SAFE MUTANT VIRAL VACCINES

Description

Field Of The Invention

[0001] The present invention relates generally to vaccines suitable for administration to animals against viral infections. More specifically, the present invention relates to safe vaccines and methods of preparing such vaccines. The vaccines of the present invention contain at least two live mutant viruses of the same family or nucleic acid molecules encoding such viruses, wherein each of the viruses or the encoding nucleic acids contains a mutation that confers a desirable phenotype and the mutations In the viruses reside in the same genomic site such that the mutant viruses cannot recombine with each other to eliminate the mutations. Specifically, two of the live mutant viruses consist of Bovine Viral Diarrhea Viruses (BVDV).

Background Of The Invention

[0002] The virus family Flaviviridea consists of the genera Pestivirus, Flavivirus and Hepacivirus. The genus Pestivirus is represented by the species Bovine viral diarrhea virus 1 (BVDVs-1), BVDV-2, classical swine fever virus, and Border disease virus. The virions of the family members encapsulate positive-strand RNA genomes of about 9.5 to 12.3 kb. The genomic RNAs contain contiguous long open reading frames (ORFs), which are translated into polyproteins that are processed by cellular and viral proteases to give rise to the mature viral proteins. For members of Pestivirus, the ORF encodes a polyprotein of about 3900 amino acids, which is cotranslationally and posttranslationally processed to the following mature viral proteins (from 5' to 3'): N^pro, C, E^rns, E1, E2, NS2-3, NS4A, NS4B, NS5A, and NS5B.

[0003] Two blotypes are found among some members of Pestivirus based on their effect on tissue culture cells, namely cytopathogenic (cytopathic or cp) and noncytopathogenic (noncytopathic or ncp). Genome analyses revealed insertions of cellular sequences, sometimes accompanied by duplication of viral sequences, genomic rearrangements, and/or deletions of viral sequences in the genomes of cp pestiviruses, but not in the RNAs of the corresponding ncp pestiviruses. This suggests that cp pestiviruses are evolved from ncp pestiviruses by RNA recombination.

[0004] BVDV is a widely distributed pathogen of cattle. BVDV-1 usually produces only mild diarrhea in immunocompetent animals, whereas BVDV-2 can produce thrombocytopenia, hemorrhages and acute fatal disease. BVDV is capable of crossing the placenta of pregnant cattle and may result in the birth of persistently infected (PI) calves (Malmquist, J. Am. Vet. Med. Assoc. 152:763-768 (1968); Ross, et al., J. Am. Vet. Med. Assoc. 188:618-619 (1986)). Viremic calves are Immunotolerant to the virus and persistently viremic for the rest of their lives. They provide a source for outbreaks of mucosal disease (Liess, et al., Dtsch. Tieraerztl. Wschr. 81:481-487 (1974)) and are highly predisposed to infection with microorganisms causing diseases such as pneumonia or enteric disease (Barber, et al., Vet. Rec. 117:459-464 (1985)). Viruses of either genotype may exist as one of the two biotypes, cp or ncp. The cp phenotype correlates with the expression of NS3, since cells infected with either cp or ncp BVDV both express NS2-3, whereas NS3 is detected only after infection with cp BVDV. NS3 is colinear to the C-terminal part of NS2-3. The expression of NS3 appears to be a result of genomic alterations observed for cp BVDV.

[0005] Presently available viral vaccines include killed or attenuated live viral vaccines, live-vectored vaccines, subunit vaccines, and DNA or RNA vaccines. See Roth et al., "New Technology For Improved Vaccine Safety And Efficacy", Veterinary Clinics North America: Food Animal Practice 17(3): 585-597 (2001). Attenuation of viruses can be achieved by UV irradiation, chemical treatment, or high serial passage in vitro. The number, position and nature of mutations induced by these methods are unknown absent genomic sequence analyses. Attenuation can also be achieved by making defined genetic alterations, for example, specific deletion of viral sequences known to confer virulence, or insertion of sequences into the viral genome. One concern with respect to the use of attenuated live viral vaccines is that attenuated mutant viruses have the potential to recombine in vivo to eliminate the attenuating mutation(s) thereby restoring virulence. For example, in the presence of a virulent (wild type) field strain, attenuated viruses having deletions in the viral genome have the potential to recombine with the virulent strain to restore the deleted sequence. See, e.g., Roth et al., supra. Cytopathic pestiviruses having cellular insertions have also been observed to give rise to noncytopathic viruses in cell culture by deletion of the cellular sequences, possibly through RNA recombination. See, e.g., Baroth et al., "Insertion of cellular NEDD8 coding sequences in a pestivirus", Virology. 278(2): 456-66, (2000), and Becher et al., "RNA recombination between persisting pestivirus and a vaccine strain: generation of cytopathogenic virus and induction of lethal disease", Journal of Virology 75(14): 6256-64 (2001). Where it is desired to include two attenuated mutant viruses from the same species, genus or family in a vaccine composition, there is a concern that the two viruses may recombine in the vaccinated animal thereby eliminating the attenuating mutations. See, e.g., Glazenburg et al., "Genetic recombination of pseudorabies virus: evidence that homologous recombination between insert sequences is less frequent than between autologous sequences", Archives of Virology, 140(4): 671-85 (1995).

[0006] There remains a need to develop safe and effective vaccines that protect animals against viral infections.

Summary Of The Invention

[0007] The present invention provides safe vaccines which contain at least two live mutant viruses of the same family or nucleic acid molecules encoding such viruses, wherein each virus or the encoding nucleic acid contains a mutation that confers a desirable phenotype, and the mutations In the viruses reside in the same genomic site such that the mutant viruses cannot recombine with each other to eliminate the mutations. Specifically, two of the live mutant viruses consist of Bovine Viral Diarrhea Viruses (BVDV).

