Technical Field
[0001] The present invention relates to a method for screening induced pluripotent stem
cells. More specifically, the present invention relates to a method for screening
induced pluripotent stem cells exhibiting no differentiation resistance through confirmation
of the expression of large intergenic non-coding RNA (lincRNA) or mRNA in induced
pluripotent stem cells.
Background Art
[0002] In recent years, mouse and human induced pluripotent stem cells (iPS cells) have
been successively established. Yamanaka et al., have induced iPS cells by introducing
Oct3/4, Sox2, Klf4, and c-Myc genes into mouse-derived fibroblasts so as to enable
the forced expression of such genes (
WO 2007/069666 A1 and
Takahashi, K. and Yamanaka, S., Cell, 126: 663-676 (2006)). Subsequently, it has been revealed that iPS cells can also be prepared using 3
of the above factors (excluding the c-Myc gene) (
Nakagawa, M. et al., Nat. Biotechnol., 26: 101-106 (2008)). Furthermore, Yamanaka et al., have succeeded in establishing iPS cells by introducing
the 4 above genes into human skin-derived fibroblasts, similarly to the case involving
mice (
WO 2007/069666 A1 and
Takahashi, K. et al., Cell, 131: 861-872 (2007)). Meanwhile, Thomson et al.,'s group has prepared human iPS cells using Nanog and
Lin28 instead of Klf4 and c-Myc (
WO 2008/118820 A2 and
Yu, J. et al., Science, 318: 1917-1920 (2007)). iPS cells can solve bioethical issues such as embryo disruption, and can be grown
while maintaining their pluripotency, so that iPS cells are expected as grafting materials
for regenerative medicine.
[0003] Meanwhile, even when the thus established iPS cells are induced to differentiate
into specific tissue cells, the resulting cells may include undifferentiated (or insufficiently
differentiated) cells having proliferation potency (
Miura K. et al., Nat Biotechnol., 27: 743-745 (2009)). In such a case, there are concerns about tumorigenesis after grafting. Hence,
a method for screening for an iPS cell line containing no cells that exhibit resistance
to differentiation induction from among the thus established iPS cell lines has been
desired.
Summary of Invention
Technical Problem
[0004] An object of the invention is to efficiently select safe iPS cells (induced pluripotent
stem cells) suitable for clinical applications. Specifically, an object of the invention
is to provide a means for screening for a cell line exhibiting no differentiation
resistance.
Solution to Problem
[0005] To achieve the above objects, the present inventors have examined RNA that is specifically
expressed in iPS cell lines exhibiting differentiation resistance or RNA that is specifically
expressed in iPS cell lines exhibiting no differentiation resistance using iPS cell
lines exhibiting differentiation resistance and iPS cell lines exhibiting no differentiation
resistance. It was thus confirmed that large intergenic non-coding RNA (lincRNA) or
mRNA encoded by a specific genomic region is specifically expressed in iPS cell lines
exhibiting differentiation resistance or iPS cell lines exhibiting no differentiation
resistance.
[0006] Based on the above results, the present inventors have discovered that iPS cells
exhibiting differentiation resistance can be screened for through the use of large
intergenic non-coding RNA (lincRNA) or mRNA encoded by a specific genomic region as
an indicator (marker), and thus have completed the present invention.
[0007] Specifically, the present invention includes the following [1] to [9].
- [1] A method for screening for a human induced pluripotent stem cell line exhibiting
no differentiation resistance, comprising the steps of:
- (i) measuring expression of at least one large intergenic non-coding RNA (lincRNA)
or mRNA selected from group A and/or group B,
- (ii) selecting a human induced pluripotent stem cell line in which the lincRNA or
mRNA selected from group A expresses or the lincRNA or mRNA selected from group B
does not express;
Group A consisting of
(A1) lincRNA:chr1:852245-854050 reverse strand,
(A2) GPR177,
(A3) VTCN1,
(A4) lincRNA:chr1:142803013-142804254 reverse strand,
(A5) APOA2,
(A6) WNT6,
(A7) EPAS1,
(A8) COL3A1,
(A9) SLC40A1,
(A10) S100P,
(A11) HOPX,
(A12) GUCY1A3,
(A13) CDH10,
(A14) HAPLN1,
(A15) PITX1,
(A16) HAND1,
(A17) CGA,
(A18) AQP1,
(A19) DLX6,
(A20) DLX5,
(A21) SOX17,
(A22) FLJ45983,
(A23) PLCE1,
(A24) H19,
(A25) lincRNA:chr11:2016408-2017024 reverse strand,
(A26) lincRNA:chr11:2017517-2017651 forward strand,
(A27) IGF2,
(A28) P2RY6,
(A29) SLN,
(A30) NNMT,
(A31) APOA1,
(A32) ERP27,
(A33) LUM,
(A34) CCDC92,
(A35) CDX2,
(A36) FLJ41170,
(A37) MEG3,
(A38) lincRNA:chr14:101292469-101299626 forward strand,
(A39) lincRNA:chr14:101295637-101302637 forward strand,
(A40) lincRNA:chr14:101296681-101298460 forward strand,
(A41) lincRNA:chr14:101298129-101300147 forward strand,
(A42) lincRNA:chr14:101324825-101327247 forward strand,
(A43) MEG8,
(A44) lincRNA:chr14:101365673-101366049 forward strand,
(A45) lincRNA:chr14:101396955-101397357 forward strand,
(A46) lincRNA:chr14:101430757-101433381 forward strand,
(A47) lincRNA:chr14:101434059-101436282 forward strand,
(A48) lincRNA:chr14:101472355-101473369 forward strand,
(A49) DIO3,
(A50) MEIS2,
(A51) PRTG,
(A52) C17orf51,
(A53) lincRNA:chr17:21434064-21435857 reverse strand,
(A54) lincRNA:chr17:21435180-21454915 reverse strand,
(A55) lincRNA:chr17:21435959-21436405 reverse strand,
(A56) CCR7,
(A57) KRT23,
(A58) GREB1L,
(A59) GATA6,
(A60) TTR,
(A61) UCA1,
(A62) FLRT3,
(A63) lincRNA:chrX:73040495-73047819 reverse strand,
(A64) VGLL1,
(A65) RPS4Y1,
(A66) DDX3Y, and
(A67) RPS4Y2,
Group B consisting of
(B1) DMRTB1,
(B2) lincRNA:chrl:73430887-73446112 reverse strand,
(B3) lincRNA:chrl:73444697-73444997 reverse strand,
(B4) C4orf51,
(B5) PCDHA1,
(B6) lincRNA:chr6:95250854-95263604 reverse strand,
(B7) lincRNA:chr6:14280358-14285376 reverse strand,
(B8) lincRNA:chr6:14283301-14285685 reverse strand,
(B9) C7orf57,
(B10) lincRNA:chr7:124873114-124899839 reverse strand,
(B11) lincRNA:chr8:129599518-129624118 reverse strand,
(B12) OC90,
(B13) lincRNA:chr8:133071643-133092468 reverse strand,
(B14) lincRNA:chr8:133073732-133075753 reverse strand,
(B15) HHLA1,
(B16) incRNA:chr8:133076031-133093351 reverse strand,
(B17) lincRNA:chr8:133090096-133097869 reverse strand,
(B18) lincRNA:chr8:138387843-138421643 reverse strand,
(B19) lincRNA:chr8:138418343-138425831 reverse strand,
(B20) NDUFA4L2,
(B21) lincRNA:chr13:54698462-54707001 reverse strand,
(B22) ABHD12B,
(B23) lincRNA:chr18:54721302-54731677 reverse strand,
(B24) ZNF208,
(B25) ZNF257,
(B26) ZNF676,
(B27) ZNF541,
(B28) TBX1,
(B29) CXorf61, and
(B30) DB090170 TESTI4 Homo sapiens cDNA clone TESTI4038997 5', mRNA sequence [DB090170].
- [2] The method according to [1], wherein the lincRNA or mRNA selected from group A
is selected from the group consisting of
(A20) DLX5,
(A50) MEIS2,
(A53) lincRNA:chr17:21434064-21435857 reverse strand, and
(A58) GREB1L.
- [3] The method according to [1], wherein the lincRNA or mRNA selected from group B
is selected from the group consisting of
(B4) C4orf51,
(B9) C7orf57,
(B10) lincRNA:chr7:124873114-124899839 reverse strand,
(B12) OC90,
(B13) lincRNA:chr8:133071643-133092468 reverse strand,
(B14) lincRNA:chr8:133073732-133075753 reverse strand,
(B15) HHLA1,
(B16) lincRNA:chr8:133076031-133093351 reverse strand,
(B17) lincRNA:chr8:133090096-133097869 reverse strand,
(B22) ABHD12B,
(B23) lincRNA:chr18:54721302-54731677 reverse strand,
(B27) ZNF541,
(B28) TBX1,
(B29) CXorf61, and
(B30) DB090170 TESTI4 Homo sapiens cDNA clone TESTI4038997 5', mRNA sequence [DB090170].
- [4] The method according to [1], wherein the lincRNA or mRNA selected from group B
is selected from the group consisting of;
(B4) C4orf51,
(B15) HHLA1, and
(B22) ABHD12B.
- [5] A method for screening for a human induced pluripotent stem cell line exhibiting
no differentiation resistance, comprising the following steps;
- (i) measuring DNA-methylated state of LTR region or neighborhood thereof located in
at least one gene selected from group of (B4) C4orf51, (B15) HHLA1, and (B22) ABHD12B,
and
- (ii) selecting a human induced pluripotent stem cell line in which the LTR7 region
is in a DNA-methylated state.
- [6] A reagent for screening for a human induced pluripotent stem cell line exhibiting
no differentiation resistance, containing a polynucleotide having at least 15 continuous
nucleotides in the nucleotide sequence of at least one mRNA or LincRNA shown in the
above group A or B, or a polynucleotide complementary thereto.
- [7] The reagent according to [6], which is a microarray prepared by immobilizing,
as a probe, a polynucleotide complementary to a polynucleotide having at least 15
continuous nucleotides in the nucleotide sequence of at least one mRNA or LincRNA
shown in the above group A or B.
- [8] A reagent for screening for a human induced pluripotent stem cell line exhibiting
no differentiation resistance, containing an antibody that recognizes a protein encoded
by at least one mRNA shown in the above group A or B.
- [9] A kit for screening for a human induced pluripotent stem cell line exhibiting
no differentiation resistance, containing the reagent according to any one of [6]
to [8].
Advantageous Effects of Invention
[0009] According to the present invention, human iPS cells exhibiting no differentiation
resistance can be efficiently screened for. Therefore, the present invention is extremely
useful for application of iPS cells to regenerative medicine.
Brief Description of Drawings
[0010]
Fig.1 shows the result of measuring expression level of HHLA1, ABHD12B and C4orf51
of cell lines exhibiting differentiation resistance (shown as differentiation resistance):
FB-RV3F-4, CB-RV4F-2, DP-EP6F-1, FB-RV3F-4 sub2, CB-RV4F-2 sub2 and DP-EP6F-1, and
cell lines exhibiting no differentiation resistance (shown as normal): H1, FB-RV4F-2,
FB-RV3F-1, FB-RV3F-4 sub6, CB-RV4F-2 sub1 and DP-EP6F-1 sub5, with quantitative PCR.
Fig. 2 is a schematic diagram showing locations of LTR region in C4orf51, HHLA1 and
ABHD12B.
