BACKGROUND INFORMATION
[0001] Theilerioses are a group of disease syndromes affecting cattle, sheep, goats and
domestic buffalo caused by tick-borne haemo-protozoan parasites in the genus
Theileria. The most economically important diseases include East Coast fever (ECF), Mediterranean
fever, and malignant theileriosis. ECF, caused by
Theileria parva (T: parva), affects 30 million cattle in eastern, central and southern Africa. Mediterranean
fever caused by
T. annulata occurs in North Africa, southern Europe, Near East, Middle East and many parts of
Far East Asia with a population of 200 million cattle and buffalo at risk. Malignant
theileriosis caused by
T. lestoquardi affects sheep and goats in southeastern Europe, North Africa, the Near and Middle
East and southern Russia and neighboring States. These parasites belong to the same
api-complexan group as
Plasmodium falciparum, Toxoplasma gondii, Cytoxauzoon spp, Eimeria spp and
Babesia spp, with a life-cycle having the arthropod and mammalian components in which sexual and
asexual stages develop, respectively. The pathogenic stages of
Theileria parasites differ.
T.
parva causes a lymphoproliferative disorder in which schizont-infected lymphoblasts are
responsible for the pathogenesis of the disease.
T. parva is known to cause a lymphoproliferative response in infected animals that resembles
a variety of T-cell lynlphomas, leukemias and other lymphocytic cancers. On the other
hand, anaemic disease caused by
T. lesloquardi and
T. sergenti is due to piroplasm-infected erythrocytes, while both the schizont and piroplasm
of
T. annulata are pathogenic resulting in lymphoproliferative and anaemic syndromes, respectively.
[0002] Currently, theilerioses are controlled largely by tick control using acaricides,
such as the chlortetracyclines (first used as a prophylactic), hydroxynaphthoquinone,
menoctone and its two analogues, parvaquone and bupavaquone, and through "infection
and treatment" vaccination protocols of animals at risk. Such vaccination protocols
are deemed effective in that an animal vaccinated in this manner will not develop
ECF disease upon subsequent exposure to infectious
T. parva. Due to cost and problems of tick resistance and environmental pollution, control
of these diseases through acaricidal destruction of ticks is not sustainable.
[0003] Vaccination, on the other hand, while effective, presents with certain shortcomings
associated with the use of live vaccines. Owing to the ease of transmission of
T. annulata, infected blood was originally used to immunise cattle by employing parasites of low
virulence as the immunizing agent. However, such immunisations were still accompanied
by clinically-detectable infection episodes. With the advent of
in vitro cultivation of
T. annulata (
Sharma et al. (1998) Vet. Parasito/. 79, 135041) and the development of bulk culture techniques in the 1960s, significant progress
was made in realising a more practical immunisation strategy. Currently, passage-attenuated
cultures of
T. annulata are routinely used in national vaccination programs in affected countries. By contrast,
similar efforts to immunise cattle against
T. parva have been unsuccessful. This is attributed to the failure of attenuated
T. parva parasites to induce immunity. In addition, much higher numbers of
T. parva-infected cells are required to infect cattle reliably, since the schizonts of
T. parva transfer at a low frequency and donor cells get rejected before successful transfer.
T. lestoquardi has also been cultivated
in vitro and studies have shown that attenuated parasites can be used to immunise animals
with a degree of success.
[0004] Given the unsuccessful attempts to immunise cattle witch attenuated
T. parva, subsequent efforts have focused on the use of virulent parasites with accompanying
chemotherapy. The rationale of this infection and treatment method (ITM) is to allow
the infection to establish and suppress development of frank clinical disease by administering
theileriacidal drugs. Animals thus immunised were found to be protected against the
development of disease when exposed to the homologous parasite. This vaccination strategy
has undergone successive refinements including the use of cryopreserved triturated
tick stabilites containing sporozoites (the parasite stage infective for cattle lymphocytes)
to standardise the immunisation-infection dose, as well as simultaneous drug administration.
Further improvement of this immunisation approach has involved the identification
and use of a combination of parasite stocks to broaden the immunising spectrum of
the vaccine against several field
T. parva parasite populations. The use of local parasite stocks to immunise in areas where
they have been isolated is also practised. ITM immunisation against
T. parva has been tested extensively under laboratory and field conditions and is now deployed
in the affected region to control ECF.
[0005] ITM has a number of practical limitations that hinder its application as a sustainable
control measure against ECF in those geographical areas most affected by the disease.
Being live, it requires a cold refrigerator chain, which is impractical in Africa.
ITM can also cause clinical disease if drug application is inadequate and it has the
potential to introduce new parasite strains in areas under the vaccination campaign.
The cost (US$10-20 per immunisation) of this current vaccine is well beyond the budget
of poor farmers with cattle afflicted by ECF, due to both the cost of the drugs and
the requirement for a trained veterinarian to administer the vaccine. Because of these
concerns associated with the ITM vaccine protocol, a great deal of investment has
been put in research work to develop a vaccine that will be sustainable and affordable.
[0006] Antigens of many parasitic protozoans that induce a protective antibody response
against the development of disease have been identified. For example, the major merozoite
surface protein of
Plasmodium species has been shown to be a target of varying degrees of protective immunity against
the asexual blood stages in rodent and human malaria. Vaccination of mice with purified
P230, the major merozoite surface protein of the rodent malaria
Plasmodium yoelii, has resulted in reduced parasitemias in comparison to controls upon intravenous challenge
with a lethal dose of parasitized erythrocytes (
Holder et al. 1981. Nature 294:361). Mice have also been protected against
P. yoelii by passive transfer of a monoclonal antibody (Mab) specific for P230 (
Majarian et al. 1984. J. Immunol. 132:3131). Mice have also been immunized against (rodent malaria)
Plasmodium chabaudi adami challenge, by passive immunization with a monoclonal antibody specific for the homologous
250-kDa molecule of this
Plasmodium species (
Lew et al. 1989. Proc. Natl. Acad. Sci. USA 86:3768).
