FIELD OF THE INVENTION
[0001] The present invention relates to a method for identifying novel fungi that produce
volatile antibiotics. The volatile compounds have biological activity against plant
and human pathogenic fungi and bacteria, insects and nematodes.
BACKGROUND OF THE INVENTION
[0002] Throughout this application, various articles and books are referenced by authorship
and date. The full bibliographic citation for each publication can be found at the
end of the specification, immediately preceding the claims.
[0003] It is well recognized that fungi produce antibiotics that are useful in the treatment
of diseases, in industrial applications and as pesticides, e.g., penicillin, cephalosporins,
tetracyclin, and cyclosporins, none of which are volatile. Many fungal species are
known to emit low concentrations of gaseous substances, especially ones that have
distinctive obnoxious odors, and this has prompted chemical analyses of the fungal
volatiles (Bjurman et al., 1992). Some of these volatile substances are common to
many fungi, whereas others seem to be unique for one species (Schnurer et al., 1999;
Rapior et al., 2000). Dennis & Webster (1971) reported that certain
Trichoderma spp. produced volatile antibiotics that inhibited the growth of such test fungi as
Rhizoctonia solani, Pythium ultimum and
Fusarium oxysporum. No lethality to any of the test fungi were reported by these authors and comprehensive
chemical analyses of the volatile components of the fungal cultures was not performed,
although acetaldehyde was suggested as one of the volatiles. Thus, in spite of some
attention being given to the volatile compounds of fungal cultures over the years,
no lethal mixture of volatile antimicrobials produced by fungi have been reported.
[0004] It is also well known that various microorganisms exhibit biological activity so
as to be useful to control plant diseases. Although progress has been made in the
field of identifying and developing biological pesticides for controlling various
plant diseases of agronomic and horticultural importance, most of the pesticides in
use are still synthetic compounds. Many of these chemical fungicides are classified
as carcinogens by the EPA and are toxic to wildlife and other non-target species.
For example, methyl bromide is widely used as a soil fumigant and to treat postharvest
microbial infections. Due to its high toxicity to humans and animals and deleterious
effect on the atmosphere, the use of methyl bromide will soon be eliminated and there
is a great need to find safer replacements for this and other synthetic pesticides.
[0005] This invention satisfies this need and provides related advantages as well.
DETAILED DESCRIPTION OF THE INVENTION
[0006] A method for identifying navel unicodor fungi including
Muscodor albus and
Muscodor roseus is provided wherein the truscodor fungi produce a mixture of volatile antibiotics
with activity against fungi, bacteria, insects and nematodes. In one aspect, the
Muscodor is identified using the information provided herein, including, but not limited to
partial genomic sequences set forth in SEQ ID NOs.: 1 to 4. Two novel strains were
deposited with the NRRL on February 1, 2002 under the provisions of the Budapest Treaty
on the International Recognition of the Deposit of Microorganisms for the Purpose
of Patent Procedure under Accession Nos. 30547 and 30548.
[0007] Compositions containing the fungi and/or the volatile compounds are also provided.
The compositions are useful to treat soil and to protect plants, seed, grain, and
fruit from pathogenic fungi and bacteria. The compositions also are useful to protect
postharvest food against bacterial and fungal infections. The compositions are further
useful for treating human or animal waste and for treating and/or preventing toxic
mold infestations of buildings and building materials such as wood. Non-therapeutic
methods of treating and protecting soil, plants, seed, grain, waste products, building
materials and postharvest food products against bacterial, insecticidal, nematicidal
and fungal infections are further provided by this invention.
BRIEF DESCRIPTION OF THE TABLES
[0008] Table 1 shows the effects of the volatile compounds of
M. albus and an artificial mixture of
M. albus compounds on a group of test microbes. After exposure to
M.
albus gases, the test microbe was evaluated for its viability after removal from the gases.
The artificial atmosphere consisted of the compounds identified after analysis of
the
M albus gases. The microbial growth in the artificial atmosphere was measured after exposure
to the artificial mixture of compounds at 3.2- 90µl/50cc in order to obtain IC
50's. The % growth over the control and viability were measured after exposure to 60µl/50cc.
Viability was determined after the removal of the compounds at 3 days.
[0009] Table 2 shows the average number of broccoli seedlings per pot one week after planting
(means ± standard deviation) using vermiculite. Pots were planted immediately without
an incubation period.
[0010] Table 3 shows the results of an experiment determining the ability of
Muscodor albus to control blue mold of apple.
[0011] Table 4 shows the results of GC/MS analysis of the volatile compounds produced by
M albus. Several minor peaks and the breakthrough peak were omitted from the total analysis
since they represent only 1% of the total area. Compounds found in the control PDA
plate are not included in this table.
[0012] Table 5 shows the results of an assay to determine the inhibitory influence of each
class of volatile compounds. This is expressed as the % of the test microbe growth
as compared to a control not in the presence of the test compounds. The compounds
were tested for a 2 day exposure at the relative concentrations that they occur in
M. albus at the optimum test concentration 60µl/50 CC air space or 1.2µl /cc.
[0013] Table 6 shows
Muscodor albus volatiles used to treat covered smut infested barley seeds. Sets of untreated and
uninfested seeds were used as controls.
MODES FOR CARRYING OUT THE INVENTION
[0014] Throughout this disclosure, various publications, patents and published patent specifications
are referenced by an identifying citation.
[0015] The practice of the present invention employs, unless otherwise indicated, conventional
techniques of molecular biology (including recombinant techniques), microbiology,
cell biology, biochemistry and immunology, which are within the skill of the art.
Such techniques are explained fully in the literature. These methods are described
in the following publications. See,
e.g.,
Sambrook et al. MOLECULAR CLONING: A LABORATORY MANUAL, 2nd edition (1989);
CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (F. M. Ausubel et al. eds. (1987)); the series
METHODS IN ENZYMOLOGY (Academic Press, Inc.);
PCR: A PRACTICAL APPROACH (M. MacPherson et al. IRL Press at Oxford University Press
(1991)); and
PCR 2: A PRACTICAL APPROACH (M.J. MacPherson, B.D. Hames and G.R. Taylor eds. (1995)).
DEFINITIONS
[0016] The singular form "a," "an" and "the" include plural references unless the context
clearly dictates otherwise. For example, the term "a cell" includes a plurality of
cells, including mixtures thereof.
[0017] The term "comprising" is intended to mean that the compositions and methods include
the recited elements, but not excluding others. "Consisting essentially of" when used
to define compositions and methods, shall mean excluding other elements of any essential
significance to the combination. Thus, a composition consisting essentially of the
elements as defined herein would not exclude trace contaminants from the isolation
and purification method and agriculturally acceptable carriers. "Consisting of" shall
mean excluding more than trace elements of other ingredients and substantial method
steps for applying the compositions of this invention. Embodiments defined by each
of these transition terms are within the scope of this invention.
[0018] As used herein, "biological control" is defined as control of a pathogen or insect
by the use of a second organism. Known mechanisms of biological control include enteric
bacteria that control root rot by out-competing fungi for space on the surface of
the root. Bacterial toxins, such as antibiotics, have been used to control pathogens.
The toxin can be isolated and applied directly to the plant or the bacterial species
may be administered so it produces the toxin
in situ.
[0019] The term "fungus" or "fungi" includes a wide variety of nucleated spore-bearing organisms
that are devoid of chlorophyll. Examples of fungi include yeasts, molds, mildews,
rusts, and mushrooms.
[0020] The term "bacteria" includes any prokaryotic organism that does not have a distinct
nucleus.
[0021] "Pesticidal" means the ability of a substance to increase mortality or inhibit the
growth rate of plant pests.
[0022] "Fungicidal" means the ability of a substance to increase mortality or inhibit the
growth rate of fungi.
[0023] "Insecticidal" means the ability of a substance to increase mortality or inhibit
the growth rate of insects or their larvae.
[0024] "Bactericidal" means the ability of a substance to increase mortality or inhibit
the growth rate of bacteria.
[0025] "Nematicidal" means the ability of a substance to increase mortality or inhibit the
growth rate of nematodes.
[0026] "Antibiotic" includes any substance that is able to kill or inhibit a microorganism.
Antibiotics may be produced by a microorganism or by a synthetic process or semisynthetic
process. The term, therefore, includes a substance that inhibits or kills fungi for
example, cycloheximide or nystatin.
[0027] The term "culturing" refers to the propagation of organisms on or in media of various
kinds. "Whole broth culture" refers to a liquid culture containing both cells and
media. "Supernatant" refers to the liquid broth remaining when cells grown in broth
are removed by centrifugation, filtration, sedimentation, or other means well known
in the art.
[0028] An "effective amount" is an amount sufficient to effect beneficial or desired results.
An effective amount can be administered in one or more administrations. In terms of
treatment and protection, an "effective amount" is that amount sufficient to ameliorate,
stabilize, reverse, slow or delay progression of the target infection or disease states.
[0029] "Positive control" means a compound known to have pesticidal activity. "Positive
controls" include, but are not limited to commercially available chemical pesticides.
The term "negative control" means a compound not known to have pesticidal activity.
Examples of negative controls are water or ethyl acetate.
[0030] The term "metabolite" or "volatile" refers to any compound, substance or byproduct
of a fermentation of a microorganism that has the biological activity. Volatiles in
most instances evaporate readily at ambient temperature and pressure.
[0031] The term "mutant" refers to a variant of the parental strain as well as methods for
obtaining a mutant or variant in which the desired biological activity is similar
to that expressed by the parental strain. The "parent strain" is defined herein as
the original
Muscodor strains before mutagenesis. Mutants occur in nature without the intervention of man.
They also are obtainable by treatment with or by a variety of methods and compositions
known to those of skill in the art. For example, parental strains may be treated with
a chemical such as N-methyl-N'-nitro-N-nitrosoguanidine, ethylmethanesulfone, or by
irradiation using gamma, x-ray, or UV-irradiation, or by other means well known to
those practiced in the art.
[0032] A "composition" is intended to mean a combination of active agent and another compound,
carrier or composition, inert (for example, a detectable agent or label or liquid
carrier) or active, such as an adjuvant. Examples of agricultural carriers are provided
below. The fungi can also be formulated as a composition, with a carrier or alternatively,
with at least one chemical or biological pesticide.
