TECHNICAL FIELD
[0001] The present invention relates generally to the fields of molecular biology and growth
factor regulation. More specifically, the invention concerns modulators of the HGF/c-met
signaling pathway, and uses of said modulators.
BACKGROUND
[0002] Hepatocyte growth factor (HGF), also known as scatter factor (SF), is the ligand
for Met (Bottaro et al., 1991), a receptor tyrosine kinase encoded by the
c-met protooncogene (Cooper et al., 1984a &b). HGF binding to Met induces phosphorylation
of the intracellular kinase domain resulting in activation of a complex set of intracellular
pathways that lead to cell growth, differentiation and migration in a variety of cell
types; several recently published reviews provide a comprehensive overview (Birchmeier
et al., 2003; Trusolino and Comoglio, 2002; Maulik et al., 2002). In addition to its
fundamental importance in embryonic development and tissue regeneration, the HGF/Met
signaling pathway has also been implicated in invasive tumor growth and metastasis
and as such represents an interesting therapeutic target (Birchmeier et al., 2003;
Trusolino and Comoglio, 2002; Danilkovitch-Miagkova and Zbar, 2002; Ma et al., 2003).
[0003] HGF belongs to the plasminogen-related growth factor family and comprises a 69 kDa
α-chain containing the N-terminal finger domain (N) and four Kringle (K1-K4) domains,
and a 34 kDa β-chain which has strong similarity to protease domains of chymotrypsin-like
serine proteases from Clan PA(S)/FamilyS1 (Nakamura et al., 1989; Donate et al., 1994;
Rawlings et al., 2002). Like plasminogen and other serine protease zymogens, HGF is
secreted as a single chain precursor form (scHGF). scHGF binds to heparan sulfate
proteoglycans, such as syndecan-1 (Derksen et al., 2002) on cell surfaces or in the
extracellular matrix. Heparan sulfate proteoglycans bind to the N domain (Hartmann
et al., 1998), which also contributes to the high affinity Met binding together with
amino acids located in K1 (Lokker et al., 1994). Although scHGF is able to bind Met
with high affinity, it cannot activate the receptor (Lokker et al., 1992; Hartmann
et al., 1992). Acquisition of HGF signaling activity is contingent upon proteolytic
cleavage (activation) of scHGF at Arg494-Val495 resulting in the formation of mature
HGF, a disulfide-linked α/β heterodimer (Lokker et al., 1992; Hartmann et al., 1992;
Naldini et al., 1992).
[0004] US-A-5 879 910 describes hepatocyte growth factor (HGF) variants that comprise an amino acid alteration
at a site within the protease domain of HGF and retaining substantially full receptor
binding affinity of the corresponding wild type HGF.
[0005] Lokker et al. (1992), referred to elsewhere herein, describes that certain mutations
in the protease-like domain of HGF (at positions Y673 and V692) result in variants
that are defective for mitogenic activity, yet exhibit apparent receptor binding affinities
similar to wild type HGF.
[0006] Matsumoto et al. (1991), also referred to elsewhere herein, also describes mutant
HGFs, in which Q534 and/or Y673 were respectively substituted for His and Ser.
[0007] The protease-like domain of HGF (HGF β-chain) is devoid of catalytic activity since
it lacks the required Asp [c102]-His [c57]-Ser [c195] (standard chymotrypsinogen numbering
in brackets throughout) catalytic triad found in all serine proteases (Perona and
Craik, 1995; Hedstrom, 2002), having a Gln534 [c57] and Tyr673 [c195].
[0008] Because of its importance in regulating HGF activity, this process must be tightly
controlled by HGF converting enzymes and their corresponding physiological inhibitors.
scHGF activation is mediated
in vitro by chymotrypsin-like serine proteases including hepatocyte growth factor activator
(HGFA) (Miyazawa et al., 1993), matriptase/MT-SP1 (Takeuchi et al. 1999; Lin et al.,
1999), urokinase-type plasminogen activator (Naldini et al., 1992), factor XIIa (Shimomura
et al., 1995), factor XIa (Peek et al., 2002) and plasma kallikrein (Peek et al.,
2002). Similar to scHGF, these protease are produced as inactive precursors; their
enzymatic activities are also tightly regulated by other activating proteases and
both Kunitz- and serpin-type inhibitors.
[0009] Serine proteases and their activation process have been described (Donate et al.,
1994). In serine proteases, activation cleavage of the zymogen effects a conformational
rearrangement of the so-called activation domain' giving rise to a properly formed
active site and the substrate/inhibitor interaction region. The activation domain
constitutes three surface-exposed loops designated the [c140]-, [c180]- and [c220]-loops
and insertion of the newly formed N-terminus into a hydrophobic pocket (Huber and
Bode, 1978). In the homologous ligend/receptor pair macrophage stimulating protein
(MSP)/Ron, the serine protease-like MSP β-chain provides the main energy for receptor
binding (Wang et al., 1997; Miller and Leonard, 1998). This is reversed from the HGF/Met
system where the high affinity receptor binding site for Met resides in the HGF α-chain
(Lokker, et al., 1994; Okigaki et al., 1992).
DISCLOSURE OF THE INVENTION
[0010] Hepatocyte growth factor (HGF), a plasminogen-related growth factor, binds to its
receptor tyrosine kinase Met (also referred to herein as c-Met or c-met), which is
implicated in development, tissue regeneration and invasive tumor growth. The successful
expression and purification of the HGF protease-like β chain, which is described herein,
enabled a definitive determination of the nature of the interaction of HGF, specifically
HGF β-chain, with c-Met, which led to a clearer understanding of the mechanism for
c-Met activation. It is empirically demonstrated herein that the serine pratease-like
HGF β-chain itself binds to Met. In comparison, the zymogen-like form of HGF β has
much weaker Met binding, suggesting optimal interactions result from conformational
changes upon processing. A panel of β-chain mutants tested in cell migration, Met
phosphorylation, HGF-dependent cell proliferation and Met binding assays showed that
reduced biological activity of full length HGF mutants is due at least in part to
reduced binding of the HGF β-chain to Met. The functional binding site comprises the
'activation domain' and 'active site region', similar to the substrate-processing
site of serine proteases. The data indicate that activated (but not the zymogen-like
form) β chain may comprise an interface required for optimal interaction with another
molecule such as another HGF β chain so as to effect maximal/optimal c-met activation.
Mutation analyses described herein provide a basis for design of HGP mutants capable
of inhibiting wild type HGF/c-met interaction across a spectrum of potencies. Examples
of such mutants are described herein. These mutants are capable of competing with
wild type HGF for binding to c-met, yet exhibit reduced ability to effect c-met associated
biological functions. This is particularly advantageous where complete or substantial
inhibition of the HGF/c-met axis is undesirable; this is of particular concern because
HGF and c-met are ubiquitously expressed in normal cells and tissues. These mutants
can also be used as advantageous therapeutic agents for treating pathological conditions
wherein reduced, but not complete absence of, HGF/
c-met biological activity is desirable. Method and compositions of the invention are
based generally on these findings, which are described in greater detail below. It
is shown that HGF β chain and its interaction with c-met can be a unique and advantageous
target for greater fine-tuning in designing prophylatic and/or therapeutic approaches
against pathological conditions associated with abnormal or unwanted signaling of
the HGF/c-met pathway. Thus, the invention provides methods, compositions, kits and
articles of manufacture for identifying and using substances that are capable of modulating
the HOF/c-met pathway through modulation of HGF β chain binding to c-met, and for
modulation of biological/physiological activities associated with HGF/c-met signaling.
[0011] Accordingly, in one aspect, the invention provides a method of screening for (or
identifying) a substance that selectively binds activated hepatocyte growth factor
β chain, said method comprising: (a) comparing (i) binding of a candidate substance
to an activated HGF β chain (as described in greater detail below), with (ii) binding
of the candidate substance to a reference HGF β chain, wherein said reference β chain
is not capable of specific and/or substantial binding to c-met; whereby a candidate
substance that exhibits greater binding affinity to the activated HGF β chain than
to the reference HGF β chain is selected (or identified) as a substance that selectively
binds activated HGF β chain, as defined in the claims. In some embodiments, the reference
β chain is contained within a single chain HGF polypeptides. In some embodiments,
the reference β Chain is fused at its N-terminus to a portion of the C-terminal region
of HGF α chain, wherein position 494 (corresponding to wild type human HGF) of the
C-terminal region is an amino acid other than arginine (for e.g., glutamic acid).
In some embodiments, the portion of the C-terminal region of HGF α chain comprises,
consists or consists essentially of amino acid sequence from residue 479 to 494 of
human HGF.
[0012] In another aspect, the invention provides a method of screening for a substance that
blocks c-met activation, said method comprising screening for a substance that binds
(preferably, but not necessarily, specifically) c-met and blocks specific binding
of HGF β chain to c-met. In some embodiments, the substance competes with HGF β chain
for binding to c-met. In one embodiment, the substance comprises, consists or consists
essentially of an amino acid sequence having at least about 60%, 70%, 80%, 90%, 95%,
99% sequence similarity or identity with respect to wild type HGF (for e.g., human)
β chain, for e.g., human β chain comprising amino acid residues 495(Val) to 728(Ser)
(for e.g., the wild type HGF β chain as described herein). In some embodiments wherein
the substance comprises, consists or consists essentially of such an amino acid sequence,
position 604 and/or 561 is an amino acid other than cysteine. In some of these embodiments,
the substance is not substantially capable of forming a link (covalent or non-covalent)
with HGF α chain or portion thereof.
[0013] In some embodiments of methods of screening (identifying) of the invention, the methods
comprise determining binding affinity of a candidate substance with respect to a target
antigen which comprises, consists or consists essentially of a portion or all of HGF
β chain in a naturally occurring form or variant form. Such target antigens can include
any polypeptide that comprises, consists or consists essentially of an HGF β chain
amino acid sequence comprising at least one mutation (in particular where said at
least one mutation results in a change in the ability of HGF β chain to bind to c-Met).
In some embodiments, the polypeptides comprise, consist or consist essentially of
an HGF β chain amino acid sequence (either wild type or comprising at least one mutation)
fused to a heterologous polypeptide sequence (such as a portion or all of the HGF
α chain). Examples of such HGF β chains include those described herein, for e.g.,
zymogen-like HGF β chain (e.g., mutation at position 494), HGF β chain (Cys
604Ser), and "active site region" mutants. HGF mutants having a mutation in one or more
positions in the β chain (including mutations in the active site region), such as
positions 534, 578, b19, 673, 692, 693, 694, 695, 696, 699 and/or 702 are described
herein. Other mutants that are described include those having mutations at positions
within HGF that render it incapable of being activated (e.g., cleaved)
in vitro or in vivo; an example of one such mutant comprises a mutation in positions 424 and/or 494.
[0014] In another aspect, the invention provides a method of screening for an HGF receptor
antagonist which blocks binding of HGF to its receptor (for e.g., the binding of HGF
to a first receptor molecule, and/or the binding of HGF, for e.g. through one or both
α and β chains, to a second receptor molecule for receptor dimerization), said method
comprising selecting for a substance that binds to at least one, two, three, four,
or any number up to all of residues 534, 578, 619, 673, 692, 693, 694, 695, 696, 699
and/or 702 of HGF β chain. Combinations of two or more residues can include any of
residues 534, 578, 619, 673, 692, 693, 694, 695, 696, 699 and/or 702 of HGF β chain.
In one embodiment, the substance binds to at least one, or both, of residues 673 and
695. In another embodiment, the substance binds to (i) at least one, or both, of residues
673 and 695, and (ii) residue 692. In another embodiment, the substance binds to (i)
at least one or both of residues 673 and 695, and (ii) residue 692, and (iii) at least
one, or both, of residues 534 and 578. In another embodiment, the substance binds
to (i) at least one or both of residues 673 and 695, and (ii) at least one, two, or
all of residues 534, 578 and 692. In another embodiment, the substance binds to (i)
at least one, both or all of residues 673, 695 and 696, and (ii) at least one, both
or any number up to all of residues 534, 578, 692 and 694. In one embodiment, the
substance binds to HGF β chain wherein if there is a mutation in position 534, 673
and/or 692, said β chain also comprises a mutation in at least one, both or any number
up to all of positions 578, 694, 695 and 696. In some embodiments of these molecules,
the activated β chain has a conformation of β chain obtained by cleavage of single
chain HGF; and in some of these embodiments, said cleavage is at or adjacent to residues
494 and 495 of single chain HGF, for e.g., said cleavage may occur between residues
494 and 495 of single chain HGF. In one embodiment, the substance binds to at least
one of residues 673, 693, 694, 695 and 696. In one embodiment, the substance binds
to at least one of residues 692 and 702. In one embodiment, the substance binds to
at least one of residues 534 and 578. In one embodiment, the substance binds to at
least one of residues 513, 516, 619 and 699. In one embodiment, the substance binds
to two or more residues selected from the group consisting of a first group consisting
of residues 673, 693, 694, 695 and 696, a second group consisting of residues 692
and 702, a third group consisting of residues 534 and 578 and a fourth group consisting
of residues 513, 516, 619 and 699. Said two or more residues can be selected from
the same group or a combination of any of the 4 groups. In some embodiments, the substance
further binds to residue 423, 424, 494 and/or 495.
[0015] As would be evident to one skilled in the art, screening assays consistent with those
described above can also comprise a first step of screening based on a functional
readout to obtain a first set of candidate modulatory substance, followed by a second
step of screening based on ability of the first set of candidate modulatory substance
to modulate binding of HGF β to c-met. A functional readout can be any that would
be evident to one skilled in the art, based on a knowledge of biological activities
associated with the HGF/c-met signaling pathway. These biological activities include
but are not limited to C-met phosphorylation, phosphorylation of cellular molecules
that are substrates of C-met kinase, cellular growth (proliferation, survival, etc.),
angiogenesis, cell migration, cell morphogenesis, etc.
[0016] In one aspect, the invention provides HGF/c-met antagonists that disrupt the HGF/c-met
signaling pathway. For example, the invention provides a molecule that binds to activated
hepatocyte growth factor β chain and inhibits specific binding of said activated HGF
β chain to c-met as defined in the claims. In one embodiment, binding affinity of
the molecule for the activated form of the β chain is greater than binding affinity
of the molecule for the β chain in zymogen form. In some embodiments, the molecule
binds to the active site/domain of the β chain. In some embodiments, said active site
comprises at least one, two, three, four, five, six or all of residues 534, 578, 673,
692, 694, 695 and/or 696 of the β chain. Combinations of two or more residues can
include any of residues 534, 578, 673, 692, 694, 695 and/or 696 of HGF β chain. In
some embodiments, the molecule binds to at least one, two, three, four, or any number
up to all of residues 534, 578, 619, 673, 692, 693, 694, 695, 696, 699 and/or 702
of HGF β chain. Combinations of two or more residues can include any of residues 534,
578, 619, 673, 692, 693, 694, 695, 696, 699 and/or 702 of HGF β chain. In one embodiment,
the substance binds to at least one, or both, of residues 673 and 695. In another
embodiment, the substance binds to (i) at least one, or both, of residues 673 and
695, and (ii) residue 692. In another embodiment, the substance binds to (i) at least
one or both of residues 673 and 695, and (ii) residue 692, and (iii) at least one,
or both, of residues 534 and 578. In another embodiment, the substance binds to (i)
at least one or both of residues 673 and 695, and (ii) at least one, two, or all of
residues 534, 578 and 692. In another embodiment, the substance binds to (i) at least
one, both or all of residues 673, 695 and 696, and (ii) at least one, both or any
number up to all of residues 534, 578, 692 and 694, In one embodiment, the substance
binds to HGF β chain wherein if there is a mutation in position 534, 673 and/or 692,
said β chain also comprises a mutation in at least one, both or any number up to all
of positions 578, 694, 695 and 696. In one embodiment, the substance binds to at least
one of residues 673, 693, 694, 695 and 696. In one embodiment, the substance binds
to at least one of residues 692 and 702. In one embodiment, the substance binds to
at least one of residues 534 and 578. In one embodiment, the substance binds to at
least one of residues 513, 516, 619 and 699. In one embodiment, the substance binds
to two or more residues selected from the group consisting of a first group consisting
of residues 673, 693, 694, 695 and 696, a second group consisting of residues 692
and 702, a third group consisting of residues 534 and 578 and a fourth group consisting
of residues 513, 516, 619 and 699. Said two or more residues can be selected from
the same group or a combination of any of the 4 groups. In some embodiments, the substance
further binds to residue 423, 424, 494 and/or 495. In some embodiments of these molecules,
the activated β chain has a conformation of β chain obtained by cleavage of single
chain HGF; and in some of these embodiments, said cleavage is at or adjacent to residues
494 and 495 of single chain HGF, for e.g., said cleavage may occur between residues
494 and 495 of single chain HGF.
[0017] As defined in the claims, the substance or molecule is or comprises a peptide, antibody,
antibody fragment, or a combination thereof.
[0018] Also described herein is an HGF mutant that has HGF/c-met modulatory activity, for
e.g. an antagonist of HGF/c-met activity or an HGF variant exhibiting a reduction,
but not an absence, of HGF biological activity (e.g., cell growth stimulatory activity),
In one embodiment, an antagonist of the invention is capable of inhibiting the biological
activity of wild type (
in vivo) HGF (such biological activity includes but is not limited to stimulation of cell
proliferation, enhancement of cell survival, promotion of angiogenesis, induction/promotion
of cell migration). An HGF variant may provide reduced cell growth (including but
not limited to cell proliferation, cell survival, angiogenic, cell migration) promoting
activity. The HGF mutant may be a zymogen-like HGF β chain (e.g., mutation at position
494). For example, these mutants include those having mutations at positions within
HGF that render it incapable of being activated (e.g., cleaved)
in vitro or
in vivo; an example of one such mutant comprises a mutation in positions 424 and 494. The
HGF mutant may be a single chain HGF, for instance HGF comprising a mutation in position
424 and/or 494, and/or a position adjacent to residue 424 and/or 494. An HGF mutant
may further comprise a mutation in position 604 (e.g. HGF β chain Cys
604Ser). An HGF mutant may be an "active site region" mutant as described above. HGF
mutants may have a mutation in one or more positions in the β chain (including mutations
in the active site region), such as positions 534, 578, 619, 673, 692, 693, 694, 695,
696, 699 and/or 702.
[0019] In some embodiments, binding of a substance or molecule of the invention to activated
β chain inhibits c-met activation by HGF. In some embodiments, binding of said substance
or molecules to activated β chain inhibits cell growth (such as cell proliferation,
survival, angiogenesis, morphogenesis, migration) induced by HGF. In some embodiments,
binding of said substance or molecule to activated P chain inhibits c-met receptor
dimerization.
[0020] In some embodiments, a substance or molecule of the invention is obtained by a screening
or identification method of the invention as described herein.
[0021] In some embodiments, a substance or molecule of the invention comprises a peptide.
In some embodiments, said peptide comprises the sequence VDWVCFRDLGCDWEL. In some
embodiments, the peptide comprises an amino acid sequence having at least 50%, 60%,
70%, 80%, 90%, 95%, 98% sequence identity or similarity with the sequence VDWVCFRDLGCDWEL.
Variants of this sequence can be obtained by methods known in the art, for example
by combinatorial mutagenesis (e.g., by phage display). Specific examples of such variants
include but are not limited to those depicted in Table 1 below. In some embodiments,
these peptides comprise modifications that enhance their inhibitory and/or therapeutic
effect (including, for e.g., enhanced affinity, improved pharmacokinetics properties
(such as half life, stability, clearance rate), reduced toxicity to the subject).
Such modifications include, for e.g., modifications involving glycosylation, pegylation,
substitution with non-naturally occurring but functionally equivalent amino acid,
linking groups, etc. Suitable modifications are well known in the art, and furthermore
can be determined empirically as necessary.
