TECHNICAL FIELD OF THE INVENTION
[0001] This invention relates to a recombinant protein of a yeast-derived enzyme, protein
disulfide isomerase (hereinafter referred to as "PDI"), and a process for production
thereof.
[0002] According to the present invention, a region within yeast PDI gene encoding the endoplasmic
reticulum localization signal at the C-terminal is modified, the modified gene is
incorporated into an expression vector, and is expressed. The recombinant yeast PDI
then can be secreted outside cells, with its enzymatic activity being fully retained,
and thus can be produced in a large amount. Further, the process for production according
to the invention provide a yeast PDI recombinant protein under culture conditions
of pH close to neutrality, by employing host cells which can be cultured at nearly
neutral pH.
BACKGROUND OF THE INVENTION
[0003] PDI is an enzyme (EC 5.3.4.1.), which catalyzes disulfide exchange in a protein.
This enzyme promotes exchange of disulfide bonds in a protein in the presence of an
appropriate oxidizing or reducing agent. The PDI protein is localized in the lumen
of an endoplasmic reticulum in an eukaryote, and has the activity of catalyzing the
binding of disulfide bonds of a secretory protein, which has been translated by a
membrane-attached ribosome and transported to the endoplasmic reticulum. It is expected
that PDI can be used to act on various proteins produced by gene recombination, and
to make these proteins take stereostructures with which they can show activity. Commercially,
this enzyme can be applied, for example, to improving the quality of protein-containing
foods, such as dough, ham, sausages, fish paste products, and soybean curd. As noted
from these facts, PDI is a useful enzyme.
[0004] Genetic engineering techniques in recent years have resulted in the disclosure of
genes encoding PDI. Japanese Patent Public Disclosure No. 197176/92 describes the
physicochemical properties of PDI derived from the yeast Saccharomyces cerevisiae,
and a gene sequence encoding the protein. The Saccharomyces cerevisiae-derived PDI
protein has a molecular weight of about 70,000 and an isoelectric point of about 4.0
to 4.1. Its optimal pH is about 8.5 to 8.75 (J. Biochem., 108, 846 (1990), Japanese
Patent Public Disclosure No. 197176/92).
[0005] Usually, yeast PDI is present in cells. In order to obtain this enzyme, it was necessary
to perform a complicated process comprising culturing the cells, grinding the cells,
extracting and purifying cell extract and obtaining a final product. This complicated
extraction process simply led to a build up of cost. Furthermore, the yeast PDI is
an enzyme having the unstable property of being easily deactivated by heat or heavy
metal ions. Because of this unstable property, in addition to said complexity of the
extraction step, a careful, tiresome manipulation is required for maintaining the
activity during the entire process.
[0006] It is one of the important challenges to produce the PDI protein, which is a useful
substance, stably and in a large amount with its enzyme activity being fully retained,
and supply it to the market in a fully active state. To attain this purpose, the extraction
step needs to be simplified. Means for allowing the enzyme, an intracellular substance,
to be secreted and produced extracellularly is effective for its simplification. Namely,
if the enzyme can be continuously produced in a culture medium outside cells, which
have once been cultured, the frequency of culturing the cells will be decreased, and
the cell grinding step will become unnecessary. Purification from the culture medium
with few impurities could simplify the purification step as well, reduce influence
on the activity, and result in efficient mass production.
[0007] Yeast PDI, at the stage of a precursor, retains an extracellular secretion signal,
and is produced in an endoplasmic reticulum, which is the starting point of a secretion
pathway. However, even if expression is attempted so that yeast PDI will be secreted
outside the cell, the wild type is not secreted extracellularly (M. Lamantia et al.,
Cell, 74, 899, 1993). It is speculated that this is because an endoplasmic reticulum
localization signal at the C-terminal (the amino acid sequence HDEL in the case of
Saccharomyces cerevisiae, for example) is retained. The number of PDI genes per cell
of yeast is only one, and the amount of PDI produced per cell is minuscule. Even if
the PDI is secreted in a culture medium, it cannot be obtained in sufficient concentration.
[0008] Further, the yeast PDI activity is unstable in an acidic region, while the optimum
pH for ordinary yeast is in a weakly acidic region. In this weak acidity (pH 6.0 or
lower), PDI is deactivated. At pH in a region in which PDI is not deactivated, yeast
cells, usually, cannot remain active. In addition, culture medium components ordinary
used for culture of yeast may contain substances which decrease or destroy PDI activity.
The use of a culture medium containing such components would deactivate PDI produced
extracellularly. For these various reasons, a method for mass production of yeast
PDI in an active state had not been developed before the present invention.
SUMMARY OF THE INVENTION
[0009] The present invention provides a process suitable for mass production of recombinant
yeast protein disulfide isomerase which is biologically active. Specifically, the
process for production of the present invention is characterized by producing the
yeast PDI protein by a genetic engineering technology using a yeast PDI gene, and
causing its extracellular secretion.
