strategy.
As an example, the leucine at position 3 in either the IV or 9B8 sequence is encoded
by the codon TTG. TTG is not one of the two most common codons for leucine in a human
cell, and therefore the codon was changed to the alternative, more common codons for
leucine, CTC (opt/optA) or CTG (optB). This same process was repeated for all leucines
in the sequence, and due to the random nature of the approach, a CTC codon could end
up in optB and the CTG could end up in optA. Because of this two codon-usage approach
to optimization, sequences opt/optA and opt B were maximally codon-distinct.
Table 17: Codons used in Codon Optimization
| Amino acid |
Choice#1 |
Choice#2 |
| Gly |
GGC |
GGG |
| Glu |
GAG |
GAA |
| Asp |
GAC |
GAT |
| Val |
GTG |
GTC |
| Ala |
GCC |
GCT |
| Ser |
AGC |
TTC |
| Lys |
AAG |
AAA |
| Asn |
AAC |
AAT |
| Met |
ATG |
|
| Ile |
ATC |
ATT |
| Thr |
ACC |
ACA |
| Trp |
TGG |
|
| Cys |
TGC |
TGT |
| Tyr |
TAC |
TAT |
| Phe |
TTC |
TTT |
| Arg |
CGG |
CGC |
| Gln |
CAG |
CAA |
| His |
CAC |
CAT |
| Leu |
CTG |
CTC |
| Pro |
CCC |
CCT |
[0245] Each of the 4 sequences (IV opt, IV optB; 9B8 opt, 9B8 optB) were then analyzed (Genomatix
Software, Germany) for the presence of transcription factor binding sites or other
regulatory sequences as described above, and these undesirable sequences were disrupted
via silent nucleotide changes. In some cases, where there were other non-rare codons
for both human and
E. coli, the transcription factor binding sites or other regulatory elements was removed by
changing to one of these codons, even though they are not choice#1 or choice#2 (see
Table 18). In cases, where removing a transcription factor binding site or other regulatory
element would have involved introducing a rare codon, the transcription binding site
(or other regulatory element) was usually not changed.
Table 18: Additional Codons used to Remove Transcription Factor Binding Sites and
Other Regulatory Elements
| Amino Acid |
Choice #3 |
Choice #4 |
| Gly |
GGA |
GGT |
| Val |
GTA |
GTT |
| Ala |
GCG |
GCA |
| Ser |
AGT |
TCA |
| Thr |
ACG |
ACT |
| Leu |
TTG |
CTT |
| Pro |
CCG |
CCA |
[0246] Codon optimized versions of IV ("IV opt" (SEQ ID NO: 22) and "IV optB" (SEQ ID NO:
23)) and 9B8 ("9B8 opt" (SEQ ID NO: 24) and "9B8 optB" (SEQ ID NO: 25)) were generated
and cloned into pF4Ag by methods known in the art. HEK293 cells were plated in 96-well
plates at 15,000 cells/well and grown overnight at 37°C. The following day, the cells
were transiently transfected in 6 well replicates using TRANSIT®-LT1 Transfection
Reagent (Mirus Bio) with 100 ng of plasmid DNA encoding the codon optimized versions
in pF4Ag and grown overnight at 37°C. HEK293 cells were also transfected with either
pGL4.13 (Luc2/SV40) (
Paguio et al., "pGL4 Vectors: A New Generation of Luciferase Reporter Vectors" Promega
Notes, 89:7-10 (2005)) or pGL4.73 (hRL/SV40) (
Id.) to normalize for differences in transfection efficiency. Ten ng/transfection or
10% of the total DNA transfected was used. Media was removed, and cells were lysed
with 100 µL lysis buffer which contained 10 mM CDTA, 150 mM KCl, 10 mM DTT, 100 mM
HEPES, pH 7.0, 35 mM thiourea, and 0.5% TERGITOL® NP-9 (v/v) to create a lysate sample.
Luminescence of the lysate sample was measured on a TECAN® INFINITE® F500 luminometer
as follows: for hRL and the OgLuc variants, 10 µL of the lysate sample was assayed
for luminescence with 50 µL of lysis buffer containing 20 µM of substrate (native
coelenterazine for hRL and PBI-3939 for the OgLuc variants). For Luc2 (SEQ ID NOs:
28 and 29), a firefly luciferase, 10 µL of lysate sample was assayed for luminescence
with 50 µL of BRIGHT-GLO™ Luciferase Assay Reagent (Promega Corp.).
[0247] FIG. 32 shows a comparison of the luminescence measured for the lysates containing
the codon optimized versions of the OgLuc variants compared to hRL and Luc2. hRL and
the OgLuc variants were normalized to pGL4.13 and Luc2 was normalized to pGL4.73 using
methods known in the art. As shown in FIG. 32, Luc2 had approximately 14 fold higher
luminescence than hRL. The OgLuc variants had higher luminescence compared to Luc2
and hRL. The codon optimized versions of IV ("IV opt" and "IV optB") and 9B8 ("9B8
opt") showed increased luminescence compared to the non-optimized versions.
[0248] As a result of this optimization, the "opt/optA" versions expressed better in human
HEK293 cells than their parental sequence, while the "optB" versions did not express
as well in HEK293 cells compared to the parental sequence.
B. L27V
[0249] The L27V variant (SEQ ID NO: 88) was optimized to minimize the occurrence of common
vertebrate response elements (any transcription factor binding site (TFBS) in the
Genomatix database). Three different optimized versions of the L27V variant were created:
- 1. L27V01 - version 1 (SEQ ID NO: 319) - Promoter modules and all other undesired
sequence elements (additional details below) were removed by nucleotide substitutions
except for individual TFBSs.
- 2. L27V02 - version 2 - L27V01 was used as the starting, i.e., parental, sequence,
and as many TFBSs were removed as possible using high stringency match criteria (A
higher stringency involves a better match to the binding site and will thus find fewer
matches than a lower stringency). There were two versions, A (SEQ ID NO: 322) & B
((SEQ ID NO: 318)), created for L27V02. These two versions were created by selecting
different codons for each version to remove undesired sequence elements. Both versions
were analyzed by searching for TFBSs with lower stringency.
- 3. L27V03 - version 3 (SEQ ID NO: 325) - L27V02B (SEQ ID NO: 318) was used as the
starting sequence. Lower stringency TFBS matches were removed where possible. L27V03
was created to be very codon distinct from L27V02A.
[0250] The following criteria were used to create the L27V optimized variants:
- 1. Codon usage: Preferably, the best two human codons were used for each amino acid
(as was done for the IV variant), and the use of rare human codons (HS; coding for
<10% of amino acids) was avoided (Table 19). The use of rare E. coli codons (EC) was used, if necessary, to remove undesired sequence elements.