Fig.3 shows the results of the average methylation state of CG dinucleotide in LTR7
region located in C4orf51, HHLA1or ABHD12B of 6 cell lines exhibiting differentiation
resistance (shown as differentiation resistance): FB-RV3F-4, CB-RV4F-2, DP-EP6F-1,
FB-RV3F-4 sub2, CB-RV4F-2 sub2 and DP-EP6F-1, and 6 cell lines exhibiting no differentiation
resistance (shown as normal): H1, FB-RV4F-2, FB-RV3F-1, FB-RV3F-4 sub6, CB-RV4F-2
sub1 and DP-EP6F-1 sub5, by the Bisulfite method.
Description of Embodiments
[0011] 1. Method for screening human induced pluripotent stem cells (iPS cells) The method
for screening human induced pluripotent stem cells (iPS cells) of the present invention
comprises using at least one lincRNA or mRNA shown in the following Table 1 (Group
A) or 2 (Group B) as a marker for screening for an iPS cell line exhibiting no differentiation
resistance.
[Table 1]
Group A |
Marker name |
Genbank Accession |
lincRNA:chr1:852245-854050 reverse strand |
|
GPR177 |
NM_001002292 |
VTCN1 |
NM_024626 |
lincRNA:chr1:142803013-142804254 reverse strand |
|
APOA2 |
NM_001643 |
WNT6 |
NM_006522 |
EPAS1 |
NM_001430 |
COL3A1 |
NM_000090 |
SLC40A1 |
NM_014585 |
S100P |
NM_005980 |
HOPX |
NM_139211 |
GUCY1A3 |
NM_000856 |
CDH10 |
NM_006727 |
HAPLN1 |
NM_001884 |
PITX1 |
NM_002653 |
HAND 1 |
NM_004821 |
CGA |
NM_000735 |
AQP1 |
NM_198098 |
DLX6 |
NM_005222 |
DLX5 |
NM_005221 |
SOX17 |
NM_022454 |
FLJ45983 |
NR_024256 |
PLCE1 |
NM_016341 |
H19 |
NR_002196 |
lincRNA:chr1 1:2016408-2017024 reverse strand |
|
lincRNA:chr11:2017517-2017651 forward strand |
|
IGF2 |
NM_000612 |
P2RY6 |
NM_176798 |
SLN |
NM_003063 |
NNMT |
NM_006169 |
APOA1 |
NM_000039 |
ERP27 |
NM_152321 |
LUM |
NM_002345 |
CCDC92 |
NM_025140 |
CDX2 |
NM_001265 |
FLJ41170 |
AK021542 |
MEG3 |
NR_003530 |
lincRNA:chr14:101292469-101299626 forward strand |
|
lincRNA:chr14:101295637-101302637 forward strand |
|
lincRNA:chr14:101296681-101298460 forward strand |
|
lincRNA:chr14:101298129-101300147 forward strand |
|
lincRNA:chr14:101324825-101327247 forward strand |
|
MEG8 |
NR_024149 |
lincRNA:chr14:101365673-101366049 forward strand |
|
lincRNA:chr14: 101396955-101397357 forward strand |
|
lincRNA:chr14:101430757-101433381 forward strand |
|
lincRNA:chr14:101434059-101436282 forward strand |
|
lincRNA:chr14:101472355-101473369 forward strand |
|
DIO3 |
NM_001362 |
MEIS2 |
NM_170677 |
PRTG |
NM_173814 |
C17orf51 |
NM_001113434 |
lincRNA: chr17:21434064-21435857 reverse strand |
|
lincRNA:chr17:21435180-21454915 reverse strand |
|
lincRNA:chr17:21435959-21436405 reverse strand |
|
CCR7 |
NM_001838 |
KRT23 |
NM_015515 |
GREBIL |
NM_001142966 |
GATA6 |
NM_005257 |
TTR |
NM_000371 |
UCA1 |
NR_015379 |
FLRT3 |
NM_198391 |
lincRNA:chrX:73040495-73047819 reverse strand |
|
VGLL1 |
NM_016267 |
RPS4Y1 |
NM_001008 |
DDX3Y |
NM_001122665 |
RPS4Y2 |
NM_001039567 |
[Table 2]
Group B |
Marker name |
Genbank Accession |
DMRTB1 |
NM_033067 |
lincRNA:chr1:73430887-73446112 reverse strand |
|
lincRNA;chr1:73444697-73444997 reverse strand |
|
C4orf51 |
NM_001080531 |
PCDHA1 |
NM_031410 |
lincRNA:chr6:95250854-95263604 reverse strand |
|
lincRNA:chr6:14280358-14285376 reverse strand |
|
lincRNA:chr6:14283301-14285685 reverse strand |
|
C7orf57 |
NM_001100159 |
lincRNA:chr7:124873114-124899839 reverse strand |
|
lincRNA:chr8:129599518-129624118 reverse strand |
|
OC90 |
NM_001080399 |
lincRNA:chr8:133071643-133092468 reverse strand |
|
lincRNA:chr8:133073732-133075753 reverse strand |
|
HHLA1 |
NM_001145095 |
lincRNA:chr8:133076031-133093351 reverse strand |
|
lincRNA:chr8:133090096-133097869 reverse strand |
|
lincRNA:chr8:138387843-138421643 reverse strand |
|
lincRNA:chr8:138418343-138425831 reverse strand |
|
NDUFA4L2 |
NM_020142 |
lincRNA:chr13:54698462-54707001 reverse strand |
|
ABHD12B |
NM_181533 |
lincRNA:chr18:54721302-54731677 reverse strand |
|
ZNF208 |
NM_007153 |
ZNF257 |
NM_033468 |
ZNF676 |
NM_001001411 |
ZNF541 |
NM_001101419 |
TBX1 |
NM_080647 |
CXorf61 |
NM_001017978 |
DB090170 TESTI4 Homo sapiens cDNA clone TESTI4038997 5', mRNA sequence |
DB090170 |
In the present invention, the term "lincRNA" refers to long-chain single-stranded
RNA transcribed from a genome, which encodes no gene. LincRNA is denoted with chromosome
No., the genome region represented by nucleotide No. described in the GenBank database,
and transcriptional direction. For example, "chr1:852245-854050 reverse strand" means
single-stranded RNA matching a sequence complementary to nucleotides 852245 to 854050
of chromosome 1 in the GenBank database.
[0012] In the present invention, the term "mRNA" may also refer to a precursor before splicing
or mature mRNA after splicing. Examples of the sequence of mature mRNA include not
only mRNAs having sequences corresponding to Accession Nos. of GenBank listed in Table
1 or 2, but also isoforms prepared by selective splicing. Also in the present invention,
a polynucleotide (e.g., cDNA) from the mRNA or a protein encoded by the RNA can also
be used as a marker.
[0013] Furthermore, in the present invention, the term "iPS cells" refers to stem cells
artificially derived from somatic cells, which can be prepared by introducing a specific
reprogramming factor in the form of DNA or protein into somatic cells and have properties
almost equivalent to those of ES cells, such as pluripotency and proliferation potency
based on self-replication (
K. Takahashi and S. Yamanaka (2006) Cell, 126: 663-676;
K. Takahashi et al. (2007), Cell, 131: 861-872;
J. Yu et al. (2007), Science, 318: 1917-1920;
Nakagawa, M. et al., Nat. Biotechnol. 26: 101-106 (2008); International Publication
WO 2007/069666).
[0014] In the present invention, lincRNA or mRNA that can be recognized as a marker may
be a polynucleotide comprising the full-length nucleotide sequence of the lincRNA
or mRNA, a polynucleotide comprising a sequence complementary thereto, or, a fragment
thereof. In the case of such a polynucleotide fragment, it preferably has a polynucleotide
having at least 15 continuous nucleotides in the sequence of the lincRNA or mRNA.
Specific examples of such a polynucleotide having at least 15 nucleotides include
a polynucleotide having a length of at least 18 continuous nucleotides, a polynucleotide
having a length of at least 19 continuous nucleotides, a polynucleotide having a length
of at least 20 continuous nucleotides, a polynucleotide having a length of at least
30 continuous nucleotides, a polynucleotide having a length of at least 40 continuous
nucleotides, a polynucleotide having a length of at least 50 continuous nucleotides,
a polynucleotide having a length of at least 60 continuous nucleotides, a polynucleotide
having a length of at least 70 continuous nucleotides, and a polynucleotide having
a length of at least 100 continuous nucleotides.
[0015] In the present invention, an iPS cell line exhibiting no differentiation resistance
can be detected by measuring the degree of the expression of the above marker, and
thus the iPS cell line can be screened for. More specifically, an iPS cell line expressing
a marker of group A listed in Table 1 can be screened for as a cell line exhibiting
no differentiation resistance, or an iPS cell line not expressing a marker of group
B listed in Table 2 can be screened for as a cell line exhibiting no differentiation
resistance.
[0016] Here, the expression "expressing a marker" refers to a situation in which a marker
is detected by an arbitrary measuring method, and more preferably to a situation in
which the thus obtained detection value is equivalent to or higher than a control
detection value. Similarly, the expression "not expressing a marker" refers to a situation
in which no marker is detected by an arbitrary measuring method, and more preferably
to a situation in which the thus obtained detection value is equivalent to or lower
than a control detection value. More specifically, when a marker of group A is used,
a case in which a detection value is similar to that of a control ES cell line or
an iPS cell line known to exhibit no differentiation resistance or a case in which
a detection value is higher than that of an iPS cell line known to exhibit differentiation
resistance indicates that a marker of group A is expressed. Meanwhile, when a marker
of group B is used, a case in which the thus obtained detection value is similar to
that of a control ES cell line or an iPS cell line known to exhibit no differentiation
resistance or a case in which the thus obtained detection value is lower than that
of an iPS cell line known to exhibit differentiation resistance indicates that a marker
of group B is not expressed. Here, the expression "detection value high(er)" refers
to a situation in which a detection value is 1.5 times, 2 times, 3 times, 4 times,
or 5 times higher than a control value, for example, and more preferably, 5 or more
times higher than the control value. The expression "detection value lower" refers
to a situation in which a detection value is 2/3, 1/2, 1/3, 1/4, or 1/5 (or less)
of the control value, for example, and more preferably, 1/5 (or less) of the control
value.
[0017] In the present invention, examples of a method for measuring a marker include, but
are not particularly limited to, a Northern blot method, in situ hybridization, RNase
protection assay, a microarray method, a PCR method, a real-time PCR method, a Western
blot method, and flow cytometry.
[0018] In the case of a measuring method using hybridization, such as the Northern blot
method, the full-length nucleotide sequence of the above marker or a polynucleotide
complementary to a partial sequence thereof can be used as a probe. Here, the term
"complementary polynucleotide (complementary strand, opposite strand)" refers to a
polynucleotide that is in a complementary relationship with a subject sequence in
terms of nucleotides on the basis of a base pair relationship such as A:T(U) or G:C.
Examples of such a complementary strand include not only a complementary sequence
completely complementary to the nucleotide sequence of a subject forward strand, but
also a sequence having a complementary relationship such that it can hybridize to
a subject forward strand under stringent conditions. In addition, stringent conditions
can be determined based on the melting temperature (Tm) of a nucleic acid to be bound
with a probe, as taught by
Berger and Kimmel (1987, Guide to Molecular Cloning Techniques Methods in Enzymology,
Vol. 152, Academic Press, San Diego CA). Washing conditions after hybridization are generally conditions of about "1 x SSC,
0.1% SDS, 37 degrees C," for example. Preferably a complementary strand can maintain
a state of hybridizing to a subject forward strand even when washed under such conditions.
