[0001] This invention relates to genetic engineering in yeast.
[0002] Technology currently exists for introducing heterologous (i.e., modified or foreign)
genes into laboratory strains of yeast of the genus
Saccharomyces, particularly
S. cerevisiae. Two- types of plasmid vectors have been used for this purpose, replicating and integrating.
Replicating vectors contain an origin of DNA replication that functions in yeast,
so that the plasmid is maintained extrachromosomally, as a circular episome. Integrating
vectors do not contain such an origin and therefore require insertion into a yeast
chromosome to be stably maintained.
[0003] Both types of plasmids can be introduced into yeast cells by standard transformation
methods. Since successful uptake and establishment of plasmid DNA by competent yeast
cells is a relatively rare event (<10⁻³), a selection mechanism is required to allow
identification of transformants.
[0004] Most commonly, selection is accomplished by introducing auxotrophic mutations into
the recipient yeast strain. The commonly used mutations are
ura3,
leu2,
trp1, and
his3. The plasmid of interest bears a wild type copy of one of these genes. Since the
wild type copy on the plasmid is dominant to the host chromosomal allele, selection
for cells that receive the plasmid is easily accomplished on a minimal medium lacking
the nutrient that is required by the auxotrophic host cell.
[0005] There have also been reports of the use of antibiotic resistance to select transformed
cells. Replicating vectors have been described that are based on the sensitivity of
most
Saccharomyces strains to the commercially available neomycin analog, antibiotic G418; Jimenez et
al. (1980) Nature
287, 869; Hollenberg (1982) in Current Topics in Microbiology and Immunology, Hofschneider
et al.,
eds. (Springer-Verlag, NY); Webster et al. (1983) Gene
26, 243. Webster et al. also describe an integrating plasmid vector which could not
be directly selected for by resistance to G418. These vectors contain a gene, called
kan
r, neo
r, or G418
r from the bacterial transposon Tn903, and a yeast origin of replication; the bacterial
gene is preceded by its native bacterial promoter.
[0006] Another replicating vector has been described which contains the gene for resistance
to the antibiotic hygromycin B under the control of a yeast promoter; Gritz et al.
(1983) Gene
25, 178.
[0007] In one aspect thereof, the invention features a vector including a gene for resistance
to an antibiotic otherwise capable of killing a ghost yeast cell, the gene being transcribed
from a yeast promoter sequence or synthetic promoter sequence, the vector being capable
of being integrated into a chromosome of the host yeast cell and directly selected
for.
[0008] A gene heterologous to the host yeast cell (i.e., a non-yeast gene, a modified gene,
a gene from a different yeast strain, or a homologous gene from a different chromosomal
location) can be inserted into the vector, and the vector used to transform the host
cells; transformants are selected on the basis of antibiotic resistance.
[0009] In preferred embodiments, the vector also includes a sequence which is homologous
with a sequence (a "target" sequence) of a host chromosome, to facilitate integration.
Preferably, the homologous sequence is separate from the control sequence which controls
the antibiotic resistance gene, and preferably the target is a region where the metabolism
of the host cell will not be interferred with.
[0010] In other preferred embodiments, the heterologous gene encodes an enzyme, e.g., glucoamylase
(which enables the generation of glucose from starch by the yeast cell), and the host
cell participates in a process, e.g., the production of dough, which employs a product
of the metabolism of the cell e.g. carbon dioxide.
[0011] In other preferred embodiments, the antibiotic resistance gene and the heterologous
gene are under the control of different promoters, the promoter controlling the heterologous
gene preferably being the more highly expressed of the two. The preferred integration
method is one which results in the depositing of the heterologous gene in the host
yeast cell chromosome, to the exclusion of much of the remainder of the vector DNA,
providing greatly increased stability. Exclusion of this DNA also eliminates a potential
source of interference with a characteristic, e.g, flavour, of the end product.
[0012] In a second and alternative aspect thereof, the invention provides a cloning vector
comprising a gene encoding glucoamylase, said vector enabling the expression of said
glucoamylase in a host yeast cell.
[0013] According to a third and alternative aspect thereof, the invention provides a cloning
vector comprising a gene encoding malolactic enzyme or malate permease, said vector
enabling the expression of said malolactic enzyme or malate permease in a host yeast
cell.
[0014] We provide, in accordance with a fourth alternative aspect of this invention, a vector
capable of being integrated into a chromosome of a host yeast cell, said vector including
a sequence homologous with a sequence of said chromosome, wherein integration of said
vector in said sequence of said chromosome does not interfere with the metabolism
of said host yeast cell.