- 2. Undesired sequence elements that were removed where possible
- A. Restriction Enzyme (RE) Sites: RE sites were removed that would be useful for cloning
and should otherwise not be present in open reading frame (ORF).
- B. Eukaryotic Sequence Elements: Splice donor and acceptor sites, splice silencers,
Kozak sequence and PolyA sequences in the (+) mRNA strand were removed.
- C. Vertebrate Promoter Modules (PM) (in Genomatix category: Vertebrate) were removed.
- D. Vertebrate TFBS (in Genomatix categories: Vertebrate, general Core Promoter Elements,
and miscellaneous other sequences) were removed where possible. This applied only
to L27V optimized versions 2 and 3, but not to version 1.
- E. E. coli Sequence Elements: E. coli promoters were removed.
- F. mRNA Secondary Structure: Strong secondary structures (high mRNA folding energy)
near the 5'end (Zuker, Nucleic Acid Res. 31(13): 3406-3415 (2003)) and other strong hairpin structures were removed.
[0251] A sequence comparison, percent pair-wise sequence identity is provided in Table 20
("()" indicate number of nucleotide differences).
Table 20
| |
L27V01 |
L27V02A |
L27V02B |
L27V03 |
| L27V00 |
99% (3) |
97% |
97% |
94% |
| L27V01 |
|
98% (12) |
98% |
94% (32) |
| L27V02A |
|
|
99% (4) |
95% (26) |
| L27V02B |
|
|
|
96% |
Example 26 - Signal Stability of OgLuc Variants
A. 15C1, 9B and IV
[0252] The signal stability of 15C1 with PBI-3945 and 9B8 with PBI-3889 was measured and
compared to IV.
E. coli containing plasmid DNA encoding 15C1, 9B8, or IV were grown and induced as described
previously in 8-well replicates. Cells were lysed using a lysis buffer containing
of 300 mM HEPES pH 8.0, 0.3X Passive Lysis Buffer ("PLB"; Promega Corp. Cat. No. E194A),
0.3 mg/mL lysozyme, and 0.003 U/µL RQ1 DNase. Lysates were diluted 1:1000 in lysis
buffer and measured for luminescence using a TECAN® INFINITE® F500 luminometer. Measurements
were taken immediately after the addition to 10 µL of diluted lysate sample of 50
µL of "Glo" 0.5% TERGITOL assay buffer ("0.5% TERGITOL"), which contained 150 mM KCl,
1 mM CDTA, 10 mM DTT, 100 mM thiourea, 0.5% TERGITOL® NP-9 (v/v), and 20 µM of either
novel coelenterazines PBI-3945 or PBI 3889.
[0253] The signal stability of the variants was determined by re-reading the plate every
30 seconds for a length of time after the addition of the assay buffer to the sample.
The signal half-life was determined from these measurements using methods known in
the art. The average signal half-life was compared between the variants and IV. Both
15C1 and 9B8 had a signal half-life of at least 30 min (FIG. 33). Although 15C1, assayed
with PBI-3945 had a higher luminescence at t=0, the signal decayed more rapidly than
variant 9B8 assayed with PBI-3889. At t=10 min, luminescence for 15C1 with PBI-3945
and 9B8 with PBI-3889 were equivalent.
B. 9B8 opt + K33N
[0254] The signal stability of the 9B8 opt + K33N variants was examined.
E. coli lysates containing the variants were prepared and analyzed as described previously
except the assay buffer contained 0.25% TERGITOL® NP-9 (v/v), 100 mM MES pH 6.0, 1
mM CDTA, 150 mM KCl, 35 mM thiourea, 2 mM DTT, and 20 µM PBI-3939. Table 22 shows
the signal half-life in min of the variants and indicates that the amino acid substitution
L27V improves signal stability.
Table 22: Signal stability of OgLuc variants in bacterial lysates
| sample |
signal half life (min) |
| 9B8 |
74 |
| K33N |
55 |
| T39T, Y68D |
87 |
| T39T, L27V, K43R |
139 |
| L27V, T39T, K43R, Y68D |
114 |
| T39T, K43R, Y68D |
61 |
| L27V, T39T, K43R, S66N |
124 |
| L27V,K43R, Y68D |
122 |
| L27V, Y68D |
139 |
| L27V, K43R, S66N |
124 |
[0255] The signal activity and stability of the L27V variant (9B8+K33N+L27V+T39T+K43R+Y68D;
SEQ ID NO: 88 and 89) was measured and compared to that of firefly (Luc2) and
Renilla luciferases. The L27V variant, Luc2 and
Renilla luciferases were fused to HALOTAG® and expressed in
E. coli. The luciferases were purified using HALOTAG® as a purification tag according to the
manufacturer's protocol (pFN18A; HALOTAG® Protein Purification System). 10 pM of each
purified luciferase (diluted in DMEM without phenol red containing 0.01% PRIONEX®)
was then mixed with an equal volume of an assay reagent (100 mM MES pH 6, 35 mM thiourea,
0.5% TERGITOL® NP-9 (v/v), 1 mM CDTA, 2 mM DTT, 150 mM KCl, and 100 µM PBI-3939 for
the L27V variant; ONE-GLO™ Luciferase Assay System (Promega Corp.) for firefly luciferase;
and RJENILLA-GLO™ Luciferase Assay System (Promega Corp.) for
Renilla luciferase), and luminescence was monitored over time (3, 10, 20, 30, 45 and 60 min).
FIGS. 34A-B demonstrates the high specific activity (FIG. 34A) and signal stability
(FIG. 34B) of the L27V variant when compared to firefly and
Renilla luciferase.
Example 27 - Enzyme Kinetics of OgLuc Variants
A. IV, 15C1, 9B8, 9F6 and 9A3
[0256] Using methods known in the art, enzyme kinetic assays measuring luminescence were
performed with the lysates of
E. coli containing IV and the IV variants 15C1, 9B8, 9F6, and 9A3. Cells were induced, lysed,
and diluted as described in Example 26 except the lysis buffer had a pH of 7.5. Two
fold serial dilutions of PBI-3939 in the assay buffer described previously in Example
26 were assayed with the diluted lysates. FIG. 35 shows the Km and Vmax values calculated
using a hyperbolic fit for IV and the variants 15C1, 9B8, 9F6, and 9A3. Variants 9B8
and 9F6 had higher Km values compared to IV while Km values for the other variants
were unchanged. Variants 15C1, 9B8, and 9F6 all had higher Vmax values, while 8A3
had a lower Vmax value compared to IV.
[0257] 15C1, which had the highest luminescence with PBI-3945 contained the amino acid substitution
K33N, indicating that K33N provided increased luminescence. A 9B8 variant was generated
to have this additional substitution to provide improvement in luminescence for this
variant. Additional variants of 9B8 and 9F6 were generated to have at least one of
amino acid substitutions K33N or V38I ("9B8+K33N+V38I" and "9F6+K33N"). Variant 1D6
was used to highlight the importance of amino acid substitutions at positions 68,
72, and 75 for increasing light output and stability. FIG. 36 shows the Km and Vmax
values calculated using a hyperbolic fit for IV and the variants 9B8, 9B8+K33N+V38I,
9F6, 9F6+K33N, and 1D6. While the actual Km values were different between FIGS. 35
and 36 for 9B8 and 9F6, the general trend between the variants was consistent.
[0258] The enzyme kinetics, i.e., Vmax and Km values, were determined and compared for the
variants 9B8 opt and 9B8 opt+K33N as described above except the
E. coli lysates were assayed with a buffer containing 1 mM CTDA, 150 mM KCl, 2 mM DTT, 100
mM MES pH 6.0, 35 mM thiourea, 0.25% TERGITOL® NP-9 (v/v), 10 mg/mL 2-hydroxypropyl-β-cyclodextrin,
and 20 µM PBI-3939. Luminescence was measured on a TECAN® INFINITE® F500 luminometer.
As shown in FIG. 37, the Vmax and Km values for 9B8 opt+K33N were higher than 9B8
opt, indicating that this clone is brighter and has a lower affinity for substrate.
B. 9B8 OPT+K33N VARIANTS
[0259] The enzyme kinetics values were determined for the OgLuc variants as described previously,
except luminescence was measured using a GLOMAX® luminometer. Three replicates were
used for each variant. Table 23 shows the average Km and Vmax values with the standard
deviation ("Km(+/-)" and "Vmax(+/-)" respectively) calculated using HYPER.EXE, Version
1.0.
Table 23: Vmax (RLU/0.5 sec) and Km (µM) values for OgLuc Variants
| sample |
Km |
Km(+/-) |
Vmax |
Vmax(+/-) |
| 9B8 |
7.7 |
2.0 |
86,000,000 |
14,000,000 |
| K33N |
12.5 |
3.0 |
110,000,000 |
17,000,000 |
| T39T, Y68D |
7.9 |
1.8 |
74,000,000 |
10,000,000 |
| T39T, L27V, K43R |
21.4 |
5.4 |
150,000,000 |
28,000,000 |
| L27V, T39T, K43R, Y68D |
13.9 |
29 |
190,000,000 |
28,000,000 |
| T39T, K43R, Y68D |
10.5 |
2.8 |
140,000,000 |
25,000,000 |
| L27V, T39T, K43R, S66N |
16.3 |
4.8 |
130,000,000 |
28,000,000 |
| L27V,K43R, Y68D |
13.7 |
4.3 |
130,000,000 |
28,000,000 |
| L27V, Y68D |
10.2 |
3.0 |
97,000,000 |
19,000,000 |
| L27V K43R, S66N |
20.0 |
6.2 |
130,000,000 |
30,000,000 |
Example 28 - Protein Stability of OgLuc variants
[0260] As stability of the luciferase protein is another factor affecting luminescence,
protein stability, i.e., thermal stability, of the variants was determined.
A. 15C1, 9B8, 9F6, 8A3 and IV
[0261] Lysates of
E. coli containing 15C1, 9B8, 9F6, 8A3 or IV and
E. coli expressing hRL (SEQ ID NO: 30 and 31) were prepared from induced cultures as described
previously. Lysate samples were diluted 1:1000 with a buffer containing 10 mM HEPES
pH 7.5 with 0.1% gelatin. Diluted lysate (100 µL) samples, in replicate 96-well plates,
were incubated at 50°C. At different time points, plates were placed at -70°C (minus
seventy degrees Celsius). Prior to measuring the luminescence as described previously,
each plate was thawed at room temperature, i.e., 22°C, for 10 min. Samples (10 µL
of each thawed sample) were assayed using native coelenterazine as a substrate. Luminescence
was measured immediately after addition of assay buffer for each time point plate.
The half-life of the protein, which indicated protein stability, was calculated from
the luminescence data for each time point using methods known in the art.
[0262] Table 24 shows the protein stability of variants 15C1, 9B8, 9F6, and 8A3 having half-lives
in min (hrs) of 630.1 (10.5), 346.6 (5.8), 770.2 (12.8) and 65.4 (1.1), respectively.
In comparison, hRL had a half-life of 9.6 min, while IV had a half-life of 27.2 min.
Table 24 also shows that at 4 hrs, 79%, 61%, and 80% of 15C1, 9B8, and 9F6, respectively,
remained active.
Table 24: Protein Stability of OgLuc Variants at 50°C
| Sample |
½ life (min) |
½ life (hrs) |
% remaining at t = 4 hrs |
| Renilla |
9.6 |
|
|
| IV |
27.2 |
|
|
| 15C1 |
630.1 |
10.5 |
79% |
| 9B8 |
346.6 |
5.8 |
61% |
| 9F6 |
770.2 |
12.8 |
80% |
| 8A3 |
65.4 |
1.1 |
|
B. 1D6, 9B8, 9B8+K33N+V38I, 9F6, 9F6+K33N, and IV
[0263] Lysates of
E. coli containing 1D6, 9B8, 9B8+K33N+V38I, 9F6, 9F6+K33N, or IV were prepared from induced
cultures and assayed for luminescence as described previously. Protein stability,
i.e., thermal stability of the lysates, was assayed as described above in this Example.
FIG. 38 shows the half-life in minutes (min) of the variants at 50°C, and the luminescence
of the sample measured at the start of the incubation period, i.e., t=0, using native
coelenterazine as a substrate. The difference between variant 9B8+33+38 and 9F6 was
one amino acid substitution, L27V, indicating that this amino acid substitution increased
stability. The addition of "activity/expression" substitutions in positions 68, 72,
and 75 increased stability. FIG. 38 shows K33N provided greater thermal stability
to variant 9F6 and that variant 9B8 had greater light output and stability than variant
1D6. The difference between these two variants, i.e., 9B8 contains additional amino
acid substitutions F68Y, L72Q, and M75K, indicated the importance of these three substitutions.
[0264] In addition to thermal stability, structural integrity determined by expression,
stability, and solubility can also affect luminescence. As a way to further test the
structural integrity of the improved variants, KRX
E. coli harboring pF4Ag-based (i.e., no HT7) OgLuc variants N166R (previously described in
U.S. Serial Application No. 12/773,002 (
U.S. Published Application No. 2010/0281552)), C1+A4E, IV, 9B8, and 9F6 were grown at 37°C in Luria broth (LB) to an OD
600=0.6 and then induced for overexpression by the addition of rhamnose (0.2% final concentration).
Duplicate induced cultures were then grown at either 25 or 37°C for 17 hrs at which
time total (T) and soluble (S) fractions were prepared and analyzed by SDS-PAGE using
SIMPLYBLUE™ SafeStain (Invitrogen) to stain the gels (FIGS. 39A-B). hRL and Luc2 were
used as controls.
[0265] The OgLuc variants, hRL and Luc2 expressed well and were soluble when the induction
occurred at 25°C (FIG. 39A; note the approximately 19 kDa dark band in the "soluble"
fraction for the OgLuc variants, excluding the N166R variant, and the approximately
36 and 64 kDa bands in the "soluble" fraction for hRL and Luc2, respectively). In
contrast, although C1+A4E, IV, 9B8, and 9F6 expressed well at 37°C (significantly
better than hRL or Luc2, as shown in the "total" fraction), only the 9B8 and 9F6 variants
were soluble when the elevated induction temperature was employed (see FIG. 39B; note
the approximately 19 kDa dark band in the "soluble" fraction for 9B8 and 9F6). These
results tracked with the thermal stability data shown in Table 24 and FIG. 38.
C. 9B8 OPT AND 9B8 OPT + K33N
[0266] The thermal stability of the variants 9B8 opt and 9B8 opt+K33N was compared.
E. coli lysates containing the variant 9B8 opt or 9B8 opt+K33N were prepared and analyzed
as described previously with the following exceptions: Lysates were diluted 1:100
in the lysis buffer described previously and replicate diluted lysates were incubated
at 60°C in a thermocycler. Aliquots were removed at different time-points and placed
on dry ice to freeze the samples. Frozen lysates were thawed at 22°C and assayed with
a buffer containing 20 mM CDTA, 150 mM KCl, 10 mM DTT, 20 µM PBI-3939, 100 mM HEPES
pH 7.0, 35 mM thiourea, and 0.1% TERGITOL® NP-9 (v/v). Luminescence was measured on
a GLOMAX® luminometer (Promega Corp.). FIG. 40A shows the light output time course
of the natural logarithm (ln) value of luminescence measured in RLU over time in min.
As shown in FIG. 40B, 9B8 opt+K33N had a half-life at 60°C of 6.8 hrs, which was longer
than the 5.7 hrs half-life of 9B8 opt.
[0267] Table 25 shows the thermal stability at 60°C ("T
1/2 (60°C)") of 9B8 opt and 9B8 opt+K33N, and the luminescence ("RLU") data at the start
of the incubation period (i.e., t=0). 9B8 opt+K33N was more stable and approximately
1.8-fold brighter than 9B8 opt, indicating that the amino acid substitution K33N provided
both greater light output and higher thermal stability.
Table 25: Thermal Stability and Luminescence Data for 9B8 opt and 9B8 opt+K33N
| Variant |
T1/2 (60°C) |
RLU |
| 9B8 opt |
5.7 hrs |
23,283,252,000 |
| 9B8 opt+K33N |
6.8 hrs |
42,278,732,000 |
D. 9B8 + K33N Variants
[0268] The thermal stability of the variants at 60°C was examined as described above, except
the assay buffer contained 100 mM MES pH 6.0 instead of HEPES. Table 26 and FIG. 41
shows the half-life in hrs of the variants at 60°C. The data indicates that the amino
acid substitution L27V improves thermal stability.
Table 26: Thermal stability of OgLuc variants at 60°C
| Sample |
1/2 life hours |
| 9B8 |
5.1 |
| K33N |
6.7 |
| T39T, Y68D |
16.3 |
| T39T, L27V, K43R |
11.8 |
| L27V, T39T, K43R, bY68D |
21.7 |
| T39T, K43R, Y68D |
15.2 |
| L27V, T39T, K43R, S66N |
11.8 |
| L27V,K43R, Y68D |
23.2 |
| L27V, Y68D |
28.5 |
| L27V, K43R, S66N |
10.7 |
[0269] The variants 9B8 and V2 (9B8+K33N+T39T+K43R+Y68D) were also screened in HEK293 cells
to determine their stability. The variants were cloned into pF4Ag and transfected
into HEK293 cells (15,000 cells/well) as previously described. After transfection,
the cells were lysed in assay reagent (as previously described; no PBI-3939), and
luminescence measured using the assay reagent with 20 µM PBI-3939. 9B8 had a half-life
of 5.2 hrs while V2 had a half-life of 16.8 hrs. This is consistent with the half-life
seen for these variants in
E. coli (Table 26).
E. L27V variant
[0270] The activity of the L27V variant (9B8+K33N+L27V+T39T+K43R+Y68D) was assessed at various
pHs and different salt conditions. 9B8 and 9B8+K33N were previously shown to have
similar stability at pH 6 and pH 7 (data not shown). For assessing activity at various
salt conditions, 50 µL of assay buffer with 20 µM PBI-3939 and varying amounts of
KCl or NaCl was mixed with 50 µL of HEK293 cells transiently transfected with L27V
(pF4Ag). Luminescence was measured, and the percent activity (the ratio of luminescence
to no salt) determined (FIG. 42B). For assessing activity in various pHs, a reagent
was made containing 100 mM citrate, 100 mM MES, 100 mM PIPES, 100 mM HEPES, 100 mM
TAPS, 0.5% TERGITOL® NP-9 (v/v), 0.05 % MAZU® DF 204, 1 mM CDTA, and 1 mM DTT titrated
to various pH values. 362 pM L27V in assay reagent was mixed with substrate 100 µM
PBI-3939 and luminescence was measured. (FIG. 42A).
Example 29 - Gel filtration Chromatographic Analysis of OgLuc Variants
A. CI+A4E and 9B8
[0271] Gel filtration analysis was used to verify the expected molecular weight of the purified
OgLuc proteins based on the theoretical values and consequently to determine their
oligomeric state. A comparison between the relative hydrodynamic volume of the OgLuc
variants C1+A4E and 9B8 was made by gel filtration chromatography. For this analysis,
the nucleotide sequence for the OgLuc variants, C1+A4E and 9B8, were cloned into a
HQ-Tagged FLEXI® Vector (Promega Corp.) to create a HQHQHQ N-terminally tagged protein
that was overexpressed in
E. coli KRX cells. The overexpressed proteins were purified using the HISLINK™ Protein Purification
System (Promega Corp.) according to manufacturer's instructions. Samples of each individual
standard and sample protein were analyzed by gel filtration chromatography, which
was performed at 24°C on an Agilent 1200 HPLC, using a Superdex 200 5/150 GL column
(GE Healthcare) with a flow rate of 0.25 mL/min (FIGS. 43A-B). The mobile phase (i.e.,
running buffer) consisted of 50 mM Tris and 150 mM NaCl, pH 7.5. Protein elution was
monitored at 214 and 280 nm. A standard calibration curve was generated using: 1)
Ovalbumin, 43 kDa (GE Healthcare), 2) Carbonic Anhydrase, 29 kDa (Sigma) and 3) Myoglobin,
17 kDa (Horse Heart, Sigma). The molecular weights of the purified proteins were calculated
directly from the calibration curve.
[0272] The relative elution of the proteins observed with this column was Ovalbumin at 7.98
min, Carbonic Anhydrase at 8.65 min, 9B8 at 8.97 min, and Myoglobin at 9.06 min (FIGS.
43A-B). As shown in FIG. 43B, 9B8 eluted as a 21 kDa protein (predicted MW is approximately
19 kDa) indicating that the 9B8 variant existed as a monomer, whereas C1+A4E eluted
at approximately 4.3 min (FIG. 43A), indicating that C1+A4E was expressed and exists
as multimer, e.g., possibly as a tetrameric complex or something larger.
B. L27V variant
[0273] To demonstrate that the OgLuc variant L27V exists in a monomeric state, gel filtration
analysis was used to verify the expected molecular weight of the purified L27V protein
based on the theoretical value, and consequently to determine its oligomeric state.
The relative hydrodynamic volume of the L27V variant was made by gel filtration chromatography.
For this analysis, the nucleotide sequence for the L27V variant was cloned into a
HaloTag® vector pFN18A (Promega Corp.) to create a HaloTag®-terminally tagged protein
that was overexpressed in
E. coli KRX cells (Promega Corp.). The overexpressed protein was purified using the HaloTag®
Protein Purification System (Promega Corp.) according to manufacturer's instructions.
Samples of each individual standard and sample protein were analyzed by gel filtration
chromatography performed at 24°C on an Agilent 1200 HPLC using a Superdex 200 5/150
GL column (GE Healthcare) with a flow rate of 0.25 mL/min (FIG. 56). The mobile phase
(i.e., running buffer) consisted of 50 mM Tris and 150 mM NaCl, pH 7.5. Protein elution
was monitored at 214 and 280 nm. A standard calibration curve was generated using:
1) Ovalbumin, 43 kDa (GE Healthcare), 2) Myoglobin, 17 kDa (Horse Heart, Sigma), and
3) Ribonuclease, 14 kDa (Bovine pancreas, GE Healthcare). As shown in FIG. 44, the
L27V variant eluted as a 24 kDa protein (predicted MW is approximately 19 kDa) indicating
that it existed as a monomer.
Example 30 - Protein Expression Levels of OgLuc variants
A. IV, 8A3, 8F2, 9B8, 9F6 and 15C1
[0274] Normalizing for protein expression provides information about potential differences
in specific activity. To provide a means for quantifying protein expression, OgLuc
variants were cloned into a pF4Ag vector containing a C-terminal HT7 to generate OgLuc
variant-HT7 fusion proteins as described previously. The following fusion proteins
were generated: IV-HT7 (SEQ ID NOs: 48 and 49), 8A3-HT7 (SEQ ID NOs: 34 and 35), 8F2-HT7
(SEQ ID NOs: 50 and 51), 9B8-HT7 (SEQ ID NOs: 36 and 37), 9F6-HT7 (SEQ ID NOs: 38
and 39), and 15C1-HT7 (SEQ ID NOs: 52 and 53).
E. coli containing the OgLuc variant-HT7 fusions were grown and induced as described previously.
900 µL of cell culture was lysed with 100 µL of 10X FASTBREAK™ Cell Lysis Reagent
(Promega Corp.). HALOTAG® TMR-ligand (Promega Corp.) was added to each bacterial lysate
sample to obtain a final concentration of 0.5 µM. Bacterial lysates were incubated
with the HALOTAG® TMR-ligand for 30 min at room temperature according to manufacture's
instructions. 10 µL of each sample was diluted 1:1 with 1X FASTBREAK™, i.e., 10 µL
sample to 10 µL 1X FASTBREAK™. 15 µL of the lysate and 15 µL of the 1:1 dilution for
each sample were analyzed by SDS PAGE. The labeled fusion proteins were resolved by
SDS-PAGE, stained with SIMPLYBLUE™ SafeStain (FIG. 45A) and fluorimaged (GE Healthcare
Typhoon). Bands were quantitated using Imagequant software (GE Healthcare). FIG. 45B
shows the band volume measured from FIG. 45A for IV-HT7 ("IV"), 15C1-HT7 ("15C1"),
9B8-HT7 ("9B8"), 9F6-HT7 ("9F6"), and 8F2-HT7 ("8F2"), normalized to IV-HT7. The data
shows that the IV variants expressed well compared to IV.
B. 9B8 opt, V2 and L27V
[0275] The expression levels and solubility of 9B8 opt, V2 and L27V were compared. These
three variants, in the context of a pF4Ag background, were used to transform
E. coli KRX cells. The resulting clones were used for an expression experiment where single
colonies were grown overnight at 30°C, diluted 1:100 in LB, grown to an OD
600 approximately 0.5, and then induced with 0.2% rhamnose for 18 hrs at 25°C. Cells
were then incubated for 30 min at room temperature in the presence of 0.5X FASTBREAK™
Lysis Reagent (Promega Corp.), and the resulting lysates stored at -20°C. Following
a slow-thaw on ice, soluble fractions were prepared by high-speed centrifugation for
10 min at 4°C. Crude total (T) and soluble (S) fractions were then analyzed for expression
levels using SDS-PAGE + Simply blue staining (FIG. 46A) as well as by measuring luminescence
(FIG. 46B). For luminescence measurement, 50 µL of soluble lysates in 96-well microtiter
plates were mixed with 50 µL assay reagent (previously described; 40 µM PBI-3939),
and luminescence measured using a TECAN® INFINITE® F500 multi-detection plate reader.
These results indicate that the ranking for these three variants, in terms of their
expression levels and solubility, is L27V > V2 > 9B8opt.
Example 31 - Brightness of OgLuc Variants Expressed in Mammalian Cells
A. IV and 9B8
[0276] The IV and 9B8 variant in pF4Ag vector (i.e., no HT7) were evaluated for brightness
in HEK293 cells. hRL was used as a control. Briefly, HEK293 cells, plated at 15,000
cells/well in a 96-well plate, were transiently transfected using TRANSIT®-LT1 with
plasmid DNAs encoding the various variants and/or control sequences. Cells were grown,
lysed, and treated as described in Example 25. Cells were co-transfected with pGL4.13
(Promega Corp.) as a transfection control (10 ng/transfection or 10% of the total
DNA transfected was used). Luminescence was measured as described previously using
native coelenterazine as a substrate for hRL or PBI-3939 as a substrate for the OgLuc
variants. The OgLuc variant data was corrected for transfection efficiency using Luc2
luminescence (i.e., measuring luminescence after the addition of luciferin substrate).
The OgLuc variants IV and 9B8 had greater luminescence compared to hRL ("Renilla")
(FIG. 47).
[0277] For comparison of brightness on a per mole basis in mammalian cells, the C-terminal
HT7 fusion protein of variant 9B8 ("pF4Ag-OgLuc-9B8-HT7") described in Example 30
was analyzed and compared with C-terminal HT7-hRL fusion protein ("pF4Ag-Renilla-HT7")
and C-terminal HT7- Luc2 fusion protein ("pF4Ag-Luc2-HT7"). HEK293 cells (15,000)
were plated and grown overnight at 37°C. These cells were transfected with 100 ng
of DNA from pF4Ag-Renilla-HT7, pF4Ag-Luc2-HT7, or pF4Ag-OgLuc-9B8-HT7 and grown overnight
at 37°C. Media was removed and cells were lysed as described previously. 10 µL of
each sample was assayed for luminescence (RLU) with 50 µL BRIGHT-GLO™ for Luc2, 50
µL of 20 µM native coelenterazine for hRL, and 50 µL of 20 µM PBI-3939 for variant
9B8.
[0278] The lysates from 6 wells were pooled and labeled with HALOTAG® TMR-ligand as described
in Example 30. The labeled fusion proteins were resolved by SDS-PAGE and fluorimaged
(GE Healthcare Typhoon). The band densities were determined to quantitate the relative
number of moles present for each luciferase enzyme and the RLU value for each sample
was normalized by the calculated band density to normalize expression levels of each
protein, i.e., RLUs normalized using TMR label quantitation (FIG. 48). On a mole-to-mole
basis, the 9B8 variant was approximately 15-fold brighter than Luc2 and >100-fold
brighter than hRL. This data represented differences in specific activity.
B. 9B8 opt and 9B8 opt+K33N
[0279] The brightness of the variants 9B8 opt and 9B8 opt+K33N expressed in HEK293 cells
was measured and compared as described for the variants without the HT7 in Example
31. 30 and 100 ng of plasmid DNA containing the variant DNA was used to transfect
HEK293 cells. Cells were grown and induced as described in Example 31 except the cells
were lysed with a lysis buffer containing 1 mM CTDA, 150 mM KCl, 2 mM DTT, 100 mM
MES pH 6.0, 35 mM thiourea, 0.25% TERGITOL® NP-9 (v/v), and 10 mg/mL 2-hydroxypropyl-β-cyclodextrin.
The lysates were assayed with lysis buffer containing 20 µM PBI-3939 and luminescence
was measured on a TECAN® GENIOS™ Pro luminometer. As shown in FIG. 49, 9B8 opt+K33N
had greater luminescence compared to 9B8 opt in HEK293 cells, which tracks with the
bacterial expression data in Table 25 and FIG. 29.
C. 9B8+K33N Variants
[0280] The brightness of the variants expressed in HEK293 and NIH3T3 cells was measured
as described previously. The luminescence of the variants was normalized to the luminescence
generated by 9B8 opt (Table 27).
Table 27: Increase in Luminescence generated by OgLuc combination variants in NIH3T3
and HEK293 cells
| Sample |
HEK293 |
NIH3T3 |
| 9B8 |
1.0 |
1.0 |
| K33N |
1.8 |
1.5 |
| T39T, Y68D |
1.9 |
1.5 |
| T39T, L27V, K43R |
1.3 |
0.9 |
| L27V, T39T, K43R, Y68D |
1.6 |
1.6 |
| T39T, K43R, Y68D |
1.9 |
1.9 |
| L27V, T39T, K43R, S66N |
1.3 |
1.2 |
| L27V, K43R, Y68D |
1.6 |
1.5 |
| L27V, Y68D |
1.7 |
1.4 |
| L27V, K43R, S66N |
1.2 |
1.0 |
D. L27V
[0281] A comparison of the luminescence of the L27V variant to firefly luciferase alone
and as a fusion was performed. HEK293 and HeLa cells were plated at 15,000 and 10,000
cells/well, respectively, into wells of 12-well plates and incubated overnight at
37°C, 5% CO
2. The cells were then transfected with serial dilutions of pF4Ag containing L27V or
Luc2. 20 ng of pGL4.13 (Promega Corp.) was co-transfected with L27V, and 20 ng of
pGL4.73 (Promega Corp.) was co-transfected with Luc2 to act as carrier DNA for lower
dilutions of the L27V or Luc2 plasmid DNA. The plasmid DNA was then transfected into
the cells (6 replicates for each dilution for each cell type) using TRANSIT®-LT1 transfection
reagent according to the manufacturer's instructions. The cells were then incubated
for 24 hrs at 37°C, 5% CO
2.
[0282] After transfection, the media was removed from the cells, and 100 µL PBS with 0.5%
TERGITOL® NP-9 (v/v) added and shaken for 10 min at room temperature. 10 µL of each
cell lysate was assayed using ONE-GLO™ Luciferase Assay System (Promega Corp.; Luc2)
or assay reagent (Example 22H with 20µM PBI-3939; OgLuc). Luminescence was measured
as previously described for the HEK293 (FIG. 50A) and HeLa cells (FIG. 50B).
[0283] Comparison of L27V and Luc2 as fusion partners was performed as described above.
L27V and Luc2 were fused to HALOTAG® protein in pF4Ag. FIGS. 50C-D show the luminescence
measured with the different fusions in HEK293 (FIG. 50C) and HeLa cells (FIG. 50D).
[0284] In addition to measuring luminescence, protein expression was also analyzed. The
transfection was performed as described above. After transfection, the media was removed
from the cells, and the cells washed in 1X PBS. 100 µL 0.1X Mammalian Lysis Buffer
(Promega Corp.) containing 1 µM HALOTAG®TMR ligand (Promega Corp.) and 20 U DNase
I was added, and the cells incubated with slow shaking for 45 min at room temperature.
The cell samples were then frozen at -20°C. For protein analysis, 32.5 µL 4X SDS loading
dye was added to each sample, and the samples heated at 95°C for 2 min. 10 µL of sample
was then loaded onto an SDS-PAGE gel and imaged on a Typhoon Scanner as previously
described (FIG. 50E).
Example 32 - Brightness of Purified OgLuc Variant Compared to Firefly Luciferase
[0285] The 9B8 OgLuc variant was overexpressed and purified as described in Example 33.
Reactions between diluted enzyme and substrate were performed using the following
2X buffer/assay reagent: 100 mM MES pH 6.0, 1 mM CDTA, 150 mM KCl, 35 mM thiourea,
2 mM DTT, 0.25% TERGITOL® NP-9 (v/v), 0.025% MAZU® DF 204, 10 mg/mL 2-hydroxy-β-cyclodextrin,
and 20 µM PBI-3939. The final assay concentrations of purified enzyme and substrate
were 0.5 pM and 10 µM, respectively. In parallel, reactions between diluted purified
firefly luciferase (i.e., QUANTILUM® Recombinant Luciferase (Promega Corp.)) and luciferin
were analyzed. The assay buffer/reagent for the firefly luciferase reaction was BRIGHT-GLO™,
and the final assay concentrations were 0.5 pM enzyme and 500 µM luciferin. As the
buffers/reagents for each reaction were known to provide "glow" kinetics, a 15 min
time point was used to collect luminescence data. The results from this experiment
showed that 9B8 opt using PBI-3939 (19,200 RLU) was approximately 8-fold brighter
than QUANTILUM® Recombinant Luciferase with BRIGHT-GLO™ (2,300 RLU).
Example 33 - Inhibition Analysis
[0286] To determine the susceptibility of the OgLuc variants to off-target interactions,
the activity of the 9B8 and L27V variants was screened against a LOPAC (library of
pharmacologically active compounds) library. A LOPAC 1280 library (Sigma) was prepared
by diluting the compounds to 1 mM in DMSO. On the day of the assay, the compounds
were diluted to 20 µM in 1X PBS, and 10 µL transferred to a 96-well, white plate.
To each well, 10 µL of purified 9B8, L27V or firefly luciferase (Luc2) enzyme diluted
10
-4 in Glo Lysis Buffer (Promega Corp.) was added and incubated at room temperature for
2 min. To the samples, 20 µL assay reagent (1 mM CDTA, 150 mM KCl, 2 mM DTT, 100 mM
MES pH 6.0, 35 mM Thiourea, 0.5% TERGITOL® NP-9 (v/v) and 60 µM PBI-3939) was added,
incubated for 3 min, and luminescence measured on a TECAN® GENIOS™ Pro Luminometer.
For assaying firefly luciferase, the BRIGHT-GLO™ Assay reagent (Promega Corp.) was
used according to the manufacturer's protocol. As a negative control, 8 wells of each
plate contained 1X PBS + 2% glycerol. As a positive control, 8 wells of each plate
contained 2 mM Suramin in 2% DMSO or 2 mM luciferase inhibitor 1 in 2% DMSO (Calbiochem).
Suramin was identified in the preliminary screen of the LOPAC library (i.e., the LOPAC
library was screened using the 9B8 variant with a lower substrate concentration of
20 µM) to be an inhibitor of OgLuc.
[0287] The results in FIG. 51 indicate a general low frequency of off-target interactions
between the compounds in the LOPAC library and L27V. This suggests a potential use
for L27V as a screening tool for large libraries of diverse chemicals and therapeutic
candidates, including live cell-based formats (e.g., high-throughput screening).
[0288] To further examine inhibition resistance, purified 9B8 and L27V were screened against
various concentrations of Suramin (Sigma S-2671) and Tyrphostin AG 835 ("Tyr ag 835")
(Sigma T-5568) (FIGS. 52A-C). FIGS. 52E-D show the chemical structures for Suramin
and Tyr ag 835, respectively. Purified 9B8 and L27V were prepared as described above.
Serial dilutions (0, 2 µM, 6 µM, 20 µM, 60 µM, 200 µM and 2 mM) of the inhibitors
were prepared in 1X PBS with 2% DMSO. To wells of a 96-well, white assay plate, 10
µL of diluted enzyme and 10 µL of diluted inhibitor were added and incubated at room
temperature for 2 min. 20 µL assay reagent (described above) was added, and luminescence
measured on a GLOMAX®-96 luminometer (FIGS. 52A-C). FIGS. 52A-B show the dose response
curves of 9B8 and L27V to Suramin (FIGS. 52A) and Tyr ag 835 (FIGS. 52B). FIG. 52C
shows the half maximal inhibitory concentration (IC
