METHOD FOR INTRODUCTION OF DISEASE AND PEST RESISTANCE INTO PLANTS AND NOVEL GENES INCORPORATED INTO PLANTS WHICH CODE THEREFOR

Description

[0001] This invention relates to a method for protecting plants from both disease and pests by means of genetic engineering to incorporate into the plant antagonistic agents or inhibitors for the infectious or harmful conditions which result. More specifically, plants suffer pathogenic conditions commonly known as diseases caused by virus, bacteria and fungus. Further, pests, such as various kinds of insects, cause untold damage to plants. The present invention provides a method for incorporating into the plant itself the means with which to deal with such pathogenic conditions.

[0002] Development of plant biology began in the early 1940s when experiments were being carried out to determine the biological principle causing formation of crown gall tumors. The tumor-inducing principle was shown to be a bacterial plasmid from the infective organism Agrobacterium tumefaciens. This plasmid has been characterized in exquisite biochemical detail utilizing the currently available techniques of recombinant DNA technology. The mode Of operation for infection was the discovery that the bacterium elicits its response by actually inserting a small fragment of the bacterial plasmid into the plant nucleus where it becomes incorporated and functions as a plant gene. This discovery opened the door to using Agrobacterium and their plasmids as vehicles to carry foreign DNA to the plant nucleus There are, however, limitations to the application of these techniques and they include: (1) susceptibility to infection with the Agrobacterium plasmid and (2) available tissue culture technology for regeneration of the transformed plants. These limitation have meant that, to date, there are no successful reports on genetic engineering of cereals because of the inability of Agrobacterium to infect cereal plants.

[0003] The plant genes, like all other genes, are simply strings of nucleic acid bases. The function of synthetic genes within the plant can be to produce a gene product which has its own intrinsic value or to produce an intermediate gene product, such as mRNA, that plays a regulatory role within the plant cell. Synthetic genes are most useable when the technical capability does not exist to isolate and purify genes from natural organisms. Both purified and synthetic genes may be used in conferring protection to plants against disease or pests. An example of the use of synthetic genes to confer resistance to viruses and viroids in plants comes through the use of the co-evolution of many viruses with the plant hosts. Plants and animals have evolved very precise and elegant mechanisms which allow the regulated expression of their genes. Viruses by co-evolution have exploited and continue to exploit the eukaryotic cell of a plant by mimicking the general structure of the plant genes. Often, the end result of this for the plant is disease. While plants and animals are prisoners of their own evolution, so are viruses since they are dependent upon the plant and animal system of gene regulation and expression to synthesize and translate their own genes into the plant. This dependency is considered the key to control of viral disease. It has recently been found that bacteria regulate expression of some genes in a rather novel way. Under conditions where the cell would repress the biosynthesis of a particular protein, an additional level of control is exerted. This newly discovered type of gene control is called "micRNA" control and stands for "mRNA-interfering complementary RNA". This micRNA or "antisense" RNA is complementary to the 5' end of the gene and when it is produced has the ultimate effect of reducing the amount of messenger RNA (mRNA) by annealing to it, thus removing it from normal protein synthesis.

[0004] Viroids are single-stranded ribonucleic acid (RNA) of a few hundred nucleotides. They are the smallest self-replicating structures known and represent the lowest form of life. They are the causative agents of a number of plant diseases and elicit mild to lethal responses in a range of plants depending on the fine structure of the viroid and the susceptibility of the plant genotype. In the case of viroids, the logic is to inhibit the replication of the disease-causing molecule. Viroids are infective pieces of nucleic acid and do not have a protein component like viruses. Using methodology similar to viruses, we have the opportunity of blocking the nucleic acid replication (called transcription).

