[0001] The invention relates to the fields of biology and medicine.
[0002] T cell responses play an important role in the mammalian immune system. For instance,
CD8+ cytotoxic T cells (CTL) play an important role in combating pathogen-infected
cells and tumor cells. Immune responses are also elicited by CD4+ helper T cells,
via the production of multiple effector cytokines such as for instance interferon
gamma (typically abbreviated as IFN-y or IFNg), tumor necrosis factor alpha (TNF-α)
and interleukin 2 (IL-2), that activate CTL and induce maturation of antibody producing
B cells. Adoptive cell therapy, which is increasingly explored for tumor treatment,
makes use of T cell responses that occur
in vivo. During this therapy, tumor-specific T cells are isolated from a patient and cultured
ex vivo. Subsequently, the tumor-specific T cells are reintroduced into the patient, preferably
after chemotherapy-induced lymphodepletion in order to eliminate immunoregulatory
cells, resulting in an increased anti-tumor response. For instance, Rosenberg
et al. 2011 describe treatment of metastatic melanoma patients with the adoptive transfer
of autologous CD8+ CTL-containing tumor infiltrating lymphocytes (TILs) in conjunction
with IL-2. High response rates were observed and in this study 22% of the melanoma
patients achieved a complete tumor regression. Tran
et al. 2014 describe immunotherapy of epithelial cancer. CD4+ T cells were obtained from
a patient and incubated with autologous dendritic cells (DCs) which presented peptides
with tumor-specific mutations. A T cell clone specific for one tumor-specific mutation
was found, and infusion of these T cells into the patient resulted in tumor regression
and prolonged stabilization of disease.
[0003] Dendritic cells are professional antigen presenting cells (APCs), which are specifically
adapted for presenting antigen in the context of major histocompatibility complex
I or II (MHC-I or MHC-II). Therefore, DCs are cells of first choice for presenting
T cell epitopes and identifying T cells with a desired specificity. However, mature
DCs cannot be expanded in long term cultures, so that monocytes have to be obtained
freshly from a large volume of blood or from the bone marrow of an individual and
a short-lived DC culture has to be prepared each time before a given T cell selection
procedure can be performed. This is time consuming, expensive and involves significant
discomfort to the individual.
[0004] It is an object of the invention to provide optimized methods for determining whether
T cells recognize T cell epitopes.
[0005] Accordingly, the invention provides a method for determining whether a sample from
an individual contains T cells that recognize a tumor-specific T cell epitope or a
T cell epitope from an autoantigen or from a pathogen, comprising:
- inducing, enhancing and/or maintaining expression of Bcl-6 in at least one B cell;
- inducing, enhancing and/or maintaining expression of an anti-apoptotic nucleic acid
in said at least one B cell;
- allowing expansion of said at least one B cell into a B cell culture;
- incubating B cells of said B cell culture with at least one compound comprising said
T cell epitope;
- incubating the resulting B cells with T cells from said sample; and
- determining whether said sample contains T cells that recognize said T cell epitope.
[0006] One interesting application of a method according to the invention is a screening
assay for T cell epitopes. In this embodiment, first an
in vitro B cell culture is obtained. Subsequently, B cells from this culture are used as antigen
presenting cells by incubating them with test compounds that are potential T cell
epitopes or that encode for potential T cell epitopes, so that the potential T cell
epitopes are displayed at the B cell surface in the context of MHCs. Subsequently,
the loaded B cells are incubated with T cells in order to test whether the T cells
recognize any of the potential T cell epitopes. This is for instance tested by determining
whether the T cells are bound to any of the test epitopes. Preferably, T cell activation
is measured. Various ways of determining T cell activation are known in the art, such
as for instance testing whether the T cells produce cytokines, or testing whether
the T cells proliferate. If tumor-specific T cells are searched for, interferon gamma
release is preferably measured because many tumor-specific T cells produce IFNg. If
a test epitope is recognized by T cells, it is then typically selected fur further
research, for instance for the development of an immunogenic composition or vaccine,
and/or for eliciting or boosting a T cell response against a disease associated with
the presence of that epitope. In one embodiment, such T cell response is elicited
or boosted
in vivo, by administration of the epitope to an individual who is suffering from, or at risk
of suffering from, a disease which is associated with the presence of said epitope,
such as for instance cancer or a pathogenic infection. Alternatively, a T cell response
against a T cell epitope that has been identified with a method according to the invention
is elicited
in vitro, preferably using T cells from an individual who is suffering from, or at risk of
suffering from, a disease which is associated with the presence of said epitope, where
after the T cells are cultured and subsequently administered to the individual as
a medicament or prophylactic agent against said disease.
[0007] Another application of a method according to the invention is a screening assay for
the presence of T cells against a known T cell epitope. In this embodiment, B cells
from the above-mentioned B cell culture are incubated with one or more known T cell
epitopes. Again, the T cell epitopes are displayed at the B cell surface in the context
of MHCs. Subsequently, the epitope-loaded B cells are incubated with T cells from
a sample in order to test whether that sample contains T cells that recognize one
or more of the T cell epitopes. If this appears to be the case, it can for instance
be concluded that (at least one of) the individual(s) from which the sample was obtained
exhibits a T cell response
in vivo against at least one of the tested T cell epitopes. This may for instance mean that
a certain treatment or vaccination procedure has been successful.
[0008] As used herein, a T cell epitope means an amino acid sequence that has the capability
of being bound by MHC molecules and recognized by T cells, such as for instance by
CD8+ CTL or CD4+ helper T cells.
[0009] A compound as used in the present invention typically comprises amino acid residues
or a nucleic acid sequence encoding for amino acid residues. Said compound is preferably
a protein or a (poly)peptide or a nucleic acid molecule comprising a nucleic acid
sequence encoding a protein or a (poly)peptide. The compound typically either comprises
one or more known T cell epitopes, or it is tested for the presence of one or more
T cell epitopes. Preferably, said compound is a protein or a (poly)peptide.
[0010] As used herein, the term "amino acid" embraces natural amino acids as well as non-natural,
or artificial, amino acids.
[0011] As used herein, the terms "nucleic acid molecule" and "nucleic acid sequence" refers
to a chain of nucleotides, preferably DNA or RNA. In other embodiments a nucleic acid
molecule comprises other kinds of nucleic acid structures such as for instance a DNA/RNA
helix, peptide nucleic acid (PNA), locked nucleic acid (LNA) and/or a ribozyme.
[0012] As used herein, a T cell "recognizes" a T cell epitope if it specifically binds to
said epitope in the context of MHC. This means that said T cell preferentially binds
said epitope over other antigens. A T cell typically binds a T cell epitope via its
T cell receptor (TCR). Non-specific binding, or sticking, of T cells to a certain
compound is not embraced by the term "recognizing".
[0013] The term "incubating" B cells with a compound or with T cells means that the B cells
are exposed to the compound or T cells for a sufficiently long time to allow an interaction
between the B cells and the compound or T cells to take place. Typically, if said
compound is a peptide, the incubation time can be considerably shorter then the incubation
time for proteins. Proteins first need to be processed by the B cells before protein-derived
peptides are displayed at the surfaces of the B cells, whereas peptides can typically
directly bind the B cell's MHC molecules without the need for internalization and
processing. In one embodiment, B cells are incubated with peptides for about 15-25
hours, preferably for about 18-24 hours. Subsequently, peptide-loaded B cells are
preferably incubated with T cells for about 5-50 hours, preferably for about 6-48
hours. If said compound is a nucleic acid molecule encoding a protein or (poly)peptide,
the B cells are transduced or transfected with said nucleic acid molecule resulting
in the translation of said nucleic acid molecule and intracellular production of said
encoded protein or (poly)peptide. Transduction or transfection of B cells with nucleic
acid molecules can be achieved with method commonly known in the art. Such methods
include, but are not limited to, viral vector particle-mediated transduction, microinjection,
and standard nucleic acid transfection methods such as those based on calcium phosphate
precipitation, liposomes, polycations, magnetofection and electroporation.
[0014] An important advantage of a method according to the present invention is the fact
that an
in vitro B cell culture is used that can be maintained for a prolonged period of time, which
includes weeks, months or even years. Each time that APCs are needed, B cells can
be taken from such B cell culture for a screening assay. Hence, B cells only once
need to be harvested from an individual, where after they remain in culture and remain
available for subsequent assays. This is an important advantage over the use of dendritic
cells.
[0015] Furthermore, a method according to the invention allows the detection of T cell epitope
recognition with a high sensitivity, because the inventors have surprisingly discovered
that with a method of the invention T cell activation towards epitopes other than
the test epitopes (background signals or background noise) is particularly low. This
is for instance in contrast with the results when Epstein Barr Virus (EBV) immortalized
B cells are used as antigen presenting cells. For instance, in Figure 4 it is very
difficult to establish which of the dots (T cell activation using EBV-immortalized
B cells as APCs) are relevant due to the high level of background signals. On the
other hand, T cell activation signals obtained with a method according to the present
invention (triangles) are clearly detectable as a result of the low (or even absent)
background noise. Hence, a method according to the present invention provides a much
more accurate and sensitive screening method for T cell epitopes, since background
signaling is so low that relevant T cell epitopes immediately become apparent, even
when the signal is weak. Such weak signals can for instance be caused by a rather
low extent of T cell activation, or a low number of epitope-recognizing T cells might
be present in the assay. In existing methods of the prior art wherein EBV immortalized
B cells are used, many relevant signals are missed because they cannot be distinguished
from the large background noise whereas in a method according to the present invention,
relevant T cell epitopes are better detected.
[0016] The particularly good results and low background noise obtained with a method according
to the invention are surprising, because B cells are used that are cultured
in vitro for a prolonged period of time. These B cells remain in a "plasmablast-like state",
meaning that the
in vitro B cells are capable of both replicating and antibody production. In a natural situation,
plasmablasts are only short lived
in vivo. Antibody is typically produced by B cells that have differentiated into plasma cells,
which have lost their capability of proliferating. The long term "plasmablast-like
cultures" that are used in the present invention are therefore unique cells that do
not exist in nature. These cells have non-natural properties. For instance, their
size is larger as compared to natural
in vivo plasmablasts and they highly express co-stimulatory molecules like CD40, CD80, CD86,
ICOSL. When such non-natural B cells are incubated with T cells, background noise
was therefore to be expected. However, surprisingly, the methods according to the
present invention involve such low background noise that a very sensitive assay has
become possible.
[0017] Hence, the very low level of background noise is surprising, since
in vitro cultured B cells are used, which are present in a non-natural environment and have
undergone non-natural treatment, which affects the characteristics of the B cells.
Moreover, in a preferred embodiment the B cells contain one or more exogenous nucleic
acid molecules, which often contain a non-natural detectable label such as for instance
green fluorescent protein. The resulting
in vitro B cells are, therefore, different from their natural counterparts and were expected
to activate T cells, independently from the administered epitopes of the test assay.
Yet, with a method according to the invention, background noise is surprisingly avoided
to such extent that a very sensitive test assay has become available. A method according
to the present invention is, therefore, preferred over existing prior art methods
because it allows very sensitive, accurate and straightforward screening assays for
T cell recognition of T cell epitopes, using B cells that are long-lived and only
need to be obtained once from an individual. Repeated harvesting of monocytes and
differentiation of these cells into DCs is no longer necessary, which reduces processing
times, costs and the extent of discomfort of the individual.
[0018] A further advantage of a method according to the invention is that the long-term
"plasmablast-like" B cells which are used in the assay are larger than their natural
counterparts
in vivo. This means that more MHC is present at the surface of the B cells, so that a larger
number of epitopes can be displayed. This also increases the sensitivity of the assays
of the present invention.
[0019] B cells have been used as antigen presenting cells before. For instance, Schultze
et al. describe a method wherein CD40-activated B cells are used as APCs for presenting
a melanoma-derived peptide to T cells from healthy individuals in order to generate
melanoma-specific T cells. The generation of antigen-specific T cells by incubating
T cells from healthy individuals with a T cell epitope does, however, not involve
the above-mentioned sensitivity concerns. Screening methods according to the present
invention are particularly advantageous when the detection of low concentrations of
T cells of interest is at stake.
[0020] Various kinds of compounds are suitable for use in a screening method according to
the invention. For instance, proteins may be used, which are internalized by the B
cells, processed and peptide fragments are subsequently displayed at their surface.
If a T cell binds such peptide and becomes activated, it is concluded that said protein
comprises a T cell epitope that is recognized by the T cell.
[0021] In a preferred embodiment, the B cells are incubated with peptides. This provides
the advantage that at least some of the peptides are directly bound to the surface
MHCs of the B cells, so that internal processing by the B cells is not necessary for
these peptides. This enables faster epitope presentation and, hence, shorter assay
times. Although the cultured B cells of the present invention will typically already
display peptides at their surface in complex with MHCs, many of these MHC-bound peptides
are easily replaced by the administered peptides, resulting in MHC- test peptide complexes,
that are subsequently tested for T cell activation.
[0022] In order to enable efficient T cell recognition, said peptides preferably have a
length of between 5 and 40 amino acids, preferably between 5 and 35 amino acids, more
preferably between 8 and 35 amino acids or between 9 and 31 amino acids or between
10 and 31 amino acids or between 11 and 31 amino acids or between 8 and 20 amino acids
or between 9 and 20 amino acids or between 10 and 20 amino acids or between 11 and
20 amino acids or between 8 and 15 amino acids or between 8 and 12 amino acids or
between 8 and 11 amino acids, enabling efficient MHC binding and surface presentation.