Examples of even more stringent hybridization conditions include, but are not particularly
limited to, washing conditions of about "0.5 x SSC, 0.1% SDS, 42 degrees C." Examples
of more stringent hybridization conditions include conditions under which a forward
strand and the complementary strand can maintain the hybridization state even when
washed under washing conditions of about "0.1 x SSC, 0.1% SDS, 65 degrees C." Specific
examples of such a complementary strand include a strand consisiting of a nucleotide
sequence that is in a complete complementary relationship with a subject forward-strand
nucleotide sequence, and a strand consisiting of a nucleotide sequence having at least
90%, preferably at least 95%, 96%, 97%, 98%, or 99% sequence identity with the strand.
The probe size is a length of at least 15 continuous nucleotides, at least 18 continuous
nucleotides, at least 19 continuous nucleotides, at least 20 continuous nucleotides,
at least 30 continuous nucleotides, at least 40 continuous nucleotides, at least 50
continuous nucleotides, at least 60 continuous nucleotides, at least 70 continuous
nucleotides, at least 100 continuous nucleotides, or full-length continuous nucleotides.
Such a probe may be labeled with a radioisotope (e.g.,
32P and
33P), a fluorescent substance (e.g., fluorescamine, rhodamine, Texas Red, dansyl, or
derivatives thereof), a chemiluminescent substance, or an enzyme, for example.
[0019] Furthermore, a poly(oligo)nucleotide serving as the above probe is preferably provided
in the form of a microarray with the poly(oligo)nucleotide immobilized on a solid-phase
support (substrate). Examples of a solid-phase support for a microarray include a
glass substrate, a silicon substrate, a membrane, and beads, but the material, size,
and shape thereof are not particularly limited. A method for forming a microarray
is not particularly limited, and any method that can be used by persons skilled in
the art may be employed herein. Examples thereof include a method (on-chip method)
that involves directly synthesizing a probe on the surface of a solid-phase support
and a method that involves binding a probe prepared in advance to the surface of a
solid-phase support. A method that is generally employed when a probe is directly
synthesized on the surface of a solid-phase support comprises performing selective
synthesis of an oligonucleotide in a predetermined micro-matrix region using a protecting
group to be selectively removed by light irradiation in combination with a photolithographic
technique and a solid phase synthesis technique that are used for semiconductor manufacturing.
Meanwhile, examples of a method that can be used herein, which comprises preparing
a probe in advance and then binding it to the surface of a solid-phase support, include
a method that comprises spotting a probe onto the surface of a solid-phase support
that has been surface-treated with a polycationic compound or a silane coupling agent
having an amino group, an aldehyde group, an epoxy group or the like using a spotter
device depending on nucleic acid probe types or solid-phase support types, and a method
that comprises synthesizing a probe having a reactive group introduced therein, spotting
the probe onto the surface of a solid-phase support that has been surface-treated
in advance so as to cause the formation of a reactive group, and thus binding and
immobilizing the probe onto the surface of the solid-phase support via covalent bonding.
[0020] In another embodiment, when the above marker is specifically recognized and amplified,
an oligonucleotide containing a nucleotide sequence of the marker or a sequence complementary
to the nucleotide sequence can be used as a primer. A primer can be prepared by designing
it based on each nucleotide sequence of the above marker using primer 3 (http://primer3.sourceforge.net/)
or vector NTI (Infomax), for example, and then performing synthesis and purification.
A primer is designed while avoiding a complementary sequence of the two primers so
as to prevent a set of or a pair of primers (2 primers) consisting of a sense strand
(5' terminal side) and an antisense strand (3' terminal side) from annealing to each
other; and also avoiding palindrome so as to prevent the formation of a hairpin structure
within a primer. The primer size is not particularly limited, as long as amplification
and detection of the above marker are possible, and is a length of at least 15 nucleotides,
preferably a length of 15 to 50 nucleotides, and more preferably a length of 20 to
35 nucleotides. A primer can be synthesized with a method known in the art as a method
for synthesizing an oligonucleotide (e.g., a phosphotriethyl method and a phosphodiester
method) using a generally employed automatic DNA synthesizer. Such a primer may be
labeled with a labeling substance similar to the above so as to facilitate the detection
of amplification products.
[0021] In another embodiment, an antibody can be used when the above marker is recognized
as a protein.
[0022] The form of the antibody of the present invention is not particularly limited and
may be a polyclonal antibody or a monoclonal antibody the immunogen of which is a
protein encoded by mRNA listed in Table 1 or 2, or, a chimeric antibody (e.g., a human/mouse
chimeric antibody), a humanized antibody, or a human antibody, or, a fragment of these
antibodies (e.g., Fab, Fab', F(ab')
2, Fc, Fv, and scFv), or, an antibody having antigen-binding property to a polypeptide
comprising at least 8 continuous amino acids (e.g., 10 to 20 continuous amino acids)
in the amino acid sequence of the protein.
[0024] Specifically, when the antibody of the present invention is a polyclonal antibody,
it can be obtained by synthesizing a protein encoded by mRNA listed in Table 1 or
2, which has been expressed and purified according to a conventional method using
Escherichia coli or the like, or an oligopeptide having a partial amino acid sequence
thereof, immunizing a non-human animal such as a domestic rabbit with the resultant,
and then obtaining the antibody from the serum of the immunized animal according to
a conventional method. Meanwhile, in the case of a monoclonal antibody, it can be
obtained by subjecting hybridoma cells (prepared by cell fusion of myeloma cells with
spleen cells obtained from the above-immunized non-human animal) to HAT selection
and affinity assay with a target polypeptide (
Current protocols in Molecular Biology edit. Ausubel et al., (1987) Publish. John
Wiley and Sons. Section 11.4-11.11), for example. The thus obtained antibody may be labeled with a fluorescent substance
(e.g, fluorescamine, rhodamine, Texas Red, dansyl, or a derivative thereof), a chemiluminescent
substance, or an enzyme, for example.
[0025] Moreover, a protein to be used for antibody preparation can be obtained by, based
on the gene sequence information from the Genbank database, DNA cloning, construction
of each plasmid, transfection to a host, culturing the transformant, and collecting
the protein from the culture product. These procedures can be performed according
to methods known by persons skilled in the art or methods described in documents (
Molecular Cloning, T. Maniatis et al., CSH Laboratory (1983),
DNA Cloning, DM. Glover, IRL PRESS (1985)), for example. Specifically, such a protein can be obtained by preparing recombinant
DNA (expression vector) that enables gene expression in desired host cells, introducing
the DNA into host cells for transformation, culturing the transformant, and then collecting
the target protein from the thus obtained culture product.
[0026] Furthermore, in the present invention, method for screening iPS cells exhibiting
no differentiation resistance may also be performed by measuring DNA-methylated state
of LTR region or neighborhood thereof located in the candidate gene bodies including
intron and exon. At this time, LTR means the repeat sequence derived from retrovirus.
For example, as the LTR subfamilies such as LTR1, LTR1B, LTR5, LTR7, LTR8, LTR16A1,
LTR16A1, LTR16C, LTR26, LTR26E, MER48, and MLT2CB are known. Preferable LTR subfamily
is LTR7 of human endogenous retroviruses (HERV)-H family in this invention. The LTR7
is located in 658 loci in gene bodies of the whole human genome. The sequence of LTR7
is shown in SEQ NO: 1. In this invention, the sequence of LTR7 include sequence having
at least 90%, preferably at least 95%, 96%, 97%, 98%, or 99% sequence identity with
the strand.
[0027] Examples of candidate genes are a marker of group B listed in Table 2. A preferable
example of such gene is selected from the group of C4orf51, HHLA1 and, ABHD12B. Examples
of LTR region in C4orf51, HHLA1, and ABHD12B is shown in SEQ NO: 2, 3, 4, 5, 6 and
7.
[0028] Example of the method of measuring DNA-methylated state involves hydrolyzing unmethylated
cytosine using bisulfite. Concretely, the methods include a method that involves performing
bisulfite treatment, PCR, and then sequencing, a method that involves using methylation-specific
oligonucleotide (MSO) microarrays, or methylation-specific PCR that involves causing
PCR primers to recognize a difference between a sequence before bisulfite treatment
and the sequence after bisulfite treatment and then determining the presence or the
absence of methylated DNA based on the presence or the absence of PCR products. Tn
addition to these methods, by chromosome immunoprecipitation using a DNA methylation-specific
antibody, DNA-methylated regions can be detected from specific regions by extracting
DNA sequences within DNA-methylated regions, performing PCR, and then performing sequencing.
[0029] Upon screening iPS cells exhibiting no differentiation resistance, subject iPS cells
in which the DNA-methylated state in the above LTR region located in the candidate
gene bodies is in a DNA-methylated state can be selected as iPS cells exhibiting no
differentiation resistance. Here, the expression, "the DNA-methylated state" refers
to, for example, a state in which the detected methylated CpGs in the subject region
account for 50%, 60%, 70%, 80%, 90% or more, preferably 100% of all detected CpGs.
[0030] As an example of a method for detecting the percentage of methylated CpGs in one
arbitrarily selected cell are sequenced. Hence, the percentage can be calculated by
repeatedly sequencing a template to which a PCR product has been cloned a plurality
of times such as 2 or more times, preferably 5 or more times, and more preferably
10 or more times and then comparing the number of sequenced clones with the number
of clones for which DNA methylation has been detected. When a pyrosequencing method
is employed, the percentage can also be directly determined by measuring amout of
cytosine or thymine (the amount of cytosine means amount of methylated DNAs and the
amount of thymine means amount of unmethylated DNAs).
[0031] Upon screening for iPS cells exhibiting no differentiation resistance with the use
of the above markers, iPS cells to be subjected to screening may be prepared by introducing
a specific reprogramming factor in the form of DNA or protein into somatic cells,
according to a previously established method.
[0032] A reprogramming factor may be composed of a gene that is specifically expressed in
ES cells, a gene product thereof, or non-coding RNA, a gene playing an important role
in maintaining undifferentiation of ES cells, a gene product thereof, or non- coding
RNA, or a low-molecular-weight compound. Examples of a gene(s) encompassed by a reprogramming
factor include Oct3/4, Sox2, Sox1, Sox3, Sox15, Sox17, Klf4, Klf2, c-Myc, N-Myc, L-Myc,
Nanog, Lin28, Fbx15, ERas, ECAT15-2, Tcl1, beta-catenin, Lin28b, Sall1, Sall4, Esrrb,
Nr5a2, Tbx3, and Glis1. These reprogramming factors may be used independently or in
combination.
[0033] Examples of combinations of reprogramming factors include the combinations as described
in
WO2007/069666,
WO2008/118820,
WO2009/007852,
WO2009/032194,
WO2009/058413,
WO2009/057831,
WO2009/075119,
WO2009/079007,
WO2009/091659,
WO2009/101084,
WO2009/101407,
WO2009/102983,
WO2009/114949,
WO2009/117439,
WO2009/126250,
WO2009/126251,
WO2009/126655,
WO2009/157593,
WO2010/009015,
WO2010/033906,
WO2010/033920,
WO2010/042800,
WO2010/050626,
WO2010/056831,
WO2010/068955,
WO2010/098419,
WO2010/102267,
WO2010/111409,
WO2010/111422,
WO2010/115050,
WO2010/124290,
WO2010/147395, and
WO2010/147612, as described in
Huangfu D, et al. (2008), Nat. Biotechnol., 26: 795-797,
Shi Y, et al. (2008), Cell Stem Cell, 2: 525-528,
Eminli S, et al. (2008), Stem Cells. 26:2467-2474,
Huangfu D, et al. (2008), Nat Biotechnol. 26:1269-1275,
Shi Y, et al. (2008), Cell Stem Cell, 3, 568-574,
Zhao Y, et al. (2008), Cell Stem Cell, 3:475-479,
Marson A, (2008), Cell Stem Cell, 3, 132-135,
Feng B, et al. (2009), Nat Cell Biol. 11:197-203,
R.L. Judson et al., (2009), Nat. Biotech., 27:459-461,
Lyssiotis CA, et al. (2009), Proc Natl Acad Sci U.S.A. 106: 8912-8917,
Kim JB, et al. (2009), Nature. 461: 649-643,
Ichida JK, et al. (2009), Cell Stem Cell. 5: 491-503,
Heng JC, et al. (2010), Cell Stem Cell. 6: 167-74,
Han J, et al. (2010), Nature. 463: 1096-100,
Mali P, et al. (2010), Stem Cells. 28: 713-720,
Maekawa M, et al. (2011), Nature. 474: 225-9.