[0005] Many plants contain genes that confer virus resistance and, in some cases, resistance is due to a single dominant gene while, in other cases, the resistance is genetically more complex, i.e., requiring a number of genes to confer resistance. While it is presently practically impossible to identify, isolate and purify these resistance genes and, in fact, the chromosomes which carry these genes cannot even be located, utilizing the in vivo-produced antisense fragments, it may be possible to attain virus and viroid resistance by the insertion of a single synthetic gene which ultimately would produce an RNA complementary to specific regions of the viral genome and would play a role in the disruption of replication or translation of the virus. This complementary or antisense gene would be specific for a particular viral pathogen. Plants endowed with a number of these antisense genes would protect them from a variety of viral diseases, such as the symptoms observed in a viral disease of a potato.

[0006] In contrast to the use of one or more synthetic genes for protection of plants against viral disease, bacterial protection employs the known response of an insect to bacterial infection to confer resistance to bacterial disease. The pupae of Hyalophora (a type of silk moth) respond to bacterial infection by the synthesis of mRNAs which culminate in the production of about 15 to 20 new proteins. Lysozyme, the antibacterial protein found in egg white and human tears, and two other classes of antibacterial peptides,called cecropins and attacins, have been purified from these newly synthesized proteins. Lysozyme has been shown to be effective in limiting bacterial growth. When lysozyme was placed on a small paper dish in two concentrations, after an agar plate was seeded with plant pathenogenic bacteria, the lysozyme inhibitory zone was quite clear.

[0007] These proteins have a rather broad spectrum activity in that they are effective on many different types of bacteria. Thus, the insects have evolved a rather successful and novel means to fight bacterial infections. Although a traditional immunologist would think this system lacks specificity, the insect has a rather potent arsenal of at least three different bacterial proteins which may work in different ways to actively seek to destroy the bacterial pathogen. Thus, the invading bacteria is presented with a formidable challenge which would be very difficult to circumvent. While a bacterial pathogen may be naturally resistant to one, it is highly improbable that it would be resistance to all three toxins. Although determination of the exact mode of action of the protein toxins is required, they are quite prokaryote specific and appear to be benign to eukaryotic cells. Science Vol 223, pages 496-498, Horsch et al discloses transgenic plants containing a selectable marker gene for kanomycin resistance. This reference teaches that plants may be transformed with a bacterial gene and that the transformed gene may be expressed.

[0008] The EMBO Journal Vol. 4 No. 8, pages 2119-2122 A. Engstram et al on the other hand discloses the existance of insect polypeptide inhibitors which are secreted by cecropin moths in response to bacterial infection. Incorporation of the proteins derived from humoral response in Hyalophora are an attractive genetic system for protecting plants from bacterial disease which causes significant economic loss. As an example, the main diseases in potato are bacterial soft rot and bacterial wilt caused by Erwiria carotovora and Pseudomonas solanacearum, respectively. These diseases are primarily responsible for limiting the growth of potatoes in many areas of Asia, Africa, South and Central America. The introduction of genes encoding for these antibacterial proteins into crop plants may revolutionize the protection of plants from bacterial-produced disease.

[0009] In a manner analogous to the antibacterial-protein producing insect, it has been found that some bacteria are natural repositories which contain genes encoding for proteins effective against fungi. The biochemical analysis of these compounds and the ultimate molecular characterization of genes encoding the synthesis of these natural antifungal agents could be of great importance in limiting the scope and severity of fungal disease in crop plants. It is believed that from 1845 to 1860 the fungal disease of the potato caused by Phytophthora infestans or Late Blight caused the Irish potato famine in which one million people died of starvation and one and a half million people immigrated to North America because of the decimation of the potato crop caused by this fungal pest.

