FIELD OF THE INVENTION
[0002] The present invention relates generally to signal transduction pathways. More particularly,
the present invention relates to chemokine receptors, nucleic acids encoding chemokine
receptors, chemokine receptor ligands, modulators of chemokine receptor activity,
antibodies recognizing chemokines and chemokine receptors, methods for identifying
chemokine receptor ligands and modulators, methods for producing chemokine receptors,
and methods for producing antibodies recognizing chemokine receptors.
BACKGROUND OF THE INVENTION
[0003] Recent advances in molecular biology have led to an appreciation of the central role
of signal transduction pathways in biological processes. These pathways comprise a
central means by which individual cells in a multicellular organism communicate, thereby
coordinating biological processes.
See Springer, Cell 76:301-314 (1994), Table I for a model. One branch of signal transduction pathways, defined by the
intracellular participation of guanine nucleotide binding proteins (G-proteins), affects
a broad range of biological processes.
[0004] Lewin, GENES V 319-348 (1994) generally discusses G-protein signal transduction pathways which involve, at a minimum,
the following components: an extracellular signal (e.g., neurotransmitters, peptide
hormones, organic molecules, light, or odorants), a signal-recognizing receptor (G-protein-coupled
receptor, reviewed in
Probst et al., DNA and Cell Biology 11:1-20 [1992] and also known as GPR or GPCR), and an intracellular, heterotrimeric GTP-binding
protein, or G protein. In particular, these pathways have attracted interest because
of their role in regulating white blood cell or leukocyte trafficking.
[0005] Leukocytes comprise a group of mobile blood cell types including granulocytes (
i.
e., neutrophils, basophils, and eosinophils), lymphocytes, and monocytes. When mobilized
and activated, these cells are primarily involved in the body's defense against foreign
matter. This task is complicated by the diversity of normal and pathological processes
in which leukocytes participate. For example, leukocytes function in the normal inflammatory
response to infection. Leukocytes are also involved in a variety of pathological inflammations.
For a summary, see
Schall et al., Curr. Opin. Immunol. 6:865-873 (1994). Moreover, each of these processes can involve unique contributions, in degree,
kind, and duration, from each of the leukocyte cell types.
[0007] Comparisons of the amino acid sequences of the known chemokines have led to a classification
scheme which divides chemokines into two groups: the α group characterized by a single
amino acid separating the first two cysteines (CXC; N-terminus as referent), and the
β group, where these cysteines are adjacent (CC).
See Baggiolini et al., supra. Correlations have been found between the chemokines and the particular leukocyte
cell types responding to those signals.
Schall et al., supra, has reported that the CXC chemokines generally affect neutrophils; the CC chemokines
tend to affect monocytes, lymphocytes, basophils and eosinophils. For example,
Baggiolini et al.,
supra, recited that RANTES, a CC chemokine, functions as a chemoattractant for monocytes,
lymphocytes (
i.
e., memory T cells), basophils, and eosinophils, but not for neutrophils, while inducing
the release of histamine from basophils.
[0008] Chemokines were recently shown by
Cocchi, et. al., Science, 270: 1811-1815 (1995) to be suppressors of HIV proliferation. Cocchi,
et al. demonstrated that RANTES, MIP-1α, and MIP-1β suppressed HIV-1, HIV-2 and SIV infection
of a CD4
+ cell line designated PM1 and of primary human peripheral blood mononuclear cells.
[0009] Recently, however, attention has turned to the cellular receptors that bind the chemokines,
because the extracellular chemokines seem to contact cells indiscriminately, and therefore
lack the specificity needed to regulate the individual leukocyte cell types.
[0010] Murphy, supra, reported that the GPCR superfamily of receptors includes the chemokine receptor family.
The typical chemokine receptor structure includes an extracellular chemokine-binding
domain located near the N-terminus, followed by seven spaced regions of predominantly
hydrophobic amino acids capable of forming membrane-spanning α-helices. Between each
of the α-helical domains are hydrophilic domains localized, alternately, in the intra-
or extra-cellular spaces. These features impart a serpentine conformation to the membrane-embedded
chemokine receptor. The third intracellular loop typically interacts with G-proteins.
In addition,
Murphy, supra, noted that the intracellular carboxyl terminus is also capable of interacting with
G-proteins.
[0011] The first chemokine receptors to be analyzed by molecular cloning techniques were
the two neutrophil receptors for human IL8, a CXC chemokine.
Holmes et al., Science 253:178-1280 (1991) and
Murphy et al., Science 253:1280-1283 (1991), reported the cloning of these two receptors for IL8.
Lee et al., J. Biol. Chem. 267:16283-16287 (1992), analyzed the cDNAs encoding these receptors and found 77% amino acid identity between
the encoded receptors, with each receptor exhibiting features of the G protein coupled
receptor family. One of these receptors is specific for IL-8, while the other binds
and signals in response to IL-8, gro/MGSA, and NAP-2. Genetic manipulation of the
genes encoding IL-8 receptors has contributed to our understanding of the biological
roles occupied by these receptors. For example,
Cacalano et al., Science 265:682-684 (1994) reported that deletion of the IL-8 receptor homolog in the mouse resulted in a pleiotropic
phenotype involving lymphadenopathy and splenomegaly. In addition, a study of missense
mutations described in
Leong et al., J. Biol. Chem. 269:19343-19348 (1994) revealed amino acids in the IL-8 receptor that were critical for IL-8 binding. Domain
swapping experiments discussed in
Murphy, supra, implicated the amino terminal extracellular domain as a determinant of binding specificity.
[0012] Several receptors for CC chemokines have also been identified and cloned. CCCKR1
binds both MIP-1α and RANTES and causes intracellular calcium ion flux in response
to both ligands.
Charo et al., Proc Natl. Acad. Sci. (USA) 91:2752-2756 (1994) reported that another CC chemokine receptor, MCP-R1 (CCCKR2), is encoded by a single
gene that produces two splice variants which differ in their carboxyl terminal domains.
This receptor binds and responds to MCP-3 in addition to MCP-1.
[0013] A promiscuous receptor that binds both CXC and CC chemokines has also been identified.
This receptor was originally identified on red blood cells and
Horuk et al., Science 261:1182-1184 (1993) reports that it binds IL-8, NAP-2, GROα, RANTES, and MCP-1. The erythrocyte chemokine
receptor shares about 25% identity with other chemokine receptors and may help to
regulate circulating levels of chemokines or aid in the presentation of chemokines
to their targets. In addition to binding chemokines, the erythrocyte chemokine receptor
has also been shown to be the receptor for plasmodium vivax, a major cause of malaria
(id.) Another G-protein coupled receptor which is closely related to chemokine receptors,
the platelet activating factor receptor, has also been shown to be the receptor for
a human pathogen, the bacterium Streptococcus
pneumoniae (
Cundell et al., Nature 377:435-438 (1995)).
[0014] In addition to the mammalian chemokine receptors, two viral chemokine receptor homologs
have been identified.
Ahuja et al., J. Biol. Chem. 268:20691-20694 (1993) describes a gene product from
Herpesvirus saimiri that shares about 30% identity with the IL-8 receptors and binds CXC chemokines.
Neote et al., Cell, 72:415-425 (1993) reports that human cytomegalovirus contains a gene encoding a receptor sharing about
30% identity with the CC chemokine receptors which binds MIP-1α, MIP-1β, MCP-1, and
RANTES. These viral receptors may affect the normal role of chemokines and provide
a selective pathological advantage for the virus.
[0015] Because of the broad diversity of chemokines and their activities, there are numerous
receptors for the chemokines. The receptors which have been characterized represent
only a fraction of the total complement of chemokine receptors. There thus remains
a need in the art for the identification of additional chemokine receptors. The availability
of these novel receptors will provide tools for the development of therapeutic modulators
of chemokine or chemokine receptor function. It is contemplated by the present invention
that such modulators are useful as therapeutics for the treatment of atherosclerosis,
rheumatoid arthritis, tumor growth suppression, asthma, viral infections, and other
inflammatory conditions. Alternatively, fragments or variants of the chemokine receptors,
or antibodies recognizing those receptors, are contemplated as therapeutics.
SUMMARY OF THE INVENTION
[0016] The present invention relates to purified and isolated nucleic acids encoding chemokine
receptors involved in leukocyte trafficking.
[0017] According to the present invention, there is provided a purified and isolated polynucleotide
encoding the amino acid sequence of chemokine receptor 88C set out in SEQ ID NO: 2
and a purified and isolated polynucleotide encoding the amino acid sequence of macqaque
chemokine receptor 88C set out in SEQ ID NO: 20.
[0018] Also provided by the present invention is a polynucleotide encoding an 88C polypeptide
wherein said polynucleotide hybridizes under stringent hybridization conditions to
the polynucleotide of SEQ ID NO: 1 and a polynucleotide encoding a macqaque 88C polypeptide
wherein said polynucleotide hybridizes under stringent hybridization conditions to
the polynucleotide of SEQ ID NO: 19.
[0019] Further provided by the present invention is a purified and isolated polypeptide
comprising the chemokine receptor 88C amino acid sequence set out in SEQ ID NO: 2
and a purified and isolated polypeptide comprising the macqaque chemokine receptor
88C amino acid sequence set out in SEQ ID NO: 20.
[0020] According to a further aspect of the invention, there is provided a method of screening
for a modulator of HIV infection, comprising steps of (a) contacting a first composition
comprising a mammalian 88C receptor of SEQ ID NO: 2 or 20 or encoded by a polynucleotide
of the invention with a second composition comprising a human immunodeficiency virus
(HIV) envelope protein, in the presence and absence of a compound; (b) measuring the
interaction of the mammalian 88C receptor with the HIV envelope protein in the presence
and absence of the compound; and screening for a modulator of HIV infection, wherein
reduced or increased interaction of the mammalian 88C receptor with the HIV in the
presence of the compound versus in the absence of the compound is indicative of the
compound being a modulator of HIV infection.
[0021] Polynucleotides of the invention (both sense and anti-sense strands thereof) include
genomic DNAs, cDNAs, and RNAs, as well as completely or partially synthetic nucleic
acids. Preferred polynucleotides include the DNA encoding the chemokine receptor 88-2B
that is set out in SEQ ID NO: 3, the DNA encoding the chemokine receptor 88C that
is set out in SEQ ID NO: 1, and DNAs which hybridize to those DNAs under standard
stringent hybridization conditions, or which would hybridize but for the redundancy
of the genetic code. Exemplary stringent hybridization conditions are as follows:
hybridization at 42°C in 50% formamide, 5X SSC, 20 mM sodium phosphate, pH 6.8 and
washing in 0.2X SSC at 55°C. It is understood by those of skill in the art that variation
in these conditions occurs based on the length and GC nucleotide content of the sequences
to be hybridized. Formulas standard in the art are appropriate for determining exact
hybridization conditions.
See Sambrook et al., §§ 9.47-9.51 in Molecular Cloning: A Laboratory Manual, Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, New York (1989). Also contemplated are polynucleotides encoding domains of 88-2B or 88C, for example,
polynucleotides encoding one or more extracellular domains of either protein or other
biologically active fragments thereof. 88-2B extracellular domains correspond to SEQ
ID NO:3 and SEQ ID NO:4 at amino acid residues 1-36, 93-107, 171-196, and 263-284.