[0010] The invention also provides recombinant yeast protein disulfide isomerase produced
by the process for production of the present invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0011]
Fig. 1 is a view showing the progress of culture of Saccharomyces cerevisiae P1 and
Y3 in a region close to neutral pH;
Figs. 2 to 4, altogether, are a series of views showing the base sequence of the PDI
gene derived from Saccharomyces cerevisiae;
Fig. 5 is a view showing a restriction map of yeast expression vector, YEp1GII;
Figs. 6 to 10, altogether, are a series of views showing the full-length base sequence
of the yeast expression vector YEp1GII; and
Fig. 11(A) is a computerized image of an electrophoresis on SDS-PAGE gel of concentrated
cultures of various types of transformed yeast, while Fig. 11(B) is a schematic representation
of the image in Fig. 11(A).
DETAILED DESCRIPTION OF THE INVENTION
[0012] The inventors of the present invention conducted extensive studies in an attempt
to solve the foregoing problems. As a result, they prepared yeast PDI by genetic engineering,
thereby making possible the mass production of this enzyme in an extracellular setting,
with its enzyme activity being fully retained.
[0013] Specifically, the inventors modified yeast PDI gene, which was obtained from chromosomal
DNA derived from the yeast Saccharomyces cerevisiae (H. Tachikawa et al., J. Biochem.,
110, 306-313, 1991) (donated by Mr. Tachikawa), by gene recombination technology so
as not to code for the C-terminal four-amino acid sequence H (histidine), D (aspartic
acid), E (glutamic acid) and L (leucine), an endoplasmic reticulum localization signal.
They linked this modified gene to a highly active promoter, and introduced the product
into host cells, which can multiply in a culture medium at nearly neutral pH, by using
a multi-copy type vector, such as YEp, to transform the cells. The transformed microorganism
was cultured in a culture medium free of a yeast PDI activity inhibitor, such as a
uracil-free minimal medium, with pH being kept nearly neutral using a HEPES buffer.
As a result, a large amount of yeast PDI having enzyme activity was expressed in the
culture medium outside the cells to complete the present invention.
[0014] In summary, the present invention is a process for producing biologically active
recombinant yeast protein disulfide isomerase, comprising the steps of:
a) deleting, substituting, or adding one or more bases in a region encoding an endoplasmic
reticulum localization signal of a gene encoding protein disulfide isomerase of yeast
to modify the gene so as not to encode part or all of the endoplasmic reticulum localization
signal;
b) incorporating said modified gene into an expression vector;
c) transforming host cells with said expression vector; and
d) culturing said host cells transformed with said expression vector in a culture
medium kept at nearly neutral pH, thereby causing protein disulfide isomerase to be
secreted in an active state outside the host cells.
[0015] Preferably, the secreted enzyme is further concentrated or purified.
[0016] According to an aspect of the present invention, the endoplasmic reticulum localization
signal is a C-terminal four-amino acid sequence (HDEL).
[0017] According to another aspect of the present invention, the expression vector is the
yeast expression vector, YEp1GII, shown in Fig. 5.
[0018] According to still another aspect of the present invention, the host cells are cultured
with the pH being kept at 6.5 to 8.
[0019] The present invention also provides recombinant yeast protein, a disulfide isomerase
produced by the above process for production of the present invention.
[0020] The present invention also includes the expression vector and the transformed host
cells used in the process for production.
Yeast PDI gene
[0021] In the present invention, the yeast PDI gene may be, but is not restricted to, the
PDI gene derived from the yeast Saccharomyces cerevisiae described, for example, as
SEQ ID: No. 1 (Figs. 2 to 4). The PDI gene derived from the yeast Saccharomyces cerevisiae
is also disclosed in H. Tachikawa et al., J. Biochem., 110, 306-313, 1991, and Japanese
Patent Public Disclosure No. 197176/92. PDI is considered to be present in various
types of yeast in addition to Saccharomyces cerevisiae. The enzyme present in such
yeast other than Saccharomyces cerevisiae, which, in a native form, has an endoplasmic
reticulum localization signal, can be used in the process of the invention. For example,
PDI genes derived from yeast, such as Pichia or Kluyveromyces, may also be used. PDI
genes can be obtained based on the foregoing prior art references by any conventionally
used techniques such as hybridization or PCR.
[0022] In eukaryotic cells, secretion of protein is performed usually along the following
pathway: A secretory protein is translated from mRNA by the ribosome. After or during
translation, the protein is transferred into the endoplasmic reticulum, and further
transported to the Golgi apparatus, from which it is allocated to the vacuole, the
cell membrane, the cell wall, or the outside of the cell. Protein, which should remain
in the endoplasmic reticulum, also takes the same route as the secretory protein,
but once transported to the Golgi apparatus, it is sent back to the endoplasmic reticulum.
