Field of the invention
[0001] The present invention relates to the field of biotechnology. In particular the present
invention provides a method for the high throughput separation and detection of nucleotide
sequences, and the use of the method in the discrimination and identification of target
sequence such as single nucleotide polymorphisms. The invention further provides for
probes that are capable of hybridising to the target sequence of interest, primers
for the amplification of ligated probes, use of these probes and primers in the identification
and/or detection of nucleotide sequences that are related to a wide variety of genetic
traits and genes and kits of primers and/or probes suitable for use in the method
according to the invention.
Background of the invention
[0002] There is a rapidly growing interest in the detection of specific nucleic acid sequences.
This interest has not only arisen from the recently disclosed draft nucleotide sequence
of the human genome and the presence therein, as well as in the genomes of many other
organisms, of an abundant amount of single nucleotide polymorphisms (SNP), but also
from marker technologies such as AFLP. The recognition that the presence of single
nucleotide substitutions (and other types of genetic polymorphisms such as small insertion/deletions;
indels) in genes provide a wide variety of information has also attributed to this
increased interest. It is now generally recognised that these single nucleotide substitutions
are one of the main causes of a significant number of monogenically and multigenically
inherited diseases, for instance in humans, or are otherwise involved in the development
of complex phenotypes such as performance traits in plants and livestock species.
Thus, single nucleotide substitutions are in many cases also related to or at least
indicative of important traits in humans, plants and animal species.
[0003] Analysis of these single nucleotide substitutions and indels will result in a wealth
of valuable information, which will have widespread implications on medicine and agriculture
in the widest possible terms. It is for instance generally envisaged that these developments
will result in patient-specific medication. To analyse these genetic polymorphisms,
there is a growing need for adequate, reliable and fast methods that enable the handling
of large numbers of samples and large numbers of (predominantly) SNPs in a high throughput
fashion, without significantly compromising the quality of the data obtained.
[0004] Even though a wide diversity of high-throughput detection platforms for SNPs exist
at present (such as fluorometers, DNA microarrays, mass-spectrometers and capillary
electrophoresis instruments), the major limitation to achieve cost-effective high
throughput detection is that a robust and efficient multiplex amplification technique
for non-random selection of SNPs is currently lacking to utilise these platforms efficiently,
which results in suboptimal use of these powerful detection platforms and/or high
costs per datapoint. "Throughput" as used herein, defines a relative parameter indicating
the number of samples and target sequences that can be analysed per unit of time.
[0005] Specifically, using common amplification techniques such as the PCR technique it
is possible to amplify a limited number of target sequences by combining the corresponding
primer pairs in a single amplification reaction but the number of target sequences
that can be amplified simultaneously is small and extensive optimisation may be required
to achieved similar amplification efficiencies of the individual target sequences.
One of the solutions to multiplex amplification is to use a single primer pair for
the amplification of all target sequences, which requires that all targets must contain
the corresponding primer-binding sites. This principle is incorporated in the AFLP
technique (
EP-A 0 534 858). Using AFLP, the primer-binding sites result from a digestion of the target nucleic
acid (i.e. total genomic DNA or cDNA) with one or more restriction enzymes, followed
by adapter ligation. AFLP essentially targets a random selection of sequences contained
in the target nucleic acid. It has been shown that, using AFLP, a practically unlimited
number of target sequences can be amplified in a single reaction, depending on the
number of target sequences that contain primer-binding region(s) that are perfectly
complementary to the amplification primers. Exploiting the use of single primer-pair
for amplification in combination with a non-random method for SNP target selection
and efficient use of a high throughput detection platform may therefore substantially
increase the efficiency of SNP genotyping, however such technology has not been provided
in the art yet.
[0006] One of the principal methods used for the analysis of the nucleic acids of a known
sequence is based on annealing two probes to a target sequence and, when the probes
are hybridised adjacently to the target sequence, ligating the probes. The OLA-principle
(Oligonucleotide Ligation Assay) has been described, amongst others, in
US 4,988,617 (Landegren et al.) and in
WO01/06012. This publication discloses a method for determining the nucleic acid sequence in
a region of a known nucleic acid sequence having a known possible mutation. To detect
the mutation, oligonucleotides are selected to anneal to immediately adj acent segments
of the sequence to be determined. One of the selected oligonucleotide probes has an
end region wherein one of the end region nucleotides is complementary to either the
normal or to the mutated nucleotide at the corresponding position in the known nucleic
acid sequence. A ligase is provided which covalently connects the two probes when
they are correctly base paired and are located immediately adjacent to each other.
The presence or absence of the linked probes is an indication of the presence of the
known sequence and/or mutation.
[0007] Abbot
et al. in
WO 96/15271 developed a method for a multiplex ligation amplification procedure comprising the
hybridisation and ligation of adjacent probes. These probes are provided with an additional
length segment, the sequence of which, according to Abbot
et al., is unimportant. The deliberate introduction of length differences intends to facilitate
the discrimination on the basis of fragment length in gel-based techniques.
[0008] WO 97/45559 (Barany et al.) describes a method for the detection of nucleic acid sequence differences by using
combinations of ligase detection reactions (LDR) and polymerase chain reactions (PCR).
Disclosed are methods comprising annealing allele-specific probe sets to a target
sequence and subsequent ligation with a thermostable ligase, optionally followed by
removal of the unligated primers with an exonuclease. Amplification of the ligated
products with fluorescently labelled primers results in a fluorescently labelled amplified
product. Detection of the products is based on separation by size or electrophoretic
mobility or on an addressable array.
[0009] Detection of the amplified probes is performed on a universally addressable array
containing capturing oligonucleotides. These capturing oligonucleotides contain a
region that is capable of annealing to a pre-determined region in the amplified probe,
a so-called zip-region or zip code. Each amplified probe contains a different zip
code and each zip code will hybridise to its corresponding capturing oligonucleotide
on the array. Detection of the label in combination with the position on the array
provides information on the presence of the target sequence in the sample. This method
allows for the detection of a number of nucleic acid sequences in a sample. However,
the design, validation and routine use of arrays for the detection of amplified probes
involves many steps (ligation, amplification, optionally purification of the amplified
material, array production, hybridisation, washing, scanning and data quantification),
of which some (particularly hybridisation and washing) are difficult to automate.
Array-based detection is therefore laborious and costly to analyse a large number
of samples for a large number of SNPs.
[0010] The LDR oligonucleotide probes in a given set may generate a unique length product
and thus may be distinguished from other products based on size. For the amplification
a primer set is provided wherein one of the primers contains a label. Different primers
can be provided with different labels to allow for the distinction of products.
[0011] The method and the various embodiments described by Barany
et al. are found to have certain disadvantages. One of the major disadvantages is that the
method in principle does not provide for a true high throughput process for the determination
of large numbers of target sequences in short periods of time using reliable and robust
methods without compromising the quality of the data produced and the efficiency of
the process.
[0012] More in particular, one of the disadvantages of the means and methods as disclosed
by Barany
et al. resides in the limited multiplex capacity when discrimination is based
inter alia, on the length of the allele specific probe sets. Discrimination between sequences
that are distinguishable by only a relatively small length difference is, in general,
not straightforward and carefully optimised conditions may be required in order to
come to the desired resolving power. Discrimination between sequences that have a
larger length differentiation is in general easier to accomplish. This may provide
for an increase in the number of sequences that can be analysed in the same sample.
However, providing for the necessary longer nucleotide probes is a further hurdle
to be taken. In the art, synthetic nucleotide sequences are produced by conventional
chemical step-by-step oligonucleotide synthesis with a yield of about 98.5% per added
nucleotide. When longer probes are synthesised (longer than ca. 60 nucleotides) the
yield generally drops and the reliability and purity of the synthetically produced
sequence can become a problem.
[0013] These and other disadvantages of the methods disclosed in
WO 97/45559 and other publications based on oligonucleotide ligation assays herein lead the present
inventors to the conclusion that the methods described therein are less preferable
for adaptation in a high throughput protocol that is capable of handling a large number
of samples each comprising large numbers of sequences.
[0014] The specific problem of providing for longer probes has been solved by
Schouten et al. (WO 01/61033).
WO 01/61033 discloses the preparation of longer probes for use in ligation-amplification assays.
They provided probes that are considerably longer than those that can be obtained
by conventional chemical synthesis methods to avoid the problem associated with the
length-based discrimination of amplified products using slab-gels or capillary electrophoresis,
namely that only a small part of the detection window / resolving capacity of up to
1 kilo base length is used when OLA probes are synthesised by chemical means. With
an upper limit in practice of around 100-150 bases for chemically synthesised oligonucleotides
according to the current state of technology, this results in amplification products
that are less than 300 base pairs long at most, but often much less (see Barany
et al.). The difficulty of generating such long probes (more than about 150 nucleotides) with
sufficient purity and yield by chemical means has been countered by Schouten
et al., using a method in which the probes have been obtained by an in vivo enzymatic template
directed polymerisation, for instance by the action of a DNA polymerase in a suitable
cell, such as an M 13 phage.
[0015] However, the production and purification of such biological probes requires a collection
of suitable host strains containing M13 phage conferring the desired length variations
and the use of multiple short chemically synthesised oligonucleotides in the process,
thus their use is very laborious and time-consuming, hence costly and not suitable
for high-throughput assay development. Furthermore, the use of relatively long probes
and relatively large length differences between the amplifiable target sequences may
result in differential amplification efficiencies in favour of the shorter target
sequences. This adversely affects the overall data quality, hampering the development
of a true high throughput method. Thus the need for a reliable and cost-efficient
solution to multiplex amplification and subsequent length-based detection for high
throughput application remains.
[0016] Other solutions that have been suggested in the art such as the use of circular (padlock)
probes (
WO 95/22623) in combination with isothermal amplification such as rolling circle amplification
(RCA) are regarded as profitable because of the improved hybridisation characteristics
of circular probes and the isothermal character of RCA.
[0017] Rolling circle amplification is an amplification method wherein a first primer is
hybridised to a ligated or connected circular probe. Subsequent primer elongation,
using a polymerase with strand displacement activity results in the formation of a
long polynucleotide strand which contains multiple representations of the connected
circular probe. Such a long strand of concatamers of the connected probe is subsequently
detected by the use of hybridisation probes. These probes can be labelled. Exponential
amplification of the ligated probe can be achieved by the hybridisation of a second
primer that hybridises to the concatameric strand and is subsequently elongated. (Exponential)
Rolling Circle Amplification ((E)RCA) is described
inter alia in
US5854033,
US6143495 WO97/19193,
Lizardi et al, Nature genetics 19(3):225-232 (1998).
[0018] US 5,876,924,
WO98/04745 and
WO98/04746 by Zhang et al. describe a ligation reaction using two adjacent probes wherein one of the probes
is a capture probe with a binding element such as biotin. After ligation, the unligated
probes are removed and the ligated captured probe is detected using paramagnetic beads
with a ligand (biotin) binding moiety. Zhang also discloses the amplification of circular
probes using PCR primers in a rolling circle amplification, using a DNA polymerase
with strand displacement activity, thereby generating a long concatamer of the circular
probe, starting from extension of the first primer. A second PCR primer subsequently
hybridises to the long concatamer and elongation thereof provides a second generation
of concatamers and facilitates exponential amplification. Detection is generally based
on the hybridisation of labelled probes.
[0019] However, these methods have proven to be less desirable in high throughput fashion.
One of the reasons is that, for a high throughput method based on length discrimination,
the use of (E)RCA results in the formation of long concatamers. These concatamers
are problematic, as they are not suitable for high throughput detection.
[0020] US 6,221,603 disclosed a circular probe that contains a restriction site. The probe is amplified
using (E)RCA and the resulting concatamers are restricted at the restriction site.
The restriction fragments are then separated by length and detected. Separation and
detection is performed on a capillary electrophoretic platform, such as the MegaBACE
equipment available from Molecular Dynamics Amersham-Pharmacia. For detection labelled
dNTP's may be incorporated into the fragments during amplification, or the fragments
may be detected by staining or by labelled detection probes. Partial digestion by
the restriction enzyme may however affect the reliability of the method. Furthermore,
the methods for labelling of the fragments as disclosed in
US 6,221,603, do not allow to fully utilise the MegaBACE's capacity of simultaneous detection
of multiple colours.
[0021] The present inventors have set out to eliminate or at least diminish the existing
problems in the art while at the same time attempting to maintain the advantageous
aspects thereof, and to further improve the technology. Other problems in the art
and solutions provided thereto by the present invention will become clear throughout
the description, the figures and the various embodiments and examples.
Description of the invention
[0022] The present invention relates to methods for high throughput separation and detection
of multiple sequences. The present method resolves many of the problems previously
encountered in the art. More in particular the present invention provides for a multiple
ligation and amplification assay that allows for the rapid and high throughput analysis
of a multiplicity of samples, preferably containing a multiplicity of sequences. The
present invention also provides for a method for the high throughput discrimination
and detection of a multitude of nucleotide sequences based on a combination of length
differences and labels. The present invention combines the advantages of certain methods
while at the same time avoids disadvantages associated with the various technique,
thereby providing for an improved method for the detection of targets sequences in
a reliable and reproducible manner and suitable for a high throughput detection method.
Detailed description of the invention
[0023] In a first aspect the invention relates to a method for high throughput separation
and detection of a multiplicity of target sequences, optionally in a multiplicity
of samples comprising subjecting each sample to a ligation-dependent amplification
assay.
[0024] The method preferably is a method for determining the presence or absence of at least
one target sequence (2) in a sample, wherein the method comprises the steps of:
- (a) providing to a nucleic acid sample at least one circular probe (26) for each target
sequence to be detected in the sample, whereby the probe has a first target specific
section at its 5'-end (4) that is complementary to a first part of a target sequence
(5) and a second target specific section at its 3'-end (6) that is complementary to
a second part of the target sequence (7), whereby the first and second part of the
target sequence are located adjacent to each other, and whereby the probe further
comprises a tag section (8, 9) that is essentially non-complementary to the target
sequence, whereby the tag section may comprise a stuffer sequence (10,11) and whereby
the tag section comprises at least one primer-binding sequence (12, 13);
- (b) allowing the first and second target specific sections of the circular probe to
anneal to the first and second parts of target sequences whereby the first and second
target specific sections of the probe are annealed adjacent on the target sequence;
- (c) providing means for ligating the first and second target specific sections annealed
adjacently to the target sequence and allowing the first and second target specific
sections to be connected, to produce a ligated circular probe (28), corresponding
to a target sequence in the sample;
- (d) providing at least a first primer that is complementary to the primer-binding
sequence (12), and a polymerase enzyme;
- (e) amplifying the resulting mixture to produce an amplified sample (19) comprising
amplicons (20) that are linear representations of the ligated circular probes;
- (f) determining the presence or absence of a target sequence in a sample by detecting
the presence or absence of the corresponding amplicon;
wherein the at least one circularisable probe contains a blocking section that comprises
a blocking group that is located adjacent to the 3' end of the primer binding site,
such that the blocking section stops elongation or amplification of the primer hybridised
to the circularised probe, thereby generating a linear representation of the circular
probe and such that the blocking group is excluded from the primer elongation or amplification.
Probe
[0025] The circular oligonucleotide probe used in the present invention is a single linear
oligonucleotide probe that is provided in step (a) for each target sequence in a sample.
This single linear oligonucleotide probe combines the two target specific section
into a single molecule that is circularised in step (c) when the annealed complementarity
sections are connected. Thus, in the single linear probe the sections of target complementarity