The extracellular domains of 88-2B are encoded by polynucleotide sequences corresponding
to SEQ ID NO:3 at nucleotides 362-469, 638-682, 872-949, and 1148-1213. Extracellular
domains of 88C correspond to SEQ ID NO:1 and SEQ ID NO:2 at amino acid residues 1-32,
89-112, 166-191, and 259-280. The 88C extracellular domains are encoded by polynucleotide
sequences that correspond to SEQ ID NO:1 at nucleotides 55-150, 319-390, 550-627,
and 829-894. Also comprehended are polynucleotides encoding intracellular domains
of these chemokine receptors. The intracellular domains of 88-2B include amino acids
60-71, 131-151, 219-240, and 306-355 of SEQ ID NO:3 and SEQ ID NO:4. Those domains
are encoded by polynucleotide sequences corresponding to SEQ ID NO:3 at nucleotides
539-574, 752-814, 1016-1081, and 1277-1426, respectively. The 88C intracellular domains
include amino acid residues 56-67, 125-145, 213-235, and 301-352 of SEQ ID NO:1 and
SEQ ID NO:2. The intracellular domains of 88C are encoded by polynucleotide sequences
corresponding to SEQ ID NO:1 at nucleotides 220-255, 427-489, 691-759, and 955-1110.
Peptides corresponding to one or more of the extracellular or intracellular domains,
or antibodies raised against those peptides, are contemplated as modulators of receptor
activities, especially ligand and G protein binding activities of the receptors.
[0022] The nucleotide sequences of the invention and this disclosure may also be used to
design oligonucleotides for use as labeled probes to isolate genomic DNAs encoding
88-2B or 88C under stringent hybridization conditions (
i.
e., by Southern analyses and Polymerase Chain Reaction methodologies). Moreover, these
oligonucleotide probes can be used to detect particular alleles of the genes encoding
88-2B or 88C, facilitating both diagnosis and gene therapy treatments of disease states
associated with particular alleles. In addition, these oligonucleotides can be used
to alter chemokine receptor genetics to facilitate identification of chemokine receptor
modulators. Also, the nucleotide sequences can be used to design antisense genetic
elements of use in exploring or altering the genetics and expression of 88-2B or 88C.
The invention also comprehends biological replicas (
i.
e., copies of isolated DNAs made
in vivo or
in vitro) and RNA transcripts of DNAs of the invention. Autonomously replicating recombinant
constructions such as plasmid, viral, and chromosomal (
e.
g., YAC) nucleic acid vectors effectively incorporating 88-2B or 88C polynucleotides,
and, particularly, vectors wherein DNA effectively encoding 88-2B or 88C is operatively
linked to one or more endogenous or heterologous expression control sequences are
disclosed.
[0023] The 88-2B and 88C receptors may be produced naturally, recombinantly or synthetically.
Host cells (prokaryotic or eukaryotic) transformed or transfected with polynucleotides
of the invention and this disclosure by standard methods may be used to express the
88-2B and 88C chemokine receptors. Beyond the intact 88-2B or 88C gene products, biologically
active fragments of 88-2B or 88C, analogs of 88-2B or 88C, and synthetic peptides
derived from the amino acid sequences of 88-2B, set out in SEQ ID NO:4, or 88C, set
out in SEQ ID NO:2, are contemplated. Moreover, the 88-2B or 88C gene product, or
a biologically active fragment of either gene product, when produced in a eukaryotic
cell, may be post-translationally modified (
e.
g., via disulfide bond formation, glycosylation, phosphorylation, myristoylation, palmitoylation,
acetylation, etc.) The 88-2B and 88C gene products, or biologically active fragments
thereof, are further contemplated in monomeric, homomultimeric, or heteromultimeric
conformations.
[0024] In particular, one aspect of the disclosure involves antibody products capable of
specifically binding to the 88-2B or 88C chemokine receptors. The antibody products
are generated by methods standard in the art using recombinant 88-2B or 88C receptors,
synthetic peptides or peptide fragments of 88-2B or 88C receptors, host cells expressing
88-2B or 88C on their surfaces, or 88-2B or 88C receptors purified from natural sources
as immunogens. The antibody products may include monoclonal antibodies or polyclonal
antibodies of any source or sub-type. Moreover, monomeric, homomultimeric, and heteromultimeric
antibodies, and fragments thereof, are contemplated by the invention. Further, the
invention comprehends CDR-grafted antibodies, "humanized" antibodies, and other modified
antibody products retaining the ability to specifically bind a chemokine receptor.
[0025] Also disclosed is the use of antibody products for detection of the 88-2B or 88C
gene products, their analogs, or biologically active fragments thereof. For example,
antibody products may be used in diagnostic procedures designed to reveal correlations
between the expression of 88-2B, or 88C, and various normal or pathological states.
In addition, antibody products can be used to diagnose tissue-specific variations
in expression of 88-2B or 88C, their analogs, or biologically active fragments thereof.
Antibody products specific for the 88-2B and 88C chemokine receptors may also act
as modulators of receptor activities. In another aspect, antibodies to 88-2B or 88C
receptors are useful for therapeutic purposes.
[0026] Assays for ligands capable of interacting with the chemokine receptors of the invention
are also disclosed. These assays may involve direct detection of chemokine receptor
activity, for example, by monitoring the binding of a labeled ligand to the receptor.
In addition, these assays may be used to indirectly assess ligand interaction with
the chemokine receptor. As used herein the term "ligand" comprises molecules which
are agonists and antagonists of 88-2B or 88C, and other molecules which bind to the
receptors.
[0027] Direct detection of ligand binding to a chemokine receptor may be achieved using
the following assay. Test compounds (
i.
e., putative ligands) are detectably labeled (
e.
g., radioiodinated). The detectably labeled test compounds are then contacted with
membrane preparations containing a chemokine receptor of the invention. Preferably,
the membranes are prepared from host cells expressing chemokine receptors of the invention
from recombinant vectors. Following an incubation period to facilitate contact between
the membrane-embedded chemokine receptors and the detectably labeled test compounds,
the membrane material is collected on filters using vacuum filtration. The detectable
label associated with the filters is then quantitated. For example, radiolabels are
quantitated using liquid scintillation spectrophotometry. Using this technique, ligands
binding to chemokine receptors are identified. To confirm the identification of a
ligand, a detectably labeled test compound is exposed to a membrane preparation displaying
a chemokine receptor in the presence of increasing quantities of the test compound
in an unlabeled state. A progressive reduction in the level of filter-associated label
as one adds increasing quantities of unlabeled test compound confirms the identification
of that ligand.
[0028] Agonists are ligands which bind to the receptor and elicit intracellular signal transduction
and antagonists are ligands which bind to the receptor but do not elicit intracellular
signal transduction. The determination of whether a particular ligand is an agonist
or an antagonist can be determined, for example, by assaying G protein-coupled signal
transduction pathways. Activation of these pathways can be determined by measuring
intracellular ca
++ flux, phospholipase C activity or adenylyl cyclase activity, in addition to other
assays (see examples 5 and 6).
[0029] As discussed in detail in the Examples herein, chemokines that bind to the 88C receptor
include RANTES, MIP-1α, and MIP-1β, and chemokines that bind to the 88-2B receptor
include RANTES.
[0030] In another aspect of the disclosure, modulators of the interaction between the 88C
and 88-2B receptors and their ligands are specifically contemplated. Modulators of
chemokine receptor function may be identified using assays similar to those used for
identifying ligands. The membrane preparation displaying a chemokine receptor is exposed
to a constant and known quantity of a detectably labeled functional ligand. In addition,
the membrane-bound chemokine receptor is also exposed to an increasing quantity of
a test compound suspected of modulating the activity of that chemokine receptor. If
the levels of filter-associated label correlate with the quantity of test compound,
that compound is a modulator of the activity of the chemokine receptor. If the level
of filter-associated label increases with increasing quantities of the test compound,
an activator has been identified. In contrast, if the level of filter-associated label
varies inversely with the quantity of test compound, an inhibitor of chemokine receptor
activity has been identified. Testing for modulators of receptor binding in this way
allows for the rapid screening of many putative modulators, as pools containing many
potential modulators can be tested simultaneously in the same reaction.
[0031] The indirect assays for receptor binding involve measurements of the concentration
or level of activity of any of the components found in the relevant signal transduction
pathway. Chemokine receptor activation often is associated with an intracellular Ca
++ flux. Cells expressing chemokine receptors may be loaded with a calcium-sensitive
dye. Upon activation of the expressed receptor, a Ca
++ flux would be rendered spectrophotometrically detectable by the dye. Alternatively,
the Ca
++ flux could be detected microscopically. Parallel assays, using either technique,
may be performed in the presence and absence of putative ligands. For example, using
the microscopic assay for Ca
++ flux, RANTES, a CC chemokine, was identified as a ligand of the 88-2B chemokine receptor.
Those skilled in the art will recognize that these assays are also useful for identifying
and monitoring the purification of modulators of receptor activity. Receptor activators
and inhibitors will activate or inhibit, respectively, the interaction of the receptors
with their ligands in these assays.
[0032] Alternatively, the association of chemokine receptors with G proteins affords the
opportunity of assessing receptor activity by monitoring G protein activities. A characteristic
activity of G proteins. GTP hydrolysis, may be monitored using, for example,
32P-labeled GTP.
[0033] G proteins also affect a variety of other molecules through their participation in
signal transduction pathways. For example. G protein effector molecules include adenylyl
cyclase, phospholipase C, ion channels, and phosphodiesterases. Assays focused on
any of these effectors may be used to monitor chemokine receptor activity induced
by ligand binding in a host cell that is both expressing the chemokine receptor of
interest and contacted with an appropriate ligand. For example, one method by which
the activity of chemokine receptors may be detected involves measuring phospholipase
C activity. In this assay, the production of radiolabeled inositol phosphates by host
cells expressing a chemokine receptor in the presence of an agonist is detected. The
detection of phospholipase activity may require cotransfection with DNA encoding an
exogenous G protein. When cotransfection is required, this assay can be performed
by cotransfection of chimeric G protein DNA, for example, Gqi5 (
Conklin, et al., Nature 363:274-276 (1993), with 88-2B or 88C DNA and detecting phosphoinositol production when the cotransfected
cell is exposed to an agonist of the 88-2B or 88C receptor. Those skilled in the art
will recognize that assays focused on G-protein effector molecules are also useful
for identifying and monitoring the purification of modulators of receptor activity.
Receptor activators and inhibitors will activate or inhibit, respectively, the interaction
of the receptors with their ligands in these assays.
[0034] Chemokines have been linked to many inflammatory diseases, such as psoriasis, arthritis,
pulmonary fibrosis and atherosclerosis.
See Baggiolini et al., supra. Inhibitors of chemokine action may be useful in treating these conditions. In one
example,
Broaddus et al., J. of Immunol. 152:2960-2967 (1994), describes an antibody to IL-8 which can inhibit neutrophil recruitment in endotoxin-induced
pleurisy, a model of acute inflammation in rabbit lung. It is also contemplated that
ligand or modulator binding to, or the activation of, the 88C receptor may be useful
in treatment of HIV infection and HIV related disease states. Modulators of chemokine
binding to specific receptors contemplated by the invention may include antibodies
directed toward a chemokine or a receptor, biological or chemical small molecules,
or synthetic peptides corresponding to fragments of the chemokine or receptor.