Examples of the above reprogramming factor also include factors to be used for improving
the efficiency for establishment such as histone deacetylase (HDAC) inhibitors {e.g.,
low-molecular weight inhibitors such as valproic acid (VPA), tri-chostatin A, sodium
butyrate, MC 1293, and M344, and nucleic acid expression inhibitors such as siRNA
and shRNA against HDAC (e.g., HDAC1 siRNA Smartpool™ (Millipore) and HuSH 29mer shRNA
Constructs against HDAC1 (OriGene))}, MEK inhibitors (e.g., PD184352, PD98059, U0126,
SL327, and PD0325901), Glycogen synthase kinase-3 inhibitors (e.g., Bio and CHIR99021),
DNA methyl transferase inhibitors (e.g., 5-azacytidine), histone methyltransferase
inhibitors (e.g., low-molecular-weight inhibitors such as BIX-01294, and nucleic acid
expression inhibitors such as siRNA and shRNA against Suv39hl, Suv39h2, SetDBl, and
G9a), L-channel calcium agonists (e.g., Bayk8644), butyric acid, TGF beta inhibitors
or ALK5 inhibitors (e.g., LY364947, SB431542, 616453, and A-83-01), p53 inhibitors
(e.g., siRNA and shRNA against p53), ARID3A inhibitors (e.g., siRNA and shRNA against
ARID3A), miRNA (e.g., miR-291-3p, miR-294, miR-295, and mir-302), Wnt Signaling (e.g.,
soluble Wnt3a), neuropeptide Y, prostaglandins (e.g., prostaglandin E2 and prostaglandin
J2), hTERT, SV40LT, UTF1, IRX6, GLIS1, PITX2, and DMRTB1. In the Description, these
factors to be used for improving the efficiency for establishment are not particularly
distinguished from reprogramming factors.
[0034] When a reprogramming factor is in the form of protein, it may be introduced into
somatic cells by techniques such as lipofection, fusion with a cell membrane-permeable
peptide (e.g., HIV-derived TAT and polyarginine), or microinjection.
[0035] Meanwhile, when a reprogramming factor is in the form of DNA, it can be introduced
into somatic cells with a technique using a vector such as a virus, a plasmid, or
an artificial chromosome, lipofection (or liposome transfetion), or microinjection,
for example. Examples of viral vectors include a retrovirus vector, a lentivirus vector
(
Cell, 126, pp. 663-676, 2006;
Cell, 131, pp. 861-872, 2007;
Science, 318, pp. 1917-1920, 2007), an adenovirus vector (
Science, 322, 945-949, 2008), an adeno-associated virus vector, and a Sendai virus vector (
WO 2010/008054). Furthermore, examples of artificial chromosome vectors include a human artificial
chromosome (HAC), a yeast artificial chromosome (YAC), and a bacterial artificial
chromosome (BAC or PAC), As a plasmid, a plasmid for mammalian cells can be used (
Science, 322: 949-953, 2008). A vector to be used herein can contain regulatory sequences such as a promoter,
an enhancer, a ribosome binding sequence, a terminator, and a polyadenylation site
so that a nuclear reprogramming substance can be expressed. Furthermore, if necessary,
such a vector can further contain a selection marker sequence such as a drug resistance
gene (e.g., a kanamycin resistance gene, an ampicillin resistance gene, and a puromycin
resistance gene), a thymidine kinase gene, and a diphtheria toxin gene, and a reporter
gene sequence such as a green fluorescent protein (GFP), beta glucuronidase (GUS),
and FLAG. Moreover, the above vector can further cotain LoxP sequences at the 5'-end
and 3'-end of a gene encoding a reprogramming factor or a gene encoding a reprogramming
factor linked to a promoter, which allows it to cleave the gene after introduction
into somatic cells.
[0036] Furthermore, when a reprogramming factor is in the form of RNA, it may be introduced
into somatic cells with techniques such as lipofection or microinjection. To suppress
degradation, RNA with 5-methylcytidine and pseudouridine (TriLink Biotechnologies)
incorporated therein may also be used (
Warren L, (2010) Cell Stem Cell, 7: 618-630).
[0037] Examples of culture solutions for inducing iPS cells include 10% to 15% FBS-containing
DMEM, DMEM/F12, or DME culture solutions (these culture solutions may further appropriately
contain LIF, penicillin/streptomycin, puromycin, L-glutamine, nonessential amino acids,
beta-mercaptoethanol, or the like) or commercially available culture solutions {e.g.,
a culture solution for culturing mouse ES cells (TX-WES culture solution, Thromb-X),
a culture solution for culturing primate ES cells (a culture solution for primate
ES/iPS cells, ReproCELL), and serum free medium (mTeSR, Stemcell Technology)}.
[0038] An example of culture methods is as follows. Somatic cells are brought into contact
with a reprogramming factor on a DMEM or DMEM/F12 culture solution containing 10%
FBS at 37 degrees C in the presence of 5% CO
2 and are cultured for about 4 to 7 days. Subsequently, the cells are reseeded on feeder
cells (e.g., mitomycin C-treated STO cells or SNL cells). About 10 days after contact
between somatic cells and the reprogramming factor, cells are cultured in a culture
solution for primate ES cell culture containing bFGF. About 30 to 45 days or more
after the contact, iPS cell-like colonies can be formed.
[0039] Alternatively, cells may be cultured at 37 degrees C in the presence of 5% CO
2 using a DMEM culture solution containing 10% FBS (which may further appropriately
contain LIF, penicillin/streptomycin, puromycin, L-glutamine, nonessential amino acids,
beta-mercaptoethanol, and the like) on feeder cells (e.g., mitomycin C-treated STO
cells or SNL cells). After about 25 to 30 days or more, ES-like colonies can be formed.
Examples of desirable methods include a method that involves using directly, instead
of feeder cells, somatic cells to be reprogrammed (
Takahashi K, et al., (2009), PLoS One, 4: e8067 or
WO2010/137746) or an extracellular matrix (e.g., Laminin-5 (
WO2009/123349) and matrigel (BD)).
[0040] Another example in addition to these examples is a culture method that involves culturing
with serum-free medium (
Sun N, et al., (2009), Proc Natl Acad Sci U.S.A., 106: 15720-15725). Furthermore, iPS cells may also be established under hypoxia conditions (0.1% or
more, 15% or less oxygen concentration) in order to increase the efficiency for establishment
(
Yoshida Y, et al., (2009), Cell Stem Cell, 5: 237-241 or
WO2010/013845).
[0041] During the above culture, a culture solution is exchanged with a fresh culture solution
once a day from day 2 after the start of culture. In addition, the number of somatic
cells to be used for nuclear reprogramming is not limited, but ranges from approximately
5 x 10
3 cells to approximately 5 x 10
6 cells per culture dish (100 cm
2).
[0042] iPS cells can be selected depending on the shapes of the thus formed colonies. Meanwhile,
when a drug resistance gene to be expressed in conjunction with a gene that is expressed
when somatic cells are reprogrammed (e.g., Oct3/4 or Nanog) is introduced as a marker
gene, cells are cultured in a culture solution (selection culture solution) containing
a suitable medical agent, so that the thus established iPS cells can be selected.
Furthermore, iPS cells can be selected through observation with a fluorescence microscope
when a marker gene is a fluorescent protein gene, through addition of a luminescent
substrate when a marker gene is a luminescent enzyme gene, or through addition of
a chromogenic substrate when a marker gene is a chromogenic enzyme gene.
[0043] The term "somatic cells" as used herein may refer to all animal cells (preferably,
mammalian cells including human cells) excluding germ-line cells (e.g., ova, oocytes,
and ES cells) or totipotent cells. Examples of somatic cells include, but are not
limited to, any fetal somatic cells, neonate somatic cells, and mature healthy or
pathogenic somatic cells, or, any primary cultured cells, passaged cells, and established
cell lines. Specific examples of somatic cells include (1) tissue stem cells (somatic
stem cells) such as neural stem cells, hematopoietic stem cells, mesenchymal stem
cells, and dental pulp stem cells, (2) tissue precursor cells, (3) differentiated
cells such as lymphocytes, epithelial cells, endothelial cells, muscle cells, fibroblasts
(e.g., skin cells), hair cells, hepatocytes, gastric mucosal cells, enterocytes, spleen
cells, pancreatic cells (e.g., pancreatic exocrine cells), brain cells, pneumocytes,
renal cells, and fat cells. 2. Reagent and kit for screening human induced pluripotent
stem cell line
[0044] The present invention further provides a reagent for screening for a human induced
pluripotent stem cell line. The reagent for screening of the present invention contains
at least one type of probe, primer, or antibody for recognition of the above-described
marker. Such a reagent can be used for producing a kit in combination with other reagents
or apparatuses. The kit of the present invention may contain a reagent for RNA extraction,
a reagent for gene extraction, a reagent for chromosome extraction, or the like. Also,
the kit of the present invention may contain a means for discrimination analysis for
discrimination between a cell line exhibiting differentiation resistance and a cell
line exhibiting no differentiation resistance, such as documents or instructions containing
procedures for discrimination analysis, a program for implementing the procedures
for discrimination analysis by a computer, the program list, a recording medium containing
the program recorded therein, which is readable by the computer (e.g., flexible disk,
optical disk, CD-ROM, CD-R, and CD-RW), and an apparatus or a system (e.g., computer)
for implementation of discrimination analysis.
Examples
[0045] The present invention will next be described in detail by way of Examples, which
should not be construed as limiting the scope of the present invention.
Example 1
1. Cell
[0047] As human iPS cells, 9 families and 39 clones prepared by the following method were
used.
- (i) Six (6) factors (OCT3/4, SOX2, KLF4, L-Myc, LIN28, and p53shRNA) were introduced
into CD34 positive cells (WO2010/131747) extracted from umbilical cord blood using an episomal vector (Okita K,et al., Nat Methods, 8: 409-12, 2011), so that four CB-EP6F clones were prepared.
- (ii) Four (4) factors (OCT3/4, SOX2, KLF4, and c-MYC) were introduced into CD34 positive
cells extracted from umbilical cord blood using a retrovirus, so that three CB-RV4F
clones were prepared (WO2010/131747).
- (iii) Four (4) factors (OCT3/4, SOX2, KLF4, and c-MYC) were introduced into CD34 positive
cells (WO2010/131747) extracted from umbilical cord blood using the Sendai virus (Seki T, et al., Cell Stem Cell, 7: 11-4, 2010), so that five CB-SV4F clones were prepared.