As is well known by the skilled person, T cell epitopes presented by MHC class I typically
have a length of between 8 and 11 amino acids, whereas T cell epitopes presented by
MHC class II typically have a length of between 11 and 20 amino acids. Therefore,
test peptides with similar lengths are advantageous since this facilitates MHC binding.
However, as shown in the examples, longer peptides are also suitable for testing potential
T cell epitopes. Such longer peptides are either internalized and processed by the
B cells, or directly bound to MHC. MHC-II is particularly well capable of binding
and presenting larger peptides. Hence, longer peptides are particularly suitable for
testing CD4+ T cell epitope recognition.
[0023] As used herein, numerical ranges include the upper and lower values of that range.
Accordingly, the term "peptide with a length of between x and y amino acids" embraces
peptides with a length of x amino acids and peptides with a length of y amino acids,
as well as peptides with a length in between these values.
[0024] Alternatively, a nucleic acid molecule comprising a nucleic acid sequence encoding
a protein or (poly)peptide can be used. In that case, B cells are transduced or transfected
with said nucleic acid molecule resulting in the translation of said nucleic acid
sequence and intracellular production of said encoded protein or (poly)peptide. Fragments
of such proteins and such peptides are, optionally after processing by the B cells,
displayed at the B cell surface.
[0025] In order to be able to test T cell recognition of different test epitopes, said B
cells are preferably incubated with different kinds of peptides, or with nucleic acid
molecules comprising nucleic acid sequences encoding different kinds of peptides,
preferably with at least 2, at least 3 or at least 4 different peptides or encoding
nucleic acid sequences, preferably peptides. In a further embodiment, said B cells
are incubated with at least 5, at least 6, at least 7, at least 8, at least 9 or with
at least 10 different peptides or encoding nucleic acid sequences, preferably peptides.
In order to be able to distinguish between the different epitopes, B cells are preferably
present at spatially addressable positions. At each position, one or more compounds
are administered to the B cells. If T cell recognition appears to be present at a
certain position, it can be determined which epitope is recognized. In one embodiment
several protein or peptide mixtures are used. For instance, B cells are present in
different wells and each well is incubated with a different protein/peptide mixture.
If in one well T cell recognition appears to take place, the proteins and/or peptides
of the mixture of that particular well are typically subsequently tested individually,
in order to determine which epitope(s) is/are recognized. If no T cell recognition
is present in a certain well, the whole mixture that was administered to that well
can be disregarded.
[0026] T cell recognition of a T cell epitope can be measured in various ways known in the
art. One preferred method is measurement of T cell activation. Upon recognition of
an epitope, T cells typically become activated which is for instance measurable by
determining the extent of interferon gamma release. Hence, in one embodiment of the
invention it is determined whether T cells have recognized at least one epitope by
determining whether said T cells are activated, preferably by measuring cytokine release
by the T cells. In one embodiment, interferon gamma release is measured.
[0027] In one embodiment, compound-loaded B cells (preferably protein-loaded, peptide-loaded,
or nucleic acid molecule-loaded B cells) according to the invention are incubated
with CD8+ CTL. In a further embodiment, compound-loaded B cells according to the invention
are incubated with CD4+ helper T cells.
[0028] CD8+ CTL play an important role in combating tumor cells, as well as cells that are
infected by a pathogen. Typically, the specificity of CD8+ CTL can be tested using
non-cellular peptide-MHC-I complexes, such as for instance peptide-MHC-I multimers
as described in Davis et al., 2011. Peptide-MHC multimers are used because the affinity
of the T cell receptor (TCR) for peptide-loaded MHCs is so low that a single peptide-MHC
complex would not be able to bind a T cell with sufficient strength for performing
a test assay. As described in Davis et al., 2011, MHC multimers, typically tetramers,
with ultraviolet (UV)-sensitive peptides, which are developed by one of the current
inventors, are preferably used. These UV-sensitive peptides are cleaved by UV light,
where after the resulting MHC multimers are loaded with test peptides and used for
T cell binding assays.
[0029] Although peptide-MHC multimers provide a good tool for performing CD8+ T cell binding
assays, these multimers are not always suitable. For instance, with peptide-MHC multimers,
only the binding of T cells to test peptides can be determined. The biologic activity
of these T cells, such as for instance activation, is not tested with these multimers.
Moreover, MHC multimers are not available for each MHC allele. Therefore, if a certain
individual appears to express MHC alleles that are not commonly present in the population,
multimers of these uncommon MHC alleles will typically not be available. In such case,
the binding characteristics of such individual's T cells cannot be measured with existing
MHC multimers.
[0030] Hence, when the biologic activity of CD8+ T cells is to be investigated, or when
T cells from an individual with uncommon MHC-I alleles are tested, peptide-MHC multimers
are typically unsuitable. The methods according to the present invention , wherein
B cells are used as APCs for the T cells, are therefore preferred.
[0031] Furthermore, a method according to the invention is also preferred for testing CD4+
T cells.
In vivo, CD4+ helper T cells elicit anti-pathogenic and antitumor responses via the production
of multiple effector cytokines, which activate CTL and induce maturation of antibody
producing B cells. For adoptive cell therapy of a cancer patient, tumor infiltrating
lymphocytes (TILs) are preferably used. Typically, in TILs the proportion of CD4+
T cells is higher than the proportion of CD8+ CTL. Therefore, investigation of CD4+
T cell epitopes is an important application for adoptive cell therapy. The use of
CD4+ cells is advantageous, since this provides an effective T cell response whereas
the need for lymphodepletion is diminished as compared to the use of CD8+ CTLs. The
use of a CD4+ T cell epitope in a medicament or vaccine is also advantageous, since
such medicament or vaccine will typically elicit an effective immune response in an
individual. Determination of CD4+ T cell epitope recognition is, therefore, a preferred
embodiment. However, the production of MHC class II multimers with UV sensitive, exchangeable
peptides is more difficult than the production of peptide-MHC-I multimers, because
MHC-II molecules have a peptide-binding site that is composed of two different polypeptides,
as opposed to MHC-I molecules whose peptide-binding site is composed of only one polypeptide.
Since peptide-MHC-II multimers are not commonly available, and also in view of the
fact that peptide-MHC-II multimers cannot be used for determining T cell activation,
and in view of the fact that MHC-II is expressed on certain kinds of cells only, a
method according to the invention wherein B cells are used as APCs for testing CD4+
T cell epitope recognition is a particularly preferred embodiment.
[0032] One particular embodiment provides a method according to the invention wherein said
at least one B cell and said T cells are from the same human individual. This embodiment
is particularly advantageous if T cell recognition of certain epitopes is tested with
the aim of using the T cells as a medicament against a certain disorder. One interesting
application is adoptive cell therapy. A patient suffering from a disease often exhibits
an immune response against the disease. In case of cancer, such immune response is
typically directed against protein mutations that are present in the tumor, but not
in the original healthy tissue of the individual, so that the mutations are recognized
as non-self. Such mutations are referred to herein as "tumor-specific mutations" or
"tumor-specific amino acid sequences" (although the same kind of amino acid sequence
may occur in other diseases or pathogens as well) and the resulting antigen is typically
referred to as a "modified self antigen". Furthermore, a "disease-specific T cell
epitope" is defined herein as a T cell epitope whose presence in an individual is
associated with disease. A disease-specific T cell epitope for instance comprises
a T ell epitope from a surface protein of a pathogen. The same kind of T cell epitope
may occur in various diseases or pathogens, but is typically not - or to a significantly
lower extent - present in healthy tissue of the individual.
[0033] An individual's immune response is, however, often not sufficient to combat the disease,
for instance due to escape mechanisms and/or immunoregulatory cells. In such case,
T cells from the patient are preferably tested with a method according to the invention.
When B cells from the same patient are used, background signals are further reduced
because autologous B cells are less immunogenic for the T cells as compared to allogeneic
B cells. For adoptive cell therapy, B cells from a patient are thus preferably incubated
with compounds that comprise or encode disease-specific T cell epitopes, such as tumor-specific
or pathogen-specific amino acid sequences, and T cell recognition is tested using
T cells from the same patient.
[0034] T cells recognizing such disease-specific epitope are preferably expanded
in vitro and subsequently administered to the patient, which will for instance result in an
anti-tumor or anti-pathogen T cell response. Alternatively, or additionally, a disease-specific
T cell epitope that is recognized by a patient's T cells is administered to the patient
in order to boost his/her immune system, resulting in an enhanced immune response.
Such disease-specific T cell epitope may be administered as such, or as part of a
larger complex such as for instance an oligopeptide, protein, epitope-carrier complex,
or epitope-MHC complex. In one embodiment, such disease-specific T cell epitope is
bound to an antigen-presenting cell, preferably a B cell from a B cell culture as
prepared in a method according to the present invention. Administration of such APCs
will elicit or boost an anti-tumor response
in vivo.
[0035] One preferred embodiment provides a method according to the invention, wherein said
T cell epitope is from a modified self-antigen. Said T cell epitope preferably comprises
a tumor-specific amino acid sequence. Said tumor may be any kind of tumor. Preferred
examples are melanoma, epithelial cancer, lung squamous cell carcinoma, lung adenocarcinoma,
stomach cancer, esophagus cancer, lung small cell carcinoma, colorectal cancer, bladder
cancer, uterine cancer, cervical cancer, liver cancer, head and neck cancer, kidney
clear cell cancer, B cell lymphoma, kidney papillary cancer, breast cancer, pancreas
cancer, myeloma, ovary cancer, prostate cancer, glioblastoma, glioma, neuroblastoma,
medulloblastoma, CLL, chromophobe renal cell carcinoma, thyroid cancer, ALL, AML and
pilocytic astrocytoma. Preferably, said T cell epitope is a melanoma-specific epitope
or an epithelial cancer-specific epitope. Also provided is a method according to the
invention, wherein the B cells are incubated with T cells from an individual suffering
from, or having suffered from, cancer, preferably melanoma or epithelial cancer.
[0036] Another preferred embodiment provides a method according to the invention wherein
said T cell epitope is a from a non-self antigen, preferably from a pathogen. Said
pathogen is preferably a virus, a bacterium or a parasite, since these pathogens typically
raise a cell-mediated immune response
in vivo. In one embodiment, for instance, in order to develop a T cell vaccine against a certain
pathogen, peptides are produced based on the sequence of surface proteins of said
pathogen. B cells from a B cell culture as described herein are incubated with these
peptides and, subsequently, with T cells. Preferably, T cells are used that are from
an individual who has been exposed to said pathogen before, so that memory T cells
will be present. If one or more test peptides appear to be recognized by T cells,
these peptides are candidates for a vaccine against said pathogen. Again, the sensitivity
of such screening method according to the present invention is important.
[0037] Also provided is therefore a method according to the invention, wherein the B cells
are incubated with T cells from an individual suffering from, or having suffered from,
a pathogen, preferably a virus, a bacterium or a parasite.
[0038] Another preferred embodiment provides a method according to the invention wherein
said T cell epitope is from an autoantigen. This means that such T cell epitope is
present in proteins (or nucleic acid) that naturally occur in an individual, wherein
the epitope is normally tolerated by an individual's immune system but wherein the
epitope is recognized by the immune system of an individual suffering from an autoimmune
disease. Non-limiting examples of such autoimmune diseases include diabetes type I
(immune response against insulin-producing pancreatic cells), multiple sclerosis (immune
response against the insulating covers of nerve cells) and coeliac disease, wherein
exposure to gluten protein causes the immune system to cross-react with small intestine
tissue. In some embodiments, screening methods according to the present invention
are used in order to determine whether a sample comprises T cells that recognize an
autoantigen. For instance, B cells wherein the expression of Bcl-6 and Bcl-xL have
been induced, enhanced and/or maintained are incubated with one or more autoantigens
(or peptides derived thereof), where after T cell epitopes will be displayed at the
surface of the B cells. Subsequently, the B cells are incubated with T cells from
a sample. If one or more T cell epitopes appear to be bound by T cells from said sample,
it is concluded that said sample comprises T cells that recognize an autoantigen.
Such sample is then typically typed as being specific for a certain autoimmune disease.
In some embodiments, this result is subsequently used for determining whether an individual
from which the sample has been obtained is suffering from, or at risk of suffering
from, an autoimmune disease.
[0039] In some embodiments, a screening assay according to the invention is performed in
order to test for potential autoimmune T cell epitopes. According to these embodiments,
B cells wherein the expression of Bcl-6 and Bcl-xL have been induced, enhanced and/or
maintained are incubated with one or more test compounds, preferably peptides, where
after the peptide-loaded B cells are incubated with T cells from an autoimmune patient.
Peptides that appear to be bound by these T cells are subsequently selected, for instance
for further autoimmunity research.
[0040] Also provided is therefore a method according to the invention, wherein the B cells
are incubated with T cells from an individual suffering from, or having suffered from,
an autoimmune disease, preferably multiple sclerosis, diabetes or coeliac disease.
[0041] As used herein, a T cell epitope "from" a modified self-antigen, or "from" a non-self
antigen or "from" an autoantigen means a T cell epitope sequence, wherein said sequence
is also present on, or in, said modified self-antigen or non-self antigen or autoantigen,
respectively. Said T cell epitope could for instance be a peptide obtained from said
antigen (for instance via internalization and processing of an antigen by a B cell,
where after a T cell epitope is presented at the B cell's surface in the context of
MHC) or said T cell epitope could be artificially produced, for instance using a recombinant
cellular peptide production platform or a chemical peptide synthesizer. Hence, a T
cell epitope "from" a certain antigen does not need to be physically obtained from
said antigen. Instead, once the sequence of such T cell epitope is known, said T ell
epitope may be separately produced. Said T cell epitope preferably comprises a peptide.