[0010] Control of insect pests which cause tremendous losses of food and fiber derived from plants directly attributed to the insects and as a vector for the infection and spread of other plant pathogens requires increasing a plants tolerance to insect damage. Such increased tolerance would be of significant economic value. One method for protecting plants from insect damage is the use of natural insecticides such as a protein isolated from Bacillus thuringiensis which forms a high molecular weight crystal in the bacteria which is toxic to the larvae of a number of lepidopteral insects. However, it is believed that the insects would develop an immunity to the toxin within a few generations. Thus, other possibilities are being considered. One of the most promising is the use of an enzyme called chitinase as a natural insecticide. Chitinase is an enzyme produced in bacteria and the gene which encodes it has been isolated. An insect exoskeleton and gut are composed of chitin and it has been shown that any disruption of the chitin integument will result in the insect contracting an infection from the natural environment with death ensuing after a very short period of time. Inserting the enzyme-encoding gene for chitinase into the plant will provide a potent chitin-dissolving enzyme within the plant which will limit the extent of damage wrought by insects and secondarily limit the spread of other plant diseases which use insects as a vector.

[0011] According to the present invention there is provided a method for protecting a plant from a pathogenic plant condition comprising:
   incorporating into the plant's genome one or more genes derived from Hyalophora which encode a polypeptide inhibitor or a precursor thereof to said pathogenic plant condition which polypeptide inhibitor is one derived from the humoral response to bacterial infection of the Hyalophora and is selected form the group consisting of lysozyme, attacin and cecropin such that expression of said polypeptide inhibitor in said plant confers to said plant resistance to said pathogenic plant condition.

[0012] According to a further aspect of the present invention there is provided a plant cell comprising one or more expressible genes encoding lysozyme, attacin or cecropin.

[0013] According to a further aspect of the present invention there is provided an Agrobacterium vector for transforming a plant cell, said vector comprising one or more genes encoding lysozyme, attacin or cecropin.

[0014] Preferably, the present invention provide a method of inhibiting a pathogenic plant condition selected from viral infection, bacterial infection, fungal infection or insect infestation in a plant, said method comprising expressing into the plant genome one or more genes which encode for a polypeptide inhibitor or inhibitor precursor of said pathogenic condition, which inhibitor or precursor is a protein derived from the humoral response to bacterial infection of the Hyalophora, said expressing preferably being carried out by random ligation of a plasmid containing said inhibitor or precursor enclosing gene, uptake of the inhibitor containing plasmid into Escherchia coli having a Hind III 17 fragment of T-DNA incorporated therein, introducing into an Agrobacterium strain carrying an unmodified R1 plasmid such that culturing with the plant genome results in said T-DNA containing the passenger (synthetic) DNA being incorporated into the plant genome and can be regenerated therewith to have an inhibiting effect for the pathogenic condition.

[0015] The invention is further described, by way of specific example only with reference to the following detailed description.

[0016] The method provided by the present invention provides an inhibitor for a number of adverse plant conditions, including bacterial infections, viral infections, fungal infections, and insect infestations. Initially, the method for inhibiting plant disease, particularly plant disease caused by bacterial infections, is considered. Bacterial infections are known to cause an antibacterial response in certain insects. As indicated above, the pupae of Hyalcphora synthesize mRNA's which result in the production of 15 to 20 new proteins, from which lysozyme, cecropin and attacin have been purified.

[0017] The lysozyme gene and protein was obtained from Hyalophora-derived plasmid pBR322, provided by Kleanthis Xanthopoulos. The lysozyme gene was removed from the plasmid pBR322 by digestion with the enzyme Pst I. The resultant fragment was purified and treated with the Bal 31 enzyme to remove the 3' poly dG tail. Then the adapter shown as follows:


was ligated to the fragment after digestion with enzyme Xmn I. Then the fragment is digested with Sal I and closed into the plasmid pBR322. The lysozyme gene was rescued by digestion with enzyme Bgl II and inserted into the plant vector pMON237.