are each present at the extreme ends of the single linear probe. The complementarity
sections at the extreme ends are intervened by the sequences that may serve as primer-binding
sequences and may further be intervened by stuffer sequences of variable length. An
example of such an arrangement of functional groups in the circular probe is: (target-complementarity
section 1 - stuffer sequence 1, primer-binding sequence 1 - primer-binding sequence
2 - stuffer sequence 2 - target-complementarity section 2). The skilled person will
appreciate that the circular probes are synthesised and applied in a linear form and
that they will only be circular when the two complementary sections at the extreme
ends of the probe are connected (ligated) annealing to the appropriate target sequence.
Thus, the term "circular probe" as used herein actually refers to a linear molecule
that is circularised by target sequence dependent connection (ligation). Only the
term "connected circular probe" as used herein refers to a molecule in true circular
form.
[0026] The complementary sections of the oligonucleotide probes are designed such that for
each target sequence in a sample a probe is provided, preferably a specific probe,
whereby the probes each contain a section at both their extreme ends that is complementary
to a part of the target sequence and the corresponding complementary parts of the
target sequence are located essentially adjacent to each other. Within a circular
oligonucleotide probe, the oligonucleotide probe has a section at its 5'-end that
is complementary to a first part of a target sequence and a section at its 3'-end
that is complementary to a second part of the target sequence. Thus, when the circular
probe is annealed to complementary parts of a target sequence the 5'-end of the oligonucleotide
probe is essentially adjacent to the 3'-end of the oligonucleotide probe such that
the respective ends of the probe may be ligated to form a phosphodiester bond and
hence become a circular probe.
[0027] Circular probes are advantageous in the ligation step (c) because both target-complementarity
sections are contained in the same molecule. Compared with conventional linear probes
such as disclosed inter alia by
WO97/45559, this means that there are equimolar amounts of the two target specific sections
present and in each others vicinity. Such probes are more likely to hybridise to their
respective target sequences because hybridisation of the first target-complementarity
section to the target facilitates hybridisation of the second one and
vice versa. In addition, the use of circular probes reduces the chances of the formation of incorrect
ligation products that result from ligation between probes of different target sequences,
due to the lower number of possible combinations of ligation products that can be
formed when the first and second probes are part of the same circular molecule.
[0028] For more details regarding the characteristics, design and construction, use and
advantages of padlock probes reference is made,
inter alia, to the following documents:
M. Nilsson et. al., "Padlock Probes: Circularizing Oligonucleotides for Localized
DNA Detection," Science 265: 2085-88 (1994);
Pickering et al. in Nucleic Acids Research, 2002, vol. 30, e60-
US5854033;
US5912124;
WO 02/068683,
WO 01/06012,
WO 0077260,
WO 01/57256 the contents of which are hereby incorporated by reference.
[0029] For each target sequence for which the presence or absence in a sample is to be determined,
a specific oligonucleotide probe is designed with sections complementary to the adjacent
complementary parts of each target sequence. Thus, in the method of the invention,
for each target sequence that is present in a sample, a corresponding (specific) amplicon
may be obtained in the amplified sample. Preferably, a multiplicity of oligonucleotide
probes complementary to a multiplicity of target sequences in a sample is provided.
An oligonucleotide probe for a given target sequence in a sample will at least differ
in nucleotide sequence from probes for other target sequences, and will preferably
also differ in length from probes for other targets, more preferably a probe for a
given target will produce a connected probe and/or amplicon that differs in length
from connected probes corresponding to other targets in the sample as described below.
Alternatively, amplicons corresponding to different targets may have an identical
length if they can be otherwise distinguished e.g. by different labels as described
below.
Tag & Primer binding sites
[0030] The oligonucleotide probe further contains a tag that is essentially non-complementary
to the target sequence. The tag does not or not significantly hybridise, preferably
at least not under the above annealing conditions, to any of the target sequences
in a sample, preferably not to any of the sequences in a sample. The tag preferably
comprises at least one, preferably two primer-binding sites and may optionally comprises
one or more stuffer sequences of variable length and/or a blocking section (see below).
Stuffers
[0031] The tag of the oligonucleotide probes may comprise one or more stuffer sequence of
a variable length. The length of the stuffer varies from 0 to 500, preferably from
0 to 100, more preferably from 1 to 50. The length of the tag varies from 15 to 540,
preferably from 18 to 140, more preferably from 20 to 75. The stuffer may be a unique
sequence as is known as a Zip-code sequence as described by
Iannone et al. (2000), Cytometry 39: pp. 131-140.
Blocking section
[0032] In an alternative embodiment, the circular probe can contain a blocking section (27).
The blocking section blocks primer elongation. The blocking section is preferably
located between the two primer binding sites. Preferably the blocking section is located
essentially adjacent to the 3'-end of the forward primer and essentially adjacent
to the 5'-end of the reverse primer binding site, see also Figure 14. An example of
such an arrangement of functional groups in the circular probe is: (target-complementarity
section 1 - stuffer sequence 1, primer-binding sequence 1- blocking section - primer-binding
sequence 2 - stuffer sequence 2 - target-complementarity section 2). This blocking
section will effectively limit the primer elongation during amplification, thereby
providing linear representations of the connected circular probes. Preferably the
blocking section itself is located such between the two primer binding sites that
the section is excluded from the amplification. The blocking section can comprise
non-nucleotide polymers such as HEG (Hexaethylene glycol). If a blocking section is
present, such as a HEG group, the DNA polymerase used may have a strand displacement
activity as the blocking section will prevent the formation of long concatamers.
[0033] In an alternative embodiment, the ligated or connected circular probe comprising
a blocking section can also be amplified using only one primer, preferably the forward
primer. This amplification will result in the linear accumulation of amplicons with
each amplification round. The circular probe in this case may contain one or more
primer binding sites as long as only one primer is provided.
[0034] Generating linear representations of the connected circular probes, the amplicons,
the problem of long concatamers can be overcome, rendering the method suitable for
true high throughput electrophoretic technologies. By amplification of only short
strands of oligonucleotides, using the blocking section as described hereinabove or
by using at least one primer in combination with a polymerase lacking in strand displacement
activity, a set of amplicons representing a sample can be obtained wherein the amplicons
are of a discrete length within a predetermined range, based on the design of the
probes. Subsequent loading on a electrophoretic device will result in the swift separation
of the amplicons.
Hybridisation
[0035] In step (a) a multiplicity of different target sequences, i.e. at least two different
target sequences, is brought into contact with a multiplicity of specific oligonucleotide
probes under hybridising conditions. The oligonucleotide probes are subsequently allowed
to anneal to the adjacent complementary parts of the multiple target sequences in
the sample. Methods and conditions for specific annealing of oligonucleotide probes
to complementary target sequences are well known in the art (see e.g. in
Sambrook and Russel (2001) "Molecular Cloning: A Laboratory Manual (3rd edition),
Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press). Usually, after mixing of the oligonucleotide probes and target sequences the nucleic
acids are denatured by incubation (generally at between 94 °C and 96 °C) for a short
period of time (e.g. 30 seconds to 5 minutes) in a low salt buffer (e.g. a buffer
containing no salts or less salts than the ionic strength equivalent of 10 mM NaCl).
The sample containing the denatured probes and target sequences is anthen allowed
to cool to an optimal hybridisation temperature for specific annealing of the probes
and target sequences, which usually is about 5°C below the melting temperature of
the hybrid between the complementary section of the probe and its complementary sequence
(in the target sequence). In order to prevent aspecific or inefficient hybridisation
of one of the two probe sections, or in a sample with multiple target sequences, it
is preferred that, within one sample, the sections of the probes that are complementary
to the target sequences are of a similar, preferably identical melting temperatures
between the different target sequences present in the sample. Thus, the complementary
sections of the probes preferably differ less than 20, 15, 10, 5, or 2 °C in melting
temperature. This is facilitated by using complementary sections of the probes with
a similar length and similar G/C content. Thus, the complementary sections preferably
differ less than 20, 15, 10, 5, or 2 nucleotides in length and their G/C contents
differ by less than 30, 20, 15, 10, or 5 %. Complementary as used herein means that
a first nucleotide sequence is capable of specifically hybridising to second nucleotide
sequence under normal stringency conditions. A nucleotide sequence that is considered
complementary to another nucleotide sequence may contain a minor amount, i.e. preferably
less than 20, 15, 10, 5 or 2%, of mismatches. Alternatively, it may be necessary to
compensate for mismatches e.g. by incorporation of so-called universal nucleotides,
such as for instance described in
EP-A 974 672, incorporated herein by reference or by the use of suitable locked nucleic acids
(LNAs) and peptide nucleic acids (PNAs). Since annealing of probes to target sequences
is concentration dependent, annealing is preferably performed in a small volume, i.e.
less than 10 µl. Under these hybridisation conditions, annealing of probes to target
sequences usually is fast and does not to proceed for more than 5,10 or 15 minutes,
although longer annealing time may be used as long as the hybridisation temperature
is maintained to avoid aspecific annealing.
[0036] In a preferred embodiment of the invention, excellent results have been obtained
by prolonged hybridisation times such as overnight hybridisation or for more than
one hour. Prolonged hybridisation times can be advantageous in these assays as the
difference in signal due to different hybridisation efficiencies is reduced and it
is considered desirable to achieve complete hybridisation and ligation of all probes
for which a target sequence is present. Excellent results have been obtained by a
combined hybridisation-ligation step using a thermostable ligase described herein.
In this embodiment the hybridisation-ligation was performed by allowing the probes
to hybridise during 1 hour in the presence of a thermostable ligase, followed by a
denaturation step. Repeating these steps for at least 2 times provided good results.
Repeating these steps 10 times provided excellent results.
[0037] To avoid evaporation during denaturation and annealing, the walls and lids of the
reaction chambers (i.e. tubes or microtitre wells) may also be heated to the same
temperature as the reaction mixture. In preferred oligonucleotide probes the length
of the complementary section is preferably at least 15, 18 or 20 nucleotides and preferably
not more than 30, 40, or 50 nucleotides and the probes preferably have a melting temperature
of at least 50°C, 55°C or 60°C.
Non-hybridised probes
[0038] The probes that are not complementary to a part of the target sequence or that contain
too many mismatches will not or only to a reduced extent hybridise to the target sequence
when the sample is submitted to hybridisation conditions. Accordingly ligation is
less likely to occur. The number of spurious ligation products from these probes in
general will therefore not be sufficient and much smaller than the
bona fide ligation products such that they are outcompeted during subsequent multiplex amplification.
Consequently, they will not be detected or only to a minor extent.
Ligation
[0039] The respective 5'- and 3'-ends of the oligonucleotide probe that are annealed essentially
adjacent to the complementary parts of a target sequence are connected in step (c)
to form a covalent bond by any suitable means known in the art. The ends of the probes
may be enzymatically connected in a phosphodiester bond by a ligase, preferably a
DNA ligase. DNA ligases are enzymes capable of catalysing the formation of a phosphodiester
bond between (the ends of) two polynucleotide strands bound at adjacent sites on a
complementary strand. DNA ligases usually require ATP (EC 6.5.1.1) or NAD (EC 6.5.1.2)
as a cofactor to seal nicks in double stranded DNA. Suitable DNA ligase for use in
the present invention are T4 DNA ligase,
E.
coli DNA ligase or preferably a thermostable ligase like e.g.
Thermus aquaticus (Taq) ligase,
Thermus thermophilus DNA ligase, or
Pyrococcus DNA ligase. Alternatively, chemical autoligation of modified polynucleotide ends
may be used to ligate two oligonucleotide probes annealed at adjacent sites on the
complementary parts of a target sequence (
Xu and Kool, 1999, Nucleic Acid Res. 27: 875-881).
[0040] Both chemical and enzymatic ligation occur much more efficient on perfectly matched
probe-target sequence complexes compared to complexes in which one or both of the
ends of the probe form a mismatch with the target sequence at, or close to the ligation
site (
Wu and Wallace, 1989, Gene 76: 245-254; Xu and Kool,
supra)
. In order to increase the ligation specificity, i.e. the relative ligation efficiencies
of perfectly matched oligonucleotides compared to mismatched oligonucleotides, the
ligation is preferably performed at elevated temperatures. Thus, in a preferred embodiment
of the invention, a DNA ligase is employed that remains active at 50 - 65°C for prolonged
times, but which is easily inactivated at higher temperatures, e.g. used in the denaturation
step during a PCR, usually 90 - 100°C. One such DNA ligase is a NAD requiring DNA
ligase from a Gram-positive bacterium (strain MRCH 065) as known from
WO O1/61033. This ligase is referred to as "Ligase 65" and is commercially available from MRC
Holland, Amsterdam.
Gap Ligation
[0041] In an alternative embodiment, for instance directed to the identification of indels,
the respective ends may be annealed such that a gap is left. This gap can be filled
with a suitable oligonucleotide and ligated. Such methods are known in the art as
'gap ligation' and are disclosed
inter alia in
WO 00/77260. Another possibility to fill this gap is by extension of one end of the probe using
a polymerase and a ligase in combination with single nucleotides, optionally preselected
from A,T, C, or G, or di-, tri- or other small oligonucleotides.
Primers
[0042] The connected probes are amplified using a pair of primers corresponding to the primer-binding
sites. In a preferred embodiment at least one of the primers or the same set of primers
is used for the amplification of two or more different connected probes in a sample,
preferably for the amplification of all connected probes in a sample. Such a primer
is sometimes referred to as a universal primer as these primers are capable of priming
the amplification of all probes containing the corresponding universal primer binding
site and consequently of all ligated probes containing the universal primer binding
site. The different primers that are used in the amplification in step (d) are preferably
essentially equal in annealing and priming efficiency. Thus, the primers in a sample
preferably differ less than 20, 15, 10, 5, or 2 °C in melting temperature. This can
be achieved as outlined above for the complementary section of the oligonucleotide
probes. Unlike the sequence of the complementary sections, the sequence of the primers
is not dictated by the target sequence. Primer sequences may therefore conveniently
be designed by assembling the sequence from tetramers of nucleotides wherein each
tetramer contains one A,T,C and G or by other ways that ensure that the G/C content
and melting temperature of the primers are identical or very similar. The length of
the primers (and corresponding primer-binding sites in the tags of the probes) is
preferably at least 12, 15 or 17 nucleotides and preferably not more than 25, 30,
40 nucleotides.
[0043] In a preferred embodiment, at least two of the oligonucleotide probes that are complementary
to at least two different target sequences in a sample comprise a tag sequence that
comprises a primer-binding site that is complementary to a single primer sequence.
Thus, preferably at least one of the first and second primer in a primer pair is used
for the amplification of connected probes corresponding to at least two different
target sequences in a sample, more preferably for the amplification of connected probes
corresponding to all target sequences in a sample. Preferably only a single first
primer is used and in some embodiments only a single first and a single second primer
is used for amplification of all connected probes. Using common primers for amplification
of multiple different fragments usually is advantageous for the efficiency of the
amplification step.
[0044] The connected probes obtained from the ligation of the adjacently annealed probe
sections are amplified in step (d), using a primer set, preferably consisting of a
pair of primers for each of the connected probes in the sample. The primer pair comprises
primers that are complementary to primer-binding sequences that are present in the
connected probes. A primer pair usually comprises a first and at least a second primer,
but may consist of only a single primer that primes in both directions. Excellent
results have been obtained using primers that are known in the art as AFLP primers
such as described inter alia in
EP534858 and in
Vos et al., Nucleic Acid Research, 1995, vol. 23,4407-44014.
Selective primers
[0045] In a particular preferred embodiment, one or more of the primers used in the amplification
step of the present invention is a selective primer. A selective primer is defined
herein as a primer that, in addition to its universal sequence which is complementary
to a primer binding site in the probe, contains a region that comprises so-called
"selective nucleotides". The region containing the selective nucleotides is located
at the 3'-end of the universal primer.
[0046] The principle of selective nucleotides is disclosed inter alia in
EP534858 and in
Vos et al., Nucleic Acid Research, 1995, vol. 23,4407-44014. The selective nucleotides are complementary to the nucleotides in the (ligated)
probes that are located adjacent to the primer sequence. The selective nucleotides
generally do not form part of the region in the (ligated) probes that is depicted
as the primer sequence. Primers containing selective nucleotide are denoted as +N
primers, in which N stands for the number of selective nucleotides present at the
3'-end of the primer. N is preferably selected from amongst A, C, T or G.
[0047] N may also be selected from amongst various nucleotide alternatives, i.e. compounds
that are capable of mimicking the behavior of ACTG-nucleotides but in addition thereto