[0007] A 67 kDa glycoprotein (p67) from the surface of the
T. parva sporozoite has been isolated (
U.S. Patent Number 5273744) and used in a variety of immunization protocols, with little success reported so
far, in the development of pratical levels of immune-mediated disease resistance.
However, cattle recovering from a single infection with
T. parva sporozoites resist infection upon homologous challenge. Such animals have weak antibody
and T cell responses to p67. There is a need to identify
T. parva antigens that can induce antigen-specific class I MHC-restricted CD8
+ cytotoxic T lymphocytes (CTLs).
SUMMARY OF THE INVENTION
[0009] In one aspect, the present invention provides an isolated polypeptide comprising
a sequence represented by SEQ ID NO:1, or a variant thereof having greater than 90%
identity thereto and having the same or similar biological activity as SEQ ID NO:
1, or any one of SEQ ID Nos 4 to 7.
[0010] In a further aspect, the present inventions provides a pharmaceutical composition,
comprising a polypeptide of the present invention and a pharmaceutically acceptable
carrier.
[0011] There is provided, in another aspect of the present invention, an immunogenic composition,
comprising a polypeptide of the present invention and, optionally, an adjuvant, the
composition being immunogenic.
[0012] In another aspect, the present invention provides a vaccine, comprising one or more
polypeptides of the present invention and, optionally, an adjuvant; wherein said polypeptide
is immunogenic.
[0013] There is provided, in a further aspect, a method for producing a polypeptide which
stimulates a
T. parva-antigen specific cytotoxic lymphocyte (CTL), comprising culturing a host cell,
wherein said host cell comprises a vector comprising a recombinant construct comprising
a polynucleotide encoding a polypeptide according to the present invention, operably
linked to an expression control sequence, wherein said host cell is cultured under
conditions effective for producing a polypeptide encoded by the polynucleotide, and
harvesting the polypeptide.
[0014] Further, there is provided in another aspect of the present invention an antibody
specific for the polypeptide of the present invention.
[0015] There is provided, in a further aspect of the present invention, a kit for detecting
the presence of
T. parva in a sample suspected of containing
T. parva, or for purifying
T. parva from a sample containing
T. parva, comprising an antibody according to the present invention.
[0016] In another aspect, the present invention provides the use of a polypeptide according
to the present invention, or a vector comprising a recombinant construct comprising
a polynucleotide encoding a polypeptide according the present invention, operably
linked to an expression control sequence, or a host cell comprising a vector comprising
a recombinant construct comprising a polynucleotide encoding a polypeptide according
to the present invention, operably linked to an expression control sequence, in the
preparation of a medicament for the prevention and/or treatment of infection by
T. parva.
[0017] The present invention provides, in another aspect, a method for preparing a polyclonal
antibody, comprising immunizing an animal with one or more polypeptides of the present
invention; and recovering serum from the animal.
[0018] The present invention provides, in a further aspect, a method for preparing a polyclonal
antibody, comprising immunizing an animal with a host cell; wherein said host cell
comprises a vector comprising a recombinant construct comprising a polynucleotide
encoding a polypeptide according to the present invention, operably linked to an expression
control sequence; and recovering serum from the animal.
[0019] In another aspect, the present invention provides a method for preparing a monoclonal
antibody, comprising:
- (a) immunizing an animal with a polypeptide according to the present invention,
- (b) recovering cells from the animal which produce antibody that binds to the polypeptide,
- (c) preparing a hybridoma with the cells isolated in (b), and
- (d) recovering a monoclonal antibody from the hybridoma that binds to the polypeptide
in (a).
[0020] In a further aspect, the present invention provides a method for preparing a monoclonal
antibody, comprising:
- (a) immunizing an animal with a host cell; wherein said host cell comprises a vector
comprising a recombinant construct comprising a polynucleotide encoding a polypeptide
according to the present invention, operably linked to an expression control sequence,
- (b) recovering cells from the animal which produce antibody that binds to a polypeptide
produced by the host cell,
- (c) preparing hybridomas with the cells isolated in (b), and
- (d) recovering a monoclonal antibody from the hybridoma that binds to the polypeptide
in (b).
[0021] There is provided, in a further aspect of the present invention, the use of an antibody
according to the present invention in the preparation of a composition for the diagnosis
of infection by
T. parva in a sample.
[0022] There is provided, in another aspect of the present invention, a vaccine comprising
a vector comprising a recombinant construct comprising a polynucleotide encoding a
polypeptide according to the present invention, operably linked to an expression control
sequence.
[0023] In another aspect, the present invention provides a vector comprising a recombinant
construct comprising a polynucleotide encoding a polypeptide according to the present
invention, operably linked to an expression control sequence.