[0033] All numerical designations, e.g., pH, temperature, time, concentration, and molecular
weight, including ranges, are approximations which may be varied (+) or ( - ) by increments
of 0.1. It is to be understood, although not always explicitly stated that all numerical
designations are preceded by the term "about". It also is to be understood, although
not always explicitly stated, that the reagents described herein are merely exemplary
and that equivalents of such are well known in the art.
[0034] In order to achieve good dispersion and adhesion of compositions within the present
invention, it may be advantageous to formulate the whole broth culture, supernatant
and/or volatile with components that aid dispersion and adhesion. Suitable formulations
will be known to those skilled in the art (wettable powders, granules and the like,
or can be microencapsulated in a suitable medium and the like, liquids such as aqueous
flowables and aqueous suspensions, volatile compositions and emulsifiable concentrates.
Other suitable formulations will be known to those skilled in the art.
[0035] A "variant" is a strain having all the identifying characteristics of the strains
of this invention and can be identified as having a genome that hybridizes under conditions
of high stringency to the genome of the organism, the partial sequence of which has
been deposited in the GenBank depository. "Hybridization" refers to a reaction in
which one or more polynucleotides react to form a complex that is stabilized via hydrogen
bonding between the bases of the nucleotide residues. The hydrogen bonding may occur
by Watson-Crick base pairing, Hoogstein binding, or in any other sequence-specific
manner. The complex may comprise two strands forming a duplex structure, three or
more strands forming a multi-stranded complex, a single self-hybridizing strand, or
any combination of these. Hybridization reactions can be performed under conditions
of different "stringency." In general, a low stringency hybridization reaction is
carried out at about 40°C in 10 X SSC or a solution of equivalent ionic strength/temperature.
A moderate stringency hybridization is typically performed at about 50°C in 6 X SSC,
and a high stringency hybridization reaction is generally performed at about 60°C
in 1 X SSC.
[0036] A variant may also be defined as a strain having a genomic sequence that is greater
than 85%, more preferably greater than 90% or more preferably greater than 95% sequence
identity to the genome of
M. roseus or
M.
albus. A polynucleotide or polynucleotide region (or a polypeptide or polypeptide region)
has a certain percentage (for example, 80%, 85%, 90%, or 95%) of "sequence identity"
to another sequence means that, when aligned, that percentage of bases (or amino acids)
are the same in comparing the two sequences. This alignment and the percent homology
or sequence identity can be determined using software programs known in the art, for
example, those described in CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (F.M. Ausubel et
al., eds., 1987) Supplement 30, section 7.7.18, Table 7.7.1. Preferably, default parameters
are used for alignment. A preferred alignment program is BLAST, using default parameters.
In particular, preferred programs are BLASTN and BLASTP, using the following default
parameters: Genetic code = standard; filter = none; strand = both; cutoff= 60; expect
= 10; Matrix = BLOSUM62; Descriptions = 50 sequences; sort by =HIGH SCORE; Databases
= non-redundant, GenBank + EMBL + DDBJ + PDB +GenBank CDS translations + SwissProtein
+ SPupdate + PIR. Details of these programs can be found at the following Internet
address:
www.ncbi.nlm.nih.gov/cgi-bin/BLAST.
[0037] Applicants have isolated and characterized a novel fungi named
Muscodor. Two species of the novel Muscodor have also been isolated and characterized, i.e.,
Muscodor albus and
Muscodor roseus. Partial genomic sequences for
Muscodor albus are provided in SEQ ID NOS.: 1 and 2 and partial genomic sequences for
Muscodor roseus (designated A3-5) are provided in SEQ ID NOS. 3 and 4. A partial genomic sequence
for
M. roseus (A10) was also obtained. An isolated culture of
Muscodor albus has been deposited with the NRRL under Accession No. 30547 An isolated culture of
Muscodor roseus designated A3-5 has been deposited with the NRRL under Accession No. 30548
Thus, this invention provides an isolated novel fungi designated
Muscodor and two species thereof,
Muscodor albus and
Muscodor roseus, and mutants thereof.
[0038] Also provided by this invention are gaseous composition(s) ("volatiles") produced
by the isolated
Muscodor cultures. In one aspect, the volatile composition has the components recited in Table
4. The gaseous compositions can be combined with a suitable dispersing agent or carrier.
In another aspect, the compositions optionally contain an effective amount of one
or more of a fungicide, an insecticide, a nematicide, an antimicrobial, a bactericide
or a food preservative.
[0039] Applicants have further identified the components of the volatile byproduct and have
synthesized it from commercially available materials. The components of the synthetic
volatile are recited in Table 4. It should be understood, although not always explicitly
stated that the synthetic composition can be used in the methods described herein
as an alternative or as a substitute to the natural gaseous byproduct produced by
Muscodor fungi.
[0040] Muscodor gases affect a number of other microbes related to human health issues. It is lethal
to the major fungal and bacterial pathogens of humans including C.
albicans (Table 2) and
A. fumigatus and
Pseudomonas sp. It kills bacteria that contaminate food such as
S.
aureus and
E. coli (Table 2). It has been found to be lethal to
Stachybotrys sp. (contaminator of homes, and public buildings) and also a number of wood decay
fungi.
[0041] Thus, the fungi and the gases produced by the fungi are useful in a non-therapeutic
method of inhibiting the growth of or kill an organism selected from the group consisting
of a fungus, a bacteria, a microorganism, a nematode and an insect. Using methods
well known to those of skill in the art, the fungi or its volatile byproduct is contacted
with the organism in an amount effective to kill or inhibit the growth of the organism.
Alternatively, the fungi and/or its volatile byproduct can be used to treat human
or animal waste, e.g., as a component of a waste water or solid management or treatment.
They also are useful to decontaminate human and animal waste, e.g., decrease or remove
bacterial and fungal contamination. Yet further, the fungi and/or its volatile byproduct
can be used to treat or prevent toxic mold on building materials and in buildings
by contacting the building, the building materials, or the spaces between the building
materials with an effective amount of the volatile byproduct. For the purpose of illustration
only, an effective amount of the volatile byproduct can be used alone or in combination
with other fumigants in a room or alternatively, during whole building fumigations.
[0042] When used in agricultural applications, the invention provides a method for treating
or protecting fruit, seeds, plants or the soil surrounding the plants from an infestation
by an organism selected from the group consisting of a fungus, a bacteria, a microorganism,
and an insect, by contacting the microorganism with an effective amount of an isolated
Muscodor culture or its volatile byproduct.
[0043] Further provided by this invention is a method for identifying novel
Muscodor fungi, comprising contacting an effective amount of the fungi to be screened with
the volatiles of
Muscodor albus or
Muscodor roseus under culturing conditions and selecting the fungi which is resistant to the volatiles
of the
Muscodor albus or
Muscodor roseus thereby identifying novel
Muscodor fungi. Further provided are the isolated
Muscodor fungi selected by this method.
[0044] Yet further provided is a method for obtaining a volatile composition by culturing
the isolated
Muscodor of this invention and collecting the volatile composition produced by the growing
Muscodor.
[0045] The following examples are provided to illustrate the invention.
EXAMPLES
Example 1 - Fungal Isolation
Muscodor albus
[0046] Several small limbs of a mature
Cinnamomum zeylanicum tree located 20 miles west of La Ceiba, Honduras, were removed and immediately transported
back to Montana State University for processing in the fall of 1997. Small pieces
of inner bark, sapwood and outer xylem tissues of the limbs were aseptically removed
and placed on Petri plates containing water agar. After incubation for several days,
hyphal tips of developing fungi were aseptically removed and placed on potato dextrose
agar (PDA).
In addition, after 7 days, fungal colonies were transferred to gamma irradiated carnation
leaves (0.5x 0.5 cm) to encourage spore production. Of several fungi that were isolated
the one of great interest, because of its musty odor, was an isolate designated -
"620", later identified as
Muscodor albus.
Muscodor roseus
[0047] Fungus was isolated from several small limbs of a Fern-Leafed Grevellia
(Grevillea pteridifolia) 12° 59' 39" South and 132° 28' 50" East obtained from the Northern Territory of Australia.
Small pieces of inner bark, sapwood and outer xylem tissues of some small limbs (0.5
cm dia) were aseptically removed and placed on Petri plates containing water agar
(Strobel et al., 1996). After incubation for several days, hyphal tips of developing
fungi were aseptically removed and placed on potato dextrose agar (PDA). In addition,
after 7 days, fungal colonies were transferred to gamma irradiated carnation leaves
(0.5x 0.5 cm) and other plant materials to encourage spore production. Of the several
fungi that were isolated, the one of greatest interest, because of its musty odor,
was an isolate designated - "A3-5."
[0048] An additional strain of
Muscodor was obtained from the small limbs of the Australia Ironwood
(Erythophelum chlorostachys) at 15° 29' 29" South and 131° 23' 12" East. This endophyte was isolated using the
volatiles of
M. albus as a selection tool. Plant material, from which endophytes were to be isolated, were
placed in the same agar plate as a rapidly growing two -week old culture of
M. albus. Then, the only organisms developing from the plant material were the ones resistant
to
M albus, which are possibly other volatile antibiotic producers or relatives of
M.
albus in the xylariaceous group (Strobel et al., 2001). The most commonly isolated endophytes
from this tree were
Pestalotiopsis spp. and other
Xylaria spp. It was internally designated "A-10".
Example 2- Fungal Growth and Storage
[0049] The fungus was grown on a number of different media including Tryptic Soy Broth Agar
(TSBA), Corn Meal Agar (CMA), Malt Agar (MA), Potato Dextrose Agar (PDA), Difco, Laboratories,
Detroit, Mich. Also the fungus was inoculated on to Petri plates containing water
agar with individual samples of small wood shavings of western white pine
(Pinus monticola), black walnut
(Juglans nigra), and maple
(Acer saccharum). as well as bark pieces of
C.
zeylanicum in order to encourage spore production.
[0050] In order to determine how to best store isolate 620, several conditions were tried.
