|
(11) | EP 3 208 335 B1 |
| (12) | EUROPEAN PATENT SPECIFICATION |
|
|
| (54) |
METHOD FOR BREAKING NUCLEIC ACID AND ADDING ADAPTOR BY MEANS OF TRANSPOSASE, AND REAGENT VERFAHREN ZUM AUFBRECHEN VON NUKLEINSÄURE UND ZUM HINZUFÜGEN EINES ADAPTERS MITTELS TRANSPOSASE UND REAGENZ PROCÉDÉ DE RUPTURE D'ACIDE NUCLÉIQUE ET D'AJOUT D'ADAPTATEUR AU MOYEN D'UNE TRANSPOSASE, ET RÉACTIF |
|
|
||||||||||||||||||||||||||||
| Note: Within nine months from the publication of the mention of the grant of the European patent, any person may give notice to the European Patent Office of opposition to the European patent granted. Notice of opposition shall be filed in a written reasoned statement. It shall not be deemed to have been filed until the opposition fee has been paid. (Art. 99(1) European Patent Convention). |
TECHNICAL FIELD
BACKGROUND OF THE INVENTION
SUMMARY OF THE INVENTION
randomly interrupting a nucleic acid by using a transposase-embedded complex, wherein the transposase-embedded complex comprises a transposase and a first adapter comprising a transposase identification sequence, and both ends of the interrupted nucleic acid are separately ligated to the first adapter to form a gap at each end;
eliminating the influence of the transposase in the system on a follow-up reaction by means of purification or chemical reagent treatment;
ligating to a second adapter at the gap by using a ligase, wherein the sequence of the second adapter is different from that of the first adapter; and
performing a PCR reaction by using primers targeted to the first adapter and the second adapter respectively, so as to obtain a product whose both ends are respectively ligated to different adapter sequences.
a transposase and a first adapter comprising a transposase identification sequence for forming a transposase-embedded complex to randomly interrupt a nucleic acid, so as both ends of the interrupted nucleic acid are separately ligated to the first adapter to form a gap at each end;
a second adapter and a ligase component for ligating the second adapter at the gap; and
primers targeted to the first adapter and the second adapter respectively, so as to obtain a product whose both ends are respectively ligated to different adapter sequences by performing a PCR reaction.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 is a schematic flow diagram of a technical solution in which a transposase interrupting a nucleic acid and ligating a gap adapter (i.e., No. 2 adapter) in the present invention;
Figure 2 is a result of the gel electrophoresis of the PCR product after the ligation of a gap adapter (i.e., No. 2 adapter) in Example 1 of the present invention, wherein lane 1 is the annealing product at 60 °C after the interruption by single-adapter-2 and after the ligation of the gap adapter; lane 2 is the annealing product at 55°C after the interruption by single-adapter-2 and after the ligation of the gap adapter; lane 3 is the annealing product at 60 °C after the interruption by single-adapter-3 and after the ligation of the gap adapter; lane 4 is the annealing product at 55°C after the interruption by single-adapter-3 and after the ligation of the gap adapter; lane 5 is the annealing product at 60 °C after the interruption by single-adapter-1 and after the ligation of the gap adapter; lane 6 is the annealing product at 55°C after the interruption by single-adapter-1 and after the ligation of the gap adapter; lane 7 is the annealing product at 60 °C after the interruption by double-adapters and after the direct PCR; lane 8 is the annealing product at 55°C after the interruption by double-adapters and after the direct PCR; M1 is the DL2000 DNA Marker; M2 is the 50bp DNA Marker; N is the negative control.