50) of Suramin and Tyr ag 835 for 9B8 and L27V. The data indicates that L27V is a robust
reporter that could be used as a screening tool for large libraries of diverse chemicals
and/or therapeutic candidates.
Example 34 - Resistance to Non-specific Protein Interactions
[0289]
- 1. Purified 9B8 and L27V enzyme were serial diluted in 1:10 in buffer (1X PBS, 1 mM
DTT, and 0.005% IGEPAL® CA-630) with or without 0.5 mg/mL BSA (4 sets of each dilution)
to 200 µL into PCR strip tubes. The samples were incubated at 60°C wherein at 0, 2,
4, and 6 hrs one set of dilutions for each variant was transferred to -70°C.
[0290] To analyze activity, the samples were thawed to room temperature in a water bath.
50 µL assay reagent (as previously described with 100 µM PBI-3939) was added, and
luminescence measured for each minute for 30 min on a TECAN® INFINITE® F500 plate
reader. Activity was calculated using the average luminescence of the 1x10
6 and 1x10
7 dilutions (FIG. 53).
[0291] 2. To demonstrate the reactivity of the OgLuc variants to plastic, purified 9B8 and
L27V were exposed to polystyrene plates, and their activity measured.
[0292] 50 µL purified 9B8 (45.3 pM) and L27V (85.9 pM) in DMEM without phenol red with 0.1%
PRIONEX® was placed into wells of a 96-well, polystyrene microtiter plate at 60, 40,
20 and 0 min. To the samples, 50 µL assay reagent (described above) containing 20
µM PBI-3939 was added and incubated for 5 min at room temperature. Luminescence was
measured as previously described, and percent activity determined (FIG. 54; ratio
of luminescence to time 0).
Example 35 - Post Translational Modification
[0293] To determine if the OgLuc variants undergo any post translation modifications when
expressed in mammalian cells, the 9B8 and L27V variants were expressed in both mammalian
cells and
E. coli and analyzed via mass spectrometry (MS).
[0294] 9B8 and L27V variants were expressed as N-terminal HALOTAG® fusions (pFN18K for
E. coli; pFN21K for HEK293 cells) in HEK293 and
E. coli KRX (Promega Corp.) cells and purified using the HALOTAG® Protein Purification System
(Promega Corp.) according to the manufacture's instructions. Approximately 5 pmols
of purified enzyme was analyzed via LC/MS using a C4 column (Waters Xbridge BEH300,
3.5pm) interfaced to an LTQ Orbitrap Velos mass spectrometer (Thermo Scientific).
Data was acquired from 600-2000
m/
z using the LTQ for detection and processed using the MagTran vl.03 software (
Zhang et al., J Am. Soc. Mass Spectrom., 9:225-233 (1998)). Both purified enzymes had an experimentally determined mass of 19,666 Da, compared
to a calculated mass of an un-modified OgLuc variant, i.e., absent of any post translational
modifications, of 19,665 Da.
Example 36 - Evaluation of OgLuc Variants as a Transcriptional Reporter
A. IV
[0295] The use of the OgLuc variants as a transcriptional reporter was examined. To generate
a transcriptional reporter of cAMP, hRL and IV were sub-cloned using methods known
in the art into a modified pGL4 vector (Promega Corp.) containing a barnase sequence,
which was replaced by the DNA fragment of interest. The leader sequence of the modified
pGL4 contained a minimal promoter and a cAMP-response element (CRE; SEQ ID NO: 96),
so that upon stimulation with a cAMP agonist such as forskolin (FSK), cells accumulating
cAMP activated the reporter and generated luminescence. In this experiment, 2 ng DNA
of either the hRL or IV transcriptional reporter construct was used to transfect HEK293
cells as described in Example 25. At 24 hrs post transfection, the cells were treated
with 100 µM FSK. Cells that were not treated with FSK were used as a control. After
6 hrs, a reporter reagent was added to treated and control cells. For hRL, the reporter
reagent was Renilla-Glo™ reagent (Promega Corp.). For IV, the reporter reagent contained
1 mM CDTA pH 5.5, 150 mM KCl, 10 mM DTT, 0.5% TERGITOL® NP-9 (v/v), 20 µM coelenterazine-h,
and 150 mM thiourea. After 10 min, luminescence was read on a Varioskan® Flash (Thermo
Scientific).
[0296] FIG. 55 shows the normalized luminescence of HEK293 cells containing the hRL ("Renilla")
or IV transcriptional reporter treated ("+FSK") or not treated ("-FSK") with FSK.
The response, i.e., fold-induction or fold-increase ("FOLD") in luminescence was determined
by dividing the luminescence from the treated cells (+FSK) with the luminescence from
the control cells (-FSK). As shown in FIG. 55, the response for hRL was <50, while
for IV it was >300, demonstrating the use of IV as a transcriptional reporter.
B. 9B8 and 9B8 opt
[0297] The use of variants 9B8 and 9B8 opt as a transcriptional reporter was also examined
and compared to hRL and Luc2 transcriptional reporters as previously described for
the IV transcriptional reporter with the following modifications. Transcriptional
reporters of cAMP containing either variants 9B8 or 9B8 opt were generated as described
above. After 6 hrs of FSK induction, the media was removed from the cells and replaced
with 100 µL of the lysis buffer described in Example 25 creating a lysate. The lysate
of transfected cells treated with or without FSK were assayed for luminescence as
described in Example 25. 10 µL of the Luc2 lysate was assayed with 50 µL of BRIGHT-GLO™
Luciferase Assay Reagent. 10 µL of the hRL lysate was assayed with 50 µL of lysis
buffer containing 20 µM native coelenterazine. 10 µL of the variants 9B8 and 9B8 opt
lysates were assayed with 50 µL of lysis buffer containing 20 µM PBI-3939.
[0298] FIG. 56 shows the normalized luminescence of HEK293 cells containing the 9B8, 9B8
opt, hRL, or Luc2 transcriptional reporter treated ("induced") or not treated ("basal")
with FSK. The response, i.e., fold-induction or fold-increase ("fold") in luminescence,
was determined by dividing the induced luminescence by the basal luminescence (FIG.
56). Although the fold induction values are similar for each of the reporters except
Luc2, the luminescence generated by the induced 9B8 opt transcriptional reporter was
approximately 2.5 logs higher than the induced
Renilla transcriptional reporter and approximately 1.5 logs higher than the Luc2 transcriptional
reporter. FIG. 56 demonstrated the use of 9B8 and 9B8 opt as transcriptional reporters.
C. 9B8 opt and 9B8 opt+K33N
[0299] The variants 9B8 opt and 9B8 opt+K33N were compared in a lytic transcriptional reporter
assay. The variant 9B8 opt+K33N was cloned using methods known in the art into a pGL4.29
vector (Promega Corp.), which contains a cyclic AMP response element (CRE). The 9B8
opt+K33N transcriptional reporter was tested and compared to the 9B8 opt transcriptional
reporter as described above in HEK293 cells. 30 and 100 ng of plasmid DNA containing
the transcriptional reporter versions of the variants were used to transfect HEK293
cells. The cells were induced with FSK for 5 hrs prior to measurement for luminescence.
Cells were lysed with a lysis buffer containing 1 mM CTDA, 150 mM KCI, 2 mM DTT, 100
mM MES pH 6.0, 35 mM thiourea, 0.25% TERGITOL® NP-9 (v/v), and 10 mg/mL 2-hydroxypropyl-β-cyclodextrin.
Luminescence was measured on a TECAN® GENIOS™ Pro luminometer. The lysate was assayed
with the lysis buffer containing 20 µM PBI-3939. FIG. 57 shows the normalized luminescence
(transfection corrected) of HEK293 cells expressing the 9B8 opt or 9B8 opt+K33N transcriptional
reporter construct treated ("Induced") or not treated ("Basal") with FSK. As shown
in FIG. 57, the fold-induction for 9B8 opt was 360 when 30 ng of DNA was used for
transfection and 109 when 100 ng was used for transfection, while the fold-induction
for 9B8 opt+K33N was 275 and 147, respectively. When higher amounts of DNA were used
for transfection, K33N provided a greater response.
D. L27V
[0300]
- 1. L27V was cloned into a reporter vector as described in C of this Example containing
a CRE, NFkB or HSE (Heat shock element) response element. Reporter constructs were
then transfected into HEK293 cells or HeLa cells as previously described. The cells
were then induced using FSK for CRE, TNFα for NFkB or 17-AAG for HSE. Luminescence
was measured as previously described using the assay reagent with 20 µM PBI-3939 (FIGS.
58A-C). The reporter constructs were all validated in HEK293, HeLa, NIH3T3, U2OS and
Jurkat cell lines (data not shown).
- 2. L27V02 and L27V02P (containing a PEST sequence; SEQ ID NO: 323) were cloned into
a reporter vector (pGL4.32 based) as described in C of this Example. Other OgLuc variants
containing a PEST sequence include L27V01-PEST00 and L27V03-PEST02 (SEQ ID NOs: 320
and 326, respectively). The reporter construct was then transfected into HEK293 cells
as previously described. The cells were then induced using FSK, and luminescence was
measured as previously described using the assay reagent with 20 µM PBI-3939 (FIGS.
59A-B). Various other reporter constructs were also created and tested in various
cell lines (FIGS. 59C). FIG. 59A shows the full dose response for the CRE system in
HEK293 cells. FIG. 59B summarizes FIG. 59B. FIG. 59C summarizes the data in FIGS.
59A-B and shows the same type of data for the NFkB response element. Both CRE and
NFkB report constructs were examined in HEK293, HeLa, HepG2, Jurkat, ME180, HCT116,
and U2OS cell lines.
- 3. HEK293 cells (0.9x106 cells in a T25 flask) were transfected with pNFkB-L27V secretion construct (SEQ ID
NOS: 463 & 464; wherein the IL-6 secretion sequence (SEQ ID NOs: 461 and 462) replaced
the native OgLuc secretion sequence SEQ ID NO: 54), Metridia longa (Clontech), pNFkB-L27V
(native secretion sequence; SEQ ID NOs: 465 and 466) or firefly luciferase (Luc2;
pGL4.32-based) plasmid DNA using FUGENE® HD (Promega Corp.) according to the manufacturer's
instructions. Cells were incubated at 37°C, 5% CO2 for 8 hrs, then trypsinized in 0.5 mL TrypLE (Invitrogen). The lysates were then
resuspended in 8 mL DMEM with 10% FBS, 1X NEAA and 1X sodium pyruvate. 100 µL of the
resuspended sample was then added to wells of a 96-well plate and incubated for 16
hrs at 37°C, 5% CO2.
[0301] Following incubation, the media was removed from the cells and replaced with 100
µL fresh media with our without TNFα (serially diluted). To assay for secretion, at
3 and 6 hrs, 5 µL of media (in triplicate) was removed from the cells, brought to
50 µL with PBS and mixed with 50 µL assay reagent (as previously described with 100
µM PBI-3939). Luminescence was measured at 0 and 10 min as previously described (FIG.
60).
[0302] For measuring
Metridia longa luciferase activity, the Ready-To-Glow™ Secreted Luciferase System (Clontech) was
used according to the manufacturer's protocol. Briefly, 5 µL Ready-to-Glow™ reagent
was added to 5 µL of sample and 45 µL of PBS. Luminescence was measured immediately
after reagent addition (FIG. 60).
E. L27V optimized variants.
[0303] Plasmid DNAs (pGL4.32-L27V00, pGL4.32-L27V01, pGL4.32-L27V02, pGL4.32-L27V03, and
pGL4.13) were prepared for transfection using FUGENE® HD according to the manufacturer's
protocol. The pGL4.32 vector (Promega Corp.) contains the NF-κB response element.
The L27V codon optimized sequences replaced the Luc2P sequence in the vector. pGL4.13
vector (Promega Corp.) contains the Luc2 gene driven by the SV40 promoter.
[0304] 300 µL of DNA transfection mixture was then mixed with 6 mL of HeLa cell suspension
(2x10
5 cells/mL), homogenized, and 100 µL plated into wells of a 96-well plate. The cells
were then incubated overnight at 37°C, 5% CO
2. Following incubation, 10 µL of 10X rhTNFα in DPBS with BSA was added to the wells
and incubated for 4.5 hrs at 37°C, 5% CO
2. Six wells were given vehicle only. The cells were then allowed to equilibrate at
room temperature for 20 min, and then 100 µL assay reagent (as previously described
with 100 µM PBI-3939) was added. To cells expressing Luc2 or receiving vehicle only
treatment, 100 µL of the ONE-GLO™ Luciferase Assay Reagent was added. Luminescence
was measured 12 min post-assay reagent addition as previously described. FIGS. 61A-B
shows the absolute luminescence, FIGS. 61C-D shows normalized luminescence and FIGS.
61E-F shows fold response.
Example 37 - OgLuc Variants in a Transcription Reporter Assay
[0305] To demonstrate the ability of the OgLuc variants of the present invention to be used
as transcription reporters, the OgLuc variant 9B8 opt was used as a transcriptional
reporter in a forward, reverse, and bulk transfection. These methods of transfection
were chosen because they are representative of the approaches commonly used for the
transient expression of genetic transcriptional reporters.
Forward Transfection
[0306] Transcriptional reporters containing the cAMP response element (CRE) and 9B8 opt
or 9B8 opt further comprising the PEST protein degradation sequence (9B8 opt-P) were
prepared in the pGL4.29 (Promega Corp.) backbone, i.e., the luc2P gene of the pGL4.29
vector was replaced with 9B9 opt (SEQ ID NO: 24) or 9B8 opt-P (SEQ ID NO: 65). pGL4.29
was used as a control/benchmark.
[0307] HEK293 cells were plated at 15,000 cells/well in six 96-well tissue culture plates.
Cells were grown in 100 µL of DMEM + 10% FBS + 1X non-essential amino acids (NEAA)
and incubated overnight at 37°C. The cells were transiently transfected with either
10 ng or 100 ng plasmid DNA/well of pGL4.29 9B8 opt, pGL4.29 9B8 opt-P, or pGL4.29.
Plasmid DNA was mixed with 850 µL of OPTI-MEM® (Invitrogen) and 32.4 µL of FUGENE®
HD transfection reagent (Promega Corp.) and incubated at room temperature for 10 min.
Eight µL of the transfection/reporter DNA mixture was added to the appropriate wells
(2 constructs/plate). Cells were incubated for 4 hrs at 37°C. The medium was replaced
with OPTI-MEM® + 0.5% dialyzed FBS + 1X NEAA + 1X sodium pyruvate + 1X Penn-Strep
and incubated overnight at 37°C.
[0308] Following incubation, 10 nM or 10 µM FSK (from a 10X stock) in OPTI-MEM® was added
to the cells and incubated for 3 hrs at 37°C. A lytic reagent containing 100 mM MES
pH 6.1, 1 mM CDTA, 150 mM KCl, 35 mM thiourea, 2 mM DTT, 0.25% TERGITOL® NP-9 (v/v),
0.025% MAZU® DF 204, and 20 µM PBI-3939 was added to the cells containing pGL4.29
9B8 opt or pGL4.29 9B8 opt-P and allowed to incubated for 10 min at room temperature
(100 µL lytic reagent added to 100 µL cells). ONE-GLO™ assay reagent (Promega Corp.)
was added to cells containing pGL4.29 and used according to the manufacturer's protocol
(100 µL reagent added to 100 µL cells). Luminescence was measured on a GLOMAX® Luminometer.
Table 26 shows the luminescence of the HEK293 cells expressing the transcriptional
reporters containing CRE treated with 10 nM ("baseline") or 10 mM FSK, and the response
to FSK (i.e., the luminescence generated by the 10 mM FSK treated cells divided by
the luminescence generated of the 10 nM FSK treated cells.)
[0309] The results shown in Table 28 indicate that 9B8 opt and 9B8 opt-P were brighter than
luc2P, and that all the luciferase reporters responded to FSK when 100 ng of DNA was
used for the transfection. However, when only 10 ng of DNA was used for the transfection,
the luminescence for the luc2P reporter was below the detection level for the luminometer.
Table 28: Transcriptional Reporters Containing CRE in HEK293 Cells (3 h timepoint)
| Reporter construct |
100 ng DNA for transfection |
10 ng DNA for transfection |
| baseline |
RLU (10 mM FSK) |
Response |
baseline |
RLU (10 mM FSK) |
Response |
| 9B8 opt |
3,078,418 |
104,687,723 |
34 |
192810 |
12,926,465 |
67 |
| 9B8 opt-P |
122,071 |
20,544,753 |
168 |
11179 |
1,353,459 |
121 |
| luc2P |
356 |
5,293 |
15 |
0 |
0 |
- |
Reverse Transfection
[0310] Transcriptional reporters containing the antioxidant response element (ARE) and 9B8
opt or 9B8 opt-P were prepared in the pGL4.29 (Promega Corp.) backbone, i.e., the
luc2P gene of the pGL4.29 vector was replaced with 9B9 opt or 9B8 opt-P, and CRE was
replaced with 2X ARE (SEQ ID NO: 66) using methods known in the arts.
[0311] HEK293 cells were trypsinized (T75 flask, 3 mL trypsin) and resuspended in 1x10
5 cells/mL (approximately 8.9x10
6 total cells) in medium containing DMEM + 10% FBS + 1X NEAA. Each transcriptional
reporter was prepared for transfection by mixing 1.2 mL OPTI-MEM®, 12 µL transcription
reporter DNA (100 ng) and 36 µL FUGENE® HD transfection reagent together and incubated
at room temperature for 35 min. Following incubation, 624µL of the transfection/reporter
DNA mixture was added to 12 mL of cell suspension and mixed by inversion. After mixing,
100 µL of the cell/DNA mixture was added to wells of a 96-well plate (2 constructs/plate).
The cells were incubated at 37°C for 22 hrs. Tert-butylhydroquinone (a Nrf2 stabilizer;
tBHQ; 1 µM ("baseline") or 20 µM) or sulphoraphane, (an organosulfer antioxidant known
to activate Nrf2; 1 µM ("baseline") or 20 µM) in OPTI-MEM® was added to each well
and incubated at 37°C for 24 hrs. Cells were lysed with 100 µL lytic reagent as described
above for the forward transfection. Luminescence was measured on a GLOMAX® Luminometer.
[0312] Table 29 shows the luminescence of the HEK293 cells expressing the transcriptional
reporters containing ARE treated with 1 µM ("baseline") or 20 µM sulphoraphane and
the response to sulphoraphane (i.e., the luminescence generated by the 1 µM sulphoraphane
treated cells divided by the luminescence generated of the 20 µM sulphoraphane treated
cells). Table 30 shows the luminescence of the HEK293 cells expressing the transcriptional
reporters containing ARE treated with 1 µM ("baseline") or 20 µM tBHQ, and the response
to tBHQ (i.e., the luminescence generated by the 1 µM tBHQ treated cells divided by
the luminescence generated of the 20 µM tBHQ treated cells). Tables 29 and 30 show
that 9B8 opt and 9B8 opt-P could report the presences of two different known stimuli
for ARE.
Table 29: Transcriptional Reporters Containing ARE in HEK293 Cells (24 h time point)
| Reporter construct |
100 ng DNA for transfection |
| baseline |
RLU (20 mM sulphoraphane) |
Response |
| 9B8 opt |
15,600,000 |
89,600,000 |
5.8 |
| 9B8 opt-P |
258,406 |
3,940,000 |
15 |
Table 30: Transcriptional Reporters Containing ARE in HEK293 Cells (24 h time point)
| Reporter construct |
100 ng DNA for transfection |
| baseline |
RLU (20 mM tBHQ) |
Response |
| 9B8 opt |
15,100,000 |
120,000,000 |
8 |
| 9B8 opt-P |
317,238 |
8,460,000 |
27 |
Bulk Transfection
[0313] The transcriptional reporters containing CRE and 9B8 opt or 9B8 opt-P described in
the forward transfection were used in the bulk transfection of HEK293 and NIH3T3 cells.
Transcriptional reporters containing the heat shock response element (HRE; SEQ ID
NO: 67) and 9B8 opt or 9B8 opt-P were prepared in the pGL4.29 (Promega Corp.) backbone,
i.e., the luc2P gene of the pGL4.29 vector was replaced with 9B9 opt or 9B8 opt-P,
and the CRE was replaced with HRE. The transcriptional reporter containing HRE and
9B8 opt-P was used in the bulk transfection of HeLa cells
[0314] HEK293, NIH3T3, or HeLa cells were plated to a single well of a 6-well tissue culture
plate the day before transfection at a density of 4.5x10
5 cells/well in 3 mL complete medium (DMEM + 10% FBS + 1X NEAA + 1X sodium pyruvate)
for HEK293 cells, 3x10
5 cells/well in 3 mL complete medium (DMEM + 10% fetal calf serum (FCS) + 1X NEAA+1X
sodium pyruvate) for NIH3T3 cells, or 9.9x10
5 cells/well in 3 mL complete medium (DMEM + 10% FBS + 1X NEAA) for HeLa cells. Cells
were grown overnight at 37°C.
[0315] 3,300 ng of reporter plasmid DNA in 155 µL OPTI-MEM® was mixed with 9.9 µL FUGENE®
HD transfection reagent, vortexed briefly, and incubated at room temperature for 10
min. The CRE transcriptional reporters were used to transfect HEK293 and NIH3T3 cells.
The HRE transcriptional reporters were used to transfect HeLa cells. The reporter
mixture was added to cells and mixed by gentle rocking followed by incubation at 37°C
for 6 hrs (HEK293 and NIH3T3) or 3 hrs (HeLa) Cells were then trypsinized and resuspended
in medium (DMEM + 10% FBS + 1X NEAA + 1X sodium pyruvate for HEK293 cells, DMEM +
10% FCS + 1X NEAA + 1X sodium pyruvate for N1H3T3 cells, or DMEM + 10% FBS + 1X NEAA
for HeLa cells), followed by plating to the individual wells of a 96-well plate (20,000
cells/100 µL for HEK293, 10,000 cells/100 µL for NIH3T3, or 13,000 cells/µL for HeLa)
and incubated at 37°C overnight.
[0316] FSK (CRE stimulator) or 17-AAG (HRE stimulator; 17-Allylamino-demethoxy geldanamycin)
in OPTI-MEM® was added to the cells (10 nM or 10 µM final concentration for FSK; 1
nM or 1 µM final concentration for 17-AAG) and incubated at 37°C for 4 hrs (FSK) or
6 hrs (17-AAG). Plates were removed from the incubator and allowed to equilibrate
to room temperature for 25 min. Cells were lysed with 100 µL lytic reagent as described
above for the forward transfection. Luminescence was measured on a GLOMAX® Luminometer.
[0317] Table 31 shows the luminescence of the HEK293 cells expressing the transcriptional
reporters containing CRE treated with 10 nM ("baseline") or 10 mM FSK and the response
to FSK. Table 32 shows the luminescence of the NIH3T3 cells expressing the transcriptional
reporters containing CRE treated with 10 nM ("baseline") or 10 mM FSK and the response
to FSK. Table 33 shows the luminescence of the HeLa cells expressing the transcriptional
reporters containing HRE treated with 10 nM ("baseline") or 10 mM 17-AAG and the response
to 17-AAG.
[0318] Tables 29-31 show that 1) both versions of the 9B8opt OgLuc variant can report the
presence and stimulatory effects of FSK on CRE in the context of two different cell
lines, HEK293 and NIH3T3, and 2) 9B8 optP can report the presence and stimulatory
effects of 17-AAG on HRE in the context of HeLa cells.
Table 31: Transcriptional Reporters Containing CRE in HEK293 Cells (4 h time point)
| Reporter construct |
100 ng DNA for transfection |
| baseline |
RLU (10 mM FSK) |
Response |
| 9B8 opt |
39,700,000 |
654,000,000 |
16 |
| 9B8 opt-P |
3,960,000 |
460,000,000 |
116 |
Table 32: Transcriptional Reporters Containing CRE in NIH3T3 Cells (4 h time point)
| Reporter construct |
100 ng DNA for transfection |
| baseline |
RLU (10 mM FSK) |
Response |
| 9B8 opt |
9,187,000 |
23,600,000 |
2.6 |
| 9B8 opt-P |
410,461 |
3,720,000 |
9 |
Table 33: Transcriptional Reporters Containing HRE in HeLa Cells (6 h time point)
| Reporter construct |
100 ng DNA for transfection |
| baseline |
RLU(1 mM 17-AAG) |
Response |
| 9B8 opt-P |
278,118 |
3,204,000 |
12 |
Example 38 - Lytic and Secretable Reporter in Difficult to Express Cells
[0319] HepG2 cells, 1x10
5 cells/mL in a cell suspension, were reverse transfected with plasmid DNA (pGL4.32
backbone; Promega Corp.) containing L27V02, luc2P (Promega Corp.), luc2 (Promega Corp.)
or L27V02-IL6 (L27V02 with the native secretion sequence replaced with the IL-6 secretion
sequence; ("IL601-L27V02A"; SEQ ID NO: 324) using FUGENE® HD according to the manufacturer's
instructions (1:20 DNA-transfection mixture to cells). 100 µL cell suspension was
then plated into wells of a 96-well plate and incubated for 22 hrs at 37°C, 5% CO
2. Other OgLuc constructs which have the native secretion sequence replaced by the
IL-6 secretion sequence include IL601-L27V01 and IL602-L27V03 (SEQ ID NOs: 321 and
327, respectively).
[0320] For secretion analysis, the media was removed from the cells, and the cells washed
in 100 µL DPBS. 100 µL complete media (DMEM + 10% FBS+ 1X NEAA) was added along with
- varying doses (1 pg/mL - 100 ng/mL) of rhTNFα ("'T'NFα") for 4.5 h. 10 µL of the
media was then removed, added to 90 µL complete media, and 100 µL assay reagent (as
previously described; 100 µM PBI-3939) added. Luminescence was measured as previously
described (FIG. 62A).
[0321] For lytic analysis, following plating, the cells were incubated for 4.5 hrs at 37°C,
5% CO
2. The cells were then allowed to equilibrate to room temperature for 20 min. Assay
reagent (as previously described; 100 µM PBI-3939) was added to the cells, and luminescence
measured as previously described (FIG. 62B).
Example 39 - Additional lytic reporter features
[0322] The OgLuc variants of the present invention in the context of a cell-based, lytic
transcriptional reporter should offer a luminescent signal of a magnitude such that
the signal appears sooner than it might with other luciferases. The bright luminescence
should also allow for weak promoters to be examined.
Example 40 - Mammalian cell transfections
[0323] The OgLuc variants of the present invention were used as reporters in difficult to
transfect cell lines, e.g., Jurkat, HepG2, primary cells, non-dividing primary cells,
or stem cells. (
See e.g., FIG. 59C) Due to their high signal intensity, the OgLuc variants enable detectable
luminescence when transfection efficiency is low. The OgLuc variants can also be used
as reporters in cells that are especially sensitive to conditions associated with
transfection, i.e., DNA concentration, transfection reagent addition. Due to the brightness
of the OgLuc variants, an adequate level of luminescence can be achieved using lower
DNA concentrations, less transfection reagent, and perhaps shorter post-transfection
times prior to beginning an assay. This will place less of a toxicity burden on what
would otherwise be sensitive cells. The bright luminescence of the OgLuc variants
should also allow for a signal to be detected at very long time points in the event
such an output is desirable. As another example, the OgLuc variants could be used
as reporters for single copy native promoters, e.g., HSB thymidylate kinase (TK) promoter,
HOX genes, or LIN28.
Example 41 - Stable cell lines
[0324] The identification of robust, stable cell lines expressing an OgLuc variant of the
present invention, either in the cytoplasm or as a secreted form, can be facilitated
by the bright signal of the luciferase and the small size of the OgLuc gene. The relatively
small gene sequence should reduce the likelihood of genetic instability resulting
from the integration of the foreign DNA.
[0325] To generate stable cell lines using an OgLuc variant of the present invention, plasmid
DNA comprising a nucleotide sequence for an OgLuc variant and a selectable marker
gene, e.g., neomycin, hygromycin, or puromycin, is used to transfect a cell line of
interest, e.g., HEK293 cells. Cells of an early passage number, e.g., less than 10
passages, are plated into T25 (1x10
6) or T75 (3x10
6) tissue culture flasks and allowed to grow overnight to approximately 75% confluency.
Cells are then transfected using the above plasmid DNA and an appropriate transfection
reagent, e.g., TRANSIT®-LT1 or FUGENE® HD. Forty-eight hrs post-transfection, the
media is replaced on the cells with selection media containing the selection drug,
e.g., G418, hygromycin or puromycin, at a concentration previously determined to kill
untransfected cells. Selection of cells containing the plasmid DNA occurs over 2-4
weeks. During this time, the cells are re-plated in selection media at various concentrations
into either T25 or T75 tissue culture flasks. The media on the re-plated cells is
replaced every 3-4 days for 2-3 weeks with fresh selection media. The flasks are monitored
for the formation of live cell colonies. Eventually, the flasks will contain many
large colonies and few dead cells.
[0326] From the pool of stable colonies in the flasks, single colonies are isolated and
expanded into a single 24-well tissue culture plate. Briefly, cells are harvested
using the trypsin/EDTA method, i.e., cells are harvested by removing media, rinsing
with Ca
2+ and Mg
2+ free PBS and detached by treatment with Trypsin/EDTA, The cells are counted using
a hemocytometer and diluted 1x10
5 in complete media. The cells are then diluted to 100 cells/mL, 33 cells/mL, 10 cells/mL,
and 3.3 cells/mL in complete media. 100 µL of each dilution is plated into all wells
of 96-well tissue culture plate (1 plate for each dilution) and allowed to grow 4-5
days after which 50 µL of selection media is added to the cells. Approximately a week
after plating, cells are visually screened for colony growth and another 50 µL of
selection media is added. The cells continue to be monitored until a single colony
covers 40-60% of the well area. When a colony is ready for expansion and screening,
colonies are harvested using the trypsin/EDTA method. Each colony is transferred to
selection media as follows: 1) Dilute 1:10 into 6 wells of a 96-well assay plate for
functional assay, e.g., luminescence detection; 2) Dilute 1:10 into 3 wells of a clear
bottom 96-well assay plate for cell viability assay, e.g., CELLTITER-GLO® Luminescent
Cell Viability Assay (Promega Corp.); and 3) Dilute 1:10 into a 24-well tissue culture
plate for expansion. Cells in the plates for the functional and cell viability assay
are then grown 2-3 days and the functional and cell viability assays performed. Positive
clones in the 24-well plate are further tested with the functional and cell viability
assays as well as for stability of expression and response for at least 20 passages,
normal growth rate morphology, and frozen for future use at the earliest possible
passage.
Example 42 - OgLuc Secretion Signal Analysis
A. IV opt
[0327] The wild-type OgLuc is processed after synthesis into a mature protein with the secretion
signal sequence cleaved off. To determine if the secretion signal sequence would facilitate
secretion of the OgLuc variant, the IV opt variant of Example 25 and hRL were cloned
into pF4Ag containing an N-terminal OgLuc secretion signal (SEQ ID NO: 54). HEK293
cells (15,000) in 100 µL Dulbecco's Modified Eagle's medium ("DMEM") with 10% fetal
bovine serum (FBS) were transfected as described in Example 25 with 100 ng of plasmid
DNA, i.e., hRL or IV opt with or without the secretion signal and grown overnight
at 37°C. 50 µ L of media was removed to a new plate and saved for a later assay generating
a "media" sample. The rest of the media was removed, and the cells were lysed with
100 µL of lysis buffer described in Example 25 to generate a "lysate" sample. 10 µL
of media sample and 10 µL of lysate sample were assayed for luminescence (FIG. 63).
Samples for hRL with ("Renilla sig") or without ("Renilla") the OgLuc secretion signal
sequence were measured using 50 µL of lysis buffer containing 20 µM native coelenterazine.
Samples for IV opt with ("IV opt sig") or without ("IV opt") the OgLuc secretion signal
sequence were measured using 50 µL of lysis buffer containing 20 µM PBI-3939.
[0328] In FIG. 63, the filled bars represent the amount of light that was detected from
the media in the absence of any lytic reagent. The open bars represent the total light
(secreted + non-secreted) that was detected upon addition of a lytic reagent. FIG.
63 shows that IV opt was secreted from HEK293 cells into the growth media and that
the secretion signal sequence was functional in mammalian cells. "IV opt sig" represents
the only situation where a significant amount of luciferase was detected in the media.
The results also indicate that this particular signal peptide did not facilitate secretion
of hRL.
B. 9B8, V2 and L27V
[0329] To determine if the secretion signal sequence of OgLuc facilitates its secretion,
the OgLuc variants 9B8, V2 and L27V were cloned into pF4Ag containing an N-tenninal
OgLuc secretion signal sequence. The variants were also cloned into vectors without
the secretion signal sequence. CHO or HeLa cells were then plates at 100,000 cells/well
in 1 mL F12 media with 10% FBS and 1X sodium pyruvate (CHO cells) or DMEM with 10%
FBS and 1X sodium pyruvate (HeLa cells) into 12-well plates and incubated overnight
at 37°C, 5% CO
2.
[0330] After the overnight incubation, the cells were transfected with 1µg plasmid DNA containing
9B8, V2, or L27V with or without the secretion signal sequence using the TRANSIT®-LTI
transfection reagent (Mirus Bio) and OPTI-MEM® media (Invitrogen). The cells were
again incubated overnight at 37°C, 5% CO
2.
[0331] After the second overnight incubation, the media was removed and saved for analysis.
To the cells, 1 mL of assay buffer (1 mM CDTA, 150 mM KCl, 2 mM DTT, 100 mM MES pH
6.0, 35 mM Thiourea and 0.5% TERGITOL® NP-9 (v/v)) was added to create a cell lysate.
To 10 µL of cell lysate or saved media from each sample, 50 µL assay buffer with 40
µM PBI-3939 was added, and luminescence measured as described above. FIGS. 64A-D demonstrates
that 9B8, V2 and L27V variants can be used in a secretable system.
[0332] To determine the stability of the secreted variants, 150 µL aliquots of the saved
media from each sample was placed at 37°C or 50°C. The aliquots were then removed
at different time points (0, 1, 2, 3, 5, 6, and 7 min), frozen on dry ice, and kept
at -20°C until assayed. To assay for stability, the media aliquots were thawed to
room temperature, and 10 µL of each aliquot was mixed with assay buffer with PBI-3939
(pH 6.0) as described above. Luminescence was measured as above, and the half-life
(t
50) determined (Table 34).