The fungus was grown on sterilized Whatmann No. 1 filter paper discs that were placed
on to the surface of PDA in Petri Plates. The fungus was inoculated as an agar plug
in the middle of the filter paper disc on the PDA plate. The plate was incubated for
14 days at 22°C. The paper disc was then removed and placed in a laminar flow hood
under sterile conditions for 1 day, or until the paper with its fungal mycelium was
dry. The paper disc was then cut into many pieces and stored under various conditions.
Also, agar plugs containing the fungus were placed in sterile distilled water and
stored at 4°C. In another set of test conditions, mycelial pieces growing on agar
were placed in 15 % glycerol and stored at -70°C. In each test, fungal viability was
determined by placing the mycelial fragments on to a PDA plate and examining it for
fungal growth after 3-4 days.
[0051] In order to determine how to best store
Muscodor roseus isolates (designated internally as A3-5 and A-10) several conditions were tried.
The fungus was grown on sterilized Whatmann No. 1 filter paper discs that were placed
on to the surface of PDA in Petri Plates. The fungus was inoculated as an agar plug
in the middle of the filter paper disc on the PDA plate. The plate was incubated for
14 days at 22°C. The paper disc was then removed and placed in a laminar flow hood
under sterile conditions for 1 day, or until the paper with its fungal mycelium was
dry. The paper disc was then cut into many pieces and stored at 23°C, 4°C, 0°C and
-70°C. Also, agar plugs containing the fungus were placed in sterile distilled water
and stored at 4°C. In another set of test conditions, mycelial pieces growing on agar
were placed in 15 % glycerol and stored at -70°C. In each test, fungal viability was
determined by placing the mycelial fragments on to a PDA plate and examining it for
fungal growth after 3-4 days.
Example 3 - Fungal DNA Isolation
[0052] For DNA isolation, all fungi were grown in potato dextrose broth (PDA) in 1.5 ml
for 18 to 24 h at 23 °C. The mycelium was harvested by centrifugation and washed twice
with sterile ddH
2O. Total genomic DNA was extracted by the methods of Lee and Taylor (1990).
Example 4 - Amplification of 18S Ribosomal DNA
[0053] Partial nucleotide base pair fragments of the 18S r DNA gene from each fungus was
amplified via the polymerase chain reaction (PCR) as a single fragment with the primer
UK4F (5' CYGGTTGATCCTGCCRG) and UREV(5'GYTACCTTGACGA ACTT). PCR was performed in a
50 µl reaction vial containing 0.1 µg genomic DNA, 0.4 µM each primer, 0.16 mM four
dNTPs and 5µ
Taq polymerase (Promega) in a buffer of 10 mM tris-HCl (pH 9.0 at 25 ° C), 50 mM KCl,
3 mM MgCl
2, 0.1 % Triton X-100. Amplification was for 30 cycles (45 s at 94.5 °C, 45 s at 53.5
°C, 90 at 72.5 ° C).
Example 5 - Amplification of Internal Transcribed Space sequences (ITS) and 5.8S rDNA.
[0054] The ITS regions of the test fungus was amplified using PCR and the universal ITS
primers ITS5 (5' GGAAGTAAAAGTCGTAACAAGG) and ITS4 (5' TCCTCCGCTTATTGATATGC) (White
et al., 1990). PCR was performed in a 50 µl reaction containing 0.1 µg genomic DNA,
0.4 µM each primer, 0.16 mM four dNTPs and 5u
Taq polymerase (Promega) in a buffer of 10 mM tris-HCl (pH 9.0 at 25 °C), 50 mM KCl,
3 mM MgCl
2, and 0.1 % Triton X-100. PCR cycling conditions consisted of denaturation at 94 °
C for 1.5 min, annealing at 55 °C for 2.5 min, and extension at 72 °C for 3 min for
40 cycles, with a final extension at 72 °C for 10 min (Willits, 1999). The PCR products
were gel purified and desalted using the QuickStep PCR purification kit (Edge Biosystems).
Example 6 - Searching and Comparison 18S rDNA and ITS1&2 Sequences
Muscodor albus
[0055] Both 18S rDNA and ITS 1-2 sequences of
Muscodor albus were submitted to GenBank with serial numbers AF324337 and AF324336, respectively.
These sequences were also were searched or compared with other fungal sequences under
BLAST 2.1.and a search of NCBI at the web site
www.ncbi.nlm.nih.govBLAST. Comparison and alignment sequences were done by using Clustal W version 1.7 (Thomson,
J. and Gibson T., 1997), and manually aligned afterward.
[0056] Maximum parsimony bootstrap method (Felsenstein, 1985) with heuristic search and
maximum parsimonious consensus heuristic search were performed using PAUP* (Swofford,
1999). The bootstrap analysis was set as the following: 100 replications, tree bisection-reconnection
branch swapping, and random sequence addition. All characters were weighted equally.
Reference taxa were
Taphrinales: Protomyces inouyei (GenBank serial number D11377),
Taphrina wiesneri (D12531),
T.
deformans (U00971) and
T. pruni-subcordatae (AB000957).
Muscodor roseus
[0057] Both 18S rDNA and ITS1&2 sequences of culture collection "A3-5" were submitted to
GenBank with serial number AY034664 and AY034665, respectively. While the 18S r DNA
of isolate "A-10" was assigned AYO49023. In addition, both 18S rDNA and ITS1&2 sequences
of "A3-5" also were searched or compared with other fungal sequences under BLAST 2.2.1
(Altschul et al., 1997), a search of NCBI at the web site
http:Hwww.ncbi.nlm.nih.gov/BLAST. Comparison and alignment sequences were done by using CLUSTALW version 1.7 (Thomson
and Gibson, 1997), and manually aligned afterward.
[0058] Phylogenetic analysis of the aligned 1708 bp of partial 18S rDNA sequences was performed
using the maximum parsimony analysis of the Phylogeny Using Parsimony Analysis (PAUP*)
program version 4.0b4a (Swofford, 1999). The number of parsimony-informative characters
are 190, and 1448 characters and are constant. The phylogenetic analysis was performed
on eighteen taxa, including reference taxa. The reference taxa were Traphinales:
Taphrina wiesneri (GenBank accession number
D12531), Taphrina deformans (U00971) and
Taphrina pruni-subcordatae (AB000957). The remaining fifteen species were
Muscodor albus (AF324337),
Muscodor roseus (AY034664),
Xylaria carpophila (Z49785), X. curta (U32417),
X. hypoxylon (U20378),
X. polymorpha (AB014043),
Xylaria sp. (AB014042),
Rosellinia necatrix (AB014044),
Poronia punctata (AF064052),
Daldinia concentrica (U32402),
Hypoxylon fragiforme (AB014046) and
Hypoxylon atroroseus (U32411),
Pestalosphaeria hansenii (AF242846)
Discostroma tricellular (AF346546) and
Amphisphaeria sp. (AF346545). The bootstrap analysis was set as the following: 100 replications,
tree bisection-reconnection branch swapping, random sequence addition. All characters
were weighted equally.
Example 7 - Analysis of Antibiotic Volatiles Produced by Muscodor albus
[0059] A method was devised to analyze the gases in the air space above the
M albus mycelium growing in Petri plates. A "Solid Phase Micro Extraction" syringe was used
to trap the fungal volatiles. The fiber material (Supelco) was 50/30 divinylbenzene/carburen
on polydimethylsiloxane on a stable flex fiber. The syringe was placed through a small
hole drilled in the side of the Petri plate and exposed to the vapor phase for 45
min. The syringe was then inserted into a gas chromatograph (Hewlett Packard 5890
Series II Plus) equipped with a mass-selective detector. A 30 m x 0.25 mm I.D. ZB
Wax capillary column with a film thickness of 0.50 mm was used for the separation
of the volatiles. The column was temperature programmed as follows: 25 °C for 2 min
followed to 220°C at 5°C/min. The carrier gas was Helium Ultra High Purity (local
distributor) and the initial column head pressure was 50 kPa. The He pressure was
ramped with the temperature ramp of the oven to maintain a constant carrier gas flow
velocity during the course of the separation. Prior to trapping the volatiles, the
fiber was conditioned at 240 °C for 20 minutes under a flow of helium gas. A 30 sec.
injection time was used to introduce the sample fiber into the GC. The gas chromatograph
was interfaced to a VG 70E-HF double focusing magnetic mass spectrometer operating
at a mass resolution of 1500. The MS was scanned at a rate of 0.50 sec. per mass decade
over a mass range of 35-360 amu. Data acquisition and data processing was performed
on the VG SIOS/OPUS interface and software package. Initial identification of the
unknowns produced by
M. albus was made through library comparison using the NIST database.
[0060] Comparable analyses were conducted on Petri plates containing only PDA and the compounds
obtained therefrom, mostly styrene, were subtracted from the analyses done on plates
containing the fungus. Final identification of 20/ 28 compounds was done on a comparative
basis to authentic standards using the GC/MS methods described herein. However, 8
other compounds composing only approximately 20% of the volatiles have only been tentatively
identified on the basis of the NIST data base information and were not included in
any of the bioassay tests that employed artificial mixtures of
M. albus compounds.
[0061] As a first approximation, the quantitative analysis of each compound found in fungal
cultures is based on its relative peak area obtained after GC-MS analysis. This number
was used to prepare artificial atmospheres of the
M. albus gases in the relative proportions that they occur in culture.
Example 8 - Sourcing of Fungal Volatile Compounds
[0062] The majority of the compounds produced by
M. albus were obtained from Aldrich Chem Co., however, valencene was obtained from Fluka Chem
Co. and synthetic bulnesene was obtained from Dr. Clayton Heathcock of U.C. Berkeley,
Dept of Chemistry and can be synthesized following the procedures of Heathcock and
Ratcliffe (1971).
[0063] The other esters that were not commercially available were made following some of
the acylation procedures as set forth in Hoefle, G. et al., (1978).