[0018] The lysozyme gene coding for antibacterial proteins has been identified and contains the following nucleotide sequence:


This lysozyme gene produces an accompanying protein or polypeptide which has the amino acid sequence:

[0019] In a somewhat similar manner, the attacin gene and its accompanying protein, obtained as a part of the plasmid pBR322 from Kleanthis Xanthopoulos, were removed, provided with appropriate start and stop amino acids and inserted into a plant vector for inclusion into a suitable host for growth and testing for antibacterial properties in plant cells. The attacin gene was removed from pBR322 by digestion with the enzyme Pst I, according to conventional procedures. The resultant plasmid fragment was purified and digested with FnuDII and Dra I. The adapter oligonucleotide


was joined to the fragment by ligation. Then the adapter-containing fragment was digested with Sal I and cloned into plasmid pBR322. The full length attacin gene was then obtained from pBR322 by digestion with Bgl II and inserted into the plant vector pMON237 and had the start methionine at the amino terminus end. The plant vector pMON237 containing the antibacterial attacin gene confers this antibacterial property on plants produced from plant cells having the pMON237 inserted.

[0020] The attacin gene coding for antibacterial protein has been identified and contains the following nucleotide sequence:


This attacin gene produces an accompanying protein or polypeptide having the amino acid sequence as follows:

[0021] Further, and similarly, the antibacterial protein producing cecropin gene, obtained in plasmid pBR322 received from Kleanthis Xanthopoulos was first cut with restriction enzymes Pst I and HinPlI to provide a plasmid fragment pCPFL1. The resulting 260 base pair fragment was purified and treated with T4 DNA polymerase to fill in the HinPlI site. The resultant fragment was then treated with T4 DNA ligase and the synthetic adapter C3, which is identified as follows:


was joined to the fragment. The new gene fragment was then ligated to pBR322 which had been cleaved with restriction enzymes XmnI and AatII. Clones containing the correct ampicillin sensitive genotype were selected, cut with XmnI and ligated with a synthetic adaptor identified as C5, which has the following nucleotide sequence:


The resultant fragment was retransformed with E. Coli. The cecropin gene is rescued from E. Coli by digestion with Bgl II and inserted into the plant vector pMON237. Thus, the cecropin gene is regenerated without its leader peptide and with an appropriate start methionine at the amino terminus end and the correct translational termination (stop) signal at the carboxy terminus end.

[0022] The cecropin gene has been identified and has the following nucleotide sequence:


This cecropin gene produces an accompanying protein or polypeptide having an antibacterial amino acid sequence as follows:

[0023] The Agrobacterium tumefaciens microbes containing the insect produced antibacterial proteins produced according to the method of the present invention have been given the designations pAT-LYS, pAT-ATN and pAT-CN for those which contain genes encoding for lysozyme, attacin and cecropin proteins, respectively. These novel microbes are available for reproduction and maintenance and will be preserved by the inventor at Louisiana State University, Baton Rouge, Louisiana, until such time as deposit in a commercial depository is required in the event of allowance of the present application. In view of the present discoveries and inventions, another feature of this invention is a composition comprising a plasmid contained in a microbe which contains a DNA sequence which codes for a polypeptide derived from the humoral response to bacterial infection of the Hyalophora. Particularly, the present invention includes a composition in which the microbe is Agrobacterium tumefaciens. More particularly, the composition of this invention includes such a microbe in which the polypeptide is selected from lysozyme, attacin, cecropin and a mixture thereof.

[0024] The method of inhibiting fungi includes the selection, cloning and insertion of genes encoding for antifungal compounds into an appropriate plant vector. Certain naturally occurring bacteria produce toxins for fungi. Such bacteria retain gene(s) which encode for the production of these antifungal compounds. The DNA separated from these antifungal compound producing bacteria are isolated, shotgun cloned into a lambda vector and subsequently used to transfect E. coli. In addition, the same DNA can be shotgun cloned into Pseudomonas directly using the Pseudomonas vectors pWS3 and pWS6 described by Werneke et al, Gene 38 (1985) 73-84. The resultant transformants are plated and oversprayed with the indicator single cell eukaryote Rhodotorula. This powerful selection tool locates the DNA (genes) encoding for the antifungal toxin compounds and characterizes them sufficiently to allow for their expression in a plant by suitable plant vectors in the manner previously described. Insertion of the antifungal compounds as genes or DNA encoding therefor provides plant species having antifungal properties.