[0015] In another alternative aspect thereof, the invention features a replicating vector
which includes a gene for resistance to G418, which gene is under the control of a
yeast control sequence.
[0016] Integrating vectors in accordance with this invention provide stability over generations
of host divisions in the absence of selection, an important advantage in industrial
fermentation processes; replicating vectors can be lost from yeast cells at rates
up to 1% to 5% per generation. Stable maintenance of integrated sequences over generations
obviates the addition of toxic antibiotics to the fermentation medium to exert selective
pressure to maintain the sequences. The vectors of the invention also function well
in yeast, by virtue of the yeast promoter sequence controlling the gene for antibiotic
resistance. Furthermore, since industrial yeast strains are usually diploid or polyploid
(as opposed to haploid laboratory strains), introduction into them of auxotrophic
mutations (used for selection of transformants in haploid strains) is difficult. The
use of antibiotic resistance in an integrating vector permits selection of stable
transformants in any yeast strain, regardless of number of chromosomes or the presence
or absence of specific mutations.
[0017] Introduction of genes encoding heterologous enzymes into industrial yeast strains
using the vectors of the invention will facilitate the production of such products
as alcohol, which ordinarily relies on sugars to feed the yeast. An enzyme such as
glucoamylase will enable the yeast to break down starch from inexpensive sources such
as tapioca and potatoes to yield glucose, which can be fed on by the yeast. Similarly,
bread-making can be made cheaper when starch (flour) rather than sugar is used as
the primary energy source.
[0018] Heterologous enzymes can also facilitate the production of light beer, which has
a lower starch content than regular beer. One method currently used in light beer
brewing to break down residual starch which remains after completion of the malting
process is to add to the wort glucoamylase derived from bread mould, a step which
can be eliminated where the yeast used in brewing also carries and expresses a glucoamylase
encoding gene.
[0019] Other enzymes can facilitate commercial fermentation processes in other respects.
For example, in wine-making, insertion of the gene for malolactic enzyme or malate
permease will permit host yeast cells to convert metabolized malic acid from grapes,
thus inhibiting spoilage of the wine by removing malic acid, which is otherwise fed
on by spoilage bacteria.
[0020] Other features and advantages of the invention will be apparent from the following
description of the preferred embodiments, and from the Claims.
[0021] We first briefly describe the drawings.
[0022] Figure 1 is a diagrammatic representation of a replicating vector of the invention.
[0023] Figures 2, 3a, and 3b are diagrammatic representations of integrating vectors of
the invention.
[0024] Figure 4 is a diagrammatic representation of a mechanism by which an integrating
vector is integrated into a host yeast chromosome.
Plasmid Structure
[0025] In Figs. 1-3, the following abbreviations are used for restriction endonuclease cleavage
sites: A, Xbal; B, BamHI; E, EcoRI; H, HindIII; K, KpnI; M, SmaI; PI, PvuI; PII, PvuII;
S, SalI; TII, SstII; U, Stul; X, Xhol. (A) denotes the position of a
former Xbal site located about 3 kilobases away from the 5' end of the
HO gene. This site was destroyed and replaced by a SalI site in the construction of
pRY253. (PII) denotes a former PvuII site similarly destroyed during plasmid construction.
Complete genes or gene fusions are shown by boxes. The abbreviations for the genes
are as follows: amp
r, ampicillin resistance; G418
r antibiotic G418 resistance;
HO, homothallism; CYCl, iso-1-cytochrome c;
URA3, orotidine-5'-monophosphate decarboxylase;
GALl, galactokinase;
lacZ, beta-galactosidase. The concentric arrows inside the circles indicate segments of
DNA whose origin is other than pBR322. The extent of these sequences is indicated
by the arrowheads and the source is indicated by the labels. pBR322 sequences have
no concentric arrows. Other abbreviations are: kb, kilobase pairs; ori,
E. coli origin of replication.
[0026] In Fig. 4, the following abbreviations are used: X, any gene or DNA sequence to be
integrated into a yeast chromosome and expressed; S, a cloning site (for example:
a restriction endonuclease site) into which gene X is inserted; L, a site (for example,
a restriction endonuclease site) for linearizing the vector within the target sequence,
"T" or "Target"; R, a site, not necessarily specific, where recombination between
homologous vector-derived and chromosome-derived target sequences occurs. An apostrophe
designates half of a site (such as S or L) that is separated from its other half by
cleavage, by insertion of an intervening DNA sequence, or by integration into a chromosome.
A subscript of V or C designates sites or portions of sites that are derived from
the vector or chromosome, respectively. Other abbreviations are as in Fig. 1-3.