[0024] The description relates,
e.g., to methods for the identification of parasite antigens, such as
Theileria parva antigens, that stimulate antigen-specific cytotoxic T lymphocyte (CTL) responses
(
e.g. for inducing immunoprotection against
T. parva in bovine species); and compositions identified by this method (
e.g. that can be used to generate a protective response in cattle, to resist the development
of ECF disease, when subsequently challenged with infectious
T. parva material). More particularly, the method includes steps wherein polynucleotide sequences
encoding candidate antigens are identified by conventional nucleic sequence alignment
and parsing programs that have been fine-tuned using polynucleotide sequence information
employing polynucleotide sequences known to encode
T. parva antigens that stimulate CTLs in an antigen-specific manner. Candidate antigens and
epitopes, and the nucleotide sequences that encode or result in the production of
these candidate antigens and/or epitopes, that were identified, can be used,
e.g., to stimulate CTLs and to successfully immunize cattle against infection with subsequent
exposure to
T. parva expressing such antigens.
[0025] In further refinement of the antigenic properties of the polypeptides encoded by
nucleotide sequences identified in such a manner, the nucleotide sequences are transfected
into cells wherein the stimulation of responding lymphocytes to cells transfected
by these nucleotides encoding parasite antigen is measured in a high throughput manner,
by the release of soluble factors, such as gamma interferon, using either an antibody-elispot
assay or a bioassay employing endothelial cells. The use of immortalized skin fibroblast
(iSF) cells from outbred animals that have recovered from exposure, as antigen presenting
cells, confirms the antigen identification, especially where cloned bovine MHC class
I genes are not available for co-transfection into COS-7 cells.
[0026] One aspect mentioned herein is an isolated polypeptide, comprising a sequence represented
by one of SEQ ID NO:1 through SEO ID NO:7. Such isolated polypeptides are sometimes
referred to herein as "polypeptides described herein." In embodiments, an isolated
polypeptide described herein is in detectable amounts in isolates of
T. parva; and/or comprises a
T. parva antigen.
[0027] Another aspect mentioned herein is a pharmaceutical composition, which comprises
a polypeptide described herein and a pharmaceutically acceptable carrier or excipicent.
Another aspect mentioned herein is an immunogenic composition, which comprises one
or more polypeptides described herein and, optionally, an adjuvant. The immunogenic
composition may stimulate cytotoxic T cells specific to the polypeptide; and/or comprise
an epitope that stimulates
T. parva- specific cytotoxic T cells. Another aspect mentioned herein is a vaccine, which comprises
one or more polypeptides described herein and, optionally, an adjuvant. In an embodiment,
the vaccine protects an animal against
T. parva infection.
[0028] Another aspect mentioned herein is an isolated polynucleotide comprising:
- (a) a sequence represented by one of SEQ ID NO:25 through SEQ ID NO: 31;
- (b) a sequence which is at least about 90% identical to a sequence of (a);
- (c) a sequence which hybridizes under conditions of high stringency to a polynucleotide
which comprises a sequence of (a);
- (d) a sequence which encodes a polypeptide represented by SEQ ID NO:1 through SEQ
ID NO:7; or
- (e) a complement of any of (a), (b), (c) or (d). Such isolated polynucleotides are
sometimes referred to herein as "polynucleotides described herein."
[0029] Other aspects described herein include a pharmaceutical composition comprising a
polynucleotide described herein and a pharmaceutically acceptable carrier or excipient;
a recombinant construct comprising a polynucleotide described herein, which is operably
linked to an expression control sequence; and a vector comprising such a construct.
The term "operably linked" refers to a functional linkage between a nucleic acid expression
control sequence (such as a promoter, or array of transcription factor binding sites)
and a second nucleic acid sequence, wherein the expression control sequence directs
transcription of the nucleic acid corresponding to the second sequence. A vector mentioned
herein may further comprise one or more sequences encoding a selectable marker; and
the vector may comprise a plasmid, a bacteriophage, a minichromosome or a eukaryotic
virus vector. The selectable marker can be a nucleotide sequence that, when incorporated
and expressed, provides resistance to an antibiotic such as geneticin (G418), penicillin,
tetracycline, or other types of selectable markers such as methotrexate resistance,
expression of a metallothionein gene or a luciferase gene. Another aspect mentioned
herein is a host cell (
e.g., a prokaryotic cell or a eukaryotic cell) which comprises a polynucleotide or a
vector described herein. Another aspect mentioned herein is a method for producing
a polypeptide which stimulates a
T. parva-antigen specific cytotoxic lymphocyte (CTL), comprising culturing a host cell mentioned
herein under conditions effective for producing a polypeptide encoded by the polynucleotide,
and harvesting the polypeptide
[0030] Another aspect mentioned herein is an antibody (
e.g., a polyclonal antibody or a monoclonal antibody) specific for a polypeptide described
herein. In an embodiment, the antibody is coupled to a carrier and/or a label.
[0031] Another aspect mentioned herein is a method for preparing a polyclonal antibody,
comprising immunizing a non-human animal with one or more polypeptides described herein
or with cells comprising polynucleotides or vectors described herein. Another aspect
mentioned herein is a method for preparing a monoclonal antibody, comprising (a) immunizing
a non-human animal with a polypeptide described herein; (b) recovering cells from
the non-human animal which produce antibody that binds to the polypeptide; (c) preparing
a hybridoma with the cells isolated in (b), and (d) recovering a monoclonal antibody
from the hybridoma that binds to the polypeptide in (a). Another aspect mentioned
herein is a method for preparing a monoclonal antibody, comprising: (a) immunizing
a non-human animal with a host cell comprising a polynucleotide or vector of the described
herein;(b) recovering cells from the non-human animal which produce antibody that
binds to a polypeptide produced by the host cell; (c) preparing hybridomas with the
cells isolated in (b), and (d) recovering a monoclonal antibody from the hybridoma
that binds to the polypeptide in (b).
