(19)
(11) EP 0 765 394 B1

(12) EUROPEAN PATENT SPECIFICATION

(45) Mention of the grant of the patent:
04.10.2001 Bulletin 2001/40

(21) Application number: 95921503.9

(22) Date of filing: 31.05.1995
(51) International Patent Classification (IPC)7C12N 15/53, C12N 1/15, A61K 7/13, A61K 7/06, D21C 5/00
// (C12N1/15, C12R1:66)
(86) International application number:
PCT/US9506/815
(87) International publication number:
WO 9533/836 (14.12.1995 Gazette 1995/53)

(54)

PURIFIED MYCELIOPHTHORA LACCASES AND NUCLEIC ACIDS ENCODING SAME

GEREINIGTE MYCELIOPHTHORA LACCASEN UND NUKLEINSÄUREN DAFÜR KODIEREND

LACCASES MYCELIOPHTHORA PURIFIEES ET ACIDES NUCLEIQUES CODANT CES DERNIERES


(84) Designated Contracting States:
AT BE CH DE DK ES FR GB GR IE IT LI LU NL PT SE

(30) Priority: 03.06.1994 US 253781
15.05.1995 US 441146

(43) Date of publication of application:
02.04.1997 Bulletin 1997/14

(73) Proprietors:
  • NOVO NORDISK BIOTECH, INC.
    Davis, CA 95616-4880 (US)
  • Novozymes A/S
    2880 Bagsvaerd (DK)

(72) Inventors:
  • BERKA, Randy, M.
    Davis, CA 95616 (US)
  • BROWN, Stephen, H.
    Davis, CA 95616 (US)
  • XU, Feng
    Woodland, CA 95776 (US)
  • SCHNEIDER, Palle
    DK-2750 Bellerup (DK)
  • AASLYNG, Dorrit, Anita
    DK-3500 Vaerlöse (DK)
  • OXENBÖLL, Karen, M.
    DK-2920 Charlottenlund (DK)

(74) Representative: Jensen, Bo Hammer et al
Novozymes A/S Patents Krogshöjvej 36
2880 Bagsvaerd
2880 Bagsvaerd (DK)


(56) References cited: : 
EP-A- 0 317 243
WO-A-95/01426
   
  • ABSTRACTS OF PAPERS, vol.209, no.1-2, April 1995, ANAHEIM, CA BERKA R. ET AL. 'Cloning of laccases from the thermophilic fungi Myceliophthora thermophila and Scytalidium thermophilum and their heterologous expression in Aspergillus oryzae'
  • JOURNAL OF BIOLOGICAL CHEMISTRY, vol.263, no.2, 1988, BALTIMORE, MD US pages 885 - 896 GERMANN U. ET AL. 'Characterization of two allelic forms of Neurospora crassa laccase'
   
Note: Within nine months from the publication of the mention of the grant of the European patent, any person may give notice to the European Patent Office of opposition to the European patent granted. Notice of opposition shall be filed in a written reasoned statement. It shall not be deemed to have been filed until the opposition fee has been paid. (Art. 99(1) European Patent Convention).


Description

Field of the Invention



[0001] The present invention relates to isolated nucleic acid fragments encoding a fungal oxidoreductase enzyme and the purified enzymes produced thereby. More particularly, the invention relates to nucleic acid fragments encoding a phenol oxidase, specifically a laccase, of a thermophilic ascomycete, Myceliophthora.

Background of the Invention



[0002] Laccases (benzenediol:oxygen oxidoreductases) are multi-copper-containing enzymes that catalyze the oxidation of phenolics. Laccase-mediated oxidations result in the production of aryloxy-radical intermediates from suitable phenolic substrate; the ultimate coupling of the intermediates so produced provides a combination of dimeric, oligomeric, and polymeric reaction products. Such reactions are important in nature in biosynthetic pathways which lead to the formation of melanin, alkaloids, toxins, lignins, and humic acids. Laccases are produced by a wide variety of fungi, including ascomycetes such as Aspergillus, Neurospora, and Podospora, the deuteromycete Botrytis, and basidiomycetes such as Collybia, Fomes, Lentinus, Pleurotus, Trametes, and perfect forms of Rhizoctonia. Laccase exhibits a wide range of substrate specificity, and each different fungal laccase usually differs only quantitatively from others in its ability to oxidize phenolic substrates. Because of the substrate diversity, laccases generally have found many potential industrial applications. Among these are lignin modification, paper strengthening, dye transfer inhibition in detergents, phenol polymerization, juice manufacture, phenol resin production, and waste water treatment.

[0003] Although the catalytic capabilities are similar, laccases made by different fungal species do have different temperature and pH optima, and these may also differ depending on the specific substrate. A number of these fungal laccases have been isolated, and the genes for several of these have been cloned. For example, Choi et al. (Mol. Plant-Microbe Interactions 5: 119-128, 1992) describe the molecular characterization and cloning of the gene encoding the laccase of the chestnut blight fungus, Cryphonectria parasitica. Kojima et al. (J. Biol. Chem. 265: 15224-15230, 1990; JP 2-238885) provide a description of two allelic forms of the laccase of the white-rot basidiomycete Coriolus hirsutus. Germann and Lerch (Experientia 41: 801,1985; PNAS USA 83: 8854-8858, 1986) have reported the cloning and partial sequencing of the Neurospora crassa laccase gene. Saloheimo et al. (J. Gen. Microbiol. 137: 1537-1544, 1985; WO 92/01046) have disclosed a structural analysis of the laccase gene from the fungus Phlebia radiata.

[0004] Attempts to express laccase genes in heterologous fungal systems frequently give very low yields(Kojima et al., supra; Saloheimo et al., Bio/Technol. 9: 987-990, 1991). For example, heterologous expression of Phlebia radiata laccase in Trichoderma reesei gave only 20 mg per liter of active enzyme(Saloheimo, 1991, supra). Although laccases have great commercial potential, the ability to express the enzyme in significant quantities is critical to their commercial utility. At the present time there are no laccases which are expressed at high levels in commercially utilized hosts such as Aspergillus. Thus, the need exists for a laccase which can be produced in commercially useful (i.e., gram per liter or more) quantities. The present invention fulfills such a need.

Summary of the Invention



[0005] The present invention relates to a DNA construct containing a nucleic acid sequence encoding a Myceliophthora laccase. The invention also relates to an isolated laccase encoded by the nucleic acid sequence. Preferably, the laccase is substantially pure. By "substantially pure" is meant a laccase which is essentially (i.e.,≥90%) free of other non-laccase proteins.

[0006] In order to facilitate production of the novel laccase, the invention also provides vectors and host cells comprising the claimed nucleic acid sequence, which vectors and host cells are useful in recombinant production of the laccase. The sequence is operably linked to transcription and translation signals capable of directing expression of the laccase protein in the host cell of choice. A preferred host cell is a fungal cell, most preferably of the genus Aspergillus. Recombinant production of the laccase of the invention is achieved by culturing a host cell transformed or transfected with the construct of the invention, or progeny thereof, under conditions suitable for expression of the laccase protein, and recovering the laccase protein from the culture.

[0007] The laccases of the present invention are useful in a number of industrial processes in which oxidation of phenolics is required. These processes include lignin manipulation, juice manufacture, phenol polymerization and phenol resin production.

Brief Description of the Figures



[0008] Figure 1 shows a restriction map of a 7.5 EcoRI fragment in pRaMB1. The region hybridizing to the N. crassa laccase gene probe is shaded.

[0009] Figure 2 illustrates the nucleotide(SEQ ID NO: 1) and amino acid (SEQ ID NO: 2) sequence of Myceliophthora thermophila laccase. Lower case letters in the nucleotide sequence indicate the position of introns. Putative TATA and CART sequences in the promoter region are in boldface and underlined. Consensus lariat structures(PuCTPuAC)within the introns are underlined.

[0010] Figure 3 illustrates the construction of plasmid pRaMB5.

Detailed Description of the Invention



[0011] Myceliophthora thermophila is a thermophilic Ascomycete originally described by Apinis (Nova Hedwigia 5: 57-78, 1963) and named Sporotrichum thermophile. Subsequent taxonomic revisions have placed this organism in the genus Chrysosporium (Von Klopotek, A. Arch. Microbiol. 98: 365-369, 1974) and later to Myceliophthora (Van Oorschot, Persoonia 9: 401-408, 1977). A number of organisms known by other names also appear to belong to this species. These include Sporotrichum cellulophilum (U.S. Patent No. 4,106,989); Thielavia thermophila (Fergus and Sinden, Can. J. Botany 47: 1635-1637, 1968); Chrysosporium fergussi and Corynascus thermophilus (Von Klopotek, supra). This species is known as a source of a number of different industrially useful enzymes, such as cellulases, β-glucosidase and xylanase (see, e.g., Oberson et al., Enzyme Microb. Technol. 14 : 303-312, 1992; Merchant et al., Biotechnol. Lett. 10: 513-516, 1988; Breuil et al. Biotechnol. Lett. 8: 673-676, 1986; Gilbert et al., Bioresource Technol. 39: 147-154, 1992). It has now been determined that Myceliophthora produces a neutral pH laccase, and the gene encoding this laccase can be used to produce large yields of the enzyme in convenient host systems such as Aspergillus.

[0012] To identify the presence of a laccase gene in Myceliophthora, a 5' portion of the Neurospora crassa laccase gene(lcc1) is used as a probe, under conditions of mild stringency, in southern hybridization of total genomic DNA of different fungal species. An approximately 12 kb laccase specific sequence is detected in the Myceliophthora DNA. The N. crassa fragment is then used to screen about 20,000 plaques of an M. thermophila genomic DNA library in a λ EMBL4 bacteriophage cloning vector. Eight plaques strongly hybridize with the probe; from these eight, DNA is isolated from three. Each of these clones contains a 7.5 EcoRI fragment which also hybridizes to the probe (Figure 1). One of the fragments is subcloned into pBR322 to generate plasmid pRaMB1. Using the lcc1 probe, the position of the coding region of the clone is determined. The entire M. thermophila coding region appears to be contained with a 3.2 kb NheI-BglII segment, which is then cloned into pUC119 and sequenced by the primer walking method.

[0013] Once the sequence is determined, the positions of introns and exons within the gene is assigned based on alignment of the deduced amino acid sequence to the corresponding N. crassa laccase gene product. From this comparison, it appears that the gene (lccM) of M. thermophila is composed of seven exons(246, 79, 12, 70, 973, 69 and 411 nucleotides) interrupted by six introns (85, 84, 102, 72, 147, and 93 nucleotides). The coding region, excluding intervening sequences, is very GC-rich(65.5% G+C) and encodes a preproenzyme of 620 amino acids: a 22 amino acid signal peptide, a 25 amino acid propeptide, and a mature laccase comprising 573 amino acids. The sequence of the M. thermophila gene and the predicted amino acid sequence is shown in Figure 2 (SEQ ID NOS: 1 and 2).