[0027] Referring to Fig. 1, replicating plasmid vector pRY252 is composed, beginning at
the 12 o'clock position of the drawing and moving clockwise, of sequence E-H, a small
piece of DNA from the
E.
coli plasmid pBR322; sequence H-H, which includes the yeast
URA3 gene (one of the genes required for the ability to grow on uracil-deficient media;
this gene is an unnecessary artifact in the plasmid which was originally inserted
to provide a comparative selection means); sequence H-S, another piece of pBR322;
sequence S-(PII), which includes the yeast
CYCl (cytochrome c) promoter and most of the gene for resistance to G418 from the bacterial
transposon Tn903 (the non-essential N-terminal region is not included); sequence (PII)-E,
including the
E. coli origin of replication from pBR322 and the amp
r gene for selecting transformants in
E. coli; and sequence E-E, the yeast origin of replication from a yeast 2 micron circle.
[0028] Referring to Figure 2, integrating plasmid vector pRY253 is derived from pRY252 in
that the yeast origin of replication sequence is replaced by a 7.0 kb EcoRI fragment
of
S.
cerevisiae containing the
HO (homothallism) gene, including site K for insertion of a desired heterologous gene.
[0029] Referring to Fig. 3a, integrating plasmid vector pRY255 is derived from pRY253 in
that a 3.3 kilobase SalI to XhoI fragment extending from one end of the HO insert
to the beginning of the
CYCI promoter sequence and containing the
URA3 gene has been replaced with a 6.0 kilobase Xhol to SalI fragment containing,a gene
fusion of the yeast
GALl gene and the
E.
coli lacZ gene. Referring to Fig. 3b, pRY255A is similar to pRY255, in that it is also derived
from pRY253, in that the 6.0 kilobase Xhol to SalI fragment containing the
GALl-
lacZ fusion is substituted for the 2.5 kilobase SalI fragment of pRY253.
[0030] Referring also to Figure 3b, pDY3 was derived from pRY255A by deleting the 1.8 kilobase
region between a Stul site and, the Smal site upstream from the
CYCl promoter.
[0031] pRY255A and pDY3 can be used in substantially the same way as pRY255, as described
below. In addition, in pDY3, an SstII site near the 3' end of the
HO unique on the vector, making it a more convenient site for linearization of the vector.
[0032] Plasmids pRY252, pRY253, pRY255, and pRY255A were deposited in the American Type
Culture Collection, Rockville, Maryland, and have the depository numbers, respectively,
ATCC 39687, 39688, 39689, and 39822.
[0033] Referring to Fig. 4, plasmid pRY257 will contain a gene X for a desired heterologous
protein, e.g., glucoamylase or interferon, inserted at site S in plasmid pRY255.
Plasmid Construction
[0034] The plasmids illustrated in Figs. 1-3 were made using conventional recombinant DNA
methods and publicly available materials.
[0035] Plasmids pRY253, pRY255, pRY255A, and pDY3 were derived from replicating plasmid
pRY252 which, briefly, was, constructed as follows.
[0036] The
URA3 gene was inserted into plasmid pBR322 as illustrated, and then the origin of replication
from the endogenous yeast 2 micron circle, without the three genes normally accompanying
it, was inserted. The vector is able to replicate in host yeast cells without containing
these three genes, two of which encode proteins essential for replication, because
host yeast cells already contain the endogenous 2 micron circle encoding those proteins
(Botstein et al. (1979) Gene
8, 17).
[0037] The
CYCl-G418
r fusion portion of the plasmid was constructed by fusing the XhoI site near the 5'
end of the G418
r gene of transposon Tn903 (described in Oka, et al. (1981) J. Mol. Biol.
147, 217) to the BamHI site following the
CYCl promoter and the 5' end of the
CYCl coding sequences of plasmid pLG669 (described in Guarente et al. (1981) PNAS USA
78, 2199) after rendering both ends flush with mung bean nuclease. The DNA sequence
of this fusion junction is (
CYCl) . . . TAAATTAATAATGACCGGGCCG . . . (G418
r). The arrow shows the point of fusion.
[0038] Plasmids pRY253, pRY255, pRY255A, and pDY3 were constructed from pRY252 by making
the gene fragment substitutions and deletions shown in the Figures. Plasmid pRY257
can be constructed by inserting a gene X for a desired protein at site S of pRY255,
within the
HO gene, so that there are portions of the
HO gene on either side of gene X, as shown in Fig. 4.
Plasmid Use
[0039] The vectors of the invention can be used in any useful process in which host yeast
cells express a desired heterologous gene. The desired heterologous gene can be inserted
using conventional recombinant DNA techniques, e.g., as described in Maniatis et al.