have other characteristics such as the capability of improved hybridisation compared
to the ACTG-nucleotides or the capability to modify the stability of the duplex resulting
from the hybridisation. Examples thereof are PNA's, LNA's, inosine etc. When the amplification
is performed with more than one primer, such as with PCR using two primers, one or
both primers can be equipped with selective nucleotides. The number of selective nucleotides
may vary, depending on the species or on other particulars determinable by the skilled
man. In general the number of selective nucleotides is not more than 10, but at least
5, preferably 4, more preferably 3, most preferred 2 and especially preferred is 1
selective nucleotide.
[0048] A +1 primer thus contains one selective nucleotide, a +2 primer contains 2 selective
nucleotides etc. A primer with no selective nucleotides (i.e. a conventional primer)
can be depicted as a +0 primer (no selective nucleotides added). When a specific selective
nucleotide is added, this is depicted by the notion +A or +C etc.
[0049] By amplifying a set of (ligated) probes with a selective primer, a subset of (ligated)
probes is obtained, provided that the complementary base is incorporated at the appropriate
position in the desired of the probes that are supposed to be selectively amplified
using the selective primer. Using a +1 primer, for example, the multiplex factor of
the amplified mixture is reduced by a factor 4 compared to the mixture of ligated
probes prior to amplification. Higher reductions can be achieved by using primers
with multiple selective nucleotides, i.e. 16 fold reduction of the original multiplex
ration is obtained with 2 selective nucleotides etc.
[0050] When an assay is developed which, after ligation, is to be selectively amplified,
it is preferred that the probe contains the complementary nucleotide adjacent to the
primer binding sequence. This allows for pre-selection of the ligated probe to be
selectively amplified.
[0051] The use of selective primers in the present invention has proven to be advantageously
when developing ligation based assays with high multiplex ratios of which subsequently
only a specific part needs to be analyzed resulting in further cost reduction of the
ligation reaction per datapoint. By designing primers together with adjacent selective
nucleotides, the specific parts of the sample that are to be amplified separately
can be selected beforehand.
[0052] One of the examples in which this is useful and advantageous is in case of analysis
of samples that contain only minute amounts of DNA and/or for the identification of
different (strains of) pathogens. For example, in an assay directed to the detection
of various strains of anthrax
(Bacillus anthracis), for each of the strains a set of representative probes is designed. The detection
of the presence or absence of this set (or a characterizing portion thereof) of ligated
probes after the hybridisation and ligation steps of the method of the invention may
serve as an identification of the strain concerned. The selective amplification with
specifically designed primers (each selective primer is linked to a specific strain)
can selectively amplify the various strains, allowing their identification. For instance,
amplification with an +A primer selectively amplifies the ligated probes directed
to strain X where a +G primer selectively amplifies the ligated probes directed to
strain Y. If desired, for instance in the case of small amounts of sample DNA, an
optional first amplification with a +0 primer will increase the amount of ligated
probes, thereby facilitating the selective amplification.
[0053] For example, a universal primer of 20 nucleotides becomes a selective primer by the
addition of one selective nucleotide at its 3' end, the total length of the primer
now is 21 nucleotides. See also Figure 15. Alternatively, the universal primer can
be shortened at its 5' end by the number of selective nucleotides added. For instance,
adding two selective nucleotides at the 3' end of the primer sequence can be combined
with the absence (or removal) of two nucleotides from the 5'end of the universal primer,
compared to the original universal primer. Thus a universal primer of 20 nucleotides
is replaced by a selective primer of 20 nucleotides. These primers are depicted as
'nested primers' throughout this application. The use of selective primers based on
universal primers has the advantage that amplification parameters such as stringency
and temperatures may remain essentially the same for amplification with different
selective primers or vary only to a minor extent. Preferably, selective amplification
is carried out under conditions of increased stringency compared to non-selective
amplification. With increased stringency is meant that the conditions for annealing
the primer to the ligated probe are such that only perfectly matching selective primers
will be extended by the polymerase used in the amplification step. The specific amplification
of only perfectly matching primers can be achieved in practice by the use of a so-called
touchdown PCR profile wherein the temperature during the primer annealing step is
stepwise lowered by for instance 0.5 °C to allow for perfectly annealed primers. Suitable
stringency conditions are for instance as described for AFLP amplification in
EP 534858 and in
Vos et al., Nucleic Acid Research, 1995, vol. 23, 4407-44014. The skilled man will, based on the guidance find ways tot adapt the stringency conditions
to suit his specific need without departing from the gist of the invention.
[0054] One of the further advantages of the selective amplification of ligated probes is
that an assay with a high multiplex ratio can be adapted easily for detection with
methods or on platforms that prefer a lower multiplex ratio.
[0055] One of many examples thereof is the detection based on length differences such as
electrophoresis and preferably capillary electrophoresis such as is performed on a
MegaBACE or using nano-technology such as Lab-on-a-Chip.
Amplification
[0056] In step (d) of the method of the invention, the connected probes are amplified to
produce (detectable) amplified connected probes (amplicons) that are linear representations
of the connected circular probes by any suitable nucleic acid amplification method
known in the art. Nucleic acid amplification methods usually employ two primers, dNTP's,
and a (DNA) polymerase. A preferred method for amplification is PCR. "PCR" or "Polymerase
Chain Reaction" is a rapid procedure for in vitro enzymatic amplification of a specific
DNA segment. The DNA to be amplified is denatured by heating the sample. In the presence
of DNA polymerase and excess deoxynucleotide triphosphates, oligonucleotides that
hybridise specifically to the target sequence prime new DNA synthesis. It is preferred
that the polymerase is a DNA polymerase that does not express strand displacement
activity or at least not significantly. Examples thereof are Amplitaq and Amplitaq
Gold (supplier Perkin Elmer) and Accuprime (Invitrogen). One round of synthesis results
in new strands of determinate length, which, like the parental strands, can hybridise
to the primers upon denaturation and annealing. The second cycle of denaturation,
annealing and synthesis produces two single-stranded products that together compose
a discrete doublestranded product, exactly the length between the primer ends. This
discrete product accumulates exponentially with each successive round of amplification.
Over the course of about 20 to 30 cycles, many million-fold amplification of the discrete
fragment can be achieved. PCR protocols are well known in the art, and are described
in standard laboratory textbooks, e.g.
Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc. (1995). Suitable conditions for the application of PCR in the method of the invention are
described in
EP-A 0 534 858 and
Vos et al. (1995; Nucleic Acids Res.23: 4407- 23:4407- 4407-4407-4414), where multiple DNA fragments between 70 and 700
nucleotides and containing identical primer-binding sequences are amplified with near
equal efficiency using one primer pair. Other multiplex and/or isothermal amplification
methods that may be applied include e.g. LCR, self-sustained sequence replication
(3SR), Q-β-replicase mediated RNA amplification, or strand displacement amplification
(SDA). In some instances this may require replacing the primer-binding sites in the
tags of the probes by a suitable (RNA) polymerase-binding site as long as they lead
to linear amplification products as defined herein before, i.e. of discrete lengths
and corresponding to the length of the circular probes.
[0057] As described herein, linear representations of the connected circular probes can
be obtained by exponential amplification of the circular probe with two primers, one
forward and one reverse, using a polymerase that does not or not significantly have
a strand displacement activity. The first primer elongation in the amplification with
the forward primer generates an oligonucleotide product until the 5'end of the forward
primer is reached. There the primer elongation is terminated, due to the substantial
absence of strand displacement activity of the polymerase used, leaving a elongated
primer with substantially the same length as the connected circular probe. The second
cycle of denaturation, primer hybridisation and primer elongation will, for the forward
primer, produce the identical strand as during the first primer elongation, while
the reverse primer will hybridise to the oligonucleotide product from the elongation
of the first primer elongation and thereby produce the complementary strand, resulting
in the exponential amplification of the circular probe to thereby produce amplicons
of discrete length which are representations of the connected circular oligonucleotide
probes.
Amplicons
[0058] The term 'amplicon' as used herein refers to the product of the amplification step
of the connected or ligated probe. The term 'amplicon' as used herein thus refers
to an amplified connected probe. After the ligation step wherein the two target specific
section are connected by mean of a ligase, the connected or ligated probe is combined
with one or more primers and a polymerase and amplified. The ligated probe, the primers,
the polymerase and/or other parameters and variables are such that the amplification
results in linear representations of the circular probe. In the present invention
the amplicon is a linear oligonucleotide having a length that does not substantially
exceed the length of the circular probe. The minimum length of the amplicon is at
least the sum of the length of the two target complementary sections. It is preferred
that the length of the amplicon corresponds to the length of the circular probe. It
is more preferred that the length of the amplicon is indicative of the ligation of
the corresponding circular probe. Preferably an amplicon does not contain repetitions
of sections of the circular probe, i.e. is not a concatamer or a multimer of the circular
probe or a multimeric representation thereof. Preferably an amplicon is a linear and
monomeric representation of the connected circular probe.
[0059] The advantage obtained by the conversion from circular probes to linear amplicons
is that the advantageous characteristics of the circular probe are used (improved
kinetics, increased hybridisation to the target strand due to the formation of the
'padlock' conformation), while the resulting amplicons are of a discrete length an
can be detected subsequently without the need for additional steps such as restriction
and labelling. Figure 14 displays a schematic representation of circular probes and
amplicons. The various embodiments of the present invention will provide further detail
in this respect.
Detection
[0060] Detection of the labelled separated samples is performed by a detector to result
in detection data. The detector is of course dependent on the general system on which
the separation is carried out (capillary electrophoresis, slab-gel electrophoresis,
fixed detector-continuous gel-electrophoresis) but is also depending on the label
that is present on the primer, such as a fluorescent or a radioactive label.
[0061] The amplicons in a sample are preferably analysed on an electrophoretic device. The
electrophoretic device preferably separates the different amplicons in an amplified
sample on the basis of length, after which the separated amplicons may be detected
as described below. A suitable electrophoretic device may be a gel-electrophoresis
device, e.g. for conventional (polyacrylamide) slab gel-electrophoresis, or a capillary
electrophoresis device such as exemplified by the MegaBACE equipment available from
Molecular Dynamics Amersham-Biosciences. An alternative is the nano-sized capillary
electrophoretic devices known as Lab-on-a-Chip. The electrophoretic device preferably
is a multichannel device in which multiple samples are electrophoresed in multiple
channels in parallel. The electrophoretic device has an application location (per
channel) for application (loading) of the amplified sample to be electrophoresed,
a separation area over which the fragments in the sample migrate by electrophoresis,
and preferably also a detection device located at a detection location distal from
the application location. The detection device will usually comprises a photomultiplier
for the detection of fluorescence, phosphorescence or chemiluminescence. Alternatively,
in the case of gel-electrophoresis, the separated fragments may be detected in the
gel e.g. by autoradiography or fluorography.
Length discrimination
[0062] To discriminate between different target sequences in the sample preferably a difference
in length of the respective corresponding amplicons is used. By separating the amplicons
based on length, the presence of the corresponding target nucleotides sequences in
the sample can be determined. Accordingly, in a preferred embodiment of the present
invention, the discrimination between amplicons derived from different target sequences
in a sample is based on a length difference between the respective amplicons corresponding
to different target sequences in a sample or amplified sample.
[0063] Preferably, the length difference is provided by the length of the stuffer sequence(s)
in the oligonucleotide probes. By including in each oligonucleotide probe a stuffer
of a pre-determined length, the length of each amplicon in an amplified sample can
be controlled such that an adequate discrimination based on length differences of
the amplicon obtained in step (d) is enabled. In a preferred embodiment of a probe
according to the invention, the stuffer is located between the probe's section complementary
to the target sequence and a primer-binding sequence. As there are two target specific
sections at both ends of the probe and two primer binding sites, two stuffer can be
incorporated in the probe therein between. As such, the total length of the stuffer
is provided by the combination of the length of the first stuffer and second stuffer
in the probe. Accordingly, in a preferred embodiment, the oligonucleotide probe comprises
two stuffers, preferably in the non target complementary tags. A graphic representation
thereof can be found in Figure 14.
[0064] The length differentiation between amplicons obtained from target sequences in the
sample is preferably chosen such that the amplicons can be distinguished based on
their length. This is accomplished by using stuffer sequences or combinations of stuffer
sequences which (together) result in clear length differences that may be distinguished
on electrophoretic devices. Thus, from the perspective of resolving power, the length
differences between the different amplicons, as may be caused by their stuffers, are
as large as possible. However, for several other important considerations, as noted
before, the length differences between the different amplicon is preferably as small
as possible: (1) the upper limit that exists in practice with respect to the length
of chemically synthesised probes of about 100-150 bases at most; (2) the less efficient
amplification of larger fragments, (3) the increased chances for differential amplification
efficiencies of fragments with a large length variation; and (4) the use of multiple
injections of detection samples on the detection device which works best with fragments
in a narrow length range. Preferably the length differences between the sequences
to be determined and provided by the stuffers is at least sufficient to allow discrimination
between essentially all amplicons. By definition, based on chemical, enzymatic and
biological nucleic acid synthesis procedures, the minimal useable size difference
between different amplicon in an amplified sample is one base, and this size difference
fits within the resolving power of most electrophoresis devices, especially in the
lower size ranges. Thus based on the above it is preferred to use multiplex assays
with amplification products with differ in length by a single base(pair). In a preferred
embodiment, the length difference between different amplicons in an amplified sample
is at least two nucleotides. In a particularly preferred embodiment of the invention
the amplicon corresponding to different target sequences in a sample have a length
difference of two nucleotides.
Labels
[0065] In a preferred embodiment, at least one of the primers complementary to the primer-binding
sites of the first and second oligonucleotide probes in the sample comprises a label,
preferably the second primer comprises a label. The label can be selected from a large
group, amongst others comprising fluorescent and/or phosphorescent moieties such as
dyes, chromophores, or enzymes, antigens, heavy metals, magnetic probes, phosphorescent
moieties, radioactive labels, chemiluminescent moieties or electrochemical detecting
moieties. Preferably the label is a fluorescent or phosphorescent dye, more preferably
selected from the group of FAM, HEX, TET, JOE, NED, and (ET-)ROX. Dyes such as FITC,
Cy2, Texas Red, TAMRA, Alexa fluor 488
™, Bodipy
™ FL, Rhodamine 123, R6G, Bodipy 530, Alexafluor
™532 and IRDyes
™ by Licor as used on the NEN Glober IR
2 platform are also suitable for use in the present invention. Preferably the label
may be chosen from amongst the fluorescent or phosphorescent dyes in the group consisting
of FAM, TET, JOE, NED, HEX, (ET-)ROX, FITC, Cy2, Texas Red, TAMRA, Alexa fluor 488
™, Bodipy
™ FL, Rhodamine 123, R6G, Bodipy 530, Alexafluor
™532 and IRDyes
™.
[0066] By using a primer set comprising differently labelled primers, the number of connected
probes that can be discriminated in a sample and hence the number of target sequences
in a sample can be doubled for each additional label. Thus, for each additional label
that is used in a sample, the number of target sequences that can be analysed in a
sample is doubled. The maximum number of labels that can be used in one sample in
a high throughput method is governed mostly by the limitations in the detection capabilities
of the available detection platforms. At present, one of the most frequently used
platforms (MegaBACE, by Molecular Dynamics -Amersham-Biosciences Ltd. allows the simultaneous
detection of up to four fluorescent dyes, being FAM, JOE or HEX, NED and (ET-)ROX.
However, alternative capillary electrophoresis instruments are also suitable, which
includes ABI310, ABI3100, ABI3700 (Perkin-Elmer Corp.), CEQ2000 XL (Beckman Coulter)
and others. Nonlimiting examples of slab-gel based electrophoresis devices include
ABI377 (Perkin Elmer Corp.) and the global IR
2 automated DNA sequencing system, available from LI-COR, Lincoln, Nebraska, USA.
Length and label
[0067] Throughput can be increased by the use of multiple labelled primers. One of the problems
associated with the use of different labels in one sample is cross talk or residual
cross talk. Cross talk or residual cross talk, as used herein, refers to the overlap
between the emission spectra of different (fluorescent) labels. For instance when
fluorescent dyes are used, each dye has a different emission (and absorption) spectrum.
In case of two dyes in one sample, these spectra can overlap and may cause a disturbance
of the signal, which contravenes the quality of the data obtained. Particularly when
