LINKAGE MODIFIED OLIGOMERIC COMPOUNDS

Description

FIELD OF THE INVENTION

[0001] The present invention pertains generally to chemically-modified antisense oligonucleotides for use in research, diagnostics, and/or therapeutics.

SEQUENCE LISTING

[0002] The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled CHEM0091WOSEQ_ST25.txt, created April 15, 2015, which is 284 Kb in size.

BACKGROUND OF THE INVENTION

[0003] Antisense compounds have been used to modulate target nucleic acids. Antisense compounds comprising a variety of chemical modifications and motifs have been reported. In certain instances, such compounds are useful as research tools, diagnostic reagents, and as therapeutic agents. In certain instances antisense compounds have been shown to modulate protein expression by binding to a target messenger RNA (mRNA) encoding the protein. In certain instances, such binding of an antisense compound to its target mRNA results in cleavage of the mRNA. Antisense compounds that modulate processing of a pre-mRNA have also been reported. Such antisense compounds alter splicing, interfere with polyadenlyation or prevent formation of the 5'-cap of a pre-mRNA.

[0004] The synthesis and biochemical properties of oligonucleotides containing phosphorus-modified phosphonoacetate and thio-phosphonoacetate deoxyribonucleotides have been described in scientific journals and patent literature (see Dellinger et al., J. Am. Chem. Soc. 2003, 125(4), 940-950; Sheehan et al., Nucl. Acids Res. 2003, 31(14), 4109-4118); also see published US patent applications (US 2004/0116687 and US 2002/0058802) and US patent 6,693,187.

[0005] DNA or RNA containing oligonucleotides comprising alkylphosphonate internucleoside linkage backbone have been disclosed (see US patents 5,264,423 and 5,286,717).

[0006] The synthesis of oligodeoxyribonucleotides containing a methyl phosphonate locked nucleic acid (LNA) thymine monomer has been described. The Tm values of the duplexes with their DNA or RNA complements have also been reported (see Lauritsen et al., Bioorg. Med. Chem. Lett. 13(2), 253-256).

[0007] Oligomeric compounds have been prepared using Click chemistry wherein alkynyl phosphonate internucleoside linkages on an oligomeric compound attached to a solid support are converted into the 1,2,3-triazolylphosphonate internucleoside linkages and then cleaved from the solid support (Krishna et al., J. Am. Chem. Soc. 2012, 134(28), 11618-11631).

[0008] Targeting disease-causing gene sequences was first suggested more than thirty years ago (Belikova et al., Tet. Lett. 1967, 8(37), 3557-3562), and antisense activity was demonstrated in cell culture more than a decade later (Zamecnik et al., Proc. Natl. Acad. Sci. U.S.A. 1978, 75(1), 280-284). One advantage of antisense technology in the treatment of a disease or condition that stems from a disease-causing gene is that it is a direct genetic approach that has the ability to modulate (increase or decrease) the expression of specific disease-causing genes. Another advantage is that validation of a therapeutic target using antisense compounds results in direct and immediate discovery of the drug candidate; the antisense compound is the potential therapeutic agent.

[0009] Generally, the principle behind antisense technology is that an antisense compound hybridizes to a target nucleic acid and modulates gene expression activities or function, such as transcription or translation. The modulation of gene expression can be achieved by, for example, target degradation or occupancy-based inhibition. An example of modulation of RNA target function by degradation is RNase H-based degradation of the target RNA upon hybridization with a DNA-like antisense compound. Another example of modulation of gene expression by target degradation is RNA interference (RNAi). RNAi generally refers to antisense-mediated gene silencing involving the introduction of dsRNA leading to the sequence-specific reduction of targeted endogenous mRNA levels. An additional example of modulation of RNA target function by an occupancy-based mechanism is modulation of microRNA function. MicroRNAs are small non-coding RNAs that regulate the expression of protein-coding RNAs. The binding of an antisense compound to a microRNA prevents that microRNA from binding to its messenger RNA targets, and thus interferes with the function of the microRNA. Regardless of the specific mechanism, this sequence-specificity makes antisense compounds extremely attractive as tools for target validation and gene functionalization, as well as therapeutics to selectively modulate the expression of genes involved in the pathogenesis of malignancies and other diseases.

[0010] Antisense technology is an effective means for reducing the expression of one or more specific gene products and can therefore prove to be uniquely useful in a number of therapeutic, diagnostic, and research applications. Chemically modified nucleosides are routinely used for incorporation into antisense compounds to enhance one or more properties, such as nuclease resistance, pharmacokinetics or affinity for a target RNA. In 1998, the antisense compound, Vitravene® (fomivirsen; developed by Isis Pharmaceuticals Inc., Carlsbad, CA) was the first antisense drug to achieve marketing clearance from the U.S. Food and Drug Administration (FDA), and is currently a treatment of cytomegalovirus (CMV)-induced retinitis in AIDS patients.

[0011] New chemical modifications have improved the potency and efficacy of antisense compounds, uncovering the potential for oral delivery as well as enhancing subcutaneous administration, decreasing potential for side effects, and leading to improvements in patient convenience. Chemical modifications increasing potency of antisense compounds allow administration of lower doses, which reduces the potential for toxicity, as well as decreasing overall cost of therapy. Modifications increasing the resistance to degradation result in slower clearance from the body, allowing for less frequent dosing. Different types of chemical modifications can be combined in one compound to further optimize the compound's efficacy.

[0012] The synthesis of 5'-substituted DNA and RNA derivatives and their incorporation into oligomeric compounds has been reported in the literature (Saha et al., J. Org. Chem. 1995, 60, 788-789; Wang et al., Bioorg. Med. Chem. Lett. 1999, 9(6), 885-890; and Mikhailov et al., Nucleosides Nucleotides 1991, 10(1-3), 339-343; Beigelman et al., Nucleosides Nucleotides 1995, 14(3-5), 901-905; and Eppacher et al., Helv. Chim. Acta. 2004, 87, 3004-3020). The 5'-substituted monomers have also been made as the monophosphate with modified bases (Wang et al., Nucleosides Nucleotides Nucleic Acids 2004, 23 (1 & 2), 317-337).

[0013] A genus of modified nucleosides including optional modification at a plurality of positions including the 5'-position and the 2'-position of the sugar ring and oligomeric compounds incorporating these modified nucleosides therein has been reported (see International Application Number: PCT/US94/02993, Published on October 13, 1994 as WO 94/22890).

[0014] The synthesis of 5'-CH₂-R substituted 2'-O-protected nucleosides and their incorporation into oligomers has been previously reported (see Wu et al., Helv. Chim. Acta. 2000, 83, 1127-1143 and Wu et al., Bioconjug. Chem. 1999, 10, 921-924).

[0015] Amide linked nucleoside dimers have been prepared for incorporation into oligonucleotides wherein the 3' linked nucleoside in the dimer (5' to 3') comprises a 2'-OCH₃ and a 5'-(S)-CH₃ (De Mesmaeker et al., Synlett 1997, 11, 1287-1290).

[0016] A genus of 2'-substituted 5'-CH₂-R (or O) modified nucleosides and a discussion of incorporating them into oligonucleotides has been previously reported (see International Application Number: PCT/US92/01020, published on February 07, 1992 as WO 92/13869).

[0017] The synthesis of modified 5'-methylene phosphonate monomers having 2'-substitution and their use to make modified antiviral dimers has been previously reported (see US Patent Application Number: 10/418,662, published on April 6, 2006 as US 2006/0074035).

[0018] Various analogs of 5'-alkynylphosphonate ribonucleosides have been prepared and reported in the literature (see Meurillon et al., Tetrahedron 2009, 65, 6039-6046; Meurillon et al., Nucleic Acids Symp. Ser. 2008, 52(1), 565-566; Lera et al., Org. Lett. 2000, 2(24), 3873-3875).

[0019] The preparation of 5'-vinylphosphonate DNA and RNA monomers and their use to make dimeric compounds for oligonucleotide synthesis have been described. Their biochemical studies have also been discussed (see Whittaker et al., Tet. Lett. 2008, 49, 6984-6987; Abbas et al., Org. Lett. 2001, 3(21), 3365-3367; Bertram et al., Biochemistry 2002, 41, 7725-7731; Zhao et al., Tet. Lett. 1996, 37(35), 6239-6242 and Jung et al., Bioorg. Med. Chem. 2000, 8, 2501-2509).

[0020] Various BNA's have been prepared and reported in the patent literature as well as in scientific literature, see for example: Singh et al., Chem. Commun. 1998, 4, 455-456; Koshkin et al., Tetrahedron 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A. 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett. 1998, 8, 2219-2222; Wengel et al., PCT International Application WO 98-DK393 19980914; Singh et al., J. Org. Chem. 1998, 63, 10035-10039. Examples of issued US patents and published applications include for example: U.S. Patents 7,053,207, 6,770,748, 6,268,490 and 6,794,499 and published U.S. applications 2004/0219565, 2004/0014959, 2003/0207841, 2004/0192918, 2003/0224377, 2004/0143114 and 2003/0082807.

[0021] The synthesis of various cyclohexitol nucleoside analogs (tetrahydropyran nucleoside analogs) has been reported in the literature, see for example: Verheggen et al., J. Med. Chem. 1995, 38, 826-835; Altmann et al., Chimia 1996, 50, 168-176; Herdewijn et al., Bioorg. Med. Chem. Lett. 1996, 6(13), 1457-1460; Verheggen et al., Nucleosides Nucleotides 1996, 15(1-3), 325-335; Ostrowski et al., J. Med. Chem. 1998, 41, 4343-4353; Allart et al., Tetrahedron. 1999, 55, 6527-6546; Wouters et al., Bioorg. Med. Chem. Lett. 1999, 9, 1563-1566; Brown et al., Drug Dev. Res. 2000, 49, 253-259; published PCT application: WO 93/25565; WO 02/18406; and WO 05/049582; US Patents 5,314,893; 5,607,922; and 6,455,507. Various cyclohexitol nucleoside analogs (tetrahydropyran nucleoside analogs) have been described as monomers and have also been incorporated into oligomeric compounds (see for example: Published PCT application, WO 93/25565, published December 23, 1993; Augustyns et al., Nucleic Acids Res. 1993, 21(20), 4670-4676; Verheggen et al., J. Med. Chem., 1993, 36, 2033-2040; Van Aerschol et al., Angew. Chem. Int. Ed. Engl., 1995, 34(12), 1338-1339; Anderson et al., Tetrahedron Lett. 1996, 37(45), 8147-8150; Herdewijn et al., Liebigs Ann. 1996, 1337-1348; De Bouvere et al., Liebigs Ann./Recueil 1997, 1453-1461; 1513-1520; Hendrix et al., Chem. Eur. J. 1997, 3(1), 110-120; Hendrix et al., Chem. Eur. J. 1997, 3(9), 1513-1520; Hossain et al, J. Org. Chem. 1998, 63, 1574-1582; Allart et al., Chem. Eur. J. 1999, 5(8), 2424-2431; Boudou et al., Nucleic Acids Res. 1999, 27(6), 1450-1456; Kozlov et al., J. Am. Chem. Soc. 1999, 121, 1108-1109; Kozlov et al., J. Am. Chem. Soc., 1999, 121, 2653-2656; Kozlov et al., J. Am. Chem. Soc., 1999, 121, 5856-5859; Pochet et al., Nucleosides & Nucleotides, 1999, 18 (4&5), 1015-1017; Vastmans et al., Collection Symposium Series, 1999, 2, 156-160; Froeyen et al., Helv. Chim. Acta. 2000, 83, 2153-2182; Kozlov et al., Chem. Eur. J., 2000, 6(1), 151-155; Atkins et al., Parmazie, 2000, 55(8), 615-617; Lescrinier et al., Chemistry & Biology, 2000, 7, 719-731; Lescrinier et al., Helv. Chim. Acta. 2000, 83, 1291-1310; Wang et al., J. Am. Chem. 2000, 122, 8595-8602; US Patent Application US 2004/0033967; Published US Patent Application US 2008/0038745; Published and Issued US Patent 7,276,592). DNA analogs have also been reviewed in an article (see: Leumann, Bioorg. Med. Chem. 2002, 10, 841-854) which included a general discussion of cyclohexitol nucleoside analogs (under the name: hexitol nucleic acid family).

[0022] Oligomeric compounds having phosphodiester linked hexitol nucleic acids (HNA, or 1,5-anhydrohexitol nucleic acids, 3'-H tetrahydropyran nucleoside analogs) have also been prepared for evaluation in cell assays. The different motifs that have been evaluated are fully modified wherein each monomer is a phosphodiester linked hexitol nucleic acid analog and gapped wherein each monomer in the 3' and 5' external regions of the oligomeric compound are each phosphodiester linked hexitol nucleic acid analogs and each monomer in the internal region is a phosphorothioate linked deoxyribonucleoside (see: Kang et al., Nucleic Acids Research, 2004, 32(14), 4411-4419; Vandermeeren et al.,2000, 55, 655-663; Flores et al., Parasitol Res., 1999, 85, 864-866; and Hendrix et al., Chem. Eur. J, 1997, 3(9), 1513-1520).

[0023] Oligomeric compounds having phosphodiester linked analogs having the 3'-OH group which are referred to in the art as ANA or D-altritol nucleic acids (3'-OH tetrahydropyran nucleoside analogs) have been prepared and evaluated both structurally and in vitro (Allart et al., Chem. Eur. J. 1999, 5(8), 2424-2431).

[0024] Chemically modified siRNA's having incorporated hexitol nucleotides (also referred to in the art as HNA, hexitol nucleic acids and tetrahydropyran nucleoside analogs) have been prepared and tested for silencing capacity (see: Published PCT application, WO 06/047842, published May 11,2006.

[0025] Cyclohexenyl nucleic acids (ceNA) and analogs thereof have been reported in the scientific and patent literature as monomers as well as in oligomeric compounds, see for example: Robeyns et al., J. Am. Chem. Soc. 2008, 130(6), 1979-1984; Horváth et al., Tetrahedron Lett. 2007, 48, 3621-3623; Nauwelaerts et al., J. Am. Chem. Soc. 2007, 129(30), 9340-9348; Gu et al., Nucleosides Nucleotides Nucleic Acids 2005, 24(5-7), 993-998; Nauwelaerts et al., Nucleic Acids Res. 2005, 33(8), 2452-2463; Robeyns et al., Acta Crystallogr. F Struct. Biol. Commun. 2005, F61(6), 585-586; Gu et al., Tetrahedron 2004, 60(9), 2111-2123; Gu et al., Oligonucleotides 2003, 13(6), 479-489; Wang et al., J. Org. Chem. 2003, 68, 4499-4505; Verbeure et al., Nucleic Acids Res. 2001, 29(24), 4941-4947; Wang et al., J. Org. Chem. 2001, 66, 8478-82; Wang et al., Nucleosides Nucleotides Nucleic Acids 2001, 20(4-7), 785-788; Wang et al., J. Am. Chem. 2000, 122, 8595-8602; Published PCT application, WO 06/047842; and Published PCT Application WO 01/049687.

[0026] The synthesis of 5'-phosphonate deoxyribonucleoside monomers and dimers having a 5'-phosphate group and their incorporation into oligomeric compounds have been described. Their physico-chemical properties including thermal stability as well as substrate activity toward certain nucleases have also been discussed (see Nawrot et al., Oligonucleotides 2006, 16(1), 68-82).

[0027] Nucleosides having a 6'-phosphonate group have been reported wherein the 5' or/and 6'-position is unsubstituted or substituted with a thio-tert-butyl group (SC(CH₃)₃) (and analogs thereof); a methyleneamino group (CH2NH2) (and analogs thereof) or a cyano group (CN) (and analogs thereof) (see Fairhurst et al., Synlett 2001, 4, 467-472; Kappler et al., J. Med. Chem. 1986, 29, 1030-1038; Kappler et al., J. Med. Chem. 1982, 25, 1179-1184; Vrudhula et al., J. Med. Chem. 1987, 30, 888-894; Hampton et al., J. Med. Chem. 1976, 19, 1371-1377; Geze et al., J. Am. Chem. Soc. 1983, 105(26), 7638-7640 and Hampton et al., J. Am. Chem. Soc. 1973, 95(13), 4404-4414).

[0028] The synthesis and biochemical properties of oligonucleotides containing phosphorus-modified phosphonoacetate and thio-phosphonoacetate deoxyribonucleotides have been described in scientific journals and patent literature (see Dellinger et al., J. Am. Chem. Soc. 2003, 125, 940-950; Sheehan et al., Nucleic Acids Res. 2003, 31(14), 4109-4118); also see published US patent applications (US 2004/0116687 and US 2002/0058802) and US patent US 6,693,187.

[0029] DNA or RNA containing oligonucleotides comprising alkylphosphonate internucleoside linkage backbone have been disclosed (see US patents 5,264,423 and 5,286,717).

[0030] The synthesis of oligodeoxyribonucleotides containing a methyl phosphonate locked nucleic acid (LNA) thymine monomer has been described. The Tm values of the duplexes with their DNA or RNA complements have also been reported (see Lauritsen et al., Bioorg. Med. Chem. Lett. 2003, 13(2), 253-256).

[0031] Oligomeric compounds have been prepared using Click chemistry wherein alkynyl phosphonate internucleoside linkages on an oligomeric compound attached to a solid support are converted into the 1,2,3-triazolylphosphonate internucleoside linkages and then cleaved from the solid support (Krishna et al., J. Am. Chem. Soc. 2012, 134(28), 11618-11631).

[0032] WO 2013/022966 A1 discloses oligonucleotides comprising internucleoside linking groups of formula -P(CH₂CH₂OCH₃)(=O/S)-.

SUMMARY OF THE INVENTION

[0033] The present invention relates to antisense oligomeric compounds comprising a contiguous sequence of monomer subunits linked by internucleoside linking groups wherein at least one of the internucleoside linking groups has Formula I:

wherein each X is independently O or S wherein the antisense oligomeric compound comprising from 12 to 24 monomer subunits.

[0034] As used herein, an "oligomeric compound" is an antisense oligomeric compound. In certain embodiments, the oligomeric compounds provided herein comprise gapped oligomeric compounds comprising at least one modified internucleoside linkage having Formula I. In certain embodiments, the oligomeric compounds provided herein hybridize to a portion of a target RNA resulting in loss of normal function of the target RNA. In certain embodiments, the oligomeric compounds disclosed herein provide improved selectivity for a target RNA. In certain embodiments, the oligomeric compounds disclosed herein provide improved selectivity for a target RNA relative to an off target RNA. In certain embodiments, the oligomeric compounds provide improved potency for a target RNA. In certain embodiments, the oligomeric compounds provided herein provide enhanced stability to base exposure. In certain embodiments, the oligomeric compounds provided herein provide enhanced stability to base exposure during synthesis of the oligomeric compound. In certain embodiments, the oligomeric compounds provided herein provide an enhanced off target profile.

[0035] The variables are defined individually in further detail herein. It is to be understood that the oligomeric compounds provided herein include all combinations of the embodiments disclosed and variables defined herein.

[0036] Provided herein are oligomeric compounds comprising a contiguous sequence of monomer subunits linked by internucleoside linking groups wherein at least one of the internucleoside linking groups has Formula I:

wherein each X is independently O or S; wherein the oligomeric compound comprising from 12 to 24 monomer subunits;

and each

represents an attachment to a monomer subunit within said oligomeric compound.

[0037] In certain embodiments, each internucleoside linking group of Formula I forms a 3'-5' linkage between two monomer subunits comprising furanosyl sugar moieties within the oligomeric compound. In certain embodiments, one or more internucleoside linking groups of Formula I forms a 2'-3' and or a 2'-5' linkage between two monomer subunits comprising furanosyl sugar moieties within the oligomeric compound.

[0038] In certain embodiments, one or more internucleoside linking groups of Formula I forms a linkage between a 3' or a 5'-position on a monomer subunit comprising a furanosyl sugar moiety and a ring atom on a sugar surrogate group as disclosed herein. In certain embodiments, one or more internucleoside linking groups of Formula I form a linkage between two monomer subunits comprising sugar surrogate groups as disclosed herein.

[0039] In certain embodiments, oligomeric compounds are provided comprising a contiguous sequence of monomer subunits linked by internucleoside linking groups wherein at least one of the internucleoside linking groups has Formula I, wherein the oligomeric compound comprises a gapped oligomeric compound having a gap region of from 6 to 14 contiguous monomer subunits selected from β-D-2'-deoxyribonucleosides and modified nucleosides that are DNA-like that each adopt a 2'-endo conformational geometry located between a 5'-region and a 3'-region wherein the 5' and 3'-regions each, independently, have from 2 to 8 contiguous monomer subunits selected from RNA-like modified nucleosides that each adopt a 3'-endo conformational geometry.

[0040] In certain embodiments, oligomeric compounds are provided comprising from 12 to 24 monomer subunits. In certain embodiments, oligomeric compounds are provided comprising from 14 to 20 monomer subunits.

[0041] In certain embodiments, gapped oligomeric compounds are provided wherein the gap region has 10 contiguous monomer subunits and the 5' and 3'-regions each, independently, have 2, 3 or 5 contiguous monomer subunits. In certain embodiments, the gap region has 10 contiguous monomer subunits and the 5' and 3'-regions each have 5 contiguous monomer subunits. In certain embodiments, the gap region has 10 contiguous monomer subunits and the 5' and 3'-regions each have 3 contiguous monomer subunits. In certain embodiments, the gap region has 10 contiguous monomer subunits and the 5' and 3'-regions each have 2 contiguous monomer subunits. In certain embodiments, gapped oligomeric compounds are provided wherein the gap region has 8 contiguous monomer subunits and the 5' and 3'-regions each, independently, have 4 contiguous monomer subunits.

[0042] In certain embodiments, oligomeric compounds are provided comprising from 1 to 10 internucleoside linking groups of Formula I. In certain embodiments, oligomeric compounds are provided comprising from 1 to 5 internucleoside linking groups of Formula I. In certain embodiments, oligomeric compounds are provided comprising from 1 to 3 internucleoside linking groups of Formula I. In certain embodiments, oligomeric compounds are provided comprising 1 internucleoside linking group of Formula I. In certain embodiments, oligomeric compounds are provided comprising 4 internucleoside linking groups of Formula I. In certain embodiments, oligomeric compounds are provided comprising 3 internucleoside linking groups of Formula I. In certain embodiments, oligomeric compounds are provided comprising 2 internucleoside linking groups of Formula I.

[0043] In certain embodiments, oligomeric compounds are provided wherein internucleoside linking groups of Formula I are contiguous. Contiguous internucleoside linkages means that each successive linkage is an internucleoside linking groups of Formula I such as 2, 3, 4, 5 in a row or wherein each internucleoside linkage in an oligomeric compound is an internucleoside linking group of Formula I.

[0044] In certain embodiments, gapped oligomeric compounds are provided wherein each internucleoside linking group of Formula I is, independently, located in the gap region or between the gap region and the 5' or 3'-region. In certain embodiments, gapped oligomeric compounds are provided wherein each internucleoside linking group of Formula I is, independently, located in the gap region or between the gap region and the 5'-region or the 3'-region. In certain embodiments, gapped oligomeric compounds are provided wherein each internucleoside linking group of Formula I is, independently, located in the 5'-region, the 3'-region or between the gap region and the 5'-region or the 3'-region.

[0045] In certain embodiments, oligomeric compounds are provided wherein each internucleoside linking group of Formula I is, independently, located in the 5'-region. In certain embodiments, each internucleoside linking group of Formula I is, independently, located in the 3'-region. In certain embodiments, each internucleoside linking group of Formula I is, independently, located in the 5'-region or the gap region. In certain embodiments, each internucleoside linking group of Formula I is, independently, located in the 3'-region or the gap region. In certain embodiments, at least one internucleoside linking group of Formula I is located between the gap region and the 5'-region. In certain embodiments, at least one internucleoside linking group of Formula I is located in the gap region between monomer subunits 1 and 2 counting from the first monomer subunit at the 5' end of the gap region.

[0046] In certain embodiments, oligomeric compounds are provided having two internucleoside linking groups of Formula I wherein one internucleoside linking group of Formula I is located between the gap region and the 5'-region and the other internucleoside linking group of Formula I is located in the gap region between monomer subunits 1 and 2 counting from the first monomer subunit at the 5' end of the gap region.

[0047] In certain embodiments, oligomeric compounds are provided wherein at least one internucleoside linking group of Formula I is located in the gap region between monomer subunits 2 and 3 counting from the first monomer subunit at the 5' end of the gap region. In certain embodiments, oligomeric compounds are provided having two internucleoside linking groups of Formula I wherein one internucleoside linking group of Formula I is located in the gap region between monomer subunits 1 and 2 counting from the first monomer subunit at the 5' end of the gap region and the other internucleoside linking group of Formula I is located in the gap region between monomer subunits 2 and 3 counting from the first monomer subunit at the 5' end of the gap region.

[0048] In certain embodiments, oligomeric compounds are provided wherein at least one internucleoside linking group of Formula I is located in the gap region between monomer subunits 3 and 4 counting from the first monomer subunit at the 5' end of the gap region. In certain embodiments, oligomeric compounds are provided having two internucleoside linking groups of Formula I wherein one internucleoside linking group of Formula I is located in the gap region between monomer subunits 2 and 3 counting from the first monomer subunit at the 5' end of the gap region and the other internucleoside linking group of Formula I is located in the gap region between monomer subunits 3 and 4 counting from the first monomer subunit at the 5' end of the gap region.

[0049] In certain embodiments, oligomeric compounds are provided wherein at least one internucleoside linking group of Formula I is located in the gap region between monomer subunits 4 and 5 counting from the first monomer subunit at the 5' end of the gap region. In certain embodiments, oligomeric compounds are provided having two internucleoside linking groups of Formula I wherein one internucleoside linking group of Formula I is located in the gap region between monomer subunits 3 and 4 counting from the first monomer subunit at the 5' end of the gap region and the other internucleoside linking group of Formula I is located in the gap region between monomer subunits 4 and 5 counting from the first monomer subunit at the 5' end of the gap region.

[0050] In certain embodiments, oligomeric compounds are provided wherein at least one internucleoside linking group of Formula I is located between the gap region and the 3'-region. In certain embodiments, at least one internucleoside linking group of Formula I is located in the gap region between monomer subunits 1 and 2 counting from the first monomer subunit at the 3' end of the gap region. In certain embodiments, oligomeric compounds are provided having two internucleoside linking groups of Formula I wherein one internucleoside linking group of Formula I is located between the gap region and the 3'-region and the other internucleoside linking group of Formula I is located in the gap region between monomer subunits 1 and 2 counting from the first monomer subunit at the 3' end of the gap region.

[0051] In certain embodiments, oligomeric compounds are provided wherein at least one internucleoside linking group of Formula I is located in the gap region between monomer subunits 2 and 3 counting from the first monomer subunit at the 3' end of the gap region. In certain embodiments, oligomeric compounds are provided having two internucleoside linking groups of Formula I wherein one internucleoside linking group of Formula I is located in the gap region between monomer subunits 1 and 2 counting from the first monomer subunit at the 3' end of the gap region and the other internucleoside linking group of Formula I is located in the gap region between monomer subunits 2 and 3 counting from the first monomer subunit at the 3' end of the gap region.

[0052] In certain embodiments, oligomeric compounds are provided wherein at least one internucleoside linking group of Formula I is located in the gap region between monomer subunits 3 and 4 counting from the first monomer subunit at the 3' end of the gap region. In certain embodiments, oligomeric compounds are provided having two internucleoside linking groups of Formula I wherein one internucleoside linking group of Formula I is located in the gap region between monomer subunits 2 and 3 counting from the first monomer subunit at the 3' end of the gap region and the other internucleoside linking group of Formula I is located in the gap region between monomer subunits 3 and 4 counting from the first monomer subunit at the 3' end of the gap region.

[0053] In certain embodiments, oligomeric compounds are provided wherein at least one internucleoside linking group of Formula I is located in the gap region between monomer subunits 4 and 5 counting from the first monomer subunit at the 3' end of the gap region. In certain embodiments, oligomeric compounds are provided having two internucleoside linking groups of Formula I wherein one internucleoside linking group of Formula I is located in the gap region between monomer subunits 3 and 4 counting from the first monomer subunit at the 3' end of the gap region and the other internucleoside linking group of Formula I is located in the gap region between monomer subunits 4 and 5 counting from the first monomer subunit at the 3' end of the gap region.

[0054] In certain embodiments, oligomeric compounds are provided wherein each internucleoside linking group is, independently, a phosphodiester, a phosphorothioate or an internucleoside linking group of Formula I. In certain embodiments, oligomeric compounds are provided wherein each internucleoside linking group is, independently, a phosphorothioate or an internucleoside linking group of Formula I.

[0055] In certain embodiments, oligomeric compounds are provided wherein each monomer subunit comprises an optionally protected heterocyclic base moiety independently selected from thymine, cytosine, 5-methylcytosine, adenine and guanine.

[0056] In certain embodiments, oligomeric compounds are provided wherein each X is O. In certain embodiments, oligomeric compounds are provided wherein each X is S.

[0057] In certain embodiments, the chirality of each internucleoside linking group having Formula I is R_P. In certain embodiments, the chirality of each internucleoside linking group having Formula I is S_P.

[0058] In certain embodiments, gapped oligomeric compounds are provided wherein each modified nucleoside in the 5' and 3'-regions comprises a modified sugar moiety independently selected from a bicyclic nucleoside comprising a bicyclic furanosyl sugar moiety, a modified nucleoside comprising a furanosyl sugar moiety having at least one substituent group and a modified nucleoside comprising a sugar surrogate group. In certain embodiments, each modified nucleoside in the 5' and 3'-regions is, independently, selected from a bicyclic nucleoside comprising a bicyclic furanosyl sugar moiety having a bridging group between the 4' and 2' carbon atoms of the furanosyl ring independently selected from 4'-(CH₂)-O-2', 4'-(CH₂)₂-O-2', 4'-CH(CH₃)-O-2', 4'-CH₂-NCH₃-O-2', 4'-CH₂-C-(H)(CH₃)-2' and 4'-CH₂-C(=CH₂)-2' and a modified nucleoside comprising a ribofuranosyl sugar moiety having at least a 2'-substituent group independently selected from F, OCH₃, O(CH₂)₂-OCH₃ and OCH₂C(=O)-N(H)CH₃. In certain embodiments, each modified nucleoside in the 5' and 3'-regions is, independently, selected from a bicyclic nucleoside comprising a bicyclic furanosyl sugar moiety having a 4'-CH[(S)-(CH₃)]-O-2' bridging group and a modified nucleoside comprising a ribofuranosyl sugar moiety having a 2'-O(CH₂)₂-OCH₃ substituent group. In certain embodiments, each modified nucleoside in the 5' and 3'-regions is, independently, selected from a bicyclic nucleoside comprising a bicyclic furanosyl sugar moiety having a 4'-CH₂-O-2' or 4'-CH[(S)-(CH₃)]-O-2' bridging group and a modified nucleoside comprising a ribofuranosyl sugar moiety having a 2'-O(CH₂)₂-OCH₃ substituent group.

[0059] In certain embodiments, gapped oligomeric compounds are provided wherein the modified nucleosides in the 5' and 3'-regions comprise at least 2 different types of sugar moieties. In certain embodiments, one or more of the modified nucleosides in the 5' and 3'-regions comprises a sugar surrogate.

[0060] In certain embodiments, gapped oligomeric compounds are provided wherein essentially each monomer subunit in the gap region is a β-D-2'-deoxyribonucleoside. In certain embodiments, at least one monomer subunit in the gap region is a modified nucleoside.

[0061] In certain embodiments, gapped oligomeric compounds are provided comprising at least one 5' or 3'-terminal group. In certain embodiments, gapped oligomeric compounds are provided comprising one 5' or 3'-conjugate group. In certain embodiments, the conjugate group comprises a cell targeting moiety. In certain embodiments, the cell targeting moiety has the formula:

[0062] In certain embodiments, the cell targeting moiety has the formula:

[0063] In certain embodiments, the attachment of the cell targeting moiety to the oligomeric compound includes a conjugate linker having the formula: -C(=O)-(CH₂)₃-C(=O)N(H)-(CH₂)₆-O-.

[0064] In certain embodiments, the attachment of the cell targeting moiety to the oligomeric compound includes a conjugate linker and a cleavable moiety. In certain embodiments, the cleavable moiety has the formula:

wherein X is O or S.

[0065] In certain embodiments, X is O. In certain embodiments, X is S.

[0066] In certain embodiments, attachment of the cell targeting moiety to the oligomeric compound includes a conjugate linker and a cleavable moiety.

[0067] In certain embodiments, the gap region has from 8 to 12 contiguous monomer subunits and the 5' and 3'-regions each, independently, have from 2 to 5 contiguous monomer subunits. In certain embodiments, the gap region has from 9 to 10 contiguous monomer subunits. In certain embodiments, the gap region has 10 contiguous monomer subunits.

[0068] In certain embodiments, the 5' and 3'-regions each have 5 contiguous monomer subunits. In certain embodiments, the 5' and 3'-regions each have 2 to 3 contiguous monomer subunits. In certain embodiments, the 5' and 3'-regions each have 3 contiguous monomer subunits.

[0069] In certain embodiments, oligomeric compounds are provided comprising from 2 to 3 internucleoside linking groups of Formula I. In certain embodiments, the internucleoside linking groups having Formula I are contiguous.

[0070] In certain embodiments, each internucleoside linking group of Formula I is, independently, located in the gap region or between the gap region and the 5'-region or the 3'-region. In certain embodiments, each internucleoside linking group of Formula I is, independently, located in the 5'-region, the 3'-region or between the gap region and the 5'-region or the 3'-region.

[0071] In certain embodiments, oligomeric compounds are provided comprising only 1 internucleoside linking group of Formula I. In certain embodiments, oligomeric compounds are provided comprising a gapped oligomeric compound comprising only 1 internucleoside linking group of Formula I. In certain embodiments, the internucleoside linking group of Formula I is located in between two monomer subunits in the gap region.

[0072] In certain embodiments, oligomeric compounds are provided wherein each internucleoside linking group is, independently, a phosphodiester, a phosphorothioate or an internucleoside linking group of Formula I. In certain embodiments, each internucleoside linking group is a phosphorothioate or an internucleoside linking group of Formula I.

[0073] In certain embodiments, oligomeric compounds are provided wherein each monomer subunit comprises an optionally protected heterocyclic base moiety independently selected from a purine, substituted purine, pyrimidine or substituted pyrimidine. In certain embodiments, each heterocyclic base moiety is independently selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine.

[0074] In certain embodiments, oligomeric compounds are provided comprising a contiguous sequence of monomer subunits linked by internucleoside linking groups wherein at least one of the internucleoside linking groups has Formula I, wherein each X is O. In certain embodiments, each X is S.

[0075] In certain embodiments, the chirality of each internucleoside linking group having Formula I is Rp. In certain embodiments, the chirality of each internucleoside linking group having Formula I is S_P.

[0076] In certain embodiments, gapped oligomeric compounds are provided wherein each modified nucleoside in the 5'-region and the 3'-region provides enhanced hybridization affinity for an RNA target as compared to an unmodified nucleoside. In certain embodiments, each modified nucleoside in the 5' and 3'-regions comprises a modified sugar moiety. In certain embodiments, each modified nucleoside in the 5' and 3'-regions is, independently, a bicyclic nucleoside comprising a bicyclic furanosyl sugar moiety, a modified nucleoside comprising a furanosyl sugar moiety having at least one substituent group or a modified nucleoside comprising a sugar surrogate group. In certain embodiments, each modified nucleoside in the 5' and 3'-regions is, independently, a bicyclic nucleoside comprising a bicyclic furanosyl sugar moiety or a modified nucleoside comprising a ribofuranosyl sugar moiety having at least a 2'-substituent group.

[0077] In certain embodiments, one or more of the modified nucleosides in the 5' and 3'-regions comprises a modified sugar moiety having 2'-substituent group independently selected from halogen, OCH₃, OCH₂F, OCHF₂, OCF₃, OCH₂CH₃, O(CH₂)₂F, OCH₂CHF₂, OCH₂CF₃, OCH₂-CH=CH₂, O(CH₂)₂-OCH₃, O(CH₂)₂-SCH₃, O(CH₂)₂-OCF₃, O(CH₂)₃-N(R₃)(R4), O(CH₂)₂-ON(R₃)(R₄), O(CH₂)₂-O(CH₂)₂-N(R₃)(R₄), OCH₂C(=O)-N(R₄)(R₄), OCH₂C(=O)-N(R₅)-(CH₂)₂-N(R₃)(R₄) and O(CH₂)₂-N(R₅)-C(=NR₆)[N(R₃)(R₄)] wherein R₃, R₄, R₅ and R₆ are each, independently, H and C₁-C₆ alkyl. In certain embodiments, each 2'-substituent group is independently selected from F, OCH₃, OCF₃, OCH₂CH₃, OCH₂CF₃, OCH₂-CH=CH₂, O(CH₂)₂-OCH₃, O(CH₂)₂-O(CH₂)₂-N(CH₃)₂, OCH₂C(=O)-N(H)CH₃, OCH₂C(=O)-N(H)-(CH₂)₂-N(CH₃)₂ and OCH₂-N(H)-C(=NH)NH₂. In certain embodiments, each 2'-substituent group is independently selected from F, OCH₃, O(CH₂)₂-OCH₃ and OCH₂C(=O)-N(H)CH₃. In certain embodiments, each 2'-substituent group is O(CH₂)₂-OCH₃.

[0078] In certain embodiments, one or more of the modified nucleosides in the 5' and 3'-regions is a bicyclic nucleoside comprising a bicyclic furanosyl sugar moiety having a bridging group between the 4' and 2' carbon atoms of the furanosyl ring independently selected from 4'-(CH₂)-O-2', 4'-(CH₂)-S-2', 4'-(CH₂)₂-O-2', 4'-CH(CH₃)-O-2', 4'-CH(CH₂OCH₃)-O-2', 4'-C(CH₃)₂-O-2', 4'-CH₂-N(OCH₃)-2', 4'-CH₂-O-N(CH₃)-2', 4'-CH₂-NCH₃-O-2', 4'-CH₂-C(H)(CH₃)-2' and 4'-CH₂-C(=CH₂)-2'. In certain embodiments, each of the bridging groups is selected from 4'-(CH₂)-O-2', 4'-(CH₂)₂-O-2', 4'-CH(CH₃)-O-2', 4'-CH₂-NCH₃-O-2', 4'-CH₂-C(H)(CH₃)-2' and 4'-CH₂-C(=CH₂)-2'. In certain embodiments, each bridging group is 4'-CH[(S)-(CH₃)]-O-2'.

[0079] In certain embodiments, gapped oligomeric compounds are provided wherein each modified nucleoside in the 5' and 3'-regions have identical sugar moieties. In certain embodiments, the modified nucleosides in the 5' and 3'-regions have at least two different types of sugar moieties. In certain embodiments, the different types of sugar moieties are selected from bicyclic furanosyl sugar moieties and furanosyl sugar moieties having at least one substituent group. In certain embodiments, the different types of sugar moieties are selected from bicyclic ribofuranosyl sugar moieties having a 4'-CH[(S)-(CH₃)]-O-2' bridging group and 2'-O(CH₂)₂-OCH₃ substituted ribonucleosides.

[0080] In certain embodiments, gapped oligomeric compounds are provided wherein at least one modified nucleosides in the 5' and 3'-regions comprises a sugar surrogate.

[0081] In certain embodiments, gapped oligomeric compounds are provided wherein each monomer subunit in the gap region is a β-D-2'-deoxyribonucleoside. In certain embodiments, at least one monomer subunit in the gap region is a modified nucleoside.

[0082] In certain embodiments, oligomeric compounds are provided comprising at least one 5' or 3'-terminal group.

[0083] In certain embodiments, oligomeric compounds are provided for use in methods of inhibiting gene expression comprising contacting one or more cells, a tissue or an animal with an oligomeric compound as provided herein wherein the oligomeric compound is complementary to a target RNA. In certain embodiments, the cells are in a human. In certain embodiments, the target RNA is human mRNA. In certain embodiments, the target RNA is cleaved thereby inhibiting its function.

[0084] In certain embodiments, oligomeric compounds are provided for use in methods of inhibiting gene expression comprising contacting one or more cells or a tissue with an oligomeric compound as provided herein.

[0085] In certain embodiments, oligomeric compounds are provided for use in in vivo methods of inhibiting gene expression comprising contacting one or more cells, a tissue or an animal with an oligomeric compound as provided herein.

[0086] In certain embodiments, oligomeric compounds as provided herein are used in medical therapy.

BRIEF DESCRIPTION OF THE FIGURE

[0087] FIG. 1 is a picture of a polyacrylamide gel showing cleavage patterns resulting from RNaseH 1 treatment of RNA/ASO duplexes. The ASO strands are 3/10/3 cEt gapmers having 2 contiguous MOP linkages walked from the 5'-gap junction to the 3'-gap junction one nucleoside at a time (see Example 38).

DETAILED DESCRIPTION OF THE INVENTION

[0088] Provided herein are antisense oligomeric compounds comprising a contiguous sequence of monomer subunits linked by internucleoside linking groups wherein at least one of the internucleoside linking groups has Formula I:

wherein each X is independently O or S wherein the antisense oligomeric compound comprising from 12 to 24 monomer subunits.

[0089] As used herein, an "oligomeric compound" is an antisense oligomeric compound. In certain embodiments, the oligomeric compounds provided herein comprise gapped oligomeric compounds comprising at least one modified internucleoside linkage having Formula I. In certain embodiments, the oligomeric compounds provided herein hybridize to a portion of a target RNA resulting in loss of normal function of the target RNA. In certain embodiments, the oligomeric compounds disclosed herein provide improved selectivity for a target RNA. In certain embodiments, the oligomeric compounds disclosed herein provide improved selectivity for a target RNA relative to an off target RNA. In certain embodiments, the oligomeric compounds provide improved potency for a target RNA. In certain embodiments, the oligomeric compounds provided herein provide enhanced stability to base exposure. In certain embodiments, the oligomeric compounds provided herein provide enhanced stability to base exposure during synthesis. In certain embodiments, the oligomeric compounds provided herein provide an enhanced off target profile.

[0090] In certain embodiments, the oligomeric compounds provided herein comprise gapped oligomeric compounds that each have a gap region of from 6 to 14 contiguous monomer subunits selected from β-D-2'-deoxyribonucleosides and modified nucleosides that are DNA-like that each adopt a 2'-endo conformational geometry located between a 5'-region and a 3'-region wherein the 5' and 3'-regions each, independently, have from 2 to 8 contiguous monomer subunits selected from RNA-like modified nucleosides that each adopt a 3'-endo conformational geometry.

[0091] The gapped oligomeric compounds provided herein have been shown to have improved properties. In certain embodiments, the activity of an otherwise unmodified gapped oligomeric compound against a target nucleic acid is enhanced by incorporation of one internucleoside linking group having Formula I in the gap region. In certain embodiments, at least one internucleoside linking group having Formula I is located in the gap but not at a gap junction. In certain embodiments, at least one internucleoside linking group having Formula I is located at the gap junction on the 5' side wherein the internucleoside linkage separates the gap region from the wing 5'-region. In certain embodiments, at least one internucleoside linking group having Formula I is located at the gap junction on the 3' side. In certain embodiments, at least one internucleoside linking group having Formula I is located in at least one of the 5' and 3'-regions. As indicated in the data provided in the example section herein, such properties include selectivity and potency.

[0092] In certain embodiments, a gapped oligomeric compound of interest is identified and then a series of identical oligomeric compounds are prepared with a single internucleoside linking group having Formula I walked across the gap region. If there are 8 monomer subunits in the gap then there will be 8 oligomeric compounds prepared having the internucleoside linking group having Formula I located at a different position in each of the oligomeric compounds which are subsequently assayed in one or more assays as illustrated herein to determine the lead from the series.

[0093] In certain embodiments, a gapped oligomeric compound of interest is identified and then a series of identical oligomeric compounds are prepared with two contiguous internucleoside linking group having Formula I walked across the gap region. If there are 10 monomer subunits in the gap then there will be 10 oligomeric compounds prepared having the internucleoside linking groups of Formula I located at a different positions in each of the oligomeric compounds which are subsequently assayed in one or more assays as illustrated herein to determine the lead from the series (such as a 3/10/3 gapmer, see for example, Example 38).

[0094] In certain embodiments, additional internucleoside linking groups having Formula I are incorporated into the gap region of the lead oligomeric compound and assayed in one or more assays as illustrated herein. In certain embodiments, the lead compound is further functionalized with one or more terminal groups such as for example a conjugate group. In certain embodiments, a gapped oligomeric compound of interest is identified and then a series of identical oligomeric compounds are prepared with blocks of at least two internucleoside linking group having Formula I walked across the gap region.

[0095] In certain embodiments, gapped oligomeric compounds having a single internucleoside linking group having Formula I are provided having enhanced or comparable (IC₅₀) and enhanced selectivity when compared to unmodified gapped oligomeric compounds and otherwise identical oligomeric compounds having a methyl phosphonate linkage. Oligomeric compounds comprising a single internucleoside linking group having Formula I have also been shown to have enhanced stability to aqueous ammonia during the deblocking and cleavage steps of oligomeric compound synthesis as compared to an otherwise identical oligomeric compounds having a methyl phosphonate linkage substituted for the internucleoside linking group having Formula I.

[0096] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of "or" means "and/or" unless stated otherwise. Furthermore, the use of the term "including" as well as other forms, such as "includes" and "included", is not limiting. Also, terms such as "element" or "component" encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise.

[0097] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.