[0064] Propanoic acid, 2-methyl,3-methylbutyl ester. Isobutyryl chloride (2 ml 19.1 mmol) was slowly added to a 0 C solution of isoamyl
alcohol (1 ml, 9.5 mmol), 4-dimethylaminopyridine (583 mg, 4.8 mmol), and pyridine
(0.85ml, 10.5 mmol) in dichloromethane. A precipitate was evident 5 minutes after
addition was complete. After stirring 12 h under argon, the reaction was poured into
20 ml of 0.1 N HCl. The layers were separated and the aqueous layer was extracted
with 20 ml of methylene chloride. The organic layers were combined and washed with
10 ml of saturated aqueous ammonium chloride then 10 ml of saturated aqueous sodium
bicarbonate. The organic layers were dried over magnesium sulfate, filtered, and concentrated
in vacuo. Purified by distillation through a 14 mm Vigreaux column (bp 60-62 C, 25
mm). The resulting clear, colorless oil was stirred over Amberlyst 15 to remove any
remaining isobutyryl chloride.
1H NMR (250 MHz, CDCl
3) 4.09 (t, 2H, J 6.7), 2.53 (m, 1H), 1.68 (m, 1H), 1.52 (q, 2H, J 6.5), 1.16 (d, 6H,
J 7.0), 0.92 (d, 6H, J 6.5).
[0065] Propanoic acid, 2-methyl-ethyl ester. Isobutyryl chloride (2 ml 19.1 mmol) was slowly added to a 0 C solution of ethyl
alcohol (0.55 ml, 9.5 mmol), 4-dimethylaminopyridine (583 mg, 4.8 mmol), and pyridine
(0.85ml, 10.5 mmol) in dichloromethane. A precipitate was evident 5 minutes after
addition was complete. After stirring 12 h under argon, the reaction was poured into
20 ml of 0.1 N HCl. The layers were separated and the aqueous layer was extracted
with 20 ml of methylene chloride. The organic layers were combined and washed with
10 ml of saturated aqueous ammonium chloride then 10 ml of saturated aqueous sodium
bicarbonate. The organic layers were dried over magnesium sulfate, filtered, and concentrated
in vacuo. Purified by distillation through a 14 mm Vigreaux column (bp 102 C).
1H (300 MHz, CDCl
3) 4.12 (q, 2H, J 7.2), 2.52 (m, 1H), 1.25 (t, 3H, J 6.9), 1.16 (d, 6H, J 7.2).
[0066] 1-Butanol, 3 methyl, acetate. Under an atmosphere of argon, acetyl chloride (6.5 ml, 91.8 mmol) was added dropwise
to a 0 °C solution of isoamyl alcohol (5 ml, 45.9 mmol), N, N-dimethylpyridine (2.8
g, 23 mmol), and anhydrous pyridine (4.1 ml, 50.5 mol) in dichloromethane (92 ml).
The reaction mixture was poured into 100 ml of 0.1 N HCl, and the resulting layers
were separated. The organic layer was washed with 50 ml of saturated aqueous ammonium
chloride then dried over magnesium sulfate. The organic layer was filtered and concentrated
in vacuo to a clear oil. The resulting oil was purified by distillation (bp 134-136
°C) to give isoamyl acetate.
1H NMR (300 MHz, CDCl
3) 4.08 (t, 2H, J 6.9), 2.03 (s, 3H), 1.68 (m, 1H), 1.51 (q, 2H, J 6.9), 0.92 (d, 6H,
J 6.6).
Example 9 - Inhibition of Fungal and Human Pathogens by Volatiles in in vitro Petri Plate Assays
[0067] A strip of agar was removed from the middle of PDA plates, creating two approximately
equal and separate sections where microorganisms could grow, as described by Strobel
et al., 2001. One agar plug of
M. albus culture was placed on one section and grown for 10 days with the plates enclosed
in a plastic bag. After ten days, the other section was inoculated with various fungal
pathogens, with sectioned plates without
M albus serving as control. There were three plates for each treatment.
Penicillium expansum, Monilinia fructicola, Candida albicans and bacteria were applied as a spore/cell suspension, while the other pathogens were
applied as a single 3 or 6 mm mycelial plug in each plate. Pathogen growth, measured
by colony diameter, was evaluated after 3 days. Reisolation of pathogens, to evaluate
their viability, was attempted at the end of the experiments by lifting the agar in
the inoculated area and transferring it to fresh PDA plates.
[0068] The relative ability of the authenticated volatile
M. albus compounds to inhibit and kill test organisms is also shown in Table 1. Test solutions
were prepared by placing compounds in vials in the relative proportions that they
occurred in the gas phase of
M. albus cultures. The test mixture was placed in a presterilized microcup (4x6 mm) located
in the center of a Petri plate containing PDA. When not in use, the mixture was stored
at 0°C. The test organisms, freshly growing and excised on 3mm
3 agar blocks (at least 3 agar blocks per test fungus), were placed 2-3 cm from the
microcup and the plate wrapped with two layers of parafilm. Measurements were made
on mycelial growth from the edge of the agar blocks after a given time period. However,
in the case of bacteria and
Candida albicans they were streaked on the test side of the PDA plate and checked for new visible
growth and viability by restreaking from the original area of the agar plate that
had been inoculated. Appropriate controls were also set up in which no test solution
was placed into the microcup. Tests on 3.2-90 µl of the artificial mixture per 50
CC of air space above the PDA plate were done on 3 replicates in order to obtain IC
50 data for each test organism. Individual classes of compounds were also tested in
the relative amounts in which they occur at the optimum concentration of the entire
mixture which is 60µl of test mixture per 50 CC of air space above the culture in
a standard Petri plate. For instance, the esters represent 44% of the mixture of the
identified volatiles and were tested at 26.4 µl / 50 CC air space and the same procedure
was used for each of the other classes of compounds that were identified. Finally,
each individual compound, especially among the esters, was tested at the concentration
or relative percentage in which it occurs in 60µl. Viability of the test microbes
was made by aseptically removing the small agar block and placing it on a PDA plate
and observing growth after 1-3 days.
[0069] None of the pathogens, except
F.
solani and
F. oxysporum lycopersici, grew in the presence of
M. albus (Table 1) and their growth was inhibited. Both of these pathogens survived in the
presence of
M. albus, when transferred to fresh plates three days later. Also the volatiles of
M. albus did not kill
M. albus itself or its close relative
Xylaria sp., although they did inhibit the growth of
Xylaria sp. (Table 1).
Example 10
Testing of Classes of Volatile Compounds and Individual VolatileComponents in in vitro Assays
[0070] Individual classes of compounds in the natural volatiles of
M. albus were evaluated in order to determine the relative biological activity of each. Each
class of compounds, in the relative proportions that they occur, was tested at the
level of the percentages that they occur in the total 60µl/ 50CC (1.2 µl/CC) (Table
5). This was done with a selected group of 7 test fungi. Each group of compounds possessed
some inhibitory activity against the test organisms (Table 5). However, on a comparative
basis the esters had more inhibitory activity than any other group of compounds (Table
5).
[0071] Each compound in the class of esters was individually evaluated. When a comparable
test on each ester was conducted as per the conditions in Table 5, 1-butanol, 3-methyl,
acetate, almost completely mimicked the results of all esters as in Table 5. It represented
62% of all of the identified combined esters and was therefore tested at the level
of 0.32 µl/CC. Additionally, minimal inhibitory bioactivity was displayed by propionic
acid, 2-methyl, 3-methylbutyl ester and little or no activity was noted on the part
of the other esters. Although the esters, and the 1-butanol, 3 methyl-acetate had
inhibitory activity in the bioassay tests, under no conditions in any test, was death
of any test fungus observed under the standard 3 day exposure period (Table 5). This
is a significant observation, since the death of test organisms was noted in both
the complete artificial atmosphere and in the natural Petri plate atmosphere of
M albus. The result strongly suggests that an additive or synergistic mechanism is operational
in the case of the
M. albus volatiles. Thus, while each class of compounds possesses more or less inhibitory
activity, a complete mixture of the ingredients is needed to bring about death of
the test fungi and bacterium (Table 1).
[0072] Based on the fact that the volatiles of
M. albus can inhibit and kill E.
coli (Table 1) experiments were done using
M albus to determine if its gases can inhibit and kill the microflora found in human and
animal wastes such as E.
coli and other fecal microbes. These microbes commonly are the cause of dysentery and
other diseases during times of major crises including natural disasters, and wars.
Conceivably,
M. albus could be developed and used for field applications to decontaminate human and animal
wastes. Thus, according to our experiments, a two week old colony of
M albus growing on a half side of a Petri plate containing PDA was prepared. Then on the
separated other half plate was streaked (using standard microbiological methods) solid
human waste. A control plate was set up in which no colony of
M. albus was present. After two days, of incubation at 23°C, there were significantly more
bacterial and fungal colonies growing in the control plate than the plate with
M. albus. In a comparable experiment,
M. albus was incubated solely in liquid human waste (urine) and total bacterial growth was
precluded as contrasted to a control (without the
M. albus) in which bacterial growth flourished.
Example 11 - Activity of Muscodor albus Against the Soil Pathogen Rhizoctonia solani in vivo
[0073] For these experiments, the growing medium is first infested with
R. solani by adding one culture on a PDA plate to 1L of growing medium (vermiculite). This
rate allows near 100 % seedling mortality with low variability among pots.
Muscodor albus in various forms is then added to the growing medium, which is then placed in 3 inch
plastic pots. The pots are planted with approximately 70 seeds of broccoli, placed
in a tray and watered from the bottom. The seedlings are counted after approximately
one week. Controls consist of
R. solani only,
Muscodor albus only and plain growing medium. Depending on the experiment, there are 3 or 4 pots
per treatment, arranged in a completely randomized design.
[0074] A 10 day-old liquid culture of PDB was homogenized for a few seconds in a blender
and incorporated at a rate of 50 or 200 ml per L of vermiculite. The solid agar culture
treatment was done as described above, with 2 plates of 2 week-old culture per L.
The pots were sown immediately after filling. The effect of sealing the volatiles
in the pots was also investigated: for each treatment, a plastic bag was sealed over
3 pots with a rubber band while 3 other pots were left uncovered. The bags were removed
after 3 days. Results show that liquid culture applied at the higher rate (200 ml/L
of vermiculite) was as effective in preventing damping off as solid
Muscodor cultures on PDA (Table 2). The effect of
Muscodor application appears to be immediate, as normal emergence rates were obtained with
these treatments, even though there was no incubation period before planting. The
low rate of liquid culture caused some reduction in damping off, but was not as effective.