two nucleotide fragments to be detected in a sample are labelled with a different
label and one of the fragments is present in an abundant amount whereas the other
is present only in minute amounts, residual cross talk can cause that the measured
signal of the fragment that is present in only minute amounts is mostly derived from
the emission of another label with an overlapping emission spectrum that is abundantly
contained in a fragment with identical size of another sample. The reciprocal effect
of the other dye may also occur but in this example its effect is probably less because
of the abundance differences between the amplicons labelled with the respective dyes.
[0068] Chehab et al. (Proc. Natl. Acad. Sci. USA, 86:9178-9182 (1989) have attempted to discriminate between alleles by attaching different fluorescent
dyes to competing alleles in a single reaction tube by selecting combinations of labels
such that the emission maximum of one dye essentially coincides with the emission
minimum of the other dye. However, at a certain wavelength at which one dye expresses
an absorption maximum, there is always also some remaining absorption from another
dye present in the sample, especially when the sample contains multiple dyes.
[0069] This route to multiplex analysis was found to be limited in scale by the relatively
few dyes that can be spectrally resolved. One of the major problems with the use of
multiple dyes is that the emission spectra of different fluorescent labels often overlap.
The resulting raw data signals have to be corrected for the contribution of similar
size fragments that are detected simultaneously and are labelled with another fluorescent
dye by a process called cross-talk correction. Cross-talk correction is commonly carried
out by mathematical means, based on the known theoretical absorption spectra for both
dyes, after "raw" data collection from the detection device. Mathematical correction
is based on theoretical spectra and ignores that emission spectra of labels are sensitive
and often affected by the composition of the detection sample. These sensitivities
can affect the brightness and/or the wavelength of the emission. This means that parameters
such as pH, temperature, excitation light intensity, non-covalent interactions, salt
concentration and ionic strength strongly influence the resulting emission spectrum.
In particular, it is known that the presence of residual salts in a sample affects
the fluorescence signal emitted by the dye and is a critical factor in case of detection
by capillary electrophoresis using electrokinetic injection because it then also affects
the injection efficiency. Thus, spectral overlap is a potential source of error that
negatively impacts on data quality in case of multiplex detection using different
fluorescent dyes.
[0070] The present invention provides for a solution to this problem such that two (or more)
labels with overlapping spectra can be used in the same sample without significantly
affecting data quality. By a predetermined combination of length differences and labels,
an increase in the number of target nucleotide sequences that can be detected in sample
is obtained while the quality of the data remains at least constant. In a preferred
embodiment of the invention, spectral overlap between two differently labelled sequences
is reduced by the introduction of a length difference between the two sequences. This
label-related length difference can be provided for by the length of the stuffer sequence
as described herein. The number of different labels that can be used in the same sample
in the present method is at least two, preferably at least three, more preferably
at least four. The maximum number of labels is functionally limited by the minimum
of spectral overlap that remains acceptable, which for most applications typically
amounts to less than 15 percent of the true signal, preferably less than 10 percent,
more preferably lees than 5 percent and most preferably less than 1 percent of the
true signal.
[0071] In order to avoid the potential influence of residual cross-talk on the data quality
in case different samples are labelled with multiple fluorescent dyes with overlapping
emission spectra and fragments with identical length are detected simultaneously in
the same run, in a particular preferred embodiment it is preferred to choose the stuffer
sequences such that amplicons differ by at least two base pairs within a multiplex
set and differ by a single base pair between multiplex sets labelled with the different
dyes that have overlapping spectra. By doing so, the length of the fragments labelled
with the respective dyes can be chosen such that the potential influence of residual
cross-talk on the quality of the data is circumvented because unique combinations
of fragments size and labelling dye are defined (Figure 3).
[0072] A particular preferred embodiment of the invention is directed to a method in which
a sample comprising amplicons is derived from a multiplicity of target sequences.
These amplicons are differently labelled, thereby defining groups of amplicons carrying
the same label. Within each group, the stuffer provided for a length difference of
at least two, preferably two nucleotides. Between two groups with labels having spectral
overlap, the stuffer provides a length difference of one nucleotide, effectively resulting
in one group having an even number of nucleotides and one group having an odd number
of nucleotides as described above.
[0073] In one aspect the present invention pertains to a method for the improved discrimination
and detection of target sequences in a sample, comprising providing at least a two
or more groups of oligonucleotide probes, wherein the amplicons obtained with different
groups of oligonucleotide probes have different labels, wherein substantially each
amplified connected probe target sequence within a group has the same label, wherein
within a group of identically labelled amplicons a length difference is provided between
each identically labelled probe within that group, wherein between the first and second
group an additional length difference is provided such that each amplified connected
probe in the amplified sample is characterised by a combination of length of the sequence
and the label.
[0074] In a preferred embodiment of the method of the invention, at least two groups of
oligonucleotide probes are provided to a sample, whereby each group of oligonucleotide
probes has tag sequences with at least one group specific primer-binding site. The
connected probes of each group are amplified from a primer pair wherein at least one
of the first and second primers is complementary to the group specific primer-binding
site, and whereby at least one of the first and second primers of a group comprises
a group specific label. In each group, an amplicon corresponding to a target sequence
in the sample differs in length from an amplicon corresponding to a different target
sequence in the sample. The group specific labels are preferably such that the detection
device can distinguish between the different group specific labels. The length difference
is preferably provided by the length of the stuffer sequence. Preferably in this embodiment
of the method of the invention, a first part of the groups has amplicons having an
even number of nucleotides and a second part of the groups has amplicons having an
odd number of nucleotides. Preferably, the groups of amplicons having an even number
of nucleotides and the groups amplicons having an odd number of nucleotides are labelled
with (fluorescent) labels, which have the least overlap in their emission spectra.
Thus, two groups of amplicons, each group having an odd number of nucleotides are
labelled with labels, which have the least overlap in their emission spectra. The
same holds for two groups of amplicons, each group having an even number of nucleotides.
Two groups of amplicons, one group having an odd number of nucleotides and the other
group having an even number of nucleotides are labelled with labels that have a larger
overlap in their emission spectra. The relative notions as used herein of 'the least
overlap in their emission spectra' and have a larger overlap in their emission spectra'
refer to a group of labels from which a selection of the labels can be made for use
in the present invention. This group of labels may depend on the detection platform
used to other factors such as those disclosed herein before. In a particularly preferred
embodiment of this method, a first and second groups of amplicons having an even number
of nucleotides are produced and a third and fourth group of connected amplified probes
having an odd number of nucleotides are produced and whereby the first and second
group are labelled with FAM and NED, respectively, and the third and fourth group
are labelled with (ET-)ROX and either JOE or HEX, respectively; or
vice versa, whereby the first and second group are labelled with (ET-)ROX and either JOE or HEX,
respectively, and the third and fourth group are labelled with FAM and NED, respectively.
Thus, in these embodiments, the fluorescent labels are chosen such that the groups
of amplicons that co-migrate, because they both contain fragments with either even
or odd numbers of nucleotides, have labels which have the least overlap in their emission
spectra, thereby avoiding as much as possible cross-talk in the detection of amplicons
in different groups (see also below).
[0075] In a preferred embodiment to avoid cross-talk it is therefore desirable to combine
a difference in length with a different label when analysing a set of amplicons in
such a way that the influence of spectral overlap on the data quality is avoided by
length differences between the amplicons labelled with the dyes that have overlapping
emission spectra.
[0076] It is preferred that in each sample the connected probes derived from each target
sequence differ from any other connected probe in the sample in length, and/or in
the label or, preferably in the combination of the length and the label. To provide
for an adequate separation of the amplicons of different length it is preferred that
the length difference between two different connected probes is at least two nucleotides,
preferably two. When detecting polymorphisms it is preferred that the difference in
length between two or more (SNP) alleles of the polymorphism is not more than two,
thereby ensuring that the efficiency of the amplification is similar between different
alleles or forms of the same polymorphism. This implies that preferably both alleles
are amplified with the same pair of primers and hence will be labelled with the same
dye.
[0077] In a preferred embodiment, for example directed to the detection of different alleles
of a multiplicity of loci, the distribution between odd/even lengths within a group
can be designed in the following way. Two loci L1, L2 are each represented by two
alleles A11, A12 for L1 and A21, A22 for L2. The lengths of the various alleles (or
ligated and amplified probes representing those alleles) is such that A1 1>A12>A21>A22;
A12-A1 1=2; A22-A21=2; A12-A21=3. Between groups G1 and G2 carrying labels that may
have an overlap in their spectra there can be a length difference of 1 nucleotide.
Thus G1(A11)-G2(A11)=1, hence the group starts with either an even or an uneven length.
[0078] This distribution has some significant advantages compared to the more densely packed
distribution disclosed herein. It is known that due to conformational differences
that different sequences of identical length generally differ in their electrophoretic
mobility. When there is only a difference in length of one nucleotide, this may cause
overlap between the peaks if the sequences are of a very different mobility. For instance
the difference in mobility between two alleles of one locus (A11, A12), will be less
than the difference in mobility between two alleles from different loci (A12, A21).
When there is a significant difference in mobility between A12 and A21, this may lead
to unreliable detection. By creating length distributions as herein disclosed this
can be avoided. The lower throughput is then weighed against the reliability of the
detection.
[0079] The problem of the overlap between the spectra of the different labels is then adequately
avoided. This is schematically depicted in Table A.
Table A Alternative distribution scheme of labels and lengths of probes.
| Length |
Group 1-Label 1 |
Group 2-Label 2 |
Group 3-Label 3 |
Group 4-Label 4 |
| N |
G1A11 |
|
G3A11 |
|
| N+1 |
|
G2A11 |
|
G4A11 |
| N+2 |
G1A12 |
|
G3A12 |
|
| N+3 |
|
G2A12 |
|
G4A12 |
| N+4 |
|
|
|
|
| N+5 |
G1A21 |
|
G3A21 |
|
| N+6 |
|
G2A21 |
|
G4A21 |
| N+7 |
G1A22 |
|
G3A22 |
|
| N+8 |
|
G2A22 |
|
G4A22 |
| N+9 |
|
|
|
|
| N+10 |
G1A31 |
|
G3A31 |
|
| N+11 |
|
G2A31 |
|
G4A31 |
| N+12 |
G1A32 |
|
G3A32 |
|
| N+13 |
|
G2A32 |
|
G4A32 |
| N+14 |
|
|
|
|
| N+15 |
G1A41 |
|
G3A41 |
|
| N+16 |
|
G2A41 |
|
G4A41 |
| N+17 |
G1A42 |
|
G3A42 |
|
| N+18 |
|
G2A42 |
|
G4A42 |
[0080] In an embodiment of the present invention there is provided between the amplicons
within one group, a length difference of alternating two and three nucleotides, i.e.
0, 2, 5, 7, 10, 12 etc. The other group then has a length difference of 1, 3, 6, 8,
11, 13 etc.
Target sequences
[0081] In its widest definition, the target sequence may be any nucleotide sequence of interest.
The target sequence preferably is a nucleotide sequence that contains, represents
or is associated with a polymorphism. The term polymorphism herein refers to the occurrence
of two or more genetically determined alternative sequences or alleles in a population.
A polymorphic marker or site is the locus at which divergence occurs. Preferred markers
have at least two alleles, each occurring at frequency of greater than 1%, and more
preferably greater than 10% or 20% of a selected population. A polymorphic locus may
be as small as one base pair. Polymorphic markers include restriction fragment length
polymorphisms, variable number of tandem repeats (VNTR's), hypervariable regions,
minisatellites, dinucleotide repeats, trinucleotide repeats, tetranucleotide repeats,
simple sequence repeats, and insertion elements such as Alu. The first identified
allelic form is arbitrarily designated as the reference form and other allelic forms
are designated as alternative or variant alleles. The allelic form occurring most
frequently in a selected population is sometimes referred to as the wild type form.
Diploid organisms may be homozygous or heterozygous for allelic forms. A diallelic
polymorphism has two forms. A triallelic polymorphism has three forms. A single nucleotide
polymorphism occurs at a polymorphic site occupied by a single nucleotide, which is
the site of variation between allelic sequences. The site is usually preceded by and
followed by highly conserved sequences of the allele (e.g., sequences that vary in
less than 1/100 or 1/1000 members of the populations). A single nucleotide polymorphism
usually arises due to substitution of one nucleotide for another at the polymorphic
site. Single nucleotide polymorphisms can also arise from a deletion of a nucleotide
or an insertion of a nucleotide relative to a reference allele. Other polymorphisms
include small deletions or insertions of several nucleotides, referred to as indels.
A preferred target sequence is a target sequence that is associated with an AFLP
® marker, i.e. a polymorphism that is detectable with AFLP
®.
DNA
[0082] In the nucleic acid sample, the nucleic acids comprising the target may be any nucleic
acid of interest. Even though the nucleic acids in the sample will usually be in the
form of DNA, the nucleotide sequence information contained in the sample may be from
any source of nucleic acids, including e.g. RNA, polyA
+ RNA, cDNA, genomic DNA, organellar DNA such as mitochondrial or chloroplast DNA,
synthetic nucleic acids, DNA libraries, clone banks or any selection or combinations
thereof. The DNA in the nucleic acid sample may be double stranded, single stranded
and double stranded DNA denatured into single stranded DNA. Denaturation of double
stranded sequences yields two single stranded fragments one or both of which can be
analysed by probes specific for the respective strands. Preferred nucleic acid samples
comprise target sequences on cDNA, genomic DNA, restriction fragments, adapter-ligated
restriction fragments, amplified adapter-ligated restriction fragments. AFLP fragments
or fragments obtained in an AFLP-template preamplification.
Samples
[0083] It is preferred that a sample contains two or more different target sequences, i.e.
two or more refers to the identity rather than the quantity of the target sequences
in the sample. In particular, the sample comprises at least two different target sequences,
in particular at least 10, preferably at least 25, more preferably at least 50, more
in particular at least 100, preferably at least 250, more preferably at least 500
and most preferably at least 1000 additional target sequences. In practice, the number
of target sequences is limited, among others, by the number of connected circular
probes. E.g., too many different oligonucleotide probes in a sample may corrupt the
reliability of the multiplex amplification step.
[0084] A further limitation is formed e.g. by the number of fragments in a sample that can
be resolved by the electrophoretic device in one injection. The number can also be
limited by the genome size of the organism or the transcriptome complexity of a particular
cell type from which the DNA or cDNA sample, respectively, is derived.
Multiple injection
[0085] In a preferred embodiment of the invention, in order to come to a high throughput
method of a multiplicity of samples, a number of samples are treated similar to thereby
generate a multiplicity of amplified detection samples which can then be analysed
on a multichannel device which is at least capable of detecting the labels and/or
length differences. Suitable devices are described herein.
[0086] To increase throughput on electrophoretic platforms methods have been developed that
are described in this application and are commonly depicted as multiple injection.
By injecting multiple samples containing fragments of discrete, pre-determined lengths,
in the same electrophoretic matrix and/or in short consecutive runs, throughput can
be increased. All detectable fragments preferably have a length within a specific
span and only a limited number of fragments can be detected in one sample, hence the
advantage of selective amplification for the reduction of the multiplex ratio by the
selection of a subset of the connected probes in the amplification step resulting
in a subset of amplicons.
[0087] Steps (a) to (e) of the method of the invention may be performed on two or more nucleic
acid samples, each containing two or more different target nucleic acids, to produce
two or more amplified samples in which is presence or absence of amplicons is analysed.
[0088] The multiplex analysis of the amplified samples following the method of the invention
comprises applying at least part of an amplified sample to an electrophoretic device
for subsequent separation and detection. Preferably such an amplified sample contains,
or is at least suspected to contain, amplified connected probes, which is an indication
that a target sequence has hybridised with the provided oligonucleotide probes and
that those probes were annealed adjacently on the complementary target sequence so
that they where connected, i.e. ligated. Subsequently, an amplified sample is subjected
to a separating step for a selected time period before a next amplified sample is
submitted.
[0089] In the method of the invention, (parts of) two or more different amplified samples
are applied consecutively to the same channel of the electrophoretic device (Fig 8).
Depending on the electrophoresis conditions, the time period (23) between two (or
more) consecutively applied amplified samples is such that the slowest migrating amplified
connected probe (19) in an amplified sample is detected at the detection location
(24), before the fastest migrating amplified connected probe of a subsequently applied
amplified sample is detected at the detection location (24). Thus, the time intervals