A. Definitions

[0098] Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques may be used for chemical synthesis, and chemical analysis. Certain such techniques and procedures may be found for example in "Carbohydrate Modifications in Antisense Research" Edited by Sangvi and Cook, American Chemical Society , Washington D.C., 1994; "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, Pa., 21st edition, 2005; and "Antisense Drug Technology, Principles, Strategies, and Applications" Edited by Stanley T. Crooke, CRC Press, Boca Raton, Florida; and Sambrook et al., "Molecular Cloning, A laboratory Manual," 2nd Edition, Cold Spring Harbor Laboratory Press, 1989.

[0099] Unless otherwise indicated, the following terms have the following meanings:

As used herein, "chemical modification" means a chemical difference in a compound when compared to a naturally occurring counterpart. Chemical modifications of oligonucleotides include nucleoside modifications (including sugar moiety modifications and nucleobase modifications) and internucleoside linkage modifications. In reference to an oligonucleotide, chemical modification does not include differences only in nucleobase sequence.

As used herein, "furanosyl" means a structure comprising a 5-membered ring comprising four carbon atoms and one oxygen atom.

As used herein, "naturally occurring sugar moiety" means a ribofuranosyl as found in naturally occurring RNA or a 2'-deoxyribofuranosyl as found in naturally occurring DNA.

As used herein, "sugar moiety" means a naturally occurring sugar moiety or a modified sugar moiety of a nucleoside.

As used herein, "modified sugar moiety" means a substituted sugar moiety or a sugar surrogate.

As used herein, "substituted sugar moiety" means a furanosyl that is not a naturally occurring sugar moiety. Substituted sugar moieties include, but are not limited to furanosyls comprising substituents at the 2'-position, the 3'-position, the 5'-position and/or the 4'-position. Certain substituted sugar moieties are bicyclic sugar moieties.

As used herein, "2'-substituted sugar moiety" means a furanosyl comprising a substituent at the 2'-position other than H or OH. Unless otherwise indicated, a 2'-substituted sugar moiety is not a bicyclic sugar moiety (i.e., the 2'-substituent of a 2'-substituted sugar moiety does not form a bridge to another atom of the furanosyl ring.

As used herein, "MOE" means -OCH₂CH₂OCH₃.

As used herein, "2'-F nucleoside" refers to a nucleoside comprising a sugar comprising fluorine at the 2' position. Unless otherwise indicated, the fluorine in a 2'-F nucleoside is in the ribo position (replacing the OH of a natural ribose).

As used herein, "2'-(ara)-F" refers to a 2'-F substituted nucleoside, wherein the fluoro group is in the arabino position.

As used herein the term "sugar surrogate" means a structure that does not comprise a furanosyl ring and that is capable of replacing the naturally occurring sugar moiety of a nucleoside, such that the resulting nucleoside sub-units or monomer subunits are capable of linking together and/or linking to other nucleosides or other monomer subunits to form an oligomeric compound which is capable of hybridizing to a complementary oligomeric compound such as a nucleic acid target. Such structures include rings comprising a different number of atoms than furanosyl (e.g., 4, 6, or 7-membered rings); replacement of the oxygen atom of a furanosyl with a non-oxygen atom (e.g., carbon, sulfur, or nitrogen, wherein replacement of the oxygen atom with sulfur in furanose is generally considered a modified nucleoside as opposed to a sugar surrogate but can be considered both); or both a change in the number of atoms and a replacement of the oxygen. Such structures may also comprise substitutions corresponding to those described for substituted sugar moieties (e.g., 6-membered carbocyclic bicyclic sugar surrogates optionally comprising additional substituents). Sugar surrogates also include more complex sugar replacements (e.g., the non-ring systems of peptide nucleic acid). Sugar surrogates include without limitation morpholinos, cyclohexenyls and cyclohexitols. The synthesis and incorporation of modified nucleosides that include a sugar surrogate is well known in the art (see for example: U.S. 8,530,640; 8,088,904; 8,604,192; and 8,536,320, each of which are commonly owned).

As used herein, "bicyclic sugar moiety" means a modified sugar moiety comprising a 4 to 7 membered ring (including but not limited to a furanosyl) comprising a bridge connecting two atoms of the 4 to 7 membered ring to form a second ring, resulting in a bicyclic structure. In certain embodiments, the 4 to 7 membered ring is a sugar ring. In certain embodiments the 4 to 7 membered ring is a furanosyl. In certain such embodiments, the bridge connects the 2'-carbon and the 4'-carbon of the furanosyl.

As used herein, "nucleoside" means a compound comprising a nucleobase moiety and a sugar moiety. Nucleosides include, but are not limited to, naturally occurring nucleosides (as found in DNA and RNA) and modified nucleosides. Nucleosides may be linked to a phosphate moiety.

As used herein, "nucleotide" means a nucleoside further comprising a phosphate linking group. As used herein, "linked nucleosides" may or may not be linked by phosphate linkages and thus includes, but is not limited to "linked nucleotides." As used herein, "linked nucleosides" are nucleosides that are connected in a continuous sequence (i.e. no additional nucleosides are present between those that are linked).

As used herein the term "nucleobase" generally refers to the nucleobase of a nucleoside or modified nucleoside. The term "heterocyclic base moiety" is broader than the term nucleobase in that it includes any heterocyclic base that can be attached to a sugar to prepare a nucleoside or modified nucleoside. Such heterocyclic base moieties include but are not limited to naturally occurring nucleobases (adenine, guanine, thymine, cytosine and uracil) and protected forms of unmodified nucleobases (4-N-benzoylcytosine, 6-N-benzoyladenine and 2-N-isobutyrylguanine) as well as modified (5-methyl cytosine) or non-naturally occurring heterocyclic base moieties and synthetic mimetics thereof (such as for example phenoxazines).

As used herein the term "modified nucleoside" refers to a nucleoside comprising a modified heterocyclic base and or a sugar moiety other than ribose and 2'-deoxyribose. In certain embodiments, a modified nucleoside comprises a modified heterocyclic base moiety. In certain embodiments, a modified nucleoside comprises a sugar moiety other than ribose and 2'-deoxyribose. In certain embodiments, a modified nucleoside comprises a modified heterocyclic base moiety and a sugar moiety other than ribose and 2'-deoxyribose. The term "modified nucleoside" is intended to include all manner of modified nucleosides that can be incorporated into an oligomeric compound using standard oligomer synthesis protocols. Modified nucleosides include abasic nucleosides but in general a heterocyclic base moiety is included for hybridization to a complementary nucleic acid target.

[0100] In certain embodiments, modified nucleosides include a furanose or modified furanose sugar group such as a 4'-S analog (4'-S-modified nucleoside and 4'-S-ribonucleoside refer to replacement of the furanose oxygen atom with S). Such modified nucleosides include without limitation, substituted nucleosides (such as 2', 5', and/or 4' substituted nucleosides) 4'-S-modified nucleosides, (such as 4'-S-ribonucleosides, 4'-S-2'-deoxyribonucleosides and 4'-S-2'-substituted ribonucleosides), bicyclic modified nucleosides (such as 2'-O-CH(CH₃)-4', 2'-O-CH₂-4' or 2'-O-(CH₂)₂-4' bridged furanose analogs) and base modified nucleosides. The sugar can be modified with more than one of these modifications listed such as for example a bicyclic modified nucleoside further including a 5'-substitution or a 5' or 4' substituted nucleoside further including a 2' substituent. The term modified nucleoside also includes combinations of these modifications such as base and sugar modified nucleosides. These modifications are meant to be illustrative and not exhaustive as other modifications are known in the art and are also envisioned as possible modifications for the modified nucleosides described herein.

[0101] In certain embodiments, modified nucleosides comprise a sugar surrogate wherein the furanose ring has been replaced with a mono or polycyclic ring system or a non-cyclic sugar surrogate such as that used in peptide nucleic acids. Illustrative examples of sugar moieties for such modified nucleosides includes without limitation morpholino, hexitol, cyclohexenyl, 2.2.2 and 3.2.1 cyclohexose and open non-cyclic groups.

[0102] In certain embodiments, modified nucleosides comprise a non-naturally occurring sugar moiety and a modified heterocyclic base moiety. Such modified nucleosides include without limitation modified nucleosides wherein the heterocyclic base moiety is replaced with a phenoxazine moiety (for example the 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one group, also referred to as a G-clamp which forms four hydrogen bonds when hybridized with a guanosine base) and further replacement of the sugar moiety with a sugar surrogate group such as for example a morpholino, a cyclohexenyl or a bicyclo[3.1.0]hexyl.

[0103] As used herein, "bicyclic nucleoside" or "BNA" means a nucleoside comprising a bicyclic sugar moiety.

[0104] As used herein, "constrained ethyl nucleoside" or "cEt" means a nucleoside comprising a bicyclic sugar moiety comprising a 4'-CH(CH₃)-O-2' bridge. In certain embodiments, the cEt comprises a comprising a 4'-CH((S)-CH₃)-O-2' bridge. In certain embodiments, the cEt comprises a comprising a 4-CH((R)-CH₃)-O-2' bridge.

[0105] As used herein, "locked nucleic acid nucleoside" or "LNA" means a nucleoside comprising a bicyclic sugar moiety comprising a 4'-CH₂-O-2'bridge.

[0106] As used herein, "2'-substituted nucleoside" means a ribofuranosyl nucleoside comprising a substituent at the 2'-position other than H or OH. Unless otherwise indicated, a 2'-substituted nucleoside is not a bicyclic nucleoside.

[0107] As used herein, "2'-deoxynucleoside" means a nucleoside comprising 2'-H(H) furanosyl sugar moiety, as found in naturally occurring deoxyribonucleosides (DNA). In certain embodiments, a 2'-deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (e.g., uracil).

[0108] As used herein, "RNA-like nucleoside" means a modified nucleoside other than a β-D-ribose nucleoside that provides an A-form (northern) duplex when incorporated into an oligomeric compound and duplexed with a complementary RNA. RNA-like nucleosides are used as replacements for RNA nucleosides in oligomeric compounds to enhance one or more properties such as, for example, nuclease resistance and or hybridization affinity. RNA-like nucleosides include, but are not limited to modified furanosyl nucleosides that adopt a 3'-endo conformational geometry when put into an oligomeric compound. RNA-like nucleosides also include RNA surrogates such as F-HNA. RNA-like nucleosides include but are not limited to modified nucleosides comprising a 2'-substituent group selected from F, O(CH₂)₂OCH₃ (MOE) and OCH₃. RNA-like nucleosides also include but are not limited to modified nucleosides comprising bicyclic furanosyl sugar moiety comprising a 4'-CH₂-O-2', 4'-(CH₂)₂-O-2', 4'-C(H)[(R)-CH₃]-O-2' or 4'-C(H)[(S)-CH₃]-O-2' bridging group.

[0109] As used herein, "DNA-like nucleoside" means a modified nucleoside other than a β-D-2'-doxyribose nucleoside that provides a B-form (southern) duplex when incorporated into an oligomeric compound and duplexed with a complementary DNA. DNA-like nucleosides provide an intermediate duplex when incorporated into an oligomeric compound and duplexed with a complementary RNA that is between A-form and B-form. DNA -like nucleosides are used as replacements for DNA nucleosides in oligomeric compounds to enhance one or more properties. DNA-like nucleosides include, but are not limited to modified nucleosides that adopt a 2'-endo conformational geometry when put into an oligomeric compound.

[0110] As used herein, the term "single-stranded" refers to an oligomeric compound that is not hybridized to its complement and that does not have sufficient self-complementarity to form a hairpin structure under physiologically relevant conditions. A single-stranded compound may be capable of binding to its complement to become a double-stranded or partially double-stranded compound.

[0111] As used herein, "oligonucleotide" means a compound comprising a plurality of linked nucleosides. In certain embodiments, an oligonucleotide comprises one or more unmodified ribonucleosides (RNA) and/or unmodified deoxyribonucleosides (DNA) and/or one or more modified nucleosides.

[0112] As used herein "oligonucleoside" means an oligonucleotide in which none of the internucleoside linkages contains a phosphorus atom. As used herein, oligonucleotides include oligonucleosides.

[0113] As used herein, "modified oligonucleotide" means an oligonucleotide comprising at least one modified nucleoside and/or at least one modified internucleoside linkage.

[0114] As used herein "internucleoside linkage" means a covalent linkage between adjacent nucleosides in an oligonucleotide.

[0115] As used herein "naturally occurring internucleoside linkage" means a 3' to 5' phosphodiester linkage.

[0116] As used herein, "modified internucleoside linkage" means any internucleoside linkage other than a naturally occurring internucleoside linkage.

[0117] As used herein the term "monomer subunit" is meant to include all manner of monomers that are amenable to oligomer synthesis. In general a monomer subunit includes at least a sugar moiety or modified sugar moiety having at least two reactive sites that can form linkages to further monomer subunits. Essentially all monomer subunits include a heterocyclic base moiety that is hybridizable to a complementary site on a nucleic acid target. Reactive sites on monomer subunits located on the termini of an oligomeric compound can be protected or unprotected (generally OH) or can form an attachment to a terminal group (conjugate or other group). Monomer subunits include, without limitation, nucleosides and modified nucleosides. In certain embodiments, monomer subunits include nucleosides such as β-D-ribonucleosides and β-D-2'-deoxyribnucleosides and modified nucleosides including but not limited to substituted nucleosides (such as 2', 5' and bis substituted nucleosides), 4'-S-modified nucleosides (such as 4'-S-ribonucleosides, 4'-S-2'-deoxyribonucleosides and 4'-S-2'-substituted ribonucleosides), bicyclic modified nucleosides (such as bicyclic nucleosides wherein the sugar moiety has a 2'-O-CHR_a-4' bridging group, wherein R_a is H, alkyl or substituted alkyl), other modified nucleosides and nucleosides having sugar surrogates.

[0118] As used herein, "conjugate" means an atom or group of atoms bound to an oligonucleotide or oligomeric compound. In general, conjugate groups modify one or more properties of the compound to which they are attached, including, but not limited to pharmacodynamic, pharmacokinetic, binding, absorption, cellular distribution, cellular uptake, charge and/or clearance properties.

[0119] As used herein, "conjugate linking group" means any atom or group of atoms used to attach a conjugate to an oligonucleotide or oligomeric compound.

[0120] As used herein, "antisense compound" means a compound comprising or consisting of an oligonucleotide or oligomeric compound wherein at least a portion of which is complementary to a target nucleic acid to which it is capable of hybridizing, resulting in at least one antisense activity.

[0121] As used herein, "antisense activity" means any detectable and/or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid.

[0122] As used herein, "detecting" or "measuring" means that a test or assay for detecting or measuring is performed. Such detection and/or measuring may result in a value of zero. Thus, if a test for detection or measuring results in a finding of no activity (activity of zero), the step of detecting or measuring the activity has nevertheless been performed.

[0123] As used herein, "detectable and/or measureable activity" means a statistically significant activity that is not zero.

[0124] As used herein, "essentially unchanged" means little or no change in a particular parameter, particularly relative to another parameter which changes much more. In certain embodiments, a parameter is essentially unchanged when it changes less than 5%. In certain embodiments, a parameter is essentially unchanged if it changes less than two-fold while another parameter changes at least ten-fold. For example, in certain embodiments, an antisense activity is a change in the amount of a target nucleic acid. In certain such embodiments, the amount of a non-target nucleic acid is essentially unchanged if it changes much less than the target nucleic acid does, but the change need not be zero.

[0125] As used herein, "expression" means the process by which a gene ultimately results in a protein. Expression includes, but is not limited to, transcription, post-transcriptional modification (e.g., splicing, polyadenlyation, addition of 5'-cap), and translation.

[0126] As used herein, "target nucleic acid" means a nucleic acid molecule to which an antisense compound hybridizes.

[0127] As used herein, "RNAi compound" refers to an oligomeric compound that acts, at least in part, through an RNAi mechanism to modulate a target nucleic acid and/or protein encoded by a target nucleic acid. RNAi compounds include, but are not limited to double-stranded short interfering RNA (siRNA), single-stranded RNA (ssRNA), and microRNA, including microRNA mimics.

[0128] As used herein, "mRNA" means an RNA molecule that encodes a protein.

[0129] As used herein, "pre-mRNA" means an RNA transcript that has not been fully processed into mRNA. Pre-RNA includes one or more intron.

[0130] As used herein, "pdRNA" refers to a pre-selected RNA molecule that interacts with one or more promoter to modulate transcription.

[0131] As used herein, "object RNA" means an RNA molecule other than a target RNA, the amount, activity, splicing, and/or function of which is modulated, either directly or indirectly, by a target nucleic acid. In certain embodiments, a target nucleic acid modulates splicing of an object RNA. In certain such embodiments, an antisense compound modulates the amount or activity of the target nucleic acid, resulting in a change in the splicing of an object RNA and ultimately resulting in a change in the activity or function of the object RNA.

[0132] As used herein, "microRNA" means a naturally occurring, small, non-coding RNA that represses gene expression of at least one mRNA. In certain embodiments, a microRNA represses gene expression by binding to a target site within a 3' untranslated region of an mRNA. In certain embodiments, a microRNA has a nucleobase sequence as set forth in miRBase, a database of published microRNA sequences found at http://microma.sanger.ac.uk/sequences/. In certain embodiments, a microRNA has a nucleobase sequence as set forth in miRBase version 12.0 released September 2008.

[0133] As used herein, "target microRNA" refers to a pre-selected non-coding RNA molecule 18-30 nucleobases in length that modulates expression of one or more proteins or to a precursor of such a non-coding molecule.

[0134] As used herein, "microRNA mimic" means an oligomeric compound having a sequence that is at least partially identical to that of a microRNA. In certain embodiments, a microRNA mimic comprises the microRNA seed region of a microRNA. In certain embodiments, a microRNA mimic modulates translation of more than one target nucleic acids. In certain embodiments, a microRNA mimic is double-stranded.

[0135] As used herein, "seed region" refers to a region at or near the 5'end of an antisense compound having a nucleobase sequence that is import for target nucleic acid recognition by the antisense compound. In certain embodiments, a seed region comprises nucleobases 2-8 of an antisense compound. In certain embodiments, a seed region comprises nucleobases 2-7 of an antisense compound. In certain embodiments, a seed region comprises nucleobases 1-7 of an antisense compound. In certain embodiments, a seed region comprises nucleobases 1-6 of an antisense compound. In certain embodiments, a seed region comprises nucleobases 1-8 of an antisense compound.

[0136] As used herein, "microRNA seed region" refers to a seed region of a microRNA or microRNA mimic. In certain embodiments, a microRNA seed region comprises nucleobases 2-8 of a microRNA or microRNA mimic. In certain embodiments, a microRNA seed region comprises nucleobases 2-7 of a microRNA or microRNA mimic. In certain embodiments, a microRNA seed region comprises nucleobases 1-7 of a microRNA or microRNA mimic. In certain embodiments, a microRNA seed region comprises nucleobases 1-6 of a microRNA or microRNA mimic. In certain embodiments, a microRNA seed region comprises nucleobases 1-8 of a microRNA or microRNA mimic.

[0137] As used herein, "seed match segment" refers to a portion of a target nucleic acid having nucleobase complementarity to a seed region. In certain embodiments, a seed match segment has nucleobase complementarity to nucleobases 2-8 of an siRNA, ssRNA, natural microRNA or microRNA mimic. In certain embodiments, a seed match segment has nucleobase complementarity to nucleobases 2-7 of an siRNA, ssRNA, microRNA or microRNA mimic. In certain embodiments, a seed match segment has nucleobase complementarity to nucleobases 1-6 of an siRNA, ssRNA, microRNA or microRNA mimic. In certain embodiments, a seed match segment has nucleobase complementarity to nucleobases 1-7 of an siRNA, ssRNA, microRNA or microRNA mimic. In certain embodiments, a seed match segment has nucleobase complementarity to nucleobases 1-8 of an siRNA, ssRNA, microRNA or microRNA mimic.

[0138] As used herein, "seed match target nucleic acid" refers to a target nucleic acid comprising a seed match segment.

[0139] As used herein, "microRNA family" refers to a group of microRNAs that share a microRNA seed sequence. In certain embodiments, microRNA family members regulate a common set of target nucleic acids. In certain embodiments, the shared microRNA seed sequence is found at the same nucleobase positions in each member of a microRNA family. In certain embodiments, the shared microRNA seed sequence is not found at the same nucleobase positions in each member of a microRNA family. For example, a microRNA seed sequence found at nucleobases 1-7 of one member of a microRNA family may be found at nucleobases 2-8 of another member of a microRNA family.

[0140] As used herein, "differentiating nucleobase" means a nucleobase that differs between two nucleic acids. In certain instances, a target region of a target nucleic acid differs by 1-4 nucleobases from a non-target nucleic acid. Each of those differences is referred to as a differentiating nucleobase. In certain instances, a differentiating nucleobase is a single-nucleotide polymorphism.

[0141] As used herein, "target-selective nucleoside" means a nucleoside of an antisense compound that corresponds to a differentiating nucleobase of a target nucleic acid.

[0142] As used herein, "allele" means one of a pair of copies of a gene existing at a particular locus or marker on a specific chromosome, or one member of a pair of nucleobases existing at a particular locus or marker on a specific chromosome, or one member of a pair of nucleobase sequences existing at a particular locus or marker on a specific chromosome. For a diploid organism or cell or for autosomal chromosomes, each allelic pair will normally occupy corresponding positions (loci) on a pair of homologous chromosomes, one inherited from the mother and one inherited from the father. If these alleles are identical, the organism or cell is said to be "homozygous" for that allele; if they differ, the organism or cell is said to be "heterozygous" for that allele. "Wild-type allele" refers to the genotype typically not associated with disease or dysfunction of the gene product. "Mutant allele" refers to the genotype associated with disease or dysfunction of the gene product.

[0143] As used herein, "allelic variant" means a particular identity of an allele, where more than one identity occurs. For example, an allelic variant may refer to either the mutant allele or the wild-type allele.

[0144] As used herein, "single nucleotide polymorphism" or "SNP" means a single nucleotide variation between the genomes of individuals of the same species. In some cases, a SNP may be a single nucleotide deletion or insertion. In general, SNPs occur relatively frequently in genomes and thus contribute to genetic diversity. The location of a SNP is generally flanked by highly conserved sequences. An individual may be homozygous or heterozygous for an allele at each SNP site.

[0145] As used herein, "single nucleotide polymorphism site" or "SNP site" refers to the nucleotides surrounding a SNP contained in a target nucleic acid to which an antisense compound is targeted.

[0146] As used herein, "targeting" or "targeted to" means the association of an antisense compound to a particular target nucleic acid molecule or a particular region of a target nucleic acid molecule. An antisense compound targets a target nucleic acid if it is sufficiently complementary to the target nucleic acid to allow hybridization under physiological conditions.

[0147] As used herein, "nucleobase complementarity" or "complementarity" when in reference to nucleobases means a nucleobase that is capable of base pairing with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In certain embodiments, complementary nucleobase means a nucleobase of an antisense compound that is capable of base pairing with a nucleobase of its target nucleic acid. For example, if a nucleobase at a certain position of an antisense compound is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be complementary at that nucleobase pair. Nucleobases comprising certain modifications may maintain the ability to pair with a counterpart nucleobase and thus, are still capable of nucleobase complementarity.

[0148] As used herein, "non-complementary" in reference to nucleobases means a pair of nucleobases that do not form hydrogen bonds with one another.

[0149] As used herein, "complementary" in reference to oligomeric compounds (e.g., linked nucleosides, oligonucleotides, or nucleic acids) means the capacity of such oligomeric compounds or regions thereof to hybridize to another oligomeric compound or region thereof through nucleobase complementarity under stringent conditions. Complementary oligomeric compounds need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated. In certain embodiments, complementary oligomeric compounds or regions are complementary at 70% of the nucleobases (70% complementary). In certain embodiments, complementary oligomeric compounds or regions are 80% complementary. In certain embodiments, complementary oligomeric compounds or regions are 90% complementary. In certain embodiments, complementary oligomeric compounds or regions are 95% complementary. In certain embodiments, complementary oligomeric compounds or regions are 100% complementary.

[0150] As used herein, "mismatch" means a nucleobase of a first oligomeric compound that is not capable of pairing with a nucleobase at a corresponding position of a second oligomeric compound, when the first and second oligomeric compound are aligned. Either or both of the first and second oligomeric compounds may be oligonucleotides.

[0151] As used herein, "hybridization" means the pairing of complementary oligomeric compounds (e.g., an antisense compound and its target nucleic acid). While not limited to a particular mechanism, the most common mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.

[0152] As used herein, "specifically hybridizes" means the ability of an oligomeric compound to hybridize to one nucleic acid site with greater affinity than it hybridizes to another nucleic acid site. In certain embodiments, an antisense oligonucleotide specifically hybridizes to more than one target site.

[0153] As used herein, "fully complementary" in reference to an oligonucleotide or portion thereof means that each nucleobase of the oligonucleotide or portion thereof is capable of pairing with a nucleobase of a complementary nucleic acid or contiguous portion thereof. Thus, a fully complementary region comprises no mismatches or unhybridized nucleobases in either strand.

[0154] As used herein, "percent complementarity" means the percentage of nucleobases of an oligomeric compound that are complementary to an equal-length portion of a target nucleic acid. Percent complementarity is calculated by dividing the number of nucleobases of the oligomeric compound that are complementary to nucleobases at corresponding positions in the target nucleic acid by the total length of the oligomeric compound.

[0155] As used herein, "percent identity" means the number of nucleobases in a first nucleic acid that are the same type (independent of chemical modification) as nucleobases at corresponding positions in a second nucleic acid, divided by the total number of nucleobases in the first nucleic acid.

[0156] As used herein, "modulation" means a change of amount or quality of a molecule, function, or activity when compared to the amount or quality of a molecule, function, or activity prior to modulation. For example, modulation includes the change, either an increase (stimulation or induction) or a decrease (inhibition or reduction) in gene expression. As a further example, modulation of expression can include a change in splice site selection of pre-mRNA processing, resulting in a change in the absolute or relative amount of a particular splice-variant compared to the amount in the absence of modulation.

[0157] As used herein, "modification motif" means a pattern of chemical modifications in an oligomeric compound or a region thereof. Motifs may be defined by modifications at certain nucleosides and/or at certain linking groups of an oligomeric compound.

[0158] As used herein, "nucleoside motif' means a pattern of nucleoside modifications in an oligomeric compound or a region thereof. The linkages of such an oligomeric compound may be modified or unmodified. Unless otherwise indicated, motifs herein describing only nucleosides are intended to be nucleoside motifs. Thus, in such instances, the linkages are not limited.

[0159] As used herein, "sugar motif" means a pattern of sugar modifications in an oligomeric compound or a region thereof.

[0160] As used herein, "linkage motif" means a pattern of linkage modifications in an oligomeric compound or region thereof. The nucleosides of such an oligomeric compound may be modified or unmodified. Unless otherwise indicated, motifs herein describing only linkages are intended to be linkage motifs. Thus, in such instances, the nucleosides are not limited.

[0161] As used herein, "nucleobase modification motif" means a pattern of modifications to nucleobases along an oligonucleotide. Unless otherwise indicated, a nucleobase modification motif is independent of the nucleobase sequence.

[0162] As used herein, "sequence motif' means a pattern of nucleobases arranged along an oligonucleotide or portion thereof. Unless otherwise indicated, a sequence motif is independent of chemical modifications and thus may have any combination of chemical modifications, including no chemical modifications.

[0163] As used herein, "type of modification" in reference to a nucleoside or a nucleoside of a "type" means the chemical modification of a nucleoside and includes modified and unmodified nucleosides. Accordingly, unless otherwise indicated, a "nucleoside having a modification of a first type" may be an unmodified nucleoside.

[0164] As used herein "positionally modified" means an oligomeric compound or portion thereof comprising any modification at any position. In certain embodiments, positionally modified is used to describe sugar or linkage modified nucleosides. In certain embodiments, the term positionally modified includes a sequence of β-D-ribonucleosides wherein the sequence is interrupted by two or more regions comprising from 1 to 4 sugar modified nucleosides. The positionally modified motif includes internal regions of sugar modified nucleoside and can also include one or both termini. Each particular sugar modification within a region of sugar modified nucleosides is variable with uniform modification desired. The sugar modified regions can have the same sugar modification or can vary such that one region may have a different sugar modification than another region. Positionally modified oligomeric compounds are distinguished from gapped motifs, hemimer motifs, blockmer motifs and alternating motifs because the pattern of regional substitution defined by any positional motif is not defined by these other motifs.

[0165] As used herein, "uniform modified" or "uniformly modified" means an oligomeric compound or a portion thereof that comprise the same modifications. In certain embodiments, the nucleosides of the oligomeric compound or a region thereof will all have identical sugar moieties. In certain embodiments, the internucleoside linkages of the oligomeric compound or a region thereof will be identical. As such the term uniform modification applies to the sugar moieties and or the internucleoside linkages and is independent of the heterocyclic bases present in the oligomeric compound.

[0166] As used herein, "fully modified" or "fully modified motif' means an oligomeric compound or portion thereon wherein each nucleoside comprises a modified sugar moiety other than β-D-ribose or β-D-2'-deoxyribose. The modified sugar moieties of the nucleosides of a fully modified oligomeric compound may all be the same (uniformly modified) or one or more may be different from one another. As such the term fully modified applies to the sugar moieties and is independent of the heterocyclic bases present in the oligomeric compound.

[0167] As used herein, "differently modified" mean chemical modifications or chemical substituents that are different from one another, including absence of modifications. Thus, for example, a MOE nucleoside and an unmodified DNA nucleoside are "differently modified," even though the DNA nucleoside is unmodified. Likewise, DNA and RNA are "differently modified," even though both are naturally-occurring unmodified nucleosides. Nucleosides that are the same but for comprising different nucleobases are not differently modified. For example, a nucleoside comprising a 2'-OMe modified sugar and an unmodified adenine nucleobase and a nucleoside comprising a 2'-OMe modified sugar and an unmodified thymine nucleobase are not differently modified.

[0168] As used herein, "the same type of modifications" refers to modifications that are the same as one another, including absence of modifications. Thus, for example, two unmodified DNA nucleoside have "the same type of modification," even though the DNA nucleoside is unmodified. Such nucleosides having the same type modification may comprise different nucleobases.

[0169] As used herein, "pharmaceutically acceptable carrier or diluent" means any substance suitable for use in administering to an animal. In certain embodiments, a pharmaceutically acceptable carrier or diluent is sterile saline. In certain embodiments, such sterile saline is pharmaceutical grade saline.

[0170] As used herein, "substituent" and "substituent group," means an atom or group that replaces the atom or group of a named parent compound. For example a substituent of a modified nucleoside is any atom or group that differs from the atom or group found in a naturally occurring nucleoside (e.g., a modified 2'-substuent is any atom or group at the 2'-position of a nucleoside other than H or OH). Substituent groups can be protected or unprotected. In certain embodiments, compounds of the present invention have substituents at one or at more than one position of the parent compound. Substituents may also be further substituted with other substituent groups and may be attached directly or via a linking group such as an alkyl or hydrocarbyl group to a parent compound.

[0171] Likewise, as used herein, "substituent" in reference to a chemical functional group means an atom or group of atoms differs from the atom or a group of atoms normally present in the named functional group. In certain embodiments, a substituent replaces a hydrogen atom of the functional group (e.g., in certain embodiments, the substituent of a substituted methyl group is an atom or group other than hydrogen which replaces one of the hydrogen atoms of an unsubstituted methyl group). Unless otherwise indicated, groups amenable for use as substituents include without limitation, halogen, hydroxyl, alkyl, alkenyl, alkynyl, acyl (-C(O)R_aa), carboxyl (-C(O)O-R_aa), aliphatic groups, alicyclic groups, alkoxy, substituted oxy (-O-R_aa), aryl, aralkyl, heterocyclic radical, heteroaryl, heteroarylalkyl, amino (-N(R_bb)(R_cc)), imino(=NR_bb), amido (-C(O)N(R_bb)(R_cc) or -N(R_bb)C(O)R_aa), azido (-N₃), nitro (-NO₂), cyano (-CN), carbamido (-OC(O)N(R_bb)(R_cc) or -N(R_bb)C(O)OR_aa), ureido (-N(R_bb)C(O)N(R_bb)(R_cc)), thioureido (-N(R_bb)C(S)N(R_bb)(R_cc)), guanidinyl (-N(R_bb)C(=NR_bb)N(R_bb)(R_cc)), amidinyl (-C(=NR_bb)N(R_bb)(R_cc) or -N(R_bb)C(=NR_bb)(R_aa)), thiol (-SR_bb), sulfinyl (-S(O)R_bb), sulfonyl (-S(O)₂R_bb) and sulfonamidyl (-S(O)₂N(R_bb)(R_cc) or -N(R_bb)S(O)₂R_bb). Wherein each R_aa, R_bb and R_cc is, independently, H, an optionally linked chemical functional group or a further substituent group with a preferred list including without limitation, alkyl, alkenyl, alkynyl, aliphatic, alkoxy, acyl, aryl, aralkyl, heteroaryl, alicyclic, heterocyclic and heteroarylalkyl. Selected substituents within the compounds described herein are present to a recursive degree.

[0172] As used herein, "alkyl," as used herein, means a saturated straight or branched hydrocarbon radical containing up to twenty four carbon atoms. Examples of alkyl groups include without limitation, methyl, ethyl, propyl, butyl, isopropyl, n-hexyl, octyl, decyl, dodecyl and the like. Alkyl groups typically include from 1 to 24 carbon atoms, more typically from 1 to 12 carbon atoms (C₁-C₁₂ alkyl) with from 1 to 6 carbon atoms being more preferred. Alkyl groups as used herein may optionally include one or more further substituent groups.

[0173] As used herein, "alkenyl," means a straight or branched hydrocarbon chain radical containing up to twenty four carbon atoms and having at least one carbon-carbon double bond. Examples of alkenyl groups include without limitation, ethenyl, propenyl, butenyl, 1-methyl-2-buten-1-yl, dienes such as 1,3-butadiene and the like. Alkenyl groups typically include from 2 to 24 carbon atoms, more typically from 2 to 12 carbon atoms with from 2 to 6 carbon atoms being more preferred. Alkenyl groups as used herein may optionally include one or more further substituent groups.

[0174] As used herein, "alkynyl," means a straight or branched hydrocarbon radical containing up to twenty four carbon atoms and having at least one carbon-carbon triple bond. Examples of alkynyl groups include, without limitation, ethynyl, 1-propynyl, 1-butynyl, and the like. Alkynyl groups typically include from 2 to 24 carbon atoms, more typically from 2 to 12 carbon atoms with from 2 to 6 carbon atoms being more preferred. Alkynyl groups as used herein may optionally include one or more further substituent groups.

[0175] As used herein, "acyl," means a radical formed by removal of a hydroxyl group from an organic acid and has the general Formula -C(O)-X where X is typically aliphatic, alicyclic or aromatic. Examples include aliphatic carbonyls, aromatic carbonyls, aliphatic sulfonyls, aromatic sulfinyls, aliphatic sulfinyls, aromatic phosphates, aliphatic phosphates and the like. Acyl groups as used herein may optionally include further substituent groups.

[0176] As used herein, "alicyclic" means a cyclic ring system wherein the ring is aliphatic. The ring system can comprise one or more rings wherein at least one ring is aliphatic. Preferred alicyclics include rings having from 5 to 9 carbon atoms in the ring. Alicyclic as used herein may optionally include further substituent groups.

[0177] As used herein, "aliphatic" means a straight or branched hydrocarbon radical containing up to twenty four carbon atoms wherein the saturation between any two carbon atoms is a single, double or triple bond. An aliphatic group preferably contains from 1 to 24 carbon atoms, more typically from 1 to 12 carbon atoms with from 1 to 6 carbon atoms being more preferred. The straight or branched chain of an aliphatic group may be interrupted with one or more heteroatoms that include nitrogen, oxygen, sulfur and phosphorus. Such aliphatic groups interrupted by heteroatoms include without limitation, polyalkoxys, such as polyalkylene glycols, polyamines, and polyimines. Aliphatic groups as used herein may optionally include further substituent groups.

[0178] As used herein, "alkoxy" means a radical formed between an alkyl group and an oxygen atom wherein the oxygen atom is used to attach the alkoxy group to a parent molecule. Examples of alkoxy groups include without limitation, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, n-pentoxy, neopentoxy, n-hexoxy and the like. Alkoxy groups as used herein may optionally include further substituent groups.

[0179] As used herein, "aminoalkyl" means an amino substituted C₁-C₁₂ alkyl radical. The alkyl portion of the radical forms a covalent bond with a parent molecule. The amino group can be located at any position and the aminoalkyl group can be substituted with a further substituent group at the alkyl and/or amino portions.

[0180] As used herein, "aralkyl" and "arylalkyl" mean an aromatic group that is covalently linked to a C₁-C₁₂ alkyl radical. The alkyl radical portion of the resulting aralkyl (or arylalkyl) group forms a covalent bond with a parent molecule. Examples include without limitation, benzyl, phenethyl and the like. Aralkyl groups as used herein may optionally include further substituent groups attached to the alkyl, the aryl or both groups that form the radical group.

[0181] As used herein, "aryl" and "aromatic" mean a mono- or polycyclic carbocyclic ring system radicals having one or more aromatic rings. Examples of aryl groups include without limitation, phenyl, naphthyl, tetrahydronaphthyl, indanyl, idenyl and the like. Preferred aryl ring systems have from 5 to 20 carbon atoms in one or more rings. Aryl groups as used herein may optionally include further substituent groups.

[0182] As used herein, "halo" and "halogen," mean an atom selected from fluorine, chlorine, bromine and iodine.

[0183] As used herein, "heteroaryl," and "heteroaromatic," mean a radical comprising a mono- or poly-cyclic aromatic ring, ring system or fused ring system wherein at least one of the rings is aromatic and includes one or more heteroatoms. Heteroaryl is also meant to include fused ring systems including systems where one or more of the fused rings contain no heteroatoms. Heteroaryl groups typically include one ring atom selected from sulfur, nitrogen or oxygen. Examples of heteroaryl groups include without limitation, pyridinyl, pyrazinyl, pyrimidinyl, pyrrolyl, pyrazolyl, imidazolyl, thiazolyl, oxazolyl, isooxazolyl, thiadiazolyl, oxadiazolyl, thiophenyl, furanyl, quinolinyl, isoquinolinyl, benzimidazolyl, benzooxazolyl, quinoxalinyl and the like. Heteroaryl radicals can be attached to a parent molecule directly or through a linking moiety such as an aliphatic group or hetero atom. Heteroaryl groups as used herein may optionally include further substituent groups.

[0184] As used herein the term "mono or polycyclic ring system" is meant to include all ring systems selected from single or polycyclic radical ring systems wherein the rings are fused or linked and is meant to be inclusive of single and mixed ring systems individually selected from aliphatic, alicyclic, aryl, heteroaryl, aralkyl, arylalkyl, heterocyclic, heteroaryl, heteroaromatic and heteroarylalkyl. Such mono and poly cyclic structures can contain rings that each have the same level of saturation or each, independently, have varying degrees of saturation including fully saturated, partially saturated or fully unsaturated. Each ring can comprise ring atoms selected from C, N, O and S to give rise to heterocyclic rings as well as rings comprising only C ring atoms which can be present in a mixed motif such as for example benzimidazole wherein one ring has only carbon ring atoms and the fused ring has two nitrogen atoms. The mono or polycyclic ring system can be further substituted with substituent groups such as for example phthalimide which has two =O groups attached to one of the rings. Mono or polycyclic ring systems can be attached to parent molecules using various strategies such as directly through a ring atom, fused through multiple ring atoms, through a substituent group or through a bifunctional linking moiety.

[0185] The term "phosphate moiety" means a terminal phosphate group that includes phosphates as well as modified phosphates. The phosphate moiety can be located at either terminus but is preferred at the 5'-terminal nucleoside. In one aspect, the terminal phosphate is unmodified having the formula -O-P(=O)(OH)OH. In another aspect, the terminal phosphate is modified such that one or more of the O and OH groups are replaced with H, O, S, N(R) or alkyl where R is H, an amino protecting group or unsubstituted or substituted alkyl. In certain embodiments, the 5' and or 3' terminal group can comprise from 1 to 3 phosphate moieties that are each, independently, unmodified (di or tri-phosphates) or modified.

[0186] As used herein, the term "phosphorus moiety" refers to a group having the formula:

wherein:

R_a and R_c are each, independently, OH, SH, C₁-C₆ alkyl, substituted C₁-C₆ alkyl, C₁-C₆ alkoxy, substituted C₁-C₆ alkoxy, amino or substituted amino; and

R_b is O or S.

[0187] Phosphorus moieties included herein can be attached to a monomer, which can be used in the preparation of oligomeric compounds, wherein the monomer may be attached using O, S, NR_d or CR_eR_f, wherein R_d includes without limitation H, C₁-C₆ alkyl, substituted C₁-C₆ alkyl, C₁-C₆ alkoxy, substituted C₁-C₆ alkoxy, C₂-C₆ alkenyl, substituted C₂-C₆ alkenyl, C₂-C₆ alkynyl, substituted C₂-C₆ alkynyl or substituted acyl, and R_e and R_f each, independently, include without limitation H, halogen, C₁-C₆ alkyl, substituted C₁-C₆ alkyl, C₁-C₆ alkoxy or substituted C₁-C₆ alkoxy. Such linked phosphorus moieties include without limitation, phosphates, modified phosphates, thiophosphates, modified thiophosphates, phosphonates, modified phosphonates, phosphoramidates and modified phosphoramidates.

B. Oligomeric Compounds

[0188] As used herein, the term "oligomeric compound" refers to a contiguous sequence of linked monomer subunits, wherein the oligomeric compound is an antisense oligomeric compound. Each linked monomer subunit normally includes a heterocyclic base moiety but monomer subunits also includes those without a heterocyclic base moiety such as abasic monomer subunits. At least some and generally most if not essentially all of the heterocyclic bases in an oligomeric compound are capable of hybridizing to a nucleic acid molecule, normally a preselected RNA target. The term "oligomeric compound" therefore includes oligonucleotides, oligonucleotide analogs and oligonucleosides. It also includes polymers having one or a plurality of nucleosides having sugar surrogate groups.

[0189] In certain embodiments, oligomeric compounds comprise a plurality of monomer subunits independently selected from naturally occurring nucleosides, non-naturally occurring nucleosides, modified nucleosides and nucleosides having sugar surrogate groups. In certain embodiments, oligomeric compounds are single stranded. In certain embodiments, oligomeric compounds are double stranded comprising a double-stranded duplex. In certain embodiments, oligomeric compounds comprise one or more conjugate groups and/or terminal groups. In certain embodiments, oligomeric compounds comprise a contiguous sequence of monomer subunits wherein each monomer subunit comprises a heterocyclic base moiety and a sugar moiety. In certain embodiments, oligomeric compounds include one or more abasic sites. In certain embodiments, oligomeric compounds include one or more acyclic nucleosides.

[0190] In certain embodiments, the oligomeric compounds as provided herein can be modified by covalent attachment of one or more terminal groups to the 5' or 3'-terminal groups. A terminal group can also be attached at any other position at one of the terminal ends of the oligomeric compound. As used herein the terms "5'-terminal group", "3'-terminal group", "terminal group" and combinations thereof are meant to include useful groups known to the art skilled that can be placed on one or both of the terminal ends, including but not limited to the 5' and 3'-ends of an oligomeric compound respectively, for various purposes such as enabling the tracking of the oligomeric compound (a fluorescent label or other reporter group), improving the pharmacokinetics or pharmacodynamics of the oligomeric compound (such as for example: uptake and/or delivery) or enhancing one or more other desirable properties of the oligomeric compound (a group for improving nuclease stability or binding affinity). In certain embodiments, 5' and 3'-terminal groups include without limitation, modified or unmodified nucleosides; two or more linked nucleosides that are independently, modified or unmodified; conjugate groups; capping groups; phosphate moieties; and protecting groups.

[0191] The present invention provides oligomeric compounds. In certain embodiments, such oligomeric compounds comprise oligonucleotides optionally comprising one or more conjugate and/or terminal groups. In certain embodiments, an oligomeric compound consists of an oligonucleotide. In certain embodiments, oligonucleotides comprise one or more chemical modifications. Such chemical modifications include modifications of one or more nucleoside (including modifications to the sugar moiety and/or the nucleobase) and/or modifications to one or more internucleoside linkage.

i. Certain Modified Nucleosides

[0192] Provided herein are oligomeric compounds comprising modified nucleosides. Such modified nucleosides comprise a modified sugar moeity, a modified nucleobase, or both a modifed sugar moiety and a modified nucleobase.

a. Certain Modified Sugar Moieties

[0193] In certain embodiments, compounds of the invention comprise one or more modifed nucleosides comprising a modifed sugar moiety. Such compounds comprising one or more sugar-modified nucleosides may have desirable properties, such as enhanced nuclease stability or increased binding affinity with a target nucleic acid relative to an oligonucleotide comprising only nucleosides comprising naturally occurring sugar moieties. In certain embodiments, modified sugar moieties are substitued sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surogates may comprise one or more substitutions corresponding to those of substituted sugar moieties.