Sealing the volatiles in the pot with a plastic bag did not improve efficacy (Table
2).
Example 12 - Activity of Muscodor albus as a Postharvest Treatment of Infested Fruit
[0075] Single wounds were made with a nail on the equator of apples, cv Gala, which were
placed in plastic plates, wounded side up, in 3.8 L plastic boxes. Nine apples were
placed in each box and there were three boxes per treatment. The fruits were inoculated
with blue mold,
Penicillium expansum by pipetting 20 µl of conidial suspension (10
4/ml) into each wound either 24 hours before (pre-inoculation) or immediately before
the experiment. For the
Muscodor fumigation treatment, 140 grams of colonized rye grain were placed in the containers
which were then sealed. The control contained only inoculated fruits in sealed boxes.
They were incubated at room temperature (19-22°C). Disease was evaluated as the percentage
of infected fruits after 7, 14 and 21 days (Table 3). The treatment that was pre-inoculated
showed no infection of the apples while a very low infection rate was seen of only
7% at the 21 day rating for fruit inoculated immediately before exposing the fruit
to
Muscodor.
Example 13 - Activity of Muscodor albus Against Insects and NematodesNematode (Caenorhabditis elegans)
[0076] Plates using the moat system (Worapong et al., 2001) were inoculated on one side
with
M. albus, and on the opposite side with E.
coli, or free-living nematodes with
E. coli. Identical plates were set up without the
Muscodor. After five-days the plate without the
Muscodor had developed a large reproducing population of nematodes which crossed the moat
and were beginning to populate the opposite side of the petri dish. The
E. coli had grown to normal colony morphology on the companion plate. The
Muscodor treated plate had developed a substantial colony that was sending mycelia across
the surface of the PDA. The nematodes that were present were sluggish, yet motile.
By seven days, the
Muscodor reached the edge of the PDA and was sending mycelia into the moat of the plate with
E.
coli, and the plate with the round worms. Only a small number of living adult nematodes
were present on the agar, and their mobility was limited.
Beet armyworm (Spodoptera exigua)
[0077] Three small plastic beakers containing approximately 150 grams of autoclaved rye
seed colonized with
M. albus were placed in a plastic box (approximately 250 in
2). A companion box was set up at room temperature with out the three beakers of fungus.
Both boxes contained a petri plate of PDA with a small plug of
Rhizoctonia solani in the center, as a bioassay indicator. 96-well microtitre plates containing beet
armyworm eggs that had been overlaid onto artificial diet were introduced into each
box. After two days, the eggs in the box without the
Muscodor began to hatch, and the
R.
solani developed new mycelia. The armyworm eggs did not hatch in the box containing the
rye culture of
M albus. Moreover, the growth of
R.
solani was suppressed. After 5 days, the armyworms in the untreated box had achieved second
to third instar.
[0078] Paired microtitre plates were introduced into the boxes with armyworm larvae that
had been grown for three days on artificial diet. The plate in the
Muscodor box ceased feeding and remained stunted compared to the untreated controls. After
five days, the armyworms in the treated plate were dead.
Corn rootworm beetles, Diabrotica undecimpunctata
[0079] Paired microtitre plates were introduced into the boxes with corn rootworm eggs that
had been overlaid onto artificial diet. The eggs had just begun to hatch when the
plates were introduced into the test boxes. Approximately half of the eggs hatched
in the
Muscodor box. The remainder did not hatch, and all of the neonates were dead within two days.
The microtitre plate in the untreated control box developed a normal infestation that
progressed with 3-6 third-instar grubs per well, after one-week.
Example 14 - Treatment of Smut Infested Barley Seeds with Muscodor albus
[0080] In controlled, replicated experiments, 25 barley seeds infested with
Ustilago hordei (covered smut, Table 6) were placed in each of two agar plates with the gases of
M albus for four days and then planted in test pots in the greenhouse. After 15 weeks the
plants were harvested and evaluated for smut in the seed heads. There was 100% control
of this disease in two groups of plants that had been exposed to
M albus gases and no sign of any inhibition or damage to the plants caused by the gas treatment.
An identical number of control plants (untreated and
U. hordei infested seed) had 50% and 41 %, respectively of infected seed heads in this experiment.
Also, as expected, uninfected seed yielded plants having no diseased grains.
RESULTS AND DISCUSSION
[0081] Muscodor albus, gen. et sp. nov., is a deuteromycetous (mycelial sterilia) endophytic species bearing
molecular relatedness to the ascomyceteous group
-Xylaria. The fungus is related to
Xylariaceae by virtue of 96-98 % homology of its 18S rDNA (2089 bp) to representative members
of this group. Furthermore, ITS 1, 5.8S, and ITS2 sequences (652 bp) of
M. albus showed close relatedness to several
Xylaria spp. including
X arbuscula, X. longipes, and
X. mali at the 89-92% level. Both the 18S rDNA and the ITS 1&25.8 S rDNA are unique, and
therefore,
Muscodor is considered a taxonomically distinct genus and species. (Worapong et al., 2001)
[0082] The volatiles of
M. albus were also tested against plants inoculated with pathogenic fungi. The volatiles themselves
had no detrimental effects on higher plants that were tested. However, it was possible
to demonstrate a 100% control of covered smut of barley using the volatiles to treat
seed inoculated with
Ustilago hordei. Thus, because of the potential practical importance of volatile antibiotic producing
fungi it was deemed important to determine if other organisms in this group exist
in nature.
[0083] Using standard techniques for the isolation of endophytic fungi, as well as the use
of the volatiles of
M. albus as a selection tool in culture, at least two more volatile antibiotic producing endophytes
were isolated. These organisms were obtained from two separate tree species native
to Australia. These two fungal cultures bore similarities to
M albus in that they made no fruiting structures in culture, produced no spores, had a musty
odor and were inhibitory or lethal to many microorganisms. However, by the same token,
these organisms possessed cultural, chemical, and molecular biological characteristics
that differed from
M albus.
[0084] It has been well demonstrated that the molecular characteristics of an organism are
unique to it and it can be used to help in classification especially when critical
structures (spore production) or other features are missing. Thus, the phylogenetic
character mapping method combined with morphological data can assist in fungal identification.
Commonly, the rDNA genes are targeted for taxonomic purposes because they are highly
conserved (Bruns et al., 1991; Guarro et al., 1999 and Mitchell et al., 1995). In
addition to its 18S rDNA, the ITS1&2 sequences are also conserved. After searching
partial 18S rDNA sequences of
M. roseus "A3-5" (2055 bp) with data in GenBank under BLASTN 2.2.1, the results showed 100
% similarities with 2089 bp of
Muscodor albus (AF324337) from site 1-981, 1319-2048, and 98 % similarities with 982 bp of
Xylaria polymorpha (AB014043) and
Hypoxylon fragiforme (ABO14046), and 97 % similarities with 982 bp of
Rosellinia necatrix (AB014044). In addition, isolate "A-10" possesses 99% sequence similarity of its
18Sr DNA (2051 bp) to that of isolate "A3-5."
[0085] On the other hand, comparative analysis of the ITS 1&2 and 5.8S rDNA sequences of
M. roseus "A3-5" hit ITS 1&2 of
Muscodor albus (AF324337),
X. arbuscula CBS 452.63 (AF163029) and CBS 454.63 (AF163028),
X. enteroleuca CBS 148. (AF163033),
X. longipes CBS 148.73 (AF163038),
X. mali CBS 385.35 (AF163040),
X. cornu-damae CBS 724.69 (AF163031), at 99, 91, 91, 91, 90 and 89 % similarities, respectively.
No total identities of either partial 18S rDNA or ITS 1 &2 and 5.8S rDNA sequences
were found.
[0086] Phylogenetic analysis based on 18S sequences showed that
M. roseus is a sister group to
Muscodor albus (AF324337) with robust bootstrap confidence measured 100 % from 100 replications.
In addition, maximum parsimony analysis shows that both
M. albus and
M. roseus are more closely related to the
Xylariaceae e.g.
Xylaria spp.,
Rosellinia necatrix (AB014044) and
Poronia punctata (AF064052) than to three representative genera of Amphishaeriaceae:
Pestalosphaeria hansenii (AF242846),
Discostroma tricellular (AF346546) and
Amphisphaeria sp. (AF346545) with bootstrap confidence measured at 68 % from 100 replications (Felsenstein,
1985). This result was also supported by a strict consensus heuristic search phylogenic
tree of 30 equally most parsimonious 18s rDNA cladograms. Therefore,
M. roseus should be placed in the family Xylariaceae, Xylariales. Moreover, the results of
the comparison both the 18S rDNA and the ITS 1&2 and 5.8S rDNA of
M. roseus "A3-5" possess high similarities to
M. albus (Worapong et al., 2001). Also, the molecular biological data (18Sr DNA) suggests
that both isolates "A3-5"and "A-10" of
M. roseus should be considered closely related, and virtually identical organisms. Furthermore,
the molecular biological data provides some support of the concept for the division
of
M. albus, previously described, from this proposed new fungal species-
M. roseus.
[0087] While the molecular biology of
M. roseus shows that this organism has the best fit into the group - Xylariaceae, it also demonstrates
close 18Sr DNA relatedness to
M. albus. However, because there is such relatedness at the limited r-DNA molecular level,
it may be argued that the two fungi are identical. Nevertheless, other chemical characters
in both
M. albus and
M. roseus were examined and discovered to be different. Thus, while both
M. albus and
M. roseus shared the biochemical ability of producing a musty smelling odor, which has been
demonstrated to have powerful antibiotic properties, many of the volatiles produced
by these two organisms were identical as measured by GC/MS. It has been often noted
that fungi do produce a variety of odorous substances, but the impressive antibiotic
properties of
Muscodor spp. seems to be unique (Bjurman et al., 1992; Rapoir et al., 2000 and Schnurer et
al., 1999). However, the volatiles of these two fungi also contained different compounds
(Strobel et al., 2001). As an example,
M. albus produced 2-nonanone, caryophyllene, and acetic acid 2-phenylethyl ester, while these
compounds were not detected in either isolate of
M. roseus. On the other hand, both isolates of
M. roseus made compounds not detected in
M. albus volatiles, such as 2-butenoic acid, ethyl ester; 1,2,4, trimethyl benzene and 2,3
nonadiene. This result lends some chemical support to the assignment given in this