between subsequent multiple injections in one channel of the device are chosen such
that consecutively applied samples after separation do not overlap at a point of detection.
[0090] In a preferred embodiment the method of the invention further comprises the following
steps:
- (e1) repeating steps (a) to (e) to generate at least two amplified samples;
- (e2) consecutively applying at least part of the amplified samples obtained in steps
(e) and (e1), to an application location of a channel of an electrophoretic device,
electrophoretically separating the amplicons in the amplified samples and detecting
the separated amplicons at a detection location located distal from the application
location of the channel; whereby the time period between the consecutively applied
amplified samples is such that the slowest migrating amplified connected probe in
an amplified sample is detected at the detection location before the fastest migrating
amplified connected probe of a subsequently applied amplified sample is detected at
the detection location.
[0091] The method according to the invention allows for the high throughput analysis of
a multiplicity of samples each comprising a multiplicity of different target sequences
by the consecutive injection of amplified samples, comprising amplicons corresponding
to the target sequences in the samples, in a channel of a multichannel electrophoretic
device such as a capillary electrophoresis device. The method according to the invention
allows for the analysis of a multiplicity of target sequences in a multiplicity of
samples on a multiplicity of channels, thereby significantly increasing the throughput
of the number of samples that can be analysed in a given time frame compared to conventional
methods for the analysis of nucleotide sequences. This method profits from samples
containing amplicons to be detected that are of a discrete size range as thereby the
time period (23) between the successive injections can be significantly reduced compared
to methods wherein the (remains of) concatamers are present.
[0092] The selected time period prevents that consecutively applied samples after separation
have an overlap of amplicons at the detection point. The selected time period is influenced
by i). the length of the amplicons; ii). the length variation in amplicons; and iii).
the detection device and its operating conditions. Applying samples and separating
consecutively applied samples in the same channel can be repeatedly performed in one
or more channels, preferably simultaneously to allow for consecutive electrophoretic
separation of multiple samples in one channel and/or simultaneous analysis of multiple
samples over multiple channels and/or simultaneous analysis of multiple samples over
multiple channels carried out consecutively. A graphic representation thereof is given
in Figure 8.
[0093] The period of time between two consecutively loaded amplified samples can be determined
experimentally prior to executing the method. This period of time is selected such
that, given the characteristics of an amplified sample, especially the difference
in length between the shortest and the longest amplicons in an amplified sample, as
well as other experimental factors such as gel (matrix) and/or buffer concentrations,
ionic strength etc., the fragments in an amplified samples are separated to such extent
at the detection location which is located at the opposite end (distal) from the application
location where the sample was applied, that the different amplicons in a sample may
be individually detected. After applying the last amplified sample, the separation
can be continued for an additional period of time to allow the amplicons of the last
sample to be separated and detected. The combination of the selected period of time
between applying two consecutive samples and the optional additional time period is
chosen such that at the detection location the different amplicons in consecutively
applied samples are separated such that they may be individually detected, despite
the limited length variation that exists between the different amplicons within a
single sample. Thus overlapping migration patterns are prevented when samples containing
fragments of varying length are consecutively applied (injected) on the electrophoretic
device.
[0094] Using the method according to the invention, it is in principle possible and preferred
to continuously apply, load or inject samples. Preferably the device is able to perform
such operation automatically, e.g. controlled by a programmable computer. Preferably
the multichannel device is suitable for such operation or is at least equipped for
a prolonged operation without maintenance such as replacement of buffers, parts etcetera.
However, in practice this will generally not be the case. When a final sample is submitted
it is generally needed to continue the separation for an additional time period until
the last fragment of the final sample has been detected. In a preferred embodiment
of the invention, the stuffers present in the tags of the oligonucleotide probes is
are used to provide the length differences (i.e. 0 to 500 nucleotides, bases or base
pairs) between the amplified connected probes. The total length of the amplicon and
the variation in the length is governed mostly by the techniques by which these fragments
are analysed. In the high throughput multiple injection method of the present invention,
it is preferred that the range of lengths of amplicons in an amplified sample has
a lower limit of 40, 60, 80, or 100 and an upper limit of 120, 140, 160, or 180 nucleotides,
bases or base pairs, for conventional (capillary) electrophoresis platforms. It is
particularly preferred that the range of lengths of the amplicons varies from 100
to 140 nucleotides. However, these numbers are strongly related to the current limits
of the presently known techniques. Based on the knowledge provided by this invention,
the skilled artisan is capable of adapting these parameters when other circumstances
apply.
[0095] The reliability of the multiplex amplification is further improved by limiting the
variation in the length of the amplified connected probes. Limitations in the length
variation of amplicons is preferred to use multiple injection more efficiently and
further results in reduction of the preferential amplification of smaller amplicon
in a competitive amplification reaction with larger connected probes. This improves
the reliability of the high throughput method of the present invention. Together with
the multiple injection protocol as herein disclosed, these measures, alone or in combination
provide for a significant increase in throughput in comparison with the art. A further
improvement of the high throughput capacity is obtained by limiting the number of
different amplicons in a sample. It is regarded as more efficient and economical to
limit the multiplex capacity of the ligation/amplification step in combination with
the introduction of a multiple injection protocol. One of the most advantageous aspects
of the present invention lies in the combination of multiplex ligation, multiplex
amplification, preferably with a single primer pair or with multiple primer pairs
which each amplify multiple connected probes, repeated injection and multiplex detection
of different labels. One of the further advantageous aspects of the present invention
resides in the combined application of length differences with different (overlapping)
labels such that each connected probe and hence each target sequence within one sample
can be characterised by a unique combination of length and label. This allows for
a significant improvement of the efficiency of the analysis of target sequences as
well as a significant reduction in the costs for each target analysed.
[0096] The multiple injection protocol can be performed in a variety of ways. One of these
is the multiple loading of two or more samples in the same matrix. This is considered
as advantageously as the matrix is re-used by performing consecutive short runs, thereby
increasing efficiency and throughput. Another one is the multiple loading of two or
more samples in the same matrix in the same run. It is preferred to re-use the matrix
by performing short consecutive runs. In this embodiment, a first sample is injected
and separated. As soon as the last fragment is detected, the next sample is loaded.
Preferably, between these two consecutive short runs the matrix is not replaced so
that the runs are performed in the same matrix. This provides for additional efficiency
and improved economics as less changes o the matrix need to occur, reducing the amount
of consumables of this type of analysis ( i.e. buffers etc.), reducing the cost per
datapoint. Furthermore time-consuming replacements of the matrix can be avoided to
a large extent, further increasing the efficiency of the method.
[0097] In itself, certain aspects of multiple loading or multiple injection have been described
inter alia in
US6156178 and
WO O1/04618. The latter publication discloses an apparatus and a method for the increased throughput
analysis of small compounds using multiple temporally spaced injections. The publication
discloses that samples comprising primers, extended by one nucleotide (single nucleotide
primer extension or SnuPE, also known as minisequencing) could be detected using multiple
temporally spaced injections on a capillary electrophoresis device. Minisequencing
is based on annealing a complementary primer to a previously amplified target sequence.
Subsequent extension of the primer with a separately provided labelled nucleotide
provides for identification of the nucleotide adjacent to the primer. Principally,
the primer extension product is of a constant length. To increase throughput the use
of successive injections of extension products of the same length per run is suggested.
To further increase the throughput, primers of a different length can be used, varying
typically from 15 to 25 nucleotides. In contrast, the present invention contemplates
analysing multiplex amplification products themselves directly with a length variation
typically between 50 and 150 nucleotides. This is significantly more economical than
minisequencing or SnuPE as outlined hereinbefore because multiple target sequences
are amplified in a single reaction, whereas with minisequencing or SnuPE amplification
is carried out individually for each target sequence. Furthermore, the use of primers
of a different length and complementary to the target sequence compromises the efficiency
of the subsequent amplification step needed in the method of the present invention.
These applications in general do not address the problems associated with high throughput
detection of highly multiplexed samples, nor provide solutions thereto.
Exonucleases
[0098] A preferred method of the invention further comprises a step for the removal of oligonucleotide
probes that are not annealed to target sequences and/or that are non-connected/ligated.
Removal of such probes preferably is carried out prior to amplification, and preferably
by digestion with exonucleases. By removal/elimination of the oligonucleotide probes
that are not connected/ligated a significant reduction of ligation independent (incorrect)
target amplification can be achieved, resulting in an increased signal-to-noise ratio.
One solution to eliminate one or more of the non-connected/ligated components without
removing the information content of the connected probes is to use exonuclease to
digest non-connected/ligated oligonucleotide probes.issensitive. sensitive. Blocking
groups include use of a thiophosphate group and/or use of 2-O-methyl ribose sugar
groups in the backbone. Exonucleases include Exol (3'-5' activity), Exo III (3'-5'
activity), and Exo IV (both 5'-3' and 3'-5' activity). The circular probes of the
present invention are, once ligated, insensitive to the exonuclease, as opposed to
the unligated circular probes This is a further advantage of the use of padlock probes
in the present invention.
[0099] An advantage of using exonucleases, for example a combination of Exo I (single strand
specific) and Exo III (double strand specific), is the ability to destroy both the
target sequence and the unligated oligonucleotide probes, while leaving the ligation
product sequences substantially undigested. By using an exonuclease treatment prior
to amplification, the oligonucleotide probes in each set are substantially reduced,
and thus hybridisation of the remaining unligated oligonucleotide probes to the original
target DNA (which is also substantially reduced by exonuclease treatment) and formation
of a ligation product sequence which is a suitable substrate for PCR amplification
by the oligonucleotide primer set is substantially reduced, thereby improving the
signal to noise ratio.
Size ladder
[0100] The sample can be supplied with a nucleotide fragment size standard comprising one
or more nucleotide fragments of known length. Methods of preparing and using nucleotide
size standards are well known in the art (see e.g. Sambrook and Russel, 2001,
supra). Such a size standard forms the basis for appropriate sizing of the amplicons in the
sample, and hence, for the proper identification of the detected fragment. The size
standard is preferably supplied with every sample and/or with every injection. A size
standard preferably contains a variety of lengths that preferably spans the entire
region of lengths to be analysed. In a particular embodiment of the invention, it
is considered advantageously to add flanking size standards from which the sizes of
the amplicons can be derived by interpolation. A flanking size standard is a size
standard that comprises at least two labelled oligonucleotide sequences of which preferably
one has a length that is at least one base shorter than the shortest amplified connected
probe and preferably one that is a least one base longer than the longest amplified
connected probe to allow interpolation and minimise the introduction of further length
variation in the sample. A preferred flanking size standard contains one nucleotide
that is one nucleotide shorter the shortest amplified connected probe and one that
is a least one base longer than the longest amplified connected probe and is labelled
with at least one dye that is identical to the label used for labelling the amplicons
contained in the sample.
[0101] A convenient way to assemble a suitable size standard is by (custom) chemical synthesis
of oligonucleotides of the appropriate lengths, which are end-labelled with a suitable
label. The size standard is applied with every consecutively applied sample to serve
as local size references to size the loaded sample fragments. The size standard may
be applied in the same channel or lane of the electrophoretic device as the sample
to be analysed, i.e. together with the sample, or may be applied in a parallel channel
or lane of a multichannel/lane device. The flanking size standard can be labelled
with any of the labels used in the method. If the size standard is applied in the
same channel of the device, the fragments of the standard are preferably labelled
with a label that can be distinguished from the labels used for the detection of the
amplicons in a sample.
Pooling
[0102] In a variant of the technology, the starting (DNA) material of multiple individuals
are pooled such that less detection samples containing this material are loaded on
the detection device, This can be advantageous in the case of Linkage Disequilibrium
(LD mapping) when the objective is to identify amplified connected probes (such as
those representing SNP alleles) that are specific for a particular pool of starting
samples, for example pools of starting material derived from individuals which have
different phenotypes for a particular trait.
Application
[0103] One aspect of the invention pertains to the use of the method in a variety of applications.
Application of the method according to the invention is found in, but not limited
to, techniques such as genotyping, transcript profiling, genetic mapping, gene discovery,
marker assisted selection, seed quality control, hybrid selection, QTL mapping, bulked
segregant analysis, DNA fingerprinting and microsatellite analysis. Another aspect
pertains to the simultaneous high throughput detection of the quantitative abundance
of target nucleic acids sequences. This approach is commonly known as Bulk Segregant
Analysis (BSA).
Detection of single nucleotide polymorphisms
[0104] One particular preferred application of the high throughput method according to the
invention is found in the detection of single nucleotide polymorphisms (SNPs). A first
target complementary part of the circular oligonucleotide probes is preferably located
adjacent to the polymorphic site, i.e. the single polymorphic nucleotide. A second
target complementary part is designed such that its terminal base is located at the
polymorphic site, i.e. is complementary to the single polymorphic nucleotide. If the
terminal base is complementary to the nucleotide present at the polymorphic site in
a target sequence, it will anneal to the target sequence and will result in the ligation
of the two target complementary parts. When the end-nucleotide, i.e. the allele-specific
nucleotide does not match, no ligation or only a low level of ligation will occur
and the polymorphism will remain undetected.
[0105] When one of the target sequences in a sample is derived from or contains a single
nucleotide polymorphism (SNP), in addition to the probes specific for that allele,
further probes can be provided that not only allow for the identification of that
allele, but also for the identification of each of the possible alleles of the SNP
(co-dominant scoring). To this end a combination of target complementary parts can
be provided: one complementary part is the same for all alleles concerned and one
or more of the other complementary parts which is specific for each of the possible
alleles. These one or more other type of complementary parts contain the basically
the same complementary sequence but differ in that each contains a nucleotide, preferably
at the end, that corresponds to the specific allele. The allele specific part can
be provided in a number corresponding to the number of different alleles expected.
The result is that one SNP can be characterised by the combination of one complementary
part with four other (allele-specific) complementary parts, identifying all four theoretically
possible alleles (one for A, T, C, and G), by incorporating stuffer sequences of different
lengths (preferred) or different labels into the allele specific probes.
[0106] In a particular embodiment, preferably directed to the identification of single nucleotide
polymorphisms, the first complementary part of the oligonucleotide probe is directed
to a part of the target sequence that does not contain the polymorphic site and the
second complementary part of the oligonucleotide probe contains, preferably at the
end distal from first complementary part, one or more nucleotide(s) complementary
to the polymorphic site of interest. After ligation of the adjacent parts, the connected
probe is specific for one of the alleles of a single nucleotide polymorphism.
[0107] To identify the allele of polymorphic site in the target sequence, a set of oligonucleotide
probes can be provided wherein one first complementary part is provided and one or
more second complementary parts. Each second complementary part then contains a specific
nucleotide at the end of the complementary sequence, preferably the 3'-end, in combination
with a known length of the stuffer. For instance, in case of an A/C polymorphism,
the second complementary part can contain a specific nucleotide T in combination with
a stuffer length of 2 nucleotides and another second complementary part for this polymorphism
combines G with a stuffer length of 0. As the primers and the complementary parts
of the probes are preferably the same length, this creates a length difference of
the resulting amplicons of 2 nucleotides. In case the presence and/or the absence
of all four theoretically possible nucleotides of the polymorphic site is desired,
the stuffer-specific nucleotide combination can be adapted accordingly. In a sample