[0032] Another aspect mentioned herein is a kit for detecting the presence of
T. parva in a sample suspected of containing
T. parva, or for purifying
T. parva from a sample containing
T. parva, comprising an antibody mentioned herein. Detection of
T. parva in a sample may require cell lysis or cell membrane solubilization by standards methods,
such as, but not limited to, the use of non-denaturing detergents or the like. The
kit may further comprise means for performing an enzyme-linked or Western blot assay
to detect the presence of
T.
parva; and/or means for binding the antibody to
T. parva in the sample, and for releasing the organism from the antibody.
[0033] Another aspect mentioned herein is a method for protecting an animal against infection
by
T. parva, comprising administering to the animal a polypeptide described herein under conditions
effective for the animal to generate a protective antibody against the polypeptide,
or effective for the animal to generate
T. parva-antigen-specific CTLs. Another aspect mentioned herein is a method for protecting
an animal against infection by
T. parva, comprising administering to the animal a cell comprising a polynucleotide or vector
of the described herein, under conditions effective for the animal to generate a protective
antibody against a polypeptide encoded by the polynucleotide (expressed from the polynucleotide),
or effective for the animal to generate
T. parva-antigen-specific CD4+ helper and CD8+ CTL responses. A "CD8+ CTL response" means
that the stimulation of the CD8+CTL can be detected by measuring the release of a
factor, such as a soluble factor or other response such as the lysis of antigen-displaying
cell.
[0034] Another aspect mentioned herein is a method for detecting a pathogenic protozoan
infection in a subject, comprising contacting peripheral blood monocytes from the
subject with peptide-antigen pulsed cytotoxic T lymphocytes, wherein the cytotoxic
T lymphocytes are obtained from an animal to which has been administered a polypeptides
described herein, under conditions effective for the animal to generate
T. parva-antigen-specific CTLs, or effective for the animal to generate
T. parva-antigen-specific CD4+ helper and CD8+ cytotoxic T lymphocyte responses. Another aspect
mentioned herein is a method for detecting
T. parva in a sample suspected of containing
T. parva, comprising detecting in the sample a polynucleotide described herein. Any of the
method mentioned herein, including these detection methods, may be high throughput
methods.
[0035] Another aspect mentioned herein is a method for identifying
T. parva in a sample suspected of containing
T. parva, comprising contacting the sample with an antibody mentioned herein, under conditions
effective for the antibody to bind specifically to its cognate antigen, and detecting
the presence of bound antibody. In embodiments mentioned herein, the detection is
carried out by enzyme immunoassay, radioimmunoassay, fluorescence immunoassay, flocculation,
particle agglutination, flow microfluorimetry, a competition assay, or
in situ chromogenic assay; the antibody is either a monoclonal antibody or a polyclonal antibody;
the assay is quantitative; or the assay is high through put.
[0036] Another aspect mentioned herein is a method for the identification of parasite antigens,
selected from candidate antigens, that are targets of cytotoxic T lymphocytes or other
immune responses, comprising co-culturing immortalized fibroblast cell lines transfected
with pooled cDNA harvested from a pathogen, with clones of lines of cytotoxic T cells,
generated in an animal that has been immunized, by infection and treatment with the
pathogen and assaying the supernatant from the co-culture for the presence of a soluble
factor, such as a cytokine,
e.g. a gamma interferon; the pathogen is a protozoan organism (
e.g. an organism in the genus
Theileria, such as
T. parva); the fibroblast cell line is of bovine origin; or the fibroblast cell line of bovine
origin displays bovine Class I, MHC antigens.
[0037] In another embodiment,
T. parva antigen encoding polynucleotides, a method for the identification of candidate parasite
antigens, that are targets of cytotoxic T lymphocytes or other immune responses, comprising
using conventional genome scanning and alignment methods such as "GlimmerM" and "phat"
in which sequence information of candidate antigens that cause stimulated of CTLs
is used to refine the genome scanning and alignment methods. Such sequence identity
may be optimized by sequence comparison and alignment algorithms known in the art
(see
Gribskov and Devereus, Sequence Analysis Primer, Stockton Press, 1991 and the references cited therein) and calculating the percent difference between
the nucleotides sequences by, for example, the Smith-Waterman algorithm as implemented
in the BESTFIT software program using default parameters (e.g., University of Wisconsin
Genetic Computing Group).
[0038] An additional embodiment mentioned herein is a method of using the nucleotide sequences,
that have been shown to encode
T. parva antigens which stimulate CTLs, to identify additional candidate CTL-stimulatory antigens
from nucleotide sequence information, such as sequence contigs or whole genome sequence
isolate from an organism using techniques such as hybridization under conditions of
high stringency, or under other conditions that allow the identification of sequences
with 95%-97% homology with known sequence.
[0039] As
T. parva is known to cause a lymphoproliferative response in infected animals that resembles
a variety of T-cell lymphomas, leukemias and other lymphocytic cancers the presently
identified
T. parva proteins, for example, could have utility in formulating an anticancer composition,
e.g., antigenic proteins could have utility in prevention schemes, whereby radioactively
labeled-antigens would compete for intracellular or extracellular binding sites in
order to destroy cells undergoing lymphoproliferation. The
T. parva antigens mentioned herein are also candidates for a method to prevent lymphoproliferation
by assisting in the identification and manufacture of small molecules that would manipulate
the signaling pathways targeted by parasite proteins.
DESCRIPTION OF THE DRAWINGS
[0040]
FIG. 1 is a graph that demonstrates IFN-gamma elispot detection of BoLA class I restricted
CTL responses to schizont infected cells. Autologous TpM were pre-incubated in elispot
plates with monoclonal antibodies specific for BoLA class I, BoLA class II or bovine
CD21 (isotype control) before the addition of schizont specific polyclonal CTL. Cells
were co-cultured for 20 hours before the plates were developed. IFN-gamma production
is presented as mean number of spot forming cells (SFC)/well.