In some embodiments, said T cell epitope is part of a protein or polypeptide or other
proteinaceous compound.
[0042] As used herein, the term "B cell" means a B cell that has been obtained from an individual,
or a B cell that originates from such B cell. Said individual is preferably a mammal,
such as for instance a human, mouse, rat, rabbit, ape, monkey, cow, sheep, dog or
cat. In one preferred embodiment, said individual is a human individual or a rabbit.
An example of B cells originating from an individual's B cell is the progeny of a
B cell from an individual, that is formed
in vitro after one or more cell division cycles. Such progeny for instance includes an
ex vivo B cell culture.
[0043] An
ex vivo B cell culture is a culture that contains B cells and/or progeny thereof. Other kinds
of cells may also be present in the culture. For instance, B cell stimulator cells
such as CD40 positive L cells and/or EL4B5 cells are typically also present in a B
cell culture used in the invention. Additionally, other kinds of cells, which were
also present in a sample from an individual from which the B cells were obtained,
could still be present in a B cell culture. When present in B cell culturing conditions,
such non-B cells are typically less capable of proliferating as compared to B cells,
so that the number of such contaminating cells will typically decline in time. Preferably,
at least 70% of the cells of a B cell culture are B cells. More preferably, at least
75%, 80%, 85%, 90% or 95% of the cells of said B cell culture are B cells. In one
embodiment, B cells and B cell stimulator cells such as CD40 positive L cells and/or
EL4B5 cells are essentially the only kinds of cell present in a B cell culture as
used in the invention. In some embodiments, essentially all cells of said B cell culture
are B cells.
[0044] Bcl-6 encodes a transcriptional repressor which is required for normal B cell and
T cell development and maturation and which is required for the formation of germinal
centers. Bcl-6 is highly expressed in germinal center B cells whereas it is hardly
expressed in plasma cells. Bcl-6 inhibits differentiation of activated B cells into
plasma cells. In a method according to the invention, Bcl-6 expression product remains
present in the B cells of an
ex vivo culture. The presence of Bcl-6 expression product, together with the presence of
an anti-apoptotic nucleic acid, prolongs the replicative life span of the B cells.
Expression of Bcl-6 is preferably induced, enhanced or maintained by administering
a Bcl-6 expression-promoting compound to the original B cell(s) used for culturing,
or by culturing B cells in the presence of such compound.
[0045] Further provided is therefore a method according to the invention, wherein expression
of Bcl-6 in said at least one B cell is induced, enhanced and/or maintained by:
- providing said B cell with a compound capable of directly or indirectly enhancing
expression of Bcl-6; and/or
- culturing said B cell in the presence of a compound capable of directly or indirectly
enhancing expression of Bcl-6.
[0046] As used herein, the term "Bcl-6" also embraces homologues thereof, such as Bcl-6
homologues that are present in non-human mammals.
[0047] Various compounds capable of directly or indirectly enhancing expression of Bcl-6
are known in the art. Such compound for instance comprises a Signal Transducer of
Activation and Transcription 5 (STAT5) protein, or a functional part or a functional
derivative thereof, and/or a nucleic acid sequence coding therefore. STAT5 is a signal
transducer capable of enhancing Bcl-6 expression. There are two known forms of STAT5,
STAT5a and STAT5b, which are encoded by two different, tandemly linked genes. Administration
and/or activation of STAT5, or a homologue thereof, results in enhanced levels of
Bcl-6. Hence, STAT5, or a homologue thereof, or a functional part or a functional
derivative thereof, is capable of directly increasing expression of Bcl-6. Provided
is therefore a method according to the invention, comprising:
- inducing, enhancing and/or maintaining expression of STAT5 in at least one B cell;
- inducing, enhancing and/or maintaining expression of an anti-apoptotic nucleic acid
in said at least one B cell;
- allowing expansion of said at least one B cell into a B cell culture;
- incubating B cells of said B cell culture with at least one compound;
- incubating the resulting B cells with T cells; and
- determining whether at least one T cell recognizes at least one T cell epitope of
said at least one compound. Also provided is a method according to the invention,
wherein expression of Bcl-6 in said at least one B cell is induced, enhanced and/or
maintained by providing said B cell with STAT5, or with a homologue thereof, or with
a functional part or a functional derivative thereof. Alternatively, or additionally,
expression of Bcl-6 in said at least one B cell is induced, enhanced and/or maintained
by providing said B cell with a nucleic acid molecule encoding STAT5, or a homologue
thereof, or a functional part or a functional derivative thereof, or by culturing
said B cell in the presence of STAT5, or in the presence of a homologue, or functional
part, or functional derivative thereof.
[0048] The presence of STAT5 directly increases the amount of Bcl-6. It is also possible
to indirectly increase expression of Bcl-6. This is for instance done by regulating
the amount of a certain compound, which in turn is capable of directly or indirectly
activating STAT5, or a homologue thereof, and/or increasing expression of STAT5, or
expression of a homologue thereof. Hence, in one embodiment the expression and/or
activity of endogenous and/or exogenous STAT5, or the expression of a homologue thereof,
is increased.
[0049] As used herein, the term "homologue" of, for instance, Bcl-6 or STAT5 or Blimp-1
means a mammalian protein corresponding to Bcl-6 or STAT5 or Blimp-1, respectively,
which means that it has a corresponding, similar function in non-human B cells as
compared to the function of Bcl-6 or STAT5 or Blimp-1 in human B cells.
[0050] It is preferred to provide a B cell with a nucleic acid molecule encoding Bcl-6,
or encoding a homologue thereof, or a functional part or a functional derivative thereof.
This way, it is possible to directly regulate the amount of Bcl-6 expression product
in said B cell. Also provided is therefore a method according to the invention, wherein
expression of Bcl-6 in said at least one B cell is induced, enhanced and/or maintained
by providing said B cell with a nucleic acid molecule encoding Bcl-6, or encoding
a homologue, or a functional part, or a functional derivative of Bcl-6. In one embodiment,
said nucleic acid molecule is constitutively active, meaning that Bcl-6, or a homologue,
functional part or functional derivative thereof, is continuously expressed, independent
of the presence of a regulator. In another embodiment, said nucleic acid molecule
is inducible, meaning that the expression thereof is regulated by at least one inducer
and/or repressor. This way, expression of said nucleic acid molecule is regulated
at will. For instance, Tet-On and Tet-Off expression systems (for example Tet-On®
and Tet-Off® Advanced Inducible Gene Expression Systems, Clontech) can be used for
inducible expression of a nucleic acid sequence of interest. In these systems expression
of the transcriptional activator (tTA) is regulated by the presence (Tet-On) or absence
(Tet-Off) of tetracycline (TC) or a derivative like doxycycline (dox). In principle,
tTA is composed of the
Escherichia coli Tet repressor protein (TetR) and the
Herpes simplex virus transactivating domain VP16. tTA regulates transcription of a nucleic acid
sequence of interest under the control of a tetracycline-responsive element (TRE)
comprising the Tet operator (TetO) DNA sequence and a promoter sequence, for instance
the human cytomegalovirus (hCMV) promoter. A nucleic acid sequence encoding, for instance,
Bcl6, or a homologue or functional part or functional derivative thereof, can be placed
downstream of this promoter.
[0051] In the Tet-off system, tTA binds to TRE in the absence of TC or dox and transcription
of a nucleic acid sequence of interest is activated, whereas in the presence of TC
or dox tTA cannot bind TRE and expression of a nucleic acid sequence of interest is
inhibited. In contrast, the Tet-on system uses a reverse tTA (rtTA) that can only
bind the TRE in the presence of dox. Transcription of a nucleic acid sequence of interest
is inhibited in the absence of dox and activated in the presence of dox.
[0052] In another embodiment, inducible expression is executed using a hormone inducible
gene expression system such as for instance an ecdysone inducible gene expression
system (for example RheoSwitch®, New England Biolabs) (
Christopherson, K.S. et al. PNAS 89, 6314-8 (1992)). Ecdysone is an insect steroid hormone from for example
Drosophila melanogaster. In cells transfected with the ecdysone receptor, a heterodimer consisting of the
ecdysone receptor (Ecr) and retinoid X receptor (RXR) is formed in the presence of
an ecdyson agonist selected from ecdysone, one of its analogues such as muristerone
A and ponasterone A, and a non-steroid ecdysone agonist. In the presence of an agonist,
Ecr and RXR interact and bind to an ecdysone response element that is present on an
expression cassette. Expression of a nucleic acid sequence of interest that is placed
in an expression cassette downstream of the ecdysone response element is thus induced
by exposing a B-cell to an ecdyson agonist.
[0053] In yet another embodiment of the invention inducible expression is executed using
an arabinose-inducible gene expression system (for example pBAD/gIII kit, Invitrogen)
(
Guzman, L. M. et al. Bacteriol 177, 4121-4130 (1995)). Arabinose is a monosaccharide containing five carbon atoms. In cells transfected
with the arabinose-inducible promoter PBAD, expression of a nucleic acid sequence
of interest placed downstream of PBAD can then be induced in the presence of arabinose.
[0054] It is also possible to use (a nucleic acid molecule encoding) a Bcl-6 protein, or
a homologue or functional part or functional derivative thereof, wherein the activity
of said Bcl-6 or homologue or functional part or functional derivative is regulated
by at least one inducer and/or repressor. A non-limiting example is a fusion protein
wherein a regulatory element is fused to a sequence encoding at least part of Bcl-6.
For instance, an estrogen receptor (ER) is fused to Bcl-6, resulting in fusion protein
ER-Bcl-6. This fusion protein is inactive because it forms a complex with heat shock
proteins in the cytosol. Upon administration of the exogenous inducer 4 hydroxy-tamoxifen
(4HT), the fusion protein ER-Bcl-6 dissociates from the heat shock proteins, so that
the Bcl-6 part of the fusion protein becomes active.
[0055] As used herein, the term "anti-apoptotic nucleic acid molecule" refers to a nucleic
acid molecule, which is capable of delaying and/or preventing apoptosis in a B cell.
Preferably, said anti-apoptotic nucleic acid molecule is capable of delaying and/or
preventing apoptosis in a plasmablast-like B cell, which is typically present in a
B cell culture as used in the invention. Preferably, an anti-apoptotic nucleic acid
molecule is used which comprises an exogenous nucleic acid molecule. This means that
either a nucleic acid sequence is used which is not naturally expressed in B cells,
or that an additional copy of a naturally occurring nucleic acid sequence is used,
so that expression in the resulting B cells is enhanced as compared to natural B cells
in vivo. Various anti-apoptotic nucleic acid molecules are known in the art, so that various
embodiments are available. Preferably, an anti-apoptotic nucleic acid molecule is
used which is an anti-apoptotic member of the Bcl-2 family because anti-apoptotic
Bcl-2 proteins are good apoptosis inhibiters in B cells. Many processes that are controlled
by the Bcl-2 family (which family includes both pro- and anti-apoptotic proteins)
relate to the mitochondrial pathway of apoptosis. The use of anti-apoptotic Bcl-2
family members Bcl-2, Bcl-xL, Bcl-w, Bcl-2-related protein A1 (also named Bcl2-A1
or A1), Bcl-2 like 10 (Bcl2L10) and Mcl-1, or a homologue thereof, or a functional
part or functional derivative thereof, is preferred because Bcl-2, Bcl-xL, Bcl-w,
A1, Bcl2L10 and Mcl-1 are generally integrated with the outer mitochondrial membrane.
They directly bind and inhibit the pro-apoptotic proteins that belong to the Bcl-2
family to protect mitochondrial membrane integrity.
[0056] A preferred embodiment therefore provides a method according to the invention, wherein
said anti-apoptotic nucleic acid molecule comprises an anti-apoptotic gene of the
Bcl2 family, preferably Bcl-xL or Mcl-1 or Bcl-2 or A1 or Bcl-w or Bcl2L10, or a homologue
thereof, or a functional part or a functional derivative thereof.
[0057] In one embodiment, expression of Bcl-xL or Mcl-1 or Bcl-2 or A1 or Bcl-w or Bcl2L10,
or a homologue thereof, is induced, enhanced or maintained by administering at least
one compound, capable of promoting expression of any of these anti-apoptotic genes,
to B cell(s), or by culturing B cells in the presence of such compound(s). Further
provided is therefore a method according to the invention, comprising:
- providing said B cell with a compound capable of directly or indirectly enhancing
expression of Bcl-xL and/or Mcl-1 and/or Bcl-2 and/or A1 and/or Bcl-w and/or Bcl2L10,
or a homologue thereof; and/or
- culturing said B cell in the presence of a compound capable of directly or indirectly
enhancing expression of Bcl-xL and/or Mcl-1 and/or Bcl-2 and/or A1 and/or Bcl-w and/or
Bcl2L10, or a homologue thereof.
[0058] Preferably, however, a B cell is provided with at least one nucleic acid molecule
encoding an anti-apoptotic gene of the Bcl2 family, preferably selected from the group
consisting of Bcl-xL, Mcl-1, Bcl-2, A1, Bcl-w, Bcl2L10, and homologues thereof and
functional parts thereof and functional derivatives thereof. This way, it is possible
to directly enhance the amount of expression product in said B cell. Also provided
is therefore a method according to the invention, comprising providing said B cell
with at least one nucleic acid molecule encoding an anti-apoptotic gene of the Bcl2
family, preferably selected from the group consisting of Bcl-xL, Mcl-1, Bcl-2, A1,
Bcl-w, Bcl2L10, and homologues thereof, and functional parts and functional derivatives
thereof. In one embodiment, said nucleic acid molecule is constitutively active, meaning
that said nucleic acid molecule is continuously expressed. In another embodiment,
said nucleic acid molecule is inducible, meaning that the expression thereof is regulated
by at least one inducer and/or repressor. Non-limiting examples of inducible nucleic
acid expression systems known in the art are described herein before.