[0008] The present invention also provides a method of preparing a safe viral vaccine by selecting or constructing two or more live mutant viruses of the same family, genus or species, wherein each virus contains a mutation that confers a desirable phenotype, and the mutations in the viruses reside in the same genomic site such that the mutant viruses can not undergo homologous recombination to eliminate the mutations. Specifically, two of the live mutant viruses consist of Bovine Viral Diarrhea Viruses (BVDV).

[0009] The present invention further provides a method of protecting an animal against viral infections by administering to the animal a vaccine composition of the present invention.

Brief Description Of The Drawings

[0010] Figure 1. Alignment of the cellular insertions and flanking viral sequences from the NS2-3 regions of BVDV-1 strain NADL and BVDV-2 strain 53637.

Detailed Description Of The Invention

[0011] It has been uniquely recognized in accordance with the present invention that live mutant viruses of the same family, which contain mutations at the same genomic site of the viruses, cannot recombine with one another to eliminate the mutations.

[0012] Accordingly, In one embodiment, the present invention provides safe vaccine compositions containing at least two, i.e., two or more, live mutant viruses of the same family, or nucleic acid molecules encoding such viruses, wherein the mutations In the viruses reside in the same genomic site such that the mutant viruses cannot recombine with each other to eliminate the mutations. Specifically, two of the live mutant viruses consist of Bovine Viral Diarrhea Viruses (BVDV).

[0013] In another embodiment, the present invention provides a method of preparing a safe viral vaccine, as described hereinabove. Specifically, a safe vaccine is prepared by selecting or constructing two or more live mutant viruses of the same family, genus or species, wherein each virus contains a mutation that confers a desirable phenotype (for example attenuation of virulence, alteration of cellular tropism or biotype, alteration of species tropism, or expression of a foreign gene cassette), and the mutations in the viruses reside in the same genomic site such that the mutant viruses can not undergo homologous recombination with each other to eliminate the mutations. Specifically, two of the live mutant viruses consist of Bovine Viral Diarrhea Viruses (BVDV).

[0014] The term "vaccine" or "vaccine composition" refers to a composition containing live mutant viruses which, upon Inoculation into an animal, Induces a complete or partial immunity to the pathogenic version of the viruses, or alleviates the symptoms of diseases caused by the pathogenic versions of the viruses. The protective effects of a vaccine composition against a virus are normally achieved by inducing in the subject an immune response, either a cell-mediated or a humoral immune response, or a combination of both. Generally speaking, abolished or reduced Incidences of viral infection, amelioration of the symptoms, or accelerated elimination of the viruses from the infected subjects, are indicative of the protective effects of the vaccine composition.

[0015] By "animal" is meant to include birds, for example, chickens, turkeys, domestic waterfowl, and any mammal, for example, cattle, sheep, swine, goats, dogs, cats, and horses.

[0016] The term "viruses", "viral isolates" or "viral strains" as used herein refer to viral particles or virions that contain viral genomic DNA or RNA, associated proteins, and other chemical constituents (such as lipids).

[0017] By "nucleic acid molecule encoding a virus" or "nucleic acid molecule of a virus" is meant the genomic nucleic acid molecule of the virus, either in the form of RNA or DNA.

[0018] By "mutation" is meant to include deletion, insertion or substitution of one or more nucleotides, or a combination thereof. In accordance with the present invention, the mutation preferably confers a desirable phenotype, for example attenuation of virulence, alteration of cellular tropism or biotype, alteration of species tropism, or expression of a foreign gene cassette. Especially preferred mutations are mutations that confer attenuated virulence.

[0019] By "attenuation" is meant that the virus has lost some or all of its ability to proliferate and/or cause disease in an animal infected with the virus. For example, an attenuated virus can be a virus that is unable to replicate at all or is limited to one or a few rounds of replication, or restricted in cell or tissue tropism, when present in an animal in which a wild type pathogenic version of the attenuated virus can replicate.

[0020] An attenuated virus may have one or more mutations in a gene or genes that are involved in pathogenicity of the virus. Such mutations are also referred to herein as "attenuating mutation(s)". An attenuated virus can be produced from the wild type, pathogenic virus by UV irradiation, chemical treatment, or high serial passage of the wild type, pathogenic virus in vitro. Alternatively, an attenuated virus can be produced from the wild type, pathogenic virus by making specific deletion of viral sequences known to confer virulence, insertion of sequences into the viral genome, or making one or more point mutations in the viral genome. An attenuated virus can be a viral isolate obtained from an animal, which isolate is derived from the wild type, pathogenic version of the virus through events other than artificial means, e.g., events that have occurred in a host animal such as recombination.

[0021] The two or more live mutant viruses present in the vaccine compositions of the present invention contain mutations that reside in the same genomic site. By "same genomic site" is meant that when the genomic nucleotide sequences of the viruses are aligned, the mutations in the viral genomes overlap with one another such that there is no opportunity for homologous recombination between and among the viral genomes to eliminate the mutations. In other words, when the genomic nucleotide sequences of the viruses are aligned, there is at least one contiguous portion of the aligned sequences where the sequences In the aligned viral genomes are mutant sequences. There are a number of computer programs that compare and align nucleic acid sequences which one skilled in the art may use. The sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in a nucleic acid sequence for optimal alignment with a second nucleic add sequence). For example, the NBLAST and XBLAST programs as described in Altschul, et al., 1990, J. Mol. Biol. 215:403-410, the Gapped BLAST program as described in Altschul et al., 1997, Nucleic Acids Res. 25:3389-3402, and the PSI-Blast program as described in Altschul et al., 1997, supra. When utilizing BLAST, Gapped BLAST, and PSI-Blast programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used (see http://www.ncbi.nim.nih.gov).