[0194] In certain embodiments, modified sugar moieties are substituted sugar moieties comprising one or more non-bridging sugar substituents, including but not limited to substituents at the 2' and/or 5' positions. Examples of sugar substituents suitable for the 2'-position, include, but are not limited to: 2'-F, 2'-OCH₃ ("OMe" or "O-methyl"), and 2'-O(CH₂)₂OCH₃ ("MOE"). In certain embodiments, sugar substituents at the 2' position are selected from allyl, amino, azido, thio, O-allyl, O-C₁-C₁₀ alkyl, O-C₁-C₁₀ substituted alkyl; OCF₃, O(CH₂)₂SCH₃, O(CH₂)₂-O-N(Rm)(Rn), and O-CH₂-C(=O)-N(Rm)(Rn), where each Rm and Rn is, independently, H or substituted or unsubstituted C₁-C₁₀ alkyl. Examples of sugar substituents at the 5'-position, include, but are not limited to:, 5'-methyl (R or S); 5'-vinyl, and 5'-methoxy. In certain embodiments, substituted sugars comprise more than one non-bridging sugar substituent, for example, 2'-F-5'-methyl sugar moieties (see,e.g., PCT International Application WO 2008/101157, for additional 5', 2'-bis substituted sugar moieties and nucleosides).

[0195] Nucleosides comprising 2'-substituted sugar moieties are referred to as 2'-substituted nucleosides. In certain embodiments, a 2'- substituted nucleoside comprises a 2'-substituent group selected from halo, allyl, amino, azido, SH, CN, OCN, CF₃, OCF₃, O, S, or N(R_m)-alkyl; O, S, or N(R_m)-alkenyl; O, S or N(R_m)-alkynyl; O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH₂)₂SCH₃, O-(CH₂)₂-O-N(R_m)(R_n) or O-CH₂-C(=O)-N(R_m)(R_n), where each R_m and R_n is, independently, H, an amino protecting group or substituted or unsubstituted C₁-C₁₀ alkyl. These 2'-substituent groups can be further substituted with one or more substituent groups independently selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO₂), thiol, thioalkoxy (S-alkyl), halogen, alkyl, aryl, alkenyl and alkynyl.

[0196] In certain embodiments, a 2'- substituted nucleoside comprises a 2'-substituent group selected from F, NH₂, N₃, OCF₃, O-CH₃, O(CH₂)₃NH₂, CH₂-CH=CH₂, O-CH₂-CH=CH₂, OCH₂CH₂OCH₃, O(CH₂)₂SCH₃, O-(CH₂)₂-O-N(R_m)(R_n), O(CH₂)₂O(CH₂)₂N(CH₃)₂, and N-substituted acetamide (O-CH₂-C(=O)-N(R_m)(R_n) where each R_m and R_n is, independently, H, an amino protecting group or substituted or unsubstituted C₁-C₁₀ alkyl.

[0197] In certain embodiments, a 2'- substituted nucleoside comprises a sugar moiety comprising a 2'-substituent group selected from F, OCF₃, O-CH₃, OCH₂CH₂OCH₃, O(CH₂)₂SCH₃, O-(CH₂)₂-ON(CH₃)₂, -O(CH₂)₂O(CH₂)₂N(CH₃)₂, and O-CH₂-C(=O)-N(H)CH₃.

[0198] In certain embodiments, a 2'- substituted nucleoside comprises a sugar moiety comprising a 2'-substituent group selected from F, O-CH₃, and OCH₂CH₂OCH₃.

[0199] Certain modifed sugar moieties comprise a bridging sugar substituent that forms a second ring resulting in a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety comprises a bridge between the 4' and the 2' furanose ring atoms. Examples of such 4' to 2' sugar substituents, include, but are not limited to: -[C(R_a)(R_b)]_n-, -[C(R_a)(R_b)]_n-O-, -C(R_aR_b)-N(R)-O- or, -C(R_aR_b)-O-N(R)-; 4'-CH₂-2', 4'-(CH₂)₂-2', 4'-(CH₂)₃-2',. 4'-(CH₂)-O-2' (LNA); 4'-(CH₂)-S-2'; 4'-(CH₂)₂-O-2' (ENA); 4'-CH(CH₃)-O-2' (cEt) and 4'-CH(CH₂OCH₃)-O-2',and analogs thereof (see, e.g., U.S. Patent 7,399,845, issued on July 15, 2008); 4'-C(CH₃)(CH₃)-O-2'and analogs thereof, (see, e.g., WO2009/006478, published January 8, 2009); 4'-CH₂-N(OCH₃)-2' and analogs thereof (see, e.g., WO2008/150729, published December 11, 2008); 4'-CH₂-O-N(CH₃)-2' (see, e.g., US2004/0171570, published September 2, 2004); 4'-CH₂-O-N(R)-2', and 4'-CH₂-N(R)-O-2'-, wherein each Ris, independently, H, a protecting group, or C₁-C₁₂ alkyl; 4'-CH₂-N(R)-O-2', wherein R is H, C₁-C₁₂ alkyl, or a protecting group (see, U.S. Patent 7,427,672, issued on September 23, 2008); 4'-CH₂-C(H)(CH₃)-2' (see, e.g., Zhou et al., J. Org. Chem. 2009, 74, 118-134); and 4'-CH₂-C(=CH₂)-2' and analogs thereof (see, published PCT International Application WO 2008/154401, published on December 8, 2008).

[0200] In certain embodiments, such 4' to 2' bridges independently comprise from 1 to 4 linked groups (generally forming a 4 to 6 membered ring with the parent sugar moiety) independently selected from -[C(R_a)(R_b)]_n-, -C(R_a)=C(R_b)-, -C(R_a)=N-, -C(=NR_a)-, -C(=O)-, -C(=S)-, -O-, - Si(R_a)₂-, -S(=O)_x-, and -N(R_a)-;
wherein:

x is 0, 1, or 2;

n is 1, 2, 3, or 4;

each R_a and R_b is, independently, H, a protecting group, hydroxyl, C₁-C₁₂ alkyl, substituted C₁-C₁₂ alkyl, C₂-C₁₂ alkenyl, substituted C₂-C₁₂ alkenyl, C₂-C₁₂ alkynyl, substituted C₂-C₁₂ alkynyl, C₅-C₂₀ aryl, substituted C₅-C₂₀ aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C₅-C₇ alicyclic radical, substituted C₅-C₇ alicyclic radical, halogen, OJ₁, NJ₁J₂, SJ₁, N₃, COOJ₁, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)₂-J₁), or sulfoxyl (S(=O)-J₁); and

each J₁ and J₂ is, independently, H, C₁-C₁₂ alkyl, substituted C₁-C₁₂ alkyl, C₂-C₁₂ alkenyl, substituted C₂-C₁₂ alkenyl, C₂-C₁₂ alkynyl, substituted C₂-C₁₂ alkynyl, C₅-C₂₀ aryl, substituted C₅-C₂₀ aryl, acyl (C(=O)-H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C₁-C₁₂ aminoalkyl, substituted C₁-C₁₂ aminoalkyl, or a protecting group.

[0201] Nucleosides comprising bicyclic sugar moieties are referred to as bicyclic nucleosides or BNAs. Bicyclic nucleosides include, but are not limited to, (A) α-L-Methyleneoxy (4'-CH₂-O-2') BNA, (B) β-D-Methyleneoxy (4'-CH₂-O-2') BNA (also referred to as locked nucleic acid or LNA), (C) Ethyleneoxy (4'-(CH₂)₂-O-2') BNA, (D) Aminooxy (4'-CH₂-O-N(R)-2') BNA, (E) Oxyamino (4'-CH₂-N(R)-O-2') BNA, (F) Methyl(methyleneoxy) (4'-CH(CH₃)-O-2') BNA (also referred to as constrained ethyl or cEt), (G) methylene-thio (4'-CH₂-S-2') BNA, (H) methylene-amino (4'-CH₂-N(R)-2') BNA, (I) methyl carbocyclic (4'-CH₂-CH(CH₃)-2') BNA, (J) propylene carbocyclic (4'-(CH₂)₃-2') BNA, and (K) Ethylene(methoxy) (4'-(CH(CH₂OMe)-O-2') BNA (also referred to as constrained MOE or cMOE) as depicted below.







wherein Bx is a nucleobase moiety and R is, independently, H, a protecting group, or C₁-C₁₂ alkyl.

[0202] Additional bicyclic sugar moieties are known in the art, for example: Singh et al., Chem. Commun. 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A. 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett. 1998, 8, 2219-2222; Singh et al., J. Org. Chem. 1998, 63, 10035-10039; Srivastava et al. J. Am. Chem. Soc. 2007, 129(26) 8362-8379; Elayadi et al., Curr. Opin. Investig. Drugs 2001, 2, 558-561; Braasch et al., Chem. Biol. 2001, 8, 1-7; Orum et al., Curr. Opin. Mol. Ther. 2001, 3, 239-243; U.S. Patent Nos. 7,053,207, 6,268,490, 6,770,748, 6,794,499, 7,034,133, 6,525,191, 6,670,461, and 7,399,845; WO 2004/106356, WO 1994/14226, WO 2005/021570, and WO 2007/134181; U.S. Patent Publication Nos. US 2004/0171570, US 2007/0287831, and US 2008/0039618; U.S. Patent Serial Nos. 12/129,154, 60/989,574, 61/026,995, 61/026,998, 61/056,564, 61/086,231, 61/097,787, and 61/099,844; and PCT International Applications Nos. PCT/US2008/064591, PCT/US2008/066154, and PCT/US2008/068922.

[0203] In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, a nucleoside comprising a 4'-2' methylene-oxy bridge, may be in the α-L configuration or in the β-D configuration. Previously, α-L-methyleneoxy (4'-CH₂-O-2') bicyclic nucleosides have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Res. 2003, 21, 6365-6372).

[0204] In certain embodiments, substituted sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5'-substituted and 4'-2' bridged sugars). (see, PCT International Application WO 2007/134181, published on 11/22/07, wherein LNA is substituted with, for example, a 5'-methyl or a 5'-vinyl group).

[0205] In certain embodiments, modified sugar moieties are sugar surrogates. In certain such embodiments, the oxygen atom of the naturally occuring sugar is substituted, e.g., with a sulfer, carbon or nitrogen atom. In certain such embodiments, such modified sugar moiety also comprises bridging and/or non-bridging substituents as described above. For example, certain sugar surogates comprise a 4'-sulfer atom and a substitution at the 2'-position (see, e.g., published U.S. Patent Application US 2005/0130923, published on June 16, 2005) and/or the 5' position. By way of additional example, carbocyclic bicyclic nucleosides having a 4'-2' bridge have been described (see, e.g., Freier et al., Nucleic Acids Res. 1997, 25(22), 4429-4443 and Albaek et al., J. Org. Chem. 2006, 71, 7731-7740).

[0206] In certain embodiments, sugar surrogates comprise rings having other than 5-atoms. For example, in certain embodiments, a sugar surrogate comprises a six-membered tetrahydropyran. Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid (HNA), anitol nucleic acid (ANA), manitol nucleic acid (MNA) (see Leumann, Bioorg. Med. Chem. 2002, 10, 841-854), fluoro HNA (F-HNA, see e.g., US Patents 8,088,904; 8,440,803; and 8,796,437, F-HNA can also be referred to as a F-THP or 3'-fluoro tetrahydropyran), and including further compounds also having Formula VII:

wherein independently for each of said at least one tetrahydropyran nucleoside analog of Formula VII:

Bx is a nucleobase moiety;

T₃ and T₄ are each, independently, an internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound or one of T₃ and T₄ is an internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound and the other of T₃ and T₄ is H, a hydroxyl protecting group, a linked conjugate group, or a 5' or 3'-terminal group;

q₁, q₂, q₃, q₄, q₅, q₆ and q₇ are each, independently, H, C₁-C₆ alkyl, substituted C₁-C₆ alkyl, C₂-C₆ alkenyl, substituted C₂-C₆ alkenyl, C₂-C₆ alkynyl, or substituted C₂-C₆ alkynyl; and

each of R₁ and R₂ is independently selected from among: hydrogen, halogen, substituted or unsubstituted alkoxy, NJ₁J₂, SJ₁, N₃, OC(=X)J₁, OC(=X)NJ₁J₂, NJ₃C(=X)NJ₁J₂, and CN, wherein X is O, S or NJ₁, and each J₁, J₂, and J₃ is, independently, H or C₁-C₆ alkyl.

[0207] In certain embodiments, the modified THP nucleosides of Formula VII are provided wherein q₁, q₂, q₃, q₄, q₅, q₆ and q₇ are each H. In certain embodiments, at least one of q₁, q₂, q₃, q₄, q₅, q₆ and q₇ is other than H. In certain embodiments, at least one of q₁, q₂, q₃, q₄, q₅, q₆ and q₇ is methyl. In certain embodiments, THP nucleosides of Formula VII are provided wherein one of R₁ and R₂ is F. In certain embodiments, R₁ is fluoro and R₂ is H, R₁ is methoxy and R₂ is H, and R₁ is methoxyethoxy and R₂ is H. In certain embodiments, the modified THP nucleoside is F-THP.

[0208] Many other bicyclo and tricyclo sugar surrogate ring systems are also known in the art that can be used to modify nucleosides for incorporation into antisense compounds (see, e.g., review article: Leumann, Bioorg. Med. Chem. 2002, 10, 841-854).

[0209] Combinations of modifications are also provided without limitation, such as 2'-F-5'-methyl substituted nucleosides (see PCT International Application WO 2008/101157 Published on 8/21/08 for other disclosed 5', 2'-bis substituted nucleosides) and replacement of the ribosyl ring oxygen atom with S and further substitution at the 2'-position (see published U.S. Patent Application US 2005/0130923, published on June 16, 2005) or alternatively 5'-substitution of a bicyclic nucleic acid (see PCT International Application WO 2007/134181, published on 11/22/07 wherein a 4'-CH₂-O-2' bicyclic nucleoside is further substituted at the 5' position with a 5'-methyl or a 5'-vinyl group). The synthesis and preparation of carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described (see, e.g., Srivastava et al., J. Am. Chem. Soc. 2007, 129(26), 8362-8379).

[0210] In certain embodiments, the present invention provides oligonucleotides comprising modified nucleosides. Those modified nucleotides may include modified sugars, modified nucleobases, and/or modified linkages. The specific modifications are selected such that the resulting oligonucleotides possess desirable characteristics. In certain embodiments, oligonucleotides comprise one or more RNA-like nucleosides. In certain embodiments, oligonucleotides comprise one or more DNA-like nucleosides.

[0211] In certain embodiments, the oligomeric compounds provided herein include RNA-like nucleosides that have been modified to influence the sugar conformation to have predominantly 3'-endo conformational geometry. In certain embodiments, such modified nucleosides include synthetic modifications of the heterocyclic base moiety, the sugar moiety or both to induce a 3'-endo sugar conformation. In certain embodiments, RNA-like nucleosides are selected from RNA surrogates such as including, but not limited to, F-HNA or cyclohexenyl nucleic acid. RNA-like nucleosides are used to replace and mimic RNA nucleosides in an oligomeric compound so that particular properties of the oligomeric compound can be enhanced. Typically RNA-like nucleosides are used in the 5' and 3'-regions (wings) of gapped oligomeric compounds to improve stability in the presence of nucleases and also to increase the affinity for nucleic a nucleic acid target. Other properties that can also be enhanced by using RNA-like nucleosides include but aren't limited to modulation of pharmacokinetic properties through modification of protein binding, protein off-rate, absorption and clearance as well as chemical stability and specificity of the oligomeric compound (affinity and specificity for enzymes as well as for complementary sequences); and increasing efficacy of RNA cleavage.

[0212] In certain embodiments, RNA-like nucleosides include modified nucleosides comprising one or more 2', 3', 4' and 5' substituent groups, bicyclic nucleosides and RNA-surrogates. In certain embodiments, RNA-like nucleosides include, but are not limited to modified nucleosides comprising 2'-ribo-substituent groups selected from: F, OCH₃, O-C₂-C₄ alkyl, O-CH₂CH=CH₂, O-(CH₂)₂-O-CH₃ (MOE), O-(CH₂)₃-NH₂, O-(CH₂)₂-O-N(R₁)₂, O-CH₂C(O)-N(R₁)₂, O-(CH₂)₂-O-(CH₂)₂-N(R₁)₂, O-(CH₂)₃-NHR₁ and O-CH₂-N(H)-C(=NR₁)[N(R₁)₂] wherein each R₁ is, typically H, C₁-C₁₂ alkyl or a protecting group. RNA-like nucleosides also include but are not limited to modified nucleosides having a bicyclic furanosyl sugar moiety (bicyclic nucleosides) comprising a bridging group between the 4' and 2'-carbon atoms. Such bicyclic nucleosides include, but are not limited to bridging groups consisting of from 1 to 3 linked biradical groups selected from O, S, NR_a, C(R_b)(R_c), C=O, C(R_b)=C(R_c) and C[=C(R_b)(R_c)] wherein C(R_b)=C(R_c) counts as 2 of said biradical groups wherein each R_a, R_b and R_c is, independently, H, C₁-C₆ alkyl, C₁-C₆ alkoxy, C₂-C₆ alkenyl or C₂-C₆ alkynyl. In certain embodiments, the bridging groups include, but are not limited to 4'-(CH₂)-O-2', 4'-(CH₂)-S-2', 4'-(CH₂)₂-O-2', 4'-CH(CH₃)-O-2', 4'-CH(CH₂OCH₃)-O-2', 4'-C(CH₃)₂-O-2', 4'-CH₂-N(OCH₃)-2', 4'-CH₂-O-N(CH₃)-2', 4'-CH₂-NCH₃-O-2', 4'-CH₂-C(H)(CH₃)-2' and 4'-CH₂-C(=CH₂)-2'. In certain embodiments, the bridging groups include, but are not limited to 4'-CH₂-O-2', 4'-(CH₂)₂-O-2', 4'-C(H)[(R)-CH₃]-O-2' and 4'-C(H)[(S)-CH₃]-O-2'.

[0213] In certain embodiments, the oligomeric compounds provided herein include DNA-like nucleosides that have been modified to influence the sugar conformation to have predominantly 2'-endo conformational geometry. Such modified nucleosides can include synthetic modifications of the heterocyclic base moiety, the sugar moiety or both to induce the desired 2'-endo sugar conformation. These modified nucleosides are used to mimic RNA nucleosides so that particular properties of an oligomeric compound can be enhanced while maintaining the desirable 2'-endo conformational geometry.

[0214] In certain embodiments, DNA-like nucleosides include, but are not limited to 2'-substituted furanosyl nucleosides comprising: 2'=CH₂, 2'-ara-CN, 2'-ara-F, 2'-ara-Br or 2'-ara-Cl, 2'-ara-N₃, 2'-ara-OH, 2'-ara-O-CH₃ or 2'-dehydro-2'-ara-CH₃.

[0215] The C3'-endo and C2'-endo conformational geometries are shown below:

ii. Certain Modified Nucleobases

[0216] In certain embodiments, nucleosides of the present invention comprise one or more unmodified nucleobases. In certain embodiments, nucleosides of the present invention comprise one or more modifed nucleobases (heterocyclic base moieties).

[0217] In one embodiment, a heterocyclic base moiety is any heterocyclic system that contains one or more atoms or groups of atoms capable of hydrogen bonding to a heterocyclic base of a nucleic acid. In certain embodiments, nucleobase refers to purines, modified purines, pyrimidines and modified pyrimidines. In certain embodiments, nucleobase refers to unmodified or naturally occurring nucleobases which include, but are not limited to, the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U) and analogs thereof such as 5-methyl cytosine. The terms nucleobase and heterocyclic base moiety also include optional protection for any reactive functional groups such as 4-N-benzoylcytosine, 4-N-benzoyl-5-methylcytosine, 6-N-benzoyladenine or 2-N-isobutyrylguanine.

[0218] In certain embodiments, heterocyclic base moieties include without limitation modified nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (-C≡C-CH₃) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine, 3-deazaguanine and 3-deazaadenine, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases as defined herein.

[0219] In certain embodiments, heterocyclic base moieties include without limitation tricyclic pyrimidines such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). Heterocyclic base moieties also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further heterocyclic base moieties include without limitation those known to the art skilled (see for example: United States Patent No. 3,687,808; Swayze et al., The Medicinal Chemistry of Oligonucleotides in Antisense a Drug Technology, Chapter 6, pages 143-182, Crooke, S.T., ed., 2008); The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J.I., Ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y.S., Chapter 15, Antisense Research and Applications, Crooke, S.T. and Lebleu, B., Eds., CRC Press, 1993, 273-302).

[0220] Modified polycyclic heterocyclic compounds useful as heterocyclic base moieties are disclosed in the above noted U.S. 3,687,808, as well as U.S.: 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,434,257; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,645,985; 5,646,269; 5,681,941; 5,750,692; 5,763,588; 5,830,653; 6,005,096; and U.S. Patent Application Publication 20030158403.

ii. Certain Internucleoside Linkages

[0221] In certain embodiments, nucleosides may be linked together using any internucleoside linkage to form oligonucleotides. The two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters (P=O), phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates (P=S). Representative non-phosphorus containing internucleoside linking groups include, but are not limited to, methylenemethylimino (-CH₂-N(CH₃)-O-CH₂-), thiodiester (-O-C(O)-S-), thionocarbamate (-O-C(O)(NH)-S-); siloxane (-O-Si(H)₂-O-); and N,N'-dimethylhydrazine (-CH₂-N(CH₃)-N(CH₃)-). Modified linkages, compared to natural phosphodiester linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide. In certain embodiments, internucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Representative chiral linkages include, but are not limited to, alkylphosphonates and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing internucleoside linkages are well known to those skilled in the art.

[0222] The oligonucleotides described herein contain one or more asymmetric centers and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), α or β such as for sugar anomers, or as (D) or (L) such as for amino acids etc. Included in the antisense compounds provided herein are all such possible isomers, as well as their racemic and optically pure forms.

[0223] Neutral internucleoside linkages include without limitation, phosphotriesters, methylphosphonates, MMI (3'-CH₂-N(CH₃)-O-5'), amide-3 (3'-CH₂-C(=O)-N(H)-5'), amide-4 (3'-CH₂-N(H)-C(=O)-5'), formacetal (3'-O-CH₂-O-5'), and thioformacetal (3'-S-CH₂-O-5'). Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH₂ component parts.

iii. Certain Motifs

[0224] In certain embodiments, oligomeric compounds comprise or consist of oligonucleotides. In certain embodiments, such oligonucleotides comprise one or more chemical modifications. In certain embodiments, chemically modified oligonucleotides comprise one or more modified sugars. In certain embodiments, chemically modified oligonucleotides comprise one or more modified nucleobases. In certain embodiments, chemically modified oligonucleotides comprise one or more modified internucleoside linkages. In certain embodiments, the chemical modifications (sugar modifications, nucleobase modifications, and/or linkage modifications) define a pattern or motif. In certain embodiments, the patterns of chemical modifications of sugar moieties, internucleoside linkages, and nucleobases are each independent of one another. Thus, an oligonucleotide may be described by its sugar modification motif, internucleoside linkage motif and/or nucleobase modification motif (as used herein, nucleobase modification motif describes the chemical modifications to the nucleobases independent of the sequence of nucleobases).

a. Certain sugar motifs

[0225] In certain embodiments, oligonucleotides comprise one or more type of modified sugar moieties and/or naturally occurring sugar moieties arranged along an oligonucleotide or region thereof in a defined pattern or sugar motif. Such sugar motifs include but are not limited to any of the sugar modifications discussed herein.

[0226] In certain embodiments, the oligomeric compounds provided herein comprise a gapmer sugar motif, which comprises two external regions or "wings" and a central or internal region or "gap" (also referred to as 5'-region and 3'-region). The three regions of a gapmer sugar motif (the 5'-wing, the gap, and the 3'-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap. Specifically, at least the sugar moieties of the nucleosides of each wing that are closest to the gap (the 3'-most nucleoside of the 5'-wing and the 5'-most nucleoside of the 3'-wing) differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap. In certain embodiments, the sugar moieties within the gap are the same as one another. In certain embodiments, the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap. In certain embodiments, the sugar moieties of the two wings are the same as one another (symmetric sugar gapmer). In certain embodiments, the sugar moieties of the 5'-wing differs from the sugar moieties of the 3'-wing (asymmetric sugar gapmer). In certain embodiments, the sugar moieties in the two wings are selected from at least two different types that are different from the sugar moieties in the gap and at least one of each are in each wing.

[0227] In certain embodiments, the term "gapped oligomeric compound" refers to an oligomeric compound having two external regions or wings and an internal region or gap (also referred to as 5'-region and 3'-region). The three regions form a contiguous sequence of monomer subunits with the sugar moieties of the external regions (wings) being different than the sugar moieties of the internal region (gap). In certain embodiments, the sugar moieties of each monomer subunit within a particular region is essentially the same. In certain embodiments, the sugar moieties of each monomer subunit within each wing region is selected independently from 2 different types of modified nucleosides. In certain embodiments, the sugar moieties of each monomer subunit within each wing region is selected independently from 3 different types of modified nucleosides. In certain embodiments, the sugar moieties of each monomer subunit within each wing region is selected independently from 4 different types of modified nucleosides. In certain embodiments, the sugar moiety of essentially each monomer subunit within the internal region is essentially the same. In certain embodiments, the sugar moiety of each monomer subunit within the internal region is a β-D-2'-deoxyribonucleoside, a nucleoside that is DNA-like and/or a nucleoside that supports RNaseH when in the gap region.

[0228] In certain embodiments, each monomer subunit within a particular region has the same sugar moiety. When the sugar moieties of the external regions are the same the gapmer is a symmetric gapmer and when the sugar moiety used in the 5'-external region is different from the sugar moiety used in the 3'-external region, the gapmer is an asymmetric gapmer. In certain embodiments, the external regions are small (each independently 2, 3, 4, 5 or about 6 monomer subunits) and the monomer subunits comprise non-naturally occurring sugar moieties with the internal region comprising β-D-2'-deoxyribonucleosides. In certain embodiments, the external regions each, independently, comprise from 2 to 8 monomer subunits having non-naturally occurring sugar moieties and the internal region comprises from 6 to 14 unmodified nucleosides. The internal region or the gap generally comprises β-D-2'-deoxyribonucleosides but can comprise non-naturally occurring sugar moieties. The heterocyclic base and internucleoside linkage is independently variable at each position of a gapped oligomeric compound. A gapped oligomeric compound can further include one or more additional groups including but not limited to capping groups, conjugate groups and other 5' or 3'-terminal groups.

[0229] In certain embodiments, gapped oligomeric compounds comprise an internal region of β-D-2'-deoxyribonucleosides with a single internucleoside linkage having Formula I. In certain embodiments, gapped oligomeric compounds comprise an internal region of β-D-2'-deoxyribonucleosides having two internucleoside linkages having Formula I. In certain embodiments, gapped oligomeric compounds comprise an internal region of β-D-2'-deoxyribonucleosides having three internucleoside linkages having Formula I.

[0230] In certain embodiments, the 5' and 3'-wing regions of gapped oligomeric compounds comprise modified nucleosides wherein all the sugar moieties have the same type of modification such as cEt or MOE. In certain embodiments, the 5' and 3'-wing regions of gapped oligomeric compounds comprise two types of modified nucleosides having sugar moieties independently selected from 2'-substituted sugar moieties and furanosyl bicyclic sugar moieties. In certain embodiments, the 5' and 3'-wing regions of gapped oligomeric compounds comprise two types of modified nucleosides having sugar moieties independently selected from 2'-MOE substituted sugar moieties and furanosyl bicyclic sugar moieties each having a 4'-CH((S)-CH₃)-O-2' bridge.

[0231] In certain embodiments, gapped oligomeric compounds are provided that are from 12 to 20 monomer subunits in length. In certain embodiments, gapped oligomeric compounds are provided that are from 14 to 20 monomer subunits in length. In certain embodiments, gapped oligomeric compounds are provided that are from 14 to 18 monomer subunits in length.

b. Certain Nucleobase Modification Motifs

[0232] In certain embodiments, oligonucleotides comprise chemical modifications to nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or nucleobases modification motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases is chemically modified.

[0233] In certain embodiments, oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3'-end of the oligonucleotide. In certain embodiments the block is within 3 nucleotides of the 3'-end of the oligonucleotide. In certain such embodiments, the block is at the 5 '-end of the oligonucleotide. In certain embodiments the block is within 3 nucleotides of the 5'-end of the oligonucleotide.

[0234] In certain embodiments, nucleobase modifications are a function of the natural base at a particular position of an oligonucleotide. For example, in certain embodiments each purine or each pyrimidine in an oligonucleotide is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each cytosine is modified. In certain embodiments, each uracil is modified.

[0235] In certain embodiments, oligonucleotides comprise one or more nucleosides comprising a modified nucleobase. In certain embodiments, oligonucleotides having a gapmer sugar motif comprise a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobases is in the gap of an oligonucleotide having a gapmer sugar motif. In certain embodiments, the sugar is an unmodified 2'deoxynucleoside. In certain embodiments, the modified nucleobase is selected from: a 2-thio pyrimidine and a 5-propyne pyrimidine

[0236] In certain embodiments, some, all, or none of the cytosine moieties in an oligonucleotide are 5-methyl cytosine moieties. Herein, 5-methyl cytosine is not a "modified nucleobase." Accordingly, unless otherwise indicated, unmodified nucleobases include both cytosine residues having a 5-methyl and those lacking a 5 methyl. In certain embodiments, the methylation state of all or some cytosine nucleobases is specified.

c. Certain Nucleoside Motifs

[0237] In certain embodiments, oligomeric compounds comprise nucleosides comprising modified sugar moieties and/or nucleosides comprising modified nucleobases. Such motifs can be described by their sugar motif and their nucleobase motif separately or by their nucleoside motif, which provides positions or patterns of modified nucleosides (whether modified sugar, nucleobase, or both sugar and nucleobase) in an oligonucleotide.

[0238] In certain embodiments, oligomeric compounds are provided herein wherein most if not all of the nucleosides are selected from those having particular nucleobases. In certain embodiments, nucleosides are provided wherein each nucleobase is, independently, selected from adenine, guanine, thymine, cytosine, 5-methyl cytosine and uracil. In certain embodiments, nucleosides are provided wherein each nucleobase is, independently, selected from 6-N-benzoyladenine, 2-N-isobutyrylguanine, thymine, 4-N-benzoylcytosine, 5-methyl 4-N-benzoylcytosine and uracil.

[0239] In certain embodiments, oligomeric compounds are provided herein wherein most if not all of the nucleosides are selected from those having particular sugar moieties. In certain embodiments, nucleosides are provided wherein each sugar moiety is, independently, selected from β-D-2'-deoxyribose, a ribofuranosyl sugar moiety having a 2' substituent group selected from F, OCH₃, MOE and NMA, a bicyclic sugar selected from LNA, cEt, R-cEt or S-cEt, and a sugar moiety comprising a F-substituted hexitol as in a F-HNA. In certain embodiments, nucleosides are provided wherein each sugar moiety is, independently, selected from β-D-2'-deoxyribose, a ribofuranosyl sugar moiety having a 2' substituent group selected from MOE and NMA, a bicyclic sugar selected from LNA or S-cEt, and a sugar moiety comprising a F-substituted hexitol as in a F-HNA. In certain embodiments, nucleosides are provided wherein each sugar moiety is, independently, selected from β-D-2'-deoxyribose, a 2'-MOE substituted ribofuranosyl sugar moiety, and a bicyclic sugar selected from S-cEt.

[0240] In certain embodiments, oligomeric compounds are provided herein wherein most if not all of the nucleosides are selected from those having particular sugar moieties. In certain embodiments, nucleosides are provided wherein each sugar moiety is, independently, selected from β-D-ribose, a ribofuranosyl sugar moiety having a 2' substituent group selected from F, OCH₃ and MOE, a 4'-thio ribofuranosyl sugar moiety and a 4'-thio-2'-modified nucleoside wherein the 2'-substituent is selected from F, OCH₃ and MOE. In certain embodiments, nucleosides are provided wherein each sugar moiety is, independently, selected from β-D-ribose and a ribofuranosyl sugar moiety having a 2' substituent group selected from F, OCH₃ and MOE.

[0241] In certain embodiments, oligomeric compounds provided herein include a 5'-stabilized nucleoside. In certain embodiments, the oligomeric compound is a single stranded RNAi compound. In certain embodiments, the 5'-stabilized nucleoside has the formula:

wherein:

T₁ is an optionally protected phosphorus moiety;

A has one of the formulas:

Q₁ and Q₂ are each, independently, H, halogen, C₁-C₆ alkyl, substituted C₁-C₆ alkyl, C₂-C₆ alkenyl, substituted C₂-C₆ alkenyl, C₂-C₆ alkynyl, substituted C₂-C₆ alkynyl, C₁-C₆ alkoxy, substituted C₁-C₆ alkoxy or N(R₃)(R₄);

Q₃ is O, S, N(R₅) or C(R₆)(R₇);

each R₃, R₄ R₅, R₆ and R₇ is, independently, H, C₁-C₆ alkyl, substituted C₁-C₆ alkyl or C₁-C₆ alkoxy;

Bx is a heterocyclic base moiety;

T₃ is a 2'-substituent group; and

T₂ is an internucleoside linkage connecting the 5'-stabilized nucleoside to the remainder of an oligomeric compound.

[0242] In certain embodiments, the 5'-stabilized nucleoside has the configuration of the formula:

[0243] In certain embodiments, the 5'-stabilized nucleoside has the formula:

[0244] In certain embodiments, the 5'-stabilized nucleoside has the formula:

or a protected analog thereof.

[0245] In certain embodiments, the oligomeric compounds comprise or consist of a region having a gapmer nucleoside motif, which comprises two external regions or "wings" and a central or internal region or "gap." The three regions of a gapmer nucleoside motif (the 5'-wing, the gap, and the 3'-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties and/or nucleobases of the nucleosides of each of the wings differ from at least some of the sugar moieties and/or nucleobase of the nucleosides of the gap. Specifically, at least the nucleosides of each wing that are closest to the gap (the 3'-most nucleoside of the 5'-wing and the 5'-most nucleoside of the 3'-wing) differ from the neighboring gap nucleosides, thus defining the boundary between the wings and the gap. In certain embodiments, the nucleosides within the gap are the same as one another. In certain embodiments, the gap includes one or more nucleoside that differs from one or more other nucleosides of the gap. In certain embodiments, the nucleoside motifs of the two wings are the same as one another (symmetric gapmer). In certain embodiments, the nucleoside motifs of the 5'-wing differs from the nucleoside motif of the 3'-wing (asymmetric gapmer).

d. Certain 5'-wings

[0246] In certain embodiments, the 5'- wing of a gapmer consists of 2 to 8 linked nucleosides. In certain embodiments, the 5'- wing of a gapmer consists of 2 to 5 linked nucleosides. In certain embodiments, the 5'-wing of a gapmer consists of 3 to 5 linked nucleosides. In certain embodiments, the 5'- wing of a gapmer consists of 4 or 5 linked nucleosides. In certain embodiments, the 5'- wing of a gapmer consists of 1 to 4 linked nucleosides. In certain embodiments, the 5'- wing of a gapmer consists of 1 to 3 linked nucleosides. In certain embodiments, the 5'- wing of a gapmer consists of 1 or 2 linked nucleosides. In certain embodiments, the 5'-wing of a gapmer consists of 2 to 4 linked nucleosides. In certain embodiments, the 5'-wing of a gapmer consists of 2 or 3 linked nucleosides. In certain embodiments, the 5'-wing of a gapmer consists of 3 or 4 linked nucleosides. In certain embodiments, the 5'- wing of a gapmer consists of 1 nucleoside. In certain embodiments, the 5'-wing of a gapmer consists of 2 linked nucleosides. In certain embodiments, the 5'-wing of a gapmer consists of 3 linked nucleosides. In certain embodiments, the 5'-wing of a gapmer consists of 4 linked nucleosides. In certain embodiments, the 5'- wing of a gapmer consists of 5 linked nucleosides. In certain embodiments, the 5'- wing of a gapmer consists of 6 linked nucleosides. In certain embodiments, the 5'- wing of a gapmer consists of 7 linked nucleosides. In certain embodiments, the 5'-wing of a gapmer consists of 8 linked nucleosides.

[0247] In certain embodiments, the 5'- wing of a gapmer comprises at least one bicyclic nucleoside. In certain embodiments, the 5'- wing of a gapmer comprises at least two bicyclic nucleosides. In certain embodiments, the 5'- wing of a gapmer comprises at least three bicyclic nucleosides. In certain embodiments, the 5'- wing of a gapmer comprises at least four bicyclic nucleosides. In certain embodiments, the 5'- wing of a gapmer comprises at least one constrained ethyl nucleoside. In certain embodiments, the 5'- wing of a gapmer comprises at least one LNA nucleoside. In certain embodiments, each nucleoside of the 5'- wing of a gapmer is a bicyclic nucleoside. In certain embodiments, each nucleoside of the 5'- wing of a gapmer is a constrained ethyl nucleoside. In certain embodiments, each nucleoside of the 5'-wing of a gapmer is a LNA nucleoside.

[0248] In certain embodiments, the 5'- wing of a gapmer comprises at least one non-bicyclic modified nucleoside. In certain embodiments, the 5'- wing of a gapmer comprises at least one 2'-substituted nucleoside. In certain embodiments, the 5'-wing of a gapmer comprises at least one 2'-MOE nucleoside. In certain embodiments, the 5'- wing of a gapmer comprises at least one 2'-OMe nucleoside. In certain embodiments, each nucleoside of the 5'- wing of a gapmer is a non-bicyclic modified nucleoside. In certain embodiments, each nucleoside of the 5'-wing of a gapmer is a 2'-substituted nucleoside. In certain embodiments, each nucleoside of the 5'- wing of a gapmer is a 2'-MOE nucleoside. In certain embodiments, each nucleoside of the 5'- wing of a gapmer is a 2'-OMe nucleoside.

[0249] In certain embodiments, the 5'-wing of a gapmer comprises at least one bicyclic nucleoside and at least one non-bicyclic modified nucleoside. In certain embodiments, the 5'-wing of a gapmer comprises at least one bicyclic nucleoside and at least one 2'-substituted nucleoside. In certain embodiments, the 5'-wing of a gapmer comprises at least one bicyclic nucleoside and at least one 2'-MOE nucleoside. In certain embodiments, the 5'-wing of a gapmer comprises at least one bicyclic nucleoside and at least one 2'-OMe nucleoside.

[0250] In certain embodiments, the 5'-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one non-bicyclic modified nucleoside. In certain embodiments, the 5'-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one 2'-substituted nucleoside. In certain embodiments, the 5'-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one 2'-MOE nucleoside. In certain embodiments, the 5'-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one 2'-OMe nucleoside.

[0251] In certain embodiments, the 5'- wing of a gapmer has a nucleoside motif selected from among the following: ABBA; ABB; ABAA; AABAA; AAABAA; AAAABAA; AAAAABAA; AAABAA; AABAA; ABAB; AAABB; AAAAA; ABBC; AA; AAA; AAAA; AAAAB; AAAAAAA; AAAAAAAA; ABBB; AB; ABAB; AAAAB; AABBB; AAAAB; and AABBB, wherein each A is a modified nucleoside of a first type, each B is a modified nucleoside of a second type and each C is a modified nucleoside of a third type. In certain embodiments, such an oligomeric compound is a gapmer. In certain such embodiments, the 3'-wing of the gapmer may comprise any nucleoside motif.

1. Certain 3'-wings

[0252] In certain embodiments, the 3'- wing of a gapmer consists of 2 to 8 linked nucleosides. In certain embodiments, the 3'- wing of a gapmer consists of 2 to 5 linked nucleosides. In certain embodiments, the 3'-wing of a gapmer consists of 3 to 5 linked nucleosides. In certain embodiments, the 3'- wing of a gapmer consists of 4 or 5 linked nucleosides. In certain embodiments, the 3'- wing of a gapmer consists of 1 to 4 linked nucleosides. In certain embodiments, the 3'-wing of a gapmer consists of 1 to 3 linked nucleosides. In certain embodiments, the 3'- wing of a gapmer consists of 1 or 2 linked nucleosides. In certain embodiments, the 3'- wing of a gapmer consists of 2 to 4 linked nucleosides. In certain embodiments, the 3'-wing of a gapmer consists of 2 or 3 linked nucleosides. In certain embodiments, the 3'- wing of a gapmer consists of 3 or 4 linked nucleosides. In certain embodiments, the 3'- wing of a gapmer consists of 1 nucleoside. In certain embodiments, the 3'-wing of a gapmer consists of 2 linked nucleosides. In certain embodiments, the 3'-wing of a gapmer consists of 3 linked nucleosides. In certain embodiments, the 3'-wing of a gapmer consists of 4 linked nucleosides. In certain embodiments, the 3'- wing of a gapmer consists of 5 linked nucleosides. In certain embodiments, the 3'- wing of a gapmer consists of 6 linked nucleosides. In certain embodiments, the 3'- wing of a gapmer consists of 7 linked nucleosides. In certain embodiments, the 3'- wing of a gapmer consists of 8 linked nucleosides.

[0253] In certain embodiments, the 3'- wing of a gapmer comprises at least one bicyclic nucleoside. In certain embodiments, the 3'- wing of a gapmer comprises at least one constrained ethyl nucleoside. In certain embodiments, the 3'-wing of a gapmer comprises at least one LNA nucleoside. In certain embodiments, each nucleoside of the 3'-wing of a gapmer is a bicyclic nucleoside. In certain embodiments, each nucleoside of the 3'-wing of a gapmer is a constrained ethyl nucleoside. In certain embodiments, each nucleoside of the 3'- wing of a gapmer is a LNA nucleoside.

[0254] In certain embodiments, the 3'- wing of a gapmer comprises at least one non-bicyclic modified nucleoside. In certain embodiments, the 3'- wing of a gapmer comprises at least two non-bicyclic modified nucleosides. In certain embodiments, the 3'-wing of a gapmer comprises at least three non-bicyclic modified nucleosides. In certain embodiments, the 3'- wing of a gapmer comprises at least four non-bicyclic modified nucleosides. In certain embodiments, the 3'- wing of a gapmer comprises at least one 2'-substituted nucleoside. In certain embodiments, the 3'- wing of a gapmer comprises at least one 2'-MOE nucleoside. In certain embodiments, the 3'- wing of a gapmer comprises at least one 2'-OMe nucleoside. In certain embodiments, each nucleoside of the 3'- wing of a gapmer is a non-bicyclic modified nucleoside. In certain embodiments, each nucleoside of the 3'- wing of a gapmer is a 2'-substituted nucleoside. In certain embodiments, each nucleoside of the 3'- wing of a gapmer is a 2'-MOE nucleoside. In certain embodiments, each nucleoside of the 3'-wing of a gapmer is a 2'-OMe nucleoside.

[0255] In certain embodiments, the 3'-wing of a gapmer comprises at least one bicyclic nucleoside and at least one non-bicyclic modified nucleoside. In certain embodiments, the 3'-wing of a gapmer comprises at least one bicyclic nucleoside and at least one 2'-substituted nucleoside. In certain embodiments, the 3'-wing of a gapmer comprises at least one bicyclic nucleoside and at least one 2'-MOE nucleoside. In certain embodiments, the 3'-wing of a gapmer comprises at least one bicyclic nucleoside and at least one 2'-OMe nucleoside.

[0256] In certain embodiments, the 3'-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one non-bicyclic modified nucleoside. In certain embodiments, the 3'-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one 2'-substituted nucleoside. In certain embodiments, the 3'-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one 2'-MOE nucleoside. In certain embodiments, the 3'-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one 2'-OMe nucleoside.

[0257] In certain embodiments, the 3'-wing of a gapmer comprises at least one LNA nucleoside and at least one non-bicyclic modified nucleoside. In certain embodiments, the 3'-wing of a gapmer comprises at least one LNA nucleoside and at least one 2'-substituted nucleoside. In certain embodiments, the 3'-wing of a gapmer comprises at least one LNA nucleoside and at least one 2'-MOE nucleoside. In certain embodiments, the 3'-wing of a gapmer comprises at least one LNA nucleoside and at least one 2'-OMe nucleoside.

[0258] In certain embodiments, the 3'-wing of a gapmer has a nucleoside motif selected from among the following: ABB; ABAA; AAABAA, AAAAABAA; AABAA; AAAABAA; AAABAA; ABAB; AAAAA; AAABB; AAAAAAAA; AAAAAAA; AAAAAA; AAAAB; AAAA; AAA; AA; AB; ABBB; ABAB; AABBB; wherein each A is a modified nucleoside of a first type, each B is a modified nucleoside of a second type. In certain embodiments, an oligonucleotide comprises any 3'-wing motif provided herein. In certain such embodiments, the 5'-wing of the gapmer may comprise any nucleoside motif.

e. Certain Central Regions (gap regions)

[0259] In certain embodiments, the gap of a gapmer consists of 6 to 20 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 6 to 14 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 6 to 12 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 6 to 10 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 6 to 9 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 6 to 8 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 6 or 7 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 7 to 10 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 7 to 9 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 7 or 8 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 8 to 10 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 8 or 9 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 6 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 7 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 8 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 9 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 10 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 11 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 12 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 13 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 14 linked nucleosides.

[0260] In certain embodiments, each nucleoside of the gap of a gapmer is a 2'-deoxynucleoside. In certain embodiments, the gap comprises one or more modified nucleosides. In certain embodiments, each nucleoside of the gap of a gapmer is a 2'-deoxynucleoside or is a modified nucleoside that is "DNA-like". In certain embodiments, "DNA-like" means that the nucleoside has similar characteristics to DNA, such that a duplex comprising the gapmer and an RNA molecule is capable of activating RNase H. In certain embodiments, modified nucleosides that are DNA-like are 2'-endo. For example, under certain conditions, 2'-(ara)-F have been shown to support RNase H activation, and thus is DNA-like and further has 2'-endo conformation geometry. In certain embodiments, one or more nucleosides of the gap of a gapmer is not a 2'-deoxynucleoside and is not DNA-like. In certain such embodiments, the gapmer nonetheless supports RNase H activation (e.g., by virtue of the number or placement of the non-DNA nucleosides).