[0035] Administration of compositions containing 88-2B or 88C modulators to mammalian subjects,
for the purpose of monitoring or remediating normal or pathological immune reactions
and viral infections including infection by retroviruses such as HIV-1, HIV-2 and
SIV is contemplated. In particular, the mitigation of inflammatory responses, abnormal
hematopoietic processes, and viral infections by delivery of a pharmaceutically acceptable
quantity of 88-2B or 88C chemokine receptor modulators is comprehended. Further comprehended
is delivery of these active substances in pharmaceutically acceptable compositions
comprising carriers, diluents, or medicaments. A variety of administration routes
is contemplated. For example, the active substances may be administered by the following
routes: intravenous, subcutaneous, intraperitoneal, intramuscular, oral, anal (
i.
e., via suppository formulations), or pulmonary (
i.
e., via inhalers, atomizers, nebulizers, etc.)
[0037] Other aspects and advantages of the present invention will become apparent to one
skilled in the art upon consideration of the following examples.
DETAILED DESCRIPTION OF THE INVENTION
[0038] The following examples illustrate the invention. Example I describes the isolation
of genomic DNAs encoding the 88-2B and 88C chemokine receptors. Example 2 presents
the isolation and sequencing of cDNAs encoding human 88-2B and 88C and macaque 88C.
Example 3 provides a description of Northern analyses revealing the expression patterns
of the 88-2B and 88C receptors in a variety of tissues. Example 4 details the recombinant
expression of the 88-2B and 88C receptors. Example 5 describes Ca
++ flux assays, phosphoinositol hydrolysis assays, and binding assays for 88-2B and
88C receptor activity in response to a variety of potential ligands. Experiments describing
the role of 88C and 882B as co-receptors for HIV is presented in Examples 6 and 7.
The preparation and characterization of monoclonal and polyclonal antibodies immunoreactive
with 88C is described in Example 8. Example 9 describes additional assays designed
to identify 88-2B or 88C ligands or modulators.
Example 1
[0039] Partial genomic clones encoding the novel chemokine receptor genes of this invention
were isolated by PCR based on conserved sequences found in previously identified genes
and based on a clustering of these chemokine receptor genes within the human genome.
The genomic DNA was amplified by standard PCR methods using degenerate oligonucleotide
primers.
[0040] Templates for PCR amplifications were members of a commercially available source
of recombinant human genomic DNA cloned into Yeast Artificial Chromosomes (
i.
e., YACs). (Research Genetics, Inc., Huntsville, AL. YAC Library Pools, catalog no.
95011 B). A YAC vector can accommodate inserts of 500-1000 kilobase pairs. Initially,
pools of YAC clone DNAs were screened by PCR using primers specific for the gene encoding
CCCKR1. In particular, CCCKR(2)-5', the sense strand primer (corresponding to the
sense strand of CCCKR1), is presented in SEQ ID NO:15. Primer CCCKR(2)-5' consisted
of the sequence 5'-CGTAAGCTTAGAGAAGCCGGGATGGGAA-3', wherein the underlined nucleotides
are the translation start codon for CCCKR1. The anti-sense strand primer was CCCKR-3'
(corresponding to the anti-sense strand of CCCKR1) and its sequence is presented in
SEQ ID NO:16. The sequence of CCCKR-3', 5'-GCCTCTAGAGTCAGAGACCAGCAGA-3', contains
the reverse complement of the CCCKR1 translation stop codon (underlined). Pools of
YAC clone DNAs yielding detectable PCR products (
i.
e., DNA bands upon gel electrophoresis) identified appropriate sub-pools of YAC clones,
based on a proprietary identification scheme. (Research Genetics, Inc., Huntsville,
AL). PCR reactions were initiated with an incubation at 94°C for four minutes. Sequence
amplifications were achieved using 33 cycles of denaturation at 94°C for one minute,
annealing at 55°C for one minute, and extension at 72°C for two minutes.
[0041] The sub-pools of YAC clone DNAs were then subjected to a second round of PCR reactions
using the conditions, and primers, that were used in the first round of PCR. Results
from sub-pool screenings identified individual clones capable of supporting PCR reactions
with the CCCKR-specific primers. One clone, 881F10, contained 640 kb of human genomic
DNA from chromosome 3p21 including the genes for CCCKR1 and CCCKR2, as determined
by PCR and hybridization. An overlapping YAC clone, 941A7, contained 700 kb of human
genomic DNA and also contained the genes for CCCKR1 and CCCKR2. Consequently, further
mapping studies were undertaken using these two YAC clones. Southern analyses revealed
that CCCKR1 and CCCKR2 were located within approximately 100 kb of one another.
[0042] The close proximity of the CCCKR1 and CCCKR2 genes suggested that novel related genes
might be linked to CCCKR1 and CCCKR2. Using DNA from yeast containing YAC clones 881F10
and 941A7 as templates, PCR reactions were performed to amplify any linked receptor
genes. Degenerate oligodeoxyribonucleotides were designed as PCR primers. These oligonucleotides
corresponded to regions encoding the second intracellular loop and the sixth transmembrane
domain of CC chemokine receptors, as deduced from aligned sequence comparisons of
CCCKR1, CCCKR2, and V28. V28 was used because it is an orphan receptor that exhibits
the characteristics of a chemokine receptor; V28 has also been mapped to human chromosome
3.
Raport et al., Gene 163:295-299 (1995). Of further note, the two splice variants of CCCKR2. CCCKR2A and CCCKR2B, are identical
in the second intracellular loop and sixth transmembrane domain regions used in the
analysis. The 5' primer, designated V28degf2, contains an internal
BamHI site (see below); its sequence is presented in SEQ ID NO:5. The sequence of primer
V28degf2 corresponds to DNA encoding the second intracellular loop region of the canonical
receptor structure.
See Probst et al., supra. The 3' primer, designated V28degr2, contains an internal
HindIII site (see below); its sequence is presented in SEQ ID NO:6. The sequence of primer
V28degr2 corresponds to DNA encoding the sixth transmembrane domain of the canonical
receptor structure.
[0043] Amplified PCR DNA was subsequently digested with
BamHI and
HindIII to generate fragments of approximately 390 bp, consistent with the fragment size
predicted from inspection of the canonical sequence. Following endonuclease digestion,
these PCR fragments were cloned into pBluescript (Stratagene Inc., LaJolla, CA). A
total of 54 cloned fragments were subjected to automated nucleotide sequence analyses.
In addition to sequences from CCCKR1 and CCCKR2, sequences from the two novel chemokine
receptor genes of the invention were identified. These two novel chemokine receptor
genes were designated 88-2B and 88C.
[0044] Restriction endonuclease mapping and hybridization were utilized to map the relative
positions of genes encoding the receptors 88C, 88-2B. CCCKR1, and CCCKR2. These four
genes are closely linked, as the gene for 88C is approximately 18 KBP from the CCCKR2
gene on human chromosome 3p21.
Example 2
[0045] Full-length 88-2B and 88C cDNAs were isolated from a macrophage cDNA library by the
following procedure. Initially, a cDNA library, described in
Tjoelker et al., Nature 374:549-553 (1995), was constructed in pRc/CMV (Invitrogen Corp., San Diego, CA) from human macrophage
mRNA. The cDNA library was screened for the presence of 88-2B and 88C cDNA clones
by PCR using unique primer pairs corresponding to 88-2B or 88C. The PCR protocol involved
an initial denaturation at 94°C for four minutes. Polynucleotides were then amplified
using 33 cycles of PCR under the following conditions: Denaturation at 94°C for one
minute, annealing at 55°C for one minute, and extension at 72°C for two minutes. The
first primer specific for 88-2B was primer 88-2B-f1, presented in SEQ ID NO:11. It
corresponds to the sense strand of SEQ ID NO:3 at nucleotides 844-863. The second
PCR primer specific for the gene encoding 88-2B was primer 88-2B-rl, presented in
SEQ ID NO:12; the 88-2B-r1 sequence corresponds to the anti-sense strand of SEQ ID
NO:3 at nucleotides 1023-1042. Similarly, the sequence of the first primer specific
for the gene encoding 88C. primer 88C-f1, is presented in SEQ ID NO:13 and corresponds
to the sense strand of SEQ ID NO:1 at nucleotides 453-471. The second primer specific
for the gene encoding 88C is primer 88C-r3, presented in SEQ ID NO:14; the sequence
of 88C-r3 corresponds to the anti-sense strand of SEQ ID NO:1 at nucleotides 744-763.
[0046] The screening identified clone 777, a cDNA clone of 88-2B. Clone 777 contained a
DNA insert of 1915 bp including the full length coding sequence of 88-2B as determined
by the following criteria: the clone contained a long open reading frame beginning
with an ATG codon, exhibited a Kozak sequence, and had an in-frame stop codon upstream.
The DNA and deduced amino acid sequences of the insert of clone 777 are presented
in SEQ ID NO:3 and SEQ ID NO:4, respectively. The 88-2B transcript was relatively
rare in the macrophage cDNA library. During the library screen, only three 88-2B clones
were identified from an estimated total of three million clones.
[0047] Screening for cDNA clones encoding the 88C chemokine receptor identified clones 101
and 134 which appeared to contain the entire 88C coding region, including a putative
initiation codon. However, these clones lacked the additional 5' sequence needed to
confirm the identity of the initiation codon. The 88C transcript was relatively abundant
in the macrophage cDNA Library. During the library screen, it was estimated that 88C
was present at one per 3000 transcripts (in a total of approximately three million
clones in the library).
[0048] RACE PCR (
Rapid
Amplification of
cDNA
Ends) was performed to extend existing 88C clone sequences, thereby facilitating the
accurate characterization of the 5' end of the 88C cDNA. Human spleen 5'-RACE-ready
cDNA was purchased from Clontech Laboratories, Inc., Palo Alto, CA. and used according
to the manufacturer's recommendations. The cDNA had been made "5'-RACE-ready" by ligating
an anchor sequence to the 5' ends of the cDNA fragments. The anchor sequence is complementary
to an anchor primer supplied by Clontech Laboratories, Inc., Palo Alto, CA. The anchor
sequence-anchor primer duplex polynucleotide contains an
EcoRI site. Human spleen cDNA was chosen as template DNA because Northern blots had revealed
that 88C was expressed in this tissue. The PCR reactions were initiated by denaturing
samples at 94°C for four minutes. Subsequently, sequences were amplified using 35
cycles involving denaturation at 94°C for one minute, annealing at 60°C for 45 seconds,
and extension at 72°C for two minutes. The first round of PCR was performed on reaction
mixtures containing 2µl of the 5'-RACE-ready spleen cDNA, 1 µl of the anchor primer,
and 1 µl of primer 88c-r4 (100 ng/µl) in a total reaction volume of 50 µl. The 88C-specific
primer, primer 88c-r4 (5'-GATAAGCCTCACAGCCCTGTG-3'), is presented in SEQ ID NO:7.
The sequence of primer 88c-r4 corresponds to the anti-sense strand of SEQ ID NO:1
at nucleotides 745-765. A second round of PCR was performed on reaction mixtures including
1 µl of the first PCR reaction with 1 µl of anchor primer and 1 µl of primer 88C-rlb
(100 ng/µl) containing the following sequence (5'-GCTAAGCTTGATGACTATCTTTAATGTC-3')
and presented in SEQ ID NO:8. The sequence of primer 88C-rlb contains an internal
HindIII cloning site (underlined). The sequence 3' of the
HindIII site corresponds to the anti-sense strand of SEQ ID NO:1 at nucleotides 636-654.
The resulting PCR product was digested with
EcoRI and
HindIII and fractionated on a 1% agarose gel. The approximately 700 bp fragment was isolated
and cloned into pBluescript. Clones with the largest inserts were sequenced. Alternatively,
the intact PCR product was ligated into vector pCR using a commercial TA cloning kit
(Invitrogen Corp., San Diego, CA) for subsequent nucleotide sequence determinations.