[0059] In a particularly preferred embodiment said anti-apoptotic nucleic acid molecule
encodes Bcl-xL or Mcl-1, or a homologue thereof, or a functional part or a functional
derivative thereof. According to the present invention, a combination of Bcl-6 and
Bcl-xL is particularly well capable of increasing the replicative life span of B-cells,
thereby forming long term cultures of the resulting plasmablast-like B-cells. The
same holds true for a combination of Bcl-6 and Mcl-1. Most preferably, said anti-apoptotic
nucleic acid encodes Bcl-xL or a functional part or a functional derivative thereof.
[0060] US 2010/0113745 A1 describes the production of long term
ex vivo B cell cultures wherein the expression of Bcl6, and preferably also Bcl-xL, is increased
in the B cells.
[0061] A functional part of Bcl-6, Bcl-xL, Mcl-1, Bcl-2, A1, Bcl-w or Bcl2L10, or of a homologue
thereof, is a proteinaceous molecule that has the same capability - in kind, not necessarily
in amount - of increasing the replicative life span of a B cell as compared to natural
Bcl-6, Bcl-xL, Mcl-1, Bcl-2, A1, Bcl-w or Bcl2L10, or a homologue thereof, respectively.
Such functional part is for instance devoid of amino acids that are not, or only very
little, involved in said capability.
[0062] For instance, functional parts of Bcl-xL, Mcl-1, Bcl-2, A1, Bcl-w and Bcl2L10, or
of a homologue thereof, are defined herein as fragments of Bcl-xL, Mcl-1, Bcl-2, A1,
Bcl-w and Bcl2L10, respectively, or of a homologue thereof, which have retained the
same kind of anti-apoptotic characteristics as full length Bcl-xL, Mcl-1, Bcl-2, A1,
Bcl-w and Bcl2L10, respectively, or a homologue thereof (in kind, but not necessarily
in amount). Functional parts of Bcl-xL, Mcl-1, Bcl-2, A1, Bcl-w or Bcl2L10, or of
a homologue thereof, are typically shorter fragments of Bcl-xL, Mcl-1, Bcl-2, A1,
Bcl-w or Bcl2L10, respectively, or of a homologue thereof, which are capable of delaying
and/or preventing apoptosis in a B-cell. Such functional parts are for instance devoid
of sequences which do not significantly contribute to the anti-apoptotic activity
of Bcl-xL, Mcl-1, Bcl-2, A1, Bcl-w and Bcl2L10. A functional part of Bcl-6, or of
a homologue thereof, is typically a shorter fragment of Bcl-6, or a shorter fragment
of a homologue thereof, which is also capable of increasing the replicative life span
of a B cell.
[0063] A functional derivative of Bcl-6, Bcl-xL, Mcl-1, Bcl-2, A1, Bcl-w or Bcl2L10, or
of a homologue thereof, is defined as a Bcl-6, Bcl-xL, Mcl-1, Bcl-2, A1, Bcl-w or
Bcl2L10 protein, respectively, or a homologue thereof, which has been altered but
has maintained its capability (in kind, not necessarily in amount) of increasing the
replicative life span of a B cell. A functional derivative is provided in many ways,
for instance through conservative amino acid substitution wherein one amino acid is
substituted by another amino acid with generally similar properties (size, hydrophobicity,
etc), such that the overall functioning is not seriously affected. Alternatively,
a functional derivative for instance comprises a fusion protein with a detectable
label or with an inducible compound.
[0064] Besides increasing Bcl-6 expression and the expression of an anti-apoptotic nucleic
acid molecule, it is also advantageous to induce, enhance and/or maintain expression
of Blimp-1, or a homologue thereof, in a B-cell. One aspect thus provides a method
according to the invention, wherein the method further comprises inducing, enhancing
and/or maintaining expression of Blimp-1, or a homologue thereof, in said at least
one B-cell.
[0065] The extent of expression of Blimp-1, or of a homologue thereof, in a B cell is regulated
in a variety of ways. In one embodiment a B cell is provided with a compound, which
is capable of directly or indirectly increasing expression of Blimp-1, or of a homologue
thereof. Additionally, or alternatively, a B cell is cultured in the presence of a
compound capable of directly or indirectly increasing expression of Blimp-1, or of
a homologue thereof. Further provided is therefore a method according to the invention,
further comprising:
- providing said B cell with a compound capable of directly or indirectly increasing
expression of Blimp-1, or expression of a Blimp-1 homologue; and/or
- culturing said B cell in the presence of a compound capable of directly or indirectly
increasing expression of Blimp-1, or expression of a Blimp-1 homologue.
[0066] Said compound capable of increasing Blimp-lexpression most preferably comprises IL21.
Hence, in one preferred embodiment of the present invention, B cells are cultured
in the presence of IL21, at least during part of the culture time.
[0067] In another embodiment said compound capable of increasing Blimp-1 expression comprises
a Signal Transducer of Activation and Transcription 3 (STAT3) protein or a functional
part or a functional derivative thereof, and/or a nucleic acid molecule coding therefore.
STAT3 is a signal transducer, which is involved in B cell development and differentiation.
STAT3 is capable of upregulating Blimp-1 expression. In one preferred embodiment,
a B cell is provided with a nucleic acid molecule encoding STAT3 or a functional part
or a functional derivative thereof, wherein the expression of said nucleic acid molecule
is regulated by an exogenous inducer of repressor, so that the extent of STAT3 expression
is regulated at will. For instance, one of the earlier mentioned inducible expression
systems is used. In one embodiment a fusion product comprising STAT3, or a functional
part or a functional derivative, and ER is used. For instance, a B cell is provided
with a nucleic acid molecule encoding an estrogen receptor (ER) and STAT3 as a fusion
protein ER-STAT3. This fusion protein is inactive because it forms a complex with
heat shock proteins in the cytosol. This way, STAT3 is unable to reach the nucleus
and Blimp-1 expression is not enhanced. Upon administration of the exogenous inducer
4 hydroxy-tamoxifen (4HT), the fusion protein ER-STAT3 dissociates from the heat shock
proteins, so that STAT3 is capable of entering the nucleus and activating Blimp-1
expression.
[0068] As used herein, a functional part of STAT3 is defined as a fragment of STAT3 that
has the same capability - in kind, not necessarily in amount - of increasing expression
of Blimp-1, or of a homologue thereof, as compared to natural STAT3. Such functional
part is for instance devoid of amino acids that are not, or only very little, involved
in said capability.
[0069] A functional derivative of STAT3 is defined as a STAT3 protein, which has been altered
but has maintained its capability (in kind, not necessarily in amount) of increasing
expression of Blimp-1, or of a homologue thereof. A functional derivative is provided
in many ways, for instance through conservative amino acid substitution wherein one
amino acid is substituted by another amino acid with generally similar properties
(size, hydrophobicity, etc), such that the overall functioning is not seriously affected.
Alternatively, a functional derivative for instance comprises a fusion protein with
a detectable label or with an inducible compound.
[0070] Since STAT3 is capable of increasing expression of Blimp-1, it is also possible to
indirectly increase expression of Blimp-1, or of a Blimp-1 homologue, by administering
a compound capable of increasing the activity and/or expression of STAT3. In one embodiment,
a B cell is therefore provided with a compound that is capable of enhancing the activity
of STAT3, so that expression of Blimp-1, or of a Blimp-1 homologue, is indirectly
enhanced.
[0071] STAT3 is activated in a variety of ways. Preferably, STAT3 is activated by providing
a B cell with a cytokine. Cytokines, being naturally involved in B cell differentiation,
are very effective in regulating STAT proteins. Very effective activators of STAT3
are IL21 and IL6, but also IL2, IL7, IL10, IL15 and IL27 are known to activate STAT3.
Moreover, Toll-like receptors (TLRs), which are involved in innate immunity, are also
capable of activating STAT3. One embodiment therefore provides a method of the invention,
wherein said B cell is cultured in the presence of IL21, IL2, IL6, IL7, IL10, IL15
and/or IL27. Most preferably IL21 is used, since IL21 is particularly suitable for
upregulating Blimp-1 expression, even when Blimp-1 expression is counteracted by BCL6.
[0072] Additionally, or alternatively a mutated Janus kinase (JAK), or a mutated homologue
of a JAK, is used in order to activate STAT3. Naturally, a JAK is capable of phosphorylating
STAT3 after it has itself been activated by at least one cytokine. A mutated Janus
kinase, or a mutated homologue of a JAK, capable of activating STAT3 independently
of the presence of cytokines, is particularly suitable in a method according to the
present invention.
[0073] In yet another embodiment, expression of Blimp-1, or of a Blimp-1 homologue, is increased
by providing a B cell with a suppressor of cytokine signalling (SOCS) protein, or
a SOCS homologue, and/or by activating a SOCS protein or a SOCS homologue within said
cell. Alternatively, or additionally, at least one of the E-proteins E47, E12, E2-2
and HEB is used in order to increase expression of Blimp-1, or expression of a Blimp-1
homologue. E47 is a transcription factor that belongs to a family of helix-loop-helix
proteins, named E-proteins. There are four E-proteins, E12, E47, E2-2 and HEB, which
are involved in lymphocyte development. E12 and E47 are encoded by one gene, named
E2A, which is spliced differently. E proteins have been described as tumor suppressors.
One of the specific targets of E47 are the Socs1 and Socs3 genes.
[0074] One aspect thus provides a method according to the present invention, further increasing
expression of Blimp-1 in a B cell by providing said B cell with a compound capable
of directly or indirectly increasing expression of Blimp-1 and/or culturing said B
cell in the presence of a compound capable of directly or indirectly increasing expression
of Blimp-1, wherein said compound comprises:
- STAT3 or a functional part or a functional derivative thereof, and/or
- a compound capable of activating STAT3, and/or
- a compound capable of enhancing expression of STAT3, and/or
- IL21, IL2, IL6, IL7, IL10, IL15, IL27, a SOCS protein, one of the E-proteins E47,
E12, E2-2 or HEB, a mutated Janus kinase and/or a nucleic acid sequence encoding STAT3
, or a homologue or a functional part or a functional derivative thereof.
[0075] Most preferably, said compound is IL21.
[0076] As described above, methods according to the present invention are particularly suitable
for developing medicaments and vaccines, preferably against tumors, pathogens and/or
autoimmune diseases. One aspect therefore provides a method according to the invention,
further comprising preparing a medicament comprising T cells that recognize at least
one T cell epitope of or encoded by the tested compounds. Further provided is also
a medicament comprising T cells that recognize a disease-specific epitope, preferably
a tumor-specific epitope or a T cell epitope from a pathogen or an autoantigen, when
obtained with a method according to the invention. Said medicament preferably further
comprises a pharmaceutically acceptable carrier, diluent or excipient. Said medicament
is preferably a medicament against melanoma, epithelial cancer, lung squamous cell
carcinoma, lung adenocarcinoma, stomach cancer, esophagus cancer, lung small cell
carcinoma, colorectal cancer, bladder cancer, uterine cancer, cervical cancer, liver
cancer, head and neck cancer, kidney clear cell cancer, B cell lymphoma, kidney papillary
cancer, breast cancer, pancreas cancer, myeloma, ovary cancer, prostate cancer, glioblastoma,
glioma, neuroblastoma, medulloblastoma, CLL, chromophobe renal cell carcinoma, thyroid
cancer, ALL, AML or pilocytic astrocytoma. Most preferably, said medicament is against
melanoma or epithelial cancer.
[0077] In some embodiments, said medicament is against an infectious disease, preferably
caused by a virus, bacterium or parasite.
[0078] As used herein, the term "medicament against" a certain disease means that said medicament
is capable of at least in part treating or preventing, or delaying, the onset or progression
of said disease. Additionally, or alternatively, said medicament is capable of at
least in part alleviating at least one symptom of said disease.
[0079] Another aspect provides a method according to the invention, further comprising identifying
at least one T cell epitope that is recognized by a T cell in the test assay. Such
epitope recognized by a T cell is preferably used for preparing an immunogenic composition,
or a prophylactic agent or vaccine.
[0080] A further aspect provides a method according to the invention, further comprising
preparing an immunogenic composition, or a prophylactic agent or vaccine, comprising
a B cell which displays at its surface at least one T cell epitope recognized by a
T cell in the test assay. An immunogenic composition, or a prophylactic agent or vaccine,
according to the invention preferably further comprises a pharmaceutically acceptable
carrier, diluent or excipient.
[0081] An immunogenic composition, or a prophylactic agent or vaccine, comprising a disease-specific
T cell epitope, preferably a tumor-specific T cell epitope or a T cell epitope from
a pathogen or an autoantigen, when obtained with a method according to the invention,
is also provided. Said T cell epitope may be displayed on the surface of an antigen-presenting
cell, preferably a B cell as used herein.