Table 1
| V |
D |
W |
I |
C |
F |
R |
D |
I |
G |
C |
D |
W |
V |
V |
| V |
D |
W |
I |
C |
L |
R |
D |
V |
G |
C |
D |
W |
V |
Q |
| V |
D |
W |
V |
C |
F |
R |
D |
F |
G |
C |
D |
W |
V |
V |
| V |
D |
W |
V |
C |
F |
R |
D |
F |
G |
C |
D |
W |
V |
L |
| V |
D |
W |
V |
C |
F |
R |
D |
F |
G |
C |
D |
W |
V |
H |
| V |
D |
W |
V |
C |
F |
R |
D |
F |
G |
C |
Y |
W |
E |
Q |
| V |
D |
W |
V |
C |
F |
R |
D |
F |
G |
C |
W |
F |
E |
S |
| V |
D |
W |
V |
C |
F |
R |
D |
H |
G |
C |
E |
Y |
V |
E |
| V |
D |
W |
V |
C |
F |
R |
D |
I |
G |
C |
D |
W |
V |
L |
| V |
D |
W |
V |
C |
F |
R |
E |
F |
G |
C |
D |
W |
V |
L |
| V |
D |
W |
V |
C |
F |
R |
E |
I |
G |
C |
D |
W |
V |
L |
| V |
D |
W |
V |
C |
F |
R |
G |
I |
G |
C |
D |
W |
V |
L |
| V |
D |
W |
V |
C |
L |
R |
D |
I |
G |
C |
D |
W |
V |
P |
| V |
D |
W |
V |
C |
F |
R |
D |
L |
G |
C |
D |
Y |
E |
H |
| V |
D |
W |
V |
C |
F |
R |
D |
L |
G |
C |
D |
Y |
V |
L |
| V |
D |
W |
V |
C |
F |
R |
E |
L |
G |
C |
D |
W |
V |
V |
| V |
D |
W |
V |
C |
F |
R |
E |
L |
G |
C |
D |
W |
V |
F |
| V |
D |
W |
V |
C |
F |
R |
D |
M |
G |
C |
Y |
Y |
E |
L |
| V |
D |
W |
V |
C |
F |
R |
D |
M |
G |
C |
D |
W |
V |
L |
| V |
D |
W |
V |
C |
F |
R |
D |
S |
G |
C |
Y |
Y |
A |
T |
| V |
D |
W |
V |
C |
F |
R |
D |
T |
G |
C |
D |
W |
V |
L |
| V |
D |
W |
V |
C |
F |
R |
D |
V |
G |
C |
D |
W |
V |
Q |
| V |
D |
W |
V |
C |
F |
R |
D |
V |
G |
C |
D |
W |
V |
L |
| V |
D |
W |
V |
C |
F |
R |
E |
V |
G |
C |
D |
W |
V |
L |
| V |
D |
W |
V |
C |
F |
R |
D |
V |
G |
|
D |
W |
V |
M |
| V |
D |
W |
V |
C |
F |
R |
D |
Y |
G |
C |
D |
M |
V |
P |
| V |
D |
W |
V |
C |
F |
R |
D |
V |
G |
C |
D |
W |
V |
Q |
| V |
D |
W |
V |
C |
F |
R |
D |
Y |
G |
C |
E |
W |
V |
A |
| V |
D |
W |
V |
C |
F |
R |
D |
V |
G |
C |
E |
W |
V |
V |
| V |
N |
W |
V |
C |
F |
R |
D |
I |
G |
C |
D |
W |
V |
L |
| V |
N |
W |
V |
C |
F |
R |
D |
L |
G |
C |
D |
W |
V |
A |
| V |
N |
W |
V |
C |
F |
R |
D |
L |
G |
C |
D |
W |
V |
L |
| V |
N |
W |
V |
C |
F |
R |
D |
L |
G |
C |
D |
W |
V |
P |
| V |
N |
W |
V |
C |
F |
R |
D |
L |
G |
C |
D |
W |
V |
V |
| V |
N |
W |
V |
C |
F |
R |
D |
Q |
G |
C |
D |
W |
V |
L |
| V |
N |
W |
V |
C |
F |
R |
D |
V |
G |
C |
D |
W |
V |
L |
| V |
N |
W |
V |
C |
F |
R |
E |
L |
G |
C |
D |
W |
V |
L |
| V |
N |
W |
V |
C |
L |
R |
D |
V |
G |
C |
D |
W |
V |
L |
[0022] Described herein is an HGF/c-met antagonist which is a substance or molecule that
competes with hepatocyte growth factor β chain for binding to c-met, where said molecule
may inhibit c-met receptor multimerization (for e.g., dimerization). Said molecule
may comprise a variant (mutant) β chain having reduced ability to interact (for e.g.,
multimerize/dimerize) with another β chain molecule, or may inhibit HGF β chain multimerization
(for e.g., dimerization). Said molecule may bind to c-met but exhibit reduced ability
to effect c-met activation (for e.g., as indicated by reduced c-met phosphorylation,
mitogen activated protein kinase (MAPK) phosphorylation, and/or reduced HGF/c-met
dependent cell migration, cell proliferation, cell survival, cell morphogenesis, etc.).
The molecule may comprise, consist or consist essentially of a polypeptide comprising
at least a portion of an HGF β chain, wherein said β chain comprises a mutation in
one or more of positions 695, 696 and 673, or in one or more of positions 695, 696
and 673, and in one or more of positions 534, 578, 692 and 694. Combinations of two
or more residues can include any of residues 534, 578, 673, 692, 694, 695 and 696
of HGF β chain. The molecule may comprise, consist or consist essentially of a polypeptide
comprising at least a portion of an HGF β chain, wherein said β chain comprises a
mutation in at least one, or both, of residues 673 and 695, or comprises a mutation
in at least one, or both, of residues 673 and 695, and (ii) residue 692, or comprises
a mutation in at least one or both of residues 673 and 695, and (ii) residue 692,
and (iii) at least one, or both, of residues 534 and 578, or comprises a mutation
in at least one or both of residues 673 and 695, and (ii) at least one, two, or all
of residues 534, 578 and 692, or comprises a mutation in at least one, both or all
of residues 673, 695 and 696, and (ii) at least one, both or any number up to all
of residues 534, 578, 692 and 694, or comprises a mutation, and wherein if there is
a mutation in position 534, 673 and/or 692, said β chain also comprises a mutation
in at least one, both or any number up to all of positions 578, 694, 695 and 696,
or comprises a mutation in one or more positions in the β chain (including mutations
in the active site region), such as positions 534, 578, 619, 673, 692, 693, 694,695,696,699
and/or 702. The molecule may comprise, consist, or consist essentially of at least
a portion of HGF, wherein said portion comprises a mutation at one or more positions
within HGF that renders it incapable of being activated (e.g., cleaved)
in vitro or
in vivo; an example of one such mutant comprises a mutation in positions 424 and/or 494. In
some of cases , the β chain is linked (for e.g., by a disulfide bond) to at least
a portion of the HGF alpha chain (or functional equivalents thereof), or the β chain
is linked (for e.g., by a disulfide bond) to substantially all of the HGF alpha chain
(or functional equivalents thereof). In some cases, the β chain is not linked to an
HGF alpha chain sequence (or functional equivalents thereof). Other substances or
molecules can be obtained by screening or identification methods of the invention.
In some instances, the substance or molecule can be the product of modifying iterations
of a starting substance or molecule designed ' based on the information provided herein,
for e.g., based on small molecule scaffolds or peptide sequence predicted to interact
with a functionally-significant residue, including but not limited to residues in
the activation domain, active region, and/or specific residues (such as one or more
of residues 534, 578, 619, 673, 692, 693, 694, 695, 696, 699 and/or 702) of HGF β
chain (e.g., residues in the protease-like domain).
[0023] In any molecule of the invention wherein one or more positions is mutated relative
to the wild type counterpart sequence, the mutation can be of any form that reduces
or eliminates (or in some instances increases) the functional effect of the corresponding
wild type residue. A mutation can be obtained in any suitable form known in the art
(and/or determined empirically), e.g. by substitution, insertion, addition and/or
deletion. In some embodiment, a mutation comprises a non-conservative substitution.
Suitable substitutions include but are not limited to those described herein (in particular
in the Examples), e.g. with amino acids such as alanine and serine.
[0024] In one aspect, a molecule/substance (e.g., HGF/c-met modulators as described herein)
is linked to a toxin such as a cytotoxic agent. These molecules/substances can be
formulated or administered in combination with an additive/enhancing agent, such as
a radiation and/or chemotherapeutic agent.
[0025] The invention also provides medical uses and compositions useful for modulating disease
states associated with dysregulation of the HGF/c-met signaling axis. Thus, in one
aspect, the invention provides medical uses for modulating c-met activation in a subject,
using an HGF/c-met modulator molecule of the invention (for e.g, a substance that
inhibits specific binding of wild type (native) HGF β chain to c-met), whereby c-met
activation is modulated as defined in the claims. Said molecule is an HGF/c-met antagonists
that inhibits HaF/c-met activity. In one embodiment, said antagonist inhibits specific
binding of HGF β to c-met. In one aspect, the invention provides medical uses for
treating a pathological condition associated with activation of c-met in a subject,
using a c-met antagonist of the invention (for e.g., a substance that inhibits specific
binding of wild type (native) HGF β chain to c-met), whereby c-met activation is inhibited
as defined in the claims.
[0026] The HGF/c-met signaling pathway is involved in multiple biological and physiological
functions, including, for e.g., cell growth stimulation (e.g. cell proliferation,
cell survival, cell migration, cell morphogenesis) and angiogenesis. Thus, in another
aspect, the invention provides medical uses for inhibiting c-met activated cell growth
(e,g, proliferation and/or survival), using a c-met antagonist of the invention (for
e.g., a substance that inhibits specific binding of wild type (native) HGF β chain
to c-met), whereby cell proliferation associated with c-met activation is inhibited
as defined in the claims. In yet another aspect, the invention provides medical methods
for modulating angiogenesis, in a subject with a condition associated with abnormal
angiogenesis using a c-met antagonist of the invention (for e.g., a substance that
inhibits specific binding of wild type (native) HGF β chain to c-met), whereby angiogenesis
is modulated.
[0027] In one aspect, the invention provides use of a c-met antagonist of the invention
in the preparation of a medicament for the therapeutic and/or prophylactic treatment
of a disease, such as a cancer, a tumor, a cell proliferative disorder, an immune
(such as autoimmune) disorder and/or an angiogenesis-related disorder. The c-met antagonist
can be of any form described herein, including antibody, antibody fragment, polypeptide
(for e.g., an oligopeptide), nucleic acid (for e.g., an oligonucleotide, such as an
antisense oligonucleotide), or combination thereof.
[0028] In one aspect, the invention provides use of a nucleic acid of the invention in the
preparation of a medicament for the therapeutic and/or prophylactic treatment of a
disease, such as a cancer, a tumor, a cell proliferative disorder, an immune (such
as autoimmune) disorder and/or an angiogenesis-related disorder.
[0029] In one aspect, the invention provides use of an expression vector of the invention
in the preparation of a medicament for the therapeutic and/or prophylactic treatment
of a disease, such as a cancer, a tumor, a cell proliferative disorder, an immune
(such as autoimmune) disorder and/or an angiogenesis-related disorders.
[0030] In one aspect, the invention provides use of a host cell of the invention in the
preparation of a medicament for the therapeutic and/or prophylactic treatment of a
disease, such as a cancer, a tumor, a cell proliferative disorder, an immune (such
as autoimmune) disorder and/or an angiogenesis-related disorder.
[0031] In one aspect, the invention provides use of an article of manufacture of the invention
in the preparation of a medicament for the therapeutic and/or prophylactic treatment
of a disease, such as a cancer, a tumor, a cell, proliferative disorder, an immune
(such as autoimmune) disorder and/or an angiogenesis-related disorder.
[0032] In one aspect, the invention provides use of a kit of the invention in the Reparation
of a medicament for the Therapeutic and/or prophylactic treatment of a disease, such
as a cancer, a tumor, a cell proliferative disorder; an immune (such as autoimmune)
disorder and/or an angiogenesis-related disorder.
[0033] In one aspect, the invention relates to medical uses for inhibiting c-met activated
cell proliferation, using an effective amount of a c-met antagonist of the invention,
whereby cell proliferation associated with c-met activation is inhibited.
[0034] In one aspect, the invention relates to medical uses for treating a pathological
condition associated with dysregulation of c-met activation in a subject, using an
effective amount of a c-met antagonist of the invention, whereby said condition is
treated.
[0035] In one aspect, the invention relates to medical uses for inhibiting the growth of
a cell that expresses c-met or hepatocyte growth factor, or both, using a c-met antagonist
of the invention thereby causing an inhibition of growth of said cell.
[0036] In one aspect, the invention provides medical uses for therapeutically treating a
mammal having a cancerous tumor comprising a cell that expresses c-met or hepatocyte
growth factor, or both, using an effective amount of a c-met antagonist of the invention,
thereby effectively treating said mammal.
[0037] In one aspect, the invention provides medical uses for treating or preventing a cell
proliferative disorder associated with increased expression or activity of c-met or
hepatocyte growth factor, or both, using an effective amount of a c-met antagonist
of the invention, thereby effectively treating or preventing said cell proliferative
disorder. In one embodiment, said proliferative disorder is cancer.
[0038] In one aspect, the invention relates to medical uses for inhibiting the growth of
a cell, wherein growth of said cell is at least in part dependent upon a growth potentiating
effect of c-met or hepatocyte growth factor, or both, using an effective amount of
a c-met antagonist of the invention, thereby inhibiting the growth of said cell. In
one embodiment, the cell is contacted by HGF expressed by a different cell (for e.g.,
through a paracrine effect).
[0039] In one aspect, the invention provides medical uses for therapeutically treating a
tumor in a mammal, wherein the growth of said tumor is at least in part dependent
upon a growth potentiating effect of c-met or hepatocyte growth factor, or both, using
an effective amount of a c-met antagonist of the invention, thereby effectively treating
said tumor. In one embodiment, the cell is contacted by HGF expressed by a different
cell (for e.g., through a paracrine effect).
[0040] Medicaments of the invention can be used in methods to affect any suitable pathological
state, for example, cells and/or tissues associated with dysregulation of the HGF/c-met
signaling pathway. In one embodiment; a cell that is targeted in a method of the invention
is a cancer cell. For example, a cancer cell can be one selected from the group consisting
of a breast cancer cell, a colorectal cancer cell, a lung cancer cell, a papillary
carcinoma cell (for e.g., of the thyroid gland), a colon cancer cell, a pancreatic
cancer cell, an ovarian cancer cell, a cervical cancer cell, a central nervous system
cancer cell, an osteogenic sarcoma cell, a renal carcinoma cell, a hepatocellular
carcinoma cell, a bladder cancer cell, a gastric carcinoma cell, a head and neck squamous
carcinoma cell, a melanoma cell and a leukemia cell. In one embodiment, a cell that
is targeted in a method of the invention is a hyperproliferative and/or hyperplastic
cell. In one embodiment, a cell that is targeted in a method of the invention is a
dysplastic cell. In yet another embodiment, a cell that is targeted in a method of
the invention is a metastatic cell.
[0041] Methods indicated in the medical uses of the invention can further comprise additional
treatment steps. For example, in one embodiment, a method further comprises a step
wherein a targeted cell and/or tissue (for e.g., a cancer cell) is exposed to radiation
treatment or a chemotherapeutic agent.
[0042] As described herein, c-met activation is an important biological process the dysregulation
of which leads to numerous pathological conditions. Accordingly, in one embodiment
of the invention, a cell that is targeted (for e.g., a cancer cell) is one in which
activation of c-met is enhanced as compared to a normal cell of the same tissue origin.
In one embodiment, a method indicated in the medical uses of the invention causes
the death of a targeted cell. For example, contact with an antagonist of the invention
may result in a cell's inability to signal through the c-met pathway, which results
in cell death.
[0043] Dysregulation of c-met activation (and thus signaling) can results from a number
of cellular changes, including, for example, overexpression of HGF (c-met's cognate
ligand) and/or c-met itself. Accordingly, in some embodiments, a method indicated
in the medical uses of the invention comprises targeting a cell wherein c-met or hepatoctye
growth factor, or both, is more abundantly expressed by said cell (for e.g., a cancer
cell) as compared to a normal cell of the same tissue origin. A c-met-expressing cell
can be regulated by HGF from a variety of sources, i.e. in an autocrine or paracrine
manner. For example, in one embodiment of methods indicated in the medical uses of
the invention, a targeted cell is contacted/bound by hepatocyte growth factor expressed
in a different cell (for e.g., via a paracrine effect). Said different cell can be
of the same or of a different tissue origin. In one embodiment, a targeted cell is
contacted/bound by HGF expressed by the targeted cell itself (for e.g., via an autocrine
effect/loop).
[0044] Described herein is a method comprising administering to a subject an HGF variant
capable of effecting HGF biological activity at a supra-normal level (e.g., less than
the level of activity obtained with a similar amount of wild type HGF under similar
therapeutic conditions), wherein HGF activity is desired at a sub-optimal (i.e., less
than wild type) levels, whereby the desired amount of HGF biological activity is achieved.
Said HGF variant may comprise a mutation at one or more of positions 534, 578, 619,
673, 692, 693, 694, 695, 696, 699 and/or 702, or comprise a mutation within HGF that
renders it incapable of being activated (e.g., cleaved)
in vitro or
in vivo; an example of one such mutant comprises a mutation in positions 424 and/or 494. Suitable
conditions to be treated by this method include any pathological conditions that are
associated with an abonormally/undesirably low physiological level of HGF/c-met activity
in a subject, and wherein there is a need to tightly regulate the amount of HGF/c-met
activity induced by a therapeutic agent, Examples of such conditions include but are
not limited to wound healing, cardiac hypertrophy, cardiac infarction, limb ischemia,
peripheral arterial disease, etc.
[0045] Any of the c-met antagonists of the invention can be used in medical uses of the
invention.
[0046] In some embodiments of medical uses of the invention, the substance or molecule is
or comprises a peptide, antibody, antibody fragment, or a combination thereof.
[0047] In some embodiments of medical uses of the invention, a c-met antagonist is a substance
or molecule comprising, consisting or consisting essentially of a peptide, which in
some embodiments comprises, consists or consists essentially of the sequence VDWVCFRDLGCDWEL.
In some embodiments, the peptide comprises, consists or consists essentially of an
amino acid sequence having at least 50%.60%, 70%, 80%, 90%, 95%, 98% sequence identity
or similarity with the sequence VDWVCFRDLGCDWEL. In one embodiment, a variant of this
sequence is any of those depicted in Table 1 above. In some embodiments, these peptides
comprise modifications that enhance their inhibitory and/or therapeutic effect (including,
for e.g., enhanced affinity, improved pharmacokinetics properties (such as half life,
stability, clearance rate), reduced toxicity to the subject). Such modifications include,
for e.g., modifications involving glycosylation, pegylation, substitution with non-naturally
occurring but functionally equivalent amino acid, linking groups, etc. Suitable modifications
are well known in the art, and furthermore can be determined empirically as necessary
[0048] In some embodiments, medical uses of the invention utilize a substance or molecule
obtained by any of the screening and/or identification methods of the invention.
[0049] In some embodiments of medical uses and compositions of the invention, a substance/molecule
that inhibits HGF/c-met signaling does not substantially interfere with binding interaction
between cellular components other than activated HGF β chain and c-met. For example,
in one embodiment, the substance/molecule does not substantially interfere with binding
of HGF α chain to c-met.
[0050] In one aspect, the invention provides compositions comprising one or more substances/molecules
(for e.g., HGF/c-met antagonists) of the invention and a carrier. In one embodiment,
the carrier is pharmaceutically acceptable.
[0051] In one aspect, the invention provides nucleic acids encoding a substance/molecule
(for e.g., a HOF/c-met antagonist) of the invention. In one embodiment, a nucleic
acid of the invention encodes a substance/molecule (for e.g., a HGF/c-met antagonist)
which is or comprises a polypeptide (for e.g., an oligopeptide). In one embodiment,
a nucleic acid of the invention encodes a substance/molecule (for e.g., a HGF/c-met
antagonist) which is or comprises an antibody or fragment thereof.
[0052] In one aspect, the invention provides vectors comprising a nucleic acid of the invention.
[0053] In one aspect, the invention provides host cells comprising a nucleic acid or a vector
of the invention. A vector can be of any type, for example a recombinant vector such
as an expression vector. Any of a variety of host cells can be used. In one embodiment,
a host cell is a prokaryotic cell, for example,
E. coli. In one embodiment, a host cell is a eukaryotic cell, for example a mammalian cell
such as Chinese Hamster Ovary (CHO) cell.
[0054] In one aspect, the invention provides methods for making a substance/molecule (for
e.g., a HGF/c-met antagonist) of the invention. For example, the invention provides
a method of making a c-met antagonist which is or comprises an antibody (or fragment
thereof), said method comprising expressing in a suitable host cell a recombinant
vector of the invention encoding said antibody (or fragment thereof), and recovering
said antibody. In another example, the invention provides a method of making a substance/molecule
(for e.g., a HGF/c-met antagonist) which is or comprises a polypeptide (such as an
oligopeptide), said method comprising expressing in a suitable host cell a recombinant
vector of the invention encoding said polypeptide (such as an oligopeptide), and recovering
said polypeptide (such as an oligopeptide).
[0055] In one aspect, the invention provides an article of manufacture comprising a container;
and a composition contained within the container, wherein the composition comprises
one or more substances/molecules (for e.g., HGF/c-met antagonists) of the invention.
In one embodiment, the composition comprises a nucleic acid of the invention. In one
embodiment, a composition comprising a substance/molecule (for e.g., a HGF/c-met antagonist)
further comprises a carrier, which in some embodiments is pharmaceutically acceptable.
In one embodiment, an article of manufacture of the invention further comprises instructions
for administering the composition (for e.g., the antagonist) to a subject.