FIG.2A is a graph that indicates the sensitivity of IFN-gamma elispot to detect CTL
recognition of schizont infected cells when the effects of varying the CTL input on
responses to TpM titrated in COS-7 cells was addressed; FIG.2B is a graph that indicates
the ability of the elispot test to detect responses to very small numbers of TpM,
using a CTL input of 10,000/well. FIG.2C shows the effect of titrating TpM in COS-7
cells, when autologous primary SF or iSF were examined and found to have no effect
on the background or sensitivity of the elispot assay. IFN-gamma production is presented
as mean number of spot forming cells (SFC)/well.
FIG. 3 is a graph showing the results generated when selected Tp2 transfected immortalized
skin fibroblast cells (iSF) were used to stimulate BW002, BW014 CD8+ polyclonal CTL
lines and D409 CTL clone #10. Recognition of selected gene #5 (also known as, Tp2)
transfected iSF by BW002 (BW2), BW014 (BW14) CD8+ polyclonal CTL lines and D409 CTL
clone #10 was measured by co-culture of transfected cells with CTLs. The iSF were
transfected with selected genes, cultured with CTL and recognition assessed by IFN-gamma
elispot. Responses are presented as mean numbers of spot forming cells (SFC)/well.
FIG. 4 is a graph indicating the lysis of Tp2 transfected autologous (BW002) and allogeneic
(BV050) iSF by the schizont specific BW002 polyclonal CD8+ CTL line. Tp5 transfected
autologous iSF also served as a negative control. BoLA class I restriction was assessed
by pre-incubating Tp2 transfected iSF with an anti-BoLA MHC Class I mAb (class I block).
Data are expressed as percent of cells that are lysed.
FIG. 5A, FIG. 5B, and FIG. 5C indicate Tp2 specific CD8+ T cell responses following
challenge of immune cattle. Three ECF immune cattle, 5A (BW002), 5B (BW013), and 5C
(BW014), from which schizont specific CTL lines had been generated and shown to recognize
Tp2, --were challenged with a lethal dose of T. parva (Muguga) sporozoites. Peripheral blood was collected daily between day 7 - 13 post-challenge,
and CD8+ T cells and monocytes purified. Responses to Tp2 peptides containing previously
identified CTL epitopes (positive or "+ve") or control peptides were assessed by co-culturing
CD8+ T cells and monocytes in the presence of 1mg/ml peptide and measuring the release
of IFN-gamma by Elispot. Responses to autologous TpM were included as a positive control.
Responses are presented as mean numbers of spot forming cells (SFC)/well.
FIG. 6 is a graph showing the mapping of Tp2 CTL epitopes using synthetic peptides.
Eighty-four 12mer peptides overlapping by two amino acids encompassing the full length
of Tp2 were synthesized and used at a final concentration of 1pg/ml for BW002 (BW2)
or 1ug/ml for BW013 (BW13), BW014 (BW14) & D409, to pulse autologous iSF. Recognition
of peptide pulsed iSF by CD8+ polyclonal lines from BW002 (BW2), BW013 (BW13), BW014
(BW14), and D409 CTL clone #10 was assessed by IFN-gamma-elispot. Significant responses
were observed against different sets of overlapping peptides suggesting a number of
unique, overlapping and shared CTL epitopes. IFN-gamma production is presented as
mean number of spot forming cells (SFC)/well.
FIG. 7 is a graph that illustrates the identification of Tp2 CTL epitopes using synthetic
9mer peptides. The 6 possible 9mer peptides derived from the epitope containing SEQ
ID. NO:11, FAQSLVCVLMKCRG were synthesized and used at a final concentration of 1ug/ml
to pulse autologous iSF. Recognition of peptide pulsed iSF by CD8+ polyclonal lines
from BW013 and BW014, and D409 CTL clone #10 assessed by IFN-gamma-elispot, indicated
that the peptide #. IFN-gamma production is presented as mean number of spot forming
cells (SFC)/well.
FIG. 8 is a graph of data indicating the lysis of Tp2 synthetic peptide pulsed autologous
iSF by the schizont specific D409 CTL clone #10. D409 iSF were pulsed overnight with
the Tp2 epitope containing 12mer peptide #77; (SEQ ID. NO:14) or a control Tp2 12mer
peptide #36; (SEQ ID NO:15) at final peptide concentration of 1ug/ml. Autologous and
allogeneic (4229) TpM were included as a positive and negative controls. Data are
expressed at percent of peptide-pulsed cells that were lysed.
FIG. 9 is a graph that indicates the lysis of Tp2 synthetic peptide pulsed autologous
iSF by the schizont specific BW014 polyclonal CD8+ CTL line. BW014 iSF were pulsed
overnight with the Tp2 epitope 9mer peptide #75, (SEQ ID NO: 16) or a control Tp2
9mer peptide #76, (SEQ ID NO:17) at final peptide concentration of 1ug/ml. Autologous
and allogeneic (F100) TpM were included as a positive and negative controls. Data
are: expressed at percent of peptide-pulsed cells that were lysed.