To remain in the endoplasmic reticulum, these proteins localized in the endoplasmic
reticulum contain in their structure a special structure in addition to a signal necessary
for entry into the secretion pathway, such as a particular amino acid sequence comprising
several residues (consensus sequence), or a consensus sequence called "motif" in which
amino acid residues with similar properties may be substituted conservatively. In
the present specification, such a special structure necessary for persistent presence
in the endoplasmic reticulum is designated as an "endoplasmic reticulum localization
signal."
[0023] According to the present invention, one or more bases are deleted, substituted, or
added in a region of a gene encoding an endoplasmic reticulum localization signal
of PDI protein to modify the gene so as not to encode part or all of the endoplasmic
reticulum localization signal.
[0024] As for Saccharomyces cerevisiae, for example, the endoplasmic reticulum localization
signal consists of four amino acid residues (HDEL) at the C-terminal. Other yeasts
may have an endoplasmic reticulum localization signal of a different sequence. In
any case, the recombinant yeast PDI modification product such that the gene is modified
so as not to encode part or all of the endoplasmic reticulum localization signal,
and the expressed recombinant PDI protein is not localized in the endoplasmic reticulum,
but is secreted outside the cells.
[0025] Modification of the region encoding the endoplasmic reticulum localization signal
can be achieved by any of many known techniques. Mutation can be introduced at a particular
position by synthesizing an oligonucleotide containing a mutant sequence adjacent
to restriction sites which can be connected to a fragment of a native sequence. After
connection, the resulting reconstituted sequence encodes a modified variant having
desired insertion, replacement or deletion of amino acid(s) in the endoplasmic reticulum
localization signal.
[0026] Alternatively, a modified gene having a particular codon modified by a necessary
deletion, substitution or addition can be provided by using a site-specific mutagenic
producer governed by an oligonucleotide. Techniques for performing such modification
include those described in Walder et al. (Gene 42:133, 1986); Bauer et al. (Gene 37:73,
1985); Craik (BioTechniques, January 1985, 12-19); Smith et al. (Genetic Engineering:
Principles and Methods, Plenum Press, 1981); and United States Patents No. 4,518,584
and No. 4,737,462). These documents are cited in the present specification.
[0027] The gene of the recombinant yeast PDI modified variant of the present invention is
modified so as not to encode part or all of the endoplasmic reticulum localization
signal, but such variant still has biologic activity. That is, this product retains
its enzymatic activity of catalyzing disulfide exchange in a protein.
[0028] Furthermore, an analogue, which differs from a native amino acid sequence in terms
of a region other than the endoplasmic reticulum localization signal region, but has
the biological activity of PDI, is included in the recombinant yeast PDI of the present
invention. The analogue, for example, can contain a conservatively substituted sequence,
and one or more amino acid residues of native PDI protein can be substituted by different
residues. The conservatively substituted PDI protein is shown to retain desired biological
activity essentially comparable to that of the native protein. An example of a conservative
substitution is the substitution for amino acids which do not change a secondary and/or
a tertiary structure of PDI. A person skilled in the art can easily perform deletion,
substitution or addition of one or more bases of the sequence in a portion of yeast
PDI gene other than a coding region for the endoplasmic reticulum localization signal
by the use of the above-described publicly known genetic engineering techniques to
obtain an analogue to yeast PDI. A naturally occurring analogue to yeast PDI, e.g.,
allyl, is also included in the yeast PDI of the present invention. Moreover, modification
can be carried out such that a yeast PDI derivative is produced by forming a covalent
bond or a cohesive bond to other chemical residue, such as a glycosyl group, a lipid,
a phosphate, or an acetyl group.
Expression vector and host cells
[0029] The present invention provides a recombinant expression vector for expression of
recombinant yeast PDI, and host cells transformed with the expression vector. Any
suitable expression system can also be used. Preferred is a yeast expression system.
The expression vector includes a gene encoding a yeast PDI modified variant, which
has been operably linked to a suitable transcriptional or translational regulatory
nucleotide sequence, such as one derived from a microbial (e.g., yeast), mammalian,
viral or insect gene. Examples of the regulatory sequence include a transcription
promoter, operator or enhancer, a ribosome binding site of mRNA, and appropriate sequences
which control the initiation and termination of transcription and translation. To
enable mass expression of the modified variant of yeast PDI, it is preferred to incorporate
a powerful transcription promoter sequence into the expression vector. Generally,
moreover, a replication origin which imparts replicability in the desired host cells,
and one or more selectable markers for identifying transformed cells may be incorporated
into the expression vector.
[0030] The expression vector of the invention is obtained in the following manner, for example:
Yeast PDI gene and DNAs serving as a promoter and a vector, in accordance with the
method described in Biochem. Biophys. Acta, 72, 619-629, 1963, are digested with restriction
enzymes, such as EcoRI and BamHI, and then ligated by a ligase such as T4DNA ligase,
as in the method described in J. Mol. Biol., 96, 171-184. 1974.