[0014] The laccase gene is then used to create an expression vector for transformation of Aspergillus host cells. The vector, pRaMB5 contains the A. oryzae TAKA-amylase promoter and terminator regions. The construction of pRaMB5 is outlined in Figure 3. Aspergillus cells are cotransformed with the expression vector and a plasmid containing the pyrG or amdS selectable marker. Transformants are selected on the appropriate selective medium containing ABTS. Laccase-producing colonies exhibit a green halo and are readily isolatable. Selected transformants are grown up in shake flasks and culture broths tested for laccase activity by the syringaldazine method. Shake flask cultures are capable of producing 0.2 or more g/liter of laccase, and in fermentors, yields of over 1-2 g/liter are observed.

[0015] According to the invention, a Myceliophthora gene encoding a laccase can be obtained by methods described above, or any alternative methods known in the art, using the information provided herein. The gene can be expressed, in active form, using an expression vector. A useful expression vector contains an element that permits stable integration of the vector into the host cell genome or autonomous replication of the vector in a host cell independent of the genome of the host cell, and preferably one or more phenotypic markers which permit easy selection of transformed host cells. The expression vector may also include control sequences encoding a promoter, ribosome binding site, translation initiation signal, and, optionally, a repressor gene or various activator genes. To permit the secretion of the expressed protein, nucleotides encoding a signal sequence may be inserted prior to the coding sequence of the gene. For expression under the direction of control sequences, a laccase gene to be used according to the invention is operably linked to the control sequences in the proper reading frame. Promoter sequences that can be incorporated into plasmid vectors, and which can direct the transcription of the laccase gene, include but are not limited to the prokaryotic β-lactamase promoter (Villa-Kamaroff, et al., 1978, Proc. Natl. Acad. Sci. U.S.A. 75:3727-3731) and the tac promoter (DeBoer, et al., 1983, Proc. Natl. Acad. Sci. U.S.A. 80:21-25). Further references can also be found in "Useful proteins from recombinant bacteria" in Scientific American, 1980, 242:74-94; and in Sambrook et al., Molecular Cloning, 1989.

[0016] The expression vector carrying the DNA construct of the invention may be any vector which may conveniently be subjected to recombinant DNA procedures, and the choice of vector will typically depend on the host cell into which it is to be introduced. Thus, the vector may be an autonomously replicating vector, i.e. a vector which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g. a plasmid, or an extrachromosomal element, minichromosome or an artificial chromosome. Alternatively, the vector may be one which, when introduced into a host cell, is integrated into the host cell genome and replicated together with the chromosome(s) into which it has been integrated.

[0017] In the vector, the laccase DNA sequence should be operably connected to a suitable promoter sequence. The promoter may be any DNA sequence which shows transcriptional activity in the host cell of choice and may be derived from genes encoding proteins either homologous or heterologous to the host cell. Examples of suitable promoters for directing the transcription of the DNA construct of the invention, especially in a bacterial host, are the promoter of the lac operon of E.coli, the Streptomyces coelicolor agarase gene dagA promoters, the promoters of the Bacillus licheniformis α-amylase gene (amyL), the promoters of the Bacillus stearothermophilus maltogenic amylase gene (amyM), the promoters of the Bacillus amyloliquefaciens α-amylase (amyQ), or the promoters of the Bacillus subtilis xylA and xylB genes. In a yeast host, a useful promoter is the eno-1 promoter. For transcription in a fungal host, examples of useful promoters are those derived from the gene encoding A. oryzae TAKA amylase, Rhizomucor miehei aspartic proteinase, A. niger neutral α-amylase, A. niger acid stable α-amylase, A. niger or A. awamori glucoamylase (glaA), Rhizomucor miehei lipase, A. oryzae alkaline protease, A. oryzae triose phosphate isomerase or A. nidulans acetamidase. Preferred are the TAKA-amylase and glaA promoters.

[0018] The expression vector of the invention may also comprise a suitable transcription terminator and, in eukaryotes, polyadenylation sequences operably connected to the DNA sequence encoding the laccase of the invention. Termination and polyadenylation sequences may suitably be derived from the same sources as the promoter. The vector may further comprise a DNA sequence enabling the vector to replicate in the host cell in question. Examples of such sequences are the origins of replication of plasmids pUC19, pACYC177, pUB110, pE194, pAMB1 and pIJ702.

[0019] The vector may also comprise a selectable marker, e.g. a gene the product of which complements a defect in the host cell, such as the dal genes from B.subtilis or B.licheniformis, or one which confers antibiotic resistance such as ampicillin, kanamycin, chloramphenicol or tetracycline resistance. Examples of Aspergillus selection markers include amds, pyre, argB, niaD, sC, and hygB, a marker giving rise to hygromycin resistance. Preferred for use in an Aspergillus host cell are the amdS and pyrG markers of A. nidulans or A. oryzae. A frequently used mammalian marker is the dihydrofolate reductase (DHFR) gene. Furthermore, selection may be accomplished by co-transformation, e.g. as described in WO 91/17243.

[0020] It is generally preferred that the expression gives rise to a product which is extracellular. The laccases of the present invention may thus comprise a preregion permitting secretion of the expressed protein into the culture medium. If desirable, this preregion may be native to the laccase of the invention or substituted with a different preregion or signal sequence, conveniently accomplished by substitution of the DNA sequences encoding the respective preregions. For example, the preregion may be derived from a glucoamylase or an amylase gene from an Aspergillus species, an amylase gene from a Bacillus species, a lipase or proteinase gene from Rhizomucor miehei, the gene for the α-factor from Saccharomyces cerevisiae or the calf preprochymosin gene. Particularly preferred, when the host is a fungal cell, is the preregion for A. oryzae TAKA amylase, A. niger neutral amylase, the maltogenic amylase form Bacillus NCIB 11837, B. stearothermophilus α-amylase, or Bacillus licheniformis subtilisin. An effective signal sequence is the A. oryzae TAKA amylase signal, the Rhizomucor miehei aspartic proteinase signal and the Rhizomucor miehei lipase signal.

[0021] The procedures used to ligate the DNA construct of the invention, the promoter, terminator and other elements, respectively, and to insert them into suitable vectors containing the information necessary for replication, are well known to persons skilled in the art (cf., for instance, Sambrook et al. Molecular Cloning, 1989).

[0022] The cell of the invention either comprising a DNA construct or an expression vector of the invention as defined above is advantageously used as a host cell in the recombinant production of a enzyme of the invention. The cell may be transformed with the DNA construct of the invention, conveniently by integrating the DNA construct in the host chromosome. This integration is generally considered to be an advantage as the DNA sequence is more likely to be stably maintained in the cell. Integration of the DNA constructs into the host chromosome may be performed according to conventional methods, e.g. by homologous or heterologous recombination. Alternatively, the cell may be transformed with an expression vector as described above in connection with the different types of host cells.

[0023] The host cell may be selected from prokaryotic cells, such as bacterial cells. Examples of suitable bacteria are gram positive bacteria such as Bacillus subtilis, Bacillus licheniformis, Bacillus lentus, Bacillus brevis, Bacillus stearothermophilus, Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus coagulans, Bacillus circulans, Bacillus lautus, Bacillus megaterium, Bacillus thuringiensis, or Streptomyces lividans or Streptomyces murinus, or gram negative bacteria such as E.coli. The transformation of the bacteria may for instance be effected by protoplast transformation or by using competent cells in a manner known per se.

[0024] The host cell may also be a eukaryote, such as mammalian cells, insect cells, plant cells or preferably fungal cells, including yeast and filamentous fungi. For example, useful mammalian cells include CHO or COS cells. A yeast host cell may be selected from a species of Saccharomyces or Schizosaccharomyces, e.g. Saccharomyces cerevisiae. Useful filamentous fungi may selected from a species of Aspergillus, e.g. Aspergillus oryzae or Aspergillus niger. Alternatively, a strain of a Fusarium species, e.g. F. oxysporum, can be used as a host cell. Fungal cells may be transformed by a process involving protoplast formation and transformation of the protoplasts followed by regeneration of the cell wall in a manner known per se. A suitable procedure for transformation of Aspergillus host cells is described in EP 238 023. A suitable method of transforming Fusarium species is described by Malardier et al., 1989.

[0025] The present invention thus provides a method of producing a recombinant laccase of the invention, which method comprises cultivating a host cell as described above under conditions conducive to the production of the enzyme and recovering the enzyme from the cells and/or culture medium. The medium used to cultivate the cells may be any conventional medium suitable for growing the host cell in question and obtaining expression of the laccase of the invention. Suitable media are available from commercial suppliers or may be prepared according to published formulae (e.g. in catalogues of the American Type Culture Collection).

[0026] In a preferred embodiment, the recombinant production of laccase in culture is achieved in the presence of an excess amount of copper. Although trace metals added to the culture medium typically contain a small amount of copper, experiments conducted in connection with the present invention show that addition of a copper supplement to the medium can increase the yield of active enzyme many-fold. Preferably, the copper is added to the medium in soluble form, preferably in the form of a soluble copper salt, such as copper chloride, copper sulfate, or copper acetate. The final concentration of copper in the medium should be in the range of from 0.2-2mM, and preferably in the range of from 0.05-0.5mM. This method can be used in enhancing the yield of any recombinantly produced fungal laccase, as well as other copper-containing enzymes, in particular oxidoreductases.

[0027] The resulting enzyme may be recovered from the medium by conventional procedures including separating the cells from the medium by centrifugation or filtration, precipitating the proteinaceous components of the supernatant or filtrate by means of a salt, e.g. ammonium sulphate, followed by purification by a variety of chromatographic procedures, e.g. ion exchange chromatography, gel filtration chromatography, affinity chromatography, or the like. Preferably, the isolated protein is about 90% pure as determined by SDS-PAGE, purity being most important in food, juice or detergent applications.

[0028] In a particularly preferred embodiment, the expression of laccase is achieved in a fungal host cell, such as Aspergillus. As described in detail in the following examples, the laccase gene is ligated into a plasmid containing the Aspergillus oryzae TAKA α-amylase promoter, and the Aspergillus nidulans amdS selectable marker. Alternatively, the amdS may be on a separate plasmid and used in co-transformation. The plasmid (or plasmids) is used to transform an Aspergillus species host cell, such as A. oryzae or A. niger in accordance with methods described in Yelton et al. (PNAS USA 81: 1470-1474,1984).

[0029] Those skilled in the art will recognize that the invention is not limited to use of the nucleic acid fragments specifically disclosed herein, for example, in Figure 1. It will also be apparent that the invention encompasses those nucleotide sequences that encode the same amino acid sequences as depicted in Figure 1, but which differ from the specifically depicted nucleotide sequences by virtue of the degeneracy of the genetic code. Also, reference to Figure 1 in the specification and the claims will be understood to encompass both the genomic sequence depicted therein as well as the corresponding CDNA and RNA sequences, and the phrases "DNA construct" and "nucleic acid sequences" as used herein will be understood to encompass all such variations. "DNA construct" shall generally be understood to mean a DNA molecule, either single- or doublestranded, which may be isolated in partial form from a naturally occurring gene or which has been modified to contain segments of DNA which are combined and juxtaposed in a manner which would not otherwise exist in nature.

[0030] The Myceliophthora laccase described herein has a particularly high specific activity on a syringaldazine substrate relative to other known ascomycete or deuteromycete extracellular laccases in which such specific activity has been described. The present sequence provides a means by which other such ascomycete and/or deuteromycete laccases can also be isolated. Identification and isolation of laccase genes from sources other than those specifically exemplified herein can be achieved by utilization of the methodology described in the present examples, with publicly available ascomycete and deuteromycete strains. In particular, the specific sequence disclosed herein can be used to design primers and/or probes useful in isolating similar laccase genes by standard PCR or southern hybridization techniques. The present invention thus encompasses those ascomycete and deuteromycete laccases which have a specific activity of at least about 30 SOU/mg, and preferably at least about 40 SOU/mg, "SOU" being defined as µmole of substrate oxidized per minute as measured with syringaldazine as a substrate, at optimum pH.

[0031] In addition, the invention also encompasses other Myceliophthora laccases, including alternate forms of laccase which may be found in M. thermophila and as well as laccases which may be found in other fungi falling within the definition of Myceliophthora as defined by Van Oorschot, 1977, supra. Identification and isolation of laccase genes from sources other than those specifically exemplified herein can be achieved by utilization of the methodology described in the preseent examples, with publicly available Myceliophthora strains. Alternately, the sequence disclosed herein can be used to design primers and/or probes useful in isolating laccase genes by standard PCR or southern hybridization techniques. Other named Myceliophthora species include Myceliphthora hinnulea (Awao et al., Mycotaxon. 16: 436-440, 1983), Myceliophthora vellerea (Guarro et al, Mycotaxon. 23: 419-427, 1985), and Myceliophthora lutea Costatin. Also encompassed are laccases which are synonyms, e.g., anamorphs or perfect states of species or strains of the genus Myceliophthora. Strains of Myceliophthora are readily accessible to the public in a number of culture collections, such as ATCC 48102, 48103, 48104 et al.; CBS 117.65, 131.65, 379.65 et al., DSM 1799 (M. thermophila), ATCC 52474, CBS 539.82, 540.82 et al. (M. hinnulea), DSM 62114, CBS 146.50, 147.50, 157.51 et al (M. lutea), and CBS 478.76, 479.76 and 715.84(M. vellerea). The invention also encompasses any variant nucleotide sequence, and the protein encoded thereby, which protein retains at least about an 80%, preferably at least 85%, and most preferably at least 90-95% homology with the amino acid sequence depicted in Figure 1, and which qualitatively retains the laccase activity of the sequence described herein. Useful variants within the categories defined above include, for example, ones in which conservative amino acid substitutions have been made, which substitutions do not significantly affect the activity of the protein. By conservative substitution is meant that amino acids of the same class may be substituted by any other of that class. For example, the nonpolar aliphatic residues Ala, Val, Leu, and Ile may be interchanged, as may be the basic residues Lys and Arg, or the acidic residues Asp and Glu. Similarly, Ser and Thr are conservative substitutions for each other, as are Asn and Gln. It will be apparent to the skilled artisan that such substitutions can be made outside the regions critical to the function of the molecule and still result in an active enzyme. Retention of the desired activity can readily be determined by conducting a standard ABTS oxidation method, such as is described in the present examples.

[0032] The protein can be used in number of different industrial processes. These processes include polymerization of lignin, both Kraft and lignosulfates, in solution, in order to produce a lignin with a higher molecular weight. A neutral/alkaline laccase is a particular advantage in that Kraft lignin is more soluble at higher pHs. Such methods are described in, for example, Jin et al., Holzforschung 45(6): 467-468, 1991; US Patent No. 4,432,921; EP 0 275 544; PCT/DK93/00217, 1992.

[0033] The laccase of the present invention can also be used for in-situ depolymerization of lignin in Kraft pulp, thereby producing a pulp with lower lignin content. This use of laccase is an improvement over the current use of chlorine for depolymerization of lignin, which leads to the production of chlorinated aromatic compounds, which are an environmentally undesirable by-product of paper mills. Such uses are described in, for example, Current opinion in Biotechnology 3: 261-266, 1992; J. Biotechnol. 25: 333-339, 1992; Hiroi et al., Svensk papperstidning 5: 162-166, 1976. Since the environment in a paper mill is typically alkaline, the present laccase is more useful for this purpose than other known laccases, which function best under acidic conditions.

[0034] Oxidation of dyes or dye precursors and other chromophoric compounds leads to decolorization of the compounds. Laccase can be used for this purpose, which can be particularly advantageous in a situation in which a dye transfer between fabrics is undesirable, e.g., in the textile industry and in the detergent industry. Methods for dye transfer inhibition and dye oxidation can be found in WO 92/01406; WO 92/18683; EP 0495836; Calvo, Mededelingen van de Faculteit Landbouw-wetenschappen/Rijiksuniversitet Gent.56: 1565-1567, 1991; Tsujino et al., J. Soc. Chem.42: 273-282, 1991.

[0035] The laccase is particularly well-suited for use in hair dyeing. In such an application, the laccase is contacted with a dye precursor, preferably on the hair, whereby a controlled oxidation of the dye precursor is achieved to convert the precursor to a dye, or pigment producing compound, such as a quinoid compound. The dye precursor is preferably an aromatic compound belonging to one of three major chemical families: the diamines, aminophenols(or aminonaphthols) and the phenols. The dye precursors can be used alone or in combination. At least one of the intermediates in the copolymerization must be an ortho- or para-diamine or aminophenol(primary intermediate). Examples of such are found in Section IV, below, and include p-phenylene-diamine(pPD), p-toluylene-diamine, chloro-p-phenylenediamine, p-aminophenol, o-aminophenol. 3,4-diaminotoluene; additional compounds are also described in US Patent No. 3,251,742, the contents of which are incorporated herein by reference. In one embodiment, the starting materials include not only the enzyme and a primary intermediate, but also a modifier(coupler) (or combination of modifiers), which modifier is typically a meta-diamine, meta-aminophenol, or a polyphenol. Examples of modifier compounds include m-phenylene-diamine, 2,4-diaminoanisole, α-naphthol, hydroquinone, pyrocatechol, resorcinol. and 4-chlororesorcinol. The modifier then reacts with the primary intermediate in the presence of the laccase, converting it to a colored compound. In another embodiment, the laccase can be used with the primary intermediate directly, to oxidize it into a colored compound. In all cases, the dyeing process can be conducted with one or more primary intermediates, either alone or in combination with one or more modifiers. Amounts of components are in accordance with usual commercial amounts for similar components, and proportions of components may be varied accordingly.

[0036] The use of this laccase is an improvement over the more traditional use of H2O2, in that the latter can damage the hair, and its use usually requires a high pH, which is also damaging to the hair. In contrast, the reaction with laccase can be conducted at alkaline, neutral or even acidic pH, and the oxygen needed for oxidation comes from the air, rather than via harsh chemical oxidation. The result provided by the use of the Myceliophthora laccase is comparable to that achieved with use of H2O2, not only in color development, but also in wash stability and light fastness. An additional commercial advantage is that a single container package can be made containing both the laccase and the precursor, in an oxygen free atmosphere, which arrangement is not possible with the use of H2O2.

[0037] The present laccase can also be used for the polymerization of phenolic compounds present in liquids. An example of such utility is the treatment of juices, such as apple juice, so that the laccase will accelerate a precipitation of the phenolic compounds present in the juice, thereby producing a more stable juice. Such applications have been described in Stutz, Fruit processing 7/93, 248-252, 1993; Maier et al., Dt. Lebensmittelrindschau 86(5): 137-142, 1990; Dietrich et al., Fluss. Obst 57(2) : 67-73, 1990,.

[0038] Laccases such as the Myceliophthora laccase are also useful in soil detoxification (Nannipieri et al., J. Environ. Qual. 20: 510-517,1991; Dec and Bollag, Arch. Environ. Contam. Toxicol. 19: 543-550, 1990).

[0039] The invention is further illustrated by the following non-limiting examples.

EXAMPLES


I. ISOLATION OF MYCELIOPHTHORA THERMOPHILA LACCASE GENE


A. MATERIALS AND METHODS


1. DNA Extraction and Hvbridization analysis



[0040] Total cellular DNA is extracted from fungal cells of Myceliophthora thermophila strain E421 grown 24 hours in 25 ml of YEG medium (0.5% yeast extract, 2% glucose) using the following protocol: mycelia are collected by filtration through Miracloth (Calbiochem) and washed once with 25 ml of TE buffer. Excess buffer is drained from the mycelia which are subsequently frozen in liquid nitrogen. Frozen mycelia are ground to a fine powder in an electric coffee grinder,and the powder added to 20 ml of TE buffer and 5 ml of 20% SDS (w/v) in a disposable plastic centrifuge tube. The mixture is gently inverted several times to ensure mixing, and extracted twice with an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1). Sodium acetate (3M solution) is added to give a final concentration of 0.3 M and the nucleic acids are precipitated with 2.5 volumes of ice cold ethanol. The tubes are centrifuged at 15,000 x g for 30 minutes and the pellet is allowed to air-dry for 30 minutes before resuspending in 0.5 ml of TE buffer. DNase-free ribonuclease A is added to a concentration of 100µg/ml and the mixture is incubated at 37°C for 30 minutes. Proteinase K (200µg/ml) is added and each tube is incubated an additional one hour at 37°C. Finally, each sample is extracted twice with phenol:chloroform:isoamyl alcohol before precipitating the DNA with sodium acetate and ethanol. DNA pellets are dried under vacuum, resuspended in TE buffer, and stored at 4°C.