FIG. 10 shows the minimal length of the CTL-stimulating epitope Tp2.1, present within
the Tp2 polypeptide as established by using sets of overlapping peptides in an Elispot
assay. Autologous immortalized fibroblasts (iSF) or P815 cells, stably expressing
the BoLA Class I HD6 (P815-HD6) or JSP-1 (P815-JSP-1) were pulsed with overlapping
9-mer polypeptides represented by SEQ ID. NO: 4, 16, and 17 and the 8-mer SEQ ID NO:
18. Pulsed cells were tested for IFN-gamma release using the Elispot assay. Responses
are presented as mean numbers of spot forming cells (SFC)/well.
FIG. 11 shows the minimal length of the CTL-stimulating epitope Tp2.2, present within
the Tp2 polypeptide as established by using sets of overlapping peptides in an Elispot
assay. Autologous immortalized fibroblasts (iSF) or P815 cells, stably expressing
the BoLA Class I HD6 (P815-HD6) or JSP-1 (P815-JSP-1) were pulsed with overlapping
9-mer polypeptides represented by SEQ ID. NO: 5 (Tp2 Epitope 2 (Tp2.2)) and 16 (synthesized
peptide #75, amino acids residues 97-105 of Tp2), and the 8-mer SEQ ID NO: 21 (amino
acid residues 97-104 of Tp2). The peptides shown in the figure, from left to right,
are SEQ ID NO: 20, NO: 5 and NO: 16. Pulsed cells were tested for IFN-gamma release
using the Elispot assay. Responses are presented as mean numbers of spot forming cells
(SFC)/well.
FIG. 12 shows the minimal length of the CTL-stimulating epitope Tp2.3, present within
the Tp2 polypeptide as established by using sets of overlapping peptides in an Elispot
assay. Autologous immortalized fibroblasts (iSF) or P815 cells, stably expressing
the BoLA Class I HD6 (P815-HD6) or JSP-1 (P815-JSP-1) were pulsed with overlapping
10-mer polypeptides represented by SEQ ID. NO: 13 (a peptide of Tp2) and 20 (amino
acid residues 49-58 of Tp2), and the 11-mer SEQ ID NO: 6 (Tp2 epitope 3 (Tp2.3)).
The peptides shown in the figure, from left to right, are SEQ ID NO: 13, NO: 6 and
NO: 20. Pulsed cells were tested for IFN-gamma release using the Elispot assay. Responses
are presented as mean numbers of spot forming cells (SFC)/well.
FIG. 13 shows the minimal length of the CTL-stimulating epitope Tp2.4, present within
the Tp2 polypeptide as established by using sets of overlapping peptides in an Elispot
assay. Autologous immortalized fibroblasts (iSF) or P815 cells, stably expressing
the BoLA Class I HD6 (P815-HD6) or JSP-1 (P815-JSP-1) were pulsed with overlapping
12-mer polypeptides represented by SEQ ID. NO: 8 (a peptide of Tp2), 22 (amino acid
residues 97-104 of Tp2), 23 (amino acid residues 28-39 of Tp2) and the 11-mer SEQ
ID NO: 7 (Tp2 epitope 4 (Tp2.4)). The peptides shown in the figure, from left to right,
are SEQ ID NO: 22, NO: 8, NO: 23 and NO: 7. Pulsed cells were tested for IFN-gamma
release using the Elispot assay. Responses are presented as mean numbers of spot forming
cells (SFC)/well.
FIG. 14 is a graph that indicating the lysis of Tp2 peptide-pulsed autologous iSF
by TpM stimulated PBMC. BW002 PBMC were collected 14 days post-challenge and co-cultured
for 7 days with autologous TpM. Cells were tested for their ability to lyse Tp2 peptide
pulsed autologous iSF using a 51Chromium release assay. iSF were pulsed overnight with a Tp2 12mer peptide known to
contain a CTL epitope (#43; positive (+ve peptide)) or a control Tp2 12mer peptide
(#40; control peptide) at a concentration of 1ug/ml. Autologous and allogeneic (F100)
TpM were included as positive and negative controls. Data are expressed at percent
of peptide-pulsed cells that were lysed.
FIG. 15A and FIG. 15B represents a photograph of an agarose gel showing the expression
of T. parva Tp2 antigen protein. Recombinant protein was isolated by Ni-NTA agarose and run on
12% SDS-PAGE gels. In figure 15A the proteins that are present in the gel are stained
with Coomassie blue. In figure 15B an anti-His-tag antibody is used to specifically
stain the expressed Tp2-His-labelled protein (immunoblot).
FIG. 16 is a photograph of an SDS-PAGE (12.5%) analysis of over-expression of recombinant
Tp3 in E. coli. The complete ORF of Tp3 containing 5' BamHI and 3' Bgl II was PCR amplified and cloned into plasmid vector pQE-16 (Qiagen) from which DFHR
fragment was excised using BamH I and Bgl II. The rcombinant plasmid was transformed into E. coli JM109 and plated. Two colonies
(Tp3-1 and Tp3-2) were picked for over-expression as described in the "Example" section.
Tp3-1 was expressed in LB broth (Tp3-la) or in 2X YT (Tp3-1b) while Tp3-2 was expressed
only in LB broth. Aliquots of midi-preps of the cultures were separated using SDS-PAGE
(12.5%) gel electrophoresis. The proteins in the resultant gel were stained with Coomassie
blue. An irrelevant protein of 50 kDa was used as control (TLTF). Lane MW is the size
makers indicated in kiloDalton (kDa).
FIG. 17 is a photograph of an SDS-PAGE (12.5%) analysis of purified recombinant Tp6.
A partial fragment (70%) of Tp6 was PCR amplified and cloned into plasmid vector pQE-16
(Qiagen). The recombinant plasmid was transformed into E. coli JM109. A number of colonies were identified for over-expression. The protein was
purified using an anti-his-tag antibody and then analyzed using SDS-PAGE electrophoresis,
followed by staining of the proteins in the polyacrylamide gel with Coomassie blue.