(1982)
Molecular Cloning:
A Laboratory Manual, Cold Spring Harber Press, Cold Spring Harbor, New York, hereby incorporated by reference.
pRY253, pRY255, pRY255A, pDY3 can also be used to delete genes from wild type yeast
strains. For the deletion of genes, the
HO portion of the vectors becomes irrelevant. Deletion of a gene or a portion of a gene
can be accomplished as follows:
1. Clone the gene to be deleted with some adjacent sequence on both sides of the gene.
2. Create a deletion of the cloned gene in vitro, leaving a portion of each of the 3' and 5' ends of the gene sufficient for homologous
recombination but insufficient to encode the protein normally encoded by the gene.
3. Place the deletion-containing DNA at an appropriate location in one of the integration
vectors described herein.
4. Linearize the vector at a point in one of the sequences adjacent to the deletion,
and perform integration transformation, selecting for G418 resistance.
5. Grow a stable transformant for 20 to 40 generations non-selectively, and screen
for vector jettisoning events by either loss of blue colony color on Xgal indicator
plates or by replica plating to G418 containing plates.
6. Screen among colonies that have jettisoned the vector for those that retained the
deleted version of the gene by Southern blotting.
[0040] The vectors are particularly useful in industrial yeast strains used in the production
of end products such as wine, bread, and beer which involve carboydrate fermentation.
Transformation
[0041] Yeast cells were transformed with vectors as follows.
[0042] Laboratory yeast strain DBY 745 (described ink Guarente et al. (1981) PNAS USA
78, 2199); a Carlsberg® brewing strain (isolated from unpasteurized beer); Fleischman's®
baking yeast (purchased at a supermarket); and a Bordeaux wine yeast (ATCC 42928)
were grown in a standard rich medium, YEP-D, spheroplasted with glusulase, and exposed
to plasmid DNA by standard methods of yeast transformation, as described in Sherman
et al. (1981) Methods in Yeast Genetics (Cold Spring Harbor Laboratories Press, Cold
Spring Harbor, New York). Integrating plasmid pRY253 was linearized by restriction
endonuclease digestion, at a unique SstII site near the 3' end of the
HO gene, and pRY255 was linearized at a unique KpnI site near the 5' end of the
HO gene, prior to transformation, in order to direct integration at the
HO locus. Replicating plasmid pRY252 was not linearized.
[0043] After exposure to the plasmids. 10⁸ spheroplasts were grown in YEP-D plus 1.0 M sorbitol
for 30 minutes at 30°C and then plated in 6 ml of warm 3% agarose containing YEP-D
over 20 ml of 2% agar. YEP-D, 1.0 M sorbitol, and 70 mM potassium phosphate, pH 7.0.
After 10 minutes of cooling at room temperature, another 4 ml of warm 1% agar, YEP-D,
1.0 M sorbitol was layered over the top agar. The cells were then allowed to grow
at 30°C for 6 generations, corresponding to 8 hours for DBY 745, 9 hours for Carlsberg,
7 hours for the wine yeast, and 6 hours for Fleishman's. After this "growing out"
period, 0.6 ml of a sterile solution of antibiotic G418 at 25 mg/ml was spread over
the agar surface and allowed to dry in a sterile hood. The plates were then incubated
for 2-5 days at 30°C, after which time colonies appeared out of a background of untransformed
cells. Several of these colonies were toothpicked onto fresh YEP-D plates containing
500 µg/ml G418. Cells that were successfully transformed gave rise to visible colonies
within 24 hours, while untransformed cells did not. A summary of these results is
given in Table 1, below.
Table 1
| Number of G418 resistant transformants per 10⁸ competent cells from 1 µg of plasmid
DNA. |
| Strain |
DNA |
| |
None |
pRY252 |
pRY253a |
pRY255b |
| DBY 745 |
0 |
5,200 |
890 |
800 |
| Carlsberg |
0 |
260 |
13 |
7 |
| Wine Yeast (ATCC #42928) |
0 |
450 |
30 |
21 |
| Fleischman's |
0 |
510 |
22 |
17 |
| a linearized with SstII prior to transformation. |
| b linearized with KpnI prior to transformation |
[0044] Transformants obtained from the integrating plasmids pRY253 and pRY255 were shown
to contain stably integrated plasmids, by growing isolated transformants for 10 to
20 generations non-selectively in YEP-D and showing that reversion to G418 sensitivity
occurred at a rate less than 10⁻³. Transformants containing pRY255 gave blue colonies
on plates containing galactose as the sole carbon source. 70 mM potassium phosphase
buffer, pH 7.0, and Xgal indicator dye (5'-bromo-4'-chloro-3'-indoyl-beta-D-galactoside).
