Field of Invention
[0001] The present invention relates to methods of diagnosing traumatic brain injury (TBI)
in a subject.
Background of the Invention
[0002] Traumatic brain injury (TBI) is a problem with epidemic magnitude involving both
civilian, military service members and professional athletes. In the United States,
more than 1.3 million emergency room visits account for TBI and is a cause of almost
a third of all injury related deaths. The economic burden of TBI in the United States
is estimated to be $76.5 billion annually, in total lifetime direct medical costs
and productivity losses.
[0003] Mild TBI (mTBI), also called concussion, accounts for more than 77 % of the total
reported TBI cases in the United States. Among these cases it is estimated that around
40% of injuries are often ignored and do not seek medical attention. mTBI is also
a major cause of morbidity in the veterans returning from the recent wars with more
than 20% of the veterans returning from the recent wars in Iraq and Afghanistan experienced
a mTBI. Most of the symptoms associated with mTBI resolve within days or weeks of
injury with substantial recovery in most cases. However, approximately, 10-20% of
mTBI patients complain of prolonged problems and some experience symptoms lasting
more than a year. mTBI can induce neurological, cognitive and behavioral changes in
an individual. The clinical symptoms may include headaches, sleep disturbance, impaired
memory, anxiety and depression. The accelerating and decelerating forces during the
impact to the head also results in the injury to the white matter causing diffuse
axonal injury. Axonal injury may peak at 24 h post injury and can progress up to a
year post injury. It is believed that this continuous progression may be a causative
factor for the poor outcome post mTBI.
[0004] mTBI usually is a challenge for the clinicians to diagnose because of the lack of
apparent signs of a brain injury. mTBI is currently assessed using the Glasgow comma
scale (GCS) which measure a score by assessing the eye, verbal, and motor response
of the patient. GCS score and loss or alterations of consciousness are used to determine
the severity of the injury. The GCS score can be of limited use in mTBI diagnosis
due to the presence of polytrauma, alcohol abuse, use of sedatives and psychological
stress. Computed tomography (CT) and magnetic resonance imaging (MRI) are used to
detect the extent of brain injury, however, in case of a concussion, CT and MRIs often
fail to detect any specific injury lesion due to limited sensitivity and absence of
micro-bleeds. With new technological advancements, MRIs have become more sensitive
than CT but due to their limited availability and the cost of the scan makes the utilization
of this technique difficult for the acute stage diagnosis for both military and civilians.
[0005] Biomarkers in biofluids offer many advantages for mTBI diagnosis since they can be
measured from the peripheral tissues such as blood, urine and saliva and can be easily
quantitated using existing methods. Several protein markers in serum and cerebrospinal
fluid (CSF) like S-100 calcium binding protein (S-100β), glial fibrillary acidic protein
(GFAP) and Ubiquitin C-Terminal Hydrolase-L1 (UCH-L1) have been extensively studied
for their utility as biomarkers for mild to severe TBI (sTBI). However, most of the
protein biomarkers studied have relatively less sensitivity for mTBI with no intracranial
lesions. Combinations of more than one protein biomarkers for mTBI diagnosis have
been recently studied, and these show better diagnostic accuracy in comparison to
single markers. Despite extensive studies most of the protein markers are in preclinical
testing and none of the markers are available for clinical use.
[0006] MicroRNAs (miRNA) are small (19-28nt) endogenous RNA molecules that regulate protein
synthesis at post transcriptional level. MiRNAs can be detected in serum and can be
an indicator of disease pathology in the cell of origin including neuronal cells.
This property of reflecting a diseased condition has recently gained attention towards
miRNAs as biomarkers of central nervous system (CNS) pathology. Serum miRNAs are relatively
stable and are resistant to repeated freeze thaw, enzymatic degradation and can survive
variable pH conditions which make them a suitable biomarker candidate for mTBI.
[0007] MiRNAs have been recently reported as specific and sensitive biomarkers of many CNS
diseases. The serum expression of miRNAs in response to a concussive mild injury in
a closed head injury model was recently reported, and a signature of nine miRNAs was
found to be modulated in serum immediately after the injury. MiRNA modulation was
also analyzed in a rodent model of traumatic stress, and a signature of 9 miRNAs was
identified which were upregulated in serum and amygdala of the animals 2 weeks post
exposure to traumatic stress. Interestingly, miRNAs reported in this study did not
have any similarities with the miRNAs reported for TBI studies, suggesting miRNA expression
in serum may be a specific indicator of the altered physical state of the brain.
US 2013/0022982 and
Redell et al. (J Neurotrauma 2010, 27:2147-2156) disclose that human traumatic brain injury alters plasma microRNA levels. There
remains a need for a non-invasive, sensitive reliable test for diagnosis and monitoring
TBI.
Summary of the Invention
[0008] The present invention is defined by the appended claims and relates to a method of
diagnosing severe traumatic brain injury (TBI) in a human subject with a head injury,
the method comprising: a) determining level(s) of one or more micro RNAs (miRNAs)
in a serum biological sample taken from the subject; and b) comparing the determined
level(s) of the one or more miRNAs against level(s) of the same one or more miRNAs
from a control subject determined not to be suffering from TBI or from the same subject
at an earlier timepoint; wherein the one or more miRNAs comprise hsa-miR-151-5p; and
wherein a fold change of a level of hsa-mir-151-5p above 5 compared to the control
level determined in step b) is indicative that the subject is suffering from severe
TBI. Further disclosed herein are methods of diagnosing traumatic brain injury (TBI)
in a subject, the method comprising (a) determining a level(s) of one or more specific
microRNAs (miRNAs) in a biological sample taken from the subject, and (b) comparing
the determined level(s) of the one or more miRNAs against a level(s) of the same one
or more miRNAs from a control subject determined not to be suffering from TBI, wherein
an increase in the level(s) of the one or more miRNAs compared to level(s) of the
one or more miRNAs from the control subject determined not to be suffering from TBI
is indicative that the subject may be suffering from TBI.
[0009] Further disclosed herein are methods of monitoring the progression of traumatic brain
injury (TBI) in a subject, the method comprising (a) analyzing at least two biological
samples from the subject taken at different time points to determine a level(s) of
one or more specific miRNAs, and (b) comparing the level(s) of the one or more specific
miRNAs over time to determine if the subject's level(s) of the one or more specific
miRNAs is changing over time, wherein an increase in the level(s) of the one or more
specific miRNAs over time is indicative that the subject's risk of suffering from
TBI is increasing over time.
[0010] Further disclosed herein are methods of detecting a miRNA or plurality of microRNA's
in a biological sample, comprising: obtaining a first biological sample from a subject
presenting with clinical symptoms of a TBI; contacting said first biological sample
with a probe for binding at least one miRNA; and detecting with Northern blot or a
real-time PCR the presence or absence of the microRNA-cDNA complex, wherein the absence
of the complex is indicative of the absence of the microRNA in the first biological
sample.
[0011] In one aspect, said miRNA is selected from the group consisting of hsa-miR-328, hsa-miR-362-3p,
hsa-miR-486, hsa-miR-151-5p, hsa-miR-942, hsa-miR-194, hsa-miR-361, hsa-miR-625*,
hsa-miR-1255B, hsa-miR-381, hsa-miR-425*, hsa-miR-638, hsa-miR-93, hsa-miR-1291, hsa-miR-19a,
hsa-miR-601, hsa-miR-660, hsa-miR-9*, hsa-miR-130b, hsa-miR-339-3p, hsa-miR-34a, hsa-miR-455,
hsa-miR-579, hsa-miR-624, mmu-miR-491, hsa-miR-195, hsa-miR-30d, hsa-miR-20a, hsa-miR-505*,
mmu-miR-451, hsa-miR-199a-3p, hsa-miR-27a, hsa-miR-27b, hsa-miR-296, hsa-miR-92a and
hsa-miR-29c. In some embodiments, said miRNAs exclude one, two, three, four, five,
six, seven, eight or more, or all of hsa-miR-425*, hsa-miR-942, hsa-miR-361, hsa-miR-93,
hsa-miR-34a, hsa-miR-455, hsa-miR-624, mmu-miR-491, and hsa-miR-27a.
[0012] In another aspect, the TBI is mild TBI (mTBI) or severe TBI (sTBI). In another aspect,
the TBI is a closed head injury (CHI) or a blast-induced traumatic brain injury (bTBI).
In another aspect, the subject is human. In another aspect, the biological sample
is a serum and/or plasma sample. In another aspect, the biological sample is taken
from the subject less than one day, or less than 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, or 14 days after the suspected traumatic episode.
[0013] In another aspect, the level(s) of one or more specific miRNAs are determined by
a real time PCR. The methods of diagnosing the TBI according to some embodiments of
the present specification further comprise amplifying the miRNAs.
Brief Description of the Drawings
[0014]
Figure 1 shows the hierarchical clustering of the miRNA profile for most miRNAs of
all the samples using their delta Ct values to understand pattern of expression in
different experimental groups. Control groups and the TBI groups and showed distinct
changes. Orthopedic injury groups were distinct from control but most of these samples
were clustered separately from the TBI groups.
Figure 2 shows two exemplary Venn diagrams showing significant expression of miRNAs
in mTBI, sTBI and orthopedic injury control groups over control samples in some embodiments.
MiRNA expression was normalized using global normalization algorithm. Each of the
injury group was normalized with the control samples to identify significantly modulated
miRNAs in injury groups.
Figure 3 shows the ingenuity pathway analysis program that identifies direct targets
for TBI miRNA candidates; hsa-miR-328, hsa-miR-362-3p, and hsa-miR-486 show upregulated
expression.
Figure 4 depicts another ingenuity pathway analysis program that identified direct
targets for TBI miRNA candidates.