[0031] Suitable host cells suitable for the expression of the yeast PDI modified variant
include yeasts, prokaryotic cells or higher eukaryotic cells. Suitable cloning and
expression vectors for use together with yeasts, bacteria, fungal and mammalian cellular
hosts are described, for example, in Pouwels et al., Cloning Vectors: A Laboratory
Manual, Elsevier, New York (1985)).
[0032] Yeast PDI can be expressed, preferably, in a yeast host, and more preferably, in
the genus Saccharomyces (e.g., Saccharomyces cerevisiae). Other genera of yeast, such
as Pichia or Kluyveromyces, may also be used. Yeast vectors will often contain an
origin of replication sequence from a 2 µ yeast plasmid, an autonomously replicating
sequence (ARS), a promoter region, sequences for polyadenylation. sequences for termination
of transcription, and a selective marker.
[0033] Particular examples of the promoter sequence suitable for the yeast vector include
promoters of metallothionein, 3-phosphoglycerate kinase (PGK) (Hitzeman at al., J.
Biol. Chem. 255:2073, 1980), or other glycolytic enzymes (Hess et al., J. Adv. Enzyme
Rag. 7:149, 1968; and Holland et al., Biochem. 17:4900, 1978), such as enolase, glyceraldehyde-3-phosphate
dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phophate
isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase,
phosphoglucose isomerase, and glucokinase. Other suitable vectors and promoters for
use in yeast expression are further described in Hitzeman, EPA-73, No. 657. Glucose-repressible
ADH1 (Bennetzen et al., J. Biol. Chem. 257:3018, 1982) or ADH2 (Russell et al., J.
Biol. Chem. 258:2674, 1982; and Beier at al., Nature 300:724, 1982) may also be used.
GAL1 and GAL10 (St. John et al., Cell 16:443, 1979; and St. John et al., J. Mol. Biol.
152:285, 1981) are also usable. A shuttle vector capable of replicating in yeast or
Escherichia coli can be constructed by inserting a DNA sequence (Amp-resistant gene
and replication origin) from pBR322 (ATCC37017) for selection and replication in E.
coli into the foregoing yeast vector.
[0034] The preferred expression vector in yeast host cells is yeast-derived YEpGII (Japanese
Patent Public Disclosure No. 289267/95) shown, for example, in Figs. 5 to 10.
[0035] Instead of yeast host cells, it is possible to use a prokaryote, such as gram negative
or gram positive organisms (e.g., E. coli or Bacilli), as host cells. Examples of
the prokaryotic host cells suitable for transformation include E. coli, Bacillus subtilis,
Salmonella typhimurium, and various other species of the genera Pseudomonas, Streptomyces
and Staphylococcus.
[0036] The expression vector for use in the prokaryotic host cells generally includes one
or more phenotypic selectable marker genes. A phenotypic selectable marker gene is,
for instance, a gene encoding a protein which confers antibiotic resistance or that
supplies an autotrophic requirement. Examples of the expression vector useful for
prokaryotic host cells include those from commercially available plasmids, such as
cloning vector pBR322 (ATCC37017). Other commercially available vectors include, for
example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and pGEM1 (Promega Biotec,
Madison, WI, U.S.A.).
[0037] The promoter sequence commonly used for the recombinant prokaryotic host cell expression
vector includes, for example, β-lactamase (penicillinase), lactose promoter system
(Chang et al., Nature 275:615, 1978; and Goeddel et al., Nature 281:544, 1979), tryptophan
(trp) promoter system (Goeddel et al., Nucl. Acids Res. 8:4057, 1980; and EPA-36776),
T7 promoter system (Davanloo et al., Proc. Natl. Acad. Sci. USA 81:2035, 1984), and
tac promoter (Maniatis. Molecular Cloning:A Laboratory Manual, Cold Spring Harbor
Laboratory. 412, 1982). Phage λP
L promoter, and cI857ts heat-labile repressor sequence can also be used.
[0038] Alternatively, a mammalian or insect host cell culture system is also usable for
expression of the recombinant yeast PDI modified variant. The expression vector for
use in the mammalian host cells can be constructed as disclosed, for example, by Okayama
and Berg (Mol. Cell Biol. 3:280, 1983).
[0039] As stated above, host cells selected from wide ranges can be used in the present
invention. However, yeast PDI is deactivated under weakly acidic (pH 6.0) conditions.
Thus, it is desirable to select and use host cells which can be proliferated and cultured
under nearly neutral pH conditions. A person skilled in the art can select suitable
host cells on the basis of the descriptions in the present specification. The preferred
host cells can also be obtained by publicly known genetic engineering technologies
or mating techniques. Alternatively, the preferred host cells can be selected from
naturally occurring mutants.
[0040] For instance, the optimal pH for multiplication of yeast is, usually, in a weakly
acidic region. However, yeast, which can grow in a culture medium at pH close to neutrality
can be screened, for example, by the method described in Example 1. Preferably, Saccharomyces
cerevisiae P1 (Oriental Yeast Co., Ltd.) can be used as host cells in the process
for production of the present invention. Alternatively, instead of yeast cells, there
can be selected and used a prokaryotic, mammalian or insect cell culture system which
can be allowed to proliferate and culture under nearly neutral pH conditions.