[0022] Generally speaking, the concept of the present invention, i.e., including in the same vaccine composition two or more live mutant viruses of the same family having mutations at the same genomic site, applies to mutant viruses from any family where the viral genomes have sufficient sequence identity to permit homologous recombination. It has been shown that a nucleotide identity as short as 15 nucleotides can lead to efficient homologous recombination (Nagy and Bujarski. J. Virol. 69:131-140, 1995).

[0023] The vaccine composition of the present invention contains two or more live mutant viruses from the Pestivirus genus, specifically BVDV. The genus Pestivirus is represented by the species Bovine Viral Diarrhea Virus Type 1 (BVDV-1), Bovine Viral Diarrhea Virus Type 2 (BVDV-2), classical swine fever virus, and Border disease virus. The ORF encodes a polyprotein of about 3900 amino acids, which is co-translationally and posttranslationally processed to the following mature viral proteins (from 5' to 3'): N^pro, C, E^rns, E1, E2, NS2-3, NS4A, NS4B, NS5A, and NS5B.

[0024] Ordinarily, BVDV has a genome In the form of RNA. RNA can be reverse-transcribed into DNA for use in cloning. Thus, references made herein to nucleic acid and BVD viral sequences encompass both viral RNA sequences and DNA sequences derived from the viral RNA sequences. For convenience, genomic sequences of BVDV as depicted in the SEQUENCE LISTING hereinbelow only refer to the DNA sequences. The corresponding RNA sequence for each is readily apparent to those of skill In the art.

[0025] In a more preferred embodiment, the vaccine composition of the present invention contains a cytopathic BVDV-1 and a cytopathic BVDV-2, wherein the mutations in both viruses associated with the cytopathic biotype reside in the same genomic site such that the two mutant viruses cannot recombine to eliminate the mutations.

[0026] BVDV-1 and BVDV-2 represent two closely related genotypes of BVDV. The nucleotide sequences of the two viruses share about 70% identity over the entire genome, and slightly higher percent identity within the NS2-3 region. It is believed that the percent identity between the viral genomes of BVDV-1 and BVDV-2, at least in the NS2-3 region, is sufficient to permit homologous recombination.

[0027] BVDV-1 usually produce only mild diarrhea in animals, whereas BVDV-2 are viruses with high virulence which can produce thrombocytopenia, hemorrhages and acute fatal disease (Corapi et al., J. Virol. 63: 3934-3943; Bolin et al., Am. J. Vet. Res. 53: 2157-2163; Pellerin et al., Virology 203: 260-268, 1994; Ridpath et al., Virology 205: 66-74, 1994; Carman et al., J. Vet. Diagn. Invest. 10: 27-35, 1998). The two types of viruses have distinct antigenicity determined by a panel of MAbs and by cross-neutralization using virus-specific antisera raised in animals (Corapi et al., Am. J. Vet. Res. 51: 1388-1394, 1990). Viruses of either genotype may exist as one of the two biotypes, cytopathogenic (cytopathic or cp) or noncytopathogenic (noncytopathic or ncp). Cp viruses induce cytopathic effects (e.g., cell lysis) on cultured cells, while noncytopathic viruses do not.

[0028] It is desirable to prepare vaccines that provide protection against both BVDV-1 and BVDV-2. However, because of the high degree of sequence identity between the two viruses, there is a possibility that a live cytopathic BVDV-1 and a live cytopathic BVDV-2 included in the same vaccine composition, could recombine with each other in the vaccinated animal to yield noncytopathic viruses. Recombination between BVDV-1 and BVDV-2 has been documented. See, e.g., Ridpath et al., Virology 212: 259-262 (1995). Infection of the fetus in pregnant cattle with ncp viruses before immunocompetence develops can result in the fetus remaining viremic through the period of gestation and the subsequent birth of a calf that remains persistently viremic. Such a calf can die of mucosal disease upon superinfection with a cp BVDV. Accordingly, the vaccine compositions provided by the present invention, which contain live cp BVDV-1 and live cp BVDV-2 having mutations at the same genomic site, are especially desirable for protecting animals against both BVDV-1 and BVDV-2.

[0029] In one embodiment, BVDV cp isolates obtained from animals can be used in the vaccine composition of the present invention. Cp isolates of both BVDV-1 and BVDV-2 have been reported and are available to those skilled in the art, e.g., BVDV-1 NADL (ATCC# VR1422 or VR-534), BVDV-2 53637 strain (deposited with the ATCC as PTA-4859), and type 2 field isolates such as those described by Ridpath and Neill, J. Virol 74:8771-8774, (2000). Cp isolates reported so far typically contain an insertion of a heterologous sequence, e.g., an ubiquitin coding sequence (Genbank accession number M96687 or De Moerlooze et al., J. Gen. Virol. 74:1433-1438, (1993)), a bovine NEDD8 coding sequence (Baroth et al., supra), or a Bos taurus DnaJ1 coding sequence (as described in the Examples hereinbelow), among others.

[0030] In another embodiment, a cp BVDV is generated by making defined alterations in the BVDV genome, e.g., by deleting specific viral sequences, inserting sequences into a specific viral genomic site, or making one or more substitutions, or combinations thereof.

[0031] Where a cp BVDV is generated by inserting a heterologous (i.e., foreign to the virus) sequence into a specific genomic site, the nature of the sequence to be inserted is generally not critical to the present invention. In addition, the insertion is not limited to any particular site so long as the insertion results in an attenuated phenotype. As heterologous sequences in cp isolates are often found in the NS2-3 region, the NS2-3 region, especially the part surrounding the putative NS2-3 cleavage site which corresponds to, e.g., amino acid residues # 1679 to #1680 of the BVDV-1 NADL strain (the numbering is based on the published genomic sequence Genbank accession No. M31182, SEQ ID NO: 4), is a preferred location for insertions.

[0032] An cp BVDV-1 can be generated by making a defined genomic alteration that mimics the mutation identified in a cp BVDV-2 isolate obtained from an animal, such that these viruses have mutations associated with the cp biotype in the same genomic site. Similarly, a cp BVDV-2 can be generated by way of making a defined genomic alteration that mimics the mutation identified in a cp BVDV-1 isolate obtained from an animal.

[0033] In a preferred embodiment, the vaccine composition of the present invention contains NADL (a cp BVDV-1 isolate), and BVDV-2 53637 (a cp BVDV-2 isolate), where the two cp isolates each contain a mutation at the same genomic site which results in the cytopathic biotype. The genomic sequence of the BVDV-1 NADL strain is set forth in SEQ ID NO: 4, and the BVDV-2 53637 strain was deposited with the ATCC as PTA-4859. Both isolates contain an insertion in the NS2-3 region. The attenuated cp BVDV-1 contains an insertion of a Bos taurus DnaJ1 coding sequence 3' of the thymidine at nucleotide position # 4993 (NADL sequence numbering), which is the third nucleotide of the codon encoding the glycine residue at amino acid position 1536. The attenuated cp BVDV-2 contains an insertion of a Bos taurus DnaJ1 coding sequence at the same genomic site.

[0034] According to the present invention, the cp BVDV isolates employed in the present vaccine composition have been attenuated and are therefore nonpathogenic. Methods of attenuation are known to those skilled in the art and are also described hereinbelow.

[0035] In another embodiment, the vaccine composition of the present invention contains an attenuated BVDV-1 and an attenuated BVDV-2, wherein the attenuating mutations in both viruses reside in the same genomic site such that the two mutant viruses cannot recombine to eliminate the attenuating mutations.

[0036] An attenuated BVDV is generated by UV irradiation, chemical treatment, or high serial passage of the pathogenic version of the viruse in vitro. Sequence analysis can be conducted in order to determine the nature and genomic location of mutations generated by these methods. The mutation can be in the form of a deletion, insertion or substitution of one or more nucleotides, or a combination thereof. Alternatively, an attenuated BVDV is generated by making defined alterations in the BVDV genome, e.g., by deleting specific viral sequences, inserting sequences into a specific viral genomic site, or making one or more substitutions, or combinations thereof.

[0037] As described above, the live mutant viruses for use in the vaccine composition of the present invention can be from the same family, genus or species, where the viral genomes have sufficient sequence identity to permit homologous recombination. Additional examples of combinations of viruses appropriate for use in the vaccine composition of the present invention Include, but are not limited to, combinations of different types of pollovirus, combinations of multiple live mutant strains of infectious bronchitis virus, combinations of multiple live mutant strains of Newcastle disease virus, combinations of Canine adenovirus - 1 and canine adenovirus-2, combinations of equine herpesvirus-1 and equine herpesvirus-4, combinations of multiple live mutant strains of influenza virus, combinations of multiple live attenuated strains of Feline calicivirus, combinations of multiple serotypes of Rotavirus, combinations of multiple serotypes of Rhinovirus, combinations of multiple serotypes of Foot and Mouth Disease virus, combinations of the European and North American genotypes of Porcine reproductive and respiratory syndrome virus, combinations of standard and variant strains of infectious bursal disease virus.

[0038] In accordance with the present invention, although viral particles are the preferred form for use in the vaccines, nucleic add molecules encoding mutant viruses of the same family, genus or species, can be used directly in vaccines as well. The DNA or RNA molecule can be present in a "naked' form or it can be combined with an agent which facilitates cellular uptake (e.g., liposomes or cationic lipids). Vaccines and vaccination procedures that utilize nucleic acids (DNA or mRNA) have been well described in the art, e.g., U.S. Patent No. 5,703,055, U.S. Patent No. 5,580,859, U.S. Patent No. 5,589,466, international Patent Publication WO 98/35562, and by Ramsay et al., 1997, Immunol. Cell Biol. 75:360-363; Davis, 1997, Cur. Opinion Biotech. 8: 635-640; Manickan et al., 1997, Critical Rev. Immunol. 17: 139-154; Robinson, 1997, Vaccine 15(8): 785-787; Robinson et al., 1996, AIDS Res. Hum. Retr. 12(5): 455-457; Lal and Bennett, 1998, Critical Rev. Immunol. 18:449-484; and Vogel and Sarver, 1995, Clin. Microbiol. Rev. 8(3): 406-410, all of which are incorporated herein by reference.

[0039] In addition to two or more live mutant viruses from the same family, genus or species (specifically BVDV), the vaccine compositions can include other antigenic component. Other antigenic components appropriate for use in accordance with the present invention Include, but are not limited to, antigens prepared from pathogenic bacteria such as Mycoplasma hyopneumonia, Haemophilus somnus, Haemophilus parasuls, Bordetella bronchiseptica, Bacillus anthracis, Actinobacillus pleuropneumonie, Pasteurella multocida, Mannhemia haemolytica, Mycoplasma bovis, Mycoplasma galanacieum, Mycoplasma gallisepticum, Mycobacterium bovis, Mycobacterium paratuberculosis, Clostridial spp., Streptococcus uberis, Streptococcus suis, Staphylococcus aureus, Erysipelothrix rhusopathiae, Campylobacter spp., Fusobacterium necrophorum, Escherichia coli, Lawsonia intracellularis, Listeria monocytogenes, Rickettsia rickettsii, Borrelia spp., Ehrlichia spp., Chlamydia spp., Brucella spp., Vibrio spp., Salmonella enterica serovars, Leptospira spp.; pathogenic fungi such as Candida; protozoa such as Cryptosporidium parvum, Neospora canium, Toxoplasma gondii, Eimeria spp., Babesia spp., Giardia spp.; helminths such as Ostertagia, Cooperia, Haemonchus, Fasciola; either in the form of an inactivated whole or partial cell preparation, or in the form of antigenic molecules obtained by genetic engineering techniques or chemical synthesis. Additional antigens include pathogenic viruses such as Marek's disease virus, infectious bursal disease virus, Newcastle's disease virus, chicken anemia virus, fowlpox virus, avian leukosis virus, infectious laryngotracheitis virus, reticuloendothelial virus, canine parvovirus, canine distemper virus, canine herpesvirus, canine coronavirus, canine parainfluenza-5, feline panleukopenia virus, feline herpes virus, feline calicivirus, feline immunodeficiency virus, feline infectious peritonitis virus, equine herpesvirus, equine arteritis virus, equine infectious anemia virus, Eastern equine encephalitis virus, Western equine encephalitis virus, Venezuelan equine encephalitis virus, West Nile virus, transmissible gastroenteritis virus, bovine coronavirus, Bovine herpesviruses-1,3,6, Bovine parainfluenza virus, Bovine respiratory syncytial virus, bovine leukosis virus, rinderpest virus, foot and mouth disease virus, rabies virus, African swine fever virus, Porcine parvovirus, PRRS virus, Porcine circovirus, influenza virus, swine vesicular disease virus, Techen fever virus, Pseudorabies virus, either in the form of modified live (attenuated) viral preparation, an inactivated whole or partial virus preparation, or in the form of antigenic molecules obtained by genetic engineering techniques or chemical synthesis. When additional attenuated live viruses are used, such additional viruses should preferably be from a family different from that of the two principal attenuated viruses, as described above.

[0040] In a preferred embodiment, the present invention provides a vaccine composition which contains an attenuated cp BVDV-1 derived from the BVDV-1 NADL strain, an attenuated cp BVDV-2 derived from the BVDV-2 53637 strain, where the two cp isolates each contain a mutation associated with the cp biotype at the same genomic site, and at least one (i.e., one or more) of the following antigenic component, either in inactivated or modified live form: bovine herpesvirus-1, bovine respiratory syncytial virus, parainfluenza virus-3, Campylobacter fetus, Leptospira canicola, Leptospira grippotyphosa, Leptospira hardjo, Leptospira icterohaemorrhagiae, Leptospira pomona, or Mannhemia haemolytica.

[0041] In addition, the vaccine compositions of the present invention can include one or more veterinarily-acceptable carriers. As used herein, "a veterinarily-acceptable carrier" includes any and all solvents, dispersion media, coatings, adjuvants, stabilizing agents, diluents, preservatives, antibacterial and antifungal agents, isotonic agents, adsorption delaying agents, and the like. Diluents can include water, saline, dextrose, ethanol, glycerol, and the like. Isotonic agents can include sodium chloride, dextrose, mannitol, sorbitol, and lactose, among others. Stabilizers include albumin, among others. The vaccine compositions can further include one or more other immunomodulatory agents such as, e.g., interleukins, interferons, or other cytokines

[0042] Adjuvants suitable for use in the vaccine compositions include, but are not limited to, the RIBI adjuvant system (Ribi inc.), alum, aluminum hydroxide gel, oil-in water emulsions, water-in-oll emulsions such as, e.g., Freund's complete and incomplete adjuvants, Block co polymer (CytRx, Atlanta GA), SAF-M (Chiron, Emeryville CA), AMPHIGEN® adjuvant, saponin, Quil A, cholesterol, QS-21 (Cambridge Biotech Inc., Cambridge MA), or other saponin fractions, monophosphoryl lipid A, Avridine lipid-amine adjuvant, heat-labile enterotoxin from E. coli (recombinant or otherwise), cholera toxin, or muramyl dipeptide, among many others.

[0043] Typically, a live mutant virus is present in a vaccine at an amount of about 1 x 10⁶ and about 1 x 10⁸ virus particles per dose, with a veterinarily acceptable carrier, in a volume of between about 0.5 and about 5 ml. The precise amount of a virus in a vaccine composition effective to provide a protective effect can be determined by a skilled veterinarian. Where the DNA or RNA molecule of the virus is used in the vaccine, the amount of the nucleic acids should generally be between about 0.1 µg/ml and about 5.0 mg/ml.

[0044] The vaccine compositions of the present invention can be made in various forms depending upon the route of administration. For example, the vaccine compositions can be made in the form of sterile aqueous solutions or dispersions suitable for injectable use, or made in lyophilized forms using freeze-drying techniques. Lyophilized compositions are typically maintained at about 4°C, and can be reconstituted in a stabilizing solution, e.g., saline or and HEPES, with or without adjuvant

[0045] The vaccine compositions of the present invention can be administered to an animal for treating or preventing a disease caused by the pathogenic versions of the viruses in the vaccine compositions. Therefore, methods of vaccinating an animal against a disease caused by a virus are also dercribed.

[0046] In practicing the present methods, a vaccine composition of the present invention is administered to an animal preferably via parenteral routes, although other routes of administration can be used as well, such as e.g., by oral, intranasal, intramuscular, intra-lymph node, intradermal, intraperitoneal, subcutaneous, rectal or vaginal administration, or by a combination of routes. Boosting regimens may be required and the dosage regimen can be adjusted to provide optimal vaccination.

[0047] The present invention is further illustrated by, but by no means limited to, the following examples.

EXAMPLE I

Determination Of The Position Of The Cellular Insertion In BVDV2 Strain 53637

[0048] A portion of the sequence of the NS2-3 region from BVDV2-53637 was determined, in order to identify and map the location of any cellular insertions in the region. A 670 base RT-PCR product was amplified from viral RNA, using forward primer 53637U1 (5'-CGTCCACAGATGGTTTGGT-3'; SEQ ID NO: 1) and reverse primer 53637L (5'-GGCTATGTATTGGACGTAACCC-3'; SEQ ID NO: 2). The RT-PCR product was purified and submitted for sequence analysis (SEQ ID NO: 3). When aligned with BVDV1-NADL (Genbank accession number M31182, SEQ ID NO: 4), striking similarities were observed (FIGURE 1). Both viruses contain an in-frame insertion derived from the Bos taurus DnaJ1 gene. In the case of NADL, the insertion is 90 amino acids (270 nucleotides) in length and is located between glycine-1536 and proline-1627 in the NADL polyprotein. These coordinates correspond to glycine-1536 and proline-1537 in non-cytopathic BVDV1 strains such as SD-1 (Genbank accession number AAA42860, SEQ ID NO: 6), indicating that the genome alteration in NADL is a simple insertion with no concomitant deletion or duplication of flanking viral sequences. Like BVDV1-NADL, there is an insertion of a portion of the Bos taurus DnaJ1 gene in BVDV2-53637. The cellular insertion is longer (131 amino acids, 393 nucleotides), being extended in both directions relative to the insertion in BVDV1-NADL. The location of the cellular insertion within the NS2-3 region is identical in the two viruses. Unlike BVDV1-NADL, the BVDV2-53637 insertion is accompanied by a deletion of 5 amino acids (15 nucleotides) of flanking viral sequences. Three amino acid residues are absent flanking the 5' end of the insertion, while two amino acids residues are absent flanking the 3' end of the insertion. Because the cellular insertions are at the same genome position in the two vaccine viruses, they cannot undergo homologous recombination to delete the insertion to generate a non-cytopathic chimeric virus.

Example II

Attempts To Detect Non-Cytopathic BVDV Viruses In Co-Passaged BVDV1-NADL / BVDV2-53637 Cultures

[0049] In order to determine whether the two vaccine viruses are capable of recombining to generate detectable levels of non-cytopathic BVDV, the viruses were co-cultivated on susceptible cells and a sensitive hemi-nested RT-PCR assay was used to detect potential non-cytopathic viruses from among an excess of longer cytopathic products that still contain the cellular insert. To increase the probability of intertypic recombination in vitro, each virus was inoculated simultaneously onto confluent BK-6 cells in 6-well plates at a multiplicity of infection of 2-4 (12 replicates per experiment). After 2 - 3 days of co-cultivation the cells were frozen and thawed twice, and cell debris was removed by low speed centrifugation. The resulting supernatant fluid was then used as inoculum for the next passage. A total of seven serial passages were conducted in several studies. During the passages BVDV1-NADL grew more rapidly than BVDV2-53637, but the type II virus was still detectable after seven passages using nested RT-PCR. A sensitive hemi-nested RT-PCR assay was employed in an attempt to detect any non-cytopathic virus.

[0050] In first round RT-PCR, forward primers 53637U1 (SEQ ID NO: 1) or NADL4744 (5'-CGTGGCTTCTTGGTACGGG-3', SEQ ID NO: 7) were used in conjunction with reverse primers 53637L (SEQ ID NO: 2) or NADL5305 (5'- AGCGGTATATTGTACAAAGCCA-3', SEQ IDNO: 8). All four combinations of forward and reverse primers were used in order to detect BVDV1, BVDV2, and intertypic recombinants. The expected size of RT-PCR product was 562 bp for cytopathic BVDV1-NADL and 670 bp for cytopathic BVDV2-53637. Non-cytopathic viruses, if present at detectible levels, would be expected to yield first round products of 292 bp (BVDV1-NADL) or 277 bp (BVDV2-53637). Intertypic recombinants should be similar in size to one of the parents, or of intermediate length, depending on the location of the recombination site. Non-cytopathic BVDVs were never detected following first round RT-PCR.

[0051] To increase the sensitivity of detecting non-cytopathic BVDV in the presence of a large excess of cytopathic BVDV, a restriction enzyme digestion step was included before the nested PCR to destroy the larger NS2-3 templates derived from the cytopathic viruses. A combination of MspI and DraI was selected based on the observation that they cut within the Bos taurus DnaJ1 insert but do not cut the flanking viral sequences. In second round (hemi-nested) PCR, forward primers 53637U2 (5'-TGCACGATCTGTGAAGGGAAAGAA -3', SEQ ID NO: 9) or NADL4844 (5'- TGCACTGTATGTGAGGGCCGAGAG -3', SEQ ID NO: 10) were used in conjunction with the same two reverse primers 53637L or NADL5305. Appropriate primer combinations were used to attempt to detect intertypic recombinants as well as BVDV1 and BVDV2. The expected size of RT-PCR product is 462 bp for cytopathic BVDV1-NADL and 570 bp for cytopathic BVDV2-53637 (present at low levels due to incomplete digestion of the cytopathic BVDV RT-PCR products). Non-cytopathic viruses, if present at detectable levels, would be expected to yield second round products of 192 bp (BVDV1-NADL) or 177 bp (BVDV2-53637). Intertypic recombinants should be similar in size to one of the parents, or of intermediate length, depending on the location of the recombination site. Non-cytopathic BVDVs were never detected following second round PCR. In a few individual reactions, aberrant bands of various sizes were seen. All bands between 100 and 300 bp were considered to be potential non-cytopathic products and were submitted for DNA sequence analysis. In every case the aberrant band was the result of false priming during PCR. There was no evidence of non-cytopathic virus in any of the studies.

SEQUENCE LISTING

[0052] 

<110> Welch, Siao-Kun Wan, et al.

<120> SAFE MUTANT VIRAL VACCINES

<130> PC25951A

<140> PCT/US2004/024011
<141> 2004-07-26

<160> 10

<170> PatentIn version 3.2

<210> 1
<211> 19
<212> DNA
<213> Artificial Sequence

<220>
<223> synthetic oligonucleotide forward primer 53637U1

<400> 1
cgtccacaga tggtttggt     19

<210> 2
<211> 22
<212> DNA
<213> Artificial Sequence

<220>
<223> synthetic reverse primer 53637L

<400> 2
ggctatgtat tggacgtaac cc     22

<210> 3
<211> 670
<212> DNA
<213> Bovine Viral Diarrhea Virus 2 strain 53637

<400> 3

<210> 4
<211> 12573
<212> DNA
<213> Bovine Viral Diarrhea Virus 1 strain NADL

<400> 4

<210> 5
<211> 3988
<212> PRT
<213> Bovine Viral Diarrhea Virus 1 strain NADL

<400> 5

<210> 6
<211> 3898
<212> PRT
<213> Bovine Viral Diarrhea Virus 1

<400> 6

<210> 7
<211> 19
<212> DNA
<213> Artificial Sequence

<220>
<223> synthetic oligonucleotide primer NADL4744

<400> 7
cgtggcttct tggtacggg     19

<210> 8
<211> 22
<212> DNA
<213> Artificial Sequence

<220>
<223> synthetic oligonucleotide primer NADL5305

<400> 8
agcggtatat tgtacaaagc ca     22

<210> 9
<211> 24
<212> DNA
<213> Artificial Sequence

<220>
<223> synthetic oligonucleotide primer 53637U2

<400> 9
tgcacgatct gtgaagggaa agaa    24

<210> 10
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> synthetic oligonucleotide primer NADL4844

<400> 10
tgcactgtat gtgagggccg agag    24

Claims

1. A vaccine composition comprising at least two live mutant viruses of the same family,
wherein each virus contains a mutation in the viral genome, and the mutations in the viruses reside in the same genomic site such that the mutant viruses cannot recombine with each other to eliminate the mutations, and wherein two of the live mutant viruses consist of mutant Bovine Viral Diarrhea Viruses (BVDV).

2. The vaccine composition of claim 1, wherein the two mutant live viruses consist of a mutant Bovine Viral Diarrhea Virus Type 1 (BVDV-1) and a mutant Bovine Viral Diarrhea Virus Type 2 (BVDV-2).

3. The vaccine composition of claim 2, wherein the two mutant live viruses consist of a cytopathic (cp) BVDV-1 and a cp BVDV-2, and are both attenuated.

4. The vaccine composition of claim 3, wherein the cp BVDV-1 and the cp BVDV-2 both comprise a mutation in the NS2-3 region that results in a cytopathic biotype.

5. The vaccine composition of claim 4, wherein the cp BVDV-1 is BVDV-1 NADL, and the cp BVDV-2 is BVDV-2 53637.

6. The vaccine composition of claim 2, further comprising at least one of bovine herpesvirus-1, bovine respiratory syncytial virus, parainfluenza virus-3, Campylobacter fetus, Leptospira canicola, Leptospira grippotyphosa, Leptospira hardjo, Leptospira icterohaemorrhagiae, Leptospira pomona, or Mannhemia haemolytica.

7. The vaccine composition of claim 1, further comprising a veterinarily-acceptable carrier.

8. A method of preparing a safe viral vaccine comprising selecting or constructing two live mutant viruses of the same family, wherein each virus contains a mutation and the mutations in the viruses reside in the same genomic site such that the mutant viruses can not undergo homologous recombination to eliminate the mutations, and wherein the viruses consist of mutant BVDV.

9. The method of claim 8, wherein said mutation is selected from a deletion, an insertion, a substitution, or a combination thereof.

10. The method of claim 8, wherein said mutation confers a phenotype selected from attenuation of virulence, alteration of cellular tropism or biotype, alteration of species tropism, expression of a foreign gene cassette, or a combination thereof.

11. The method of claim 8, wherein the two mutant live viruses consist of a mutant BVDV-1 and a mutant BVDV-2.

Ansprüche

1. Vakzinzusammensetzung, welche mindestens zwei lebende Virusmutanten der gleichen Familie umfasst, wobei jedes Virus eine Mutation in dem viralen Genom enthält, und die Mutationen in den Viren an der gleichen genomischen Stelle liegen, so dass die Virusmutanten nicht miteinander rekombinieren können, um die Mutationen zu eliminieren, und wobei zwei der lebenden Virusmutanten aus Bovine-Virusdiarrhoe-Virus(BVDV)-Mutanten bestehen.

2. Vakzinzusammensetzung gemäß Anspruch 1, wobei die zwei lebenden Virusmutanten aus einer Bovine-Virusdiarrhoe-Virus-Typ1(BVDV-1)-Mutante und einer Bovine-Virusdiarrhoe-Virus-Typ2(BVDV-2)-Mutante bestehen.

3. Vakzinzusammensetzung gemäß Anspruch 2, wobei die zwei lebenden Virusmutanten aus einem zytopathischen (cp) BVDV-1 und einem cp BVDV-2 bestehen und beide attenuiert sind.

4. Vakzinzusammensetzung gemäß Anspruch 3, wobei beide, das cp BVDV-1 und das cp BVDV-2, eine Mutation in der NS2-3 Region umfassen, welche zu einem zytopathischen Biotyp führt.

5. Vakzinzusammensetzung gemäß Anspruch 4, wobei das cp BVDV-1 BVDV-1 NADL ist und das cp BVDV-2 BVDV-2 53637 ist.

6. Vakzinzusammensetzung gemäß Anspruch 2, welche weiter mindestens eines/eine von Bovines Herpesvirus-1, bovines respiratorisches-Synzytial-Virus, ParainfluenzaVirus-3, Campylobacter fetus, Leptospira canicola, Leptospira grippotyphosa, Leptospira hardjo, Leptospira icteronaemorrhagiae, Leptospira pomona oder Mannhemia haemolytica enthält.

7. Vakzinzusammensetzung gemäß Anspruch 1, welche weiter einen verterinärmedizinisch annehmbaren Träger enthält.

8. Verfahren zur Herstellung eines sicheren viralen Vakzins, welches das Auswählen oder Erstellen von zwei lebenden Virusmutanten der gleichen Familie umfasst, wobei jedes Virus eine Mutation enthält und die Mutationen in den Viren an der gleichen genomischen Stelle liegen, so dass die Virusmutanten keine homologe Rekombination durchmachen können, um die Mutationen zu eliminieren, und wobei die Viren aus BVDV-Mutanten bestehen.

9. Verfahren gemäß Anspruch 8, wobei die Mutation aus einer Deletion, einer Insertion, einer Substitution oder einer Kombination davon ausgewählt ist.

10. Verfahren gemäß Anspruch 8, wobei die Mutation einen Phänotyp, ausgewählt aus einer Attenuation der Virulenz, einer Änderung des zellulären Tropismus oder Biotyps, einer Änderung des Speziestropismus, einer Expression von einer fremden Genkassette oder einer Kombination davon, verleiht.

11. Verfahren gemäß Anspruch 8, wobei die zwei lebenden Virusmutanten aus einer BVDV-1-Mutante und einer BVDV-2-Mutante bestehen.

Revendications

1. Composition de vaccin comprenant au moins deux virus mutants vivants de la même famille, dans laquelle chaque virus contient une mutation dans le génome viral, et les mutations dans les virus se trouvent dans le même site génomique de telle sorte que les virus mutants ne puissent pas se recombiner mutuellement pour éliminer les mutations, et dans laquelle deux des virus mutants vivants consistent en virus mutants de la diarrhée virale bovine (BVDV).

2. Composition de vaccin suivant la revendication 1, dans laquelle les deux virus vivants mutants consistent en un virus de la diarrhée virale bovine de type 1 (BVDV-1) mutant et un virus de la diarrhée virale bovine de type 2 (BVDV-2) de type 2.

3. Composition de vaccin suivant la revendication 2, dans laquelle les deux virus vivants mutants consistent en un BVDV-1 cytopathogène (cp) et un BVDV-2 cp et sont tous deux atténués.

4. Composition de vaccin suivant la revendication 3, dans laquelle le BVDV-1 cp et le BVDV-2 cp comprennent tous deux une mutation dans la région NS2-3 ayant pour résultat un biotype cytopathogène.

5. Composition de vaccin suivant la revendication 4, dans laquelle le BVDV-1 cp est le BVDV-1 NADL et le BVDV-2 cp est BVDV-2 53637.

6. Composition de vaccin suivant la revendication 2, comprenant en outre au moins un des herpesvirus-1 bovin, virus syncytial respiratoire bovin, virus parainfluenza3, Campylobacter fetus, Leptospira canicola, Leptospira grippotyphosa, Leptospira hardjo, Leptospira icterohaemorrhagiae, Leptospira pomona ou Mannhemia haemolytica.

7. Composition de vaccin suivant la revendication 1, comprenant en outre un support acceptable du point de vue vétérinaire.

8. Procédé pour la préparation d'un vaccin viral sûr, comprenant la sélection ou la construction de deux virus mutants vivants de la même famille, dans lequel chaque virus contient une mutation et les mutations dans les virus résident dans le même site génomique de telle sorte que les virus mutants ne puissent pas subir de recombinaison homologue pour éliminer les mutations, et dans lequel les virus consistent en BVDV mutant.

9. Procédé suivant la revendication 8, dans lequel ladite mutation est choisie entre une délétion, une insertion, une substitution et leurs combinaisons.

10. Procédé suivant la revendication 8, dans lequel ladite mutation confère un phénotype choisi entre l'atténuation de la virulence, la modification du tropisme cellulaire ou du biotype, la modification du tropisme spécifique, l'expression d'une cassette de gène étrangère et une de leurs combinaisons.

11. Procédé suivant la revendication 8, dans lequel les deux virus vivants mutants consistent en un BVDV-1 mutant et un BVDV-2 mutant.

Drawing