- (iv) Six (6) factors (OCT3/4, SOX2, KLF4, L-Myc, LIN28, and p53shRNA) were introduced
into dental pulp stem cells using an episomal vector, so that two DP-EP6F clones were
prepared (Okita K, et al., Nat Methods, 8: 409-12, 2011).
- (v) Six (6) factors (OCT3/4, SOX2, KLF4, L-Myc, LIN28, and p53shRNA) were introduced
into fibroblasts using an episomal vector, so that three FB-EP6F clones were prepared
(Okita K, et al., Nat Methods, 8: 409-12, 2011).
- (vi) Three (3) factors (OCT3/4, SOX2, and KLF4) were introduced into fibroblasts using
retrovirus, so that four FB-RV3F clones were prepared (Okita K, et al., Nat Methods, 8: 409-12, 2011).
- (vii) Four (4) factors (OCT3/4, SOX2, KLF4, and c-MYC) were introduced into fibroblasts
using retrovirus, so that eleven FB-RV4F clones were prepared (Okita K, et al., Nat Methods, 8: 409-12, 2011).
- (viii) Six (6) factors (OCT3/4, SOX2, KLF4, L-Myc, LIN28, and p53shRNA) were introduced
into T cells (Seki T, et al., Cell Stem Cell, 7: 11-4, 2010) included in peripheral blood mononuclear cells (PBMC) using an episomal vector,
so that four PM-EP6F clones were prepared (Okita K, et al., Nat Methods, 8: 409-12, 2011).
- (ix) Four (4) factors (OCT3/4, SOX2, KLF4, and c-MYC) were introduced into T cells
included in peripheral blood mononuclear cells (PBMC) using Sendai virus, so that
four PM-SV4F clones were prepared (Seki T, et al., Cell Stem Cell, 7: 11-4, 2010).
2. Confirmation of differentiation resistance
[0048] To confirm differentiation resistance of ES cells and iPS cells, the aforementioned
cells were subjected to differentiation induction to result in neural cells using
a modified SFEBq method comprising the following steps.
- (1) 10 micromolar Y27632 (WAKO) was added to a culture solution of ES cells or iPS
cells and then the solution was left to stand for 3 hours.
- (2) Feeder cells were removed using a CTK solution (collagenase-trypsine-KSR), the
resultant was treated with Accumax (Innovate cell technologies) and then disintegrated
into single cells, and the resulting cells were plated on a 96-well plate (Lipidure-coat
U96w, NOF Corporation) at 9,000 cells/150 microliter/well.
- (3) Cells were cultured in DMEM/F12 (Invitrogen) containing 10 micromolar Y-27632,
2 micromolar Dorsomorphin (Sigma), 10 micromolar SB431542 (Sigma), 5% KSR (Invitrogen),
MEM-Non essential amino acid solution (Invitrogen), L-glutamine (Invitrogen), and
2-Mercaptoethanol (Invitrogen). One-half the medium was exchanged every 3 or 4 days
with medium lacking Y-27632, Dorsomorphin, and SB431542, followed by 14 days of culture.
Subsequently, the thus obtained neural cells were isolated, fixed in 37% formalin,
stained with Alexa Fluor 488 Mouse anti-Oct3/4 (BD Pharmingen), and then analyzed
using a flow cytometer. In the cases of CB-RV4F-2, DP-EP6F-1, FB-RV3F-3, FB-RV3F-4,
FB-RV4F-5, and FB-RV4F-11, Oct3/4 positive cells were contained at 5% or higher even
after differentiation induction. These iPS cells were used as the cells of cell lines
exhibiting differentiation resistance. The results are shown in Table 3.
[Table 3]
Content of Oct3/4 positive cells in each iPS cell line |
patent cell name |
Souce |
Factor |
method |
Oct3/4 positive cells (%) |
determination |
1st |
2nd |
3rd |
4th |
5th |
6th |
7th |
8th |
9th |
Max rate |
KhES1 |
|
|
|
0 |
0.8 |
0.08 |
0.13 |
0.07 |
0.01 |
1.7 |
0.59 |
0 |
1.7 |
|
KhES3 |
|
|
|
0.2 |
|
|
|
|
|
|
|
|
0.2. |
○ |
H1 |
|
|
|
0.13 |
0.09 |
|
|
|
|
|
|
|
0.13 |
○ |
H9 |
|
|
|
0 |
0.05 |
0.1 |
0.05 |
0 |
0.3 |
|
|
|
0.3 |
○ |
CB-EP6F-1 |
CB |
OSKUL+ shp53 |
Episomal plasmid |
0.3 |
0.01 |
|
|
|
|
|
|
|
0.3 |
○ |
CB-EP6F-2 |
CB |
OSKUL+ shp53 |
Episomal plasmid |
0.3 |
0.07 |
|
|
|
|
|
|
|
0.3 |
○ |
CB-EP6F-3 |
CB |
OSKUL+ shp53 |
Episomal plasmid |
0.1 |
0.03 |
|
|
|
|
|
|
|
0.1 |
○ |
CB-EP6F-4 |
CB |
OSKUL+ shp53 |
Episomal plasmid |
4.7 |
0.1 |
|
|
|
|
|
|
|
4.7 |
|
CB-RV4F-1 |
CB |
OSKM |
Retro virus |
0 |
0.35 |
0.49 |
|
|
|
|
|
|
0.49 |
○ |
CB-RV4F-2 |
CB |
OSKM |
Retro virus |
10.74 |
8.69 |
19.01 |
9.6 |
14.44 |
12.78 |
|
|
|
19.01 |
x |
CB-RV4F-3 |
CB |
OSKM |
Retro virus |
0 |
0.39 |
0.04 |
|
|
|
|
|
|
0.39 |
○ |
CB-SV4F-1 |
CB |
OSKM |
Sendai virus |
0.9 |
0.7 |
0.7 |
|
|
|
|
|
|
0.9 |
○ |
CB-SV4F-2 |
CB |
OSKM |
Sendai virus |
0 |
0.1 |
0.1 |
|
|
|
|
|
|
0.1 |
○ |
CB-SV4F-3 |
CB |
OSKM |
Sendai virus |
0.3 |
0.1 |
|
|
|
|
|
|
|
0.3 |
○ |
CB-SV4F-4 |
CB |
OSKM |
Sendai virus |
0.2 |
0.3 |
|
|
|
|
|
|
|
0.3 |
○ |
CB-SV4F-5 |
CB |
OSKM |
Sendai virus |
0.1 |
0 |
|
|
|
|
|
|
|
0.1 |
○ |
DP-EP6F-1 |
dental pulp |
OSKUL+ shp53 |
Episomal plasmid |
13.61 |
13.91 |
2.42 |
6.1 |
2.18 |
1.3 |
1.96 |
|
|
13.91 |
x |
DP-EP6F-2 |
dental pulp |
OSKUL+ shp53 |
Episomal plasmid |
0.01 |
0.06 |
0,08 |
|
|
|
|
|
|
0.08 |
○ |
FB-EP6F-1 |
Fibro |
OSKUL+ shp53 |
Episomal plasmid |
0 |
0.02 |
|
|
|
|
|
|
|
0.02 |
○ |
FB-EP6F-2 |
Fibro |
OSKUL+ shp53 |
Episomal plasmid |
0.16 |
0.02 |
|
|
|
|
|
|
|
0.16 |
○ |
FB-EP6F-3 |
Fibro |
OSKUL+ shp53 |
Episomal plasmid |
0.11 |
0.05 |
0.1 |
|
|
|
|
|
|
0.11 |
○ |
FB-RV3F-1 |
Fibro |
OSK |
Retro virus |
0 |
0 |
0.1 |
|
|
|
|
|
|
0.1 |
○ |
FB-RV3F-2 |
Fibro |
OSK |
Retro virus |
0.28 |
0.1 |
|
|
|
|
|
|
|
0.28 |
○ |
FB-RV3F-3 |
Fibro |
OSK |
Retro virus |
0 |
7.64 |
14.25 |
1.19 |
|
|
|
|
|
14.25 |
x |
FB-RV3F-4 |
Fibro |
OSK(M) |
Retro virus |
1.24 |
12.41 |
8.4 |
8.9 |
14.9 |
14.16 |
4 |
|
|
14.9 |
x |
FB-RV4F-1 |
Fibro |
OSKM |
Retro virus |
0.05 |
0.4 |
|
|
|
|
|
|
|
0.4 |
○ |
FB-RV4F-2 |
Fibro |
OSKM |
Retro virus |
0.15 |
0.26 |
0 |
0 |
0 |
0.01 |
0.04 |
|
|
0.26 |
○ |
FB-RV4F-3 |
Fibro |
OSKM |
Retro virus |
0.92 |
3.62 |
11.2 |
|
|
|
|
|
|
11.2 |
x |
FB-RV4F-4 |
Fibro |
OSKM |
Retro virus |
0.04 |
0,04 |
|
|
|
|
|
|
|
0.04 |
○ |
FB-RV4F-5 |
Fibro |
OSKM |
Retro virus |
17.47 |
5.19 |
12.6 |
8.3 |
6.94 |
17.1 |
|
|
|
17.47 |
x |
FB-RV4F-6 |
Fibro |
OSKM |
Retro virus |
0 |
3.64 |
|
|
|
|
|
|
|
3.64 |
|
FB-RV4F-7 |
Fibro |
OSKM |
Retro virus |
0.01 |
0.07 |
|
|
|
|
|
|
|
0.07 |
○ |
FB-RV4F-8 |
Fibro |
OSKM |
Retro virus |
0 |
0.09 |
|
|
|
|
|
|
|
0.09 |
○ |
FB-RV4F-9 |
Fibro |
OSKM |
Retro virus |
0 |
0.05 |
|
|
|
|
|
|
|
0.05 |
○ |
FB-RV4F-10 |
Fibro |
OSKM |
Retro virus |
0.03 |
0.02 |
|
|
|
|
|
|
|
0.03 |
○ |
FB-RV4F-11 |
Fibro |
OSKM |
Retro virus |
1.11 |
13.06 |
14.39 |
|
|
|
|
|
|
14.39 |
x |
PB-EP6F-1 |
PBMN |
OSKUL+ shp53 |
Episomal plasmid |
0.1 |
0.04 |
0.13 |
|
|
|
|
|
|
0.13 |
○ |
PB-EP6F-2 |
PBMN |
OSKUL+ shp53 |
Episomal plasmid |
4.7 |
0.02 |
|
|
|
|
|
|
|
4.7 |
|
PB-EP6F-3 |
PBMN |
OSKUL+ shp53 |
Episomal plasmid |
0.2 |
0.02 |
|
|
|
|
|
|
|
0.2 |
○ |
PB-EP6F-4 |
PBMN |
OSKUL+ shp53 |
Episomal plasmid |
0.1 |
0.94 |
|
|
|
|
|
|
|
0.94 |
○ |
PB-SEP4F-1 |
PBMN |
OSKM |
Sendai virus |
0.1 |
0.1 |
|
|
|
|
|
|
|
0.1 |
○ |
PB-SV4F-2 |
PBMN |
OSKM |
Sendai virus |
0.1 |
0.2 |
|
|
|
|
|
|
|
0.2 |
○ |
PB-SV4F-3 |
PBMN |
OSKM |
Sendai virus |
0.1 |
1.3 |
1.3 |
|
|
|
|
|
|
1.3 |
|
PB-SV4F-4 |
PBMN |
OSKM |
Sendai virus |
0.1 |
0.2 |
0.4 |
|
|
|
|
|
|
0.4 |
○ |
"○" means the clone exhibiting no differentiation resistance.
"x" measns the clone exhibiting differentiation resistance. |
3. Identification of differentiation resistance marker
[0049] RNA was collected from 5 iPS cell lines exhibiting differentiation resistance (CB-RV4F-2,
DP-EP6F-1, FB-RV3F-3, FB-RV3F-4, and FB-RV4F-5) and 27 iPS cell lines (including ES
cells) exhibiting no differentiation resistance. RNA expression was measured using
microarrays (Human GE G3 8x60k, Agilent). Table 4 shows marker groups that were expressed
in cell lines exhibiting no differentiation resistance at a level 5 or more times
higher than that in cell lines exhibiting differentiation resistance. Similarly, Table
5 shows marker groups that were expressed in cell lines exhibiting no differentiation
resistance at a level 5 or more times lower than that in cell lines exhibiting differentiation
resistance. Here, four markers, the P value of each of which obtained by t-test was
0.05 or less, were confirmed from Table 4 (DLX5, MEIS2, lincRNA:chr17:21434064-21435857
reverse strand, GREB1L) and 12 markers, the P value of each of which obtained by t-test
was 0.05 or less, were confirmed from Table 5 (C4orf51, C7orf57, lincRNA:chr7:124873114-124899839
reverse strand, OC90, lincRNA:chr8:133071643-133092468 reverse strand, lincRNA:chr8:133076031-133093351
reverse strand, ABHD12B, lincRNA:chr18:54721302-54731677 reverse strand, ZNF541, TBX1,
CXorf61, DB090170 TESTI4 Homo sapiens cDNA clone TESTI4038997 5', mRNA sequence [DB090170]).
[Table 4-1]
Markers for cell lines exhibiting no differentiation resistance |
Marker name |
Genbank Accession |
Chromosome Number |
Strand Direction |
Region |
P<0.05 |
lincRNA:chr1:852245-854050 reverse strand |
|
chr1 |
- |
852,245-854,050 |
|
GPR177 |
NM_001002292 |
chr1 |
- |
29,518,977-29,543,121 |
|
VTCN1 |
NM_024626 |
chr1 |
- |
117,686,209. 117,753,549 |
|
lincRNA:chr1:142803013-142804254 reverse strand |
|
chr1 |
- |
142,803,013-142,804,254 |
|
APOA2 |
NM_001643 |
chr1 |
- |
161.192.083-161,193,418 |
|
WNT6 |
NM_006522 |
chr2 |
+ |
23,961,932-23,965,019 |
|
EPAS1 |
NM_001430 |
chr2 |
+ |
46,524,541-46,613,842 |
|
COL3A1 |
NM_000090 |
chr2 |
+ |
189,839,099-189,877,472 |
|
SLC40A1 |
NM_014585 |
chr2 |
- |
190,425,316-190,445,53 7 |
|
S100P |
NM_005980 |
chr4 |
+ |
6,695,566-6, 698,897 |
|
HOPX |
NM_139211 |
chr4 |
- |
57,514,154-57,547,872 |
|
GUCY1A3 |
NM_000856 |
chr4 |
+ |
156,587,862-156,658,214 |
|
CDH10 |
NM_006727 |
chr5 |
- |
24,487,209-24,645,085 |
|
HAPLN1 |
NM_001884 |
chr5 |
- |
82,934,017-83,016,896 |
|
PITX1 |
NM_002653 |
chr5 |
- |
134,363,424-134,369,964 |
|
HAND1 |
NM_004821 |
chr5 |
- |
153,854,532-153,857,824 |
|
CGA |
NM_000735 |
chr6 |
- |
87,795,222-87,804,824 |
|
AQP1 |
NM_198098 |
chr7 |
+ |
30,951,415-30,965,131 |
|
[Table 4-2]
Marker name |
Genbank Accession |
Chromosome Number |
Strand Direction |
Region |
P<0.05 |
DLX6 |
NM_005222 |
chr7 |
+ |
96,635,290-96,640,352 |
|
DLX5 |
NM_005221 |
chr7 |
- |
96,649,702-96,654,143 |
○ |
SOX17 |
NM_022454 |
chr8 |
+ |
55,370,495-55,373,456 |
|
FLJ45983 |
NR_024256 |
chr10 |
- |
8,092,413-8,095,447 |
|
PLCE1 |
NM_016341 |
chr10 |
+ |
95,753,746-96,088,149 |
|
H19 |
NR_002196 |
chr11 |
- |
2,016,406-2,019,065 |
|
lincRNA:chr11:2016408-2017024 reverse strand |
|
chr11 |
- |
2,016,408-2,017,024 |
|
lincRNA:chr11:2017517-2017651 forward strand |
|
chr11 |
+ |
2,017,517-2,017,651 |
|
IGF2 |
NM_000612 |
chr11 |
- |
2,150,350-2,182,439 |
|
P2RY6 |
NM_176798 |
chr11 |
+ |
72.975,570-73,009,664 |
|
SLN |
NM_003063 |
chr11 |
- |
107,578,101-107,582,787 |
|
NNMT |
NM_006169 |
chr11 |
+ |
114,166,535-114,183,238 |
|
APOA1 |
NM_000039 |
chr11 |
- |
116,706,469-116,708,338 |
|
ERP27 |
NM_152321 |
chr12 |
- |
15,066,976-15,091,463 |
|
LUM |
NM_002345 |
chr12 |
- |
91,497,232-91,505,542 |
|
CCDC92 |
NM_025140 |
chr12 |
- |
124,420,955-124,457,163 |
|
CDX2 |
NM_001265 |
chr13 |
- |
28,536,278-28,543,317 |
|
FLJ41170 |
AK021542 |
chr14 |
+ |
81,527,645-81,529,369 |
|
MEG3 |
NR_003530 |
chr14 |
+ |
101,292,445-101,327,363 |
|
[Table 4-3]
Marker name |
Genbank Accession |
Chromosome Number |
Strand Direction |
Region |
P<0.05 |
lincRNA:chr14:101292469-101299626 forward strand |
|
chr14 |
+ |
101,292,469-101,299,626 |
|
lincRRA:chr14:101295637-101302637 forward strand |
|
chr14 |
+ |
101,295,637-101,302,637 |
|
lincRNA:chr14:101296681-101298460 forward strand |
|
chr14 |
+ |
101,296,681-101,298,460 |
|
lincRNA:chr14:101298129-101300147 forward strand |
|
chr14 |
+ |
101,298,129-101,300,147 |
|
lincRNA:chr14:101324825-101327247 forward strand |
|
chr14 |
+ |
101,324,825-101,327,247 |
|
MEG8 |
NR_024149 |
chr14 |
+ |
101,361,107- 101,373,305 |
|
lincRNA:chr14:101365673-101366049 forward strand |
|
chr14 |
+ |
101,365,673-101,366,049 |
|
lincRNA:chr14:101396955-101397357 forward strand |
|
chr14 |
+ |
101,396,955-101,397,357 |
|
lincRNA:chr14:101430757-101433381 forward strand |
|
chr14 |
+ |
101,430,757-101,433,381 |
|
lincRNA:ch14:101434059-101436282 forward strand |
|
chr14 |
+ |
101,434,059-101,436,282 |
|
lincRNA:chr14:101472355-101473369 forward strand |
|
chr14 |
+ |
101,472,355-101,473,369 |
|
DI03 |
NM_001362 |
chr14 |
+ |
902,027,688-102,029,789 |
|
MEIS2 |
NM_170677 |
chr15 |
- |
37,183,232-37,393,500 |
○ |
PRTG |
NM_173814 |
chr15 |
- |
55,903,738-56,035,177 |
|
C17orf51 |
NM_001113434 |
chr17 |
- |
21,431,571-21,454,941 |
|
lincRNA:chr17:21434064-21435857 reverse strand |
|
chr17 |
- |
21,434,064-21,435,857 |
○ |
lincRNA:chr17:21436180-21454915 reverse strand |
|
chr17 |
- |
21,435,180-21,454,915 |
|
lincRNA:chr17:21435959-21436405 reverse strand |
|
chr17 |
- |
21,435,959-21,436,405 |
|
CCR7 |
NM_001838 |
chr17 |
- |
38,710,021-38,721,736 |
|
[Table 4-4]
Marker name |
Genbank Accession |
Chromosome Number |
Strand Direction |
Region |
P<0.05 |
KRT23 |
NM_015515 |
chr17 |
- |
39,078,952-39,093,836 |
|
GREB1L |
NM_001142966 |
chr18 |
+ |
18,822,203-19,102,791 |
○ |
GATA6 |
NM_005257 |
chr18 |
+ |
19,749,416-19,782,227 |
|
TTR |
NM_000371 |
chr18 |
+ |
29,171,730-29,178,987 |
|
UCA1 |
NR_015379 |
chr19 |
+ |
15,939,757-15,946,230 |
|
FLRT3 |
NM_198391 |
chr20 |
- |
14,304,639-14,318,313 |
|
lincRNA:chrX:73040495-73047819 reverse strand |
|
chrX |
- |
73,040,495-73,047,819 |
|
VGLL1 |
NM_016267 |
chrX |
+ |
135,614,311-135,638,966 |
|
RPS4Y1 |
NM_001008 |
chrY |
+ |
2,709,623-2,734,997 |
|
DDX3Y |
NM_001122665 |
chrY |
+ |
15,016,019-15,032,390 |
|
RPS4Y2 |
NM_001039567 |
chrY |
+ |
22,917,954-22,942,918 |
|
[Table 5-1]
Markers for cell lines exhibiting differentiation resistance |
Marker name |
Genbank Accession |
Chromosome Number |
Strand Direction |
Region |
P<0.05 |
DMRTB1 |
NM_033067 |
chr1 |
+ |
53,925,072-53,933,158 |
|
lincRNA:chr1:73430887-73446112 reverse strand |
|
chr1 |
- |
73,430,887-73,446,112 |
|
lincRNA:chr1:73444697-73444997 reverse strand |
|
chr1 |
- |
73,444,697-73,444,997 |
|
C4orf51 |
NM_001080531 |
chr4 |
+ |
146,601,356-146,653,949 |
○ |
PCDHA1 |
NM_031410 |
chr5 |
+ |
140,165,876-140,391,929 |
|
lincRNA:Chr6:95250854-95263604 reverse strand |
|
chr6 |
- |
95,250,854-95,263,604 |
|
lincRNA:chr6:14280358-14285376 reverse strand |
|
chr6 |
- |
14,280,358-14,285,376 |
|
lincRNA:chr6:14283301-14286685 reverse strand |
|
chr6 |
- |
14,263,301-14,285,685 |
|
C7orf57 |
NM_001100159 |
chr7 |
+ |
48,075,117-48,100,894 |
○ |
lincRNA:chr7:124873114-124899839 reverse strand |
|
chr7 |
- |
124,873,114-124,899,839 |
○ |
lincRNA:chr8:129599518-129624118 reverse strand |
|
chr8 |
- |
129,599,518-129,624,118 |
|
OC90 |
NM_001080399 |
chr8 |
- |
133,036,467-133,071,627 |
○ |
lincRNA:chr8:133071643-133092468 reverse strand |
|
chr8 |
- |
133,071,643-133,092,468 |
○ |
lincRNA:chr8:133073732-133075753 reverse strand |
|
chr8 |
- |
133,073,732-133,075,753 |
|
HHLA1 |
NM_001146095 |
chr8 |
- |
133,073,733-133,117,512 |
|
lincRNA:chr8:133076031-133093351 reverse strand |
|
chr8 |
- |
133,076,031-133,093,351 |
○ |
lincRNA:chr8:138387843-138421643 reverse strand |
|
chr8 |
- |
138,387,843-138,421,643 |
|
lincRNA:chr8:138418343-138425831 reverse strand |
|
chr8 |
- |
138,418,343-138,425,831 |
|
[Table 5-2]
Marker name |
Genbank Accession |
Chromosome Number |
Strand Direction |
Region |
P<0.05 |
NDUFA4L2 |
NM_020142 |
chr12 |
- |
57,628,686-57,634,545 |
|
lincRNA:chr13:54698462-54707001 reverse strand |
|
chr13 |
- |
54,698,462-54,707,001 |
|
ABHD128 |
NM_181533 |
chr14 |
+ |
51,338,878-51,371,688 |
○ |
lincRNA:chr18:54721302-54731677 reverse strand |
|
chr18 |
- |
54,721,302-54,731,677 |
○ |
ZNF208 |
NM_007153 |
chr19 |
- |
22,148,897-22,193,745 |
|
ZNF257 |
NM_033468 |
chr19 |
+ |
22,235,266-22,273,905 |
|
ZNF676 |
NM_001001411 |
chr19 |
- |
22,361,903-22,379,753 |
|
ZNF541 |
NM_001101419 |
chr19 |
- |
48,023,947-48,059,113 |
○ |
TBX1 |
NM_080647 |
chr22 |
+ |
19,744,226-19,771,116 |
○ |
CXorf61 |
NM_001017978 |
chrX |
- |
115,592,852-115,594,137 |
○ |
DB090170 TEST[4 Homo sapiens cDNA clone TEST[4038997 5', mRNA sequence [DB090170] |
DB090170 |
chrX |
- |
|
○ |
Example 2
(1) Cell
[0050] The above four iPS cell lines exhibiting differentiation resistance (CB-RV4F-2, DP-EP6F-1,
FB-RV3F-4, and FB-RV4F-5) were seeded and then the thus obtained colonies were picked
up, so that 15 subclones were obtained from CB-RV4F-2, 15 subclones were obtained
from DP-EP6F-1, 10 subclones were obtained from FB-RV3F-4, and 11 subclones were obtained
from FB-RV4F-5.
(2) Confirmation of differentiation resistance
[0051] To confirm the differentiation resistance of ES cells and iPS cells, differentiation
induction to neural cells was performed using the above modified SFEBq method, and
then the contents of TRA-1-60 positive cells were examined using a flow cytometer.
As a result, 12 out of 15 CB-RV4F-2 subclones contained TRA-1-60 positive cells at
1% or more after induction of cell differentiation to neural cells (Table 6). Similarly,
12 out of 15 DP-EP6F-1 subclones (Table 7), 8 out of 10 FB-RV3F-4 subclones (Table
8), and 3 out of 11 FB-RV4F-5 subclones (Table 9) contained TRA-1-60 positive cells
at 1% or more. These 35 subclones found to contain TRA-1-60 positive cells at 1% or
more were screened for as iPS cell lines exhibiting differentiation resistance.
[Table 6]
TRA-1-60 positive cell content in CB-RV4F-2 subclone |
subclone name |
TRA-1-60 positive cells (%) |
1st try |
2nd try |
3rd try |
Average |
CB-RV4F-2 sub1 |
0.1 |
0.1 |
0.1 |
0.1 |
CB-RV4F-2 sub2 |
24.6 |
10.1 |
11.5 |
15.4 |
CB-RV4F-2 sub3 |
17,2 |
14.7 |
4.2 |
12.03333 |
CB-RV4F-2 sub4 |
8.4 |
20 |
41.8 |
23.4 |
CB-RV4F-2 sub5 |
12 |
13.8 |
11 |
12.26667 |
CB-RV4F-2 sub6 |
20.7 |
15 |
14 |
16.56667 |
CB-RV4F-2 sub7 |
25.1 |
21.8 |
24.1 |
23.66667 |
CB-RV4F-2 sub8 |
10 |
4.6 |
2 |
5.533333 |
CB-RV4F-2 sub9 |
9.6 |
3.5 |
1.9 |
5 |
CB-RV4F-2 sub10 |
17.5 |
11.8 |
15.5 |
14.93333 |
CB-RV4F-2 sub11 |
0.1 |
0.3 |
0.1 |
0.166667 |
CB-RV4F-2 sub12 |
28.8 |
23.8 |
15.7 |
22.76667 |
CB-RV4F-2 sub13 |
23.1 |
21.5 |
12.1 |
18.9 |
CB-RV4F-2 sub14 |
14.2 |
7.3 |
11.8 |
11.1 |
CB-RV4F-2 sub15 |
0 |
0.5 |
0.1 |
0.2 |
CB-RV4F-2 |
27.3 |
26 |
8 |
20.43333 |
H9 |
0.2 |
0.1 |
0.2 |
0.166667 |
khES1 |
0 |
0 |
0.3 |
0.1 |
khES3 |
0.1 |
0 |
0.1 |
0.066667 |
[Table 7]
TRA-1-60 positive cell content in DP-EP6F-1 subclone |
subclone name |
TRA-1-60 positive cells (%) |
DP-EP6F-1 sub1 |
8.8 |
DP-EP6F-1 sub2 |
21 |
DP-EP6F-1 sub3 |
48.3 |
DP-EP6F-1 sub4 |
11.4 |
DP-EP6F-1 sub5 |
0.6 |
DP-EP6F-1 sub6 |
8.1 |
DP-EP6F-1 sub7 |
43.9 |
DP-EP6F-1 sub8 |
9.5 |
DP-EP6F-1 sub9 |
0.2 |
DP-EP6F-1 sub10 |
22 |
DP-EP6F-1 sub11 |
0.1 |
DP-EP6F-1 sub12 |
44.1 |
DP-EP6F-1 sub13 |
41.3 |
DP-EP6F-1 sub14 |
10.9 |
DP-EP6F-1 sub15 |
16.9 |
DP-EP6F-1 |
53.5 |
H9 |
0.1 |
khES3 |
0.1 |
[Table 8]
TRA-1-60 positive cell content in FB-RV3F-4 subclone |
subclone name |
TRA-1-60(%) |
1st try |
2nd try |
3rd try |
Average |
FB-RV3F-4 sub1 |
10.9 |
29.1 |
9.9 |
16.63333 |
FB-RV3F-4 sub2 |
9.4 |
28.3 |
8.5 |
15.4 |
FB-RV3F-4 sub3 |
7.7 |
26 |
6.7 |
13,46667 |
FB-RV3F-4 sub4 |
0 |
0.1 |
0 |
0.033333 |
FB-RV3F-4 sub5 |
0.1 |
0 |
0 |
0.033333 |
FB-RV3F-4 sub6 |
6.7 |
12.9 |
7.5 |
9.033333 |
FB-RV3F-4 sub7 |
14 |
12.5 |
6.6 |
11.03333 |
FB-RV3F-4 sub8 |
12.9 |
25.9 |
24.8 |
21.2 |
FB-RV3F-4 sub9 |
7.5 |
9.5 |
5.2 |
7.4 |
FB-RV3F-4 sub10 |
21.4 |
32 |
21 |
24.8 |
FB-RV3F-4 |
30.8 |
41.4 |
19.9 |
30.7 |
H9- |
0.1 |
0 |
0.1 |
0.066667 |
khES1 |
0.1 |
0.1 |
0 |
0.066667 |
khES3 |
0 |
0.1 |
0 |
0.033333 |
[Table 9]
TRA-1-60 positive cell content in FB-RV4F-5 subclone |
subclone name |
TRA-1-60 positive cells (%) |
1st try |
2nd try |
Average |
FB-RV4F-5 sub1 |
0.1 |
0.8 |
0.45 |
FB-RV4F-5 sub2 |
3.8 |
13.1 |
8.45 |
FB-RV4F-5 sub3 |
0.3 |
0.5 |
0.4 |
FB-RV4F-5 sub4 |
0.1 |
0.1 |
0.1 |
FB-RV4F-5 sub5 |
14.8 |
20.9 |
17.85 |
FB-RV4F-5 sub6 |
38.9 |
19.6 |
29.25 |
FB-RV4F-5 sub7 |
0.1 |
0 |
0.05 |
FB-RV4F-5 sub8 |
0.1 |
0.2 |
0.15 |
FB-RV4F-5 sub9 |
0.4 |
0.1 |
0.25 |
FB-RV4F-5 sub10 |
0.2 |
0.7 |
0.45 |
FB-RV4F-5 sub11 |
0.1 |
0.8 |
0.45 |
FB-RV4F-5 |
2.8 |
7.7 |
5.25 |
H9 |
0.2 |
0.1 |
0.15 |
khES1 |
0.1 |
0.3 |
0.2 |
khES3 |
0.1 |
0.3 |
0.2 |
Identification of differentiation resistance marker
[0052] RNAs were extracted from the 35 subclones exhibiting differentiation resistance and
16 subclones exhibiting no differentiation resistance, which had been screened for
by the above method, and then the expression level of each RNA was examined using
mi-croarrays. As a result, lincRNA and mRNA were expressed at significantly high levels
in subclones exhibiting differentiation resistance, as shown in Table 10.
[Table 10]
Marker name |
Genbank Accession |
Chromosome Number |
Strand Direction |
Region |
P<0.05 |
OC90 |
NM_001080399 |
chr8 |
- |
133,036,467-133,071,627 |
○ |
lincRNA:chr8:133071643-133092468 reverse strand |
|
chr8 |
- |
133,071,643-133,092,468 |
○ |
lincRNA:chr8:133073732-133075753 reverse strand |
|
chr8 |
- |
133,073,732-133,075,753 |
○ |
HHLA1 |
NM_001145095 |
chr8 |
- |
133,073,733-133,117,512 |
○ |
lincRNA:chr8:133076031-133093351 reverse strand |
|
chr8 |
- |
133,076,031-133,093,351 |
○ |
lincRNA:chr8:133090096-133097669 reverse strand |
|
chr8 |
- |
133,090,096-133,097,869 |
○ |
ABHD12B |
NM_181533 |
chr14 |
+ |
51,338,878-51,371,688 |
○ |
Example 3
[0053] RNA expression of C4orf51, HHLA1 and ABHD12B contained in the Table 5 (Example 1)
and Table 10 (Example 2) as the markers for cell lines exhibiting differentiation
resistance was measured in 6 clones exhibiting differentiation resistance and 6 clones
exhibiting no differentiation resistance with quantitative PCR (Fig. 1). It was confirmed
that these marker genes were expressed in the clone exhibiting differentiation resistance
as the same manner of former result. Furthermore, it was known that these genes have
the LTR7 region in their gene bodies (Fig. 2). Consequently, percentage of methylated
cytosines in CpG dinucleotide in LTR7 region or neighborhood thereof was measured
with Pyrosequencing (Fig. 3). Briefly, pyrosequencing was carried out with primers
designed with the Pyromark Assay Design Software 2.0 (Qiagen). The primer sequence
and the CpG dinucleotide in LTR7 region is shown in Tables 11 and 12. PCR was performed
in a 25 microliter reaction mix containing 25ng bisulfite-converted DNA, 1X Pyromark
PCR Master Mix (Qiagen), 1X Coral Load Concentrate (Qiagen), and 0.3 micromolar forward
and 5' biotinylated reverse primers. PCR conditions were 45 cycles of 95 degrees C
for 30 s, 50 degrees C for 30 s, and 72 degrees C for 30 s. PCR product was bound
to streptavidin sepharose beads (Amersham Biosciences), and then was purified, washed,
denatured, and washed again. Then, 0.3 micromol/L pyrosequencing primer was annealed
to the purified PCR product. Pyrosequencing reactions were performed in the PSQ HS
96 Pyrosequencing System. The degree of methylation was expressed as percentage of
methylated cytosines divided by the sum of methylated and unmethylated cytosines (percentage
of 5mC). To validate PCR pyrosequencing assay, each CpG dinucleotide position was
assayed in triplicate and their averages were used in final analysis. As the result,
the methylated status of CpG dinucleotide position in the LTR7 region or neighborhood
thereof located in C4orf51, HHLA1 and ABHD12B gene bodies were significantly high
level.