[0082] As discussed before, one of the advantages of a method according to the present invention
is the very low extent (if any) of background signals that is obtained, so that even
a low extent of T cell recognition can be detected. This is particularly advantageous
if the B cells, loaded with test compounds, are incubated with T cells from an individual
suffering from a disorder. If disease-specific T cell levels within said individual
are low, epitope recognition by these low amounts of T cells is easily overlooked
in existing EBV immortalized B cell assays due to many background signals caused by
the relatively high frequencies of EBV-specific T cells in most individuals. A method
according to the invention provides a solution for this. As shown in the Examples,
even low numbers of T cell epitope recognizing T cells are detectable with a method
according to the invention. For instance, with the use of EBV immortalized B cells
as APCs only one very prominent disease-specific T cell response was detected, wherein
the amount of the T cells of interest was as large as 24% of the total T cells within
the infusion cell product. On the other hand, with the use of a method according to
the present invention, using B cells wherein the expression of Bcl-6 and Bcl-xL is
induced, enhanced and/or maintained, it has become possible to detect T cell responses
with a much lower frequency, even as low as 0.264 - 0.053% (Figures 3b and 3c). One
preferred embodiment therefore provides a method according to the invention, wherein
said T cells are from a sample from said individual, characterized in that the proportion
of T cells specific for a T cell epitope that is associated with said disease, relative
to the total amount of T cells, is lower than 24%, more preferably lower than 23%,
more preferably lower than 22%, more preferably lower than 21%, more preferably lower
than 20%, more preferably lower than 15%, more preferably lower than 10%, more preferably
lower than 9%, more preferably lower than 8%, more preferably lower than 7%, more
preferably lower than 6%, more preferably lower than 5% in said sample or in a T cell
culture after
in vitro expansion of said sample.
[0083] In preferred embodiments, a method according to the invention is provided wherein
said T cells are from a sample from said individual, characterized in that the proportion
of T cells specific for a T cell epitope that is associated with a disorder of interest,
relative to the total amount of T cells, is lower than 1.9%, more preferably lower
than 1.8%, more preferably lower than 1.7%, more preferably lower than 1.6%, more
preferably lower than 1.5% in said sample or in a T cell culture after
in vitro expansion of said sample.
[0084] In further preferred embodiments, said T cells are from a sample from said individual,
characterized in that the proportion of T cells specific for a T cell epitope that
is associated with a disorder of interest, relative to the total amount of T cells,
is lower than 1.0%, more preferably lower than 0.9%, more preferably lower than 0.8%,
more preferably lower than 0.7%, more preferably lower than 0.6%, more preferably
lower than 0.5%, more preferably lower than 0.4%, more preferably lower than 0.3%
in said sample or in a T cell culture after
in vitro expansion of said sample. In one embodiment, said proportion is between 0.264% and
0.053%. In further embodiments, said proportion is 0.264% or lower. In further embodiments,
said proportion is 0.246% or lower. In further embodiments, said proportion is 0.096%
or lower. In further embodiments, said proportion is 0.053% or lower.
[0085] Also provided is a method according to the invention, wherein a sample from said
individual is used, or wherein T cells of a resulting T cell culture after
in vitro expansion of said sample are used, wherein the percentage of T cells specific for
a T cell epitope that is associated with said disease, relative to the total number
of T cells in said sample or in said resulting
in vitro T cell culture, is lower than 24%, more preferably lower than 23%, more preferably
lower than 22%, more preferably lower than 21%, more preferably lower than 20%, more
preferably lower than 15%, more preferably lower than 10%, more preferably lower than
9%, more preferably lower than 8%, more preferably lower than 7%, more preferably
lower than 6%, more preferably lower than 5%.
[0086] In preferred embodiments, a method according to the invention is provided wherein
a sample from said individual is used, or wherein T cells of a resulting T cell culture
after
in vitro expansion of said sample are used, wherein the percentage of T cells specific for
a T cell epitope that is associated with a disorder of interest, relative to the total
number of T cells in said sample or in said resulting
in vitro T cell culture, is lower than 1.9%, more preferably lower than 1.8%, more preferably
lower than 1.7%, more preferably lower than 1.6%, more preferably lower than 1.5%.
[0087] In further preferred embodiments, a method according to the invention is provided
wherein a sample from said individual is used, or wherein T cells of a resulting T
cell culture after
in vitro expansion of said sample are used, wherein the percentage of T cells specific for
a T cell epitope that is associated with a disorder of interest, relative to the total
number of T cells in said sample or in said resulting
in vitro T cell culture, is lower than 1.0%, more preferably lower than 0.9%, more preferably
lower than 0.8%, more preferably lower than 0.7%, more preferably lower than 0.6%,
more preferably lower than 0.5%, more preferably lower than 0.4%, more preferably
lower than 0.3%. In one embodiment, said percentage is between 0.264% and 0.053%.
In further embodiments, said percentage is 0.264% or lower. In further embodiments,
said percentage is 0.246% or lower. In further embodiments, said percentage is 0.096%
or lower. In further embodiments, said percentage is 0.053% or lower.
[0088] Said disease or said disorder is preferably selected from the group consisting of:
- cancer, preferably melanoma or epithelial cancer, and
- an infectious disease, preferably a viral infection, a bacterial infection or a parasite
infection, and
- an autoimmune disease, preferably multiple sclerosis, diabetes or coeliac disease.
[0089] In one preferred embodiment, said T cells are CD4+ T cells. One preferred aspect
therefore provides a method according to the invention, wherein said T cells are CD4+
T cells from a sample from an individual who is suffering from, or who has suffered
from, a disease, characterized in that the concentration in said sample, or in a T
cell culture after
in vitro expansion of said sample, of CD4+ T cells that are specific for a T cell epitope
that is associated with said disease is lower than 24% of the total amount of CD4+
T cells in said sample or in said T cell culture. The proportion of certain CD4+ T
cells of interest, compared to the total amount of CD4+ T cells in a sample or T cell
culture, is called the frequency. Preferably, the frequency of CD4+ T cells that are
specific for a T cell epitope that is associated with said disease is lower than 23%,
more preferably lower than 22%, more preferably lower than 21%, more preferably lower
than 20%, more preferably lower than 15%, more preferably lower than 10%, more preferably
lower than 9%, more preferably lower than 8%, more preferably lower than 7%, more
preferably lower than 6%, and even more preferably lower than 5% of the total amount
of CD4+ T cells in said sample or in said T cell culture. In one embodiment, the frequency
of CD4+ T cells that are specific for a T cell epitope that is associated with said
disease is between 1.7% and 4.5% of the total CD4+ cells in said sample or in said
T cell culture.
[0090] In preferred embodiments, a method according to the invention is provided wherein
said T cells are CD4+ T cells from a sample from an individual who is suffering from,
or who has suffered from, a disease, characterized in that the concentration in said
sample, or in a T cell culture after
in vitro expansion of said sample, of CD4+ T cells that are specific for a T cell epitope
that is associated with said disease is lower than 1.9%, more preferably lower than
1.8%, more preferably lower than 1.7%, more preferably lower than 1.6%, more preferably
lower than 1.5% of the total amount of CD4+ T cells in said sample or in said T cell
culture.
[0091] In further preferred embodiments, a method according to the invention is provided
wherein said T cells are CD4+ T cells from a sample from an individual who is suffering
from, or who has suffered from, a disease, characterized in that the concentration
in said sample, or in a T cell culture after
in vitro expansion of said sample, of CD4+ T cells that are specific for a T cell epitope
that is associated with said disease is lower than 1.0%, more preferably lower than
0.9%, more preferably lower than 0.8%, more preferably lower than 0.7%, more preferably
lower than 0.6%, more preferably lower than 0.5%, more preferably lower than 0.4%,
more preferably lower than 0.3% of the total amount of CD4+ T cells in said sample
or in said T cell culture. In one embodiment, said CD4+ T cell concentration is between
0.264% and 0.053%. In further embodiments, said concentration is 0.264% or lower.
In further embodiments, said concentration is 0.246% or lower. In further embodiments,
said concentration is 0.096% or lower. In further embodiments, said concentration
is 0.053% or lower.
[0092] Said T cell epitope that is associated with said disease is preferably a tumor-specific
T cell epitope or a T cell epitope from a pathogen or a T cell epitope from an autoantigen.
[0093] Also low levels of CD8+ T cells are detectable with a method according to the invention.
One preferred aspect therefore provides a method according to the invention, wherein
said T cells are CD8+ T cells from a sample from an individual who is suffering from,
or who has suffered from, a disease, characterized in that the proportion in said
sample, or in a T cell culture after
in vitro expansion of said sample, of CD8+ T cells that are specific for a T cell epitope
that is associated with said disease is lower than 24% of the total amount of CD8+
T cells in said sample or in said T cell culture. Preferably, the frequency of CD8+
T cells that are specific for a T cell epitope that is associated with said disease,
relative to the total amount of CD8+ T cells in said sample or in said T cell culture,
is lower than 23%, more preferably lower than 22%, more preferably lower than 21%,
more preferably lower than 20%, more preferably lower than 15%, more preferably lower
than 10%, more preferably lower than 9%, more preferably lower than 8%, more preferably
lower than 7%, more preferably lower than 6%, and even more preferably lower than
5% of the total amount of CD8+ T cells in said sample or in said T cell culture.
[0094] In preferred embodiments, a method according to the invention is provided wherein
said T cells are CD8+ T cells from a sample from an individual who is suffering from,
or who has suffered from, a disease, characterized in that the proportion in said
sample, or in a T cell culture after
in vitro expansion of said sample, of CD8+ T cells that are specific for a T cell epitope
that is associated with said disease is lower than 1.9%, more preferably lower than
1.8%, more preferably lower than 1.7%, more preferably lower than 1.6%, more preferably
lower than 1.5% of the total amount of CD8+ T cells in said sample or in said T cell
culture.
[0095] In further preferred embodiments, a method according to the invention is provided
wherein said T cells are CD8+ T cells from a sample from an individual who is suffering
from, or who has suffered from, a disease, characterized in that the proportion in
said sample, or in a T cell culture after
in vitro expansion of said sample, of CD8+ T cells that are specific for a T cell epitope
that is associated with said disease is lower than 1.0%, more preferably lower than
0.9%, more preferably lower than 0.8%, more preferably lower than 0.7%, more preferably
lower than 0.6%, more preferably lower than 0.5%, more preferably lower than 0.4%,
more preferably lower than 0.3% of the total amount of CD8+ T cells in said sample
or in said T cell culture. As described hereinbefore, said T cell epitope that is
associated with said disease is preferably a tumor-specific T cell epitope or a T
cell epitope from a pathogen or a T cell epitope from an autoantigen.
[0096] Also provided is a method according to the invention, wherein a sample from an individual
suffering from, or having suffered from, a disorder is used, or wherein T cells of
a resulting T cell culture after
in vitro expansion of said sample are used, wherein the proportion of T cells specific for
a T cell epitope that is associated with said disease, preferably for a tumor-specific
T cell epitope or a T cell epitope from a pathogen or a T cell epitope from an autoantigen,
relative to the total number of T cells in said sample or in said resulting
in vitro T cell culture, is lower than 24%, more preferably lower than 23%, more preferably
lower than 22%, more preferably lower than 21%, more preferably lower than 20%, more
preferably lower than 15%, more preferably lower than 10%, more preferably lower than
9%, more preferably lower than 8%, more preferably lower than 7%, more preferably
lower than 6%, and even more preferably lower than 5% of the total amount of T cells
in said sample or in said resulting T cell culture. In some embodiments, said proportion
in said sample or in said resulting
in vitro T cell culture of T cells that are specific for a T cell epitope that is associated
with said disease, relative to the total number of T cells in said sample or in said
resulting
in vitro T cell culture, is between 1.7% and 4.5%, preferably lower than 1.9%, more preferably
lower than 1.8%, more preferably lower than 1.7%, more preferably lower than 1.6%,
more preferably lower than 1.5%, more preferably lower than 1.0%, more preferably
lower than 0.9%, more preferably lower than 0.8%, more preferably lower than 0.7%,
more preferably lower than 0.6%, more preferably lower than 0.5%, more preferably
lower than 0.4%, more preferably lower than 0.3% of the total amount of T cells in
said sample or in said
in vitro T cell culture. In one preferred embodiment, said T cells are CD4+ T cells.
[0097] Another aspect of the disclosure provides a use of a B cell for presenting an epitope
of interest, characterized in that the
in vitro replicative life span of said B cell is prolonged by inducing, enhancing and/or maintaining
expression of Bcl-6 and/or STAT5 in said B cell and by inducing, enhancing and/or
maintaining expression of an anti-apoptotic nucleic acid in said B cell. Said epitope
is preferably a T cell epitope.
[0098] In one embodiment, a method according to the invention is used for testing the affinity
of a B cell for a certain (test) compound. In this embodiment, B cells are incubated
with large compounds such as for instance proteins or polypeptides that cannot be
bound directly to the MHC molecules at the surface of the B cells. Instead, the compounds
may, or may not, be internalized via the B cell receptor (BCR). If internalized, the
compounds are processed and subsequently displayed at the surface of the B cell. Then
the B cells are incubated with T cells. If a T cell appears to recognize a surface-bound
peptide derived from a compound that was used in the assay, it is concluded that the
B cells were capable of efficiently internalizing said compound. Hence, this way it
is determined whether or not the B cells have a high affinity for one or more test
compounds. A B cell with an affinity for one or more test compounds can then be selected
for further use. In some embodiments, the affinities of several B cells for a given
test compound are compared with each other. This is for instance possible using serial
dilution experiments, wherein it is determined whether T cell activation still occurs
when the B cells are incubated with decreasing concentrations of a given test compound.
Subsequently, a B cell with a higher affinity for a test compound, as compared to
the affinity of one or more other B cell(s) for said test compound, is preferably
selected.
[0099] In a further embodiment, a method according to the invention is provided wherein
compounds are used that comprise both at least one B cell epitope and at least one
T cell epitope. Incubation of B cells with such compound results in efficient internalization
and presentation of compound-derived peptides, and the resulting B cells will also
be capable of eliciting a particularly high T cell response.