Size markers are indicated in kiloDalton (kDa).
FIG. 18 indicates the level of CTL responses to several Tp antigens, following CP(Canary
Pox mediated)/MVA (modified Vaccinia Virus Ankara-vector mediated) immunization protocols.
The data indicates the production of T. parva antigen-specific CD8 (CTLs) in animals following immunization protocols with CanaryPox
viral vectors, expressing T. parva antigen. Responses are presented as mean numbers of spot forming cells (SFC)/well.
FIG. 19 indicates the level of CTL responses to several Tp antigens, following DNA/MVA
immunization protocols. The data indicates the production of T. parva antigen-specific CD8 (CTLs) in animals following immunization protocols with modified
Vaccinia (Ankara) viral vectors, expressing T. parva antigen. Responses are presented as mean numbers of spot forming cells (SFC)/well.
FIG. 20 indicates control data for CP/MVA and DNA/MVA immunization protocols, where
cattle were given phosphate buffered saline injections rather than Tp antigens. The
control experimental data for measuring the development of CTLs following immunization
indicates a lack of T parva, antigen-specific CD8+ cells in PBS immunized animals. Responses are presented as
mean numbers of spot forming cells (SFC)/well.
DETAILED DESCRIPTION
[0041] Class I MHC-restricted CD8
+ cytotoxic T lymphocytes (CTLs) are responsible for protecting cattle against a lethal
challenge with Theileria parva (
T. parva), sporozoites (Morrison, Taracha, and McKeever, 1995). These CTLs are directed at
schizont-infected cells, which they recognize and lyse. Schizont antigens that are
recognized by these CD8
+ CTLs are the prime candidates for inclusion into an effective sub-unit vaccine for
the prevention of East Coast Fever disease (ECF).
[0042] The examples herein illustrate the identification of a variety of antigens which
are suitable for use in subunit vaccines.
[0043] There is provided polynucleotides, and novel methods for their identification, which
encode proteins and peptides that are targets of antigen-specific cytotoxic CD8+ T
lymphocytes which have been shown to be protective against ECF infection in adoptive
cell transfer experiments. Experimental immunisation of cattle with these antigens
or recombinant viral vector cell systems producing these antigens have stimulated
the production of antigen-specific T cell responses in the immunized animals.
[0044] The proteins identified by the novel method can also be used to as antigens to stimulate
the production of Antibodies. Such antibodies are useful for the detection of the
presence of a stimulating antigen, in animals tissues and fluids. Presence of such
antigen would indicate infection of the animal by organisms producing or bearing,
the antigen. For example, in one embodiment mentioned herein infection of an animals
by
T. parva is detected by antibodies produced as a result of using peptides encoded by polynucleotide
sequences as antigens to stimulate the production of such antibodies.
[0045] The
T. parva nuclear genome consists of 4 chromosomes and is approximately 8.2 Mb in length. The
T. parva genome was sequenced using a whole genome shotgun strategy.
T. parva genomic DNA (Muguga clone) was sheared and cloned into plasmid vectors. Both ends
of randomly selected clones were sequenced. A total of 152,226 sequences with an average
read length of 623 nt were obtained, equivalent to 9.48X coverages assuming a genome
size of 10 Mb. Assembly of the sequences with "TIGR Assembler" produced a set of preliminary
contigs representing 95% of the genome sequence to begin the process of identification
of schizont antigens. The preliminary contigs were loaded into an annotation database
and subjected to an automated process that searched the
T. parva contigs against a nonredundant database of proteins extracted from GenBank (called
"nraa"). The search results were used to produce a set of
T. parva gene models that encoded proteins similar to those in other organisms. This set of
gene models and sequence data from 164 cDNA clones were used to train the gene finding
programs "GlimmerM" and "phat", which were subsequently run against all of the preliminary
contigs to produce gene models for the entire preliminary genome sequence. A program
called "Combiner" was then used to evaluate predicted gene models, cDNA and protein
alignments to produce consensus gene models.
[0046] The proteins encoded by the predicted
T. parva genes were subjected to a variety of analyses such as database searched ("blastp"),
predictions of signal peptides and signal anchors ("SignalP 2.0"), and transmembrane
domains ("TMHMM"). The results were reviewed and a set of about 55 genes encoding
candidate antigens were selected for screening for immunogenicity, as tested by stimulation
of cloned cytotoxic T cells lines. When these gene sequences were screened, this led
to the identification of antigens referred to herein as Tp2 (SEQ ID NO: 1), Tp3 (SEQ
ID NO: 2), and Tp6 (SEQ ID NO: 3). The nucleic acid sequences encoding Tp2, Tp3 and
Tp6 are represented by SEQ ID NOs: 25, 26 and 27, respectively.
[0047] The candidate antigens encoded by polynucleotide sequences, cloned from expressed
genes of
T. parva, were confirmed by the use of immortalized cloned bovine skin fibroblast cell lines
to stimulate the activation of cytotoxic CD8+ T lymphocytes by antigen when stimulation
is measured by the release of soluble factors, more specifically gamma interferon.