[0049] The 88-2B and 88C cDNAs were sequenced using the PRISM™ Ready Reaction DyeDeoxy™
Terminator Cycle Sequencing Kit (Perkin Elmer Corp., Foster City, CA) and an Applied
Biosystems 373A DNA Sequencer. The insert of clone 777 provided the double-stranded
template for sequencing reactions used to determine the 88-2B cDNA sequence. The sequence
of the entire insert of clone 777 was determined and is presented as the 88-2B cDNA
sequence and deduced amino acid sequence in SEQ ID NO:3. The sequence is 1915 bp in
length, including 361 bp of 5' untranslated DNA (corresponding to SEQ ID NO:3 at nucleotides
1-361), a coding region of 1065 bp (corresponding to SEQ ID NO:3 at nucleotides 362-1426),
and 489 bp of 3' untranslated DNA (corresponding to SEQ ID NO:3 at nucleotides 1427-1915).
The 88-2B genomic DNA, described in Example 1 above, corresponds to SEQ ID NO:3 at
nucleotides 746-1128. The 88C cDNA sequence, and deduced amino acid sequence, is presented
in SEQ ID NO:1. The 88C cDNA sequence is a composite of sequences obtained from RACE-PCR
cDNA, clone 134, and clone 101. The RACE-PCR cDNA was used as a sequencing template
to determine nucleotides 1-654 in SEQ ID NO:1, including the unique identification
of 9 bp of 5' untranslated cDNA sequence in SEQ ID NO:1 at nucleotides 1-9. The sequence
obtained from the RACE PCR cDNA confirmed the position of the first methionine codon
at nucleotides 55-57 in SEQ ID NO:1, and supported the conclusion that clone 134 and
clone 101 contained full-length copies of the 88C coding region. Clone 134 contained
45 bp of 5' untranslated cDNA (corresponding to SEQ ID NO:1 at nucleotides 10-54),
the 1056 bp 88C coding region (corresponding to SEQ ID NO:1 at nucleotides 55-1110),
and 492 bp of 3' untranslated cDNA (corresponding to SEQ ID NO:1 at nucleotides 1111-1602).
Clone 101 contained 25 bp of 5' untranslated cDNA (corresponding to SEQ ID NO:1 at
nucleotides 30-54), the 1056 bp 88C coding region (corresponding to SEQ ID NO:1 at
nucleotides 55-1110), and 2273 bp of 3' untranslated cDNA (corresponding to SEQ ID
NO:1 at nucleotides 1111-3383). The 88C genomic DNA described in Example 1 above,
corresponds to SEQ ID NO:1 at nucleotides 424-809.
[0050] The deduced amino acid sequences of 88-2B and 88C revealed hydrophobicity profiles
characteristic of GPCRs, including seven hydrophobic domains corresponding to GPCR
transmembrane domains. Sequence comparisons with other GPCRs also revealed a degree
of identity. Significantly, the deduced amino acid sequences of both 88-2B and 88C
had highest identity with the sequences of the chemokine receptors. Table 1 presents
the results of these amino acid sequence comparisons.
Table 1
| Chemokine Receptors |
88-2B |
88C |
| IL-8RA |
30% |
30% |
| IL-8RB |
31 % |
30% |
| CCCKR1 |
62 % |
54% |
| CCCKR2A |
46% |
66% |
| CCCKR2B |
50% |
72% |
| 88-2B |
100% |
50% |
| 88-C |
50% |
100 % |
Table 1 shows that 88-2B is most similar to CCCKR1 (62% identical at the amino acid
level) and 88C is most similar to CCCKR2 (72% identical at the amino acid level).
[0051] The deduced amino acid sequences of 88-2B and 88C also reveal the intracellular and
extracellular domains characteristic of GPCRs. The 88-2B extracellular domains correspond
to the amino acid sequence provided in SEQ ID NO:3, and SEQ ID NO:4, at amino acid
residues 1-36, 93-107, 171-196, and 263-284. The extracellular domains of 88-2B are
encoded by polynucleotide sequences corresponding to SEQ ID NO:3 at nucleotides 362-469,
638-682, 872-949, and 1148-1213. Extracellular domains of 88C include amino acid residues
1-32, 89-112, 166-191, and 259-280 in SEQ ID NO:1 and SEQ ID NO:2. The 88C extracellular
domains are encoded by polynucleotide sequences that correspond to SEQ ID NO:1 at
nucleotides 55-150, 319-390, 550-627, and 829-894. The intracellular domains of 88-2B
include amino acids 60-71, 131-151, 219-240, and 306-355 of SEQ ID NO:3 and SEQ ID
NO:4. Those domains are encoded by polynucleotide sequences corresponding to SEQ ID
NO:3 at nucleotides 539-574, 752-814, 1016-1081, and 1277-1426, respectively. The
88C intracellular domains include amino acid residues 56-67, 125-145, 213-235, and
301-352 of SEQ ID NO:1 and SEQ ID NO:2. The intracellular domains of 88C are encoded
by polynucleotide sequences corresponding to SEQ ID NO:1 at nucleotides 220-255, 427-489,
691-759, and 955-1110.
[0052] In addition, a macaque 88C DNA was amplified by PCR from macaque genomic DNA using
primers corresponding to 5' and 3' flanking regions of the human 88C cDNA. The 5'
primer corresponded to the region immediately upstream of and including the initiating
Met codon. The 3' primer was complementary to the region immediately downstream of
the termination codon. The primers included restriction sites for cloning into expression
vectors. The sequence of the 5' primer was GAC
AAGCTTCACAGGGTGGAACAAGATG (With the HindIII site underlined) (SEQ ID NO: 17) and the sequence
of the 3' primer was GTC
TCTAGACCACTTGAGTCCGTGTCA (with the XbaI site underlined) (SEQ ID NO: 18). The conditions
of the PCR amplification were 94°C for eight minutes, then 40 cycles of 94°C for one
minute, 55°C for forty-five seconds, and 72°C one minute. The amplified products were
cloned into the HindIII and XbaI sites of pcDNA3 and a clone was obtained and sequenced.
The full length macaque cDNA and deduced amino acid sequences are presented in SEQ
ID NOs: 19 and 20, respectively. The nucleotide sequence of macaque 88C is 98 % identical
to the human 88C sequence. The deduced amino acid sequences are 97% identical.
Example 3
[0053] The mRNA expression patterns of 88-2B and 88C were determined by Northern blot analyses.
[0054] Northern blots containing immobilized poly A
+ RNA from a variety of human tissues were purchased from Clontech Laboratories, Inc.,
Palo Alto, CA. In particular, the following tissues were examined: heart, brain, placenta,
lung, liver, skeletal muscle, kidney, pancreas, spleen, thymus, prostate, testis,
ovary, small intestine, colon and peripheral blood leukocytes.
[0055] A probe specific for 88-2B nucleotide sequences was generated from cDNA clone 478.
The cDNA insert in clone 478 contains sequence corresponding to SEQ ID NO: 3 at nucleotides
641-1915. To generate a probe, clone 478 was digested and the insert DNA fragment
was isolated following gel electrophoresis. The isolated insert fragment was then
radiolabeled with
32P-labeled nucleotides, using techniques known in the art.
[0056] A probe specific for 88C nucleotide sequences was generated by isolating and radiolabeling
the insert DNA fragment found in clone 493. The insert fragment from clone 493 contains
sequence corresponding to SEQ ID NO: 1 at nucleotides 421-1359. Again, conventional
techniques involving
32P-labeled nucleotides were used to generate the probe.
[0057] Northern blots probed with 88-2B revealed an approximately 1.8 kb mRNA in peripheral
blood leukocytes. The 88C Northerns showed an approximately 4 kb mRNA in several human
tissues, including a strong signal when probing spleen or thymus tissue and less intense
signals when analyzing mRNA from peripheral blood leukocytes and small intestine.
A relatively weak signal for 88C was detected in lung tissue and in ovarian tissue.
[0058] The expression of 88C in human T-cells and in hematopoietic cell lines was also determined
by Northern blot analysis. Levels of 88C in CD4
+ and CD8
+ T-cells were very high. The transcript was present at relatively high levels in myeloid
cell lines THP1 and HL-60 and also found in the B cell line Jijoye. In addition, the
cDNA was a relatively abundant transcript in a human macrophage cDNA library based
on PCR amplification of library subfractions.
Example 4
[0059] The 88-2B and 88C cDNAs were expressed by recombinant methods in mammalian cells.
[0060] For transient transfection experiments, 88C was subcloned into the mammalian cell
expression vector pBJ1 (
Ishi, K. et. al., J. Biol. Chem 270:16435-16440 (1995). The construct included sequences encoding a prolactin signal sequence for efficient
cell surface expression and a FLAG epitope at the amino terminus of 88C to facilitate
detection of the expressed protein. The FLAG epitope consists of the sequence "DYKDDDD."
COS-7 cells were transiently transfected with the 88C expression plasmid using Lipofectamine
(Life Technology, Inc., Grand Island, NY) following the manufacturer's instructions.
Briefly, cells were seeded in 24-well plates at a density of 4 X 10
4 cells per well and grown overnight. The cells were then washed with PBS, and 0.3
mg of DNA mixed with 1.5 µl of lipofectamine in 0.25 ml of Opti-MEM was added to each
well. After 5 hours at 37°C, the medium was replaced with medium containing 10% FCS.
quantitative ELISA confirmed that 88C was expressed at the cell surface in transiently
transfected COS-7 cells using the M1 antibody specific for the FLAG epitope (Eastman
Co., New Haven, CT).
[0061] The FLAG-tagged 88C receptor was also stably transfected into HEK-293 cells, a human
embryonic kidney cell line, using transfection reagent DOTAP (N-[1-[(2,3-Dioleoyloxy)propyl]-N,N,N-trimethylammoniummethylsulfate,
Boehringer-Mannheim, Inc., Indianapolis. IN) according to the manufacturer's recommendations.
Stable lines were selected in the presence of the drug G418. The transfected HEK-293
cells were evaluated for expression of 88C at the cell surface by ELISA, using the
M1 antibody to the FLAG epitope. ELISA showed that 88C tagged with the FLAG epitope
was expressed at the cell surface of stably transformed HEK-293 Cells.
[0062] The 88-2B and 88C cDNAs were used to make stable HEK-293 transfectants. The 88-2B
receptor cDNA was cloned behind the cytomegalovirus promoter in pRc/CMV (Invitrogen
Corp. , San Diego, CA) using a PCR-based strategy. The template for the PCR reaction
was the cDNA insert in clone 777. The PCR primers were 88-2B-3 (containing an internal
XbaI site) and 88-2B-5 (containing an internal
HindIII site). The nucleotide sequence of primer 88-2B-3 is presented in SEQ ID NO:9;
the nucleotide sequence of primer 88-2B-5 is presented in SEQ ID NO:10. An 1104 bp
region of cDNA was amplified. Following amplification, the DNA was digested with
XbaI and
HindIII and cloned into similarly digested pRc/CMV. The resulting plasmid was named 777XP2,
which contains 18 bp of 5' untranslated sequence, the entire coding region of 88-2B,
and 3 bp of 3' untranslated sequence. For the 88C sequence, the full-length cDNA insert
in clone 134 was not further modified before transfecting HEK-293 cells.