report suggesting that
M. albus is taxonomically distinct from
M. roseus.
[0088] Other, more classical features of
M. roseus (isolates"A3-5" and "A-10") were also examined and compared to
M. albus. These isolates of
M. roseus produced a slow growing, dense, lightly rose colored mycelium on all media tested.
This contrasts to
M. albus that produces a whitish mycelium on all comparable media tested (Worapong et al.,
2001). No spores formed on any medium including ones containing the host plant material
or carnation leaves. Hyphae varied in diameter (0.8-3.6 µm) and were often intertwined
to make more complex structures and even hyphal coils. These hyphae were generally
bigger than those of
M. albus. The mycelia of
M. roseus generally make more complex intertwined structures in culture than
M. albus. In fact, the appearance of hyphal coils of fungi in culture is not common, in our
experience, and yet these structures often appeared in
M. roseus cultures.
[0089] Finally it is to be noted that for
M. roseus, the best storage condition was after drying on filter paper and placement at -70°C.
Under these conditions the fungus remains viable for over 1.5 years. Also, this fungus
could be stored at 4°C in sterile water but with less certainty of recovering a viable
organism after 6 months. Also, storage in 15 % glycerol at -70°C effectively preserved
the viability of the organism.
References
[0090]
- 1. Altschul, S. F., et al. (1997). Nucleic Acids Res. 25: 3389-3402.
- 2. Bacon C.W. and White JR. J.F. Microbial Endophytes. Marcel Dekker Inc., New York.
- 3. Bjurman J. and Kristensson, J. (1992) Mycopathologia 118: 173.
- 4. Bruns, T. D., et al. (1991). Annu. Rev. Ecol. Syst. 22: 525-564.
- 5. Dennis, C. & Webster, J. (1971) Trans. Br. Mycol. Soc. 57: 41-48
- 6. Felsenstein, J. (1985). Evolution 39: 783-791.
- 7. Guarro, J., et al. (1999). Clinical Microbiology Reviews, 12: 454-500.
- 8. Hawksworth, D.C. and Rossman, A.Y. (1987) Phytopath. 87: 888.
- 9. Heathcock, R. and Ratcliffe, R. (1971). J. Am. Chem. Soc. 93: 1746.
- 10. Hoefle, G. et al., (1978) Vorbrueggen, Agnew. Chem., Int. Ed. Engl. 17: 569.
- 11. Lee, S. B. and Taylor, J. W. (1990). In PCR Protocols A Guide to Methods and Applications.
Edited by Innis, M. A., Gelfand, D. H., Sninsky J. J., White, T. J. Academic Press,
Inc., California: pp. 282-287.
- 12. Li, J.Y. et al., (2000), Org. Lett. 2: 767.
- 13. Li, J.Y. et al., (2001), Phytochem. 56: 463.
- 14. Mitchell, J. I., et al. (1995). Mycologist 9: 67-75.
- 15. Nelson, P.V. (1998) Greenhouse Operation and Management 5th ed. Prentice-Hall.
- 16. Rapior, S., et al. (1995). Mycologia 92: 305-308.
- 17. Rapior, S. (2000), Mycologia 92: 305.
- 18. Schnürer, J., et al. (1999). Fungal Genetics and Biology 27: 209-217.
- 19. Schnurer, J. et al., (1999), Fungal Genetics and Biology 27: 209.
- 20. Stierle, A. et al., (1993), Science 260: 214.
- 21. Strobel, G.A. et al., (2001), Microbiol. 147: 2943-2950.
- 22. Strobel, G. A., et al. (1996). Microbiology 142: 435-440.
- 23. Strobel, G. A., et al. (2000). Mycotaxon. 76: 257-266.
- 24. Swofford, D. L. (1999). Phylogenetic Analysis Using parsimony (*and Other Methods).
Version 4.0d64. Sunderland, MA: Sinauer Associates.
- 25. Thomson, J. and Gibson T. (1997). Clustal V. Multiple Sequence Alignments. In: Documentation
(Installation and Usage) European Molecular Biology Laboratory Postfach Germany: 1-37.
- 26. White, T. J., et al. (1990). Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. In PCR Protocols: A guide to Methods and Applications.
Edited by Innis, M. A., Gelfand, D. H., Sninsky J. J., White, T. J. Academic Press,
Inc., California: 315-324.
- 27. Willits, D. A. and Sherwood, J. E. (1999). Phytopath. 89: 212-217.
- 28. Worapong, J. et al. (2001). Mycotaxon. 79: 67-69.
- 29. Yang, X. et al., (1994), Plant Science 102:1.
Table 1. The effects of the volatile compounds of M. albus and an artificial mixture of M. albus compounds on a group of test microbes.
| Test Microbe |
% Growth over control after a 2 day exposure to M.albus |
Viability after 3 days exposure to M albus culture |
IC50 in artificial atmosphere for 2days (µl/CC) |
% Growth (mm) over control in artificial atmosphere |
Viability after 3 days exposure artificial atmosphere |
| Pythium ultimum |
0 |
Dead |
0.48±0.01 |
0 |
Dead |
| Phytophthora cinnamoni |
0 |
Dead |
0.29±0.06 |
0 |
Dead |
| Penicillium expansum |
0 |
Dead |
# |
# |
# |
| Rhizoctonia solani |
0 |
Dead |
0.08±0.02 |
0 |
Dead |
| Ustilago hordei |
0 |
Dead |
0.31±0.09 |
0 |
Dead |
| Stagnospora nodorum |
0 |
Dead |
0.15±0 |
0 |
Dead |
| Sclerotinia sclerotiorum |
0 |
Dead |
0.17±0.05 |
0 |
Alive |
| Scerotinia minor |
0 |
Dead |
# |
# |
# |
| Aspergillus fumigatus |
0 |
Dead |
0.41±0.05 |
0 |
Alive |
| Monilinia fructicola |
0 |
Dead |
# |
# |
# |
| Fusarium solani |
19.4±0.284 |
Alive |
1.13±0.07 |
42.0 ±2 |
Alive |
| Fusarium oxysporum |
4 |
Alive |
# |
# |
# |
| Verticillum dahliae |
0 |
Dead |
0.3±0 |
0 |
Dead |
| Cercospora beticola |
17.5± 3.5 |
Alive |
0.12±0.15 |
8±2 |
Alive |
| Tapesia yallundae |
0 |
Dead |
0.64±0 |
0 |
Dead |
| Xylaria sp. |
25±0 |
Alive |
0.41±0.03 |
0 |
Alive |
| Muscodor albus |
100±0 |
Alive |
0.6±0 |
17.5±7.5 |
Alive |
| Escherichia coli |
0 |
Dead |
# |
0 |
Dead |
| Staphlococcus aureus |
0 |
Dead |
# |
0 |
Dead |
| Micrococcus luteus |
0 |
Dead |
# |
0 |
Dead |
| Candida albicans |
0 |
Dead |
# |
Trace |
Alive |
| Bacillus subtilus |
0 |
Alive |
# |
0 |
Alive |
| Legend: *The amount of each positively identified compound used in the artificial mixture
was obtained by applying the electron ionization cross section (% of the total area)
of the compound obtained in the GC/MS analysis. The artificial mixtures were subsequently
tested by placing them in a pre-sterilized microcup (4x6 mm) located in the center
of a test Petri plate containing PDA. Agar plugs containing freshly growing test microbes
(or streaked microbes) were positioned about 2-3 cm from the center microcup. Then
the plate was wrapped with 2 layers of parafilm and incubated for two or more days
at 23°C. Measurements of linear mycelial growth were made from the edge of the inoculum
agar plug to the edge of the mycelial colony. # Not measured in this experimental
design. |
Table 2. Average number of broccoli seedlings per pot one week after planting (means
± standard deviation) using vermiculite.
| Muscodor treatment |
Non-infested |
Rhizoctonia-infested |
| Unsealed pots |
|
|
| Check |
65 ± 1 |
1 ± 1 |
| Liquid: 50 ml/L |
64 ± 11 |
39 ± 11 |
| Liquid: 200 ml/L |
61 ± 8 |
63 ± 15 |
| PDA culture |
62 ± 5 |
68 ± 1 |
| |
|
|
| Sealed pots |
|
|
| Check |
65 ± 1 |
1 ± 1 |
| Liquid: 50 ml/L |
59 ± 3 |
31 ± 19 |
| Liquid: 200 ml/L |
57 ± 2 |
66 ± 11 |
| PDA culture |
62 ± 6 |
62 ± 10 |
Table 3. Percent of apples infected with blue mold (Penicillium expansum) after 7,14 and 21 days, comparing pre-inoculation with blue mold to inoculation immediately
before exposure to Muscodor. Untreated controls were not exposed to Muscodor.
| Treatments |
7 days |
14 days |
21 days |
| Untreated Control |
100 |
100 |
100 |
| Muscodor |
0 |
0 |
7 + 13 |
| 24 hour pre-inoc |
|
|
|
| Untreated Control |
100 |
100 |
100 |
| Muscodor |
0 |
0 |
0 |
| a: standard deviations are high due to small number of fruits. |
Table 4. GC/MS analysis of the volatile compounds produced by M. albus.