C. 9B8 and V2 comparison to secreted luciferase of Metridia longa
[0333] The secretion of the OgLuc variants 9B8 and V2 was compared to that of the secreted
luciferase from
Metridia longa. CHO cells were plated at 300,000 cells/well in 3 mL F12 media with 10% FBS into wells
of 6-well plates and incubated overnight at 37°C, 5% CO
2. The cells were then transfected with either 10 or 100 ng of each variant or
Metridia luciferase (Clontech) plasmid DNA using TRANSIT®-LTI according to the manufacturer's
instructions and incubated for 20 hrs at 37°C, 5% CO
2. After transfection, the media was removed from the cells and assayed. For the OgLuc
variants, 50 µL of media was assayed with 50 µL of assay reagent (previously described;
40 µM PBI-3939). For
Metridia luciferase, the media was assayed using the Ready-to-Glo™ Secreted Luciferase Reporter
System (Clontech) according to the manufacture's protocol. Briefly, 5 µL of the 1X
substrate/reaction buffer was added to 50 µL of media sample. Luminescence was then
measured as previously described (FIGS. 65A-B).
Example 43 - Evaluation of OgLuc Variants and Novel Coelenterazine in Live Cells
[0334]
- A. The use of OgLuc variants and PBI-3939 in live cells was examined. HEK293 cells
were plated in 96-well plates at 15,000 cells/well and grown overnight at 37°C. The
following day, the cells were transiently transfected using TRANSIT®-LT1 in 3 replicates
with 100 ng of hRL or 9B8 opt in pF4Ag and grown overnight at 37°C. The following
day the growth media was removed and replaced with media containing 60 µM VIVIREN™
Live Cell Substrate (Promega Corp.), 60 µM ENDUREN™ Live Cell Substrate (Promega Corp.),
or 60 µM PBI-3939 for both hRL and 9B8 opt transfected cells. Non-transfected cells
were used as background control. The plate was incubated at 37°C during the course
of one day and periodically measured on a TECAN® GENIOS™ Pro luminometer, i.e., 11
times over the course of 24 hrs. FIGS. 66A-B shows the luminescence of the transfected
cells divided by the luminescence of the non-transfected cells for each of the substrates,
i.e., the signal to background ratio: The data shows that 9B8 opt generated luminescence
in a live cell setting (i.e., no lysis) by incubating cells with VIVIREN™, ENDUREN™,
or PBI-3939. The data also demonstrated that PBI-3939 can permeate cells in culture,
react with the OgLuc variant, and generate luminescence, thus making it compatible
with use in a live cell assay.
- B. To demonstrate live cell analysis using the OgLuc variants, L27V was fused to HALOTAG®
and expressed and monitored in live cells. U2OS cells were plated at 40,000 cells/mL
into imaging chamber wells and incubated overnight at 37°C, 5% CO2. Cells were than transfected using FUGENE® HD according to the manufacturer's protocol
with the plasmids pFC14K, pFN21K or pF4Ag (all Promega Corp.) containing L27V or pF4Ag
containing L27V with the native or IL-6 secretion sequence. Cells were then incubated
for 24 hrs at 37°C, 5% CO2.
[0335] Following incubation, the cells were exposed to HALOTAG® TMR ligand (Promega Corp.),
imaged, and fixed. Immunocytochemistry (ICC) was then performed according to the ICC
protocol in the HALOTAG® Technology: Focus on Imaging technical manual (Promega Corp.;
TM260). The primary antibody used was a polyclonal rabbit, anti-OgLuc 9B8 antibody
(1:1000). The secondary antibody used was an Alexa 488 conjugated secondary antibody
(green) (FIG. 67A). FIG. 67A shows green fluorescent channel and FIG. 67B shows the
differential interference contrast (DIC). Images were acquired using an Olympus Fluoview
FV500 confocal microscope (Olympus, USA) outfitted with a 37°C + CO2 environmental
chamber (Solent Scientific Ltd., UK).
[0336] FIGS. 67B-D shows the ICC images with native or IL-6 secretion sequence. Both signal
sequences dramatically decrease the amount of enzyme in the nucleus. The punctuate
nature of the labeling in the cytoplasm is indicative of vesicle formation expected
to occur during the secretion process. The data demonstrates that the presence of
a signal peptide reduces the amount of luciferase in the nucleus.
[0337] C. As shown above, the OgLuc variants and novel substrates of the present invention
are biocompatible. A reporter system is envisioned where the OgLuc variant is cloned
into an expression vector with a promoter of interest and expressed in cells as a
reporter protein. The cells are then treated with PBI-3939 which will permeate cells
in culture, react with the OgLuc variant, and generate luminescence.
[0338] In addition to being cell permeant, PBI-3939 shows comparable biocompatibility to
native coelenterazine in terms of cell viability. A version of compound 3939 containing
chemical modifications known to increase the stability of native coelenterazine in
media can be synthesized and used for more robust, live cell OgLuc variant-based reporter
assays. Another example of live cell reporting includes the use of a secretable OgLuc
variant as a reporter. The native secretion signal peptide (or other known secretion
signal peptides) can be fused to the N-terminus of an QgLuc variant so that when the
fusion is expressed in mammalian cells, a portion of it will be secreted through the
cell membrane into the culture media. Upon addition of substrate luminescence is generated.
Example 44 - Protein fusion reporters
[0339] The OgLuc variants of the present invention can be used as fusion tags for a target
protein of interest as a way to monitor intracellular levels of that target protein.
Specific proteins involved in stress response pathways, e.g., DNA damage, oxidative
stress, inflammation, can be monitored in cells as a way to probe the role various
types of stimuli may play in these pathways. The variants can also be used as a means
to monitor cellular trafficking of a target protein. The variants can also be fused
to viral genomes (e.g., HIV, HCV) so that titer levels, i.e., infectivity, can be
monitored in cells following treatment with potential antiviral agents. The variants
can also be fused to green fluorescent protein (GFP) or HALOTAG® (in addition to a
target protein) so that FACS could be used to identify high expression clones and
to provide localization information.
Example 45 - Evaluation of OgLuc Variant in 3-Component Fusion Protein ("Sandwich")
[0340] 3-component fusion proteins, or "sandwich" fusions, can be used to place bioluminescent
and fluorescent proteins close to one another for optimization of a biosensor based
on BRET.
A. C1+4AE, IV, 9B8 and 9F6
[0341] The OgLuc variants C1+4AE (SEQ ID NOs: 55 and 56), IV (SEQ ID NOs: 57 and 58), 9B8
(SEQ ID NOs: 61 and 62), and 9F6 (SEQ ID NOs: 63 and 64), and hRL (SEQ ID NOs: 32
and 33) were cloned into a pF4Ag fusion vector with an N-terminal Id (
Benezra et al., Cell, 61(1):49-59 (1990)), known to be a poor fusion partner, and a C-terminal HT7, which was used for normalization.
The gene of interest was "sandwiched" between Id and HT7, i.e., Id-Luciferase-HT7.
E. coli lysates, containing the variant constructs in pF4Ag or pF4Ag sandwich background,
were prepared as described in Example 26 and then assayed with 20 µM native coelenterazine
in the buffer described in Example 25.
[0342] FIG. 68 shows the luminescence for each variant in either pF4Ag or pF4Ag sandwich
background ("Sand"). FIG. 69 shows the fold-decrease in luminescence due to the presence
of Id and HT7 and determined by dividing the luminescence of the variant in pF4Ag
by the luminescence of the variant in the pF4Ag-sandwich. Samples with the largest
values showed the most sensitivity to the poor fusion partner Id. The variant 9B8
was the brightest in the sandwich context.
B. 9B8 OPT AND 9B8 OPT+K33N
[0343] The variants 9B8 opt and 9B8 opt+K33N were analyzed in a sandwich background as described
above. Sandwich constructs for 9B8 opt (SEQ ID NOs: 40 and 41) and 9B8 opt+K33N (SEQ
ID NOs: 59 and 60) were generated as described above.
E. coli lysates were assayed and measured using the same assay buffer and luminometer as
used for generating FIG. 40. FIG. 70 shows the fold-decrease in the presence of a
sandwich background indicating that 9B8 opt+K33N is less sensitive to the poor fusion
partner Id than 9B8 opt.
C. 23D2 and 24C2
[0344] Variants 23D4 (NF) and 24C2 (NF) were subcloned into the Id-OgLuc-HT7 sandwich background
and assayed in
E. coli. The sandwich variants, 23D4 (F) (SEQ ID NOs: 76 and 77) and 24C2 (F) (SEQ ID NOs:
78 and 79) were compared to 9B8 opt+K33N in the sandwich background (SEQ ID NO: 59
and 60). Table 35 shows the variants had at least the same luminescence as 9B8 opt+K33N
in the sandwich background context.
Table 35: Increase in Luminescence Generated by OgLuc Variants Compared to 9B8 opt+K33N+170G
in Sandwich Background
| Sample |
Sequence |
Fold over 9B8 opt+K33N sandwich (E. coli) |
| 23D4 (F) |
G26G, M106L, R112R, 170G |
1.0 |
| 24C2 (F) |
R11Q, T39T, 170G |
1.0 |
D. 1F7 and 15H1
[0345] The PCR library in the Id-OgLuc-HT7 sandwich background was screened for additional
Variants with increased luminescence compared to 9B8 opt+K33N in sandwich background.
Selected variants were then assayed in HEK293 and NIH3T3 cells. Table 36 shows the
fold-increase in luminescence of the sandwich variants in
E. coli, HEK293 and NIH3T3 cells, and the amino acid substitutions found in the variants.
1F7 (F) (SEQ ID NOs: 84 and 85) and 15H1 (F) (SEQ ID NOs: 86 and 87) had at least
1.3 fold-increase in luminescence in
E. coli. 1F7 (F) was brighter than 9B8 opt+K33N in the sandwich background in HEK293 and NIH3T3
cells.
Table 36: Increase in Luminescence Generated by OgLuc Variants Compared to 9B8 opt+K33N
in Sandwich Background
| Sample |
Sequence |
Fold over 9B8 opt+K33N sandwich |
| E. coli |
HEK293 |
NIH3T3 |
| 1F7 (F) |
K43R, Y68D |
1.9 |
2.4 |
1.4 |
| 15H1 (F) |
D19D, S66N |
1.5 |
0.9 |
1.2 |
[0346] The sandwich variants were subcloned into the pF4Ag-based non-fusion background vector
to generate 1F7 (NF) (SEQ ID NOs: 80 and 81) and 15H1 (NF) (SEQ ID NOs: 82 and 83)
and were analyzed as described above and compared to 9B8 opt+K33N. Table 37 shows
the fold-increase in luminescence of the variants in
E. coli, HEK293 and NIH3T3 cells. 1F7 (NF) and 15H1 (F) had at least 1.3 fold-increase in
luminescence in
E. coli and HEK293 cells.
Table 37: Increase in Luminescence Generated by OgLuc Variants Compared to 9B8 opt+K33N
+170G
| Sample |
Sequence |
Fold over 9B8 opt+K33N + 170G |
| E. coli |
HEK293 |
NIH3T3 |
| 1F7 (NF) |
K43R, Y68D |
1.5 |
1.5 |
1.1 |
| 15H1 (NF) |
D19D, S66N |
1.7 |
1.7 |
1.2 |
E. V2, 9B8 opt+K33N+L27V+K43R+Y68D, 988 opt+K33N+L27V+T39T+K43R+S66M and L27V
[0347] The variants 9B8 opt+K33N+T39T+K43R+Y68D ("V2"; SEQ ID NOs: 92 and 93), 9B8 opt+K33N+L27V+K43R+Y68D
(SEQ ID NOs: 339 and 340), 9B8 opt+K33N+L27V+T39T+K43R+S66N (SEQ ID NOs: 341 and 342),
and 9B8 opt+K33N+L27V+T39T+K43R+Y68D ("L27V"; SEQ ID NOs: 88 and 89) were subcloned
into the Id-OgLuc-HT7 sandwich background as described above and assayed in HEK293
and NIH3T3 cells as described above. The luminescence generated by the sandwiched
variants were compared to the luminescence generated by the 9B9 opt+K33N sandwich
(SEQ ID NOs: 59 and 60) (Table 38). The L27V sandwich (SEQ ID NOs: 90 and 91) and
V2 sandwich (SEQ ID NOs: 94 and 95) had at least 1.3X fold-increase in luminescence
in HEK293 and NIH3T3 cells.
Table 38: Increase in Luminescence Generated by OgLuc variants in sandwich background
compared to 9B8 opt+K33N in sandwich background
| Sample |
NIH 313 cells |
HEK 293 |
| K33N Sand |
1.0 |
1.0 |
| T39T, K43R, Y68D Sand |
1.6 |
2.3 |
| L27V, K43R, Y68D Sand |
1.4 |
1.7 |
| L27V, T39T, K43R, S66N Sand |
0.7 |
0.7 |
| L27V, T39T, K43R, Y68D Sand |
1.4 |
1.7 |
[0348] The sandwich and non-sandwich versions of the variants V2, 9B8 opt+K33N+L27V+K43R+Y68D,
9B8 opt+K33N+L27V+T39T+K43R+S66N, and L27V were assayed in HEK293 and NIH3T3 cells
as described in Example 37. The luminescence generated by the non-sandwiched variants
was compared to the luminescence generated by the sandwiched variants (Table 39).
The data shown in Table 39 indicates that the fold-decrease in luminescence for the
9B8 opt+K33N sandwich was less in mammalian cells than in
E. coli cells as shown in FIG. 70.
Table 39: Fold-Decrease in Luminescence of the OgLuc Variants in the Presence of Sandwich
Background
| Sample |
NIH 313 cells |
HEK 293 |
| K33N |
29 |
15 |
|
| T39T, K43R, Y68D |
20 |
6 |
|
| L27V, K43R, Y68D |
22 |
8 |
|
| L27V, T39T, K43R, S66N |
25 |
12 |
|
| L27V, T39T, K43R, Y68D |
18 |
6 |
|
Example 46 - Multiplexing
[0349]
- A. Lysates of E. coli expressing the variant 9B8 opt were prepared as previously described in Example 27
and diluted 1000-fold in DMEM without phenol red + 0.1% PRIONEX®. Luminescence from
a sample containing 6.3 µg/mL of purified red click beetle luciferase and E. coli lysate expressing the variant 9B8 opt was detected using a modified DUAL-GLO® Luciferase
Assay System (Promega Corp.). DUAL-GLO® STOP&GLO® Reagent containing 20 µM coelenterazine-h
and DUAL-GLO® STOP&GLO® Reagent containing 20 µM PBI 3939 were used, according to
the manufacturer's protocol, to detect the red click beetle luciferase and OgLuc variant
9B8 luciferase from a single sample. Three replicates were performed.
[0350] Luminescence was detected on a Turner MODULUS™ luminometer. Table 40 shows the average
luminescence generated by the red click beetle luciferase ("click beetle"), and the
luminescence generated by 9B8 opt ("Ogluc") with coelenterazine-h ("coel h") or PBI-3939
("3939"). The standard deviation ("+/-") and coefficient of variance ("CV") are also
shown. A "no coelenterazine" control was performed to illustrate the amount of quenching
of the red click beetle signal by the DUAL-GLO® STOP&GLO® Reagent of the DUAL-GLO®
Luciferase Assay System in the absence of coelenterazine. The "no coelenterazine"
control yielded a 349-fold quench. Table 40 shows that large luminescent signals from
both the red click beetle and
OgLuc variant 9B8 was detected in a single sample. This demonstrates that each signal can
be read sequentially in a two-step assay, and the signal from the first enzyme can
be quenched enough to not contribute significantly to the signal from the second enzyme.
Table 40: Average Luminescence Generated by the Red Click Beetle and 9B8 opt Luciferases
Using a Modified DUAL-LUCIFERASE™ Reporter Assay
| |
click beetle |
+/- |
CV |
Ogluc |
+/- |
CV |
fold-quench |
+/- coel |
| no coel |
5,061,163 |
147,145 |
2.9% |
14.504 |
214 |
1.5% |
349 |
|
| coel h |
5,082,100 |
152,254 |
3.0% |
921.440 |
47,623 |
5.2% |
|
64 |
| 3939 |
6,078,547 |
41,753 |
0.8% |
2,996,940 |
187,300 |
6.2% |
|
207 |
[0351] B. To demonstrate that the multiplex reporter assay described above could be done
in reverse, i.e., OgLuc luminescence detected first, quenched and a second luminescence
detected, e.g., red click beetle or firefly luciferase, various
Renilla luciferase inhibitors (see
U.S. Published Application No. 2008/0248511) were screened for their ability to also inhibit OgLuc. Two different, previously
identified,
Renilla inhibitors, PBI-3077 and 1424, were added at various concentrations
(see Table 41) to
E. coli lysate samples expressing the variant 9B8 (diluted as above) and a buffer containing
100 mM MES pH 6.0, 1 mM CDTA, 150 mM KCI, 35 mM Thiourea, 2 mM DTT, 0.25% TERGITOL®
NP-9 (v/v), 0.025% MAZU® DF 204, and 20 µM PBI-3939. Luminescence was measured as
described previously except luminescence was measured using the GLOMAX®-Multi Microplate
luminometer (Promega Corp.; also known as Turner MODULUS™). As shown in Table 41,
both compounds were able to inhibit OgLuc luminescence. This demonstrates that an
OgLuc variant can be multiplexed in a reporter assay with another luciferase wherein
luminescence from an OgLuc variant is detected first in the reporter assay.
Table 41: The effect of PBI-3077 and PBI-1424 on Luminescence Generated by Bacterial
Lysates Expressing 9B8 opt Using PBI-3939 as a Substrate
| |
(mM or %) |
RLU |
+/- |
% |
| |
control |
27,794,600 |
626,862 |
100% |
| AI (3077) |
3 |
15,473,100 |
209,567 |
56% |
| mM |
0.3 |
22,210,433 |
102,888 |
80% |
| |
0.03 |
22,484,933 |
927,459 |
81% |
| AC (1424) |
0.4 |
176,868 |
9,579 |
0.64% |
| % |
0.04 |
24,267,533 |
363,861 |
87% |
| |
0.004 |
25,126,900 |
1,569,453 |
90% |
C. The spectral resolution between OgLuc Variant L27V and firefly luciferase (Fluc)
was analyzed. Purified L27V (previously described; 9.54 pM) in DMEM without phenol
red + 0.1% PRIONEX® was mixed with assay reagent (previously described) containing
20 µM PBI-3939. Purified firefly luciferase enzyme (QUANTILUM® Recombinant Luciferase;
Promega Corp.; 271 ng/mL) in the same media was mixed with a test reagent (100 mM
HEPES, pH 7.4, 1 mM CDTA, 16 mM MgSO4, 1% TERGITOL® NP-9 (v/v), 0.1% MAZU® DF 204,
5 mM ATP, 50 mM DTT, 333 µM luciferin). Purified Renilla luciferase (5 ng/mL GST-Renilla) in 1X Renilla Luciferase Assay Lysis Buffer (Promega
Corp.) was mixed with 10.5 µM native coelenterazine in Renilla Luciferase Assay Buffer.
Luminescence was measured after 3 min for L27V and Fluc and after 10 min for Renilla luciferase (FIG. 71)
D. As another example, an OgLuc variant of the present invention could be used as
transcriptional reporter and paired with either aequorin or a cAMP circularly permuted
firefly luciferase biosensor (or both simultaneously) to detect multiple pathways
in a single sample, e.g., aequorin for the detection and/or measurement of calcium,
the biosensor for the detection and/or measurement of cAMP, and an OgLuc variant for
monitoring of downstream gene expression.
E. Other examples for multiplexing with the OgLuc variants of the present invention
include:
- i) Transfecting cells with constructs containing an OgLuc variant of the present invention
and Firefly luciferase. After transfection, a first reagent could be added to lyse
the cells as well as provide the substrate to generate luminescence for the first
luciferase. Luminescence from the first luciferase would then be measured. A second
reagent would then be added to quench luminescence from the first luciferase as well
as provide the substrate to generate luminescence from the second luciferase. Luminescence
from the second luciferase would then be measured. The choice of which luciferase
to measure first would only depend on the ability to quench the luminescence from
the first luciferase with the second reagent. For this example, luminescence from
the OgLuc variant could be measured first as high concentrations of luciferin (substrate
for firefly luciferase) has been shown to inhibit OgLuc variant activity.
- ii) Transfecting cells with constructs containing an OgLuc variant of the present
invention and Firefly luciferase. After transfection, a first reagent could be added
which contained a live cell substrate to generate luminescence for the first luciferase.
Luminescence from the first luciferase would then be measured. A second reagent would
then be added to lyse the cells, quench luminescence from the first luciferase and
provide the substrate to generate luminescence from the second luciferase. Luminescence
from the second luciferase would then be measured. This is similar to i) except cell
lysis will further limit usage of the live cell substrate and contribute to the quenching
of luminescence from the first luciferase.
- iii) Transfecting cells with constructs containing an OgLuc variant of the present
invention and Firefly luciferase. After transfection, one reagent could be added which
contained substrates to generate luminescence from both luciferases, but the luminescence
from each luciferase is spectrally different. The emission max of the OgLuc variants
is approximately 460 nm, and certain substrates for Firefly luciferase, for example
5'-chloroluciferin and 5'-methylluciferin, can yield an emission max of approximately
610 nm. Therefore, although there may be some overlap from the blue emission into
the red emission, there would be no overlap of the red emission into the blue emission
suggesting that little to no mathematical correction would be involved.
- iv) Transfecting cells with constructs containing an OgLuc variant of the present
invention and Firefly luciferase. After transfection, one reagent could be added which
contained live cell substrates to generate luminescence from both luciferases. The
unique feature of this example is that firefly luminescence tends to shift to red
at live cell assay temperatures, e.g., 37°C, therefore, a number of different luciferin
derivatives could be chosen as a live cell substrate for firefly luciferase to generate
luminescence which is spectrally different from that of the OgLuc variant.
- v) Transfecting cells with constructs containing an OgLuc variant of the present invention
and Renilla luciferase. After transfection, a first reagent could be added to lyse the cells
as well as provide the substrate to generate luminescence for the first luciferase.
Luminescence from the first luciferase would then be measured. A second reagent would
then be added to quench luminescence from the first luciferase as well as provide
the substrate to generate luminescence from the second luciferase. Luminescence from
the second luciferase would then be measured. The choice of which luciferase to measure
first would only depend on the ability to quench the luminescence from the first luciferase
with the second reagent. For this example, inhibitors to quench either the OgLuc variant
or Renilla luciferase luminescence would need to be used.
- vi) Transfecting cells with constructs containing an OgLuc variant of the present
invention and click beetle luciferase. After transfection, one reagent could be added
which contained substrates to generate luminescence from both luciferases, but the
luminescence from each luciferase is spectrally different as click beetle luciferase
generates red-shifted luminescence with native luciferin.
Example 47 - Circular Permutation
[0352] Two circularly permuted (CP) versions of the L27V variant were made: CP84 and CP95.
The number designation refers to the N-terminal residue (e.g., "84" indicates the
new N-terminus of the CP version).
[0353] To create the circular permutations, the prior N- and C-termini are fused together
with no linker ("CP84 no linker" (SEQ ID NOs: 97 and 98) and "CP95 no linker" (SEQ
ID NOs: 105 and 106)) or a 5 ("CP84 5AA linker" (SEQ ID NOs: 99 and 100) and "CP95
5AA linker" (SEQ ID NOs: 107 and 108), 10 ("CP84 10AA linker" (SEQ ID NOs: 101 and
102) and "CP95 10AA linker" (SEQ ID NOs: 109 and 110), or 20 ("CP84 20AA linker" (SEQ
ID NOs: 103 and 104) and "CP95 20AA linker" (SEQ ID NOs: 111 and 112) amino acid linker,
(GSSGG)n (SEQ ID NO: 113) in between the N- and C-termini ends. (Note: L27V starts
with the phenylalanine at the N-terminus, i.e., MVF. The "MV" is present in the "no
linker" construct, but not in the "linker" constructs). Once circularly permuted,
the CP L27V variants were cloned into the pF1K vector.
E. coli cells were transformed with the CP vectors and grown in minimal media using the standard
walk away induction protocol previously described. For each CP construct, cells were
grown in 8 wells of a 96-well plate. After induction, the 8 wells from each sample
were pooled, and 10 µL lysed in 40 µL lysis buffer (100 mM MES pH 6.0, 0.3X PLB, 0.3
mg/mL lysozyme, 0.003 U/µL DNase I, and 0.25% TERGITOL® NP-9 (v/v)). The lysates were
then diluted 1:100 (CP versions with linker) or 1:1000 (non-CP versions) in lysis
buffer. The CP version without linker was not diluted. The lysates or lysate dilutions
were assayed in triplicate in 50 µL assay reagent (previously described). Luminescence
was measured as previously described (FIG. 72).
Example 48 - Identifying Additional Sites for Circular Permutation
[0354] To identify additional CP sites, determine the impact of the CP sites on luciferase
activity and investigate the use of a "tether" between fragments, CP constructs were
made with a circular permutation made at approximately every 3
rd site (i.e., amino acid) of the L27V variant (
See FIG. 73E). One skilled in the art would understand that other sites, e.g., the 1
st and 2
nd site, could also be tested and used in circular permuted OgLuc variants described
herein using the methods described here.
For example, the L27V variant has been found to be particularly tolerant to circular
permutation, particularly situations in which a relatively large binding domain is
placed in between the permuted fragments (e.g. cAMP/RIIbB-based sensors). At each site, the linker GSSGG-GSSGG-EPTT-
ENLYFQS-DN-GSSGG-GSSGG (SEQ ID NO: 328) was added. The underscored sequence refers to a TEV
protease recognition site. The purpose of the linker is to provide a long enough tether
between the two variant fragments so they can associate in a way that produces a functional
luciferase enzyme. The TEV protease recognition site was used to provide a means to
disrupt the tether (in the presence of TEV protease) so that its importance to maintaining
activity could be investigated. The use of the TEV protease recognition site created
a mode to predict which CP sites would be useful for protein complementation assays
(PCA) or for biosensor applications (e.g., insertion of a response element between
the CP sites).
[0355] The activity that is seen prior to TEV cleavage represents how the two halves of
the variant enzyme behaves in a tethered state. TEV binding to the recognition site
causes cleavage, thereby separating the two halves of the variant enzyme. Samples
that have been cleaved with TEV would represent the un-induced state and provide an
indication of how much background could be expected. Lower activity after TEV cleavage
indicates that the two halves cannot come together without induction. Samples that
show a large loss in activity after TEV cleavage indicate sites that would function
in PCA and biosensor applications. In the case of PCA, the two halves of the variant
enzyme would be fused to binding partners that are able to come together (tether)
after an induced binding event. In the case of a biosensor, the two halves would "tether"
after a binding-induced conformational change occurs. One example for PCA would be
to fuse one half of L27V to FRB and the other half to FKBP. The two halves would be
brought into proximity with exposure to rapamycin (
Banaszynski et al., J. Am. Chem. Soc, 127(13):4715-4721 (2005)). One example of a biosensor application would be to insert a Cyclic AMP binding
domain (e.g., RIIbB) between the CP sites and induce a conformational change by binding
of Cyclic AMP to the binding domain.
[0356] Once each CP L27V construct was made, the CP enzyme was expressed in wheat germ,
E. coli and mammalian cells and digested with TEV protease to investigate luciferase activity.
- 1. For analysis in wheat germ, the CP constructs were expressed using the TnT® T7
Coupled Wheat Germ Extract System (Promega Corp.) according to the manufacture's instructions.
The TnT® reactions were then diluted 1:100 in 1X PBS + 0.1% gelatin, and 20 µL added
to 25 µL of TEV reaction reagent (5 µL 20X ProTEV buffer (Promega Corp.), 1 µL 100
mM DTT, and 2 µL 10 U ProTEV Plus (Promega Corp.)). The volume of the digestion reactions
was the brought to 100 µL with water and incubated at 30°C for 60 min. Control samples
without TEV protease were also prepared. 10 µL of the digested samples were then added
to 40 µl DMEM to a final volume of 50 µL and assayed in 50 µL assay reagent (as previously
described; 100 µM PBI-3939). Luminescence was measured as previously described (FIGS.
73A-D).
- 2. For analysis in mammalian cells, HEK293 cells were transfected with the CP L27V
variants using a reverse transfection protocol. Briefly, 1 ng CP L27V plasmid DNA
was mixed with 1 µg carrier DNA and added to cells in a well of a 12-well plate. Cells
were then incubated for 16 hrs at 37°C, 5% CO2. Cell lysates were then prepared by removing the media from the cells, washing them
in 1X PBS, and adding 1 mL 1X PLB. Lysates were then diluted 1:10 in 1X PBS with 0.1%
gelatin. 40 µL of the diluted lysate was then used in a TEV protease digestion as
described above. 10 µL of the digestion was mixed with 40 µL DMEM without phenol red,
and 50 µL assay reagent (previously described; 100 µM PBI-3939) added. Luminescence
was measured as previously described (FIG. 73H).
- 3. For analysis in E. coli, E. coli cultures expressing the CP L27V variants were grown overnight at 30°C. These cultures were used (1:100 diluted in
LB + antibiotic) to make new starter cultures for eventual induction. The starter
cultures were incubated at 37°C with shaking for 2.5 hrs (OD600 is approximately 0.5). Rhamnose (final concentration of 0.2%) was added, the cultures
moved to 25°C, and incubated with shaking for 18 hrs.
[0357] To create lysates, 50 µL 0.5X FASTBREAK™ Cell Lysis Reagent (Promega Corp.) was added
to 950 µL of induced cultures, and the mixtures incubated for 30 min at 22°C. 50 µL
of the lysed culture was then digested with TEV protease as described above and incubated
at room temperature for 2 hrs.
[0358] For analysis, lysates were diluted 1:10,000 in HaloTag® Mammalian Purification Buffer
(Promega Corp.), and 50 µL assayed in 50 µL of assay reagent (as previously described;
100 µM PBI-3939). Basal and TEV induced luminescence was measured at 5 min time points
(FIG. 73F) and the response (FIG. 73G) was determined as previously described.
[0359] FIGS. 73A-D show the basal luminescence of various CP-TEV protease L27V constructs
expressed in wheat germ extract. FIG. 73E summarizes the derived CP variants that
responded to TEV protease (response is fold decreased), indicating that the CP variants
can be used as TEV sensors, i.e., they are indicative of "tether dependence." Variants
showing at least a 1.2-fold change were further validated as signification using Student's
Test (unpaired
p values; confidence level of 0.03). These results indicate that each CP variant is
capable of generating luminescence.
[0360] Various CP-TEV protease L27V constructs were expressed in HEK293 cells. The reverse
transfection protocol, previously described was used to transfect 1 ng DNA /well with
1 µg of carrier DNA. Each cell sample was grown in 1 mL of media in a 12 well plate.
Cell lysates were prepared by removing media and adding 1 mL of 1X PLB. Samples were
diluted 1:10 in 1X PBS+0.1% gelatin. 40 µL of the dilution sample was set up for TEV
digestion. 10 µL of the digestion reaction was added to 40 µL of DMEM without phenol
red and 50 µL of PBI-3939 as previously described. FIG. 73H shows the luminescence
of the various CP-TEV protease L27V constructs expressed in HEK293 cells.
[0361] The data in FIGS. 73A-H demonstrates that the L27V variant can be circularly permuted
at various sites, and different sites have different dependencies regarding tether
length. The mammalian cell data and Wheat Germ data show similar fold reduction with
TEV cleavage. The CP L27V variants that are more dependent on the tether, i.e., are
more sensitive to TEV protease cleavage, are potential candidates for PCA. CP L27V
variants that are less dependent on the tether may be potential candidates for self-complementation/dimerization
assays.
EXAMPLE 49 - PROTEIN COMPLEMENTATION ASSAYS
[0362] Protein complementation assays (PCA) provide a means to detect the interaction of
two biomolecules, e.g., polypeptides. PCA utilizes two fragments of the same protein,
e.g., enzyme, that when brought into close proximity with each other can reconstitute
into a functional, active protein. An OgLuc variant of the present invention can be
separated into two fragments at a site(s) tolerant to separation. Then, each fragment
of the separated OgLuc variant can be fused to one of a pair of polypeptides of interest
believed to interact, e.g., FKBP and FRB. If the two polypeptides of interest do in
fact interact, the OgLuc fragments then come into close proximity with each other
to reconstitute the functional, active OgLuc variant. The activity of the reconstituted
OgLuc variant can then be detected and measured using a native or known coelenterazine
or a novel coelenterazine of the present invention. In another example, the split
OgLuc variant can be used in a more general complementation system similar to lac-Z
(
Langley et al., PNAS, 72:1254-1257 (1975)) or ribonuclease S (
Levit and Berger, J. Biol. Chem., 251:1333 -1339 (1976)). Specifically, an OgLuc variant fragment (designated "A") known to complement with
another OgLuc variant fragment ("B") can be fused to a target protein, and the resulting
fusion can be monitored via luminescence in a cell or a cell lysate containing fragment
B. The source of fragment B could be the same cell (either in the chromosome or on
another plasmid), or it could be a lysate or purified protein derived from another
cell. This same fusion protein (fragment A) could be captured or immobilized using
a fusion between fragment B and a polypeptide such as HALOTAG® capable of attachment
to a solid support. Luminescence can then be used to demonstrate successful capture
or to quantitate the amount of material captured. Methods for protein complementation
can be carried out according to
U.S. Published Application No. 2005/0153310, incorporated herein by reference.
- 1. 9B8 opt PCA constructs were made as follows:
- p9B8PCA 1/4 = pF5A/Met-[9B8 opt (51-169)]-GGGGSGGGSS-FRB (SEQ 10 NOs: 331 and 332)
& pF5A/FKBP-GGGSSGGGSG-[9B8 opt (1-50)] (SEQ ID NOs: 337 and 338)
- p9B8PCA 1/2 = pF5A/Met-[9B8 opt (51-169)]-GGGGSGGGSS-FRB (SEQ ID NOs: 331 and 332)
& pF5A/[9B8 opt (1-50)]-GGGGSGGGSS-FRB (SEQ ID NOs: 333 and 334)
- p9B8PCA 2/3 = pF5A/[9B8 opt (1-50)]-GGGGSGGGSS-FRB (SEQ ID NOs: 333 and 334) & pF5A/FKBP-GGGSSGGGSG-[9B8
opt (51-169)] (SEQ ID NOs: 335 and 336)
- p9B8PCA 3/4 = pF5A/FKBP-GOGSSGGGSG-[9B8 opt (51-169)] (SEQ ID NOs: 335 and 336) &
pF5A/FKBP-GGGSSGGGSG-[9B8 opt (1-50)] (SEQ ID NOs: 337 and 338)
[0363] The PCA constructs were transfected into HEK293 cells (15,000cells/well) into a 96-well
plate using FUGENE® HD according to the manufacturer's instructions. The cells were
then incubated overnight at 37°C, 5% CO
2. After transfection, the media on the cells was replaced with CO
2-independent media with 10% FBS. Assay reagent with 20 µM PBI-3939 was then added,
and luminescence measured on a Varioskan Flash at 28°C. 100 µM rapamycin was then
added to the wells, and luminescence continuously measured for 1 hr. Fold response
was calculated by dividing all luminescence of a given well by the pre-rapamycin treatment
luminescence for the same well (FIG. 74).
[0364] 2. To demonstrate the use of the OgLuc variants in PCA, the L27V02A variant fragments
were complementated with FKBP or FRB, and the interaction between FKBP and FRB measured.
[0365] Table 42 lists the various protein complementation (PCA) constructs made and tested.
"2/3" designates the variant complementation pairs where 1) the "old" C-terminus of
L27V02A ("old"=original C-terminus of L27V02A) is the C-terminal partner of FKBP;
and 2) the "old" N-terminus of L27V02A is the N-terminal partner of FRB. "1/4" designates
the variant pairs where 1) the "old" N-terminus of L27V02A is the C-terminal partner
of FKBP; and 2) the "old" C-terminus of L27V02A is the N-terminal partner of FRB.
For all constructs, FKBP was located at the N-terminus of the L27V02A fragment, and
FRB was located at the C-terminus of the L27V02A fragment. For example, PCA constructs
were made with split sites at position 157
(see Table 42, "2/3" and "1/4" #s 11 and 12 (SEQ ID NOs: 288-295)), 103
(see Table 42, "2/3" and "1/4" #s 9 and 10 (SEQ ID NOs: 296-303)), and 84
(see Table 42, "2/3" and "1/4" #s 7 and 8 (SEQ ID NOs: 304-315)). Other PCA constructs
were made (SEQ ID NOs: 343-426 and 428-
440) (See Table 21)
Table 42
| |
"2/3" |
|
"1/4" |
| 1, |
FKBP-L27V 6-169 |
1. |
FKBP-L27V 1-5 |
| 2. |
L27V 1-5-FRB |
2. |
L27V 6-169-FRB |
| 3. |
FKBP-L27V 12-169 |
3. |
FKBP-L27V 1-11 |
| 4. |
L27V 1-11-FRB |
4. |
L27V 12-169-FRB |
| 5. |
FKBP-L27V 55-169 |
5. |
FKBP-L27V 1-54 |
| 6. |
L27V 1-54-FRB |
6. |
L27V 55-169-FRB |
| 7. |
FKRP-I.27V 84-169 |
7. |
FKBP-I.27V 1-83 |
| 8. |
L27V 1-83-FRB |
8. |
L27V 84-169-FRB |
| 9. |
FKBP-L27V 103-169 |
9. |
FKBP-L27V 1-102 |
| 10. |
L27V 1-102-FRB |
10. |
L27V 103-169-FRB |
| 11. |
FKBP-L27V 157-169 |
11. |
FKBP-L27V 1-156 |
| 12. |
L27V 1-156-FRB |
12. |
L27V 157-169-FRB |
| |
|
|
|
| |
"2/3" |
|
"1/4" |
| 1. |
FKBP-L27V 6-169 |
1. |
FKBP-L27V 1-5 |
| 2. |
L27V 1-5-FRB |
2. |
L27V 6-169-FRB |
| 3. |
FKBP-L27V 12-169 |
3. |
FKBP-L27V 1-11 |
| 4. |
L27V 1-11-FRB |
4. |
L27V 12-169-FRB |
| 5. |
FKBP-L27V 55-169 |
5. |
FKBP-L27V 1-54 |
| 6. |
L27V 1-54-FRB |
6. |
L27V 55-169-FRB |
| 7. |
FKBP-L27V 84-169 |
7. |
FKBP-L27V 1-83 |
| 8. |
L27V 1-83-FRS |
8. |
L27V 84-169-FRB |
| 9. |
FKBP-L27V 103-169 |
9. |
FKBP-L27V 1-102 |
| 10. |
L27V 1-102-FRB |
10. |
L27V 103-169-FRB |
| 11. |
FKBP-L27V 157-169 |
11. |
FKBP-L27V 1-156 |
| 12. |
L27V 1-156-FRB |
12, |
L27V 157-169-FRB |
Table 21
| pCA constructs |
| SEQ ID NO:343 (pCA 31 pCA L27V02A 45-169 FRB) |
| SEQ ID NO:344 (pCA 31 pCA L27V02A 45-169 FRB) |
| SEQ ID NO:345 (pCA 32 FKBP L27V02A 1-44) |
| SEQ ID NO:346 (pCA 32 FKBP L27V02A 1-44) |
| SEQ ID NO:347 (pCA 33 pCA L27V02A 46-169 FRB) |
| SEQ ID NO:348 (pCA 33 pCA L27V02A 46-169 FRB) |
| SEQ ID NO:349 (pCA 34 pCA FKBP 1-45 L27V02A) |
| SEQ ID NO:350 (pCA 34 pCA FKBP 1-45 L27V02A) |
| SEQ ID NO:351 (pCA 35 pCA L27V02A 100-169 FRB) |
| SEQ ID NO:352 (pCA 35 pCA L27V02A 100-169 FRB) |
| SEQ ID NO:353 (pCA 36 FKBP L27V02A 1-99) |
| SEQ ID NO:354 (pCA 36 FKBP L27V02A 1-99) |
| SEQ ID NO:355 (pCA 37 L27V02A 101-169 FRB) |
| SEQ ID NO:356 (pCA 37 L27V02A 101-169 FRB) |
| SEQ ID NO:357 (pCA 38 FKBP 1-100 L27V02A) |
| SEQ ID NO:358 (pCA 38 FKBP 1-100 L27V02A) |
| SEQ ID NO:359 (pCA 39 L27V02A 102-169 FRB) |
| SEQ ID NO:360 (pCA 39 L27V02A 102-169 FRB) |
| SEQ ID NO:361 (pCA 40 FKBP L27V02A 1-101) |
| SEQ ID NO:362 (pCA 40 FKBP L27V02A 1-101) |
| SEQ ID NO:363 (pCA 41 L27V02A 143-169 FRB) |
| SEQ ID NO:364 (pCA 41 L27V02A 143-169 FRB) |
| SEQ ID NO:365 (pCA 42 FKBP 1-142 L27V02A) |
| SEQ ID NO:366 (pCA 42 FKBP 1-142 L27V02A) |
| SEQ ID NO:367 (pCA 43 L27V02A 145-169 FRB) |
| SEQ ID NO:368 (pCA 43 L27V02A 145-169 FRB) |
| SEQ ID NO:369 (pCA 44 FKBP 1-144 L27V02A) |
| SEQ ID NO:370 (pCA 44 FKBP 1-144 L27V02A) |
| SEQ ID NO:371 (pCA 45 L27V02A 147-169 FRB) |
| SEQ ID NO:372 (pCA 45 L27V02A 147-169 FRB) |
| SEQ ID NO:373 (pCA 46 FKBP- L27V02A 1-146) |
| SEQ ID NO:374 (pCA 46 L27V02A-FKBP 1-146) |
| SEQ ID NO:375 (pCA 47 L27V02A 148-169 FRB) |
| SEQ ID NO:376 (pCA 47 L27V02A 148-169 FRB) |
| SEQ ID NO:377 (pCA 48 FKBP-L27V02A 1-147) |
| SEQ ID NO:378 (pCA 48 FKBP-L27V02A 1-147) |
| SEQ ID NO:379 (pCA 49 L27V02A 156-169 FRB) |
| SEQ ID NO:380 (pCA 49 L27V02A 156-169 FRB) |
| SEQ ID NO:381 (pCA 50 FKBP-L27V02A 1-155) |
| SEQ ID NO:382 (pCA 50 FKBP-L27V02A 1-155) |
| SEQ ID NO:383 (pCA 51 L27V02A 158-169 FRB) |
| SEQ ID NO:384 (pCA 51 L27V02A 158-169 FRB) |
| SEQ ID NO:385 (pCA 52 FKBP 1-157 L27V02A) |
| SEQ ID NO:386 (pCA 52 FKBP 1-157 L27V02A) |
| SEQ ID NO:387 (pCA 53 L27V02A 166-169 FRB) |
| SEQ ID NO:388 (pCA 53 L27V02A 166-169 FRB) |
| SEQ ID NO:389 (pCA 54 FKBP L27V02A 1-165) |
| SEQ ID NO:390 (pCA 54 FKBP L27V02A 1-165) |
| SEQ ID NO:391 (pCA 55 FKBP L27V02A 1-47) |
| SEQ ID NO:392 (pCA 55 FKBP L27V02A 1-47) |
| SEQ ID NO:393 (pCA 56 L27V02A 48-169-FRB) |