[0056] In one aspect, the invention provides a kit comprising a first container comprising
a composition comprising one or more substances/molecules (for e.g., HGF/c-met antagonists)
of the invention; and a second container comprising a buffer. In one embodiment, the
buffer is pharmaceutically acceptable. In one embodiment, a composition comprising
a substance/molecule (for e.g., a HGF/c-met antagonist) further comprises a carrier,
which in some embodiments is pharmaceutically acceptable. In one embodiment, a kit
further comprises instructions for administering the composition (for e.g., the antagonist)
to a subject.
BRIEF DESCRIPTION OF THE DRAWINGS
[0057]
FIG. 1 HGF β Direct and Competition Binding and Activity in Met Phosphorylation Assays.
- (A) Binding of HGF β to the extracellular domain of Met (Met ECD) by surface plasmon
resonance. Met ECD was captured on a CM5 chip at ~2000 resonance units. HGF β was
injected in a series of concentrations from 12.5 nM to 100 nM. Arrows indicate the
onset of the association and dissociation phases. Data were analyzed by Global Fit
using a 1:1 binding model from which kon, koff and Kd values were determined.
- (B) HGF β/Met-IgG competition ELISA. Met-IgG was captured on a plate coated with rabbit
anti-human IgG Fc and incubated with a mixture containing 250 nM maleimide-coupled
biotinylated wildtype HGF β and a series of concentrations of unlabeled HGF β (●)
and proHGF β(■). The amount of biotinylated wildtype HGF β bound on the plate was
detected by neutravidin-HRP. Data from at least 3 independent determinations each
were normalized, averaged and fitted by a four parameter fit using Kaleidagraph from
which IC50 values were determined; error bars represent standard deviations.
- (C) HGF-dependent phosphorylation of Met in A549 cells was carried out as described
in the Examples using HGF (▲) and HGF β (●).
- (D) Inhibition of HGF-dependent phosphorylation of Met was carried out in duplicate
as described in Examples using HGF at 0.5 nM (◆), 0.25 nM (▲) and 0.125 nM (■) to
stimulate A549 cells in the presence of increasing concentrations of HGF β.
- (E) Full length HGF/Met-IgG competition ELISA. This was carried out similarly to (A)
using 1 nM NHS-coupled biotinylated HGF and a series of concentrations of unlabeled
HGF (O), and HGF- (●). Data from 3 independent determinations each were normalized,
averaged and fitted as above.
FIG. 2 HGF-dependent cell migration by HGF mutants. (A) Representative purity of HGF
mutants. The purity of all HGF mutants analyzed by SDS-PAGE under reducing conditions
is illustrated for cation exchange purified HGF I623A. Incomplete conversion of the
secreted single-chain form by CHO expression in 1 % FBS (v/v) is shown in lane 1.
Additional exposure to 5% FBS completed the activation process yielding pure two-chain
HGF I623A (lane 2). Molecular weight markers are shown as Mr x 103. B) Migration of MDA-MB435 cells in a transwell assay in the presence of 1 nM HGF
mutants. Activities are expressed as percent migration of control cells exposed to
1 nM wildtype HGF; full length HGF sequence numbering [chymotrypsinogen numbering]
are shown. Values represent the averages of 4-8 independent experiments ± SD. (C)
Photographs of MDA-MB435 cell migration in the absence of wildtype HGF (a), with 1
nM wildtype HGF (b), 1 nM HGF R695A (c) and 1 nM HGF G696A (d).
FIG. 3 HGF-dependent phosphorylation of Met by HGF mutants. Phosphorylation of Met
of A549 cells was carried out as described in Examples using various concentrations
of HGF (●), proHGF (◆), HGF Q534A (O), HGF D578A (▲), HGF Y673A (Δ), HGF V692A (◊),
HGF R695A (□) and HGF G696A (▼).
FIG. 4 Met competition binding of HGF β mutants. HGF β/Met-IgG competition ELISA was
used to assess Met binding of wildtype HGF β (Δ), HGF β (●) and HGF β mutants Q534A
[c57] (O), D578A [c102] (▲), Y619A [c143] (◇), R695A [c217] (□), G696A [c219] (▼)
and I699A [c221a] (◆). Data were fit by a four parameter fit using Kaleidagraph; representative
individual competition assays are shown for multiple independent determinations where
n ≥ 3.
FIG. 5 Effects of mutations of the β-chain in HGF β and 2-chain HGF. Met competition
binding data of HGF β mutants in the HGF β/Met competition binding ELISA and cell
migration activity of 2-chain HGF mutants in the MDA-MB-435 cell migration assay are
shown. HGF β-chain mutants were made in C604S background unless noted otherwise.
FIG. 6 Effect of HGF mutations on stimulation and inhibition of cell proliferation.
(A) HGF-dependent cell proliferation by 2-chain HGF and 2-chain HGF mutants (having
the indicated mutations) in BxPC3 cells. (B) Inhibition of HGF-dependent cell proliferation
by 2-chain HGF mutant in HGF β chain (having the indicated mutations) and by 1-chain
HGF in BxPC3 cells.
FIG. 7 Relative binding affinities of HGF mutants to Met determined by the HGF/Met
competition binding ELISA.
FIG. 8 Pro-migratory activities of HGF mutants at different concentrations.
FIG. 9 Analysis of single chain pro-HGF and two chain HGF binding to c-Met-IgG determined
by HGF β chain competition ELISA. The data were fitted by a four parameter fit using
Kaleidagraph and IC50 for two chain HGF was determined. Single chain pro-HGF at concentrations up to 100
nM did not compete with HGF β chain binding to c-Met-IgG.
MODES FOR CARRYING OUT THE INVENTION
[0058] The invention provides methods, compositions, kits and articles of manufacture for
identifying inhibitors of the HGF/c-met signaling pathway (in particular, inhibitors
of HGF β chain binding to c-met), and methods of using such inhibitors..
[0059] Details of these methods, compositions, kits and articles of manufacture are provided
herein.
General Techniques
[0060] The practice of the present invention will employ, unless otherwise indicated, conventional
techniques of molecular biology (including recombinant techniques), microbiology,
cell biology, biochemistry, and immunology, which are within the skill of the art.
Such techniques are explained fully in the literature, such as, "
Molecular Cloning: A Laboratory Manual", second edition (Sambrook et al., 1989); "
Oligonucleotide Synthesis" (M. J. Gait, ed., 1984); "
Animal Cell Culture" (R. I. Freshney, ed., 1987); "
Methods in Enzymology" (Academic Press, Inc.); "
Current Protocols in Molecular Biology" (F. M. Ausubel et al., eds., 1987, and periodic
updates); "
PCR: The Polymerase Chain Reaction", (Mullis et al., ed., 1994); "
A Practical Guide to Molecular Cloning" (Perbal Bernard V., 1988).
Definitions
[0061] "Percent (%) amino acid sequence identity" with respect to a peptide (for e.g., VDWVCFRDLGCDWEL)
or polypeptide sequence is defined as the percentage of amino acid residues in a candidate
sequence that are identical with the amino acid residues in the specific peptide or
polypeptide sequence, after aligning the sequences and introducing gaps, if necessary,
to achieve the maximum percent sequence identity, and not considering any conservative
substitutions as part of the sequence identity. Alignment for purposes of determining
percent amino acid sequence identity can be achieved in various ways that are within
the skill in the art, for instance, using publicly available computer software such
as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. Those skilled in the art
can determine appropriate parameters for measuring alignment, including any algorithms
needed to achieve maximal alignment over the full length of the sequences being compared.
For purposes herein, however, % amino acid sequence identity values are generated
using the sequence comparison computer program ALIGN-2, wherein the complete source
code for the ALIGN-2 program is provided in Table A below. The ALIGN-2 sequence comparison
computer program was authored by Genentech, Inc. and the source code shown in Table
A below has been filed with user documentation in the U.S. Copyright Office, Washington
D.C., 20559, where it is registered under U.S. Copyright Registration No. TXU510087.
The ALIGN-2 program is publicly available through Genentech, Inc., South San Francisco,
California or may be compiled from the source code provided in Figure 8 below. The
ALIGN-2 program should be compiled for use on a UNIX operating system, preferably
digital UNIX V4.0D. All sequence comparison parameters are set by the ALIGN-2 program
and do not vary.
[0062] In situations where ALIGN-2 is employed for amino acid sequence comparisons, the
% amino acid sequence identity of a given amino acid sequence A to, with, or against
a given amino acid sequence B (which can alternatively be phrased as a given amino
acid sequence A that has or comprises a certain % amino acid sequence identity to,
with, or against a given amino acid sequence B) is calculated as follows:

where X is the number of amino acid residues scored as identical matches by the sequence
alignment program ALIGN-2 in that program's alignment of A and B, and where Y is the
total number of amino acid residues in B. It will be appreciated that where the length
of amino acid sequence A is not equal to the length of amino acid sequence B, the
% amino acid sequence identity of A to B will not equal the % amino acid sequence
identity of B to A.
[0064] The term "vector," as used herein, is intended to refer to a nucleic acid molecule
capable of transporting another nucleic acid to which it has been linked. One type
of vector is a "plasmid", which refers to a circular double stranded DNA loop into
which additional DNA segments may be ligated. Another type of vector is a phage vector.
Another type of vector is a viral vector, wherein additional DNA segments may be ligated
into the viral genome. Certain vectors are capable of autonomous replication in a
host cell into which they are introduced (e.g., bacterial vectors having a bacterial
origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal
mammalian vectors) can be integrated into the genome of a host cell upon introduction
into the host cell, and thereby are replicated along with the host genome. Moreover,
certain vectors are capable of directing the expression of genes to which they are
operatively linked. Such vectors are referred to herein as "recombinant expression
vectors" (or simply, "recombinant vectors"). In general, expression vectors of utility
in recombinant DNA techniques are often in the form of plasmids. In the present specification,
"plasmid" and "vector" may be used interchangeably as the plasmid is the most commonly
used form of vector.
[0065] "Polynucleotide," or "nucleic acid," as used interchangeably herein, refer to polymers
of nucleotides of any length, and include DNA and RNA. The nucleotides can be deoxyribonucleotides,
ribonucleotides, modified nucleotides or bases, and/or their analogs, or any substrate
that can be incorporated into a polymer by DNA or RNA polymerase, or by a synthetic
reaction. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides
and their analogs. If present, modification to the nucleotide structure may be imparted
before or after assembly of the polymer. The sequence of nucleotides may be interrupted
by non-nucleotide components. A polynucleotide may be further modified after synthesis,
such as by conjugation with a label. Other types of modifications include, for example,
"caps", substitution of one or more of the naturally occurring nucleotides with an
analog, intemucleotide modifications such as, for example, those with uncharged linkages
(e.g., methyl phosphonates, phosphotriesters, phosphoamidates, carbamates, etc.) and
with charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), those
containing pendant moieties, such as, for example, proteins (e.g., nucleases, toxins,
antibodies, signal peptides, ply-L-lysine, etc.), those with intercalators (e.g.,
acridine, psoralen, etc.), those containing chelators (e.g., metals, radioactive metals,
boron, oxidative metals, etc.), those containing alkylators, those with modified linkages
(e.g., alpha anomeric nucleic acids, etc.), as well as unmodified forms of the polynucleotide(s).
Further, any of the hydroxyl groups ordinarily present in the sugars may be replaced,
for example, by phosphonate groups, phosphate groups, protected by standard protecting
groups, or activated to prepare additional linkages to additional nucleotides, or
may be conjugated to solid or semi-solid supports. The 5' and 3' terminal OH can be
phosphorylated or substituted with amines or organic capping group moieties of from
I to 20 carbon atoms. Other hydroxyls may also be derivatized to standard protecting
groups. Polynucleotides can also contain analogous forms of ribose or deoxyribose
sugars that are generally known in the art, including, for example, 2'-O-methyl-,
2'-O-allyl, 2'-fluoro- or 2'-azido-ribose, carbocyclic sugar analogs, .alpha.-anomeric
sugars, epimeric sugars such as arabinose, xyloses or lyxoses, pyranose sugars, furanose
sugars, sedoheptuloses, acyclic analogs and abasic nucleoside analogs such as methyl
riboside. One or more phosphodiester linkages may be replaced by alternative linking
groups. These alternative linking groups include, but are not limited to, embodiments
wherein phosphate is replaced by P(O)S("thioate"), P(S)S ("dithioate"), "(O)NR.sub.2
("amidate"), P(O)R, P(O)OR', CO or CH.sub.2 ("formacetal"), in which each R or R'
is independently H or substituted or unsubstituted alkyl (1-20 C.) optionally containing
an ether (-O-) linkage, aryl, alkenyl, cycloalkyl, cycloalkenyl or araldyl. Not all
linkages in a polynucleotide need be identical. The preceding description applies
to all polynucleotides referred to herein, including RNA and DNA.
[0066] "Oligonucleotide," as used herein, generally refers to short, generally single stranded,
generally synthetic polynucleotides that are generally, but not necessarily, less
than about 200 nucleotides in length. The terms "oligonucleotide" and "polynucleotide"
are not mutually exclusive. The description above for polynucleotides is equally and
fully applicable to oligonucleotides.
[0067] The term "hepatocyte growth factor" or "HGF", as used herein, refers, unless specifically
or contextually indicated otherwise, to any native or variant (whether native or synthetic)
HGF polypeptide that is capable of activating the HGF/c-met signaling pathway under
conditions that permit such process to occur. The term "wild type HGF" generally refers
to a polypeptide comprising the amino acid sequence of a naturally occurring HGF protein.
Thet term "wild type HGF sequence" generally refers to an amino acid sequence found
in a naturally occurring HGF.
[0068] "Activated HGF β chain", or variations thereof, refers to any HGF β chain having
the conformation that is adopted by wild type HGF β chain upon conversion of wild
type HGF protein from a single chain form to a 2 chain form (i.e., α and β chain),
said conversion resulting at least in part from cleavage between residue 494 and residue
495 of the wild type HGF protein. In some embodiments, said conformation refers specifically
to the conformation of the activation domain of the protease-like domain in the β
chain. In some embodiments, said conformation refers even more specifically to the
conformation of the active site region of the protease-like domain in the β chain.
Generally, adoption of said conformation reveals a c-met binding site, as described
herein.
[0069] The terms "antibody" and "immunoglobulin" are used interchangeably in the broadest
sense and include monoclonal antibodies (for e.g., full length or intact monoclonal
antibodies), polyclonal antibodies, multivalent antibodies, multispecific antibodies
(e.g., bispecific antibodies so long as they exhibit the desired biological activity)
and may also include certain antibody fragments (as described in greater detail herein).
An antibody can be human, humanized and/or affinity matured.
[0070] "Antibody fragments" comprise only a portion of an intact antibody, wherein the portion
preferably retains at least one, preferably most or all, of the functions normally
associated with that portion when present in an intact antibody. In one embodiment,
an antibody fragment comprises an antigen binding site of the intact antibody and
thus retains the ability to bind antigen. In another embodiment, an antibody fragment,
for example one that comprises the Fc region, retains at least one of the biological
functions normally associated with the Fc region when present in an intact antibody,
such as FcRn binding, antibody half life modulation, ADCC function and complement
binding. In one embodiment, an antibody fragment is a monovalent antibody that has
an in vivo half life substantially similar to an intact antibody. For e.g., such an
antibody fragment may comprise on antigen binding arm linked to an Fc sequence capable
of conferring in vivo stability to the fragment.
[0071] The term "monoclonal antibody" as used herein refers to an antibody obtained from
a population of substantially homogeneous antibodies, i.e., the individual antibodies
comprising the population are identical except for possible naturally occurring mutations
that may be present in minor amounts. Monoclonal antibodies are highly specific, being
directed against a single antigen. Furthermore, in contrast to polyclonal antibody
preparations that typically include different antibodies directed against different
determinants (epitopes), each monoclonal antibody is directed against a single determinant
on the antigen.
[0072] The monoclonal antibodies herein specifically include "chimeric" antibodies in which
a portion of the heavy and/or light chain is identical with or homologous to corresponding
sequences in antibodies derived from a particular species or belonging to a particular
antibody class or subclass, while the remainder of the chain(s) is identical with
or homologous to corresponding sequences in antibodies derived from another species
or belonging to another antibody class or subclass, as well as fragments of such antibodies,
so long as they exhibit the desired biological activity (
U.S. Patent No. 4,816,567; and
Morrison et al., Proc. Natl. Acad. Sci. USA 81:6851-6855 (1984)).
[0073] "Humanized" forms of non-human (
e.g., murine) antibodies are chimeric antibodies that contain minimal sequence derived
from non-human immunoglobulin. For the most part, humanized antibodies are human immunoglobulins
(recipient antibody) in which residues from a hypervariable region of the recipient
are replaced by residues from a hypervariable region of a non-human species (donor
antibody) such as mouse, rat, rabbit or nonhuman primate having the desired specificity,
affinity, and capacity. In some instances, framework region (FR) residues of the human
immunoglobulin are replaced by corresponding non-human residues. Furthermore, humanized
antibodies may comprise residues that are not found in the recipient antibody or in
the donor antibody. These modifications are made to further refine antibody performance.
In general, the humanized antibody will comprise substantially all of at least one,
and typically two, variable domains, in which all or substantially all of the hypervariable
loops correspond to those of a non-human immunoglobulin and all or substantially all
of the FRs are those of a human immunoglobulin sequence. The humanized antibody optionally
will also comprise at least a portion of an immunoglobulin constant region (Fc), typically
that of a human immunoglobulin. For further details, see
Jones et al., Nature 321:522-525 (1986);
Riechmann et al., Nature 332:323-329 (1988); and
Presta, Curr Op. Struct. Biol. 2:593-596 (1992). See also the following review articles and references cited therein:
Vaswani and Hamilton, Ann. Allergy, Asthma & Immunol. 1:105-115 (1998);
Harris, Biochem. Soc. Transactions 23:1035-1.038 (1995);
Hurle and Gross, Curr. Op. Biotech. 5:428-433 (1994).
[0074] A "human antibody" is one which possesses an amino acid sequence which corresponds
to that of an antibody produced by a human and/or has been made using any of the techniques
for making human antibodies as disclosed herein. This definition of a human antibody
specifically excludes a humanized antibody comprising non-human antigen-binding residues.
[0076] A "blocking" antibody or an "antagonist" antibody is one which inhibits or reduces
biological activity of the antigen it binds (for e.g., activated HGF β chain or site/epitope
on c-met to which activated HGF β binds). Preferred blocking antibodies or antagonist
antibodies substantially or completely inhibit the biological activity of the antigen.
[0077] An "agonist antibody", as used herein, is an antibody which mimics at least one of
the functional activities of a polypeptide of interest (for e.g., an antibody could
provide at least one of the c-met activating functions of activated HGF β chain).
[0078] A "disorder" is any condition that would benefit from treatment with a substance/molecule
or method of the invention. This includes chronic and acute disorders or diseases
including those pathological conditions which predispose the mammal to the disorder
in question. Non-limiting examples of disorders to be treated herein include malignant
and benign tumors; non-leukemias and lymphoid malignancies; neuronal, glial, astrocytal,
hypothalamic and other glandular, macrophagal, epithelial, stromal and blastocoelic
disorders; and inflammatory, immunologic and other angiogenesis-related disorders.
[0079] The terms "cell proliferative disorder" and "proliferative disorder" refer to disorders
that are associated with some degree of abnormal cell proliferation. In one embodiment,
the cell proliferative disorder is cancer.
[0080] "Tumor", as used herein, refers to all neoplastic cell growth and proliferation,
whether malignant or benign, and all pre-cancerous and cancerous cells and tissues.
The terms "cancer", "cancerous", "cell proliferative disorder", "proliferative disorder"
and "tumor" are not mutually exclusive as referred to herein.
[0081] The terms "cancer" and "cancerous" refer to or describe the physiological condition
in mammals that is typically characterized by unregulated cell growth/proliferation.
Examples of cancer include but are not limited to, carcinoma, lymphoma, blastoma,
sarcoma, and leukemia. More particular examples of such cancers include squamous cell
cancer, small-cell lung cancer, non-small cell lung cancer, adenocarcinoma of the
lung, squamous carcinoma of the lung, cancer of the peritoneum, hepatocellular cancer,
gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian
cancer, liver cancer, bladder cancer, hepatoma, breast cancer, colon cancer, colorectal
cancer, endometrial or uterine carcinoma, salivary gland carcinoma, kidney cancer,
liver cancer, prostate cancer, vulval cancer, thyroid cancer, hepatic carcinoma and
various types of head and neck cancer.
[0082] As used herein, "treatment" refers to clinical intervention in an attempt to alter
the natural course of the individual or cell being treated, and can be performed either
for prophylaxis or , during the course of clinical pathology. Desirable effects of
treatment include preventing occurrence or recurrence of disease, alleviation of symptoms,
diminishment of any direct or indirect pathological consequences of the disease, preventing
metastasis, decreasing the rate of disease progression, amelioration or palliation
of the disease state, and remission or improved prognosis. In some embodiments, antibodies
of the invention are used to delay development of a disease or disorder.