Figure 3 is a base quality diagram by the sequencing of ligation method in Example 1 of the present invention;
Figure 4 is a result of the gel electrophoresis of the PCR product after the No.1 adapter single-adapter transposase complex interrupting a nucleic acid and after the introduction of the No. 2 adapter in Example 1 of the present invention, wherein D2000 is the lane of DNA Ladder; lane 1 is the result after treatment of 2µL protease +1% Triton-X100; lane 2 is the result after treatment of NT buffer+1% Triton-X100; lane 3 is the result after treatment of 1% SDS +1% Triton-X100+0.5% Tween-20; lane 4 is the result after treatment of 2µL protease +14mM EDTA+1% Triton-XlOO; lane 5 is the result after treatment of 1×PBI, 1.3×Ampure XP beads; lane 6 is the result of a negative control (without template).
DETAILED DESCRIPTION OF THE INVENTION
Example 1
Sequence A of single-adapter 1:
CTGTCUCTTAUACACATC ddT (SEQ ID NO: 1);
Sequence B of single-adapter 1:
GCTTCGACTGGAGACAGATGTGTATAAGAGACAG (SEQ ID NO: 2);
Sequence A of single-adapter 2:
GCTGTCTCTTATACACATC ddT (SEQ ID NO: 3);
Sequence B of single-adapter 2:
GCTTCGACTGGAGACAGATGTGTATAAGAGACAG ddC (SEQ ID NO: 4);
Sequence of single-adapter 3:
Sequence A of double-adapters:
CTGTCTCTTATACACATCT (SEQ ID NO: 6);
Sequence B of double-adapters:
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG (SEQ ID NO: 7);
Sequence C of double-adapters:
GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG (SEQ ID NO: 8).
| Temperature | Time |
| 75 °C | 15min |
| 60 °C | 10min |
| 50 °C | 10min |
| 40 °C | 10min |
| 25 °C | 30min |
| Hot-lid 105°C | |
| Component | Content |
| Transposase | 85µL |
| NO. 1 adapter | 30µL |
| Coupling buffer | 85µL |
| Total | 200µL |
| Component | Content |
| Water | 5µL |
| 5× interruption buffer | 2µL |
| gDNA (50ng/µL) | 1µL |
| Transposase complex | 2µL |
| Total | 10µL |
| Component | Content |
| DNA | 10µL |
| 10 × Buffer | 2µL |
| USER enzyme | 1µL |
| Water | 7µL |
| Total | 20µL |
| Component | Content |
| Water | 8µL |
| 3×ligation buffer | 20µL |
| No. 2 adapter (5µM) | 10µL |
| Ligase | 2µL |
| DNA | 20µL |
| Total | 30µL |
| Note: The sequences of the No. 2 adapter are as follows: Sequence A of the No. 2 adapter: p AAGTCGGAGGCCAAGCGGTCGT ddC (SEQ ID NO: 9); Sequence B of the No. 2 adapter: TTGGCCTCCGACT ddT (SEQ ID NO: 10); wherein p represents a 5' terminal phosphorylation modification and dd represents a 3' end dideoxy modification. |
| Component | Content |
| DNA product after purification | 30µL |
| 5× PCR buffer | 10µL |
| 10mM dNTP | 1µL |
| Primer 1 | 2µL |
| Primer 2 | 2µL |
| PCR enzyme | 1 µL |
| Pure water | 4µL |
| Total | 50 µL |
| Note: the PCR primers are as follows: Primer 1 of single-adapter: AGACAAGCTCGAGCTCGAGCGATCGGGCTTCGACTGGAGAC (SEQ ID NO: 11); Primer 2 of single-adapter: TCCTAAGACCGCTTGGCCTCCGACT (SEQ ID NO: 12); Primer 1 of double-adapters: AATGATACGGCGACCACCGA (SEQ ID NO: 13); Primer 2 of double-adapters: CAAGCAGAAGACGGCATACGA (SEQ ID NO: 14). |