[0025] In much the same manner a species providing a chitinase enzyme is selected for identification, cloning, insertion into a plant vector and production of a plant producing the chitinase enzyme. It has been found that certain species of the bacterial genus Vibrio produce a very active chitinase enzyme. Thus another aspect of this invention provides a method for inhibiting insect infestation and insect damage to plants by providing a chitinase enzyme producing plant. The DNA or gene encoding for production of the chitinase enzyme can be cut out of the Vibrio bacteria DNA with digestion by the restriction enzyme Hind III. A DNA sequence analysis can be employed to determine the appropriate start and stop positions of the gene. Further cloning is required to implant the desired gene into the plant genome as described previously for the antibacterial encoding genes inserted into plant vectors.

[0026] The method for inhibiting viruses and viroids includes the provision of an antisense or complementary oligonucleotide which inhibits or prevents the replication of the virus or viroid or which inhibits the translation of the virus. In Vitro procedures utilizing a 41 base DNA otigonueleotide having the sequence:
GATCTCCACGGTTGTGGCCATATAATCATCGTGTTTTTCAA
effectively blocked 98% of the translation of a virus genome. This procedure was carried out by hybridizing the DNA to the virus in an 8 microliter reaction mixture containing 20 mM Hepes, pH 7.6, 0.1M NaCl and 1mM ETDA. RNA concentration of the virus was 0.5 mg/ml and the DNA was added in a five-fold molar excess. In general, the reaction mixtures were heated at 70°C for 10 minutes followed by incubation at 45°C for 3 hours. The process of determining viral RNA translation is in a cell-free protein synthesis regime, such as in RNA rabbit reticulocyte lysate system described by Shih et al at Proceedings of the National Academy of Science of the U.S.A., 75, 5807-5811(1978) and in the Journal of Virology, 30, 472-480 (1979), both of which are incorporated by reference as if fully set forth. As a result of the hybridization, viral translation was effectively blocked.

[0027] In the case of viroids, replication was prevented in the potato spindle tuber viroid (PSTV) by hybridization of synthetic DNA fragments to the PSTV in the central conserved region which appears to be present in all known viroids and is presumed to be important for replication. The synthetic DNA fragments have the oligonucleotide sequence and identification as follows:



This hybridization was carried out by annealing the various oligonucleotide fractions to purified, infectious PSTV RNA. The sample mixture was heated to 90°C for 5 minutes and then allowed to cool slowly to room temperature. These mixtures were then innoculated onto PSTV sensitive tomato plants and symptoms were allowed to develop. The results are shown in the Table below.

Table of Molar Ratio of Compositions Innoculated in Tomato Plants
Innocula	Molar Ratio	Infected Tomato Plants (#infected/#innoculated)
PSTV + PSTV1	1:1	0/4
PSTV + PSTV1	10:1	0/4
PSTV + PSTV1	1:10	0/4
PSTV + PSTV2	1:1	0/4
PSTV + PSTV2	10:1	2/4
PSTV + PSTV2	1:10	0/4
PSTV + PSTVf*	1:1	1/4
PSTV + PSTVf	10:1	0/4
PSTV + PSTVf	1:10	0/4
PSTV alone		3/5

*PSTVf is a full length DNA of PSTV.

When hybridization occurs, the further replication of the PSTV molecule was blocked.

[0028] The synthetic DNA transcription blocking for viroids and synthetic DNA translation blocking for viruses are inserted into a plant vector to produce plants which are not susceptible to the viroids and viruses described.

Claims

1. A method for protecting a plant from a pathogenic plant condition comprising incorporating into the plant's genome one or more genes derived Hyalophora which encode a polypeptide inhibitor or a precursor thereof to a pathogenic plant condition which polypeptide inhibitor is one derived from the humoral response to bacterial infection of the Hyalophora and is selected from the group consisting of lysozyme, attacin and cecropin such that expression of said polypeptide inhibitor in said plant cell confers to said plant cell resistance to said pathogenic plant condition.