[0083] An "effective amount" refers to an amount effective, at dosages and for periods of
time necessary, to achieve the desired therapeutic or prophylactic result.
[0084] A "therapeutically effective amount" of a substance/molecule of the invention, agonist
or antagonist may vary according to factors such as the disease state, age, sex, and
weight of the individual, and the ability of the substance/molecule, agonist or antagonist
to elicit a desired response in the individual. A therapeutically effective amount
is also one in which any toxic or detrimental effects of the substance/molecule, agonist
or antagonist are outweighed by the therapeutically beneficial effects. A "prophylactically
effective amount" refers to an amount effective, at dosages and for periods of time
necessary, to achieve the desired prophylactic result. Typically but not necessarily,
since a prophylactic dose is used in subjects prior to or at an earlier stage of disease,
the prophylactically effective amount will be less than the therapeutically effective
amount.
[0085] The term "cytotoxic agent" as used herein refers to a substance that inhibits or
prevents the function of cells and/or causes destruction of cells. The term is intended
to include radioactive isotopes (e.g., At
211, I
131, I
125, Y
90, Re
186, Re
188, Sm
153, Bi
212, P
32 and radioactive isotopes of Lu), chemotherapeutic agents e.g. methotrexate, adriamicin,
vinca alkaloids (vincristine, vinblastine, etoposide), doxorubicin, melphalan, mitomycin
C, chlorambucil, daunorubicin or other intercalating agents, enzymes and fragments
thereof such as nucleolytic enzymes, antibiotics, and toxins such as small molecule
toxins or enzymatically active toxins of bacterial, fungal, plant or animal origin,
including fragments and/or variants thereof, and the various antitumor or anticancer
agents disclosed below. Other cytotoxic agents are described below. A tumoricidal
agent causes destruction of tumor cells.
[0086] A "chemotherapeutic agent" is a chemical compound useful in the treatment of cancer.
Examples of chemotherapeutic agents include alkylating agents such as thiotepa and
CYTOXAN® cyclosphosphamide; alkyl sulfonates such as busulfan, improsulfan and piposulfan;
aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and
methylamelamines including altretamine, triethylenemelamine, trietylenephosphoramide,
triethiylenethiophosphoramide and trimethylolomelamine; acetogenins (especially bullatacin
and bullatacinone); a camptothecin (including the synthetic analogue topotecan); bryostatin;
callystatin; CC-1065 (including its adozelesin, carzelesin and bizelesin synthetic
analogues); cryptophycins (particularly cryptophycin I and cryptophycin 8); dolastatin;
duocarmycin (including the synthetic analogues, KW-2189 and CB1-TM 1); eleutherobin;
pancratistatin; a sarcodictyin; spongistatin; nitrogen mustards such as chlorambucil,
chlornaphazine, cholophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine
oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide,
uracil mustard; nitrosureas such as carmustine, chlorozotocin, fotemustine, lomustine,
nimustine, and ranimnustine; antibiotics such as the enediyne antibiotics (e. g.,
calicheamicin, especially calicheamicin gammaII and calicheamicin omegaI1 (see, e.g.,
Agnew, Chem Intl. Ed. Engl., 33: 183-186 (1994)); dynemicin, including dynemicin A; bisphosphonates, such as clodronate; an esperamicin;
as well as neocarzinostatin chromophore and related chromoprotein enediyne antiobiotic
chromophores), aclacinomysins, actinomycin, authramycin, azaserine, bleomycins, cactinomycin,
carabicin, carminomycin, carzinophilin, chromomycinis, dactinomycin, daunorubicin,
detorubicin, 6-diazo-5-oxo-L-norleucine, ADRIAMYCIN® doxorubicin (including morpholino-doxorubicin,
cyanomorpholino-doxorubicin, 2-pyrrolino-doxorubicin and deoxydoxorubicin), epirubicin,
esorubicin, idarubicin, marcellomycin, mitomycins such as mitomycin C, mycophenolic
acid, nogalamycin, olivomycins, peplomycin, potfiromycin, puromycin, quelamycin, rodorubicin,
streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin; anti-metabolites
such as methotrexate and 5-fluorouracil (5-FU); folic acid analogues such as denopterin,
methotrexate, pteropterin, trimetrexate; purine analogs such as fludarabine, 6-mercaptopurine,
thiamiprine, thioguanine; pyrimidine analogs such as ancitabine, azacitidine, 6-azauridine,
carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine; androgens
such as calusterone, dromostanolone propionate, epitiostanol, mepitiostane, testolactone;
anti- adrenals such as aminoglutethimide, mitotane, trilostane; folic acid replenisher
such as frolinic acid; aceglatone; aldophosphamide glycoside; aminolevulinic acid;
eniluracil; amsacrine; bestrabucil; bisantrene; edatraxate; defofamine; demecolcine;
diaziquone; elfornithine; elliptinium acetate; an epothilone; etoglucid; gallium nitrate;
hydroxyurea; lentinan; lonidainine; maytansinoids such as maytansine and ansamitocins;
mitoguazone; mitoxantrone; mopidanmol; nitraerine; pentostatin; phenamet; pirarubicin;
losoxantrone; podophyllinic acid; 2-ethylhydrazide; procarbazine; PSK® polysaccharide
complex (JHS Natural Products, Eugene, OR); razoxane; rhizoxin; sizofiran; spirogermanium;
tenuazonic acid; triaziquone; 2,2',2"-trichlorotriethylamine; trichothecenes (especially
T-2 toxin, verracurin A, roridin A and anguidine); urethan; vindesine; dacarbazine;
mannomustine; mitobronitol; mitolactol; pipobroman; gacytosine; arabinoside ("Ara-C");
cyclophosphamide; thiotepa; taxoids, e.g., TAXOL® paclitaxel (Bristol- Myers Squibb
Oncology, Princeton, N.J.), ABRAXANE
™ Cremophor-free, albumin-engineered nanoparticle formulation of paclitaxel (American
Pharmaceutical Partners, Schaumberg, Illinois), and TAXOTERE® doxetaxel (Rhone- Poulenc
Rorer, Antony, France); chloranbucil; GEMZAR® gemcitabine; 6- thioguanine; mercaptopurine;
methotrexate; platinum analogs such as cisplatin and carboplatin; vinblastine; platinum;
etoposide (VP-16); ifosfamide; mitoxantrone; vincristine; NAVELBINE® vinorelbine;
novantrone; teniposide; edatrexate; daunomycin; aminopterin; xeloda; ibandronate;
CPT-11; topoisomerase inhibitor RFS 2000; difluorometlhylornithine (DMFO); retinoids
such as retinoic acid; capecitabine; and pharmaceutically acceptable salts, acids
or derivatives of any of the above.
[0087] Also included in the definition of "chemotherapeutic agent" above are anti-hormonal
agents that act to regulate or inhibit hormone action on tumors such as anti-estrogens
and selective estrogen receptor modulators (SERMs), including, for example, tamoxifen
(including NOLVADEX® tamoxifen), raloxifene, droloxifene, 4-hydroxytamoxifen, trioxifene,
keoxifene, LY117018, onapristone, and FARESTON toremifene; aromatase inhibitors that
inhibit the enzyme aromatase, which regulates estrogen production in the adrenal glands,
such as, for example, 4(5)-imidazoles, aminoglutethimide, MEGASE® megestrol acetate,
AROMASIN® exemestane, formestanie, fadrozole, RIVISOR® vorozole, FEMARA® letrozole,
and ARIMIDEX® anastrozole; and anti-androgens such as flutamide, nilutamide, bicalutamide,
leuprolide, and goserelin; as well as troxacitabine (a 1,3-dioxolane nucleoside cytosine
analog); antisense oligonucleotides, particularly those which inhibit expression of
genes in signaling pathways implicated in abherant cell proliferation, such as, for
example, PKC-alpha, Ralf and H-Ras; ribozymes such as a VEGF expression inhibitor
(e.g., ANGIOZYME® ribozyme) and a HER2 expression inhibitor; vaccines such as gene
therapy vaccines, for example, ALLOVECTIN® vaccine, LEUVECTIN® vaccine, and VAXID®
vaccine; PROLEUKIN® rIL-2; LURTOTECAN® topoisomerase 1 inhibitor; ABARELIX® rmRH;
and pharmaceutically acceptable salts, acids or derivatives of any of the above.
[0088] A "growth inhibitory agent" when used herein refers to a compound or composition
which inhibits growth of a cell whose growth is dependent upon HGF/c-met activation
either in
vitro or
in vivo. Thus, the growth inhibitory agent may be one which significantly reduces the percentage
of HGF/c-met-dependent cells in S phase. Examples of growth inhibitory agents include
agents that block cell cycle progression (at a place other than S phase), such as
agents that induce Gl arrest and M-phase arrest. Classical M-phase blockers include
the vincas (vincristine and vinblastine), taxanes, and topoisomerase II inhibitors
such as doxorubicin, epirubicin, daunorubicin, etoposide, and bleomycin. Those agents
that arrest GI also spill over into S-phase arrest, for example, DNA alkylating agents
such as tamoxifen, prednisone, dacarbazine, mechlorethamine, cisplatin, methotrexate,
5-fluorouracil, and ara-C. Further information can be found in
The Molecular Basis of Cancer, Mendelsohn and Israel, eds., Chapter 1, entitled "Cell
cycle regulation, oncogenes, and antineoplastic drugs" by Murakami et al. (WB Saunders:
Philadelphia, 1995), especially p. 13. The taxanes (paclitaxel and docetaxel) are anticancer drugs both derived from the
yew tree. Docetaxel (TAXOTERE®, Rhone-Poulenc Rorer), derived from the European yew,
is a semisynthetic analogue of paclitaxel (TAXOL®, Bristol-Myers Squibb). Paclitaxel
and docetaxel promote the assembly of microtubules from tubulin dimers and stabilize
microtubules by preventing depolymerization, which results in the inhibition of mitosis
in cells.
[0089] "Doxorubicin" is an anthracycline antibiotic. The full chemical name of doxorubicin
is (8S-cis)-10-[(3-amino-2,3,6-trideoxy-α-L-lyxo-hexapyranosyl)oxy]-7,8,9,10-tetrahydro-6,8,11-trihydroxy-8-(hydroxyacetyl)-1-methoxy-5,12-naphthacenedione.
Vector Construction
[0090] Polynucleotide sequences encoding the polypeptides described herein can be obtained
using standard recombinant techniques. Desired polynucleotide sequences may be isolated
and sequenced from appropriate source cells. Source cells for antibodies would include
antibody producing cells such as hybridoma cells. Alternatively, polynucleotides can
be synthesized using nucleotide synthesizer or PCR techniques. Once obtained, sequences
encoding the immunoglobulins are inserted into a recombinant vector capable of replicating
and expressing heterologous polynucleotides in a host cell. Many vectors that are
available and known in the art can be used for the purpose of the present invention.
Selection of an appropriate vector will depend mainly on the size of the nucleic acids
to be inserted into the vector and the particular host cell to be transformed with
the vector. Each vector contains various components, depending on its function (amplification
or expression of heterologous polynucleotide, or both) and its compatibility with
the particular host cell in which it resides. The vector components generally include,
but are not limited to: an origin of replication (in particular when the vector is
inserted into a prokaryotic cell), a selection marker gene, a promoter, a ribosome
binding site (RBS), a signal sequence, the heterologous nucleic acid insert and a
transcription termination sequence.
[0091] In general, plasmid vectors containing replicon and control sequences which are derived
from a species compatible with the host cell are used in connection with these hosts.
The vector ordinarily carries a replication site, as well as marking sequences which
are capable of providing phenotypic selection in transformed cells. For example,
E. coli is typically transformed using pBR322, a plasmid derived from an
E. coli species. pBR322 contains genes encoding ampicillin (Amp) and tetracycline (Tet) resistance
and thus provides easy means for identifying transformed cells. pBR322, its derivatives,
or other microbial plasmids or bacteriophage may also contain, or be modified to contain,
promoters which can be used by the microbial organism for expression of endogenous
proteins.
[0092] In addition, phage vectors containing replicon and control sequences that are compatible
with the host microorganism can be used as transforming vectors in connection with
these hosts. For example, bacteriophage such as λGEM.TM.-11 may be utilized in making
a recombinant vector which can be used to transform susceptible host cells such as
E. coli LE392.
[0093] Either constitutive or inducible promoters can be used in the present invention,
in accordance with the needs of a particular situation, which can be ascertained by
one skilled in the art. A large number of promoters recognized by a variety of potential
host cells are well known. The selected promoter can be operably linked to cistron
DNA encoding a polypeptide described herein by removing the promoter from the source
DNA via restriction enzyme digestion and inserting the isolated promoter sequence
into the vector of choice. Both the native promoter sequence and many heterologous
promoters may be used to direct amplification and/or expression of the target genes.
However, heterologous promoters are preferred, as they generally permit greater transcription
and higher yields of expressed target gene as compared to the native target polypeptide
promoter.
[0094] Promoters suitable for use with prokaryotic hosts include the PhoA promoter, the
β-galactamase and lactose promoter systems, a tryptophan (trp) promoter system and
hybrid promoters such as the
tac or the
trc promoter. However, other promoters that are functional in bacteria (such as other
known bacterial or phage promoters) are suitable as well. Their nucleotide sequences
have been published, thereby enabling a skilled worker operably to ligate them to
cistrons encoding the target light and heavy chains (
Siebenlist et al. (1980) Cell 20: 269) using linkers or adaptors to supply any required restriction sites.
[0095] In some embodiments, each cistron within a recombinant vector comprises a secretion
signal sequence component that directs translocation of the expressed polypeptides
across a membrane. In general, the signal sequence may be a component of the vector,
or it may be a part of the target polypeptide DNA that is inserted into the vector.
The signal sequence selected for the purpose of this invention should be one that
is recognized and processed (i.e. cleaved by a signal peptidase) by the host cell.
For prokaryotic host cells that do not recognize and process the signal sequences
native to the heterologous polypeptides, the signal sequence is substituted by a prokaryotic
signal sequence selected, for example, from the group consisting of the alkaline phosphatase,
penicillinase, Ipp, or heat-stable enterotoxin II (STII) leaders, LamB, PhoE, PelB,
OmpA and MBP.
[0096] Prokaryotic host cells suitable for expressing polypeptides include Archaebacteria
and Eubacteria, such as Gram-negative or Gram-positive organisms. Examples of useful
bacteria include Escherichia (e.g.,
E. coli), Bacilli (e.g., B. subtilis), Enterobacteria, Pseudomonas species (e.g., P. aeruginosa),
Salmonella typhimurium, Serratia marcescans, Klebsiella, Proteus, Shigella, Rhizobia,
Vitreoscilla, or Paracoccus. Preferably, gram-negative cells are used. Preferably
the host cell should secrete minimal amounts of proteolytic enzymes, and additional
protease inhibitors may desirably be incorporated in the cell culture.
Polypeptide Production
[0097] Host cells are transformed or transfected with the above-described expression vectors
and cultured in conventional nutrient media modified as appropriate for inducing promoters,
selecting transformants, or amplifying the genes encoding the desired sequences.
[0098] Transfection refers to the taking up of an expression vector by a host cell whether
or not any coding sequences are in fact expressed. Numerous methods of transfection
are known to the ordinarily skilled artisan, for example, CaPO
4 precipitation and electroporation. Successful transfection is generally recognized
when any indication of the operation of this vector occurs within the host cell.
[0099] Transformation means introducing DNA into the prokaryotic host so that the DNA is
replicable, either as an extrachromosomal element or by chromosomal integrant. Depending
on the host cell used, transformation is done using standard techniques appropriate
to such cells. The calcium treatment employing calcium chloride is generally used
for bacterial cells that contain substantial cell-wall barriers. Another method for
transformation employs polyethylene glycol/DMSO. Yet another technique used is electroporation.
[0100] Prokaryotic cells used to produce the polypeptides of the invention are grown in
media known in the art and suitable for culture of the selected host cells. Examples
of suitable media include luria broth (LB) plus necessary nutrient supplements. In
preferred embodiments, the media also contains a selection agent, chosen based on
the construction of the expression vector, to selectively permit growth of prokaryotic
cells containing the expression vector. For example, ampicillin is added to media
for growth of cells expressing ampicillin resistant gene.
[0101] Any necessary supplements besides carbon, nitrogen, and inorganic phosphate sources
may also be included at appropriate concentrations introduced alone or as a mixture
with another supplement or medium such as a complex nitrogen source. Optionally the
culture medium may contain one or more reducing agents selected from the group consisting
of glutathione, cysteine, cystamine, thioglycollate, dithioerythritol and dithiothreitol.
[0102] The prokaryotic host cells are cultured at suitable temperatures. For
E. coli growth, for example, the preferred temperature ranges from about 20°C to about 39°C,
more preferably from about 25°C to about 37°C, even more preferably at about 30°C.
The pH of the medium may be any pH ranging from about 5 to about 9, depending mainly
on the host organism. For
E. coli, the pH is preferably from about 6.8 to about 7.4, and more preferably about 7.0.
[0103] If an inducible promoter is used in the expression vector, protein expression is
induced under conditions suitable for the activation of the promoter. For example,
if a PhoA promoter is used for controlling transcription, the transformed host cells
may be cultured in a phosphate-limiting medium for induction. A variety of other inducers
may be used, according to the vector construct employed, as is known in the art.
[0104] Polypeptides described herein expressed in a microorganism may be secreted into and
recovered from the periplasm of the host cells. Protein recovery typically involves
disrupting the microorganism, generally by such means as osmotic shock, sonication
or lysis. Once cells are disrupted, cell debris or whole cells may be removed by centrifugation
or filtration. The proteins may be further purified, for example, by affinity resin
chromatography. Alternatively, proteins can be transported into the culture media
and isolated therefrom. Cells may be removed from the culture and the culture supernatant
being filtered and concentrated for further purification of the proteins produced.
The expressed polypeptides can be further isolated and identified using commonly known
methods such as fractionation on immunoaffinity or ion-exchange columns; ethanol precipitation;
reverse phase HPLC; chromatography on silica or on a cation exchange resin such as
DEAE; chromatofocusing; SDS-PAGE; ammonium sulfate precipitation; gel filtration using,
for example, Sephadex G-75; hydrophobic affinity resins, ligand affinity using a suitable
antigen immobilized on a matrix and Western blot assay.
[0105] Besides prokaryotic host cells, eukaryotic host cell systems are also well established
in the art. Suitable hosts include mammalian cell lines such as CHO, and insect cells
such as those described below.
Polypeptide Purification
[0106] Polypeptides that are produced may be purified to obtain preparations that are substantially
homogeneous for further assays and uses. Standard protein purification methods known
in the art can be employed. The following procedures are exemplary of suitable purification
procedures: fractionation on immunoaffinity or ion-exchange columns, ethanol precipitation,
reverse phase HPLC, chromatography on silica or on a cation-exchange resin such as
DEAE, chromatofocusing, SDS-PAGE, ammonium sulfate precipitation, and gel filtration
using, for example, Sephadex G-75.
Methods Of The Invention
[0107] The invention provides various methods based on the finding that activated HGF β
is capable of directly binding to c-met, and that such binding can be inhibited with
the appropriate substance or molecule.
[0108] Various substances or molecules (including peptides, etc.) may be employed as therapeutic
agents. These substances or molecules can be formulated according to known methods
to prepare pharmaceutically useful compositions, whereby the product hereof is combined
in admixture with a pharmaceutically acceptable carrier vehicle. Therapeutic formulations
are prepared for storage by mixing the active ingredient having the desired degree
of purity with optional physiologically acceptable carriers, excipients or stabilizers
(
Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980)), in the form of lyophilized formulations or aqueous solutions. Acceptable carriers,
excipients or stabilizers are nontoxic to recipients at the dosages and concentrations
employed, and include buffers such as phosphate, citrate and other organic acids;
antioxidants including ascorbic acid; low molecular weight (less than about 10 residues)
polypeptides; proteins, such as serum albumin, gelatin or immunoglobulins; hydrophilic
polymers such as polyvinylpyrrolidone, amino acids such as glycine, glutamine, asparagine,
arginine or lysine; monosaccharides, disaccharides and other carbohydrates including
glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such
as mannitol or sorbitol; salt-forming counterions such as sodium; and/or nonionic
surfactants such as TWEENT
™, PLURONICS
™ or PEG.
[0109] The formulations to be used for
in vivo administration must be sterile. This is readily accomplished by filtration through
sterile filtration membranes, prior to or following lyophilization and reconstitution.
[0110] Therapeutic compositions herein generally are placed into a container having a sterile
access port, for example, an intravenous solution bag or vial having a stopper pierceable
by a hypodermic injection needle.
[0111] The route of administration is in accord with known methods, e.g. injection or infusion
by intravenous, intraperitoneal, intracerebral, intramuscular, intraocular, intraarterial
or intralesional routes, topical administration, or by sustained release systems.