| RT |
Total Area (%) |
M/z |
Possible compound |
MW |
| 3:45 |
0.33 |
114 |
Octane |
114 |
| 4:19 |
0.93 |
58 |
Acetone |
58 |
| 4:37 |
0.68 |
74 |
Methyl acetate |
74 |
| 5:56 |
7.63 |
88 |
Ethyl acetate |
88 |
| 6:51 |
0.31 |
102 |
Propanoic acid, 2-methyl, methyl ester |
102 |
| 7:16 |
6.24 |
* |
Ethanol |
46 |
| 8:03 |
2.07 |
116 |
Propanoic acid, 2-methyl-ethyl ester |
116 |
| 11:45 |
0.58 |
* |
Propanoic acid, 2-methyl 2-methylpropyl ester |
144 |
| 12:05 |
2.06 |
74 |
Isobutyl alcohol |
74 |
| 12:50 |
22.24 |
* |
1-butanol, 3-methyl, acetate |
130 |
| 14:57 |
1.53 |
* |
Propanoic acid, 2-methyl, 3-methylbutyl ester |
158 |
| 15:28 |
22.99 |
* |
1-butanol, 3-methyl- |
88 |
| 16:08 |
0.29 |
138 |
#Furan, 2-pentyl- |
138 |
| 18:53 |
0.29 |
142 |
#4-nonanone |
142 |
| 20:38 |
0.41 |
142 |
2-nonanone |
142 |
| 21:07 |
0.30 |
204 |
# Naphthalene, decahydro-4a-methyl-1-methylene-7-(1-methylethylidene)-, (4aR-trans)- |
204 |
| 22:54 |
1.51 |
204 |
# Azulene, 1,2,3,4,5,6,7,8-octahydro-1,4-dimethyl-7-(1-methylethenyl)-,[1S-(1.alpha.,4.alpha.,7.alpha.)] |
204 |
| 23:16 |
0.94 |
204 |
# Cyclohexene, 4-(1,5-dimethyl-1,4-hexadienyl)-1-methyl- |
204 |
| 25:20 |
3.63 |
204 |
# 1H-3a,7-methanoazulene, 2,3,4,7,8,8a-hexahydro-3,6,8,8 tetramethyl-, [3R-(3.alpha.,
3a.beta.,7.beta.,8a.alpha.)] |
204 |
| 25:30 |
6.08 |
88 |
Propanoic acid, 2-methyl |
88 |
| 26:04 |
0.48 |
204 |
Caryophyllene |
204 |
| 27:55 |
0.34 |
204 |
# Naphthalene, 1,2,4a,5,6,8a-hexahydro-4,7-dimethyl-1-(1-methylethyl)-, [1R-(1.alpha.,
4a.alpha.,8a.alpha.)] |
204 |
| 28:34 |
0.36 |
204 |
# Spiro[5.5]undec-2-ene,3,7,7-trimethyl-11-methylene |
204 |
| 28:50 |
1.07 |
204 |
Azulene, 1,2,3,5,6,7,8, 8a-octahydro-1, 4-dimethyl-7- (1-methylethyenyl)-, [1S-(1.alpha.,7.alpha.,8a.beta.)]
Common Name: Bulnesene |
204 |
| 28:57 |
3.24 |
204 |
Naphthalene, 1,2,3,5,6,7,8,8a-octahydro-1,8a-dimethyl-7-(1-methylethenyl)-,[1R-(1.alpha.,7.beta.,8a.alpha.)]
Common Name: Valencene |
204 |
| 31:12 |
1.74 |
* |
Acetic acid,2-phenylethyl ester |
164 |
| 33:17 |
1.06 |
122 |
Phenylethyl alcohol |
122 |
| 39:00 |
9.76 |
204 |
Unknown |
204 |
* No molecular-ion peak was observed in the spectrum of either the standard compound
or the compound undergoing the analysis.
# Denotes that a spectrum and retention time of this component was observed and the
substance matched to the most likely compound in the NIST data base, but the data
have not been confirmed by use of an appropriate identical standard compound by either
retention time or MS. These compounds were not placed in the artifical mixture in
the bioassay test. |
Table 5. The inhibitory influence of each class of volatile compounds is expressed
as the % of the test microbe growth as compared to a control not in the presence of
the test compounds.
| Test Microbe# |
Alcohols 0.48 µl/cc % growth of control |
Esters 0.53 µl/cc % growth of control |
Ketones 0.02 µl/cc % growth of control |
Acids 0.09 µl/cc % growth of control |
Lipids 0.08µl/cc % growth of control |
| Pythium ultimum |
11.2 ± 4 |
0 |
67.5 ± 7 |
40.9 ± 3 |
75 ± 0 |
| Rhizoctonia solani |
55± 5 |
0 |
67.5±7.5 |
67.5±7.5 |
40±0 |
| Tapesia yallundae |
35±15 |
0 |
75 ± 25 |
100± 0 |
100±0 |
| Xylaria sp. |
75±25 |
0 |
100±0 |
100±0 |
100±0 |
| Sclerotinia sclerotiorum |
29±3 |
8.1±1.5 |
20.6±12 |
40±0 |
78±2 |
| Cercospora beticola |
58±8 |
5 ± 5 |
100±0 |
83±17 |
100±0 |
| Fusarium solani |
70±10 |
55± 5 |
90±10 |
80±20 |
80±10 |
*All measurements of mycelial growth compared to the untreated control were made as
described in Table 1.
#None of the microbes were killed after a three day exposure to any of the artificial
test mixtures given on this table. |
Table 6. Number of Barley Seeds Heads Infected within Ustilago hordei with and without Muscodor albus Pre-treatment.
| Treatment |
Ratio of Diseased to Healthy Plants |
| |
Expt 1 |
Expt 2 |
| No treatment |
16/32 |
13/31 |
| M. albus volatiles |
0/33 |
0/42 |
| Uninfested control |
0/41 |
0/39 |
SEQUENCE LISTING
[0091]
<110> Strobel, Gary
Manker, Denise
<120> NOVEL ENDOPHYTIC FUNGI AND METHODS OF USE
<130> AQ 2019.40
<140> Unknown
<141> 2002-04-11
<150> 60/283,902
<151> 2002-03-11
<150> 60/363,072
<151> 2001-04-16
<160> 4
<170> FastSEQ for windows version 4.0
<210> 1
<211> 2089
<212> DNA
<213> Muscodor albus
<400> 1

<210> 2
<211> 652
<212> DNA
<213> Muscodor albus
<400> 2

<210> 3
<211> 2055
<212> DNA
<213> Muscodor roseus
<400> 3

<210> 4
<211> 650
<212> DNA
<213> Muscodor roseus
<400> 4


1. A method for identifying Muscodor fungi, comprising contacting an effective amount of the fungi to be screened with
volatiles of Muscodor albus or Muscodor roseus under culturing conditions, selecting fungi resistant to the volatiles of the Muscodor albus or Muscodor roseus, and analyzing the molecular characteristics of the selected fungi.
2. An isolated Muscodor fungus obtainable by the method as defined in claim 1.
3. The isolated Muscodor fungus of claim 2, wherein the fungus is selected from the group consisting of Muscodor albus, Muscodor roseus and mutants thereof.
4. A composition comprising an isolated Muscodor fungus according to claim 2 or 3.
5. A composition comprising all the volatiles produced by an isolated Muscodor fungus, wherein the volatiles comprise octane, acetone, methyl acetate, ethyl acetate,
2-methyl propanoic acid methyl ester, ethanol, 2-methyl propanoic acid ethyl ester,
2-methyl propanoic acid 2-methylpropyl ester, isobutyl alcohol, 1-butanol-3-methyl-acetate,
2-methyl propanoic acid 3-methylbutyl ester, 1-butanol-3-methyl, 2-pentyl furan, 4-nonanone,
2-nonanone, (4aR-trans)-decahydro-4a-methyl-1-methylene-7-(1-methylethylidene)-naphthalene,
1,2,3,4,5,6,7,8-octahydro-1,4-dimethyl-7-(1-methylethenyl)-[1S-(1.alpha., 4.alpha.,
7.alpha.)]-azulene, 4-(1,5-dimethyl-1,4-hexadienyl)-1-methyl-cyclohexene, 2,3,4,7,8,8a-hexahydro-3,6,8,8-tetramethyl-[3R-(3.alpha.,
3a.beta., 7.beta., 8a.alpha.)]-1H-3a,7-methanoazulene, 2-methyl propanoic acid, caryophyllene,
1,2,4a,5,6,8a-hexahydro-4,7-dimethyl-1-(1-methylethyl)-[1R-(1.alpha.. 4a.alpha., 8a.alpha)]-naphthalene,
3,7,7-trimethyl-11-methylene-spiro[5.5]undec-2-ene, 1,2,3,5,6,7,8,8a-octahydro-1,4-dimethyl-7-(1-methylethyenyl)-[1
S-(1.alpha., 7.alpha., 8a.beta.)]-azulene, 1,2,3,5,6,7,8,8a-octahydro-1,8a-dimethyl-7-(1-methylethenyl)-[1R-(1.alpha.,
7.beta., 8a.alpha.)]-naphthalene, acetic acid 2-phenylethyl ester, and phenylethyl
alcohol.
6. The composition of claim 4, further comprising a carrier.
7. The composition of claim 6, wherein the carrier is an agriculturally-acceptable carrier.
8. The composition of any of claims 4-7, further comprising an agriculturally effective
amount of a composition selected from the group consisting of a fungicide, an insecticide,
an antimicrobial, a bactericide, a nematicide, and a food preservative.
9. A non-therapeutic method of inhibiting the growth of an organism selected from the
group consisting of a fungus, a bacteria, a microorganism, a nematode and an insect,
comprising exposing the organism to an effective amount of the composition of any
of claims 4-7.
10. The method of claim 9 for treating or protecting fruit, plants, seeds, grain or the
soil surrounding the plants from an infestation by an organism selected from the group
consisting of a fungus, a bacteria, a microorganism, a nematode and an insect.
11. The method of claim 9 for treating or protecting building material from toxic mold
infestations.
12. The method of claim 10, further comprising exposing the fruit, plants, seeds, grain
or the soil surrounding the plants to an effective amount of an agricultural composition
selected from the group consisting of a fungicide, an insecticide, an antimicrobial,
a bactericide, a nematicide, and a food preservative.
13. A method for obtaining a volatile composition of an isolated Muscodor fungus according to claim 2, comprising culturing the isolated Muscodor fungus and collecting the volatile composition produced by the growing fungus.