2. A method as claimed in claim 1 wherein the one or more genes are isolated from the Hyalophora.

3. A method as claimed in claim 1 wherein the one or more genes are synthetic genes.

4. A method as claimed in any of claims 1, 2 or 3 in which said pathogenic plant condition is a bacterial, viral or fungal infection.

5. A method as claimed in claim 4, in which said pathogenic plant condition is a bacterial infection.

6. A method as claimed in claim 5 in which said one or more genes encodes the polypeptide cecropin.

7. A plant cell comprising one of more expressible genes derived from Hyalophora which encode a polypeptide inhibitor or a precursor thereof to a pathogenic plant condition which polypeptide inhibitor is one derived from the humoral response to bacterial infection of the Hyalophora and is selected from the group consisting of lysozyme, attacin and cecropin such that expression of said polypeptide inhibitor in said plant cell confers to said plant cell resistance to said pathogenic plant condition.

8. A plant cell as claimed in claim 7 wherein the one or more expressible genes are isolated from the Hyalophora.

9. A plant cell as claimed in claim 7 wherein the one or more genes are synthetic genes.

10. An Agrobacterium vector for transforming a plant cell, said vector comprising one or more genes derived from Hyalophora which encode a polypeptide inhibitor or a precursor thereof to a pathogenic plant condition which polypeptide inhibitor is one derived from the humoral response to bacterial infection of the Hyalophora and is selected from the group consisting of lysozyme, attacin and cecropin.

11. An Agrobacterium vector as claimed in claim 10 wherein the one or more genes are isolated from Hyalophora.

12. An Agrobacterium vector as claimed in claim 10 wherein the one or more genes are synthetic genes.

Ansprüche

1. Verfahren zum Schutz einer Pflanze vor einer Pflanzenkrankheit, welches den Einbau in das Genom der Pflanze von einem oder mehreren sich von Hyalophora herleitenden Genen umfaßt, die einen Polypeptid-Inhibitor oder einen Precursor davon gegen eine Pflanzenkrankheit kodieren, bei welchem Polypeptid-Inhibitor es sich um einen handelt, der sich von der humoralen Antwort auf eine Bakterieninfektion von Hyalophora herleitet und aus der Gruppe ausgewählt wird, die aus Lysozym, Attacin und Cecropin dergestalt besteht, daß die Expression des genannten Polypeptid-Inhibitors in genannter Pflanzenzelle der genannten Pflanzenzelle Resistenz gegen genannte Pflanzenkrankheit verleiht.

2. Verfahren nach Anspruch 1, worin das eine oder mehrere Gene aus Hyalophora isoliert werden.

3. Verfahren nach Anspruch 1, worin das eine oder mehrere Gene synthetische Gene sind.

4. Verfahren nach einem der Ansprüche 1, 2 oder 3, in welchem genannte Pflanzenkrankheit eine Bakterien-, Virus- oder Pilzinfektion ist.

5. Verfahren nach Anspruch 4, in welchem genannte Pflanzenkrankheit eine Bakterieninfektion ist.

6. Verfahren nach Anspruch 5, in welchem das genannte eine oder mehrere Gene das Polypeptid Cecropin kodieren.

7. Pflanzenzelle, die ein oder mehrere sich von Hyalophora herleitende, exprimierbare Gene umfaßt, welche einen Polypeptid-Inhibitor oder einen Precursor davon gegen eine Pflanzenkrankheit kodieren, bei welchem Polypeptid-Inhibitor es sich um einen handelt, der sich von der humoralen Antwort auf eine Bakterieninfektion von Hyalophora herleitet und aus der Gruppe ausgewählt wird, die aus Lysozym, Attacin und Cecropin besteht, dergestalt, daß die Expression des genannten Polypeptid-Inhibitors in genannter Pflanzenzelle genannter Pflanzenzelle Resistenz gegen genannte Pflanzenkrankheit verleiht.