[0113] When
in vivo administration of a substance or molecule of the invention is employed, normal dosage
amounts may vary from about 10 ng/kg to up to 100 mg/kg of mammal body weight or more
per day, preferably about 1 µg/kg/day to 10 mg/kg/day, depending upon the route of
administration. Guidance as to particular dosages and methods of delivery is provided
in the literature; see, for example,
U.S. Pat. Nos. 4,657,760;
5,206,344; or
5,225,212. It is anticipated that different formulations will be effective for different treatment
compounds and different disorders, that administration targeting one organ or tissue,
for example, may necessitate delivery in a manner different from that to another organ
or tissue.
[0114] Where sustained-release administration of a substance or molecule is desired in a
formulation with release characteristics suitable for the treatment of any disease
or disorder requiring administration of the substance or molecule, microencapsulation
of the substance or molecule is contemplated. Microencapsulation of recombinant proteins
for sustained release has been successfully performed with human growth hormone (rhGH),
interferon- (rhIFN- ), interleukin-2, and MN rgp120.
Johnson et al., Nat. Med., 2:795-799 (1996);
Yasuda, Biomed. Ther., 27:1221-1223 (1993);
Hora et al., Bio/Technology, 8:755-758 (1990);
Cleland, "Design and Production of Single Immunization Vaccines Using Polylactide
Polyglycolide Microsphere Systems," in Vaccine Design: The Subunit and Adjuvant Approach,
Powell and Newman, eds, (Plenum Press: New York, 1995), pp. 439-462;
WO 97/03692,
WO 96/40072,
WO 96/07399; and
U.S. Pat. No. 5,654,010.
[0116] This invention encompasses methods of screening compounds to identify those that
inhibit HGF/c-met signaling through interfering with HGF β chain and c-met interaction.
Screening assays are designed to identify compounds that bind or complex with activated
(and preferably not zymogen-like) HGF β chain and/or c-met (at a site on c-met that
inhibits binding of activated HGF β chain to c-met), or otherwise interfere with the
interaction of activated HGF 13 chain with other cellular proteins. Such screening
assays will include assays amenable to high-throughput screening of chemical libraries,
making them particularly suitable for identifying small molecule drug candidates.
[0117] The assays can be performed in a variety of formats, including protein-protein binding
assays, biochemical screening assays, immunoassays, and cell-based assays, which are
well characterized in the art.
[0118] All assays for antagonists are common in that they call for contacting the drug candidate
with a site on HGF β chain (or equivalent thereof) and/or c-met that is involved in
the binding interaction of activated HGF β chain and c-met, under conditions and for
a time sufficient to allow these two components to interact.
[0119] In binding assays, the interaction is binding and the complex formed can be isolated
or detected in the reaction mixture. In a particular embodiment, a candidate substance
or molecule is immobilized on a solid phase, e.g., on a microtiter plate, by covalent
or non-covalent attachments. Non-covalent attachment generally is accomplished by
coating the solid surface with a solution of the substance/molecule and drying. Alternatively,
an immobilized affinity molecule, such as an antibody, e.g., a monoclonal antibody,
specific for the substance/molecule to be immobilized can be used to anchor it to
a solid surface. The assay is performed by adding the non-immobilized component, which
may be labeled by a detectable label, to the immobilized component, e.g., the coated
surface containing the anchored component. When the reaction is complete, the non-reacted
components are removed, e.g., by washing, and complexes anchored on the solid surface
are detected. When the originally non-immobilized component carries a detectable label,
the detection of label immobilized on the surface indicates that complexing occurred.
Where the originally non-immobilized component does not carry a label, complexing
can be detected, for example, by using a labeled antibody specifically binding the
immobilized complex.
[0120] If the candidate compound interacts with but does not bind to an activated HGF β
chain or c-met, its interaction with the polypeptide can be assayed by methods well
known for detecting protein-protein interactions. Such assays include traditional
approaches, such as, e.g., crosslinking, co-immunoprecipitation, and co-purification
through gradients or chromatographic columns. In addition, protein-protein interactions
can be monitored by using a yeast-based genetic system described by Fields and co-workers
(
Fields and Song, Nature (London), 340:245-246 (1989);
Chien et al., Proc. Natl. Acad. Sci. USA, 88:9578-9582 (1991)) as disclosed by
Chevray and Nathans, Proc. Natl. Acad. Sci. USA, 89: 5789-5793 (1991). Many transcriptional activators, such as yeast GAL4, consist of two physically
discrete modular domains, one acting as the DNA-binding domain, the other one functioning
as the transcription-activation domain. The yeast expression system described in the
foregoing publications (generally referred to as the "two-hybrid system") takes advantage
of this property, and employs two hybrid proteins, one in which the target protein
is fused to the DNA-binding domain of GAL4, and another, in which candidate activating
proteins are fused to the activation domain. The expression of a GAL1-
lacZ reporter gene under control of a GAL4-activated promoter depends on reconstitution
of GAL4 activity via protein-protein interaction. Colonies containing interacting
polypeptides are detected with a chromogenic substrate for p-gatactosidase. A complete
kit (MATCHMAKER
™) for identifying protein-protein interactions between two specific proteins using
the two-hybrid technique is commercially available from Clontech. This system can
also be extended to map protein domains involved in specific protein interactions
as well as to pinpoint amino acid residues that are crucial for these interactions.
[0121] Compounds that interfere with the interaction of activated HGF β chain and c-met
can be tested as follows: usually a reaction mixture is prepared containing the activated
HGF β chain and c-met (or equivalent thereof that comprises the cognate activated
HGF β chain binding site on c-met) under conditions and for a time allowing for the
interaction and binding of the two products. To test the ability of a candidate compound
to inhibit binding, the reaction is run in the absence and in the presence of the
test compound. In addition, a placebo may be added to a third reaction mixture, to
serve as positive control. The binding (complex formation) between the test compound
and activated HGF β chain and/or c-met (or equivalent thereof as described above)
present in the mixture is monitored as described hereinabove. The formation of a complex
in the control reaction(s) but not in the reaction mixture containing the test compound
indicates that the test compound interferes with the interaction of activated HGF
β chain and c-met.
[0122] To assay for inhibitors (such as antagonists), 2-chain HGF comprising activated HGF
β chain may be added to a cell along with the compound to be screened for a particular
activity and the ability of the compound to inhibit the activity of interest in the
presence of the 2-chain HGF suggests that the compound could be an antagonist to the
activated HGF β chain, a property that could be further confirmed by determining its
ability to bind or interact specifically with activated HGF β chain and not with HGF
α chain (for e.g., as found in 2-chain HGF or single chain HGF).
[0123] More specific examples of potential antagonists include an oligonucleotide (which
may be an aptamer) that binds to the activated HGF β chain and/or its binding site
on c-met, and, in particular, antibodies including, without limitation, poly- and
monoclonal antibodies and antibody fragments, single-chain antibodies, anti-idiotypic
antibodies, and chimeric or humanized versions of such antibodies or fragments, as
well as human antibodies and antibody fragments. Alternatively, a potential antagonist
may be a closely related protein, for example, a mutated form of HGF β chain that
recognizes a HGF β chain binding partner but imparts no effect, thereby competitively
inhibiting the action of wild type HGF β chain.
[0124] Potential antagonists include small molecules that bind to the active site of HGF
β chain, the binding site of activated HGF β chain on c-met, or other relevant binding
site of activated HGF β chain, thereby blocking the normal biological activity of
the activated HGF β chain. Examples of small molecules include, but are not limited
to, small peptides or peptide-like molecules, preferably soluble peptides, and synthetic
non-peptidyl organic or inorganic compounds.
[0125] These small molecules can be identified by any one or more of the screening assays
discussed hereinabove and/or by any other screening techniques well known for those
skilled in the art.
[0126] As described herein, a substance/molecule of the invention can be a peptide. Methods
of obtaining such peptides are well known in the art, and include screening peptide
libraries for binders to a suitable target antigen. In one embodiment, suitable target
antigens would comprise activated HGF β chain (or portion thereof that comprises binding
site for c-met), which is described in detail herein. For e.g., a suitable target
antigen is an activated HGF β chain polypeptide as described herein, or a 2-chain
HGF polypeptide (which, as described herein, comprises an activated HGF β chain component).
In some instances, in particular where a desired substance/molecule is one that binds
to any significant degree activated HGF β chain but not HGF α chain and/or zymogen-form
HGF β chain, a candidate binder can also be screened for lack of substantial binding
capability with respect to a polypeptide comprising HGF β chain in zymogen form (i.e.,
unactivated HGF β chain) (for e.g., single chain HGF). Libraries of peptides are well
known in the art, and can also be prepared according to art methods. See, for e.g.,
Clark et al., U.S. Pat. No. 6,121,416. Libraries of peptides fused to a heterologous protein component, such as a phage
coat protein, are well known in the art, for e.g., as described in Clark et al.,
supra. In one embodiment, a peptide having ability to block binding of activated HGF β chain
to c-met comprises the amino acid sequence VDWVCFRDLGCDWEL, or variants thereof. Variants
of a first peptide binder can be generated by screening mutants of the peptide to
obtain the characteristics of interest (e.g., enhancing target binding affinity, enhanced
pharmacokinetics, reduced toxicity, improved therapeutic index, etc.). Mutagenesis
techniques are well known in the art. Furthermore, scanning mutagenesis techniques
(such as those based on alanine scanning) can be especially helpful to assess structural
and/or functional importance of individual amino acid residues within a peptide.
[0127] Determination of the ability of a candidate substance/molecule of the invention,
such as a peptide comprising the amino acid sequence VDWVCFRDLGCDWEL or variant thereof,
to modulate HGF/c-met signaling and/or biological activities associated with said
signaling, can be performed by testing the modulatory capability of the substance/molecule
in
in vitro or
in vivo assays, which are well established in the art, for e.g., as described in Okigaki
et al.,
supra; Matsumoto et al.,
supra; Date et al., FEBS Let. (1997), 420:1-6; Lokker et al.,
supra; Hartmann et al.,
supra.
Anti-activated HGF β chain Antibodies
[0128] The present invention further provides methods comprising use of anti-activated HGF
β chain antibodies. Exemplary antibodies include polyclonal, monoclonal, humanized,
bispecific, and heteroconjugate antibodies.
1. Polyclonal Antibodies
[0129] The anti-activated HGF β chain antibodies may comprise polyclonal antibodies. Methods
of preparing polyclonal antibodies are known to the skilled artisan. Polyclonal antibodies
can be raised in a mammal, for example, by one or more injections of an immunizing
agent and, if desired, an adjuvant. Typically, the immunizing agent and/or adjuvant
will be injected in the mammal by multiple subcutaneous or intraperitoneal injections.
The immunizing agent may include an activated HGF β chain (or portion thereof) or
a fusion protein thereof. It may be useful to conjugate the immunizing agent to a
protein known to be immunogenic in the mammal being immunized. Examples of such immunogenic
proteins include but are not limited to keyhole limpet hemocyanin, serum albumin,
bovine thyroglobulin, and soybean trypsin inhibitor. Examples of adjuvants which may
be employed include Freund's complete adjuvant and MPL-TDM adjuvant (monophosphoryl
Lipid A, synthetic trehalose dicorynomycolate). The immunization protocol may be selected
by one skilled in the art without undue experimentation.
2. Monoclonal Antibodies
[0130] The anti-activated HGF β chain antibodies may, alternatively, be monoclonal antibodies.
Monoclonal antibodies may be prepared using hybridoma methods, such as those described
by
Kohler and Milstein, Nature, 256:495 (1975). In a hybridoma method, a mouse, hamster, or other appropriate host animal, is typically
immunized with an immunizing agent to elicit lymphocytes that produce or are capable
of producing antibodies that will specifically bind to the immunizing agent. Alternatively,
the lymphocytes may be immunized
in vitro.
[0131] The immunizing agent will typically include the activated HGF β chain (or portion
thereof) or a fusion protein thereof. Generally, either peripheral blood lymphocytes
("PBLs") are used if cells of human origin are desired, or spleen cells or lymph node
cells are used if non-human mammalian sources are desired. The lymphocytes are then
fused with an immortalized cell line using a suitable fusing agent, such as polyethylene
glycol, to form a hybridoma cell [
Goding, Monoclonal Antibodies: Principles and Practice, Academic Press, (1986) pp.
59-103]. Immortalized cell lines are usually transformed mammalian cells, particularly myeloma
cells of rodent, bovine and human origin. Usually, rat or mouse myeloma cell lines
are employed. The hybridoma cells may be cultured in a suitable culture medium that
preferably contains one or more substances that inhibit the growth or survival of
the unfused, immortalized cells. For example, if the parental cells lack the enzyme
hypoxanthine guanine phosphoribosyl transferase (HGPRT or HPRT), the culture medium
for the hybridomas typically will include hypoxanthine, aminopterin, and thymidine
("HAT medium"), which substances prevent the growth of HGPRT-deficient cells.
[0132] Preferred immortalized cell lines are those that fuse efficiently, support stable
high level expression of antibody by the selected antibody-producing cells, and are
sensitive to a medium such as HAT medium. More preferred immortalized cell lines are
murine myeloma lines, which can be obtained, for instance, from the Salk Institute
Cell Distribution Center, San Diego, California and the American Type Culture Collection,
Manassas, Virginia. Human myeloma and mouse-human heteromyeloma cell lines also have
been described for the production of human monoclonal antibodies [
Kozbor, J. Immunol., 133:3001 (1984);
Brodeur et al., Monoclonal Antibody Production Techniques and Applications, Marcel
Dekker, Inc., New York, (1987) pp. 51-63].
[0133] The culture medium in which the hybridoma cells are cultured can then be assayed
for the presence of monoclonal antibodies directed against activated HGF β chain.
Preferably, the binding specificity of monoclonal antibodies produced by the hybridoma
cells is determined by immunoprecipitation or by an
in vitro binding assay, such as radioimmunoassay (RIA) or enzyme-linked immunoabsorbent assay
(ELISA). Such techniques and assays are known in the art. The binding affinity of
the monoclonal antibody can, for example, be determined by the Scatchard analysis
of
Munson and Pollard, Anal. Biochem., 107:220 (1980).
[0134] After the desired hybridoma cells are identified, the clones may be subcloned by
limiting dilution procedures and grown by standard methods [Goding,
supra]. Suitable culture media for this purpose include, for example, Dulbecco's Modified
Eagle's Medium and RPMI-1640 medium. Alternatively, the hybridoma cells may be grown
in vivo as ascites in a mammal.
[0135] The monoclonal antibodies secreted by the subclones may be isolated or purified from
the culture medium or ascites fluid by conventional immunoglobulin purification procedures
such as, for example, protein A-Sepharose, hydroxylapatite chromatography, gel electrophoresis,
dialysis, or affinity chromatography.
[0136] The monoclonal antibodies may also be made by recombinant DNA methods, such as those
described in
U.S. Patent No. 4,816,567. DNA encoding the monoclonal antibodies of the invention can be readily isolated
and sequenced using conventional procedures (e.g., by using oligonucleotide probes
that are capable of binding specifically to genes encoding the heavy and light chains
of murine antibodies). The hybridoma cells of the invention serve as a preferred source
of such DNA. Once isolated, the DNA may be placed into expression vectors, which are
then transfected into host cells such as simian COS cells, Chinese hamster ovary (CHO)
cells, or myeloma cells that do not otherwise produce immunoglobulin protein, to obtain
the synthesis of monoclonal antibodies in the recombinant host cells. The DNA also
may be modified, for example, by substituting the coding sequence for human heavy
and light chain constant domains ' in place of the homologous murine sequences [
U.S. Patent No. 4,816,567; Morrison et al., supra] or by covalently joining to the immunoglobulin coding sequence
all or part of the coding sequence for a non-immunoglobulin polypeptide. Such a non-immunoglobulin
polypeptide can be substituted for the constant domains of an antibody of the invention,
or can be substituted for the variable domains of one antigen-combining site of an
antibody of the invention to create a chimeric bivalent antibody.
[0137] The antibodies may be monovalent antibodies. Methods for preparing monovalent antibodies
are well known in the art. For example, one method involves recombinant expression
of immunoglobulin light chain and modified heavy chain. The heavy chain is truncated
generally at any point in the Fc region so as to prevent heavy chain crosslinking.
Alternatively, the relevant cysteine residues are substituted with another amino acid
residue or are deleted so as to prevent crosslinking.
[0138] In vitro methods are also suitable for preparing monovalent antibodies. Digestion of antibodies
to produce fragments thereof, particularly, Fab fragments, can be accomplished using
routine techniques known in the art.
[0139] Antibodies can also be generated by screening phage display libraries for antibodies
or antibody fragments that bind with suitable/desired affinity to activated HGF β
chain (or equivalent). Such techniques are well known in the art, for e.g., as disclosed
in
U.S Pat. Nos. 5,750,373;
5,780,279;
5,821,047;
6,040,136;
5,427,908;
5,580,717, and references therein.
3. Human and Humanized Antibodies
[0140] The anti-activated HGF β chain antibodies of the invention may further comprise humanized
antibodies or human antibodies. Humanized forms of non-human (e.g., murine) antibodies
are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (such as
Fv, Fab, Fab', F(ab')
2 or other antigen-binding subsequences of antibodies) which contain minimal sequence
derived from non-human immunoglobulin. Humanized antibodies include human immunoglobulins
(recipient antibody) in which residues from a complementary determining region (CDR)
of the recipient are replaced by residues from a CDR of a non-human species (donor
antibody) such as mouse, rat or rabbit having the desired specificity, affinity and
capacity. In some instances, Fv framework residues of the human immunoglobulin are
replaced by corresponding non-human residues. Humanized antibodies may also comprise
residues which are found neither in the recipient antibody nor in the imported CDR
or framework sequences. In general, the humanized antibody will comprise substantially
all of at least one, and typically two, variable domains, in which all or substantially
all of the CDR regions correspond to those of a non-human immunoglobulin and all or
substantially all of the FR regions are those of a human immunoglobulin consensus
sequence. The humanized antibody optimally also will comprise at least a portion of
an immunoglobulin constant region (Fc), typically that of a human immunoglobulin [
Jones et al., Nature, 321:522-525 (1986);
Riechmann et al., Nature, 332:323-329 (1988); and
Presta, Curr. Op. Struct. Biol., 2:593-596 (1992)].
[0141] Methods for humanizing non-human antibodies are well known in the art. Generally,
a humanized antibody has one or more amino acid residues introduced into it from a
source which is non-human. These non-human amino acid residues are often referred
to as "import" residues, which are typically taken from an "import" variable domain.
Humanization can be essentially performed following the method of Winter and co-workers
[
Jones et al., Nature, 321:522-525 (1986);
Riechmann et al., Nature, 332:323-327 (1988);
Verhoeyen et al., Science, 239:1534-1536 (1988)], by substituting rodent CDRs or CDR sequences for the corresponding sequences of
a human antibody. Accordingly, such "humanized" antibodies are chimeric antibodies
(
U.S. Patent No. 4,816,567), wherein substantially less than an intact human variable domain has been substituted
by the corresponding sequence from a non-human species. In practice, humanized antibodies
are typically human antibodies in which some CDR residues and possibly some FR residues
are substituted by residues from analogous sites in rodent antibodies.
[0142] Human antibodies can also be produced using various techniques known in the art,
including phage display libraries [
Hoogenboom and Winter, J. Mol. Biol., 227:381 (1991);
Marks et al., J. Mol. Biol., 222:581 (1991)]. The techniques of Cole et al. and Boerner et al. are also available for the preparation
of human monoclonal antibodies (
Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985) and
Boerner et al., J. Immunol., 147(1):86-95 (1991)]. Similarly, human antibodies can be made by introducing of human immunoglobulin
loci into transgenic animals, e.g., mice in which the endogenous immunoglobulin genes
have been partially or completely inactivated. Upon challenge, human antibody production
is observed, which closely resembles that seen in humans in all respects, including
gene rearrangement, assembly, and antibody repertoire. This approach is described,
for example, in
U.S. Patent Nos. 5,545,807;
5,545,806;
5,569,825;
5,625,126;
5,633,425;
5,661,016, and in the following scientific publications:
Marks et al., Bio/Technology 10, 779-783 (1992);
Lonberg et al., Nature 368 856-859 (1994);
Morrison, Nature 368, 812-13 (1994);
Fishwild et al., Nature Biotechnology 14, 845-51 (1996);
Neuberger, Nature Biotechnology 14, 826 (1996);
Lonberg and Huszar, Intern. Rev. Immunol. 13 65-93 (1995).
[0143] The antibodies may also be affinity matured using known selection and/or mutagenesis
methods as described above. Preferred affinity matured antibodies have an affinity
which is five times, more preferably 10 times, even more preferably 20 or 30 times
greater than the starting antibody (generally murine, humanized or human) from which
the matured antibody is prepared.
4. Bispecific Antibodies
[0144] Bispecific antibodies are monoclonal, preferably human or humanized, antibodies that
have binding specificities for at least two different antigens. In the present case,
one of the binding specificities is for activated HGF β chain and/or HGF P chain binding
site of c-met, the other one is for any other antigen, and preferably for a cell-surface
protein or receptor or receptor subunit.