| Temperature | Time | Cycle |
| 72 °C | 3min | 1 Cycle |
| 98 °C | 30sec | 1 Cycle |
| 98 °C | 10sec | 15 Cycles |
| 60°C/55°C | 30sec | |
| 72 °C | 3min | |
| 72 °C | 5min | 1 Cycle |
| 4°C | ∞ | - |
| Adapter | Single - adapte r-2 | Single - adapte r-2 | Single - adapte r-3 | Single - adapte r-3 | Single - adapte r-1 | Single - adapte r-1 | Negati ve control | Doubl e-adapte rs | Double - adapter s |
| Anneali ng | 60°C | 55°C | 60 °C | 55°C | 60 °C | 55°C | - | 60 °C | 55°C |
| Product concent ration (ng/µL) | 11.8 | 13.8 | 9.6 | 10.1 | 8.24 | 10.3 | 1.64 | 29.8 | 25.8 |
| Component | Content |
| Mediating sequences (20µM) | 20µL |
| Pure water | 15 8.3 µL |
| 1 0×ligation buffer | 35µL |
| 100mM ATP | 3.5µL |
| Ligase | 1.2µL |
| PCR product after denature | 112µL |
| Total | 350µL |
| Note: Mediating sequences are as follows: Mediating sequence for single-adapter: TCGAGCTTGTCTTCCTAAGACCGC (SEQ ID NO: 15); Mediating sequence for double-adapters: CGCCGTATCATTCAAGCAGAAGAC (SEQ ID NO: 16). |
| Component | Content |
| 10× ligation buffer | 3.7µL |
| 20U/µL Exonuclease I | 11.1µL |
| 100U/µL Exonuclease III | 5.2µL |
| Total | 20µL |
Example 2
Sequence A of the NO. 1 adapter in the form single-adapter:
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG (SEQ ID NO: 17);
Sequence B of the NO. 1 adapter in the form single-adapter:
CTGTCTCTTATACACATC ddT (SEQ ID NO: 18, dd represents a dideoxy modification).
| Temperature | Time |
| 75 °C | 15min |
| 60 °C | 10min |
| 50 °C | 10min |
| 40 °C | 10min |
| 25 °C | 30min |
| Hot-lid 105°C | |
| Component | Content |
| Transposase | 85µL |
| NO. 1 adapter | 30µL |
| Coupling buffer | 85µL |
| Total | 200µL |
| Component | Content |
| Water | 5µL |
| 5× interruption buffer | 2µL |
| gDNA (50ng/µL) | 1µL |
| Transposase complex | 2µL |
| Total | 10µL |
| Component | Content |
| Water | 8µL |
| 3×ligation buffer | 20µL |
| adapter (5µM) | 10µL |
| Liagase | 2µL |
| DNA | 20µL |
| Total | 30µL |
| Note: Sequence A of the NO. 2 adapter: 5'-pAAGTCGGAGGCCAAGCGGTCGT ddC-3' (SEQ ID NO: 9); Sequence B of the NO. 2 adapter: 5'-TTGGCCTCCGACT ddT-3' (SEQ ID NO: 10)(p represents phosphorylation modification , dd represents dideoxy modification). |
| Component | Content |
| Processed DNA samples | 30µL |
| 5× PCR buffer | 10µL |
| 10mM dNTP | 1µL |
| Primer 1 | 2µL |
| Primer 2 | 2µL |
| PCR enzyme (DNA polymerase) | 1µL |
| Pure water | 4µL |
| Total | 50 µL |
| Note: Primer 1 of the NO. 1 adapter in the form of single-adapter: Primer 2 of the NO. 1 adapter in the form of single-adapter: TCCTAAGACCGCTTGGCCTCCGACT (SEQ ID NO: 20). |
| Temperature | Time | Cycle |
| 72 °C | 3min | 1 Cycle |
| 98 °C | 30sec | 1 Cycle |
| 98 °C | 10sec | 15 Cycles |
| 60 °C | 30sec | |
| 72 °C | 3min | |
| 72 °C | 5min | 1 Cycle |
| 4°C | ∞ | - |
| Group | Processing method after interruption | PCR product concentration (ng/µL) | Remarks (Fig. 4) |