[0100] The invention is further explained in the following examples. These examples do not
limit the scope of the invention, but merely serve to clarify the invention.
References
Brief description of the drawings
[0102]
Figure 1. Experimental setup for the identification of neo-antigen specific CD4+ T cells in tumor lesions. Whole exome-sequencing of tumor and healthy material in combination with RNA-sequencing
identifies tumor-specific, non-synonymous mutations within genes with confirmed RNA-expression.
This information was used to create a library of putative neo-epitopes comprised of
31 amino-acid long peptides extending each identified mutation by 15 amino-acids on
either side.
Autologous B cells immortalized by retroviral gene transfer of Bcl-6 and Bcl-xL enable
the profiling of CD4+ T cell reactivity against all MHC-class II haplotypes of the subject. Stimulation
of CD4+ T cell cells obtained from melanoma lesion of the same subject by neo-antigen peptide-loaded
Bcl-6/Bcl-xL immortalized B cells enables the detection of pre-existing CD4+ T cell reactivity with high sensitivity.
Figure 2. Characteristics of the mutational landscape in the analyzed melanoma lesions.
Figure 3. Detection of neo-epitope specific CD4+ T cells in human melanoma lesions, (a) Mean IFN-γ concentration in culture supernatant after 48 h co-culture of peptide
loaded, autologous B-cells with in vitro expanded intratumoral CD4+ T cells (n = 2-3). Dotted line indicates mean IFN-γ production of CD4+ T cells after co-culture with unloaded B-cells. Error bars depict s.d. CIRH1P>L P = 0.0026, GARTV>A P = 0.0645, ASAP1P>L P = 0.0063, RND3P>S P = 0.0061. (b,c) Detection of intracellular IFN-y levels 24 h after co-culture of peptide loaded
autologous B-cells with in vitro expanded, intratumoral CD4+ T cells for (b) NKIRTIL018 and (c) NKIRTIL034. Flow cytometry plots depicting single, live, CD4+, T cells from a representative experiment. Controls indicate frequency of single,
live, CD4+, IFN-γ+ T cells after co-culture with unloaded B-cells. Bar graphs depict mean IFN-y concentration
over multiple experiments (n = 3). Error bars depict s.d. CIRH1P>L P < 0.0001, GARTV>A P = 0.0028, ASAP1P>L P = 0.0012, RND3P>S P = 0.037.
Figure 4. Detection of neo-epitope specific CD4+ T cells in a melanoma lesion using BCL-6/BCL-XL or Epstein-Barr virus (EBV) immortalized,
autologous B cells. IFN-γ concentration in culture supernatant after 48 h co-culture of in vitro expanded intratumoral CD4+ T cells with peptide loaded, autologous B-cells immortalized by stable transfection
with BCL-6/BCL-XL (triangles) or EBV infection (circles) derived from NKIRTIL018.
Figure 5. Detection of TH1, TH2 and TH17 cytokines by intratumoral CD4+ T cells in response to putative neo-epitopes. Cytokine concentration in culture supernatant after 48 h co-culture of peptide loaded,
autologous B-cells with in vitro expanded intratumoral CD4+ T cells from (a) NKIRTIL018 and (b) NKIRTIL034. Dotted line indicates cytokine concentrations after co-culture of CD4+ T cells with unloaded B-cells.
Figure 6. Analysis of cross-reactivity of intratumoral CD4+ T cells against a non-autologous, mutated peptide library. IFN-γ concentration in culture supernatant after 48 h co-culture of in vitro expanded intratumoral CD4+ T cells obtained from (a) NKIRTIL018 and (b) NKIRTIL034 with autologous B-cells loaded with peptide libraries of the respective
other subject. Dotted line indicates IFN-y production of CD4+ T cells after co-culture with unloaded B-cells. Identified neo-epitopes of NKIRTIL018
and NKIRTIL034 were used as positive control samples.
Figure 7. Isolation and characterization of neo-epitope specific CD4+ T cells in human melanoma lesions, (a) IFN-γ concentration in culture supernatant after 48 h co-culture of CIRH1P>L reactive CD4+ T cell clones derived from NKIRTIL018 with unloaded (white bars) or peptide loaded
(black bars) autologous B cells. (b) T cell receptor (TCR) repertoire diversity among neo-antigen reactive CD4+ T cell clones of NKIRTIL018 and NKIRTIL034. Numbers indicate different TCR clonotypes;
grey segments indicate TCR clonotypes identified in at least two analyzed T cell clones.
(c) IFN-γ concentration in culture supernatant after 48 h co-culture of neo-antigen
reactive CD4+ T cell clones derived from NKIRTIL018 with autologous B-cells loaded with indicated
concentrations of mutated peptide (open squares) or wildtype peptide (black circles).
TCR clonotypes are indicated as determined in (b). (d) Mean IFN-γ concentration in culture supernatant after 48 h co-culture of neo-antigen
reactive CD4+ T cell clones derived from NKIRTIL018 with autologous B-cells loaded with truncated
variants of the mutated peptide (n = 2). Error bars depict s.d. CIRH1P>L P = 0.1012 and P = 0.1514, ASAP1P>L P = 0.0005 and P = 0.0474.
Figure 8. Isolation of neo-epitope reactive CD4+ T cells from human melanoma lesions. IFN-γ concentration in culture supernatant after 48 h co-culture of (a) GARTV>A and ASAP1P>L reactive CD4+ T cell clones derived from NKIRTIL018 and (b) RND3P>S reactive CD4+ T cell clones derived from NKIRTIL034 with unloaded (white bars) or peptide loaded
(black bars) autologous B cells.
Figure 9. Recognition of mutated and wildtype peptide by neo-antigen reactive T cell clones
of NKIRTIL018. IFN-γ concentration in culture supernatant after 48 h co-culture of GART1V>A reactive CD4+ T cell clones derived from NKIRTIL018 with autologous B-cells loaded with indicated
concentrations of mutated peptide (open squares) or wildtype peptide (black circles).
Figure 10. Identification and enumeration of neo-antigen reactive CD4+ T cell products used
for adoptive T cell therapy, (a) Mean IFNγ concentration in culture supernatant after a 48 h co-culture of peptide
loaded, autologous B cells with in vitro expanded intratumoral CD4+ T cells. Dotted line indicates mean IFNy production of
CD4+ T cells after co-culture with unloaded B cells. (b) Detection of intracellular IFNy levels after a 24 h co-culture of peptide loaded
autologous B cells with either in vitro expanded intratumoral CD4+ T cells or with the TIL infusion product of NKIRTIL027.
Flow cytometry plots depict single live CD4+ IFNγ+ T cells from a representative experiment.
Bar graphs depict mean IFNy concentrations over multiple experiments (n=3). P=0.0061
(in vitro expanded intratumoral CD4+ T cells) and 0.0011 (TIL infusion product). Error bars
depict s.d. (c) Expression of CD137 on CD4+ T cells within the T cell infusion product of subject BO after 16 h co-culture with
autologous tumor cells or with RPS12V>I peptide loaded EBV immortalized B cells. Flow cytometry plots depict single, live,
CD4+ T cells.
Figure 11. Detection of neo-epitope specific CD8+ T cells in human melanoma lesion. (a) IFN-g concentration in culture supernatant after 48 h co-culture of 582 different
31-AA peptides loaded on autologous B-cells with in vitro expanded intratumoral CD8+ T cells (n = 1). (b) IFN-g concentration in culture supernatant after 48 h co-culture of unloaded B cells,
B cells loaded with an irrelevant epitope and B cells loaded with the TTC37A>V 31-AA peptide. (c) Percentage of CD8+ multimer+ T cells, after staining with HLA-A*01:01 multimers loaded with the TTC37 undecamer
epitope.
Examples
Example 1
Intratumoral CD4+ T cell reactivity against mutated antigens is commonly observed in human melanoma
Methods
Generation of TIL material, tumor cell lines and Bcl-6/Bcl-xL transduced
[0103] B cells. PBMC and TIL material was obtained from individuals with stage IV melanoma in accordance
with Dutch guidelines, when applicable following signed informed consent and after
approval of the medical ethical committees at the NKI-AVL (Medisch Ethische Toetsingscommissie).
[0104] PBMC material was prepared by Ficoll-Isopaque density centrifugation. TIL material
and short-term tumor lines were obtained from resected melanoma lesions. Fresh tumor
material was minced and digested overnight in RPMI 1640 (Life Technologies) supplemented
with penicillin-streptomycin (Roche), 0.01 mg ml
-1 pulmozyme (Roche) and 1 mg ml
-1 collagenase type IV (BD Biosciences). A tumor line was obtained by culture of the
resulting cell suspension in RPMI 1640 supplemented with penicillin-streptomycin (Roche)
and 10% (v/v) heat-inactivated Fetal Bovine Serum (Sigma-Aldrich). TIL were obtained
by culturing the suspension cells in RPMI 1640 supplemented with penicillin-streptomycin,
10% (v/v) AB serum (Sanquin Blood Supply and Life Technologies), L-glutamine (Life
Technologies) and 6000 IU ml
-1 rhIL-2 (Novartis).
Autologous B cells from PBMC material were immortalized as part of collaboration agreement
by AIMM Therapeutics by Bcl-6/Bcl-xL gene transfer as previously described
15,16. For a detailed description, see also
WO 2007/067046. Bcl-6/Bcl-xL transduced B cells were cultured in IMDM (Life Technologies) supplemented
by 10% (v/v) Fetal bovine serum (Hyclone), penicillin-streptomycin (Roche) and 50
ng ml
-1 rm-IL21 (AIMM Therapeutics) and stimulated every 3-5 days by irradiated (50 Gy) mouse
L cell fibroblasts expressing CD40L (2:1 B cell-to/L cell ratio).
[0105] Exome sequencing. Genomic DNA was extracted from cell pellets using a DNeasy purification kit (Qiagen),
fragmented using the Covaris S220 Focused-ultrasonicator (Woburn). DNA libraries were
created using the Illumina TruSeq DNA library preparation kit. Exonic sequences were
enriched capturing DNA fragments with the Sure Select Human All Exon 50Mb Target Enrichment
system (Agilent)
28, according to Agilent protocols with modifications. 1:2 of standard bait reaction
was used and Block #3 in the hybridization mixture was replaced with a custom NKI-Block
#3 to support the TruSeq DNA libraries in which the indexes require additional blocking.
NKI-Block #3 consists of equal amounts of two DNA oligos (IDT-DNA) at 16.6 ug/ul:
NKI 3.1

NKI 3.2

Captured library fragments were split into two fractions and both were PCR enriched
(13 cycles) using the Illumina P5 and P7 oligonucleotides (IDT-DNA).
P5 primer: 5'AATGATACGGCGACCACCGAGATCT 3',
P7 primer: 5'CAAGCAGAAGACGGCATACGAG 3'.
Both PCR reactions quantified on a BioAnalyzer DNA7500 Chip (Agilent), equally combined
and diluted to 10nM concentrations for paired-end 75bp sequencing on a Illumina HiSeq2000
sequencer. Reads were aligned to the human reference genome GRCh37 using BWA version
0.5.10
20. PCR duplicates were filtered using Picard (http://picard.sourceforge.net) and realignment
around insertions and deletions (indels) was performed using GATK toolkit
21.
Somatic single nucleotide variants (SNV) were called using Somatic-sniper
22 and filtered using a somatic score cut-off > 34 and a minimum of 4 reads in both
tumor and control. Somatic indels were called using the GATK somatic indel detector
and filtered using a minimum variation frequency of 25% and having at least 5 reads
showing the indel. Germ-line variants in the vicinity of detected somatic variants
were identified using Samtools
23 and filtered using minimum coverage and minimum number of alternate reads of 10 and
6 reads, respectively. SNPeff
24 was then used to predict the effect of all variants on the Ensembl gene build version
65. Using a custom Perl script and the Ensembl API, coding variants were edited into
the cDNA sequence and subsequently translated into protein sequence. These protein
sequences were separately generated for normal (only germline variants) and tumor
samples (germline variants and tumor specific mutations).
[0106] RNA-sequencing. RNA was isolated using TriZol reagent (Life Technologies). Poly-A selected RNA libraries
were prepared using the TruSeq RNA library protocol (Illumina) and Paired-end 50bp
sequencing was performed on an Illumina HiSeq2000. Reads were aligned to human reference
genome GRCh37 using Tophat 1.4
25. Expression values were calculated as FPKM using Cufflinks
26.
[0107] Peptide synthesis. Peptides were synthesized at the NKI Peptide synthesis facility (Amsterdam) using
preloaded Wang resin with a SYRO II robot using standard Fmoc Solid Phase Peptide
Chemistry, with PyBop and Dipea as activator and base.
[0108] Generation of CD4+ T cell material from TIL and detection of neo-antigen reactivity. Cell-sorting was performed on a FACSAria I (BD Biosciences) or MoFlo Astrios (Beckman
Coulter). Bulk CD4
+ T cell populations were generated from cryo-preserved TIL material by sorting of
live single CD4
+ T cells stained antibody against CD8 (BD Biosciences; SK1; 1:50) and CD4 (BD Biosciences;
SK3; 1:50). Isolated live single CD4
+ CD8
- T cells were expanded using 30 ng ml
-1 CD3-specific antibody (OKT-3; Janssen-Cilag) and 3,000 IU ml
-1 rh-IL-2 (Novartis) in 1:1 (v/v) medium mixture of RPMI 1640 and AIM-V (Life Technologies)
supplemented with 10% AB serum (Life Technologies), Glutamax (Life Technologies) at
a 1:200 T cell/feeder cell ratio to obtain pure CD4
+ T cell populations (routinely >97% CD4
+) which were used for determination of T cell reactivity against neo-epitopes.