[0261] In certain embodiments, the gap comprise a stretch of unmodified 2'-deoxynucleosides interrupted by one or more modified nucleosides, thus resulting in three sub-regions (two stretches of one or more 2'-deoxynucleosides and a stretch of one or more interrupting modified nucleosides). In certain embodiments, no stretch of unmodified 2'-deoxynucleosides is longer than 5, 6, or 7 nucleosides. In certain embodiments, such short stretches is achieved by using short gap regions. In certain embodiments, short stretches are achieved by interrupting a longer gap region.

f. Certain Gapmer Motifs

[0262] In certain embodiments, a gapmer comprises a 5'-wing, a gap comprising at least one internucleoside linkage of Formula I, and a 3' wing, wherein the 5'-wing, gap, and 3' wing are independently selected from among those discussed above. For example, in certain embodiments, a gapmer has a 5'-wing, a gap, and a 3'-wing having features selected from among those listed in the following non-limiting table:

Table 1

Certain Gapmer Nucleoside Motifs
5'-wing region	Gap region	3'-wing region
AAAAAAA	DDDDDDDDDDD	AAA
AAAAABB	DDDDDDDD	BBAAAAA
ABB	DDDDDDDDD	BBA
AABAA	DDDDDDDDD	AABAA
ABB	DDDDDD	AABAA
AAABAA	DDDDDDDDD	AAABAA
AAABAA	DDDDDDDDD	AAB
ABAB	DDDDDDDDD	ABAB
AAABB	DDDDDDD	BBA
ABAB	DDDDDDDD	BBA
AA	DDDDDDDD	BBBBBBBB
ABB	DDDDDD	ABADB
AAAAB	DDDDDDD	BAAAA
ABBB	DDDDDDDDD	AB
AB	DDDDDDDDD	BBBA
ABBB	DDDDDDDDD	BBBA
AB	DDDDDDDD	ABA

wherein each A is a modified nucleoside of a first type, each B is a modified nucleoside of a second type and each D is a β-D-2'-deoxyribonucleoside or a nucleoside that is DNA-like. Each gap region includes at least one internucleoside linkage of Formula I.

[0263] In certain embodiments, each A comprises a modified sugar moiety. In certain embodiments, each A comprises a 2'-substituted sugar moiety. In certain embodiments, each A comprises a 2'-substituted sugar moiety selected from among F, OCH₃, OCH₂-C(=O)-N(H)(CH₃) and O(CH₂)₂-OCH₃. In certain embodiments, each A comprises a bicyclic sugar moiety. In certain embodiments, each A comprises a bicyclic sugar moiety selected from among cEt, cMOE, LNA, α-L-LNA, ENA and 2'-thio LNA. In certain embodiments, each A is a modified nucleoside comprising a sugar surrogate selected from morpholino, cyclohexenyl and cyclohexitol. In certain embodiments, each A is a modified nucleoside comprising a sugar surrogate selected from morpholino and F-tetrahydropyran (F-HNA). In certain embodiments, each A comprises a F-HNA surrogate modified nucleoside. In certain embodiments, each A comprises a modified nucleobase. In certain embodiments, each A comprises a modified nucleobase selected from among 2-thio-thymidine nucleoside and 5-propyne uridine nucleoside.

[0264] In certain embodiments, each B comprises a modified sugar moiety. In certain embodiments, each B comprises a 2'-substituted sugar moiety. In certain embodiments, each B comprises a 2'-subsituted sugar moiety selected from among F, OCH₃, OCH₂-C(=O)-N(H)(CH₃) and O(CH₂)₂-OCH₃. In certain embodiments, each B comprises a bicyclic sugar moiety. In certain embodiments, each B comprises a bicyclic sugar moiety selected from among cEt, cMOE, LNA, α-L-LNA, ENA and 2'-thio LNA. In certain embodiments, each B is a modified nucleoside comprising a sugar surrogate selected from morpholino, cyclohexenyl and cyclohexitol. In certain embodiments, each B is a modified nucleoside comprising a sugar surrogate selected from morpholino and F-tetrahydropyran (F-HNA). In certain embodiments, each B comprises a F-HNA surrogate modified nucleoside. In certain embodiments, each B comprises a modified nucleobase. In certain embodiments, each B comprises a modified nucleobase selected from among 2-thio-thymidine nucleoside and 5-propyne uridine nucleoside.

[0265] In certain embodiments, at least one of A or B comprises a bicyclic sugar moiety, and the other comprises a 2'-substituted sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside and the other of A or B comprises a 2'-substituted sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside and the other of A or B comprises a 2'-substituted sugar moiety. In certain embodiments, one of A or B is an α-L-LNA nucleoside and the other of A or B comprises a 2'-substituted sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside and the other of A or B comprises a 2'-MOE sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside and the other of A or B comprises a 2'-MOE sugar moiety. In certain embodiments, one of A or B comprises a sugar surrogate selected from morpholino, cyclohexenyl and cyclohexitol and the other of A or B comprises a 2'-substituted sugar moiety. In certain embodiments, one of A or B comprises a sugar surrogate selected from morpholino, cyclohexenyl and cyclohexitol and the other of A or B comprises a 2'-MOE sugar moiety. In certain embodiments, one of A or B comprises a F-THP sugar surrogate and the other of A or B comprises a 2'-substituted sugar moiety. In certain embodiments, one of A or B comprises a F-THP sugar surrogate and the other of A or B comprises a 2'-MOE sugar moiety. In certain embodiments, one of A or B is an α -L-LNA nucleoside and the other of A or B comprises a 2'-MOE sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside and the other of A or B comprises a 2'-F sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside and the other of A or B comprises a 2'-F sugar moiety. In certain embodiments, one of A or B is an α-L-LNA nucleoside and the other of A or B comprises a 2'-F sugar moiety.

[0266] In certain embodiments, A comprises a bicyclic sugar moiety, and B comprises a 2'-substituted sugar moiety. In certain embodiments, A is an LNA nucleoside and B comprises a 2'-substituted sugar moiety. In certain embodiments, A is a cEt nucleoside and B comprises a 2'-substituted sugar moiety. In certain embodiments, A is an α-L-LNA nucleoside and B comprises a 2'-substituted sugar moiety.

[0267] In certain embodiments, A comprises a bicyclic sugar moiety, and B comprises a 2'-MOE sugar moiety. In certain embodiments, A is an LNA nucleoside and B comprises a 2'-MOE sugar moiety. In certain embodiments, A is a cEt nucleoside and B comprises a 2'-MOE sugar moiety. In certain embodiments, A is an α-L-LNA nucleoside and B comprises a 2'-MOE sugar moiety.

[0268] In certain embodiments, A comprises a bicyclic sugar moiety, and B comprises a 2'-F sugar moiety. In certain embodiments, A is an LNA nucleoside and B comprises a 2'-F sugar moiety. In certain embodiments, A is a cEt nucleoside and B comprises a 2'-F sugar moiety. In certain embodiments, A is an α-L-LNA nucleoside and B comprises a 2'-F sugar moiety.

[0269] In certain embodiments, B comprises a bicyclic sugar moiety, and A comprises a 2'-MOE sugar moiety. In certain embodiments, B is an LNA nucleoside and A comprises a 2'-MOE sugar moiety. In certain embodiments, B is a cEt nucleoside and A comprises a 2'-MOE sugar moiety. In certain embodiments, B is an α-L-LNA nucleoside and A comprises a 2'-MOE sugar moiety.

[0270] In certain embodiments, B comprises a bicyclic sugar moiety, and A comprises a 2'-F sugar moiety. In certain embodiments, B is an LNA nucleoside and A comprises a 2'-F sugar moiety. In certain embodiments, B is a cEt nucleoside and A comprises a 2'-F sugar moiety. In certain embodiments, B is an α-L-LNA nucleoside and A comprises a 2'-F sugar moiety.

[0271] In certain embodiments, each A and B is, independently, a modified nucleoside comprising a bicyclic sugar moiety comprising a 4'-CH(CH₃)-O-2' bridge or a modified nucleoside comprising a 2'-OCH₂CH₂OCH₃ (MOE) substituent group. In certain embodiments, each A and B is, independently, a modified nucleoside comprising a bicyclic sugar moiety comprising a 4'-CH[(S)-(CH₃)]-O-2' bridge or a modified nucleoside comprising a 2'-OCH₂CH₂OCH₃ (MOE) substituent group. In certain embodiments, each A and B is, independently, a modified nucleoside comprising a bicyclic sugar moiety comprising a 4'-CH[(R)-(CH₃)]-O-2' bridge or a modified nucleoside comprising a 2'-OCH₂CH₂OCH₃ (MOE) substituent group. In certain embodiments, at least one modified nucleoside comprising a 2'-OCH₂CH₂OCH₃ (MOE) substituent group and at least one modified nucleoside comprising a 4'-CH(CH₃)-O-2' bridge is located in each of the 3' and 5' wings. In certain embodiments, at least one modified nucleoside comprising a 2'-OCH₂CH₂OCH₃ (MOE) substituent group and at least one modified nucleoside comprising a 4'-CH[(S)-(CH₃)]-O-2' bridge is located in each of the 3' and 5' wings. In certain embodiments, at least one modified nucleoside comprising a 2'-OCH₂CH₂OCH₃ (MOE) substituent group and at least one modified nucleoside comprising a 4'-CH[(R)-(CH₃)]-O-2' bridge is located in each of the 3' and 5' wings.

g. Certain Internucleoside Linkage Motifs

[0272] In certain embodiments, oligomeric compounds comprise modified internucleoside linkages arranged along the oligomeric compound or region thereof in a defined pattern or modified internucleoside linkage motif provided that at least one internucleoside linkage has Formula I. In certain embodiments, internucleoside linkages are arranged in a gapped motif, as described above for nucleoside motif. In such embodiments, the internucleoside linkages in each of two wing regions are different from the internucleoside linkages in the gap region. In certain embodiments the internucleoside linkages in the wings are phosphodiester and the internucleoside linkages in the gap are phosphorothioate. The nucleoside motif is independently selected, so such oligomeric compounds having a gapped internucleoside linkage motif may or may not have a gapped nucleoside motif and if it does have a gapped nucleoside motif, the wing and gap lengths may or may not be the same.

[0273] In certain embodiments, oligomeric compounds comprise a region having an alternating internucleoside linkage motif. In certain embodiments, oligomeric compounds of the present invention comprise a region of uniformly modified internucleoside linkages. In certain such embodiments, the oligomeric compound comprises a region that is uniformly linked by phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide is uniformly linked by phosphorothioate. In certain embodiments, each internucleoside linkage of the oligomeric compound is selected from phosphodiester and phosphorothioate. In certain embodiments, each internucleoside linkage of the oligomeric compound is selected from phosphodiester and phosphorothioate and at least one internucleoside linkage is phosphorothioate. In certain embodiments, at least one internucleoside linkage of the oligomeric compound is selected from other than phosphodiester and phosphorothioate.

[0274] In certain embodiments, oligomeric compounds comprise a positionally modified internucleoside linkage motif. In certain embodiments, oligomeric compounds as provided herein comprise a region of uniformly modified internucleoside linkages. In certain such embodiments, the oligomeric compound comprises one or more modified internucleoside linkages of one or more different types.

[0275] In certain embodiments, the oligomeric compound comprises at least 6 phosphorothioate internucleoside linkages. In certain embodiments, the oligomeric compound comprises at least 8 phosphorothioate internucleoside linkages. In certain embodiments, the oligomeric compound comprises at least 10 phosphorothioate internucleoside linkages. In certain embodiments, the oligomeric compound comprises at least one block of at least 6 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligomeric compound comprises at least one block of at least 8 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligomeric compound comprises at least one block of at least 10 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligomeric compound comprises at least one block of at least one 12 consecutive phosphorothioate internucleoside linkages. In certain such embodiments, at least one such block is located at the 3' end of the oligomeric compound. In certain such embodiments, at least one such block is located within 3 nucleosides of the 3' end of the oligomeric compound. In certain embodiments, each internucleoside linkage a phosphorothioate internucleoside linkage.

h. Certain Modification Motifs

[0276] Modification motifs define oligonucleotides by nucleoside motif (sugar motif and nucleobase motif) and linkage motif. For example, certain oligonucleotides have the following modification motif:
AAADDDDDDDDDBBB;
wherein each A is a modified nucleoside comprising a 2'-substituted sugar moiety; each D is a β-D-2'-deoxyribonucleoside or a modified nucleoside having B form conformation geometry and each B is a modified nucleoside comprising a bicyclic sugar moiety wherein at least one internucleoside linkage had Formula I. The following non-limiting Table further illustrates certain modification motifs:

Table 2

Certain Modification Motif
5'-wing region	Gap region	3'-wing region
BB	DDDDDDDDD	AAAAAAAA
ABB	DDDDDDDDD	BBA
ABB	DDDDDDDDD	BBA
ABBB	DDDDDDDDD	BBABB
ABB	DDDDDDDDD	BBABB
BBABB	DDDDDDDDD	BBA
ABB	DDDDDDDDD	BBABBBB
AABAA	DDDDDDDDD	BBA
AAABAA	DDDDDDDDD	BBA
AABAA	DDDDDDDDD	AABAA
AAABAA	DDDDDDDDD	AABAAA
AAAABAA	DDDDDDDDD	BBA
ABAB	DDDDDDDDD	BABA
ABAB	DDDDDDDDD	AABAA
ABB	DDDDDDDDD	BABA
BBABBBB	DDDDDDDDD	BABA
AAAAA	DDDDDDDDD	AAAAA
AAAAA	DDDDDDD	AAAAA
AAAAA	DDDDDDDDD	BBABBBB
AAABB	DDDDDDD	BBA
ABAB	DDDDDDDD	BBA
ABAB	DDDDDDD	AAABB
AAAAB	DDDDDDD	BAAAA
BB	DDDDDDDD	AA
AA	DDDDDDD	AAAAAAAA
AAA	DDDDDDD	AAAAAAA
AAA	DDDDDDD	AAAAAA
AB	DDDDDDD	BBBA
ABBB	DDDDDDDDD	BA
AB	DDDDDDDDD	BBBA
AAABB	DDDDDDD	BBAAA
AAAAB	DDDDDDD	BAAAA
AABBB	DDDDDDD	BBBAA
AAAAB	DDDDDDD	AAAAA
AAABB	DDDDDDD	AAAAA
AABBB	DDDDDDD	AAAAA
AAAAA	DDDDDDD	BAAAA
AAAAA	DDDDDDD	BBAAA
AAAAA	DDDDDDD	BBBAA

wherein each A is a modified nucleoside of a first type, each B is a modified nucleoside of a second type and each D is a β-D-2'-deoxyribonucleoside or a nucleoside that is DNA-like. Each gap region includes at least one internucleoside linkage of Formula I.

[0277] In certain embodiments, each A comprises a modified sugar moiety. In certain embodiments, each A comprises a 2'-substituted sugar moiety. In certain embodiments, each A comprises a 2'-substituted sugar moiety selected from among F, OCH₃, OCH₂-C(=O)-N(H)(CH₃) and O(CH₂)₂-OCH₃. In certain embodiments, each A comprises a bicyclic sugar moiety. In certain embodiments, each A comprises a bicyclic sugar moiety selected from among cEt, cMOE, LNA, α-L-LNA, ENA and 2'-thio LNA. In certain embodiments, each A is a modified nucleoside comprising a sugar surrogate selected from morpholino, cyclohexenyl and cyclohexitol. In certain embodiments, each A is a modified nucleoside comprising a sugar surrogate selected from morpholino and F-tetrahydropyran (F-HNA). In certain embodiments, each A comprises a F-HNA sugar surrogate modified nucleoside. In certain embodiments, each A comprises a modified nucleobase. In certain embodiments, each A comprises a modified nucleobase selected from among 2-thio-thymidine nucleoside and 5-propyne uridine nucleoside.

[0278] In certain embodiments, each B comprises a modified sugar moiety. In certain embodiments, each B comprises a 2'-substituted sugar moiety. In certain embodiments, each B comprises a 2'-subsituted sugar moiety selected from among F, OCH₃, OCH₂-C(=O)-N(H)(CH₃) and O(CH₂)₂-OCH₃. In certain embodiments, each B comprises a bicyclic sugar moiety. In certain embodiments, each B comprises a bicyclic sugar moiety selected from among cEt, cMOE, LNA, α-L-LNA, ENA and 2'-thio LNA. In certain embodiments, each B is a modified nucleoside comprising a sugar surrogate selected from morpholino, cyclohexenyl and cyclohexitol. In certain embodiments, each B is a modified nucleoside comprising a sugar surrogate selected from morpholino and F-tetrahydropyran (F-HNA). In certain embodiments, each B comprises a F-HNA sugar surrogate modified nucleoside. In certain embodiments, each B comprises a modified nucleobase. In certain embodiments, each B comprises a modified nucleobase selected from among 2-thio-thymidine nucleoside and 5-propyne urindine nucleoside.

[0279] In certain embodiments, at least one of A or B comprises a bicyclic sugar moiety, and the other comprises a 2'-substituted sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside and the other of A or B comprises a 2'-substituted sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside and the other of A or B comprises a 2'-substituted sugar moiety. In certain embodiments, one of A or B is an α-L-LNA nucleoside and the other of A or B comprises a 2'-substituted sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside and the other of A or B comprises a 2'-MOE sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside and the other of A or B comprises a 2'-MOE sugar moiety. In certain embodiments, one of A or B comprises a sugar surrogate selected from morpholino, cyclohexenyl and cyclohexitol and the other of A or B comprises a 2'-substituted sugar moiety. In certain embodiments, one of A or B comprises a sugar surrogate selected from morpholino, cyclohexenyl and cyclohexitol and the other of A or B comprises a 2'-MOE sugar moiety. In certain embodiments, one of A or B comprises a F-THP sugar surrogate and the other of A or B comprises a 2'-substituted sugar moiety. In certain embodiments, one of A or B comprises a F-THP sugar surrogate and the other of A or B comprises a 2'-MOE sugar moiety. In certain embodiments, one of A or B is an α -L-LNA nucleoside and the other of A or B comprises a 2'-MOE sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside and the other of A or B comprises a 2'-F sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside and the other of A or B comprises a 2'-F sugar moiety. In certain embodiments, one of A or B is an α-L-LNA nucleoside and the other of A or B comprises a 2'-F sugar moiety.

[0280] In certain embodiments, A comprises a bicyclic sugar moiety, and B comprises a 2'-substituted sugar moiety. In certain embodiments, A is an LNA nucleoside and B comprises a 2'-substituted sugar moiety. In certain embodiments, A is a cEt nucleoside and B comprises a 2'-substituted sugar moiety. In certain embodiments, A is an α-L-LNA nucleoside and B comprises a 2'-substituted sugar moiety.

[0281] In certain embodiments, A comprises a bicyclic sugar moiety, and B comprises a 2'-MOE sugar moiety. In certain embodiments, A is an LNA nucleoside and B comprises a 2'-MOE sugar moiety. In certain embodiments, A is a cEt nucleoside and B comprises a 2'-MOE sugar moiety. In certain embodiments, A is an α-L-LNA nucleoside and B comprises a 2'-MOE sugar moiety.

[0282] In certain embodiments, A comprises a bicyclic sugar moiety, and B comprises a 2'-F sugar moiety. In certain embodiments, A is an LNA nucleoside and B comprises a 2'-F sugar moiety. In certain embodiments, A is a cEt nucleoside and B comprises a 2'-F sugar moiety. In certain embodiments, A is an α-L-LNA nucleoside and B comprises a 2'-F sugar moiety.

[0283] In certain embodiments, B comprises a bicyclic sugar moiety, and A comprises a 2'-MOE sugar moiety. In certain embodiments, B is an LNA nucleoside and A comprises a 2'-MOE sugar moiety. In certain embodiments, B is a cEt nucleoside and A comprises a 2'-MOE sugar moiety. In certain embodiments, B is an α-L-LNA nucleoside and A comprises a 2'-MOE sugar moiety.

[0284] In certain embodiments, B comprises a bicyclic sugar moiety, and A comprises a 2'-F sugar moiety. In certain embodiments, B is an LNA nucleoside and A comprises a 2'-F sugar moiety. In certain embodiments, B is a cEt nucleoside and A comprises a 2'-F sugar moiety. In certain embodiments, B is an α-L-LNA nucleoside and A comprises a 2'-F sugar moiety. In certain embodiments, each A and B is, independently, a modified nucleoside comprising a bicyclic sugar moiety comprising a 4'-CH(CH₃)-O-2' bridge or a modified nucleoside comprising a 2'-OCH₂CH₂OCH₃ (MOE) substituent group. In certain embodiments, each A and B is, independently, a modified nucleoside comprising a bicyclic sugar moiety comprising a 4'-CH[(S)-(CH₃)]-O-2' bridge or a modified nucleoside comprising a 2'-OCH₂CH₂OCH₃ (MOE) substituent group. In certain embodiments, each A and B is, independently, a modified nucleoside comprising a bicyclic sugar moiety comprising a 4'-CH[(R)-(CH₃)]-O-2' bridge or a modified nucleoside comprising a 2'-OCH₂CH₂OCH₃ (MOE) substituent group. In certain embodiments, at least one modified nucleoside comprising a 2'-OCH₂CH₂OCH₃ (MOE) substituent group and at least one modified nucleoside comprising a 4'-CH(CH₃)-O-2' bridge is located in each of the 3' and 5' wings. In certain embodiments, at least one modified nucleoside comprising a 2'-OCH₂CH₂OCH₃ (MOE) substituent group and at least one modified nucleoside comprising a 4'-CH[(S)-(CH₃)]-O-2' bridge is located in each of the 3' and 5' wings. In certain embodiments, at least one modified nucleoside comprising a 2'-OCH₂CH₂OCH₃ (MOE) substituent group and at least one modified nucleoside comprising a 4'-CH[(R)-(CH₃)]-O-2' bridge is located in each of the 3' and 5' wings.

b. Certain Antisense Activities and Mechanisms

[0285] Antisense mechanisms include any mechanism involving the hybridization of an oligomeric compound with a target nucleic acid, wherein the hybridization results in a biological effect. In certain embodiments, such hybridization results in either target nucleic acid degradation or occupancy with concomitant inhibition or stimulation of the cellular machinery involving, for example, translation, transcription, or splicing of the target nucleic acid.

[0286] Antisense activities may be observed directly or indirectly. In certain embodiments, observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid; a change in the ratio of splice variants of a nucleic acid or protein; and/or a phenotypic change in a cell or animal.

[0287] In certain antisense activities, hybridization of an antisense compound results in recruitment of a protein that cleaves a target nucleic acid. For example, certain antisense compounds result in RNase H mediated cleavage of target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The "DNA" in such an RNA:DNA duplex, need not be unmodified DNA. In certain embodiments, the invention provides antisense compounds that are sufficiently "DNA-like" to elicit RNase H activity. Such DNA-like antisense compounds include, but are not limited to gapmers having unmodified deoxyfuranose sugar moieties in the nucleosides of the gap and modified sugar moieties in the nucleosides of the wings.

[0288] One type of antisense mechanism involving degradation of target RNA is RNase H mediated antisense. RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. It is known in the art that single-stranded antisense compounds which are "DNA-like" elicit RNase H activity in mammalian cells. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of DNA-like oligonucleotide-mediated inhibition of gene expression. In certain embodiments, the invention provides antisense compounds that are sufficiently "DNA-like" to elicit RNase H activity. Such DNA-like antisense compounds include, but are not limited to gapmers. In certain embodiments, such gapmers comprise 2'-β-D-ribofuranose nucleosides in the gap and modified nucleosides comprising at least modified sugar moieties in the wings.

[0289] Antisense mechanisms also include, without limitation RNAi mechanisms, which utilize the RISC pathway. Such RNAi mechanisms include, without limitation siRNA, ssRNA and microRNA mechanisms. Such mechanisms include creation of a microRNA mimic and/or an anti-microRNA.

[0290] Antisense mechanisms also include, without limitation, mechanisms that hybridize or mimic non-coding RNA other than microRNA or mRNA. Such non-coding RNA includes, but is not limited to promoter-directed RNA and short and long RNA that effects transcription or translation of one or more nucleic acids.

[0291] In certain embodiments, antisense compounds specifically hybridize when there is a sufficient degree of complementarity to avoid non-specific binding of the antisense compound to non-target nucleic acid sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, and under conditions in which assays are performed in the case of in vitro assays.

[0292] In certain embodiments, compounds comprising oligonucleotides having a gapmer nucleoside motif described herein have desirable properties compared to non-gapmer oligonucleotides or to gapmers having other motifs. In certain circumstances, it is desirable to identify motifs resulting in a favorable combination of potent antisense activity and relatively low toxicity. In certain embodiments, compounds of the present invention have a favorable therapeutic index (measure of potency divided by measure of toxicity).

iv. Certain Overall Lengths

[0293] In certain embodiments, the present invention provides oligomeric compounds including oligonucleotides of any of a variety of ranges of lengths. In certain embodiments, the invention provides oligomeric compounds or oligonucleotides consisting of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number of nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 and 24; provided that X<Y. For example, in certain embodiments, the invention provides oligomeric compounds which comprise oligonucleotides consisting of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 21 to 22, 21 to 23, 21 to 24, 22 to 23, 22 to 24 or 23 to 24 linked nucleosides. In embodiments where the number of nucleosides of an oligomeric compound or oligonucleotide is limited, whether to a range or to a specific number, the oligomeric compound or oligonucleotide may, nonetheless further comprise additional other substituents. For example, an oligonucleotide comprising 8-30 nucleosides excludes oligonucleotides having 31 nucleosides, but, unless otherwise indicated, such an oligonucleotide may further comprise, for example one or more conjugates, terminal groups, or other substituents. In certain embodiments, a gapmer oligonucleotide has any of the above lengths.

[0294] Further, where an oligonucleotide is described by an overall length range and by regions having specified lengths, and where the sum of specified lengths of the regions is less than the upper limit of the overall length range, the oligonucleotide may have additional nucleosides, beyond those of the specified regions, provided that the total number of nucleosides does not exceed the upper limit of the overall length range.

[0295] In certain embodiments, oligonucleotides of the present invention are characterized by their modification motif and overall length. In certain embodiments, such parameters are each independent of one another. Thus, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications. For example, the internucleoside linkages within the wing regions of a sugar-gapmer may be the same or different from one another and may be the same or different from the internucleoside linkages of the gap region. Likewise, such sugar-gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. One of skill in the art will appreciate that such motifs may be combined to create a variety of oligonucleotides. Herein if a description of an oligonucleotide or oligomeric compound is silent with respect to one or more parameter, such parameter is not limited. Thus, an oligomeric compound described only as having a gapmer sugar motif without further description may have any length, internucleoside linkage motif, and nucleobase modification motif. Unless otherwise indicated, all chemical modifications are independent of nucleobase sequence.

[0296] Provided herein are oligomeric compounds comprising modified nucleosides. Such modified nucleosides comprise a modified sugar moiety, a modified nucleobase, or both a modifed sugar moiety and a modified nucleobase. In certain embodiments, oligomeric compounds of the invention comprise one or more modifed nucleosides comprising a modifed sugar moiety. Such compounds comprising one or more sugar-modified nucleosides may have desirable properties, such as enhanced nuclease stability or increased binding affinity with a target nucleic acid relative to an oligonucleotide comprising only nucleosides comprising naturally occurring sugar moieties. In certain embodiments, modified sugar moieties are substitued sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surogates may comprise one or more substitutions corresponding to those of substituted sugar moieties.

[0297] In certain embodiments, the present invention provides oligonucleotides comprising modified nucleosides. Modified nucleosides may include modified sugars, modified nucleobases, and/or modified linkages. The specific modifications are selected such that the resulting oligonucleotides possess desirable characteristics. In certain embodiments, oligonucleotides comprise one or more RNA-like nucleosides. In certain embodiments, oligonucleotides comprise one or more DNA-like nucleosides.

[0298] Oligomeric compounds are routinely prepared using solid support methods as a preferred method over solution phase methods. Commercially available equipment commonly used for the preparation of oligomeric compounds that utilize the solid support method is sold by several vendors including, for example, Applied Biosystems (Foster City, CA). Any other means for such synthesis known in the art may additionally or alternatively be employed.

[0299] In certain embodiments, the preparation of oligomeric compounds as disclosed herein is performed according to literature procedures for DNA: Protocols for Oligonucleotides and Analogs, Agrawal, Ed., Humana Press, 1993, and/or RNA: Scaringe, Methods 2001, 23, 206-217; Oligonucleotides and Analogues, a Practical Approach, F. Eckstein, Ed., Oxford University Press, New York, 1991; Gait et al., Applications of Chemically synthesized RNA in RNA:Protein Interactions, Smith, Ed., 1998, 1-36; Gallo et al., Tetrahedron 2001, 57, 5707-5713. Additional methods for solid-phase synthesis may be found in Caruthers U.S. Patents Nos. 4,415,732; 4,458,066; 4,500,707; 4,668,777; 4,973,679; and 5,132,418; and Koster U.S. Patents Nos. 4,725,677 and Re. 34,069.

[0300] The synthesis of RNA and related analogs relative to the synthesis of DNA and related analogs has been increasing as efforts in RNA interference and micro RNA increase. The primary RNA synthesis strategies that are presently being used commercially include 5'-O-DMT-2'-O-t-butyldimethylsilyl (TBDMS), 5'-O-DMT-2'-O-[1(2-fluorophenyl)-4-methoxypiperidin-4-yl] (FPMP), 2'-O-[(triisopropylsilyl)oxy]methyl (2'-O-CH₂-O-Si(iPr)₃ (TOM) and the 5'-O-silyl ether-2'-ACE (5'-O-bis(trimethylsiloxy)cyclododecyloxysilyl ether (DOD)-2'-O-bis(2-acetoxyethoxy)methyl (ACE). A current list of some of the major companies currently offering RNA products include Pierce Nucleic Acid Technologies, Dharmacon Research Inc., Ameri Biotechnologies Inc., and Integrated DNA Technologies, Inc. One company, Princeton Separations, is marketing an RNA synthesis activator advertised to reduce coupling times especially with TOM and TBDMS chemistries. The primary groups being used for commercial RNA synthesis are: TBDMS: 5'-O-DMT-2'-O-t-butyldimethylsilyl; TOM: 2'-O-[(triisopropylsilyl)oxy]methyl; DOD/ACE: (5'-O-bis(trimethylsiloxy)cyclododecyloxysilyl ether-2'-O-bis(2-acetoxyethoxy)methyl; and FPMP: 5'-O-DMT-2'-O-[1(2-fluorophenyl)-4-ethoxypiperidin-4-yl]. In certain embodiments, each of the aforementioned RNA synthesis strategies can be used herein. In certain embodiments, the aforementioned RNA synthesis strategies can be performed together in a hybrid fashion e.g. using a 5'-protecting group from one strategy with a 2'-O-protecting from another strategy.

[0301] Although the sequence listing accompanying this filing identifies each sequence as either "RNA" or "DNA" as required, in reality, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that such designation as "RNA" or "DNA" to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2'-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (2'-OH for the natural 2'-H of DNA) or as an RNA having a modified base (thymine (methylated uracil) for natural uracil of RNA).

[0302] Accordingly, nucleic acid sequences provided herein, including, but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases. By way of further example and without limitation, an oligomeric compound having the nucleobase sequence "ATCGATCG" encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence "AUCGAUCG" and those having some DNA bases and some RNA bases such as "AUCGATCG" and oligomeric compounds having other modified or naturally occurring bases, such as "AT^meCGAUCG," wherein ^meC indicates a cytosine base comprising a methyl group at the 5-position.

v. Certain Oligonucleotides

[0303] In certain embodiments, oligonucleotides of the present invention are characterized by their modification motif and overall length. In certain embodiments, such parameters are each independent of one another. Thus, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications. For example, the internucleoside linkages within the wing regions of a sugar-gapmer may be the same or different from one another and may be the same or different from the internucleoside linkages of the gap region. Likewise, such sugar-gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. One of skill in the art will appreciate that such motifs may be combined to create a variety of oligonucleotides. Herein if a description of an oligonucleotide or oligomeric compound is silent with respect to one or more parameter, such parameter is not limited. Thus, an oligomeric compound described only as having a gapmer sugar motif without further description may have any length, internucleoside linkage motif, and nucleobase modification motif. Unless otherwise indicated, all chemical modifications are independent of nucleobase sequence.

vi. Certain Terminal Groups/Conjugate Groups

[0304] In certain embodiments, the oligomeric compounds as provided herein are modified by covalent attachment of one or more terminal groups to the 5' and or 3'-end. Although terminal groups are generally attached at the terminal 3' or 5'-position, attachment at any available terminal or internal position is also possible. As used herein the terms "5'-terminal group", "3'-terminal group", "terminal group" and combinations thereof are meant to include useful groups known to the art skilled that can be placed on one or both of the terminal ends of an oligomeric compound or at another reactive position at a terminal end of an oligomeric compound. Such terminal groups are useful for various purposes such as enabling the tracking of an oligomeric compound (a fluorescent label or other reporter group), improving the pharmacokinetics or pharmacodynamics of an oligomeric compound (such as for example: uptake and/or delivery) or enhancing one or more other desirable properties of an oligomeric compound (a group for improving nuclease stability or binding affinity). In certain embodiments, 5' and 3'-terminal groups include without limitation, modified or unmodified nucleosides; two or more linked nucleosides that are independently, modified or unmodified; conjugate groups; capping groups; phosphate moieties; and protecting groups.

[0305] In certain embodiments, the oligomeric compounds as provided herein are modified by covalent attachment of one or more conjugate groups. As used herein, "conjugate group" means a radical group comprising a group of atoms that are attached to an oligomeric compound. In general, conjugate groups modify one or more properties of the compound to which they are attached, including, but not limited to pharmacodynamic, pharmacokinetic, stability, binding, absorption, cellular distribution, cellular uptake, charge and/or clearance properties. Conjugate groups are routinely used in the chemical arts and can include a conjugate linker that covalently links the conjugate group to an oligomeric compound.

[0306] In certain embodiments, conjugate groups include without limitation, intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, thioethers, peptides, carbohydrates, a vitamin moiety, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins and dyes. Certain conjugate groups have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. U.S.A. 1989, 86, 6553-6556); cholic acid (Manoharan et al., Bioorg. Med. Chem. Let. 1994, 4, 1053-1060); a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci. 1992, 660, 306-309; and Manoharan et al., Bioorg. Med. Chem. Let. 1993, 3, 2765-2770); a thiocholesterol (Oberhauser et al., Nucleic Acids Res. 1992, 20, 533-538); an aliphatic chain, e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al., EMBO J. 1991, 10, 1111-1118; Kabanov et al., FEBS Lett. 1990, 259, 327-330; Svinarchuk et al., Biochimie 1993, 75, 49-54); a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett. 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res. 1990, 18, 3777-3783); a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides Nucleotides, 1995, 14, 969-973); an adamantane acetic acid (Manoharan et al., Tetrahedron Lett. 1995, 36, 3651-3654); a palmityl moiety (Mishra et al., Biochim. Biophys. Acta 1995, 1264, 229-237); an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther. 1996, 277, 923-937); or a tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; doi:10.1038/mtna.2014.72, Published online 13 January 2015; and Nishina et al., Molecular Therapy, 2008, 16(4), 734-740).

[0307] In certain embodiments, a conjugate group comprises an active drug substance including but not limited to aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.

[0308] In certain embodiments, conjugate groups are directly attached to oligomeric compounds. In certain embodiments, conjugate groups are attached to oligomeric compounds by a conjugate linking group. In certain such embodiments, conjugate linking groups include bifunctional linking moieties which are known in the art and are useful for attaching conjugate groups to oligomeric compounds. Conjugate linking groups are useful for attachment of conjugate groups, such as chemical stabilizing groups, functional groups, reporter groups and other groups to selective sites in a parent compound such as for example an oligomeric compound. In general a bifunctional linking moiety comprises a hydrocarbyl group having at least two functional groups. One of the functional groups is selected to bind to a parent molecule or compound of interest and the other is selected to bind essentially any selected group such as chemical functional group or a conjugate group. In certain embodiments, the conjugate linking group comprises a chain structure or an oligomer of repeating units such as ethylene glycol or amino acid units. Examples of functional groups that are routinely used in a bifunctional linking moiety include, but are not limited to, electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In certain embodiments, bifunctional linking moieties include one or more groups selected from, but not limited to, alkyl, alkenyl, alkynyl, amino, amido, hydroxyl, thiol, acyl and carboxyl.

[0309] Some nonlimiting examples of conjugate linking moieties include pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other linking groups include, but are not limited to, substituted C₁-C₁₀ alkyl, substituted or unsubstituted C₂-C₁₀ alkenyl or substituted or unsubstituted C₂-C₁₀ alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.

[0310] In certain embodiments, one or more conjugate groups are attached to the 5'-end of an oligomeric compound. In certain embodiments, conjugate groups are near the 5'-end. In certain embodiments, conjugates are attached at the 5'end of an oligomeric compound, but before one or more terminal group nucleosides.

[0311] In certain embodiments, one or more conjugate groups are attached to the 3'-end of an oligomeric compound. In certain embodiments, conjugate groups are near the 3'-end. In certain embodiments, conjugates are attached at the 3'end of an oligomeric compound, but before one or more terminal group nucleosides. In certain embodiments, conjugate groups are placed within a terminal group.

[0312] In certain embodiments, conjugate groups include a cleavable moiety that covalently links the conjugate group to an oligomeric compound. In certain embodiments, conjugate groups include a conjugate linker and a cleavable moiety to covalently link the conjugate group to an oligomeric compound. In certain embodiments, a conjugate group has the general formula:

wherein n is from 1 to about 3, m is 0 when n is 1 or m is 1 when n is 2 or 3, j is 1 or 0, k is 1 or 0 and the sum of j and k is at least one.

[0313] In certain embodiments, n is 1, j is 1 and k is 0. In certain embodiments, n is 1, j is 0 and k is 1. In certain embodiments, n is 1, j is 1 and k is 1. In certain embodiments, n is 2, j is 1 and k is 0. In certain embodiments, n is 2, j is 0 and k is 1. In certain embodiments, n is 2, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 0. In certain embodiments, n is 3, j is 0 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1.

[0314] Conjugate groups are shown herein as radicals, providing a bond for forming covalent attachment to an oligomeric compound such as an antisense oligonucleotide. In certain embodiments, the point of attachment on the oligomeric compound is at the 3'-terminal nucleoside or modified nucleoside. In certain embodiments, the point of attachment on the oligomeric compound is the 3'-oxygen atom of the 3'-hydroxyl group of the 3' terminal nucleoside or modified nucleoside. In certain embodiments, the point of attachment on the oligomeric compound is at the 5'-terminal nucleoside or modified nucleoside. In certain embodiments the point of attachment on the oligomeric compound is the 5'-oxygen atom of the 5'-hydroxyl group of the 5'-terminal nucleoside or modified nucleoside. In certain embodiments, the point of attachment on the oligomeric compound is at any reactive site on a nucleoside, a modified nucleoside or an internucleoside linkage.

[0315] As used herein, "cleavable moiety" and "cleavable bond" mean a cleavable bond or group of atoms that is capable of being split or cleaved under certain physiological conditions. In certain embodiments, a cleavable moiety is a cleavable bond. In certain embodiments, a cleavable moiety comprises a cleavable bond. In certain embodiments, a cleavable moiety is a group of atoms. In certain embodiments, a cleavable moiety is selectively cleaved inside a cell or sub-cellular compartment, such as a lysosome. In certain embodiments, a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases. In certain embodiments, a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds.

[0316] In certain embodiments, conjugate groups comprise a cleavable moiety. In certain such embodiments, the cleavable moiety covalently attaches the oligomeric compound to the conjugate linker. In certain such embodiments, the cleavable moiety covalently attaches the oligomeric compound to the cell-targeting moiety.

[0317] In certain embodiments, a cleavable bond is selected from among: an amide, a polyamide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, a di-sulfide, or a peptide. In certain embodiments, a cleavable bond is one of the esters of a phosphodiester. In certain embodiments, a cleavable bond is one or both esters of a phosphodiester. In certain embodiments, the cleavable moiety is a phosphodiester linkage between an oligomeric compound and the remainder of the conjugate group. In certain embodiments, the cleavable moiety comprises a phosphodiester linkage that is located between an oligomeric compound and the remainder of the conjugate group. In certain embodiments, the cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is attached to the conjugate linker by either a phosphodiester or a phosphorothioate linkage. In certain embodiments, the cleavable moiety is attached to the conjugate linker by a phosphodiester linkage. In certain embodiments, the conjugate group does not include a cleavable moiety.

[0318] In certain embodiments, the cleavable moiety is a cleavable nucleoside or a modified nucleoside. In certain embodiments, the nucleoside or modified nucleoside comprises an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine.

[0319] In certain embodiments, the cleavable moiety is 2'-deoxy nucleoside that is attached to either the 3' or 5'-terminal nucleoside of an oligomeric compound by a phosphodiester linkage and covalently attached to the remainder of the conjugate group by a phosphodiester or phosphorothioate linkage. In certain embodiments, the cleavable moiety is 2'-deoxy adenosine that is attached to either the 3' or 5'-terminal nucleoside of an oligomeric compound by a phosphodiester linkage and covalently attached to the remainder of the conjugate group by a phosphodiester or phosphorothioate linkage. In certain embodiments, the cleavable moiety is 2'-deoxy adenosine that is attached to the 3'-oxygen atom of the 3'-hydroxyl group of the 3'-terminal nucleoside or modified nucleoside by a phosphodiester linkage. In certain embodiments, the cleavable moiety is 2'-deoxy adenosine that is attached to the 5'-oxygen atom of the 5'-hydroxyl group of the 5'-terminal nucleoside or modified nucleoside by a phosphodiester linkage. In certain embodiments, the cleavable moiety is attached to a 2'-position of a nucleoside or modified nucleoside of an oligomeric compound.

[0320] As used herein, "conjugate linker" in the context of a conjugate group means a portion of a conjugate group comprising any atom or group of atoms that covalently link the cell-targeting moiety to the oligomeric compound either directly or through the cleavable moiety. In certain embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether (-S-) and hydroxylamino (-O-N(H)-). In certain embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus linking group. In certain embodiments, the conjugate linker comprises at least one phosphodiester group. In certain embodiments, the conjugate linker includes at least one neutral linking group.

[0321] In certain embodiments, the conjugate linker is covalently attached to the oligomeric compound. In certain embodiments, the conjugate linker is covalently attached to the oligomeric compound and the branching group. In certain embodiments, the conjugate linker is covalently attached to the oligomeric compound and a tethered ligand. In certain embodiments, the conjugate linker is covalently attached to the cleavable moiety. In certain embodiments, the conjugate linker is covalently attached to the cleavable moiety and the branching group. In certain embodiments, the conjugate linker is covalently attached to the cleavable moiety and a tethered ligand. In certain embodiments, the conjugate linker includes one or more cleavable bonds. In certain embodiments, the conjugate group does not include a conjugate linker.

[0322] As used herein, "branching group" means a group of atoms having at least 3 positions that are capable of forming covalent linkages to two or more tether-ligands and the remainder of the conjugate group. In general a branching group provides a plurality of reactive sites for connecting tethered ligands to the oligomeric compound through the conjugate linker and/or the cleavable moiety. In certain embodiments, the branching group comprises groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether and hydroxylamino groups. In certain embodiments, the branching group comprises a branched aliphatic group comprising groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether and hydroxylamino groups. In certain such embodiments, the branched aliphatic group comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain such embodiments, the branched aliphatic group comprises groups selected from alkyl, amino and ether groups. In certain such embodiments, the branched aliphatic group comprises groups selected from alkyl and ether groups. In certain embodiments, the branching group comprises a mono or polycyclic ring system.

[0323] In certain embodiments, the branching group is covalently attached to the conjugate linker. In certain embodiments, the branching group is covalently attached to the cleavable moiety. In certain embodiments, the branching group is covalently attached to the conjugate linker and each of the tethered ligands. In certain embodiments, the branching group comprises one or more cleavable bond. In certain embodiments, the conjugate group does not include a branching group.

[0324] In certain embodiments, conjugate groups as provided herein include a cell-targeting moiety that has at least one tethered ligand. In certain embodiments, the cell-targeting moiety comprises two tethered ligands covalently attached to a branching group. In certain embodiments, the cell-targeting moiety comprises three tethered ligands covalently attached to a branching group.

[0325] As used herein, "tether" means a group of atoms that connect a ligand to the remainder of the conjugate group. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, substituted alkyl, ether, thioether, disulfide, amino, oxo, amide, phosphodiester and polyethylene glycol groups in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, ether, thioether, disulfide, amino, oxo, amide and polyethylene glycol groups in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, substituted alkyl, phosphodiester, ether and amino, oxo, amide groups in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, ether and amino, oxo, amide groups in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, amino and oxo groups in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl and oxo groups in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl and phosphodiester in any combination. In certain embodiments, each tether comprises at least one phosphorus linking group or neutral linking group.

[0326] In certain embodiments, tethers include one or more cleavable bond. In certain embodiments, each tethered ligand is attached to a branching group. In certain embodiments, each tethered ligand is attached to a branching group through an amide group. In certain embodiments, each tethered ligand is attached to a branching group through an ether group. In certain embodiments, each tethered ligand is attached to a branching group through a phosphorus linking group or neutral linking group. In certain embodiments, each tethered ligand is attached to a branching group through a phosphodiester group. In certain embodiments, each tether is attached to a ligand through either an amide or an ether group. In certain embodiments, each tether is attached to a ligand through an ether group.