[0063] To create stably transformed cell lines, the pRc/CMV recombinant clones were transfected
using transfection reagent DOTAP (N-[1-[(2,3-Dioleoyloxy)propyl]-N,N,N-trimethylammoniummethylsulfate,
Boehringer-Mannheim, Inc., Indianapolis, IN) according to the manufacturer's recommendations,
into HEK-293 cells, a human embryonic kidney cell line. Stable lines were selected
in the presence of the drug G418. Standard screening procedures (
i.
e., Northern blot analyses) were performed to identify stable cell lines expressing
the highest levels of 88-2B and 88C mRNA.
Example 5
A. Ca++ Flux Assays
[0064] To analyze polypeptide expression, a functional assay for chemokine receptor activity
was employed. A common feature of signalling through the known chemokine receptors
is that signal transduction is associated with the release of intracellular calcium
cations. Therefore, intracellular Ca
++ concentration in the transfected HEK-293 cells was assayed to determine whether the
88-2B or 88C receptors responded to any of the known chemokines.
[0065] HEK-293 cells, stably transfected with 88-2B, 88C (without the FLAG epitope sequence),
or a control coding region (encoding IL8R or CCCKR2, see below) as described above,
were grown in T75 flasks to approximately 90% confluence in MEM + 10% serum. Cells
were then washed, harvested with versene (0.6 mM EDTA, 10 mM Na
2HPO
4, 0.14 M NaCl, 3 mM KCl, and 1 mM glucose), and incubated in MEM + 10% serum + 1 µM
Fura-2 AM (Molecular Probes, Inc., Eugene, OR) for 30 minutes at room temperature.
Fura-2 AM is a Ca
++-sensitive dye. The cells were resuspended in Dulbecco's phosphate-buffered saline
containing 0.9 mM CaCl
2 and 0.5 mM MgCl
2 (D-PBS) to a concentration of approximately 10
7 cells/ml and changes in fluorescence were monitored using a fluorescence spectrophotometer
(Hitachi Model F-4010). Approximately 10
6 cells were suspended in 1.8 ml D-PBS in a cuvette maintained at 37°C. Excitation
wavelengths alternated between 340 and 380 nm at 4 second intervals; the emission
wavelength was 510 nm. Test compositions were added to the cuvette via an injection
port; maximal Ca
++ flux was measured upon the addition of ionomycin.
[0066] Positive responses were observed in cells expressing IL-8RA when stimulated with
IL-8 and also when CCCKR2 was stimulated with MCP-1 or MCP-3. However, HEK-293 cells
expressing either 88-2B or 88C failed to show a flux in intracellular Ca
++ concentration when exposed to any of the following chemokines: MCP-1, MCP-2, MCP-3,
MIP-1α, MIP-1β, IL8, NAP-2, gro/MGSA, IP-10, ENA-78, or PF-4. (Peprotech, Inc., Rocky
Hill, NJ).
[0067] Using a more sensitive assay, a Ca
++ flux response to RANTES was observed microscopically in Fura-2 AM-loaded cells expressing
88-2B. The assay involved cells and reagents prepared as described above. RANTES (
Regulated on
Activation,
Normal
T Expressed and
Secreted) is a CC chemokine that has been identified as a chemoattractant and activator
of eosinophils.
See Neote et al., supra. This chemokine also mediates the release of histamine by basophils and has been shown
to function as a chemoattractant for memory T cells
in vitro. Modulation of 88-2B receptor activities is therefore contemplated to be useful in
modulating leukocyte activation.
[0068] FLAG tagged 88C receptor was expressed in HEK-293 cells and tested for chemokine
interactions in the CA
++ flux assay. Cell surface expression of 88C was confirmed by ELISA and by FACScan
analysis using the M1 antibody. The chemokines RANTES, MIP-1α, and MIP-1β all induced
a Ca
++ flux in 88C-transfected cells when added at a concentration of 100 nM.
[0069] Ca
++ flux assays can also be designed to identify modulators of chemokine receptor binding.
The preceding fluorimetric or microscopic assays are carried out in the presence of
test compounds. If Ca
++ flux is increased in the presence of a test compound, that compound is an activator
of chemokine receptor binding. In contrast, a diminished Ca
++ flux identifies the test compound as an inhibitor of chemokine receptor binding.
B. Phosphoinositol Hydrolysis
[0070] Another assay for ligands or modulators involves monitoring phospholipase C activity,
as described in
Hung et al., J. Biol. Chem. 116:827-832 (1992). Initially, host cells expressing a chemokine receptor are loaded with
3H-inositol for 24 hours. Test compounds (
i.
e., potential ligands) are then added to the cells and incubated at 37°C for 15 minutes.
The cells are then exposed to 20 mM formic acid to solubilize and extract hydrolyzed
metabolites of phosphoinositol metabolism (
i.e., the products of phospholipase C-mediated hydrolysis). The extract is subjected
to anion exchange chromatography using an AG1X8 anion exchange column (formate form).
Inositol phosphates are eluted with 2 M ammonium formate/0.1 M formic acid and the
3H associated with the compounds is determined using liquid scintillation spectrophotometry.
The phospholipase C assay can also be exploited to identify modulators of chemokine
receptor activity. The aforementioned assay is performed as described, but with the
addition of a potential modulator. Elevated levels of detectable label would indicate
the modulator is an activator; depressed levels of the label would indicate the modulator
is an inhibitor of chemokine receptor activity.
[0071] The phospholipase C assay was performed to identify chemokine ligands of the FLAG-tagged
88C receptor. Approximately 24 hours after transfection, COS-7 cells expressing 88C
were labeled for 20-24 hours with
myo-[2-
3H]inositol (1 µCi/ml) in inositol-free medium containing 10% dialyzed FCS. Labeled
cells were washed with inositol-free DMEM containing 10 mM LiCl and incubated at 37°C
for 1 hour with inositol-free DMEM containing 10 mM LiCl and one of the following
chemokines: RANTES, MIP-1β, MIP-1α, MCP-1, IL-8, or the murine MCP-1 homolog JE. Inositol
phosphate (IP) formation was assayed as described in the previous paragraph. After
incubation with chemokines, the medium was aspirated and cells were lysed by addition
of 0.75 ml of ice-cold 20 mM formic acid (30 min). Supernatant fractions were loaded
onto AG1-X8 Dowex columns (Biorad. Hercules, CA), followed by immediate addition of
3 ml of 50 mM NH
4OH. The columns were then washed with 4 ml of 40 mM ammonium formate, followed by
elution with 2 M ammonium formate. Total inositol phosphates were quantitated by counting
beta-emissions.
[0072] Because it has been shown that some chemokine receptors, such as IL8RA AND IL8RB,
require contransfection with an exogenous G protein before signalling can be detected
in COS-7 cells, the 88C receptor was co-expressed with the chimeric G protein Gqi5
(
Conklin, et al., Nature 363:274-276, (1993). Gqi5 ia a G protein which has the carboxyl terminal five amino acids of Gi (which
bind to the receptor) spliced onto Gαq. Co-transfection with Gqi5 significantly potentiates
signaling by CCCKR1 and CCKR2B. Co-transfection with Gqi5 revealed that 88C signaled
well in response to RANTES, MIP-1β, and MIP-1α, but not in response to MCP-1, IL-8
or the murine MCP-1 homologue JE. Dose-response curves revealed EC
50 values of 1nM for RANTES, 6nM for MIP-1β, and 22nM for MIP-1α.
[0073] 88C is the first cloned human receptor with a signaling response to MIP-1β. Compared
with other CC chemokines, MIP-1β clearly has a unique cellular activation pattern.
It appears to activate T cells but not monocytes (Baggiolini et al., Supra) which
is consistent with receptor stimulation studies. For example, while MIP-1β binds to
CCCKR1, it does not induce calcium flux (Neote et al., Supra). In contrast, MIP-1α
and RANTES bind to and causes signalling in CCCKR1 and CCCKR5 (RANTES also causes
activation of CCCKR3). MIP-1β thus appears to be much more selective than other chemokines
of the CC chemokine family. Such selectivity is of therapeutic significance because
a specific beneficial activity can be stimulated (such as suppression of HIV infection)
without stimulating multiple leukocyte populations which results in general pro-inflammatory
activities.
C. BINDING ASSAYS
[0074] Another assay for receptor interaction with chemokines was a modification of the
binding assay described by
Ernst et al. J. Immunol. 152:3541-3549 (1994). MIP-1β as labeled using the Bolton and Hunter reagent (di-iodide, NEN, Wilmington,
DE), according to the manufacturer's instructions. Unconjugated iodide was separated
from labeled protein by elution using a PD-10 column (Pharmacia) equilibrated with
PBS and BSA (1 % w/v). The specific activity was typically 2200 Ci/mmole. Equilibrium
binding was performed by adding
125I-labeled ligand with or without a 100-fold excess of unlabeled ligand, to 5 X 10
5 HEK-293 cells transfected with 88C tagged with the FLAG epitope in polypropylene
tubes in a total volume of 300 µl (50 mM HEPES pH 7.4, 1 mM CaCl
2, MgCl
2, 0.5% BSA) and incubating for 90 minutes at 27°C with shaking at 150 rpm. The cells
were collected, using a Skatron cell harvester (Skatron Instruments Inc.. Sterling,
VA), on glass fiber filters presoaked in 0.3% polyethyleneimine and 0.2 % BSA. After
washing, the filters were removed and bound ligand was quantitated by counting gamma
emissions. Ligand binding by competition with unlabeled ligand was determined by incubation
of 5 X 10
5 transfected cells (as above) with 1.5 nM of radiolabeled ligand and the indicated
concentrations of unlabeled ligand. The samples were collected, washed and counted
as above. The data was analyzed using the curve-fitting program Prism (GraphPad Inc.,
San Diego, CA) and the iterative non-linear regression program, LIGAND (PM220).
[0075] In equilibrium binding assays, 88C receptor bound radiolabeled MIP-1β in a specific
and saturable manner. Analysis of this binding data by the method of Scatchard revealed
a dissociation constant (Kd) of 1.6 nM. Competition binding assays using labeled MIP-1β
revealed high-affinity binding of MIP-1β (IC
50 = 7.4 nM), RANTES (IC
50 = 6.9 nM), and MIP-1α (IC
50 = 7.4 nM), consistent with the signaling data obtained in transiently transfected
COS-7 cells as discussed in section B above.
Example 6
[0076] The chemokines MIP-1α, MIP-1β and RANTES have been shown to inhibit replication of
HIV-1 and HIV-2 in human peripheral blood mononuclear cells and PM1 cells (
Cocchi, et. al., supra). In view of this finding and in view of the results described in Example 5, the
present invention contemplates that activation of or ligand binding to the 88C receptor
may provide a protective role in HIV infection.
[0077] Recently, it has been reported that the orphan G protein-coupled receptor, fusin,
can act as a co-receptor for HIV entry. Fusin/CXCR4 in combination with CD4, the primary
HIV receptor, apparently facilitates HIV infection of cultured T cells (
Feng, et al., Science 272:872-877 (1996). Based upon the homology of fusin to chemokine receptors and the chemokine binding
profile of 88C, and because 88C is constitutively expressed in T cells and abundantly
expressed in macrophages, 88C is likely to be involved in viral and HIV infection.
[0078] The function of 88C and 88-2B as co-receptors for HIV was determined by transfecting
cells which express CD4 with 88C or 88-2B and challenging the co-transfected cells
with HIV. Only cells expressing both CD4 and a functional co-receptor for HIV become
infected. HIV infection can be determined by several methods. ELISAs which test for
expression of HIV antigens are commercially available, for example Coulter HIV-1
P24 antigen assay (
US Patent Nos. 4,886,742), Coulter Corp., 11800 SW 147th Ave., Miami, FL 33196. Alternatively, the test cells
can be engineered to express a reporter gene such as
LACZ attached to the HIV LTR promoter [
Kimpton et al., J. Virol. 66:2232-2239 (1992)]. In this method, cells that are infected with HIV are detected by a colorimetric
assay.