containing multiple target sequences, amplified with the same pair of amplification-primers
(and hence label) or with multiple pairs of amplifications primers with labels that
have overlapping emission spectra, the combined stuffer lengths are chosen such that
all connected probes are of a unique length. In Figure 4 an illustration of this principle
is provided of two loci and for each locus two alleles. In a preferred embodiment
this principle can be extended to at least ten loci with at least two alleles per
locus.
Detection of specific target sequence
[0108] The target sequence contains a known nucleotide sequence derived from a genome. Such
a sequence does not necessarily contain a polymorphism, but is for instance specific
for a gene, a promoter, an introgression segment or a transgene or contains information
regarding a production trait, disease resistance, yield, hybrid vigour, is indicative
of tumours or other diseases and/or gene function in humans, animals and plants. To
this end, the first and second complementary parts of the circular probe are designed
to correspond to a, preferably unique, target sequence in genome, associated with
the desired information. The complementary parts in the target sequence are located
adjacent to each other. In case the desired target sequence is present in the sample,
the two probes will anneal adjacently and after ligation and amplification can be
detected.
Detection of AFLP markers
[0109] AFLP, its application and technology is described in
Vos et al., Nucleic Acids Research, vol. 23, (1995), 4407-4414 as well as in
EP-A 0 534 858 and
US 6045994, all incorporated herein by reference. For a further description of AFLP, its advantages,
its embodiments, its techniques, enzymes, adapters, primers and further compounds,
tools and definitions used, explicit reference is made to the relevant passages of
the publications mentioned hereinbefore relating to AFLP. AFLP and its related technology
is a powerful DNA fingerprinting technique for the identification of for instance
specific genetic markers (so-called AFLP-markers), which can be indicative of the
presence of certain genes or genetic traits or can in general be used for comparing
DNA, cDNA or RNA samples of known origin or restriction pattern. AFLP-markers are
in general associated with the presence of polymorphic sites in a nucleotide sequence
to be analysed. Such a polymorphism can be present in the restriction site, in the
selective nucleotides, for instance in the form of indels or substitutions or in the
rest of the restriction fragment, for instance in the form of indels or substitutions.
Once an AFLP marker is identified as such, the polymorphism associated with the AFLP-marker
can be identified and probes can be developed for use in the ligation assay of the
present invention.
[0110] In another aspect the present invention pertains to a circular nucleic acid probe
comprising a first and a second part that is capable of hybridising to corresponding
parts of a target sequence and further comprising at least one, preferably two primer-binding
sequence and a stuffer. Further embodiments of the probe according to the present
invention are as described herein above. The invention also pertains to a set of probes
comprising two or more probes wherein each probe comprises a first part and a second
part that is complementary to part of a target sequence and wherein the complementary
first an second parts are located essentially adjacent when hybridised to the target
sequence and wherein each probe further comprises a stuffer, which stuffer is located
essentially next to the complementary part and at least one, preferably two primer-binding
sequence located essentially adjacent to the stuffer.
[0111] The invention in a further aspect, pertains to the use of a circular probe or set
of probes in the analysis of at least one nucleotide sequence and preferably in the
detection of a single nucleotide polymorphism, wherein the set further comprises at
least one additional probe that contains a nucleotide that is complementary to the
known SNP allele. Preferably the set comprises a probe for each allele of a specific
single nucleotide polymorphism. The use of a set of probes is further preferred in
a method for the high throughput detection of single nucleotide polymorphisms wherein
the length of the stuffer in the probe is specific for a locus and/or allele of a
single nucleotide polymorphism
[0112] Another aspect of the invention relates to the primers and more in particular to
the set of primers comprising a first primer and one or more second primers, wherein
each second primer contains a label and which second primer comprises a nucleotide
sequence that is specific for said label.
[0113] The present invention also finds embodiments in the form of kits. Kits according
to the invention are for instance kits comprising probes suitable for use in the method
as well as a kit comprising primers, further a combination kit, comprising primers
and probes, preferably all suitably equipped with enzymes buffers etcetera, is provided
by the present invention.
[0114] The efficiency of the present invention can be illustrated as follows. When a capillary
electrophoretic device with 96 channels and capable of detecting four labels simultaneously
is used, allowing for 12 subsequent injections per run per channel with a empirically
optimised minimum selected time period between the injections, a sample containing
20 target sequences of interest allows for the high throughput detection of 96 (channels)
* 12 (injections) * 20 (targets) * 4 (labels) = 92160 target sequences, using the
method of the present invention. In the case of co-dominant SNP-detection, data regarding
46080 SNPs can be detected in a single run.
Description of the Figures:
[0115] This invention is illustrated by the accompanying figures. In the figures, many of
the features of the invention are demonstrated using two linear probes that hybridise
adjacently. The skilled man will appreciate that most of these features also apply
to other embodiments disclosed herein such as the circular probes and how to include
those features in the other embodiments such as the circular probes based on the information
provided in this application.
Figure 1: Schematic representation of the oligonucleotide ligation- amplification assay, resulting
in amplified connected probes.
A target sequence (2) comprising a first (5) and a second (7) part to which parts
first and second probes can be hybridised with sections (4) and (6) that are complementary,
respectively. The probes contain a tag sequence (8,9) that is not complementary to
the target sequence. The tag sequence may comprise a stuffer sequence (10,11) and
a primer-binding site (12,13). After probe hybridisation and ligation the connected
probe (15) can be amplified using primers (16, 17) capable of hybridising to the corresponding
primer-binding sites. At least one of the primers contains a label (L). Amplification
results in an amplified sample, comprising amplicons (20)
Figure 2: Schematic representation of two connected probes, wherein
- (a) only one probe contains a stuffer (10) and primer-binding sequences (12,13); and
- (b) both probes contain a stuffer (10, 11) and primer-binding sequences (12,13).
Figure 3: Schematic representation of the unique combination of different lengths and labels
with a schematic elution profile in one channel of a multichannel device.
Figure 4: Schematic representation of the oligonucleotide ligation-ligation assay of the present
invention. The principle is represented for two loci 1 and 2 and for each locus two
alleles for reasons of simplicity only, but can easily be extended to at least 10
loci with 2 alleles each. The primer set consists of one first primer (solid bold
line) and one second primer (dashed bold line). The theoretically possible connected
probes are schematically outlined, together with the primers. The connected probes
differ in length.
Figure 5: Schematic representation of the oligonucleotide ligation-ligation assay of the present
invention. The principle is represented for two loci 3 and 4 and for each locus two
alleles. The primer set consists of one first primer and two second primers. The theoretically
possible connected probes are schematically outlined, together with the primers. The
connected probes differ in length and in label.
Figure 6: Schematic representation of the results of a sample containing 80 amplified connected
probes with:
- a length difference between 135 base pairs (bp) to 97 bp for the amplified connected
probes with an odd length and labelled with Label 1 and Label 3; and
- a length difference between 134 bp to 96 bp for the amplified connected probes with
an even length and labelled with Label 2 and Label 4; and
- a flanking size ladder with oligonucleotides of 94/95 and 136/137 (bp) carrying label
1,2, 3 or 4
Figure 7: Schematic representation of the separation profile in one channel, submitting one
sample comprising multiple amplified connected probes labelled with Label 1, 2, 3,
and 4. The multiple labelled amplified connected probes are detectably separated at
the point of detection.
Figure 8: Schematic representation of the multiple injection of samples in one channel, with
a graphic illustration of the selected time period (23) between the injection of subsequent
samples and the additional time period (25) after submitting the last sample.
Figure 9: Schematic representation of the ligation of up to 40 loci, and the subsequent amplification
and detection phase of the method. Depending on the complexity and the number of loci
to be analysed, the points in the procedure at which pooling can be contemplated is
indicated as an optional (dotted) feature). Amplification is here carried out by using
one forward primer (Forward) and for each label one (differently labelled) reverse
primer (Reverse 1, 2, 3, 4). When the ligation (sub)samples are pooled, there are
in principle two options for amplification. For instance if (sub)samples derived from
Loci 1-10 are pooled with (sub)samples derived from Loci 11-20 prior or subsequent
to ligation, the pooled (sub)sample can be amplified with the Forward primer and the
Reverse primers 1 and 2 in one step or in two steps, first with Forward and Reverse
1, followed by Forward and Reverse 2 or vice versa. Detection can also be performed in a similar way, detecting both labels simultaneously
or first label 1, followed by label 2, optionally by double injection.
Figure 10: A gel of a multiplex oligonucleotide ligation assay of 12 SNPs from the Colombia ecotype,
the Landsberg erecta ecotype and a 50/50 mixture of the Colombia and the Landsberg
erecta ecotypes.
Figure 11: A. Partial electropherogram of FAM labelled detection of the Colombia sample on a capillary
electrophoretic device (MEGABace). The same multiplex mixture was injected. Amplified
connected probes in a size range 97-134 bp and flanking sizer fragments (designated
S) are 94, 95 and 137 bp. Probes and sizers are all labelled with FAM.
B. Partial electropherogram of FAM labelled detection of the Landsberg erecta sample
on a capillary electrophoretic device (MEGABace). The same multiplex mixture was injected.
Amplified connected probes in a size range 97-134 bp and flanking sizer fragments
(designated S) are 94, 95 and 137 bp. Probes and sizers are all labelled with FAM.
Figure 12: A: Raw trace file of a sample containing a 120 bp ET-ROX labelled fragment and a 124
bp NED -labelled fragments. Note the FAM and JOE labels from other labelled fragments
in the sample with the same length. FAM and JOE have overlapping fluorescence spectra
(ET-ROX and FAM, JOE and NED), resulting in overlapping signals (cross-talk) with
sequences of equal length.
B: Mathematical cross-talk correction resulting in a processed, cross-talk corrected
trace file. Cross talk is reduced, but remains of the overlapping spectra (FAM, JOE)
are present, resulting in false positive (or negative) signals.
C, D, E, F: single label plots illustrate the presence of remnants (D, E) of the mathematical
correction, compared to the positive signals (C, F)
Figure 13 A: Representation of the effect of incomplete removal of cross-talk of a 120 bp ET-ROC
fragment and a 124 bp NED fragment, resulting in incorrect scored data, compared to
theoretically expected data.
B: Representation of the effect of the use of cross-talk correction by length-label
combinations. Scored data and expected data are correctly interpreted and false-positive
or negative data are eliminated.
Figure 14: Representation of a circular probe with primer binding sites, primers and an optional
blocking section and their relative positioning in the circular probe. After amplification
amplicons are formed that are representations of the circular probe.
Figure 15: Representation of the design of the selective or nested primers used in the selective
amplification of a sample of connected circular probes. The connected circular probe
is schematically drawn with one primer binding site and adjacent nucleotides denoted
as N. For a 24-plex ligation assay, the selective amplification with one selective
nucleotide is used to visualise the reduction to 6-plex amplification and detection
assays.
Figure 16: Amplification with primer Eook+T5'-JOE of a 10 plex ligation product of set 4 on
sample 2. Signal of Joe channel is shown.
- A. Cross-talk in the NED channel caused by the amplification of the 10 plex ligation
of set 4 on sample 2with primer Eook+T5'-JOE (see A). NED signal has been omitted.
- B. Signal in the NED channel caused by the amplification with primer Eook+T5'-JOE and
a NED labelled E00k amplification of a 10 plex ligation of set 4 on sample 2 (see
A). Because 5'+T E00k-Joe signal in NED differs 1bp, this two peaks can be distinguished.
X means cross-talk of the Joe fluorescent dye in Ned channel (corresponds to signal
in B).
- C. Amplification of a 10-plex ligation of set 4 on sample 2 was carried out using a
NED labelled E00k amplification primer and a 5' +T E00k JOE labelled primer and the
reaction products were combined for detection on the MegaBACE. Unprocessed signal
in the NED channel is shown. Because the JOE labelled products differ by one bp in
length, the peaks from NED and JOE can be distinguished in the NED channel.
- D. The same reaction products shown in C but after processing of the raw data, i.e.
after cross talk removal. The 1 bp size difference of the 5'T E00k JOE products prevent
miss-scoring caused by cross-talk of JOE signals into the NED channel as show in Figures
16 A, B and C.
All signals of A, B, C and D are obtained after processing by Genetic Profiler version
1 software from Molecular Dynamics. Signal shown in D is corrected for cross talk
and hence shows processed signals. The signals in A, B, and C are raw data and are
not corrected for cross talk.
Figure 17:
- A. Analysis of 5'+T Joe and FAM labelled E00k amplification of ligation products of
set 4 for sample5 (capillary G05) and 6 (capillary G06). Run time was 40 minutes.
- B. Second analysis of 5'+T Joe and FAM labelled E00k amplification of ligation products
of set 4 for sample5 (capillary G05) and 6 (capillary G06). This run was performed
directly after the one shown in A, on the same matrix. Run time was 40 minutes.
Figure 18:
Selective amplification of 3 sets out of one 40-plex ligation for sets 1, 2, 4 and
5 from sample 3.
- A. Selective amplification of set 1 with E01k-Ned and M01k.
- B. Selective amplification of set 2 with E03k-5'+T-JOE and M04k.
- C. Selective amplification of set 5 with E04k-Fam and M03k.
[0116] All channels are visible. It is clear that it is possible to amplify a specific set
out of a multiplex ligation product for more sets.
Examples
I. Design of the stuffer sequences
[0117] In order to prevent cross-hybridisation between the amplification products, it is
preferred that the sequences of the stuffer sequences are different and do not form
hairpins. In the tables 1-5, stuffer sequences are presented which can be used for
the development of probes for each fluorescent dye, and have been verified for the
absence of hairpins using Primer Designer version 2.0 (copyright 1990,1991, Scientific
and Educational software) The stuffer sequences are assembled from randomly chosen
tetramer blocks containing one G, C, T and A, and have therefore by definition a 50%
GC content. The stuffer sequence in the forward OLA probe for the two SNP alleles
are kept identical to avoid preferential SNP allele amplification.
Table 1: Lengths of stuffer sequences
| ET-ROX and JOE probes. |
FAM and NED probes. |
| Total stuffer length |
Stuffer length 1st type probe |
Stuffer length 2nd type probe |
Total stuffer length |
Stuffer length 1st type probe |
Stuffer length 2nd type probe |
| 0 |
0 |
0 |
1 |
1 |
0 |
| 2 |
0 |
2 |
3 |
1 |
2 |
| 4 |
4 |
0 |
5 |
5 |
0 |
| 6 |
4 |
2 |
7 |
5 |
2 |
| 8 |
8 |
0 |
9 |
9 |
0 |
| 10 |
8 |
2 |
11 |
9 |
2 |
| 12 |
12 |
0 |
13 |
13 |
0 |
| 14 |
12 |
2 |
15 |
13 |
2 |
| 16 |
16 |
0 |
17 |
17 |
0 |
| 18 |
16 |
2 |
19 |
17 |
2 |
| 20 |
20 |
0 |
21 |
21 |
0 |
| 22 |
20 |
2 |
23 |
21 |
2 |
| 24 |
24 |
0 |
25 |
25 |
0 |
| 26 |
24 |
2 |
27 |
25 |
2 |
| 28 |
28 |
0 |
29 |
29 |
0 |
| 30 |
28 |
2 |
31 |
29 |
2 |
| 32 |
32 |
0 |
33 |
33 |
0 |
| 34 |
32 |
2 |
35 |
33 |
2 |
| 36 |
36 |
0 |
37 |
37 |
0 |
| 38 |
36 |
2 |
39 |
37 |
2 |
Table 2: Stuffer sequences for ET-ROX probes (5'-3').
| Stuffer length |
| 1st type probe |
2nd type probe |
| 0 |
0 |
| 0 |
2 CA |
| 4 TGCA |
0 |
| 4TGCA |
2CA |
| 8 ACGT TACG |
0 |
| 8 ACGT TACG |
2CA |
| 12 TAGC GTCA GCAT |
0 |
| 12 TAGC GTCA GCAT |
2 CA |
| 16 CATG GCAT ACGT TACG |
0 |
| 16 CATG GCAT ACGT TACG |
2 CA |
| 20 GATC GCTA ACGT TACG GCAT |
0 |
| 20 GATC GCTA ACGT TACG GCAT |
2 CA |
| 24 TCGA GATC ACGT CATG CTGA GCAT |
0 |
| 24 TCGA GATC ACGT CATG CTGA GCAT |
2 CA |
| 28 CAGT TCAG GCAT TCGA CTAG CGTA TACG |
0 |
| 28 CAGT TCAG GCAT TCGA CTAG CGTA TACG |
2 CA |
| 32 GTCA ATCG GACT CTGA GACT CATG CGAT GACT |
0 |
| 32 GTCA ATCG GACT CTGA GACT CATG CGAT GACT |
2 CA |
| 36 GATC CGAT CGAT ATCG ACGT AGCT GCAT CGTA ATCG |
0 |
| 36 GATC CGAT CGAT ATCG ACGT AGCT GCAT CGTA ATCG |
2 CA |
Table 3: Stuffer sequences for JOE probes (5'-3').
| Stuffer length |
| First type probe |
2nd type probe |
| 0 |
0 |
| 0 |
2 TG |
| 4 ACTG |
0 |
| 4 ACTG |
2 TG |
| 8 GCAT CAGT |
0 |
| 8 GCAT CAGT |
2 TG |
| 12 ATCG GCAT TACG |
0 |
| 12 ATCG GCAT TACG |
2 TG |
| 16 TACG GCAT AGTC ACGT |
0 |
| 16 TACG GCAT AGTC ACGT |
2 TG |
| 20 GATC GCTA ACGT TACG GCAT |
0 |
| 20 GATC GCTA ACGT TACG GCAT |
2 TG |
| 24 CTAG ATGC TCAG GCTA TCGA CATG |
0 |
| 24 CTAG ATGC TCAG GCTA TCGA CATG |
2 TG |
| 28 GTAC CGAT ACGT TAGC GACT TAGC CGTA |
0 |
| 28 GTAC CGAT ACGT TAGC GACT TAGC CGTA |
2 TG |
| 32 CGTA ATCG GATC CGTA ACGT GCAT ATGC CAGT |
0 |
| 32 CGTA ATCG GATC CGTA ACGT GCAT ATGC CAGT |
2 TG |
 |
0 |
 |
2 TG |
Table 4: Stuffer sequences for FAM probes (5'-3').
| Stuffer length |
| First type probe |
2nd type probe |
| 1C |
0 |
| 1 C |
2 GA |
| 5 C GACT |
0 |
| 5 C GACT |
2 GA |
| 9 C CGAT TAGC |
0 |
| 9 C CGAT TAGC |
2 GA |
| 13 C ATCG GATC AGCT |
0 |
| 13 C ATCG GATC AGCT |
2 GA |
| 17 C ATGC TAGC ACGT ACTG |
0 |
| 17 C ATGC TAGC ACGT ACTG |
2 GA |
| 21 C GTAC CAGT CATG GATC CGAT |
0 |
| 21 C GTAC CAGT CATG GATC CGAT |
2 GA |
| 25 C GATC ATCG ACTG GTAC TACG GACT |
0 |
| 25 C GATC ATCG ACTG GTAC TACG GACT |
2 GA |
| 29 C GTAC GCAT GCTA ACGT TACG GACT ATCG |
0 |
| 29 C GTAC GCAT GCTA ACGT TACG GACT ATCG |
2 GA |
| 33 C CGTA GCAT CGAT ATCG GTCA ACTG GATC AGCT |
0 |
| 33 C CGTA GCAT CGAT ATCG GTCA ACTG GATC AGCT |
2 GA |
| 37 C GTAC CATG TCGA CGTA GATC CGTA TAGC ACTG AGTC |
0 |
| 37 C GTAC CATG TCGA CGTA GATC CGTA TAGC ACTG AGTC |
2 GA |
Table 5: Stuffer sequences for NED probes (5'-3').
| Stuffer length |
| First type probe |
2nd type probe |
| 1C |
0 |
| 1 C |
2 TC |
| 5 C GTAC |
0 |
| 5 C GTAC |
2 TC |
| 9 C GCAT TCGA |
0 |
| 9 C GCAT TCGA |
2 TC |
| 13 C ATCG GCAT GACT |
0 |
| 13 C ATCG GCAT GACT |
2 TC |
| 17 C GTCA ATGC ACGT TACG |
0 |
| 17 C GTCA ATGC ACGT TACG |
2 TC |
| 21 C GCAT CGAT AGCT CTGA ACGT |
0 |
| 21 C GCAT CGAT AGCT CTGA ACGT |
2 TC |
| 25 C GCAT ATCG GATC GATC GCAT ACGT |
0 |
| 25 C GCAT ATCG GATC GATC GCTA ACGT |
2 TC |
| 29 C ATCG GATC CATG CGTA GCAT ATCG ACGT |
0 |
| 29 C ATCG GATC CATG CGTA GCAT ATCG ACGT |
2 TC |
| 33 C TGCA AGTC CGAT TACG ATCG ACGT GCTA TGCA |
0 |