Expression of yeast PDI variant
[0041] The selected desirable host cells can be transformed with the expression vector by
the use of a publicly known technique. For example, a transformation protocol for
yeast is described in Hinnen et al., Proc. Natl. Acad. Sci. USA 75:1929, 1978.
[0042] The transformed host cells are cultured under conditions which are adapted for expression
of a recombinant yeast PDI modified variant, depending on the type of the host cell.
Culture is performed under nearly neutral pH conditions, preferably, at pH 6.5 to
8.0. The recombinant yeast PDI modified protein expressed by the process of the present
invention is secreted outside the host cells. In order for the secreted PDI protein
to be maintained stably, a buffer such as HEPES is used on the culture medium for
the transformants, to keep the pH nearly neutral. To exclude a substance inhibitory
to yeast PDI protein activity, it is preferred to use a minimal medium as the culture
medium, or add a chelating agent. As the culture medium, it is possible to use, but
without restriction to, a uracil-free minimal medium (6.7 g/L yeast nitrogen base
without amino acid (Difco), 20 g/L glucose, 20 mg/L adenine, 10 mg/L L-histidine,
60 mg/L L-leucine, 20 mg/L L-tryptophan, 100 mM HEPES, 10 mM EDTA-2Na, pH 7.5).
[0043] The yeast PDI modified protein produced by the process of the present invention can
be purified by a publicly known method. In this invention, the recombinant protein
is secreted out of the cells. Thus, the cultured broth can be concentrated using a
commercially available protein concentration filter, e.g., Amicon or Millipore Pellicon
ultrafiltration device. Following the concentration step, the concentrate can be applied
to a purification matrix such as a gel filtration medium. Alternatively, an anion
exchange resin, e.g., a matrix or substrate having pendant diethylaminoethyl (DEAE)
groups, can be used. The matrices can be acrylamide, agarose, dextran, cellulose,
or other types commonly employed in protein purification. A cation exchange step may
also be used. As suitable cation exchangers, various insoluble matrices comprising
sulfopropyl groups or carboxymethyl groups are available. Finally, to further purify
the PDI protein, one or more reverse phase high performance liquid chromatography
(RP-HPLC) steps employing hydrophobic RP-HPLC base media (e.g., silica gel having
pendant methyl or other aliphatic groups) can be employed. Some or all of the foregoing
purification steps are used in various combinations to provide a purified yeast PDI
modified protein.
[0044] The secreted recombinant protein from a yeast host cell fermentation can be purified,
for example, by the same method as disclosed by Urdal et al. (J. Chromatog. 296:171,
1984).
[0045] The yeast PDI modified protein is purified, for example, such that protein bands
corresponding to other proteins are not detectable by SDS-polyacrylamide gel electrophoresis
(SDS-PAGE). Protein bands can be visualized by silver staining, Coomassie blue staining,
or autoradiography (when the protein is radiolabeled).
PDI enzyme activity
[0046] The recombinant yeast PDI modified protein of the present invention has a modified
endoplasmic reticulum localization signal portion, but still retains PDI biological
activity. The enzymatic activity of the PDI protein can be measured by a publicly
known technique. The in vitro activity can be measured by the restoration of activity
or the like using a reductively denatured enzyme as a substrate. For example, the
measurement can be made by using, but not restricted to, the method described in Example
5 that is a modification of the method of Mizunaga et al. (J. Biochem., 108, 846,
1990). That is, the activity of RnaseA, whose activity has been restored by the action
of PDI, is measured by modifying in accordance with the method of Uchida (Course of
Lectures on Biochemical Experiments 2, page 68, Tokyo Kagaku Dozin Co., Ltd., 1976).
[0047] The present invention will be described in detail by way of the following Examples,
which in no way limit the technical scope of the invention. A person skilled in the
art can easily modify and change the invention on the basis of descriptions in the
present specification, and all such modifications and changes are included within
the technical scope of the invention.
Examples
Example 1 Selection of host cells for production of yeast PDI
[0048] Host cells for production of PDI having activity even at nearly neutral pH were selected
by the following method:
[0049] For preliminary culture, 5 mL of a uracil-free minimal medium shown in Table 1 was
placed in a 16 mm-diameter test tube. The culture medium was separately inoculated
with a loopful of each of the yeasts P1, Y3 and X3 (all products of Oriental Yeast),
and shake cultured for a whole day at 30°C.