[0145] Methods for making bispecific antibodies are known in the art. Traditionally, the
recombinant production of bispecific antibodies is based on the co-expression of two
immunoglobulin heavy-chain/light-chain pairs, where the two heavy chains have different
specificities [
Milstein and Cuello, Nature, 305:537-539 (1983)]. Because of the random assortment of immunoglobulin heavy and light chains, these
hybridomas (quadromas) produce a potential mixture of ten different antibody molecules,
of which only one has the correct bispecific structure. The purification of the correct
molecule is usually accomplished by affinity chromatography steps. Similar procedures
are disclosed in
WO 93/08829, published 13 May 1993, and in
Traunecker et al., EMBO J., 10:3655-3659 (1991).
[0146] Antibody variable domains with the desired binding specificities (antibody-antigen
combining sites) can be fused to immunoglobulin constant domain sequences. The fusion
preferably is with an immunoglobulin heavy-chain constant domain, comprising at least
part of the hinge, CH2, and CH3 regions. It is preferred to have the first heavy-chain
constant region (CH1) containing the site necessary for light-chain binding present
in at least one of the fusions. DNAs encoding the immunoglobulin heavy-chain fusions
and, if desired, the immunoglobulin light chain, are inserted into separate expression
vectors, and are co-transfected into a suitable host organism. For further details
of generating bispecific antibodies see, for example,
Suresh et al., Methods in Enzymology, 121:210 (1986).
[0147] According to another approach described in
WO 96/27011, the interface between a pair of antibody molecules can be engineered to maximize
the percentage of heterodimers which are recovered from recombinant cell culture.
The preferred interface comprises at least a part of the CH3 region of an antibody
constant domain. In this method, one or more small amino acid side chains from the
interface of the first antibody molecule are replaced with larger side chains (e.g.
tyrosine or tryptophan). Compensatory "cavities" of identical or similar size to the
large side chain(s) are created on the interface of the second antibody molecule by
replacing large amino acid side chains with smaller ones (e.g. alanine or threonine).
This provides a mechanism for increasing the yield of the heterodimer over other unwanted
end-products such as homodimers.
[0148] Bispecific antibodies can be prepared as full length antibodies or antibody fragments
(e.g. F(ab')
2 bispecific antibodies). Techniques for generating bispecific antibodies from antibody
fragments have been described in the literature. For example, bispecific antibodies
can be prepared can be prepared using chemical linkage.
Brennan et al., Science 229:81 (1985) describe a procedure wherein intact antibodies are proteolytically cleaved to generate
F(ab')
2 fragments. These fragments are reduced in the presence of the dithiol complexing
agent sodium arsenite to stabilize vicinal dithiols and prevent intermolecular disulfide
formation. The Fab' fragments generated are then converted to thionitrobenzoate (TNB)
derivatives. One of the Fab'-TNB derivatives is then reconverted to the Fab'-thiol
by reduction with mercaptoethylamine and is mixed with an equimolar amount of the
other Fab'-TNB derivative to form the bispecific antibody. The bispecific antibodies
produced can be used as agents for the selective immobilization of enzymes.
[0149] Fab' fragments may be directly recovered from
E. coli and chemically coupled to form bispecific antibodies.
Shalaby et al., J. Exp. Med. 175:217-225 (1992) describe the production of a fully humanized bispecific antibody F(ab')
2 molecule. Each Fab' fragment was separately secreted from
E. coli and subjected to directed chemical coupling
in vitro to form the bispecific antibody. The bispecific antibody thus formed was able to
bind to cells overexpressing the ErbB2 receptor and normal human T cells, as well
as trigger the lytic activity of human cytotoxic lymphocytes against human breast
tumor targets.
[0150] Various techniques for making and isolating bispecific antibody fragments directly
from recombinant cell culture have also been described. For example, bispecific antibodies
have been produced using leucine zippers.
Kostelny et al., J. Immunol. 148(5):1547-1553 (1992). The leucine zipper peptides from the Fos and Jun proteins were linked to the Fab'
portions of two different antibodies by gene fusion. The antibody homodimers were
reduced at the hinge region to form monomers and then re-oxidized to form the antibody
heterodimers. This method can also be utilized for the production of antibody homodimers.
The "diabody" technology described by
Hollinger et al., Proc. Natl. Acad. Sci. USA 90:6444-6448 (1993) has provided an alternative mechanism for making bispecific antibody fragments.
The fragments comprise a heavy-chain variable domain (V
H) connected to a light-chain variable domain (V
L) by a linker which is too short to allow pairing between the two domains on the same
chain. Accordingly, the V
H and V
L domains of one fragment are forced to pair with the complementary V
L and V
H domains of another fragment, thereby forming two antigen-binding sites. Another strategy
for making bispecific antibody fragments by the use of single-chain Fv (sFv) dimers
has also been reported. See,
Gruber et al., J. Immunol. 152:5368 (1994).
[0152] Exemplary bispecific antibodies may bind to two different epitopes on activated HGF
β chain or to an epitope on activated HGF β chain and an epitope on another polypeptide
(for e.g., c-met or HGF chain).
5. Heteroconjugate Antibodies
[0153] Heteroconjugate antibodies are also within the scope of the present invention. Heteroconjugate
antibodies are composed of two covalently joined antibodies. Such antibodies have,
for example, been proposed to target immune system cells to unwanted cells [
U.S. Patent No. 4,676,980], and for treatment of HIV infection [
WO 91/00360;
WO 92/200373;
EP 03089]. It is contemplated that the antibodies may be prepared
in vitro using known methods in synthetic protein chemistry, including those involving crosslinking
agents. For example, immunotoxins may be constructed using a disulfide exchange reaction
or by forming a thioether bond. Examples of suitable reagents for this purpose include
iminothiolate and methyl-4-mercaptobutyrimidate and those disclosed, for example,
in
U.S. Patent No. 4,676,980.
6. Effector Function Engineering
[0154] It may be desirable to modify the antibody of the invention with respect to effector
function, so as to enhance,
e.g., the effectiveness of the antibody in treating cancer. For example, cysteine residue(s)
may be introduced into the Fc region, thereby allowing interchain disulfide bond formation
in this region. The homodimeric antibody thus generated may have improved internalization
capability and/or increased complement-mediated cell killing and antibody-dependent
cellular cytotoxicity (ADCC). See
Caron et al., J. Exp Med., 176: 1191-1195 (1992) and
Shopes, J. Immunol., 148: 2918-2922 (1992). Homodimeric antibodies with enhanced antitumor activity may also be prepared using
heterobifunctional cross-linkers as described in
Wolff et al. Cancer Research, 53: 2560-2565 (1993). Alternatively, an antibody can be engineered that has dual Fc regions and may thereby
have enhanced complement lysis and ADCC capabilities. See
Stevenson et al., Anti-Cancer Drug Design, 3: 219-230 (1989).
7. Immunoconjugates
[0155] The invention also pertains to immunoconjugates comprising an antibody conjugated
to a cytotoxic agent such as a chemotherapeutic agent, toxin (
e.g., an enzymatically active toxin of bacterial, fungal, plant, or animal origin, or
fragments thereof), or a radioactive isotope (i.e., a radioconjugate).
[0156] Chemotherapeutic agents useful in the generation of such immunoconjugates have been
described above. Enzymatically active toxins and fragments thereof that can be used
include diphtheria A chain, nonbinding active fragments of diphtheria toxin, exotoxin
A chain (from
Pseudomonas aeruginosa), ricin A chain, abrin A chain, modeccin A chain, alpha-sarcin,
Aleurites fordii proteins, dianthin proteins,
Phytolaca americana proteins (PAPI, PAPII, and PAP-S), momordica charantia inhibitor, curcin, crotin,
sapaonaria officinalis inhibitor, gelonin, mitogellin, restrictocin, phenomycin, enomycin,
and the tricothecenes. A variety of radionuclides are available for the production
of radioconjugated antibodies. Examples include
212Bi,
131I,
131In,
90Y, and
186Re. Conjugates of the antibody and cytotoxic agent are made using a variety of bifunctional
protein-coupling agents such as N-succinimidyl-3-(2-pyridyldithiol) propionate (SPDP),
iminothiolane (IT), bifunctional derivatives of imidoesters (such as dimethyl adipimidate
HCL), active esters (such as disuccinimidyl suberate), aldehydes (such as glutareldehyde),
bis-azido compounds (such as bis (p-azidobenzoyl) hexanediamine), bis-diazonium derivatives
(such as bis-(p-diazoniumbenzoyl)-ethylenediamine), diisocyanates (such as tolyene
2,6-diisocyanate), and bis-active fluorine compounds (such as 1,5-difluoro-2,4-dinitrobenzene).
For example, a ricin immunotoxin can be prepared as described in
Vitetta et al., Science, 238: 1098 (1987). Carbon-14-labeled 1-isothiocyanatobenzyl-3-methyldiethylene triaminepentaacetic
acid (MX-DTPA) is an exemplary chelating agent for conjugation of radionucleotide
to the antibody. See
W094/ 11026.
[0157] In another embodiment, the antibody may be conjugated to a "receptor" (such streptavidin)
for utilization in tumor pretargeting wherein the antibody-receptor conjugate is administered
to the patient, followed by removal of unbound conjugate from the circulation using
a clearing agent and then administration of a "ligand" (
e.g., avidin) that is conjugated to a cytotoxic agent (
e.g., a radionucleotide).
8. Immunoliposomes
[0158] The antibodies disclosed herein may also be formulated as immunoliposomes. Liposomes
containing the antibody are prepared by methods known in the art, such as described
in
Epstein et al., Proc. Natl. Acad. Sci. USA, 82: 3688 (1985);
Hwang et al., Proc. Natl Acad. Sci. USA, 77: 4030 (1980); and
U.S. Pat. Nos. 4,485,045 and
4,544,545. Liposomes with enhanced circulation time are disclosed in
U.S. Patent No. 5,013,556.
[0159] Particularly useful liposomes can be generated by the reverse-phase evaporation method
with a lipid composition comprising phosphatidylcholine, cholesterol, and PEG-derivatized
phosphatidylethanolamine (PEG-PE). Liposomes are extruded through filters of defined
pore size to yield liposomes with the desired diameter. Fab' fragments of the antibody
of the present invention can be conjugated to the liposomes as described in
Martin et al., J. Biol. Chem., 257: 286-288 (1982) via a disulfide-interchange reaction. A chemotherapeutic agent (such as Doxorubicin)
is optionally contained within the liposome. See
Gabizon et al., J. National Cancer Inst., 81(19); 1484 (1989).
9. Pharmaceutical Compositions of Antibodies
[0160] Antibodies as well as other molecules identified by the screening assays disclosed
hereinbefore, can be administered for the treatment of various disorders in the form
of pharmaceutical compositions.
[0161] If whole antibodies are used as inhibitors, internalizing antibodies are preferred.
However, lipofections or liposomes can also be used to deliver a substance/molecule
of the invention into cells where that is desired. Where antibody fragments are used,
the smallest inhibitory fragment is preferred. For example, based upon the variable-region
sequences of an antibody, peptide molecules can be designed that retain the ability
to bind activated HGF β chain and/or HGF β chain binding site on c-met and/or interfere
with interaction between activated HGF β chain and c-met. Such peptides can be synthesized
chemically and/or produced by recombinant DNA technology. See,
e.g.,
Marasco et al., Proc. Natl. Acad. Sci. USA, 90: 7889-7893 (1993). The formulation herein may also contain more than one active compound as necessary
for the particular indication being treated, preferably those with complementary activities
that do not adversely affect each other. Alternatively, or in addition, the composition
may comprise an agent that enhances its function, such as, for example, a cytotoxic
agent, cytokine, chemotherapeutic agent, or growth-inhibitory agent. Such molecules
are suitably present in combination in amounts that are effective for the purpose
intended.
[0162] The active ingredients may also be entrapped in microcapsules prepared, for example,
by coacervation techniques or by interfacial polymerization, for example, hydroxymethylcellulose
or gelatin-microcapsules and poly-(methylmethacylate) microcapsules, respectively,
in colloidal drug delivery systems (for example, liposomes, albumin microspheres,
microemulsions, nanoparticles, and nanocapsules) or in macroemulsions. Such techniques
are disclosed in Remington's
Pharmaceutical Sciences, supra.
[0163] The formulations to be used for in
vivo administration must be sterile. This is readily accomplished by filtration through
sterile filtration membranes.
[0164] Sustained-release preparations may be prepared. Suitable examples of sustained-release
preparations include semipermeable matrices of solid hydrophobic polymers containing
the antibody, which matrices are in the form of shaped articles,
e.g., films, or microcapsules. Examples of sustained-release matrices include polyesters,
hydrogels (for example, poly(2-hydroxyethyl-methacrylate), or poly(vinylalcohol)),
polylactides (
U.S. Pat. No. 3,773,919), copolymers of L-glutamic acid and γ ethyl-L-glutamate, non-degradable ethylene-vinyl
acetate, degradable lactic acid-glycolic acid copolymers such as the LUPRON DEPOT
™ (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide
acetate), and poly-D-(-)-3-hydroxybutyric acid. While polymers such as ethylene-vinyl
acetate and lactic acid-glycolic acid enable release of molecules for over 100 days,
certain hydrogels release proteins for shorter time periods. When encapsulated antibodies
remain in the body for a long time, they may denature or aggregate as a result of
exposure to moisture at 37°C, resulting in a loss of biological activity and possible
changes in immunogenicity. Rational strategies can be devised for stabilization depending
on the mechanism involved. For example, if the aggregation mechanism is discovered
to be intermolecular S-S bond formation through thio-disulfide interchange, stabilization
may be achieved by modifying sulfhydryl residues, lyophilizing from acidic solutions,
controlling moisture content, using appropriate additives, and developing specific
polymer matrix compositions.
[0165] The following are examples of the methods and compositions of the invention. It is
understood that various other embodiments may be practiced, given the general description
provided above.
EXAMPLES
MATERIALS & METHODS
Materials
[0166] The mature forms of the Met ECD (Glu25 to Gln929) domain containing a C-terminal
His
6 tag was expressed in insect cells and purified by Ni-NTA metal chelate and gel filtration
chromatography using standard protocols described below. Met-IgG fusion protein was
obtained as previously described (Mark et al., 1992).
Expression and purification of HGF β proteins
[0167] HGF β proteins were expressed in insect cells using baculovirus secretion vector
pAcGP67 (BD Biosciences, Pharmingen, San Diego, CA), which contains a signal sequence
for secretion of the product into the media. All constructs contained a His
6 tag at the carboxy terminus and were purified to homogeneity (>95% purity) by Ni
NTA metal chelate and gel filtration chromatography. For wildtype HGF β, a cDNA fragment
encoding the HGF β-chain from residues Val495 [c16] to Ser728 [c250] was cloned by
PCR such that Val495 [c16] was inserted immediately after the secretion signal sequence.
Site-directed mutagenesis was carried out using QuikChange
™ (Stratagene, La Jolla, CA) with oligonucleotide 5'CCTAATTATGGATCCACAATTCCTG3' to
make HGF β containing a Cys604 [cl28] to Ser mutation (HGF β) to avoid potential complications
of an exposed unpaired Cys in the protease-like domain. HGF β mutants Y513A [c36],
R516A [c39], Q534A [c57], D578A [c102], Y619A [c143],Y673A [c195], V692A [c214], P693D
[c215], G694E [c216], R695A [c217], G696A [c219],1699A [c221a] and R702A [c224] were
made as above in the HGF β construct (having the C604S mutation). HGF β mutant C561S
[c78] (i.e., C561S:C604S) was also made as above in the HGF β construct in order to
eliminate both free cysteines. proHGFβ encodes HGF from residues Asn479 to Ser728
and has a R494E mutation made using the oligonucleotide 5'CAAAACGAAACAATTGGAAGTTGTAAATGGGATTC
3'. The cysteine was not altered in this construct to allow putative disulfide formation
between Cys487 and Cys604. Numbering of amino acid position is as follows: full length
HGF sequence [chymotrypsinogen numbering].
[0168] Baculovirus vectors containing the desired inserts were transfected into
Spodoptera frugiperda (Sf 9) cells on plates in TNM-FH media via the Baculogold
™ Expression System according to manufacturer's instructions (BD Biosciences Pharmingen,
San Diego, CA). After 2-4 rounds of virus amplification, 10 ml of viral stock was
used to infect 11 of High Five
™ cells (Invitrogen, San Diego, CA) in suspension at 5×10
5 cells/ml in TNM-FH media. Cultures were incubated at 27 °C for 72 h before harvesting
the culture media by centrifugation at 8,000 x g for 15 min. Cell culture media was
applied to a 4 ml Ni-NTA agarose column (Qiagen, Valencia, CA). After washing with
4 column volumes of 50 mM Tris•HCl, pH 8.0, 500 mM NaCl, 5 mM imidazole, HGF β proteins
were eluted with 50 mM Tris•HCl pH 8.0, 500 mM NaCl, 500 mM imidazole. The eluate
was pooled and applied to a Superdex
™-200 column (Amersham Biosciences, Piscataway, NJ) equilibrated in 10 mM HEPES pH
7.2, 150 mM NaCl, 5 mM CaCl
2. Protein peaks were collected and concentrated using a Centriprep
™ YM-10 (Millipore, Bedford, MA). Fractions were analyzed by 12% SDS-PAGE stained with
Coomassie blue. All mutations were verified by DNA sequencing and mass spectrometry.
Protein concentration was determined by quantitative amino acid analysis. N-terminal
sequencing revealed a single correct N-terminus present for proHGF β and HGF β Purified
proteins showed the correct molecular mass on SDS-PAGE; multiple bands observed were
likely due to heterogeneous glycosylation, consistent with the mass spectrometry data
having molecular masses - 2 kDa higher than predicted from the sequence.
Construction, expression and purification of full length HGF proteins
[0169] Recombinant proteins were produced in 11 cultures of Chinese hamster ovary (CHO)
cells by transient transfection (Peek et al., 2002). Amino acid changes were introduced
by site-directed mutagenesis (Kunkel, 1985) and verified by DNA sequencing. The expression
medium (F-12/Dulbecco's modified Eagle's medium) contained 1% (v/v) ultra low IgG
fetal bovine serum (FBS) (Gibco, Grand Island, NY). After 8 days the medium was harvested
and supplemented with FBS to give a final content of 5-10% (v/v). Additional incubation
for 2-3 days at 37 °C resulted in complete single-chain HGF conversion. This step
was omitted for expression of proHGF, an uncleavable single chain form, which has
amino acid changes at the activation cleavage site (R494E) and at a protease-susceptible
site in the α-chain (R424A) (Peek et al., ., 2002). Mutant proteins were purified
from the medium by HiTrap-Sepharose SP cation exchange chromatography (Amersham Biosciences,
Piscataway, NJ) as described (Peek et al., 2002). Examination by SDS-PAGE (4-20% gradient
gel) under reducing conditions and staining with Simply Blue Safestain showed that
all mutant HGF proteins were >95% pure and were fully converted into α/β-heterodimers
except for proHGF, which remained as a single-chain form. Protein concentration for
each mutant was determined by quantitative amino acid analysis.
HGF β and Met binding affinity by surface plasmon resonance
[0170] The binding affinity of HGF β for Met was determined by surface plasmon resonance
using a Biacore 3000 instrument (Biacore, Inc., Piscataway, NJ). The Met ECD domain
was immobilized on a CM5 chip using amine coupling at ~2000 resonance units according
to the manufacturer's instructions. A series of concentrations of HGF β (i.e., C604S
mutant) in 10 mM HEPES pH 7.2, 150 mM NaCl, 5 mM CaCl
2 ranging from 12.5 nM to 100 nM were injected at a flow rate of 20 µl/min for 40 s.
Bound HGF β was allowed to dissociate for 10 min. Appropriate background subtraction
was carried out. The association (k
on) and dissociation (k
off) rate constants were obtained by a global fitting program provided with the instrument;
the ratio of k
off/k
on was used to calculate the dissociation constant (K
d).
Binding of HGF β to Met and competition binding ELISA
[0171] Microtiter plates (Nunc, Roskilde, Denmark) were coated overnight at 4°C with 2 µg/ml
of rabbit anti-human IgG Fc specific antibody (Jackson ImmunoResearch Laboratory,
West Grove, PA) in 50 mM sodium carbonate buffer, pH 9.6. After blocking with 1% BSA
in HBS buffer (50 mM HEPES pH 7.2, 150 mM NaCl, 5 mM CaCl
2 and 0.1% Tween-20), 1 µg/ml Met-IgG fusion protein (Mark et al., 1992) was added
and plates were incubated for 1 h with gentle shaking at room temperature. After washing
with HBS buffer, HGF β proteins were added for 1 h. Bound HGF β was detected using
anti-His-HRP (Qiagen, Valencia, CA) followed by addition of TMB/H
2O
2 substrate (KPL, Gaithersburg, MD). The reaction was stopped with 1M H
3PO
4 and the A
450 was measured on a Molecular Devices SpectraMax Plus
384 microplate reader. The effective concentration to give half-maximal binding (EC
50) was determined by a four parameter fit using Kaleidagraph (Synergy Software, Reading,
PA).