[0109] Detection of neo-epitope reactive CD4+ T cells. 1×10
5 Bcl-6/Bcl-xL transduced B cells per well were loaded with peptide (20 µg ml
-1 unless otherwise indicated) in 96-round-bottom plates for 18-24 hours in 200 µl IMDM
medium (Life Technologies) supplemented by 10% (v/v) Fetal bovine serum (Hyclone),
penicillin-streptomycin (Roche) and 50 ng ml
-1 rm-IL21 (AIMM Therapeutics). Afterwards, medium was removed and 1×10
5 CD4
+ T cells were added per well in 200 µl RPMI 1640 (Life Technologies) supplemented
by 10% (v/v) AB serum (Life Technologies), penicillin-streptomycin (Roche) and 50
ng ml
-1 rm-IL21 (AIMM Therapeutics). 48 hours later, culture supernatant was harvested and
analyzed using Human T
H1/T
H2/T
H17 cytometric bead array (BD Biosciences) or IFN-y Flex bead E7 cytometric bead array
(BD Biosciences) according to manufacturer's guidelines. For detection of intracellular
levels of IFN-y by flow cytometry, CD4
+ T cells were stimulated with peptide-loaded B cells for 24 hours. Subsequently, cells
were stained using IR-Dye (Life Technologies) for exclusion of dead cells and the
Cytofix/Cytoperm kit (BD Biosciences) and an antibody against IFN-y (BD Biosciences;
25723; 1:50) according to the manufacturer's guidelines.
For isolation of live, IFN-y producing CD4
+ T cells, T cells were stimulated with peptide-loaded B cells for 6 hours. Subsequently,
cells were stained using the IFN-y secretion capture kit (Miltenyi Biotec) and an
antibody for CD4 (BD Biosciences; SK3; 1:50). Single, live IFN-γ producing CD4
+ T cells were sorted by flow cytometry and collected in 96-well round-bottom culture
plates containing 2×10
5 irradiated PBMCs, 30 ng ml
-1 CD3-specific antibody (OKT-3; Janssen-Cilag) and 3,000 IU ml
-1 recombinant human IL-2 (Novartis) in 200 µl 1:1 (v/v) medium mixture of RPMI 1640
and AIM-V (Life Technologies) supplemented with 10% AB serum (Life Technologies),
penicillin-streptomycin (Roche) and Glutamax (Life Technologies). After 7 days, 100
µl was replaced with fresh medium supplemented with rh-IL-2 (3,000 IU ml
-1 final) and T cell specificity was confirmed by assessing IFN-y in response to neo-epitope
after 14 days.
[0110] Identification of TCR sequences. cDNA of T cell clones was generated and used to prepare DNA libraries with the Illumina
TruSeq DNA library preparation kit. The resulting DNA libraries were sequenced on
a Illumina MiSeq sequenzer using Paired-end 150bp chemistry.
Sequencing reads in FASTQ files were mapped to the human genome, build NCBI36/hg18,
using BWA
20 and SAMtools
23. PCR duplicates in resulting BAM files were filtered using Picard (http://picard.sourceforge.net).
CDR3 TCR sequences were identified as previously reported
27. TCRα and -β sequences were conferred with an in-house developed python script.
[0111] Statistical analysis. Differences in cytokine concentrations and frequencies of cytokine-producing T were
compared using a two-tailed Student's
t test.
P values <0.05 were considered significant; Significance was indicated as
P < 0.05 (*),
P <0.01 (**) and P < 0.001 (***).
Results
[0112] Tumor-specific neo-antigens arising as a consequence of mutations in human cancers
1,2 are thought to be important for the efficacy of clinically used cancer immunotherapies
3-5. While tumor-specific CD4
+ T cell responses are known and growing evidence suggests that neo-antigens may be
commonly recognized by intratumoral CD8
+ T cells
3,4,6, it is unknown whether neo-antigen specific CD4
+ T cells commonly reside within human tumors. Here, we use immortalized Bcl-6/Bcl-xL
transduced B cells to measure the occurrence of CD4
+ T cell responses against putative neo-epitopes that are identified by tumor exome
sequencing. Using this approach, we show the presence of neo-antigen reactive CD4
+ T cells in 4 out of 5 melanoma patients analyzed, including melanoma patients who
demonstrate a clinical response after adoptive T cell therapy.
[0113] Based on I) the evidence that supports a role for CD4
+ T cells in the efficacy of cancer immunotherapies
7-12, II) the proposed correlation between mutational load and clinical response to immunotherapy
13, and III) the recent observation that neo-antigen specific CD4
+ T cells can mediate tumor-regression in a metastatic cholangiocarcinoma
10, we wish to understand whether neo-antigen specific CD4
+ T cell reactivity is a rare or common phenomenon in human cancers.
The average mutational load of melanoma is high
1. Furthermore, the tumor-infiltrating lymphocyte (TIL) products that are generated
for cellular therapy of melanoma
14 regularly contain substantial fractions of CD4
+ T cells, potentially mediating clinical effects
7,10. Because of these data, we chose to examine the occurrence of neo-antigen specific
CD4
+ T cell reactivity in a set of melanoma specimens with varying mutational loads.
[0114] To assess the occurrence of intratumoral CD4
+ T cell responses against non-synonymous somatic mutations within these tumors, we
used whole exome-sequencing and RNA-sequencing data to first identify the entire set
of tumor-specific, non-synonymous mutations within expressed genes. Subsequently CD4
+ T cell reactivity against any of these mutated peptides was analyzed by the use of
retrovirally Bcl-6 and Bcl-xL immortalized autologous B cells
15,16 (see also
WO 2007/067046) which were loaded with mutated peptides (
Fig. 1).
[0115] This screening platform was validated by the analysis of three melanoma lesions -
NKIRTIL018, NKIRTIL034 and NKIRTIL045 - from patients who underwent palliative metastasectomy.
While all three tumors showed the expected UV induced mutational signature, total
mutational load varied considerably (range: 180-464 somatic mutations,
Fig. 2)1,2. On average 153 mutations (Range: 99-187) were identified as candidate neo-epitopes
(defined as a tumor-specific, non-synonymous mutation in a gene with confirmed RNA-expression).
Peptides (31 amino-acids) that covered the individual mutations were then loaded onto
the Bcl-6/Bcl-xL immortalized, autologous B cells, and the resulting targets were
incubated with
in vitro expanded, intratumoral CD4
+ T cells (routinely ≥97% CD4
+). Subsequently, we assessed culture supernatants for the presence of the T
H1, T
H2 and T
H17 cytokines IFN-y, TNF-α, IL-10, IL-2, IL-4, IL-6 and IL-17a.
For subject NKIRTIL018, IFN-γ production of tumor-derived CD4
+ T cells was observed in response to three mutated gene products, CIRH1A P333L (CIRH1A
P>L), GART V551A (GART
V>A), and ASAP1 P941L (ASAP1
P>L) (
Fig. 3a).
[0116] Importantly, detection of these neo-antigen specific CD4
+ T cells was readily feasible as a result of the constant low background observed
when using autologous Bcl-6/Bcl-xL immortalized B cells. Contrary, detection of these
neo-antigen specific CD4
+ T cells was impossible with autologous Epstein-Barr virus (EBV) immortalized B cells
(
Fig. 4).
This demonstrates that the use of Bcl-6/Bcl-xL immortalized B cells is superior over
the use of EBV immortalized B cells.
[0117] Melanoma-derived CD4
+ T cells of subject NKIRTIL034 also showed neo-antigen reactivity, in this case to
a mutation within the Rho family GTPase 3 RND P49S (RND3
P>S). Only in the subject with the lowest mutational load, NKIRTIL027, reactivity against
neo-antigens as measured by production of T
H-cytokines was not observed within the intratumoral CD4
+ T cell compartment (
Fig. 3a and data not shown). The presence of neo-antigen reactive CD4
+ T cells within the melanoma lesions of NKIRTIL018 and NKIRTIL034 was confirmed by
analysis of intracellular IFN-y levels upon antigen stimulation (
Fig. 3b,c). Of note, in this experiment wherein Bcl-6/Bcl-xL immortalized B cells were used,
the control frequency of single, live, CD4+, IFN-γ
+ T cells after co-culture with unloaded B cells was 0.078% (
Fig. 3b) or 0.277% (
Fig. 3c). This means that only 0.078% or 0.277% of the CD4+ T cells that were co-cultured
with unloaded Bcl-6/Bcl-xL immortalized B cells displayed IFN-y production (indicative
for T cell activation). Importantly, these control frequencies are much lower than
the control frequency of 1.98% that was obtained when EBV-immortalized B cells were
used (see Example 3 and
Fig. 10c).
As shown in Figures 3b and 3c, the frequency of the CIRH1a
P>L-recognizing T cells was 0.096% (i.e. 0.174% minus the control frequency of 0.078%).
The frequency of the GART
V>A-recognizing T cells was 0.053% (i.e. 0.131% minus the control frequency of 0.078%).
The frequency of the ASAP1
P>L- recognizing T cells was 0.264% (i.e. 0.342% minus the control frequency of 0.078%)
and the frequency of the RND3
P>S-recognizing T cells was 0.246% (i.e. 0.523% minus the control frequency of 0.277%).
Hence, it is clear that the neo-antigen recognizing T cells were present in very low
frequencies. Nevertheless, they could still be detected, thanks to the very sensitive
screening methods according to the present invention wherein Bcl-6/Bcl-xL immortalized
B cells are used for T cell neo-antigen presentation. These T cells could not have
been detected using EBV-immortalized B cells as antigen presenting cells.
[0118] Neo-antigen reactive CD4
+ T cells did not show production of any of the other cytokines tested (
Fig. 5).
[0119] T cell receptors can trigger T cell function upon interaction with a large number
of different epitopes, and in the above screens, a diverse T cell pool is tested for
recognition of a sizable set of peptides. Thus, we assessed in a set of validation
screens whether the observed T cell reactivity represented a genuine neo-antigen driven
T cell response, rather than T cell cross reactivity. In these screens, the ability
of CD4
+ T cell pools from NKIRTIL018 and NKIRTIL034 to react against the set of potential
neo-epitopes of the other subject was evaluated. This analysis showed that IFN-y production
by tumor-derived CD4
+ T cells was patient mutanome specific as none of the other subject's neo-epitopes
were recognized (
Fig. 6), indicating that the presence of CD4
+ T cells with neo-antigen reactivity identified through the use of Bcl-6/Bcl-xL immortalized
B cells reflects a true neo-antigen specific CD4+ T cell response, driven by expression
of the antigen in the autologous melanoma.
In order to further characterize the neo-antigen reactive CD4
+ T cell compartment in these melanoma patients, we generated a panel of neo-epitope
reactive CD4
+ T cell clones from TIL by isolation of antigen-specific IFN-y producing CD4
+ T cells (
Fig. 7 + 8). To assess the capacity of neo-antigen reactive CD4
+ T cells to discriminate between the mutated cognate peptide and its parental sequence,
neo-antigen specific CD4
+ T cells were stimulated with different concentrations of either peptide (
Fig. 7c + Fig 9). For all T cell clones, specific for either ASAP1
P>L, CIRH1A
P>L, or GART
V>A,, recognition of the mutant peptide was detectable at concentrations that were ∼100
to >1,000 lower than that required for recognition of the parental peptide (
Fig. 7c + Fig. 9). Thus, both by their restriction towards the autologous mutanome set and by their
preferential recognition of the mutant peptide over its wild-type counterpart, these
tumor-resident CD4+ T cell responses are defined as true neo-antigen driven T cell
reactivities.
[0120] Truncation of two of the identified neo-epitopes revealed that peptides of 13 amino
acids (RKITF
LHRCLISC; CIRH1A
P>L) and 19 amino acids (KPPPGDLP
LKPTELAPKPQ; ASAP1
P>L) were still recognized with high efficiency (
Fig. 7c). For both epitopes, the mutated residue was located at a central position within
truncated epitope, consistent with an essential role of this amino acid in T cell
activation
17,18. For each of the four identified neo-epitopes, TCR alpha-beta sequences were obtained
for a small set (8-11) of T cell clones. This analysis demonstrated that the TCR repertoire
of neo-epitope specific T cell responses is generally oligoclonal to polyclonal, with
2-7 identified TCR clonotypes for these 4 epitopes (
Fig. 7b). Hence, the neo-antigen specific T cell responses towards these 4 epitopes are not
due to the outgrowth of rare neo-antigen reactive CD4+ T cells but are oligo- to polyclonal.
Example 2
[0121] Based on the observation that neo-antigen specific CD4
+ T cell reactivity can readily be detected on the basis of cancer exome data (
Fig. 3), and that a T cell product containing a high frequency of neo-antigen specific CD4
+ T cells was recently shown to mediate partial regression of a cholangiocarcinoma
10, we analyzed whether a neo-antigen reactive CD4
+ T cell compartment is also prevalent in melanoma patients who experience a clinical
response upon adoptive T cell therapy.