Table 1
| Composition of uracil-free minimal medium (pH 7.5) |
| Yeast nitrogen base without amino acid (Difco) |
0.67% |
| Glucose |
2.0% |
| Adenine |
2.0% |
| L-histidine |
1.0% |
| L-leucine |
6.0% |
| L-tryptophan |
2.0% |
[0050] Then, full-scale culture was performed at nearly neutral pH. A Sakaguchi flask was
charged with 100 mL of a YPAD medium (10 g/L yeast extract, 20 g/L peptone, 140 mg/L
adenine, 20 g/L glucose) that was adjusted to pH 7.5 by the addition of 100 mM HEPES.
To this medium, 1 mL of the above-mentioned preculture fermentation mash was added,
and the mixture was shake cultured at 30°C and 105 rpm.
[0051] As a result, Saccharomyces cerevisiae P1 (a product of Oriental Yeast; MATa leu2-3,
112 trpl-289 ura3-1,2 his3-532 his4-516 ade2) was selected, since it grew well and
maintained above pH 7.0 for 7 days of culture.
Example 2 Modification of C-terminal endoplasmic reticulum localization signal of
yeast PDI
[0052] A base sequence "CACGATGAATTG" encoding a C-terminal endoplasmic reticulum localization
signal "HDEL" of yeast (Saccharomyces cerevisiae) PDI was substituted by "CACGATTAATTG"
so that a termination codon could be inserted midway in the endoplasmic reticulum
localization signal.
[0053] Both ends of a 6,386 bp long fragment between EcoRI-XhoI cleavage sites containing
a PDI structural gene (Tachikawa et al.. J. Biochem. 110:306, 1991; kindly provided
by Mr. Tachikawa) on the 3rd chromosome of a yeast laboratory strain, Saccharomyces
cerevisiae TM5, were modified to BamHI cleavage sites. Then, the modified gene was
inserted between BamHI cleavage sites of Escherichia coli vector pUC18 to construct
pUCPDI. The portion between SalI-EcoRV cleavage sites, which contains a PDI structural
gene region and a termination codon, was transferred from the resulting plasmid pUCPDI
into between SalI-SmaI cleavage sites of commercially available E. coli vector pUC19
to construct pUCPDIC1.
[0054] Then, a termination codon (TAA) was introduced into the sequence encoding the endoplasmic
reticulum localization signal by PCR site-specific mutation introduction. Primers
for PCR are shown in Table 2.
Table 2
| Primers used in PCR |
| Primer |
Base sequence |
Origin |
| 1 RV |
5'CAGGAAACAGCTATGAC3' |
Product of TAKARA SHUZO CO., LTD. |
| 2 GPI |
5'AACGTTAGCATTTTGTTTATTTATGTGTG3' |
Synthesized |
| 3 PDIN |
5'AACAAAATGAAGTTTTCTGCTGG3' |
Synthesized |
| 4 M4 |
5'GTTTCCCAGTCACGAC3' |
Product of TAKARA SHUZO CO., LTD. |
| 5 PDIC |
5'TAACAATTAATCGTGAATGGC3' |
Synthesized Product of |
| 6 MUT3 |
5'TGATTACGCCTAGCTTACAT3' |
TAKARA SHUZO CO., LTD. |
[0055] Specifically, a DNA fragment was amplified by PCR in accordance with the description
of "A Guide to Genetic Engineering Products" (TAKARA SHUZO, 1995-1996) by the use
of the above-mentioned plasmid pUCPDIC1 as a template, and by use of a combination
of a single-strand synthetic oligonucleotide RV (TAKARA SHUZO) and PDIC (synthesized
by the inventors) or a combination of MUT3 and M4 (TAKARA SHUZO). Furthermore, two
types of the resulting primary amplification products were mixed, and annealed for
use as a template. Then, secondary PCR was performed using a combination of RV and
M4 as primers. The resulting secondary amplification product containing two types
of DNA fragments was treated with SphI and EcoRI. The resulting SphI-EcoRI fragment
was inserted between SphI-EcoRI cleavage sites to construct pUCPDIC2.
[0056] Furthermore, SphI-SalI restriction fragment derived from pUCPDIC2 was inserted into
between SphI-SalI cleavage sites containing a promoter region and a structural gene
for PDI of pUCPDI to construct pUCPDIC.
Example 3 Preparation of expression vector for expression of recombinant yeast PDI
[0057] As a multi-copy type vector for expression in yeast, YEp1GII having a base sequence
shown in Figs. 5 to 10 (Japanese Patent Public Disclosure No. 289267/95) was utilized.
YEp1GII contains a GAP (glyceraldehyde 3-phosphate dehydrogenase) promoter having
high promoter activity.
[0058] YEp1GII was cleaved with EcoRI, and its ends were blunted with a DNA polymerase.
A portion between DraI-DraI cleavage sites of pUCPDIC, containing the PDI structural
gene, was inserted into between the cleaved sites of YEp1GII to construct YEpGIIPDIC.
As a control, YEpGIIPDI was constructed similarly by cleaving YEp1GII with EcoRI,
blunting its ends with a DNA polymerase, and inserting a portion between DraI-DraI
cleavage sites of pUCPDI, which contained PDI structural gene, into an area between
the cleaved sites of YEp1GII. The constructed yeast PDI expression vectors are shown
in Table 3.