[0079] 88C was transiently transfected into a cat cell line, CCC [Clapham,
et al., 181:703-715 (1991)], which had been stably tranformed to express human CD4 (CCC-CD4).
These cells are normally resistant to infection by any strain of HIV-1 because they
do not endogenously express 88C. In these experiments, CCC/CD4 cells were transiently
transfected with 88C cloned into the expression vector pcDNA3.1 (Invitrogen Corp.,
San Diego, CA) using lipofectamine (Gibco BRL, Gaithersburg, MD). Two days after transfection,
cells were challenged with HIV. After 4 days of incubation, cells were fixed and stained
for p24 antigen as a measure of HIV infection. 88C expression by these cells rendered
them susceptible to infection by several strains of HIV-1. These strains included
four primary non-syncytium-inducing HIV-1 isolates (M23, E80, SL-2 and SF-162) which
were shown to use only 88C as a co-receptor but not fusin. Several primary syncytium-inducing
strains of HIV-1 (2006, M13, 2028 and 2076) used either 88C or fusin as a co-receptor.
Also, two established clonal HIV-1 viruses (GUN-1 and 89.6) used either 88C or fusin
as a co-receptor.
[0080] It has been reported that some strains of HIV-2 can infect certain CD4-negative cell
lines, thus implying a direct interaction of HIV-2 with a receptor other than CD4
[
Clapham, et al., J. Virol. 66:3531-3537 (1992)] For some strains of HIV-2, this infection is facilitated by the presence of soluble
CD4 (sCD4). Since 88-2B shares high sequence similarity with other chemokine receptors
that act as HIV co-receptors (namely 88C and fusin), 88-2B was considered to be a
likely HIV-2 co-receptor. The role of 88-2B as an HIV-2 co-receptor was demonstrated
using HIV-2 strain ROD/B. Cat CCC cells which do not endogeneously express CD4 were
transfected with 88-2B. In these experiments, cells were transfected with pcDNA3.1
containing 88-2B using lipofectamine and infected with HIV-2 48 hours later. Three
days after infection, cells were immunostained for the presence of HIV-2 envelope
glycoproteins. The presence of sCD4 during HIV-2
ROD/B challenge increased the infection of these cells by by 10-fold. The entry of HIV-2
into the 88-2B transfected cells could be blocked by the presence of 400-800 ng/ml
eotaxin, one of the ligands for 88-2B. The baseline infectivity levels of CCC/88-2B
(with no soluble CD4) were equivalent to CCC cells which were not transfected with
88-2B.
[0081] The role of 88-2B and 88C as co-receptors for HIV was confirmed by preparing and
challenging cell lines stably transformed to express 88C or 88-2B with various strains
of HIV and SIV. These results are described in Example 7.
[0082] Alternatively, the co-receptor role of 88C and 88-2B can be demonstrated by an experimental
method which does not require the use of live virus. In this method, cell lines co-expressing
88C or 88-2B, CD4 and a
LACZ reporter gene are mixed with a cell line co-expressing the HIV envelope glycoprotein
(ENV) and a transcription factor for the reporter gene construct (Nussbaum, et al.,
1994 J. Virol. 68:5411). Cells expressing a functional co-receptor for HIV will fuse
with the ENV expressing cells and thereby allow expression of the reporter gene. In
this method, detection of reporter gene product by colorimetric assay indicates that
88C or 88-2B function as a co-receptor for HIV.
[0083] The mechanism by which chemokines inhibit viral infection has not yet been elucidated.
One possible mechanism involves activation of the receptor by binding of a chemokine.
The binding of the chemokine leads to signal transduction events in the cell that
renders the cell resistant to viral infection and/or prevents replication of the virus
in the cell. Similar to interferon induction, the cell may differentiate such that
it is resistant to viral infection, or an antiviral state is established. Alternatively,
a second mechanism involves direct interference with viral entry into cells by blocking
access of viral envelope glycoproteins to the co-receptor by chemokine binding. In
this mechanism, G-protein signalling is not required for chemokine suppression of
HIV infection.
[0084] To distinguish between two mechanisms by which 88C or 88-2B may function as co-receptors
for viral or HIV infection, chemokine binding to the receptor is uncoupled from signal
transduction and the effect of the chemokine on suppression of viral infection is
determined.
[0085] Ligand binding can be uncoupled from signal transduction by the addition of compounds
which inhibit G-protein mediated signaling. These compounds include, for example,
pertussis toxin and cholera toxin. In addition, downstream effector polypeptides can
be inhibited by other compounds such as wortmannin. If G-protein signalling is involved
in suppression of viral infection, the addition of such compounds would prevent suppression
of viral infection by the chemokine. Alternatively, key residues or receptor domains
of 88C or 88-2B receptor required for G-protein coupling can be altered or deleted
such that G-protein coupling is altered or destroyed but chemokine binding is not
affected.
[0086] Under these conditions, if chemokines are unable to suppress viral or HIV infection,
then signaling through a G-protein is required for suppression of viral or HIV infection.
If however, chemokines are able to suppress viral infection, then G-protein signaling
is not required for chemokine suppression of viral infection and the protective effects
of chemokines may be due to the chemokine blocking the availability of the receptor
for the virus.
[0087] Another approach involves the use of antibodies directed against 88C or 88-2B. Antibodies
which bind to 88C or 88-2B which can be shown not to elicit G-protein signaling may
block access to the chemokine or viral binding site of the receptor. If in the presence
of antibodies to 88C or 88-2B, viral infection is suppressed, then the mechanism of
the protective effects of chemokines is blocking viral access to its receptor. Feng,
et al. Reported that antibodies to the amino terminus of the fusin receptor suppressed
HIV infection (Feng,
et al., 1996).
Example 7
[0091] In order to construct indicator cell lines that could detect either Macrophage or
T cell tropic viruses, epitope-tagged 88C or 88-2B encoding DNA was transfected into
HeLa-MAGI or U373-MAGI cells by infection with a retroviral vector to generate HeLA-MAGI-88C
or U373-MAGI-88C cell lines, respectively. Expression of the co-receptors on the cell
surface was demonstrated by immunostaining live cells using the anti-FLAG M1 antibody
and by RT-PCR.
[0092] The 88C and 88-2B genes utilized to construct HeLa-MAGI-88C and U373-MAGI-88C included
sequences encoding the prolactin signal peptide followed by a FLAG epitope as described
in Example 4. This gene was inserted into the retroviral vector pBabe-Puro [
Morgenstern and Land Nucelic Acids Research, 18(12):3587-3596 (1990)]. High titer retroviral vector stocks pseudotyped with the VSV-G protein were made
by transient transfection as described in
Bartx et al., J. Virol. 70:2324-2331 (1996), and used to infect HeLa-MAGI and U373-MAGI cells. Cells resistant to 0.6 µg/ml
puromycin (HeLa) or 1 µg/ml puromycin (U373) were pooled. Each pool contained at least
1000 independent transduction events. An early passage (passage 2) stock of the original
HeLa-MAGI cells [Kimpton and Emerman,
supra] was used to create HeLa-MAGI-88C cells.
[0093] Infections of the indicator cell lines with HIV were performed in 12-well plates
with 10-fold serial dilutions of 300 µl of virus in the presence of 30 µg/ml DEAE-Dextran
as described [Kimpton and Emerman,
supra].
[0095] U373-MAGI-88C cells and U373-MAGI cells (controls) and were infected with limiting
dilutions of a T-tropic strain of HIV-1 (HIV
LAI), an M-tropic strain (HIV
YU-2), and an SIV isolate. SIV
MAC239. Infectivity was measured by counting the number of blue cells per well per volume
of virus (Table 2).
Table 2
| virus straina |
titer on cell line (IU/ml)b |
| |
U373-MAGI |
U373-MAGI-88C |
| HIV-1LAI |
<100 |
< 100 |
| HIV-1YU-2 |
<100 |
2.2 x 106 |
| SIVMAC239 |
1.2 x 103 |
4 x 105 |
| a Viruses derived by transfection of molecular clones into 293 cells. |
| b Infectious units (IU) per ml is the number of blue cells per well multiplied by the
dilution of virus supernatant and normalized to 1 ml final volume. |
[0096] Two days after infection, cells were fixed and stained for β-galactosidase activity
with X-gal. The U373-derived MAGI cells were stained for 120 minutes at 37°C and the
HeLa-derived MAGI cells were stained for 50 minutes at 37°C. Background staining of
non-infected cells never exceeded more than approximately three blue cells per well.
Only dark blue cells were counted, and syncytium with multiple nuclei were counted
as a single infected cell. The infectious titer is the number of blue cells per well
multiplied by the dilution of virus and normalized to 1 ml. The titer of HIV
YU-2 on U373-MAGI-88C cells was 2 x 10
6. In contrast, the titer of HIV-1
LAI was less than 100 on U373-MAGI-88C. Thus, the specificity of a particular HIV strain
for 88C varied by four orders of magnitude.
[0097] Although SIV
MAC239 infection was increased to 4 x 10
5 in U373-MAGI-88C it also clearly infected U373-MAGI cells (Table 2).
[0098] Next, a series of primary uncloned HIV strains and cloned M-tropic strains of HIV-1
were analyzed for their ability to infect indicator cell lines that express 88C.
[0099] As described above, HeLa-MAGI and HeLa-MAGI-88C cells were infected with limiting
dilutions of various HIV strains. The two cloned M-tropic viruses, HIV
JR-CSF and HIV
YU-2, both infected HeLa-MAGI-88C, but not HeLa-MAGI cells, showing that both strains
use 88C as a co-receptor (Table 3. See note c). However, a great disparity in the
ability of each of these two viral strains to infect HeLa-MAGI-88C cells was observed,
6.2 x 10
5 IU/ml for HIV
YU-2 and 1.2 x 10
4 for HIV
IR-CSF. The infectivity of virus stock (Table 3) is the number of infectious units per physical
particle (represented here by the amount of viral core protein). In addition, it was
observed that the infectivity of these two cloned viral strains differed by over 50-fold
in viral stocks that were independently prepared.
[0100] The variability of infectivity of primary viral isolates was further examined by
analyzing a collection of twelve different uncloned virus stocks from three different
clades (Table 3). Three clade A primary isolates, three clade E isolates, and three
additional clade B isolates from geographically diverse origins were used. With all
nine strains, the primary strains of HIV could be detected on HeLa-MAGI-88C cells,
but not on HeLa-MAGI cells (Table 3). However, the efficacy of infection varied from
five infectious units per ng p24
gag to over 100 infectious units per ng p24
gag (table 3). These results indicate that absolute infectivity of M-tropic strains varies
considerably and is independent of clade. A hypothesis that may explain this discrepancy
may involve the affinity of the V3 loop of each viral strain for 88C after CD4 binding
[
Trkola et al., Nature, 384(6605):184-187 (1996);
Wu et al., Nature, 384(6605):179-183 (1996)].