The first patient, NKIRTIL027, was a stage IV melanoma patient who exhibited a partial
clinical response upon TIL therapy. Exome sequencing revealed a very high mutational
burden in the tumor of this patient (total of 1393 somatic mutations) (
Fig. 2). Bcl-6/Bcl-xL transduced B cells were loaded with the collection of 582 candidate
neo-epitopes, identified after filtering for non-synonymous and RNA expressed mutations,
and used as targets for CD4
+ T cells expanded from an autologous melanoma lesion. Strikingly, this analysis identified
CD4
+ T cell reactivity against 7 different mutated gene products (CPT1A G212S (CPT1A
G>S), HERC4 P768S (HERC4
P>S), GYLTL1B D597E (GYLTL1B
D>E), KRTAP4-11 P187S (KRTAP4-11
P>S), LEMD2 P495L (LEMD2
P>L), DTNBP1 D334H (DTNBP1
D>H), MFSD9 P219L (MFSD9
P>L) as detected by IFN-y production in culture supernatants and independent confirmation
by intracellular detection of IFN-y production. In particular, this analysis identified
strong CD4+ T cell reactivity against the mutated gene product LEM Domain Containing
2 P495L (LEMD2
P>L), as detected by IFNy secretion (
Fig. 10a).
[0122] Of note, the T cell product infused into subject NKIRTIL027 contained a substantial
fraction of CD4
+ T cells (70 % of all CD3
+ T cells; data not shown). Thus, we assessed the frequency of neo-antigen reactive
CD4
+ T cells within the T cell product used for adoptive T cell therapy. This analysis
revealed the presence of 7 different neo-epitope reactive CD4
+ T cell populations within the infusion cell product with an average frequency of
2.9 % (Range: 1.7-4.5 %) of total CD4
+ T cells.
Fig. 10b depicts LEMD2
P>L reactive CD4+ T cells (3.8% of total CD4+ T cells) that were observed within the
T cell product used for adoptive T cell therapy by intracellular cytokine staining.
[0123] Of note, also in this experiment wherein Bcl-6/Bcl-xL immortalized B cells were used,
the control frequencies of single, live, CD4+, IFN-y
+ T cells after co-culture with unloaded B cells were 0.52% (
In vitro expanded intratumoral CD4+ T cells from an autologous melanoma lesion) and 0.20%
(TIL infusion product used for adoptive T cell therapy); see
Fig. 10b. Importantly, these control frequencies are much lower than the control frequency
of 1.98% that was obtained when EBV-immortalized B cells were used (see Example 3
and
Fig. 10c).
[0124] The frequency of the LEMD2
P>L -recognizing T cells in the
in vitro expanded intratumoral CD4+ T cells was 4,74% (i.e. 5.26% minus the control frequency
of 0.52%). The frequency of the LEMD2
P>L -recognizing T cells in the TIL infusion product used for adoptive T cell therapy
was 3.33% (i.e. 3.53% minus the control frequency of 0.20%).
Example 3
[0125] Next, we analyzed neo-antigen specific CD4
+ T cell reactivity in a stage IV melanoma patient (BO) who received multiple infusions
of
in vitro expanded, autologous tumor-specific T cells obtained by stimulation of peripheral
blood mononuclear cells (PBMCs) with autologous tumor cells (ref 19). Following treatment,
this patient experienced a complete tumor remission, now ongoing for 7 years. Furthermore,
CD4
+ T cells present within the T cell product showed strong recognition of the autologous
melanoma line (
Fig. 10c). As Bcl-6/Bcl-xL immortalized B cells were not yet available for this subject, autologous
EBV-immortalized B cells had to be used in spite of the larger background noise. The
EBV-immortalized B cells were loaded with 31-mer peptides covering the 501 non-synonymous
mutations within expressed genes that were detected in this patient. In spite of the
higher background noise due to the use of EBV-transformed APCs, this screen identified
one prominent CD4
+ T cell response (24% of total CD4
+ T cells within the infusion product; i.e. 26.0% minus the control frequency of 1.98%)
that was directed against a mutant version of ribosomal protein S12 (RPS12 V104I)
(
Fig. 10c).
[0126] Of note, in this experiment wherein EBV-immortalized B cells were used, the control
frequency of single, live, CD4+, IFN-γ
+ T cells after co-culture with unloaded B cells, is 1.98%. This means that 1.98% of
the CD4+ T cells that were co-cultured with unloaded EBV-immortalized B cells displayed
IFN-y production (indicative for T cell activation). Importantly, this control frequency
is much higher than the frequencies of each of the four neo-epitope-specific T cells
that were found in Example 1. As shown in Figures 3b and 3c, the frequency of the
CIRH1a
P>L-recognizing T cells was 0.096% (i.e. 0.174% minus the control frequency of 0.078%).
The frequency of the GART
V>A-recognizing T cells was 0.053% (i.e. 0.131% minus the control frequency of 0.078%).
The frequency of the ASAP1
P>L-recognizing T cells was 0.264% (i.e. 0.342% minus the control frequency of 0.078%)
and the frequency of the RND3
P>S-recognizing T cells was 0.246% (i.e. 0.523% minus the control frequency of 0.277%).
It is clear that these low concentrations of neo-epitope-specific T cells would not
have been detected using EBV-immortalized B cells in view of the much higher background
noise that is present when EBV-immortalized B cells are used. Hence, if EBV-immortalized
B cells were used as APCs, all four neo-epitope specific T cells identified in Example
1 would have been missed. This emphasizes the superiority of the use of Bcl-6/Bcl-xL
immortalized B cells as T cell (neo)epitope presenting APCs.
Conclusion
[0127] The above data show that B cells that are immortalized with a method according to
WO 2007/067046 are preferred APCs for testing T cell recognition of T cell epitopes.
[0128] As shown in Examples 1 and 2, the use of Bcl-6/Bcl-xL immortalized B cells is superior
over the use of EBV immortalized B cells, because EBV immortalized B cells provide
high levels of background noise. Contrary, when Bcl-6/Bcl-xL immortalized B cells
are used as APCs, background noise is much lower, if present at all. This is for instance
shown in Figure 4.
This is also apparent from a comparison between the low control frequencies of Figures
3b and 3c, obtained with the use of Bcl-6/Bcl-xL immortalized B cells as APCs (0.078%
and 0.277%, respectively) and the high control frequency of Figure 10, obtained with
the use of EBV-immortalized B cells as APCs (1.98%). In fact, the control frequency
of Figure 10 is much higher that the frequencies of the neo-epitope-specific T cells
depicted in Figure 3.
As a consequence, a more sensitive detection method is provided by the present invention,
which enables detection of T cells which are present in low frequencies. For instance,
7 different neo-epitope reactive CD4+ T cell populations with an average frequency
of 2.9% of total CD4+ T cells were identified in Example 1, using Bcl-6/Bcl-xL immortalized
B cells as APCs. With EBV immortalized B cells, only one prominent CD4+ T cell response
with a much higher frequency of 24% of total CD4+ T cells was detected (i.e. 26.0%
minus the control frequency of 1.98%).
Example 4
Detection of neo-epitope specific CD8+ T cells in a human melanoma lesion.
[0129] This Example shows that the use of Bcl-6/Bcl-xL immortalized B cells as APCs, as
described in the previous Examples for the identification of neo-epitope specific
CD4+ T cell responses, is also suitable to identify neo-epitope specific
CD8+ T cell responses.
[0130] Based on exome- and RNA sequencing data of patient NKIRTIL027 (see Example 2), 582
tumor-specific single nucleotide variants were identified with RNA expression > 0
FPKM. 31 amino acid peptides covering these mutations were synthesized and loaded
on Bcl-6/Bcl-xL immortalized autologous B cells. A 48 co-culture with CD8 enriched
tumor infiltrating T cells (TIL) was performed and IFNg concentration was measured
in the culture supernatant. Incubation of CD8 enriched TIl with one peptide (TTC37
A>V) resulted in a signal above background (i.e. above the control signals of unloaded
B cells). This is shown in
Fig. 11a. As a validation of this result, an independent co-culture in which IFNg concentration
was measured in the culture supernatant was performed (
Fig.
11b). In parallel, epitope predictions were performed in which the 31 AA epitope was
fed into netMHCpan to test for affinity to the patient's HLA-A and HLA-B alleles.
A putative candidate undecamer epitope was predicted to bind to HLA-A*01:01. HLA-A*01:01
TTC37
A>V multimers were generated and conjugated to two different fluorochromes. Staining
of the CD8
+ enriched T cell product resulted in a double positive multimer staining of 0.737%
of all CD8
+ T cells (
Fig. 11c).
[0131] The applicability of the use of Bcl-6/Bcl-xL immortalized B cells as APCs for both
screening neo-epitope specific CD8 and CD4 restricted T cell responses greatly increases
the value of this analytic platform in the field of cancer immunotherapy.
References of Examples 1-4
[0132]
- 1. Alexandrov, L.B., et al. Signatures of mutational processes in human cancer. Nature
500, 415-421 (2013).
- 2. Vogelstein, B., et al. Cancer genome landscapes. Science 339, 1546-1558 (2013).
- 3. Robbins, P.F., et al. Mining exomic sequencing data to identify mutated antigens recognized
by adoptively transferred tumor-reactive T cells. Nature medicine 19, 747-752 (2013).
- 4. van Rooij, N., et al. Tumor exome analysis reveals neoantigen-specific T-cell reactivity
in an ipilimumab-responsive melanoma. Journal of clinical oncology : official journal
of the American Society of Clinical Oncology 31, e439-442 (2013).
- 5. Lu, Y.C., et al. Mutated PPP1R3B is recognized by T cells used to treat a melanoma
patient who experienced a durable complete tumor regression. J Immunol 190, 6034-6042
(2013).
- 6. Wick, D.A., et al. Surveillance of the tumor mutanome by T cells during progression
from primary to recurrent ovarian cancer. Clinical cancer research : an official journal
of the American Association for Cancer Research 20, 1125-1134 (2014).
- 7. Friedman, K.M., et al. Tumor-specific CD4+ melanoma tumor-infiltrating lymphocytes.
J Immunother 35, 400-408 (2012).
- 8. Kitano, S., et al. Enhancement of tumor-reactive cytotoxic CD4(+) T cell responses
after ipilimumab treatment in four advanced melanoma patients. Cancer immunology research
1(2013).
- 9. Quezada, S.A., et al. Tumor-reactive CD4(+) T cells develop cytotoxic activity and
eradicate large established melanoma after transfer into lymphopenic hosts. The Journal
of experimental medicine 207, 637-650 (2010).
- 10. Tran, E., et al. Cancer immunotherapy based on mutation-specific CD4+ T cells in a
patient with epithelial cancer. Science 344, 641-645 (2014).
- 11. Kenter, G.G., et al. Vaccination against HPV-16 oncoproteins for vulvar intraepithelial
neoplasia. The New England journal of medicine 361, 1838-1847 (2009).
- 12. Ossendorp, F., Mengede, E., Camps, M., Filius, R. & Melief, C.J. Specific T helper
cell requirement for optimal induction of cytotoxic T lymphocytes against major histocompatibility
complex class II negative tumors. The Journal of experimental medicine 187, 693-702
(1998).
- 13. Champiat, S., Ferte, C., Lebel-Binay, S., Eggermont, A. & Soria, J.C. Exomics and
immunogenics: Bridging mutational load and immune checkpoints efficacy. Oncoimmunology
3, e27817 (2014).
- 14. Dudley, M.E., et al. Cancer regression and autoimmunity in patients after clonal repopulation
with antitumor lymphocytes. Science 298, 850-854 (2002).
- 15. Kwakkenbos, M.J., et al. Genetic manipulation of B cells for the isolation of rare
therapeutic antibodies from the human repertoire. Methods 65, 38-43 (2014).
- 16. Kwakkenbos, M.J., et al. Generation of stable monoclonal antibody-producing B cell
receptor-positive human memory B cells by genetic programming. Nature medicine 16,
123-128 (2010).
- 17. Kessels, H.W., et al. The impact of self-tolerance on the polyclonal CD8+ T cell repertoire.
J Immunol 172, 2324-2331 (2004).
- 18. Calis, J.J., et al. Properties of MHC class I presented peptides that enhance immunogenicity.
PLoS computational biology 9, e1003266 (2013).
- 19. Verdegaal, E.M., et al. Successful treatment of metastatic melanoma by adoptive transfer
of blood-derived polyclonal tumor-specific CD4+ and CD8+ T cells in combination with
low-dose interferon-alpha. Cancer immunology, immunotherapy: CII 60, 953-963 (2011).
- 20. Li, H. & Durbin, R. Fast and accurate short read alignment with Burrows-Wheeler transform.
Bioinformatics 25, 1754-1760 (2009).
- 21. DePristo, M.A., et al. A framework for variation discovery and genotyping using next-generation
DNA sequencing data. Nature genetics 43, 491-498 (2011).
- 22. Larson, D.E., et al. SomaticSniper: identification of somatic point mutations in whole
genome sequencing data. Bioinformatics 28, 311-317 (2012).
- 23. Li, H., et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics 25,
2078-2079 (2009).
- 24. Cingolani, P., et al. A program for annotating and predicting the effects of single
nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain
w1118; iso-2; iso-3. Fly 6, 80-92 (2012).
- 25. Trapnell, C., Pachter, L. & Salzberg, S.L. TopHat: discovering splice junctions with
RNA-Seq. Bioinformatics 25, 1105-1111 (2009).
- 26. Trapnell, C., et al. Transcript assembly and quantification by RNA-Seq reveals unannotated
transcripts and isoform switching during cell differentiation. Nature biotechnology
28, 511-515 (2010).
- 27. Linnemann, C., et al. High-throughput identification of antigen-specific TCRs by TCR
gene capture. Nature medicine 19, 1534-1541 (2013).
- 28. Varela, I., et al. Exome sequencing identifies frequent mutation of the SWI/SNF complex
gene PBRM1 in renal carcinoma. Nature 469, 539-542 (2011).