[0041] Total cellular DNA samples from transformants and an untransformed control strain are analyzed by Southern hybridization. Approximately 5µg of DNA is digested with EcoRI and fractionated by size on a 1% agarose gel. The gel is photographed under short wavelength UV and soaked for 15 minutes in 0.5 M NaOH, 1.5 M NaCl followed by 15 minutes in 1 M Tris-HCl, pH 8, 1.5 M NaCl. DNA in the gel is transferred onto Zeta-Probe™ hybridization membrane (BioRad Laboratories) by capillary blotting in 20 X SSPE (R. W. Davis et al., Advanced Bacterial Genetics, A Manual for Genetic Engineering. Cold Spring Harbor Press. 1980) Membranes are baked for 2 hours at 80°C under vacuum and soaked for 2 hours in the following hybridization buffer at 45°C with gentle agitation: 5X SSPE, 35% formamide (v/v), 0.3% SCS, 200µg/ml denatured and sheared salmon testes DNA. The laccase-specific probe fragment (approx. 1.5 kb) encoding the 5'-portion of the N. crassa lcc1 gene is amplified from N. crassa genomic DNA using standard PCR conditions (Perkin-Elmer Cetus, Emeryville, CA) with the following pair of primers: forward primer, 5' CGAGACTGATAACTGGCTTGG 3'; reverse primer, 5' ACGGCGCATTGTCAGGGAAGT 3'. The amplified DNA segment is first cloned into a TA-cloning vector (Invitrogen, Inc., San Diego, CA), then purified by agarose gel electrophoresis following digestion with EcoRI. The purified probe fragment is radiolabeled by nick translation with α[32P]dCTP(Amersham) and added to the hybridization buffer at an activity of approximately 1 X 106 cpm per ml of buffer. the mixture is incubated overnight at 45°C in a shaking water bath. Following incubation, the membranes are washed once in 0.2 X SSPE with 0.1% SDS at 45°C followed by two washes in 0.2 X SSPE(no SDS) at the same temperature. The membranes are allowed to dry on paper towels for 15 minutes, then wrapped in Saran Wrap™ and exposed to x-ray film overnight at -70°C with intensifying screens(Kodak).

2. DNA Libraries and Identification of Laccase Clones



[0042] Genomic DNA libraries are constructed in the bacteriophage cloning vector λ-EMBL4(J.A.Sorge, in Vectors, A Survey of Molecular Cloning Vectors and Their Uses, Rodriguez et al., eds, pp.43-60, Butterworths, Boston, 1988). Briefly, total cellular DNA is partially digested with Sau3A and size-fractionated on low-melting point agarose gels. DNA fragments migrating between 9kb and 23 kb are excised and eluted from the gel using β-agarase (New England Biolabs, Beverly MA). The eluted DNA fragments are ligated with BamHI-cleaved and dephosphorylated λ-EMBL4 vector arms, and the ligation mixtures are packaged using commercial packaging extracts (Stratagene, LaJolla, CA). The packaged DNA libraries are plated and amplified on Escherichia coli K802 cells. Approximately 10,000-20,000 plaques from each library are screened by plaque-hybridization with the radiolabeled lcc1 DNA fragment using the conditions described above. Plaques which give hybridization signals with the probe are purified twice on E. coli K802 cells, and DNA from the corresponding phage is purified from high titer lysates using a Qiagen Lambda kit(Qiagen, Inc., Chatsworth, CA).

3. Analysis of Laccase Genes



[0043] Restriction mapping of laccase clones is done using standard methods (Lewin, Genes. 2d ed., Wiley & Sons, 1985, New York). DNA sequencing is done with an Applied Biosystems Model 373A automated DNA Sequencer (Applied Biosystems, Inc., Foster City, CA) using the primer walking technique with dye-terminator chemistry (H. Giesecke et al., J. Virol. Methods 38: 47-60, 1992). Oligonucleotide sequencing primers are synthesized on an Applied Biosystems model 394 DNA/RNA Synthesizer.

B. RESULTS AND DISCUSSION


1. Identification of Laccase Gene Sequence



[0044] Total cellular DNA samples are prepared from the species Neurospora crassa, Botrytis cinerea, and Myceliophthora. Aliquots of these DNA preparations are digested with BamHI and fractionated by agarose gel electrophoresis. DNA in the gel is blotted to a Zeta-Probe™ membrane filter (BioRad Laboratories, Hercules,CA) and probed under conditions of mild stringency with a radiolabeled fragment encoding a portion of the N. crassa lcc1 gene, as described above. Laccase-specific sequences are detected in the genomes of M. thermophila and the N. crassa control, but not in the B. cinerea genomic DNA with this probe.

2. Cloning and Characterization of Myceliophthora thermophila Laccase (MtL) Gene



[0045] Approximately 20,000 plaques from a M. thermophila genomic DNA library constructed in a λ-EMBL4 cloning vector are screened. The library is composed of approximately 10,000 independent clones with inserts ranging in size from 9kb to 23kb. Assuming an average insert size of 10 kb and a total genome size of 4 x 107 bp for M. thermophila, this figure is about 2.5 times the number of clones required to represent the entire genome. Eight plaques are identified that hybridized strongly to the N. crassa laccase gene probe. DNA is isolated from three of these, cleaved with EcoRI and analyzed by agarose gel electrophoresis and Southern hybridization. All three of these clones contain a 7.5 kb EcoRI fragment which hybridized to the laccase-specific probe. One of these EcoRI fragments is subcloned into pBR322 (Bolivar et al., Gene 2: 95-113, 1977) to generate plasmid pRaMB1. A restriction map of this DNA segment is shown in Fig. 1. The position of the laccase coding region on this clone is determined by hybridization with the lcc1 gene fragment described above. Based on mapping data obtained, and an estimated size of the laccase protein of approximately 80 kdal, it is reasoned that the entire M. thermophila laccase coding region is contained with a 3.2 kb NheI-BglII segment which is then subcloned into pUC119(Viera and Messing, Methods Enzymol. 153: 3-11, 1987). The nucleotide sequence of this segment is determined using the primer walking method(Giesecke et al., supra). The nucleic acid sequence is shown in Figure 2 and SEQ ID NO: 1.

[0046] The deduced amino acid sequence of MtL is obtained on the basis of amino acid sequence homology with the N. crassa laccase. At the amino acid level, these two laccases share approximately 60% sequence identity. Similarity is highest in regions that correspond to the four histidines and one cysteine which are involved in the formation of the trinuclear copper cluster(Perry et al., J. Gen. Microbiol. 139: 1209-1218, 1993; Coll et al. Appl. Environ. Microbiol. 59: 4129-4135, 1993; Messerschmidt et al. J. Mol. Biol. 206: 513-530, 1989). There are 11 potential sites for N-linked glycosylation in the deduced amino acid sequence of MtL. the first 22 amino acids of MtL appear to comprise a canonical signal peptide with a predicted cleavage following an Ala residue (vonHeijne,J.Mol. Biol. 173:243-251, 1984). Although the amino terminal sequence of the native MtL is unknown, the amino terminus of recombinant MtL produced in A. oryzae is blocked with a pyro-glutamate residue. Enzymatic removal of this residue followed by amino acid sequencing suggests that mature MtL begins with a Gln residue (position 1 in Figure 2; SEQ ID NO: 2). Thus, MtL is apparently synthesized as a 620 amino acid preproenzyme having a 22 amino acid signal peptide and propeptide of 25 residues. Neurospora crassa laccase(NcL) is processed similarly at its amino terminal end. In addition, NcL is also proteolytically processed at its C-terminus, resulting in the removal of 13 amino acids (Germann et al. J. Biol. Chem. 263: 885-896, 1988). The processing site is contained within the sequence Asp-Ser-Gly-Leu*Arg558 (where * designates the cleavage site). A similar sequence exists near the C-terminal end of MtL(Asp-Ser-Gly-Leu-Lys560), suggesting the Myceliophthora enzyme may also be subject to C-terminal processing (Asp-Ser-Gly-Leu*Lys560) which would remove 12 amino acids.

[0047] The positions of six introns (85, 84, 102, 72, 147, and 93 nucleotides) within the lcc1 coding region are determined by comparing the deduced amino acid sequence of MtL to that of NcL and by applying the consensus rules for intron features in filamentous fungi (Gurr et al., in Gene Structure in Eukaryotic Microbes, J.R. Kinghorn, ed.) pp 93-139, IRL Press, Oxford, 1987). The 1860 nucleotides of coding sequence, excluding introns, are rich in guanosine and cytosine (65.5% G+C). The codon usage pattern for this gene reflects the DNA base composition in a strong bias(89.7%) for codons ending in G or C.

II. EXPRESSION OF MYCELIOPHTHORA LACCASE IN ASPERGILLUS


A. MATERIALS AND METHODS


1. Bacterial and Fungal Host Strains



[0048] Escherichia coli JM101(Messing et al., Nucl. Acids Res. 9:309-321, 1981) is used as a host for construction and routine propagation of laccase expression vectors in this study. Fungal hosts for laccase expression included the Aspergillus niger strains Bo-1, AB4.1 and AB1.13(Mattern et al., Mol. Gen. Genet. 234: 332-336), as well as a uridine-requiring(pyrG) mutant of the α-amylase-deficient Aspergillus oryzae strain HowB104.

2. Plasmids



[0049] Plasmid pRaMB2 is a pUC119 derivative which contains a 3.2 kb BglII-NheI fragment of M. thermophila genomic DNA encoding MtL. The vector pMWR is constructed by inserting the A. oryzae TAKA-amylase promoter and terminator elements from pTAKA17(Christensen et al., Bio/Technol. 6: 1419-1422, 1988; EP 238 023) into pUC18(Yanisch-Perron et al., Gene 33: 103-119, 1985). In this vector, there is a unique SwaI site at the end of the promoter element and a single NsiI site at the beginning of the terminator for directional cloning of coding sequences. The cloning vehicle pUC518 is derived by inserting a small linker containing NsiI, ClaI, XhoI, and BglII restriction sites between the adjacent BamHI and XbaI sites of pUC118(Vieira and Messing, supra). Plasmid pToC68(WO 91/17243) contains the A. oryzae TAKA-amylase promoter and A. niger glaA terminator, and pToC90(WO 91/17243) carries the A. nidulans amdS gene.

3. Construction of Laccase Expression Vectors



[0050] The construction strategy for the laccase expression vector pRaMB5 is outlined in Figure 3. The promoter directing transcription of the laccase gene is obtained from the A. oryzae α-amylase (TAKA-amylase) gene (Christensen et al., supra), as well as the TAKA-amylase terminator region. The plasmid is constructed first by modifying pMWR3 by inserting a small linker which contains an ApaI site between the SwaI and NsiI sites, creating a plasmid called pMWR3-SAN. PfuI polymerase-directed PCR (Stratagene, La Jolla, CA) is used to amplify a short DNA segment encoding the 5'-portion of MtL, from the start codon to an internal PstI site (approximately 0.5 kb). The forward primer for this PCR reaction is designed to create an EcoRI site just upstream of the start codon. Next, the amplified fragment is digested with EcoRI and PstI[during this step, the EcoRI site is made blunt by treatment with dNTPs and DNA polymerase I(Klenow fragment)] and purified by agarose gel electrophoresis. The 3' portion of the M. thermophila coding region is excised from pRaMB2 as a 2kb PstI-ApaI fragment(this segment also contains approximately 110 bp from the 3'-untranslated region). These two fragments are combined with SwaI- and ApaI-cleaved pMWR3-SAN in a three-part ligation reaction to generate the laccase expression vector pRaMB5.