[0327] In certain embodiments, each tether comprises from 8 to 20 atoms in chain length between the ligand and the branching group. In certain embodiments, each tether comprises from 10 to 18 atoms in chain length between the ligand and the branching group. In certain embodiments, each tether comprises about 13 atoms in chain length.

[0328] In certain embodiments, the present disclosure provides ligands wherein each ligand is covalently attached to the remainder of the conjugate group through a tether. In certain embodiments, each ligand is selected to have an affinity for at least one type of receptor on a target cell. In certain embodiments, ligands are selected that have an affinity for at least one type of receptor on the surface of a mammalian liver cell. In certain embodiments, ligands are selected that have an affinity for the hepatic asialoglycoprotein receptor (ASGP-R). In certain embodiments, each ligand is a carbohydrate. In certain embodiments, each ligand is, independently selected from galactose, N-acetyl galactoseamine, mannose, glucose, glucosamone and fucose. In certain embodiments, each ligand is N-acetyl galactoseamine (GalNAc). In certain embodiments, the targeting moiety comprises 1 to 3 ligands. In certain embodiments, the targeting moiety comprises 3 ligands. In certain embodiments, the targeting moiety comprises 2 ligands. In certain embodiments, the targeting moiety comprises 1 ligand. In certain embodiments, the targeting moiety comprises 3 N-acetyl galactoseamine ligands. In certain embodiments, the targeting moiety comprises 2 N-acetyl galactoseamine ligands. In certain embodiments, the targeting moiety comprises 1 N-acetyl galactoseamine ligand.

[0329] In certain embodiments, each ligand is a carbohydrate, carbohydrate derivative, modified carbohydrate, multivalent carbohydrate cluster, polysaccharide, modified polysaccharide, or polysaccharide derivative. In certain embodiments, each ligand is an amino sugar or a thio sugar. For example, amino sugars may be selected from any number of compounds known in the art, for example glucosamine, sialic acid, α-D-galactosamine, N-acetylgalactosamine, 2-acetamido-2-deoxy-D-galactopyranose (GalNAc), 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose (β-muramic acid), 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose and N-sulfo-D-glucosamine, and N-glycoloyl-α-neuraminic acid. For example, thio sugars may be selected from the group consisting of 5-Thio-β-D-glucopyranose, methyl 2,3,4-tri-O-acetyl-1-thio-6-O-trityl-α-D-glucopyranoside, 4-thio-β-D-galactopyranose, and ethyl 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-gluco-heptopyranoside.

[0330] In certain embodiments, conjugate groups as provided herein comprise a carbohydrate cluster. As used herein, "carbohydrate cluster" means a portion of a conjugate group wherein two or more carbohydrate residues are attached to a branching group through tether groups. (see, e.g., Maier et al., Bioconjug. Chem. 2003, 14, 18-29, or Rensen et al., J. Med. Chem. 2004, 47, 5798-5808, for examples of carbohydrate conjugate clusters).

[0331] As used herein, "modified carbohydrate" means any carbohydrate having one or more chemical modifications relative to naturally occurring carbohydrates.

[0332] As used herein, "carbohydrate derivative" means any compound which may be synthesized using a carbohydrate as a starting material or intermediate.

[0333] As used herein, "carbohydrate" means a naturally occurring carbohydrate, a modified carbohydrate, or a carbohydrate derivative.

[0334] In certain embodiments, conjugate groups are provided wherein the cell-targeting moiety has the formula:

[0335] In certain embodiments, conjugate groups are provided wherein the cell-targeting moiety has the formula:

[0336] In certain embodiments, conjugate groups are provided wherein the cell-targeting moiety has the formula:

[0337] In certain embodiments, conjugate groups have the formula:

[0338] Representative United States patents, United States patent application publications, and international patent application publications that teach the preparation of certain of the above noted conjugates, conjugated oligomeric compounds such as antisense compounds, tethers, conjugate linkers, branching groups, ligands, cleavable moieties as well as other modifications include without limitation, US 5,994,517, US 6,300,319, US 6,660,720, US 6,906,182, US 7,262,177, US 7,491,805, US 8,106,022, US 7,723,509, US 2006/0148740, US 2011/0123520, WO 2013/033230 and WO 2012/037254.

[0339] Representative publications that teach the preparation of certain of the above noted conjugates, conjugated oligomeric compounds such as antisense compounds, tethers, conjugate linkers, branching groups, ligands, cleavable moieties as well as other modifications include without limitation, Biessen et al., J. Med. Chem. 1995, 38, 1846-1852; Biessen et al., J. Med. Chem., 1995, 38, 1538-1546, Lee et al., Bioorg. Med. Chem. 2011, 19, 2494-2500; Rensen et al., J. Biol. Chem. 2001, 276(40), 37577-37584; Rensen et al., J. Med. Chem. 2004, 47, 5798-5808, Sliedregt et al., J. Med. Chem. 1999, 42, 609-618, and Valentijn et al., Tetrahedron 1997, 53(2), 759-770.

[0340] In certain embodiments, conjugated antisense compounds comprise an RNase H based oligonucleotide (such as a gapmer) or a splice modulating oligonucleotide (such as a fully modified oligonucleotide) and any conjugate group comprising at least one, two, or three GalNAc groups. In certain embodiments a conjugated antisense compound comprises any conjugate group found in any of the following references: Lee, Carbohydr Res. 1978, 67, 509-514; Connolly et al., J. Biol. Chem. 1982, 257, 939-945; Pavia et al., Int. J. Pep. Protein Res. 1983, 22, 539-548; Lee et al., Biochem 1984, 23, 4255-4261; Lee et al., Glycoconjugate J. 1987, 4, 317-328; Toyokuni et al., Tetrahedron Lett. 1990, 31, 2673-2676; Biessen et al., J. Med. Chem. 1995, 38, 1538-1546; Valentijn et al., Tetrahedron 1997, 53, 759-770; Kim et al., Tetrahedron Lett. 1997, 38, 3487-3490; Lee et al., Bioconjug. Chem. 1997, 8, 762-765; Kato et al., Glycobiol. 2001, 11, 821-829; Rensen et al., J. Biol. Chem. 2001, 276, 37577-37584; Lee et al., Methods Enzymol. 2003, 362, 38-43; Westerlind et al., Glycoconj. J. 2004, 21, 227-241; Lee et al., Bioorg. Med. Chem. Lett. 2006, 16(19), 5132-5135; Maierhofer et al., Bioorg. Med. Chem. 2007, 15, 7661-7676; Khorev et al., Bioorg. Med. Chem. 2008, 16, 5216-5231; Lee et al., Bioorg. Med. Chem. 2011, 19, 2494-2500; Kornilova et al., Analyt. Biochem. 2012, 425, 43-46; Pujol et al., Angew. Chemie. Int. Ed. Engl. 2012, 51, 7445-7448; Biessen et al., J. Med. Chem. 1995, 38, 1846-1852; Sliedregt et al., J. Med. Chem. 1999, 42, 609-618; Rensen et al., J. Med. Chem. 2004, 47, 5798-5808; Rensen et al., Arterioscler. Thromb. Vasc. Biol. 2006, 26, 169-175; van Rossenberg et al., Gene Ther. 2004, 11, 457-464; Sato et al., J. Am. Chem. Soc. 2004, 126, 14013-14022; Lee et al., J. Org. Chem. 2012, 77, 7564-7571; Biessen et al., FASEB J. 2000, 14, 1784-1792; Rajur et al., Bioconjug. Chem. 1997, 8, 935-940; Duff et al., Methods Enzymol. 2000, 313, 297-321; Maier et al., Bioconjug. Chem. 2003, 14, 18-29; Jayaprakash et al., Org. Lett. 2010, 12, 5410-5413; Manoharan, Antisense Nucleic Acid Drug. Dev. 2002, 12, 103-128; Merwin et al., Bioconjug. Chem. 1994, 5, 612-620; Tomiya et al., Bioorg. Med. Chem. 2013, 21, 5275-5281; International applications WO 1998/013381; WO 2011/038356; WO 1997/046098; WO 2008/098788; WO 2004/101619; WO 2012/037254; WO 2011/120053; WO 2011/100131; WO 2011/163121; WO 2012/177947; WO 2013/033230; WO 2013/075035; WO 2012/083185; WO 2012/083046; WO 2009/082607; WO 2009/134487; WO 2010/144740; WO 2010/148013; WO 1997/020563; WO 2010/088537; WO 2002/043771; WO 2010/129709; WO 2012/068187; WO 2009/126933; WO 2004/024757; WO 2010/054406; WO 2012/089352; WO 2012/089602; WO 2013/166121; WO 2013/165816; U.S. Patents 4,751,219; 8,552,163; 6,908,903; 7,262,177; 5,994,517; 6,300,319; 8,106,022; 7,491,805; 7,491,805; 7,582,744; 8,137,695; 6,383,812; 6,525,031; 6,660,720; 7,723,509; 8,541,548; 8,344,125; 8,313,772; 8,349,308; 8,450,467; 8,501,930; 8,158,601; 7,262,177; 6,906,182; 6,620,916; 8,435,491; 8,404,862; 7,851,615; Published U.S. Patent Application Publications US 2011/0097264; US 2011/0097265; US 2013/0004427; US 2005/0164235; US 2006/0148740; US 2008/0281044; US 2010/0240730; US 2003/0119724; US 2006/0183886; US 2008/0206869; US 2011/0269814; US 2009/0286973; US 2011/0207799; US 2012/0136042; US 2012/0165393; US 2008/0281041; US 2009/0203135; US 2012/0035115; US 2012/0095075; US 2012/0101148; US 2012/0128760; US 2012/0157509; US 2012/0230938; US 2013/0109817; US 2013/0121954; US 2013/0178512; US 2013/0236968; US 2011/0123520; US 2003/0077829; US 2008/0108801; and US 2009/0203132.

[0341] In certain embodiments, oligomeric compounds comprise an oligonucleotide. In certain embodiments, an oligomeric compound comprises an oligonucleotide and one or more conjugate and/or terminal groups. Such conjugate and/or terminal groups may be added to oligonucleotides having any of the motifs discussed above. Thus, for example, an oligomeric compound comprising an oligonucleotide having region of alternating nucleosides may comprise a terminal group.

B. Antisense Compounds

[0342] Oligomeric compounds provided herein are antisense compounds. Such antisense compounds are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity. In certain embodiments, antisense compounds specifically hybridize to one or more target nucleic acid. In certain embodiments, a specifically hybridizing antisense compound has a nucleobase sequence comprising a region having sufficient complementarity to a target nucleic acid to allow hybridization and result in antisense activity and insufficient complementarity to any non-target so as to avoid non-specific hybridization to any non-target nucleic acid sequences under conditions in which specific hybridization is desired (e.g., under physiological conditions for in vivo or therapeutic uses, and under conditions in which assays are performed in the case of in vitro assays).

[0343] In certain embodiments, the present invention provides antisense compounds comprising oligonucleotides that are fully complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, oligonucleotides are 99% complementary to the target nucleic acid. In certain embodiments, oligonucleotides are 95% complementary to the target nucleic acid. In certain embodiments, such oligonucleotides are 90% complementary to the target nucleic acid.

[0344] In certain embodiments, such oligonucleotides are 85% complementary to the target nucleic acid. In certain embodiments, such oligonucleotides are 80% complementary to the target nucleic acid. In certain embodiments, an antisense compound comprises a region that is fully complementary to a target nucleic acid and is at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain such embodiments, the region of full complementarity is from 6 to 14 nucleobases in length.

i. Certain Antisense Activities and Mechanisms

[0345] Antisense mechanisms include any mechanism involving the hybridization of an oligomeric compound with a target nucleic acid, wherein the hybridization results in a biological effect. In certain embodiments, such hybridization results in either target nucleic acid degradation or occupancy with concomitant inhibition or stimulation of the cellular machinery involving, for example, translation, transcription, or splicing of the target nucleic acid.

[0346] Antisense activities may be observed directly or indirectly. In certain embodiments, observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid; a change in the ratio of splice variants of a nucleic acid or protein; and/or a phenotypic change in a cell or animal.

[0347] One type of antisense mechanism involving degradation of target RNA is RNase H mediated antisense. RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex wherein the DNA strand may comprise modified nucleosides at one or more positions. It is known in the art that single-stranded antisense compounds which are "DNA-like" elicit RNase H activity in mammalian cells. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of DNA-like oligonucleotide-mediated inhibition of gene expression. In certain embodiments, the invention provides antisense compounds that are sufficiently "DNA-like" to elicit RNase H activity. Such DNA-like antisense compounds include, but are not limited to gapmers. In certain embodiments, such gapmers comprise 2'-β-D-ribofuranose nucleosides in the gap and modified nucleosides comprising at least modified sugar moieties in the wings.

[0348] Antisense mechanisms also include, without limitation RNAi mechanisms, which utilize the RISC pathway. Such RNAi mechanisms include, without limitation siRNA, ssRNA and microRNA mechanisms. Such mechanisms include creation of a microRNA mimic and/or an anti-microRNA.

[0349] Antisense mechanisms also include, without limitation, mechanisms that hybridize or mimic non-coding RNA other than microRNA or mRNA. Such non-coding RNA includes, but is not limited to promoter-directed RNA and short and long RNA that effects transcription or translation of one or more nucleic acids.

[0350] In certain embodiments, antisense compounds specifically hybridize when there is a sufficient degree of complementarity to avoid non-specific binding of the antisense compound to non-target nucleic acid sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, and under conditions in which assays are performed in the case of in vitro assays.

[0351] In certain embodiments, compounds comprising oligonucleotides having a gapmer nucleoside motif described herein have desirable properties compared to non-gapmer oligonucleotides or to gapmers having other motifs. In certain circumstances, it is desirable to identify motifs resulting in a favorable combination of potent antisense activity and relatively low toxicity. In certain embodiments, compounds of the present invention have a favorable therapeutic index (measure of potency divided by measure of toxicity).

ii. Selective Antisense Compounds

[0352] In certain embodiments, antisense compounds provided herein are selective for a target relative to a non-target nucleic acid. In certain embodiments, the nucleobase sequences of the target and non-target nucleic acids differ by no more than 4 differentiating nucleobases in the targeted region. In certain embodiments, the nucleobase sequences of the target and non-target nucleic acids differ by no more than 3 differentiating nucleobases in the targeted region. In certain embodiments, the nucleobase sequences of the target and non-target nucleic acids differ by no more than 2 differentiating nucleobases in the targeted region. In certain embodiments, the nucleobase sequences of the target and non-target nucleic acids differ by a single differentiating nucleobase in the targeted region. In certain embodiments, the target and non-target nucleic acids are transcripts from different genes. In certain embodiments, the target and non-target nucleic acids are different alleles for the same gene.

[0353] Selectivity of antisense compounds is achieved, principally, by nucleobase complementarity. For example, if an antisense compound has no mismatches for a target nucleic acid and one or more mismatches for a non-target nucleic acid, some amount of selectivity for the target nucleic acid will result. In certain embodiments, provided herein are antisense compounds with enhanced selectivity (i.e. the ratio of activity for the target to the activity for non-target is greater). For example, in certain embodiments, a selective nucleoside comprises a particular feature or combination of features (e.g., chemical modification, motif, placement of selective nucleoside, and/or self-complementary region) that increases selectivity of an antisense compound compared to an antisense compound not having that feature or combination of features. In certain embodiments, such feature or combination of features increases antisense activity for the target. In certain embodiments, such feature or combination of features decreases activity for the target, but decreases activity for the non-target by a greater amount, thus resulting in an increase in selectivity.

[0354] Without being limited by mechanism, enhanced selectivity may result from a larger difference in the affinity of an antisense compound for its target compared to its affinity for the non-target and/or a larger difference in RNase H activity for the resulting duplexes. For example, in certain embodiments, a selective antisense compound comprises a modified nucleoside at that same position as a differentiating nucleobase (i.e., the selective nucleoside is modified). That modification may increase the difference in binding affinity of the antisense compound for the target relative to the non-target. In addition or in the alternative, the chemical modification may increase the difference in RNAse H activity for the duplex formed by the antisense compound and its target compared to the RNase activity for the duplex formed by the antisense compound and the non-target. For example, the modification may exaggerate a structure that is less compatible for RNase H to bind, cleave and/or release the non-target.

[0355] Antisense compounds having certain specified motifs have enhanced selectivity, including, but not limited to motifs described above. In certain embodiments, enhanced selectivity is achieved by oligonucleotides comprising any one or more of:

a modification motif comprising a long 5'-wing (longer than 5, 6, or 7 nucleosides);

a modification motif comprising a long 3'-wing (longer than 5, 6, or 7 nucleosides);

a modification motif comprising a short gap region (shorter than 8, 7, or 6 nucleosides); and

a modification motif comprising an interrupted gap region (having no uninterrupted stretch of unmodified 2'-deoxynucleosides longer than 7, 6 or 5).

a. Certain Selective Nucleobase Sequence Elements

[0356] In certain embodiments, selective antisense compounds comprise nucleobase sequence elements. Such nucleobase sequence elements are independent of modification motifs. Accordingly, oligonucleotides having any of the motifs (modification motifs, nucleoside motifs, sugar motifs, nucleobase modification motifs, and/or linkage motifs) may also comprise one or more of the following nucleobase sequence elements.

1. Alignment of Differentiating Nucleobase/Target-Selective Nucleoside

[0357] In certain embodiments, a target region and a region of a non-target nucleic acid differ by 1-4 differentiating nucleobase. In such embodiments, selective antisense compounds have a nucleobase sequence that aligns with the non-target nucleic acid with 1-4 mismatches. A nucleoside of the antisense compound that corresponds to a differentiating nucleobase of the target nucleic acid is referred to herein as a target-selective nucleoside. In certain embodiments, selective antisense compounds having a gapmer motif align with a non-target nucleic acid, such that a target-selective nucleoside is positioned in the gap. In certain embodiments, a target-selective nucleoside is the 1^st nucleoside of the gap from the 5' end. In certain embodiments, a target-selective nucleoside is the 2^nd nucleoside of the gap from the 5' end. In certain embodiments, a target-selective nucleoside is the 3^rd nucleoside of the gap from the 5'-end. In certain embodiments, a target-selective nucleoside is the 4^th nucleoside of the gap from the 5 '-end. In certain embodiments, a target-selective nucleoside is the 5^th nucleoside of the gap from the 5'-end. In certain embodiments, a target-selective nucleoside is the 6^rd nucleoside of the gap from the 5'-end. In certain embodiments, a target-selective nucleoside is the 8^th nucleoside of the gap from the 3'-end. In certain embodiments, a target-selective nucleoside is the 7^th nucleoside of the gap from the 3'-end. In certain embodiments, a target-selective nucleoside is the 6^th nucleoside of the gap from the 3'-end. In certain embodiments, a target-selective nucleoside is the 5^th nucleoside of the gap from the 3'-end. In certain embodiments, a target-selective nucleoside is the 4^th nucleoside of the gap from the 3'-end. In certain embodiments, a target-selective nucleoside is the 3^rd nucleoside of the gap from the 3'-end. In certain embodiments, a target-selective nucleoside is the 2^nd nucleoside of the gap from the 3'-end.

2. Mismatches to the Target Nucleic Acid

[0358] In certain embodiments, selective antisense compounds comprise one or more mismatched nucleobases relative to the target nucleic acid. In certain such embodiments, antisense activity against the target is reduced by such mismatch, but activity against the non-target is reduced by a greater amount. Thus, in certain embodiments selectivity is improved. Any nucleobase other than the differentiating nucleobase is suitable for a mismatch. In certain embodiments, however, the mismatch is specifically positioned within the gap of an oligonucleotide having a gapmer motif. In certain embodiments, a mismatch relative to the target nucleic acid is at positions 1, 2, 3, 4, 5, 6, 7, or 8 from the 5'-end of the gap region. In certain embodiments, a mismatch relative to the target nucleic acid is at positions 9, 8, 7, 6, 5, 4, 3, 2, 1 of the antisense compounds from the 3'-end of the gap region. In certain embodiments, a mismatch relative to the target nucleic acid is at positions 1, 2, 3, or 4 of the antisense compounds from the 5'-end of the wing region. In certain embodiments, a mismatch relative to the target nucleic acid is at positions 4, 3, 2, or 1 of the antisense compounds from the 3 '-end of the wing region.

3. Self Complementary Regions

[0359] In certain embodiments, selective antisense compounds comprise a region that is not complementary to the target. In certain embodiments, such region is complementary to another region of the antisense compound. Such regions are referred to herein as self-complementary regions. For example, in certain embodiments, an antisense compound has a first region at one end that is complementary to a second region at the other end. In certain embodiments, one of the first and second regions is complementary to the target nucleic acid. Unless the target nucleic acid also includes a self-complementary region, the other of the first and second region of the antisense compound will not be complementary to the target nucleic acid. For illustrative purposes, certain antisense compounds have the following nucleobase motif:

ABCXXXXXXXXXC'B'A';

ABCXXXXXXX(X/C')(X/B')(X/A');

(X/A)(X/B)(X/C)XXXXXXXXXC'B'A'

where each of A, B, and C are any nucleobase; A', B', and C' are the complementary bases to A, B, and C, respectively; each X is a nucleobase complementary to the target nucleic acid; and two letters in parentheses (e.g., (X/C')) indicates that the nucleobase is complementary to the target nucleic acid and to the designated nucleoside within the antisense oligonucleotide.

[0360] Without being bound to any mechanism, in certain embodiments, such antisense compounds are expected to form self-structure, which is disrupted upon contact with a target nucleic acid. Contact with a non-target nucleic acid is expected to disrupt the self-structure to a lesser degree, thus increasing selectivity compared to the same antisense compound lacking the self-complementary regions.

4. Combinations of features

[0361] Though it is clear to one of skill in the art, the above motifs and other elements for increasing selectivity may be used alone or in combination. For example, a single antisense compound may include any one, two, three, or more of: self-complementary regions, a mismatch relative to the target nucleic acid, a short nucleoside gap, an interrupted gap, and specific placement of the selective nucleoside.

C. Certain Target Nucleic Acids

[0362] In certain embodiments, antisense compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid is a non-coding RNA. In certain such embodiments, the target non-coding RNA is selected from: a long-non-coding RNA, a short non-coding RNA, an intronic RNA molecule, a snoRNA, a scaRNA, a microRNA (including pre-microRNA and mature microRNA), a ribosomal RNA, and promoter directed RNA. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from: an mRNA and a pre-mRNA, including intronic, exonic and untranslated regions. In certain embodiments, oligomeric compounds are at least partially complementary to more than one target nucleic acid. For example, antisense compounds of the present invention may mimic microRNAs, which typically bind to multiple targets.

[0363] In certain embodiments, the target nucleic acid is a nucleic acid other than a mature mRNA. In certain embodiments, the target nucleic acid is a nucleic acid other than a mature mRNA or a microRNA. In certain embodiments, the target nucleic acid is a non-coding RNA other than a microRNA. In certain embodiments, the target nucleic acid is a non-coding RNA other than a microRNA or an intronic region of a pre-mRNA. In certain embodiments, the target nucleic acid is a long non-coding RNA. In certain embodiments, the target RNA is an mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain such embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron/exon junction. In certain embodiments, the target region is at least 50% within an intron. In certain embodiments, the target nucleic acid is selected from among non-coding RNA, including exonic regions of pre-mRNA. In certain embodiments, the target nucleic acid is a ribosomal RNA (rRNA). In certain embodiments, the target nucleic acid is a non-coding RNA associated with splicing of other pre-mRNAs. In certain embodiments, the target nucleic acid is a nuclear-retained non-coding RNA.

[0364] In certain embodiments, antisense compounds described herein are complementary to a target nucleic acid comprising a single-nucleotide polymorphism. In certain such embodiments, the antisense compound is capable of modulating expression of one allele of the single-nucleotide polymorphism-containing-target nucleic acid to a greater or lesser extent than it modulates another allele. In certain embodiments an antisense compound hybridizes to a single-nucleotide polymorphism-containing-target nucleic acid at the single-nucleotide polymorphism site. In certain embodiments, the target nucleic acid is a Huntingtin gene transcript. In certain embodiments, the target nucleic acid is a single-nucleotide polymorphism-containing-target nucleic acid of a Huntingtin gene transcript. In certain embodiments, the target nucleic acid is not a Huntingtin gene transcript. In certain embodiments, the target nucleic acid is a single-nucleotide polymorphism-containing-target nucleic acid of a gene transcript other than Huntingtin. In certain embodiments, the target nucleic acid is any nucleic acid other than a Huntingtin gene transcript.

i. Single-Nucleotide Polymorphism

[0365] Embodiments of the present invention provide compounds and compositions, and compounds and compositions for use in methods for selectively inhibiting mRNA and protein expression of an allelic variant of a particular gene or DNA sequence. In certain embodiments, the allelic variant contains a single nucleotide polymorphism (SNP). In certain embodiments, a SNP is associated with a mutant allele. In certain embodiments, a mutant SNP is associated with a disease. In certain embodiments a mutant SNP is associated with a disease, but is not causative of the disease. In certain embodiments, mRNA and protein expression of a mutant allele is associated with disease.

[0366] In certain embodiments, the expressed gene product of a mutant allele results in aggregation of the mutant proteins causing disease. In certain embodiments, the expressed gene product of a mutant allele results in gain of function causing disease. In certain embodiments, genes with an autosomal dominant mutation resulting in a toxic gain of function of the protein are the APP gene encoding amyloid precursor protein involved in Alzheimer's disease (Feng et al., Gene 2006, 371(1), 68-74); the PrP gene encoding prion protein involved in Creutzfeldt-Jakob disease and in fatal familial insomnia (Chen et al., Nat. Med. 1997, 3, 1009-1015); GFAP gene encoding glial fibrillary acidic protein involved in Alexander disease (Hagemann et al., J. Neurosci. 2006, 26(43), 11162-11173); alpha-synuclein gene encoding alpha-synuclein protein involved in Parkinson's disease (Dawson et al., J. Clin. Invest. 2003, 111(2), 145-151); SOD-1 gene encoding the SOD-1 protein involved in amyotrophic lateral sclerosis (Bruijn et al., Science 1998, 281(5384), 1851-1854); atrophin-1 gene encoding atrophin-1 protein involved in dentato-rubral and pallido-luysian atrophy (DRPA) (Margolis et al., Trends Mol. Med. 2001, 7, 479-482); SCA1 gene encoding ataxin-1 protein involved in spino-cerebellar ataxia-1 (SCA1) (Sen et al., Protein Sci. 2003, 12(5), 953-962); PLP gene encoding proteolipid protein involved in Pelizaeus-Merzbacher disease (Gow et al., Neuromolecular Med. 2003, 4, 73-94); DYT1 gene encoding torsinA protein involved in Torsion dystonia (Shashidharan et al., Brain Res. 2000, 877(2), 379-381); and alpha-B crystalline gene encoding alpha-B crystalline protein involved in protein aggregation diseases, including cardiomyopathy (Rajasekaran et al., Cell 2007, 130, 427-439); alphal-antitrypsin gene encoding alpha 1-antitrypsin protein involved in chronic obstructive pulmonary disease (COPD), liver disease and hepatocellular carcinoma (Carrell et al., N. Engl. J. Med. 2002, 346, 45-53); Ltk gene encoding leukocyte tyrosine kinase protein involved in systemic lupus erythematosus (Li et al., Hum. Mol. Gen. 2004, 13(2), 171-179); PCSK9 gene encoding PCSK9 protein involved in hypercholesterolemia (Abifadel et al., Hum. Mutat. 2009, 30(4), 520-529); prolactin receptor gene encoding prolactin receptor protein involved in breast tumors (Bogorad et al., Proc. Natl. Acad. Sci. U.S.A. 2008, 105(38), 14533-14538); CCL5 gene encoding the chemokine CCL5 involved in COPD and asthma (Hizawa et al., Eur. Respir. J. 2008, 32, 372-378); PTPN22 gene encoding PTPN22 protein involved in Type 1 diabetes, Rheumatoid arthritis, Graves disease, and SLE (Yu et al., Proc. Natl. Acad. Sci. U.S.A. 2007, 104, 19767-19772); androgen receptor gene encoding the androgen receptor protein involved in spinal and bulbar muscular atrophy or Kennedy's disease (Palazzolo et al., J. Steroid Biochem. Mol. Biol. 2008, 108(3-5), 245-253); CHMP4B gene encoding chromatin modifying protein-4B involved in progressive childhood posterior subcapsular cataracts (Shiels et al., Am. J. Hum. Genet. 2007, 81(3), 596-606); FXR / NR1H4 gene encoding Farnesoid X receptor protein involved in cholesterol gallstone disease, arthrosclerosis and diabetes (Marzolini et al., Mol. Endocrinol. 2007, 21(8), 1769-1780); ABCA1 gene encoding ABCA1 protein involved in cardiovascular disease (Mantaring et al., Transl. Res. 2007, 149(4), 205-210); CaSR gene encoding the calcium sensing receptor protein involved in primary hypercalciuria (Vezzoli et al., Kidney Int. 2007, 71, 1155-1162); alpha-globin gene encoding alpha-globin protein involved in alpha-thallasemia (De Gobbi et al., Science 2006, 312(5777), 1215-1217); httlpr gene encoding HTTLPR protein involved in obsessive compulsive disorder (Xian-Zhang et al., Am. J. Hum. Genet. 2006, 78(5), 815-826); AVP gene encoding arginine vasopressin protein in stress-related disorders such as anxiety disorders and comorbid depression (Landgraf, CNS Neurol. Disord. Drug Targets 2006, 5(2), 167-179); GNAS gene encoding G proteins involved in congenital visual defects, hypertension, metabolic syndrome (Weinstein et al., Trends Pharmacol. Sci. 2006, 27(5), 260-266); APAF1 gene encoding APAF1 protein involved in a predisposition to major depression (Harlan et al., Mol. Psychiatry 2006, 11(1), 76-85); TGF-betal gene encoding TGF-betal protein involved in breast cancer and prostate cancer (Ewart-Toland et al., Cancer Epidemiol. Biomarkers Prev. 2004, 13(5), 759-764); AChR gene encoding acetylcholine receptor involved in congentialmyasthenic syndrome (Webster et al., Neurology 2004, 62(7), 1090-1096); P2Y12 gene encoding adenosine diphosphate (ADP) receptor protein involved in risk of peripheral arterial disease (Fontana et al., Circulation 2003, 108, 2971-2973); LQT1 gene encoding LQT1 protein involved in atrial fibrillation (Lai et al., Cardiology 2003, 100, 109-113); RET protooncogene encoding RET protein involved in sporadic pheochromocytoma (McWhinney et al., J. Clin. Endocrinol. Metab. 2003, 88(10), 4911-4916); filamin A gene encoding filamin A protein involved in various congenital malformations (Robertson et al., Nat. Genet. 2003, 33(4), 487-491); TARDBP gene encoding TDP-43 protein involved in amyotrophic lateral sclerosis (Kabashi et al., Hum. Mol. Genet. 2010, 19(4), 671-683); SCA3 gene encoding ataxin-3 protein involved in Machado-Joseph disease (Alves et al., PLoS One 2008, 3(10), e3341); SCA7 gene encoding ataxin-7 protein involved in spino-cerebellar ataxia-7 (Scholefield et al., PLoS One 2009, 4(9), e7232); and HTT gene encoding huntingtin protein involved in Huntington's disease (Persichetti et al., Neurobiol. Dis. 1996, 3(3), 183-190); and the CA4 gene encoding carbonic anhydrase 4 protein, CRX gene encoding cone-rod homeobox transcription factor protein, FSCN2 gene encoding retinal fascin homolog 2 protein, IMPDH1 gene encoding inosine monophosphate dehydrogenase 1 protein, NR2E3 gene encoding nuclear receptor subfamily 2 group E3 protein, NRL gene encoding neural retina leucine zipper protein, PRPF3 (RP18) gene encoding pre-mRNA splicing factor 3 protein, PRPF8 (RP13) gene encoding pre-mRNA splicing factor 8 protein, PRPF31 (RP11) gene encoding pre-mRNA splicing factor 31 protein, RDS gene encoding peripherin 2 protein, ROM1 gene encoding rod outer membrane protein 1 protein, RHO gene encoding rhodopsin protein, RP1 gene encoding RP1 protein, RPGR gene encoding retinitis pigmentosa GTPase regulator protein, all of which are involved in Autosomal Dominant Retinitis Pigmentosa disease (Daiger et al., Adv. Exp. Med. Biol. 2008, 613, 203-209)

[0367] In certain embodiments, the mutant allele is associated with any disease from the group consisting of Alzheimer's disease, Creutzfeldt-Jakob disease, fatal familial insomnia, Alexander disease, Parkinson's disease, amyotrophic lateral sclerosis, dentato-rubral and pallido-luysian atrophy DRPA, spino-cerebellar ataxia, Torsion dystonia, cardiomyopathy, chronic obstructive pulmonary disease (COPD), liver disease, hepatocellular carcinoma, systemic lupus erythematosus, hypercholesterolemia, breast cancer, asthma, Type 1 diabetes, Rheumatoid arthritis, Graves disease, SLE, spinal and bulbar muscular atrophy, Kennedy's disease, progressive childhood posterior subcapsular cataracts, cholesterol gallstone disease, arthrosclerosis, cardiovascular disease, primary hypercalciuria, alpha-thallasemia, obsessive compulsive disorder, Anxiety, comorbid depression, congenital visual defects, hypertension, metabolic syndrome, prostate cancer, congentialmyasthenic syndrome, peripheral arterial disease, atrial fibrillation, sporadic pheochromocytoma, congenital malformations, Machado-Joseph disease, Huntington's disease, and Autosomal Dominant Retinitis Pigmentosa disease.

a. Certain Huntingtin Targets

[0368] In certain embodiments, an allelic variant of huntingtin is selectively reduced. Nucleotide sequences that encode huntingtin include, without limitation, the following: GENBANK Accession No. NT_006081.18, truncated from nucleotides 1566000 to 1768000 (replaced by GENBANK Accession No. NT_006051), incorporated herein as SEQ ID NO: 1, and NM_002111.6, incorporated herein as SEQ ID NO: 2.

[0369] Table 3 provides SNPs found in the GM04022, GM04281, GM02171, and GM02173B cell lines. Also provided are the allelic variants found at each SNP position, the genotype for each of the cell lines, and the percentage of HD patients having a particular allelic variant. For example, the two allelic variants for SNP rs6446723 are T and C. The GM04022 cell line is heterozygous TC, the GM02171 cell line is homozygous CC, the GM02173 cell line is heterozygous TC, and the GM04281 cell line is homozygous TT. Fifty percent of HD patients have a T at SNP position rs6446723.

Table 3

Allelic Variations for SNPs Associated with HD
SNP	Variation	GM04022	GM02171	GM02173	GM04281	TargetPOP	allele
rs6446723	T/C	TC	CC	TC	TT	0.50	T
rs3856973	A/G	AG	AA	AG	GG	0.50	G
rs2285086	A/G	AG	GG	AG	AA	0.50	A
rs363092	A/C	AC	AA	AC	CC	0.49	C
rs916171	C/G	GC	GG	GC	CC	0.49	C
rs6844859	T/C	TC	CC	TC	TT	0.49	T
rs7691627	A/G	AG	AA	AG	GG	0.49	G
rs4690073	A/G	AG	AA	AG	GG	0.49	G
rs2024115	A/G	AG	GG	AG	AA	0.48	A
rs1 1731237	T/C	CC	CC	TC	TT	0.43	T
rs362296	A/C	CC	AC	AC	AC	0.42	C
rs10015979	A/G	AA	AA	AG	GG	0.42	G
rs7659144	C/G	CG	CG	CG	CC	0.41	C
rs363096	T/C	CC	CC	TC	TT	0.40	T
rs362273	A/G	AA	AG	AG	AA	0.39	A
rs16843804	T/C	CC	TC	TC	CC	0.38	C
rs362271	A/G	GG	AG	AG	GG	0.38	G
rs362275	T/C	CC	TC	TC	CC	0.38	C
rs3121419	T/C	CC	TC	TC	CC	0.38	C
rs362272	A/G	GG	--	AG	GG	0.38	G
rs3775061	A/G	AA	AG	AG	AA	0.38	A
rs34315806	T/C	CC	TC	TC	CC	0.38	C
rs363099	T/C	CC	TC	TC	CC	0.38	C
rs2298967	T/C	TT	TC	TC	TT	0.38	T
rs363088	A/T	AA	TA	TA	AA	0.38	A
rs363064	T/C	CC	TC	TC	CC	0.35	C
rs363102	A/G	AG	AA	AA	AA	0.23	G
rs2798235	A/G	AG	GG	GG	GG	0.21	A
rs363080	T/C	TC	CC	CC	CC	0.21	T
rs363072	A/T	TA	TA	AA	AA	0.13	A
rs363125	A/C	AC	AC	CC	CC	0.12	C
rs362303	T/C	TC	TC	CC	CC	0.12	C
rs362310	T/C	TC	TC	CC	CC	0.12	C
rs10488840	A/G	AG	AG	GG	GG	0.12	G
rs362325	T/C	TC	TC	TT	TT	0.11	T
rs35892913	A/G	GG	GG	GG	GG	0.10	A
rs363102	A/G	AG	AA	AA	AA	0.09	A
rs363096	T/C	CC	CC	TC	TT	0.09	C
rs1 1731237	T/C	CC	CC	TC	TT	0.09	C
rs10015979	A/G	AA	AA	AG	GG	0.08	A
rs363080	T/C	TC	CC	CC	CC	0.07	C
rs2798235	A/G	AG	GG	GG	GG	0.07	G
rs1936032	C/G	GC	CC	CC	CC	0.06	C
rs2276881	A/G	GG	GG	GG	GG	0.06	G
rs363070	A/G	AA	AA	AA	AA	0.06	A
rs35892913	A/G	GG	GG	GG	GG	0.04	G
rs12502045	T/C	CC	CC	CC	CC	0.04	C
rs6446723	T/C	TC	CC	TC	TT	0.04	C
rs7685686	A/G	AG	GG	AG	AA	0.04	G
rs3733217	T/C	CC	CC	CC	CC	0.03	C
rs6844859	T/C	TC	CC	TC	TT	0.03	C
rs362331	T/C	TC	CC	TC	TT	0.03	C

ii. Single-stranded RNAi compounds

[0370] In certain embodiments, oligomeric compounds as provided herein are particularly suited for use as single-stranded antisense compounds. In certain such embodiments, such oligomeric compounds are single-stranded RNAi (ssRNA) compounds. In certain embodiments, such oligomeric compounds are ssRNA compounds or microRNA mimics. In certain embodiments, ssRNA compounds comprise a 5'-stabilized nucleoside such as a 5'-terminal nucleosides described herein that provide enhanced nuclease resistance to such ssRNA compounds. Certain such 5'-terminal nucleosides are disclosed having a 5'-phosphate group wherein the 5'-nucleoside is modified to provide the enhanced stability. Certain such 5'-terminal nucleosides are disclosed wherein a 5'-phosphorus moiety provides the enhanced stability. Certain such 5'-terminal nucleosides are disclosed wherein a 5'-phosphorus moiety in combination with the modified 5'-nucleoside provides the enhanced stability. In certain embodiments, the 5'-terminal nucleoside provides enhanced RISC loading. In certain embodiments, the 3'-terminal nucleoside(s) is also selected to provide enhanced stability.

[0371] In certain instances, a single-stranded oligomeric compound comprising a 5'-phosphorous moiety is desired. For example, in certain embodiments, such 5'-phosphorous moiety is necessary or useful for RNAi compounds, particularly, ssRNA compounds. In such instances, it is further desirable to stabilize the phosphorous moiety against degradation or de-phosphorylation, which may inactivate the compound. Further, it is desirable to stabilize the entire 5'-nucleoside from degradation, which could also inactivate the compound. Thus, in certain embodiments, oligonucleotides in which both the 5 '-phosphorous moiety and the 5 '-nucleoside have been stabilized are desired. In certain embodiments, modified nucleosides are disclosed that may be placed at the 5 '-end of an oligomeric compound, resulting in stabilized phosphorous and or stabilized nucleoside. In certain such embodiments, the phosphorous moiety is resistant to removal in biological systems, relative to unmodified nucleosides and/or the 5'-nucleoside is resistant to cleavage by nucleases. In certain embodiments, such nucleosides are modified at one, at two or at all three of: the 2'-position, the 5'-position, and at the phosphorous moiety. Such modified nucleosides may be incorporated at the 5'-end of an oligomeric compound. Certain 5'-stabilized nucleosides comprising a 5'-phosphate, 5'-phosphorus moiety, modified 5'-nucleoside or combinations thereof have been previously disclosed (see US published applications US 2013/033961 and US 2013/0084576).

[0372] In certain embodiments, ssRNA oligomeric compounds comprise at least one modification at or between positions 6, 7 and 8 of the oligomeric compound (from the 5'-end) in addition to a 5'-terminal stabilizing nucleoside as described herein. Modification at or between positions 6, 7 and 8 is expected to alleviate distortion at position 6 which was observed from crystal structure data of an ssRNA Ago-2 complex. Chemical modifications in and or near this observed distortion is expected to improve one or more properties of the ssRNA oligomeric compound. Such properties, include, but are not limited to pharmakodynamic, pharmacokinetic, binding, absorption, cellular distribution, cellular uptake, charge and clearance. In certain embodiments, it is expected that chemical modification at or between positions 6, 7 and 8 will improve the loading of the ssRNA oligomeric compounds provided herein to Ago-2 protein and therefore improve slicer activity of the ssRNA oligomeric compound. Although certain oligomeric compounds as provided herein have particular use as single-stranded compounds, such compounds may also be paired with a second strand to create a double-stranded oligomeric compound.

[0373] In certain embodiments, oligomeric compounds as provided herein bind and/or activate one or more nucleases. In certain embodiments, such binding and/or activation ultimately results in antisense activity. In certain embodiments, an oligomeric compound of the invention interacts with a target nucleic acid and with a nuclease, resulting in activation of the nuclease and cleavage of the target nucleic acid. In certain embodiments, an oligomeric compound of the invention interacts with a target nucleic acid and with a nuclease, resulting in activation of the nuclease and inactivation of the target nucleic acid. In certain embodiments, an oligomeric compound of the invention forms a duplex with a target nucleic acid and that duplex activates a nuclease, resulting in cleavage and/or inactivation of one or both of the oligomeric compound and the target nucleic acid. In certain embodiments, an oligomeric compound of the invention binds and/or activates a nuclease and the bound and/or activated nuclease cleaves or inactivates a target nucleic acid. Nucleases include, but are not limited to, ribonucleases (nucleases that specifically cleave ribonucleotides), double-strand nucleases (nucleases that specifically cleave one or both strands of a double-stranded duplex), and double-strand ribonucleases. For example, nucleases include, but are not limited to RNase H, an argonaute protein (including, but not limited to Ago2), and dicer.

[0374] In certain embodiments, oligomeric compounds as provided herein interact with an argonaute protein (Ago). In certain embodiments, such oligomeric compounds first enter the RISC pathway by interacting with another member of the pathway (e.g., dicer). In certain embodiments, oligomeric compounds first enter the RISC pathway by interacting with Ago. In certain embodiments, such interaction ultimately results in antisense activity. In certain embodiments, the invention provides oligomeric compounds for use in methods of activating Ago comprising contacting Ago with an oligomeric compound. In certain embodiments, such oligomeric compounds comprise a modified 5'-phosphate group. In certain embodiments, the invention provides oligomeric compounds for use in methods of modulating the expression or amount of a target nucleic acid in a cell comprising contacting the cell with an oligomeric compound capable of activating Ago, ultimately resulting in cleavage of the target nucleic acid. In certain embodiments, the cell is in an animal. In certain embodiments, the cell is in vitro. In certain embodiments, the methods are performed in the presence of manganese. In certain embodiments, the manganese is endogenous. In certain embodiment the methods are performed in the absence of magnesium. In certain embodiments, the Ago is endogenous to the cell. In certain such embodiments, the cell is in an animal. In certain embodiments, the Ago is human Ago. In certain embodiments, the Ago is Ago2. In certain embodiments, the Ago is human Ago2.

[0375] In certain embodiments, oligomeric compounds as provided herein interact with the enzyme dicer. In certain such embodiments, oligomeric compounds bind to dicer and/or are cleaved by dicer. In certain such embodiments, such interaction with dicer ultimately results in antisense activity. In certain embodiments, the dicer is human dicer. In certain embodiments, oligomeric compounds that interact with dicer are double-stranded oligomeric compounds. In certain embodiments, oligomeric compounds that interact with dicer are single-stranded oligomeric compounds. In embodiments in which a double-stranded oligomeric compound interacts with dicer, such double-stranded oligomeric compound forms a dicer duplex. In certain embodiments, any oligomeric compound described herein may be suitable as one or both strands of a dicer duplex. In
certain embodiments, each strand of the dicer duplex is an oligomeric compound of the present invention. In certain embodiments, one strand of the dicer duplex is an oligomeric compound of the present invention and the other strand is any modified or unmodified oligomeric compound. In certain embodiments, one strand of a dicer duplex is an antisense oligomeric compound and the other strand is its sense complement.

[0376] In certain embodiments, the dicer duplex comprises a 3'-overhang at one or both ends. In certain embodiments, such overhangs are additional nucleosides. In certain embodiments, the dicer duplex comprises a 3' overhang on the sense oligonucleotide and not on the antisense oligonucleotide. In certain embodiments, the dicer duplex comprises a 3' overhang on the antisense oligonucleotide and not on the sense oligonucleotide. In certain embodiments, 3'overhangs of a dicer duplex comprise 1-4 nucleosides. In certain embodiments, such overhangs comprise two nucleosides. In certain embodiments, the nucleosides in the 3'-overhangs comprise purine nucleobases. In certain embodiments, the nucleosides in the 3' overhangs comprise adenine nucleobases. In certain embodiments, the nucleosides in the 3' overhangs comprise pyrimidines. In certain embodiments, dicer duplexes comprising 3 '-purine overhangs are more active as antisense compounds than dicer duplexes comprising 3' pyrimidine overhangs. In certain embodiments, oligomeric compounds of a dicer duplex comprise one or more 3' deoxy nucleosides. In certain such embodiments, the 3' deoxy nucleosides are dT nucleosides.

[0377] In certain embodiments, the 5' end of each strand of a dicer duplex comprises a phosphorus moiety. In certain embodiments the antisense strand of a dicer duplex comprises a phosphorus moiety and the sense strand of the dicer duplex does not comprise a phosphorus moiety. In certain embodiments the sense strand of a dicer duplex comprises a phosphorus moiety and the antisense strand of the dicer duplex does not comprise a phosphorus moiety. In certain embodiments, a dicer duplex does not comprise a phosphorus moiety at the 3' end. In certain embodiments, a dicer duplex is cleaved by dicer. In such embodiments, dicer duplexes do not comprise 2'-OMe modifications on the nucleosides at the cleavage site. In certain embodiments, such cleavage site nucleosides are RNA.

[0378] In certain embodiments, interaction of an oligomeric compound with dicer ultimately results in antisense activity. In certain embodiments, dicer cleaves one or both strands of a double-stranded oligomeric compound and the resulting product enters the RISC pathway, ultimately resulting in antisense activity. In certain embodiments, dicer does not cleave either strand of a double-stranded oligomeric compound, but nevertheless facilitates entry into the RISC pathway and ultimately results in antisense activity. In certain embodiments, dicer cleaves a single-stranded oligomeric compound and the resulting product enters the RISC pathway, ultimately resulting in antisense activity. In certain embodiments, dicer does not cleave the single-stranded oligomeric compound, but nevertheless facilitates entry into the RISC pathway and ultimately results in antisense activity.

[0379] In certain embodiments, the invention provides oligomeric compounds for use in methods of activating dicer comprising contacting dicer with an oligomeric compound. In certain such embodiments, the dicer is in a cell. In certain such embodiments, the cell is in an animal.

a. Dicer

[0380] In certain embodiments, oligomeric compounds as provided herein interact with the enzyme dicer. In certain such embodiments, oligomeric compounds bind to dicer and/or are cleaved by dicer. In certain such embodiments, such interaction with dicer ultimately results in antisense activity. In certain embodiments, the dicer is human dicer. In certain embodiments, oligomeric compounds that interact with dicer are double-stranded oligomeric compounds. In certain embodiments, oligomeric compounds that interact with dicer are single-stranded oligomeric compounds. In certain embodiments, oligomeric compounds that interact with dicer are single-stranded RNAi compounds.

[0381] In embodiments in which a double-stranded oligomeric compound interacts with dicer, such double-stranded oligomeric compound forms a dicer duplex. In certain embodiments, any oligomeric compound described herein may be suitable as one or both strands of a dicer duplex. In certain embodiments, each strand of the dicer duplex is an oligomeric compound of the present invention. In certain embodiments, one strand of the dicer duplex is an oligomeric compound of the present invention and the other strand is any modified or unmodified oligomeric compound. In certain embodiments, one strand of a dicer duplex is an antisense oligomeric compound and the other strand is its sense complement.

[0382] In certain embodiments, the invention provides single-stranded oligomeric compounds that interact with dicer. In certain embodiments, such single-stranded dicer compounds comprise a 5'-stabilized nucleoside. In certain embodiments, single-stranded dicer compounds do not comprise a phosphorous moiety at the 3'-end. In certain embodiments, such single-stranded dicer compounds may comprise a 3'-overhangs. In certain embodiments, such 3'-overhangs are additional nucleosides. In certain embodiments, such 3'-overhangs comprise 1-4 additional nucleosides that are not complementary to a target nucleic acid and/or are differently modified from the adjacent 3' nucleoside of the oligomeric compound. In certain embodiments, a single-stranded oligomeric compound comprises an antisense oligonucleotide having two 3'-end overhang nucleosides wherein the overhang nucleosides are adenine or modified adenine nucleosides. In certain embodiments, single stranded oligomeric compounds that interact with dicer comprise a 5'-stabilized nucleoside.

[0383] In certain embodiments, interaction of an oligomeric compound with dicer ultimately results in antisense activity. In certain embodiments, dicer cleaves one or both strands of a double-stranded oligomeric compound and the resulting product enters the RISC pathway, ultimately resulting in antisense activity. In certain embodiments, dicer does not cleave either strand of a double-stranded oligomeric compound, but nevertheless facilitates entry into the RISC pathway and ultimately results in antisense activity. In certain embodiments, dicer cleaves a single-stranded oligomeric compound and the resulting product enters the RISC pathway, ultimately resulting in antisense activity. In certain embodiments, dicer does not cleave the single-stranded oligomeric compound, but nevertheless facilitates entry into the RISC pathway and ultimately results in antisense activity.

[0384] In certain embodiments, the invention provides oligomeric compounds for use in methods of activating dicer comprising contacting dicer with an oligomeric compound. In certain such embodiments, the dicer is in a cell. In certain such embodiments, the cell is in an animal.

b. Ago

[0385] In certain embodiments, oligomeric compounds as provided herein interact with Ago. In certain embodiments, such oligomeric compounds first enter the RISC pathway by interacting with another member of the pathway (e.g., dicer). In certain embodiments, oligomeric compounds first enter the RISC pathway by interacting with Ago. In certain embodiments, such interaction ultimately results in antisense activity. In certain embodiments, the invention provides oligomeric compounds for use in methods of activating Ago comprising contacting Ago with an oligomeric compound. In certain such embodiments, the Ago is in a cell. In certain such embodiments, the cell is in an animal.

E. Certain methods/uses

[0386] In certain embodiments, the present invention provides compounds and compounds for use in methods for reducing the amount or activity of a target nucleic acid. In certain embodiments, the invention provides antisense compounds and antisense compounds for use in methods. In certain embodiments, the invention provides antisense compounds and antisense compounds for use in based on activation of RNase H. In certain embodiments, the invention provides RNAi compounds and compounds for use in methods.

[0387] In certain instances it is desirable to use an antisense compound that functions at least in part through RISC. In certain such instances unmodified RNA, whether single-stranded or double stranded is not suitable. Single-stranded RNA is relatively unstable and double-stranded RNA does not easily enter cells. The challenge has been to identify modifications and motifs that provide desirable properties, such as improved stability, without interfering with (and possibly even improving upon) the antisense activity of RNA through RNAi.

[0388] In certain embodiments, the present invention provides oligonucleotides having motifs (nucleoside motifs and/or linkage motifs) that result in improved properties. Certain such motifs result in single-stranded oligonucleotides with improved stability and/or cellular uptake properties while retaining antisense activity. For example, oligonucleotides having an alternating nucleoside motif and seven phosphorothioate linkages at to 3'-terminal end have improved stability and activity. Similar compounds that comprise phosphorothioate linkages at each linkage have further improved stability, but are not active as RNAi compounds, presumably because the additional phosphorothioate linkages interfere with the interaction of the oligonucleotide with the RISC pathway components (e.g., with Ago). In certain embodiments, the oligonucleotides having motifs herein result in single-stranded RNAi compounds having desirable properties. In certain embodiments, such oligonucleotides may be paired with a second strand to form a double-stranded RNAi compound. In such embodiments, the second strand of such double-stranded RNAi compounds may comprise a motif of the present invention, may comprise another motif of modifications or may be unmodified.

[0389] It has been shown that in certain circumstances for single-stranded RNA comprising a 5'-phosphate group has RNAi activity if but has much less RNAi activity if it lacks such 5'-phosphate group. The present inventors have recognized that in certain circumstances unmodified 5'-phophate groups may be unstable (either chemically or enzymatically). Accordingly, in certain circumstances, it is desirable to modify the oligonucleotide to stabilize the 5'-phosphate. In certain embodiments, this is achieved by modifying the phosphate group (phosphorus moiety). In certain embodiments, this is achieved by modifying the sugar of the 5'-terminal nucleoside. In certain embodiments, this is achieved by modifying the phosphate group and the sugar. In certain embodiments, the sugar is modified at the 5'-position, the 2'-position, or both the 5'-position and the 2'-position. As with motifs, above, in embodiments in which RNAi activity is desired, a phosphate stabilizing modification must not interfere with the ability of the oligonucleotide to interact with RISC pathway components (e.g., with Ago).

[0390] In certain embodiments, oligonucleotides are provided comprising a phosphate-stabilizing modification and a motif described herein. In certain embodiments, such oligonucleotides are useful as single-stranded RNAi compounds (ssRNA) having desirable properties. In certain embodiments, such oligonucleotides may be paired with a second strand to form a double-stranded RNAi compound. In such embodiments, the second strand may comprise a motif of the present invention, may comprise another motif of modifications or may be unmodified RNA.

[0391] The target for such antisense compounds comprising a motif and/or 5'-phosphate stabilizing modification of the present invention can be any naturally occurring nucleic acid. In certain embodiments, the target is selected from: pre-mRNA, mRNA, non-coding RNA, small non-coding RNA, pd-RNA, and microRNA. In embodiments, in which a target nucleic acid is a pre-RNA or a mRNA, the target may be the same as that of a naturally occurring micro-RNA (i.e., the oligonucleotide may be a microRNA mimic). In such embodiments, there may be more than one target mRNA.

[0392] In certain embodiments, the invention provides compounds and compounds for use in methods for antisense activity in a cell. In certain embodiments, the cell is in an animal. In certain embodiments, the animal is a human. In certain embodiments, the invention provides compounds for use in methods of administering a compound of the present invention to an animal to modulate the amount or activity or function of one or more target nucleic acid.

F. Certain Pharmaceutical Compositions

[0393] In certain embodiments, the present invention provides pharmaceutical compositions comprising one or more antisense compound. In certain embodiments, such pharmaceutical composition comprises a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutical composition comprises a sterile saline solution and one or more antisense compound. In certain embodiments, such pharmaceutical composition consists of a sterile saline solution and one or more antisense compound. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises one or more antisense compound and sterile water. In certain embodiments, a pharmaceutical composition consists of one or more antisense compound and sterile water. In certain embodiments, the sterile saline is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises one or more antisense compound and phosphate-buffered saline (PBS). In certain embodiments, a pharmaceutical composition consists of one or more antisense compound and sterile phosphate-buffered saline (PBS). In certain embodiments, the sterile saline is pharmaceutical grade PBS.

[0394] In certain embodiments, antisense compounds may be admixed with pharmaceutically acceptable active and/or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

[0395] Pharmaceutical compositions comprising antisense compounds encompass any pharmaceutically acceptable salts, esters, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising antisense compounds comprise one or more oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

[0396] A prodrug can include the incorporation of additional nucleosides at one or both ends of an oligomeric compound which are cleaved by endogenous nucleases within the body, to form the active antisense oligomeric compound.

[0397] Lipid moieties have been used in nucleic acid therapies in a variety of methods. In certain such methods, the nucleic acid is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids. In certain methods, DNA complexes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to fat tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to muscle tissue.

[0398] In certain embodiments, pharmaceutical compositions provided herein comprise one or more modified oligonucleotides and one or more excipients. In certain such embodiments, excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone.

[0399] In certain embodiments, a pharmaceutical composition provided herein comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds. In certain embodiments, certain organic solvents such as dimethylsulfoxide are used.

[0400] In certain embodiments, a pharmaceutical composition provided herein comprises one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents of the present invention to specific tissues or cell types. For example, in certain embodiments, pharmaceutical compositions include liposomes coated with a tissue-specific antibody.

[0401] In certain embodiments, a pharmaceutical composition provided herein comprises a co-solvent system. Certain of such co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant Polysorbate 80™ and 65% w/v polyethylene glycol 300. The proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80™; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.

[0402] In certain embodiments, a pharmaceutical composition provided herein is prepared for oral administration. In certain embodiments, pharmaceutical compositions are prepared for buccal administration.

[0403] In certain embodiments, a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, etc.). In certain of such embodiments, a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives). In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like. Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes. Aqueous injection suspensions may contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Optionally, such suspensions may also contain suitable stabilizers or agents that increase the solubility of the pharmaceutical agents to allow for the preparation of highly concentrated solutions.

[0404] In certain embodiments, a pharmaceutical composition is prepared for transmucosal administration. In certain of such embodiments penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.

[0405] In certain embodiments, a pharmaceutical composition provided herein comprises an oligonucleotide in a therapeutically effective amount. In certain embodiments, the therapeutically effective amount is sufficient to prevent, alleviate or ameliorate symptoms of a disease or to prolong the survival of the subject being treated. Determination of a therapeutically effective amount is well within the capability of those skilled in the art.

[0406] In certain embodiments, one or more modified oligonucleotide provided herein is formulated as a prodrug. In certain embodiments, upon in vivo administration, a prodrug is chemically converted to the biologically, pharmaceutically or therapeutically more active form of an oligonucleotide. In certain embodiments, prodrugs are useful because they are easier to administer than the corresponding active form. For example, in certain instances, a prodrug may be more bioavailable (e.g., through oral administration) than is the corresponding active form. In certain instances, a prodrug may have improved solubility compared to the corresponding active form. In certain embodiments, prodrugs are less water soluble than the corresponding active form. In certain instances, such prodrugs possess superior transmittal across cell membranes, where water solubility is detrimental to mobility. In certain embodiments, a prodrug is an ester. In certain such embodiments, the ester is metabolically hydrolyzed to carboxylic acid upon administration. In certain instances the carboxylic acid containing compound is the corresponding active form. In certain embodiments, a prodrug comprises a short peptide (polyaminoacid) bound to an acid group. In certain of such embodiments, the peptide is cleaved upon administration to form the corresponding active form.

[0407] In certain embodiments, the present invention provides compositions and compositions for use in methods for reducing the amount or activity of a target nucleic acid in a cell. In certain embodiments, the cell is in an animal. In certain embodiments, the animal is a mammal. In certain embodiments, the animal is a rodent. In certain embodiments, the animal is a primate. In certain embodiments, the animal is a non-human primate. In certain embodiments, the animal is a human.

[0408] In certain embodiments, the present invention provides pharmaceutical compositions for use in methods of administering a pharmaceutical composition comprising an oligomeric compound of the present invention to an animal. Suitable administration routes include, but are not limited to, oral, rectal, transmucosal, intestinal, enteral, topical, suppository, through inhalation, intrathecal, intracerebroventricular, intraperitoneal, intranasal, intraocular, intratumoral, and parenteral (e.g., intravenous, intramuscular, intramedullary, and subcutaneous). In certain embodiments, pharmaceutical intrathecals are administered to achieve local rather than systemic exposures. For example, pharmaceutical compositions may be injected directly in the area of desired effect (e.g., into the liver).

Nonlimiting disclosure

[0409] Although the sequence listing accompanying this filing identifies each sequence as either "RNA" or "DNA" as required, in reality, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that such designation as "RNA" or "DNA" to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2'-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (2'-OH for the natural 2'-H of DNA) or as an RNA having a modified base (thymine (methylated uracil) for natural uracil of RNA).

[0410] Accordingly, nucleic acid sequences provided herein, including, but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases. By way of further example and without limitation, an oligomeric compound having the nucleobase sequence "ATCGATCG" encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence "AUCGAUCG" and those having some DNA bases and some RNA bases such as "AUCGATCG" and oligomeric compounds having other modified or naturally occurring bases, such as "AT^meCGAUCG," wherein ^meC indicates a cytosine base comprising a methyl group at the 5-position.

Examples

[0411] The following examples illustrate certain embodiments of the present invention and are not limiting. Moreover, where specific embodiments are provided, the inventors have contemplated generic application of those specific embodiments. For example, disclosure of an oligonucleotide having a particular motif provides reasonable support for additional oligonucleotides having the same or similar motif. And, for example, where a particular high-affinity modification appears at a particular position, other high-affinity modifications at the same position are considered suitable, unless otherwise indicated.

Example 1

Synthesis of Nucleoside Phosphoramidites

[0412] The preparation of nucleoside phosphoramidites is performed following procedures that are illustrated herein and in the art such as but not limited to US Patent 6,426,220 and published PCT WO 02/36743.

Example 2

Synthesis of Oligomeric Compounds

[0413] The oligomeric compounds used in accordance with this invention may be conveniently and routinely made through the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, CA). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is well known to use similar techniques to prepare oligonucleotides such as alkylated derivatives and those having phosphorothioate linkages.

[0414] Oligomeric compounds: Unsubstituted and substituted phosphodiester (P=O) oligomeric compounds, including without limitation, oligonucleotides can be synthesized on an automated DNA synthesizer (Applied Biosystems model 394) using standard phosphoramidite chemistry with oxidation by iodine.

[0415] In certain embodiments, phosphorothioate internucleoside linkages (P=S) are synthesized similar to phosphodiester internucleoside linkages with the following exceptions: thiation is effected by utilizing a 10% w/v solution of 3,H-1,2-benzodithiole-3-one 1,1-dioxide in acetonitrile for the oxidation of the phosphite linkages. The thiation reaction step time is increased to 180 sec and preceded by the normal capping step. After cleavage from the CPG column and deblocking in concentrated ammonium hydroxide at 55°C (12-16 hr), the oligomeric compounds are recovered by precipitating with greater than 3 volumes of ethanol from a 1 M NH₄OAc solution. Phosphinate internucleoside linkages can be prepared as described in U.S. Patent 5,508,270.

[0416] Alkyl phosphonate internucleoside linkages can be prepared as described in U.S. Patent 4,469,863.

[0417] 3'-Deoxy-3'-methylene phosphonate internucleoside linkages can be prepared as described in U.S. Patents 5,610,289 or 5,625,050.

[0418] Phosphoramidite internucleoside linkages can be prepared as described in U.S. Patent, 5,256,775 or U.S. Patent 5,366,878.

[0419] Alkylphosphonothioate internucleoside linkages can be prepared as described in published PCT applications PCT/US94/00902 and PCT/US93/06976 (published as WO 94/17093 and WO 94/02499, respectively).

[0420] 3'-Deoxy-3'-amino phosphoramidate internucleoside linkages can be prepared as described in U.S. Patent 5,476,925.

[0421] Phosphotriester internucleoside linkages can be prepared as described in U.S. Patent 5,023,243.

[0422] Borano phosphate internucleoside linkages can be prepared as described in U.S. Patents 5,130,302 and 5,177,198.

[0423] Oligomeric compounds having one or more non-phosphorus containing internucleoside linkages including without limitation methylenemethylimino linked oligonucleosides, also identified as MMI linked oligonucleosides, methylenedimethylhydrazo linked oligonucleosides, also identified as MDH linked oligonucleosides, methylenecarbonylamino linked oligonucleosides, also identified as amide-3 linked oligonucleosides, and methyleneaminocarbonyl linked oligonucleosides, also identified as amide-4 linked oligonucleosides, as well as mixed backbone oligomeric compounds having, for instance, alternating MMI and P=O or P=S linkages can be prepared as described in U.S. Patents 5,378,825, 5,386,023, 5,489,677, 5,602,240 and 5,610,289.

[0424] Formacetal and thioformacetal internucleoside linkages can be prepared as described in U.S. Patents 5,264,562 and 5,264,564.

[0425] Ethylene oxide internucleoside linkages can be prepared as described in U.S. Patent 5,223,618.

Example 3

Isolation and Purification of Oligomeric Compounds

[0426] After cleavage from the controlled pore glass solid support or other support medium and deblocking in concentrated ammonium hydroxide at 55°C for 12-16 hours, the oligomeric compounds, including without limitation oligonucleotides and oligonucleosides, are recovered by precipitation out of 1 M NH₄OAc with >3 volumes of ethanol. Synthesized oligomeric compounds are analyzed by electrospray mass spectroscopy (molecular weight determination) and by capillary gel electrophoresis. The relative amounts of phosphorothioate and phosphodiester linkages obtained in the synthesis is determined by the ratio of correct molecular weight relative to the -16 amu product (+/-32 +/-48). For some studies oligomeric compounds are purified by HPLC, as described by Chiang et al., J. Biol. Chem. 1991, 266(27), 18162-18171. Results obtained with HPLC-purified material are generally similar to those obtained with non-HPLC purified material.

Example 4

Synthesis of Oligomeric Compounds using the 96 Well Plate Format

[0427] Oligomeric compounds, including without limitation oligonucleotides, can be synthesized via solid phase P(III) phosphoramidite chemistry on an automated synthesizer capable of assembling 96 sequences simultaneously in a 96-well format. Phosphodiester internucleoside linkages are afforded by oxidation with aqueous iodine. Phosphorothioate internucleoside linkages are generated by sulfurization utilizing 3,H-1,2 benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) in anhydrous acetonitrile. Standard base-protected beta-cyanoethyl-diiso-propyl phosphoramidites can be purchased from commercial vendors (e.g. PE-Applied Biosystems, Foster City, CA, or Pharmacia, Piscataway, NJ). Non-standard nucleosides are synthesized as per standard or patented methods and can be functionalized as base protected beta-cyanoethyldiisopropyl phosphoramidites.

[0428] Oligomeric compounds can be cleaved from support and deprotected with concentrated NH₄OH at elevated temperature (55-60 °C) for 12-16 hours and the released product then dried in vacuo. The dried product is then re-suspended in sterile water to afford a master plate from which all analytical and test plate samples are then diluted utilizing robotic pipettors.

Example 5

Analysis of Oligomeric Compounds using the 96-Well Plate Format

[0429] The concentration of oligomeric compounds in each well can be assessed by dilution of samples and UV absorption spectroscopy. The full-length integrity of the individual products can be evaluated by capillary electrophoresis (CE) in either the 96-well format (Beckman P/ACE™ MDQ) or, for individually prepared samples, on a commercial CE apparatus (e.g., Beckman P/ACE™ 5000, ABI 270). Base and backbone composition is confirmed by mass analysis of the oligomeric compounds utilizing electrospray-mass spectroscopy. All assay test plates are diluted from the master plate using single and multi-channel robotic pipettors. Plates are judged to be acceptable if at least 85% of the oligomeric compounds on the plate are at least 85% full length.

Example 6

In Vitro Treatment of Cells with Oligomeric Compounds

[0430] The effect of oligomeric compounds on target nucleic acid expression is tested in any of a variety of cell types provided that the target nucleic acid is present at measurable levels. This can be routinely determined using, for example, PCR or Northern blot analysis. Cell lines derived from multiple tissues and species can be obtained from American Type Culture Collection (ATCC, Manassas, VA).

[0431] The following cell type is provided for illustrative purposes, but other cell types can be routinely used, provided that the target is expressed in the cell type chosen. This can be readily determined by methods routine in the art, for example Northern blot analysis, ribonuclease protection assays or RT-PCR.

[0432] b.END cells: The mouse brain endothelial cell line b.END was obtained from Dr. Werner Risau at the Max Plank Institute (Bad Nauheim, Germany). b.END cells are routinely cultured in DMEM, high glucose (Invitrogen Life Technologies, Carlsbad, CA) supplemented with 10% fetal bovine serum (Invitrogen Life Technologies, Carlsbad, CA). Cells are routinely passaged by trypsinization and dilution when they reached approximately 90% confluence. Cells are seeded into 96-well plates (Falcon-Primaria #353872, BD Biosciences, Bedford, MA) at a density of approximately 3000 cells/well for uses including but not limited to oligomeric compound transfection experiments.

[0433] Experiments involving treatment of cells with oligomeric compounds:
When cells reach appropriate confluency, they are treated with oligomeric compounds using a transfection method as described.

LIPOFECTIN™

[0434] When cells reached 65-75% confluency, they are treated with one or more oligomeric compounds. The oligomeric compound is mixed with LIPOFECTIN™ Invitrogen Life Technologies, Carlsbad, CA) in Opti-MEM™-1 reduced serum medium (Invitrogen Life Technologies, Carlsbad, CA) to achieve the desired concentration of the oligomeric compound(s) and a LIPOFECTIN™ concentration of 2.5 or 3 µg/mL per 100 nM oligomeric compound(s). This transfection mixture is incubated at room temperature for approximately 0.5 hours. For cells grown in 96-well plates, wells are washed once with 100 µL OPTI-MEM™-1 and then treated with 130 µL of the transfection mixture. Cells grown in 24-well plates or other standard tissue culture plates are treated similarly, using appropriate volumes of medium and oligomeric compound(s). Cells are treated and data are obtained in duplicate or triplicate. After approximately 4-7 hours of treatment at 37°C, the medium containing the transfection mixture is replaced with fresh culture medium. Cells are harvested 16-24 hours after treatment with oligomeric compound(s).

[0435] Other suitable transfection reagents known in the art include, but are not limited to, CYTOFECTIN™, LIPOFECTAMINE™, OLIGOFECTAMINE™, and FUGENE™. Other suitable transfection methods known in the art include, but are not limited to, electroporation.

Example 7

Real-time Quantitative PCR Analysis of target mRNA Levels

[0436] Quantitation of target mRNA levels is accomplished by real-time quantitative PCR using the ABI PRISM™ 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, CA) according to manufacturer's instructions. This is a closed-tube, non-gel-based, fluorescence detection system which allows high-throughput quantitation of polymerase chain reaction (PCR) products in real-time. As opposed to standard PCR in which amplification products are quantitated after the PCR is completed, products in real-time quantitative PCR are quantitated as they accumulate. This is accomplished by including in the PCR reaction an oligonucleotide probe that anneals specifically between the forward and reverse PCR primers, and contains two fluorescent dyes. A reporter dye (e.g., FAM or JOE, obtained from either PE-Applied Biosystems, Foster City, CA, Operon Technologies Inc., Alameda, CA or Integrated DNA Technologies Inc., Coralville, IA) is attached to the 5' end of the probe and a quencher dye (e.g., TAMRA, obtained from either PE-Applied Biosystems, Foster City, CA, Operon Technologies Inc., Alameda, CA or Integrated DNA Technologies Inc., Coralville, IA) is attached to the 3' end of the probe. When the probe and dyes are intact, reporter dye emission is quenched by the proximity of the 3' quencher dye. During amplification, annealing of the probe to the target sequence creates a substrate that can be cleaved by the 5'-exonuclease activity of Taq polymerase. During the extension phase of the PCR amplification cycle, cleavage of the probe by Taq polymerase releases the reporter dye from the remainder of the probe (and hence from the quencher moiety) and a sequence-specific fluorescent signal is generated. With each cycle, additional reporter dye molecules are cleaved from their respective probes, and the fluorescence intensity is monitored at regular intervals by laser optics built into the ABI PRISM™ Sequence Detection System. In each assay, a series of parallel reactions containing serial dilutions of mRNA from untreated control samples generates a standard curve that is used to quantitate the percent inhibition after antisense oligonucleotide treatment of test samples.

[0437] Prior to quantitative PCR analysis, primer-probe sets specific to the target gene being measured are evaluated for their ability to be "multiplexed" with a GAPDH amplification reaction. In multiplexing, both the target gene and the internal standard gene GAPDH are amplified concurrently in a single sample. In this analysis, mRNA isolated from untreated cells is serially diluted. Each dilution is amplified in the presence of primer-probe sets specific for GAPDH only, target gene only ("single-plexing"), or both (multiplexing). Following PCR amplification, standard curves of GAPDH and target mRNA signal as a function of dilution are generated from both the single-plexed and multiplexed samples. If both the slope and correlation coefficient of the GAPDH and target signals generated from the multiplexed samples fall within 10% of their corresponding values generated from the single-plexed samples, the primer-probe set specific for that target is deemed multiplexable. Other methods of PCR are also known in the art.

[0438] RT and PCR reagents are obtained from Invitrogen Life Technologies (Carlsbad, CA). RT, real-time PCR is carried out by adding 20 µL PCR cocktail (2.5x PCR buffer minus MgCl₂, 6.6 mM MgCl₂, 375 µM each of dATP, dCTP, dCTP and dGTP, 375 nM each of forward primer and reverse primer, 125 nM of probe, 4 Units RNAse inhibitor, 1.25 Units PLATINUM® Taq, 5 Units MuLV reverse transcriptase, and 2.5x ROX dye) to 96-well plates containing 30 µL total RNA solution (20-200 ng). The RT reaction is carried out by incubation for 30 minutes at 48°C. Following a 10 minute incubation at 95°C to activate the PLATINUM® Taq, 40 cycles of a two-step PCR protocol are carried out: 95°C for 15 seconds (denaturation) followed by 60°C for 1.5 minutes (annealing/- extension).

[0439] Gene target quantities obtained by RT, real-time PCR are normalized using either the expression level of GAPDH, a gene whose expression is constant, or by quantifying total RNA using RIBOGREEN™ (Molecular Probes, Inc. Eugene, OR). GAPDH expression is quantified by real time RT-PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA is quantified using RiboGreen™ RNA quantification reagent (Molecular Probes, Inc. Eugene, OR). Methods of RNA quantification by RIBOGREEN™ are taught in Jones, L.J., et al, (Analytical Biochemistry, 1998, 265, 368-374).

[0440] In this assay, 170 µL of RIBOGREEN™ working reagent (RIBOGREEN™ reagent diluted 1:350 in 10mM Tris-HCl, 1 mM EDTA, pH 7.5) is pipetted into a 96-well plate containing 30 µL purified, cellular RNA. The plate is read in a CytoFluor 4000 (PE Applied Biosystems) with excitation at 485nm and emission at 530nm.

Example 8

Analysis of inhibition of target expression

[0441] Antisense modulation of a target expression can be assayed in a variety of ways known in the art. For example, a target mRNA levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or real-time PCR. Real-time quantitative PCR is presently desired. RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. One method of RNA analysis of the present disclosure is the use of total cellular RNA as described in other examples herein. Methods of RNA isolation are well known in the art. Northern blot analysis is also routine in the art. Real-time quantitative (PCR) can be conveniently accomplished using the commercially available ABI PRISM™ 7600, 7700, or 7900 Sequence Detection System, available from PE-Applied Biosystems, Foster City, CA and used according to manufacturer's instructions.

[0442] Protein levels of a target can be quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked immunosorbent assay (ELISA) or fluorescence-activated cell sorting (FACS). Antibodies directed to a target can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, MI), or can be prepared via conventional monoclonal or polyclonal antibody generation methods well known in the art. Methods for preparation of polyclonal antisera are taught in, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.12.1-11.12.9, John Wiley & Sons, Inc., 1997. Preparation of monoclonal antibodies is taught in, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.4.1-11.11.5, John Wiley & Sons, Inc., 1997.

[0443] Immunoprecipitation methods are standard in the art and can be found at, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 10.16.1-10.16.11, John Wiley & Sons, Inc., 1998. Western blot (immunoblot) analysis is standard in the art and can be found at, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 10.8.1-10.8.21, John Wiley & Sons, Inc., 1997. Enzyme-linked immunosorbent assays (ELISA) are standard in the art and can be found at, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.2.1-11.2.22, John Wiley & Sons, Inc., 1991.

Example 9

Design of phenotypic assays and in vivo studies for the use of target inhibitors

Phenotypic assays

[0444] Once target inhibitors have been identified by the methods disclosed herein, the oligomeric compounds are further investigated in one or more phenotypic assays, each having measurable endpoints predictive of efficacy in the treatment of a particular disease state or condition.

[0445] Phenotypic assays, kits and reagents for their use are well known to those skilled in the art and are herein used to investigate the role and/or association of a target in health and disease. Representative phenotypic assays, which can be purchased from any one of several commercial vendors, include those for determining cell viability, cytotoxicity, proliferation or cell survival (Molecular Probes, Eugene, OR; PerkinElmer, Boston, MA), protein-based assays including enzymatic assays (Panvera, LLC, Madison, WI; BD Biosciences, Franklin Lakes, NJ; Oncogene Research Products, San Diego, CA), cell regulation, signal transduction, inflammation, oxidative processes and apoptosis (Assay Designs Inc., Ann Arbor, MI), triglyceride accumulation (Sigma-Aldrich, St. Louis, MO), angiogenesis assays, tube formation assays, cytokine and hormone assays and metabolic assays (Chemicon International Inc., Temecula, CA; Amersham Biosciences, Piscataway, NJ).

[0446] In one non-limiting example, cells determined to be appropriate for a particular phenotypic assay (i.e., MCF-7 cells selected for breast cancer studies; adipocytes for obesity studies) are treated with a target inhibitors identified from the in vitro studies as well as control compounds at optimal concentrations which are determined by the methods described above. At the end of the treatment period, treated and untreated cells are analyzed by one or more methods specific for the assay to determine phenotypic outcomes and endpoints.

[0447] Phenotypic endpoints include changes in cell morphology over time or treatment dose as well as changes in levels of cellular components such as proteins, lipids, nucleic acids, hormones, saccharides or metals. Measurements of cellular status which include pH, stage of the cell cycle, intake or excretion of biological indicators by the cell, are also endpoints of interest.

[0448] Measurement of the expression of one or more of the genes of the cell after treatment is also used as an indicator of the efficacy or potency of the target inhibitors. Hallmark genes, or those genes suspected to be associated with a specific disease state, condition, or phenotype, are measured in both treated and untreated cells.

In vivo studies

[0449] The individual subjects of the in vivo studies described herein are warm-blooded vertebrate animals, which includes humans.

Example 10

RNA Isolation

Poly(A)+mRNA isolation

[0450] Poly(A)+ mRNA is isolated according to Miura et al., (Clin. Chem., 1996, 42, 1758-1764). Other methods for poly(A)+ mRNA isolation are routine in the art. Briefly, for cells grown on 96-well plates, growth medium is removed from the cells and each well is washed with 200 µL cold PBS. 60 µL lysis buffer (10 mM Tris-HCl, pH 7.6, 1 mM EDTA, 0.5 M NaCl, 0.5% NP-40, 20 mM vanadyl-ribonucleoside complex) is added to each well, the plate is gently agitated and then incubated at room temperature for five minutes. 55 µL of lysate is transferred to Oligo d(T) coated 96-well plates (AGCT Inc., Irvine CA). Plates are incubated for 60 minutes at room temperature, washed 3 times with 200 µL of wash buffer (10 mM Tris-HCl pH 7.6, 1 mM EDTA, 0.3 M NaCl). After the final wash, the plate is blotted on paper towels to remove excess wash buffer and then air-dried for 5 minutes. 60 µL of elution buffer (5 mM Tris-HCl pH 7.6), preheated to 70°C, is added to each well, the plate is incubated on a 90°C hot plate for 5 minutes, and the eluate is then transferred to a fresh 96-well plate.

[0451] Cells grown on 100 mm or other standard plates may be treated similarly, using appropriate volumes of all solutions.

Total RNA Isolation

[0452] Total RNA is isolated using an RNEASY 96™ kit and buffers purchased from Qiagen Inc. (Valencia, CA) following the manufacturer's recommended procedures. Briefly, for cells grown on 96-well plates, growth medium is removed from the cells and each well is washed with 200 µL cold PBS. 150 µL Buffer RLT is added to each well and the plate vigorously agitated for 20 seconds. 150 µL of 70% ethanol is then added to each well and the contents mixed by pipetting three times up and down. The samples are then transferred to the RNEASY 96™ well plate attached to a QIAVAC™ manifold fitted with a waste collection tray and attached to a vacuum source. Vacuum is applied for 1 minute. 500 µL of Buffer RW1 is added to each well of the RNEASY 96™ plate and incubated for 15 minutes and the vacuum is again applied for 1 minute. An additional 500 µL of Buffer RW1 is added to each well of the RNEASY 96™ plate and the vacuum is applied for 2 minutes. 1 mL of Buffer RPE is then added to each well of the RNEASY 96™ plate and the vacuum applied for a period of 90 seconds. The Buffer RPE wash is then repeated and the vacuum is applied for an additional 3 minutes. The plate is then removed from the QIAVAC™ manifold and blotted dry on paper towels. The plate is then re-attached to the QIAVAC™ manifold fitted with a collection tube rack containing 1.2 mL collection tubes. RNA is then eluted by pipetting 140 µL of RNAse free water into each well, incubating 1 minute, and then applying the vacuum for 3 minutes.

[0453] The repetitive pipetting and elution steps may be automated using a QIAGEN Bio-Robot 9604 (Qiagen, Inc., Valencia CA). Essentially, after lysing of the cells on the culture plate, the plate is transferred to the robot deck where the pipetting, DNase treatment and elution steps are carried out.

Example 11

Target-specific primers and probes

[0454] Probes and primers may be designed to hybridize to a target sequence, using published sequence information.

[0455] For example, for human PTEN, the following primer-probe set was designed using published sequence information (GENBANK™ accession number U92436.1, SEQ ID NO: 3).

Forward primer: AATGGCTAAGTGAAGATGACAATCAT (SEQ ID NO: 4)

Reverse primer: TGCACATATCATTACACCAGTTCGT (SEQ ID NO: 5)

And the PCR probe:
FAM-TTGCAGCAATTCACTGTAAAGCTGGAAAGG-TAMRA (SEQ ID NO: 6), where FAM is the fluorescent dye and TAMRA is the quencher dye.

Example 12

Western blot analysis of target protein levels

[0456] Western blot analysis (immunoblot analysis) is carried out using standard methods. Cells are harvested 16-20 h after oligonucleotide treatment, washed once with PBS, suspended in Laemmli buffer (100 µl/well), boiled for 5 minutes and loaded on a 16% SDS-PAGE gel. Gels are run for 1.5 hours at 150 V, and transferred to membrane for western blotting. Appropriate primary antibody directed to a target is used, with a radiolabeled or fluorescently labeled secondary antibody directed against the primary antibody species. Bands are visualized using a PHOSPHORIMAGER™ (Molecular Dynamics, Sunnyvale CA).

Example 13

Preparation of Compound 2

[0457] 

[0458] To a suspension of Mg/I₂ (297 mg, 8.25 mmol) in THF (16 mL) was added 1-bromo-3-methoxypropane (1.26 g, 8.25 mmol, commercially available) with stirring at room temperature for about 50 minutes to provide Compound 1. In a separate flask, bis(diisopropylaminochlorophos-phine (2.0 g, 7.50 mmol, commercially available) was dissolved in diethyl ether (125 mL) with cooling to 0 °C. The solution of Compound 1 was cooled to about 0 °C and cannulated into the stirred solution of bis(diisopropylamino)chlorophosphine with the temperature of the reaction mixture maintained at about 0 °C. The reaction was monitored by ³¹P NMR. After about 1 hour the reaction mixture was allowed to warm to room temperature and filtered. The filtrate was concentrated under reduced pressure and the residue washed with hexane. The remaining residue was dissolved in acetonitrile and extracted with hexane. The hexane layers were combined, dried over Na₂SO₄, filtered and concentrated under reduced pressure to provide Compound 2 (1.7 g).

[0459] Reaction repeated starting with 22.0g 1-bromo-3-methoxypropane to provide 22.5g Compound 2 (76% yield). The structure of Compound 2 was confirmed by ¹H NMR.

Example 14

Preparation of methoxypropyl (MOP)-diisopropylaminophosphonamidite DMT-T, Compound 3

[0460] 

[0461] Dimethoxytrityl thymidine (3.0 g, 5.59 mmol, commercially available) and 1H-tetrazole (587 mg, 8.39 mmol) were dissolved in DMF (20 mL). N-methyl imidazole (116 mg, 1.40 mmol) and Compound 2 were added with stirring at room temperature for 1 hour at which time the reaction was complete by TLC. The reaction was diluted with ethyl acetate and quenched by addition of saturated NaHCO₃. The ethyl acetate layer was collected and dried over MgSO₄, filtered and concentrated under reduced pressure. The residue was purified by column chromatography (eluted with ethyl acetate/hexane 50/50 v/v) to provide Compound 3 (1.67 g, 78%). The structure of Compound 3 was confirmed by ¹H NMR.

Example 15

Preparation of protected MOP-phosphonate linked TT dimer, Compound 4

[0462] 

[0463] Dry 3'-O-t-butyldiphenylsilyl thymidine (400 mg, 0.832 mmol, commercially available) dissolved in ACN was cannulated into dry 1H-tetrazole (408 mg, 5.83 mmol) followed by Compound 3 (746 mg, 0.998 mmol) in ACN with stirring for 8 minutes. Cumene hydroperoxide (171 mg, 0.72 mL, 1.123 mmol) was added and the reaction was stirred for about 10 minutes. The reaction was quenched by addition of sodium bisulfite solution (1 g/mL) followed by extraction with ethyl acetate. Ethyl acetate layers were combined, dried over MgSO₄, filtered and concentrated under reduced pressure. The residue was purified by column chromatography to provide three fractions. The first fraction that eluted from the column (the fast fraction) was identified as the Rp isomer of Compound 4 (241 mg). The slower fractions were isolated and identified as the Sp isomer and the racemic mixture of Compound 4. The structure of Compound 4 was confirmed by ¹H NMR.

Example 16

Preparation of 5'-ODMT MOP-phosphonate linked TT dimer, Compound 5

[0464] 

[0465] A solution of tetrabutylammonium fluoride (0.42 mL, 0.42 mmol, 1 N/THF) was added to a solution of Compound 4 (241 mg, 0.21 mmol) in THF (2 mL) with stirring for 2 hours. The reaction was diluted with water and extracted with ethyl acetate. The combined ethyl acetate layers were combined, dried over MgSO₄, filtered and concentrated under reduced pressure. The residue was purified by column chromatography (10% EtOH/ethyl acetate) to provide Compound 5 (146 mg, 76.8%).

Example 17

Preparation of 5'-ODMT-3'-phosphoramidite MOP-phosphonate linked TT dimer, Compound

[0466] 

[0467] To a solution of Compound 5 in DMF (10 mL) was added 1H-tetrazole (127 mg, 1.82 mmol) followed by N-methyl imidazole (46 mg, 0.567 mmol) with stirring. 2-Cyanoethyl-N,N,N',N'-tetra-isopropylphosphorodiamidite (73 mg, .08 mL, 0.243 mmol) was added and the reaction mixture was stirred at room temperature for about 3 hours. The reaction was quenched by addition of saturated NaCl and extracted with ethyl acetate. The ethyl acetate layers were combined, dried over Na₂SO₄, filtered and concentrated under reduced pressure. The residue was purified by column chromatography (Biotage, 80% EtOAc/hexanes) to provide Compound 6 (90 mg).

Example 18

General preparation of 5'-ODMT methoxypropyl-diisopropylaminophosphonamidite nucleoside, Compound 8

[0468] 

[0469] Following the procedures illustrated in Example 14 or optionally the procedures illustrated in Example 21, an optionally modified nucleoside having the formula of Compound 7 is converted to the methoxypropyl phosphonamidite having the formula of Compound 8. Many such optionally modified nucleosides represented by Compound 7 are disclosed herein and well known to the art skilled, many of which are commercially available. Included in Compound 7 are ribonucleosides and 2'-deoxyribonucleosides as well as optionally substituted analogs such as 2'-substituted nucleosides (A and Q are each H and E is a 2'-substituent group); 5'-substituted modified nucleosides (Q and E are H and A is a 5'-substituent group); 2',5'-substituted modified nucleosides (Q is H and E is a 2'-substituent group and A is a 5'-substituent group); and bicyclic nucleosides (A is H or an optional 5'-substituent group and Q and E together form a bridging group).

[0470] Modified nucleosides and or modified nucleosides that have been functionalized as methoxypropyl phosphonamidites can be incorporated into an oligomeric compound directly as the DMT phosphonamidite or as a DMT phosphonamidate dimer, prepared as per the procedures illustrated examples 15 to 17, following standard oligonucleotide synthesis protocols. Any nucleoside or modified nucleoside can be coupled to the DMT phosphonamidite to prepare the DMT phosphoramidite dimer such as the TT dimer illustrated in Example 17. The modified nucleoside can also have any heterocyclic base with uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine being preferred.

Example 19

General preparation of methoxypropyl phosphonamidite monomers comprising a sugar surrogate group, preparation of F-HNA methoxypropyl phosphoramidite, Compound 10

[0471] 

[0472] Following the procedures illustrated in Example 14 or optionally the procedures illustrated in Example 21, a DMT protected modified nucleoside comprising a sugar surrogate group having a free hydroxyl group (DMT-F-HNA, Formula 9 prepared as per U.S. 8,088,904) is converted to the methoxypropyl phosphoramidite of Formula 10. Such DMT protected modified nucleosides comprising a sugar surrogate group having a free hydroxyl group are disclosed herein and well known to the art skilled, many of which are commercially available.

[0473] Modified nucleosides comprising sugar surrogate groups that have been functionalized as methoxypropyl phosphoramidites can be incorporated into an oligomeric compound directly as the DMT phosphoramidite as per Formula 10 or as a DMT phosphoramidite dimer, prepared as per the procedures illustrated examples 15 to 17, following standard oligonucleotide synthesis protocols. Any nucleoside or modified nucleoside can be coupled to a DMT phosphoramidite comprising a sugar surrogate (such as Formula 10) to prepare a DMT phosphoramidite dimer such as illustrated in Example 17. The modified nucleoside can also have any heterocyclic base with uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine being preferred.

Example 20

Preparation of cEt methoxypropyl phosphonamidite, Compound 12

[0474] 

[0475] DMT cEt thymidine (Compound 11, prepared as per published literature procedures, 5.0 g, 8.43 mmol) and 1H-tetrazole (1.0 g, 14.3 mmol) were dried over phosphorus pentoxide for 4 hours and dissolved in DMF (20 mL) with stirring under nitrogen. N-methyl imidazole (350 mg, 4.26 mmol) and Compound 2 (7.0 g, 23.0 mmol) were added with stirring at room temperature for about 5 hours at which time the reaction was complete by TLC. The reaction was diluted with EtOAc (100 mL) and the organic layer was washed with half-saturated brine (200 mL), half saturated NaHCO₃ (2 x 200 mL), half saturated brine (1 x 200 mL), brine (1 x 100 mL), dried over MgSO4, filtered through a sintered glass funnel and concentrated under reduced pressure. Purify by biotage, 50 gram column pre-washed with 0.5 % TEA in hexanes, then equilibrated in 2% EtOAc in hexanes. The crude material was loaded using ACN (∼ 10 mL) and the column was washed with flash 3 CV of 2 % EtOAc in hexanes followed by 20 % EtOAc in hexanes over 5 CV and 80 % EtOAc in hexanes. The fractions containing the desired compound were pooled and concentrated to give the final product was a white solid. The structure of Compound 12 was confirmed by ¹H NMR.

Example 21

General procedure for preparation of diisopropylamino-methoxypropyl phosphonate monomer subunits

[0476] To a solution of 1H-tetrazole (1.5 eq), 1-methyl imidazole (0.4 eq) and a commercially available or synthesized monomer subunit such as a nucleoside, modified nucleoside or a nucleoside comprising a surrogate sugar group having a free hydroxyl group (5'-ODMT/or equivalent position, with optional base protection, 1.0 eq) dissolved in DMF (160 mL) is added dropwise a solution of Compound 2 (2.0 eq) dissolved in THF. The reaction is stirred at room temperature overnight and then the reaction was stopped by addition of Et₃N (0.5 mL) and then water (20 mL). The resulting milky solution is washed with hexane (3 x 100 mL) and the hexane layers were decanted. To the remaining aqueous layer containing an oil is added toluene/hexane (200 mL, 3/1, v/v) to obtained two layers.

[0477] DMF/water (20 mL, 3/2, v/v) is added with mixing and then the bottom DMF/water layer is removed in a separatory funnel. The organic layer is washed twice with additional DMF/water (50 mL, 3/2, v/v) followed by saturated NaHCO₃ (30 mL, Sat) and brine (30 mL). The organic layer is separated, dried over Na₂SO₄, filtered and evaporated to dryness.

[0478] The resulting colorless oil is purified using silica gel flash column chromatography eluted with ETOAc/hexane to provide the monomer subunit with the free hydroxyl group functionalized with the methoxypropyl phosphonate group, Compound 13:

Example 22

Preparation of compound 15

[0479] 

[0480] Compound 15 was prepared as per the procedure of Example 21 based on 1 eq., of Compound 14 (prepared as per published literature procedures, 10.0 g, 0.016 mol, 1.0 eq), Compound 2 (7.38 g, 0.024 mol, 2.0 eq), 1H-tetrazole (1.68 g, 0.024 mol, 1.5 eq), and 1-methyl imidazole (0.58 g, 0.007 mol, 0.4 eq). The resulting material was purified by passing through plug of silica gel eluted with ETOAc/Hexane (7/3, v/v) to afford 8.40 g of Compound 15 (63% yield). NMRs (¹H and ³¹P) were consistent Compound 15.

Example 23

Preparation of compound 17

[0481] 

[0482] Compound 17 was prepared as per the procedure of Example 21 based on 1 eq., of Compound 16 (prepared as per published procedures, 10.0 g, 0.014 mol, 1.0 eq), Compound 2 (8.85 g, 0.029 mol, 2.0 eq), 1H-tetrazole (1.50 g, 0.021 mol, 1.5 eq), and 1-methyl imidazole (0.52 g, 0.006 mol, 0.4 eq). The resulting material was purified by passing through plug of silica gel eluted with ETOAc/hexane (7/3, v/v) to afford 7.70 g of Compound 17 (60% yield). NMRs (¹H and ³¹P) were consistent Compound 17.

Example 24

Preparation of compound 19

[0483] 

[0484] Compound 19 was prepared as per the procedure of Example 21 based on 1 eq., of Compound 18 (prepared as per published procedures, 10.0 g, 0.013 mol, 1.0 eq), Compound 2 (8.32 g, 0.027 mol, 2.0 eq), 1H-tetrazole (1.43 g, 0.020 mol, 1.5 eq), and 1-methyl imidazole (0.50 g, 0.006 mol, 0.4 eq). The resulting material was purified by passing through plug of silica gel eluted with ETOAc/hexane (7/3, v/v) to afford 3.51 g of Compound 19 (27% yield). NMRs (¹H and ³¹P) were consistent Compound 19.

Example 25

Preparation of compound 21

[0485] 

[0486] Compound 21 was prepared as per the procedure of Example 21 based on 1 eq., of Compound 20 (prepared as per published procedures, 10.0 g, 0.014 mol, 1.0 eq), Compound 2 (8.53 g, 0.028 mol, 2.0 eq), 1H-tetrazole (1.47 g, 0.021 mol, 1.5 eq), and 1-methyl imidazole (0.50 g, 0.006 mol, 0.4 eq). The resulting material was purified by passing through plug of silica gel eluted with ETOAc/hexane (7/3, v/v) to afford 9.65 g of Compound 21 (75% yield). NMRs (¹H and ³¹P) were consistent Compound 21.

Example 26

Preparation of compound 23

[0487] 

[0488] Compound 23 was prepared as per the procedure of Example 21 based on 1 eq., of Compound 22 (prepared as per published procedures, 3 g, 0.005 mol, 1.0 eq), Compound 2 (4.78 g, 0.015 mol, 3.0 eq), 1H-tetrazole (0.55 g, 0.007 mol, 1.5 eq), and 1-methyl imidazole (0.190 g, 0.002 mol, 0.4 eq). The resulting material was purified by passing through plug of silica gel eluted with ETOAc/hexane (7/3, v/v) to afford 2.7 g of Compound 23 (67% yield). NMRs (¹H and ³¹P) were consistent Compound 23.

Example 27

Preparation of compound 25

[0489] 

[0490] Compound 25 was prepared as per the procedure of Example 21 based on 1 eq., of Compound 24 (prepared as per published procedures, 10.0 g, 0.014 mol, 1.0 eq), Compound 2 (8.70 g, 0.029 mol, 2.0 eq), 1H-tetrazole (1.50 g, 0.021 mol, 1.5 eq), and 1-methyl imidazole (0.46 g, 0.006 mol, 0.4 eq). The resulting material was purified by passing through plug of silica gel eluted with ETOAc/hexane (7/3, v/v) to afford 11.13 g of Compound 25 (88% yield). NMRs (¹H and ³¹P) were consistent Compound 25.

Example 28

General procedure for synthesis of oligomeric compounds comprising at least one methoxypropyl phosphonate internucleoside linkage, synthesis of oligomeric compounds ISIS-619442 to ISIS-619444

[0491] Oligomeric compounds were synthesized on a 2 µmol scale on an ABI 394 DNA/RNA synthesizer using MOE ^mC^Bz loaded primer support (loading: 215 µmol/g). Oligomeric compounds ISIS-619441 and ISIS-619442 were prepared using the thymidine methoxypropyl phosphoramidite monomer prepared as per the procedures illustrated in Example 14 and oligomeric compounds ISIS-619443 and ISIS-619444 were prepared using the thymidine methoxypropyl phosphoramidite dimer prepared as per the procedures illustrated in example 15 to 17. The other phosphoramidites (optionally protected: dA^bz, dG^DMF, d^mC^Bz, cEt A^Bz and cEt ^mC^Bz) were incorporated using standard solid-phase synthesis, i.e. 3% dichloroacetic acid in DCM for deblocking, 1 M 4,5-dicyanoimidazole 0.1 M N-methylimidazole in acetonitrile as activator, acetic acid in THF and 10% 1-methyl - imidazole in THF/pyridine for capping, 0.2 M phenylacetyl disulfide in pyridine:acetonitrile 1:1 (v:v) for thiolation and 10% tert-butyl hydroperoxide in acetonitrile for MOP oxidation. DNA and MOE amidites were dissolved to 0.1 M in acetonitrile while S-cEt amidites were dissolved to 0.2 M in acetonitrile:toluene 1:1 (v:v). DNA amidites were coupled for 2 times 4 min. while DNA MOP, MOE and S-cEt amidites were coupled for 2 times 6 min.

[0492] After synthesis was complete cyanoethyl groups were removed by treatment with trietylamine:acetonitrile 1:1 (v:v) for 25 min. The remaining protecting groups were cleaved in aq. conc. ammonia at room temperature for 6 h. The resulting oligomeric compounds were purified by strong anionic ion-exchange high performance liquid chromatography using a linear gradient of buffer A to B. Buffer A: 50 mM NaHCO₃; Buffer B: 50 mM NaHCO₃ 1.5 M NaBr, both buffers in acetonitrile:water 3:7 (v:v). Purified oligomeric compounds were desalted using a C18 reverse-phase cartridge. The identity of the oligomeric compounds was determined by electrospray ionization mass spectrometry.

SEQ ID NO./ISIS NO.	Composition (5' to 3')	Linkage/isomer
09/619441	TeAkAkATTqGTmCATmCAkmCkmCe	MOP
09/619442	TeAkAkATqTGTmCATmCAkmCkmCe	MOP
09/619443	TeAkAkATq(S)TGTmCATmCAkmCkmCe	MOP/Sp
09/619444	TeAkAkATq(R)TGTmCATmCAkmCkmCe	MOP/Rp

[0493] Between adjacent nucleosides subscript "q" indicates a methoxypropyl phosphonate modified internucleoside linkage (-P(CH₃O-(CH₂)₃-)(=O)-, MOP) between adjacent nucleosides and all other internucleoside linkages are phosphorothioate internucleoside linkages. Subscript "(R)" or "(S)" indicates the isomer of the internucleoside linkage as Rp or Sp respectively. Each nucleoside followed by a subscript "e" indicates a 2'-O-methoxyethyl (MOE) modified nucleoside and each nucleoside followed by a subscript "k" is a bicyclic nucleoside having a 4'-CH((S)-CH₃))-O-2' bridging group (cEt) and all other nucleosides are 2'-deoxyribonucleosides. Each "^mC" is a 5-methyl cytosine modified nucleoside. Nucleosides followed by subscripts "e" or "k" are further illustrated below.

Example 29

Modified methods for deprotection and cleavage of oligonucleotides with modified internucleoside linkages (synthesis of ISIS 736646)

[0494] The SRB-1 targeted oligonucleotide ISIS 736646 (see examples 34 and 35) was synthesized using standard methods on a 40 µM scale. The first base (^mC_k, 3'-end) was pre-loaded on VIMAD solid support via succinate at 326 µmol/gram. For the modified methods non-standard protecting groups were used for particular amidites. The exocyclic amino groups of 2'-deoxy ^mC and ^mC_k were protected with isobutyryl groups and the exocyclic amino group of 2'-deoxy G was protected with DMF.

SEQ ID NO./ISIS NO.	Composition (5' to 3')	Linkage
12/736646	TkTkmCkAGTmCATGAmCTTkxmCkxmCk	MP

MW 5638.325 (DMT on), MW 5335.325 (DMT off)

[0495] Between adjacent nucleosides subscript "x" indicates a methyl phosphonate modified internucleoside linkage (-P(CH₃)(=O)-, MP) and all other internucleoside linkages are phosphorothioate internucleoside linkages. Each nucleoside followed by a subscript "k" is a bicyclic nucleoside having a 4'-CH((S)-CH₃))-O-2' bridging group (cEt) and all other nucleosides are 2'-deoxyribonucleosides. Each "^mC" is a 5-methyl cytosine nucleoside.

[0496] 400 mg fully protected oligo on VIMAD resin was placed in a glass pressure vial with a magnetic stir bar. Dry THF (5 mL) was added, and the mixture was allowed to stir and swell for 15 minutes. Ethylenediamine (EDA, 5 mL) was added via syringe with stirring at room temperature. The reaction was heated 55 °C with stirring in an oil bath for 15 minutes. The reaction was cooled in an ice bath and diluted with THF (5 mL). The reaction was centrifuged (3000 rpm, 5 minutes), and the solvent was removed via pipette. The residue was re-suspended in dry THF (7 mL) and was stirred vigorously for 5 minutes, followed by centrifugation and removal of solvent. The THF rinse process was repeated a third time. The pellet was suspended in 50 % EtOH in H₂O (7 mL) with vigorous stirring (5 minutes). The spent resin was removed by filtration, and was rinsed with 50 % EtOH (15 mL). The crude cleavage solution was diluted to a final volume of 25 mL. Quantification of the crude cleavage solution (UV, 260 nm) indicated 19.54 µmol recovery (crude, 50 %).

[0497] The modified cleavage and deprotection methods are amenable to any of the modified internucleoside linkages, including those disclosed herein such as the methoxypropyl phosphonate modified internucleoside linkages (-P(CH₃O-(CH₂)₃-)(=O,S)-, MOP) and are merely exemplified for ISIS 736646.

Example 30

Thermal Stability Assay

[0498] A series of modified oligomeric compounds were evaluated in a thermal stability (T_m) assay. A Cary 100 Bio spectrophotometer with the Cary Win UV Thermal program was used to measure absorbance vs. temperature. For the T_m experiments, oligomeric compounds were prepared at a concentration of 8 µM in a buffer of 100 mM Na+, 10 mM phosphate and 0.1 mM EDTA (pH 7). The concentration of the oligonucleotides was determined at 85 °C. The concentration of each oligomeric compound was 4 µM after mixing of equal volumes of test oligomeric compound and complimentary RNA strand. Oligomeric compounds were hybridized with the complimentary RNA strand by heating the duplex to 90 °C for 5 minutes followed by cooling to room temperature. Using the spectrophotometer, T_m measurements were taken by heating the duplex solution at a rate of 0.5 °C/min in cuvette starting @ 15 °C and heating to 85 °C. T_m values were determined using Vant Hoff calculations (A₂₆₀ vs temperature curve) using non self-complementary sequences where the minimum absorbance which relates to the duplex and the maximum absorbance which relates to the non-duplex single strand are manually integrated into the program. The oligomeric compounds were hybridized to complementary RNA (ISIS 606581). The results are presented below.

SEQ ID NO./ISIS NO.	Composition (5' to 3')	Tm	ΔTm	Linkage/chemistry
07/606581	UCGAGAACAUCC	n/a		PO/RNA complement
08/606339	GGATGTTCTCGA	49.4	std.	PO/DNA unmodified
08/614338	GGATGTxTCTCGA	47.5	-1.9	MP
08/614362	GGATGTx(S)TCTCGA	45.2	-4.2	MP(Sp)
08/614361	GGATGTX(R)TCTCGA	48.9	-0.9	MP(Rp)
08/618681	GGATGTqTCTCGA	48.7	-0.7	MOP
08/619024	GGATGTq(S)TCTCGA	44.8	-4.6	MOP(Sp)
08/619025	GGATGTq(R)TCTCGA	48.9	-0.9	MOP(Rp)
08/606346	GGATGTkTCTCGA	54.7	5.3	PO/cEt
08/614341	GGATGTkxTCTCGA	53.5	4.1	MP/cEt
08/614365	GGATGTkx(S)TCTCGA	50.2	0.8	MP(Sp)/cEt
08/614366	GGATGTkx(R)TCTCGA	54.2	4.8	MP(Rp)/cEt
08/618684	GGATGTkqTCTCGA	53.9	4.5	MOP/cEt
08/606349	GGATGTkTkCTCGA	62.3	6.5	cEt (x2)
08/614342	GGATGTkxTkCTCGA	59.6	5.1	MP/cEt (x2)
08/618685	GGATGTkqTkCTCGA	59.4	5.0	MOP/cEt (x2)

[0499] Between adjacent nucleosides subscript "x" indicates a methyl phosphonate modified internucleoside linkage (-P(CH₃)(=O)-, MP), subscript "q" indicates a methoxypropyl phosphonate modified internucleoside linkage (-P(CH₃O-(CH₂)₃-)(=O)-, MOP) and all other internucleoside linkages are phosphodiester (PO) internucleoside linkages. Subscript "(R)" or "(S)" indicates the isomer of the internucleoside linkage as Rp or Sp respectively. ΔTm's are calculated relative to 606339. Each nucleoside followed by a subscript "k" is a bicyclic ribofuranosyl nucleoside having a 4'-CH((S)-CH₃))-O-2' bridging group.

Example 31

Thermal Stability Assay

[0500] A series of modified oligomeric compounds were evaluated in a thermal stability (T_m) assay following the procedures illustrated in Example 30. The results are presented below.

SEQ ID NO./ISIS NO.	Composition (5' to 3')	Tm	ΔTm	Linkage
07/606581	UCGAGAACAUCC	n/a		PO (RNA)
08/606339	GGATGTTCTCGA	49.4	std.	PO (DNA)
08/748260	GGATlqGTTCTCGA	54.2	4.8	MOP
08/748261	GGATGTlqTCTCGA	52.9	3.5	MOP
08/748262	GGATGTTlqCTCGA	54.9	5.5	MOP
08/748263	GGATGTTCTlqCGA	52.5	3.1	MOP
08/748256	GGATlxGTTCTCGA	55.0	5.6	MP
08/748257	GGATGTlxTCTCGA	52.3	2.9	MP
08/748258	GGATGTTlxCTCGA	55.0	5.6	MP
08/748259	GGATGTTCTlxCGA	52.6	3.2	MP.

between adjacent nucleosides subscript "x" indicates a methyl phosphonate modified internucleoside linkage (-P(CH₃)(=O)-, MP), subscript "q" indicates a methoxypropyl modified internucleoside linkage (-P(CH₃O-(CH₂)₃-)(=O)-, MOP) and all other internucleoside linkages are phosphodiester internucleoside linkages. Each nucleoside followed by a subscript "l" is a bicyclic ribofuranosyl nucleoside having a 4'-CH₂-O-2' bridging group (LNA). ΔTm's are calculated relative to 606339.

Example 32

Stability of Modified Linkages to Aqueous Ammonia

[0501] To evaluate internucleoside linkage stability under conditions similar to those encountered during deblocking and cleavage steps of oligomeric compound synthesis a comparative assay was performed with 2 sets of 2 identical oligomeric compounds wherein the only difference in each set is that one of the oligomeric compounds had a single methoxypropyl phosphonate modified internucleoside linkage (-P(CH₃O-(CH₂)₃-)(=O)- MP) and the other oligomeric compound had a single methylene phosphonate modified internucleoside linkage (-P(CH₃)(=O)-, MP). The stability was measured up to 16 days.

[0502] Each oligonucleotide was subjected to standard deprotection conditions used for automated oligonucleotide synthesis (ammonium hydroxide aqueous). Each oligonucleotide listed (10 nmol) is dissolved in concentrated aqueous ammonia (0.5 mL) and mixed at room temperature. Aliquots are taken out at the time points indicated and analyzed using LCMS.

SEQ ID NO./ISIS NO.	Composition (5' to 3')	Linkage/isomer
09/619442	TeAkAkATqTGTmCATmCAkmCkmCe	MOP full PS
09/558256	TeAkAkATxTGTmCATmCAkmCkmCe	MP full PS
08/748262	GoGoAoToGoToTlqCoToCoGoA	MOP full PO
08/748258	GoGoAoToGoToTlxCoToCoGoA	MP full PO

[0503] Between adjacent nucleosides subscript "x" indicates a methyl phosphonate modified internucleoside linkage (-P(CH₃)(=O)-, MP), subscript "q" indicates a methoxypropyl phosphonate modified internucleoside linkage (-P(CH₃O-(CH₂)₃-)(=O)-, MOP), subscript "o" indicates a phosphodiester (PO) internucleoside linkage and all other internucleoside linkages are phosphorothioate (PS) internucleoside linkages. Each nucleoside followed by a subscript "k" is a bicyclic nucleoside having a 4'-CH((S)-CH₃))-O-2' bridging group, each nucleoside followed by a subscript "l" is a bicyclic nucleoside having a 4'-CH₂-O-2' bridging group and all other nucleosides are 2'-deoxyribonucleosides. Each "^mC" is a 5-methyl cytosine nucleoside.

SEQ ID NO./ISIS NO.	% Cleavage
	Day-1	Day-2	Day-3	Day-4	Day-8	Day-16	Linkages
09/619442	<1			2	7	12	MOP	(PS)
09/558256	<1			4	35	43	MP	(PS)
08/748262	40	57	75				MOP	(PO)
08/748258	86	95	100				MP	(PO).

[0504] To determine the effect of ammonium hydroxide treatment on the overall yield of various oligomeric compounds, a series of oligomeric compounds were prepared for comparison. The oligomeric compounds were prepared in pairs that differ only in having either MOP or MP internucleoside linkages at the same locations. The demonstrated degradation caused by treatment with ammonium hydroxide also results in a reduction in yield during the standard deblocking and cleavage steps. The lability of each oligomeric compound will depend on the chemistry and position of each modified internucleoside linkage. The oligomeric compounds listed below were prepared having either MOP or MP internucleoside linkages located at selected positions. The syntheses were performed on 40 µmol scale. It is shown that overall the MOP internucleoside linkage leads to a higher yield.

SEQ ID NO./ISIS NO.	Composition (5' to 3')	Linkage
12/736674	TkTkqmCkqAGTmCATGAmCTTkmCkmCk	MOP	24%
12/736645	TkTkxmCkxAGTmCATGAmCTTkmCkmCk	MP	10%
12/736648	TkTkmCkAqGqTmCATGAmCTTkmCkmCk	MOP	21%
12/582074	TkTkmCkAXGXTmCATGAmCTTkmCXmCk	MP	11%
12/736649	TkTkmCkAGTmCATGAmCqTqTkmCkmCk	MOP	21%
12/736673	TkTkmCkAGTmCATGAmCxTxTkmCkmCk	MP	5%
12/736675	TkTkmCkAGTmCATGAmCTTkqmCkqmCk	MOP	16%
12/736646	TkTkmCkAGTmCATGAmCTTkxmCkxmCk	MP	31%
12/736676	TkTkqmCkqAGTmCATGAmCTTkqmCkqmCk	MOP	19%
12/736647	TkTkxmCkxAGTmCATGAmCTTkxmCkxmCk	MP	11%.

Example 33

Modified oligonucleotides comprising a methoxypropyl phosphonate internucleoside linkage targeting HTT SNP in vitro study

[0505] Modified oligonucleotides were designed based on ISIS 460209, having a 3/9/3 gapmer motif wherein each internucleoside linkage is a phosphorothioate, the gap region contains nine β-D-2'-deoxyribonucleosides and each wing contains 3 modified nucleosides. For each of the modified oligonucleotides a modified internucleoside linkage was placed between nucleosides 5 and 6, from the 5'-end. The modified oligonucleotides were tested for their ability to selectively inhibit mutant (mut) HTT mRNA expression levels targeting rs7685686 while leaving the expression of the wild-type (wt) intact. The potency and selectivity of the modified oligonucleotides were evaluated and compared to the control ISIS 460209 which was identical to the other oligonucleotides but did not include a modified linkage. The position on the oligonucleotides opposite to the SNP position, as counted from the 5'-terminus is position 8.

[0506] The modified oligonucleotides were tested in vitro using heterozygous fibroblast GM04022 cell line was used (from Coriell Institute). Cultured GM04022 cells at a density of 25,000 cells per well were transfected using electroporation with 0.1, 0.4, 1.1, 3.3 and 10 µM concentrations of modified oligonucleotides. After a treatment period of approximately 24 hours, cells were washed with DPBS buffer and lysed. RNA was extracted using Qiagen RNeasy purification and mRNA levels were measured by quantitative real-time PCR using ABI assay C_2229297_10 which measures at dbSNP rs362303. RT-PCR method in short; A mixture was made using 2020 uL 2X PCR buffer, 101 uL primers (300 µM from ABI), 1000 uL water and 40.4 uL RT MIX. To each well was added 15 uL of this mixture and 5 uL of purified RNA. The mutant and wild-type HTT mRNA levels were measured simultaneously by using two different fluorophores, FAM for mutant allele and VIC for wild-type allele. The HTT mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN.

[0507] The half maximal inhibitory concentration (IC₅₀) of each oligonucleotide is presented below and was calculated by plotting the concentrations of oligonucleotides used versus the percent inhibition of HTT mRNA expression achieved at each concentration, and noting the concentration of oligonucleotide at which 50% inhibition of HTT mRNA expression was achieved compared to the control. The IC₅₀ at which each oligonucleotide inhibits the mutant HTT mRNA expression is denoted as 'mut IC₅₀'. The IC₅₀ at which each oligonucleotide inhibits the wild-type HTT mRNA expression is denoted as 'wt IC₅₀'. Selectivity as expressed in "fold" was calculated by dividing the IC₅₀ for inhibition of the wild-type HTT versus the IC₅₀ for inhibiting expression of the mutant HTT mRNA and the results are presented below.

[0508] The modified oligomeric compounds were also evaluated in a thermal stability (T_m) assay using the procedure illustrated in Example 30. The oligomeric compounds were hybridized to a complementary region of an RNA 30mer (ISIS 539568). The results are presented below.

SEQ ID NO./ISIS NO.	Composition (5' to 3')	Tm/ΔTm	Linkage(isomer)
09/460209	TeAkAkATTGTmCATmCAkmCkmCe	54.7/-	unmodified (full PS)
09/558256	TeAkAkATxTGTmCATmCAkmCkmCe	53.8/-0.9	MP
09/622261	TeAkAkATx(S)TGTmCATmCAkmCkmCe	51.3/-3.4	MP(Sp)
09/622262	TeAkAkATx(R)TGTmCATmCAkmCkmCe	53.1/-1.6	MP(Rp)
09/619442	TeAkAkATqTGTmCATmCAkmCkmCe	53.6/-1.1	MOP
09/619443	TeAkAkATq(S)TGTmCATmCAkmCkmCe	51.7/-3.0	MOP(Sp)
09/619444	TeAkAkATq(R)TGTmCATmCAkmCkmCe	53.8/-0.9	MOP(Rp)

SEQ ID NO. Sequence (5' to 3', RNA complement)

[0509] 10/539568 AGACUUUUUCUGGUGAUGACAAUUUAUUAA RNA (full PO)

[0510] Between adjacent nucleosides subscript "x" indicates a methyl phosphonate modified internucleoside linkage (-P(CH₃)(=O)-, MP), subscript "q" indicates a methoxypropyl phosphonate modified internucleoside linkage (-P(CH₃O-(CH₂)₃-)(=O)- MOP) and all other internucleoside linkages are phosphorothioate internucleoside linkages except that each internucleoside linkage for the RNA complement (539568) is a phosphodiester internucleoside linkage. Subscript "(R)" or "(S)" indicates the isomer of the internucleoside linkage as Rp or Sp respectively. Each nucleoside followed by a subscript "e" indicates a 2'-O-methoxyethyl (MOE) modified nucleoside and each nucleoside followed by a subscript "k" is a bicyclic nucleoside having a 4'-CH((S)-CH₃))-O-2' bridging group (cEt) and all other nucleosides are 2'-deoxyribonucleosides. Each "^mC" is a 5-methyl cytosine modified nucleoside. ΔTm's are calculated relative to 460209.

SEQ ID NO./ISIS NO.	mut IC50 (µM)	wt IC50 (µM)	Fold Selectivity (mut vs. wt)	Modified linkage
09/460209	0.50	2.5	5.0	Positive control (3/9/3)
09/558256	0.34	4.76	14	MP
09/622261	0.62	8.86	14	MP(Sp)
09/622262	0.45	>10	>22	MP(Rp)
09/619442	0.44	>10	>34	MOP
09/619443	1.14	9.46	8.3	MOP(Sp)
09/619444	0.33	8.25	25	MOP(Rp).

Example 34

Modified oligonucleotides targeting SRB-1 in vitro study

[0511] Modified oligonucleotides were designed based on the control oligonucleotide ISIS 449093, having a 3/10/3 gapmer motif wherein each internucleoside linkage is a phosphorothioate, the gap region contains ten β-D-2'-deoxyribonucleosides and each wing contains 3 cEt bicyclic nucleosides. Either 2 or 4 methoxypropyl modified internucleoside linkages were positioned in each of the modified oligonucleotides which were tested for their ability to inhibit SRB-1 mRNA expression levels. The potency of the modified oligonucleotides was evaluated and compared to the control oligonucleotide.

[0512] The modified oligonucleotides were tested in vitro in primary mouse hepatocyte cells. Cells at a density of 35,000 cells per well were transfected using electroporation with 0.000976, 0.0039, 0.0156, 0.0625, 0.250 and 1.000 nM concentrations of each of the oligonucleotides listed below. After a treatment period of approximately 24 hours, RNA is isolated from the cells and mRNA levels are measured by quantitative real-time PCR wherein the SRB-1 mRNA levels are adjusted according to total RNA content, as measured by RIBOGREEN®.

SEQ ID NO./ISIS NO.	Composition (5' to 3')	Linkage
17/463290	AAGGAAGUCAUGACUGAAGC	RNA (full PO)
12/449093	TkTkmCkAGTmCATGAmCTTkmCkmCk	unmodified (full PS)
12/736674	TkTkqmCkqAGTmCATGAmCTTkmCkmCk	MOP
12/736648	TkTkmCkAqGqTmCATGAmCTTkmCkmCk	MOP
12/736649	TkTkmCkAGTmCATGAmCqTqTkmCkmCk	MOP
12/736675	TkTkmCkAGTmCATGAmCTTkqmCkqmCk	MOP
12/736676	TkTkqmCkqAGTmCATGAmCTTkqmCkqmCk	MOP

[0513] Between adjacent nucleosides subscript "q" indicates a methoxypropyl phosphonate (MOP) modified internucleoside linkage (-P(CH₃O-(CH₂)₃-)(=O)-) and all other internucleoside linkages are phosphorothioate internucleoside linkages. Each nucleoside followed by a subscript "k" is a bicyclic nucleoside having a 4'-CH((S)-CH₃)-O-2' bridging group (cEt) and all other nucleosides are 2'-deoxyribonucleosides. Each "^mC" indicates that this nucleoside comprises a 5-methyl cytosine heterocyclic base. The hybridizing region of the RNA complementary strand is underlined.

SEQ ID NO./ISIS NO.	Tm,°C	ΔTm,°C	IC50 free uptake	IC50 electroporation
12/449093	70.4	n/a	1.0	9.9
12/736674	64.9	-2.8	12.1	22.9
12/736648	68.1	-1.2	2.0	14.2
12/736649	68.8	-0.8	2.9	13.7
12/736675	68.4	-1.0	2.9	10
12/736676	66.0	-1.1	12.5	23.3

[0514] The half maximal inhibitory concentration (IC₅₀) of each oligonucleotide listed above is calculated by plotting the concentrations of oligonucleotides used versus the percent inhibition of SRB-1 mRNA expression achieved at each concentration, and noting the concentration of oligonucleotide at which 50% inhibition of SRB-1 mRNA expression is achieved compared to the control. ΔTm's are calculated relative to 449093.

Example 35

Modified oligonucleotides targeting SRB-1 in vivo study

[0515] Modified oligonucleotides were designed based on the control oligonucleotide ISIS 449093, having a 3/10/3 gapmer motif wherein each internucleoside linkage is a phosphorothioate, the gap region contains ten β-D-2'-deoxyribonucleosides and each wing contains 3 cEt bicyclic nucleosides. Either 2 or 4 methoxypropyl (MOP) modified internucleoside linkages were positioned in each of the modified oligonucleotides which were tested for their ability to inhibit SRB-1 mRNA expression levels. The study included unmodified oligonucleotide 449093 for comparison. The potency of the modified oligonucleotides was evaluated and compared to the control oligonucleotide.

[0516] Six week old BALB/C mice (Jackson Laboratory, Bar Harbor, ME) were injected subcutaneously once at dosage of 3, 10, 30 or 100 mg/kg with the modified oligonucleotides targeted to SRB-1 mRNA. The mice were sacrificed 72 hrs following administration. Liver tissues were homogenized and mRNA levels were quantitated using real-time PCR as described herein for comparison to untreated control levels (%UTC). Organs (liver, kidney and spleen) were collected for PK.

SEQ ID NO./ISIS NO.	Composition (5' to 3')	Linkage
12/449093	TkTkmCkAGTmCATGAmCTTkmCkmCk	full PS
12/736674	TkTkqmCkqAGTmCATGAmCTTkmCkmCk	MOP
12/736648	TkTkmCkAqGqTmCATGAmCTTkmCkmCk	MOP
12/736649	TkTkmCkAGTmCATGAmCqTqTkmCkmCk	MOP
12/736675	TkTkmCkAGTmCATGAmCTTkqmCkqmCk	MOP
12/736676	TkTkqmCkqAGTmCATGAmCTTkqmCkqmCk	MOP

[0517] Between adjacent nucleosides subscript "q" indicates a methoxypropyl phosphonate (MOP) modified internucleoside linkage (-P(CH₃O-(CH₂)₃-)(=O)-) and all other internucleoside linkages are phosphorothioate internucleoside linkages. Each nucleoside followed by a subscript "k" is a bicyclic nucleoside having a 4'-CH((S)-CH₃)-O-2' bridging group (cEt) and all other nucleosides are 2'-deoxyribonucleosides. Each "^mC" indicates that this nucleoside comprises a 5-methyl cytosine heterocyclic base.

SEQ ID NO./ISIS NO.	ED50	MTD	TI	Linkage
12/449093	3.2	10	3.1	full PS
12/736674	13	>100	>7.7	MOP
12/736648	7.6	>100	>13	MOP
12/736649	11.3	>100	>8.8	MOP
12/736675	5.7	30	5.3	MOP
12/736676	28	>100	>3.6	MOP

[0518] The ED₅₀, is the effective dose, for 50% of the animals receiving the drug. The ED₅₀ is commonly used as a measure of the reasonable expectancy of a drug effect. The ED₅₀s listed in the table below were calculated by plotting the concentrations of oligonucleotides used versus the percent inhibition of SRB-1 mRNA expression achieved at each concentration, and noting the concentration of oligonucleotide at which 50% inhibition of SRB-1 mRNA expression was achieved compared to the control.

[0519] The mean tolerable dose (MTD) is the lowest dose wherein the ALT is normal (generally less than 3 times the value of the saline treated animal).

[0520] The therapeutic index (TI) is calculated as the MTD divided by the ED₅₀.

SEQ ID NO./ISIS NO.	ALT	ALT	ALT	ALT
	3 mg/kg	10 mg/kg	30 mg/kg	100 mg/kg
saline	38
12/449093	92	47	473	2246
12/736674	53	66	51	41
12/736648	68	35	35	74
12/736649	55	73	63	55
12/736675	43	42	55	297
12/736676	108	58	56	35.

Example 36

Modified oligonucleotides targeting FXI in vitro study

[0521] Modified oligonucleotides were designed based on the control oligonucleotide ISIS 464917, having a 3/10/3 gapmer motif wherein each internucleoside linkage is a phosphorothioate, the gap region contains ten β-D-2'-deoxyribonucleosides and each wing contains 3 cEt bicyclic nucleosides. Two methoxypropyl phosphonate modified internucleoside linkages were positioned in each of the modified oligonucleotides which are tested for their ability to inhibit FXI mRNA expression levels. The potency of the modified oligonucleotides are evaluated and compared to the control oligonucleotide.

[0522] The modified oligonucleotides are tested in vitro in primary mouse hepatocyte cells. Cells at a density of 35,000 cells per well are transfected using electroporation with 0.015, 0.056, 0.234, 0.937, 3.750 and 15.000 µM concentrations of each of the oligonucleotides listed below. After a treatment period of approximately 24 hours, RNA is isolated from the cells and mRNA levels are measured by quantitative real-time PCR and the SRB-1 mRNA levels are adjusted according to total RNA content, as measured by RIBOGREEN®.

SEQ ID NO./ISIS NO.	Composition (5' to 3')	Linkage
11/464917	GkTkmCkTGTGmCATmCTmCTkmCkmCk	full PS
11/718411	GkTkqmCkqTGTGmCATmCTmCTkmCkmCk	MOP
11/718413	GkTkmCkTqGqTGmCATmCTmCTkmCkmCk	MOP
11/718416	GkTkmCkTGTGmCATmCTqmCqTkmCkmCk	MOP
11/718417	GkTkmCkTGTGmCATmCTmCTkqmCkqmCk	MOP
11/718418	GkTkqmCkTqGTGmCATmCTmCTkmCkmCk	MOP

[0523] Between adjacent nucleosides subscript "q" indicates a methoxypropyl phosphonate (MOP) modified internucleoside linkage (-P(CH₃O-(CH₂)₃-)(=O)-) and all other internucleoside linkages are phosphorothioate internucleoside linkages. Each nucleoside followed by a subscript "k" is a bicyclic nucleoside having a 4'-CH((S)-CH₃)-O-2' bridging group (cEt) and all other nucleosides are 2'-deoxyribonucleosides. Each "^mC" indicates that this nucleoside comprises a 5-methyl cytosine heterocyclic base.

[0524] The half maximal inhibitory concentration (IC₅₀) of each oligonucleotide listed above is calculated by plotting the concentrations of oligonucleotides used versus the percent inhibition of FXI mRNA expression achieved at each concentration, and noting the concentration of oligonucleotide at which 50% inhibition of FXI mRNA expression is achieved compared to the control.

Example 37

Modified oligonucleotides targeting CXCL12 in vitro study

[0525] Modified oligonucleotides were designed based on the control oligonucleotide ISIS 558807, having a 3/10/3 gapmer motif wherein each internucleoside linkage is a phosphorothioate, the gap region contains ten β-D-2'-deoxyribonucleosides and each wing contains 3 cEt bicyclic nucleosides. Methoxypropyl phosphonate internucleoside linkages were positioned at various positions within gap of the oligonucleotides as illustrated below. The resulting modified oligonucleotides were tested for their ability to inhibit CXCL12 (Chemokine ligand 12) and Raptor mRNA expression levels. The potency of the modified oligonucleotides was evaluated and compared to the control oligonucleotide. The table is divided into 6 sections to reflect that 6 separate assays were performed (3 assays targeting CXCL12 and 3 assays targeting Raptor).

[0526] The modified oligonucleotides were tested in vitro in mouse b.END cells by electroporation. Cells at a density of 20,000 cells per well are transfected using electroporation with 0.027, 0.082, 0.25, 0.74, 2.22, 6.67 and 20 uM concentrations of each of the oligonucleotides listed below. After a treatment period of approximately 24 hours, RNA is isolated from the cells and mRNA levels are measured by quantitative real-time PCR and the CXCL12 mRNA and Raptor mRNA levels are adjusted according to total RNA content, as measured by RIBOGREEN®.

SEQ ID NO./ISIS NO.	Composition (5' to 3')	Tm/ΔTm °C	Linkage
15/558807	GkmCkAkTGTTmCTmCAmCATkTkAk	63.7/std	full PS
15/766653	GkmCkAkTqGqTTmCTmCAmCATkTkAk	60.3/-1.7	MOP/PS
15/766654	GkmCkAkTGqTqTmCTmCAmCATkTkAk	60.0/-1.9	MOP/PS
15/766655	GkmCkAkTGTqTqmCTmCAmCATkTkAk	61.9/-0.9	MOP/PS
15/766666	GkmCkAkTGTTqmCqTmCAmCATkTkAk	61.2/-1.3	MOP/PS
15/766657	GkmCkAkTGTTmCqTqmCAmCATkTkAk	60.1/-1.8	MOP/PS
15/766658	GkmCkAkTGTTmCTqmCqAmCATkTkAk	54.5/-4.6	MOP/PS
15/766659	GkmCkAkTGTTmCTmCqAqmCATkTkAk	61.0/-1.4	MOP/PS
15/766665	GkmCkAkTGTTmCTmCAqmCqATkTkAk	61.6/-1.1	MOP/PS
15/766664	GkmCkAkTGTTmCTmCAmCqAqTkTkAk	61.3/-1.2	MOP/PS

[0527] Between adjacent nucleosides subscript "q" indicates a methoxypropyl phosphonate modified internucleoside linkage (-P(CH₃O-(CH₂)₃-)(=O)-, MOP) and all other internucleoside linkages are phosphorothioate internucleoside linkages. Each nucleoside followed by a subscript "k" is a bicyclic nucleoside having a 4'-CH((S)-CH₃))-O-2' bridging group (cEt) and all other nucleosides are 2'-deoxyribonucleosides. Each "^mC" indicates that this nucleoside comprises a 5-methyl cytosine heterocyclic base. Tm's were performed following essentially the procedures illustrated in Example 30.

[0528] The half maximal inhibitory concentration (IC₅₀) of each oligonucleotide listed above was calculated by plotting the concentration of oligonucleotide versus the percent inhibition of CXCL12 mRNA or Raptor mRNA expression achieved at each concentration, and noting the concentration of oligonucleotide at which 50% inhibition of CXCL12 mRNA expression is achieved compared to the control.

SEQ ID NO./ISIS NO.	IC50/CXCL12	Linkage
15/558807	150	full PS
15/766653	200	MOP/PS
15/766654	250	MOP/PS
15/766655	250	MOP/PS
15/558807	200	full PS
15/766666	200	MOP/PS
15/766657	200	MOP/PS
15/766658	350	MOP/PS
15/558807	100	full PS
15/766659	100	MOP/PS
15/766665	100	MOP/PS
15/766664	100	MOP/PS

SEQ ID NO./ISIS NO.	IC50/Raptor	Linkage
15/558807	3000	full PS
15/766653	>20000	MOP/PS
15/766654	>20000	MOP/PS
15/766655	>20000	MOP/PS
15/558807	4000	full PS
15/766666	>20000	MOP/PS
15/766657	6000	MOP/PS
15/766658	6000	MOP/PS
15/558807	2500	full PS
15/766659	2000	MOP/PS
15/766665	1500	MOP/PS
15/766664	2000	MOP/PS

[0529] Addition modified oligonucleotides were designed based on the control oligonucleotide ISIS 558807, having a 3/10/3 gapmer motif wherein each internucleoside linkage is a phosphorothioate, the gap region contains ten β-D-2'-deoxyribonucleosides and each wing contains 3 cEt bicyclic nucleosides for evaluation in the above illustrated assays.

SEQ ID NO./ISIS NO.	Composition (5' to 3')	Linkage
15/558807	GkmCkAkTGTTmCTmCAmCAmCATkTkAk	full PS
15/766676	GkmCkAkTqGTTmCTmCAmCATkTkAk	MOP/PS
15/766677	GkmCkAkTGqTTmCTmCAmCATkTkAk	MOP/PS
15/766678	GkmCkAkTGTqTmCTmCAmCATkTkAk	MOP/PS
15/766679	GkmCkAkTGTTqmCTmCAmCATkTkAk	MOP/PS
15/766680	GkmCkAkTGTTmCqTmCAmCATkTkAk	MOP/PS
15/766681	GkmCkAkTGTTmCTqmCAmCATkTkAk	MOP/PS
15/766682	GkmCkAkTGTTmCTmCqAmCATkTkAk	MOP/PS
15/766683	GkmCkAkTGTTmCTmCAqmCATkTkAk	MOP/PS
15/766684	GkmCkAkTGTTmCTmCAmCqATkTkAk	MOP/PS
15/766685	GkmCkAkTGTTmCTmCAmCAqTkTkAk	MOP/PS
16/558765	AkmCkAkTmCTTmCAGATmCAkTkTk	full PS
16/766686	AkmCkAkTqmCqTTmCAGATmCAkTkTk	MOP/PS
16/766687	AkmCkAkTmCqTqTmCAGATmCAkTkTk	MOP/PS
16/766688	AkmCkAkTmCTqTqmCAGATmCAkTkTk	MOP/PS
16/766689	AkmCkAkTmCTTqmCqAGATmCAkTkTk	MOP/PS
16/766690	AkmCkAkTmCTTmCqAqGATmCAkTkTk	MOP/PS
16/766691	AkmCkAkTmCTTmCAqGqATmCAkTkTk	MOP/PS
16/766692	AkmCkAkTmCTTmCAGqAqTmCAkTkTk	MOP/PS
16/766693	AkmCkAkTmCTTmCAGAqTqmCAkTkTk	MOP/PS
16/766694	AkmCkAkTmCTTmCAGATqmCqAkTkTk	MOP/PS
16/766695	AkmCkAkTqmCTTmCAGATmCAkTkTk	MOP/PS
16/766696	AkmCkAkTmCqTTmCAGATmCAkTkTk	MOP/PS
16/766697	AkmCkAkTmCTqTmCAGATmCAkTkTk	MOP/PS
16/766698	AkmCkAkTmCTTqmCAGATmCAkTkTk	MOP/PS
16/766699	AkmCkAkTmCTTmCqAGATmCAkTkTk	MOP/PS
16/766700	AkmCkAkTmCTTmCAqGATmCAkTkTk	MOP/PS
16/766701	AkmCkAkTmCTTmCAGqATmCAkTkTk	MOP/PS
16/766702	AkmCkAkTmCTTmCAGAqTmCAkTkTk	MOP/PS
16/766703	AkmCkAkTmCTTmCAGATqmCAkTkTk	MOP/PS
16/766704	AkmCkAkTmCTTmCAGATmCqAkTkTk	MOP/PS

Example 38

Stability and cleavage patterns of modified oligonucleotides (RNA/ASO duplexes) subjected to RNaseH 1 treatment

[0530] Modified oligonucleotides were designed based on the control oligonucleotide ISIS 558807, having a 3/10/3 gapmer motif wherein each internucleoside linkage is a phosphorothioate, the gap region contains ten β-D-2'-deoxyribonucleosides and each wing contains 3 cEt bicyclic nucleosides. Methoxypropyl phosphonate internucleoside linkages were positioned at various positions within gap of the oligonucleotides as illustrated below. The resulting modified oligonucleotides (ASOs) were hybridized to complementary RNA strands to provide RNA/ASO duplexes that were then treated with Human RNase H1.

[0531] Human RNase H1 (1:100 dilution) was prepared by adding Human RNase H1 (1.0 µL) to RNase H1 dilution buffer (72 µL) (RNase H1 dilution buffer: glycerol 30%; 20 mM Tris pH7.5; 50 mM NaCl) and RNAseOUT (8 µL). The dilution was allowed to incubate for 1 hour prior to use.

[0532] RNA/ASO duplexes were prepared by heating a buffered solution of each of the modified oligonucleotides (400 nM) listed in the table below with the complementary RNA (IDT, 200 nm unlabeled and 1 nm 5'-³²P labeled) to 90 °C for 2 minutes. The buffered solution is prepared having 20 mM Tris pH 7.5; 50 mM NaCl; 2 mM MgCl; 0.2 mM TCEP; and 2 µL RNAseOUT.

[0533] To each of the RNA/ASO duplexes (20 µL) is added the Human RNase H1 solution (1 µL) in a heat block at 37 °C for 30 minutes. The samples are then quenched with urea (20 µL, 8M) and heated to 90 °C for 2 minutes.

[0534] The percent cleavage at the 30 minute is shown below.

SEQ ID NO./ISIS NO.	Composition (5' to 3')	Cleavage %	Linkage
17/IDT	UAAUGUGAGAACAUGC	n/a	RNA
15/558807	GkmCkAkTGTTmCTmCAmCATkTkAk	36.80	full PS
15/766653	GkmCkAkTqGqTTmCTmCAmCATkTkAk	50.10	MOP/PS
15/766654	GkmCkAkTGqTqTmCTmCAmCATkTkAk	48.60	MOP/PS
15/766655	GkmCkAkTGTqTqmCTmCAmCATkTkAk	44.30	MOP/PS
15/766666	GkmCkAkTGTTqmCqTmCAmCATkTkAk	45.00	MOP/PS
15/766657	GkmCkAkTGTTmCqTqmCAmCATkTkAk	48.70	MOP/PS
15/766658	GkmCkAkTGTTmCTqmCqAmCATkTkAk	44.40	MOP/PS
15/766659	GkmCkAkTGTTmCTmCqAqmCATkTkAk	40.30	MOP/PS
15/766665	GkmCkAkTGTTmCTmCAqmCqATkTkAk	44.40	MOP/PS
15/766664	GkmCkAkTGTTmCTmCAmCqAqTkTkAk	50.30	MOP/PS

[0535] Between adjacent nucleosides subscript "q" indicates a methoxypropyl phosphonate modified internucleoside linkage (-P(CH₃O-(CH₂)₃-)(=O)-, MOP) and all other internucleoside linkages are phosphorothioate internucleoside linkages. Each nucleoside followed by a subscript "k" is a bicyclic nucleoside having a 4'-CH((S)-CH₃))-O-2' bridging group (cEt) and all other nucleosides are 2'-deoxyribonucleosides except for the complementary RNA sequence Seq Id No.: 17. Each "^mC" indicates that this nucleoside comprises a 5-methyl cytosine heterocyclic base. The complementary RNA was purchased from IDT.

[0536] The cleavage products were resolved on polyacrylamide gel and quantitated further quantitated using GE Image quant software. The polyacrylamide gel is shown in Figure 1.

Example 39

Modified oligonucleotides targeting Malatl in vitro study

[0537] Modified oligonucleotides were designed based on the control oligonucleotide ISIS 602056, having a 5/10/5 gapmer motif wherein each internucleoside linkage is a phosphorothioate except that 3 of the oligonucleotides have some of the phosphorothioate internucleoside linkages replaced with phosphodiester internucleoside linkages (mixed backbone), the gap region contains ten β-D-2'-deoxyribonucleosides and each wing contains 5 2'-MOE modified nucleosides. Methoxypropyl phosphonate internucleoside linkages are positioned at various positions within the oligonucleotides as illustrated below. The resulting modified oligonucleotides are tested for their ability to inhibit Malatl mRNA expression levels. The potency of the modified oligonucleotides is evaluated and compared to the control oligonucleotide.

[0538] The modified oligonucleotides are tested in vitro in primary mouse hepatocyte cells. Cells at a density of 35,000 cells per well are transfected using electroporation with 0.000976, 0.0039, 0.0156, 0.0625, 0.250 and 1.000 nM concentrations of each of the oligonucleotides listed below. After a treatment period of approximately 24 hours, RNA is isolated from the cells and mRNA levels are measured by quantitative real-time PCR wherein the Malatl mRNA levels are adjusted according to total RNA content, as measured by RIBOGREEN®.

SEQ ID NO /ISIS NO.	Composition (5' to 3')	Linkage
13/602056	GemCemCeAeGeGmCTGGTTATGAemCeTemCeAe	full PS
13/766753	GeqmCemCeqAeGeqGmCTGGTTATGAemCeTemCeAe	MOP/PS
13/766754	GeqmCeqmCeqAeGeGmCTGGTTATGAemCeTemCeAe	MOP/PS
13/766755	GemCemCeqAeqGeqGmCTGGTTATGAemCeTemCeAe	MOP/PS
13/766756	GemCemCeqAeGeqGmCTGGTTATGAemCeTemCeAe	MOP/PS
13/761957	GemCemCeAeGeGmCTGGTTATGAeqmCeTeqmCeAe	MOP/PS
13/766757	GemCemCeAeGeGmCTGGTTATGAemCeqTeqmCeqAe	MOP/PS
13/766758	GemCemCeAeGeGmCTGGTTATGAeqmCeqTeqmCeAe	MOP/PS
13/766759	GemCeqmCeqAeqGeqGmCTGGTTAGAeqmCeqTemCeAe	MOP/PS
13/766766	GeqmCeomCeoAeoGeoGmCTGGTTATGAeoCeoTeqmCeqAe	MOP/PO/PS
13/766761	GeqmCeqmCeoAeoGeGmCTGGTTATGAeomCeoTeqmCeqAe	MOP/PO/PS
13/766762	GeqmCeomCeqAeGeGmCTGGTTATGAemCeqTeomCeqAe	MOP/PO/PS
13/766763	GeqmCeqmCeqAeqGeqGmCTGGTTATGAemCeTemCeAe	MOP/PS
13/766764	GemCemCeAeGeGmCTGGTTATGAeqmCeqTeqmCeqAe	MOP/PS
13/766765	GeqmCeqmCeqAeqGeqGmCTGGTTATGAeqmCeqTeqmCeqAe	MOP/PS
13/766767	GemCemCeAeGeGqmCqTGGTTATGAemCeTemCeAe	MOP/PS
13/766768	GemCemCeAeGeGmCqTqGGTTATGAemCeTemCeAe	MOP/PS
13/766769	GemCemCeAeGeGmCTqGqGTTATGAemCeTemCeAe	MOP/PS
13/766770	GemCemCeAeGeGmCTGqGqTTATGAemCeTemCeAe	MOP/PS
13/766771	GemCemCeAeGeGmCTGGqTqTATGAemCeTemCeAe	MOP/PS
13/766772	GemCemCeAeGeGmCTGGTqTqATGAemCeTemCeAe	MOP/PS
13/766773	GemCemCeAeGeGmCTGGTTqAqTGAemCeTemCeAe	MOP/PS
13/766774	GemCemCeAeGeGmCTGGTTAqTqGAemCeTemCeAe	MOP/PS
13/766775	GemCemCeAeGeGmCTGGTTATqGqAemCeTemCeAe	MOP/PS
13/766784	GemCemCeAeGeGqmCTGGTTATGqAemCeTemCeAe	MOP/PS
13/766785	GemCemCeAeGeGqmCqTGGTTATqGqAemCeTemCeAe	MOP/PS
13/766787	GemCemCeAeGeGqmCqTqGqGTTqAqTqGqAemCeTemCeAe	MOP/PS
13/766776	GemCemCeAeGeGqmCqTqGGTTATGAemCeTemCeAe	MOP/PS
13/766777	GemCemCeAeGeGmCqTqGqGTTATGAemCeTemCeAe	MOP/PS
13/766778	GemCemCeAeGeGmCTqGqGqTTATGAemCeTemCeAe	MOP/PS
13/766779	GemCemCeAeGeGmCTGqGqTqTATGAemCeTemCeAe	MOP/PS
13/766780	GemCemCeAeGeGmCTGGqTqTqATGAemCeTemCeAe	MOP/PS
13/766781	GemCemCeAeGeGmCTGGTqTqAqTGAemCeTemCeAe	MOP/PS
13/766782	GemCemCeAeGeGmCTGGTTqAqTqGAemCeTemCeAe	MOP/PS
13/766783	GemCemCeAeGeGmCTGGTTAqTqGqAemCeTemCeAe	MOP/PS

[0539] Between adjacent nucleosides subscript "q" indicates a methoxypropyl phosphonate (MOP) modified internucleoside linkage (-P(CH₃O-(CH₂)₃-)(=O)-) and all other internucleoside linkages are phosphorothioate internucleoside linkages. Each nucleoside followed by a subscript "e" is a 2'-O-methoxyethyl (MOE) modified nucleoside and all other nucleosides are 2'-deoxyribonucleosides. Each "^mC" indicates that this nucleoside comprises a 5-methyl cytosine heterocyclic base.

[0540] The half maximal inhibitory concentration (IC₅₀) of each oligonucleotide listed above is calculated by plotting the concentrations of oligonucleotides used versus the percent inhibition of Malatl mRNA expression achieved at each concentration, and noting the concentration of oligonucleotide at which 50% inhibition of Malatl mRNA expression is achieved compared to the control.

Example 40

Modified oligonucleotides targeting Androgen receptor in vitro study

[0541] Modified oligonucleotides were designed based on the control oligonucleotide ISIS 585268, having a 4/8/4 gapmer motif wherein each internucleoside linkage is a phosphorothioate, the gap region contains 8 β-D-2'-deoxyribonucleosides and each wing contains 4 modified nucleosides independently selected from 2'-MOE modified nucleosides and bicyclic nucleosides having a 4'-CH((S)-CH₃))-O-2' bridging group. Additional similar motifs are also provided. Methoxypropyl phosphonate internucleoside linkages are positioned at various positions within the oligonucleotides as illustrated below. The resulting modified oligonucleotides are tested for their ability to inhibit Androgen receptor mRNA expression levels. The potency of the modified oligonucleotides is evaluated and compared to the control oligonucleotide.

[0542] The modified oligonucleotides are tested in vitro in primary mouse hepatocyte cells. Cells at a density of 35,000 cells per well are transfected using electroporation with 0.000976, 0.0039, 0.0156, 0.0625, 0.250 and 1.000 nM concentrations of each of the oligonucleotides listed below. After a treatment period of approximately 24 hours, RNA is isolated from the cells and mRNA levels are measured by quantitative real-time PCR and the Androgen receptor mRNA levels are adjusted according to total RNA content, as measured by RIBOGREEN®.

SEQ ID NO./ISIS NO.	Composition (5' to 3')	Linkage
14/585268	AkAeGkTeTGTAGTAGTemCkGemCk	full PS
14/766788	AkAeqGkqTeTGTAGTAGTeqmCkGemCk	MOP/PS
14/766789	AkAeqGkqTeTGTAGTAGTeqmCkqGemCk	MOP/PS
14/766790	AkAeqGkqTeqTGTAGTAGTeqmCkGemCk	MOP/PS
14/766791	AkAeqGkqTeTGTAGTAGTeqmCkqGemCk	MOP/PS
14/766793	AkqAeqGkqTeqTGTAGTAGTemCkGemCk	MOP/PS
14/766794	AkAeGkTeTGTAGTAGTeqmCkqGeqmCk	MOP/PS
14/766795	AkqAeqGkqTeqTGTAGTAGTeqmCkqGeqmCk	MOP/PS
14/766796	AkqAeGkqTeTGTAGTAGTemCkqGemCk	MOP/PS
14/766797	AkAeqGkTeqTGTAGTAGTeqmCkGeqmCk	MOP/PS
14/549372	AkAkGkTTGTAGTAGTmCkGkmCk	MOP/PS
14/766798	AkqAkqGkqTTGTAGTAGTmCkGkmCk	MOP/PS
14/766799	AkAkGkTTGTAGTAGTmCkqGkqmCk	MOP/PS
14/766800	AkqAkqGkqTTGTAGTAGTmCkqGkqmCk	MOP/PS
14/766801	AkAkGkTqTqGTAGTAGTmCkGkmCk	MOP/PS
14/766802	AkAkGkTTqGqTAGTAGTmCkGkmCk	MOP/PS
14/766803	AkAkGkTTGqTqAGTAGTmCkGkmCk	MOP/PS
14/766804	AkAkGkTTGTqAqGTAGTmCkGk mCk	MOP/PS
14/766805	AkAkGkTTGTAqGqTAGTmCkGk mCk	MOP/PS
14/766806	AkAkGkTTGTAGqTqAGTmCkGk mCk	MOP/PS
14/766807	AkAkGkTTGTAGTqAqGTmCkGkmCk	MOP/PS
14/766808	AkAkGkTTGTAGTAqGqTmCkGk mCk	MOP/PS
14/766809	AkAkGkTTGTAGTAGqTqmCkGk mCk	MOP/PS
14/766800	AkqAkqGkqTTGTAGTAGTmCkqGkqmCk	MOP/PS
14/766810	AkqAkqGkqTTGTAGTAqGqTqmCeGemCe	MOP/PS
14/766811	AkqAkqGkqTTGTAGTAGqTqmCkqGemCe	MOP/PS
14/766812	AeAkqGeTqTGTAGTAGTemCkqGemCk	MOP/PS
14/642460	AqAqGqTTGTAGTAGTmCqGqmCq	MOP/PS
14/642461	AkqAkqGkqTTGTAGTAqGqTqmCeGemCe	MOP/PS
14/642462	AkqAkqGkqTTGTAGTAGqTqmCkqGemCe	MOP/PS
14/642463	AeAqGeTqTGTAGTAGTemCqGemCq	MOP/PS
14/642464	AqAeGqTeTGTAGTAGTemCqGemCk	MOP/PS

[0543] Between adjacent nucleosides subscript "q" indicates a methoxypropyl phosphonate modified internucleoside linkage (-P(CH₃O-(CH₂)₃-)(=O)-, MOP), subscript "o" indicates a phosphodiester internucleoside linkage (PO) and all other internucleoside linkages are phosphorothioate internucleoside linkages (PS). Each nucleoside followed by a subscript "e" is a 2'-O-methoxyethyl (MOE) modified nucleoside, each nucleoside followed by a subscript "k" is a bicyclic nucleoside having a 4'-CH((S)-CH₃))-O-2' bridging group (cEt) and all other nucleosides are 2'-deoxyribonucleosides. Each "^mC" indicates that this nucleoside comprises a 5-methyl cytosine heterocyclic base.

[0544] The half maximal inhibitory concentration (IC₅₀) of each oligonucleotide listed above is calculated by plotting the concentrations of oligonucleotides used versus the percent inhibition of Androgen receptor mRNA expression achieved at each concentration, and noting the concentration of oligonucleotide at which 50% inhibition of Androgen receptor mRNA expression is achieved compared to the control.

SEQUENCE LISTING

[0545] 

<110> Isis Pharmaceuticals, Inc.

<120> LINKAGE MODIFIED OLIGOMERIC COMPOUNDS

<130> CHEM0091WO

<150> 62/114,153
<151> 2015-02-10

<150> 61/985,196
<151> 2014-04-28

<160> 18

<170> PatentIn version 3.5

<210> 1
<211> 202001
<212> DNA
<213> Homo sapiens

<400> 1

<210> 2
<211> 13481
<212> DNA
<213> Homo sapiens

<400> 2

<210> 3
<211> 3160
<212> DNA
<213> Homo sapiens

<400> 3

<210> 4
<211> 26
<212> DNA
<213> Artificial sequence

<220>
<223> Primer

<400> 4
aatggctaag tgaagatgac aatcat   26

<210> 5
<211> 25
<212> DNA
<213> Artificial sequence

<220>
<223> Primer

<400> 5
tgcacatatc attacaccag ttcgt   25

<210> 6
<211> 30
<212> DNA
<213> Artificial sequence

<220>
<223> Probe

<400> 6
ttgcagcaat tcactgtaaa gctggaaagg   30

<210> 7
<211> 12
<212> RNA
<213> Artificial sequence

<220>
<223> Synthetic oligonucleotide

<400> 7
ucgagaacau cc   12

<210> 8
<211> 12
<212> DNA
<213> Artificial sequence

<220>
<223> Synthetic oligonucleotide

<400> 8
ggatgttctc ga   12

<210> 9
<211> 15
<212> DNA
<213> Artificial sequence

<220>
<223> Synthetic oligonucleotide

<400> 9
taaattgtca tcacc   15

<210> 10
<211> 30
<212> RNA
<213> Artificial sequence

<220>
<223> Synthetic oligonucleotide

<400> 10
agacuuuuuc uggugaugac aauuuauuaa   30

<210> 11
<211> 16
<212> DNA
<213> Artificial sequence

<220>
<223> Synthetic oligonucleotide

<400> 11
gtctgtgcat ctctcc   16

<210> 12
<211> 16
<212> DNA
<213> Artificial sequence

<220>
<223> Synthetic oligonucleotide

<400> 12
ttcagtcatg acttcc   16

<210> 13
<211> 20
<212> DNA
<213> Artificial sequence

<220>
<223> Synthetic oligonucleotide

<400> 13
gccaggctgg ttatgactca   20

<210> 14
<211> 16
<212> DNA
<213> Artificial sequence

<220>
<223> Synthetic oligonucleotide

<400> 14
aagttgtagt agtcgc   16

<210> 15
<211> 16
<212> DNA
<213> Artificial sequence

<220>
<223> Synthetic oligonucleotide

<400> 15
gcatgttctc acatta   16

<210> 16
<211> 16
<212> DNA
<213> Artificial sequence

<220>
<223> Synthetic oligonucleotide

<400> 16
acatcttcag atcatt   16

<210> 17
<211> 20
<212> RNA
<213> Artificial sequence

<220>
<223> Synthetic oligonucleotide

<400> 17
aaggaaguca ugacugaagc   20

<210> 18
<211> 20
<212> DNA
<213> Artificial sequence

<220>
<223> Synthetic oligonucleotide

<400> 18
ctgctagcct ctggatttga   20

Claims

1. An antisense oligomeric compound comprising a contiguous sequence of monomer subunits linked by internucleoside linking groups wherein at least one of the internucleoside linking groups has Formula I:

wherein each X is independently O or S wherein the antisense oligomeric compound comprising from 12 to 24 monomer subunits.

2. The antisense oligomeric compound of claim 1, comprising a gapped antisense oligomeric compound, wherein the gap consists of 6 to 12 linked nucleosides, and the 5'-region and 3'-region consist of 3 to 6 linked nucleosides.

3. The antisense oligomeric compound of claim 1 comprising a gapped antisense oligomeric compound having a gap region of from 6 to 14 contiguous monomer subunits selected from β-D-2'-deoxyribonucleosides and modified nucleosides that are DNA-like that each adopt a 2'-endo conformational geometry located between a 5'-region and a 3'-region wherein the 5' and 3'-regions each, independently, have from 2 to 8 contiguous monomer subunits selected from RNA-like modified nucleosides that each adopt a 3'-endo conformational geometry wherein each modified nucleoside in the 5' and 3'-region comprises a modified sugar moiety independently selected from a bicyclic nucleoside comprising a bicyclic furanosyl sugar moiety, a modified nucleoside comprising a furanosyl sugar moiety having at least one substituent group and a modified nucleoside comprising a sugar surrogate group.

4. The antisense oligomeric compound of claim 3, wherein the DNA-like nucleoside is a 2'-substituted furanosyl nucleoside comprising: 2'=CH₂, 2'-ara-CN, 2'-ara-F, 2'-ara-Br or 2'-ara-Cl, 2'-ara-N₃, 2'-ara-OH, 2'-ara-O-CH₃ or 2'-dehydro-2'-ara-CH₃.

5. The antisense oligomeric compound of any of claims 2 or 3, wherein each monomer subunit in the gap region is a β-D-2'-deoxyribonucleoside.

6. The antisense oligomeric compound of any of claims 2 to 5, wherein the gap region has 10 contiguous monomer subunits and the 5' and 3'-regions each, independently, have 2, 3 or 5 contiguous monomer subunits.

7. The antisense oligomeric compound of any of claims 1 to 6 comprising 2 internucleoside linking groups of Formula I.

8. The antisense oligomeric compound of any of claims 1 to 7 wherein internucleoside linking groups of Formula I are contiguous.

9. The antisense oligomeric compound of any of claims 1 to 6 comprising 1 internucleoside linking group of Formula I.

10. The antisense oligomeric compound of any of claims 2 to 9 wherein at least one internucleoside linking group of Formula I is located in the gap region between monomer subunits 1 and 2, 2 and 3, 3 and 4 or 4 and 5 counting from the first monomer subunit at the 5' end of the gap region.

11. The antisense oligomeric compound of any of claims 2 to 9 wherein at least one internucleoside linking group of Formula I is located in the gap region between monomer subunits 1 and 2 counting from the first monomer subunit at the 5' end of the gap region.

12. The antisense oligomeric compound of any of claims 2 to 9 wherein at least one internucleoside linking group of Formula I is located in the gap region between monomer subunits 2 and 3 counting from the first monomer subunit at the 5' end of the gap region.

13. The antisense oligomeric compound of any of claims 2 to 6 having two internucleoside linking groups of Formula I wherein one internucleoside linking group of Formula I is located

i) between the gap region and the 5'-region and the other internucleoside linking group of Formula I is located in the gap region between monomer subunits 1 and 2 counting from the first monomer subunit at the 5' end of the gap region; or

ii) in the gap region between monomer subunits 1 and 2 counting from the first monomer subunit at the 5' end of the gap region and the other internucleoside linking group of Formula I is located in the gap region between monomer subunits 2 and 3 counting from the first monomer subunit at the 5' end of the gap region; or

iii) in the gap region between monomer subunits 2 and 3 counting from the first monomer subunit at the 5' end of the gap region and the other internucleoside linking group of Formula I is located in the gap region between monomer subunits 3 and 4 counting from the first monomer subunit at the 5' end of the gap region; or

iv) in the gap region between monomer subunits 3 and 4 counting from the first monomer subunit at the 5' end of the gap region and the other internucleoside linking group of Formula I is located in the gap region between monomer subunits 4 and 5 counting from the first monomer subunit at the 5' end of the gap region.

14. The antisense oligomeric compound of any of claims 1 to 13 wherein each internucleoside linking group is, independently, a phosphodiester, a phosphorothioate or an internucleoside linking group of Formula I.

15. The antisense oligomeric compound of any of claims 1 to 13 wherein each internucleoside linking group is, independently, a phosphorothioate or an internucleoside linking group of Formula I.

16. The antisense oligomeric compound of any of claims 1 to 15 wherein each monomer subunit comprises an optionally protected heterocyclic base moiety independently selected from thymine, cytosine, 5-methylcytosine, adenine and guanine.

17. The antisense oligomeric compound of any of claims 1 to 16 wherein each X is O.

18. The antisense oligomeric compound of any of claims 1 to 16 wherein each X is S.

19. The antisense oligomeric compound of any of claims 1 to 18 wherein the chirality of each internucleoside linking group having Formula I is R_P or S_P.

20. The antisense oligomeric compound of any of claims 2 to 19, wherein each modified nucleoside in the 5' and 3'-regions is, independently, selected from a bicyclic nucleoside comprising a bicyclic furanosyl sugar moiety having a bridging group between the 4' and 2' carbon atoms of the furanosyl ring independently selected from 4'-CH₂-O-2', 4'-(CH₂)₂-O-2', 4'-CH(CH₃)-O-2', 4'-CH₂-N(CH₃)-O-2', 4'-CH₂-C(H)(CH₃)-2' and 4'-CH₂-C(=CH₂)-2' and a modified nucleoside comprising a ribofuranosyl sugar moiety having at least a 2'-substituent group independently selected from F, OCH₃, O(CH₂)₂-OCH₃ and OCH₂C(=O)-N(H)CH₃.

21. The antisense oligomeric compound of any of claims 2 to 19 wherein each modified nucleoside in the 5' and 3'-regions is, independently, selected from a bicyclic nucleoside comprising a bicyclic furanosyl sugar moiety having a 4'-CH₂-O-2' or 4'-CH[(S)-(CH₃)]-O-2' bridging group and a modified nucleoside comprising a ribofuranosyl sugar moiety having a 2'-O(CH₂)₂-OCH₃ substituent group.

22. The antisense oligomeric compound of any one of claims 2 to 21 wherein the modified nucleosides in the 5' and 3'-regions comprise at least 2 different types of sugar moieties.

23. The antisense oligomeric compound of any of claims 1 to 22 further comprising one 5' or 3'-conjugate group wherein the conjugate group comprises a cell targeting moiety wherein the attachment of the cell targeting moiety to the antisense oligomeric compound includes a conjugate linker wherein the conjugate linker has the formula:

        -C(=O)-(CH₂)₃-C(=O)N(H)-(CH₂)₆-O-.

24. The antisense oligomeric compound of claim 23 wherein the cell targeting moiety has the formula:

25. The antisense oligomeric compound of any of claims 23 or 24 wherein the conjugate group further comprises a cleavable moiety, wherein the cleavage moiety has the formula:

wherein X is O or S.

26. The antisense oligomeric compound of claim 25 wherein X is O.

27. An in vitro method of inhibiting gene expression comprising contacting one or more cells or a tissue with an antisense oligomeric compound of any one of claims 1 to 26.

28. An antisense oligomeric compound of any one of claims 1 to 26 for use in medical therapy.

Ansprüche

1. Antisense-Oligomerverbindung, die eine zusammenhängende Sequenz von Monomerteileinheiten umfasst, die durch Internucleosid-Linkergruppen verknüpft sind, wobei mindestens eine der Internucleosid-Linkergruppen Formel I aufweist:

wobei jedes X unabhängig O oder S ist, wobei die Antisense-Oligomerverbindung 12 bis 24 Monomerteileinheiten umfasst.

2. Antisense-Oligomerverbindung nach Anspruch 1, umfassend eine Lücken aufweisende Antisense-Oligomerverbindung, wobei die Lücke aus 6 bis 12 verknüpften Nucleosiden besteht, und die 5'-Region und 3'-Region aus 3 bis 6 verknüpften Nucleosiden besteht.

3. Antisense-Oligomerverbindung nach Anspruch 1, umfassend eine Lücken aufweisende Antisense-Oligomerverbindung mit einer Lückenregion aus 6 bis 14 zusammenhängenden Monomerteileinheiten ausgewählt aus β-D-2'-Deoxyribonucleosiden und modifizierten Nucleosiden, die dahingehend DNA-artig sind, dass jede eine 2'-endo-Konfirmationsgeometrie annimmt, die sich zwischen einer 5'-Region und einer 3'-Region befindet, wobei die 5'- und 3'-Regionen jeweils unabhängig 2 bis 8 zusammenhängende Monomerteileinheiten ausgewählt aus RNA-artig modifizierten Nucleosiden aufweisen, die jeweils eine 3'-endo-Konfiguationsgeometrie annehmen, wobei jedes modifizierte Nucleosid in der 5'- und 3'-Region einen modifizierten Zuckeranteil umfasst, der unabhängig ausgewählt ist aus einem bicyclischen Nucleosid, das einen bicyclischen Furanosylzuckeranteil umfasst, einem modifizierten Nucleosid, das einen Furanosylzuckeranteil mit mindestens einer Substituentengruppe umfasst, und einem modifizierten Nucleosid, das eine Zuckersurrogatgruppe umfasst.

4. Antisense-Oligomerverbindung nach Anspruch 3, wobei das DNA-artige Nucleosid ein 2'-substituiertes Furanosylnucleosid ist, umfassend: 2'=CH₂, 2'-ara-CN, 2'-ara-F, 2'-ara-Br oder 2'-ara-Cl, 2'-ara-N₃, 2'-ara-OH, 2'-ara-O-CH₃ oder 2'-Dehydro-2'-ara-CH₃.

5. Antisense-Oligomerverbindung nach einem der Ansprüche 2 oder 3, wobei jede Monomerteileinheit in der Lückenregion ein β-D-2'-Deoxyribonucleosid ist.

6. Antisense-Oligomerverbindung nach einem der Ansprüche 2 bis 5, wobei die Lückenregion 10 zusammenhängende Monomerteileinheiten aufweist, und die 5'- und 3'-Regionen jeweils unabhängig 2, 3 oder 5 zusammenhängende Monomerteileinheiten aufweisen.

7. Antisense-Oligomerverbindung nach einem der Ansprüche 1 bis 6, umfassend 2 Internucleosid-Linkergruppen mit der Formel I.

8. Antisense-Oligomerverbindung nach einem der Ansprüche 1 bis 7, wobei Internucleosid-Linkergruppen mit der Formel I zusammenhängend sind.

9. Antisense-Oligomerverbindung nach einem der Ansprüche 1 bis 6, umfassend 1 Internucleosid-Linkergruppe mit der Formel I.

10. Antisense-Oligomerverbindung nach einem der Ansprüche 2 bis 9, wobei mindestens eine Internucleosid-Linkergruppe mit der Formel I sich in der Lückenregion zwischen den Monomerteileinheiten 1 und 2, 2 und 3, 3 und 4 oder 4 und 5 befindet, wobei von der ersten Monomerteileinheit am 5'-Ende der Lückenregion gezählt wird.

11. Antisense-Oligomerverbindung nach einem der Ansprüche 2 bis 9, wobei mindestens eine Internucleosid-Linkergruppe mit der Formel I sich in der Lückenregion zwischen den Monomerteileinheiten 1 und 2 befindet, wobei von der ersten Monomerteileinheit am 5'-Ende der Lückenregion gezählt wird.

12. Antisense-Oligomerverbindung nach einem der Ansprüche 2 bis 9, wobei mindestens eine Internucleosid-Linkergruppe mit der Formel I sich in der Lückenregion zwischen den Monomerteileinheiten 2 und 3 befindet, wobei von der ersten Monomerteileinheit am 5'-Ende der Lückenregion gezählt wird.

13. Antisense-Oligomerverbindung nach einem der Ansprüche 2 bis 6 mit zwei Internucleosid-Linkergruppen der Formel I, wobei eine Internucleosid-Linkergruppe der Formel I sich

i) zwischen der Lückenregion und der 5'-Region befindet, und die andere Internucleosid-Linkergruppe der Formel I sich in der Lückenregion zwischen den Monomerteileinheiten 1 und 2 befindet, wobei von der ersten Monomerteileinheit am 5'-Ende der Lückenregion gezählt wird; oder

ii) in der Lückenregion zwischen den Monomerteileinheiten 1 und 2 befindet, wobei von der ersten Monomerteileinheit an dem 5'-Ende der Lückenregion gezählt wird, und die andere Internucleosid-Linkergruppe der Formel I sich in der Lückenregion zwischen den Monomerteileinheiten 2 und 3 befindet, wobei von der ersten Monomerteileinheit am 5'-Ende der Lückenregion gezählt wird; oder

iii) in der Lückenregion zwischen den Monomerteileinheiten 2 und 3 befindet, wobei von der ersten Monomerteileinheit an dem 5'-Ende der Lückenregion gezählt wird, und die andere Internucleosid-Linkergruppe der Formel I sich in der Lückenregion zwischen den Monomerteileinheiten 3 und 4 befindet, wobei von der ersten Monomerteileinheit am 5'-Ende der Lückenregion gezählt wird; oder

iv) in der Lückenregion zwischen den Monomerteileinheiten 3 und 4 befindet, wobei von der ersten Monomerteileinheit an dem 5'-Ende der Lückenregion gezählt wird, und die andere Internucleosid-Linkergruppe der Formel I sich in der Lückenregion zwischen den Monomerteileinheiten 4 und 5 befindet, wobei von der ersten Monomerteileinheit am 5'-Ende der Lückenregion gezählt wird.

14. Antisense-Oligomerverbindung nach einem der Ansprüche 1 bis 13, wobei jede Internucleosid-Linkergruppe unabhängig ein Phosphodiester, ein Phosphorthioat oder eine Internucleosid-Linkergruppe der Formel I ist.

15. Antisense-Oligomerverbindung nach einem der Ansprüche 1 bis 13, wobei jede Internucleosid-Linkergruppe unabhängig ein Phosphorthioat oder eine Internucleosid-Linkergruppe der Formel I ist.

16. Antisense-Oligomerverbindung nach einem der Ansprüche 1 bis 15, wobei jede Monomerteileinheit einen gegebenenfalls geschützten heterocyclischen Basenanteil umfasst, der unabhängig ausgewählt ist aus Thymin, Cytosin, 5-Methylcytosin, Adenin und Guanin.

17. Antisense-Oligomerverbindung nach einem der Ansprüche 1 bis 16, wobei jedes X O ist.

18. Antisense-Oligomerverbindung nach einem der Ansprüche 1 bis 16, wobei jedes X S ist.

19. Antisense-Oligomerverbindung nach einem der Ansprüche 1 bis 18, wobei die Chiralität jeder Internucleosid-Linkergruppe mit Formel I R_P oder S_P ist.

20. Antisense-Oligomerverbindung nach einem der Ansprüche 2 bis 19, wobei jedes modifizierte Nucleosid in den 5'- und 3'-Regionen unabhängig ausgewählt ist aus einem bicyclischen Nucleosid, das einen bicyclischen Furanosylzuckeranteil mit einer Brückengruppe zwischen den 4'- und 2'-Kohlenstoffatomen des Furanosylrings umfasst, die ausgewählt ist aus 4'-CH₂-O-2', 4'-(CH₂)₂-O-2', 4'-CH(CH₃)-O-2', 4'-CH₂-N(CH₃)-O-2', 4'-CH₂-C(H)(CH₃)-2' und 4'-CH₂-C(=CH₂)-2', und einem modifizierten Nucleosid, das einen Ribofuranosylzuckeranteil mit mindestens einer 2'-Substituentengruppe umfasst, die unabhängig ausgewählt ist aus F, OCH₃, O(CH₂)₂-OCH₃ und OCH₂C(=O)-N(H)CH₃.

21. Antisense-Oligomerverbindung nach einem der Ansprüche 2 bis 19, wobei jedes modifizierte Nucleosid in den 5'- und 3'-Regionen unabhängig ausgewählt ist aus einem bicyclischen Nucleosid, das einen bicyclischen Furanosylzuckeranteil mit einer Brückengruppe 4'-CH₂-O-2' oder 4'-CH[(S)-(CH₃)]-O-2' umfasst, und einem modifizierten Nucleosid, das einen Ribofuranosylzuckeranteil mit einer Substituentengruppe 2'-O(CH₂)₂-OCH₃ umfasst.

22. Antisense-Oligomerverbindung nach einem der Ansprüche 2 bis 21, wobei die modifizierten Nucleoside in den 5'- und 3'-Regionen mindestens 2 unterschiedliche Typen von Zuckeranteilen umfassen.

23. Antisense-Oligomerverbindung nach einem der Ansprüche 1 bis 22, ferner umfassend eine 5'- oder 3'-Konjugatgruppe, wobei die Konjugatgruppe einen zellzielgerichteten Anteil umfasst, wobei das Anfügen des zellzielgerichteten Anteils an die Antisense-Oligomerverbindung einen Konjugat-Linker einschließt, wobei der Konjugat-Linker die folgende Formel aufweist:

        -C(=O)-(CH₂)₃-C(=O)N(H)-(CH₂)₆-O-.

24. Antisense-Oligomerverbindung nach Anspruch 23, wobei der zellzielgerichtete Anteil die folgende Formel aufweist:

25. Antisense-Oligomerverbindung nach einem der Ansprüche 23 oder 24, wobei die Konjugatgruppe ferner einen abspaltbaren Anteil umfasst, wobei der Abspaltungsanteil die folgende Formel aufweist:

wobei X O oder S ist.

26. Antisense-Oligomerverbindung nach Anspruch 25, wobei X O ist.

27. In-vitro-Verfahren zum Inhibieren der Genexpression, umfassend Kontaktieren von einer oder mehreren Zellen oder einem Gewebe mit einer Antisense-Oligomerverbindung gemäß einem der Ansprüche 1 bis 26.

28. Antisense-Oligomerverbindung nach einem der Ansprüche 1 bis 26 zur Verwendung in der medizinischen Therapie.

Revendications

1. Composé oligomère antisens comprenant une séquence contiguë de sous-unités monomères liées par des groupes de liaison internucléosidiques, au moins un des groupes de liaison internucléosidiques ayant la formule I :

dans laquelle chaque X est indépendamment O ou S dans lequel le composé oligomère antisens comprenant de 12 à 24 sous-unités monomères.

2. Composé oligomère antisens selon la revendication 1, comprenant un composé oligomère antisens à brèche, dans lequel la brèche est constituée de 6 à 12 nucléosides liés, et la région 5' et la région 3' sont constituées de 3 à 6 nucléosides liés.

3. Composé oligomère antisens selon la revendication 1 comprenant un composé oligomère antisens à brèche ayant une région de brèche de 6 à 14 sous-unités monomères contiguës choisies parmi des β-D-2'-désoxyribonucléosides et des nucléosides modifiés qui sont de type ADN qui adoptent chacun une géométrie de conformation 2'-endo située entre une région 5' et une région 3', les régions 5' et 3' comportant chacune, indépendamment, de 2 à 8 sous-unités monomères contiguës choisies parmi des nucléosides modifiés de type ARN qui adoptent chacun une géométrie de conformation 3'-endo, dans lequel chaque nucléoside modifié dans les régions 5' et 3' comprend un fragment de sucre modifié indépendamment choisi parmi un nucléoside bicyclique comprenant un fragment furanosyl-sucre bicyclique, un nucléoside modifié comprenant un fragment furanosyl-sucre comportant au moins un groupe substituant et un nucléoside modifié comprenant un groupe substitut de sucre.

4. Composé oligomère antisens selon la revendication 3, dans lequel le nucléoside de type ADN est un furanosyl-nucléoside 2'-substitué comprenant : 2'-CH₂, 2'-ara-CN, 2'-ara-F, 2'-ara-Br ou 2'-ara-Cl, 2'-ara-N₃, 2'-ara-OH, 2'-ara-O-CH₃ ou 2'-déshydro-2'-ara-CH₃.

5. Composé oligomère antisens selon l'une quelconque des revendications 2 ou 3, dans lequel chaque sous-unité monomère dans la région de brèche est un β-D-2'-désoxyribonucléoside.

6. Composé oligomère antisens selon l'une quelconque des revendications 2 à 5, dans lequel la région de brèche comporte 10 sous-unités monomères contiguës et les régions 5' et 3' comportent chacune, indépendamment, 2, 3 ou 5 sous-unités monomères contiguës.

7. Composé oligomère antisens selon l'une quelconque des revendications 1 à 6, comprenant 2 groupes de liaison internucléosidiques de formule I.

8. Composé oligomère antisens selon l'une quelconque des revendications 1 à 7, dans lequel les groupes de liaison internucléosidiques de formule I sont contigus.

9. Composé oligomère antisens selon l'une quelconque des revendications 1 à 6, comprenant 1 groupe de liaison internucléosidique de formule I.

10. Composé oligomère antisens selon l'une quelconque des revendications 2 à 9, dans lequel au moins un groupe de liaison internucléosidique de formule I est situé dans la région de brèche entre les sous-unités monomères 1 et 2, 2 et 3, 3 et 4 ou 4 et 5 en comptant de la première sous-unité monomère à l'extrémité 5' de la région de brèche.

11. Composé oligomère antisens selon l'une quelconque des revendications 2 à 9, dans lequel au moins un groupe de liaison internucléosidique de formule I est situé dans la région de brèche entre les sous-unités monomères 1 et 2 en comptant de la première sous-unité monomère à l'extrémité 5' de la région de brèche.

12. Composé oligomère antisens selon l'une quelconque des revendications 2 à 9, dans lequel au moins un groupe de liaison internucléosidique de formule I est situé dans la région de brèche entre les sous-unités monomères 2 et 3 en comptant de la première sous-unité monomère à l'extrémité 5' de la région de brèche.

13. Composé oligomère antisens selon l'une quelconque des revendications 2 à 6 ayant deux groupes de liaison internucléosidiques de formule I, dans lequel un groupe de liaison internucléosidique de formule I est situé

i) entre la région de brèche et la région 5' et l'autre groupe de liaison internucléosidique de formule I est situé dans la région de brèche entre les sous-unités monomères 1 et 2 en comptant de la première sous-unité monomère à l'extrémité 5' de la région de brèche ; ou

ii) dans la région de brèche entre les sous-unités monomères 1 et 2 en comptant de la première sous-unité monomère à l'extrémité 5' de la région de brèche et l'autre groupe de liaison internucléosidique de formule I est situé dans la région de brèche entre les sous-unités monomères 2 et 3 en comptant de la première sous-unité monomère à l'extrémité 5' de la région de brèche ; ou

iii) dans la région de brèche entre les sous-unités monomères 2 et 3 en comptant de la première sous-unité monomère à l'extrémité 5' de la région de brèche et l'autre groupe de liaison internucléosidique de formule I est situé dans la région de brèche entre les sous-unités monomères 3 et 4 en comptant de la première sous-unité monomère à l'extrémité 5' de la région de brèche ; ou

iv) dans la région de brèche entre les sous-unités monomères 3 et 4 en comptant de la première sous-unité monomère à l'extrémité 5' de la région de brèche et l'autre groupe de liaison internucléosidique de formule I est situé dans la région de brèche entre les sous-unités monomères 4 et 5 en comptant de la première sous-unité monomère à l'extrémité 5' de la région de brèche.

14. Composé oligomère antisens selon l'une quelconque des revendications 1 à 13, dans lequel chaque groupe de liaison internucléosidique est, indépendamment, un phosphodiester, un phosphorothioate ou un groupe de liaison internucléosidique de formule I.

15. Composé oligomère antisens selon l'une quelconque des revendications 1 à 13, dans lequel chaque groupe de liaison internucléosidique est, indépendamment, un phosphorothioate ou un groupe de liaison internucléosidique de formule I.

16. Composé oligomère antisens selon l'une quelconque des revendications 1 à 15, dans lequel chaque sous-unité monomère comprend un fragment de base hétérocyclique facultativement protégé indépendamment choisi parmi la thymine, la cytosine, la 5-méthylcytosine, l'adénine et la guanine.

17. Composé oligomère antisens selon l'une quelconque des revendications 1 à 16, dans lequel chaque X est O.

18. Composé oligomère antisens selon l'une quelconque des revendications 1 à 16, dans lequel chaque X est S.

19. Composé oligomère antisens selon l'une quelconque des revendications 1 à 18, dans lequel la chiralité de chaque groupe de liaison internucléosidique ayant la formule I est R_P ou S_P.

20. Composé oligomère antisens selon l'une quelconque des revendications 2 à 19, dans lequel chaque nucléoside modifié dans les régions 5' et 3' est, indépendamment, choisi parmi un nucléoside bicyclique comprenant un fragment furanosyl-sucre bicyclique ayant un groupe de pontage entre les atomes de carbone 4' et 2' du cycle furanosyle indépendamment choisi parmi 4'-CH₂-O-2', 4'-(CH₂)₂-O-2', 4'-CH(CH₃)-O-2', 4'-CH₂-N(CH₃)-O-2', 4'-CH₂-C(H)(CH₃)-2' et 4'-CH₂-C(=CH₂)-2' et un nucléoside modifié comprenant un fragment ribofuranosyl-sucre comportant au moins un groupe substituant 2' indépendamment choisi parmi F, OCH₃, O(CH₂)₂-OCH₃ et OCH₂C(=O)-N(H)CH₃.

21. Composé oligomère antisens selon l'une quelconque des revendications 2 à 19, dans lequel chaque nucléoside modifié dans les régions 5' et 3' est, indépendamment, choisi parmi un nucléoside bicyclique comprenant un fragment furanosyl-sucre bicyclique comportant un groupe de pontage 4'-CH₂-O-2' ou 4'-CH[(S)-(CH₃)]-O-2' et un nucléoside modifié comprenant un fragment ribofuranosyl-sucre comportant un groupe substituant 2'-O(CH₂)₂-OCH₃.

22. Composé oligomère antisens selon l'une quelconque des revendications 2 à 21, dans lequel les nucléosides modifiés dans les régions 5' et 3' comprennent au moins 2 types de fragments de sucre différents.

23. Composé oligomère antisens selon l'une quelconque des revendications 1 à 22, comprenant en outre un groupe conjugué en 5' ou 3', dans lequel le groupe conjugué comprend un fragment de ciblage cellulaire, dans lequel la liaison du fragment de ciblage cellulaire au composé oligomère antisens comprend un lieur de conjugué, le lieur de conjugué ayant la formule :

        -C(=O)-(CH₂)₃-C(=O)N(H)-(CH₂)₆-O-.

24. Composé oligomère antisens selon la revendication 23, dans lequel le fragment de ciblage cellulaire a la formule :

25. Composé oligomère antisens selon l'une quelconque des revendications 23 ou 24, dans lequel le groupe conjugué comprend en outre un fragment clivable, le fragment de clivage ayant la formule :

dans laquelle X est O ou S.

26. Composé oligomère antisens selon la revendication 25 dans lequel X est O.

27. Procédé in vitro d'inhibition d'expression génique comprenant la mise en contact d'une ou plusieurs cellules ou d'un tissu avec un composé oligomère antisens selon l'une quelconque des revendications 1 à 26.

28. Composé oligomère antisens selon l'une quelconque des revendications 1 à 26 pour utilisation en thérapie médicale.

Drawing