| 1 | 2µL protease +1% Triton-X100 | 11.4 | Lane 1 |
| 2 | NT buffer +1% Triton-X100 | 13 | Lane 2 |
| 3 | 1% SDS +1% Triton-X100+0.5% Tween-20 | 12.4 | Lane 3 |
| 4 | 2µL protease +14mM EDTA+1% Triton-X100 | 12 | Lane 4 |
| 5 | 1 ×PBI, 1.3×Ampure XP beads | 13.5 | Lane 5 |
| 6 | 0.1µL protease +1mM EDTA+0.1 % Triton-X 100 | 6.2 | - |
| 7 | 5µL protease +50mM EDTA+2% Triton-X100 | 10.3 | - |
| 8 | 0.01% SDS+0.1% Triton-X100+0.1% Tween-20 | 5.3 | - |
| 9 | 1.5% SDS+2% Triton-X100+2% Tween-20 | 9.1 | - |
| 10 | 0.1µL protease +0.1% Triton-X100 | 6 | - |
| 11 | 5µL protease +2% Triton-X100 | 10.1 | - |
SEQUENCE LISTING
<110> BGI SHENZHEN CO., LIMITED
<120> METHOD FOR BREAKING NUCLEIC ACID AND ADDING ADAPTOR BY MEANS OF
TRANSPOSASE, AND REAGENT
<130> P49118EP-PCT
<140> EP14903871.3
<141> 2014-10-14
<160> 20
<170> PatentIn version 3.3
<210> 1
<211> 19
<212> DNA
<213> Artificial sequence
<220>
<223> Sequence A of single-adapter 1
<220>
<221> modified_base
<222> (19)..(19)
<223> dideoxy modification, 3'end dideoxy modification
<400> 1
ctgtcuctta uacacatct 19
<210> 2
<211> 34
<212> DNA
<213> Artificial sequence
<220>
<223> Sequence B of single-adapter 1
<400> 2
gcttcgactg gagacagatg tgtataagag acag 34
<210> 3
<211> 20
<212> DNA
<213> Artificial sequence
<220>
<223> Sequence A of single-adapter 2
<220>
<221> modified_base
<222> (20)..(20)
<223> dideoxy modification
<400> 3
gctgtctctt atacacatct 20
<210> 4
<211> 35
<212> DNA
<213> Artificial sequence
<220>
<223> Sequence B of single-adapter 2
<220>
<221> modified_base
<222> (35)..(35)
<223> dideoxy modification, 3'end dideoxy modification
<400> 4
gcttcgactg gagacagatg tgtataagag acagc 35
<210> 5
<211> 53
<212> DNA
<213> Artificial sequence
<220>
<223> Sequence of single-adapter 3
<220>
<221> modified_base
<222> (53)..(53)
<223> dideoxy modification,3'end dideoxy modification
<400> 5
gcttcgactg gagacagatg tgtataagag acagctgtct cttatacaca tct 53
<210> 6
<211> 19
<212> DNA
<213> Artificial sequence
<220>
<223> Sequence A of double-adapters
<400> 6
ctgtctctta tacacatct 19
<210> 7
<211> 33
<212> DNA
<213> Artificial sequence
<220>
<223> Sequence B of double-adapters
<400> 7
tcgtcggcag cgtcagatgt gtataagaga cag 33
<210> 8
<211> 34
<212> DNA
<213> Artificial sequence
<220>
<223> Sequence C of double-adapters
<400> 8
gtctcgtggg ctcggagatg tgtataagag acag 34
<210> 9
<211> 23
<212> DNA
<213> Artificial sequence
<220>
<223> Sequence A of the NO.2 adapter
<220>
<221> modified_base
<222> (1)..(1)
<223> phosphorylation modification, 5'end phosphorylation modification
<220>
<221> modified_base
<222> (23)..(23)
<223> dideoxy modification, 3'end dideoxy modification
<400> 9
aagtcggagg ccaagcggtc gtc 23
<210> 10
<211> 14
<212> DNA
<213> Artificial sequence
<220>
<223> Sequence B of the No.2 adapter
<220>
<221> modified_base
<222> (14)..(14)
<223> dideoxy modification, 3'end dideoxy modification
<400> 10
ttggcctccg actt 14
<210> 11
<211> 41
<212> DNA