4. Transformation of Aspergillus host cells



[0051] Methods for co-transformation of Aspergillus strains are as described in Christensen et al., supra. For introduction of the laccase expression vectors into A. oryzae
HowB 104 pyrG, equal amounts (approximately 5 µg each) of laccase expression vector and one of the following plasmids are used: pPYRG (Fungal Genetics Stock Center, Kansas City, KS) which contains the A. nidulans pyrG gene(Oakley et al, Gene 61385-399, 1987); pSO2 which harbors the clones A. oryzae pyrG gene; pPRYG24 which contains the A. ficuum(=A. niger)pyrG gene. Protrophic(Pyr+) transformants are selected on Aspergillus minimal medium (Rowlands and Turner, Mol. Gen. Genet. 126: 201-216, 1973), and the transformants are transformants are screened for the ability to produce laccase on minimal medium containing 1 mM 2,2'-azinobis(3-ethylbenzthiazolinesulfonic acid)[ABTS]. Cells which secrete active laccase oxidize the ABTS, producing a green halo surrounding the colony. Lastly, A. niger Bo-1 protoplasts are co-transformed using equal amounts (approximately 5µg each) of laccase expression vector and pToC90 which contains the A. nidulans amdS (acetamidase) gene (Hynes et al., Mol. Cell Biol. 3: 1430-1439, 1983. AmdS+ transformants are selected on Cove minimal medium (Cove, Biochim. Biophys. Acta 113: 51-56, 1966) with 1% glucose as the carbon source and acetamide as the sole nitrogen source and screened for laccase expression on cove medium with 1 mM ABTS.

5. Analysis of Laccase-Producing Transformants



[0052] Transformants which produce laccase activity on agar plates are purified twice through conidiospores and spore suspensions in sterile 0.01% Tween-80 are made from each. The density of spores in each suspension is estimated spectrophotometrically (A595 nm). Approximately 0.5 absorbance units of spores are used to inoculate 25 ml of ASPO4 or MY50 medium in 125 ml plastic flasks. The cultures are incubated at 37°C with vigorous aeration (approximately 200 rpm) for four to five days. Culture broths are harvested by centrifugation and the amount of laccase activity in the supernatant is determined using syringaldazine as a substrate. Briefly, 800 µl of assay buffer (25 mM sodium acetate, pH 5.5, 40 µM CuSo4) is mixed with 20 µl of culture supernatant and 60 µl of 0.28 mM syringaldazine (Sigma Chemical Co., St. Louis, MO) in 50% ETOH. The absorbance at 530 nm is measured over time in a Genesys 5 UV-vis spectrophotometer (Milton-Roy). One laccase unit(LACU) is defined as the amount of enzyme which oxidizes one mole of substrate per minute at room temperature. SDS-polyacrylamide gel electrophoresis(PAGE) is done using precast 10-27% gradient gels from Novex(San Diego, CA). Protein bands are developed using Coomassie Brilliant Blue(Sigma).

B.RESULTS AND DISCUSSION


1. Expression of Myceliophthora laccase



[0053] Laccase-producing transformants are detected by incorporation of ABTS into selective media. Using pyrG or amdS as the selectable marker, co-transformation frequencies vary from about 30% to 70%. Heterologous expression of MtL appears to be highest in A. oryzae transformants. Furthermore, production appears to be better in ASPO4 medium compared to MY50, although the reasons for this are unknown. SDS-PAGE analysis of culture broth samples shows a prominent laccase band at approximately 80 kdal, which is similar to the size of the native enzyme purified from M. thermophila. Similar analysis of the culture filtrates from A. niger Bo-transformants indicate that the laccase band is obscured by very intense glucoamylase and acid-stable amylase protein bands. Results are shown in Table 1.
Table 1.
MtL expression among selected A. orvzae and A. niger transformants
HOST STRAIN TRANSFORMANT TRANSFORMING DNAS MTLACU/ML
      ASPO4 MY50
A. oryzae HowB104 pyrG untransformed none 0.00 0.00
RaMB5.15 pRaMB5+pPYRG 0.85 0.29
RaMB5.30 pRaMB5+pPYRG 0.71 0.87
RaMB5.33 pRaMB5+pPYRG 0.60 0.26
RaMB5.108 pRaMB5+PSO2 0.68 0.19
RaMB5.111 pRaMB5+PSO2 0.70 0.17
RaMB5.121 pRaMB5+PSO2 0.49 0.20
RaMB5.142 pRaMB5+PSO2 0.54 0.04
A. Niger Bo-1 untransformed none 0.00 0.00
RaMB5.1 pRaMB5+pToC90 n.d. 0.20
RaMB5.25 pRaMB5+pToC90 n.d. 0.09
RaMB5.49 pRaMB5+pToC90 n.d. 0.06
RaMB5.51 pRaMB5+pToC90 n.d. 0.12
RaMB5.53 pRaMB5+pToC90 n.d. 0.21
RaMB5.62 pRaMB5+pToC90 n.d. 0.16
n.d.= not determined

2. Expression in the presence or absence of excess copper



[0054] A 1 ml aliquot of a spore suspension of Aspergillus oryzae transformant HowB104-pRaMB5.30(approximately 109 spores/ml) is added aseptically to a 500 ml shake flask containing 100 ml of sterile shake flask medium (maltose, 50g/l; MgSO4·7H2O, 2g/l; KH2PO4, 10g/l; K2SO4, 2g/l; CaCl2·2H2O 0.5 g/l; Citric acid, 2g/l; yeast extract, 10g/l; trace metals[ZnSO4·7H2O, 14.3 g/l; CuSO4·5H2O, 2.5 g/l; NiCl2·6H2O, 0.5 g/l; FeSO4·7H2O, 13.8 g/l, MnSO4·H2O, 8.5 g/l; citric acid, 3.0 g/l], 0.5 ml/l; urea, 2g/l, made with tap water and adjusted to pH 6.0 before autoclaving), and incubated at 37°C on a rotary shaker at 200 rpm for 18 hours. 50 ml of this culture is aseptically transferred to a 3 liter fermentor containing 1.8 liters of the fermentor media (MgSO4·7H2O, 2g/l; KH2PO4, 2g/l; citric acid 4g/l; K2SO4, 3g/l;CaCl2·2H2O, 2g/l; trace metals, 0.5 ml/l; pluronic antifoam, 1ml/l). The fermentor temperature is maintained at 34°C by the circulation of cooling water through the fermentor jacket. Sterile air is sparged through the fermentor at a rate of 1.8 liter/min (1v/v/m). The agitiation rate is maintained between 600 and 1300 rpm at approximately the minimum level required to maintain the dissolved oxygen level in the culture above 20%. Sterile feed (Nutriose 725[maltose syrup], 225 g/l; urea, 30 g/l; yeast extract, 15 g/l; pluronic antifoam, 1.5 ml/l, made up with distilled water and autoclaved) is added to the fermentor by use of a peristaltic pump. The feed rate profile during the fermentation is as follows: 30 g of feed is added initially before inoculation; 0-24 h, 2 g/l h; 24-48 h, 4 g/l h, 48h-end, 6 g/l.

[0055] Copper is made as a 400X stock in water or a suitable buffer, filter sterilized and added aseptically to the tank to a final level of 0.5 mM. The fermentation described above is also conducted without the addition of copper supplement to tha tank medium. Samples for enzyme activity determination are withdrawn and filtered through Miracloth to remove mycelia. These samples are assayed for laccase activity by the LACU assay described above. Laccase activity is found to increase continuously during the course of the fermentation, with a value of approximately 45 LACU/ml achieved after 180 hours in the fermentation containing excess copper. At a specific activity of 22 LACU/mg, this corresponds to 2g/l of recombinant laccase expressed. On the other hand, the maximum laccase activity achieved in the fermentation without copper supplement is approximately 10 LACU/ml after 170 hours, or about 25% of that found in the presence of additional copper.

III. PURIFICATION AND CHARACTERIZATION OF MYCELIOPTHORA LACCASE


A. MATERIALS AND METHODS


1. Materials



[0056] Chemicals used as buffers and substrates are commercial products of at least reagent grade. Endo/N-glycosidase F and pyroglutamate amino peptidase are purchased from Boehringer Mannheim. Chromatography is performed on either a Pharmacia FPLC or a conventional low pressure system. Spectroscopic assays are conducted on either a spectrophotometer(Shimadzu PC160) or a microplate reader(Molecular Devices). Britton & Robinson(B&R) buffers are prepared according to the protocol described in Quelle, Biochemisches Taschenbuch, H.M. Raven, II. Teil, S.93 u. 102, 1964.

2. Enzymatic Assay



[0057] Laccase activity is determined by syringaldazine oxidation at 30°C in a 1-cm quartz cuvette. 60µl syringaldazine stock solution (0.28 mM in 50% ethanol) and 20 µl sample are mixed with 0.8 ml preheated buffer solution. The oxidation is monitored at 530nm over 5 minutes. The activity is expressed as µmole substrate oxidized per minute. B&R buffers with various pHs are used. The activity unit is referred to here as "SOU". A buffer of 25 mM sodium acetate, 40 µM CuSO4, pH 5.5, is also used to determine the activity, which is referred to as LACU, as defined above. 2,2'-azinobis(3-ethylbenzo thiazoline-6-sulfonic acid) (ABTS) oxidation assays are done using 0.4 mM ABTS, B&R buffer, pH 4.1, at room temperature by monitoring ΔA405. An ABTS oxidase activity overlay assay is performed by pouring cooled ABTS-agarose(0.05 g ABTS, 1 g agarose, 50 ml H2O, heated to dissolve agarose) over a native IEF gel and incubating at room temperature. Thermostability analysis of the laccase(r-MtL) is performed using samples that have 3 SOU activity pre-incubated in B&R buffer, pH 6, at various temperatures. Samples are assayed after a 400-fold dilution into the same buffer at room temperature.

3. Purification from a fermentor broth



[0058] 3.7 liters of cheese-cloth filtered broth (pH 7.6, 16 mS) is filtered through Whatman #2 filter paper. The broth is concentrated on a Spiral Concentrator (Amicon) with a S1Y100 membrane (MWCO:100) from 3700 ml to 200 ml. The concentrate is adjusted to 0.75 mS by diluting it in water and reconcentrated on S1Y100 to 170 ml. The washed and concentrated broth has a dense greenish color.