8. Pflanzenzelle nach Anspruch 7, worin das eine oder mehrere exprimierbare Gene aus Hyalophora isoliert werden.

9. Pflanzenzelle nach Anspruch 7, worin das eine oder mehrere Gene synthetische Gene sind.

10. Agrobacterium-Vektor zum Transformieren einer Pflanzenzelle, worin genannter Vektor ein oder mehrere sich von Hyalophora herleitende Gene umfaßt, die einen Polypeptid-Inhibitor oder einen Precursor davon gegen eine Pflanzenkrankheit kodieren, bei welchem PolypeptidInhibitor es sich um einen handelt, der sich von der humoralen Antwort auf eine Bakterieninfektion von Hyalophora herleitet und aus der Gruppe ausgewählt wird, die aus Lysozym, Attacin und Cecropin besteht.

11. Agrobacterium-Vektor nach Anspruch 10, worin das eine oder mehrere Gene aus Hyalophora isoliert werden.

12. Agrobacterium-Vektor nach Anspruch 10, worin das eine oder mehrere Gene synthetische Gene sind.

Revendications

1. Procédé de protection d'une plante contre une condition de plante pathogène comportant l'incorporation dans le génome de la plante d'un ou des gènes dérivés de l'Hyalophora qui codent un inhibiteur polypeptidique ou son précurseur en une condition de plante pathogénique, cet inhibiteur polypeptidique est un inhibiteur dérivé de la réaction humorale à l'infection bactérienne de l'Hyalophora et est selectionné du groupe composé de lysozyme, attacine et cécropine de sorte que l'expression dudit inhibiteur polypeptidique dans ladite cellule de plante confère à ladite cellule de plante une résistance à ladite condition de plante pathogénique.

2. Procédé selon la revendication 1 dans lequel le ou les gènes sont isolés de l'Hyalophora.

3. Procédé selon la revendication 1 dans lequel le ou les gènes sont des gènes synthétiques.

4. Procédé selon le revendication 1, 2 ou 3 dans lequel ladite condition de plante pathogénique est une infection bactérienne, virale ou fongique.

5. Procédé selon la revendication 4, dans lequel ladite condition de plante pathogénique est une infection bactérienne.

6. Procédé selon la revendication 5 dans lequel le ou lesdits gènes codent la cécropine polypeptidique.

7. Cellule de plante comportant un ou des gènes exprimables dérivés de l'Hyalophora qui codent l'inhibiteur polypeptidique ou son précurseur en une condition de plante pathogénique, cet inhibiteur polypeptidique est un inhibiteur dérivé de la réaction humorale à l'infection bactérienne de l'Hyalophora et est sélectionné du groupe composé de lysozyme, attacine et cécropine de sorte que l'expression dudit inhibiteur polypeptidique dans ladite cellule de plante confère à ladite cellule de plante une résistance à ladite condition de plante pathogénique.

8. Cellule de plante selon la revendication 7 dans laquelle le ou les gènes exprimables sont isolés de l'Hyalophora.

9. Cellule de plante selon la revendication 7 dans laquelle le ou les gènes sont des gènes synthétiques.

10. Vecteur d'Agrobactérie pour transformer une cellule de plante, ledit vecteur comportant un ou des gènes dérivés de l'Hyalophora qui codent un inhibiteur polypeptidique ou son précurseur en une condition de plante pathogénique, cet inhibiteur polypeptidique est un inhibiteur dérivé de la réaction humorale de l'infection bactérienne de l'Hyalophora et est selectionné du groupe composé de lysozyme, attacine et cécropine.

11. Vecteur d'Agrobactérie selon la revendication 10 dans lequel le ou les gènes sont isolés de l'Hyalophora.

12. Vecteur d'Agrobactérie selon le revendication 10 dans lequel le ou les gènes sont des gènes synthétiques.