| 33 C TGCA AGTC CGAT TACG ATCG ACGT GCTA TGCA |
2 TC |
| 37 C AGCT CAGT ATCG AGTC GACT ACGT TGCA TACG GATC |
0 |
| 37 C AGCT CAGT ATCG AGTC GACT ACGT TGCA TACG GATC |
2 TC |
II. EXAMPLES MULTIPLEX LIGATION ASSAY AND DETECTION
Example 1. Description of biological materials and DNA isolation.
[0118] Recombinant Inbred (RI) lines generated from a cross between the
Arabidopsis ecotypes Colombia and Landsberg
erecta (
Lister and Dean, Plant Journal, 4, pp 745-750, (1993) were used. Seeds from the parental and RI lines were obtained from the Nottingham
Arabidopsis Stock Centre.
[0119] DNA was isolated from leaf material of individual seedlings using methods known
per se, for instance essentially as described in
EP-0534858, and stored in IX TE (10 mM Tris-HCl pH 8.0 containing 1 mM EDTA) solution. Concentrations
were determined by UV measurements in a spectrophotometer (MERK) using standard procedures,
and adjusted to 100 ng / µl using 1X TE.
Example 2. Selection of Arabidopsis SNP's.
[0120] The Arabidopsis SNP's that were selected from
The Arabidopsis Information Resource (TAIR) website:
http://www.arabidopsis.org/SNPs.html:, are summarised in Table 6 in
Table 6. Selected SNPs from
Arabidopsis thaliana.
| |
SNP |
SNP alleles* |
RI Map position |
| 1 |
SGCSNP1 |
G/A |
chr. 2; 72,81 |
| 2 |
SGCSNP20 |
A/C |
chr. 4; 15,69 |
| 3 |
SGCSNP27 |
T/G |
chr. 3; 74,81 |
| 4 |
SGCSNP37 |
C/G |
chr 2; 72,45 |
| 5 |
SGCSNP39 |
T/C |
chr.5;39,64 |
| 6 |
SGCSNP44 |
A/T |
not mapped |
| 7 |
SGCSNP55 |
C/A |
chr. 5; 27,68 |
| 8 |
SGCSNP69 |
G/A |
chr. 1; 81,84 |
| 9 |
SGCSNP119 |
A/T |
chr. 4; 62,06 |
| 10 |
SGCSNP164 |
T/C |
chr. 5; 83,73 |
| 11 |
SGCSNP209 |
C/G |
chr. 1; 70,31 |
| 12 |
SGCSNP312 |
G/T |
chr. 4; 55,95 |
| * For all SNP's the allele preceding the backslash is the Colombia allele. |
Example 3. Oligonucleotide probe design for oligonucleotide ligation reaction
Example 4. Design of the PCR amplification primers
[0122] The sequences of the primer used for PCR amplification were complementary to the
PCR primer binding regions incorporated in the ligation probes described in Example
3. The sequences represent the so called M1 3 forward and M13 reverse primers. Usually
the forward primer is labelled with FAM or □
33P-dATP depending on the detection platform. The sequence of the primers in 5'-3' orientation
are:
M13 forward: CGCCAGGGTTTTCCCAGTCACGAC [SEQ ID No. 37]
M13 reverse: AGCGGATAACAATTTCACACAGGA [SEQ ID No.38]
[0123] The concentration of these oligo's was adjusted to 50 ng / µl.
Example 5. Buffers and Reagents
[0124] The composition of the buffers was: Hybridisation buffer (1X), 20 mM Tris-HCl pH
8.5, 5 mM MgCl
2,100 mM KCl, 10 mM DTT, 1 mM NAD
+ Ligation buffer (1X) 20 mM Tris-HCl pH 7.6, 25 mM Kac, 10 mM MgAc
2,10 mM DTT, 1 mM NAD
+, 0.1 % Triton-X100.PCR buffer (10X):10x PCR buffer (contains 15 mM MgCl
2). (Qiagen, Valencia, United States of America).No additions were used in the PCR
Example 6. Ligation and Amplification
Ligation reactions:
[0125] Ligation reactions were carried out as follows: 100 ng genomic DNA (1 µl of 100 ng
/ µl) in 5 µl total volume was heat denatured by incubation for 5 minutes at 94 °C
and cooled on ice. Next 4 fmol of each OLA forward and reverse probes described in
Example 3 (36 oligonucleotides in total) were added, and the mixture was incubated
for 16 hours at 60 °C. Next, 1 unit of Taq Ligase (NEB) was added and the mixture
was incubated for 15 minutes at 60 °C.
[0126] Next, the ligase was heat-inactivated by incubation for 5x minutes at 94 °C and stored
at -20°C until further use.
PCR amplification:
[0127] PCR reactions mixture contained 10 µl ligation mixture, 1 µl of 50 ng/µl (FAM or
33P) labelled M13 forward and reverse primer (as described in Example 4), 200 µM of
each dNTP, 2.5 Units HotStarTaq Polymerase Qiagen, 5 µl 10X PCR buffer in a total
volume of 50 µl.
[0128] Amplifications were carried out by thermal cycling in a Perkin Elmer 9700 thermo
cycler (Perkin Elmer Cetus, Foster City, United States of America), according to the
following thermal cycling profile:
Profile 1: Initial denaturation/enzyme activation 15 min at 94 °C, followed by 35
cycles of: 30 sec at 94 °C, 30 sec at 55 °C, 1 min at 72 °C, and a final extension
of 2 min at 72 °C, 4 °C, forever.
Profile 2: Initial denaturation/enzyme activation 15 min at 94 °C, followed by 35
cycles of: 5 se
Example 7. Radioactive detection of 12-plex SNPWave products
[0130] Figure 10 shows an electrophoretic gel from a multiplex oligonucleotide ligation
assay of the 12 Arabidopsis SNPs listed in Example 2. Following the procedures described
here-in before, using DNA of the Colombia ecotype (C), Landsberg erecta ecotype (L)
or a mixture of equal amount of both ecotype (C+L) as the starting material.
[0131] Figure 10 shows that the appropriate alleles of SNP's SNP SGCSNP164, SGCSNP119, SGCSNP69,
SGCSNP29, SGCSNP27 and SGCSNP1 are clearly observed in the Colombia sample, , and
the appropriate SNP alleles of SNP loci SGCSNP164, SGCSNP119, SGCSNP69, SGCSNP29,
SGCSNP27 and SGCSNP1 are clearly observed in the Landsberg sample and that all these
SNP alleles together are observed in the mixture of both samples.
[0132] This Example illustrates that at least six SNP's can be simultaneously ligated and
amplified using the multiplex ligation / amplification procedure. This example further
illustrates that at least 12 SNPs can be detected in one sample. The results are represented
in Table 8
Table 8
| |
SNP Name |
Length |
Allele |
Result |
| Lan |
SGCSNP164 |
136 |
C |
Yes |
| Col |
SGCSNP164 |
134 |
T |
Yes |
| Lan |
SGCSNP119 |
132 |
T |
Yes |
| Col |
SGCSNP119 |
130 |
A |
Yes |
| Lan |
SGCSNP69 |
128 |
A |
Yes |
| Col |
SGCSNP69 |
126 |
G |
Yes |
| Lan |
SGCSNP55 |
124 |
A |
No |
| Col |
SGCSNP55 |
122 |
C |
yes |
| Lan |
SGCSNP44 |
120 |
T |
No |
| Col |
SGCSNP44 |
118 |
A |
No |
| Lan |
SGCSNP39 |
116 |
C |
No |
| Col |
SGCSNP39 |
114 |
T |
yes |
| Lan |
SGCSNP37 |
112 |
G |
Yes |
| Col |
SGCSNP37 |
110 |
C |
No |
| Lan |
SGCSNP27 |
108 |
G |
Yes |
| Col |
SGCSNP27 |
106 |
T |
Yes |
| Lan |
SGCSNP20 |
104 |
C |
Ns* |
| Col |
SGCSNP20 |
102 |
A |
Ns |
| Lan |
SGCSNP312 |
104 |
T |
Ns |
| Col |
SGCSNP312 |
102 |
G |
Ns |
| Lan |
SGCSNP209 |
100 |
G |
Yes |
| Col |
SGCSNP209 |
98 |
C |
Yes |
| Lan |
SGCSNP1 |
100 |
A |
Yes |
| Col |
SGCSNP1 |
97 |
G |
Yes |
| *; not scored; Col: Colombia allele, Lan: Landsberg allele |
Example 8. Gel electrophoresis
[0133] Gel electrophoresis was performed as described in
Vos et al., Nucleic Acids research 23(21),(1995), 4407-4414. After exposure of the dried gel to phospho-imaging screens (Fuji Photo Film Co.,
LTD, Type BAS III) for 16 hours, an image was obtained by scanning using the Fuji
scanner (Fuji Photo Film Co., LTD, Fujix BAS 2000) and stored in digital form.
Example 9. Oligonucleotide sizers for capillary electrophoresis
sizer 94 bp:
[0134] 
sizer 95 bp:
[0135] 
sizer 137 bp:
[0136] 
Example 10. Purification and dilution of amplified connected probes
[0137] In case of detection using the MegaBACE 1000 capillary sequencing instrument, desalting
and purification of the PCR reactions mixtures was carried in 96-well format, using
the following procedure:
A. Preparation of the 96-well Sephadex purification plates
[0138] Dry Sephadex
™ G-50 superfine (Amersham Pharmacia Biotech, Uppsala, Sweden) was loaded into the
wells of a 96-well plate (MultiScreen
®-HV, Millipore Corporation, Bedford, MA, USA), using the 45 microliter column loader
(Millipore Corporation) as follows:
- 1. Sephadex G-50 superfine was added to the column loader.
- 2. Excess Sephadex was removed from the top of the column loader with a scraper.
- 3. The Multiscreen-HV plate was placed upside-down on top of the Column Loader.
- 4. The Multiscreen-HV plate and the Column Loader were both inverted.
- 5. The Sephadex G-50 was released by tapping on top or at the side of the Column Loader.
[0139] Next, the Sephadex G-50 was swollen en rinsed as follows:
6. 200 µl Milli-Q water was added per well using a multi-channel pipettor.
7. A centrifuge alignment frame was placed on top of a standard 96-well microplate,
the Multiscreen-HV plate was place on top and the minicolumns were packed by centrifugation
for 5 min at 900 g.
8. The 96-well plate was emptied and placed back.
9. Steps 5-7 were repeated once.
10. 200 µl Milli-Q water was added to each well to swell the Sephadex G-50 and incubated
for 2-3 hours. Occasionaly, at this stage the Multiscreen-HV plates with swollen mini-columns
of Sephadex G-50 superfine were tightly sealed with parafilm and stored a refrigerator
at 4 °C until further use.
11. A centrifuge alignment frame was placed on top of a standard 96-well microplate,
the Multiscreen-HV plate was placed on top of the assembly and the minicolumns were
packed by centrifugation for 5 min at 900 g.
12. The 96-well microplate was removed.
13. The mixtures containing the amplified connected probes were carefully added to
the centre of each well.
14. Using the centrifuge alignment frame, the Multiscreen-HV plate was placed on top
of a new standard U-bottom microtitre plate and centrifugation was carried out for
5 min at 900 g.
15. The eluate in the standard 96-well plate (approximately 25 µl per well) contains
the purified product.
B. Dilution of the purified products
[0140] Purified samples were diluted 25-75 fold in Milli-Q water before injection.
Example 11. Capillary electrophoresis on the MegaBACE
Preparation of the samples:
[0141] A 800-fold dilution of ET-900 Rox size standard (Amersham Pharmacia Biotech) was
made in water. 8 µl diluted ET-900 Rox was added to 2 µl purified sample. Prior to
running, the sample containing the sizing standard was heat denatured by incubation
for 1 min at 94 °C and subsequently put on ice.
Detection on the MegaBACE:
[0142] MegaBACE capillaries were filled with 1X LPA matrix (Amersham Pharmacia Biotech,
Piscataway, NJ, USA) according to the manufacturer's instructions. Parameters for
electrokinetic injection of the samples were as follows: 45 sec at 3 kV. The run parameters
were 110 min at 10 kV. Post-running, the cross-talk correction, smoothing of the peaks
and cross-talk correction was carried out using Genetic Profiler software, version
1.0 build 20001017 (Molecular Dynamics, Sunnyvale, CA, USA), and electropherograms
generated.
Example 12. Repeated injection on the MegaBACE.
[0143] The minimum time interval for adequate separation between two consecutively injected
samples was determined by injecting the sizer sample as described in Example 8. The
resulting time interval was used, with a small additional margin, when injecting the
purified amplified connected probes from the oligonucleotide assay. The results are
presented in Fig 11.
- A. Partial electropherogram of FAM labelled detection of the Colombia sample on a capillary
electrophoretic device (MegaBACE). The same multiplex mixture was injected twice.
Amplified connected probes (size range 97-134 bp) and flanking sizer fragments (94,
95 and 137 bp) are all labelled with FAM
- B. Partial electropherogram of FAM labelled detection of the Landsberg erecta sample
on a capillary electrophoretic device (MegaBACE). The same multiplex mixture was injected
twice. Amplified connected probes (size range 97-134 bp) and flanking sizer fragments
(94, 95 and 137 bp) are all labelled with FAM.
Example 13. Cross-talk reduction using stuffer sequences of different lengths
[0144] In this experiment the use of different length-label combinations to avoid the negative
influence of incomplete cross-talk removal on the quality of a dominantly scored (presence
/absence) dataset of SNP markers is demonstrated. Stuffer lengths were chosen such
that ET-ROX and JOE-labelled fragments have identical sizes, and that FAM and NED
fragments have identical sizes, but differing by 1 basepair from those of ET-ROX and
JOE-labelled fragments. The result is that even in case of incomplete cross-talk removal
between dyes with overlapping emission spectra, the observed signal will not result
in incorrect scoring because the expected sizes of the amplification products are
known for every label. Hence length-label combinations define the expectance patterns
for genuine signals are signals originating from incomplete cross-talk correction.
The results are presented in Fig 12 and 13.
[0145] The example shows in Figure 13:
- A). The effect of incomplete cross talk removal on the data quality in case of a sample
that contains a ET-ROX labelled fragment of 120 basepair and a NED labelled fragment
of 124 basepairs in a situation where fragments of a particular size can be observed
in combination with all labels. In this case, incomplete cross-talk of ET-ROX signal
into the FAM Channel at 120 bp removal leads to the incorrect scoring of a FAM fragment
of 120 basepairs (in reality an ET-ROX labelled fragment of 120 basepairs).Similarly,
incomplete cross-talk correction removal of NED signal into JOE at 124 bp leads to
incorrect scoring of a JOE fragment of 124 basepairs (in reality a NED labelled fragment
of 124 basepairs), in addition to the correct fragments.
- B). The effect of the use of cross-talk-optimised length-label combinations such that
ET-ROX- and FAM-labelled fragments of the same length are not avoided by choosing
different stuffer lengths, because their emission spectra overlap. Similarly, same-size
amplified connected probe fragments labelled with JOE and NED are avoided. In case
of a hypothetical sample containing a 120 bp ET-ROX -labelled fragment and a 124 bp
NED labelled fragment (identical to the that described above in A), the small but
detectable signals (peaks) of FAM at 120 bp and of JOE at 124 bp that remain after
incomplete (mathematical) cross-talk correction will not be scored because they are
known to originate from cross talk of ET-ROX and NED signals, respectively. Hence,
they have no impact on the data quality and both fragments are scored correctly.
Example 14. Identification of SNPs
[0146] The selected SNPs are identified and summarized in Table 9.
Example 15. Oligonucleotide probe design for oligonucleotide ligation reaction
[0147] The circular oligonucleotide probes (5'-3' orientation) were selected to discriminate
the SNP alleles for each of the SNP loci described in Example 14. PCR binding regions
are underlined, stuffer sequences are double underlined. Reverse primers are phosphorylated
at the 5' end:. p indicates phosphorylated. The sequences are summarised in Table
10.
Example 16. Design of the PCR amplification primers
[0148] The sequence of one of the primers used for PCR amplification was complementary to
the PCR primer binding regions incorporated in the ligation probes described in Example
15. The sequence of the second PCR primer matched the PCR primer binding region of
the probe. Usually the forward primer is labelled. The concentration of the oligonucleotides
was adjusted to 50 ng / µl. The sequence of the primers in 5'-3' orientation are depicted
in Table 11.
Table 11. PCR amplification primers
| SEQ ID # |
|
Primer nr |
5'-3' |
|
| 215 |
MseI+0: |
93E40 |
GATGAGTCCTGAGTAA* |
M00k |
| 216 |
EcoRI+0 |
93L01 |
GACTGCGTACCAATTC* |
E00k |
| |
|
|
|
|
| 217 |
EcoRI+1 |
93LO2 |
GACTGCGTACCAATTCA |
E01K NED |
| 218 |
EcoRI+1 |
93LO4 |
GACTGCGTACCAATTCG |
E03K 5'+T Joe |
| 219 |
EcoRI+1 |
93LO5 |
GACTGCGTACCAATTCT |
E04K FAM |
| *Multiple labels possible |
Example 17. Ligation and amplification
[0149] 9 samples (samples1-9) of homozygous tomato lines (Example 14) were subjected to
a multiplex oligonucleotide ligation reaction using a mixture of 20 padlock probes
(set 4). Conditions used were 1x Taq DNA ligase buffer (NEB), 0.2 U/µl Taq DNA ligase,
and 0.05 fmol/µl of each probe in a volume of 10 µl. Ligation was performed in a thermocycler
(Perkin Elmer) with the following cycling conditions: 2 minutes at 94 °C + 10*(15
seconds at 94 °C + 60 minutes at 60°C) + 4 °C continuously. Following ligation, the
10 µl ligation product was diluted with 30 µl 1x Taq DNA ligase buffer. The 40 µl
of each reaction was used to perform 4 amplification reactions using 4 different labelled
E00k primers each combined with M00k. The E00k primer labelled with ET-ROX and JOE
were designed with an extra 1 bp in comparison with E00k labelled with FAM and NED
length, to prevent possible crosstalk between fluorescent labels when analysing these
products on the MegaBACE. Conditions used were 30 ng labelled E00k primer and 30 ng
M00k primer, 1x Accuprime buffer I, 0.4 ul Accuprime polymerase (Invitrogen) on 10
µl diluted ligation product in a 20 µl PCR reaction. PCR was performed in a thermocycler
with the following cycling conditions: 2 minutes at 94 °C + 35 *(15 seconds at 94
°C + 30 seconds at 56 °C + 60 seconds at 68 °C) +4 °C continuously. PCR product was
purified using Sephadex 50 and diluted 80 times with MQ. Diluted PCR product was analysed
on the MegaBACE. The different fluorescent-labelled products were run separately and
in different combinations (2, 3 and 4 fluorescent dyes). The results are presented
in Fig 16.
Example 18: Use of length/dye combinations and the principle of repeated injection in combination
with reuse of the LPA matrix.
[0150] The amplification products of set 4 were analysed using consecutive runs without
replacement of the LPA matrix between runs. Samples of the amplification products
were injected after a run period of 40 minutes without changing the matrix. Results
are presented in Fig 17. Consecutive runs can be performed without changing the matrix
and without significant loss of data quality.
Example 19: Selective amplification of a multiplex ligation sample
[0151] This experiment demonstrates the possibility of a higher multiplex of oligonucleotide
ligation, in combination with the selective amplification of a subset of the formed
ligation products using (AFLP) amplification primers with selective nucleotides.
[0152] Using the 4 designed probe sets, primers are based on set 1,2,4 and 5 but with additional
selective nucleotides located immediately 3' of the primer binding sites in the probes.
[0153] Each set was ligated separately, and in combination with other sets, up to a multiplex
of 40 based on the 4 sets together. AFLP+1/+1 amplifications using different labelled
E00k primers were performed using the scheme depicted below.
| Ligation set |
Amplification |
| |
Label |
Primers |
Selective bases |
Set |
| 1 |
NED |
E01k/M01k |
+A/+A |
1 |
| 2 |
JOE |
E03k/M04k |
+G/+T |
2 |
| 5 |
FAM |
E04k/M03k |
+T/+G |
5 |
| 1+4 |
NED |
E01k/M01k |
+A/+A |
1 |
| 2+4 |
JOE |
E03k/M04k |
+G/+T |
2 |
| 4+5 |
FAM |
E04k/M03k |
+T/+G |
5 |
| 1+2+4+5 |
JOE |
E03k/M04k |
+G/+T |
2 |
| 1+2+4+5 |
NED |
E01k/M01k |
+A/+A |
1 |
| 1+2+4+5 |
FAM |
E04k/M03k |
+T/+G |
5 |
[0154] Conditions used were 1x Taq DNA ligase buffer (NEB), 0.2 U/µl Taq DNA ligase, and
0.05 fmol/µl of each probe in a volume of 10 µl. Ligation was performed in a thermocycler
(Perkin Elmer) with the following cycling conditions: 2 minutes at 94 °C+10*(15 seconds
at 94 °C; 60 minutes at 60 °C)+ 4 °C continuously. Following ligation, the 10 µl ligation
product was diluted with 30 µl 1x Taq DNA ligase buffer. Conditions used were 30 ng
labelled E0k primer and 30 ng M00k primer, 1x Accuprime buffer (Invitrogen) I, 0.4
ul Accuprime polymerase (Invitrogen) on 10 µl diluted ligation product in a 20 µl
PCR reaction. PCR was performed in a thermocycler with the following cycling conditions:
2 minutes at 94 °C+35*(15 seconds at 94 °C + 30 seconds at 56 °C + 6 minutes at 68
°C)+ 4 °C continuously. PCR product was purified using Sephadex 50 and diluted 80
times with MQ. Diluted PCR product was analysed on the Megabace. The different fluorescent-labelled
products were run in separate capillaries. The results are presented in Fig 18.
Buffer compositions:
1x Taq DNA ligase buffer
[0155]
20 mM Tris-HCl
25 mM potassium acetate
10 mM Magnesium acetate
10 mM DTT
1 mM NAD
0.1% Triton X-100
(pH 7.6@ 25°C)
1xAccuPrime Taq DNA polymerase buffer
[0156]
20 mM Tris-HCl (pH8.4)
50 mM KCl
1.5 mM MgCl2
0.2 mM dGTP, dATP, dTTP and dCTP
thermostable AccuPrime™ protein
10% glycerol
SEQUENCE LISTING
[0157]
<110> Keygene N.V.
<120> Analysis and detection of multiple target sequences using circular probes
<130> P205833PCT
<140> P205833PCT
<141> 2002-12-16
<150> EP 01204912.8
<151> 2001-12-14
<160> 219
<170> PatentIn version 3.1
<210> 1
<211> 48
<212> DNA
<213> artificial
<400> 1