[0059] The broth is frozen overnight at -20°C, thawed the next day and loaded onto a Q-sepharose XK26 column (120 ml), pre-equilibrated with 10 mM Tris, pH 7.5, 0.7 mS(Buffer A). The blue laccase band migrates slowing down the column during loading. One group of blue fractions runs through the column after loading and washing by Buffer A. A second group eluted during the linear gradient with Buffer B (Buffer A plus 2 M NaCl). Some brown material with no laccase activity is eluted out later with 1 M NaOH. SDS-PAGE analysis shows that this preparation results in pure laccase.

4. Analyses of amino acid content, extent of glycosylation, and N-terminal sequence



[0060] N-terminal sequencing is performed on an ABI 476A sequencer. Total amino acid analysis, from which the extinction coefficient of r-MtL is determined, is performed on a HP AminoQuant instrument. Deglycosylation is done using endo/N-glucosidase F according to the manufacturer's instructions and carbohydrate content is estimated by mobility difference as determined on SDS-PAGE. N-terminus de-blocking with pyroglutamate amino peptidase is carried out according to manufacturer's instructions. About 80µg r-MtL is treated with 4 µg peptidase with or without the presence of 1 M urea or 0.1 M guanidine HCl before being blotted on a PVDF membrane for sequencing. About 20 pmol de-blocked protein is obtained and sequenced.

[0061] SDS-PAGE and native IEF analysis are performed on either a Novex cell or a Mini Protean II and a Model 111 Mini IEF cells (Bio-Rad). Gel filtration analyses are done on a Sephacryl S-300(Pharmacia), from which the native MW is estimated by using Blue Dextran (2000 kdal), bovine IgG (158 kdal), bovine serum albumin (66 kdal), ovalbumin (45 kdal) and horse heart myoglobin(17 kdal) to calibrate the column.

B. RESULTS AND DISCUSSION


1. Purification and characterization of r-MtL from a fermentor broth



[0062] From 3.7 1 of fermentor broth, about 2-3 g of r-MtL are isolated. Initial concentration using a membrane with MWCO of 100 kdal removed significant amounts of brown material and small contaminant proteins. The low affinity of r-MtL toward Q-Sepharose matrix equilibrated with 10 mM Tris, pH 7.5, facilitates its separation from other more acidic and more tightly bound impurities. As shown by SDS-PAGE, this preparation resulted in essentially pure laccase for the most active fractions located around the peak. Other less active fractions can be further purified on either Mono-Q with a shallower gradient or a gel filtration column, such as S-300, from which the contaminants are separated due to their smaller MW. An overall 18-fold purification and a recovery of 67% are achieved. As discussed below, the existence of two elution bands of r-MtL on Q-Sepharose chromatogram is probably due to a differential glycosylation.

[0063] The purified r-MtL shows a MW of 100-140 kdal on S-300 gel filtration and a MW of 85 kdal on SDS-PAGE. The increase of r-MtL mobility on SDS-PAGE after deglycosylation suggests that carbohydrates account for 14% of its total mass. Native IEF shows a major band at pI ~4.2 that is active in ABTS overlay assay.

[0064] Directly sequencing the N-terminus of the purified r-MtL from samples either in desalted solution or on PVDF membrane are unsuccessful. However, treatment of r-MtL with pyroglutamate amino peptidase yielded a protein with deblocked N-terminus. This suggests the processing of a propeptide during the maturation of r-MtL, a posttranslational event similar to that of N. crassa laccase but not found in other laccases such as Rhizoctonia solani. The proposed scheme is outlined below.



[0065] The spectrum of the blue r-MtL has absorption maxima at 276 and 589 nm.

[0066] The activity of the laccase is tested by using either syringaldazine and ABTS as substrates. Expressed as per Abs276 or per mg, the laccase has a value of 20 or 45 units for SOU at pH 6.5, respectively. The LACU assay yields a value of 10 or 22 units per Abs276 or per mg.

[0067] The pH profile of r-MtL activity is quite close to that of the wild type, with an optimal pH of 6.5. The upper temperature limit for retaining full activity after a 20 minute preincubation observed for r-MtL is approximately 60°C. The purified r-MtL shows no activity loss over a 5 week storage frozen in Q-sepharose elution buffer at -20°C.

[0068] When comparing the two forms of r-MtL obtained from the fermentor broth isolated on Q-Sepharose, there are no significant differences seen in terms of SDS-PAGE, native PAGE, native IEF, S-300 gel filtration, UV-visible spectrum, specific activity towards syringaldazine and ABTS, and deblocked N-terminus sequencing measurements. Likely, the different elution pattern on Q-Sepharose arises from some sort of differential glycosylation.

IV. USE OF MYCELIOPHTHORA LACCASE IN DYEING HAIR



[0069] The dyeing effect of Myceliophthora laccase is tested on various dye precursors and further on 0.1% p-phenylenediamine compared with a number of modifiers.

Materials:


Dye precursors:



[0070] 

0.1 % p-phenylene-diamine in 0.1 M K-phosphate buffer, pH=7.0)

0.1 % o-aminophenol in 0.1 M K-phosphate buffer, pH=7.0)


Enzymes :



[0071] Recombinant Myceliophthora thermophila laccase, 16 LACU/ml (in final dye solution).

Equipment :



[0072] Datacolor Textflash 2000 (CIE-Lab)

Assessment of the hair color



[0073] The quantitative color of the hair tresses is determined on a Datacolor Textflash 2000 by the use of CIE-Lab parameters L* ("0"=black and "100"=white) combined with a* ("-"=green and "+"=red).

Results:


Dyeing effect



[0074] Tresses of blond European hair (1 gram) are used for testing Myceliophthora thermophila laccase in the context of oxidative hair dyeing. p-phenylene diamine and o-aminophenol are used as the dye precursors.

Hair dyeing



[0075] 4 ml dye precursor solution is mixed with 1 ml laccase on a Whirley mixer, applied to the hair tresses and kept at 30°C for 60 minutes. The hair tresses are then rinsed with running water for about 3 minutes, pressed between two fingers, combed, and air dried.

[0076] The results of the dyeing effect test are displayed below in Table 1 and 2.
Table 1
o-aminophenol enzyme L* a*
Untreated blond hair - 70.3 2.3
Laccase + 57.7 15.3
*: 0=black, 100=white
a*: -=green, +=red
Table 2
p-phenylenediamine enzyme L* a*
Untreated blond hair - 70.3 2.3
1.0 ml laccase + 29.1 4.1
L*: 0=black, 100=white
a*: -=green, +=red

Result of test:



[0077] From Table 1 and 2 it can be seen that the Myceliophthora thermophila laccase can be used for oxidative dyeing of hair.

Deposit of Biological Materials



[0078] The following biological materials have been deposited under the terms of the Budapest Treaty with the Agricultural Research Service Patent Culture Collection, Northern Regional Research Center, 1815 University Street, Peoria, Illinois, 61604 on May 25, 1994, and given the following accession number.
Deposit Accession Number
E. coli JM101 containing pRaMB5 NRRL B-21261

SEQUENCE LISTING



[0079] 

(1) GENERAL INFORMATION:

(i) APPLICANT:

(A) NAME: Novo Nordisk Biotech, Inc.

(B) STREET: 1445 Drew Avenue

(C) CITY: Davis, California

(D) COUNTRY: United States of America

(E) POSTAL CODE (ZIP): 95616-4880

(F) TELEPHONE: (916) 757-8100

(G) TELEFAX: (916) 758-0317

(i) APPLICANT:

(A) NAME: Novo Nordisk A/S

(B) STREET: Novo Alle

(C) CITY: Bagsværd

(D) COUNTRY: Denmark

(E) POSTAL CODE (ZIP): DK-2880

(F) TELEPHONE: +45 4444 8888

(G) TELEFAX: +45 4449 3256

(ii) TITLE OF INVENTION: PURIFIED MYCELIOPHTHORA LACCASES AND NUCLEIC ACIDS ENCFODING SAME

(iii) NUMBER OF SEQUENCES: 2

(iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: Novo Nordisk of North America, Inc.

(B) STREET: 405 Lexington Avenue, Suite 6400

(C) CITY and STATE: New York, New York

(D) COUNTRY: U.S.A.

(E) ZIP: 10174-6401

(v) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk

(B) COMPUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: PatentIn Release #1.0, Version #1.25 (EPO)

(vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER: to be assigned

(B) FILING DATE: 31-May-1995

(C) CLASSIFICATION:

(vii) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER: US 08/253, 781

(B) FILING DATE: 03-June-1994

(viii) ATTORNEY/AGENT INFORMATION:

(A) NAME: Lowney, Karen A.

(B) REGISTRATION NUMBER: 31, 274

(C) REFERENCE/DOCKET NUMBER: 4184.204-WO

(ix) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: 212 867 0123

(B) TELEFAX: 212 867 0298

(2) INFORMATION FOR SEQ ID NO: 1:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 3187 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: double

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(vi) ORIGINAL SOURCE:
   (A) ORGANISM: Myceliophthora thermophila

(ix) FEATURE:

(A) NAME/KEY: intron

(B) LOCATION: 833...917

(ix) FEATURE:

(A) NAME/KEY: intron

(B) LOCATION: 996...1077

(ix) FEATURE:

(A) NAME/KEY: intron

(B) LOCATION: 1090...1188

(ix) FEATURE:

(A) NAME/KEY: intron

(B) LOCATION: 1261...1332

(ix) FEATURE:

(A) NAME/KEY: intron

(B) LOCATION: 2305...2451

(ix) FEATURE:

(A) NAME/KEY: intron

(B) LOCATION: 2521...2613

(ix) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION: join (587..832, 918..995, 1078..1089, 1189..1260, 1333..2304, 2452..2520, 2614..3024)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:







(2) INFORMATION FOR SEQ ID NO: 2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 620 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(vi) ORIGINAL SOURCE:
   (A) ORGANISM: Myceliophthora thermophila

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:








Claims

1. A substantially pure Myceliophthora laccase having an amino acid sequence which is at least about 80% homologous to the amino acid sequence set forth in SEQ ID NO. 2.
 
2. A Myceliophthora laccase according to claim 1 which has an amino acid sequence which is at least about 85% homologous to the amino acid sequence set forth in SEQ ID NO. 2.
 
3. A Myceliophthora laccase according to claim 1 which has an amino acid sequence which is at least about 90% homologous to the amino acid sequence set forth in SEQ ID NO.2.
 
4. A Myceliophthora laccase according to claim 1 which has an amino acid sequence which is at least about 95% homologous to the amino acid sequence set forth in SEQ ID NO. 2.
 