1. Ein Verfahren zur Identifizierung eines Muscodor Pilzes, das das In-Kontakt-bringen einer wirksamen Menge des zu überprüfenden Pilzes
mit leicht flüchtigen Anteilen von Muscodor albus oder Muscodor roseus unter Kultivierungsbedingungen, Auswählen von Pilzen, die gegenüber den leicht flüchtigen
Anteilen des Muscodor albus oder Muscodor roseus resistent sind, und Analysieren der molekularen Charakteristika der ausgewählten
Pilze, umfasst.
2. Ein isolierter Muscodor Pilz, der durch das wie in Anspruch 1 definierte Verfahren erhältlich ist.
3. Der isolierte Muscodor Pilz nach Anspruch 2, wobei der Pilz aus der Gruppe, die aus Muscodor albus, Muscodor roseus oder Mutationen davon besteht, ausgewählt wird.
4. Eine Zusammensetzung, die einen isolierten Muscodor Pilz gemäß Anspruch 2 oder 3 umfasst.
5. Eine Zusammensetzung, die all die leicht flüchtigen Anteile, die von einem isolierten
Muscodor Pilz erzeugt werden, umfasst, wobei die leicht flüchtigen Anteile Oktan, Aceton,
Methylacetat, Ethylacetat, 2-Methylpropansäuremethylester, Ethanol, 2-Methylpropansäureethylester,
2-Methylpropansäure-2-methylpropylester, Isobutylalkohol, 1-Butanol-3-methylacetat,
2-Methylpropansäure-3-methylbutylester, 1-Butanol-3-methyl, 2-Pentylfuran, 4-Nonanon,
2-Nonanon, (4aR-trans)-Decahydro-4a-methyl-1-methylene-7-(1-methylethyliden)-napthalen,
1,2,3,4,5,6,7,8-Octahydro-1,4-dimethyl-7-(1-methylethenyl)-[1S-(1.alpha, 4.alpha,
7-alpha)]-azulen, 4-(1,5-Dimethyl-1,4-hexadienyl)-1-methylcyclohexen, 2,3,4,7,8,8a-Hexyhydro-3,6,8,8-tetramethyl-[3R-(3.alpha,
3a.beta, 7.beta, 8a.alpha)]-1H-3a,7-methanoazulen, 2-Methylpropansäure, Caryophyllen,
1,2,4a,5,6,8a-Hexahydro-4,7-dimethyl-1-(1-methylethyl)-[1R-(1.alpha, 4a.alpha, 8a.alpha)]-napthalen,
3,7,7-Trimethyl-11-methylen-spiro[5.5]undec-2-en, 1,2,3,5,6,7,8,8a-Octahydro-1,4-dimethyl-7-(1-methylethenyl)-[1S-(1.alpha,
7.alpha, 8a.beta)]-azulen, 1,2,3,5,6,7,8,8a-Octahydro-1,8a-dimethyl-7-(1-methylethenyl)-[1R-(1.alpha,
7.beta, 8a.alpha)]-napthalen, Essigsäure-2-phenylethylester und Phenylethylalkohol
umfassen.
6. Die Zusammensetzung nach Anspruch 4, die weiter einen Träger umfasst.
7. Die Zusammensetzung nach Anspruch 6, wobei der Träger ein landwirtschaftlich-geeigneter
Träger ist.
8. Die Zusammensetzung nach einem der Ansprüche 4-7, die weiter eine landwirtschaftlich
wirksame Menge einer Zusammensetzung umfasst, die aus der Gruppe, die aus einem Fungizid,
einem Insektizid, einer antimikrobiellen Substanz, einem Bakterizid, einem Nematizid
und einem Nahrungsmittelkonservierungsstoff besteht, ausgewählt wird.
9. Ein nicht-therapeutisches Verfahren zur Inhibierung des Wachstums eines Organismus,
der aus der Gruppe, die aus einem Pilz, einem Bakterium, einem Mikroorganismus, einer
Nematode und einem Insekt besteht, ausgewählt wird, das das Aussetzen des Organismus
gegenüber einer wirksamen Menge der Zusammensetzung nach einem der Ansprüche 4-7 umfasst.
10. Das Verfahren nach Anspruch 9 zum Behandeln oder Schützen von Früchten, Pflanzen,
Samen, Getreide oder der Erde, die die Pflanzen umgibt, gegenüber einer Infestation
durch einen Organismus, der aus der Gruppe, die aus einem Pilz, einem Bakterium, einem
Mikroorganismus, einer Nematode und einem Insekt besteht, ausgewählt wird.
11. Das Verfahren nach Anspruch 9 zum Behandeln oder Schützen von Baumaterial gegenüber
toxischen Schimmelpilzinfestationen.
12. Das Verfahren nach Anspruch 10, das weiter das Aussetzen der Früchte, Pflanzen, Samen,
Getreide oder der Erde, die die Pflanzen umgibt, gegenüber einer wirksamen Menge einer
landwirtschaftlichen Zusammensetzung, die aus der Gruppe, die aus einem Fungizid,
einem Insektizid, einer antimikrobiellen Substanz, einem Bakterizid, einem Nematizid
und einem Nahrungsmittelkonservierungsstoff besteht, ausgewählt wird, umfasst.
13. Ein Verfahren zum Erhalten einer leicht flüchtigen Zusammensetzung eines isolierten
Muscodor Pilzes gemäß Anspruch 2, das das Kultivieren des isolierten Muscodor Pilzes und das Sammeln der leicht flüchtigen Zusammensetzung, die von dem wachsenden
Pilz erzeugt wird, umfasst.
1. Procédé d'identification de champignons Muscodor, comprenant les étapes consistant à mettre en contact une quantité efficace des champignons
destinés à être criblé avec des éléments volatils de Muscodor albus ou Muscodor roseus dans des conditions de mise en culture, choisir des champignons résistants aux éléments
volatiles de Muscodor albus ou Muscodor roseus, et analyser les caractéristiques moléculaires des champignons sélectionnés.
2. Champignon Muscodor isolé susceptible d'être obtenu par le procédé tel que défini dans la revendication
1.
3. Champignon Muscodor isolé selon la revendication 2, où le champignon est choisi parmi le groupe consistant
en Muscodor albus, Muscodor roseus et des mutants de ceux-ci.
4. Composition comprenant un champignon Muscodor isolé selon la revendication 2 ou 3.
5. Composition comprenant tous les éléments volatils produit par un champignon Muscodor isolé, où les éléments volatils comprennent l'octane, l'acétone, l'acétate de méthyle,
l'acétate d'éthyle, l'ester méthylique de l'acide 2-méthyl propanoïque, l'éthanol,
l'ester éthylique de l'acide 2-méthyl propanoïque, l'ester méthylpropylique de l'acide
2-méthyl propanoïque, l'alcool isobutylique, le 1-butanol-3-méthylacétate, l'ester
3-méthylbutylique de l'acide 2-méthyl propanoïque, le 1-butanol-3-méthyle, le 2-pentyl
furane, le 4-nonanone, le 2-nonanone, le (4aR-trans)-décahydro-4a-méthyl-1-méthylène-7-(1-méthyléthylidène)-naphthalène,
le 1,2,3,4,5,6,7,8-octahydro-1,4-diméthyl-7-(1-méthyléthènyl)-[1S-(1.alpha., 4.alpha.,
7.alpha.)]-azulène, le 4-(1,5-diméthyl-1,4-hexadiényl)-1-méthyl-cyclohexène, le 2,3,4,7,8,8a-hexahydro-3,6,8,8-tétraméthyl-(3R-(3.alpha.,
3a.bêta., 7.bêta., 8a.alpha.)]-1H-3a,7-méthanoazulène, l'acide 2-méthyl propanoïque,
le caryophyllène, le 1,2,4a,5,6,8a-hexahydro-4,7-diméthyl-1-(1-méthyléthyl)-[1R-(1.alpha.,4a.alpha.,8a.alpha)]-naphtalène,
le 3,7,1-triméthyl-1 1-méthylène-spiro[5.5]-undéc-2-ène, le 1,2,3,5,6,7,8,8a-octahydro-1,4-diméthyl-7-(1-méthyléthylènnyl)-[1
S-(1.alpha., 7.alpha., 8a.bêta.)]-azulène, le 1,2,3,5,6,7,8,8a-octahydro-1,8a-diméthyl-7-(1-méthyléthényl)-[1R-(1.alpha.,7.bêta.,
8a.alpha.)]-naphtalène, le 2-phényléthyl ester d'acide acétique, et l'alcool phényléthylique.
6. Composition selon la revendication 4, comprenant en outre un véhicule.
7. Composition selon la revendication 6, où le véhicule est un véhicule acceptable de
manière agricole.
8. Composition selon l'une quelconque des revendications 4 à 7, comprenant en outre une
quantité efficace de manière agricole d'une composition choisie parmi le groupe consistant
en un fongicide, un insecticide, un antimicrobien, un bactéricide, un nématicide,
et un conservateur alimentaire.
9. Procédé non thérapeutique d'inhibition de la croissance d'un organisme choisi parmi
le groupe consistant en un champignon, une bactérie, un micro-organisme, un nématode
et un insecte, comprenant l'étape consistant à exposer l'organisme à une quantité
efficace de la composition selon l'une quelconque des revendications 4 à 7.
10. Procédé selon un revendication 9 destiné à traiter ou protéger des fruits, des plantes,
des semences, du grain ou le sol entourant les plantes d'une infestation par un organisme
choisi parmi le groupe consistant en un champignon, une bactérie, un micro-organisme,
un nématode et un insecte.
11. Procédé selon la revendication 9 destiné à traiter ou protéger un matériau de construction
d'infestations de moisissures toxiques.
12. Procédé selon la revendication 10, comprenant en outre l'étape consistant à exposer
les fruits, les plantes, les graines, le grain ou le sol entourant les plantes d'une
quantité efficace d'une composition agricole choisie parmi le groupe consistant en
un fongicide, un insecticide, un antimicrobien, un bactéricide, un nématicide, et
un conservateur alimentaire.
13. Procédé pour obtenir une composition volatile d'un champignon Muscador isolé selon la revendication 2, comprenant l'étape consistant à mettre en culture
le champignon Muscodor isolé et à recueillir la composition volatile produite par le champignon Muscodor en croissance.