<213> Artificial sequence
<220>
<223> Primer 1 of single-adapter
<400> 11
agacaagctc gagctcgagc gatcgggctt cgactggaga c 41
<210> 12
<211> 25
<212> DNA
<213> Artificial sequence
<220>
<223> Primer 2 of single-adapter
<400> 12
tcctaagacc gcttggcctc cgact 25
<210> 13
<211> 20
<212> DNA
<213> Artificial sequence
<220>
<223> Primer 1 of double-adapters
<400> 13
aatgatacgg cgaccaccga 20
<210> 14
<211> 21
<212> DNA
<213> Artificial sequence
<220>
<223> Primer 2 of double-adapters
<400> 14
caagcagaag acggcatacg a 21
<210> 15
<211> 24
<212> DNA
<213> Artificial sequence
<220>
<223> Mediating sequence for single-adapter
<400> 15
tcgagcttgt cttcctaaga ccgc 24
<210> 16
<211> 24
<212> DNA
<213> Artificial sequence
<220>
<223> Mediating sequence for double-adapters
<400> 16
cgccgtatca ttcaagcaga agac 24
<210> 17
<211> 33
<212> DNA
<213> Artificial sequence
<220>
<223> Sequence A of the NO.1 adapter in the form single-adapter
<400> 17
tcgtcggcag cgtcagatgt gtataagaga cag 33
<210> 18
<211> 19
<212> DNA
<213> Artificial sequence
<220>
<223> Sequence B of the NO.1 adapter in the form of single-adapter
<220>
<221> modified_base
<222> (19)..(19)
<223> dideoxy modification, 3'end dideoxy modification
<400> 18
ctgtctctta tacacatct 19
<210> 19
<211> 59
<212> DNA
<213> Artificial sequence
<220>
<223> Primer 1 of the NO.1 adapter in the form of single-adapter
<400> 19
agacaagctc gagctcgagc gatcgggatc tacacgactc actgatcgtc ggcagcgtc 59
<210> 20
<211> 25
<212> DNA
<220>
<223> Primer 2 of the NO.1 adapter in the form of single-adapter
<400> 20
tcctaagacc gcttggcctc cgact 25
randomly interrupting a nucleic acid by using a transposase-embedded complex, wherein the transposase-embedded complex comprises a transposase and a first adapter comprising a transposase identification sequence, and both ends of the interrupted nucleic acid are separately ligated to the first adapter to form a gap at each end, wherein the first adapter is a double-stranded adapter;
eliminating the transposase in the system by means of purification, or by dissociating the transposase from a target sequence by denaturing or digesting the transposase by means of chemical reagent treatment;
ligating to a second adapter at the gap by using a ligase, wherein the sequence of the second adapter is different from that of the first adapter, wherein the second adapter having a modification preventing self-ligation, and the modification on the second adapter is a 3' terminal base dideoxy modification, wherein the second adapter is a double-stranded adapter; and
performing a PCR reaction by using primers targeted to the first adapter and the second adapter respectively, so as to obtain a product whose both ends are respectively ligated to different adapter sequences ;
wherein the first adapter has a modification to prevent self-ligation and inter-ligation with the second adapter , wherein the modification on the first adapter is a 3' terminal base dideoxy modification.