Table 3
| Yeast transformation vectors |
| Name |
Vector |
Promoter |
Endoplasmic reticulum localization signal |
Name of strain for introduction |
| YEp1GII |
YEp1GII |
- |
- |
E0 |
| YepGIIPDI |
YEp1GII |
Variant |
Wild type |
E1 |
| YepGIIPDIC |
YEp1GII |
Variant |
Variant |
E2 |
Example 4 Transformation of host cells with expression vector
[0059] Using the yeast PDI expression vector obtained in Example 3, host cells for production
of PDI, i.e., Saccharomyces cerevisiae P1, were transformed by the competent cell
technique involving lithium acetate in accordance with the customary method. The strains
incorporating YEp1GII was designated as E0, the yeast strain incorporating YEpGIIPDI
as E1, and the yeast strain incorporating YEpGIIPDIC as E2. The resulting transformant
E2 was deposited at the National Institute of Bioscience and Human Technology, Japan
(Higashi 1-1-3, Tsukuba City, Ibaragi 305, Japan) with the accession number FERM P-15951
on November 15, 1996. FERM P-15951 was transferred to deposition under the Budapest
Treaty on January 28, 1998, and given the accession number FERM BP-6240.
Example 5 Measurement of PDI activity
[0060] Measurement of PDI activity was made by a modification of the method of Mizunaga
et al. (J. Biochem., 108, 846, 1990). That is, the activity of RnaseA, whose activity
was restored by the of PDI, was measured by modifying in accordance with the method
of Uchida (Course of Lectures on Biochemical Experiments 2, page 68, Tokyo Kagaku
Dozin Co., Ltd., 1976).
[0061] 40 µL of a sample for PDI activity measurement (or ultrapure water), 40 µL of 2.5X
PE buffer (125 mM NaH
2PO
4, 6.25 mM EDTA-2Na, pH 7.5), and 10 µL of 0.1 mM dithiothreitol (within 2 hours after
preparation) were mixed in a 1.5 mL Eppendorf tube. Then, the mixture was preincubated
for 5 minutes at 30°C. To the preincubated mixture, 10 µL of a solution of 5 mg/mL
RNaseA and scrambled disulfide bonds (SIGMA) prepared with 10 mM acetic acid (or 10
µL of 10 mM acetic acid only) was added, where PDI reaction was then performed for
10 to 30 minutes at 30°C. Separately, 1 mL of 2 mg/mL RNA (TypeXI, SIGMA) prepared
using autoclaved TKM buffer (50 mM tris, 5 mM magnesium chloride, 25 mM potassium
chloride, pH 7.5) was placed in a 1.5 mL Eppendorf tube, and preincubated for 8 minutes
at 37°C. To the preincubated liquid, 10 µL of the abovementioned PDI reaction mixture
was added, and the resulting mixture was subjected to RNaseA reaction for 3 minutes
at 37°C. Then, 150 µL of the RNaseA reaction mixture was taken, and mixed with 50
µL of a modified uranyl reagent (a reagent formed by dissolving 0.75% uranyl acetate
in 10% perchloric acid) that had been placed in another Eppendorf tube. The resulting
mixture was centrifuged for 5 minutes at 12,000 rpm. Then, 40 µL of the supernatant
was taken out into a cuvette, diluted with 1 mL ultra-pure water heated to 37°C, and
measured at 37°C for absorbance at 260 nm.
[0062] "One unit (1U) of PDI" was defined as enzymatic activity which restored 1U RNaseA
over 1 minute at pH 7.5 and 30°C. "One unit (1U) of RNaseA" was defined as enzymatic
activity which increased absorbance by 1 over 1 minute, when the absorbance was measured
with a spectrophotometer at 260 nm in the foregoing method (in which the RNaseA reaction
mixture was diluted 1:200/150x1040/40 on termination of the reaction and dilition).
Example 6 Selection of culture medium not inhibiting PDI activity
[0063] A yeast culture medium for production of yeast PDI was selected by mixing a crude
enzyme solution, which was extracted from yeast cells, with a culture medium, and
measuring the PDI activity.
[0064] A loopful of yeast (Saccharomyces cerevisiae) was inoculated into a 16 mm-diameter
test tube containing 5 mL of a uracil-free minimal medium (6.7 g/L yeast nitrogen
base without amino acid (Difco), 20 g/L glucose, 20 mg/L adenine, 10 mg/L L-histidine,
60 mg/L L-leucine, 20 mg/L L-tryptophan, 100 mM HEPES, 10 mM EDTA-2Na, pH 7.5). The
inoculum was shake cultured for 3 days at 30°C to prepare a crude enzyme solution
from the cells. The cultured broth was centrifuged for 5 minutes at 3,000 rpm. The
centrifuged cells were washed twice with ice cooled 4X PE buffer (200 mM NaH
2PO
4, 10 mM EDTA-2Na, pH 7.5) to obtain the cells. To these cells, 300 µL of 4X PE buffer
was added to make a cell suspension (total volume of about 600 µL). The cell suspension
(about 300 µL) was added into a 1.5 mL Eppendorf tube containing about 0.4 g of glass
beads (average diameter: 0.40-0.45 mm). The Eppendorf tube was shaken for 10 minutes
at a maximum speed by means of a micro tube mixer (MT-360, Tomy Seiko) in a refrigerator
to grind the cells. Upon completion of grinding, the Eppendorf tube was centrifuged
for 15 minutes at 13,000 rpm. The supernatant was collected into another tube, and
obtained as a crude enzyme solution.
[0065] Then, 20 µL of the resulting crude enzyme solution and 20 µL of a desirable culture
medium were mixed to form a sample for determination of PDI activity. The PDI activity
was measured by the foregoing method. The culture medium contained a buffer and a
chelating agent. As the culture medium, the foregoing uracil-free minimal medium and
YAD medium (10 g/L yeast extract, 20 g/L glucose, 20 mg/L adenine, 100 mM HEPES, 10
mM EDTA-2Na, pH 7.5) were each used. The results of their comparison are shown in
Table 4.
Table 4
| Selection of culture medium not inhibiting PDI activity |
| Culture medium |
PDI relative activity (%) |
| Water |
100 |
| YAD |
68 |
| Uracil-free minimal medium |
100 |
[0066] Based on Table 4, the uracil-free minimal medium was selected as a culture medium
which does not inhibit PDI activity.
Example 7 Culture of transformed host cells
[0067] A loopful of the transformed yeast host cells obtained in Example 4 was inoculated
into a 16 mm-diameter test tube containing 5 mL of YPAD medium. The inoculum was shake
cultured for 3 days at 30°C. The cultured broth was centrifuged for 5 minutes at 3,000
rpm, and then washed twice with ice cooled 4X PE buffer (200 mM NaH
2PO
4, 10 mM EDTA-2Na, pH 7.5). To cells collected after recentrifugation, was added 2
mL of a PDI production culture medium of the above-described composition that was
prepared by adding a buffer and a chelating agent to the uracil-free minimal medium.
The resulting mixture was shake cultured for 15 hours at 30°C. Thereafter, the cultured
broth was ice cooled, and then centrifuged for 5 minutes at 3,000 rpm to separate
cells and the culture medium.
Example 8 PDI activity of recombinant yeast PDI protein
[0068] To the culture medium obtained by culture for yeast PDI production, bovine serum
albumin (BSA) (a product of Wako) was added so as to make the final concentration
of 0.1 g/L. Then, the mixture was placed in a centrifugal filtration tube (Millipore,
Ultrafree C3LGC, fractionated molecular weight 10,000), and concentrated at 6,000
rpm and 5°C to a total volume of about 100 µL, thereby obtaining solution containing
the yeast PDI. PDI protein was secreted and expressed in the culture medium by using
each of the various transformed yeasts shown in Table 3, and the PDI activity was
measured by the method of Example 5. The results are shown in Table 5. The PDI activity
was the highest for E2 strain (incorporating yeast PDI gene modified to a secretor
type), demonstrating the effectiveness of the present invention.
Table 5
| PDT activity of E0, E1 and E2 strains |
| Experiment |
Strain |
Sample |
PDI activity (U/mL)*) |
| 1 |
E0 |
Culture medium |
0 |
| E1 |
Culture medium |
0.95x10-1 |
| E2 |
Culture medium |
1.43x10-1 |
| 2 |
E0 |
Culture medium |
0 |
| E1 |
Culture medium |
1.15x10-1 |
| E2 |
Culture medium |
2.27x10-1 |
| 3 |
E0 |
Culture medium |
0 |
| E1 |
Culture medium |
0.36x10-1 |
| E2 |
Culture medium |
0.90x10-1 |
| *): PDI activity of the culture medium was expressed as that per ml of the concentrate. |
Example 9 SDS-PAGE of culture medium
[0069] Detection of yeast PDI in the culture medium was also performed by SDS-PAGE.
[0070] The culture medium was concentrated about 60-fold by the same method as described
above without the addition of BSA. The device used was ATTO's tandem minislab gel
electrophoresis device (AE6450), and the method followed the Laemmli method in accordance
with the attached manual. The separation gel concentration was 7.5%. For staining,
BLUPRINT Fast-PAGE Stain (a product of GIBCOBRL) was used.
[0071] Fig. 11 shows a computerized image of the stained SDS-PAGE gel. Bands characteristic
of the PDI-incorporating strains (E1, E2) appear around molecular weights of 70,000
daltons. A yeast PDI molecule has about 70 kDa, and the bands suggest yeast PDI. The
color density of the band was higher in E2 than in E1, thus confirming the effectiveness
of the present invention by SDS-PAGE as well.
Effects of the Invention