Figure 5 shows MiRNA specific validation assays in serum samples of mTBI and sTBI.
Values are expressed as fold change ± SD over control in linear scale. Significance
was calculated using paired student t test (p<0.05).
Figure 6 depicts miRNA specific validation assays in CSF samples of sTBI. Specific
miRNA assays were performed for the five candidate miRNAs. Normalization was done
with miR-202 which showed the least standard deviation and was selected as a normalizing
control. Among the five tested, miRNAs, miR-328, miR-362-3p and miR-486 were significantly
upregulated. Values are expressed as fold change ± SD over control in linear scale.
Significance was calculated using paired student t test (p<0.05).
Figure 7 depicts additional miRNA specific validation assays in CSF samples of sTBI.
Figure 8 depicts levels of MicroRNA Biomarkers in those with head Ct lesions versus
no head Ct lesions showing comparison of levels of miRNA in two groups of human subjects.
Group 1 is comprised of subjects (TBI and controls) without any lesions on head CT
(n = 19). Group 2 is TBI subjects with lesions on head CT (n = 12). The assumption
was made that all controls (normal and trauma) had negative CT scans. There were significant
differences between the two groups for all but two of the selected miRNA (see asterisks):
miR-195 (p < 0.001); miR-30d (p < 0.001); miR-451 (p < 0.011); miR-328 (p = 0.101);
miR-92a (p < 0.001); miR-486 (p = 0.006); miR-505 (p = 0.008); and miR-362 (p = 0.035);
miR-151 (p = 0.065); and miR-20a (p = 0.012).
Figure 9 depicts that the diagnostic accuracy was assessed using the ROC Curve to
determine the area under the curve for distinguishing TBI from controls. The AUC's
were: miR-195 (0.81), miR-30d (0.75), miR-451 (0.82), miR-328 (0.73), miR-92a (0.86),
miR-486 (0.81), miR-505 (0.82), miR-362 (0.79), miR-151 (0.66), miR-20a (0.78).
Detailed Description of the Invention
[0015] The present disclosure relates to microRNA (miRNA) biomarkers from subjects with
mild and severe traumatic brain injury (TBI), and their use thereof. MiRNAs are small
RNA molecules (e.g. 22 nucleotides long) and are often, but need not be, post-transcriptional
regulators that bind to complementary sequences on target messenger RNA transcripts
(mRNAs), usually resulting in translational repression and gene silencing. MiRNAs
may serve as good biomarkers because they are highly stable in serum due to their
ability to withstand repeated freeze thaw, enzymatic degradation, and extreme pH conditions.
As used herein, the term "microRNA" (miRNA) includes human miRNAs, mature single stranded
miRNAs, precursor miRNAs (pre-miR), and variants thereof, which may be naturally occurring.
In some instances, the term "miRNA" also includes primary miRNA transcripts and duplex
miRNAs. Unless otherwise noted, when used herein, the name of a specific miRNA refers
to the mature miRNA. For example, miR-194 refers to a mature miRNA sequence derived
from pre-miR-194. The sequences for particular miRNAs, including human mature and
precursor sequences, are reported, for example, in miRBase: Sequences Database on
the web at: mirbase.org (version 20 released June 2013);
Griffiths-Jones et al., Nucleic Acids Research, 2008, 36, Database Issue, D154-D158;
Griffiths-Jones et al., Nucleic Acids Research, 2006, 34, Database Issue, D140-D144;
Griffiths-Jones, Nucleic Acids Research, 2004, 32, Database Issue, D109-D111. For certain miRNAs, a single precursor contains more than one mature miRNA sequence.
In other instances, multiple precursor miRNAs contain the same mature sequence. In
some instances, mature miRNAs have been re-named based on new scientific consensus.
The skilled artisan will appreciate that scientific consensus regarding the precise
nucleic acid sequence for a given miRNAs, in particular for mature forms of the miRNAs,
may change with time.
[0016] Disclosed herein are methods of diagnosing traumatic brain injury (TBI) in a subject.
In some embodiments, the methods comprise (a) determining a level(s) of one or more
miRNAs in a biological sample taken from the subject, and (b) comparing the determined
level(s) of the one or more miRNAs against a level(s) of the same one or more miRNAs
from a control subject determined not to be suffering from TBI. An increase in the
level(s) of the one or more miRNAs compared to level(s) of the one or more miRNAs
from the control subject determined not to be suffering from TBI may be indicative
that the subject may be suffering from TBI.
[0017] Further disclosed herein are methods of monitoring the progression of traumatic brain
injury (TBI) in a subject. In some embodiments, the method comprises (a) analyzing
at least two biological samples from the subject taken at different time points to
determine a level(s) of one or more specific miRNAs, and (b) comparing the level(s)
of the one or more specific miRNAs over time to determine if the subject's level(s)
of the one or more specific miRNAs is changing over time. An increase in the level(s)
of the one or more specific miRNAs over time may be indicative that the subject's
risk of suffering from TBI is increasing over time. In some embodiments, the level(s)
of the one or more specific miRNAs may be normalized by the level(s) of one or more
miRNA found to be consistent under various conditions. In some embodiments, the "one
or more" miRNAs refer to one, two, three, four, five, six, seven, eight, nine, ten
or more of miRNAs.
[0018] The term "diagnosing" includes making diagnostic or prognostic determinations or
predictions of disease. In some instances, "diagnosing" includes identifying whether
a subject has a disease such as TBI. Additionally, "diagnosing" includes distinguishing
patients with mTBI from patients having sTBI. In other circumstances, "diagnosing"
includes determining the stage or aggressiveness of a disease state, or determining
an appropriate treatment method for TBI.
[0019] In some aspects, the methods of the present disclosure use miRNAs as markers for
TBI. In some embodiments, miRNAs that are present at elevated levels in a biological
sample (e.g. serum or plasma) from a subject with TBI are used as markers. In other
embodiments, miRNAs that have reduced levels are used as markers. In some embodiments,
more than one miRNA from the biological sample may be used as markers. When more than
one miRNA biomarker is used, the miRNAs may all have elevated levels, all have reduced
levels, or a mixture of miRNAs with elevated and reduced levels may be used.
[0020] The term "an increase in the level(s) of the one or more miRNAs" refers to an increase
in the amount of a miRNA in a biological sample from a subject compared to the amount
of the miRNA in the biological sample from a cohort or cohorts that do not have the
TBI that the subject is being tested for. For instance, increased levels of miRNA
in the biological sample indicate presence or prognosis for the TBI. In additional
embodiments, certain miRNAs may be present in reduced levels in subjects with TBI.
In some embodiments, the level of the miRNAs marker will be compared to a control
to determine whether the level is decreased or increased. The control may be, for
example, miRNAs in a biological sample from a subject known to be free of TBI. In
other embodiments, the control may be miRNAs from a non-serum sample like a tissue
sample or a known amount of a synthetic RNA. In additional embodiments, the control
may be miRNAs in a biological sample from the same subject at a different time.
[0021] In one aspect, said miRNA is selected from the group consisting of hsa-miR-328, hsa-miR-362-3p,
hsa-miR-486, hsa-miR-151-5p, hsa-miR-942, hsa-miR-194, hsa-miR-361, hsa-miR-625*,
hsa-miR-1255B, hsa-miR-381, hsa-miR-425*, hsa-miR-638, hsa-miR-93, hsa-miR-1291, hsa-miR-19a,
hsa-miR-601, hsa-miR-660, hsa-miR-9*, hsa-miR-130b, hsa-miR-339-3p, hsa-miR-34a, hsa-miR-455,
hsa-miR-579, hsa-miR-624, mmu-miR-491, hsa-miR-195, hsa-miR-30d, hsa-miR-20a, hsa-miR-505*,
mmu-miR-451, hsa-miR-199a-3p, hsa-miR-27a, hsa-miR-27b, hsa-miR-296, hsa-miR-92a and
hsa-miR-29c. These miRNAs have elevated levels in serum from patients with TBI. Exemplary
miRNAs are reported in
Bhomia et al., Scientific Reports, 2016, 6, Article number: 28148. These miRNAs may be useful for diagnosing TBI, including distinguishing mild and
sTBI. In some embodiments, said miRNAs exclude one, two, three, four, five, six, seven,
eight or more, or all of hsa-miR-425*, hsa-miR-942, hsa-miR-361, hsa-miR-93, hsa-miR-34a,
hsa-miR-455, hsa-miR-624, mmu-miR-491, and hsa-miR-27a.
[0022] In addition, these miRNA may be used to predict the aggressiveness or outcome of
TBI. In another aspect, said one or more miRNAs is selected from the group consisting
of hsa-miR-328, hsa-miR-151-5p, hsa-miR-362-3p, hsa-miR-486, hsa-miR-942, hsa-miR-194,
hsa-miR-361, hsa-miR-625*, hsa-miR-1255B, hsa-miR-381, hsa-miR-425*, has-miR-638,
hsa-miR-93, hsa-miR-195, hsa-miR-30d, hsa-miR-20a, hsa-miR-505*, mmu-miR-451, hsa-miR-199-3p,
hsa-miR-27a, hsa-miR-92a and hsa-miR-27b. These miRNAs may be used to diagnose mTBI.
In another aspect, said one or more miRNAs is selected from the group consisting of
hsa-miR-328, hsa-miR-151-5p, hsa-miR-362-3p, hsa-miR-486, hsa-miR-942, hsa-miR-1291,
hsa-miR-19a, hsa-miR-601, hsa-miR-660, hsa-miR-9*, miR-130b, hsa-miR-339-3p, hsa-miR-34a,
hsa-miR-455, hsa-miR-579, hsa-miR-624, mmu-miR-491, hsa-miR-195, hsa-miR-30d, hsa-miR-20a,
hsa-miR-505*, mmu-miR-451, hsa-miR-27a, hsa-miR-296, hsa-miR-92a and hsa-miR-29c.