[Table 11]
Region |
primer |
sequence |
SEQ ID NO |
HHLA1 3'LTR-I (pos.1,2) |
forward primer |
TGTGAAAGTTTTTTTTTTGGTTTATTTTG |
8 |
reverse primer |
CCTCTCCAAAACTCTAATACATATCTT |
9 |
pyrosequencing primer |
ACAATAAAACTATTTATTTCACCT |
10 |
HHLA1 3"LTR-2 (pos.3,4) |
forward primer |
AAAGTTTGTTTGGTGGTTTTTT |
11 |
reverse primer |
AAAAAAATTAATCTCCTCCATATACCTT |
12 |
pyrosequencing primer |
TTGTTTGGTGGTTTTTTTA |
13 |
ABHD12B before 5'LTR (pos. 1,2,3) |
forward primer |
TGTGTATTAATGTATGGTTAATTTTGGTAA |
14 |
reverse primer |
CAAACCATCTAAACAAATACCTACAA |
15 |
pyrosequencing primer |
GTTGTTTTTTATGTAGTGTTT |
16 |
ABHD12B 5'LTR (pos.4) |
forward primer |
TGTGTATTAATGTATGGTTAATTTTGGTAA |
14 |
reverse primer |
CAAACCATCTAAACAAATACCTACAA |
15 |
pyrosequencing primer |
TTAGGTTTTTGAGTTTAAGTTAA |
17 |
ABHD12B 3'LTR (pos.1,2) |
forward primer |
AAGTTTGTTTGGTGGTTTTTTTATATAGA |
18 |
reverse primer |
ACCATTCCACAATCATAATAAAATACTTT |
19 |
pyrosequencing primer |
ACCAATAACAATAAACAAAATTT |
20 |
ABHD12B after 3'LTR-1 (pos.3) |
forward primer |
GTTGTGGAGTTATTTAGATTTGGGTTTA |
21 |
reverse primer |
CTTTTCCTACCATACATAACACTTTAAC |
22 |
pyrosequencing primer |
TTTTTTATTAAGGGGTTGG |
23 |
ABHD12B after 3'LTR-2 (pos.4) |
forward primer |
TTTTTTTTTTGAAGGTGAGGGAAAGTAGTT |
24 |
reverse primer |
AACCTATAAATCTCCATTTCTCTCATCTC |
25 |
pyrosequencing primer |
TGGTAGGAATGGGGT |
26 |
C4orf51 5'LTR (pos.1,2) |
forward primer |
GGATAATTTGAAAATGTTTTTGGTTAAGG |
27 |
reverse primer |
ATAATTCTTCAATTACTTCAAACCATCTA |
28 |
pyrosequencing primer |
GGTTTTTGAGTTTAAGTTAAG |
29 |
C4orf51 3'LTR (pos.1,2,3) |
forward primer |
TTTTTTTTTTGGTTTATTTTGGTTTAAAAG |
30 |
reverse primer |
ACAAACCATATCTCAAATAAAAAATTTCAT |
31 |
pyrosequencing primer |
ATATAAAATTTGTTTGGTGG |
32 |
[0054] From the above result, clone exhibiting differentiation resistance can be sorted
by the recognition of the expression of C4orf51, HHLA1 and ABHD12B. Similarly, clone
exhibiting differentiation resistance can be sorted by the recognition of the DNA-methylated
state in LTR7 region or neighborhood thereof located in C4orf51, HHLA1, and ABHD12B
gene bodies.
[0055] All publications, patents, and patent applications cited herein are incorporated
herein by reference in their entirety.
Industrial Applicability
[0056] The invention of the present application can be used in the fields of producing regenerative
medicine materials.
[0057] Aspects of the invention:
Paragraph 1: A method for screening for a human induced pluripotent stem cell line
exhibiting no differentiation resistance, comprising the steps of:
- (i) measuring expression of at least one large intergenic non-coding RNA (lincRNA)
or mRNA selected from group A and/or group B,
- (ii) selecting a human induced pluripotent stem cell line in which the lincRNA or
mRNA selected from group A expresses or the lincRNA or mRNA selected from group B
does not express;
Group A consisting of
(A1) lincRNA:chr1:852245-854050 reverse strand,
(A2) GPR177,
(A3) VTCN1,
(A4) lincRNA:chr1:142803013-142804254 reverse strand,
(A5) APOA2,
(A6) WNT6,
(A7) EPAS1,
(A8) COL3A1,
(A9) SLC40A1,
(A10) S100P,
(A11) HOPX,
(A12) GUCY1A3,
(A13) CDH10,
(A14) HAPLN1,
(A15) PITX1,
(A16) HAND1,
(A17) CGA,
(A18) AQP1,
(A19) DLX6,
(A20) DLX5,
(A21) SOX17,
(A22) FLJ45983,
(A23) PLCE1,
(A24) H19,
(A25) lincRNA:chr11:2016408-2017024 reverse strand,
(A26) lincRNA:chr11:2017517-2017651 forward strand,
(A27) IGF2,
(A28) P2RY6,
(A29) SLN,
(A30) NNMT,
(A31) APOA1,
(A32) ERP27,
(A33) LUM,
(A34) CCDC92,
(A35) CDX2,
(A36) FLJ41170,
(A37) MEG3,
(A38) lincRNA:chr14:101292469-101299626 forward strand,
(A39) lincRNA:chr14:101295637-101302637 forward strand,
(A40) lincRNA:chr14:101296681-101298460 forward strand,
(A41) lincRNA:chr14:101298129-101300147 forward strand,
(A42) lincRNA:chr14:101324825-101327247 forward strand,
(A43) MEG8,
(A44) lincRNA:chrl4:101365673-101366049 forward strand,
(A45) lincRNA:chr14:101396955-101397357 forward strand,
(A46) lincRNA:chr14:101430757-101433381 forward strand,
(A47) lincRNA:chr14:101434059-101436282 forward strand,
(A48) lincRNAchr14:101472355-101473369 forward strand,
(A49) DIO3,
(A50) MEIS2,
(A51) PRTG,
(A52) C17orf51,
(A53) lincRNA:chr17:21434064-21435857 reverse strand,
(A54) lincRNA:chr17:21436180-21464916 reverse strand,
(A55) lincRNA:chr17:21435959-21436405 reverse strand,
(A56) CCR7,
(A57) KRT23,
(A58) GREB1L,
(A59) GATA6,
(A60) TTR,
(A61) UCA1,
(A62) FLRT3,
(A63) lincRNA:chrX:73040495-73047819 reverse strand,
(A64) VGLL1,
(A65) RPS4Y1,
(A66) DDX3Y, and
(A67) RPS4Y2,
Group B consisting of
(B1) DMRTB1,
(B2) lincRNAchr1:73430887-73446112 reverse strand,
(B3) lincRNA:chr1:73444697-73444997 reverse strand,
(B4) C4orf51,
(B5) PCDHA1,
(B6) lincRNA:chr6:95250854-95263604 reverse strand,
(B7) lincRNA:chr6:14280358-14285376 reverse strand,
(B8) lincRNA:chr6:14283301-14285685 reverse strand,
(B9) C7orf57,
(B10) lincRNA:chr7:124873114-124899839 reverse strand,
(B11) lincRNA:chr8:129599518-129624118 reverse strand,
(B12) OC90,
(B13) lincRNA:chr8:133071643-133092468 reverse strand,
(B14) lincRNA:chr8:133073732-133075753 reverse strand,
(B15) HHLA1,
(B16) lincRNA:chr8:133076031-133093351 reverse strand,
(B17) lincRNA:chr8:133090096-133097869 reverse strand,
(B18) lincRNA:chr8:138387843-138421643 reverse strand,
(B19) lincRNA:chr8:138418343-138425831 reverse strand,
(B20) NDUFA4L2,
(B21) lincRNA:chr13:54698462-54707001 reverse strand,
(B22) ABHD12B,
(B23) lincRNA:chr18:54721302-54731677 reverse strand,
(B24) ZNF208,
(B25) ZNF257,
(B26) ZNF676,
(B27) ZNF541,
(B28) TBX1,
(B29) CXorf61, and
(B30) DB090170 TESTI4 Homo sapiens cDNA clone TESTI4038997 5',
mRNA sequence [DB090170].
Paragraph 2: The method according to paragraph 1, wherein the lincRNA or mRNA selected
from group A is selected from the group consisting of
(A20) DLX5,
(A50) MEIS2,
(A53) lincRNA:chr17:21434064-21435857 reverse strand, and
(A58) GREB1L.
Paragraph 3: The method according to paragraph 1, wherein the lincRNA or mRNA selected
from Group B is selected from the group consisting of
(B4) C4orf51,
(B9) C7orf57,
(B10) lincRNA:chr7:124873114-124899839 reverse strand,
(B12) OC90,
(B13) lincRNA:chr8:133071643-133092468 reverse strand,
(B14) lincRNA:chr8:133073732-133075753 reverse strand,
(B15) HHLA1,
(B16) lincRNA:chr8:133076031-133093351 reverse strand,
(B17) lincRNA:chr8:133090096-133097869 reverse strand,
(B22) ABHD12B,
(B23) lincRNA:chr18:54721302-54731677 reverse strand,
(B27) ZNF541,
(B28) TBX1,
(B29) CXorf61, and
(B30) DB090170 TESTI4 Homo sapiens cDNA clone TESTI4038997 5',
mRNA sequence [DB090170],
Paragraph 4: The method according to paragraph 1, wherein the lincRNA or mRNA selected
from Group B is selected from the group consisting of;
(B4) C4orf51,
(B15) HHLA1, and
(B22) ABHD12B.
Paragraph 5: A method for screening for a human induced pluripotent stem cell line
exhibiting no differentiation resistance, comprising the following steps;
- (i) measuring DNA-methylated state of LTR region or neighborhood thereof located in
at least one gene selected from group of (B4) C4orf51, (B15) HHLA1, and (B22) ABHD12B,
and
- (ii) selecting a human induced pluripotent stem cell line in which the LTR7 region
is in a DNA-methylated state.
Paragraph 6: A reagent for screening for a human induced pluripotent stem cell line
exhibiting no differentiation resistance, containing a polynucleotide having at least
15 continuous nucleotides in the nucleotide sequence of at least one mRNA or LincRNA
shown in the above group A or B, or a polynucleotide complementary thereto.
Paragraph 7: The reagent according to paragraph 6, which is a microarray prepared
by immobilizing, as a probe, a polynucleotide complementary to a polynucleotide having
at least 15 continuous nucleotides in the nucleotide sequence of at least one mRNA
or LincRNA shown in the above group A or B.
Paragraph 8: A reagent for screening for a human induced pluripotent stem cell line
exhibiting no differentiation resistance, containing an antibody that recognizes a
protein encoded by at least one mRNA shown in the above group A or B.
Paragraph 9: A kit for screening for a human induced pluripotent stem cell line exhibiting
no differentiation resistance, containing the reagent according to any one of paragraphs
6 to 8.