5. A laccase of claim 1 which is a Myceliophthora thermophila laccase.
 
6. A Myceliophthora laccase according to claim 1 which has an amino acid sequence set forth in SEQ ID NO. 2.
 
7. A laccase according to claim 1 having a specific activity of at least 30 SOU/mg on syringaldazine at optimum pH.
 
8. A DNA construct comprising a nucleic acid sequence encoding a Myceliophthora laccase according to claim 1.
 
9. A DNA construct comprising a nucleic acid sequence encoding a Myceliophthora laccase according to claim 2.
 
10. A DNA construct comprising a nucleic acid sequence encoding a Myceliophthora laccase according to claim 3.
 
11. A DNA construct comprising a nucleic acid sequence encoding a Myceliophthora laccase according to claim 4.
 
12. A DNA construct comprising a nucleic acid sequence encoding a Myceliophthora laccase according to claim 5.
 
13. A DNA construct comprising a nucleic acid sequence encoding a Myceliophthora laccase according to claim 6.
 
14. A DNA construct comprising a nucleic acid sequence encoding a Myceliophthora laccase according to claim 7.
 
15. A recombinant vector comprising the DNA construct of claim 8.
 
16. The vector of claim 15 in which the construct is operably linked to a promoter sequence.
 
17. The vector of claim 16 in which the promoter is a fungal or yeast promoter.
 
18. The vector of Claim 17 in which the promoter is the TAKA amylase promoter of Aspergillus oryzae.
 
19. The vector of Claim 17 in which the promoter is the glucoamylase (gluA) promoter of Aspergillus niger or Aspergillus awamori.
 
20. The vector of Claim 15 which also comprises a selectable marker.
 
21. The vector of Claim 20 in which the selectable marker is selected from the group consisting of amdS, pyrG, argB, niaD, sC, and hygB.
 
22. The vector of Claim 20 in which the selectable marker is the amdS marker of Aspergillus nidulans or Aspergillus oryzae, or the pyrG marker of Aspergillus nidulans, Aspergillus niger, Aspergillus awamori, or Aspergillus oryzae.
 
23. The vector of Claim 20 which comprises both the TAKA amylase promoter of Aspergillus oryzae and the amdS or pyrG marker of Aspergillus nidulans or Aspergillus oryzae.
 
24. A recombinant host cell comprising a heterologous DNA construct of claim 8.
 
25. The cell of Claim 24 which is a fungal cell.
 
26. The cell of Claim 24 which is an Aspergillus cell.
 
27. The cell of Claim 24 in which the construct is integrated into the host cell genome.
 
28. The cell of Claim 24 in which the construct is contained on a vector.
 
29. The cell of Claim 24 in which the nucleic acid sequence encodes a laccase having the amino acid sequence depicted in SEQ ID NO. 2.
 
30. A method for obtaining a laccase according to claim 1, which comprises culturing a recombinant host cell comprising a DNA construct containing a nucleic acid sequence encoding a [the] laccase according to claim 1 under conditions conducive to expression of the laccase, and recovering the enzyme from the culture.
 
31. A method of enhancing yield of active recombinant laccase according to claim 1, which comprises culturing a recombinant host cell comprising a DNA construct containing a sequence encoding a copper containing enzyme, under conditions conducive to expression of the enzyme, in the presence of at least about 0.02 mM copper.
 
32. A method for polymerizing a lignin or lignosulfate substrate in solution which comprises contacting the substrate with a laccase according to claim 1.
 
33. A method for in situ depolymerization in Kraft pulp which comprises contacting the pulp with a laccase according to claim 1.
 
34. A method for oxidizing dyes or dye precursors which comprises contacting the dye with a laccase according to claim 1.
 
35. A method for dyeing hair which comprises contacting a Myceliophthora laccase according to claim 1, in the presence or absence of at least one modifier, with at least one dye precursor, for a time and under conditions sufficient to permit oxidation of the dye precursor to a dye.
 
36. The method of claim 35 in which the dye precursor is selected from the group consisting of a diamine, aminophenol, and a phenol.
 
37. The method of claim 35, wherein the modifier, when used, is a meta-diamine, a meta-amino-phenol or a polyphenol.
 
38. The method of claim 36 in which the dye precursor is a primary intermediate selected from the group consisting of an ortho- or para-diamine or aminophenol.
 
39. The method of claim 35 in which more than one modifier is used.
 
40. The method of claim 35 in which one modifier is used.
 
41. The method of claim 35 in which both the primary intermediate and modifier are used.
 
42. A dye composition comprising a Myceliophthora laccase according to claim 1 combined with at least one dye precursor.
 
43. A dye composition according to claim 42, further comprising at least one primary intermediate and at least one modifier.
 
44. A container containing a dye composition according to claim 42 in an oxygen free atmosphere.
 
45. The container of claim 44 further comprising at least one primary intermediate dye precursor combined with at least one modifier.
 
46. A method of polymerizing or oxidizing a phenolic or aniline compound which comprises contacting the phenolic or aniline compound with a Myceliophthora laccase according to claim 1.
 
47. A DNA construct comprising the nucleic acid sequence encoding a Myceliophthora laccase contained in NRRL B-21261.
 


Ansprüche

1. Im wesentlichen reine Myceliophthora-Laccase mit einer Aminosäuresequenz, die zu mindestens ungefähr 80% homolog zu der in SEQ ID NO. 2 angegebenen Aminosäuresequenz ist.
 
2. Myceliophthora-Laccase nach Anspruch 1, die eine Aminosäuresequenz hat, die zu mindestens ungefähr 85% homolog zu der in SEQ ID NO. 2 angegebenen Aminosäuresequenz ist.
 
3. Myceliophthora-Laccase nach Anspruch 1, die eine Aminosäuresequenz hat, die zu mindestens ungefähr 90% homolog zu der in SEQ ID NO. 2 angegebenen Aminosäuresequenz ist.
 
4. Myceliophthora-Laccase nach Anspruch 1, die eine Aminosäuresequenz hat, die zu mindestens ungefähr 95% homolog zu der in SEQ ID NO. 2 angegebenen Aminosäuresequenz ist.
 
5. Laccase nach Anspruch 1, die eine Myceliophthora thermophila-Laccase ist.
 
6. Myceliophthora-Laccase nach Anspruch 1, die eine Aminosäuresequenz hat, die in SEQ ID NO. 2 angegeben ist.
 
7. Laccase nach Anspruch 1, die eine spezifische Aktivität von mindestens 30 SOU/mg gegenüber Syringaldazin bei optimalem pH aufweist.
 
8. DNA-Konstrukt, das eine Nukleinsäuresequenz umfasst, die eine Myceliophthora-Laccase nach Anspruch 1 kodiert.
 
9. DNA-Konstrukt, das eine Nukleinsäuresequenz umfasst, die eine Myceliophthora-Laccase nach Anspruch 2 kodiert.
 
10. DNA-Konstrukt, das eine Nukleinsäuresequenz umfasst, die eine Myceliophthora-Laccase nach Anspruch 3 kodiert.
 
11. DNA-Konstrukt, das eine Nukleinsäuresequenz umfasst, die eine Myceliophthora-Laccase nach Anspruch 4 kodiert.
 
12. DNA-Konstrukt, das eine Nukleinsäuresequenz umfasst, die eine Myceliophthora-Laccase nach Anspruch 5 kodiert.
 
13. DNA-Konstrukt, das eine Nukleinsäuresequenz umfasst, die eine Myceliophthora-Laccase nach Anspruch 6 kodiert.
 
14. DNA-Konstrukt, das eine Nukleinsäuresequenz umfasst, die eine Myceliophthora-Laccase nach Anspruch 7 kodiert.
 
15. Rekombinanter Vektor, der das DNA-Konstrukt von Anspruch 8 umfasst.
 
16. Vektor nach Anspruch 15, in dem das Konstrukt funktionell mit einer Promotorsequenz verknüpft ist.
 
17. Vektor nach Anspruch 16, in dem der Promotor ein Pilz- oder Hefe-Promotor ist.
 
18. Vektor nach Anspruch 17, in dem der Promotor der TAKA-Amylase-Promotor von Aspergillus oryzae ist.
 
19. Vektor nach Anspruch 17, in dem der Promotor der Glucoamylase (gluA)-Promotor von Aspergillus niger oder Aspergillus awamori ist.
 
20. Vektor nach Anspruch 15, der auch einen selektierbaren Marker umfasst.
 
21. Vektor nach Anspruch 20, bei dem der selektierbare Marker aus der Gruppe, bestehend aus amdS, pyrG, argB, niaD, sC und hygB, ausgewählt ist.
 
22. Vektor nach Anspruch 20, bei dem der selektierbare Marker der amdS-Marker von Aspergillus nidulans oder Aspergillus oryzae oder der pyrG-Marker von Aspergillus nidulans, Aspergillus niger, Aspergillus awamori oder Aspergillus oryzae ist.
 
23. Vektor nach Anspruch 20, der sowohl den TAKA-Amylase-Promotor von Aspergillus oryzae als auch den amdS- oder pyrG-Marker von Aspergillus nidulans oder Aspergillus oryzae umfasst.
 
24. Rekombinante Wirtszelle, die ein heterologes DNA-Konstrukt nach Anspruch 8 umfasst.
 
25. Zelle nach Anspruch 24, die eine Pilzzelle ist.
 
26. Zelle nach Anspruch 24, die eine Aspergillus-Zelle ist.
 
27. Zelle nach Anspruch 24, bei der das Konstrukt in das Genom der Wirtszelle integriert ist.
 
28. Zelle nach Anspruch 24, bei der das Konstrukt auf einem Vektor enthalten ist.
 
29. Zelle nach Anspruch 24, bei der die Nukleinsäuresequenz eine Laccase kodiert, die die in SEQ ID NO. 2 angegebene Aminosäuresequenz hat.
 
30. Verfahren zum Gewinnen einer Laccase nach Anspruch 1, das umfasst, eine rekombinante Wirtszelle, die ein DNA-Konstrukt umfasst, das eine Nukleinsäuresequenz enthält, die eine Laccase nach Anspruch 1 kodiert, unter Bedingungen, die der Expression der Laccase förderlich sind, zu züchten und das Enzym aus der Kultur zu gewinnen.
 
31. Verfahren zum Erhöhen der Ausbeute an aktiver rekombinanter Laccase nach Anspruch 1, das umfasst, eine rekombinante Wirtszelle, die ein DNA-Konstrukt umfasst, das eine Sequenz enthält, die ein kupferhaltiges Enzym kodiert, unter Bedingungen, die der Expression des Enzyms förderlich sind, in Gegenwart von mindestens ungefähr 0,02 mM Kupfer zu züchten.
 
32. Verfahren zum Polymerisieren eines Lignin- oder Lignosulfatsubstrats in Lösung, das umfasst, das Substrat mit einer Laccase nach Anspruch 1 in Kontakt zu bringen.
 
33. Verfahren zur in situ-Depolymerisation in Kraftzellstoff, das umfasst, den Zellstoff mit einer Laccase nach Anspruch 1 in Kontakt zu bringen.
 
34. Verfahren zum Oxidieren von Farbstoffen oder Farbstoffvorstufen, das umfasst, den Farbstoff mit einer Laccase nach Anspruch 1 in Kontakt zu bringen.
 
35. Verfahren zum Färben von Haaren, das umfasst, eine Myceliophthora-Laccase nach Anspruch 1 in Anwesenheit oder Abwesenheit von mindestens einem Modifizierungsmittel mit mindestens einer Farbstoffvorstufe für eine Zeitdauer und unter Bedingungen, die ausreichend sind, um eine Oxidation der Farbstoffvorstufe zu einem Farbstoff zu ermöglichen, in Kontakt zu bringen.
 
36. Verfahren nach Anspruch 35, bei dem die Farbstoffvorstufe aus der Gruppe, bestehend aus einem Diamin, Aminophenol und einem Phenol, ausgewählt ist.
 
37. Verfahren nach Anspruch 35, wobei das Modifizierungsmittel, sofern ein solches verwendet wird, ein meta-Diamin, ein meta-Aminophenol oder ein Polyphenol ist.
 
38. Verfahren nach Anspruch 36, bei dem die Farbstoffvorstufe ein primäres Zwischenprodukt, ausgewählt aus der Gruppe, bestehend aus einem ortho- oder para-Diamin oder -Aminophenol, ist.
 
39. Verfahren nach Anspruch 35, bei dem mehr als ein Modifizierungsmittel verwendet wird.
 
40. Verfahren nach Anspruch 35, bei dem ein Modifizierungsmittel verwendet wird.
 
41. Verfahren nach Anspruch 35, bei dem sowohl das primäre Zwischenprodukt als auch Modifizierungsmittel verwendet wird.
 
42. Farbstoffzusammensetzung, umfassend eine Myceliophthora-Laccase nach Anspruch 1 in Kombination mit mindestens einer Farbstoffvorstufe.
 
43. Farbstoffzusammensetzung nach Anspruch 42, die ferner mindestens ein primäres Zwischenprodukt und mindestens ein Modifizierungsmittel umfasst.
 
44. Behälter, der eine Farbstoffzusammensetzung nach Anspruch 42 in einer sauerstofffreien Atmosphäre enthält.
 
45. Behälter nach Anspruch 44, der ferner mindestens eine aus einem primären Zwischenprodukt gebildete Farbstoffvorstufe in Kombination mit mindestens einem Modifizierungsmittel enthält.
 
46. Verfahren zum Polymerisieren oder Oxidieren einer phenolischen Verbindung oder Anilinverbindung, das umfasst, die phenolische Verbindung oder Anilinverbindung mit einer Myceliophthora-Laccase nach Anspruch 1 in Kontakt zu bringen.
 
47. DNA-Konstrukt, das die Nukleinsäuresequenz umfasst, die eine Myceliophthora-Laccase kodiert, die in NRRL B-21261 enthalten ist.
 


Revendications

1. Laccase de Myceliophthora pratiquement pure ayant une séquence d'acides aminés qui est au moins homologue à environ 80 % à la séquence d'acides aminés établie dans SEQ ID N° 2.
 
2. Laccase de Myceliophthora selon la revendication 1, qui a une séquence d'acides aminés qui est au moins homologue à environ 85 % à la séquence d'acides aminés établie dans la SEQ ID N° 2.
 
3. Laccase de Myceliophthora selon la revendication 1, qui a une séquence d'acides aminés qui est au moins homologue à environ 90 % à la séquence d'acides aminés établie dans la SEQ ID N° 2.
 
4. Laccase de Myceliophthora selon la revendication 1, qui a une séquence d'acides aminés qui est au moins homologue à environ 95 % à la séquence d'acides aminés établie dans la SEQ ID N° 2.
 
5. Laccase selon la revendication 1, qui est une laccase de Myceliophthora thermophila.
 
6. Laccase de Myceliophthora selon la revendication 1, qui a une séquence d'acides aminés établie dans la SEQ ID N° 2.
 
7. Laccase selon la revendication 1, ayant une activité spécifique d'au moins 30 SOU/mg sur syringaldazine à pH optimal.
 
8. Produit de synthèse d'ADN comportant une séquence d'acide nucléique codant pour une laccase de Myceliophthora selon la revendication 1.
 
9. Produit de synthèse d'ADN comportant une séquence d'acide nucléique codant pour une laccase de Myceliophthora selon la revendication 2.
 
10. Produit de synthèse d'ADN comportant une séquence d'acide nucléique codant pour une laccase de Myceliophthora selon la revendication 3.
 
11. Produit de synthèse d'ADN comportant une séquence d'acide nucléique codant pour une laccase de Myceliophthora selon la revendication 4.
 
12. Produit de synthèse d'ADN comportant une séquence d'acide nucléique codant pour une laccase de Myceliophthora selon la revendication 5.
 
13. Produit de synthèse d'ADN comportant une séquence d'acide nucléique codant pour une laccase de Myceliophthora selon la revendication 6.
 
14. Produit de synthèse d'ADN comportant une séquence d'acide nucléique codant pour une laccase de Myceliophthora selon la revendication 7.
 
15. Vecteur recombinant comportant le produit de synthèse d'ADN de la revendication 8.
 
16. Vecteur selon la revendication 15, dans lequel le produit de synthèse est lié de manière opérationnelle à une séquence de promoteur.
 
17. vecteur selon la revendication 16, dans lequel le promoteur est un promoteur fongique ou de levure.
 
18. Vecteur selon la revendication 17, dans lequel le promoteur est le promoteur de la TAKA-amylase de Aspergillus oryzae.
 
19. Vecteur selon la revendication 17, dans lequel le promoteur est le promoteur de la glucoamylase (gluA) de Aspergillus niger ou Aspergillus awamori.
 
20. Vecteur selon la revendication 15, qui comporte également un marqueur pouvant être sélectionné.
 
21. Vecteur selon la revendication 20, dans lequel le marqueur pouvant être sélectionné est sélectionné parmi le groupe constitué de amdS, pyrG, argB, niaD, sC, et hygB.
 
22. Vecteur selon la revendication 20, dans lequel le marqueur pouvant être sélectionné est le marqueur amdS de Aspergillus nidulans ou Aspergillus oryzae, ou le marqueur pyrG de Aspergillus nidulans, Aspergillus niger, Aspergillus awamori, ou Aspergillus oryzae.
 
23. Vecteur selon la revendication 20, qui comporte à la fois le promoteur de la TAKA-amylase de Aspergillus oryzae et le marqueur amdS ou pyrG de Aspergillus nidulans ou Aspergillus oryzae.
 
24. Cellule hôte recombinante comportant un produit de synthèse d'ADN hétérologue selon la revendication 8.
 
25. Cellule selon la revendication 24, qui est une cellule fongique.
 
26. Cellule selon la revendication 24, qui est une cellule d'Aspergillus.
 
27. Cellule selon la revendication 24, dans laquelle le produit de synthèse est intégré dans le génome de la cellule hôte.
 
28. Cellule selon la revendication 24, dans laquelle le produit de synthèse est contenu sur un vecteur.
 
29. Cellule selon la revendication 24, dans laquelle la séquence d'acide nucléique code pour une laccase ayant la séquence d'acides aminés représentée dans la SEQ ID N° 2.
 
30. Procédé pour obtenir une laccase selon la revendication 1, qui comporte la culture d'une cellule hôte recombinante comportant un produit de synthèse d'ADN contenant une séquence d'acide nucléique codant pour la laccase selon la revendication 1 sous des conditions entraînant l'expression de la laccase, et la récupération de l'enzyme à partir de la culture.
 
31. Procédé pour accentuer le rendement de laccase recombinante active selon la revendication 1, qui comporte la culture d'une cellule hôte recombinante comportant un produit de synthèse d'ADN contenant une séquence codant pour une enzyme contenant du cuivre, sous des conditions entraînant une expression de l'enzyme, en présence d'au moins environ 0,02 mM de cuivre.
 
32. Procédé de polymérisation d'un substrat de lignine ou de lignosulfate en solution qui comporte la mise en contact du substrat et d'une laccase selon la revendication 1.
 
33. Procédé pour une dépolymérisation in situ dans une pâte Kraft qui comporte la mise en contact de la pâte et d'une laccase selon la revendication 1.
 
34. Procédé pour oxyder des colorants ou des précurseurs de colorant qui comporte la mise en contact du colorant et d'une laccase selon la revendication 1.
 
35. Procédé pour colorer des cheveux qui comporte la mise en contact d'une laccase de Myceliophthora selon la revendication 1, en présence ou l'absence d'au moins un modificateur, avec au moins un précurseur de colorant, pendant un instant et sous des conditions suffisants pour permettre l'oxydation du précurseur de colorant en un colorant.
 
36. Procédé selon la revendication 35, dans lequel le précurseur de colorant est sélectionné parmi le groupe constitué d'une diamine, d'un aminophénol et d'un phénol.
 
37. Procédé selon la revendication 35, dans lequel le modificateur, lorsqu'il est utilisé, est une méta-diamine, un méta-amino-phénol ou un polyphénol.
 
38. Procédé selon la revendication 36, dans lequel le précurseur de colorant est un intermédiaire primaire sélectionné parmi le groupe constitué d'une ortho- ou para-diamine ou d'un aminophénol.
 
39. Procédé selon la revendication 35, dans lequel plus d'un modificateur est utilisé.
 
40. Procédé selon la revendication 35, dans lequel un modificateur est utilisé.
 
41. Procédé selon la revendication 35, dans lequel l'intermédiaire primaire et le modificateur sont tous deux utilisés.
 
42. Composition colorante comportant une laccase de Myceliophthora selon la revendication 1, combinée à au moins un précurseur de colorant.
 
43. Composition colorante selon la revendication 42, comportant de plus au moins un intermédiaire primaire et au moins un modificateur.
 
44. Conteneur contenant une composition colorante selon la revendication 42 dans une atmosphère exempte d'oxygène.
 
45. Conteneur selon la revendication 44, comportant de plus au moins un précurseur de colorant intermédiaire primaire combiné à au moins un modificateur.
 
46. Procédé de polymérisation ou d'oxydation d'un composé phénolique ou d'aniline qui comporte la mise en contact du composé phénolique ou d'aniline avec une laccase de Myceliophthora selon la revendication 1.
 
47. Produit de synthèse d'ADN comportant la séquence d'acide nucléique codant pour une laccase de Myceliophthora contenue dans NRRL B-21261.
 




Drawing