These miRNAs may be used to diagnose sTBI. In another aspect, said one or more miRNAs
is selected from the group consisting of hsa-miR-328, hsa-miR-362-3p, hsa-miR-486,
hsa-miR-151-5p, hsa-miR-942, hsa-miR-195, hsa-miR-30d, hsa-miR-20a, hsa-miR-505*,
mmu-miR-451, hsa-miR-92a and hsa-miR-27a. These miRNAs may be used to diagnose either
mTBI or sTBI. In some embodiments, said miRNAs exclude one, two, three, four, five,
six, seven, eight or more, or all of hsa-miR-425*, hsa-miR-942, hsa-miR-361, hsa-miR-93,
hsa-miR-34a, hsa-miR-455, hsa-miR-624, mmu-miR-491, and hsa-miR-27a.
[0023] In some embodiments, said one or more miRNAs is selected from the group consisting
of hsa-miR-328, hsa-miR-151-5p, hsa-miR-362-3p, hsa-miR-486, hsa-miR-194, hsa-miR-625*,
hsa-miR-1255B, hsa-miR-381, has-miR-638, hsa-miR-195, hsa-miR-30d, hsa-miR-20a, hsa-miR-505*,
mmu-miR-451, hsa-miR-199-3p, hsa-miR-27a, hsa-miR-92a and hsa-miR-27b. These miRNAs
may be used to diagnose mTBI. In another aspect, said one or more miRNAs is selected
from the group consisting of hsa-miR-328, hsa-miR-151-5p, hsa-miR-362-3p, hsa-miR-486,
hsa-miR-1291, hsa-miR-19a, hsa-miR-601, hsa-miR-660, hsa-miR-9*, miR-130b, hsa-miR-339-3p,
hsa-miR-579, hsa-miR-195, hsa-miR-30d, hsa-miR-20a, hsa-miR-505*, mmu-miR-451, hsa-miR-296,
hsa-miR-92a and hsa-miR-29c. These miRNAs may be used to diagnose sTBI. In another
aspect, said one or more miRNAs is selected from the group consisting of hsa-miR-328,
hsa-miR-362-3p, hsa-miR-486, hsa-miR-151-5p, hsa-miR-195, hsa-miR-30d, hsa-miR-20a,
hsa-miR-505*, mmu-miR-451, and hsa-miR-92a. These miRNAs may be used to diagnose TBI,
or either mTBI or sTBI.
[0024] In another aspect, the miRNAs comprise at least one, two or three miRNAs of miR-328,
miR-362-3p and miR-486. For example, the methods may comprise assessing only miR-328,
miR-362-3p and miR-486. In another embodiment, the methods comprise at least hsa-miR-328,
hsa-miR-362-3p and hsa-miR-486, plus one or more of miR-151-5p, hsa-miR-942, hsa-miR-194,
hsa-miR-361, hsa-miR-625*, hsa-miR-1255B, hsa-miR-381, hsa-miR-425*, hsa-miR-638,
hsa-miR-93, hsa-hsa-miR-1291, hsa-miR-19a, hsa-miR-601, hsa-miR-660, hsa-miR-9*, hsa-miR-130b,
hsa-miR-339-3p, hsa-miR-34a, hsa-miR-455, hsa-miR-579, hsa-miR-624, mmu-miR-491, hsa-miR-195,
hsa-miR-30d, hsa-miR-20a, hsa-miR-505*, mmu-miR-451, hsa-miR-199a-3p, hsa-miR-27a,
hsa-miR-27b, hsa-miR-296, hsa-miR-92a and hsa-miR-29c. In some embodiments, said miRNAs
exclude one, two, three, four, five, six, seven, eight or more, or all of hsa-miR-425*,
hsa-miR-942, hsa-miR-361, hsa-miR-93, hsa-miR-34a, hsa-miR-455, hsa-miR-624, mmu-miR-491,
and hsa-miR-27a.
[0025] In another aspect, TBI may be classified as mTBI or sTBI. In some embodiments, the
TBI is a closed head injury (CHI) or a blast-induced traumatic brain injury (bTBI).
[0026] In one aspect, injury severity may be based on duration of loss of consciousness
and/or coma rating scale or score, post-traumatic amnesia (PTA), and/or brain imaging
results. In some cases, mTBI may be characterized by brief loss of consciousness (e.g.
a few seconds or minutes), PTA for less than 1 hour of the TBI, and normal brain imaging
results. In additional embodiments, a case of mild traumatic brain injury may be an
occurrence of injury to the head resulting from blunt trauma or acceleration or deceleration
forces with one or more of the following conditions attributable to the head injury
during the surveillance period: (i) any period of observed or self-reported transient
confusion, disorientation, or impaired consciousness; (ii) any period of observed
or self-reported dysfunction of memory (amnesia) around the time of injury; (iii)
Observed signs of other neurological or neuropsychological dysfunction, such as seizures
acutely following head injury, irritability, lethargy, or vomiting following head
injury among infants and very young children, and among older children and adults,
headache, dizziness, irritability, fatigue, or poor concentration, when identified
soon after injury; and/or (iv) any period of observed or self-reported loss of consciousness
lasting 30 minutes or less. In other cases, sTBI may be characterized by loss of consciousness
or coma for more than 24 hours, PTA for more than 24 hours of the TBI, and/or abnormal
brain imaging results.
[0027] In another aspect, the subject is human or animal. In another aspect, the biological
samples described herein include, but is not limited to, homogenized tissues such
as but not limited to brain tissue, spinal cord tissue, and tissue from specific regions
of the central nervous system, blood, plasma, serum, urine, sputum, cerebrospinal
fluid, milk, and ductal fluid samples. In some embodiments, the biological sample
is a serum and/or plasma sample. Serum is typically the fluid, non-cellular portion
of coagulated blood. Plasma is also a non-cellular blood sample, but unlike serum,
plasma contains clotting factors. In some embodiments, serum or plasma samples may
be obtained from a human subject previously screened for TBI using other diagnostic
methods. Additional embodiments include measuring miRNA in samples from subjects previously
or currently undergoing treatment for TBI. The volume of plasma or serum obtained
and used in the methods described herein may be varied depending upon clinical intent.
[0028] One of skill in the art may recognize that many methods exist for obtaining and preparing
serum samples. Generally, blood is drawn into a collection tube using standard methods
and allowed to clot. The serum is then separated from the cellular portion of the
coagulated blood. In some embodiments clotting activators such as silica particles
are added to the blood collection tube. In other methods, the blood is not treated
to facilitate clotting. Blood collection tubes are commercially available from many
sources and in a variety of formats (e.g., Becton Dickenson Vacutainer® tubes-SST™,
glass serum tubes, or plastic serum tubes).
[0029] In some embodiments, the blood is collected by venipuncture and processed within
three hours after drawing to minimize hemolysis and minimize the release of miRNAs
from intact cells in the blood. In some methods, blood is kept on ice until use. The
blood may be fractionated by centrifugation to remove cellular components. In some
embodiments, centrifugation to prepare serum can be at a speed of at least 500, 1000,
2000, 3000, 4000, or 5000×G. In certain embodiments, the blood can be incubated for
at least 10, 20, 30, 40, 50, 60, 90, 120, or 150 minutes to allow clotting. In other
embodiments, the blood is incubated for at most 3 hours. When using plasma, the blood
is not permitted to coagulate prior to separation of the cellular and acellular components.
Serum or plasma may be frozen after separation from the cellular portion of blood
until further assayed.
[0030] Before performing the methods according to the present disclosure RNA may be extracted
from biological samples such as but not limited to serum or plasma and purified using
methods known in the art. Many methods are known for isolating total RNA, or to specifically
extract small RNAs, including miRNAs. The RNA may be extracted using commercially-available
kits (e.g., Perfect RNA Total RNA Isolation Kit, Five Prime-Three Prime, Inc.; mirVana™
kits, Ambion, Inc.). Alternatively, RNA extraction methods previously published for
the extraction of mammalian intracellular RNA or viral RNA may be adapted, either
as published or with modification, for extraction of RNA from plasma and serum. RNA
may be extracted from plasma or serum using silica particles, glass beads, or diatoms,
as in the method or adaptations described in
U.S. Publication No. 2008/0057502.
[0031] In another aspect, the biological sample may be collected from a subject more than
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days after a suspected traumatic
episode. In another aspect, the biological sample may be collected from a subject
less than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 days after a suspected
traumatic episode.
[0032] In another aspect, the level(s) of one or more specific miRNAs are determined by
a real time PCR. In some embodiments, the methods of the present inventions comprise
amplifying the miRNAs.
[0033] Many methods of measuring the levels or amounts of miRNAs are contemplated. Any reliable,
sensitive, and specific method may be used. In some embodiments, the miRNAs are amplified
prior to measurement. In other embodiments, the level of miRNAs is measured during
the amplification process. In still other methods, the miRNAs is not amplified prior
to measurement.
[0034] Many methods exist for amplifying miRNA nucleic acid sequences such as mature miRNAs,
primary miRNAs and precursor miRNAs. Suitable nucleic acid polymerization and amplification
techniques include reverse transcription (RT), polymerase chain reaction (PCR), real-time
PCR (quantitative PCR (q-PCR)), nucleic acid sequence-base amplification (NASBA),
ligase chain reaction, multiplex ligatable probe amplification, invader technology
(Third Wave), rolling circle amplification, in vitro transcription (IVT), strand displacement
amplification, transcription-mediated amplification (TMA), RNA (Eberwine) amplification,
and other methods that are known to persons skilled in the art. In certain embodiments,
more than one amplification method is used, such as reverse transcription followed
by real time quantitative PCR (qRT-PCR) (
Chen et al., Nucleic Acids Research, 33(20):e179 (2005)).
[0035] A typical PCR reaction includes multiple amplification steps, or cycles that selectively
amplify target nucleic acid species: a denaturing step in which a target nucleic acid
is denatured; an annealing step in which a set of PCR primers (forward and reverse
primers) anneal to complementary DNA strands; and an elongation step in which a thermostable
DNA polymerase elongates the primers. By repeating these steps multiple times, a DNA
fragment is amplified to produce an amplicon, corresponding to the target DNA sequence.
Typical PCR reactions include 20 or more cycles of denaturation, annealing, and elongation.
In many cases, the annealing and elongation steps can be performed concurrently, in
which case the cycle contains only two steps. Since mature miRNAs are single-stranded,
a reverse transcription reaction (which produces a complementary cDNA sequence) may
be performed prior to PCR reactions. Reverse transcription reactions include the use
of, e.g., a RNA-based DNA polymerase (reverse transcriptase) and a primer.
[0036] In PCR and q-PCR methods, for example, a set of primers is used for each target sequence.
In certain embodiments, the lengths of the primers depends on many factors, including,
but not limited to, the desired hybridization temperature between the primers, the
target nucleic acid sequence, and the complexity of the different target nucleic acid
sequences to be amplified. In certain embodiments, a primer is about 15 to about 35
nucleotides in length. In other embodiments, a primer is equal to or fewer than 15,
20, 25, 30, or 35 nucleotides in length. In additional embodiments, a primer is at
least 35 nucleotides in length.
[0037] In a further aspect, a forward primer can comprise at least one sequence that anneals
to a miRNA biomarker and alternatively can comprise an additional 5' non-complementary
region. In another aspect, a reverse primer can be designed to anneal to the complement
of a reverse transcribed miRNAs. The reverse primer may be independent of the miRNA
biomarker sequence, and multiple miRNA biomarkers may be amplified using the same
reverse primer. Alternatively, a reverse primer may be specific for a miRNA biomarker.
[0038] In some embodiments, two or more miRNAs are amplified in a single reaction volume.
One aspect includes multiplex q-PCR, such as Real Time quantitative PCR (qRT-PCR),
which enables simultaneous amplification and quantification of at least two miRNAs
of interest in one reaction volume by using more than one pair of primers and/or more
than one probe. The primer pairs comprise at least one amplification primer that uniquely
binds each miRNA, and the probes are labeled such that they are distinguishable from
one another, thus allowing simultaneous quantification of multiple miRNAs. Multiplex
qRT-PCR has research and diagnostic uses, including but not limited to detection of
miRNAs for diagnostic, prognostic, and therapeutic applications.
[0039] The qRT-PCR reaction may further be combined with the reverse transcription reaction
by including both a reverse transcriptase and a DNA-based thermostable DNA polymerase.
When two polymerases are used, a "hot start" approach may be used to maximize assay
performance (
U.S. Pat. Nos. 5,411,876 and
5,985,619). For example, the components for a reverse transcriptase reaction and a PCR reaction
may be sequestered using one or more thermoactivation methods or chemical alteration
to improve polymerization efficiency (
U.S. Pat. Nos. 5,550,044,
5,413,924, and
6,403,341).
[0040] In certain embodiments, labels, dyes, or labeled probes and/or primers are used to
detect amplified or unamplified miRNAs. The skilled artisan will recognize which detection
methods are appropriate based on the sensitivity of the detection method and the abundance
of the target. Depending on the sensitivity of the detection method and the abundance
of the target, amplification may or may not be required prior to detection. One skilled
in the art will recognize the detection methods where miRNA amplification is preferred.
[0041] A probe or primer may include Watson-Crick bases or modified bases. Modified bases
include, but are not limited to, the AEGIS bases (from Eragen Biosciences), which
have been described, e.g., in
U.S. Pat. Nos. 5,432,272,
5,965,364, and
6,001,983. In certain aspects, bases are joined by a natural phosphodiester bond or a different
chemical linkage. Different chemical linkages include, but are not limited to, a peptide
bond or a Locked Nucleic Acid (LNA) linkage, which is described, e.g., in
U.S. Pat. No. 7,060,809.
[0042] In a further aspect, oligonucleotide probes or primers present in an amplification
reaction are suitable for monitoring the amount of amplification product produced
as a function of time. In certain aspects, probes having different single stranded
versus double stranded character are used to detect the nucleic acid. Probes include,
but are not limited to, the 5'-exonuclease assay (e.g., TaqMan™) probes (see
U.S. Pat. No. 5,538,848), stem-loop molecular beacons (see, e.g.,
U.S. Pat. Nos. 6,103,476 and
5,925,517), stemless or linear beacons (see, e.g.,
WO 9921881,
U.S. Pat. Nos. 6,485,901 and
6,649,349), peptide nucleic acid (PNA) Molecular Beacons (see, e.g.,
U.S. Pat. Nos. 6,355,421 and
6,593,091), linear PNA beacons (see, e.g.
U.S. Pat. No. 6,329,144), non-FRET probes (see, e.g.,
U.S. Pat. No. 6,150,097), Sunrise™/AmplifluorB™probes (see, e.g.,
U.S. Pat. No. 6,548,250), stem-loop and duplex Scorpion™ probes (see, e.g.,
U.S. Pat. No. 6,589,743), bulge loop probes (see, e.g.,
U.S. Pat. No. 6,590,091), pseudo knot probes (see, e.g.,
U.S. Pat. No. 6,548,250), cyclicons (see, e.g.,
U.S. Pat. No. 6,383,752), MGB Eclipse™ probe (Epoch Biosciences), hairpin probes (see, e.g.,
U.S. Pat. No. 6,596,490), PNA light-up probes, antiprimer quench probes (
Li et al., Clin. Chem. 53:624-633 (2006)), self-assembled nanoparticle probes, and ferrocene-modified probes described, for
example, in
U.S. Pat. No. 6,485,901.
[0043] In certain embodiments, one or more of the primers in an amplification reaction can
include a label. In yet further embodiments, different probes or primers comprise
detectable labels that are distinguishable from one another. In some embodiments a
nucleic acid, such as the probe or primer, may be labeled with two or more distinguishable
labels.
[0044] In some aspects, a label is attached to one or more probes and has one or more of
the following properties: (i) provides a detectable signal; (ii) interacts with a
second label to modify the detectable signal provided by the second label, e.g., FRET
(Fluorescent Resonance Energy Transfer); (iii) stabilizes hybridization, e.g., duplex
formation; and (iv) provides a member of a binding complex or affinity set, e.g.,
affinity, antibody-antigen, ionic complexes, hapten-ligand (e.g., biotin-avidin).
In still other aspects, use of labels can be accomplished using any one of a large
number of known techniques employing known labels, linkages, linking groups, reagents,
reaction conditions, and analysis and purification methods.
[0045] MiRNAs can be detected by direct or indirect methods. In a direct detection method,
one or more miRNAs are detected by a detectable label that is linked to a nucleic
acid molecule. In such methods, the miRNAs may be labeled prior to binding to the
probe. Therefore, binding is detected by screening for the labeled miRNAs that is
bound to the probe. The probe is optionally linked to a bead in the reaction volume.
[0046] In certain embodiments, nucleic acids are detected by direct binding with a labeled
probe, and the probe is subsequently detected. In one embodiment of the present invention,
the nucleic acids, such as amplified miRNAs, are detected using FIexMAP Microspheres
(Luminex) conjugated with probes to capture the desired nucleic acids.
[0047] Some methods may involve detection with polynucleotide probes modified with fluorescent
labels or branched DNA (bDNA) detection, for example.
[0048] In other embodiments, nucleic acids are detected by indirect detection methods. For
example, a biotinylated probe may be combined with a streptavidin-conjugated dye to
detect the bound nucleic acid. The streptavidin molecule binds a biotin label on amplified
miRNAs, and the bound miRNA is detected by detecting the dye molecule attached to
the streptavidin molecule. In one embodiment, the streptavidin-conjugated dye molecule
comprises Phycolink® Streptavidin R-Phycoerythrin (PROzyme). Other conjugated dye
molecules are known to persons skilled in the art.
[0049] Labels include, but are not limited to: light-emitting, light-scattering, and light-absorbing
compounds which generate or quench a detectable fluorescent, chemiluminescent, or
bioluminescent signal (see, e.g.,
Kricka, L., Nonisotopic DNA Probe Techniquies, Academic Press, San Diego (1992) and
Garman A., Non-Radioactive Labeling, Academic Press (1997). Fluorescent reporter dyes useful as labels include, but are not limited to, fluoresceins
(see, e.g.,
U.S. Pat. Nos. 5,188,934,
6,008,379, and
6,020,481), rhodamines (see, e.g.,
U.S. Pat. Nos. 5,366,860,
5,847,162,
5,936,087,
6,051,719, and
6,191,278), benzophenoxazines (see, e.g.,
U.S. Pat. No. 6,140,500), energy-transfer fluorescent dyes, comprising pairs of donors and acceptors (see,
e.g.,
U.S. Pat. Nos. 5,863,727;
5,800,996; and
5,945,526), and cyanines (see, e.g.,
WO 9745539), lissamine, phycoerythrin, Cy2, Cy3, Cy3.5, Cy5, Cy5.5, Cy7, FluorX (Amersham),
Alexa 350, Alexa 430, AMCA, BODIPY 630/650, BODIPY 650/665, BODIPY-FL, BODIPY-R6G,
BODIPY-TMR, BODIPY-TRX, Cascade Blue, Cy3, Cy5, 6-FAM, Fluorescein Isothiocyanate,
HEX, 6-JOE, Oregon Green 488, Oregon Green 500, Oregon Green 514, Pacific Blue, REG,
Rhodamine Green, Rhodamine Red, Renographin, ROX, SYPRO, TAMRA, Tetramethylrhodamine,
and/or Texas Red, as well as any other fluorescent moiety capable of generating a
detectable signal. Examples of fluorescein dyes include, but are not limited to, 6-carboxyfluorescein,
2',4',1,4,-tetrachlorofluorescein and 2',4',5',7',1,4-hexachlorofluorescein. In certain
aspects, the fluorescent label is selected from SYBR-Green, 6-carboxyfluorescein ("FAM"),
TET, ROX, VICTM, and JOE. For example, in certain embodiments, labels are different
fluorophores capable of emitting light at different, spectrally-resolvable wavelengths
(e.g., 4-differently colored fluorophores); certain such labeled probes are known
in the art and described above, and in
U.S. Pat. No. 6,140,054. A dual labeled fluorescent probe that includes a reporter fluorophore and a quencher
fluorophore is used in some embodiments. It will be appreciated that pairs of fluorophores
are chosen that have distinct emission spectra so that they can be easily distinguished.
[0050] In still a further aspect, labels are hybridization-stabilizing moieties which serve
to enhance, stabilize, or influence hybridization of duplexes, e.g., intercalators
and intercalating dyes (including, but not limited to, ethidium bromide and SYBR-Green),
minor-groove binders, and cross-linking functional groups (see, e.g.,
Blackburn et al., eds. "DNA and RNA Structure" in Nucleic Acids in Chemistry and Biology
(1996)).
[0051] In further aspects, methods relying on hybridization and/or ligation to quantify
miRNAs may be used, including oligonucleotide ligation (OLA) methods and methods that
allow a distinguishable probe that hybridizes to the target nucleic acid sequence
to be separated from an unbound probe. As an example, HARP-like probes, as disclosed
in
U.S. Publication No. 2006/0078894 may be used to measure the amount of miRNAs. In such methods, after hybridization
between a probe and the targeted nucleic acid, the probe is modified to distinguish
the hybridized probe from the unhybridized probe. Thereafter, the probe may be amplified
and/or detected. In general, a probe inactivation region comprises a subset of nucleotides
within the target hybridization region of the probe. To reduce or prevent amplification
or detection of a HARP probe that is not hybridized to its target nucleic acid, and
thus allow detection of the target nucleic acid, a post-hybridization probe inactivation
step is carried out using an agent which is able to distinguish between a HARP probe
that is hybridized to its targeted nucleic acid sequence and the corresponding unhybridized
HARP probe. The agent is able to inactivate or modify the unhybridized HARP probe
such that it cannot be amplified.
[0052] In an additional embodiment of the method, a probe ligation reaction may be used
to quantify miRNAs. In a Multiplex Ligation-dependent Probe Amplification (MLPA) technique
(
Schouten et al., Nucleic Acids Research 30:e57 (2002)), pairs of probes which hybridize immediately adjacent to each other on the target
nucleic acid are ligated to each other only in the presence of the target nucleic
acid. In some aspects, MLPA probes have flanking PCR primer binding sites. MLPA probes
can only be amplified if they have been ligated, thus allowing for detection and quantification
of miRNA biomarkers.
Examples
[0053] The following examples illustrate various embodiments of the present disclosure and
are not intended to limit the scope of the invention, which is limited by the appended
claims.
Experiment 1
[0054] Global normalization on the miRNA expression data of samples from subjects with mild
TBI (mTBI), severe TBI (sTBI), and orthopedic injury to control samples was performed,
and candidates for each group were identified. Human serum samples were collected
from each of subjects with mTBI (n=8), sTBI (n=8), and orthopedic injury (n=7). The
mTBI samples were collected within 24hr of injury and sTBI samples were collected
within 48hr of injury. Control samples (n=8) were also collected from healthy control
subjects.
[0055] RNA isolation was performed using miRNeasy Serum/Plasma Kit (Qiagen Inc). For RNA
quality control, all total RNA samples were analyzed with the Agilent Small RNA kit
(Agilent Technologies Inc, Santa Clara, CA, USA) to measure the small RNA/ miRNA concentration.
Reverse transcription (RT) was performed with TaqMan miRNA RT Kit (Life Technologies,
Carlsbad, CA, USA) and miRNA quantity was measured from the total RNA of bioanalyzer
data and used as template RNA (3µl out of 16 µl total eluted RNA)) for RT reactions.
Pre-amplification of the cDNA product after RT was done using 12.5 µl TaqMan PreAmp
Master Mix, 2.50 µl Megaplex PreAmp primers human Pool A/B (v3.0), 5 µl of nuclease-free
water and 5µl of RT product to make up a final volume of 25 µl of final reaction mixture.
[0056] Real time PCR was performed for a set of 792 human miRNAs for serum samples of mild
(n=8), severe (n=8), orthopedic injury (n=7) and healthy controls (n=8). PCR was carried
out with the TaqMan Low Density Human MicroRNA array cards (TLDA) and using default
thermal-cycling conditions in AB7900 Real Time HT machine (Applied Biosystem). PCR
amplification of the serum miRNAs detected more than 140 miRNAs in the control serum
samples. For relative quantization of miRNAs in serum samples, a stable endogenous
control is a major limitation. To analyze the real time PCR miRNA data, a global normalization
algorithm was used which calculates a reference endogenous control based on the overall
amplification of the miRNAs in the same plate. This method has been widely accepted
as a way of normalization for multiplexing assays in serum samples.
[0057] The normalized delta Ct values were used to perform hierarchical clustering to understand
pattern of expression between the experimental groups. Hierarchical clustering segregated
the study under four differentially expressing groups which belonged to control, orthopedic
injury and the TBI groups suggesting a clear difference in miRNA expression between
these experimental groups (Figure 1). After the normalization, the fold change for
the serum miRNAs in mTBI, sTBI and orthopedic injury groups was calculated using healthy
control subjects as baseline. MiRNAs with more than 2 fold upregulation and adjusted
p value ≤0.05 were selected for further analysis. From this analysis, it was found
that in serum samples of mTBI and sTBI, 39 and 37 miRNAs were significantly upregulated
respectively whereas 33 miRNAs were found to be modulated in orthopedic injury group
as shown in Tables 1-3.
Table 1: Total MiRNAs altered in serum samples of MTBI after normalizing with healthy
controls. Data was normalized using global normalization and was compared with healthy
controls. Data was adjusted for multiple comparisons using adjusted p value <0.05
calculated using Benjamin Hochberg algorithm.
| MTBI vs Control |
| S# |
Detector |
RQ_ mTBI-Control |
adj.P.Val_ mTBI-Control |
P.Value_ mTBI-Control |
GeneSymbol |
| 1 |
hsa-miR-381-000571 |
2255.75 |
0.01 |
0.01 |
hsa-miR-381 |
| 2 |
hsa-miR-185-002271 |
605.52 |
0.00 |
0.00 |
hsa-miR-185 |
| 3 |
hsa-miR-486-001278 |
523.46 |
0.01 |
0.00 |
hsa-miR-486 |
| 4 |
hsa-miR-532-001518 |
492.81 |
0.00 |
0.00 |
hsa-miR-532 |
| 5 |
hsa-miR-423-5p-002340 |
415.56 |
0.00 |
0.00 |
hsa-miR-423 |
| 6 |
hsa-miR-193a-5p-002281 |
221.14 |
0.00 |
0.00 |
hsa-miR-193a |
| 7 |
hsa-miR-133a-002246 |
75.25 |
0.02 |
0.01 |
hsa-miR-133a |
| 8 |
hsa-miR-638-001582 |
46.48 |
0.05 |
0.03 |
hsa-miR-638 |
| 9 |
hsa-miR-151-5P-002642 |
45.52 |
0.03 |
0.02 |
hsa-miR-151 |
| 10 |
hsa-miR-223#-002098 |
42.61 |
0.01 |
0.01 |
hsa-miR-223 |
| 11 |
hsa-miR-625#-002432 |
40.51 |
0.03 |
0.03 |
hsa-miR-625 |
| 12 |
hsa-miR-505#-002087 |
33.39 |
0.04 |
0.03 |
hsa-miR-505 |
| 13 |
hsa-miR-194-000493 |
31.43 |
0.04 |
0.03 |
hsa-miR-194 |
| 14 |
hsa-miR-576-3p-002351 |
25.40 |
0.02 |
0.01 |
hsa-miR-576 |
| 15 |
hsa-miR-1255B-002801 |
19.19 |
0.01 |
0.00 |
hsa-miR-1255B |
| 16 |
hsa-miR-362-3p-002117 |
14.54 |
0.01 |
0.01 |
hsa-miR-362 |
| 17 |
hsa-miR-409-3p-002332 |
12.83 |
0.02 |
0.01 |
hsa-miR-409 |
| 18 |
mmu-miR-451-001141 |
8.37 |
0.00 |
0.00 |
mmu-miR-451 |
| 19 |
hsa-miR-16-000391 |
7.44 |
0.00 |
0.00 |
hsa-miR-16 |
| 20 |
hsa-miR-365-001020 |
6.76 |
0.01 |
0.01 |
hsa-miR-365 |
| 21 |
hsa-miR-25-000403 |
6.71 |
0.00 |
0.00 |
hsa-miR-25 |
| 22 |
hsa-miR-151-3p-002254 |
6.61 |
0.02 |
0.01 |
hsa-miR-151 |
| 23 |
hsa-miR-376c-002122 |
5.21 |
0.00 |
0.00 |
hsa-miR-376c |
| 24 |
hsa-miR-21-000397 |
4.95 |
0.00 |
0.00 |
hsa-miR-21 |
| 25 |
hsa-miR-146a-000468 |
4.25 |
0.00 |
0.00 |
hsa-miR-146a |
| 26 |
hsa-miR-20a-000580 |
4.19 |
0.00 |
0.00 |
hsa-miR-20a |
| 27 |
hsa-miR-484-001821 |
3.89 |
0.00 |
0.00 |
hsa-miR-484 |
| 28 |
hsa-miR-92a-000431 |
3.77 |
0.00 |
0.00 |
hsa-miR-92a |
| 29 |
hsa-miR-152-000475 |
3.64 |
0.00 |
0.00 |
hsa-miR-152 |
| 30 |
hsa-miR-590-5p-001984 |
3.27 |
0.04 |
0.03 |
hsa-miR-590 |
| 31 |
hsa-miR-199a-3p-002304 |
3.02 |
0.00 |
0.00 |
hsa-miR-199a |
| 32 |
hsa-miR-30d-000420 |
2.92 |
0.00 |
0.00 |
hsa-miR-30d |
| 33 |
hsa-miR-223-002295 |
2.65 |
0.02 |
0.02 |
hsa-miR-223 |
| 34 |
hsa-miR-186-002285 |
2.57 |
0.00 |
0.00 |
hsa-miR-186 |
| 35 |
hsa-miR-328-000543 |
2.56 |
0.00 |
0.00 |
hsa-miR-328 |
| 36 |
hsa-miR-27b-000409 |
2.51 |
0.00 |
0.00 |
hsa-miR-27b |
| 37 |
hsa-miR-195-000494 |
2.46 |
0.01 |
0.01 |
hsa-miR-195 |
| 38 |
hsa-miR-27a-000408 |
2.06 |
0.00 |
0.00 |
hsa-miR-27a |
| 39 |
hsa-miR-19b-000396 |
2.06 |
0.04 |
0.03 |
hsa-miR-19b |
Table 2: Total MiRNAs altered in serum samples of STBI after normalizing with healthy
controls. Data was normalized using global normalization and was compared with healthy
controls. Data was adjusted for multiple comparisons using adjusted p value <0.05
calculated using Benjamin Hochberg algorithm.
| sTBI vs Control |
| S# |
Detector |
RQ_sTBI-Control |
adj.P.Val_sTBI-Control |
P.Value_sTBI-Control |
GeneSymbol |
| 1 |
hsa-miR-193a-5p-002281 |
476.64 |
0.00 |
0.00 |
hsa-miR-193a |
| 2 |
hsa-miR-486-001278 |
281.67 |
0.01 |
0.01 |
hsa-miR-486 |
| 3 |
hsa-miR-423-5p-002340 |
207.23 |
0.01 |
0.00 |
hsa-miR-423 |
| 4 |
hsa-miR-532-001518 |
202.24 |
0.01 |
0.01 |
hsa-miR-532 |
| 5 |
hsa-miR-185-002271 |
92.99 |
0.04 |
0.03 |
hsa-miR-185 |
| 6 |
hsa-miR-133a-002246 |
82.04 |
0.01 |
0.01 |
hsa-miR-133a |
| 7 |
hsa-miR-576-3p-002351 |
74.38 |
0.00 |
0.00 |
hsa-miR-576 |
| 8 |
hsa-miR-130b-000456 |
59.04 |
0.04 |
0.03 |
hsa-miR-130b |
| 9 |
hsa-miR-296-000527 |
43.17 |
0.02 |
0.01 |
hsa-miR-296 |
| 10 |
hsa-miR-505#-002087 |
36.62 |
0.01 |
0.00 |
hsa-miR-505 |
| 11 |
hsa-miR-223#-002098 |
34.41 |
0.02 |
0.01 |
hsa-miR-223 |
| 12 |
hsa-miR-151-5P-002642 |
29.71 |
0.05 |
0.03 |
hsa-miR-151 |
| 13 |
hsa-miR-579-002398 |
18.64 |
0.01 |
0.01 |
hsa-miR-579 |
| 14 |
hsa-miR-339-3p-002184 |
14.00 |
0.03 |
0.02 |
hsa-miR-339 |
| *15 |
hsa-miR-362-3p-002117 |
13.74 |
0.05 |
0.04 |
hsa-miR-362 |
| 16 |
hsa-miR-365-001020 |
12.41 |
0.00 |
0.00 |
hsa-miR-365 |
| 17 |
hsa-miR-29a-002112 |
6.90 |
0.00 |
0.00 |
hsa-miR-29a |
| 18 |
hsa-miR-19a-000395 |
5.53 |
0.02 |
0.01 |
hsa-miR-19a |
| 19 |
hsa-miR-9#-002231 |
4.74 |
0.00 |
0.00 |
hsa-miR-9 |
| 20 |
hsa-miR-30d-000420 |
4.56 |
0.00 |
0.00 |
hsa-miR-30d |
| 21 |
hsa-miR-25-000403 |
4.22 |
0.00 |
0.00 |
hsa-miR-25 |
| 22 |
hsa-miR-601-001558 |
4.12 |
0.03 |
0.02 |
hsa-miR-601 |
| 23 |
hsa-miR-16-000391 |
4.01 |
0.00 |
0.00 |
hsa-miR-16 |
| 24 |
hsa-miR-1291-002838 |
3.72 |
0.02 |
0.01 |
hsa-miR-1291 |
| 25 |
hsa-miR-21-000397 |
3.69 |
0.00 |
0.00 |
hsa-miR-21 |
| 26 |
hsa-miR-195-000494 |
3.52 |
0.00 |
0.00 |
hsa-miR-195 |
| 27 |
hsa-miR-146a-000468 |
3.12 |
0.01 |
0.00 |
hsa-miR-146a |
| 28 |
hsa-miR-660-001515 |
2.84 |
0.01 |
0.01 |
hsa-miR-660 |
| 29 |
hsa-miR-29c-000587 |
2.80 |
0.01 |
0.00 |
hsa-miR-29c |
| 30 |
hsa-miR-19b-000396 |
2.63 |
0.01 |
0.00 |
hsa-miR-19b |
| 31 |
mmu-miR-451-001141 |
2.57 |
0.05 |
0.03 |
mmu-miR-451 |
| 32 |
hsa-miR-92a-000431 |
2.57 |
0.00 |
0.00 |
hsa-miR-92a |
| 33 |
hsa-miR-186-002285 |
2.56 |
0.02 |
0.02 |
hsa-miR-186 |
| 34 |
hsa-miR-484-001821 |
2.49 |
0.00 |
0.00 |
hsa-miR-484 |
| 35 |
hsa-miR-20a-000580 |
2.31 |
0.01 |
0.01 |
hsa-miR-20a |
| 36 |
hsa-miR-24-000402 |
2.25 |
0.00 |
0.00 |
hsa-miR-24 |
| 37 |
hsa-miR-328-000543 |
2.02 |
0.02 |
0.01 |
hsa-miR-328 |
Table 3: Total MiRNAs altered in serum samples of Orthopedic Injury group after normalizing
with healthy controls. Data was normalized using global normalization and was compared
with healthy controls. Data was adjusted for multiple comparisons using adjusted p
value <0.05 calculated using Benjamin Hochberg algorithm.
| Ortho vs Control |
| S# |
Detector |
RQ_Ortho-Control |
adj.P.Val_Ortho-Control |
P.Value_Ortho-Control |
GeneSymbol |
| 1 |
hsa-miR-520c-3p-002400 |
23063.46 |
0.02 |
0.00 |
hsa-miR-520c |
| 2 |
hsa-miR-155-002623 |
941.78 |
0.01 |
0.00 |
hsa-miR-155 |
| 3 |
hsa-miR-185-002271 |
467.20 |
0.03 |
0.00 |
hsa-miR-185 |
| 4 |
hsa-miR-766-001986 |
425.82 |
0.01 |
0.00 |
hsa-miR-766 |
| 5 |
hsa-miR-532-001518 |
366.99 |
0.01 |
0.00 |
hsa-miR-532 |
| 6 |
hsa-miR-193a-5p-002281 |
322.15 |
0.01 |
0.00 |
hsa-miR-193a |
| 7 |
hsa-miR-423-5p-002340 |
216.43 |
0.03 |
0.00 |
hsa-miR-16 |
| 8 |
hsa-miR-132-000457 |
197.50 |
0.03 |
0.01 |
hsa-miR-132 |
| 9 |
hsa-miR-133a-002246 |
49.67 |
0.03 |
0.02 |
hsa-miR-133a |
| 10 |
hsa-miR-223#-002098 |
42.32 |
0.03 |
0.01 |
hsa-miR-223 |
| 11 |
hsa-miR-642-001592 |
27.33 |
0.03 |
0.02 |
hsa-miR-642 |
| 12 |
hsa-miR-576-3p-002351 |
22.18 |
0.04 |
0.02 |
hsa-miR-576 |
| 13 |
hsa-miR-409-3p-002332 |
16.73 |
0.04 |
0.03 |
hsa-miR-409 |
| 14 |
hsa-miR-375-000564 |
16.69 |
0.03 |
0.02 |
hsa-miR-375 |
| 15 |
hsa-miR-146a-000468 |
12.84 |
0.00 |
0.00 |
hsa-miR-146a |
| 16 |
hsa-miR-29a-002112 |
10.45 |
0.03 |
0.01 |
hsa-miR-29a |
| 17 |
hsa-miR-186-002285 |
9.91 |
0.03 |
0.01 |
hsa-miR-186 |
| 18 |
hsa-miR-376c-002122 |
8.41 |
0.02 |
0.00 |
hsa-miR-376c |
| 19 |
hsa-miR-197-000497 |
6.62 |
0.00 |
0.00 |
hsa-miR-197 |
| 20 |
hsa-miR-365-001020 |
6.16 |
0.03 |
0.00 |
hsa-miR-365 |
| 21 |
hsa-miR-222-002276 |
5.57 |
0.01 |
0.00 |
hsa-miR-222 |
| 22 |
mmu-miR-374-5p-001319 |
5.29 |
0.03 |
0.00 |
mmu-miR-374 |
| 23 |
hsa-miR-21-000397 |
4.55 |
0.03 |
0.00 |
hsa-miR-21 |
| 24 |
hsa-miR-16-000391 |
4.43 |
0.03 |
0.00 |
hsa-miR-409 |
| 25 |
hsa-miR-192-000491 |
4.30 |
0.03 |
0.01 |
hsa-miR-192 |
| 26 |
hsa-miR-484-001821 |
4.23 |
0.01 |
0.00 |
hsa-miR-484 |
| 27 |
hsa-miR-25-000403 |
4.16 |
0.02 |
0.00 |
hsa-miR-25 |
| 28 |
hsa-miR-223-002295 |
4.05 |
0.03 |
0.01 |
hsa-miR-223 |
| 29 |
hsa-miR-151-3p-002254 |
3.56 |
0.03 |
0.01 |
hsa-miR-151 |
| 30 |
hsa-miR-590-5p-001984 |
3.50 |
0.05 |
0.03 |
hsa-miR-590 |
| 31 |
hsa-miR-24-000402 |
3.48 |
0.01 |
0.00 |
hsa-miR-24 |
| 32 |
hsa-miR-152-000475 |
2.97 |
0.03 |
0.01 |
hsa-miR-152 |
| 33 |
hsa-miR-19b-000396 |
2.60 |
0.03 |
0.01 |
hsa-miR-19b |
[0058] The real time PCR results of the samples from the subjects with the mTBI, sTBI and
orthopedic injury were normalized to the real time PCR result of the control sample.
Our analysis showed that 82, 74 and 58 miRNAs were significantly modulated in serum
samples from the subjects with the mTBI, sTBI and orthopedic injury, respectively.
The levels of the miRNAs in the samples from the subjects with the mTBI and sTBI were
compared to the level of the miRNAs in the sample from the subjects with the orthopedic
injury. The results showed upregulation of 22 and 26 miRNAs in the samples from the
subjects with mTBI and sTBI compared to the modulated level of the miRNAs in the sample
from the subjects with the orthopedic injury. These 22 unique miRNAs for mTBI and
26 unique miRNAs for sTBI are listed in Tables 4 and 5 along with their normalized
fold changes indicating their level of expression.
Table 4: MiRNAs altered in serum samples of mTBI.
| S# |
Micro RNA |
Fold Change |
Mature Sequence |
Mirbase ID |
| 1. |
hsa-miR-381 |
2238.72 |
UAUACAAGGGCAAGCUCUCUGU |
MIMAT0000736 |
| 2. |
hsa-miR-425* |
645.65 |
AUCGGGAAUGUCGUGUCCGCCC |
MIMAT0001343 |
| 3. |
hsa-miR-486 |
523.46 |
UCCUGUACUGAGCUGCCCCGAG |
MIMAT0002177 |
| 4. |
hsa-miR-942 |
424.19 |
UCUUCUCUGUUUUGGCCAUGUG |
MIMA T0004985 |
| 5. |
hsa-miR-638 |
46.48 |
AGGGAUCGCGGGCGGGUGGCGGCCU |
MIMAT0003 308 |
| 6. |
hsa-miR-151-5p |
45.52 |
UCGAGGAGCUCACAGUCUAGU |
MIMA T0004697 |
| 7. |
hsa-miR-625* |
40.51 |
GACUAUAGAACUUUCCCCCUCA |
MIMAT0004808 |
| 8. |
hsa-miR-505* |
33.39 |
GGGAGCCAGGAAGUAUUGAUGU |
MIMAT0004776 |
| 9. |
hsa-miR-194 |
31.43 |
UGUAACAGCAACUCCAUGUGGA |
MIMAT0000460 |
| 10. |
hsa-miR-1255B |
19.19 |
CGGAUGAGCAAAGAAAGUGGUU |
MIMAT0005945 |
| 11. |
hsa-miR-362-3p |
14.54 |
AACACACCUAUUCAAGGAUUCA |
MIMAT0004683 |
| 12. |
mmu-miR-451 |
8.37 |
AAACCGUUACCAUUACUGAGUU |
MIMAT0001631 |
| 13. |
hsa-miR-20a |
4.19 |
UAAAGUGCUUAUAGUGCAGGUAG |
MIMAT0000075 |
| 14 |
hsa-miR-199a-3p |
3.02 |
ACAGUAGUCUGCACAUUGGUUA |
MIMAT0004563 |
| 15 |
hsa-miR-30d |
2.92 |
UGUAAACAUCCCCGACUGGAAG |
MIMAT0000245 |
| 16 |
hsa-miR-328 |
2.56 |
CUGGCCCUCUCUGCCCUUCCGU |
MIMAT0000752 |
| 17 |
hsa-miR-27b |
2.51 |
UUCACAGUGGCUAAGUUCUGC |
MIMAT0000419 |
| 18 |
hsa-miR-195 |
2.46 |
UAGCAGCACAGAAAUAUUGGC |
MIMAT0000461 |
| 19 |
hsa-miR-27a |
2.06 |
UUCACAGUGGCUAAGUUCCGC |
MIMAT0000084 |
| 20 |
hsa-miR-361 |
2.69 |
UUAUCAGAAUCUCCAGGGGUAC |
MIMAT0000703 |
| 21 |
hsa-miR-93 |
5.88 |
ACUGCUGAGCUAGCACUUCCCG |
MIMAT0004509 |
| 22 |
hsa-miR-92a |
3.77 |
UAUUGCACUUGUCCCGGCCUGU |
MIMAT0000092 |
[0059] In Table 4, data was normalized using global normalization and was compared with
healthy controls and orthopedic injury samples. Adjusted p value<0.05 calculated using
Benjamin Hochberg algorithm.
Table 5: MiRNAs altered in serum samples of sTBI.
| S# |
Micro RNA |
Fold Change |
Mature Sequence |
Mirbase ID |
| 1 |
hsa-miR-34a |
5128.61384 |
UGGCAGUGUCUUAGCUGGUUGU |
MIMAT0000255 |
| 2 |
hsa-miR-486 |
281.6657 |
UCCUGUACUGAGCUGCCCCGAG |
MIMAT0002177 |
| 3 |
hsa-miR-455 |
122.4616199 |
UAUGUGCCUUUGGACUACAUCG |
MIMAT0003150 |
| 4 |
hsa-miR-624 |
114.5512941 |
UAGUACCAGUACCUUGUGUUCA |
MIMAT0003293 |
| 5 |
hsa-miR-942 |
86.9048 |
UCUUCUCUGUUUUGGCCAUGUG |
MIMAT0004985 |
| 6 |
hsa-miR-130b |
59.04301 |
CAGUGCAAUGAUGAAAGGGCAU |
MIMAT0000691 |
| 7 |
hsa-miR-296 |
43.17099 |
AGGGCCCCCCCUCAAUCCUGU |
MIMAT0000690 |
| 8 |
hsa-miR-505* |
36.61881 |
GGGAGCCAGGAAGUAUUGAUGU |
MIMAT0004776 |
| 9 |
mmu-miR-491 |
34.9945167 |
AGUGGGGAACCCUUCCAUGAGG |
MIMAT0002807 |
| 10 |
hsa-miR-151-5p |
29.7126 |
UCGAGGAGCUCACAGUCUAGU |
MIMAT0004697 |
| 11 |
hsa-miR-579 |
18.64192 |
UUCAUUUGGUAUAAACCGCGAUU |
MIMAT0003244 |
| 12 |
hsa-miR-339-3p |
13.99902 |
UGAGCGCCUCGACGACAGAGCCG |
MIMAT0004702 |
| 13 |
hsa-miR-362-3p |
13.73953 |
AACACACCUAUUCAAGGAUUCA |
MIMAT0004683 |
| 14 |
hsa-miR-19a |
5.525949 |
UGUGCAAAUCUAUGCAAAACUGA |
MIMAT0000073 |
| 15 |
hsa-miR-9* |
4.742191 |
AUAAAGCUAGAUAACCGAAAGU |
MIMAT0000442 |
| 16 |
hsa-miR-30d |
4.555606 |
UGUAAACAUCCCCGACUGGAAG |
MIMAT0000245 |
| 17 |
hsa-miR-601 |
4.121515 |
UGGUCUAGGAUUGUUGGAGGAG |
MIMAT0003269 |
| 18 |
hsa-miR-1291 |
3.716838 |
UGGCCCUGACUGAAGACCAGCAGU |
MIMAT0005881 |
| 19 |
hsa-miR-195 |
3.515882 |
UAGCAGCACAGAAAUAUUGGC |
MIMAT0000461 |
| 20 |
hsa-miR-660 |
2.841981 |
UACCCAUUGCAUAUCGGAGUUG |
MIMAT0003338 |
| 21 |
hsa-miR-328 |
2.015088 |
CUGGCCCUCUCUGCCCUUCCGU |
MIMAT0000752 |
| 22 |
hsa-miR-29c |
2.80347 |
UAGCACCAUUUGAAAUCGGUUA |
MIMAT0000681 |
| 23 |
mmu-miR-451 |
2.569689 |
AAACCGUUACCAUUACUGAGUU |
MIMAT0001631 |
| 24 |
hsa-miR-20a |
2.312593 |
UAAAGUGCUUAUAGUGCAGGUAG |
MIMAT0000075 |
| 25 |
hsa-miR-27a |
1.813638 |
UUCACAGUGGCUAAGUUCCGC |
MIMAT0000084 |
| 26 |
hsa-miR-92a |
2.57 |
UAUUGCACUUGUCCCGGCCUGU |
MIMAT0000092 |
[0060] In Table 5, data was normalized using global normalization and was compared with
healthy controls and orthopedic injury samples. Adjusted p value<0.05 calculated using
Benjamin Hochberg algorithm.
[0061] The analysis identified a novel signature of miRNAs whose expression was elevated
in both sTBI and mTBI groups which were then selected for further biomarker analysis
(Figures 2 and 3).
[0062] Table 6 shows one embodiment of the signature miRNA biomarkers used to identify mTBI
and sTBI. The miRNA biomarkers as shown in Table 6 were present in samples from subjects
with mTBI and sTBI, but not in samples from subjects with orthopedic injury.
Table 6: miRNA biomarkers for TBI.
| MiRNA |
Mature Sequence |
Mirbase ID |
| hsa-miR-151-5p |
UCGAGGAGCUCACAGUCUAGU |
MIMAT0004697 |
| hsa-miR-328 |
CUGGCCCUCUCUGCCCUUCCGU |
MIMAT0000752 |
| hsa-miR-486 |
UCCUGUACUGAGCUGCCCCGAG |
MIMAT0002177 |
| hsa-miR-362-3p |
AACACACCUAUUCAAGGAUUCA |
MIMAT0004683 |
| hsa-miR-942 |
UCUUCUCUGUUUUGGCCAUGUG |
MIMAT0004985 |
| hsa-miR-505* |
GGGAGCCAGGAAGUAUUGAUGU |
MIMAT0004776 |
| hsa-miR-195 |
UAGCAGCACAGAAAUAUUGGC |
MIMAT0000461 |
| hsa-miR-20a |
UAAAGUGCUUAUAGUGCAGGUAG |
MIMAT0000075 |
| hsa-miR-27a |
UUCACAGUGGCUAAGUUCCGC |
MIMAT0000084 |
| hsa-miR-30d |
UGUAAACAUCCCCGACUGGAAG |
MIMAT0000245 |
| mmu-miR-451 |
AAACCGUUACCAUUACUGAGUU |
MIMAT0001631 |
| has-miR-92a |
UAUUGCACUUGUCCCGGCCUGU |
MIMAT0000092 |
[0063] Functional pathway analysis of altered miRNAs and their association with TBI related
gene targets was performed using Ingenuity Pathway Analysis (IPA) program (Ingenuity
Systems Inc., Redwood City, CA). In IPA, there are currently 87 target molecules whose
association has been linked with miRNA regulation in TBI. The eighty seven TBI related
molecules were used to identify direct relation of the targets with certain candidate
miRNAs shown in Table 6. The pathway explorer function of IPA was used to build putative
pathways between TBI miRNA biomarker candidates and TBI related molecules. Thirty
genes were identified as direct targets for TBI and nine miRNA candidates were identified
as direct biomarkers, including miR-151-5p, miR-27a, miR-195, miR-328, miR-362-3p,
miR-30d, miR-20a, miR-486 and miR-942. These genes were further analyzed by overlying
them in the canonical pathway category. This analysis identified that most of the
molecules predicted to be targeted by the miRNAs are involved in major TBI related
canonical pathways such as erythropoietin signaling, G protein coupled receptor signaling,
GABA receptor signaling and , neuropathic pain signaling in dorsal horn neurons. Overall,
it was found that all the most of the miRNAs target important neurological pathways
(Figure 3).
[0064] As discussed above, the eighty seven TBI related molecules that are available in
the disease and function category were used, and any direct relation of these targets
with the 10 candidate miRNAs were also identified. The pathway explorer function of
IPA was used to build putative pathways between TBI miRNA biomarker candidates and
TBI related molecules. This analysis identified 30 genes as direct targets for the
8 miRNA candidate miR-151-5p, miR-195, miR-328-3p, miR-362-3p, miR-30d, miR-20a, miR-486
and miR-92a. MiR-505* and miR-451 were not predicted to target any of the target molecules
for TBI in IPA. These genes were further analyzed by overlying them in the canonical
pathway category. This analysis identified that most of the molecules predicted to
be targeted by the miRNAs are involved in major TBI related canonical pathways such
as erythropoietin signaling, G protein coupled receptor signaling, GABA receptor signaling,
and neuropathic pain signaling in dorsal horn neurons. Specifically, miR-328 was predicted
to regulate erythropoietin and erythropoietin receptor which are important mediators
of erythropoietin signaling. MiR-486, miR-27a and miR-195 targeted molecules involved
in glutamate receptor signaling and GABA receptor signaling. MiR-151-5p and miR-362-3p
target molecule SCN4A which is shown to be responsible for generation and propagation
of neurons. MiR-30d was also predicted to target adrenoceptors and GABA receptor signaling.
Overall, it was found that all the most of the miRNAs target important neurological
pathways (Figure 4).
[0065] To validate the findings of the methods of detecting miRNA levels using TaqMan Low
Density Human MicroRNA array cards (TLDA) platform, specific miRNA PCR was performed
for selected miRNAs: miR-195, miR-505*, miR-151-5p, miR-328, miR-362-3p, miR-486 and
miR-942. To perform the specific miRNA PCR assays, an endogenous control was required.
For specific assays, an endogenous control was identified by selecting the miRNA with
the least standard deviation in the delta Ct values obtained after global normalization.
MiR-202 was identified and selected as endogenous control for all the specific PCR
validation experiments. RNA was again isolated from the serum samples and assays were
performed without pre-amplification of cDNA. The validation showed significant upregulation
of the miRNAs in both mTBI and sTBI groups as observed previously in the miRNA profiling
result (Figure 5). The expression value of miR-151-5p, however, was not significantly
upregulated in mTBI injury though its expression was upregulated in sTBI (Figure 5).
The results demonstrate that all the selected miRNAs were significantly upregulated
after TBI.
[0066] To validate the presence of miRNAs observed in serum studies, a complete miRNA profiling
was performed using CSF samples from sTBI patients (n=8) and control CSF samples (n=6).
MiR-202 was selected as the endogenous control for the specific PCR assays in the
CSF samples. The conventional miRNA assay was modified by adding an additional pre-amplified
the product using the real time primers, which does not introduce additional bias
since only one primer is used for pre-amplification reaction. The real time data for
miR-151-5p, miR-328, miR-362-3p, miR-486 and miR-942 were normalized using miR-202.
MiR-202 was found stable in the CSF samples with a mean Ct value of 26.2 and 25.8
in injury and control samples respectively. Normalization with miR-202 showed a significant
upregulation of miR-328, miR-362-3p and miR-486 (Figure 6). Increase in miR-151-5p
was also observed.
[0067] Additional miRNA assays for candidate miRNAs identified in serum as biomarker candidates
in both MMTBI and STBI groups. The conventional miRNA assay methodology was modified
and an additional pre-amplification step was added in the analysis. This pre-amplification
does not introduce additional bias since only one primer is used for pre-amplification
reaction. The real time data for miR-151-5p, miR-195, miR-20a, miR-30d, miR-328, miR-362-3p,
miR-451, miR-486, miR-505* and miR-92a was normalized using miR-202. MiR-202 was found
extremely stable in the CSF samples with a mean Ct value of 26.2 and 25.8 in injury
and control samples respectively. Normalization with miR-202 showed a significant
upregulation of miR-328, miR-362-3p, miR-451 and miR-486 (Figure 7). For miR-505*
and miR-195, although the mean fold upregulation was more than 10 fold, however it
was only observed in 50-60% of the samples whereas in the remaining samples it was
not detected, hence these failed the statistical test. Similar observation was also
found for miR-20a. An increase in miR-151-5p was observed, but it was not significant
due to sample outliers. No significant upregulation in the level of miR-30d was observed
between control and injury groups.
[0068] The miRNA data was analyzed with the delta Ct data from the real time PCR data of
the TBI and trauma control groups to identify a correlation of miRNAs with CT lesions.
The comparison between these groups was performed using the delta Ct values because
of the absence of absolute fold change. A comparison of level of miRNA was performed
in 2 groups of human subjects comprised of (1) subjects (TBI and all controls) without
any lesions on head CT (n=19); and (2) TBI subjects with lesions on head CT (n=12).
The assumption was made that all normal and trauma controls had negative CT scans.
There were significant differences between the two groups for all but two of the selected
miRNA: miR-195 (p≤0.001); miR-30d (p≤0.001); miR-451 (p≤0.011); miR-328 (p≤0.101);
miR-92a (p≤0.001); miR-486 (p≤0.006); miR-505 (p≤0.008); and miR-362 (p≤0.035); miR-151
(p≤0.065); and miR-20a (p≤0.012) (Figure 8).
[0069] Receiver operator characteristic (ROC) curve was generated to calculate the area
under the curve (AUC) to identify the accuracy of the miRNAs in diagnosing TBI. The
analysis identified the AUC values as miR-195 (0.81, p value < 0.003), miR-30d (0.75,
p value <0.016), miR-451 (0.82, p value <0.002), miR-328 (0.73, p value < 0.030),
miR-92a (0.86, p value <0.001), miR-486 (0.81, p value <0.003), miR-505 (0.82, p value
<0.002), miR-362 (0.79, p value <0.006), miR-151 (0.66, p value < 0.123), miR-20a
(0.78, 0.007). All miRNAs except for miR-151 showed good diagnostic accuracy (Figure
9).