(a) introducing a dUTP into a chain of the first adapter for subsequent enzymatic cleavage of excess adapters; and
(b) introducing a base pair at the outside of the transposase identification sequence of the first adapter.
zufälliges Unterbrechen einer Nukleinsäure mithilfe eines Transposase-eingebetteten Komplexes, wobei der Transposase-eingebettete Komplex eine Transposase und einen ersten Adaptor enthält, umfassend eine Transposase-Identifikationssequenz, und beide Enden der unterbrochenen Nukleinsäure zur Bildung einer Lücke getrennt an den ersten Adaptor an jedem Ende ligiert werden, wobei der erste Adaptor ein doppelsträngiger Adaptor ist;
Eliminieren der Transposase in dem System mittels Reinigung, oder durch Dissoziation der Transposase aus einer Zielsequenz durch Denaturierung oder Aufschluss der Transposase mittels einer Behandlung mit einem chemischen Reagenz;
Ligieren an einen zweiten Adaptor an der Lücke mithilfe einer Ligase, wobei die Sequenz des zweiten Adaptors sich von der des ersten Adaptors unterscheidet, wobei der zweite Adaptor eine Selbstligation verhindernde Modifikation aufweist, und die Modifikation an dem zweiten Adaptor eine 3'-terminale Basen-Didesoxy-Modifikation ist, wobei der zweite Adaptor ein doppelsträngiger Adaptor ist; und
Durchführen einer PCR-Reaktion mithilfe von an den ersten Adaptor bzw. an den zweiten Adaptor targetierten Primern, um auf diese Weise ein Produkt zu erhalten, dessen beide Enden jeweils an verschiedene Adaptorsequenzen ligiert sind;
wobei der erste Adaptor eine Modifikation zur Verhinderung einer Selbstligation und Zwischenligation mit dem zweiten Adaptor aufweist, wobei die Modifikation an dem ersten Adapter eine 3'-terminale Basen-Didesoxy-Modifikation ist.
(a) Einführen eines dUTP in eine Kette des ersten Adaptors für die anschließende enzymatische Spaltung von überschüssigen Adaptoren; und
(b) Einführen eines Basenpaars an der Außenseite der Transposase-Identifikationssequenz des ersten Adaptors.
interruption aléatoire d'un acide nucléique en utilisant un complexe incrusté de transposase, dans lequel le complexe incrusté de transposase comprend une transposase et un premier adaptateur comprenant une séquence d'identification de transposase, et les deux extrémités de l'acide nucléique interrompu sont ligaturées séparément au premier adaptateur pour former un écartement au niveau de chaque extrémité, dans lequel le premier adaptateur est un adaptateur double brin ;
élimination de la transposase dans le system au moyen de la purification, ou en dissociant la transposase d'une séquence cible par dénaturation ou digestion de la transposase au moyen d'un traitement avec un réactif chimique ;
ligation d'un deuxième adaptateur au niveau de l'écartement en utilisant une ligase, dans lequel la séquence du deuxième adaptateur est différente de celle du premier adaptateur, dans lequel le deuxième adaptateur a une modification empêchant l'auto-ligation, et la modification sur le deuxième adaptateur est une modification didésoxy de base 3'-terminale, dans lequel le deuxième adaptateur est un adaptateur double brin ; et
réalisation d'une réaction de PCR en utilisant des amorces ayant pour cible le premier adaptateur et le deuxième adaptateur respectivement, de manière à obtenir un produit dont les deux extrémités sont respectivement ligaturées à des séquences d'adaptateur différentes ;
dans lequel le premier adaptateur comporte une modification pour prévenir l'auto-ligation et l'inter-ligation avec le deuxième adaptateur, dans lequel la modification sur le premier adaptateur est une modification didésoxy de base 3'-terminale.
(a) introduction d'une dUTP dans une chaîne du premier adaptateur pour le clivage enzymatique subséquent d'adaptateurs excédentaires ; et
(b) introduction d'une paire de bases à l'extérieur de la séquence d'identification de transposase du premier adaptateur.
REFERENCES CITED IN THE DESCRIPTION
Patent documents cited in the description