Table 3
| virus straina |
viral sub-type (country of origin)b |
titer (IU/ml) on HeLa-MAGI-88Cc |
P24gag ng/ml |
Infectivityd |
| HIV-1YU-2 |
B (USA) |
6.2 x 105 |
2200 |
281 |
| HIV-1IR-CSF |
B (USA) |
12000 |
2800 |
4.2 |
| HIV-1TH020 |
E (Thailand) |
4133 |
93 |
44 |
| HIV-1TH021 |
E (Thailand) |
4967 |
52 |
96 |
| HIV-1TH022 |
E (Thailand) |
200 |
15 |
13 |
| HIV-1US660 |
B (USA) |
2367 |
127 |
19 |
| HIV-1UG031 |
A (Uganda) |
1633 |
71 |
23 |
| HIV-1RW009 |
A (Rwanda) |
3333 |
158 |
21 |
| HIV-1RW026 |
A (Rwanda) |
739 |
143 |
5.2 |
| HIV-1US727 |
B (USA) |
14,067 |
289 |
49 |
| HIV-1US056 |
B (USA) |
5833 |
284 |
21 |
| HIV-1LAI |
B (France) |
2.8 x 105 |
167 |
1600 |
| a HIV-1YU-2 and HIV-1IR-CSF were derived by transfection of molecular clones. All others were tested as crude
supernatants of uncloned viral stocks derived from infection of heterologous peripheral
blood mononuclear cells. |
| b Clade designation according to Myers et al., 1995 for the env gene: country of origin refers to the country of residence of the HIV-positive individual
from whom blood was obtained for viral isolation (World Health Organization Viral
Isolate Program). |
| c Infectious units (IU) per ml is the number of blue cells per well multiplied by the
dilution of virus supernatant and normalized to 1 ml final volume. All viruses, except
HIV-1LAI, had less than 10 IU/ml when tested on HeLa-MAGI cells without 88C. HIVLAI, a T-tropic strain, has a titer of 2.8 x 105 on HeLa-MAGI cells with or without 88C. |
| d Infectivity is the infectious units per ng P24gag (column four divided by column five). |
[0101] The ability of the HeLa-MAGI-88C cells to detect HIV-2 and other SIV strains was
also determined. HIV-2
Rod has been reported to use fusin as a receptor even in the absence of CD4 [
Endres et al., Cell, 87(4):745-756 (1996)]. HIV-2
Rod is able to infect HeLa-MAGI cells, however its infectivity is enhanced at least 10-fold
in HeLa-MagI-88C (Table 4). HeLa cells endogenously express fusin. Thus, the molecular
clone of HIV-2
Rod is dual tropic, and is able to use 88C as one of its co-receptors in addition to
CXCR4. Similarly, a primary strain of HIV-2
7312A infected HeLa-MAGI-88C cells and not the HeLa-MAGI cells, indicating that like primary
strain of HIV-1, it uses 88C as a receptor.
Table 4
| virus straina |
reference |
titer (IU/ml) on HeLa-MAGIb |
titer (IU/ml) on HeLa-MAGI-88C |
Infectivity on HeLa-MAGI-88Cc |
| HIV-2ROD9 |
(Guyader et al., 1987) |
967 |
5900 |
13 |
| HIV-27312A |
(Gao et al., 1994) |
<30 |
6500 |
17 |
| SIVMAC239 |
(Naidu et al., 1988) |
<30 |
20900 |
90 |
| SIVMNEc18 |
(Overbaugh et al., 1991) |
<30 |
15700 |
19 |
| SIVMNE170 |
(Rudensey et al., 1995) |
<30 |
10700 |
27 |
| SIVSMPbj1.9 |
(Dewhurst et al., 1990) |
<30 |
776 |
NDd |
| SIVAGM9063 |
(Hirsch et al., 1995) |
<30 |
50 |
< 1 |
| a HIV-2 stocks, SIVSMPbj1.9, and SIVAGM9063 were tested directly after by transfection of molecular clones in 293 cells.
All others were derived from transfection of molecular clones and subsequently amplified
in CEMx174 cells. |
| b Infectious units (IU) per ml is the number of blue cells per well multiplied by the
dilution of virus supernatant and normalized to 1 ml final volume. All viruses in
this panel were also negative on HeLa-MAGI-88-2B. |
| c Infectivity is the infectious units (on 88C expressing cells) per ng P27gag determined by ELISA. |
| d ND, not determined. |
[0102] None of the SIV strains tested infected the HeLa-MAGI cells (Table 4), and none infected
HeLa-MAGI cells that expresses 88-2B. This indicates that an alternative co-receptor
used by SIV in U373 cells is not expressed in HeLa cells, and is not 88-2B. All SIV
strains tested infected the HeLa-MAGI-88C cells to some extent (Table 3) indicating
that all of the tested SIV strains use at least 88C as one of their co-receptors.
[0103] The classification of M-tropic and T-tropic strains of HIV in the past has often
been correlated with another designation "non-syncytium inducing" (NSI), and "syncytium
inducing" (SI), respectively. Assays based on the cell lines described herein are
sensitive to syncytium formation. The infected cells can form large and small foci
of infection containing multiple nuclei [Kimpton and Emerman,
supra].
[0104] Experiments using multiple different viral strains and U373-MAGI-88C or HeLa-MAGI-88C
indicate that SI/NSI designation is not meaningful because all viral strains formed
syncytia if the correct co-receptor was present. These experiments show that syncytium
formation is more likely a marker for the presence of an appropriate co-receptor on
the infected cell, rather than an indication of tropism. Infection of the HeLa-MAGI-88C
cells with SIV strains reported in the literature to be non-syncytium forming strains,
in particular, SIV
MAC239, SIV
MNEc18, and SIV
MNE170, was remarkable because the size of the syncytia induced in the monolayer was
much larger than those induced by any other the HIV strains.
Example 8
[0105] Mouse monoclonal antibodies which specifically recognize 88C were prepared. The antibodies
were produced by immunizing mice with a peptide corresponding to the amino terminal
twenty amino acids of 88C. The peptide was conjugated to Keyhole Limpet Cyanin (KLH)
according to the manufacturer's directions (Pierce, Imject maleimide activated KLH),
emulsified in complete Freund's adjuvant and injected into five mice. Two additional
injections of conjugated peptide in incomplete Freund's adjuvant occurred at three
week intervals. Ten days after the final injection, serum from each of the five mice
was tested for immunoreactivity with the twenty amino acid peptide by ELISA. In addition,
the immunoreactivity of the sera were tested against intact 88C receptor expressed
on the surface of 293 cells by fluorescence activated cell sorting (FACS). The mouse
with the best anti-88C activity was chosen for spleen cell fusion and production of
monoclonal antibodies by standard laboratory methods. Five monoclonal cell lines (227K,
227M, 227N, 227P, 227R) were established which produced antibodies that recognized
the peptide by ELISA and the 88C protein on 293 cells by FACS. Each antibody was shown
to react only with 88C-expressing 293 cells, but not with 293 cells expressing the
closely related MCP receptor (CCCKR-2). Each antibody was also shown to recognize
88C expressed transiently in COS cells.
[0106] Rabbit polyclonal antibodies were also generated against 88C. Two rabbits were injected
with conjugated amino-terminal peptide as described above. The rabbits were further
immunized by four additional injections of the conjugated amino-terminal peptide.
Serum from each of the rabbits (2337J and 2470J) was tested by FACS of 293 cells expressing
88C. The sera specifically recognized 88C on the surface of 293 cells.
[0107] The five anti-88C monoclonal antibodies were tested for their ability to block infection
of cells by SIV, the simian immunodeficiency virus closely related to HIV [
Lehner, et al., Nature Medicine, 2:767 (1996)]. Simian CD4
+ T cells, which are normally susceptible to infection by SIV, were incubated with
the SIV
mac32HJ5 clone in the presence of the anti-88C monoclonal antibody supernatants diluted
1:5. SIV infection was measured by determining reverse transcriptase (RT) activity
on day nine using the RT detection and quantification method (Quan-T-RT assay kit,
Amersham, Arlington Heights, IL). Four of the antibodies were able to block SIV infection:
antibody 227K blocked by 53%, 227M by 59 %, 227N by 47% and 227P by 81 %. Antibody
227R did not block SIV infection.
[0108] The five monoclonal antibodies raised against human 88C amino-terminal peptide were
also tested for reactivity against macaque 88C (SEQ ID NO: X) (which has two amino
acid differences from human 88C within the amino-terminal peptide region). The coding
regions of human 88C and macaque 88C were cloned into the expression vector pcDNA3
(Invitrogen). These expression plasmids were used to transfect COS cells using DEAE.
The empty vector was used as a negative control. Three days after transfection, cells
were harvested and incubated with the five anti-88C monoclonal antibodies and prepared
for FACS. The results showed that four of the five antibodies (227K, 227M, 227N, 227P)
recognized macaque 88C while one (227R) did not. All five antibodies recognized the
transfected human 88C, and none cross-reacted with cells transfected with vector alone.
Example 9
[0109] Additional methods may be used to identify ligands and modulators of the chemokine
receptors of the invention.
[0110] In one embodiment, the invention comprehends a direct assay for ligands. Detectably
labeled test compounds are exposed to membrane preparations presenting chemokine receptors
in a functional conformation. For example, HEK-293 cells, or tissue culture cells,
are transfected with an expression vehicle encoding a chemokine receptor. A membrane
preparation is then made from the transfected cells expressing the chemokine receptor.
The membrane preparation is exposed to
125I-labeled test compounds (
e.
g., chemokines) and incubated under suitable conditions (
e.
g., 10 minutes at 37°C). The membranes, with any bound test compounds, are then collected
on a filter by vacuum filtration and washed to remove unbound test compounds. The
radioactivity associated with the bound test compound is then quantitated by subjecting
the filters to liquid scintillation spectrophotoinetry. The specificity of test compound
binding may be confirmed by repeating the assay in the presence of increasing quantities
of unlabeled test compound and noting the level of competition for binding to the
receptor. These binding assays can also identify modulators of chemokine receptor
binding. The previously described binding assay may be performed with the following
modifications. In addition to detectably labeled test compound, a potential modulator
is exposed to the membrane preparation. An increased level of membrane-associated
label indicates the potential modulator is an activator; a decreased level of membrane-associated
label indicates the potential modulator is an inhibitor of chemokine receptor binding.
[0111] In another embodiment, the invention comprehends indirect assays for identifying
receptor ligands that exploit the coupling of chemokine receptors to G proteins. As
reviewed in
Linder et al., Sci. Am., 267:56-65 (1992), during signal transduction, an activated receptor interacts with a G protein, in
turn activating the G protein. The G protein is activated by exchanging GDP for GTP.
Subsequent hydrolysis of the G protein-bound GTP deactivates the G protein. One assay
for G protein activity therefore monitors the release of
32P, from [γ-
32P]-GTP. For example, approximately 5 x 10
7 HEK-293 cells harboring plasmids of the invention are grown in MEM + 10% FCS. The
growth medium is supplemented with 5 mCi/ml [
32P]-sodium phosphate for 2 hours to uniformly label nucleotide pools. The cells are
subsequently washed in a low-phosphate isotonic buffer. One aliquot of washed cells
is then exposed to a test compound while a second aliquot of cells is treated similarly,
but without exposure to the test compound. Following an incubation period (
e.
g., 10 minutes), cells are pelleted, lysed and nucleotide compounds fractionated using
thin layer chromatography developed with 1 M LiCl. Labeled GTP and GDP are identified
by co-developing known standards. The labeled GTP and GDP are then quantitated by
autoradiographic techniques that are standard in the art. Relatively high levels of
32P-labeled GDP identify test compounds as ligands. This type of GTP hydrolysis assay
is also useful for the identification of modulators of chemokine receptor binding.