| SEQ ID NO:394 (pCA 56 L27V02A 48-169-FRB) |
| SEQ ID NO:395 (pCA 57 FKBP L27V02A 1-49) |
| SEQ ID NO:396 (pCA 57 FKBP L27V02A 1-49) |
| SEQ ID NO:397 (pCA 58 pCA L27V02A 50-169 FRB) |
| SEQ ID NO:398 (pCA 58 pCA L27V02A 50-169 FRB) |
| SEQ ID NO:399 (pCA 59 FKBP L27V02A 1-82) |
| SEQ ID NO:400 (pCA 59 FKBP L27V02A 1-82) |
| SEQ ID NO:401 (pCA 60 L27V02A 83-169-FRB) |
| SEQ ID NO:402 (pCA 60 L27V02A 83-16-FRB) |
| SEQ ID NO:403 (pCA 61 FKBP L27V02A 1-84) |
| SEQ ID NO:404 (pCA 61 FKBP L27V02A 1-84) |
| SEQ ID NO:405 (pCA 62 L27V02A 85-169-FRB) |
| SEQ ID NO:406 (pCA 62 L27V02A 85-169-FRB) |
| SEQ ID NO:407 (pCA 63 FKBP L27V02A 1-122) |
| SEQ ID NO:408 (pCA 63 FKBP L27V02A 1-122) |
| SEQ ID NO:409 (pCA 64 L27V02A 123-169-FRB) |
| SEQ ID NO.410 (pCA 64 L27V02A 123-169-FRB) |
| SEQ ID NO:411 (pCA 65 FKBP L27V02A 1-123) |
| SEQ ID NO:412 (pCA 65 FKBP L27V02A 1-123) |
| SEQ ID NO:413 (pCA 66 L27V02A 124-169 FRB) |
| SEQ ID NO.414 (pCA 66 L27V02A 124-169 FRB) |
| SEQ ID NO:415 (pCA 67 L27V02A 1-168) |
| SEQ ID NO:416 (pCA 67 L27V02A 1-168) |
| SEQ ID NO:417 (pCA 67 L27V02A 1-168) |
| SEQ ID NO:418 (*pCA 68 L27V02A 169 FRB) |
| SEQ ID NO:419 (*pCA 68 L27V02A 169 FRB) |
| SEQ ID NO:420 (pCA 69 FKBP L27V02A 1-166) |
| SEQ ID NO:421 (pCA 69 FKBP L27V02A 1-166) |
| SEQ ID NO:422 (*pCA 70 L27V02A 167-169 FRB) |
| SEQ ID NO:423 (*pCA 70 L27V02A 167-169 FRB) |
| SEQ ID NO:424 (pCA 71 FKBP L27V02A 1-164) |
| SEQ ID NO:425 (pCA 71 FKBP L27V02A 1-164) |
| SEQ ID NO:426 (pCA 72 L27V02A 165-169 FRB) |
| SEQ ID NO:428 (pCA 72 L27V02A 165-169 FRB) |
| SEQ ID NO:429 (pCA 73 FKBP L27V02A 1-162) |
| SEQ ID NO:430 (pCA 73 FKBP L27V02A 1-162) |
| SEQ ID NO:431 (pCA 74 L27V02A 163-169 FRB) |
| SEQ ID NO:432 (pCA 74 L27V02A 163-169 FRB) |
| SEQ ID NO:433 (pCA 75 FKBP L27V02A 1-160) |
| SEQ ID NO:434 (pCA 75 FKBP L27V02A 1-160) |
| SEQ ID NO:435 (pCA 76 L27V02A 161-169 FRB) |
| SEQ ID NO:436 (pCA 76 L27V02A 161-169 FRB) |
| SEQ ID NO:437 (pCA 77 FKBP L27V02A 1-158) |
| SEQ ID NO:438 (pCA 77 FKBP L27V02A 1-158) |
| SEQ ID NO:439 (pCA 78 L27V02A 159-169 FRB) |
| SEQ ID NO:440 (pCA 78 L27V02A 159-169 FRB) |
[0366] The complementation pairs described in Table 42 were cloned into the pF4Ag vector
as previously described. The PCA constructs (900 µL) were then expressed in rabbit
reticulocyte lysate (RRL; Promega Corp.) or wheat germ extract (Promega Corp.) following
the manufacture's instructions. 1.25 µL of the expression reactions for each PCA pair
were mixed with 10 µL of 2X Binding Buffer (100 mM HEPES, 200 mM NaCl, 0.2% CHAPS,
2 mM EDTA, 20% glycerol, 20 mM DTT, pH 7.5) and 7.5 µL water, and 18 µL transferred
to wells of a 96-well plate. 2 µL of 5 µM Rapamycin (final concentration 0.5 µM) was
added and incubated for 10 min at room temperature.
[0367] Following incubation, 100 µL of PBI-3939 (50X stock diluted to 1X in assay buffer)
and incubate for 3 min at room temperature. Luminescence was measured as previously
described (FIG. 76A-B: wheat germ; FIG. 76C-D: rabbit reticulocyte; FIG. 76E-F: cell
free system [which system? WG or RRL?]; FIG. 76G: HEK293 cells).
[0368] FIG. 76A-G show the luminescence of various protein complementation (PCA) L27V pairs:
one L27V fragment of each pair was fused to either FKBP or FRB using a 2/3 configuration
(FIGS. 76A and 76C) or a 1/4 configuration (FIGS. 76B and 76D) as described, and the
interaction of FKBP and FRB monitored in wheat germ extract (FIGS. 76A and 76B) and
rabbit reticulocyte lysate (RRL) (FIGS. 76C and 76D); and the luminescence of various
protein complementation (PCA) negative controls (FIG. 76E). The luminescence of various
protein complementation L27V using a 1/4 configuration in a cell free system (RRL)
(FIG. 76F) and HEK293 cells (FIG. 76G) was measured. The data in FIGS. 76A-G demonstrates
that a variety of different deletions, i.e.; small fragments of the L27V variant,
are functional.
[0369] 3. To demonstrate the use of the PCA constructs for cell-based PCA, the constructs
were transfected into HEK293 cells and assayed with PBI-4377. Plasmid DNA (5 ng) from
each PCA pair (6, 12, 55; 84, and 103) were mixed with 40 ng carrier DNA (pGEM-3fz)
and 5 µL OPTI-MEM® and incubated at room temperature for 5 min. FUGENE® HD (0.15 µL)
was then added and again incubated at room temperature for 15 min. The DNA transfection
mixtures were added to 100 µL HEK293 cells (1.5x10
5 cells/mL) in DMEM with 10% FBS (no antibiotics), transferred to wells of a 96-well
plate, and incubated overnight at 37°C, 5% CO
2.
[0370] After transfection, the media was removed and replaced with CO
2-independent media with 20 µM or 50X PBI-4377 and incubated at 37°C without CO
2 regulation for 2 hrs. Luminescence was measured, 10 µL rapamycin added, and luminescence
measured again every 2 min for 2 hrs (FIGS. 76A-C).
[0371] 4. To demonstrate the use of the PCA constructs to identify inhibitors of protein-protein
interactions, the constructs described in #2 of this example were used.
[0372] The complementation pairs, 103 "2/3", 157 "2/3", 103 "1/4" and 157 "1/4" described
in Table 42 were cloned into the pF4Ag vector as previously described. The PCA constructs
(25 µL) were then expressed in rabbit reticulocyte lysate (RRL; Promega Corp.) following
the manufacture's instructions. 1.25 µL of the expression reactions for each PCA pair
were mixed with 10 µL of 2X Binding Buffer (100 mM HEPES, 200 mM NaCl, 0.2% CHAPS,
2 mM EDTA, 20% glycerol, 20 mM DTT, pH 7.5) and 7.5 µL water, and 16.2 µL transferred
to wells of a 96-well plate. Rapamycin was examined with various amounts of FK506.
To the reactions, the FRB-FKBP binding inhibitor, FK506 (10X) was added, and the reactions
incubated at room temperature for 10 min. 15 nM rapamycin (10X stock solution) was
added to get a final concentration of 1.5 nM rapamycin and incubated for 2 hrs at
room temperature. Following incubation, 100 µL of PBI-3939 (50X stock diluted to 1X
in assay buffer) and incubated for 3 min at room temperature. Luminescence was measured
on a GLOMAX® luminometer. FIG. 77 demonstrates that the PCA constructs disclosed herein
can be used to identify inhibitors of protein-protein interactions.
[0373] 5. To demonstrate the use of the PCA constructs in a lytic format, the complementation
pairs, 103 "2/3", 157 "2/3", and 103 "1/4" were transfected into HEK293 cells and
assayed with PBI-3939. 0.5 ng plasmid from each PCA pair was mixed with 5 µL OPTI-MEM®
and 49 ng pGEM-3zf (Promega Corp.). The sample mixture was incubated at room temperature
for 5 min. 0.15 µL FUGENE® HD was then added to the sample mixture and incubated at
room temperature for 15 min. 100 µL of HEK293 cells in DMEM with 10% FBS (no antibiotics)
at a concentration of 1.5x10
5 cells/mL was added to each sample mixture. The cell sample was then transferred to
a well of a 96-well plate and incubated at 37°C, 5% CO
2 overnight.
[0374] The next day, 11.1 µL of 10 µM Rapamycin (Final concentration 1 µM) was added to
half of the wells and 11.1 µL water was added to other half of the wells. The 96-well
plates were incubated at 37°C for 1 hr. 100 µL of assay reagent + PBI-3939 (2 µL 50X
PBI-3939 mixed with 98 µL assay reagent, previously described) was added to each well
and the plates were incubated at 37°C for 4 min. Luminescence was measured on a GLOMAX®
luminometer at 37°C with 0.5s integration time and 1 read. (FIG. 76H).
Example 50 - OgLuc cAMP Biosensor
[0375] The OgLuc variants of the present invention can be linked to light output not only
through concentration, but also through modulation of enzymatic activity. For example,
a cAMP biosensor can be developed by incorporating a cAMP-binding domain from Protein
Kinase A into a circularly permuted OgLuc variant. An OgLuc variant of the present
invention can be circularly permuted at a site(s) tolerable to such permutation by
methods known in the art (e.g.,
U.S. Published Application No. 2005/0153310). The resulting circularly permuted OgLuc variant chimeric protein can function as
an intracellular biosensor for cAMP when expressed in mammalian cells. Upon binding
of cAMP to the biosensor, the biosensor undergoes a conformational change that creates
an active luciferase enzyme. Treating the cells with forskolin, an activator for adenylate
cyclase, should result in an increase in luminescence with increasing concentrations
of forskolin. Similar biosensors for targets including but not limited to calcium
(Ca+2), cGMP, and proteases such as caspases and tobacco etch virus (TEV) can be developed
by incorporating the appropriate binding domain or cleavage site for each into a circularly
permuted OgLuc variant.
[0376] The utility of OgLuc as a biosensor was demonstrated by analysis of variant 9B8 opt
in the context of a cAMP sensor. Circularly permuted constructs containing the RIIβB
subunit of Protein Kinase-A flanked by OgLuc variant sequences were made and expressed
in a cell free system as described in described in PCT application
PCT/US2007/008176, except the sites for circular permutation were chosen as described below. The nascent
protein was assayed in the presence and absence of cAMP. Response to cAMP is defined
as the ratio of activity (+) cAMP/ (-) cAMP.
[0377] A structural model for OgLuc has been created, based on similarities to certain fatty
acid binding proteins of known structure, previously described in
PCT/US2010/33449. The model predicts an ordered sequence of the standard protein structural motifs;
α-helix and β-sheet. The regions that transition between these structural elements
as circular permutation sites were chosen (see Table 43).
- 1. The template for expression of the biosensor constructs consisted of: C-terminal
OgLuc sequence-RIIβB sequence-N-terminal OgLuc sequence in plasmid pF5 (Promega Corp.).
The TNT® T7 Coupled Wheat Germ Extract System (Promega Part #L4140) was used to translate
the construct. The TNT® Wheat Germ Extract Reaction included 25 µL TNT® Wheat Germ
Extract (L411A), 2 µL TNT® Reaction Buffer (L462A), 1 µL Amino Acid Mixture, Complete
(L446A), 1 µL RNasin® (40 U/µL) (N2615), 1 µL TNT® T7 RNA Polymerase (L516A), 1.0
µg DNA template and Nuclease-Free Water to bring the total volume to 50 µL. The reaction
mixture was incubated at 30°C for 120 min.
[0378] An OgLuc activity assay was performed by adding to the 50 µL OgLuc translation mixture,
50 µL OgLuc Glo Reagent (100 mM MES (pH 6.0), 1 mM CDTA, 150 mM KCl, 35 mM thiourea,
2 mM DTT, 0.25% TERGITOL® NP-9 (v/v), 0.025% MAZU® DF 204, and 20 µM PBI-3939) with
or without 100 µM cAMP, and performing a kinetic read for 30 min (TECAN® INFINITE®
F500 Plate Reader). Response is determined by dividing the luminescence generated
by the biosensor with cAMP by the luminescence generated by the biosensor without
cAMP (Table 43).
Table 43: Response of Circularly-Permuted OgLuc Biosensors to cAMP
| CP-SITE |
RESPONSE |
| 27 |
2.6X |
| 51 |
2.2X |
| 84 |
1.5X |
| 122 |
4.3X |
| 147 |
1.9X |
| 157 |
5.6X |
2. A cAMP biosensor of 9B8opt circularly permuted at the CP-site 51 was created as
described in 1. The biosensor was then transfected into HEK293 cells (15,000 cells/well)
using FUGENE® HD according to the manufacturer's instructions into a 96-well plate,
and incubated overnight at 37°C, 5% CO2. After transfection, the media was removed and replaced with CO2-independent media with 10% FBS. The cells were then incubated for 2 hrs at 37°C,
5% CO2 after which varying amounts of FSK were added. The cells were then again incubated
for 3 hrs at 37°C, 5% CO2. 6 µM PBI-3939 was then added, and luminescence measured after 13 min (FIG. 78).
3. Circularly permuted ("CP"; e.g., CP6 refers to the old residue 6 being new residue
1 after Met) and Straight Split ("SS"; e.g., SS6 refers to a sensor orientated as
follows: OgLuc (1-6)-RIIβB binding site (SEQ ID NOs: 441 and 442) -OgLuc (7-169))
versions of L27V were used as cAMP biosensors (SEQ ID NOs: 467-574). CP (SEQ ID NOs:
467-498 and 555-574) and SS (SEQ ID NOs: 499-554) versions of the L27V variant were
derived as previously described and expressed in expressed in rabbit reticulocyte
lysate (RRL; Promega Corp.) following the manufacture's instructions. The linker sequence
between the C-terminus of the RIIβB binding site and OgLuc luciferase sequence was
GGGTCAGGTGGATCTGGAGGTAGCTCTTCT (SEQ ID NO: 575). The linker sequence between the N-terminus
of the RIIβB binding site and OgLuc luciferase sequence was AGCTCAAGCGGAGGTTCAGGCGGTTCCGGA
(SEQ ID NO: 576) 3.75 µL of the expression reactions were mixed with 1.25 µL 4X cAMP
(final concentration 1 nM-0.1 mM), and incubated at room temperature for 15 min. Following
incubation, 100 µL of PBI-3939 (50X stock diluted to 1X in assay buffer) and incubated
for 3 min at room temperature. Luminescence was measured on a GLOMAX® luminometer
(FIGS. 79A-B). Luminescence was also measured for CP and SS versions of the L27V variant
expressed in HEK293 cells and treated with forskolin as previously described (FIGS.
79C-D). FIGS. 79A-D demonstrates that circularly permuted and straight split versions
of the OgLuc variants disclosed herein can be used as biosensors.
Example 51 - Subcellular Distribution and Localization
[0379] To analysis subcellular distribution, U2OS cells were plated at 2x10
4 cells/cm
2 into glass-bottom culture dishes in McCoy's 5A media (Invitrogen) containing 10%
FBS. The cells were then incubated for 24 hrs at 37°C, 5% CO
2. Cells were then transfected with 1/20 volume transfection mixture (FUGENE® HD and
pF5A-CMV-L27V (the L27V variant (SEQ ID NO: 88) cloned into the pF5A vector with CMV
promoter (Promega Corp.)) or pGEM3ZF (Promega Corp.; negative control)) and incubated
for 24 hrs at 37°C, 5% CO
2. Following incubation, the cell media was replaced with CO
2-independent media with 0.5% FBS and 100 µM PBI-4378. After a 30 min incubation at
37°C, unfiltered images were captured on an Olympus LV200 bioluminescence microscope
using a 60X objective (FIGS. 80A-B) for 25, 100, 1000, and 5000 ms.
[0380] To analyze subcellular localization, N-terminal L27V fusions with the GPCR AT1R (Angiotensin
type 1 receptor (SEQ ID NOs: 459 and 460)) with IL-6 secretion sequence (SEQ ID NOs:
461 and 462) or the transcription factor, Nrf2 (SEQ ID NO: 317), were made using a
GSSG linker (SEQ ID NOs: 457 and 458) and transfected into U2OS cells as described
above (FIGS. 81A-C). FIG. 81C ("GPRC") shows expression of a construct where the IL6
signal sequence is upstream of the L27V variant sequence and the AT1R is downstream
of the L27V variant sequence. The L27V variant alone was also transfected ("Unfused").
After a 24 hr incubation at 37°C, 5% CO
2, cell media was replaced with CO
2-independent media with 0.5% FBS and equilibrated for 1 hr at 37°C in a non-CO
2-regulated atmosphere. An equal volume of media + 200 µM PBI-3939 was then added,
and unfiltered images were captured immediately on an Olympus LV200 bioluminescence
microscope using a 60X or 150X objective (FIGS. 81A-C). For cells expressing L27V
alone, PBI-3939 was washed off the cells immediately before image capture.
Example 52 - Monitoring Intracellular Signal Pathways
[0381] This example provides two examples of the novel luciferase being used to monitor
intracellular signal pathways at the protein level (as opposed to the response element
examples which represent transcriptional activation). The variant 9B8opt (SEQ ID NO:
24) was fused to either IkB (
Gross et al., Nature Methods 2(8):607-614 (2005)) (at the C-terminus, i.e., N-IkB-(9B8opt)-C)) or ODD(oxygen-dependent degradation
domain of Hif-1-α (
Moroz et al., PLoS One 4(4):e5077 (2009)) (at the N-terminus, i.e., N-(9B8opt)-ODD-C)). IKB is known to be degraded in cells
upon stimulation with TNFα; therefore, the IKB-(9B8opt) construct could be used as
a live cell TNFα sensor. ODD (Hif-1-α) is known to accumulate inside cells upon stimulation
with compounds that induce hypoxia; therefore, the ODD-(9B8opt) construct could be
used as a live cell hypoxia sensor.
[0382] Constructs containing fusions with IkB or ODD with 9B8opt (pF5A) were expressed in
HEK293 cells via reverse transfection (5 ng (IkB) or 0.05 ng (ODD) DNA (mixed with
carrier DNA to give a total of 50 ng)) as previously described and incubated for 24
hrs at 37°C, 5% CO
2. After transfection, the media was replaced with fresh CO
2-independent media containing 0.5% FBS and 20 µM PBI-4377 and allowed to equilibrate
for 4 hrs at 37°C, atmospheric CO
2. Cells were then exposed to a stimulus: TNFα for IkB fusion expressing cells and
phenanthroline for ODD fusion expressing cells. DMSO (vehicle) was added to control
cells. For the TNFα/IKB samples, 100 µg/mL cycloheximide was added approximately 15
min prior to adding the stimulus to prevent synthesis of new protein. At the indicated
time points following treatment, cells were assayed for luminescence. For data normalization,
the RLU of each sample at a given time point were divided by the RLU from the same
sample immediately after stimulation. Fold response for each sensor was then determined
(FIGS. 82A-C).
[0383] B. L27V was used to monitor the oxidative stress signal pathways at the protein level.
L27V or
Renilla luciferase (Rluc) was fused to Nrf2/NFE2L2 in a pF5K expression vector (at the C-terminus;
i.e., N-Nrf2-(L27V)-C or N-Nrf2-(Rluc)-C). Keap1 is a negative regulator of Nrf2 (SEQ
ID NO: 217). In order to faithfully represent regulation of Nrf2-L27V02 protein levels,
Keapl, was co-expressed to keep Nrf2 levels low (via ubiquitination).
[0384] Nrf2-L27V or Nrf2-Rluc (5 ng, pF5K) and a HALOTAG®- Keap1 fusion protein (pFN21-HT7-Keap1
(SEQ ID NO: 316); 50 ng) were expressed in HEK293 cells by transfection of the cells
at the time of seeding into the 96-well plates as previously described and incubated
for 24 hrs at 37°C, 5% CO
2. After transfection, the media was replaced with fresh CO
2-independent media with 0.5% FBS and 20 µM PBI-4377 for L27V or 20 µM ENDUREN™ (Promega
Corp.) for
Renilla luciferase, and the cells equilibrated for 4 hrs at 37°C under atmospheric CO
2. For kinetic analysis, 20 µM D,L sulforaphane or vehicle (DMSO) were used. In FIG.
83A, luminescence was measured as previously described at the indicated time points
following treatment. For data normalization, the luminescence of each sample at a
given time point was divided by the luminescence from the same sample immediately
after stimulation (FIGS. 83B-C).
[0385] C. A comparison of the response of the Nrf2 sensor described in B and Nrf2(ARE)-Luc2P
reporter (Promega Corp.) was performed. Both the Nrf2 sensor and reporter were screened
as described in section B above. For the firefly (Luc2P) reporter gene assay, the
ONE-GLO™ assay reagent was used. FIGS. 84A-B provides the normalized response of Nrf2-L27V
at 2 hrs and Nrf2(ARE)-Luc2P at 16 hrs
Example 53 - Evaluation of OgLuc Variant as Bioluminescent Reporter with BRET
[0386] Bioluminescence resonance energy transfer (BRET) allows monitoring of protein-protein
interactions. The intramolecular energy transfer was examined between IV and a HT7
fusion partner where HT7 was previously labeled with a fluorophore, i.e., TMR (excitation/emission
(ex/em) wavelength = 555/585 nm) or Rhodamine 110 (excitation/emission wavelength
= 502/527 nm). 50 µL of a bacterial cell lysate containing the IV-HT7 fusion protein
of Example 34 was incubated with or without 0.001-10 µM fluorophore ligand for 1 hr
at room temperature. After the incubation, 50 µL of RENILLA-GLO™, which contains 22
µM coelenterazine-h, was added to 50 µL of the enzyme-ligand mixture, and the emission
spectrum was recorded at 5 min. Example spectra of IV-HT7 with TMR (FIG. 83A) or Rhodamine
110 ("Rhod110") (FIG. 85B) are shown indicating BRET was greater when the ex/em of
the ligand was closer to the 460 nm luminescent peak of OgLuc, i.e., greater with
Rhodamine 110. This data shows that intramolecular energy transfer can occur between
OgLuc variants and a fluorophore on a fusion protein. Three different controls were
used for comparison (data not shown): 1) a non-HT fusion, 2) a HT-fusion that was
not labeled with a HT ligand, and 3) a labeled HT-fusion that was proteolytically
cleaved at a TEV site between OgLuc and HT (which indicated the involvement of proximity/distance).
BRET was not observed in the three different controls suggesting that HT was involved
to achieve BRET. BRET was greater for C1+A4E and IV with a C-terminal HT7 compared
to N-terminal HT7.
Example 54 - Protein Proximity Assays for live cells or lytic formats
[0387] In one example, circularly permuted (CP) or straight split (SS) OgLuc fusion proteins
is applied to measurements of protein proximity. OgLuc is permuted or split via insertion
of a protease substrate amino acid sequence (e.g., TEV) to generate low bioluminescence.
The inactive luciferase is tethered (e.g., via genetic fusion) to a monitor protein.
A potential interacting protein is tethered (e.g., via genetic fusion) to a protease
(e.g., TEV). When the two monitor proteins interact or are in sufficient proximity
(e.g., via a constitutive interaction, a drug stimulus or a pathway response), the
luciferase is cleaved to generate increased bioluminescence activity. The example
may be applied to measurements of protein proximity in cells or in biochemical assays.
Furthermore, the high thermal stability of an OgLuc variant luciferase could enable
measurements of antibody-antigen interactions in lysed cells or biochemical assays.
Example 55 - Bioluminescent Assays
[0388] 1. To demonstrate the use of an OgLuc variant in a bioluminescent assay to detect
caspase-3 enzyme, the 9B8 opt variant was used in a bioluminescent assay using a pro-coelenterazine
substrate comprising the DEVD caspase-3 cleavage sequence. Purified caspase-3 enzyme
was mixed with an
E. coli lysate sample expressing the variant 9B8 opt, which was prepared as described in
Example 27, and diluted 10-fold in a buffer containing 100 mM MES pH 6.0, 1 mM CDTA,
150 mM KCI, 35 mM thiourea, 2 mM DTT, 0.25% TERGITOL® NP-9 (v/v), 0.025% MAZU® DF
204, with or without 23.5 µM z-DEVD-coelenterazine-h in 100 mM HEPES pH 7.5. The caspase-3
enzyme was incubated with the lysate sample for 3 hrs at room temperature, and luminescence
detected on a Turner MODULUS™ luminometer at various time points. A sample containing
only bacterial lysate and a sample containing only caspase-3 were used as controls.
Three replicates were used. FIG. 86 and Table 44 demonstrate that 9B8 opt, and thus
other OgLuc variants of the present invention, can be used in a bioluminescent assay
with a pro-coelenterazine substrate to detect an enzyme of interest.
Table 44: Average luminescence in RLU generated from bacterial lysates expressing
the 9B8 opt variant incubated with or without purified caspase-3 using z-DEVD-coelenterazine-h
as a substrate.
| time (min) |
no caspase (RLU) |
+ caspase (RLU) |
| 5 |
26,023 |
25,411 |
| 15.3 |
7,707 |
36,906 |
| 29.9 |
4,013 |
41,854 |
| 60.9 |
2,305 |
43,370 |
| 190.3 |
1,155 |
42,448 |
2. The L27V variant was used in a bioluminescent assay using a pro-coelenterazine
substrate comprising the DEVD caspase-3 cleavage sequence. Purified caspase-3 enzyme
(1 mg/mL) in 100 mM MES pH 6 (50 µL) was mixed with 227 nM L27V02 variant and 47 µM
PBI-3741 (z-DEVD-coelenterazine-h) in assay buffer (50 µL). Reactions were incubated
for 3 hrs at room temperature, and luminescence detected as previously described.
The assay with the L27V variant was compared to a firefly luciferase version of the
assay, CASPASE-GLO® 3/7-Assay system (Caspase-Glo; Promega Corp.). Table 45 demonstrate
that L27V variant, and thus other OgLuc variants of the present invention, can be
used in a bioluminescent assay with a pro-coelenterazine substrate to detect an enzyme
of interest.
Table 45
| |
(+) caspase |
+/- |
(-) caspase |
+/- |
| L27V |
11,532 |
93 |
803 |
25 |
| Caspase-Glo |
15,156,567 |
793,981 |
302 |
5 |
Example 56 - Immunoassays
[0389] The OgLuc variants of the present invention are integrated into a variety of different
immunoassay concepts. For example, an OgLuc variant is genetically-fused or chemically
conjugated to a primary or secondary antibody to provide a method of detection for
a particular analyte. As another example, an OgLuc variant is genetically-fused or
chemically conjugated to protein A, protein G, protein L, or any other peptide or
protein known to bind to Ig fragments, and this could then be used to detect a specific
antibody bound to a particular analyte. As another example, an OgLuc variant is genetically-fused
or chemically conjugated to streptavidin and used to detect a specific biotinylated
antibody bound to a particular analyte. As another example, complementary fragments
of an OgLuc variant are genetically-fused or chemically conjugated to primary and
secondary antibodies, where the primary antibody recognizes a particular immobilized
analyte, and the secondary antibody recognizes the primary antibody, all in an ELISA-like
format. The OgLuc variant activity, i.e., luminescence, is reconstituted in the presence
of immobilized analyte and used as a means to quantify the analyte.
[0390] As another example, complementary fragments of an OgLuc variant can be fused to two
antibodies, where one antibody recognizes a particular analyte at one epitope, and
the second antibody recognizes the analyte at a separate epitope. The OgLuc variant
activity would be reconstituted in the presence of analyte. The method would be amenable
to measurements of analyte quantification in a complex milieu such as a cell lysate
or cell medium. As another example, complementary fragments of an OgLuc variant can
be fused to two antibodies, where one antibody recognizes a particular analyte regardless
of modification, and the second antibody recognizes only the modified analyte (for
example, following post-translational modification). The OgLuc variant activity would
be reconstituted in the presence of analyte only when it is modified. The method would
be amenable to measurements of modified analyte in a complex milieu such as a cell
lysate. As another example, an OgLuc variant can be conjugated to an analyte (e.g.,
prostaglandins) and used in a competitive sandwich ELISA format.
Example 57 - Dimerization Assay
[0391] This example demonstrates that full-length circularly permuted OgLuc variants can
be fused to respective binding partners, e.g., FRB and FKBP, and used in a protein
complementation-type assay. The key difference between the method disclosed herein
and traditional protein complementation is that there was no complementation, but
rather there was dimerization of two full length enzymes, e.g., circularly permuted
OgLuc variants.
[0392] Briefly, the circularly permuted reporter proteins similarly configured for low activity
were fused to both of the fusion protein partners (
See FIG. 87A). For example, each fusion partner may be linked to identically structured,
permuted reporters. Interaction of the fusion partners brought the permuted reporters
into close proximity, thereby allowing reconstitution of a hybrid reporter having
higher activity. The new hybrid reporter included portions of each of the circularly
permuted reporters in a manner to reduce the structural constraint.
[0393] Circularly permuted, straight split L27V variants CP84 and CP103 (N-(SS-169)-(1-SS
1)-FRB-C and C-(1-SS
1)-(SS-169)-FKBP) were cloned as previously described and expressed (25 µL) in rabbit
reticulocyte lysate (RRL; Promega Corp.) following the manufacture's instructions.
1.25 µL of the expression reactions for each dimerization pair were mixed with 10
µL of 2X Binding Buffer (100 mM HEPES, 200 mM NaCl, 0.2% CHAPS, 2 mM EDTA, 20% glycerol,
20 mM DTT, pH 7.5) and 7.5 µL water, and 18 µL transferred to wells of a 96-well plate.
To the reactions, 2 µL rapamycin (final concentration 0 and 0.1-1000 nM) was added,
and the reactions incubated at room temperature for 10 min. Following incubation,
100 µL of PBI-3939 (50X stock diluted to 1X in assay buffer) and incubated for 3 min
at room temperature. Luminescence was measured on a GLOMAX® luminometer (FIG. 87B)
and the response was determined (FIG. 87C). FIGS. 87B-C demonstrates that the OgLuc
variants of the present invention can be used to detect protein-protein interactions
via a PCA-type dimerization assay.
Example 58 - Intercellular Half-Life
[0394] The intracellular half-life of the OgLuc variants 9B8, 9B8+K33N, V2, L27V, and V2+L27M
were determined. CHO cells (500,000) in 15-100 mm plates in F12 media with 10% FBS
and 1X sodium pyruvate were transfected with 30 µL 100 ng/µL plasmid DNA containing
9B8, 9B8+K33N, V2, L27V ("V2+L27V") or V2+L27M (all in pF4A vector background) using
TRANSIT®-LT1 (Mirus) according to the manufacture's instructions. The cells were then
incubated for 6 hrs.
[0395] After incubation, the media was removed and 1 mL Trypsin added to dissociate the
cells from the plate. 3 mL of F12 media was then added, and the cells counted. Cells
were then plated at 10,000 cells/well into 6 wells of a 96-well plate (6 wells/variant)
and incubated overnight at 37°C. Samples were distributed over 3 plates. Each plate
had 6 replicates for different time point measurements.
[0396] After overnight incubation, the media was removed from the cells for t=0 samples,
and 100 µL assay buffer (previously described; no substrate) was added. The sample
was frozen on dry ice and stored at -20°C. Cycloheximide (100 mg/mL) was diluted 1:100
to a final concentration of 1 mg/mL in OPTI-MEM®. DMSO (100%) was also diluted 1:100
(final concentration 1%) in OPTI-MEM®, The diluted cycloheximide (1 mg/mL) was added
(11 µL) to 3 replicates of each transfected variant sample and 11 µL of the diluted
DMSO (1%) was added to the other 3 replicates. The cells were then incubated at 37°C,
5% CO
2 and removed at various timepoints (i.e., 0, 0.5, 0.9, 2.5, 4.3, and 6.2 hrs) and
processed as the t=0 samples.
[0397] For analysis, the samples were thawed to room temperature, and 10 µL assayed in 50
µL assay reagent. Luminescence was measured on a GLOMAX® luminometer. At each time-point,
luminescence was measured for untreated and cycloheximide-treated samples. The RLU
for the cells treated with cycloheximide was normalized by the RLU for the untreated
cells.
[0398] The intracellular half-life of each variant was calculated by measuring the ratio
of the luminescence from the cycloheximide (CHX)-treated to the untreated at each
time-point. The ratio was then plotted In (% treated to untreated) over time, and
the half-life calculated (Table 46). The OgLuc variants had intracellular half-lives
of approximately 6-9 hrs with a full strength CMV promoter, but the half lives were
reduced with a CMV deletion variant (d2). The presence of a PEST degradation signal
combined with the full strength CMV promoter reduces half-life significantly.
Table 46
| Sample |
CMV no deg. |
CMV d2 no deg. |
CMV Pest |
| 9B8 |
6.32 |
3.87 |
1.43 |
| K33N |
9.24 |
3.70 |
1.18 |
| V2 |
9.63 |
4.28 |
1.61 |
| V2+L27V |
6.66 |
4.78 |
1.63 |
| V2+L27M |
8.89 |
6.98 |
1.63 |
[0399] Another experiment was completed using the reverse transfection protocol described
in Example 52 with HEK293 cells (data not shown). The results from this experiment
indicate that the intracellular half-life for the L27V variant with PEST is 10 min.
The L27V variant with no degradation signal used in this experiment did not show a
decay over the course of this experiment. In this case the decay was normalized to
untreated cells at t=0.
Example 59 - Exposure of OgLuc Variants to Urea
[0400] Since Firefly luciferase is known to be relatively unstable, it is much more sensitive
to urea exposure. To determine whether this was also the case with the OgLuc variants,
the sensitivity of the OgLuc to urea was determined. 5 µl of 45.3 µM L27V enzyme was
mixed with 100 µL of a urea solution (100 mM MOPS, pH 7.2, 100 mM NaCl, 1 mM CDTA,
5% glycerol and various concentrations of urea) and incubated for 30 min at room temperature.
5 µL of the urea+L27V enzyme solution was diluted 10,000-fold into DMEM without phenol
red + 0.1% PRIONEX®, 50 µL was mixed with 50 µL of assay reagent containing 100 µM
PBI-3939 (previously described) and the luminescence was read at 10 min. (FIG. 88).
FIG. 88 indicates that L27V is either resistant to urea or refolds to a functional
enzyme very quickly upon removal of urea. This suggests that L27V could be used as
a reporter enzyme when chemical denaturing conditions are involved, e.g., multiplexing
in conditions where a denaturant is used to stop an enzymatic reaction prior to the
OgLuc variant-based reaction.
[0401] A 0.31 mg/mL stock of purified L27V variant was diluted 100,000-fold into buffer
(PBS + 1 mM DTT + 0.005% IGEPAL) and incubated with 3 M urea for 30 min at 25°C and
then mixed 1:1 (50 µL + 50 µL) with an assay reagent containing 100 µM PBI-3939 (previously
described). The reactions were read on a TECAN® INFINITE® F500 luminometer as described
previously (for 100 min; 1 min read intervals) (FIG. 89). The results indicate that
3M urea reduces the activity of L27V variant by approximately 50%, but, upon diluting
out the urea by 2-fold (to a 1.5 M final concentration) the activity increases, presumably
due to refolding.
Example 60 - Imaging of OgLuc Fusion Proteins
[0402] This example demonstrates the use of OgLuc and OgLuc variants to monitor protein
translocation in living cells without the need for fluorescence excitation. OgLuc
variants were fused to human glucocorticoid receptor (GR; SEQ ID NOs: 451 and 452),
human protein kinase C alpha (PKCa; SEQ ID NOs: 449 and 450) or LC3 (SEQ ID NOs: 577
and 578)._ To analyze subcellular protein translocation using bioluminescence imaging,
HeLa cells were plated at 2x10
4 cells/cm
2 into glass-bottom culture dishes (MatTek) in DMEM medium (Invitrogen) containing
10% FBS. The cells were then incubated for 24 hrs at 37°C, 5% CO2. Cells were then
transfected with 1/20 volume transfection mixture (FUGENE® HD and DNA encoding L27V02-GR
(SEQ ID NOs: 453 and 454) or L27V02-PKC alpha (SEQ ID NOs: 455 and 456) cloned into
the pF5A vector (Promega Corp.)). The plasmid DNA for L27V02-GR was diluted 1:20 into
pGEM-3ZF (Promega Corp.) to achieve appropriate expression levels of L27V02-GR. The
plasmid DNA for L27V02-LC3 and L27V02-PKC alpha was used undiluted. Cells were then
incubated for 24 hrs at 37°C, 5% CO
2. Cells transfected with GR fusion proteins were starved of GR agonist for 20 hrs
using MEM medium supplemented with 1% charcoal/dextran-treated FBS (Invitrogen). Twenty-four
hrs post-transfection (for PKC alpha measurements) or 48 hrs post-transfection (for
GR measurements), the cell media was replaced with CO
2-independent media containing 100 µM PBI-3939 immediately before imaging. Unfiltered
images were immediately captured on an Olympus LV200 bioluminescence microscope using
a 150X objective.
[0403] Cytosol-to-nucleus translocation of L27V02-GR fusion protein was achieved via stimulation
with 0.5 mM dexamethasone for 15 min. Cytosol-to-plasma membrane translocation of
L27V02-PKC alpha fusion protein was achieved via stimulation with 100 nM PMA for 20
min. L27V02-LC3 fusion protein transfected cells were left untreated or treated with
50 mM Chloroquine in DMEM medium (Invitrogen) containing 10% FBS.
L27V02-Glucocorticoid receptor
[0404] In the absence of glucocorticoids, glucocorticoid receptor (GR) is complexed to Hsp90
proteins and resides in the cytosol. Upon interaction of GR with glucocorticoids,
such as dexamethasone, GR proteins dissociate from these protein complexes and translocate
to the nucleus to regulate gene transcription. FIGS. 90A-B show the bioluminescence
imaging of dexamethasone-induced cytosol to nuclear receptor (NR) translocation of
L27V02-glucocorticoid receptor (GR) fusion proteins using PBI-3939 substrate in HeLa
cells.
L27V02-PKCα
[0405] Upon treatment with phorbol esters, PKC alpha proteins are recruited to the plasma
membrane and regulate cellular responses including membrane dynamics and signal transduction.
FIGS. 91A-B show the bioluminescence imaging of phorbol ester-induced Protein Kinase
C alpha (PKC alpha) cytosol to plasma membrane translocation of OgLuc L27V02-PKC alpha
fusions using PBI3939 substrate in U-2 OS cells.
L27V-LC3
[0407] The present disclosure also includes the following items.
- 1. An isolated polynucleotide encoding an OgLuc variant polypeptide having at least
60% amino acid sequence identity to SEQ ID NO: 1 comprising at least one amino acid
substitution at a position corresponding to an amino acid in SEQ ID NO: 1 wherein
the OgLuc variant polypeptide has enhanced luminescence relative to a non-Oplophorus luciferase.
- 2. The polynucleotide of item 1, wherein the non-Oplophorus luciferase is a Renilla luciferase.
- 3. The polynucleotide of item 1, wherein the non-Oplophorus luciferase is a firefly luciferase.
- 4. A polynucleotide encoding an OgLuc variant polypeptide having at least 60% amino
acid sequence identity to SEQ ID NO: 1 comprising at least one amino acid substitution
at a position corresponding to an amino acid in SEQ ID NO: 1 wherein the OgLuc variant
polypeptide has enhanced luminescence relative to an OgLuc polypeptide of SEQ ID NO:
3 with the proviso that the polypeptide encoded by the polynucleotide is not one of
those listed in Table 47.
- 5. A polynucleotide encoding an OgLuc variant polypeptide having at least 60% amino
acid sequence identity to SEQ ID NO: 1 comprising at least one amino acid substitution
at a position corresponding to an amino acid in SEQ ID NO: 1 wherein the OgLuc variant
polypeptide has enhanced luminescence relative to a polypeptide of SEQ ID NO: 31 with
the proviso that the polypeptide encoded by the polynucleotide is not SEQ ID NO: 3
or 15.
- 6. A polynucleotide encoding an OgLuc variant polypeptide having at least 60% amino
acid sequence identity to SEQ ID NO: 1 comprising at least one amino acid substitution
at a position corresponding to an amino acid in SEQ ID NO: 1 wherein the OgLuc variant
polypeptide has enhanced luminescence relative to a polypeptide of SEQ ID NO: 29 with
the proviso that the polypeptide encoded by the polynucleotide is not SEQ ID NO: 3
or 15.
- 7. The polynucleotide of any one of items 1-6, wherein the polypeptide has at least
80% amino acid sequence identity to SEQ ID NO: 1.
- 8. The polynucleotide of any one of items 1-7, wherein the polypeptide has at least
90% amino acid sequence identity to SEQ ID NO: 1.
- 9. The polynucleotide of any one of items 1-8, wherein the OgLuc variant polypeptide
has at least one of enhanced protein stability or enhanced biocompatibility relative
to the polypeptide of SEQ ID NO: 3.
- 10. The polynucleotide of any one of items 1-9, wherein the OgLuc variant polypeptide
has at least one of enhanced enzyme stability or enhanced biocompatibility relative
to a Renilla luciferase.
- 11. The polynucleotide of any one of items 1-10, wherein the OgLuc variant polypeptide
has at least one of enhanced enzyme stability or enhanced biocompatibility relative
to a firefly luciferase.
- 12. The polynucleotide of any one of items 1-11, wherein the OgLuc variant polypeptide
has enhanced luminescence relative to the polypeptide of SEQ ID NO: 3 in the presence
of a coelenterazine.
- 13. The polynucleotide of any one of items 1-12, wherein the OgLuc variant polypeptide
has enhanced luminescence relative to the polypeptide of SEQ ID NO: 3 in the presence
of a compound of formula (Ia) or (Ib):

or

wherein R2 is selected from the group consisting of

or C2-5 straight chain alkyl;
R6 is selected from the group consisting of -H, -OH, -NH2, -OC(O)R or -OCH2OC(O)R;
R8 is selected from the group consisting of

H or lower cycloalkyl;
wherein R3 and R4 are both H or both C1-2 alkyl;
W is -NH2, halo, -OH, -NHC(O)R, -CO2R;
X is -S-, -O- or -NR22-;
Y is -H, -OH, or -OR11;
Z is -CH- or -N-;
each R11 is independently -C(O)R" or -CH2OC(O)R";
R22 is H, CH3 or CH2CH3;
each R is independently C1-7 straight-chain alkyl or C1-7 branched alkyl;
R" is C1-7 straight-chain alkyl or C1-7 branched alkyl;
the dashed bonds indicate the presence of an optional ring, which may be saturated
or unsaturated;
with the proviso that when R2 is

or

R8 is not

with the proviso that when R2 is

R8 is

or lower cycloalkyl; and
with the proviso that when R6 is NH2, R2 is,

or C2-5 alkyl;
or R8 is not

- 14. The polynucleotide of any one of items 1-13, wherein the OgLuc variant polypeptide
has a change in relative substrate specificity relative to the polypeptide of SEQ
ID NO: 3 in the presence of a coelenterazine compared to a different coelenterazine.
- 15. The polynucleotide of any one of items 1-14, wherein the OgLuc variant polypeptide
has a change in relative substrate specificity relative to the polypeptide of SEQ
ID NO: 3 in the presence of a compound of formula (Ia) or (Ib):

or

wherein R2 is selected from the group consisting of

or C2-5 straight chain alkyl;
R6 is selected from the group consisting of-H, -OH, -NH2, -OC(O)R or -OCH2OC(O)R;
R8 is selected from the group consisting of

H or lower cycloalkyl;
wherein R3 and R4 are both H or both C1-2 alkyl;
W is -NH2, halo, -OH, -NHC(O)R, -CO2R;
X is -S-, -O- or -NR22-;
Y is -H, -OH, or -OR11;
Z is -CH- or -N-;
each R11 is independently-C(O)R" or -CH2OC(O)R";
R22 is H, CH3 or CH2CH3;
each R is independently C1-7 straight-chain alkyl or C1-7 branched alkyl;
R" is C1-7 straight-chain alkyl or C1-7 branched alkyl;
the dashed bonds indicate the presence of an optional ring, which may be saturated
or unsaturated;
with the proviso that when R2 is

or

R8 is not

with the proviso that when R2 is

R8 is

or lower cycloalkyl; and
with the proviso that when R6 is NH2, R2 is ,

or C2-5 alkyl;
or R8 is not

compared to a native or known coelenterazine.
- 16. The polynucleotide of any one of items 1-15, wherein the OgLuc variant polypeptide
has enhanced biocompatibility relative to the polypeptide of SEQ ID NO: 3.
- 17. The polynucleotide of any one of items 1-16, wherein the OgLuc variant polypeptide
has enhanced luminescence relative to a Renilla luciferase in the presence of a coelenterazine.
- 18. The polynucleotide of any one of items 1-17, wherein the OgLuc variant polypeptide
has enhanced luminescence relative to a Renilla luciferase in the presence of a compound of formula (Ia) or (Ib):

or

wherein R2 is selected from the group consisting of

or C2-5 straight chain alkyl;
R6 is selected from the group consisting of -H, -OH, -NH2, -OC(O)R or -OCH2OC(O)R;
R8 is selected from the group consisting of

H or lower cycloalkyl;
wherein R3 and R4 are both H or both C1-2 alkyl;
W is -NH2, halo, -OH, -NHC(O)R, -CO2R;
X is -S-, -O- or -NR22-;
Y is -H, -OH, or -OR11;
Z is -CH- or -N-;
each R11 is independently-C(O)R" or -CH2OC(O)R";
R22 is H, CH3 or CH2CH3;
each R is independently C1-7 straight-chain alkyl or C1-7 branched alkyl;
R" is C1-7 straight-chain alkyl or C1-7 branched alkyl;
the dashed bonds indicate the presence of an optional ring, which may be saturated
or unsaturated;
with the proviso that when R2 is

or

R8 is not

with the proviso that when R2 is

R8 is

or lower cycloalkyl; and
with the proviso that when R6 is NH2, R2 is ,

or C2-5 alkyl;
or R8 is not

- 19. The polynucleotide of any one of items 1-18, wherein the OgLuc variant polypeptide
has a change in relative substrate specificity relative to a Renilla luciferase in the presence of a coelenterazine compared to a different coelenterazine.
- 20. The polynucleotide of any one of items 1-19, wherein the OgLuc variant polypeptide
has a change in relative substrate specificity relative to a Renilla luciferase in the presence of a compound of formula (Ia) or (Ib):

or

wherein R2 is selected from the group consisting of

or C2-5 straight chain alkyl;
R6 is selected from the group consisting of -H, -OH, -NH2, -OC(O)R or -OCH2OC(O)R;
R8 is selected from the group consisting of

H or lower cycloalkyl;
wherein R3 and R4 are both H or both C1-2 alkyl;
W is -NH2, halo, -OH, -NHC(O)R, -CO2R;
X is -S-, -O- or -NR22-;
Y is -H, -OH, or -OR11;
Z is -CH- or -N-;
each R11 is independently-C(O)R" or -CH2OC(O)R";
R12 is H, CH3 or CH2CH3;
each R is independently C1-7 straight-chain alkyl or C1-7 branched alkyl;
R" is C1-7 straight-chain alkyl or C1-7 branched alkyl;
the dashed bonds indicate the presence of an optional ring, which may be saturated
or unsaturated;
with the proviso that when R2 is

or

R8 is not

with the proviso that when R2 is

R8 is

or lower cycloalkyl; and
with the proviso that when R6 is NH2, R2 is ,

or C2-5 alkyl;
or R8 is not

compared to a native or known coelenterazine.
- 21. The polynucleotide of any one of items 1-20, wherein the OgLuc variant polypeptide
has enhanced biocompatibility relative to a Renilla luciferase.
- 22. The polynucleotide of any one of items 1-21, wherein the OgLuc variant polypeptide
has enhanced luminescence in the presence of a coelenterazine relative to a firefly
luciferase in the presence of luciferin.
- 23. The polynucleotide of any one of items 1-22, wherein the OgLuc variant polypeptide
has enhanced luminescence in the presence of a compound of formula (Ia) or (Ib):

or

wherein R2 is selected from the group consisting of

or C2-5 straight chain alkyl;
R6 is selected from the group consisting of -H, -OH, -NH2, -OC(O)R or -OCH2OC(O)R;
R8 is selected from the group consisting of

H or lower cycloalkyl;
wherein R3 and R4 are both H or both C1-2 alkyl;
W is -NH2, halo, -OH, -NHC(O)R, -CO2R;
X is -S-, -O- or -NR22-;
Y is -H, -OH, or -OR11;
Z is -CH- or -N-;
each R11 is independently-C(O)R" or -CH2OC(O)R";
R12 is H, CH3 or CH2CH3;
each R is independently C1-7 straight-chain alkyl or C1-7 branched alkyl;
R" is C1-7 straight-chain alkyl or C1-7 branched alkyl;
the dashed bonds indicate the presence of an optional ring, which may be saturated
or unsaturated;
with the proviso that when R2 is

or

R8 is not

with the proviso that when R2 is

R8 is

or lower cycloalkyl; and
with the proviso that when R6 is NH2, R2 is ,

or C2-5 alkyl;
or R8 is not

relative to a firefly luciferase in the presence of luciferin.
- 24. The polynucleotide of any one of items 1-23, wherein the OgLuc variant polypeptide
has enhanced biocompatibility relative to a firefly luciferase.
- 25. The polynucleotide of any one of items 1-24, wherein the OgLuc variant polypeptide
is from Oplophorus gracilirostris, Oplophorus grimaldii, Oplophorus spinicauda, Oplophorus
foliaceus, Oplophorus novaezeelandiae, Oplophorus typus, or Oplophorus spinosus.
- 26. The polynucleotide of any one of items 1-25, wherein the at least one amino acid
substitution is in a position corresponding to positions 1, 4, 6, 10, 11, 14, 15,
16, 18, 19, 20, 21, 22, 23, 24, 25, 27, 28, 31, 32, 33, 34, 36, 38, 39, 40, 42, 43,
44, 45, 46, 47, 48, 49, 50, 51, 54, 55, 56, 58, 59, 60, 66, 67, 68, 69, 70, 71, 72,
74, 75, 76, 77, 86, 87, 89, 90, 92, 93, 94, 95, 96, 97, 98, 99, 100, 102, 106, 109,
110, 111, 112, 113, 117, 119, 124, 125, 126, 127, 128, 129, 130, 135, 136, 138, 139,
142, 145, 146, 147, 148, 149, 150, 152, 154, 155, 158, 159, 163, 164, 166, 168, or
169, or a combination thereof, of SEQ ID NO: 1.
- 27. The polynucleotide of any one of items 1-26, wherein the encoded OgLuc variant
polypeptide further comprises a substitution corresponding to at least one of F1I,
E4K, F6Y, W10Y, R11Q, A14V/S, G15R, Y16E, Q18D/F/G/H/I/K/L/M/N/P/R/S/V/W/Y, D19N,
Q20P/R, V21L/M, L22I/F, E23K, Q24A, G25L, L27M/V/A/D/G/I, S28Y, F31I, Q32H/L/P, A33N/M,
L34M, V36E/M, V38F/I, T39I, P40T/I/L/Q, Q42H, K43N/R, 144F, V45E, L46Q, S47P, G48R,
E49D/G/K, N50K/S, G51E/R/V, A54I/S, D55E/G, I56V, V58I/L, I59T, 160V, S66T/N, G67D/S,
F68L/S/W/Y/D, Q69H, M70V, G71D, L72A/C/F/G/H/I/M/N/P/Q/R/S/T/V/W/Y, E74I/K, M75F/K,
176F/N/V, F77A/C/D/G/M/N/S/T/V/W/Y, H86L/R, H87N/T, K89E, I90D/K/P/Q/R/T/V/Y, L92A/G/H/M/Q/R/S/Y,
H93R, Y94F, G95D/S, T96A, L97E, V98F, I99T/V, D100I, V102E/M/T, M106I/K, Y109F, F110I,
G111N, R112C, P113H/T/K, I117F, V119M, K124M, I125L, T126R, V127A, T128A/S, G129Q,
T130K, N135D/Y, L136M, 1138S, D139G, L142V/E/K/W, P145L/Q, D146G, G147N, S148T, L149I/M,
L150V, R152H/S/E/T, T154S, I155T, V158I, T159I/S, L163I, C164S, N166I/F/E, L168F,
or A169V, or a combination thereof, corresponding to SEQ ID NO: 1.
- 28. The polynucleotide of any one of items 1-27, wherein the polypeptide encoded by
the polynucleotide includes at least one of the following amino acids: isoleucine
at position 1, lysine at position 4, tyrosine at position 6, tyrosine at position
10, glutamine at position 11, valine or serine at position 14, arginine at position
15, glutamate at position 16, aspartate, phenylalanine, glycine, histidine, isoleucine,
lysine, leucine, methionine, asparagine, proline, arginine, serine, valine, tryptophan,
or tyrosine at position 18, asparagine at position 19, arginine or proline at position
20, leucine or methionine at position 21, isoleucine or phenylalanine at position
22, lysine at position 23, alanine at position 24, leucine at position 25, valine,
methionine, alanine, aspartate, glycine or isoleucine at position 27, tyrosine at
position 28, isoleucine at position 31, proline, histidine, or leucine at position
32, asparagine or methionine at position 33, methionine at position 34, methionine
or glutamate at position 36, isoleucine or phenylalanine at position 38, isoleucine
at position 39, threonine, isoleucine, leucine or glutamine at position 40, histidine
at position 42, asparagine or arginine at position 43, phenylalanine at position 44,
glutamate at position 45, glutamine at position 46, proline at position 47, arginine
at position 48, aspartate, glycine, or lysine at position 49, lysine or serine at
position 50, glutamate, arginine, or valine at position 51, serine or isoleucine at
position 54, glycine or glutamate at position 55, valine at position 56, isoleucine
or leucine at position 58, threonine at position 59, valine at position 60, threonine
or asparagine at position 66, serine or aspartate at position 67, leucine, aspartate,
serine, tyrosine or tryptophan at position 68, valine at position 69, valine at position
70, aspartate at position 71, glutamine, alanine, cysteine, phenylalanine, glycine,
histidine, isoleucine, methionine, asparagine, proline, arginine, serine, threonine,
valine, tryptophan, or tyrosine at position 72, lysine or isoleucine at position 74,
lysine or phenylalanine at position 75, asparagine, phenylalanine, or valine at position
76, alanine, cysteine, aspartate, glycine, asparagine, methionine, serine, threonine,
valine, tryptophan, or tyrosine at position 77, arginine or leucine at position 86,
asparagine or threonine at position 87, glutamate at position 89, aspartate, lysine,
proline, glutamine, arginine, threonine, valine, or tyrosine at position 90, alanine,
glycine, histidine, methionine, glutamine, arginine, serine, or tyrosine at position
92, arginine at position 93, phenylalanine at position 94, serine or aspartate at
position 95, alanine at position 96, glutamate at position 97, phenylalanine at position
98, threonine or valine at position 99, isoleucine at position 100, methionine, glutamate,
or threonine at position 102, isoleucine or lysine at position 106, phenylalanine
at position 109, isoleucine at position 110, asparagine at position 111, cysteine
at position 112, histidine, threonine, or lysine at position 113, phenylalanine at
position 117, methionine at position 119, methionine at position 124, leucine at position
125, arginine at position 126, alanine at position 127, alanine or serine at position
128, glutamine at position 129, lysine at position 130, aspartate or tyrosine at position
135, methionine at position 136, serine at position 138, glycine at position 139,
valine, glutamate, lysine or tryptophan at position 142, leucine or glutamine at position
145, glycine at position 146, asparagine at position 147, threonine at position 148,
isoleucine or methionine at position 149, valine at position 150, histidine, serine,
glutamate or threonine at position 152, serine at position 154, threonine at position
155, isoleucine at position 158, serine or isoleucine at position 159, isoleucine
at position 163, serine at position 164, phenylalanine at position 168, or valine
at position 169, or a combination thereof, corresponding to SEQ ID NO: 1.
- 29. The polynucleotide of any one of items 1-28, wherein the OgLuc variant polypeptide
comprises the amino acid substitutions A4E, Q11R, A33K, V44I, A54F, P115E, Q124K,
Y138I and N166R corresponding to SEQ ID NO: 1, and at least one additional amino acid
substitution at a position corresponding to positions 1, 4, 6, 11, 14, 15, 18, 19,
20, 21, 22, 23, 27, 28, 31, 32, 33, 34, 36, 38, 39, 40, 42, 43, 44, 45, 46, 47, 48,
49, 50, 51, 54, 55, 56, 58, 59, 60, 66, 67, 68, 69, 70, 71, 72, 74, 75, 76, 77, 86,
89, 90, 92, 93, 94, 95, 96, 98, 99, 102, 106, 109, 110, 112, 113, 117, 119, 124, 126,
127, 128, 135, 136, 138, 139, 142, 145, 148, 149, 152, 154, 155, 158, 159, 163, 164,
168, or 169, or a combination thereof, of SEQ ID NO: 1.
- 30. The polynucleotide of any one of items 1-29, wherein the amino acid at position
4 is glutamate, at position 11 is arginine, at position 33 is lysine, at position
44 is isoleucine, at position 54 is phenylalanine, at position 115 is glutamate, at
position 124 is lysine, at position 138 is isoleucine, and at position 166 is arginine
corresponding to SEQ ID NO: 1, and at least one additional amino acid substitution
at a position corresponding to positions 1, 4, 6, 11, 14, 15, 18, 19, 20, 21, 22,
23, 27, 28, 31, 32, 33, 34, 36, 38, 39, 40, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51,
54, 55, 56, 58, 59, 60, 66, 67, 68, 69, 70, 71, 72, 74, 75, 76, 77, 86, 89, 90, 92,
93, 94, 95, 96, 98, 99, 102, 106, 109, 110, 112, 113, 117, 119, 124, 126, 127, 128,
135, 136, 138, 139, 142, 145, 148, 149, 152, 154, 155, 158, 159, 163, 164, 168, or
169, or a combination thereof, of SEQ ID NO: 1.
- 31. The polynucleotide of item 29 or 30, wherein the at least one amino acid substitution
corresponds to at least one of F1I, E4K, F6Y, R11Q, A14V, G15R, Q18D/F/G/H/I/K/L/M/N/P/R/S/V/W/Y,
D19N, Q20P/R, V21L/M, L22I/F, E23K, L27M/V, S28Y, F31I, Q32H/L/P, A33N/M, L34M, V36E/M,
V38F/I, T39I, P40T, Q42H, K43N/R, I44F, V45E, L46Q, S47P, G48R, E49D/G/K, N50K/S,
G51E/R/V, A54I/S, D55E/G, I56V, V58I/L, I59T, I60V, S66T/N, G67D/S, F68L/S/W/Y/D,
Q69H, M70V, G71D, L72A/C/F/G/H/I/M/N/P/Q/R/S/T/V/W/Y, E74I/K, M75F/K, I76F/N/V, F77A/C/D/G/M/N/S/T/V/W/Y,
H86L/R, K89E, I90D/K/P/Q/R/T/V/Y, L92A/G/H/M/Q/R/S/Y, H93R, Y94F, G95D/S, T96A, V98F,
I99T/V, V102E/M, M106I/K, Y109F, F110I, R112C, P113H/T, I117F, V119M, K124M, T126R,
V127A, T128A/S, N135D/Y, L136M, I138S, D139G, L142V, P145L/Q, S148T, L149I, R152H/S,
T154S, I155T, V158I, T159I/S, L163I, C164S, L168F, or A169V, or a combination thereof,
corresponding to SEQ ID NO: 1.
- 32. The polynucleotide of item 29 or 30, wherein the polypeptide encoded by the polynucleotide
includes at least one of the following amino acids: isoleucine at position 1, lysine
at position 4, tyrosine at position 6, glutamine at position 11, valine at position
14, arginine at position 15, aspartate, phenylalanine, glycine, histidine, isoleucine,
lysine, leucine, methionine, asparagine, proline, arginine, serine, valine, tryptophan,
or tyrosine at position 18, asparagine at position 19, arginine or proline at position
20, leucine or methionine at position 21, isoleucine or phenylalanine at position
22, lysine at position 23, valine or methionine at position 27, tyrosine at position
28, isoleucine at position 31, proline, histidine, or leucine at position 32, asparagine
or methionine at position 33, methionine at position 34, methionine or glutamate at
position 36, isoleucine or phenylalanine at position 38, isoleucine at position 39,
threonine at position 40, histidine at position 42, asparagine or arginine at position
43, phenylalanine at position 44, glutamate at position 45, glutamine at position
46, proline at position 47, arginine at position 48, aspartate, glycine, or lysine
at position 49, lysine or serine at position 50, glutamate, arginine, or valine at
position 51, serine or isoleucine at position 54, glycine or glutamate at position
55, valine at position 56, isoleucine or leucine at position 58, threonine at position
59, valine at position 60, threonine or asparagine at position 66, serine or aspartate
at position 67, aspartate, serine, tyrosine or tryptophan at position 68, histidine
at position 69, valine at position 70, aspartate at position 71, glutamine, alanine,
cysteine, phenylalanine, glycine, histidine, isoleucine, methionine, asparagine, proline,
arginine, serine, threonine, valine, tryptophan, or tyrosine at position 72, lysine
or isoleucine at position 74, lysine or phenylalanine at position 75, asparagine,
phenylalanine, or valine at position 76, alanine, cysteine, aspartate, glycine, asparagine,
methionine, serine, threonine, valine, tryptophan, or tyrosine at position 77, arginine
or leucine at position 86, glutamate at position 89, aspartate, lysine, proline, glutamine,
arginine, threonine, valine, or tyrosine at position 90, alanine, glycine, histidine,
methionine, glutamine, arginine, serine, or tyrosine at position 92, arginine at position
93, phenylalanine at position 94, serine or aspartate at position 95, alanine at position
96, phenylalanine at position 98, threonine or valine at position 99, methionine or
glutamate at position 102, isoleucine or lysine at position 106, phenylalanine at
position 109, isoleucine at position 110, cysteine at position 112, histidine or threonine
at position 113, phenylalanine at position 117, methionine at position 119, methionine
at position 124, arginine at position 126, alanine at position 127, alanine or serine
at position 128, aspartate or tyrosine at position 135, methionine at position 136,
serine at position 138, glycine at position 139, valine at position 142, leucine or
glutamine at position 145, threonine at position 148, isoleucine at position 149,
histidine or serine at position 152, serine at position 154, threonine at position
155, isoleucine at position 158, serine or isoleucine at position 159, isoleucine
at position 163, serine at position 164, phenylalanine at position 168, or valine
at position 169, or a combination thereof, corresponding to SEQ ID NO: 1.
- 33. The polynucleotide of any one of items 1-26, wherein the OgLuc variant polypeptide
comprises the amino acid substitutions A4E, Q11R, A33K, V44I, A54F, P115E, Q124K,
Y138I and N166R corresponding to SEQ ID NO: 1, and at least one amino acid at a position
corresponding to positions 1, 4, 14, 15, 18, 20, 22, 23, 27, 33, 38, 39, 43, 49, 54,
55, 56, 58, 59, 66, 67, 68, 70, 71, 72, 75, 76, 77, 89, 90, 92, 93, 102, 106, 109,
113, 117, 126, 127, 136, 139, 145, 148, 163, 164, or 169, or a combination thereof,
of SEQ ID NO: 1.
- 34. The polynucleotide of any one of items 1-26, wherein the amino acid at position
4 is glutamate, at position 11 is arginine, at position 33 is lysine, at position
44 is isoleucine, at position 54 is phenylalanine, at position 115 is glutamate, at
position 124 is lysine, at position 138 is isoleucine, and at position 166 is arginine
corresponding to SEQ ID NO: 1, and at least one additional amino acid substitution
at a position corresponding to positions 1, 4, 14, 15, 18, 20, 22, 23, 27, 33, 38,
39, 43, 49, 54, 55, 56, 58, 59, 66, 67, 68, 70, 71, 72, 75, 76, 77, 89, 90, 92, 93,
102, 106, 109, 113, 117, 126, 127, 136, 139, 145, 148, 163, 164, or 169, or a combination
thereof, of SEQ ID NO: 1.
- 35. The polynucleotide of item 33 or 34, wherein the encoded OgLuc variant polypeptide
further comprises a substitution corresponding to at least one of F1I, E4K, A14V,
G15R, Q18D/F/G/H/I/K/L/M/N/P/R/S/W/Y, Q20R, L22I, E23K, L27M/V, A33N, V38I, T39I,
K43R, E49K, A54I/S, D55G, I56V, V58I/L, I59T, S66T/N, G67S, F68S/W/Y/D, M70V, G71D,
L72A/C/F/G/H/I/M/N/P/Q/R/S/T/V/W/Y, M75F/K, I76N, F77A/C/D/G/M/S/T/V/W/Y, K89E, I90D/K/P/Q/R/T/V/Y,
L92A/G/H/M/Q/S/Y, H93R, V102E, M106K, Y109F, P113T, I117F, T126R, V127A, L136M, D139G,
P145L, S148T, L163I, C164S, or A169V, or a combination thereof, corresponding to SEQ
ID NO: 1.
- 36. The polynucleotide of item 33 or 34, wherein the polypeptide encoded by the polynucleotide
includes at least one of the following amino acids: isoleucine at position 1, lysine
at position 4, valine at position 14, arginine at position 15, aspartate, phenylalanine,
glycine, histidine, lysine, leucine, methionine, asparagine, proline, arginine, serine,
tryptophan, or tyrosine at position 18, arginine at position 20, isoleucine at position
22, lysine at position 23, valine or methionine at position 27, asparagine at position
33, isoleucine at position 38, isoleucine at position 39, arginine at position 43,
lysine at position 49, serine or isoleucine at position 54, glycine at position 55,
valine at position 56, isoleucine or leucine at position 58, threonine at position
59, threonine or asparagine at position 66, serine at position 67, aspartate, serine,
tyrosine or tryptophan at position 68, valine at position 70, aspartate at position
71, glutamine, alanine, cysteine, phenylalanine, glycine, histidine, isoleucine, methionine,
asparagine, proline, arginine, serine, threonine, valine, tryptophan, or tyrosine
at position 72, lysine or phenylalanine at position 75, asparagine at position 76,
tryptophan, tyrosine, serine, threonine, valine, alanine, glycine, cysteine, aspartate
or methionine at position 77, glutamate at position 89, aspartate, lysine, proline,
glutamine, arginine, threonine, valine, or tyrosine at position 90, alanine, glycine,
histidine, methionine, glutamine, serine, or tyrosine at position 92, arginine at
position 93, glutamate at position 102, lysine at position 106, phenylalanine at position
109, threonine at position 113, phenylalanine at position 117, arginine at position
126, alanine at position 127, methionine at position 136, glycine at position 139,
leucine at position 145, threonine at position 148, isoleucine at position 163, serine
at position 164, or valine at position 169, or a combination thereof, corresponding
to SEQ ID NO: 1.
- 37. The polynucleotide of any one of items 1-26, wherein the OgLuc variant polypeptide
comprises the amino acid substitutions A4E, Q11R, A33K, V44I, A54F, P115E, Q124K,
Y138I and N166R corresponding to SEQ ID NO: 1, and at least one additional amino acid
substitution at a position corresponding to positions 1, 4, 6, 11, 18, 19, 20, 21,
22, 27, 28, 31, 32, 33, 34, 36, 38, 40, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 54,
55, 58, 60, 66, 67, 68, 69, 70, 72, 74, 75, 76, 77, 86, 90, 92, 94, 95, 96, 98, 99,
102, 106, 109, 110, 112, 113, 119, 124, 128, 135, 138, 142, 145, 149, 152, 154, 155,
158, 159, or 168, or a combination thereof, corresponding to SEQ ID NO: 1.
- 38. The polynucleotide of any one of items 1-26, wherein the amino acid at position
4 is glutamate, at position 11 is arginine, at position 33 is lysine, at position
44 is isoleucine, at position 54 is phenylalanine, at position 115 is glutamate, at
position 124 is lysine, at position 138 is isoleucine, and at position 166 is arginine
corresponding to SEQ ID NO: 1, and at least one additional amino acid substitution
at a position corresponding to positions 1, 4, 6, 11, 18, 19, 20, 21, 22, 27, 28,
31, 32, 33, 34, 36, 38, 40, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 54, 55, 58, 60,
66, 67, 68, 69, 70, 72, 74, 75, 76, 77, 86, 90, 92, 94, 95, 96, 98, 99, 102, 106,
109, 110, 112, 113, 119, 124, 128, 135, 138, 142, 145, 149, 152, 154, 155, 158, 159,
or 168, or a combination thereof, corresponding to SEQ ID NO: 1.
- 39. The polynucleotide of item 37 or 38, wherein the encoded OgLuc variant polypeptide
further comprises a substitution corresponding to at least one of F1I, E4K, F6Y, R11Q,
Q18H/I/LV, D19N, Q20P, V21L/M, L22F, L27V, S28Y, F31I, Q32 H/L/P, A33N/M, L34M, V36E/M,
V38F/I, P40T, Q42H, K43N/R, I44F, V45E, L46Q, S47P, G48R, E49D/G, N50K/S, G51E/R/V,
A54I, D55E, V58I, I60V, S66N, G67D/S, F68L/Y/D, Q69H, M70V, L72Q, E74I/K, M75K, I76F/N/V,
F77N/Y, H86L/R, I90T/V, L92Q/R, Y94F, G95D/S, T96A, V98F, I99T/V, V102E/M, M106I,
Y109F, F110I, R112C, P113H, V119M, K124M, T128A/S, N135D/Y, I138S, L142V, P145Q, L149I,
R152H/S, T154S, I155T, V158I, T159I/S, or L168F, or a combination thereof, corresponding
to SEQ ID NO: 1.
- 40. The polynucleotide of item 37 or 38, wherein the polypeptide encoded by the polynucleotide
includes at least one of the following amino acids: isoleucine at position 1, lysine
at position 4, tyrosine at position 6, glutamine at position 11, histidine, isoleucine,
leucine, or valine at position 18, asparagine at position 19, proline at position
20, leucine or methionine at position 21, phenylalanine at position 22, valine at
position 27, tyrosine at position 28, isoleucine at position 31, proline, histidine,
or leucine at position 32, asparagine or methionine at position 33, methionine at
position 34, methionine or glutamate at position 36, isoleucine or phenylalanine at
position 38, threonine at position 40, histidine at position 42, asparagine or arginine
at position 43, phenylalanine at position 44, glutamate at position 45, glutamine
at position 46, proline at position 47, arginine at position 48, aspartate or glycine
at position 49, lysine or serine at position 50, glutamate, arginine, or valine at
position 51, isoleucine at position 54, glutamate at position 55, isoleucine at position
58, valine at position 60, asparagine at position 66, serine or aspartate at position
67, aspartate, leucine, or tyrosine at position 68, histidine at position 69, valine
at position 70, glutamine at position 72, lysine or isoleucine at position 74, lysine
at position 75, asparagine, phenylalanine, or valine at position 76, asparagine or
tyrosine at position 77, arginine or leucine at position 86, threonine or valine at
position 90, arginine or glutamine at position 92, phenylalanine at position 94, serine
or aspartate at position 95, alanine at position 96, phenylalanine at position 98,
threonine or valine at position 99, methionine or glutamate at position 102, isoleucine
at position 106, phenylalanine at position 109, isoleucine at position 110, cysteine
at position 112, histidine at position 113, methionine at position 119, methionine
at position 124, alanine or serine at position 128, aspartate or tyrosine at position
135, serine at position 138, valine at position 142, glutamine at position 145, isoleucine
at position 149, histidine or serine at position 152, serine at position 154, threonine
at position 155, isoleucine at position 158, serine or isoleucine at position 159,
or phenylalanine at position 168, or a combination thereof, corresponding to SEQ ID
NO: 1.
- 41. The polynucleotide of any one of items 1-26, wherein the OgLuc variant polypeptide
comprises the amino acid substitutions A4E, Q11R, A33K, V44I, F54I, I90V, P115E, Q124K,
Y1381 and N166R corresponding to SEQ ID NO: 1, and at least one additional amino acid
substitution at a position corresponding to positions 1, 4, 10, 14, 16, 18, 24, 25,
27, 33, 38, 40, 68, 70, 72, 75, 87, 90, 97, 100, 102, 111, 113, 125, 129, 130, 142,
146, 147, 149, 150, 152, or 166, or a combination thereof, of SEQ ID NO: 1.
- 42. The polynucleotide of any one of items 1-26, wherein the OgLuc variant polypeptide
comprises the amino acid substitutions wherein the amino acid at position 4 is glutamate,
at position 11 is arginine, at position 33 is lysine, at position 44 is isoleucine,
at position 54 is isoleucine, at position 90 is valine, at position 115 is glutamate,
at position 124 is lysine, at position 138 is isoleucine, and at position 166 is arginine
corresponding to SEQ ID NO: 1, and at least one additional amino acid substitution
at a position corresponding to positions 1, 4, 10, 14, 16, 18, 24, 25, 27, 33, 38,
40, 68, 70, 72, 75, 87, 90, 97, 100, 102, 111, 113, 125, 129, 130, 142, 146, 147,
149, 150, 152, or 166, or a combination thereof, of SEQ ID NO: 1.
- 43. The polynucleotide of item 41 or 42, wherein the at least one amino acid substitution
corresponds to at least one of F1I, E4K, W10Y, A14S, Y16E, Q18D/F/G/H/K/L/M/N/P/R/S/W/Y,
Q24A, G25L, L27M/A/D/G/I, A33N, V38I, P40I/L/Q, F68W/Y, M70V, L72A/C/F/G/H/I/M/N/P/R/S/T/V/W/Y,
M75F/K, H87N/T, 190D/K/P/Q/R/Y, L97E, D100I, V102E/T, G111N, P113K, I125L, G129Q,
T130K, L142E/K/W, D146G, G147N, L149M, L150V, R152E/T, or N166I/F/E, or a combination
thereof, corresponding to SEQ ID NO: 1.
- 44. The polynucleotide of item 41 or 42, wherein the polypeptide encoded by the polynucleotide
includes at least one of the following amino acids: isoleucine at position 1, lysine
at position 4, tyrosine at position 10, serine at position 14, glutamate at position
16, aspartate, phenylalanine, glycine, histidine, lysine, leucine, methionine, asparagine,
proline, arginine, serine, tryptophan, or tyrosine at position 18, alanine at position
24, leucine at position 25, methionine, alanine, aspartate, glycine or isoleucine
at position 27, asparagine at position 33, isoleucine at position 38, isoleucine,
leucine or glutamine at position 40, tyrosine or tryptophan at position 68, valine
at position 70, alanine, cysteine, phenylalanine, glycine, histidine, isoleucine,
methionine, asparagine, proline, arginine, serine, threonine, valine, tryptophan,
or tyrosine at position 72, lysine or phenylalanine at position 75, asparagine or
threonine at position 87, aspartate, lysine, proline, glutamine, arginine, or tyrosine
at position 90, glutamate at position 97, isoleucine at position 100, glutamate or
threonine at position 102, asparagine at position 111, lysine at position 113, leucine
at position 125, glutamine at position 129, lysine at position 130, glutamate, lysine
or tryptophan at position 142, glycine at position 146, asparagine at position 147,
methionine at position 149, valine at position 150, glutamate or threonine at position
152, or isoleucine, phenylalanine, or glutamate at position 166, or a combination
thereof, corresponding to SEQ ID NO: 1.
- 45. The polynucleotide of any one of items 1-26, wherein the OgLuc variant polypeptide
comprises the amino acid substitutions A4E, Q11R, A33K, V44I, P115E, Q124K, Y138I,
N166R, I90V, F54I, Q18L, F68Y, L72Q, and M75K corresponding to SEQ ID NO: 1.
- 46. The polynucleotide of any one of items 1-26, wherein the amino acid at position
4 is glutamate, at position 11 is arginine, at position 18 is leucine, at position
33 is lysine, at position 44 is isoleucine, at position 54 is isoleucine, at position
68 is tyrosine, at position 72 is glutamine, at position 75 is lysine, at position
90 is valine, at position 115 is glutamate, at position 124 is lysine, at position
138 is isoleucine, and at position 166 is arginine corresponding to SEQ ID NO: 1.
- 47. The polynucleotide of item 45 or 46 wherein the amino acid substitution at a position
corresponding to 33 of SEQ ID NO: 1 is asparagine.
- 48. The polynucleotide of item 47, wherein position 39 is encoded by codon ACT, the
amino acid at position 39 is threonine, at position 43 is arginine, and at position
68 is aspartate corresponding to SEQ ID NO: 1, the OgLuc variant polypeptide having
luciferase activity.
- 49. The polynucleotide of item 48, wherein the amino acid at position 27 is valine
corresponding to SEQ ID NO: 1, the OgLuc variant polypeptide having luciferase activity.
- 50. The polynucleotide of any one of items 1-26, comprising the polynucleotide encoding
the polypeptide of SEQ ID NO: 19.
- 51. The polynucleotide of any one of items 1-26, comprising the polynucleotide of
SEQ ID NO: 18, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 42, SEQ ID NO: 88, or SEQ
ID NO: 92.
- 52. The polynucleotide of any one of items 37-40, wherein the encoded OgLuc variant
polypeptide further comprises amino acid substitutions Q18L, F54I, L92H, and Y109F
corresponding to SEQ ID NO: 1.
- 53. The polynucleotide of 52, wherein the encoded OgLuc variant polypeptide further
comprises amino acid substitutions V21L, F68Y, L72Q, M75K, H92R and V158I corresponding
to SEQ ID NO: 1.
- 54. The polynucleotide of any one of items 37-40, wherein the encoded OgLuc variant
polypeptide comprises amino acid substitutions F54I, I90V and F77Y corresponding to
SEQ ID NO: 1.
- 55. The polynucleotide of any one of items 37-40, wherein the amino acid at position
18 is leucine, at position 54 is isoleucine, at position 92 is histidine, and at position
109 is phenylalanine corresponding to SEQ ID NO: 1.
- 56. The polynucleotide of 55, wherein the amino acid at position 21 is leucine, at
position 68 is tyrosine, at position 72 is glutamine, at position 75 is lysine, at
position 92 is arginine, and at position 158 is isoleucine corresponding to SEQ ID
NO: 1.
- 57. The polynucleotide of any one of items 37-40, wherein the amino acid at position
54 is isoleucine, at position 90 is valine, and at position 77 is tyrosine corresponding
to SEQ ID NO: 1.
- 58. The polynucleotide of any one of items 52-57, wherein the encoded OgLuc variant
polypeptide further comprises a substitution corresponding to at least one of F1I,
E4K, F6Y, R11Q, Q18H/I/V, D19N, Q20P, V21M, L22F, L27V, S28Y, F31I, Q32 H/L/P, A33N/M,
L34M, V36E/M, V38F/I, P40T, Q42H, K43N/R, I44F, V45E, L46Q, S47P, G48R, E49D/G, N50K/S,
G51E/R/V, D55E, V58I, I60V, S66N, G67D/S, F68L/D, Q69H, M70V, E74I/K, I76F/N/V, F77N,
H86L/R, I90T, Y94F, G95D/S, T96A, V98F, I99T/V, V102E/M, M106I, F110I, R112C, P113H,
V119M, K124M, T128A/S, N135D/Y, I138S, L142V, P145Q, L149I, R152H/S, T154S, I155T,
T159I/S, or L168F, or a combination thereof, corresponding to SEQ ID NO: 1.
- 59. The polynucleotide of any one of items 52-57, wherein the polypeptide encoded
by the polynucleotide includes at least one of the following amino acids: isoleucine
amino acid at position 1, lysine at position 4, tyrosine at position 6, glutamine
at position 11, histidine, isoleucine, or valine at position 18, asparagine at position
19, proline at position 20, methionine at position 21, phenylalanine at position 22,
valine at position 27, tyrosine at position 28, isoleucine at position 31, proline,
histidine, or leucine at position 32, asparagine or methionine at position 33, methionine
at position 34, methionine or glutamate at position 36, isoleucine or phenylalanine
at position 38, threonine at position 40, histidine at position 42, asparagine or
arginine at position 43, phenylalanine at position 44, glutamate at position 45, glutamine
at position 46, proline at position 47, arginine at position 48, aspartate or glycine
at position 49, lysine or serine at position 50, glutamate, arginine, or valine at
position 51, glutamate at position 55, isoleucine at position 58, valine at position
60, asparagine at position 66, serine or aspartate at position 67, leucine or aspartate
at position 68, histidine at position 69, valine at position 70, lysine or isoleucine
at position 74, asparagine, phenylalanine, or valine at position 76, asparagine at
position 77, arginine or leucine at position 86, threonine at position 90, glutamine
at position 92, phenylalanine at position 94, serine or aspartate at position 95,
alanine at position 96, phenylalanine at position 98, threonine or valine at position
99, methionine or glutamate at position 102, isoleucine at position 106, isoleucine
at position 110, cysteine at position 112, histidine at position 113, methionine at
position 119, methionine at position 124, alanine or serine at position 128, aspartate
or tyrosine, at position 135 is serine at position 138, valine at position 142, glutamine
at position 145, isoleucine at position 149, histidine or serine at position 152,
serine at position 154, threonine at position 155, serine or isoleucine at position
159, or phenylalanine at position 168, or a combination thereof, corresponding to
SEQ ID NO: 1.
- 60. A polynucleotide encoding an OgLuc variant polypeptide having at least 80% amino
acid sequence identity to an OgLuc polypeptide of SEQ ID NO: 1 comprising amino acid
substitutions A4E, Q11R, A33K, V44I, P115E, Q124K, Y138I, N166R, I90V, F54I, Q18L,
F68Y, L72Q, and M75K corresponding to SEQ ID NO: 1 and the OgLuc variant polypeptide
having luciferase activity.
- 61. A polynucleotide encoding an OgLuc variant polypeptide having at least 80% amino
acid sequence identity to an OgLuc polypeptide of SEQ ID NO: 1, wherein the amino
acid at position 4 is glutamate, at position 11 is arginine, at position 18 is leucine,
at position 33 is lysine, at position 44 is isoleucine, at position 54 is isoleucine,
at position 68 is tyrosine, at position 72 is glutamine, at position 75 is lysine,
at position 90 is valine, at position 115 is glutamate, at position 124 is lysine,
at position 138 is isoleucine, and at position 166 is arginine corresponding to SEQ
ID NO: 1 and the OgLuc variant polypeptide having luciferase activity.
- 62. The polynucleotide of item 60 or 61 wherein the amino acid substitution at a position
corresponding to 33 of SEQ ID NO: 1 is asparagine.
- 63. The polynucleotide of item 62, wherein position 39 is encoded by codon ACT, the
amino acid at position 39 is threonine, at position 43 is arginine, and at position
68 is aspartate corresponding to SEQ ID NO: 1, the OgLuc variant polypeptide having
luciferase activity.
- 64. The polynucleotide of item 63, wherein the amino acid at position 27 is valine
corresponding to SEQ ID NO: 1, the OgLuc variant polypeptide having luciferase activity.
- 65. A polynucleotide encoding an OgLuc variant polypeptide having at least 80% amino
acid sequence identity to an OgLuc polypeptide of SEQ ID NO: 1 comprising amino acid
substitutions A4E, Q11R, A33K, V44I, P115E, Q124K, Y138I, N166R, Q18L, F54I, L92H,
and Y109F corresponding to SEQ ID NO: 1 and the OgLuc variant polypeptide having luciferase
activity.
- 66. The polynucleotide of item 65 further comprising the amino acid substitutions
V21L, F68Y, L72Q, M75K, H92R, and V158F corresponding to SEQ ID NO: 1.
- 67. A polynucleotide encoding an OgLuc variant polypeptide having at least 80% amino
acid sequence identity to an OgLuc polypeptide of SEQ ID NO: 1 comprising amino acid
substitutions A4E, Q11R, A33K, V44I, A54I, F77Y, I90V, P115E, Q124K, Y138I and N166R
corresponding to SEQ ID NO: 1 and the OgLuc variant polypeptide having luciferase
activity.
- 68. A polynucleotide encoding an OgLuc variant polypeptide having at least 80% amino
acid sequence identity to an OgLuc polypeptide of SEQ ID NO: 1, wherein the amino
acid at position 4 is glutamate, at position 11 is arginine, at position 18 is leucine,
at position 33 is lysine, at position 44 is isoleucine, at position 54 is isoleucine,
at position 92 is histidine, at position 109 is phenylalanine, at position 115 is
glutamate, at position 124 is lysine, at position 138 is isoleucine, and at position
166 is arginine corresponding to SEQ ID NO: 1 and the OgLuc variant polypeptide having
luciferase activity.
- 69. The polynucleotide of item 68, wherein the amino acid at position 21 is leucine,
at position 68 is tyrosine, at position 72 is glutamine, at position 75 is lysine,
at position 92 is arginine, and at position 158 is isoleucine corresponding to SEQ
ID NO: 1.
- 70. A polynucleotide encoding an OgLuc variant polypeptide having at least 80% amino
acid sequence identity to an OgLuc polypeptide of SEQ ID NO: 1, wherein the amino
acid at position 4 is glutamate, at position 11 is arginine, at position 33 is lysine,
at position 44 is isoleucine, at position 54 is isoleucine, at position 77 is tyrosine,
at position 90 is valine, at position 115 is glutamate, at position 124 is lysine,
at position 138 is isoleucine, and at position 166 is arginine corresponding to SEQ
ID NO: 1 and the OgLuc variant polypeptide having luciferase activity.
- 71. A polynucleotide comprising the polynucleotide encoding the polypeptide of SEQ
ID NO: 19.
- 72. A polynucleotide comprising the polynucleotide of SEQ ID NO: 18, SEQ ID NO: 24,
SEQ ID NO: 25, SEQ ID NO: 42, SEQ ID NO: 88, or SEQ ID NO: 92.
- 73. An isolated polynucleotide encoding a decapod luciferase polypeptide having at
least 30% amino acid sequence identity to SEQ ID NO: 1, the polypeptide comprising
a sequence pattern corresponding to the sequence pattern of Formula (VII) and including
no more than 5 differences, wherein differences include differences from pattern positions
1, 2, 3, 5, 8, 10, 12, 14, 15, 17, or 18 relative to Formula (VII) according to the
OgLuc pattern listed in Table 4 as well as gaps or insertions between any of the pattern
positions of Formula (VII) according to the OgLuc pattern listed in Table 4, wherein
the decapod luciferase produces luminescence in the presence of a coelenterazine.
- 74. The polynucleotide of item 73, wherein the decapod luciferase includes no more
than 4 differences from the sequence pattern of Formula (VII) according to the OgLuc
Pattern listed in Table 4.
- 75. The polynucleotide of item 73, wherein the decapod luciferase includes no more
than 3 differences from the sequence pattern of Formula (VII) according to the OgLuc
pattern listed in Table 4.
- 76. The polynucleotide of item 73, wherein the decapod luciferase includes no more
than 2 differences from the sequence pattern of Formula (VII) according to the OgLuc
pattern listed in Table 4.
- 77. The polynucleotide of item 73, wherein the decapod luciferase includes no more
than 1 difference from the sequence pattern of Formula (VII) according to the OgLuc
pattern listed in Table 4.
- 78. The polynucleotide of item 73, wherein the polypeptide comprises a sequence corresponding
to Formula (VII) according to the OgLuc pattern listed in Table 4.
- 79. The polynucleotide of item 73, wherein the decapod luciferase is from a Aristeidae,
Pandalidea, Solenoceridae, Luciferidae, Segestidae, Pasiphaeidae, Oplophoridae, or
Thalassocaridae family.
- 80. The polynucleotide of item 79, wherein the decapod luciferase is from the Oplophoridae
family.
- 81. The polynucleotide of item 80, wherein the decapod luciferase is from an Oplophorus
species.
- 82. The polynucleotide of item 79, wherein the decapod luciferase is a luciferase
from Plesiopenaeus coruscans, a Heterocarpus species, a Parapandalus species, Hymenopenaeus debilis, Mesopenaeus tropicalis, Lucifer typus, Sergestes atlanticus,
Sergestes arcticus, Sergestes armatus, Sergestes pediformis, Sergestes cornutus, Sergestes
edwardsi, Sergestes henseni, Sergestes pectinatus, Sergestes sargassi, Sergestes similis,
Sergestes vigilax, Sergia challengeri, Sergia grandis, Sergia lucens, Sergia prehensilis,
Sergia potens, Sergia robusta, Sergia scintillans, Sergia splendens, Glyphus marsupialis,
Leptochela bermudensis, Parapasiphae sulcatifrons, Pasiphea tarda, Acanthephyra acanthitelsonis,
Acanthephyra acutifrons, Acanthephyra brevirostris, Acanthephyra cucullata, Acanthephyra
curtirostris, Acanthephyra eximia, Acanthephyra gracilipes, Acanthephyra kingsleyi,
Acanthephyra media, Acanthephyra microphthalma, Acanthephyra pelagica, Acanthephyra
prionota, Acanthephyra purpurea, Acanthephyra sanguinea, Acanthephyra sibogae, Acanthephyra
stylorostratis, Ephyrina bifida, Ephyrina figueirai, Ephyrina koskynii, Ephyrina ombango,
Hymenodora glacialis, Hymenodora gracilis, Meningodora miccyla, Meningodora mollis,
Meningodora vesca, Notostomus gibbosus, Notostomus auriculatus, Oplophorus gracilirostris,
Oplophorus grimaldii, Oplophorus novaezealandiae, Oplophorus spinicauda, Oplophorus
foliaceus, Oplophorus spinosus, Oplophorus typus, Systellaspis braueri, Systellaspis
cristata, Systellaspis debilis, Systellaspis pellucida, Chlorotocoides spinicauda,
Thalassocaris crinita, or Thalassocaris lucida.
- 83. The polynucleotide of item 73, wherein the sequence pattern of Formula (VII) is
aligned with SEQ ID NO: 1 starting at residue 8 of SEQ ID NO: 1
- 84. The polynucleotide of any one of items 1-83, wherein the sequence has been codon-optimized.
- 85. The polynucleotide of item 84, wherein the polynucleotide comprises SEQ ID NO:
22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25.
- 86. The polynucleotide of any one of items 1-85, wherein the polynucleotide further
encodes a polypeptide of interest linked to the OgLuc variant polypeptide, the polypeptide
of interest and the OgLuc variant polypeptide capable of being expressed as a fusion
protein.
- 87. A vector comprising the polynucleotide of any of items 1-86.
- 88. The vector of item 96, wherein the polynucleotide is operably linked to a promoter.
- 89. A cell comprising the polynucleotide of any one of items 1-86 or the vector of
item 87 or 88.
- 90. A non-human transgenic animal comprising the cell of item 89.
- 91. A non-human transgenic animal comprising the polynucleotide of any one of items
1-86 or the vector of item 87 or 88.
- 92. An OgLuc variant polypeptide encoded by the polynucleotide of any one items 1-86.
- 93. A polypeptide encoded by the polynucleotide of any one of items 1-86.
- 94. A fusion protein comprising an OgLuc variant polypeptide encoded by the polynucleotide
of any one of items 1-86.
- 95. A method of producing an OgLuc variant polypeptide comprising growing the cell
of item 89 under conditions that permit expression of the OgLuc variant polypeptide.
- 96. A method of producing an OgLuc variant polypeptide comprising introducing the
vector of item 87 or 88 into a cell under conditions which permit expression of the
OgLuc variant polypeptide.
- 97. A kit comprising the polynucleotide of any one of items 1-86 or the vector of
item 87 or 88.
- 98. A kit comprising the OgLuc variant polypeptide of item 92.
- 99. The kit of any one of item 97 or 98, further comprising at least one of:
- (a) the compound of formula (Ia) or (Ib):