[0172] In order to develop a competition ELISA, wildtype HGF β was biotinylated using a
20-fold molar excess of biotin-maleimide (Pierce, Rockford, IL) at room temperature
for 2 h. Plates were treated as above except biotinylated wildtype HGF β was used
and detected using HRP-neutravidin (Pierce, Rockford, IL). Competition assays contained
a mixture of 250 nM biotinylated wildtype HGF β and various concentrations of proteins
as indicated (e.g., unlabeled HGF β variants, HGF (i.e., 2-chain) or proHGF (i.e.,
HGF in single chain form)). After incubation for 1 h at room temperature, the amount
of biotinylated wildtype HGF β bound on the plate was measured as described above.
IC
50 values were determined by fitting the data to a four-parameter equation (Kaleidagraph,
Synergy Software, Reading, PA).
Binding of HGF mutants to Met
[0173] Biotinylated HGF was prepared using the Sigma immunoprobe biotinylation kit (Sigma,
St. Louis, MO). Microtiter plates were coated with rabbit anti-human IgG Fc specific
antibody as above. Plates were washed in PBS 0.05% (v/v) Tween-20 followed by a 1
h incubation with 0.5% (w/v) of BSA, 0.05% Tween-20 in PBS, pH 7.4 at room temperature.
After washing, 1 nM biotinylated HGF and 0.2 nM Met-IgG fusion protein (Mark et al.,
1992) together with various concentrations of HGF mutants, wildtype HGF β was added
to the wells and incubated for 2 h. After washing, bound biotinylated HGF was detected
by addition of diluted (1:3000) streptavidin horseradish peroxidase conjugate (Zymed,
South San Francisco, CA) followed by SureBlue TMB peroxidase substrate and stop solution
TMB STOP (KPL, Gaithersburg, MD). The A
450 was measured and IC
50 values were determined as described above. Relative binding affinities are expressed
as the IC
50(mutant)/IC
50(wildtype HGF).
HGF-dependent phosphorylation of Met
[0174] The kinase receptor activation assay (KIRA) was run as follows. Confluent cultures
of lung carcinoma A549 cells (CCL-185, ATCC, Manassas, VA), previously maintained
in growth medium (Ham's F12/DMEM 50:50 (Gibco, Grand Island, NY) containing 10% FBS,
(Sigma, St. Louis, MO), were detached using Accutase (ICN, Aurora, OH) and seeded
in 96 well plates at a density of 50,000 cells per well. After overnight incubation
at 37°C, growth media was removed and cells were serum starved for 30 to 60 min in
medium containing 0.1 % FBS. Met phosphorylation activity by HGF or HGF mutants was
determined from addition of serial dilutions from 500 to 0.2 ng/ml in medium containing
0.1 % FBS followed by a 10 min incubation at 37°C, removal of media and cell lysis
with 1X cell lysis buffer (Cat. #9803, Cell Signaling Technologies, Beverly, MA) supplemented
with 1X protease inhibitor cocktail set I (Cat #539131, Calbiochem, San Diego, CA).
HGF β-chain was carried out similarly starting at 5 µg/ml. Inhibition of HGF dependent
Met phophorylation activity by HGF β-chain was determined from addition of serial
dilutions from 156 to 0.06 nM to assay plates followed by a 15 min incubation at 37°C,
addition of HGF at 12.5, 25 or 50 nM, an additional 10 min incubation at 37°C, removal
of media and cell lysis as above. Cell lysates were analyzed for phosphorylated Met
via an electrochemiluminescence assay using a Bio Veris M-Series instrument (Bio Veris
Corporation, Gaithersburg, MD). Anti-phosphotyrosine mAb 4G10 (Upstate, Lake Placid,
MY) was labeled with BV-TAG via NHS-ester chemistry according to manufacturer's directions
(Bio Veris). Anti-Met ECD mAb 1928 (Genentech, South San Francisco, CA) was biotinylated
using biotin-X-NHS (Research Organics, Cleveland, OH). The BV-TAG-labeled 4G10 and
biotinylated anti-Met mAb were diluted in assay buffer (PBS, 0.5% Tween-10, 0.5% BSA)
and the cocktail was added to the cell lysates. After incubation at room temperature
with vigorous shaking for 1.5 to 2 h, streptavidin magnetic beads (Dynabeads, Bio
Veris) were added and incubated for 45 min. The beads with bound material (anti-Met
antibody/Met/anti-phosphotyrosine antibody) were captured by an externally applied
magnet. After a wash step the chemiluminescent signal generated by the light source
was measured as relative luminescent units on a Bio Veris instrument. For each experiment,
the Met phosphorylation induced by HGF mutants was expressed in percent of the maximal
signal obtained with 2-chain HGF.
Proliferation Assay
[0175] BxPC3 (human pancreatic adeocarcinoma; ECACC No. 93120816) were obtained from the
European Collection of Cell Cultures (CAMR Centre for Applied Microbiology and Research,
Porton Down, Salisbury, Wiltshire (UK) and were used in an HGF-dependent proliferation
assay. Cells were grown in RPMI medium containing 10% FCS (Sigma F-6178, St. Louis,
MO), 10 mM HEPES, 2 mM glutamine, 1X Penicillin-Streptomycin (Invitrogen 15140-122,
Carlsbad, CA), 100 X penicillin 10000 u/ml- streptomycin 10000 µg/ml), and G418 (Invitrogen
10131-035) at 250 µg/ml. The cells were sequentially washed with PBS, PBS containing
10 mM EDTA, then removed using trypsin. The cells were harvested into serum containing
media and the cell density was determined using a hemacytometer. Cells at 50000-75000/ml
were seeded at 200 µl per well into a white bottom MT plate (Cultur Plate
™ 6005680 Packard/PerkinElmer, Boston, MA) using the inside 60 wells only and allowed
to grow for 24 h. The media was removed, the cells were washed with PBS and 200 µl
of serum-free media containing 0.1 % BSA (SF-BSA) was added back to the cells. The
cells were grown for an additional 24 h. The media was removed and the various test
HGF proteins (n=4) in 150 µl of SF-BSA were added to the wells. 2-chain HGF was used
at 1 nM final for inhibition assays. Controls were run in the absence of HGF and/or
in the absence of test HGF proteins.
[0176] The cells were allowed to grow for 72 h and then assayed using the CellTiter-Glo
Luminescent Kit (Promega G7571, Madison, WI). The procedure followed is described
in Promega Technical Bulletin TB288. The microtiter plate was read on a Tropix TR717
microplate luminometer (Berthold 75323 Bad Wildbad, Germany). The percent of stimulation
or inhibition of cell proliferation was normalized to the appropriate controls.
Cell migration assay
[0177] Breast cancer cells MDA-MB-435 (HTB-129, ATCC, Manassas, VA) were cultured in recommended
serum-supplemented medium. Confluent cells were detached in PBS containing 10 mM EDTA
and diluted with serum-free medium to a final concentration of 0.6-0.8 x 10
5 cells/ml. 0.2 ml of this suspension (1.2-1.6 x 10
5 total cells) was added in triplicate to the upper chambers of 24-well transwell plates
(8 µm pore size) (HTS Multiwell
™ Insert System, Falcon, Franklin Lakes, NJ) pre-coated with 10 µg/ml of rat tail collagen
Type I (Upstate, Lake Placid, NY). Wildtype HGF or HGF mutants were added to the lower
chamber at 100 ng/ml in serum-free medium, unless specified otherwise. HGF β-chain
was also tested at 30 µg/ml. After incubation for 13-14 h, cells on the apical side
of the membrane were removed and those that migrated to the basal side were fixed
in 4% paraformaldehyde followed by staining with a 0.5% crystal violet solution. After
washing and airdrying, cells were solubilized in 10% acetic acid and the A
560 was measured on a Molecular Devices microplate reader. Pro-migratory activities of
HGF mutants were expressed as percent of HGF controls after subtracting basal migration
in the absence of HGF. Photographs of stained cells were taken with a Spot digital
camera (Diagnostics Instruments, Inc., Sterling Heights, MI) connected to a Leitz
microscope (Leica Mikroskope & Systeme GmbH, Wetzlar, Germany). Pictures were acquired
by Adobe Photoshop 4.0.1 (Adobe Systems Inc., San Jose, CA).
RESULTS
Binding of HGF β to Met
[0178] HGF β binding to Met was assessed from the change in resonance units measured by
surface plasmon resonance on a CM5 chip derivatized with the extracellular domain
of Met (Met ECD). The results show that HGF β binds to Met ECD with a K
d of 87 nM calculated from relatively fast association (k
on = 1.18 × 10
5 M
-1 s
-1) and dissociation rate constants (k
off = 0.0103 s
-1) (Fig. 1A). Similar results were obtained for binding to the c-met Sema domain, where
a Kd of 27 nM was calculated (data not shown). Binding of HGF β to Met was also confirmed
by a second independent method using a plate ELISA. Following incubation of biotinylated
HGF β with a properly oriented Met-IgG fusion bound to an immobilized anti-Fc antibody
and detection with HRP-neutravidin, an EC
50 value of 320 ± 140 nM was determined (n = 6; data not shown).
[0179] Since single-chain HGF binds to Met with comparable affinity to two-chain HGF, but
does not induce Met phosphorylation (Lokker et al., 1992; Hartmann et al., 1992),
we hypothesized that this may be due to the lack of a Met binding site in the uncleaved
form of the 13-chain. To test this hypothesis, we expressed and purified proHGF β,
a zymogen-like form of HGF β containing the C-terminal 16 residues from the HGF α-chain
and a mutation at the cleavage site (R494E) to ensure that the single-chain form remained
intact. Binding of HGF β and proHGF β to Met was determined with a competition binding
ELISA, resulting in IC
50 values of 0.86 ± 0.17 and 11.6 ± 1.8 µM, respectively (Fig. 1B). The 13.5-fold reduced
binding shows that while a Met binding site on the zymogen-like HGF β does in fact
exist, it is not optimal. The loss of binding affinity of proHGF β is also exemplified
in the data summarized in Fig. 5. Indeed, in other rounds of experimentations, zymogen-like
β chain was found to be much less efficient in its ability to compete with the labeled
β chain for binding to c-Met, having an IC
50 of ca. 41 µM, about 75-fold higher than the value found for HGF β chain of 0.56 µM
in this assay, demonstrating that zymogen-like HGF β chain has significantly decreased
binding to c-Met (data not shown). Therefore, a variety of experiments confirm that
zymogen-like β chain (proHGF β) is a sub-optimal Met ligand.
Inhibition of activity by HGF β
[0180] Although HGF β binds to Met, it does not induce Met phosphorylation (Fig. 1C). Figure
1C shows that HGF β was completely inactive, even at concentrations that exceeded
optimal phosphorylation activity by full length HGF by >1000-fold. Similarly, in MDA-MB-435
cell migration assays, HGF β at concentrations of up to 0.95 µM had no effect. However,
HGF β does inhibit HGF-dependent phosphorylation of Met in a concentration dependent
manner (Fig. 1D), although the inhibition was incomplete at the highest concentration
used. Inhibition of Met phosphorylation is consistent with a direct competition with
HGF for Met binding. In agreement with this, competition binding assays show that
HGF β inhibits full length HGF binding to Met (Fig. 1E), albeit at rather high concentrations
(IC
50 = 830 ± 26 nM; n = 3). By comparison, full length wildtype HGF had an IC
50 value of 0.86 ± 0.47 nM (n = 3) in this assay.
Mutations in HGF and HGFβ affect cell migration and Met phosphorylation
[0181] To identify the Met binding site in the β-chain we systematically changed residues
in regions corresponding to the activation domain and the active site of serine proteases,
herein referred to as 'activation domain' and 'active site region' of HGF. Initial
expression of HGF mutants in CHO cells yielded a mixture of single- and two-chain
HGF forms, exemplified by mutant HGF 1623A (Fig. 2A). Complete conversion of residual
uncleaved HGF was accomplished by additional exposure of the harvested culture medium
to 5-10% serum for several days (Fig. 2A). The purity of HGF 1623A following purification
by cation exchange chromatography is representative of all HGF mutants (Fig. 2A).
[0182] The functional consequence of mutating β-chain residues in HGF was assessed by determining
the ability of the HGF mutants to stimulate migration of MDA-MB435 cells. The results
showed that 3 HGF mutants, R695A [c217], G696A [c219] and Y673A [c195] were severely
impaired, having less than 20% of wildtype activity, while 5 mutants Q534A [c57],
D578A [c102], V692A [c214], P693A [c215] and G694A [c216] had 20%-60% of wildtype
activity (Fig. 2B). An additional set of 9 mutants (R514A, P537A, Y619A, T620A, G621A,
K649A, 1699A, N701A and R702A) had 60-80% of wildtype activity. The remaining 21 mutants
had activities >80% that of wildtype and were considered essentially unchanged from
HGF. As expected, proHGF did not stimulate cell migration (Fig. 2B). The decreased
ability of 1 nM R695A [c217] or G696A [c219] to promote cell migration is illustrated
in Figure 2C, showing that migration in the presence of either mutant is similar to
basal migration in the absence of HGF.
[0183] To examine whether reduced activities in cell migration correlated with reduced Met
phosphorylation, a subset of HGF mutants was examined in a kinase receptor assay (KIRA).
For wildtype HGF and HGF mutants, maximal Met phosphorylation was observed at concentrations
between 0.63 and 1.25 nM (Fig. 3). The maximal Met phosphorylation achieved by mutants
Y673A [c195], R695A [c217] and G696A [c219] was less than 30% of wild type, agreeing
with their minimal or absent pro-migratory activities. Mutants Q534A [c57], D578A
[c102] and V692A [c214] had intermediate activities (30-60%) in cell migration assays;
they also had intermediate levels of Met phosphorylation, having 56%-83% that of wildtype
HGF. In agreement with its lack of cell migration activity, proHGF had no Met phosphorylation
activity (Fig. 3).
Effect of β-chain mutations on binding of HGF and HGF β-chain to Met
[0184] The affinity of each mutant to Met-IgG fusion protein was analyzed by HGF competition
binding. Except for K649A [c173] and Y673A [c195] (both ca. 4-fold weaker binding),
all (>30) HGF mutants had essentially the same binding affinity as two-chain HGF (IC
50 = 0.83 ± 0.32 nM; n = 30), indicated by their IC
50 ratios (IC
50mut/IC
50WT), which ranged from 0.36 to 2.25 (Figure 7). HGF Y673A [c195] and proHGF showed
ca. 4-fold weaker binding to Met-IgG compared to HGF (Figure 7). [It should be noted
that while absolute values of binding affinity measurements can vary between experiments,
the effect of specific mutations on binding ability compared to wild type is reproducible
between multiple experiments.] We also examined the cell migration activities of selected
mutants at 10- and 50-fold higher concentrations; no increase in pro-migratory activity
was observed (Figure 8). Therefore, the impaired function of HGF mutants is not due
to reduced binding to Met, since an increase in concentration of up to 50-fold had
no compensatory effect.
[0185] The poor correlation between HGF mutant binding to Met and either HGF-dependent cell
migration or Met phosphorylation is likely due to the relatively high affinity between
Met and the HGF α-chain, which could mask any reduced affinity due to the β-chain.
Therefore, we made selected mutations in HGF β itself to eliminate any α-chain effects.
HGF β mutants Y513A [c36], R516A [c39], Q534A [c57], D578A [c102], Y619A [c143],Y673A
[c195], V692A [c214], P693D [c215], G694E [c216], R695A [c217], G696A [c219], I699A
[c221a] and R702A [c224] were tested in a competition ELISA with biotinylated HGF
β binding to Met-IgG. HGF β mutant C561S [c78] (C604S:C561S) was tested to assess
activity in mutants with no free cysteines. Mutants were made in the HGF β C604S [c128]
background to avoid any potential dimerization during purification, although this
mutation had no effect on binding to Met-IgG. The binding affinities of the mutants
were then normalized to HGF β, which had an IC
50 - 0.55 ± 0.38 µM (n = 16). Results are shown in Fig. 5. A selected subset of these
are graphically depicted in Fig. 4. Most mutants had reduced binding affinity to Met
and some mutants - e.g. R695A [c217] and G696A [c219] - did not compete for binding
at all (see Fig. 5). We now see a strong correlation for reduced activity of full
length two-chain HGF mutants with reduced binding of the corresponding mutant of HGF
β. It was found that some mutants (e.g. R695A [c217], G696A [c219] and Y673A [c195]),
that had the greatest loss in migration activity (as 2-chain full length HGF mutants)
also had the greatest loss in Met binding (as HGF β mutants). Conversely, mutants
with a small reduction of migration activity (e.g. Y619A [c143] and I699A [c221a])
also had a small (less than 10-fold) reduction in Met binding Fig. 5. Thus, the elimination
of HGF α-chain binding contribution in this Met binding assay revealed that the reduced
migration activity of full length HGF mutants was due to an impaired binding interaction
of the HGF β-chain with the Met receptor.
Mutations in HGF result in reduction in growth stimulatory activity and enhanced inhibition
of HGF-dependent cell proliferation
[0186] As shown in Fig. 6A, mutants in HGF β chain are less active as activators of proliferation
in BxPC3 cells. The exemplary mutants in Fig. 6A reflect a wide spectrum of magnitudes
of reduction in growth stimulatory activity. Note that HGF WT activity at 25 ng/ml
was 83.6 ± 13.0 % (n = 12) of the activity at 100 ng/ml. % activity refers to the
amount of proliferation in the presence of HGF or HGF mutant (100 ng/ml or 25 ng/ml)
minus amount of proliferation in the absence of HGF). SD is the standard deviation
and n is the number of independent determinations.
[0187] Mutants in HGF β chain are also capable of acting as inhibitors of cell proliferation
in the presence of wild type HGF (Fig. 6B). In Fig. 6B, relative activity refers to
relative activity in proliferation assay. % Inhibition can be calculated in several
ways, two of which are shown in Fig. 6B. % activity I refers to the amount of proliferation
normalized to no HGF (0%) and 25 ng/ml HGF WT (100%). Thus HGF R695A or HGF R424A:494E
inhibit 79% or 63% of HGF-dependent cell proliferation activity, respectively. % activity
II refers to the amount of proliferation normalized to 5 µg/ml HGF R695A (0%) or HGF
R424:R494E (0%) and 25 ng/ml HGF WT (100%). Thus HGF R695A or HGF R424A:494E HGF inhibit
68% or 75% of HGF-dependent cell proliferation activity, respectively. Note that HGF
WT was at 25 ng/ml 2-chain HGF; 2-chain R695A and 1-chain R424A:494E were at 5 µg/ml.
Binding of HGF β chain to c-Met cannot be competed by single chain pro-HGF
[0188] Our data indicate that the HGF β chain binds to c-Met, and more specifically to the
Sema domain of c-Met. The HGF α chain also binds to c-Met and may also bind to the
Sema domain. We addressed whether the binding sites for these two chains might overlap
on c-Met. The results showed that single chain pro-HGF, having an intact α chain and
a zymogen-like β chain, does not compete with HGF β chain binding to c-Met-IgG at
the concentrations indicated in Fig. 9. However, two chain HGF, having an intact α
chain and an activated β chain, does compete with an IC
50 of 19 nM, supporting the conclusion that α and β chains bind at different sites on
c-Met (Fig. 9). A control experiment in a competition ELISA showed that the single
chain pro-HGF competed with biotinylated two chain HGF binding to c-Met-IgG with an
IC
50 value of 12 nM, similar to the IC
50 value of 6 nM for two chain HGF (data not shown).
DISCUSSION
[0189] HGF acquires biological activity upon proteolytic conversion of the single chain
precursor form into two-chain HGF (Naka et al., 1992; Hartmann et al., 1992; Lokker
et al., 1992; Naldini et al. 1992). Based on the structural similarity of HGF with
chymotrypsin-like serine proteases (Perona and Craik, 1995; Rawlings et al., 2002;
Donate et al., 1994) and plasminogen in particular, we hypothesize that this activation
process is associated with structural changes occurring in the HGF β-chain. Herein
is provided evidence that the 'activated' HGF β-chain, contains a distinct Met binding
site located in a region that corresponds to the substrate/inhibitor binding site
of chymotrypsin-like serine proteases.