The aforementioned assay is performed in the presence of a potential modulator. An
intensified signal resulting from a relative increase in GTP hydrolysis, producing
32P-labeled GDP, indicates a relative increase in receptor activity. The intensified
signal therefore identifies the potential modulator as an activator. Conversely, a
diminished relative signal for
32P-labeled GDP, indicative of decreased receptor activity, identifies the potential
modulator as an inhibitor of chemokine receptor binding.
[0112] The activities of G protein effector molecules (
e.
g., adenylyl cyclase, phospholipase C, ion channels, and phosphodiesterases) are also
amenable to assay. Assays for the activities of these effector molecules have been
previously described. For example, adenylyl cyclase, which catalyzes the synthesis
of cyclic adenosine monophosphate (cAMP), is activated by G proteins. Therefore, ligand
binding to a chemokine receptor that activates a G protein, which in turn activates
adenylyl cyclase, can be detected by monitoring cAMP levels in a recombinant host
cell of the invention. Implementing appropriate controls understood in the art, an
elevated level of intracellular cAMP can be attributed to a ligand-induced increase
in receptor activity, thereby identifying a ligand. Again using controls understood
in the art, a relative reduction in the concentration of cAMP would indirectly identify
an inhibitor of receptor activity. The concentration of cAMP can be measured by a
commercial enzyme immunoassay. For example, the BioTrak Kit provides reagents for
a competitive immunoassay. (Amersham, Inc., Arlington Heights, IL). Using this kit
according to the manufacturer's recommendations, a reaction is designed that involves
competing unlabeled cAMP with cAMP conjugated to horseradish peroxidase. The unlabeled
cAMP may be obtained, for example, from activated cells expressing the chemokine receptors
of the invention. The two compounds compete for binding to an immobilized anti-cAMP
antibody. After the competition reaction, the immobilized horseradish peroxidase-cAMP
conjugate is quantitated by enzyme assay using a tetramethylbenzidine/H
2O
2 single-pot substrate with detection of colored reaction products occurring at 450
nm. The results provide a basis for calculating the level of unlabeled cAMP, using
techniques that are standard in the art. In addition to identifying ligands binding
to chemokine receptors, the cAMP assay can also be used to identify modulators of
chemokine receptor binding. Using recombinant host cells of the invention, the assay
is performed as previously described, with the addition of a potential modulator of
chemokine receptor activity. By using controls that are understood in the art, a relative
increase or decrease in intracellular cAMP levels reflects the activation or inhibition
of adenylyl cyclase activity. The level of adenylyl cyclase activity, in turn, reflects
the relative activity of the chemokine receptor of interest. A relatively elevated
level of chemokine receptor activity identifies an activator; a relatively reduced
level of receptor activity identifies an inhibitor of chemokine receptor activity.
[0113] While the present invention has been described in terms of specific embodiments,
it is understood that variations and modifications will occur to those skilled in
the art. Accordingly, only such limitations as appear in the appended claims should
be placed on the invention.
SEQUENCE LISTING
[0114]
(1) GENERAL INFORMATION:
(i) APPLICANT: ICOS Corporation.
22021 20th Avenue S.E.
Bothell, WA 98201
(ii) TITLE OF INVENTION: Chemokine Receptor Materials and Methods
(iii) NUMBER OF SEQUENCES: 20
(iv) CORRESPONDENCE ADDRESS:
- (A) ADDRESSEE: Marshall, O'Toole, Gerstein, Murray & Borun
- (B) STREET: 6300 Sears Tower, 233 S. Wacker Drive
- (C) CITY: Chicago
- (D) STATE: Illinois
- (E) COUNTRY: USA
- (F) ZIP: 60606
(v) COMPUTER READABLE FORM:
- (A) MEDIUM TYPE: Floppy disk
- (B) COMPUTER: IBM PC compatible
- (C) OPERATING SYSTEM: PC-DOS/MS-DOS
- (D) SOFTWARE: PatentIn Release #1.0, Version #1.30
(vi) CURRENT APPLICATION DATA:
- (A) APPLICATION NUMBER:
- (B) FILING DATE:
- (C) CLASSIFICATION:
(viii) ATTORNEY/AGENT INFORMATION:
- (A) NAME: Noland, Greta E.
- (B) REGISTRATION NUMBER: 35,302
- (C) REFERENCE/DOCKET NUMBER: 27866/33670
(ix) TELECOMMUNICATION INFORMATION:
- (A) TELEPHONE: 312-474-6300
- (B) TELEFAX: 312-474-0448
(2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
- (A) LENGTH: 3383 base pairs
- (B) TYPE: nucleic acid
- (C) STRANDEDNESS: single
- (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(ix) FEATURE:
- (A) NAME/KEY: CDS
- (B) LOCATION: 55..1110
(ix) FEATURE:
(A) NAME/KEY: misc_feature
(D) OTHER INFORMATION: /= "88C polynucleotide and amino acid sequences"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:




(2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 352 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(ix) FEATURE:
(A) NAME/KEY: misc_feature
(D) OTHER INFORMATION: /= "88C amino acid sequence"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:

(2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
- (A) LENGTH: 1915 base pairs
- (B) TYPE: nucleic acid
- (C) STRANDEDNESS: single
- (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(ix) FEATURE:
- (A) NAME/KEY: CDS
- (B) LOCATION: 362..1426
(ix) FEATURE:
(A) NAME/KEY: misc_feature
(D) OTHER INFORMATION: /= "88-2B polynucleotide and amino acid sequences"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:



(2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 355 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(ix) FEATURE:
(A) NAME/KEY: misc_feature
(D) OTHER INFORMATION: /= "88-2B amino acid sequence"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:


(2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS:
- (A) LENGTH: 34 base pairs
- (B) TYPE: nucleic acid
- (C) STRANDEDNESS: single
- (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(ix) FEATURE:
(A) NAME/KEY: misc_feature
(D) OTHER INFORMATION: /= "V28degf2"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:
GACGGATCCA TYGAYAGRTA CCTGGCYATY GTCC 34
(2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS:
- (A) LENGTH: 32 base pairs
- (B) TYPE: nucleic acid
- (C) STRANDEDNESS: single
- (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(ix) FEATURE:
(A) NAME/KEY: misc_feature
(D) OTHER INFORMATION: /= "V28degr2"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:
GCTAAGCTTT TRTAGGGDGT CCAYAAGAGY AA 32
(2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS:
- (A) LENGTH: 21 base pairs
- (B) TYPE: nucleic acid
- (C) STRANDEDNESS: single
- (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(ix) FEATURE:
(A) NAME/KEY: misc_feature
(D) OTHER INFORMATION: /= "88c-r4"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:
GATAAGCCTC ACAGCCCTGT G 21
(2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS:
- (A) LENGTH: 28 base pairs
- (B) TYPE: nucleic acid
- (C) STRANDEDNESS: single
- (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(ix) FEATURE:
(A) NAME/KEY: misc_feature
(D) OTHER INFORMATION: /= "88c-rlb"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:
GCTAAGCTTG ATGACTATCT TTAATGTC 28
(2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS:
- (A) LENGTH: 27 base pairs
- (B) TYPE: nucleic acid
- (C) STRANDEDNESS: single
- (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(ix) FEATURE:
(A) NAME/KEY: misc feature
(D) OTHER INFORMATION: /= "88-2B-3"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:
CCCTCTAGAC TAAAACACAA TAGAGAG 27
(2) INFORMATION FOR SEQ ID NO:10:
(i) SEQUENCE CHARACTERISTICS:
- (A) LENGTH: 30 base pairs
- (B) TYPE: nucleic acid
- (C) STRANDEDNESS: single
- (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(ix) FEATURE:
(A) NAME/KEY: misc feature
(D) OTHER INFORMATION: /= "88-2B-5"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:
GCTAAGCTTA TCACAGGGAG AAGTGAAATG 30
(2) INFORMATION FOR SEQ ID NO:11:
(i) SEQUENCE CHARACTERISTICS:
- (A) LENGTH: 20 base pairs
- (B) TYPE: nucleic acid
- (C) STRANDEDNESS: single
- (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(ix) FEATURE:
(A) NAME/KEY: misc_feature
(D) OTHER INFORMATION: /= "88-2B-f1"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:
AGTGCTAGCA GCTCTTCCTG 20
(2) INFORMATION FOR SEQ ID NO:12:
(i) SEQUENCE CHARACTERISTICS:
- (A) LENGTH: 20 base pairs
- (B) TYPE: nucleic acid
- (C) STRANDEDNESS: single
- (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(ix) FEATURE:
(A) NAME/KEY: misc_feature
(D) OTHER INFORMATION: /= "88-2B-r1"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:
CAGCAGCGTT TTGATGATTC 20
(2) INFORMATION FOR SEQ ID NO:13:
(i) SEQUENCE CHARACTERISTICS:
- (A) LENGTH: 19 base pairs
- (B) TYPE: nucleic acid
- (C) STRANDEDNESS: single
- (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(ix) FEATURE:
(A) NAME/KEY: misc_feature
(D) OTHER INFORMATION: /= "88C-f1"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:
TGTGTTTGCT TTAAAAGCC 19
(2) INFORMATION FOR SEQ ID NO:14:
(i) SEQUENCE CHARACTERISTICS:
- (A) LENGTH: 17 base pairs
- (B) TYPE: nucleic acid
- (C) STRANDEDNESS: single
- (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(ix) FEATURE:
(A) NAME/KEY: misc feature
(D) OTHER INFORMATION: /= "88C-r3"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:
TAAGCCTCAC AGCCCTG 17
(2) INFORMATION FOR SEQ ID NO:15:
(i) SEQUENCE CHARACTERISTICS:
- (A) LENGTH: 28 base pairs
- (B) TYPE: nucleic acid
- (C) STRANDEDNESS: single
- (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(ix) FEATURE:
(A) NAME/KEY: misc feature
(D) OTHER INFORMATION: /= "CCCKR1(2)-5■ Primer"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:
CGTAAGCTTA GAGAAGCCGG GATGGGAA 28
(2) INFORMATION FOR SEQ ID NO:16:
(i) SEQUENCE CHARACTERISTICS:
- (A) LENGTH: 25 base pairs
- (B) TYPE: nucleic acid
- (C) STRANDEDNESS: single
- (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(iv) ANTI-SENSE: YES
(ix) FEATURE:
(A) NAME/KEY: misc_feature
(D) OTHER INFORMATION: /= "CCCKR-3■ Primer"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:
GCCTCTAGAG TCAGAGACCA GCAGA 25
(2) INFORMATION FOR SEQ ID NO:17:
(i) SEQUENCE CHARACTERISTICS:
- (A) LENGTH: 28 base pairs
- (B) TYPE: nucleic acid
- (C) STRANDEDNESS: single
- (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:
GACAAGCTTC ACAGGGTGGA ACAAGATG 28
(2) INFORMATION FOR SEQ ID NO:18:
(i) SEQUENCE CHARACTERISTICS:
- (A) LENGTH: 27 base pairs
- (B) TYPE: nucleic acid
- (C) STRANDEDNESS: single
- (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:
GTCTCTAGAC CACTTGAGTC CGTGTCA 27
(2) INFORMATION FOR SEQ ID NO:19:
(i) SEQUENCE CHARACTERISTICS:
- (A) LENGTH: 1059 base pairs
- (B) TYPE: nucleic acid
- (C) STRANDEDNESS: single
- (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(ix) FEATURE:
- (A) NAME/KEY: CDS
- (B) LOCATION: 1..1056
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:


(2) INFORMATION FOR SEQ ID NO:20:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 352 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:

