TECHNICAL FIELD
[0001] This invention relates to oligonucleotide analogues, which have stable and excellent
antisense or antigene activity or have excellent activities as reagents for detection
of particular genes, or as primers for initiation of amplification, or which are useful
as materials for various physiological and bioactive substances and pharmaceuticals,
functional materials for double-stranded oligonucleotides for RNA interference method
(RNAi or siRNA) or decoy method, functional materials for DNA chips or molecular beacons
targeting single-stranded nucleic acids such as cDNA, functional materials for applications
to various antisense methods (including ribozymes and DNAzymes), antigene method,
and genetic homologous recombination, and materials for high sensitivity analysis
of biological trace components by combinations with fluorescent or luminescent substances.
The invention also relates to nucleoside analogues which are intermediates for production
of the oligonucleotide analogues.
BACKGROUND ART
[0002] In 1978, it was reported for the first time that an antisense oligonucleotide (antisense
molecule) inhibited infection by influenza virus. Reports followed that antisense
oligonucleotides also inhibited oncogene expression and AIDS infection. Since antisense
oligonucleotides specifically control the expression of untoward genes, they are one
of the fields that have been expected most in recent years.
[0003] The antisense method is based on the concept that the flow of information in the
so-called central dogma, i.e., DNA → mRNA → protein, is to be controlled using an
antisense oligonucleotide.
[0004] However, if a natural DNA or RNA oligonucleotide was applied as an antisense molecule
to this method, the problem arose that it was hydrolyzed by an in vivo enzyme, or
its cell membrane permeation was not high. To resolve such problems, numerous nucleic
acid derivative were synthesized, and extensively studied. For example, phosphorothioates
having an oxygen atom on the phosphorus atom substituted by a sulfur atom, and methyl
phosphonates having a methyl group as a substituent were synthesized. Recently, products
having the phosphorus atom also substituted by a carbon atom, or molecules having
a ribose converted into an acyclic skeleton form have been synthesized (
F. Eckstein et al., Biochem., 18, 592(1979);
P.S. Miller et al., Nucleic Acids Res., 11, 5189(1983);
P. Herdewijn et al., J. Chem. Soc. Perkin Trans. 1, 1567(1993);
P.E. Nielsen et al., Science, 254, 1497(1991));
C.A. Stein and A. M. Krieg (ed) "Applied Antisense Oligonucleotide Technology," Willy-Liss
(1998); and
J.J. Toulme et al., Prog. Nucl. Acid Rev. Mol. Biol., 67, 1(2001)).
EP1152009 (ALKYLENE BRIDGED NUCLEOSIDES).
[0005] However, none of the artificial oligonucleotides have obtained nucleoside and oligonucleotide
analogues fully satisfactory in terms of a duplex-forming capacity with single-stranded
RNA and DNA, a triplex-forming capacity with double-stranded DNA, in vivo stability,
or ease of synthesis of oligonucleotides.
DISCLOSURE OF THE INVENTION
PROBLEMS TO BE SOLVED BY THE INVENTION
[0006] In the light of the above-described conventional technologies, it is desired to provide
a nucleotide analogue which highly penetrates the cell membrane in vivo, which minimally
undergoes hydrolysis by enzymes, which is easy to synthesize, and which is useful
for the antisense method, the antigene method, the RNA interference method, the genetic
homologous recombination method, and the decoy method.
MEANS FOR SOLVING THE PROBLEMS
[0007] The inventors of the present invention designed a nucleic acid analogue having the
sugar portion of a nucleic acid modified (i.e., artificial nucleic acid) which may
be useful as a material for various physiological and bioactive substances and pharmaceuticals,
a functional material for double-stranded oligonucleotides for the RNA interference
method (
Nature, Vol. 411, 494-498, 2001) or the decoy method, a functional material for DNA chips or molecular beacons targeting
single-stranded nucleic acids such as cDNA, a functional material for applications
to various antisense methods (including ribozymes and DNAzymes), the antigene method,
and the genetic homologous recombination method, and a material for high sensitivity
analysis of biological trace components by combinations with fluorescent or luminescent
substances. The inventors synthesized the nucleic acid analogue and confirmed its
usefulness.
[0008] As will be described in detail by Examples and Experimental Examples to be offered
later, a DNA or RNA oligonucleotide analogue (II) containing an artificial nucleic
acid 2',4'-BNA
NC unit [in the general formula (I), R
1 and R
2 are each hydrogen, and R
3 is hydrogen or a methyl group], which is one aspect of the present invention, was
confirmed to have the following excellent characteristics:
(1) Has a very high duplex-forming capacity with a complementary RNA strand.
[0009] Whenever one 2',4'-BNA
NC unit is introduced into a DNA oligonucleotide (per modification), the Tm value rises
by 3 to 6°C. Nevertheless, there is little increase (improvement) in the duplex-forming
capacity with a complementary DNA strand. In connection with this characteristic,
a dramatic increase in the Tm value (marked improvement in the duplex-forming capacity)
is present in binding affinity for a complementary RNA strand, as in the case of a
2',4'-BNA-modified DNA oligonucleotide. On the other hand, the 2',4'-BNA-modified
DNA oligonucleotide shows an improvement in the duplex-forming capacity with a complementary
DNA strand (has the Tm value increased by 2 to 4°C per modification), as compared
with an unmodified DNA oligonucleotide. By contrast, the above-mentioned 2',4'-BNA
NC-modified DNA oligonucleotide shows little improvement in binding affinity for a DNA
strand. Thus, this 2',4'-BNA
NC-modified DNA oligonucleotide is very superior in selective binding affinity for a
RNA strand.
(2) The 2',4'-BNANC-modified DNA oligonucleotide also excels in a triplex-forming capacity with a double-stranded
DNA chain.
[0010] When one 2',4'-BNA
NC unit is introduced into a DNA oligonucleotide, the Tm value rises by 7 to 12°C in
forming a triplex with a double-stranded DNA chain. Triplex formation requires sequence
selectivity such that base sequences should be strictly distinguished, and binding
only to a target sequence should be effected. The difference in the Tm value of the
2',4'-BNA
NC-modified DNA oligonucleotide with respect to a match sequence and a mismatch sequence
is 25°C or higher. Thus, this oligonucleotide has excellent sequence selectivity surpassing
that of a natural DNA oligonucleotide.
(3) Nuclease resistance is unsurpassed.
[0011] The nuclease resistance of the 2',4'-BNA
NC-modified oligonucleotide is higher than that of the natural DNA oligonucleotide,
but is much lower than that of S-oligo (phosphorothioate type oligonucleotide). The
2'4'-BNA
NC-modified oligonucleotide of the present invention is superior in nuclease resistance
not only to the 2',4'-BNA-modified oligonucleotide, but also to the S-oligo which
has been evaluated highly because of its excellent nuclease resistance. Thus, the
2',4'-BNA
NC-modified oligonucleotide of the present invention has the property of potently resisting
degradation in vivo.
(4) The N-O bond contained in the artificial nucleic acid 2',4'-BNA
NC molecule of the present invention can be selectively cleaved under mild conditions
with the use of a reducing reagent to liberate an NH group and an OH group. Binding
of a different functional molecule, with the NH group or the OH group as a foothold,
makes it easy to obtain various conjugates, whether before or after preparation of
the oligonucleotide analogue. Usable as the different functional group are labeling
molecules such as fluorescent molecules, chemiluminescent molecules, and molecular
species containing radioisotope atoms, various DNA (RNA) incision activity molecules,
and intracellular or nuclear transfer signal peptides.
[0012] As described above, the DNA or RNA oligonucleotide analogues of the present invention
having 2',4'-BNA
NC modified in various forms have very high usefulness not only as highly functional
materials for creation of genetic drugs by the antisense method, the antigene method,
the decoy method, the genetic homologous recombination method, and the RNA interference
method, but also as base materials for genetic diagnosis methods such as molecular
beacons and DNA chips, as well as starting materials for the development of research
reagents for analysis and elucidation of gene functions.
BRIEF DESCRIPTION OF THE DRAWING
[0013] [Fig. 1] A graph showing changes over time in an oligonucleotide analogue (8) of
the present invention, and natural and nonnatural oligonucleotide analogues, when
degraded by exonuclease, as the survival rates of the undegraded oligonucleotides
by HPLC determination.
Embodiments of the Invention
[0014] The nucleoside analogues of the present invention are a compound of the following
general formula (I) and a salt thereof.
[0015]

[0016] where Base represents an aromatic heterocyclic group or aromatic hydrocarbon ring
group optionally having a substituent,
[0017] R
1 and R
2 are identical or different, and each represent a hydrogen atom, a protective group
for a hydroxyl group for nucleic acid synthesis, an alkyl group, an alkenyl group,
a cycloalkyl group, an aryl group, an aralkyl group, an acyl group, a sulfonyl group,
a silyl group, a phosphate group, a phosphate group protected with a protective group
for nucleic acid synthesis, or -P(R
4)R
5 [where R
4 and R
5 are identical or different, and each represent a hydroxyl group, a hydroxyl group
protected with a protective group for nucleic acid synthesis, a mercapto group, a
mercapto group protected with a protective group for nucleic acid synthesis, an amino
group, an alkoxy group having 1 to 5 carbon atoms, an alkylthio group having 1 to
5 carbon atoms, a cyanoalkoxy group having 1 to 6 carbon atoms, or an amino group
substituted by an alkyl group having 1 to 5 carbon atoms,
[0018] R
3 represents a hydrogen atom, an alkyl group, an alkenyl group, a cycloalkyl group,
an aryl group, an aralkyl group, an acyl group, a sulfonyl group, or a functional
molecule unit substituent, and
[0019] m denotes an integer of 0 to 2, and n denotes an integer of 1 to 3.
[0020] The oligonucleotide analogue of the present invention is a DNA oligonucleotide or
RNA oligonucleotide analogue containing one or two or more of any one or more types
of unit structures of nucleoside analogues represented by the following general formula
(II), or a pharmacologically acceptable salt of the oligonucleotide analogue, provided
that if two or more of one or more types of these structures are contained, Base may
be identical or different between these structures, and that the bond between the
respective nucleosides in the oligonucleotide analogue may contain one or two or more
phosphorothioate bonds [-OP(O)(S
-)O-] aside from a phosphodiester bond [-OP(O
2-)O-] identical with that in a natural nucleic acid,
[0021]

[0022] where Base, R
1, R
2, R
3, m, and n are as defined above.
[0023] In the general formulas (I) and (II), the aromatic heterocyclic group as Base refers
to any 5-membered to 20-membered ring group which has a structure having the carbon
atom, as a constituent atom of a hydrocarbon ring, substituted by one or more hetero-atoms
such as nitrogen atoms, sulfur atoms or oxygen atoms, and which shows aromaticity,
and includes a single ring or a condensed ring. Its concrete examples are pyrimidine
or purine nucleic acid bases, and pyrimidine or purine nucleic acid bases optionally
having one or more substituents selected from an α group to be described below. The
pyrimidine or purine nucleic acid bases include bases generally known as constituent
elements of nucleic acids (for example, guanine, adenine, cytosine, thymine, uracil),
and all other chemical structures which are similar to them, and which can act as,
or can be used instead of, the bases constituting nucleic acids. Other compounds are
also included, such as thiophene, thianthrene, furan, pyran, isobenzofuran, chromene,
xanthene, phenoxthine, pyrrole, imidazole, pyrazole, isothiazole, isoxazole, pyridazine,
indolizine, indole, isoindole, isoquinoline, quinoline, naphthyridine, quinoxaline,
quinazoline, pteridine, carbazole, phenanthridine, acridine, perimidine, phenazine,
phenarsazine, phenothiazine, furazane, phenoxazine, pyrrolidine, pyrroline, imidazolidine,
imidazoline, and pyrazolidine. Preferred examples are pyrimidine or purine nucleic
acid bases, and pyrimidine or purine nucleic acid bases optionally having one or more
substituents selected from the α group to be described below. Concretely, a purin-9-yl
group, a 2-oxopyrimidin-1-yl group, or a purin-9-yl group or a 2-oxopyrimidin-1-yl
group having a substituent selected from the following α group is preferred.
[0024] α group: A hydroxyl group, a hydroxyl group protected with a protective group for
nucleic acid synthesis, an alkoxy group having 1 to 5 carbon atoms, a mercapto group,
a mercapto group protected with a protective group for nucleic acid synthesis, an
alkylthio group having 1 to 5 carbon atoms, an amino group, an amino group protected
with a protective group for nucleic acid synthesis, an amino group substituted by
an alkyl group having 1 to 5 carbon atoms, an alkyl group having 1 to 5 carbon atoms,
and a halogen atom. A group preferred as "the purine nucleic acid base optionally
having the substituent" is a 6-aminopurin-9-yl (i.e. adeninyl) group,
a 6-aminopurin-9-yl group having the amino group protected with a protective group
for nucleic acid synthesis, a 2,6-diaminopurin-9-yl group, a 2-amino-6-chloropurin-9-yl
group, a 2-amino-6-chloropurin-9-yl group having the amino group protected with a
protective group for nucleic acid synthesis, a 2-amino-6-fluoropurin-9-yl group, a
2-amino-6-fluoropurin-9-yl group having the amino group protected with a protective
group for nucleic acid synthesis, a 2-amino-6-bromopurin-9-yl group, a 2-amino-6-bromopurin-9-yl
group having the amino group protected with a protective group for nucleic acid synthesis,
a 2-amino-6-hydroxypurin-9-yl (i.e., guaninyl) group, a 2-amino-6-hydroxypurin-9-yl
group having the amino group protected with a protective group for nucleic acid synthesis,
a 6-amino-2-methoxypurin-9-yl group, a 6-amino-2-chloropurin-9-yl group, a 6-amino-2-fluoropurin-9-yl
group, a 2,6-dimethoxypurin-9-yl group,
a 2,6-dichloroprolin-2-yl group, or a 6-mercaptopurin-9-yl group. More preferred is
a 6-benzoylaminopurin-9-yl group, an adeninyl group, a 2-isobutyrylamino-6-hydroxypurin-9-yl
group, or a guaninyl group.
[0025] A group preferred as "the pyrimidine nucleic acid base optionally having the substituent"
is a 2-oxo-4-amino-1,2-dihydropyrimidin-1-yl (i.e., cytosinyl) group,
a 2-oxo-4-amino-1,2-dihydropyrimidin-1-yl group having the amino group protected with
a protective group for nucleic acid synthesis, a 2-oxo-4-amino-5-fluoro-1,2-dihydropyrimidin-1-yl
group, a 2-oxo-4-amino-5-fluoro-1,2-dihydropyrimidin-1-yl group having the amino group
protected with a protective group for nucleic acid synthesis, a 4-amino-2-oxo-5-chloro-1,2-dihydropyrimidin-l-yl
group, a 2-oxo-4-methoxy-1,2-dihydropyrimidin-1-yl group, a 2-oxo-4-mercapto-1,2-dihydropyrimidin-1-yl
group, a 2-oxo-4-hydroxy-1,2-dihydropyrimidin-1-yl (i.e., uracilyl) group, a 2-oxo-4-hydroxy-5-methyl-1,2-dihydropyrimidin-1-yl
(i.e., thyminyl) group, or a 4-amino-5-methyl-2-oxo-1,2-dihydropyrimidin-1-yl (i.e.,
5-methylcytosinyl) group. More preferred is a 2-oxo-4-benzoylamino-1,2-dihydropyrimidin-1-yl
group, a cytosinyl group, a thyminyl group, a uracinyl group, a 2-oxo-4-benzoylamino-5-methyl-1,2-dihydropyrimidin-1-yl
group, or a 5-methylcytosinyl group.
[0026] More preferred among "the purine or pyrimidine nucleic acid bases optionally having
the substituent" is 6-aminopurin-9-yl (i.e. adeninyl), 6-aminopurin-9-yl having the
amino group protected with a protective group for nucleic acid synthesis, 2,6-diaminopurin-9-yl
group, 2-amino-6-chloropurin-9-yl, 2-amino-6-chloropurin-9-yl having the amino group
protected with a protective group for nucleic acid synthesis, 2-amino-6-fluoropurin-9-yl,
2-amino-6-fluoropurin-9-yl having the amino group protected with a protective group
for nucleic acid synthesis, 2-amino-6-bromopurin-9-yl, 2-amino-6-bromopurin-9-yl having
the amino group protected with a protective group for nucleic acid synthesis, 2-amino-6-hydroxypurin-9-yl
(i.e., guaninyl), 2-amino-6-hydroxypurin-9-yl having the amino group protected with
a protective group for nucleic acid synthesis, 6-amino-2-methoxypurin-9-yl, 6-amino-2-chloropurin-9-yl,
6-amino-2-fluoropurin-9-yl, 2,6-dimethoxypurin-9-yl, 2,6-dichloropurin-2-yl, 6-mercaptopurin-9-yl,
2-oxo-4-amino-1,2-dihydropyrimidin-1-yl (i.e., cytosinyl), 2-oxo-4-amino-1,2-dihydropyrimidin-1-yl
having the amino group protected with a protective group for nucleic acid synthesis,
2-oxo-4-amino-5-fluoro-1,2-dihydropyrimidin-1-yl, 2-oxo-4-amino-5-fluoro-1,2-dihydropyrimidin-1-yl
having the amino group protected with a protective group for nucleic acid synthesis,
4-amino-2-oxo-5-chloro-1,2-dihydropyrimidin-1-yl, 2-oxo-4-methoxy-1,2-dihydropyrimidin-1-yl,
2-oxo-4-mercapto-1,2-dihydropyrimidin-1-yl, 2-oxo-4-hydroxy-1,2-dihydropyrimidin-1-yl
(i.e., uracilyl), 2-oxo-4-hydroxy-5-methyl-1,2-dihydropyrimidin-1-yl (i.e., thyminyl),
4-amino-5-methyl-2-oxo-1,2-dihydropyrimldin-1-yl (i.e., 5-methylcytosinyl), or 4-amino-5-methyl-2-oxo-1,2-dihydropyrimidin-1-yl
having the amino group protected with a protective group for nucleic acid synthesis.
[0027] In the general formulas (I) and (II), the aromatic hydrocarbon ring group as Base
refers to a monovalent substituent formed by removing one hydrogen atom from a hydrocarbon
ring having 6 to 20 carbon atoms and showing aromaticity, and includes a single ring
or a condensed ring. Concrete examples are phenyl, indenyl, naphthyl, pentalenyl,
azulenyl, heptalenyl, biphenylenyl, indacenyl, fluorenyl, phenanthryl, and anthryl.
Any other structures, which can be used alternatively as the base portion of the nucleic
acid component for the purpose of the present invention, are also included in the
examples. Moreover, the aromatic hydrocarbon ring may be substituted by one or more
groups, such as a hydroxyl group, a hydroxyl group protected with a protective group
for nucleic acid synthesis, an amino group, an amino group protected with a protective
group for nucleic acid synthesis, a halogen atom, a lower alkyl group, an alkoxy group,
a carboxyl group, an aryloxy group, a nitro group, a trifluoromethyl group, and a
phenyl group. Examples of such an optionally substituted aromatic hydrocarbon group
are 4-hydroxyphenyl, 2-hydroxyphenyl, 4-aminophenyl, 2-aminophenyl, 2-methylphenyl,
2,6-dimethyphenyl, 2-chlorophenyl, 4-chlorophenyl, 2,4-dichlorophenyl, 2,5-dichlorophenyl,
2-bromophenyl, 4-methoxyphenyl, 4-chloro-2-nitrophenyl, 4-nitrophenyl, 2,4-dinitrophenyl,
and biphenyl. Preferred examples of the optionally substituted aromatic hydrocarbon
ring group are a phenyl group, and a phenyl group substituted by a hydroxyl group,
a hydroxyl group protected with a protective group for nucleic acid synthesis, an
amino group, an amino group protected with a protective group for nucleic acid synthesis,
a lower alkoxy group, or a nitro group.
[0028] In the general formula (I) or (II), the "protective group for a hydroxyl group for
nucleic acid synthesis" as R
1 and R
2, and the protective group in the "hydroxyl group protected with a protective group
for nucleic acid synthesis" as R
4 and R
5 and in the α group are not limited, as long as they can protect the hydroxyl group
stably during nucleic acid synthesis. Concretely, they refer to protective groups
which are stable under acidic or neutral conditions, and which can be cleaved by a
chemical method such as hydrogenolysis, hydrolysis, electrolysis, or photolysis. Examples
of such protective groups are "aliphatic acyl groups", for example, alkylcarbonyl
groups such as formyl, acetyl, propionyl, butyryl, isobutyryl, pentanoyl, pivaloyl,
valeryl, isovaleryl, octanoyl, nonanoyl, decanoyl, 3-methylnonanoyl, 8-methylnonanoyl,
3-ethyloctanoyl, 3,7-dimethyloctanoyl, undecanoyl, dodecanoyl, tridecanoyl, tetradecanoyl,
pentadecanoyl, hexadecanoyl, 1-methylpentadecanoyl, 14-methylpentadecanoyl, 13,13-dimethyltetradecanoyl,
heptadecanoyl, 15-methylhexadecanoyl, octadecanoyl, 1-methylheptadecanoyl, nonadecanoyl,
eicosanoyl, and heneicosanoyl, carboxylated alkylcarbonyl groups such as succinoyl,
glutaroyl, and adipoyl, halogeno lower alkylcarbonyl groups such as chloroacetyl,
dichloroacetyl, trichloroacetyl, and trifluoroacetyl, lower alkoxy lower alkylcarbonyl
groups such as methoxyacetyl, and unsaturated alkylcarbonyl groups such as (E)-2-methyl-2-butenoyl;
"lower alkyl groups" such as methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl,
s-butyl, tert-butyl, n-pentyl, isopentyl, 2-methylbutyl, neopentyl, 1-ethylpropyl,
n-hexyl, isohexyl, 4-methylpentyl, 3-methylpentyl, 2-methylpentyl, 1-methylpentyl,
3,3,-dimethylbutyl, 2,2-dimethylbutyl, 1,1-dimethylbutyl, 1,2-dimethylbutyl, 1,3-dimethylbutyl,
2,3-dimethylbutyl, and 2-ethylbutyl; "lower alkenyl groups" such as ethenyl, 1-propenyl,
2-propenyl, 1-methyl-2-propenyl, 1-methyl-1-propenyl, 2-methyl-1-propenyl, 2-methyl-2-propenyl,
2-ethyl-2-propenyl, 1-butenyl, 2-butenyl, 1-methyl-2-butenyl, 1-methyl-1-butenyl,
3-methyl-2-butenyl, 1-ethyl-2-butenyl, 3-butenyl, 1-methyl-3-butenyl, 2-methyl-3-butenyl,
1-ethyl-3-butenyl, 1-pentenyl, 2-pentenyl, 1-methyl-2-pentenyl, 2-methyl-2-pentenyl,
3-pentenyl, 1-methyl-3-pentenyl, 2-methyl-3-pentenyl, 4-pentenyl, 1-methyl-4-pentenyl,
2-methyl-4-pentenyl, 1-hexenyl, 2-hexenyl, 3-hexenyl, 4-hexenyl, and 5-hexenyl; "aromatic
acyl groups", for example, arylcarbonyl groups such as benzoyl, α-naphthoyl, and β-naphthoyl,
halogenoarylcarbonyl groups such as 2-bromobenzoyl and 4-chlorobenzoyl, lower alkylated
arylcarbonyl groups such as 2,4,6-trimethylbenzoyl and 4-toluoyl, lower alkoxylated
arylcarbonyl groups such as 4-anisoyl, carboxylated arylcarbonyl groups such as 2-carboxybenzoyl,
3-carboxybenzoyl, and 4-carboxybenzoyl, nitrated arylcarbonyl groups such as 4-nitrobenzoyl
and 2-nitrobenzoyl, lower alkoxycarbonylated arylcarbonyl groups such as 2-(methoxycarbonyl)benzoyl,
and arylated arylcarbonyl groups such as 4-phenylbenzoyl; "tetrahydropyranyl or tetrahydrothiopyranyl
groups" such as tetrahydropyran-2-yl, 3-bromotetrahydropyran-2-yl, 4-methoxytetrahydropyran-4-yl,
tetrahydrothiopyran-4-yl, and 4-methoxytetrahydrothiopyran-4-yl; "tetrahydrofuranyl
or tetrahydrothiofuranyl groups" such as tetrahydrofuran-2-yl and tetrahydrothiofuran-2-yl;
"silyl groups", for example, lower trialkylsilyl groups such as trimethylsilyl, triethylsilyl,
isopropyldimethylsilyl, t-butyldimethylsilyl, methyldiisopropylsilyl, methyldi-t-butylsilyl,
and triisopropylsilyl, lower alkylsilyl groups substituted by one or two aryl groups,
such as diphenylmethylsilyl, diphenylbutylsilyl, diphenylisopropylsilyl, and phenyldiisopropylsilyl;
"lower alkoxymethyl groups" such as methoxymethyl, 1,1-dimethyl-1-methoxymethyl, ethoxymethyl,
propoxymethyl, isopropoxymethyl, butoxymethyl, and tert-butoxymethyl; "lower alkoxylated
lower alkoxymethyl groups" such as 2-methoxyethoxymethyl; "halogeno lower alkoxymethyl
groups" such as 2,2,2-trichloroethoxymethyl and bis(2-chloroethoxy)methyl; "lower
alkoxylated ethyl groups" such as 1-ethoxyethyl and 1-(isopropoxy)ethyl; "halogenated
ethyl groups" such as 2,2,2-trichloroethyl; "methyl groups substituted by one to three
aryl groups" such as benzyl, α-naphthylmethyl, β-naphthylmethyl, diphenylmethyl, triphenylmethyl,
α-naphthyldiphenylmethyl, and 9-anthrylmethyl; "methyl groups substituted by one to
three aryl groups having an aryl ring substituted by a lower alkyl, lower alkoxy,
halogen, or cyano group", such as 4-methylbenzyl, 2,4,6-trimethylbenzyl, 3,4,5-trimethylbenzyl,
4-methoxybenzyl, 4-methoxyphenyldiphenylmethyl, 4,4'-dimethoxytriphenylmethyl, 2-nitrobenzyl,
4-nitrobenzyl, 4-chlorobenzyl, 4-bromobenzyl, and 4-cyanobenzyl; "lower alkoxycarbonyl
groups" such as methoxycarbonyl, ethoxycarbonyl, t-butoxycarbonyl, and isobutoxycarbonyl;
"aryl groups substituted by a halogen atom, a lower alkoxy group, or a nitro group",
such as 4-chlorophenyl, 2-fluorophenyl, 4-methoxyphenyl, 4-nitrophenyl, and 2,4-dinitrophenyl;
"lower alkoxycarbonyl groups substituted by halogen or a lower trialkylsilyl group",
such as 2,2,2-trichloroethoxycarbonyl and 2-trimethylsilylethoxycarbonyl; "alkenyloxycarbonyl
groups" such as vinyloxycarbonyl and aryloxycarbonyl; and "aralkyloxycarbonyl groups
having an aryl ring optionally substituted by one or two lower alkoxy or nitro groups",
such as benzyloxycarbonyl, 4-methoxybenzyloxycarbonyl, 3,4-dimethoxybenzyloxycarbonyl,
2-nitrobenzyloxycarbonyl, and 4-nitrobenzyloxycarbonyl.
[0029] The "protective group for a hydroxyl group for nucleic acid synthesis", as R
1 and R
2, is preferably the "aliphatic acyl group", the "aromatic acyl group", the "methyl
group substituted by one to three aryl groups", the "methyl group substituted by one
to three aryl groups having an aryl ring substituted by a lower alkyl, lower alkoxy,
halogen, or cyano group", or the "silyl group", more preferably an acetyl group, a
benzoyl group, a benzyl group, a p-methoxybenzoyl group, a dimethoxytrityl group,
a monomethoxytrityl group, or a tert-butyldiphenylsilyl group. The protective group
in the "hydroxyl group protected with a protective group for nucleic acid synthesis",
as R
4, R
5, R
6, and R
7 and in the α group, is preferably the "aliphatic acyl group", the "aromatic acyl
group", the "methyl group substituted by one to three aryl groups", the "aryl group
substituted by a halogen atom, a lower alkoxy group, or a nitro group", the "lower
alkyl group", or the "lower alkenyl group", more preferably a benzoyl group, a benzyl
group, a 2-chlorophenyl group, a 4-chlorophenyl group, or a 2-propenyl group.
[0030] In the general formula (I) or (II), the "alkyl group", as R
1, R
2 and R
3, refers to a straight chain or branched chain alkyl group having 1 to 20 carbon atoms,
and includes a straight chain or branched chain alkyl group having 1 to 6 carbon atoms
(such an alkyl group may herein be referred to as a lower alkyl group), such as methyl,
ethyl, n-propyl, isopropyl, n-butyl, isobutyl, s-butyl, tert-butyl, n-pentyl, isopentyl,
2-methylbutyl, neopentyl, 1-ethylpropyl, n-hexyl, isohexyl, 4-methylpentyl, 3-methylpentyl,
2-methylpentyl, 1-methylpentyl, 3,3,-dimethylbutyl, 2,2-dimethylbutyl, 1,1-dimethylbutyl,
1,2-dimethylbutyl, 1,3-dimethylbutyl, 2,3-dimethylbutyl, or 2-ethylbutyl. The alkyl
group also includes a straight chain or branched chain alkyl group having 7 to 20
carbon atoms, such as heptyl, octyl, nonyl or decyl. Preferred is the above-mentioned
straight chain or branched chain alkyl group having 1 to 6 carbon atoms.
[0031] In the general formula (I) or (II), the "alkenyl group", as R
1, R
2 and R
3, refers to a straight chain or branched chain alkenyl group having 2 to 20 carbon
atoms, and includes a straight chain or branched chain alkenyl group having 2 to 6
carbon atoms (such an alkenyl group may herein be referred to as a lower alkenyl group),
such as ethenyl, 1-propenyl, 2-propenyl, 1-methyl-2-propenyl, 1-methyl-1-propenyl,
2-methyl-1-propenyl, 2-methyl-2-propenyl, 2-ethyl-2-propenyl, 1-butenyl, 2-butenyl,
1-methyl-2-butenyl, 1-methyl-1-butenyl, 3-methyl-2-butenyl, 1-ethyl-2-butenyl, 3-butenyl,
1-methyl-3-butenyl, 2-methyl-3-butenyl, 1-ethyl-3-butenyl, 1-pentenyl, 2-pentenyl,
1-methyl-2-pentenyl, 2-methyl-2-pentenyl, 3-pentenyl, 1-methyl-3-pentenyl, 2-methyl-3-pentenyl,
4-pentenyl, 1-methyl-4-pentenyl, 2-methyl-4-pentenyl, 1-hexenyl, 2-hexenyl, 3-hexenyl,
4-hexenyl, and 5-hexenyl. The alkeyl group also includes geranyl and farnesyl, and
is preferably the above-mentioned straight chain or branched chain alkenyl group having
2 to 6 carbon atoms.
[0032] In the general formula (I) or (II), the "cycloalkyl group", as R
1, R
2 and R
3, refers to a cycloalkyl group having 3 to 10 carbon atoms, and includes, for example,
cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, norbornyl,
and adamantyl. Preferred is a cycloalkyl group having 3 to 8 carbon atoms, such as
cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, or cyclooctyl. The
"cycloalkyl group" also includes a heterocyclic group in which one or more methylene
groups on the ring of the cycloalkyl group have been substituted by oxygen atoms or
sulfur atoms, or nitrogen atoms substituted by an alkyl group. An example of the heterocyclic
group is a tetrahydropyranyl group.
[0033] In the general formula (I) or (II), the "aryl group", as R
1, R
2 and R
3, refers to a monovalent substituent having 6 to 14 carbon atoms which remains after
removing one hydrogen atom from an aromatic hydrocarbon group, and includes, for example,
phenyl, indenyl, naphthyl, phenanthrenyl, and anthracenyl. The aryl group may be substituted
by one or more groups, such as a halogen atom, a lower alkyl group, a hydroxyl group,
an alkoxy group, an aryloxy group, an amino group, a nitro group, trifluoromethyl,
and a phenyl group. Examples of the optionally substituted aryl group are 2-methylphenyl,
2,6-dimethylphenyl, 2-chlorophenyl, 4-chlorophenyl, 2,4-dichlorophenyl, 2,5-dichlorophenyl,
2-bromophenyl, 4-methoxyphenyl, 4-chloro-2-nitrophenyl, 4-nitrophenyl, 2,4-dinitrophenyl,
and biphenyl. Preferred examples are a phenyl group, and a phenyl group substituted
by a halogen atom, a lower alkoxy group, or a nitro group.
[0034] In the general formula (I) or (II), the "aralkyl group", as R
1, R
2 and R
3, refers to an alkyl group having 1 to 6 carbon atoms which has been substituted by
an aryl group. Examples of the aralkyl group are "methyl groups substituted by one
to three aryl groups", such as benzyl, α-naphthylmethyl, β-naphthylmethyl, indenylmethyl,
phenanthrenylmethyl, anthracenylmethyl, diphenylmethyl, triphenylmethyl, α-naphthyldiphenylmethyl,
and 9-anthrylmethyl, and "methyl groups substituted by one to three aryl groups having
an aryl ring substituted by a lower alkyl, lower alkoxy, halogen, or cyano group",
such as 4-methylbenzyl, 2,4,6-trimethylbenzyl, 3,4,5-trimethylbenzyl, 4-methoxybenzyl,
4-methoxyphenyldiphenylmethyl, 4,4'-dimethoxytriphenylmethyl, 2-nitrobenzyl, 4-nitrobenzyl,
4-chlorobenzyl, 4-bromobenzyl, and 4-cyanobenzyl. Other examples include "alkyl groups
having 3 to 6 carbon atoms substituted by an aryl group", such as 1-phenethyl, 2-phenethyl,
1-naphthylethyl, 2-naphthylethyl, 1-phenylpropyl, 2-phenylpropyl, 3-phenylpropyl,
1-naphthylpropyl, 2-naphthylpropyl, 3-naphthylpropyl, 1-phenylbutyl, 2-phenylbutyl,
3-phenylbutyl, 4-phenylbutyl, 1-naphthylbutyl, 2-naphthylbutyl, 3-naphthylbutyl, 4-naphthylbutyl,
1-phenylpentyl, 2-phenylpentyl, 3-phenylpentyl, 4-phenylpentyl, 5-phenylpentyl, 1-naphthylpentyl,
2-naphthylpentyl, 3-naphthylpentyl, 4-naphthylpentyl, 5-naphthylpentyl, 1-phenylhexyl,
2-phenylhexyl, 3-phenylhexyl, 4-phenylhexyl, 5-phenylhexyl, 6-phenylhexyl, 1-naphthylpentyl,
2-naphthylpentyl, 3-naphthylpentyl, 4-naphthylpentyl, 5-naphthylpentyl, and 6-naphthylpentyl.
Preferred examples are the "methyl groups substituted by one to three aryl groups",
and the "methyl groups substituted by one to three aryl groups having an aryl ring
substituted by a lower alkyl, lower alkoxy, halogen, or cyano group". More preferred
examples are 4-methoxyphenyldiphenylmethyl, and 4,4'-dimethoxytriphenylmethyl.
[0035] Examples of the "acryl group", as R
1, R
2 and R
3, in the general formula (I) or (II) are "aliphatic acyl groups", for example, alkylcarbonyl
groups such as formyl, acetyl, propionyl, butyryl, isobutyryl, pentanoyl, pivaloyl,
valeryl, isovaleryl, octanoyl, nonanoyl, decanoyl, 3-methylnonanoyl, 8-methylnonanoyl,
3-ethyloctanoyl, 3,7-dimethyloctanoyl, undecanoyl, dodecanoyl, tridecanoyl, tetradecanoyl,
pentadecanoyl, hexadecanoyl, 1-methylpentadecanoyl, 14-methylpentadecanoyl, 13,13-dimethyltetradecanoyl,
heptadecanoyl, 15-methylhexadecanoyl, octadecanoyl, 1-methylheptadecanoyl, nonadecanoyl,
eicosanoyl, and heneicosanoyl, carboxylated alkylcarbonyl groups such as succinoyl,
glutaroyl, and adipoyl, halogeno lower alkylcarbonyl groups such as chloroacetyl,
dichloroacetyl, trichloroacetyl, and trifluoroacetyl, lower alkoxy lower alkylcarbonyl
groups such as methoxyacetyl, aryloxy lower alkylcarbonyl groups such as a phenoxyacetyl
group, and unsaturated alkylcarbonyl groups such as (E)-2-methyl-2-butenoyl; and "aromatic
acyl groups", for example, arylcarbonyl groups such as benzoyl, α-naphthoyl, and β-naphthoyl,
halogenoarylcarbonyl groups such as 2-bromobenzoyl and 4-chlorobenzoyl, lower alkylated
arylcarbonyl groups such as 2,4,6-trimethylbenzoyl and 4-toluoyl, lower alkoxylated
arylcarbonyl groups such as 4-anisoyl, carboxylated arylcarbonyl groups such as 2-carboxybenzoyl,
3-carboxybenzoyl, and 4-carboxybenzoyl, nitrated arylcarbonyl groups such as 4-nitrobenzoyl
and 2-nitrobenzoyl, lower alkoxycarbonylated arylcarbonyl groups such as 2-(methoxycarbonyl)benzoyl,
and arylated arylcarbonyl groups such as 4-phenylbenzoyl. Preferred examples are formyl,
acetyl, propionyl, butyryl, isobutyryl, pentanoyl, pivaloyl, benzoyl, and phenoxyacetyl
groups.
[0036] As the "sulfonyl group" , as R
1, R
2 and R
3, in the general formula (I) or (II), there can be named "aliphatic sulfonyl groups",
for example, sulfonyl groups substituted by a straight chain or branched chain alkyl
group having 1 to 6 carbon atoms, such as methanesulfonyl and ethanesulfonyl, and
"aromatic sulfonyl groups", for example, sulfonyl groups substituted by various aryl
groups, such as benzenesulfonyl and p-toluenesulfonyl. Preferred examples are methanesulfonyl
and p-toluenesulfonyl.
[0037] As the "silyl group", as R
1, R
2 and R
3, in the general formula (I) or (II), there can be named "lower trialkylsilyl groups"
such as trimethylsilyl, triethylsilyl, isopropyldimethylsilyl, tert-butyldimethylsilyl,
methyldiisopropylsilyl, methyldi-tert-butylsilyl, and triisopropylsilyl, "lower alkylsilyl
groups substituted by one or two aryl groups", such as diphenylmethylsilyl, tert-butyldiphenylbutylsilyl,
diphenylisopropylsilyl, and phenyldiisopropylsilyl. Preferred examples are trimethylsilyl,
triethylsilyl, triisopropylsilyl, t-butyldimethylsilyl, t-butyldiphenylsilyl. A more
preferred example is trimethylsilyl.
[0038] In the general formula (I) or (II), the "protective group" in the "phosphate group
protected with a protective group for nucleic acid synthesis" as R
1 and R
2 is not limited, as long as it can protect the phosphate group stably during nucleic
acid synthesis. Concretely, it refers to a protective group which is stable under
acidic or neutral conditions, and which can be cleaved by a chemical method such as
hydrogenolysis, hydrolysis, electrolysis, or photolysis. Examples of such a protective
group are "lower alkyl groups" such as methyl, ethyl, n-propyl, isopropyl, n-butyl,
isobutyl, s-butyl, tert-butyl, n-pentyl, isopentyl, 2-methylbutyl, neopentyl, 1-ethylpropyl,
n-hexyl, isohexyl, 4-methylpentyl, 3-methylpentyl, 2-methylpentyl, 1-methylpentyl,
3,3,-dimethylbutyl, 2,2-dimethylbutyl, 1,1-dimethylbutyl, 1,2-dimethylbutyl, 1,3-dimethylbutyl,
2,3-dimethylbutyl, and 2-ethylbutyl; "cyanated lower alkyl groups" such as 2-cyanoethyl,
and 2-cyano-1,1-dimethylethyl; "ethyl groups substituted by a silyl group", such as
2-methyldiphenylsilylethyl, 2-trimethylsilylethyl, and 2-triphenylsilylethyl; "halogenated
lower alkyl groups", such as 2,2,2-trichloroethyl, 2,2,2-tribromoethyl, 2,2,2-trifluoroethyl,
and 2,2,2-trlchloro-1,1-diemthylethyl; "lower alkenyl groups", such as ethenyl, 1-propenyl,
2-propenyl, 1-methyl-2-propenyl, 1-methyl-1-propenyl, 2-methyl-2-propenyl, 2-ethyl-2-propenyl,
1-butenyl, 2-butenyl, 1-methyl-2-butenyl, 1-methyl-1-butenyl, 3-methyl-2-butenyl,
1-ethyl-2-butenyl, 3-butenyl, 1-methyl-3-butenyl, 2-methyl-3-butenyl, 1-ethyl-3-butenyl,
1-pentenyl, 2-pentenyl, 1-methyl-2-pentenyl, 2-methyl-2-pentenyl, 3-pentenyl, 1-methyl-3-pentenyl,
2-methyl-3-pentenyl, 4-pentenyl, 1-methyl-4-pentenyl, 2-methyl-4-pentenyl, 1-hexenyl,
2-hexenyl, 3-hexenyl, 4-hexenyl, and 5-hexenyl; "cycloalkyl groups", such as cyclopropyl,
cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, norbornyl, and adamantyl;
"cyanated lower alkenyl groups" such as 2-cyanobutenyl; "aralkyl groups", such as
benzyl, α-naphthylmethyl, β-naphthylmethyl, indenylmethyl, phenanthrenylmethyl, anthracenylmethyl,
diphenylmethyl, triphenylmethyl, 1-phenethyl, 2-phenethyl, 1-naphthylethyl, 2-naphthylethyl,
1-phenylpropyl, 2-phenylpropyl, 3-phenylpropyl, 1-naphthylpropyl, 2-naphthylpropyl,
3-naphthylpropyl, 1-phenylbutyl, 2-phenylbutyl, 3-phenylbutyl, 4-phenylbutyl, 1-naphthylbutyl,
2-naphthylbutyl, 3-naphthylbutyl, 4-naphthylbutyl, 1-phenylpentyl, 2-phenylpentyl,
3-phenylpentyl, 4-phenylpentyl, 5-phenylpentyl, 1-naphthylpentyl, 2-naphthylpentyl,
3-naphthylpentyl, 4-naphthylpentyl, 5-naphthylpentyl, 1-phenylhexyl, 2-phenylhexyl,
3-phenylhexyl, 4-phenylhexyl, 5-phenylhexyl, 6-phenylhexyl, 1-naphthylpentyl, 2-naphthylpentyl,
3-naphthylpentyl, 4-naphthylpentyl, 5-naphthylpentyl, and 6-naphthylpentyl; "aralkyl
groups having an aryl ring substituted by a nitro group or a halogen atom", such as
4-chlorobenzyl, 2-(4-nitrophenyl)ethyl, o-nitrobenzyl, 4-nitrobenzyl, 2,4-dinitrobenzyl,
and 4-chloro-2-nitrobenzyl; "aryl groups", such as phenyl, indenyl, naphthyl, phenanthrenyl,
and anthracenyl; and "aryl groups substituted by a lower alkyl group, a halogen atom,
or a nitro group", such as 2-methylphenyl, 2,6-dimethylphenyl, 2-chlorophenyl, 4-chlorophenyl,
2,4-dichlorophenl, 2,5-dichlorophenyl, 2-bromophenyl, 4-nitrophenyl, and 4-chloro-2-nitrophenyl.
Preferred examples are the "lower alkyl groups", "lower alkyl groups substituted by
a cyano group", "aralkyl groups", "aralkyl groups having an aryl ring substituted
by a nitro group or a halogen atom", or "aryl groups substituted by a lower alkyl
group, a halogen atom, or a nitro group". A more preferred example is a 2-cyanoethyl
group, a 2,2,2-trichloroethyl group, a benzyl group, a 2-chlorophenyl group, or a
4-chlorophenyl group.
[0039] In the general formula (I) or (II), the "functional molecule unit substituent" as
R
3 includes labeling molecules (for example, fluorescent molecules, chemiluminescent
molecules, and molecular species containing radioisotope atoms), DNA or RNA incision
activity molecules, and intracellular or nuclear transfer signal peptides.
[0040] In the general formula (I) or (II), the protective group in "the mercapto group protected
with a protective group for nucleic acid synthesis" as R
4 and R
5 and in the α group is not limited, as long as it can protect the mercapto group stably
during nucleic acid synthesis. Concretely, it refers to a protective group which is
stable under acidic or neutral conditions, and which can be cleaved by a chemical
method such as hydrogenolysis, hydrolysis, electrolysis, or photolysis. Examples of
such a protective group are those named above as the protective group for the hydroxyl
group, as well as "disulfide-forming groups", for example, alkylthio groups such as
methylthio, ethylthio, and tert-butylthio, and arylthio groups such as benzylthio.
Preferred examples are "aliphatic acyl groups" or "aromatic acyl groups". More preferred
examples are a benzoyl group and a benzyl group.
[0041] Examples of "the alkoxy group having 1 to 5 carbon atoms" as R
4 and R
5 and in the α group in the general formula (I) or (II) are methoxy, ethoxy, n-propoxy,
isopropoxy, n-butoxy, isobutoxy, s-butoxy, tert-butoxy, and n-pentoxy. A preferred
example is a methoxy or ethoxy group.
[0042] Examples of "the alkylthio group having 1 to 5 carbon atoms" as R
4 and R
5 and in the α group in the general formula (I) or (II) are methylthio, ethylthio,
propylthio, isopropylthio, butylthio, isobutylthio, s-butylthio, tert-butylthio, and
n-pentylthio. A preferred example is a methylthio or ethylthio group.
[0043] Examples of "the cyanoalkoxy group having 1 to 6 carbon atoms" as R
4 and R
5 in the general formula (I) or (II) are the above "alkoxy groups having 1 to 5 carbon
atoms" which have been substituted by a cyano group. Such groups are, for example,
cyanomethoxy, 2-cyanoethoxy, 3-cyanopropoxy, 4-cyanobutoxy, 3-cyano-2-methylpropoxy,
and 1-cyanomethyl-1,1-dimethylmethoxy. A preferred example is a 2-cyanoethoxy group.
[0044] Examples of "the amino group substituted by an alkyl group having 1 to 5 carbon atoms",
as R
4 and R
5 and in the α group in the general formula (I) or (II), are methylamino, ethylamino,
propylamino, isopropylamino, butylamino, isobutylamino, s-butylamino, tert-butylamino,
dimethylamino, diethylamino, dipropylamino, diisopropylamino, dibutylamino, diisobutylamino,
di(s-butyl)amino, and di(tert-butyl)amino. A preferred example is methylamino, ethylamino,
dimethylamino, diethylamino, or diisopropylamino group.
[0045] As the "alkyl group having 1 to 5 carbon atoms" in the α group, there can be named,
for example, methyl, ethyl, propyl, isopropyl, isopropyl, butyl, isobutyl, s-butyl,
tert-butyl, and n-pentyl. A preferred example is a methyl or ethyl group.
[0046] As the "halogen atom" in the α group, there can be named, for example, a fluorine
atom, a chlorine atom, a bromine atom, and an iodine atom, A preferred example is
a fluorine atom or a chlorine atom.
[0047] The "phosphoroamidite group" refers to a group of the formula -P(OR
1a) (NR
1b) (where R
1a represents an alkyl group having 1 or more carbon atoms or a cyanoalkyl group having
1 to 7 carbon atoms, and R
1b represents an alkyl group having 1 to 6 carbon atoms). A preferred example is a group
of the formula -P(OC
2H
4CN)(N(i-Pr)
2) or a group of the formula -P(OCH
3)(N(i-Pr)
2).
[0048] The protective group in the "amino group protected with a protective group for nucleic
acid synthesis" in the α group is not limited, as long as it can protect the amino
group stably during nucleic acid synthesis. Concretely, it refers to a protective
group which is stable under acidic or neutral conditions, and which can be cleaved
by a chemical method such as hydrogenolysis, hydrolysis, electrolysis, or photolysis.
Examples of such a protective group are "aliphatic acyl groups", for example, alkylcarbonyl
groups such as formyl, acetyl, propionyl, butyryl, isobutyryl, pentanoyl, pivaloyl,
valeryl, isovaleryl, octanoyl, nonanoyl, decanoyl, 3-methylnonanoyl, 8-methylnonanoyl,
3-ethyloctanoyl, 3,7-dimethyloctanoyl, undecanoyl, dodecanoyl, tridecanoyl, tetradecanoyl,
pentadecanoyl, hexadecanoyl, 1-methylpentadecanoyl, 14-methylpentadecanoyl, 13,13-dimethyltetradecanoyl,
heptadecanoyl, 15-methylhexadecanoyl, octadecanoyl, 1-methylheptadecanoyl, nonadecanoyl,
nonadecanoyl, eicosanoyl, and heneicosanoyl, carboxylated alkylcarbonyl groups such
as succinoyl, glutaroyl, and adipoyl, halogeno lower alkylcarbonyl groups such as
chloroacetyl, dichloroacetyl, trichloroacetyl, and trifluoroacetyl, lower alkoxy lower
alkylcarbonyl groups such as methoxyacetyl, and unsaturated alkylcarbonyl groups such
as (E)-2-methyl-2-butenoyl; "aromatic acyl groups", for example, arylcarbonyl groups
such as benzoyl, α-naphthoyl, and β-naphthoyl, halogenoarylcarbonyl groups such as
2-bromobenzoyl and 4-chlorobenzoyl, lower alkylated arylcarbonyl groups such as 2,4,6-trimethylbenzoyl
and 4-toluoyl, lower alkoxylated arylcarbonyl groups such as 4-anisoyl, carboxylated
arylcarbonyl groups such as 2-carboxybenzoyl, 3-carboxybenzoyl, and 4-carboxybenzoyl,
nitrated arylcarbonyl groups such as 4-nitrobenzoyl and 2-nitrobenzoyl, lower alkoxycarbonylated
arylcarbonyl groups such as 2-(methoxycarbonyl)benzoyl, and arylated arylcarbonyl
groups such as 4-phenylbenzoyl; "lower alkoxycarbonyl groups" such as methoxycarbonyl,
ethoxycarbonyl, t-butoxycarbonyl, and isobutoxycarbonyl; "lower alkoxycarbonyl groups
substituted by halogen or a lower trialkylsilyl group", such as 2,2,2-trichloroethoxycarbonyl
and 2-trimethylsilylethoxycarbonyl; "alkenyloxycarbonyl groups" such as vinyloxycarbonyl
and aryloxycarbonyl; and "aralkyloxycarbonyl groups having an aryl ring optionally
substituted by one or two lower alkoxy or nitro groups", such as benzyloxycarbonyl,
4-methoxybenzyloxycarbonyl, 2-nitrobenzyloxycarbonyl, and 4-nitrobenzyloxycarbonyl.
A preferred example is the "aliphatic acyl group" or "aromatic acyl group", and a
more preferred example is a benzoyl group.
[0049] The "nucleoside analogue" refers to a nonnatural type of "nucleoside" consisting
of a purine or pyrimidine base and a sugar linked together, or a product consisting
of an aromatic heterocyclic ring or an aromatic hydrocarbon ring, which is other than
purine and pyrimidine and which can be used instead of the purine or pyrimidine base,
and a sugar linked together.
[0050] The "oligonucleotide analogue" refers to a nonnatural type derivative of "oligonucleotide"
comprising 2 to 50 identical or different "nucleosides" or "nucleoside analogues"
linked together by phosphodiester bonds. Preferred examples of such an analogue are
sugar derivatives with the sugar portion modified; thioate derivatives formed upon
thioation of the phosphodiester portion; esters formed upon esterification of the
terminal phosphoric acid portion; and amides formed upon amidation of the amino group
on the purine base. More preferred examples are sugar derivatives with the sugar portion
modified.
[0051] The "salt thereof" refers to a salt of the compound (1) of the present invention,
because the compound (1) can be converted into the salt. Preferred examples of the
salt are metal salts, for example, alkali metal salts such as sodium salt, potassium
salt, and lithium salt, alkaline earth metal salts such as calcium salt and magnesium
salt, aluminum salt, iron salt, zinc salt, copper salt, nickel salt, and cobalt salt;
amine salts, for example, inorganic salts such as ammonium salt, and organic salts
such as t-octylamine salt, dibenzylamine salt, morpholine salt, glucosamine salt,
phenylglycine alkyl ester salt, ethylenediamine salt, N-methylglucamine salt, guanidine
salt, diethylamine salt, triethylamine salt, dicyclohexylamine salt, N,N'-dibenzylethylenediamine
salt, chloroprocaine salt, procaine salt, diethanolamine salt, N-benzyl-phenethylamine
salt, piperazine salt, tetramethylammonium salt, and tris(hydroxymethyl)aminomethane
salt; inorganic acid salts, for example, halogenated hydroacid salts such as hydrofluoride,
hydrochloride, hydrobromide, and hydriodide, nitrate, perchlorate, sulfate, and phosphate;
organic acid salts, for example, lower alkanesulfonates such as methanesulfonate,
trifluoromethanesulfonate, and ethanesulfonate, arylsulfonates such as benzenesulfonate
and p-toluenesulfonate, acetate, malate, fumarate, succinate, citrate, tartrate, oxalate,
and maleate; and amino acid salts such as glycine salt, lysine salt, arginine salt,
ornithine salt, glutamate, and aspartate.
[0052] The "pharmacologically acceptable salt thereof" refers to a salt of the oligonucleotide
analogue of the present invention, because the oligonucleotide can be converted into
the salt. Preferred examples of the salt are metal salts, for example, alkali metal
salts such as sodium salt, potassium salt, and lithium salt, alkaline earth metal
salts such as calcium salt and magnesium salt, aluminum salt, iron salt, zinc salt,
copper salt, nickel salt, and cobalt salt; amine salts, for example, inorganic salts
such as ammonium salt, and organic salts such as t-octylamine salt, dibenzylamine
salt, morpholine salt, glucosamine salt, phenylglycine alkyl ester salt, ethylenediamine
salt, N-methylglucamine salt, guanidine salt, diethylamine salt, triethylamine salt,
dicyclohexylamine salt, N,N'-dibenzylethylenediamine salt, chloroprocaine salt, procaine
salt, diethanolamine salt, N-benzyl-phenethylamine salt, piperazine salt, tetramethylammonium
salt, and tris(hydroxymethyl)aminomethane salt; inorganic acid salts, for example,
halogenated hydroacid salts such as hydrofluoride, hydrochloride, hydrobromide, and
hydriodide, nitrate, perchlorate, sulfate, and phosphate; organic acid salts, for
example, lower alkanesulfonates such as methanesulfonate, trifluoromethanesulfonate,
and ethanesulfonate, arylsulfonates such as benzenesulfonate and p-toluenesulfonate,
acetate, malate, fumarate, succinate, citrate, tartrate, oxalate, and maleate; and
amino acid salts such as glycine salt, lysine salt, arginine salt, ornithine salt,
glutamate, and aspartate.
[0053] Of the compounds (I) of the present invention and the salts thereof, preferred compounds
are as follows:
- (1) Compounds and salts thereof, with R1 being a hydrogen atom, an aliphatic acyl group, an aromatic acyl group, an aliphatic
or aromatic sulfonyl group, a methyl group substituted by one to three aryl groups,
a methyl group substituted by one to three aryl groups having an aryl ring substituted
by a lower alkyl, lower alkoxy, halogen, or cyano group, or a silyl group.
- (2) Compounds and salts thereof, with R1 being a hydrogen atom, an acetyl group, a benzoyl group, a methanesulfonyl group,
a p-toluenesulfonyl group, a benzyl group, a p-methoxybenzyl group, a trityl group,
a dimethoxytrityl group, a monomethoxytrityl group, or a tert-butyldiphenylsilyl group.
- (3) Compounds and salts thereof, with R2 being a hydrogen atom, an aliphatic acyl group, an aromatic acyl group, an aliphatic
or aromatic sulfonyl group, a methyl group substituted by one to three aryl groups,
a methyl group substituted by one to three aryl groups having an aryl ring substituted
by a lower alkyl, lower alkoxy, halogen, or cyano group, a silyl group, a phosphoroamidite
group, a phosphonyl group, a phosphate group, or a phosphate group protected with
a protective group for nucleic acid synthesis.
- (4) Compounds and salts thereof, with R2 being a hydrogen atom, an acetyl group, a benzoyl group, a methanesulfonyl group,
a p-toluenesulfonyl group, a benzyl group, a p-methoxybenzyl group, a tert-butyldiphenylsilyl
group, -P(OC2H4CN) (N(i-Pr)2), -P(OCH3)(N(i-Pr)2), a phosphonyl group, or a 2-chlorophenyl- or 4-chlorophenylphosphate group.
- (5) Compounds and salts thereof, with R3 being a hydrogen atom, an alkyl group having 1 to 5 carbon atoms, an alkenyl group
having 1 to 5 carbon atoms, an aryl group having 6 to 14 carbon atoms, a methyl group
substituted by one to three aryl groups, a lower aliphatic or aromatic sulfonyl group
such as a methanesulfonyl group or a p-toluenesulfonyl group, an aliphatic acyl group
having 1 to 5 carbon atoms such as an acetyl group, or an aromatic acyl group such
as a phenoxyacetyl group or a benzoyl group; or the compounds and salts thereof according
to any one of claims 1 to 6, with the functional molecule unit substituent as R3 being a fluorescent or chemiluminescent labeling molecule, a nucleic acid incision
activity functional group, or an intracellular or nuclear transfer signal peptide.
- (6) Compounds and salts thereof, with Base being a 6-aminopurin-9-yl (i.e. adeninyl)
group, a 6-aminopurin-9-yl group having the amino group protected with a protective
group for nucleic acid synthesis, a 2,6-diaminopurin-9-yl group, a 2-amino-6-chloropurin-9-yl
group, a 2-amino-6-chloropurin-9-yl group having the amino group protected with a
protective group for nucleic acid synthesis, a 2-amino-6-fluoropurin-9-yl group, a
2-amino-6-fluoropurin-9-yl group having the amino group protected with a protective
group for nucleic acid synthesis, a 2-amino-6-bromopurin-9-yl group, a 2-amino-6-bromopurin-9-yl
group having the amino group protected with a protective group for nucleic acid synthesis,
a 2-amino-6-hydroxypurin-9-yl (i.e., guaninyl) group, a 2-amino-6-hydroxypurin-9-yl
group having the amino group protected with a protective group for nucleic acid synthesis,
a 6-amino-2-methoxypurin-9-yl group, a 6-amino-2-chloropurin-9-yl group, a 6-amino-2-fluoropurin-9-yl
group, a 2,6-dimethoxypurin-9-yl group, a 2,6-dichloropurin-9-yl group, a 6-mercaptopurin-9-yl
group, a 2-oxo-4-amino-1,2-dihydropyrimidin-1-yl (i.e., cytosinyl) group, a 2-oxo-4-amlno-1,2-dihydropyrimidin-1-yl
group having the amino group protected with a protective group for nucleic acid synthesis,
a 2-oxo-4-amino-5-fluoro-1,2-dihydropyrimidin-1-yl group, a 2-oxo-4-amino-5-fluoro-1,2-dihydropyrimidin-1-yl
group having the amino group protected with a protective group for nucleic acid synthesis,
a 4-amino-2-oxo-5-chloro-1,2-dihydropyrimidin-1-yl group, a 2-oxo-4-methoxy-1,2-dihydropyrimidin-1-yl
group, a 2-oxo-4-mercapto-1,2-dihydropyrimidin-1-yl group, a 2-oxo-4-hydroxy-1,2-dihydropyrimidln-1-yl
(i.e., uracilyl) group, a 2-oxo-4-hydroxy-5-methyl-1,2-dihydropyrimidin-1-yl (i.e.,
thyminyl) group, a 4-amino-5-methyl-2-oxo-1,2-dihydropyrimidin-1-yl (i.e., 5-methylcytosinyl)
group, or 4-amino-5-methyl-2-oxo-1,2-dihydropyrimidin-1-yl having the amino group
protected with a protective group for nucleic acid synthesis.
- (7) There can also be named compounds and salts thereof, with Base being a benzoylaminopurin-9-yl,
adenyl, 2-isobutyrylamino-6-hydroxypurin-9-yl, guaninyl, 2-oxo-4-benzoylamino-1,2-dihydropyrimidin-1-yl,
cytosinyl, 2-oxo-5-methyl-4-benzoylamino-1,2-dihydropyrimidin-1-yl, 5-methylcytosinyl,
uracinyl, or thyminyl group.
[0054] The above (1) to (2), (3) to (4), or (6) to (7) represent more preferred compounds,
as their numbers grow. Also preferred are compounds and salts thereof in which, in
the general formula (1), R
1 is arbitrarily selected from (1) to (2), R
2 is arbitrarily selected from (3) to (4), R
3 is arbitrarily selected from (5), and Base is arbitrarily selected from (6) to (7);
or compounds and salts thereof obtained by arbitrary combinations of these numbers.
Particularly preferred combinations are (2)-(3)-(5)-(6), (2)-(3)-(5)-(7), (2)-(4)-(5)-(6),
and (2)-(4)-(5)-(7).
[0055] There are named compounds of the general formula (I) and salts thereof, particularly
preferably, compounds of the following formula and salts thereof.
[0056]

2',4'-BNA
NC monomer An example of structure of 2',4'-BNA
NC modified portion in 2',4'-BNA
NC modified oligonucleotide
[0057] In the structural formula of the above group, Base has the same meanings as offered
above.
[0058] Of the oligonucleotide analogues containing one or two or more unit structures of
the nucleoside analogue represented by the general formula (II) of the present invention,
and pharmacologically acceptable salts thereof, preferred examples are as follows:
(8) Oligonucleotide analogues, and pharmacologically acceptable salts thereof, with
R3 being a hydrogen atom, an alkyl group having 1 to 5 carbon atoms, an aralkyl group
such as a benzyl group, an aliphatic or aromatic acyl group such as an acetyl group
or a benzoyl group, or an aliphatic or aromatic sulfonyl group such as a methanesulfonyl
group or a p-toluenesulfonyl group,
(9) Oligonucleotide analogues, and pharmacologically acceptable salts thereof, with
Base being a 6-aminopurin-9-yl (i.e. adeninyl) group, a 6-aminopurin-9-yl group having
the amino group protected with a protective group for nucleic acid synthesis, a 2,6-diaminopurin-9-yl
group, a 2-amino-6-chloropurin-9-yl group, a 2-amino-6-chloropurin-9-yl group having
the amino group protected with a protective group for nucleic acid synthesis, a 2-amino-6-fluoropurin-9-yl
group, a 2-amino-6-fluoropurin-9-yl group having the amino group protected with a
protective group for nucleic acid synthesis, a 2-amino-6-bromopurin-9-yl group, a
2-amino-6-bromopurin-9-yl group having the amino group protected with a protective
group for nucleic acid synthesis, a 2-amino-6-hydroxypurin-9-yl (i.e., guaninyl) group,
a 2-amino-6-hydroxypurin-9-yl group having the amino group protected with a protective
group for nucleic acid synthesis, a 6-amino-2-methoxypurin-9-yl group, a 6-amino-2-chloropurin-9-yl
group, a 6-amino-2-fluoropurin-9-yl group, a 2,6-dimethoxypurin-9-yl group, a 2,6-dichloropurin-9-yl
group, a 6-mercaptopurin-9-yl group, a 2-oxo-4-amino-1,2-dihydropyrimidin-1-yl (i.e.,
cytosinyl) group, a 2-oxo-4-amino-1,2-dihydropyrimidin-1-yl group having the amino
group protected with a protective group for nucleic acid synthesis, a 2-oxo-4-amino-5-fluoro-1,2-dihydropyrimidin-1-yl
group, a 2-oxo-4-amino-5-fluoro-1,2-dihydropyrimidin-1-yl group having the amino group
protected with a protective group for nucleic acid synthesis, a 4-amino-2-oxo-5-chloro-1,2-dihydropyrimidin-1-yl
group, a 2-oxo-4-methoxy-1,2-dihydropyrimidin-1-yl group, a 2-oxo-4-mercapto-1,2-dihydropyrimidin-1-yl
group, a 2-oxo-4-hydroxy-1,2-dihydropyrimidin-1-yl (i.e., uracilyl) group, a 2-oxo-4-hydroxy-5-methyl-1,2-dihydropyrimidin-1-yl
(i.e., thyminyl) group, a 4-amino-5-methyl-2-oxo-1,2-dihydropyrimidin-1-yl (i.e.,
5-methylcytosinyl) group, or 4-amino-5-methyl-2-oxo-1,2-dihydropyrimidin-1-yl having
the amino group protected with a protective group for nucleic acid synthesis.
(10) There can also be named oligonucleotide analogues, and pharmacologically acceptable
salts thereof, with Base being a benzoylaminopurin-9-yl, adenyl, 2-isobutyrylamino-6-hydroxypurin-9-yl,
guaninyl, 2-oxo-4-benzoylamino-1,2-dihydropyrimidin-1-yl, cytosinyl, 2-oxo-5-methyl-4-benzoylamino-1,2-dihydropyrimidin-1-yl,
5-methylcytosinyl, uracinyl, or thyminyl group.
[0059] The above (9) to (10) represent more preferred oligonucleotide analogues, as their
numbers grow. Also preferred are oligonucleotide analogues and pharmacologically acceptable
salts thereof in which R
3 is arbitrarily selected from (8), Base is arbitrarily selected from (9) to (10),
and the selected R
3 and Base are arbitrarily combined. Particularly preferred combinations in the general
formula (II) are (8)-(9) and (8)-(10).
[0060] The nucleoside analogues and oligonucleotide analogues of the present invention can
be synthesized based on the methods described in the Examples offered herein, and
the conventional technologies in the field of the art.
(1) Synthesis of nucleoside analogues
[0061] Compounds represented by the general formula (I) can be synthesized based on the
methods described in the Examples and the conventional technologies in the field of
the art. The reaction conditions, reagents for introduction of a protective group,
and reaction reagents can be determined with reference to the methods described in
the Examples. However, these methods are not limitative, and reaction conditions and
reagents usable based on common knowledge in the field of the art can be employed
as appropriate. For example, the methods described in Japanese Patent Application
Laid-Open No.
2000-297097 and Japanese Patent Application Laid-Open No.
1998-304889 can be referred to. Moreover, if the compounds of the general formula (I) or (II)
have various natural or nonnatural nucleic acid bases or other aromatic heterocyclic
rings or aromatic hydrocarbon rings as Base, the starting materials for the compounds
of the present invention can be synthesized with reference to the methods described
in Japanese Patent Application Laid-Open No.
1998-304889.
(2) Synthesis of oligonucleotide analogues
[0062] The oligonucleotide analogue containing the nucleoside analogue of the present invention
can be synthesized in various forms by a publicly known DNA synthesizer. Then, the
resulting oligonucleotide analogue is purified by use of a reversed phase column,
and the purity of the product is analyzed by reversed phase HPLC or MALDI-TOF-MS,
whereby the formation of a purified oligonucleotide analogue can be confirmed.
[0063] One or more of the nucleoside analogues of the present invention can be rendered
present in the oligonucleotide analogue. Furthermore, the nucleoside analogues may
be rendered present at two or more locations of the oligonucleotide analogue in spaced
state via one or two or more natural nucleotides. According to the present invention,
it is possible to synthesize an oligonucleotide analogue in which the nucleoside analogues
of the present invention have been introduced in necessary numbers (length) at necessary
positions. The length of the entire oligonucleotide analogue is 2 to 50, preferably
8 to 30 nucleotide units.
[0064] The oligonucleotide analogue of the present invention is minimally degradable by
nuclease and, following administration in vivo, can exist in vivo for a long period.
The oligonucleotide analogue forms a duplex with sense RNA, for example, to inhibit
the transcription of an etiological in vivo component (protein) to mRNA. The oligonucleotide
analogue is also considered to inhibit the multiplication of an infecting virus.
[0065] In the light of these facts, the oligonucleotide analogues of the present invention
can be expected to be useful as medicines, including antitumor agents and antiviral
agents, for inhibiting the actions of genes to treat diseases. That is, according
to the present invention, there are provided oligonucleotide analogues, which have
stable and excellent antisense or antigene activity or have excellent activities as
reagents for detection of particular genes, or as primers for initiation of amplification,
or nucleoside analogues which are intermediates for production of the oligonucleotide
analogues.
[0066] DNA or RNA oligonucleotide analogues (oligonucleotide analogues), which have the
2',4'-BNA
NC monomer, as one of the nucleoside analogues of the present invention, modified in
various forms, are useful as materials for various physiological and bioactive substances
and pharmaceuticals, functional materials for double-stranded oligonucleotides for
the RNA interference method or decoy method, functional materials for DNA chips or
molecular beacons targeting single-stranded nucleic acids such as cDNA, functional
materials for applications to various antisense methods (including ribozymes and DNAzymes),
antigene method, and genetic homologous recombination, materials for high sensitivity
analysis of biological trace components by combinations with fluorescent or luminescent
substances, and starting materials for the development of research reagents for analysis
and elucidation of gene functions.
[0067] The nucleoside analogues or oligonucleotide analogues of the present invention can
be formed into preparations for parenteral administration by incorporating therein
customary adjuvants such as buffers and/or stabilizers. For use as preparations for
topical administration, customary pharmaceutical carriers are incorporated, whereby
the nucleoside analogues or oligonucleotide analogues can be formed into ointments,
creams, liquids and solution, or plasters.
[0068] The nucleoside analogues and oligonucleotide analogues of the present invention were
synthesized in accordance with the synthesis scheme shown below. These syntheses will
be described in further detail in the Examples. Compounds 16, 21, 17 and 22 are amidites
for introducing 2',4'-BNA
NC (NMe) and 2',4'-BNA
NC (NH), in which the nucleic acid base portions are thymine and methylcytosine, respectively,
into oligonucleotides. From compound 28 as well, amidite 29 for introduction of a
methylcytidine BNA
NC (NH) derivative can be synthesized in the usual manner (tritylation, amiditation).
Derivatives of Compound 1, in which the nucleic acid base portions are adenine and
guanine instead of thymine, are also known. Thus, adenosine and guanosine 2',4'-BNA
NC derivatives are also considered to be synthesizable by this synthesis route.
Examples
[0069] The nucleoside analogues and oligonucleotide analogues of the present invention were
synthesized in accordance with the synthesis scheme offered below. These syntheses
will be described in further detail in the Examples. The characteristics of the synthesized
oligonucleotide analogues were measured by Experimental Examples.
[0070]

[0071]

[0072]

[Example 1]Synthesis of nucleoside analogues (2',4'-BNANC amidites)
(1) Synthesis of Compound 2
[0073] A 40% aqueous solution of methylamine (0.11 ml, 1.50 mmols) was added to a tetrahydrofuran
solution (3.5 ml) of Compound 1 (49 mg, 0.073 mmol) shown in the above synthesis scheme
under ice-cooled conditions, and the mixture was stirred for 3 hours at room temperature.
After the solvent of the reaction solution was distilled off, the residue was extracted
with ethyl acetate, and the organic layer was washed with water and a saturated aqueous
solution of sodium chloride. The organic layer was dried over anhydrous sodium sulfate,
and the solvent was distilled off. Then, the residue was purified by silica gel column
chromatography (n-hexane:ethyl acetate = 1:1) to obtain Compound 2 (45 mg, 99%) as
a white solid.
[0074] 
(2) Synthesis of Compound 3
[0075] In a stream of nitrogen, methylsulfonyl chloride (45 ml, 0.59 mmol) was added to
a pyridine solution (1.5 ml) of Compound 2 (146 mg, 0.23 mmol) under ice-cooled conditions,
and the mixture was stirred for 1 hour at room temperature. Water was added to the
reaction solution, and the mixture was extracted with ethyl acetate. The organic layer
was washed with a saturated aqueous solution of sodium bicarbonate, and a saturated
aqueous solution of sodium chloride. Then, the organic layer was dried over anhydrous
sodium sulfate. The solvent was distilled off under reduced pressure, and the resulting
crude product 3 (170 mg) was used for a next reaction without being purified.
[0076] 
(3) Synthesis of Compound 4
[0077] A 1M aqueous solution of sodium hydroxide (0.70 ml, 0.70 mmol) was added, at room
temperature, to a water-ethanol solution (1:2, 6 ml) of the crude product 3 (170 mg)
obtained in the preceding reaction, and the mixture was stirred for 1 hour. After
neutralization with a 10% aqueous solution of hydrochloric acid, the mixture was extracted
with ethyl acetate. The organic layer was washed with water and a saturated aqueous
solution of sodium chloride, and then dried over anhydrous sodium sulfate. The solvent
was distilled off under reduced pressure, and the resulting crude product was purified
by silica gel column chromatography (chloroform:methanol = 15:1) to obtain Compound
4 (139 mg, 95% from 2 in 2 steps) as a white solid.
[0078] 
(4) Synthesis of Compound 5
[0079] In a stream of nitrogen, 20% palladium hydroxide-carbon powder (0.60 g) and cyclohexene
(5.2 ml, 51 mmols) were added to an ethanol solution (10 ml) of Compound 4 (0.80 g,
1.28 mmols), and the mixture was refluxed with heating for 5 hours. Further, palladium
hydroxide-carbon powder (0.20 g) was added, and the mixture was refluxed with heating
for 17 hours. After the reaction solution was filtered, the solvent was distilled
off under reduced pressure. The resulting crude product 5 (0.46 g) was used for a
next reaction without being purified.
[0080] 
(5) Synthesis of Compound 6
[0081] In a stream of nitrogen, 1,3-dichloro-1,1,3,3-tetraisopropyldisiloxane (0.45 ml,
1.41 mmols) and imidazole (0.38 g, 5.63 mmols) were added to an N,N-dimethylformamide
solution (10 ml) of Compound 5 (0.46 g), and the mixture was stirred for 5 hours at
room temperature. The reaction mixture was extracted with ether, and the organic layer
was washed with water and a saturated aqueous solution of sodium chloride, followed
by drying the organic layer over magnesium sulfate. The solvent was distilled off
under reduced pressure, and the resulting crude product was purified by silica gel
column chromatography (n-hexane:ethyl acetate = 2:1→1:1) to obtain Compound 6 (0.60
g, 68% from 4 in 2 steps) as a white solid.
[0082] 
(6) Synthesis of Compound 7
[0083] In a stream of nitrogen, trifluoromethanesulfonic anhydride (0.15 ml, 0.88 mmol)
and 4-(dimethylamino)pyridine (7 mg, 0.06 mmol) were added to a pyridine solution
(3 ml) of Compound 6 (200 mg, 0.29 mmol) under ice-cooled conditions, and the mixture
was stirred for 7.5 hours at room temperature. Water was added to the reaction solution,
and the mixture was extracted with dichloromethane. The organic layer was washed with
a saturated aqueous solution of sodium bicarbonate, and a saturated aqueous solution
of sodium chloride. Then, the organic layer was dried over anhydrous sodium sulfate.
The solvent was distilled off under reduced pressure, and the resulting crude product
7 (0.29 g) was used for a next reaction without being purified.
[0084] 
(7) Synthesis of Compound 8
[0085] In a stream of nitrogen, N-hydroxyphthalimide (67 mg, 0.41 mmol) and 1,8-diazabicyclo[5.4.0]-7-undecene
(61 ml, 0.41 mmol) were added, at room temperature, to an acetonitrile solution (3
ml) of Crude Product 7 (0.29 g) obtained in the preceding reaction, and the mixture
was stirred for 12 hours at room temperature. The reaction solution was extracted
with dichloromethane, and the organic layer was washed with water and a saturated
aqueous solution of sodium chloride, followed by drying the organic layer over anhydrous
sodium sulfate. The solvent was distilled off under reduced pressure, and the resulting
crude product was purified by silica gel column chromatography (chloroform) to obtain
Compound 8 (0.15 g, 61% from 6 in 2 steps) as a yellow solid.
[0086] 
(8) Synthesis of Compound 9
[0087] Hydrazine hydrate (0.12 ml, 2.38 mmols) was added to an ethanol solution (35 ml)
of Compound 8 (1.16 g, 1.40 mmols), and the mixture was stirred for 10 minutes at
room temperature. After the solvent of the reaction solution was distilled off, the
residue was filtered, and the filtrate was extracted with ethyl acetate. The organic
layer was washed with water and a saturated aqueous solution of sodium chloride. Then,
the organic layer was dried over anhydrous sodium sulfate. The solvent was distilled
off under reduced pressure, and the resulting crude product 9 (0.93 g) was used for
a next reaction without being purified.
[0088] 
(9) Synthesis of Compound 10
[0089] In a stream of nitrogen, a saturated aqueous solution of sodium bicarbonate (4.0
ml, 4.2 mmols) and benzyl chloroformate (0.30 ml, 2.1 mmols) were added, under ice-cooled
conditions, to a methylene chloride solution (15 ml) of Crude Product 9 (0.93 g) obtained
in the preceding reaction, and the mixture was stirred for 1 hour. A saturated aqueous
solution of sodium bicarbonate was added to the reaction solution, and the mixture
was extracted with ethyl acetate. The organic layer was washed with water and a saturated
aqueous solution of sodium chloride, followed by drying the organic layer over magnesium
sulfate. The solvent was distilled off under reduced pressure, and the resulting crude
product was purified by silica gel column chromatography (n-hexane:ethyl acetate =
4:1) to obtain Compound 10 (0.92 g, 94% from 8 in 2 steps) as a white solid.
[0090] 
(10) Synthesis of Compound 11
[0091] In a stream of nitrogen, a tetrahydrofuran solution (15 ml) Compound 10 (3.81 g,
4.57 mmols) was added dropwise, under ice-cooled conditions, to a tetrahydrofuran
suspension (25 ml) of sodium hydride (60% in oil, 0.55 g, 13.7 mmols), and the mixture
was stirred for 1 hour, followed by stirring the mixture for 5 hours at room temperature.
After neutralization in a saturated aqueous solution of oxalic acid, the reaction
mixture was extracted with ethyl acetate. The organic layer was washed with water
and a saturated aqueous solution of sodium chloride, followed by drying the organic
layer over anhydrous sodium sulfate. The solvent was distilled off under reduced pressure,
and the resulting crude product was purified by silica gel column chromatography (chloroform
→ chloroform → methanol = 100:1) to obtain Compound 11 (2.87 g, 95%) as a white solid.
[0092] 
(11) Synthesis of Compound 12
[0093] In a stream of nitrogen, a 1M hexane solution of boron trichloride (5.29 ml, 5.29
mmols) was added, under ice-cooled conditions, to a methylene chloride solution (10
ml) of Crude Product 11 (0.35 mg, 0.53 mmol) obtained in the preceding reaction, and
the mixture was stirred for 1 hour. A saturated aqueous solution of sodium bicarbonate
was added to the reaction solution, and the mixture was extracted with ethyl acetate.
The organic layer was washed with water and a saturated aqueous solution of sodium
chloride, followed by drying the organic layer over anhydrous sodium sulfate. The
solvent was distilled off under reduced pressure, and the resulting crude product
was purified by silica gel column chromatography (chloroform:methanol = 50:1) to obtain
Compound 12 (0.27 g, 96%) as a white solid.
[0094] 
(12) Synthesis of Compound 13
[0095] A 20% aqueous solution of formaldehyde (0.06 ml, 0.40 mmol) was added to a 1M pyridinium
p-toluenesulfonate-methanol solution (3.6 ml) of Compound 12 (0.19 g, 0.36 mmol) at
room temperature, and the mixture was stirred for 10 minutes. Further, sodium cyanoborohydride
(45 mg, 0.72 mmol) was added under ice-cooled conditions, and the mixture was stirred
for 1 hour. The reaction solution was extracted with ethyl acetate, the extract was
washed with water, a saturated aqueous solution of sodium bicarbonate, and a saturated
aqueous solution of sodium chloride, and the organic layer was dried over anhydrous
sodium sulfate. The solvent was distilled off under reduced pressure, and the resulting
crude product was purified by silica gel column chromatography (n-hexane:ethyl acetate
= 2:1) to obtain Compound 13 (0.19 g, 100%) as a white solid.
[0096] 
(13) Synthesis of Compound 14
[0097] Tetra-n-butylammonium fluoride (1M in tetrahydrofuran, 0.17 ml, 0.17 mmol) was added
to a tetrahydrofuran solution (2 ml) of Compound 13 (46 mg, 0.085 mmol), and the mixture
was stirred for 5 minutes at room temperature. The solvent was distilled off under
reduced pressure, and the resulting crude product was purified by silica gel column
chromatography (ethyl acetate:methanol = 15:1) to obtain Compound 14 (25 mg, 100%)
as a white solid.
[0098] 
(14) Synthesis of Compound 15
[0099] To a pyridine solution (10 ml) of Compound 14 (0.16 g, 0.54 mmol), 4,4'-dimethoxytrityl
chloride (0.22 g, 0.64 mmol) was added, and the mixture was stirred for 12 hours at
room temperature. A saturated aqueous solution of sodium bicarbonate was added to
the reaction mixture, and the mixture was extracted with ethyl acetate. The organic
layer was washed with water and a saturated aqueous solution of sodium chloride, followed
by drying the organic layer over anhydrous sodium sulfate. The solvent was distilled
off under reduced pressure, and the resulting crude product was purified by silica
gel column chromatography (1% triethylamine-containing n-hexane:ethyl acetate = 1:2
→ ethyl acetate:methanol = 30:1) to obtain Compound 15 (0.30 g, 93%) as a white solid.
[0100] 
(15) Synthesis of Compound 16
[0101] To an acetonitrile solution (6 ml) of Compound 15 (0.17 g, 0.28 mmol) and 4,5-dicyanoimidazole
(40 mg, 0.34 mmol), 2-cyanoethyl-N,N,N',N'-tetraisopropylphosphoroamidite (0.13 ml,
0.42 mmol) was added, and the mixture was stirred for 4 hours at room temperature.
A saturated aqueous solution of sodium bicarbonate was added to the reaction mixture,
and the mixture was extracted with ethyl acetate. The organic layer was washed with
a saturated aqueous solution of sodium bicarbonate, water, and a saturated aqueous
solution of sodium chloride, followed by drying the organic layer over anhydrous sodium
sulfate. The solvent was distilled off under reduced pressure, and the resulting crude
product was purified by silica gel column chromatography (1% triethylamine-containing
n-hexane:ethyl acetate = 1:1), followed by reprecipitation (ethyl acetate-hexane)
to obtain Compound 16 (0.20 g, 88%) as a white solid.
[0102] 
(16) Synthesis of Compound 17
[0103] In a stream of nitrogen, phosphoryl chloride (86 ml, 0.92 mmol) was added, under
ice-cooled conditions, to an acetonitrile suspension (9 ml) of 1,2,4-triazole (278
mg, 4.03 mmols), and the mixture was stirred vigorously for 10 minutes. Further, triethylamine
(0.64 ml, 4.62 mmols) was added, and the mixture was stirred for 35 minutes. Under
ice-cooled conditions, an acetonitrile solution (3 ml) of Compound 16 (95 mg, 0.12
mmol) was added, and the mixture was stirred for 5.5 hours. Then, the mixture was
further stirred for 2.5 hours at room temperature. A saturated aqueous solution of
sodium bicarbonate was added to the reaction mixture, and the mixture was extracted
with ethyl acetate. The organic layer was washed with water and a saturated aqueous
solution of sodium chloride, followed by drying the organic layer over anhydrous sodium
sulfate. The solvent was distilled off under reduced pressure, and the resulting crude
product was purified by silica gel column chromatography (n-hexane:ethyl acetate =
1:2), and then reprecipitation (ethyl acetate-hexane) to obtain Compound 17 (83 mg,
83%) as a white solid.
[0104] 
(17) Synthesis of Compound 18
[0105] Phenoxyacetyl chloride (29 ml, 0.21 mmol) was added, under ice-cooled conditions,
to a methylene chloride solution (3 ml) of Compound 12 (100 mg, 0.19 mmol) and triethylamine
(32 ml, 0.12 mmol), and the mixture was stirred for 30 minutes. A saturated aqueous
solution of sodium bicarbonate was added to the reaction mixture, and the mixture
was extracted with ethyl acetate. The organic layer was washed with water and a saturated
aqueous solution of sodium chloride, followed by drying the organic layer over anhydrous
sodium sulfate. The solvent was distilled off under reduced pressure, and the resulting
crude product was purified by silica gel column chromatography (n-hexane:ethyl acetate
= 2:1) to obtain Compound 18 (115 mg, 92%) as a white solid.
[0106] 
(18) Synthesis of Compound 19
[0107] In a stream of nitrogen, tetra-n-butylammonium fluoride (1M tetrahydrofuran solution,
1.0 ml, 1.0 mmol) was added to a tetrahydrofuran solution (10 ml) of Compound 18 (0.34
g, 0.51 mmol) at room temperature, and the mixture was stirred for 5 minutes. The
solvent was distilled off under reduced pressure, and the resulting crude product
was purified by silica gel column chromatography (ethyl acetate:methanol = 15:1) to
obtain Compound 19 (0.20 g, 95%) as a white solid.
[0108] 
(19) Synthesis of Compound 20
[0109] In a stream of nitrogen, 4,4'-dimethoxytrityl chloride (0.25 g, 0.73 mmol) was added
to a pyridine solution (8 ml) of Compound 19 (0.17 g, 0.41 mmol) at room temperature,
and the mixture was stirred for 7 hours. A saturated aqueous solution of sodium bicarbonate
was added to the reaction mixture, and the mixture was extracted with ethyl acetate.
The organic layer was washed with water and a saturated aqueous solution of sodium
chloride, followed by drying the organic layer over anhydrous sodium sulfate. The
solvent was distilled off under reduced pressure, and the resulting crude product
was purified by silica gel column chromatography (1% triethylamine-containing n-hexane:ethyl
acetate = 1:1 → ethyl acetate:methanol = 50:1) to obtain Compound 20 (0.25 g, 86%)
as a white solid.
[0110] 
(20) Synthesis of Compound 21
[0111] To an acetonitrile solution (7 ml) of Compound 20 (0.25 g, 0.35 mmol) and 4,5-dicyanoimidazole
(41 mg, 0.35 mmol), 2-cyanoethyl-N,N,N',N'-tetraisopropylphosphoroamidite (0.13 ml,
0.42 mmol) was added, and the mixture was stirred for 3 hours at room temperature.
A saturated aqueous solution of sodium bicarbonate was added to the reaction mixture,
and the mixture was extracted with ethyl acetate. The organic layer was washed with
a saturated aqueous solution of sodium bicarbonate, water, and a saturated aqueous
solution of sodium chloride, followed by drying the organic layer over anhydrous sodium
sulfate. The solvent was distilled off under reduced pressure, and the resulting crude
product was purified by silica gel column chromatography (1% triethylamine-containing
n-hexane:ethyl acetate = 1:1), followed by reprecipitation (ethyl acetate-hexane)
to obtain Compound 21 (0.27 g, 85%) as a white solid.
[0112] 
(21) Synthesis of Compound 22
[0113] In a stream of nitrogen, phosphoryl chloride (71 ml, 0.76 mmol) was added, under
ice-cooled conditions, to an acetonitrile suspension (10 ml) of 1,2,4-triazole (229
mg, 3.32 mmols), and the mixture was stirred vigorously for 10 minutes. Further, triethylamine
(0.53 ml, 3.81 mmols) was added, and the mixture was stirred for 35 minutes. Under
ice-cooled conditions, an acetonitrile solution (2 ml) of Compound 21 (90 mg, 0.10
mmol) was added, and the mixture was stirred for 5 hours. A saturated aqueous solution
of sodium bicarbonate was added to the reaction mixture, and the mixture was extracted
with ethyl acetate. The organic layer was washed with water and a saturated aqueous
solution of sodium chloride, followed by drying the organic layer over anhydrous sodium
sulfate. The solvent was distilled off under reduced pressure, and the resulting crude
product was purified by reprecipitation (ethyl acetate-hexane) to obtain Compound
22 (90 mg, 95%) as a white solid.
[0114] 
(22) Synthesis of Compound 23
[0115] In a stream of nitrogen, phosphoryl chloride (0.44 ml, 4.67 mmols) was added, under
ice-cooled conditions, to an acetonitrile suspension (61 ml) of 1,2,4-triazole (1.41
g, 20.4 mmols), and the mixture was stirred vigorously for 10 minutes. Further, triethylamine
(3.27 ml, 23.4 mmols) was added, and the mixture was stirred for 35 minutes. Under
ice-cooled conditions, an acetonitrile solution (3 ml) of Compound 11 (409 mg, 0.62
mmol) was added, and the mixture was stirred for 2 hours, and further stirred for
3 hours at room temperature. A saturated aqueous solution of sodium bicarbonate was
added to the reaction mixture, and the mixture was extracted with ethyl acetate. The
organic layer was washed with water and a saturated aqueous solution of sodium chloride,
followed by drying the organic layer over anhydrous sodium sulfate. The solvent was
distilled off under reduced pressure, and the resulting crude product 23 (497 mg)
was used for a next reaction without being purified.
[0116] 
(23) Synthesis of Compound 24
[0117] To a 1,4-dioxane solution (10.6 ml) of Compound 23 (497 mg), a 28% aqueous solution
of ammonia (1.76 ml) was added, and the mixture was stirred for 2 hours at room temperature.
The solvent was distilled off under reduced pressure, and the resulting crude product
was purified by silica gel column chromatography (chloroform:methanol = 30:1) to obtain
Compound 24 (343 mg, 84% from 11 in 2 steps) as a white solid.
[0118] 
(24) Synthesis of Compound 25
[0119] A saturated aqueous solution of sodium bicarbonate (0.8 ml, 0.79 mmol) and benzoyl
chloride (92 ml, 0.79 mmol) were added to a methylene chloride solution (2.6 ml) of
Compound 24 (175 mg, 0.26 mmol) under ice-cooled conditions, and the mixture was stirred
for 2 hours, and further stirred for 1.5 hours at room temperature. A saturated aqueous
solution of sodium bicarbonate was added to the reaction mixture, and the mixture
was extracted with ethyl acetate. The organic layer was washed with water and a saturated
aqueous solution of sodium chloride, followed by drying the organic layer over anhydrous
sodium sulfate. The solvent was distilled off under reduced pressure, and the resulting
crude product was purified by silica gel column chromatography (chloroform) to obtain
Compound 25 (161 mg, 80%) as a white solid.
[0120] 
(25) Synthesis of Compound 26
[0121] In a stream of nitrogen, a 1M hexane solution of boron trichloride (1.35 ml, 1.35
mmols) was added, while being cooled at -78°C, to a methylene chloride solution (7.5
ml) of Compound 25 (115 mg, 0.15 mmol), and the mixture was stirred for 1.5 hours,
and further stirred for 2.5 hours under ice-cooled conditions. A saturated aqueous
solution of sodium bicarbonate was added to the reaction mixture, and the mixture
was extracted with ethyl acetate. The organic layer was washed with water and a saturated
aqueous solution of sodium chloride, followed by drying the organic layer over anhydrous
sodium sulfate. The solvent was distilled off under reduced pressure, and the resulting
crude product 26 (90 mg) was used for a next reaction without being purified.
[0122] 
(26) Synthesis of Compound 27
[0123] In a stream of nitrogen, phenoxyacetyl chloride (23 ml, 0.17 mmol) was added, under
ice-cooled conditions, to a methylene chloride solution (1.5 ml) of Compound 26 (90
mg) and triethylamine (25 ml, 0.18 mmol), and the mixture was stirred for 45 minutes.
A saturated aqueous solution of sodium bicarbonate was added to the reaction mixture,
and the mixture was extracted with ethyl acetate. The organic layer was washed with
water and a saturated aqueous solution of sodium chloride, followed by drying the
organic layer over anhydrous sodium sulfate. The solvent was distilled off under reduced
pressure, and the resulting crude product was purified by silica gel column chromatography
(n-hexane:ethyl acetate = 2:1) to obtain Compound 27 (49 mg, 42% from 23 in 2 steps)
as a white solid.
[0124] 
(27) Synthesis of Compound 28
[0125] In a stream of nitrogen,tetra-n-butylammonium fluoride (1M tetrahydrofuran solution,
0.12 ml, 0.12 mmol) was added, at room temperature, to a tetrahydrofuran solution
(1.2 ml) of Compound 27 (45 mg, 0.06 mmol), and the mixture was stirred for 10 minutes.
The solvent was distilled off under reduced pressure, and the resulting crude product
was purified by silica gel column chromatography (n-hexane:ethyl acetate = 1:1) to
obtain Compound 28 (31 mg, 100%) as a white solid.
[0126] 
[Example 2] Synthesis and purification of oligonucleotide analogues
(1) Synthesis of 2' ,4'-BNANC modified oligonucleotides
[0127] Oligonucleotide analogues (1) to (22) containing 2' ,4'-BNA
NC monomer units were synthesized by an automated nucleic acid synthesizer Expedite
™ 8909 (ABI) on a 0.2 mmol scale in accordance with a standard phosphoroamidite protocol.
The coupling time for the amidite and the 5'-terminal hydroxyl group was set at 94
seconds for the natural nucleoside amidite and at 300 seconds for the 2', 4'-BNA
NC amidites (16, 17 and 21).
[0128] For the 2' ,4'-BNC
NC modified oligonucleotides having the 5'-terminal protected with a DMTr group and
supported in a solid phase, removal (1.5 h) from a column using 28% aqueous ammonia
was performed. The removed oligonucleotide analogues were reacted for 16 hours at
60°C in 28% aqueous ammonia for deprotection of all protective groups.
[0129] Simple purification by an NAP-10 column was carried out, and respective fractions
obtained were subjected to UV analysis.
[0130] Based on the results of the UV measurements, oligo-containing fractions were lyophilized,
and the lyophilizates were further purified by reversed phase HPLC (WakoPak
R WS-DNA column, 10.0 mm x 250 mm) (conditions: gradient elution with 8-16% acetonitrile
for 30 min at a rate of 3 ml/min in 0.1M triethylammonium acetate buffer (pH 7.0)).
The purity of the synthetic oligonucleotide analogues was confirmed by reversed phase
HPLC (WakoPak
R WS-DNA column, 4.6 mm x 250 mm) (conditions: gradient elution with 8-16% acetonitrile
for 30 min at a rate of 1 ml/min in 0.1M triethylammonium acetate buffer (pH 7.0)).
The molecular weights were determined by MALDI-TOF-MASS measurement.
[0131] The synthetic oligonucleotide analogues (1) to (22) are indicated below.
[0132]

[0133] The amounts and yields of the 2' ,4'-BNA
NC modified oligonucleotides obtained are shown below.
[0134] [Table 1]
| Oligonucleotide |
Amount obtained (nmol) |
Yield (%) |
| ① 5'-GCGTTXTTTGCT-3' |
94.91 |
47.5 |
| ② 5'-GCGTTXTXTGCT-3' |
118.67 |
59.3 |
| ③ 5'-GCGXTXTXTGCT-3' |
126.12 |
63.1 |
| ④ 5'-GCGTTXXXTGCT-3' |
66.94 |
33.5 |
| ⑤ 5'-GCGXXXXXXGCT-3' |
99.40 |
49.7 |
| ⑥ 5'-TTTTTmCTXTmCTmCTmCT-3' |
72.44 |
36.2 |
| ⑦ 5'-TTTTXmCTXTmCXmCTmCT-3' |
61.07 |
30.6 |
| ⑧ 5'-TTTTTmCXXXmCTmCTmCT-3' |
60.40 |
30.2 |
| ⑨ 5'-XTXTXmCXTXmCXmCXmCT-3' |
41.60 |
20.8 |
| ⑩ 5'-TXTTXmCTXTmCXmCTXT-3' |
25.40 |
12.7 |
| ⑪ 5'-XTTTXmCTTXmCTmCXmCT-3' |
81.80 |
40.9 |
| ⑫ 5'-TTTTTTTTXT-3' |
100.13 |
50.1 |
[0135] Furthermore, the results of the MALDI-TOF MS measurement of the synthetic 2' ,4'-BNA
NC modified oligonucleotides are tabulated below.
[0136]
[Table 2]
| Oligonucleotides |
Calcd.For (M-H)- |
Found (M-H)- |
| |
|
|
| ① 5'-GCGTTXTTTGCT-3' |
3689.47 |
3688.52 |
| ② 5'-GCGTTXTXTGCT-3' |
3746.52 |
3746.89 |
| ③ 5'-GCGXTXTXTGCT-3' |
3803.57 |
3804.93 |
| ④ 5'-GCGTTXXXTGCT-3' |
3803.57 |
3803.18 |
| ⑤ 5'-GCGXXXXXXGCT-3' |
3974.73 |
3975.31 |
| ⑥ 5'-TTTTTmCTXTmCTmCTmCT-3' |
4553.11 |
4552.67 |
| ⑦ 5'-TTTTXmCTXTmCXmCTmCT-3' |
4667.21 |
4667.36 |
| ⑧ 5'-TTTTTmCXXXmCTmCTmCTm-3' |
4667.21 |
4666.86 |
| ⑨ 5'-XTXTXmCXTXmCXmCXmCT-3' |
4895.42 |
4896.42 |
| ⑩ 5'-TXTTXmCTXTmCXmCTXT-3' |
4781.32 |
4781.18 |
| ⑪ 5'-XTTTXmCTTXmCTmCXmCT-3' |
4724.26 |
4723.73 |
| ⑫ 5'-TTTTTTTTXT-3' |
3036.06 |
3036.36 |
| ⑬ 5'-GCGTTYTTTGCT-3' |
3675.44 |
3675.80 |
| ⑭ 5'-GCGTTYTYTGCT-3' |
3718.47 |
3717.15 |
| ⑮ 5'-GCGYTYTYTGCT-3' |
3761.49 |
3762.64 |
| ⑯ 5'-GCGTTYYYTGCT-3' |
3761.49 |
3761.24 |
| ⑰ 5'-GCGYYYYYYGCT-3' |
3890.57 |
3890.62 |
| ⑱ 5'-TTTTTmCTYTmCTmCTmCT-3' |
4539.08 |
4540.11 |
| ⑲ 5'-TTTTYmCTYTmCYmCTmCT-3' |
4625.13 |
4625.74 |
| ⑳ 5'-TTTTTmCYYYmCTmCTmCT-3' |
4625.13 |
4625.71 |
| (21) 5'-YTYTYmCYYYmCYmCYmCT-3' |
4797.23 |
4797.80 |
| (22) 5'-3TTTTTTTTYT-3' |
3022.03 |
3021.93 |
[Experimental Example 1] Measurement of melting points (Tm) of 2' ,4' -BNANC modified oligonucleotides (evaluation of duplex-forming capacity)
[0137] The oligonucleotide analogues (1) to (5) and (13) to (17) synthesized in the Examples
(i.e., antisense strands), and a sense strand of a natural DNA or RNA oligonucleotide
were annealed. The melting points (Tm) of the annealing products were measured to
investigate the duplex-forming capacity of the antisense strands.
[0138] Sample solutions (500 µL) with end concentrations of NaCl 100 mM, sodium phosphate
buffer (pH 7.2) 10 mM, antisense strand 4 µM, and sense strand 4 µM were bathed in
boiling water, and cooled down to room temperature over the course of 10 hours. A
stream of nitrogen was flowed through a cell chamber of a spectrophotometer (Beckman,
DU-650) to prevent dew formation, and the sample solutions were gradually cooled down
to 5°C. Further, the sample solutions were maintained at 10°C for 20 minutes, and
then their measurements were started. The temperature was raised up to 90°C at a rate
of 0.5°C/min, and the ultraviolet absorption at 260 nm was measured.
[0139] The results are shown in Tables 3 and 4.
[0140]
[Table 3]
| Duplex-forming capacity with DNA strand (5'-AGCAAAAAACGC-3') (Tm value evaluation):
°C |
| Antisense strand |
Tm |
ΔTm/mod. |
| 5'-GCGTTTTTTGCT-3' |
50 |
Natural |
| ① 5'-GCGTTXTTTGCT-3' |
49 |
-1 |
| ② 5'-GCGTTXTXTGCT-3' |
49 |
-0.5 |
| ③ 5'-GCGXTXTXTGCT-3' |
51 |
-0.3 |
| ④ 5'-GCGTTXXXTGCT-3' |
50 |
0 |
| ⑤ 5'-GCGXXXXXXGCT-3' |
61 |
+1.8 |
| ⑬ 5'-GCGTTYTTTGCT-3' |
51 |
+1 |
| ⑭ 5'-GCGTTYTYTGCT-3' |
52 |
+1 |
| ⑮ 5'-GCGYTYTYTGCT-3' |
55 |
+1.7 |
| ⑯ 5'-GCGTTYYYTGCT-3' |
57 |
+2.3 |
| ⑰ 5'-GCGYYYYYYGCT-3' |
73 |
+3.8 |
| Conditions: 100 mM NaCl, 10 mM Na2HP04 buffer (pH7.2), [strand] = 4 µM. Tm was the
average value of 3 or more experiments. |
[0141]
[Table 4]
| Duplex-forming capacity with RNA strand (5'-AGCAAAAAACGC-3') (Tm value evaluation):
°C |
| Antisense strand |
Tm |
ΔTm/mod. |
| 5'-GCGTTTTTTGCT-3' |
45 |
Natural |
| ① 5'-GCGTTXTTTGCT-3' |
50 |
+5 |
| ② 5'-GCGTTXTXTGCT-3' |
56 |
+5.5 |
| ③ 5'-GCGXTXTXTGCT-3' |
63 |
+6 |
| ④ 5'-GCGTTXXXTGCT-3' |
59 |
+4.7 |
| ⑤ 5'-GCGXXXXXXGCT-3' |
80 |
+5.8 |
| ⑬ 5'-GCGTTYTTTGCT-3' |
51 |
+6 |
| ⑭ 5'-GCGTTYTYTGCT-3' |
56 |
+5.5 |
| ⑮ 5'-GCGYTYTYTGCT-3' |
64 |
+6.3 |
| ⑯ 5'-GCGTTYYYTGCT-3' |
61 |
+5.3 |
| ⑰ 5'-GCGYYYYYYGCT-3' |
83 |
+6.3 |
Conditions: 100 mM NaCl, 10 mM Na2HPO4 buffer (pH7.2), [strand] = 4 µM.
Tm was the average value of 3 or more experiments. |
[0142] Based on the above findings, the nucleotide analogues of the present invention have
a much higher duplex-forming capacity with single-stranded RNA (sense strand) than
their duplex-forming capacity with single-stranded DNA (sense strand), and are considered
to be suitable for the antisense method.
[Experimental Example 2] Measurement of Tm of 2' ,4'-BNA
NC modified oligonucleotides (evaluation of triplex-forming capacity)
In connection with the oligonucleotide analogues (6) to (11) and (18) to (21) synthesized
in the Examples, the triplex-forming capacity with the target double-stranded DNA's
indicated below was investigated by the same method as in Experimental Example 1.
The salt concentrations and pH during measurement complied with the conditions described
below the respective tables.
[0143] The results and experimental conditions are shown in Table 5.
[0144] [Table 5-1]
Table 5-1. T
m values of 2',4'-BNA
NC oligonucleotides with dsDNA.
| target : |
5'-d(GCTAAAAAGAAAGAGAGATCG)-3'
3'-d(CGATTTTTCTTTCTCTCTAGC)-5' |
| oligonucleotides |
Tm (Δ Tm/modification) (°C) |
| 5'-TTTTTmCTTTmCTmCTmCT-3' |
33 |
| ⑥ 5'TTTTTmCTXTmCTmCTm-CT-3' |
38 (+5.0) |
| ⑦ 5'-TTTTXmCTXTmCXmCTmCT-3' |
47 (+4.6) |
| ⑧ 5'-TTTTTmCXXXmCTmCTmCT-3' |
42 (+3.0) |
| ⑨ 5'-XTXTXmCXTXmCXmCXmCT-3' |
59 (+3.7) |
| ⑩ 5'-TXTTXmCTXTmCXmCTX*T-3' |
50 (+3.4) |
| ⑪ 5'-XTTTXmCTTXmCTmCXmCT-3' |
45 (+3.0) |
| ⑱ 5'-TTTTTmCTYTmCTmCTmCT-3' |
44 (+11.0) |
| ⑲ 5'-TTTTYmCTYTmCYmCTmCT-3' |
60 (+9.0) |
| ⑳ 5'-TTTTTmCYYYmCTmCTm-CT-3' |
59 (+8.7) |
| (21) 5'-YTYTYmCYTYmCYmCYmCT-3' |
78 (+6.4) |
| Conditions: 140 mM KCI, 7 mM Na2HPO4 buffer (pH 7.0), each strand 1.5µM, 5°C to 90°C (0.5°C/min).X*:2',4'-BNANC(N-Me)-mC |
[0145] [Table 5-2]
Table 5-2. T
m values of 2',4'-BNA
NC oligonucleotides with dsDNA.
| target : |
5'-d(GCTGCTAAAAAGAAAGAGAGATCGTCG)-3'
3'-d(CGACGATTTTTCTTTCTCTCTAGCAGC)-5' |
| oligonucleotides |
Tm (Δ Tm/modification) (°C) |
| 5'-TTTTTmCTTTmCTmCTmCT-3' |
43 |
| ⑥ 5'-TTTTTmCTXTmCTmCTmCT-3' |
49 (+6.0) |
| ⑦ 5'-TTTTXmCTXTmCXmCTmCT-3' |
61 (+6.0) |
| ⑧ 5'-TTTTTmCXXXmCTmCTmCT-3' |
54 (+3.6) |
| ⑨ 5'-XTXTXmCXTXmCXmCXmCT-3' |
>80 (>+5) |
| ⑩ 5'-TXTTXmCTXTmCXmCTX*T-3' |
63 (+4.0) |
| ⑪ 5'-XTTTXmCTTXmCTmCXmCT-3' |
59 (+4.0) |
| ⑱ 5'-TTTTTmCTYTmCTmCTmCT-3' |
55 (+12.0) |
| ⑲ 5'-TTTTTmCTYTmCYmCTmCT-3' |
73 (+10.0) |
| ⑳ 5'-TTTTTmCYYYmCTmCTmCT-3' |
71(+9.3) |
| (21) 5'-YTYTYmCYTYmCYmCYmCT-3' |
>80 (>+5) |
| Conditions : 140 mM KCI, 10 mM MgCl2, 7 mM Na2HPO4 buffer (pH 7.0), each strand 1.5 µM, 5°C to 90°C (0.5°C/min). X*:2',4'-BNANC(N-Me)-mC |
[0146] [Table 5-3]
Table 5-3. Sequence selective triplex-formation of 2',4'-BNA
NC oligonucleotides.
| target: |
5'- d (TTTTTmCTZTmCTmCTmCT) - 3'
5'-d(GCTAAAAAGAMAGAGAGATCG)-3'
3' -d(CGATTTTTCTNTCTCTCTAGC) · 5' |
| Z |
Tm (ΔTm- Tm(mismatch)- Tm(match) ) (°C) |
| M·N- A·T |
G·C |
C·G |
T·A |
| natural-T |
43 |
21 (-22) |
25(-18) |
18 (-25) |
| ⑥ X [2',4'-BNANC (N-Me)] |
50 |
24(-26) |
22 (-28) |
14 (-36) |
| ⑱ Y [2',4'-BNANC (N-H)] |
55 |
30 (-25) |
28 (-27) |
25 (-30) |
| Conditions: 140 mM KCl, 7 mM sodium phosphate buffer (pH 7.0), each strand 1.5 µM,
5°C to 90°C (0.5°C/min). C: 2'-deoxy-5-methylcytidine. |
[0147] As shown in Table 5, the oligonucleotide analogues (6) to (11) and (18) to (21) of
the present invention were found to have an excellent triplex-forming capacity. Their
sequence selectivity was also superior to that of the natural antisense strand. Thus,
they are believed to be very useful for the antigene method as well.
Experimental Example 3: Measurement of enzyme resistance
[0148] Natural (DNA oligonucleotide) and nonnatural oligonucleotides shown below were examined
for resistance to exonuclease which degrades the oligonucleotide from the 3'-side.
[0149] 1) Each oligonucleotide and snake venom phosphodiesterase (Boehringer Mannheim) as
3'-exonuclease were added, at concentrations of 25 mg/mL and 0.5 mg/mL, into 400 mL
of 50 mM Tris-HCl buffer (pH 8.0) containing 10 mM MgCl
2, and the mixture was held at 37°C.
[0150] 2) After a constant period of time, the survival rate of each oligonucleotide was
measured by HPLC.
[0151] The sequences of the oligonucleotides used in the measurement are shown below.
[0153]

[0154] where when X is a DNA monomer, the oligonucleotide is a completely natural DNA oligonucleotide,
and the oligonucleotide containing other nucleotide analogue is a partially nonnatural
oligonucleotide; moreover, the oligonucleotide analogue with X being 2',4'-BNA
NC(N-Me) is the oligonucleotide analogue of the present invention.
Changes over time in the survival rates of the respective oligonucleotides, measured
by HPLC, are shown in Table 6 and Fig. 1.
[0155] In Table 6 and Fig. 1, "% of intact oligonucleotide" refers to the survival rate
(%) (HPLC determination) of the undegraded oligonucleotide at measurement time points
to the undegraded oligonucleotide at 0 time point.
[0156]
[Table 6]
| Evaluation of enzyme resistance |
| oligonucleotide |
% of intact oligonucleotide |
| 0min |
5min |
10min |
20min |
40min |
90min |
| D-oligo |
100 |
0 |
0 |
0 |
0 |
0 |
| Z',4'-BNA |
100 |
37 |
24 |
5 |
1 |
0 |
| 5-aligo |
100 |
94 |
92 |
91 |
83 |
70 |
| 2',4'-BNANC |
100 |
100 |
99 |
98 |
94 |
80 |
[0157] The results of Table 6 and Fig. 1 show that the oligonucleotide analogue of the present
invention had excellent enzyme resistance as compared with natural and other nonnatural
oligonucleotides.
[Sequence Listing]
[0158]
<110> ImanishiTakeshi
<120> Novel Artificial Nucleic Acids of N-O Bond Crosslinkage Type
<130> 1-352-17
<160> 22
<210> 1
<211> 12
<212> DNA
<213> Artificial Sequence
<220>
<221> modified_base
<222>
<223> Antisense
<400> 1 gcgttntttgct
<210> 2
<211> 12
<212> DNA
<213> Artificial Sequence
<220>
<221> modified_base
<222>
<223> Antisense
<400> 2 gcgttntntgct
<210> 3
<211> 12
<212> DNA
<213> Artificial Sequence
<220>
<221> modified_base
<222>
<223> Antisense
<400> 3 gcgntntntgct
<210> 4
<211> 12
<212> DNA
<213> Artificial Sequence
<220>
<221> modified_base
<222>
<223> Antisense
<400> 4 gcgttnnntgct
<210> 5
<211> 10
<212> DNA
<213> Artificial Sequence
<220>
<221> modified_base
<222>
<223> Antisense
<400> 5 gcgnnnnnngct
<210> 6
<211> 15
<212> DNA
<213> Artificial Sequence
<220>
<221> modified_base
<222>
<223> Antisense
<400> 6 tttttntntntntnt
<210> 7
<211> 15
<212> DNA
<213> Artificial Sequence
<220>
<221> modified_base
<222>
<223> Antisense
<400> 7 ttttnntntnnntnt
<210> 8
<211> 15
<212> DNA
<213> Artificial Sequence
<220>
<221> modified_base
<222>
<223> Antisense
<400> 8 tttttnnnnntntnt
<210> 9
<211> 15
<212> DNA
<213> Artificial Sequence
<220>
<221> modified_base
<222>
<223> Antisense
<400> 9 ntntnnntnnnnnnt
<210> 10
<211> 15
<212> DNA
<213> Artificial Sequence
<220>
<221> modified_base
<222>
<223> Antisense
<400> 10 tnttnntntnnntnt
<210> 11
<211> 15
<212> DNA
<213> Artificial Sequence
<220>
<221> modified_base
<222>
<223> Antisense
<400> 11 ntttnnttnntnnnt
<210> 12
<211> 10
<212> DNA
<213> Artificial Sequence
<220>
<221> modified_base
<222>
<223> Antisense
<400> 12 ttttttttnt
<210> 13
<211> 12
<212> DNA
<213> Artificial Sequence
<220>
<221> modified_base
<222>
<223> Antisense
<400> 13 gcgttntttgct
<210> 14
<211> 12
<212> DNA
<213> Artificial Sequence
<220>
<221> modified_base
<222>
<223> Antisense
<400> 14 gcgttntntgct
<210> 15
<211> 12
<212> DNA
<213> Artificial Sequence
<220>
<221> modified_base
<222>
<223> Antisense
<400> 15 gcgntntntgct
<210> 16
<211> 12
<212> DNA
<213> Artificial Sequence
<220>
<221> modified_base
<222>
<223> Antisense
<400> 16 gcgttnnntgct
<210> 17
<211> 12
<212> DNA
<213> Artificial Sequence
<220>
<221> modified_base
<222>
<223> Antisense
<400> 17 gcgnnnnnngct
<210> 18
<211> 15
<212> DNA
<213> Artificial Sequence
<220>
<221> modified_base
<222>
<223> Antisense
<400> 18 tttttntntntntnt
<210> 19
<211> 15
<212> DNA
<213> Artificial Sequence
<220>
<221> modified_base
<222>
<223> Antisense
<400> 19 ttttnntntnnntnt
<210> 20
<211> 15
<212> DNA
<213> Artificial Sequence
<220>
<221> modified_base
<222>
<223> Antisense
<400> 20 tttttnnnnntntnt
<210> 21
<211> 15
<212> DNA
<213> Artificial Sequence
<220>
<221> modified_base
<222>
<223> Antisense
<400> 21 ntntnnntnnnnnnt
<210> 22
<211> 10
<212> DNA
<213> Artificial Sequence
<220>
<221> modified_base
<222>
<223> Antisense
<400> 22 ttttttttnt
1. A compound of the following general formula (I) and a salt thereof:

where Base represents an aromatic heterocyclic group or aromatic hydrocarbon ring
group optionally having a substituent,
R
1 and R
2 are identical or different, and each represent a hydrogen atom, a protective group
for a hydroxyl group for nucleic acid synthesis, an alkyl group, an alkenyl group,
a cycloalkyl group, an aryl group, an aralkyl group, an acyl group, a sulfonyl group,
a silyl group, a phosphate group, a phosphate group protected with a protective group
for nucleic acid synthesis, or -P(R
4)R
5 [where R
4 and R
5 are identical or different, and each represent a hydroxyl group, a hydroxyl group
protected with a protective group for nucleic acid synthesis, a mercapto group, a
mercapto group protected with a protective group for nucleic acid synthesis, an amino
group, an alkoxy group having 1 to 5 carbon atoms, an alkylthio group having 1 to
5 carbon atoms, a cyanoalkoxy group having 1 to 6 carbon atoms, or an amino group
substituted by an alkyl group having 1 to 5 carbon atoms],
R
3 represents a hydrogen atom, an alkyl group, an alkenyl group, a cycloalkyl group,
an aryl group, an aralkyl group, an acyl group, a sulfonyl group, or a functional
molecule unit substituent, and
m denotes an integer of 0 to 2, and n denotes an integer of 1 to 3.
2. The compound and the salts thereof according to claim 1, wherein R1 is a hydrogen atom, an aliphatic acyl group, an aromatic acyl group, an aliphatic
or aromatic sulfonyl group, a methyl group substituted by one to three aryl groups,
a methyl group substituted by one to three aryl groups having an aryl ring substituted
by a lower alkyl, lower alkoxy, halogen, or cyano group, or a silyl group.
3. The compound and the salt thereof according to claim 1, wherein R1 is a hydrogen atom, an acetyl group, a benzoyl group, a methanesulfonyl group, a
p-toluenesulfonyl group, a benzyl group, a p-methoxybenzyl group, a trityl group,
a dimethoxytrityl group, a monomethoxytrityl group, or a tert-butyldiphenylsilyl group.
4. The compound and the salts thereof according to any one of claims 1 to 3, wherein
R2 is a hydrogen atom, an aliphatic acyl group, an aromatic acyl group, an aliphatic
or aromatic sulfonyl group, a methyl group substituted by one to three aryl groups,
a methyl group substituted by one to three aryl groups having an aryl ring substituted
by a lower alkyl, lower alkoxy, halogen, or cyano group, a silyl group, a phosphoroamidite
group, a phosphonyl group, a phosphate group, or a phosphate group protected with
a protective group for nucleic acid synthesis.
5. The compound and the salt thereof according to any one of claims 1 to 3, wherein R2 is a hydrogen atom, an acetyl group, a benzoyl group, a methanesulfonyl group, a
p-toluenesulfonyl group, a benzyl group, a p-methoxybenzyl group, a tert-butyldiphenylsilyl
group, -P(OC2H4CN)(N(i-Pr)2), -P(OCH3) (N(i-Pr)2) , a phosphonyl group, or a 2-chlorophenyl- or 4-chlorophenylphosphate group.
6. The compound and the salt thereof according to any one of claims 1 to 5, wherein R3 is a hydrogen atom, a phenoxyacetyl group, an alkyl group having 1 to 5 carbon atoms,
an alkenyl group having 1 to 5 carbon atoms, an aryl group having 6 to 14 carbon atoms,
a methyl group substituted by one to three aryl groups, a lower aliphatic or aromatic
sulfonyl group such as a methanesulfonyl group or a p-toluenesulfonyl group, an aliphatic
acyl group having 1 to 5 carbon atoms such as an acetyl group, or an aromatic acyl
group such as a benzoyl group.
7. The compound and the salt thereof according to any one of claims 1 to 6, wherein the
functional molecule unit substituent as R3 is a fluorescent or chemiluminescent labeling molecule, a nucleic acid incision activity
functional group, or an intracellular or nuclear transfer signal peptide.
8. The compound and the salt thereof according to any one of claims 1 to 7, wherein Base
is a purin-9-yl group, a 2-oxopyrimidin-1-yl group, or a purin-9-yl group or a 2-oxopyrimidin-1-yl
group having a substituent selected from the following α group:
α group: A hydroxyl group, a hydroxyl group protected with a protective group for
nucleic acid synthesis, an alkoxy group having 1 to 5 carbon atoms, a mercapto group,
a mercapto group protected with a protective group for nucleic acid synthesis, an
alkylthio group having 1 to 5 carbon atoms, an amino group, an amino group protected
with a protective group for nucleic acid synthesis, an amino group substituted by
an alkyl group having 1 to 5 carbon atoms, an alkyl group having 1 to 5 carbon atoms,
and a halogen atom.
9. The compound and the salt thereof according to any one of claims 1 to 8, wherein Base
is 6-aminopurin-9-yl (i.e., adeninyl), 6-aminopurin-9-yl having the amino group protected
with a protective group for nucleic acid synthesis, 2,6-diaminopurin-9-yl, 2-amino-6-chloropurin-9-yl,
2-amino-6-chloropurin-9-yl having the amino group protected with a protective group
for nucleic acid synthesis, 2-amino-6-fluoropurin-9-yl, 2-amino-6-fluoropurin-9-yl
having the amino group protected with a protective group for nucleic acid synthesis,
2-amino-6-bromopurin-9-yl, 2-amino-6-bromopurin-9-yl having the amino group protected
with a protective group for nucleic acid synthesis, 2-amino-6-hydroxypurin-9-yl (i.e.,
guaninyl), 2-amino-6-hydroxypurin-9-yl having the amino group protected with a protective
group for nucleic acid synthesis, 6-amino-2-methoxypurin-9-yl, 6-amino-2-chloropurin-9-yl,
6-amino-2-fluoropurin-9-yl, 2,6-dimethoxypurin-9-yl, 2,6-dichloropurin-9-yl, 6-mercaptopurin-9-yl,
2-oxo-4-amino-1,2-dihydropyrimidin-1-yl (i.e., cytosinyl), 2-oxo-4-amino-1,2-dihydropyrimidin-1-yl
having the amino group protected with a protective group for nucleic acid synthesis,
2-oxo-4-amino-5-fluoro-1,2-dihydropyrimidin-1-yl, 2-oxo-4-amino-5-fluoro-1,2-dihydropyrimidin-1-yl
having the amino group protected with a protective group for nucleic acid synthesis,
4-amino-2-oxo-5-chloro-1,2-dihydropyrimidin-1-yl, 2-oxo-4-methoxy-1,2-dihydropyrimidin-1-yl,
2-oxo-4-mercapto-1,2-dihydropyrimidin-1-yl, 2-oxo-4-hydroxy-1,2-dihydropyrimidin-1-yl
(i.e., uracilyl), 2-oxo-4-hydroxy-5-methyl-1,2-dihydropyrimidin-1-yl (i.e., thyminyl),
4-amino-5-methyl-2-oxo-1,2-dihydropyrimidin-1-yl (i.e., 5-methylcytosinyl), or 4-amino-5-methyl-2-oxo-1,2-dihydropyrimidin-1-yl
having the amino group protected with a protective group for nucleic acid synthesis.
10. The compound and the salt thereof according to any one of claims 1 to 9, wherein m
is 0, and n is 1.
11. An oligonucleotide analogue, as a DNA oligonucleotide or RNA oligonucleotide analogue,
containing one or two or more of one or more types of unit structures of nucleoside
analogues represented by the following general formula (II), or a pharmacologically
acceptable salt thereof, provided that a form of linking between respective nucleosides
in the oligonucleotide analogue may contain one or two or more phosphorothioate bonds
[-OP(O)(S
-)O-] aside from a phosphodiester bond [-OP(O
2-)O-] identical with that in a natural nucleic acid, and if two or more of one or more
types of these structures are contained, Base may be identical or different between
these structures.

where Base represents an aromatic heterocyclic group or aromatic hydrocarbon ring
group optionally having a substituent,
R
3 represents a hydrogen atom, an alkyl group, an alkenyl group, a cycloalkyl group,
an aryl group, an aralkyl group, an acyl group, a sulfonyl group, a silyl group, or
a functional molecule unit substituent, and
m denotes an integer of 0 to 2, and n denotes an integer of 1 to 3.
12. The oligonucleotide analogue or the pharmacologically acceptable salt thereof according
to claim 11, wherein R3 is a hydrogen atom, a phenoxyacetyl group, an alkyl group having 1 to 5 carbon atoms,
an alkenyl group having 1 to 5 carbon atoms, an aryl group having 6 to 14 carbon atoms,
a methyl group substituted by one to three aryl groups, a lower aliphatic or aromatic
sulfonyl group such as a methanesulfonyl group or a p-toluenesulfonyl group, an aliphatic
acyl group having 1 to 5 carbon atoms such as an acetyl group, or an aromatic acyl
group such as a benzoyl group.
13. The oligonucleotide analogue or the pharmacologically acceptable salt thereof according
to any one of claims 11 to 12, wherein the functional molecule unit substituent as
R3 is a fluorescent or chemiluminescent labeling molecule, a nucleic acid incision activity
functional group, or an intracellular or nuclear transfer signal peptide.
14. The oligonucleotide analogue or the pharmacologically acceptable salt thereof according
to any one of claims 11 to 13, wherein Base is a purin-9-yl group, a 2-oxopyrimidin-1-yl
group, or a purin-9-yl group or a 2-oxopyrimidin-1-yl group having a substituent selected
from the following α group:
α group: A hydroxyl group, a hydroxyl group protected with a protective group for
nucleic acid synthesis, an alkoxy group having 1 to 5 carbon atoms, a mercapto group,
a mercapto group protected with a protective group for nucleic acid synthesis, an
alkylthio group having 1 to 5 carbon atoms, an amino group, an amino group protected
with a protective group for nucleic acid synthesis, an amino group substituted by
an alkyl group having 1 to 5 carbon atoms, an alkyl group having 1 to 5 carbon atoms,
and a halogen atom.
15. The oligonucleotide analogue or the pharmacologically acceptable salt thereof according
to any one of claims 11 to 14, wherein Base is 6-aminopurin-9-yl (i.e. adeninyl), 6-aminopurin-9-yl having the amino
group protected with a protective group for nucleic acid synthesis, 2,6-diaminopurin-9-yl,
2-amino-6-chloropurin-9-yl, 2-amino-6-chloropurin-9-yl having the amino group protected
with a protective group for nucleic acid synthesis, 2-amino-6-fluoropurin-9-yl, 2-amino-6-fluoropurin-9-yl
having the amino group protected with a protective group for nucleic acid synthesis,
2-amino-6-bromopurin-9-yl, 2-amino-6-bromopurin-9-yl having the amino group protected
with a protective group for nucleic acid synthesis, 2-amino-6-hydroxypurin-9-yl (i.e.,
guaninyl), 2-amino-6-hydroxypurin-9-yl having the amino group protected with a protective
group for nucleic acid synthesis, 6-amino-2-methoxypurin-9-yl, 6-amino-2-chloropurin-9-yl,
6-amino-2-fluoropurin-9-yl, 2,6-dimethoxypurin-9-yl, 2,6-dichloropurin-9-yl, 6-mercaptopurin-9-yl,
2-oxo-4-amino-1,2-dihydropyrimidin-1-yl (i.e., cytosinyl), 2-oxo-4-amino-1,2-dihydropyrimidin-1-yl
having the amino group protected with a protective group for nucleic acid synthesis,
2-oxo-4-amino-5-fluoro-1,2-dihydropyrimidin-1-yl, 2-oxo-4-amino-5-fluoro-1,2-dihydropyrimidin-1-yl
group having the amino group protected with a protective group for nucleic acid synthesis,
4-amino-2-oxo-5-chloro-1,2-dihydropyrimidin-1-yl, 2-oxo-4-methoxy-1,2-dihydropyrimidin-1-yl,
2-oxo-4-mercapto-1,2-dihydropyrimidin-1-yl, 2-oxo-4-hydroxy-1,2-dihydropyrimidin-1-yl
(i.e., uracilyl), 2-oxo-4-hydroxy-5-methyl-1,2-dihydropyrimidin-1-yl (i.e., thyminyl),
4-amino-5-methyl-2-oxo-1,2-dihydropyrimidin-1-yl (i.e., 5-methylcytosinyl), or 4-amino-5-methyl-2-oxo-1,2-dihydropyrimidin-1-yl
having the amino group protected with a protective group for nucleic acid synthesis.
16. The oligonucleotide analogue or the pharmacologically acceptable salt thereof according
to any one of claims 11 to 15, wherein m is 0, and n is 1.
1. Verbindung der allgemeinen Formel (I) und ein Salz davon:

worin Base eine aromatische heterocyclische Gruppe oder eine aromatische Kohlenwasserstoffringgruppe,
die gegebenenfalls einen Substituenten hat, darstellt,
R
1 und R
2 identisch oder unterschiedlich sind und jeweils ein Wasserstoffatom, eine Schutzgruppe
für eine Hydroxylgruppe zur Nukleinsäuresynthese, eine Alkylgruppe, eine Alkenylgruppe,
eine Cycloalkylgruppe, eine Arylgruppe, eine Aralkylgruppe, eine Acylgruppe, eine
Sulfonylgruppe, eine Silylgruppe, eine Phosphatgruppe, eine Phosphatgruppe, geschützt
mit einer Schutzgruppe zur Nukleinsäuresynthese, oder -P(R
4)R
5 [worin R
4 und R
5 identisch oder unterschiedlich sind und jeweils eine Hydroxylgruppe, eine Hydroxylgruppe,
geschützt mit einer Schutzgruppe zur Nukleinsäuresynthese, eine Mercaptogruppe, eine
Mercaptogruppe, geschützt mit einer Schutzgruppe zur Nukleinsäuresynthese, eine Aminogruppe,
eine Alkoxygruppe mit 1 bis 5 Kohlenstoffatomen, eine Alkylthiogruppe mit 1 bis 5
Kohlenstoffatomen, eine Cyanoalkoxygruppe mit 1 bis 6 Kohlenstoffatomen oder eine
Aminogruppe, substituiert mit einer Alkylgruppe mit 1 bis 5 Kohlenstoffatomen, darstellen]
darstellen;
R
3 ein Wasserstoffatom, eine Alkylgruppe, eine Alkenylgruppe, eine Cycloalkylgruppe,
eine Arylgruppe, eine Aralkylgruppe, eine Acylgruppe, eine Sulfonylgruppe oder einen
funktionellen Moleküleinheitssubstituenten darstellt und
m eine ganze Zahl von 0 bis 2 bezeichnet und n eine ganze Zahl von 1 bis 3 bezeichnet.
2. Verbindung und Salze davon gemäß Anspruch 1, wobei R1 ein Wasserstoffatom, eine aliphatische Acylgruppe, eine aromatische Acylgruppe, eine
aliphatische oder aromatische Sulfonylgruppe, eine Methylgruppe, substituiert mit
1 bis 3 Arylgruppen, eine Methylgruppe, substituiert mit 1 bis 3 Arylgruppen, welche
einen mit einer Niederalkyl-, Niederalkoxy-, Halogen- oder Cyanogruppe substituierten
Arylring haben, oder eine Silylgruppe ist.
3. Verbindung und Salz davon gemäß Anspruch 1, wobei R1 ein Wasserstoffatom, eine Acetylgruppe, eine Benzoylgruppe, eine Methansulfonylgruppe,
eine p-Toluolsulfonylgruppe, eine Benzylgruppe, eine p-Methoxybenzylgruppe, eine Tritylgruppe,
eine Dimethoxytritylgruppe, eine Monomethoxytritylgruppe oder eine tert-Butyldiphenylsilylgruppe
ist.
4. Verbindung und die Salze davon gemäß einem der Ansprüche 1 bis 3, wobei R2 ein Wasserstoffatom, eine aliphatische Acylgruppe, eine aromatische Acylgruppe, eine
aliphatische oder aromatische Sulfonylgruppe, eine Methylgruppe, substituiert mit
1 bis 3 Arylgruppen, eine Methylgruppe, substituiert mit 1 bis 3 Arylgruppen, welche
einen mit einer Nierderalkyl-, Niederalkoxy-, Halogen- oder Cyanogruppe substituierten
Arylring haben, eine Silylgruppe, eine Phosphoramiditgruppe, eine Phosphonylgruppe,
eine Phosphatgruppe oder eine Phosphatgruppe, geschützt mit einer Schutzgruppe zur
Nukleinsäuresynthese, ist.
5. Verbindung und Salz davon gemäß einem der Ansprüche 1 bis 3, wobei R2 ein Wasserstoffatom, eine Acetylgruppe, eine Benzoylgruppe, eine Methansulfonylgruppe,
eine p-Toluolsulfonylgruppe, eine Benzylgruppe, eine p-Methoxybenzylgruppe, eine tert-Butyldiphenylsilylgruppe,
-P(OC2H4CN)(N-(i-Pr)2), -P(OCH3)(N-(i-Pr)2), eine Phosphonylgruppe oder eine 2-Chlorphenyl- oder 4-Chlorphenylphosphatgruppe
ist.
6. Verbindung und Salz davon gemäß einem der Ansprüche 1 bis 5, wobei R3 ein Wasserstoffatom, eine Phenoxyacetylgruppe, eine Alkylgruppe mit 1 bis 5 Kohlenstoffatomen,
eine Alkenylgruppe mit 1 bis 5 Kohlenstoffatomen, eine Arylgruppe mit 6 bis 14 Kohlenstoffatomen,
eine Methylgruppe, die mit 1 bis 3 Arylgruppen substituiert ist, eine niedere aliphatische
oder aromatische Sulfonylgruppe, zum Beispiel eine Methansulfonylgruppe oder eine
p-Toluolsulfonylgruppe, eine aliphatische Acylgruppe mit 1 bis 5 Kohlenstoffatomen,
zum Beispiel eine Acetylgruppe, oder eine aromatische Acylgruppe, zum Beispiel eine
Benzoylgruppe, ist.
7. Verbindung und Salz davon gemäß einem der Ansprüche 1 bis 6, wobei der funktionelle
Moleküleinheitssubstituent als R3 ein fluoreszentes oder chemilumineszentes Markierungsmolekül, eine funktionelle Gruppe
mit Nukleinsäure-Inzisionsaktivität oder ein intrazelluläres oder nukleäres Transfersignalpeptid
ist.
8. Verbindung und Salz davon gemäß einem der Ansprüche 1 bis 7, wobei die Base eine Purin-9-yl-Gruppe,
eine 2-Oxopyrimidin-1-yl-Gruppe oder eine Purin-9-yl-Gruppe oder eine 2-Oxopyrimidin-1-yl-Gruppe
ist, die einen Substituenten hat, der aus der folgenden α-Gruppe ausgewählt ist:
α-Gruppe: eine Hydroxylgruppe, eine Hydroxylgruppe, geschützt mit einer Schutzgruppe
zur Nukleinsäuresynthese, eine Alkoxygruppe mit 1 bis 5 Kohlenstoffatomen, eine Mercaptogruppe,
eine Mercaptogruppe, geschützt mit einer Schutzgruppe zur Nukleinsäuresynthese, eine
Alkylthiogruppe mit 1 bis 5 Kohlenstoffatomen, eine Aminogruppe, eine Aminogruppe,
geschützt mit einer Schutzgruppe zur Nukleinsäuresynthese, eine Aminogruppe, substituiert
mit einer Alkylgruppe mit 1 bis 5 Kohlenstoffatomen, eine Alkylgruppe mit 1 bis 5
Kohlenstoffatomen und ein Halogenatom.
9. Verbindung und Salz davon gemäß einem der Ansprüche 1 bis 8, wobei die Base 6-Aminopurin-9-yl
(d. h. Adeninyl), 6-Aminopurin-9-yl, das die Aminogruppe mit einer Schutzgruppe zur
Nukleinsäuresynthese geschützt hat, 2,6-Diaminopurin-9-yl, 2-Amino-6-chlorpurin-9-yl,
2-Amino-6-chlorpurin-9-yl, das die Aminogruppe mit einer Schutzgruppe zur Nukleinsäuresynthese
geschützt hat, 2-Amino-6-fluorpurin-9-yl, 2-Amino-6-fluorpurin-9-yl, das die Aminogruppe
mit einer Schutzgruppe zur Nukleinsäuresynthese geschützt hat, 2-Amino-6-brompurin-9-yl,
2-Amino-6-brompurin-9-yl, das die Aminogruppe mit einer Schutzgruppe zur Nukleinsäuresynthese
geschützt hat, 2-Amino-6-hydroxypurin-9-yl (d. h.
Guaninyl), 2-Amino-6-hydroxypurin-9-yl, das die Aminogruppe mit einer Schutzgruppe
zur Nukleinsäuresynthese geschützt hat, 6-Amino-2-methoxypurin-9-yl, 6-Amino-2-chlorpurin-9-yl,
6-Amino-2-fluorpurin-9-yl, 2,6-Dimethoxypurin-9-yl, 2,6-Dichlorpurin-9-yl, 6-Mercaptopurin-9-yl,
2-Oxo-4-amino-1,2-dihydropyrimidin-1-yl (d. h. Cytosinyl), 2-Oxo-4-amino-1,2-dihydropyrimidin-1-yl,
das die Aminogruppe mit einer Schutzgruppe zur Nukleinsäuresynthese geschützt hat,
2-Oxo-4-amino-5-fluor-1,2-dihydropyrimidin-1-yl, 2-Oxo-4-amino-5-fluor-1,2-dihydropyrimidin-1-yl,
das die Aminogruppe mit einer Schutzgruppe zur Nukleinsäuresynthese geschützt hat,
4-Amino-2-oxo-5-chlor-1,2-dihydropyrimidin-1-yl, 2-Oxo-4-methoxy-1,2-dihydropyrimidin-1-yl,
2-Oxo-4-mercapto-1,2-dihydropyrimidin-1-yl, 2-Oxo-4-hydroxy-1,2-dihydropyrimidin-1-yl
(d. h. Uracilyl), 2-Oxo-4-hydroxy-5-methyl-1,2-dihydropyrimidin-1-yl (d. h. Thyminyl),
4-Amino-5-methyl-2-oxo-1,2-dihydropyrimidin-1-yl (d. h. 5-Methylcytosinyl) oder 4-Amino-5-methyl-2-oxo-1,2-dihydropyrimidin-1-yl,
das die Aminogruppe mit einer Schutzgruppe zur Nukleinsäuresynthese geschützt hat.
10. Verbindung und Salz gemäß einem der Ansprüche 1 bis 9, wobei m 0 ist und n 1 ist.
11. Oligonukleotid-Analogon als DNA-Oligonukleatid- oder RNA-Oliganukleotid-Analogon,
enthaltend eine oder zwei oder mehr eines Typs oder mehrerer Typen von Einheitsstrukturen
von Nukleosid-Analoga, dargestellt durch die folgende allgemeine Formel (II), oder
ein pharmazeutisch verträgliches Salz davon, mit der Maßgabe, dass eine Verknüpfungsform
zwischen jeweiligen Nukleosiden in dem Oligonukleotid-Analogon eine oder zwei oder
mehr Phosphorthioat-Bindungen [-OP(O)(S
-)O-] abgesehen von einer Phosphodiester-Bindung [-OP(O
2-)P-], identisch mit der in einer natürlichen Nukleinsäure, enthalten kann, und wenn
zwei oder mehr eines Typs oder mehrere Typen dieser Strukturen enthalten sind, Base
zwischen diesen Strukturen identisch oder unterschiedlich sein kann.

worin Base eine aromatische heterocyclische Gruppe oder eine aromatische Kohlenwasserstoffringgruppe,
die gegebenenfalls einen Substituenten hat, darstellt,
R
3 ein Wasserstoffatom, eine Alkylgruppe, eine Alkenylgruppe, eine Cycloalkylgruppe,
eine Arylgruppe, eine Aralkylgruppe, eine Acylgruppe, eine Sulfonylgruppe, eine Silylgruppe
oder einen funktionellen Moleküleinheitssubstituenten darstellt und
m eine ganze Zahl von 0 bis 2 bezeichnet und n eine ganze Zahl von 1 bis 3 bezeichnet.
12. Oligonukleotid-Analogon oder pharmakologisch verträgliches Salz davon gemäß Anspruch
11, wobei R3 ein Wasserstoffatom, eine Phenoxyacetylgruppe, eine Alkylgruppe mit 1 bis 5 Kohlenstoffatomen,
eine Alkenylgruppe mit 1 bis 5 Kohlenstoffatomen, eine Arylgruppe mit 6 bis 14 Kohlenstoffatomen,
eine Methylgruppe, die mit 1 bis 3 Arylgruppen substituiert ist, eine niedere aliphatische
oder aromatische Sulfonylgruppe, zum Beispiel eine Methansulfonylgruppe oder eine
p-Toluolsulfonylgruppe, eine aliphatische Acylgruppe mit 1 bis 5 Kohlenstoffatomen,
zum Beispiel eine Acetylgruppe, oder eine aromatische Acylgruppe, zum Beispiel eine
Benzoylgruppe, ist.
13. Oligonukleotid-Analogon oder pharmakologisch verträgliches Salz davon gemäß einem
der Ansprüche 11 bis 12, wobei der funktionelle Moleküleinheitssubstituent als R3 ein fluoreszentes oder chemilumineszentes Markierungsmolekül, eine funktionelle Gruppe
mit Nukleinsäure-Inzisionsaktivität oder ein intrazelluläres oder nukleäres Transfersignalpeptid
ist.
14. Oligonukleotid-Analogon oder pharmakologisch verträgliches Salz davon gemäß einem
der Ansprüche 11 bis 13, wobei Base eine Purin-9-yl-Gruppe, eine 2-Oxopyrimidin-1-yl-Gruppe
oder eine Purin-9-yl-Gruppe oder eine 2-Oxopyrimidin-1-yl-Gruppe ist, die einen Substituenten
hat, der aus der folgenden α-Gruppe ausgewählt ist:
α-Gruppe: eine Hydroxylgruppe, eine Hydroxylgruppe, geschützt mit einer Schutzgruppe
zur Nukleinsäuresynthese, eine Alkoxygruppe mit 1 bis 5 Kohlenstoffatomen, eine Mercaptogruppe,
eine Mercaptogruppe, geschützt mit einer Schutzgruppe zur Nukleinsäuresynthese, eine
Alkylthiogruppe mit 1 bis 5 Kohlenstoffatomen, eine Aminogruppe, eine Aminogruppe,
geschützt mit einer Schutzgruppe zur Nukleinsäuresynthese, eine Aminogruppe, substituiert
mit einer Alkylgruppe mit 1 bis 5 Kohlenstoffatomen, eine Alkylgruppe mit 1 bis 5
Kohlenstoffatomen und ein Halogenatom.
15. Oligonukleotid-Analogon oder pharmakologisch verträgliches Salz davon gemäß einem
der Ansprüche 11 bis 14, wobei Base 6-Aminopurin-9-yl (d. h. Adeninyl), 6-Aminopurin-9-yl,
das die Aminogruppe mit einer Schutzgruppe zur Nukleinsäuresynthese geschützt hat,
2,6-Diaminopurin-9-yl, 2-Amino-6-chlorpurin-9-yl, 2-Amino-6-chlorpurin-9-yl, das die
Aminogruppe mit einer Schutzgruppe zur Nukleinsäuresynthese geschützt hat, 2-Amino-6-fluorpurin-9-yl,
2-Amino-6-fluorpurin-9-yl, das die Aminogruppe mit einer Schutzgruppe zur Nukleinsäuresynthese
geschützt hat, 2-Amino-6-brompurin-9-yl, 2-Amino-6-brompurin-9-yl, das die Aminogruppe
mit einer Schutzgruppe zur Nukleinsäuresynthese geschützt hat, 2-Amino-6-hydroxypurin-9-yl
(d. h. Guaninyl), 2-Amino-6-hydroxypurin-9-yl, das die Aminogruppe mit einer Schutzgruppe
zur Nukleinsäuresynthese geschützt hat, 6-Amino-2-methoxypurin-9-yl, 6-Amino-2-chlorpurin-9-yl,
6-Amino-2-fluorpurin-9-yl, 2,6-Dimethoxypurin-9-yl, 2,6-Dichlorpurin-9-yl, 6-Mercaptopurin-9-yl,
2-Oxo-4-amino-1,2-dihydropyrimidin-1-yl (d. h. Cytosinyl), 2-Oxo-4-Amino-1,2-dihydropyrimidin-1-yl,
das die Aminogruppe mit einer Schutzgruppe zur Nukleinsäuresynthese geschützt hat,
2-Oxo-4-amino-5-fluor-1,2-dihydropyrimidin-1-yl, 2-Oxo-4-amino-5-fluor-1,2-dihydropyrimidin-1-yl,
das die Aminogruppe mit einer Schutzgruppe zur Nukleinsäuresynthese geschützt hat,
4-Amino-2-oxo-5-chlor-1,2-dihydropyrimidin-1-yl, 2-Oxo-4-methoxy-1,2-dihydropyrimidin-1-yl,
2-Oxo-4-mercapto-1,2-dihydropyrimidin-1-yl, 2-Oxo-4-hydroxy-1,2-dihydropyrimidin-1-yl
(d. h. Uracilyl), 2-Oxo-4-hydroxy-5-methyl-1,2-dihyddropyrimidin-1-yl (d. h. Thyminyl),
4-Amino-5-methyl-2-oxo-1,2-dihydropyrimidin-1-yl (d. h. 5-Methylcytosinyl) oder 4-Amino-5-methyl-2-oxo-1,2-dihydropyrimidin-1-yl,
das die Aminogruppe mit einer Schutzgruppe zur Nukleinsäuresynthese geschützt hat.
16. Oligonukleotid-Analogon oder pharmakologisch verträgliches Salz davon gemäß einem
der Ansprüche 11 bis 15, wobei m 0 ist und n 1 ist.
1. Composé de formule générale (I) suivante, ou sel d'un tel composé :

dans laquelle formule
- "Base" représente un groupe hétérocyclique aromatique ou un groupe cyclique hydrocarboné
aromatique, en option porteur d'un substituant ;
- R1 et R2 représentent des entités identiques ou différentes et représentent chacun un atome
d'hydrogène, un groupe hydroxy-protecteur pour synthèse d'acide nucléique, un groupe
alkyle, alcényle, cycloalkyle, aryle ou aralkyle, un groupe acyle, sulfonyle, silyle
ou phosphate, un groupe phosphate protégé par un groupe protecteur pour synthèse d'acide
nucléique, ou un groupe de formule -P(R4)R5 où R4 et R5 représentent des entités identiques ou différentes et représentent chacun un groupe
hydroxyle, un groupe hydroxyle protégé par un groupe protecteur pour synthèse d'acide
nucléique, un groupe sulfhydryle, un groupe sulfhydryle protégé par un groupe protecteur
pour synthèse d'acide nucléique, un groupe amino, un groupe alcoxy comportant 1 à
5 atomes de carbone, un groupe alkylthio comportant 1 à 5 atomes de carbone, un groupe
cyano-alcoxy comportant 1 à 6 atomes de carbone, ou un groupe amino portant un substituant
alkyle comportant 1 à 5 atomes de carbone ;
- R3 représente un atome d'hydrogène, un groupe alkyle, alcényle, cycloalkyle, aryle ou
aralkyle, un groupe acyle ou sulfonyle, ou un substituant qui est un reste de molécule
fonctionnelle ;
- l'indice m est un nombre entier valant de 0 à 2 ;
- et l'indice n est un nombre entier valant de 1 à 3.
2. Composé et ses sels, conformes à la revendication 1, dans lesquels R1 représente un atome d'hydrogène, un groupe acyle aliphatique, un groupe acyle aromatique,
un groupe sulfonyle aliphatique ou aromatique, un groupe méthyle portant 1 à 3 substituant(s)
aryle, un groupe méthyle portant 1 à 3 substituant(s) aryle à cycle aryle porteur
d'un substituant alkyle inférieur, alcoxy inférieur, halogéno ou cyano, ou un groupe
silyle.
3. Composé et ses sels, conformes à la revendication 1, dans lesquels R1 représente un atome d'hydrogène, un groupe acétyle, un groupe benzoyle, un groupe
méthane-sulfonyle, un groupe para-toluène-sulfonyle, un groupe benzyle, un groupe
; para-méthoxy-benzyle, un groupe trityle, un groupe diméthoxy-trityle, un groupe
monométhoxy-trityle, ou un groupe tertiobutyl-diphényl-silyle.
4. Composé et ses sels, conformes à l'une des revendications 1 à 3, dans lesquels R2 représente un atome d'hydrogène, un groupe acyle aliphatique, un groupe acyle aromatique,
un groupe sulfonyle aliphatique ou aromatique, un groupe méthyle portant 1 à 3 substituant(s)
aryle, un groupe méthyle portant 1 à 3 substituant(s) aryle à cycle aryle porteur
d'un substituant alkyle inférieur, alcoxy inférieur, halogéno ou cyano, un groupe
silyl, un groupe phosphoro-amidite, un groupe phosphonyle, un groupe phosphate, ou
un groupe phosphate protégé par un groupe protecteur pour synthèse d'acide nucléique.
5. Composé et ses sels, conformes à l'une des revendications 1 à 3, dans lesquels R2 représente un atome d'hydrogène, un groupe acétyle, un groupe benzoyle, un groupe
méthane-sulfonyle, un groupe para-toluène-sulfonyle, un groupe benzyle, un groupe
para-méthoxy-benzyle, un groupe tertiobutyl-diphényl-silyle, un groupe de formule
-P(OC2H4CN)(N(i-Pr)2) ou -P(OCH3)(N(i-Pr)2), un groupe phosphonyle, ou un groupe 2-chloro-phényl-phosphate ou 4-chloro-phényl-phosphate.
6. Composé et ses sels, conformes à l'une des revendications 1 à 5, dans lesquels R3 représente un atome d'hydrogène, un groupe phénoxy-acétyle, un groupe alkyle comportant
1 à 5 atomes de carbone, un ,groupe alcényle comportant 1 à 5 atomes de carbone, un
groupe aryle comportant 6 à 14 atomes de carbone, un groupe méthyle portant 1 à 3
substituant(s) aryle, un groupe sulfonyle aliphatique inférieur ou aromatique comme
un groupe méthane-sulfonyle ou un groupe para-toluène-sulfonyle, un groupe acyle aliphatique
comportant 1 à 5 atomes de carbone comme un groupe acétyle, ou un groupe acyle aromatique
comme un groupe benzoyle.
7. Composé et ses sels, conformes à l'une des revendications 1 à 6, dans lesquels le
substituant reste de molécule fonctionnelle représenté par R3 est le reste d'une molécule de marquage par' fluorescence ou chimioluminescence,
d'un fragment fonctionnel à activité d'incision d'acide nucléique, ou d'un peptide
signal de transfert nucléaire ou intracellulaire.
8. Composé et ses sels, conformes à l'une des revendications 1 à 7, dans lesquels "Base"
représente un groupe purin-9-yle, un groupe 2-oxo-pyrimidin-1-yle, ou un groupe purin-9-yle
ou 2-oxo-pyrimidin-1-yle porteur d'un substituant choisi dans l'ensemble alpha suivant
:
Ensemble alpha :
un groupe hydroxyle, un groupe hydroxyle protégé par un groupe protecteur pour synthèse
d'acide nucléique, un groupe alcoxy comportant 1 à 5 atomes de carbone, un groupe
sulfhydryle, un groupe sulfhydryle protégé par un groupe protecteur pour synthèse
d'acide nucléique, un groupe alkylthio comportant 1 à 5 atomes de carbone, un groupe
amino,
un groupe amino protégé par un groupe protecteur pour synthèse d'acide nucléique,
un groupe amino portant un substituant alkyle comportant 1 à 5 atomes de carbone,
un groupe alkyle comportant 1 à 5 atomes de carbone, et un atome d'halogène.
9. Composé et ses sels, conformes à l'une des revendications 1 à 8, dans lesquels "Base"
représente un groupe 6-amino-purin-9-yle (ou adéninyle), un groupe 6-amino-purin-9-yle dont le groupe amino est protégé par un groupe protecteur pour synthèse d'acide
nucléique, un groupe 2,6-diamino-purin-9-yle, un groupe 2-amino-6-chloro-purin-9-yle,
un groupe 2-amino-6-chloro-purin-9-yle dont le groupe amino est protégé par un groupe
protecteur pour synthèse d'acide nucléique, un groupe 2-amino-6-fluoro-purin-9-yle,
un groupe 2-amino-6-fluoro-purin-9-yle dont le groupe amino est protégé par un groupe
protecteur pour synthèse d'acide nucléique, un groupe 2-amino-6-bromo-purin-9-yle,
un groupe 2-amino-6-bromo-purin-9-yle dont le groupe amino est protégé par un groupe
protecteur pour synthèse d'acide nucléique, un groupe 2-amino-6-hydroxy-purin-9-yle
(ou guaninyle), un groupe 2-amino-6-hydroxy-purin-9-yle dont le groupe amino est protégé
par un groupe protecteur pour synthèse d'acide nucléique, un groupe 6-amino-2-méthoxy-purin-9-yle,
6-amino-2-chloro-purin-9-yle, 6-amino-2-fluoro-purin-9-yle, 2,6-diméthoxy-purin-9-yle,
2,6-dichloro-purin-9-yle ou 6-mercapto-purin-9-yle, un groupe 2-oxo-4-amino-1,2-dihydro-pyrimidin-1-yle
(ou cytosinyle), un groupe 2-oxo-4-amino-1,2-dihydro-pyrimidin-1-yle dont le groupe
amino est protégé ; par un groupe protecteur pour synthèse d'acide nucléique, un groupe
2-oxo-4-amino-5-fluoro-1,2-dihydro-pyrimidin-1-yle, un groupe 2-oxo-4-amino-5-fluoro-1,2-dihydro-pyrimidin-1-yle
dont le groupe amino est protégé par un groupe protecteur pour synthèse d'acide nucléique,
un groupe 4-amino-2-oxo-5-chloro-1,2-dihydro-pyrimidin-1-yle, 2-oxo-4-méthoxy-1,2-dihydro-pyrimidin-1-yle,
2-oxo-4-mercapto-1,2-dihydro-pyrimidin-1-yle, 2-oxo-4-hydroxy-1,2-dihydro-pyrimidin-1-yle
(ou uracilyle), 2-oxo-4-méthoxy-5-méthyl-1,2-dihydro-pyrimidin-1-yle (ou thiminyle),
ou 4-amino-5-méthyl-2-oxo-1,2-dihydro-pyrimidin-1-yle (ou 5-méthyl-cytosinyle), ou
un groupe 4-amino-5'-méthyl-2-oxo-1,2-dihydro-pyrimidin-1-yle dont le groupe amino
est protégé par un groupe protecteur pour synthèse d'acide nucléique.
10. Composé et ses sels, conformes à l'une des revendications 1 à 9, dans lesquels l'indice
m vaut 0 et l'indice n vaut 1.
11. Analogue d'oligonucléotide, tel un analogue d'oligonucléotide d'ADN ou un analogue
d'oligonucléotide d'ARN, comportant un ou deux motifs ou plus, d'un ou plusieurs types
de structure, d'analogues de nucléosides représentés par la formule générale (II)
donnée ci-dessous, ou sel pharmacologiquement admissible d'un tel analogue, étant
entendu que dans ledit analogue de nucléotide, un mode de raccord entre nucléosides
peut comporter une ou deux liaisons de type phosphorothioate -OP(O)(S
-)O- ou plus, à côté d'une liaison de type phosphodiester -OP(O
2-)O- identique à ce qui existe dans un acide nucléique naturel, et que si deux motifs
ou plus d'un ou plusieurs types de ces structures y sont présents, les entités représentées
par "Base" peuvent être identiques ou différentes d'une structure à l'autre :

dans laquelle formule
- "Base" représente un groupe hétérocyclique aromatique ou un groupe cyclique hydrocarboné
aromatique, en option porteur d'un substituant ;
- R3 représente un atome d'hydrogène, un groupe alkyle, alcényle, cycloalkyle, aryle ou
aralkyle, un groupe acyle ou sulfonyle, un groupe silyle, ou un substituant qui est
un reste de molécule fonctionnelle ;
- l'indice m est un nombre entier valant de 0 à 2 ;
- et l'indice n est un nombre entier valant de 1 à 3.
12. Analogue d'oligonucléotide ou sel pharmacologiquement admissible d'un tel analogue,
conforme à la revendication 11, dans lequel R3 représente un atome d'hydrogène, un groupe phénoxy-acétyle, un groupe alkyle comportant
1 à 5 atomes de carbone, un groupe, alcényle comportant 1 à 5 atomes de carbone, un
groupe aryle comportant 6 à 14 atomes de carbone, un groupe méthyle portant 1 à 3
substituant(s) aryle, un groupe sulfonyle aliphatique inférieur ou aromatique comme
un groupe méthane-sulfonyle ou un groupe para-toluène-sulfonyle, un groupe acyle aliphatique
comportant 1 à 5 atomes de carbone comme un groupe acétyle, ou un groupe acyle aromatique
comme un groupe benzoyle.
13. Analogue d'oligonucléotide ou sel pharmacologiquement admissible d'un tel analogue,
conforme à l'une des revendications 11 à 12, dans lequel le substituant reste de molécule
fonctionnelle représenté par R3 est le reste d'une molécule de marquage par fluorescence ou chimioluminescence, d'un
fragment fonctionnel à activité d'incision d'acide nucléique, ou d'un peptide signal
de transfert nucléaire ou intracellulaire.
14. Analogue d'oligonucléotide ou sel pharmacologiquement admissible d'un tel analogue,
conforme à l'une des revendications 11 à 13, dans lequel "Base" représente un groupe
purin-9-yle, un groupe 2-oxo-pyrimidin-l-yle, ou un groupe purin-9-yle ou 2-oxo-pyrimidin-1-yle
porteur d'un substituant choisi dans l'ensemble alpha suivant :
Ensemble alpha :
un groupe hydroxyle, un groupe hydroxyle protégé par un groupe protecteur pour synthèse
d'acide nucléique, un groupe alcoxy comportant 1 à 5 atomes de carbone, un groupe
sulfhydryle, un groupe sulfhydryle protégé par un groupe protecteur, pour synthèse
d'acide nucléique, un groupe alkylthio comportant 1 à 5 atomes de carbone, un groupe
amino, un groupe amino protégé par un groupe protecteur pour synthèse d'acide nucléique,
un groupe amino portant un substituant alkyle comportant 1 à 5 atomes de carbone,
un groupe alkyle comportant 1 à 5 atomes de carbone, et un atome d'halogène.
15. Analogue d'oligonucléotide ou sel pharmacologiquement admissible d'un tel analogue,
conforme à l'une des revendications 11 à 14, dans lequel "Base" représente un groupe
6-amino-purin-9-yle (ou adéninyle), un groupe 6-amino-purin-9-yle dont le groupe amino
est protégé par un groupe protecteur pour synthèse d'acide nucléique, un groupe 2,6-diamino-purin-9-yle,
un groupe 2-amino-6-chloro-purin-9-yle, un groupe 2-amino-6-chloro-purin-9-yle dont
le groupe amino est protégé par un groupe protecteur pour synthèse d'acide nucléique,
un groupe 2-amino-6-fluoro-purin-9-yle, un groupe 2-amino-6-fluoro-purin-9-yle dont
le groupe amino est protégé par un groupe protecteur pour synthèse d'acide nucléique,
un groupe 2-amino-6-bromo-purin-9-yle, un groupe 2-amino-6-bromo-purin-9-yle dont
le groupe amino est protégé par un groupe protecteur pour synthèse d'acide nucléique,
un groupe 2-amino-6-hydroxy-purin-9-yle (ou guaninyle), un groupe 2-amino-6-hydroxy-purin-9-yle
dont le groupe amino est protégé par un groupe protecteur pour synthèse d'acide nucléique,
un groupe 6-amino-2-méthoxy-purin-9-yle, 6-amino-2-chloro-purin'-9-yle, 6-amino-2-fluoro-purin-9-yle,
2,6-diméthoxy-purin-9-yle, 2,6-dichloro-purin-9-yle ou 6-mercapto-purin-9-yle, un
groupe 2-oxo-4-amino-1,2-dihydro-pyrimidin-1-yle (ou cytosinyle), un groupe 2-oxo-4-amino-1,2-dihydro-pyrimidin-1-yle
dont le groupe amino est protégé par un groupe protecteur pour synthèse d'acide nucléique,
un groupe 2-oxo-4-amino-5-fluoro-1,2-dihydro-pyrimidin-1-yle, un groupe 2-oxo-4-amino-5-fluoro-1,2-dihydro-pyrimidin-1-yle
dont le groupe amine est protégé par un groupe protecteur pour synthèse d'acide nucléique,
un groupe 4-amino-2-oxo-5-chloro-1,2-dihydro-pyrimidin-1-yle, 2-oxo-4-méthoxy-1,2-dihydro-pyrimidin-1-yle,
2-oxo-4-mercapto-1,2-dihydro-pyrimidin-1-yle, 2-oxo-4-hydroxy-1,2-dihydro-pyrimidin-1-yle
(ou uracilyle), 2-oxo-4-méthoxy-5-méthyl-1,2-dihydro-pyrimidin-1-yle (ou thiminyle),
ou 4-amino-5-méthyl-2-oxo-1,2-dihydro-pyrimidin-1-yle (ou 5-méthyl-cytosinyle), ou
un groupe 4-amino-5-méthyl-2-oxo-1,2-dihydro-pyrimidin-1-yle dont le groupe amino
est protégé par un groupe protecteur pour synthèse d'acide nucléique.
16. Analogue d'oligonucléotide ou sel pharmacologiquement admissible d'un tel analogue,
conforme à l'une des revendications 11 à 15, dans lequel l'indice m vaut 0 et l'indice
n vaut 1.