HGF binding interactions to Met
[0190] Binding studies with purified HGF β-chains revealed that the 'activated' form of
HGF β (Val495-Ser728) binds to Met with ca. 14-fold higher affinity than its precursor
form, proHGF β (Asn479-Ser728), consistent with the view that optimization of the
Met binding site is contingent upon processing of single-chain HGF. This suggested
that the Met binding site includes the HGF region undergoing conformational rearrangements
after scHGF cleavage, i.e. the 'activation domain'. Indeed, functional analysis of
HGF variants with amino acid substitutions in the 'activation domain' led to the identification
of the functional Met binding site. However, HGF mutants with the greatest losses
in pro-migratory activities (Q534A, D578A, Y673A, V692A, P693A, G694A, R695A, G696A
and R702A) displayed essentially unchanged binding affinities for Met, except for
Y673A (4-fold loss), because HGF affinity is dominated by the HGF α-chain (Lokker
et al., 1994; Okigaki et al., 1992). Consistent with this, the reduced activities
remained unchanged upon increasing the concentration of HGF mutants by more than 50-fold
(Fig. 8). Therefore, the reduced activities of HGF mutants were interpreted as resulting
from perturbed molecular interactions of HGF β-chain with its specific, low affinity
binding site on Met. In support of this, we found that the reduced biological activities
of selected HGF mutants (2-chain full length) were well correlated with reduced Met
binding of the corresponding HGF β mutants in an assay that eliminated the binding
contribution of the HGF α-chain. For instance, the HGF β mutants R695A [c217], G696A
[c219] and Y673A [c195] had no measurable Met binding, correlating with greatly impaired
biological functions as full length mutants.
[0191] In agreement with the data for a relatively low affinity binding site for HGF β binding
to Met, surface plasmon resonance experiments with immobilized Met extracellular domain
showed that HGF β bound Met with a K
d of ca. 90 nM. The apparent affinity differences observed between K
d and IC
50 values are due to the different assays used, e.g. where the higher IC
50 values reflect the higher concentrations of HGF β necessary to compete with 250 nM
biotinylated HGF β for binding to Met.
[0192] The functional Met binding site is centered on 'catalytic triad residues' Gln534
[c57], Asp578 [c102], Tyr673 [c195] and the [c220]-loop (residues Val692, Gly694,
Arg695 and Gly696). All of our Ala substitutions would not require large changes of
main chain conformation except at Gly696. Here, phi/psi angles of 50°/146° and substitution
of non-Gly residue would cause conformational changes in the [c220]-loop, leading
to reduced activity of the G696A mutant. Together, these residues bear a remarkable
resemblance to the substrate-processing region of true serine proteases. This finding
agrees with an earlier study, which identified Y673 and V692 as important residues
for Met activation (Lokker et al., 1992). The normal activity measured for the HGF
variant Q534H in that study may reflect functional compensation of Gln by His, a relatively
close isostere.
[0193] The functional importance of the [c220]-loop has precedent in the well-described
family of chymotrypsin-like serine proteases (Perona and Craik, 1994; Hedstrom, 2002).
The extended canonical conformation of substrates and inhibitors includes residues
that can form main chain interactions from [c214-c218]. This region is also recognized
as an allosteric regulator of thrombin catalytic activity (Di Cera et al., 1995) and
as an interaction site with its inhibitor hirudin (Stubbs and Bode, 1993). In addition,
residues in Factor VIIa and thrombin that correspond to HGF R695 [c217] are important
for enzyme-catalyzed substrate processing (Tsiang et al., 1995; Dickinson et al.,
1996). Moreover, the corresponding residue in MSP, R683 [c217], plays a pivotal role
in the high affinity interaction of MSP β-chain with its receptor Ron (Danilkovitch
et al., 1999). MSP R683 [c217] is part of a cluster of five surface exposed arginine
residues proposed to be involved in high affinity binding to Ron (Miller and Leonard,
1998). Although only R695 [c217] and possibly K649 [c173] are conserved in HGF, these
residues are all located within the Met binding region of the HGF β-chain, leading
us to speculate that the Ron binding site on the MSP β-chain is highly homologous.
[0194] The results described herein with HGF Ala mutants agree with a previous study where
Tyr673 [c195] and Val692 [c214] were each replaced by serine (Lokker et al., 1991).
The normal biological activity measured for HGF variant Q534H [c57] in two previous
reports (Lokker et al., 1991; Matsumoto et al., 1991) may reflect functional compensation
of Gln by His, a relatively close isostere. However, our results contrast with previous
studies demonstrating that HGF β-chain itself neither binds to nor inhibits HGF binding
to Met (Hartmann et al., 1992; Matsumoto et al., 1998). In one instance, the HGF β-chain
was different from ours, having extra α-chain residues derived from elastase cleavage
of HGF, which could adversely affect Met binding. However, it is more likely that
either the concentrations used, the sensitivity of the assays or the extent of pro-HGF
processing may have been insufficient to observe binding to this low affinity site
(Matsumoto et al., 1998). HGF β-chain has been reported to bind to Met, although only
in the presence of NK4 fragment from the α-chain (Matsumoto et al., 1998).
Signaling Mechanisms
[0195] In principle, the existence of two Met binding sites - one high affinity and one
low affinity - in one HGF molecule could support a 2:1 model of a Met:HGF signaling
complex, analogous to the proposed 2:1 model of Ron:MSP (Miller and Leonard, 1998).
In the related MSP/Ron ligand/receptor system, individual α- and β-chains of MSP,
which are devoid of signaling activity, can bind to Ron and compete with full length
MSP for receptor binding (Danilkovitch et al., 1999). The same is true in the HGF/Met
system. However, biochemical studies have not identified any 2:1 complexes of Met:HGF
(Gherardi et al., 2003). In addition, this model of receptor activation requires some
as yet unknown molecular mechanism that would prevent one HGF molecule from simultaneously
binding to one Met receptor through its α-and β-chains.
[0196] Alternatively, the HGF β-chain might have critical functions in receptor activation
beyond those involved in direct interactions with Met that would favor a 2:2 complex
of HGF:Met. We found that proHGF β,, the single chain 'unactivated' form of the HGF
β-chain, bound more tightly to Met than several mutants in the 'activated' form of
HGF β, i.e. Y673A, V692A and R695A (e.g., Fig. 5). Importantly, all three corresponding
full length HGF mutants show measurable receptor phosphorylation and/or pro-migratory
activities, however proHGF does not, even at concentrations 1000-fold more than that
needed for activity by HGF. This significant distinction leads us to consider additional
functions of the HGF β-chain in receptor activation.
Conclusion
[0197] In conclusion, the results presented herein show that the β-chain of HGF contains
a hitherto unknown interaction site with Met, which is similar to the 'active site
region' of serine proteases. Thus HGF is bivalent, having a high affinity Met binding
site in the NK1 region of the α-chain. Other important interactions may occur between
two HGF β-chains, two HGF α-chains (Donate et al., 1994) and, as found with MSP/Ron
(Angeloni et al., 2004), between two Met Sema domains. Furthermore, heparin also plays
a key role in HGF/Met receptor binding. The identification of a distinct Met binding
site on the HGF β-chain provides a scientific and empirical rationale for the design
of new classes of Met inhibitors with therapeutic potential for diseases such as cancer.
PARTIAL LIST OF REFERENCES
[0198]
Angeloni, D., Danilkovitch-Miagkova, A., Miagkov, A., Leonard, E. J., and Lerman,
M. I. (2004). The soluble sema domain of the RON receptor inhibits MSP-induced receptor
activation. J. Biol. Chem., 279, 3726-3732.
Birchmeier, C., Birchmeier, W., Gherardi, E., and Vande Woude, G. F. (2003). Met,
metastasis, motility and more. Nature Rev. Mol. Cell Biol. 4, 915-925.
Boose, J. A., Kuismanen, E., Gerard, R., Sambrook, J., and Gething, M. J. (1989).
The single-chain form of tissue-type plasminogen activator has catalytic activity:
Studies with a mutant enzyme that lacks the cleavage site. Biochemistry 28, 638-643.
Bottaro, D. P., Rubin, J. S., Faletto, D. L., Chan, A. M., Kmiecik, T. E., Vande Woude,
G. F., and Aaronson, S. A. (1991). Identification of the hepatocyte growth factor
receptor as the c-met protooncogene product. Science 251, 802-804.
Broze Jr., G. J. (2001). Protein Z-dependent regulation of coagulation. Thromb. Haemost.
86, 8-13.
CCP4 (1994). The CCP4 suite: Programs for protein crystallography. Acta Crystallogr
D50, 760-763.
Chirgadze et al., FEBS Letters (1998), 430:126-129.
Cohen, G. H. (1997). Align - a program to superimpose protein coordinates, accounting
for insertions and deletions. J Appl. Crystallog. 30, 1160-1161.
Cooper, C. S., Blair, D. G., Oskarsson, M. K., Tainsky, M. A., Eader, L. A., and Vande
Woude, G. F. (1984a). Characterization of human transforming genes from chemically
transformed, teratocarcinoma, and pancreatic carcinoma cell lines. Cancer Res. 44,
1-10.
Cooper, C. S., Park, M., Blair, D. G., Tainsky, M. A., Huebner, K., Croce, C. M.,
and Vande Woude, G. F. (1984b). Molecular cloning of a new transforming gene from
a chemically transformed human cell line. Nature 311, 29-33.
Danilkovitch, A., Miller, M., and Leonard, E. J. (1999). Interaction of macrophage-stimulating
protein with its receptor. J. Biol. Chem. 274, 29937-29943.
Danilkovitch-Miagkova, A., and Zbar, B. (2002). Dysregulation of Met receptor tyrosine
kinase activity in invasive tumors. J. Clin. Invest. 109, 863-867.
Date et al., FEBS Lett. (1997), 420:1-6.
Dennis, M. S., Eigenbrot, C., Skelton, N. J., Ultsch, M. H., Santell, L., Dwyer, M.
A., O'Connell, M. P., and Lazarus, R. A. (2000). Peptide exosite inhibitors of factor
VIIa as anticoagulants. Nature 404, 465-470.
Derksen, P. W., Keehnen, R. M. J., Evers, L. M., van Oers, M. H. J., Spaargaren, M.,
and Pals, S. T. (2002). Cell surface proteoglycan syndecan-1 mediates hepatocyte growth
factor binding and promotes Met signalling in multiple myeloma. Blood 99, 1405-1410.
Di Cera, E., Guinto, E. R., Vindigni, A., Dang, Q. D., Ayala, Y. M., Wuyi, M., and
Tulinsky, A. (1995). The Na+ binding site of thrombin. J. Biol. Chem. 270, 22089-22092.
Dickinson, C. D., Kelly, C. R., and Ruf, W. (1996). Identification of surface residues
mediating tissue factor binding and catalytic function of the serine protease factor
VIIa. Proc. Natl. Acad. Sci. USA 93, 14379-14384.
Donate, L. E., Gherardi, E., Srinivasan, N., Sowdhamini, R., Aparicio, S., and Blundell,
T. L. (1994). Molecular evolution and domain structure of plasminogen-related growth
factors (HGF/SF and HGF1/MSP). Protein Sci. 3, 2378-2394.
Drain, J., Bishop, J. R., and Hajduk, S. L. (2001). Haptoglobin-related protein mediates
trypanosome lytic factor binding to Trypanosomes. J. Biol. Chem. 276, 30254-30260.
Gherardi, E., Youles, M. E., Miguel, R. N., Blundell, T. L., lamele, L., Gough, J.,
Bandyopadhyay, A., Hartmann, G., and Butler, P. J. (2003). Functional map and domain
structure of MET, the product of the c-met protooncogene and receptor for hepatocyte
growth factor/scatter factor. Proc. Natl. Acad. Sci. USA 100, 12039-12044.
Hartmann, G., Naldini, L., Weidner, K. M., Sachs, M., Vigna, E., Comoglio, P. M.,
and Birchmeier, W. (1992). A functional domain in the heavy chain of scatter factor/hepatocyte
growth factor binds the c-Met receptor and induces cell dissociation. Proc. Natl.
Acad. Sci. USA 89, 11574-11578.
Hartmann, G., Prospero, T., Brinkmann, V., Ozcelik, C., Winter, G., Hepple, J., Batley,
S., Bladt, F., Sachs, M., Birchmeier, C., et al. (1998). Engineered mutants of HGF/SF
with reduced binding to heparan sulphate proteoglycans, decreased clearance and enhanced
activity in vivo. Curr. Biol. 8, 125-134.
Hedstrom, L. (2002). Serine protease mechanism and specificity. Chem. Rev. 102, 4501-4523.
Huber, R., and Bode, W. (1978). Structural basis of the activation and action of trypsin.
Acc Chem. Res. 11, 114-122.
Kunkel, T. A. (1985) Proc. Natl. Acad. Sci USA 82, 488-492.
Kurosky, A., Barnett, D. R., Lee, T. H., Touchstone, B., Hay, R. E., Amott, M. S.,
Bowman, B. H., and Fitch, W. M. (1980). Covalent structure of human haptoglobin: a
serine protease homolog. Proc. Natl. Acad. Sci. USA 77, 3388-3392.
Lijnen, H. R., Van Hoef, B., Nelles, L., and Collen, D. (1990). Plasminogen activation
with single-chain urokinase-type plasminogen activator (scu-PA). Studies with active
site mutagenized plasminogen (Ser740 → Ala) and plasmin-resistant scu-PA (Lys158 →
Glu). J. Biol. Chem. 265, 5232-5236.
Lin, C.-Y., Anders, J., Johnson, M., Sang, Q. A., and Dickson, R. B. (1999). Molecular
cloning of cDNA for matriptase, a matrix-degrading serine protease with trypsin-like
activity. J. Biol. Chem. 274, 18231-18236.
Lokker, N. A., Mark, M. R., Luis, E. A., Bennett, G. L., Robbins, K. A., Baker, J.
B., and Godowski, P. J. (1992). Structure-function analysis of hepatocyte growth factor:
identification of variants that lack mitogenic activity yet retain high affinity receptor
binding. EMBO J. 11, 2503-2510.
Lokker, N. A., Presta, L. G., and Godowski, P. J. (1994). Mutational analysis and
molecular modeling of the N-terminal kringle-containing domain of hepatocyte growth
factor identifies amino acid side chains important for interaction with the c-Met
receptor. Protein Eng. 7, 895-903.
Ma, P. C., Maulik, G., Christensen, J., and Salgia, R. (2003). c-Met: structure, functions
and potential for therapeutic inhibition. Cancer Metastasis Rev. 22, 309-325.
Malkowski, M. G., Martin, P. D., Guzik, J. C., and Edwards, B. F. P. (1997). The co-crystal
structure of unliganded bovine α-thrombin and prethrombin-2: movement of the Tyr-Pro-Pro-Trp
segment and active site residues upon ligand binding. Protein Sci. 6, 1438-1448.
Mark, M. R., Lokker, N. A., Zioncheck, T. F., Luis, E. A., and Godowski, P. J. (1992).
Expression and characterization of hepatocyte growth factor receptor-IgG fusion proteins.
Effects of mutations in the potential proteolytic cleavage site on processing and
ligand binding. J. Biol. Chem. 267, 26166-26171.
Matsumoto, K., Takehara, T., Inoue, H., Hagiya, M., Shimizu, S., and Nakamura, T.
(1991). Biochem. Biophys. Res. Commun. 181, 691-699.
Matsumoto, K., Kataoka, H., Date, K., and Nakamura, T. (1998). Cooperative interaction
between α- and β-chains of hepatocyte growth factor on c-Met receptor confers ligand-induced
receptor tyrosine phosphorylation and multiple biological responses. J. Biol. Chem.
273, 22913-22920.
Maulik, G., Shrikhande, A., Kijima, T., Ma, P. C., Morrison, P. T., and Salgia, R.
(2002). Role of the hepatocyte growth factor receptor, c-Met, in oncogenesis and potential
for therapeutic inhibition. Cytokine Growth Factor Rev. 13, 41-59.
Miller, M., and Leonard, E. J. (1998). Mode of receptor binding and activation by
plasminogen-related growth factors. FEBS Lett. 429, 1-3.
Miyazawa, K., Shimomura, T., Kitamura, A., Kondo, J., Morimoto, Y., and Kitamura,
N. (1993). Molecular cloning and sequence analysis of the cDNA for a human serine
protease responsible for activation of hepatocyte growth factor. J. Biol. Chem. 268,
10024-10028.
Naka, D., Ishii, T., Yoshiyama, Y., Miyazawa, K., Hara, H., Hishida, T., and Kitamura,
N. (1992). Activation of hepatocyte growth factor by proteolytic conversion of single
chain form to a heterodimer. J. Biol. Chem. 267, 20114-20119.
Nakamura, T., Nishizawa, T., Hagiya, M., Seki, T., Shimonishi, M., Sugimura, A., Tashiro,
K., and Shimizu, S. (1989). Molecular cloning and expression of human hepatocyte growth
factor. Nature 342, 440-443.
Naldini, L., Tamagnone, L., Vigna, E., Sachs, M., Hartmann, G., Birchmeier, W., Daikuhara,
Y., Tsubouchi, H., Blasi, F., and Comoglio, P. M. (1992). Extracellular proteolytic
cleavage by urokinase is required for activation of hepatocyte growth factor/scatter
factor. EMBO J. 11, 4825-4833.
Okigaki, M., Komada, M., Uehara, Y., Miyazawa, K., and Kitamura, N. (1992). Functional
characterization of human hepatocyte growth factor mutants obtained by deletion of
structural domains. Biochemistry 31, 9555-9561.
Parry, M. A., Fernandez-Catalan, C., Bergner, A., Huber, R., Hopfner, K. P., Schlott,
B., Guhrs, K. H., and Bode, W. (1998). The ternary microplasmin-staphylokinase-microplasmin
complex is a proteinase-cofactor-substrate complex in action. Nat. Struct. Biol. 5,
917-923.
Peek, M., Moran, P., Mendoza, N., Wickramasinghe, D., and Kirchhofer, D. (2002). Unusual
proteolytic activation of pro-hepatocyte growth factor by plasma kallikrein and coagulation
factor XIa. J. Biol. Chem. 277, 47804-47809.
Peisach, E., Wang, J., de los Santos, T., Reich, E., and Ringe, D. (1999). Crystal
structure of the proenzyme domain of plasminogen. Biochemistry 38,11180-11188.
Perona, J. J., and Craik, C. S. (1995). Structural basis of substrate specificity
in the serine proteases. Protein Sci. 4, 337-360.
Rawlings, N. D., O'Brien, E., and Barrett, A. J. (2002). MEROPS: the protease database.
Nucl. Acid Res. 30, 343-346.
Renatus, M., Engh, R. A., Stubbs, M. T., Huber, R., Fischer, S., Kohnert, U., and
W., B. (1997). Lysine 156 promotes the anomalous proenzyme activity of tPA: X-ray
crystal structure of single-chain human tPA. EMBO J. 16, 4797-4805.
Richardson, J. L., Kroger, B., Hoeffken, W., Sadler, J. E., Pereira, P., Huber, R.,
Bode, W., and Fuentes-Prior, P. (2000). Crystal structure of the human α-thrombin-haemadin
complex: an exosite II-binding inhibitor. EMBO J. 19, 5650-5660.
Shimomura, T., Miyazawa, K., Komiyama, Y., Hiraoka, H., Naka, D., Morimoto, Y., and
Kitamura, N. (1995). Activation of hepatocyte growth factor by two homologous proteases,
blood-coagulation factor XIIa and hepatocyte growth factor activator. Eur J Biochem
229, 257-261.
Stubbs, M., and Bode, W. (1993). A player of many parts: The spotlight falls on thrombin's
structure. Thromb. Res. 69, 1-58.
Takeuchi, T., Shuman, M. A., and Craik, C. S. (1999). Reverse biochemistry: use of
macromolecular protease inhibitors to dissect complex biological processes and identify
a membrane-type serine protease in epithelial cancer and normal tissue. Proc Natl
Acad Sci USA 96, 11054-11061.
Trusolino et al., FASEB J. (1998), 12:1267-1280.
Trusolino, L., and Comoglio, P. M. (2002). Scatter-factor and semaphorin receptors:
cell signalling for invasive growth. Nature Rev. Cancer 2, 289-300.
Tsiang, M., Jain, A. K., Dunn, K. E., Rojas, M. E., Leung, L. L. K., and Gibbs, C.
S. (1995). Functional mapping of the surface residues of human thombin. J. Biol. Chem.
270, 16854-16863.
Vijayalakshmi, J., Padmanabhan, K. P., Mann, K. G., and Tulinsky, A. (1994). The isomorphous
structures of prethrombin2, hirugen-, and PPACK-thrombin: changes accompanying activation
and exosite binding to thrombin. Protein Sci. 3, 2254-2271.
Wang, D., Bode, W., and Huber. R (1985). Bovine chymotrypsinogen A: x-ray crystal
structure analysis and refinement of a new crystal form at 1.8Å resolution. J. Mol.
Biol. 185, 595-624.
Wang, D., Julian, F. M., Breathnach, R., Godowski, P. J., Takehara, T., Yoshikawa,
W., Hagiya, M., and Leonard, E. J. (1997). Macrophage stimulating protein (MSP) binds
to its receptor via the MSP β chain. J. Biol. Chem. 272, 16999-17004.