or

wherein R2 is selected from the group consisting of

or C2-5 straight chain alkyl;
R6 is selected from the group consisting of -H, -OH, -NH2, -OC(O)R or -OCH2OC(O)R;
R8 is selected from the group consisting of

H or lower cycloalkyl;
wherein R3 and R4 are both H or both C1-2 alkyl;
W is -NH2, halo, -OH, -NHC(O)R, -CO2R;
X is -S-, -O- or -NR22-;
Y is -H, -OH, or -OR11;
Z is -CH- or -N-;
each R11 is independently -C(O)R" or -CH2OC(O)R";
R22 is H, CH3 or CH2CH3;
each R is independently C1-7 straight-chain alkyl or C1-7 branched alkyl;
R" is C1-7 straight-chain alkyl or C1-7 branched alkyl;
the dashed bonds indicate the presence of an optional ring, which may be saturated
or unsaturated;
with the proviso that when R2 is

or

R8 is not

with the proviso that when R2 is

R8 is

or lower cycloalkyl; and
with the proviso that when R6 is NH2, R2 is ,

or C2-5 alkyl;
or R8 is not

and
- (b) a buffer reagent.
- 100. A kit comprising the compound

and the polynucleotide of any one of items 60-64 or 71-72 or the polypeptide encoded
by the polynucleotide of any one of items 60-64 or 71-72.
- 101. A method for measuring bioluminescence using at least one of the polynucleotide
of any one of items 1-86; the vector of any one of items 87 or 88; the cell of item
89; the animal of any of items 90-91; the OgLuc variant polypeptide of item 92; the
polypeptide of item 93; and the fusion protein of item 94.
- 102. A synthetic nucleotide sequence encoding an OgLuc variant polypeptide comprising
a fragment of at least 100 nucleotides having 80% or less nucleic acid sequence identity
to a parent nucleic acid sequence having SEQ ID NO: 2 and having 90% or more nucleic
acid sequence identity to SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO:
25 or the complement thereof, wherein the decreased sequence identity is a result
of different codons in the synthetic nucleotide sequence relative to the codons in
the parent nucleic acid sequence, wherein the synthetic nucleotide sequence encodes
a OgLuc variant which has at least 85% amino acid sequence identity to the corresponding
luciferase encoded by the parent nucleic acid sequence, and wherein the synthetic
nucleotide sequence has a reduced number of regulatory sequences relative to the parent
nucleic acid sequence.
- 103. A synthetic nucleotide sequence encoding an OgLuc variant polypeptide comprising
a fragment of at least 300 nucleotides having 80% or less nucleic acid sequence identity
to a parent nucleic acid sequence having SEQ ID NO: 14 and having 90% or more nucleic
acid sequence identity to SEQ ID NO: 22 or SEQ ID NO: 23 or the complement thereof,
wherein the decreased sequence identity is a result of different codons in the synthetic
nucleotide sequence relative to the codons in the parent nucleic acid sequence, wherein
the synthetic nucleotide sequence encodes a firefly luciferase which has at least
85% amino acid sequence identity to the corresponding luciferase encoded by the parent
nucleic acid sequence, and wherein the synthetic nucleotide sequence has a reduced
number of regulatory sequences relative to the parent nucleic acid sequence.
- 104. A synthetic nucleotide sequence encoding an OgLuc variant polypeptide comprising
a fragment of at least 100 nucleotides having 80% or less nucleic acid sequence identity
to a parent nucleic acid sequence having SEQ ID NO: 18 and having 90% or more nucleic
acid sequence identity to SEQ ID NO: 24 or SEQ ID NO: 25 or the complement thereof,
wherein the decreased sequence identity is a result of different codons in the synthetic
nucleotide sequence relative to the codons in the parent nucleic acid sequence, wherein
the synthetic nucleotide sequence encodes a OgLuc variant which has at least 85% amino
acid sequence identity to the corresponding luciferase encoded by the parent nucleic
acid sequence, and wherein the synthetic nucleotide sequence has a reduced number
of regulatory sequences relative to the parent nucleic acid sequence.
- 105. The polynucleotide of any one of items 1 -86, wherein the OgLuc variant polypeptide
is a soluble monomer.
- 106. The polynucleotide of item 86, wherein the fusion protein comprises a signal
sequence at the N-terminus of the OgLuc variant polypeptide.
- 107. The polynucleotide of item 106, wherein the fusion protein is secreted from a
cell.
- 108. A fusion peptide comprising a signal peptide from Oplophorus gracilirostris fused to a heterologous protein, wherein said signal peptide is SEQ ID NO: 54, wherein
the fusion peptide is expressed in a cell and secreted from the cell.
- 109. A bioluminescence resonance energy transfer (BRET) system comprising: a first
fusion protein including a first target protein and a bioluminescence donor molecule,
wherein the bioluminescence donor molecule is an OgLuc variant encoded by the polynucleotide
of any one of items 10-88; a second fusion protein including a second target protein
and a fluorescent acceptor molecule; and an OgLuc substrate.
- 110. The BRET system of item 109, wherein the OgLuc substrate is a native or known
coelenterazine,
- 111. The BRET system of item 109, wherein the OgLuc substrate is a compound of formula
(Ia) or (Ib):

or

wherein R2 is selected from the group consisting of

or C2-5 straight chain alkyl;
R6 is selected from the group consisting of -H, -OH, -NH2, -OC(O)R or -OCH2OC(O)R;
R8 is selected from the group consisting of

H or lower cycloalkyl;
wherein R3 and R4 are both H or both C1-2 alkyl;
W is -NH2, halo, -OH, -NHC(O)R, -CO2R;
X is -S-, -O- or -NR22-;
Y is -H, -OH, or -OR11;
Z is -CH- or -N-;
each R11 is independently -C(O)R" or -CH2OC(O)R";
R22 is H, CH3 or CH2CH3;
each R is independently C1-7 straight-chain alkyl or C1-7 branched alkyl;
R" is C1-7 straight-chain alkyl or C1-7 branched alkyl;
the dashed bonds indicate the presence of an optional ring, which may be saturated
or unsaturated;
with the proviso that when R2 is

or

R8 is not

with the proviso that when R2 is

R8 is

or lower cycloalkyl; and
with the proviso that when R6 is NH2, R2 is ,

or C2-5 alkyl;
or R8 is not

- 112. The BRET system of item 109, wherein the OgLuc substrate is the compound

- 113. A method of measuring the enzymatic activity of a luminogenic protein comprising:
contacting a luminogenic protein, a deprotecting enzyme, and a protected luminophore;
and detecting light produced from the composition, wherein the luminogenic protein
is an OgLuc variant encoded by the polynucleotide of any one of items 1-86 and the
luminophore is a compound of formula (Ia) or (Ib):

or

wherein R2 is selected from the group consisting of

or C2-5 straight chain alkyl;
R6 is selected from the group consisting of -H, -OH, -NH2. -OC(O)R or -OCH2OC(O)R;
R8 is selected from the group consisting of

H or lower cycloalkyl;
wherein R3 and R4 are both H or both C1-2 alkyl;
W is -NH2, halo, -OH, -NHC(O)R, -CO2R;
X is -S-, -O- or -NR22-;
Y is -H, -OH, or -OR11;
Z is -CH- or -N-;
each R11 is independently -C(O)R" or -CH2OC(O)R";
R22 is H, CH3 or CH2CH3;
each R is independently C1-7 straight-chain alkyl or C1-7 branched alkyl;
R" is C1-7 straight-chain alkyl or C1-7 branched alkyl;
the dashed bonds indicate the presence of an optional ring, which may be saturated
or unsaturated;
with the proviso that when R2 is

or

R8 is not

with the proviso that when R2 is

R8 is

or lower cycloalkyl; and
with the proviso that when R6 is NH2, R2 is ,

or C2-5 alkyl;
or R8 is not

- 114. The method of item 113 wherein the enzymatic activity is measured in a live,
intact non-human animal.
- 115. A method for measuring the activity of a non-luminescent enzyme of interest comprising:
- (a) providing a luminogenic molecule wherein the molecule is a substrate for the non-luminescent
enzyme of interest and a pro-substrate of an OgLuc variant encoded by the polynucleotide
of any one of items 1-86;
- (b) contacting the luminogenic molecule with at least one non-luminescent enzyme of
interest and at least one OgLuc variant to produce a reaction mixture; and
- (c) determining activity of the non-luminescent enzyme of interest by measuring luminescence
of the reaction mixture.
- 116. The method of item 115, wherein the luminogenic molecule is a modification of
the compound of formula (Ia) or (Ib):

or

wherein R2 is selected from the group consisting of

or C2-5 straight chain alkyl;
R6 is selected from the group consisting of -H, -OH, -NH2, -OC(O)R or -OCH2OC(O)R;
R8 is selected from the group consisting of

H or lower cycloalkyl;
wherein R3 and R4 are both H or both C1-2 alkyl;
W is -NH2, halo, -OH, -NHC(O)R, -CO2R;
X is -S-, -O- or -NR22-;
Y is -H, -OH, or -OR11;
Z is -CH- or N-;
each R11 is independently -C(O)R" or -CH2OC(O)R";
R22 is H, CH3 or CH2CH3;
each R is independently C1-7 straight-chain alkyl or C1-7 branched alkyl;
R" is C1-7 straight-chain alkyl or C1-7 branched alkyl;
the dashed bonds indicate the presence of an optional ring, which may be saturated
or unsaturated;
with the proviso that when R2 is

or

R8 is not

with the proviso that when R2 is

R8 is

or lower cycloalkyl; and
with the proviso that when R6 is NH2 R2 is,

or C2-5 alkyl;
or R8 is not

- 117. The method of any one of items 115 and 116 wherein the non-luminescent enzyme
of interest is a protease enzyme, a cytochrome P450 enzyme, a monoamine oxidase enzyme,
or a glutathione S-transferase enzyme.
- 118. The method of any one of items 115 to 117 wherein the activity of the non-luminescent
enzyme is measured in a live, intact animal.
- 119. A method to detect the presence of at least two molecules in a sample, comprising:
contacting the sample with a first reporter molecule comprising an OgLuc variant encoded
by the polynucleotide of any one of items 1-86, wherein the first reporter molecule
is operatively linked to a first component of the sample; contacting the sample with
a second reporter molecule, wherein the second reporter molecule is operatively linked
to a second component of the sample; detecting the presence of the first and second
reporter molecules to determine the presence and/or amounts of the first and second
components in the sample.
- 120. A method to detect the presence of at least two molecules in a cell, comprising:
contacting the cell with a first reporter molecule comprising an OgLuc variant encoded
by the polynucleotide of any one of items 1-86, wherein the first reporter molecule
is operatively linked to a first component of the sample; contacting the sample with
a second reporter molecule, wherein the second reporter molecule is operatively linked
to a second component of the sample; detecting the presence of the first and second
reporter molecules to determine the presence and/or amounts of the first and second
components in the sample.
- 121. A method of generating a polynucleotide encoding a OgLuc variant polypeptide
comprising:
- (a) using a parental fusion protein construct comprising a parental OgLuc polypeptide
and at least one heterologous polypeptide to generate a library of variant fusion
proteins; and
- (b) screening the library for at least one of enhanced luminescence, enhanced enzyme
stability or enhanced biocompatibility relative to the parental fusion protein construct.
- 122. The method of item 121, wherein the heterologous polypeptide is C-terminal to
the OgLuc polypeptide.
- 123. The method of item 121, wherein the heterologous polypeptide is N-terminal to
the OgLuc polypeptide.
- 124. The method of any one of items 121-123, wherein the heterologous polypeptide
is HALOTAG®.
- 125. The method of item 121, wherein the fusion protein constructs comprises two heterologous
polypeptides.
- 126. The method of item 125, wherein the one of the heterologous polypeptide is N-terminal
to the OgLuc polypeptide and the other heterologous polypeptide is C-terminal to the
OgLuc polypeptide.
- 127. The method of item 125 or 126, wherein the heterologous polypeptides are HALOTAG®
and Id.
- 128. A vector comprising the polynucleotide, or a fragment thereof, of any of items
1-86.
- 129. A circularly permuted luciferase comprising the polypeptide encoded by the polynucleotide
of any of items 1-86 or a fragment thereof.
- 130. A method of generating codon-optimized polynucleotides encoding a luciferase
for use in an organism, comprising: for each amino acid in the luciferase, randomly
selecting a codon from the two most commonly used codons used in the organism to encode
for the amino acid to produce a first codon-optimized polynucleotide.
- 131. The method of optimizing codons of item 130, further comprising selecting the
other of the two most commonly used codons used in the organism to encode for the
amino acid to produce a second codon-optimized polynucleotide.