Jettisoning of Vector Sequences
[0045] Plasmid vector pRY257 can be linearized and used to transform host yeast cells, as
described above for plasmids pRY253 and pRY255. As described above, transformants
are selected on the basis of antibiotic resistance (Fig. 4).
[0046] Following this selection, as shown in Fig. 4, a further step can be taken to jettison
unnecessary portions of the vector which might adversely affect transformant stability,
adversely affect the taste or any other important property of the end product, or
waste metabolic energy. In effect, this screening step "deposits" the desired gene
in the host chromosome. while excluding extraneous DNA. The exclusion of this extraneous
DNA increases transformant stability by eliminating tandem repeat sequences which
could cause undesirable recombination events resulting, for example, in loss of the
desired heterologous gene. Also, elimination of the gene for antibiotic resistance
can be an advantage if for some reason it is anticipated that the use of the antibiotic
to kill the yeast may become necessary. Finally, elimination of all
Escherichia coli derived sequences from the transformed yeast may simplify governmental regulatory
clearance for use of the organism.
[0047] The screening depends on the presence in the vector of a gene encoding a screenable
trait; in pRY257, this is the
E. coli lacZ gene which encodes beta-galactosidase. Yeast colonies that express this gene turn
blue on an appropriate indicator petri plate containing a colorimetric indicator dye
such as Xgal. Thus to select transformants in which a portion of the vector DNA, including
the
lacZ gene, has been jettisoned, transformants are plated onto an indicator plate, and
those colonies remaining white on the plates selected as the transformants, or descendants
of transformants, not retaining the
lacZ gene.
[0048] Fig. 4 illustrates the jettisoning mechanism. In some transformants there will be
a cross-over event between vector sequences homologous with chromosome sequences (see
Fig 4d). This cross-over event causes the looping out and deletion of the region of
the vector between the homologous sequences (see Fig. 4e). If desired heterologous
gene X (encoding, say, glucoamylase) is outside this region, it remains deposited
in the chromosome. The frequency of this type of event can be increased relative to
that of other unwanted events (such as looping out of the entire plasmid including
the deposited gene) by placing the deposited gene nearer to the end of the target
sequences containing the linearization site than to the end of the target sequences
that contain the "looping out" site.
[0049] The desired looping out event can be distinguished from undesired events by screening
among white colonies for those that maintain gene X. This can be done either by a
functional assay for the product of gene X (e.g., in the case of glucoamylase. halos
on starch-containing plates), or by direct assay for the presence of gene X by Southern
blotting techniques. The two screenings can be carried out at once, e.g. by using
a medium containing both Xgal and starch.
[0050] Other embodiments are within the teaching of the invention.
[0051] For example, although the frequency at which the integrating vectors integrate into
the host chromosome is increased by linearizing the vector prior to transformation,
integration, at a lower frequency, can be achieved by transformation with the vectors
in circularized form. Although the
HO gene is the most preferred target gene, any other region of the host chromosome not
involved in metabolism can be used. For example, the mutant homothallism gene of most
laboratory yeast strains (the
ho gene), which differs slightly from the wild-type
HO gene, can be used as a target; the
ho gene, like the
HO gene, has the advantages of large size (about 2.000 base pairs) and non-involvement
in metabolism in diploid or polyploid cells.
[0052] In addition to enzymes involved in the production of bread and alcoholic beverages,
the vectors of the invention can be used in processes in which the desired end product
is the protein, e.g., therapeutic proteins such as interferon, encoded by the inserted
heterologous gene. The heterologous gene can also be a gene already carried on a different
portion of the host chromosome; for example, it might be advantageous to add an additional
copy of a native gene involved in alcohol production, to increase production levels.
[0053] The promoter sequence controlling the gene for antibiotic resistance can also vary
widely, the only crucial factor being that the sequence provides that a sufficient
level of expression in yeast cells is maintained.
[0054] When a gene in the host chromosome is targeted by employing a vector containing a
homologous sequence, linearization of the vector prior to transformation can occur
anywhere within the homologous sequence: generally, however, integration efficiency
is improved when linearization occurs near the center of the sequence, and decreases
as the linearizaton point approaches either end of the sequence.
[0055] The screenable trait, in addition to the ability to produce beta-galactosidase, can
be any trait whose absence can be detected. In addition, when beta-galactosidase production
is used, the gene need not be the
E. coli lacZ gene: for example, the
LAC4 gene from
Kluyeromyces species. e.g.,
K. lactis, which also encodes a beta-galactosidase, can also be used.