<210> 2
<211> 51
<212> DNA
<213> artificial
<400> 2

<210> 3
<211> 49
<212> DNA
<213> artificial
<400> 3

<210> 4
<211> 49
<212> DNA
<213> artificial
<400> 4

<210> 5
<211> 51
<212> DNA
<213> artificial
<400> 5

<210> 6
<211> 53
<212> DNA
<213> artificial
<400> 6

<210> 7
<211> 49
<212> DNA
<213> artificial
<400> 7

<210> 8
<211> 51
<212> DNA
<213> artificial
<400> 8

<210> 9
<211> 57
<212> DNA
<213> artificial
<400> 9

<210> 10
<211> 49
<212> DNA
<213> artificial
<400> 10

<210> 11
<211> 51
<212> DNA
<213> artificial
<400> 11

<210> 12
<211> 61
<212> DNA
<213> artificial
<400> 12

<210> 13
<211> 49
<212> DNA
<213> artificial
<400> 13

<210> 14
<211> 51
<212> DNA
<213> artificial
<400> 14

<210> 15
<211> 65
<212> DNA
<213> artificial
<400> 15

<210> 16
<211> 49
<212> DNA
<213> artificial
<400> 16

<210> 17
<211> 51
<212> DNA
<213> artificial
<400> 17

<210> 18
<211> 69
<212> DNA
<213> artificial
<400> 18

<210> 19
<211> 49
<212> DNA
<213> artificial
<400> 19

<210> 20
<211> 51
<212> DNA
<213> artificial
<400> 20

<210> 21
<211> 73
<212> DNA
<213> artificial
<400> 21

<210> 22
<211> 49
<212> DNA
<213> artificial
<400> 22

<210> 23
<211> 51
<212> DNA
<213> artificial
<400> 23

<210> 24
<211> 77
<212> DNA
<213> artificial
<400> 24

<210> 25
<211> 49
<212> DNA
<213> artificial
<400> 25

<210> 26
<211> 51
<212> DNA
<213> artificial
<400> 26

<210> 27
<211> 81
<212> DNA
<213> artificial
<400> 27

<210> 28
<211> 49
<212> DNA
<213> artificial
<400> 28

<210> 29
<211> 51
<212> DNA
<213> artificial
<400> 29

<210> 30
<211> 85
<212> DNA
<213> artificial
<400> 30

<210> 31
<211> 49
<212> DNA
<213> artificial
<400> 31

<210> 32
<211> 51
<212> DNA
<213> artificial
<400> 32

<210> 33
<211> 49
<212> DNA
<213> artificial
<400> 33

<210> 34
<211> 49
<212> DNA
<213> artificial
<400> 34

<210> 35
<211> 51
<212> DNA
<213> artificial
<400> 35

<210> 36
<211> 53
<212> DNA
<213> artificial
<400> 36

<210> 37
<211> 24
<212> DNA
<213> artificial
<400> 37

<210> 38
<211> 24
<212> DNA
<213> artificial
<400> 38

<210> 39
<211> 4
<212> DNA
<213> artificial
<400> 39

<210> 40
<211> 8
<212> DNA
<213> artificial
<400> 40

<210> 41
<211> 12
<212> DNA
<213> artificial
<400> 41

<210> 42
<211> 16
<212> DNA
<213> artificial
<400> 42

<210> 43
<211> 20
<212> DNA
<213> artificial
<400> 43

<210> 44
<211> 24
<212> DNA
<213> artificial
<400> 44

<210> 45
<211> 28
<212> DNA
<213> artificial
<400> 45

<210> 46
<211> 32
<212> DNA
<213> artificial
<400> 46

<210> 47
<211> 36
<212> DNA
<213> artificial
<400> 47

<210> 48
<211> 4
<212> DNA
<213> artificial
<400> 48

<210> 49
<211> 8
<212> DNA
<213> artificial
<400> 49

<210> 50
<211> 12
<212> DNA
<213> artificial
<400> 50

<210> 51
<211> 16
<212> DNA
<213> artificial
<400> 51

<210> 52
<211> 20
<212> DNA
<213> artificial
<400> 52

<210> 53
<211> 24
<212> DNA
<213> artificial
<400> 53

<210> 54
<211> 28
<212> DNA
<213> artificial
<400> 54

<210> 55
<211> 32
<212> DNA
<213> artificial
<400> 55

<210> 56
<211> 36
<212> DNA
<213> artificial
<400> 56

<210> 57
<211> 5
<212> DNA
<213> artificial
<400> 57

<210> 58
<211> 9
<212> DNA
<213> artificial
<400> 58

<210> 59
<211> 13
<212> DNA
<213> artificial
<400> 59

<210> 60
<211> 17
<212> DNA
<213> artificial
<400> 60

<210> 61
<211> 21
<212> DNA
<213> artificial
<400> 61

<210> 62
<211> 25
<212> DNA
<213> artificial
<400> 62

<210> 63
<211> 29
<212> DNA
<213> artificial
<400> 63

<210> 64
<211> 33
<212> DNA
<213> artificial
<400> 64

<210> 65
<211> 37
<212> DNA
<213> artificial
<400> 65

<210> 66
<211> 5
<212> DNA
<213> artificial
<400> 66

<210> 67
<211> 9
<212> DNA
<213> artificial
<400> 67

<210> 68
<211> 13
<212> DNA
<213> artificial
<400> 68

<210> 69
<211> 17
<212> DNA
<213> artificial
<400> 69

<210> 70
<211> 21
<212> DNA
<213> artificial
<400> 70

<210> 71
<211> 25
<212> DNA
<213> artificial
<400> 71

<210> 72
<211> 29
<212> DNA
<213> artificial
<400> 72

<210> 73
<211> 33
<212> DNA
<213> artificial
<400> 73

<210> 74
<211> 37
<212> DNA
<213> artificial
<400> 74

<210> 75
<211> 669
<212> DNA
<213> Lycopersicon esculentum
<400> 75


<210> 76
<211> 556
<212> DNA
<213> Lycopersicon esculentum
<400> 76

<210> 77
<211> 727
<212> DNA
<213> Lycopersicon esculentum
<220>
<221> misc_feature
<222> (1)..(727)
<223>
<220>
<221> misc_feature
<222> (1)..(727)
<223> W= A or T; M= A or C; R= A or G; Y= C or T; K= G or T; S= G or C;
H= A, C or T; B= C, G or T; V= A, C or G; D= A, G or T; N= A, C, G or T
<400> 77


<210> 78
<211> 350
<212> DNA
<213> Lycopersicon esculentum
<400> 78

<210> 79
<211> 240
<212> DNA
<213> Lycopersicon esculentum
<400> 79

<210> 80
<211> 389
<212> DNA
<213> Lycopersicon esculentum
<400> 80

<210> 81
<211> 389
<212> DNA
<213> Lycopersicon esculentum
<400> 81


<210> 82
<211> 489
<212> DNA
<213> Lycopersicon esculentum
<400> 82

<210> 83
<211> 754
<212> DNA
<213> Lycopersicon esculentum
<220>
<221> misc_feature
<222> (749)..(799)
<223> W= A or T; M= A or C; R= A or G; Y= C or T; K= G or T; S= G or C; H= A, C or
T; B= C, G or T; V= A, C or G; D= G or T; N= A, C, G or T
<400> 83

<210> 84
<211> 251
<212> DNA
<213> Lycopersicon esculentum
<400> 84

<210> 85
<211> 539
<212> DNA
<213> Lycopersicon esculentum
<400> 85

<210> 86
<211> 521
<212> DNA
<213> Lycopersicon esculentum
<400> 86

<210> 87
<211> 654
<212> DNA
<213> Lycopersicon esculentum
<400> 87


<210> 88
<211> 356
<212> DNA
<213> Lycopersicon esculentum
<400> 88

<210> 89
<211> 824
<212> DNA
<213> Lycopersicon esculentum
<400> 89


<210> 90
<211> 395
<212> DNA
<213> Lycopersicon esculentum
<400> 90


<210> 91
<211> 318
<212> DNA
<213> Lycopersicon esculentum
<220>
<221> misc_feature
<222> (315)..(315)
<223> W= A or T; M= A or C; R= A or G; Y= C or T; K= G or T; S= G or C;
H= A, C or T; B= C, G or T; V= A, C or G; D= A, G or T; N= A, C, G or T
<220>
<221> misc_feature
<222> (316)..(316)
<223> W= A or T; M= A or C; R= A or G; Y= C or T; K= G or T; S= G or C;
H= A, C or T; B= C, G or T; V= A, C or G; D= A, G or T; N= A, C, G or T
<220>
<221> misc_feature
<222> (318)..(318)
<223> W= A or T; M= A or C; R= A or G; Y= C or T; K= G or T; S= G or C;
H= A, C or T; B= C, G or T; V= A, C or G; D= A, G or T; N= A, C, G or T
<400> 91

<210> 92
<211> 595
<212> DNA
<213> Lycopersicon esculentum
<220>
<221> misc_feature
<222> (418)..(418)
<223> W= A or T; M= A or C; R= A or G; Y= C or T; K= G or T; S= G or C;
H= A, C or T; B= C, G or T; V= A, C or G; D= A, G or T; N= A, C, G or T
<220>
<221> misc_feature
<222> (433)..(433)
<223> W= A or T; M= A or C; R= A or G; Y= C or T; K= G or T; S= G or C;
H= A, C or T; B= C, G or T; V= A, C or G; D= A, G or T; N= A, C, G or T
<220>
<221> misc_feature
<222> (484)..(484)
<223> W= A or T; M= A or C; R= A or G; Y= C or T; K= G or T; S= G or C;
H= A, C or T; B= C, G or T; V= A, C or G; D= A, G or T; N= A, C, G or T
<220>
<221> misc_feature
<222> (549)..(549)
<223> W= A or T; M= A or C; R= A or G; Y= C or T; K= G or T; S= G or C;
H= A, C or T; B= C, G or T; V= A, C or G; D= A, G or T; N= A, C, G or T
<400> 92

<210> 93
<211> 342
<212> DNA
<213> Lycopersicon esculentum
<400> 93

<210> 94
<211> 434
<212> DNA
<213> Lycopersicon esculentum
<400> 94


<210> 95
<211> 472
<212> DNA
<213> Lycopersicon esculentum
<400> 95

<210> 96
<211> 222
<212> DNA
<213> Lycopersicon esculentum
<400> 96


<210> 97
<211> 133
<212> DNA
<213> Lycopersicon esculentum
<400> 97

<210> 98
<211> 249
<212> DNA
<213> Lycopersicon esculentum
<400> 98

<210> 99
<211> 284
<212> DNA
<213> Lycopersicon esculentum
<400> 99

<210> 100
<211> 320
<212> DNA
<213> Lycopersicon esculentum
<400> 100

<210> 101
<211> 191
<212> DNA
<213> Lycopersicon esculentum
<400> 101

<210> 102
<211> 279
<212> DNA
<213> Lycopersicon esculentum
<400> 102

<210> 103
<211> 336
<212> DNA
<213> Lycopersicon esculentum
<400> 103


<210> 104
<211> 373
<212> DNA
<213> Lycopersicon esculentum
<400> 104

<210> 105
<211> 336
<212> DNA
<213> Lycopersicon esculentum
<400> 105


<210> 106
<211> 261
<212> DNA
<213> Lycopersicon esculentum
<400> 106

<210> 107
<211> 450
<212> DNA
<213> Lycopersicon esculentum
<400> 107


<210> 108
<211> 124
<212> DNA
<213> Lycopersicon esculentum
<400> 108

<210> 109
<211> 149
<212> DNA
<213> Lycopersicon esculentum
<400> 109

<210> 110
<211> 267
<212> DNA
<213> Lycopersicon esculentum
<400> 110

<210> 111
<211> 210
<212> DNA
<213> Lycopersicon esculentum
<400> 111

<210> 112
<211> 165
<212> DNA
<213> Lycopersicon esculentum
<400> 112

<210> 113
<211> 373
<212> DNA
<213> Lycopersicon esculentum
<400> 113

<210> 114
<211> 312
<212> DNA
<213> Lycopersicon esculentum
<400> 114


<210> 115
<211> 124
<212> DNA
<213> artificial
<400> 115

<210> 116
<211> 122
<212> DNA
<213> artificial
<400> 116

<210> 117
<211> 119
<212> DNA
<213> artificial
<400> 117

<210> 118
<211> 117
<212> DNA
<213> artificial
<400> 118

<210> 119
<211> 114
<212> DNA
<213> artificial
<400> 119

<210> 120
14 <211> 112
<212> DNA
<213> artificial
<400> 120


<210> 121
<211> 109
<212> DNA
<213> artificial
<400> 121

<210> 122
<211> 107
<212> DNA
<213> artificial
<400> 122

<210> 123
<211> 104
<212> DNA
<213> artificial
<400> 123

<210> 124
<211> 102
<212> DNA
<213> artificial
<400> 124

<210> 125
<211> 99
<212> DNA
<213> artificial
<400> 125

<210> 126
<211> 97
<212> DNA
<213> artificial
<400> 126

<210> 127
<211> 94
<212> DNA
<213> artificial
<400> 127

<210> 128
<211> 92
<212> DNA
<213> artificial
<400> 128

<210> 129
<211> 89
<212> DNA
<213> artificial
<400> 129

<210> 130
<211> 87
<212> DNA
<213> artificial
<400> 130


<210> 131
<211> 84
<212> DNA
<213> artificial
<400> 131

<210> 132
<211> 82
<212> DNA
<213> artificial
<400> 132

<210> 133
<211> 79
<212> DNA
<213> artificial
<400> 133

<210> 134
<211> 77
<212> DNA
<213> artificial
<400> 134

<210> 135
<211> 124
<212> DNA
<213> artificial
<400> 135

<210> 136
<211> 124
<212> DNA
<213> artificial
<400> 136

<210> 137
<211> 119
<212> DNA
<213> artificial
<400> 137

<210> 138
<211> 117
<212> DNA
<213> artificial
<400> 138

<210> 139
<211> 114
<212> DNA
<213> artificial
<400> 139

<210> 140
<211> 112
<212> DNA
<213> artificial
<400> 140

<210> 141
<211> 109
<212> DNA
<213> artificial
<400> 141

<210> 142
<211> 107
<212> DNA
<213> artificial
<400> 142

<210> 143
<211> 104
<212> DNA
<213> artificial
<400> 143


<210> 144
<211> 102
<212> DNA
<213> artificial
<400> 144

<210> 145
<211> 99
<212> DNA
<213> artificial
<400> 145

<210> 146
<211> 97
<212> DNA
<213> artificial
<400> 146

<210> 147
<211> 94
<212> DNA
<213> artificial
<400> 147

<210> 148
<211> 92
<212> DNA
<213> artificial
<400> 148

<210> 149
<211> 89
<212> DNA
<213> artificial
<400> 149

<210> 150
<211> 87
<212> DNA
<213> artificial
<400> 150

<210> 151
<211> 84
<212> DNA
<213> artificial
<400> 151

<210> 152
<211> 82
<212> DNA
<213> artificial
<400> 152

<210> 153
<211> 79
<212> DNA
<213> artificial
<400> 153


<210> 154
<211> 77
<212> DNA
<213> artificial
<400> 154

<210> 155
<211> 124
<212> DNA
<213> artificial
<400> 155

<210> 156
<211> 122
<212> DNA
<213> artificial
<400> 156


<210> 157
<211> 119
<212> DNA
<213> artificial
<400> 157

<210> 158
<211> 117
<212> DNA
<213> artificial
<400> 158

<210> 159
<211> 114
<212> DNA
<213> artificial
<400> 159

<210> 160
<211> 112
<212> DNA
<213> artificial
<400> 160

<210> 161
<211> 109
<212> DNA
<213> artificial
<400> 161

<210> 162
<211> 107
<212> DNA
<213> artificial
<400> 162

<210> 163
<211> 104
<212> DNA
<213> artificial
<400> 163

<210> 164
<211> 102
<212> DNA
<213> artificial
<400> 164

<210> 165
<211> 99
<212> DNA
<213> artificial
<400> 165

<210> 166
<211> 97
<212> DNA
<213> artificial
<400> 166


<210> 167
<211> 94
<212> DNA
<213> artificial
<400> 167

<210> 168
<211> 92
<212> DNA
<213> artificial
<400> 168

<210> 169
<211> 89
<212> DNA
<213> artificial
<400> 169

<210> 170
<211> 87
<212> DNA
<213> artificial
<400> 170

<210> 171
<211> 84
<212> DNA
<213> artificial
<400> 171

<210> 172
<211> 82
<212> DNA
<213> artificial
<400> 172

<210> 173
<211> 79
<212> DNA
<213> artificial
<400> 173

<210> 174
<211> 77
<212> DNA
<213> artificial
<400> 174

<210> 175
<211> 124
<212> DNA
<213> artificial
<400> 175

<210> 176
<211> 122
<212> DNA
<213> artificial
<400> 176

<210> 177
<211> 119
<212> DNA
<213> artificial
<400> 177

<210> 178
<211> 117
<212> DNA
<213> artificial
<400> 178

<210> 179
<211> 114
<212> DNA
<213> artificial
<400> 179


<210> 180
<211> 112
<212> DNA
<213> artificial
<400> 180

<210> 181
<211> 109
<212> DNA
<213> artificial
<400> 181

<210> 182
<211> 107
<212> DNA
<213> artificial
<400> 182

<210> 183
<211> 104
<212> DNA
<213> artificial
<400> 183

<210> 184
<211> 102
<212> DNA
<213> artificial
<400> 184

<210> 185
<211> 99
<212> DNA
<213> artificial
<400> 185

<210> 186
<211> 97
<212> DNA
<213> artificial
<400> 186

<210> 187
<211> 94
<212> DNA
<213> artificial
<400> 187

<210> 188
<211> 94
<212> DNA
<213> artificial
<400> 188

<210> 189
<211> 89
<212> DNA
<213> artificial
<400> 189


<210> 190
<211> 87
<212> DNA
<213> artificial
<400> 190

<210> 191
<211> 84
<212> DNA
<213> artificial
<400> 191

<210> 192
<211> 82
<212> DNA
<213> artificial
<400> 192

<210> 193
<211> 79
<212> DNA
<213> artificial
<400> 193

<210> 194
<211> 77
<212> DNA
<213> artificial
<400> 194

<210> 195
<211> 120
<212> DNA
<213> artificial
<400> 195

<210> 196
<211> 118
<212> DNA
<213> artificial
<400> 196

<210> 197
<211> 116
<212> DNA
<213> artificial
<400> 197

<210> 198
<211> 114
<212> DNA
<213> artificial
<400> 198

<210> 199
<211> 112
<212> DNA
<213> artificial
<400> 199


<210> 200
<211> 110
<212> DNA
<213> artificial
<400> 200

<210> 201
<211> 108
<212> DNA
<213> artificial
<400> 201

<210> 202
<211> 106
<212> DNA
<213> artificial
<400> 202

<210> 203
<211> 104
<212> DNA
<213> artificial
<400> 203

<210> 204
<211> 102
<212> DNA
<213> artificial
<400> 204

<210> 205
<211> 100
<212> DNA
<213> artificial
<400> 205

<210> 206
<211> 98
<212> DNA
<213> artificial
<400> 206

<210> 207
<211> 96
<212> DNA
<213> artificial
<400> 207

<210> 208
<211> 94
<212> DNA
<213> artificial
<400> 208

<210> 209
<211> 92
<212> DNA
<213> artificial
<400> 209


<210> 210
<211> 90
<212> DNA
<213> artificial
<400> 210

<210> 211
<211> 88
<212> DNA
<213> artificial
<400> 211

<210> 212
<211> 86
<212> DNA
<213> artificial
<400> 212

<210> 213
<211> 84
<212> DNA
<213> artificial
<400> 213

<210> 214
<211> 82
<212> DNA
<213> artificial
<400> 214

<210> 215
<211> 16
<212> DNA
<213> artificial
<400> 215

<210> 216
<211> 16
<212> DNA
<213> artificial
<400> 216

<210> 217
<211> 17
<212> DNA
<213> artificial
<400> 217

<210> 218
<211> 17
<212> DNA
<213> artificial
<400> 218

<210> 219
<211> 17
<212> DNA
<213> artificial
<400> 219