The description also relates to compositions isolated by methods including one or
more of these particular steps and the use of these compositions: to stimulate or
induce cytotoxic T cells, as diagnostic reagents for the detection of disease or an
immune response, in kits or high throughput "chip" methods or assay, for the detection
of or expression of, identical or homologous nucleic acids. In another preferred embodiment,
the antigens identified are useful for immunization of animals for the production
of CTLs that recognize
T. parva.
[0048] The present description identifies a group of polynucleotide sequences that encode
T. parva antigens useful for a variety of applications.
[0049] The nucleic acids described herein may comprise recombinant nucleic acid. By the
term "recombinant nucleic acid" herein is meant nucleic acid, originally formed in
vitro or in a cell in culture, in general, by the manipulation of nucleic acid by
endonucleases and/or exonucleases and/or polymerases and/or ligases and/or recombinases,
to produce a nucleic acid not normally found in nature. Thus an isolated nucleic acid,
in a linear form, or an expression vector formed in vitro by ligating DNA molecules,
that are not normally joined, are both considered recombinant for the purposes mentioned
herein, It is understood that once a recombinant nucleic acid is made and reintroduced
into a host cell or organism, it will replicate non-recombinantly, i.e., using the
in vivo cellular machinery of the host cell rather than in vitro manipulations; however,
such nucleic acids, once produced recombinantly, although subsequently replicated
non-recombinantly, are still considered recombinant for the purposes mentioned herein.
[0050] Furthermore, as a result of the degeneracy of the genetic code, a multitude of nucleotides
sequences may be produced which are based upon the sequences provided herein and corresponding
peptides, polypeptides, or proteins. Some of these nucleotide sequences will bear
only minimal homology to the sequences disclosed herein; however the subject described
herein specifically contemplates each and every possible variation of nucleotide sequence
that could be made by selecting combinations based on possible codon choices. These
combinations are made in accordance with the standard triplet genetic code as applied
to the nucleotide sequence of naturally occurring peptide, polypeptide, or protein,
and all such variations are to be considered as being specifically disclosed herein.
Recombinant nucleotide variants are alternate polynucleotides which encode a particular
protein. They may be synthesized, for example, by making use of the "redundancy" in
the genetic code. Various codon substitutions, such as the silent changes which produce
specific restriction sites or codon usage-specific mutations, may be introduced to
optimize cloning into a plasmid or viral vector or expression in a particular prokaryotic
or eukaryotic host system, respectively.
[0051] It is possible to produce the polynucleotides described herein, or portions thereof,
entirely by synthetic chemistry. After synthesis, the nucleic acid sequence can be
used alone or joined with a preexisting sequence and inserted into one of the many
available DNA vectors and their respective host cells using techniques well known
in the art Moreover, synthetic chemistry may be used to introduce specific mutations
into the nucleotide sequence. Alternatively, a portion of sequence in which a mutation
is desired can be synthesized and recombined with a portion of an existing genomic
or recombinant sequence.
[0052] Peptides and polypeptides described herein can also be produced, entirely or in part,
by synthetic chemistry, using conventional procedures.
[0053] Nucleotide sequences encoding a peptide, polypeptide, or protein may be joined to
a variety of other nucleotide sequences by means of well established recombinant DNA
techniques (
Sambrook J. et al. (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Laboratory, Cold Spring Harbor, N.Y.; or
Ausubel F. M. et al. (1989) Current Protocols in Molecular Biology, John Wiley &
Sons, New York City). Useful sequences include an assortment of cloning vectors such as plasmids, cosmids,
lambda phage derivatives, phagemids, and the like. Vectors of interest include vectors
for replication, expression, probe generation, sequencing, and the like. In general,
vectors of interest may contain an origin of replication functional in at least one
organism, convenient restriction endonuclease sensitive sites, and selectable markers
for one or more host cell systems.
[0054] Another aspect described herein is to provide for hybridization probes which are
capable of hybridizing with naturally occurring antigen sequences or nucleotide sequences
encoding the disclosed peptide, polypeptide, or protein. The stringency of the hybridization
conditions will determine whether the probe identifies only the native nucleotide
sequence or sequences of closely related molecules. If degenerate nucleotide sequences
mentioned herein are used for the detection of related sequences, they should preferably
contain at least 50% of the nucleotides of the sequences presented herein.
[0055] "Probes" are nucleic acid sequences of variable length, preferably between at least
about 10 and as many as about 6,000 nucleotides, depending on use. They are used in
the detection of identical, similar, or complementary nucleic acid sequences. Longer
length probes are usually obtained from a natural or recombinant source, are highly
specific and much slower to hybridize than oligomers. They may be single- or double-stranded
and designed to have specificity in PCR, hybridization membrane-based, or ELISA-like
technologies.
[0056] Hybridization probes mentioned herein may be derived from the polynucleotides represented
by SEQ ID NO: 25-31, or from surrounding or included genomic sequences comprising
untranslated regions such as promoters, enhancers and introns. Such hybridization
probes may be labeled with appropriate reporter molecules. Means for producing specific
hybridization probes include oligolabelling, nick translation, end-labeling or PCR
amplification using a labeled nucleotide. Alternatively, the cDNA sequence may be
cloned into a vector for the production of mRNA probe. Such vectors are known in the
art, are commercially available, and may be used to synthesize RNA probes in vitro
by addition of an appropriate RNA polymerase such as T7, T3 or SP6 and labeled nucleotides.
A number of companies (such as Pharmacia Biotech, Piscataway, N.J.; Promega, Madison,
Wis.; US Biochemical Corp, Cleveland, Ohio; etc.) supply commercial kits and protocols
for these procedures.
[0057] The nucleotide sequences (for example, SEQ ID NO: 25-42, 45-48, 51 and 53) can be
used to generate probes for mapping the native genomic sequence. The sequence may
be mapped to a particular chromosome or to a specific region of the chromosome using
well known techniques. These include in situ hybridization to chromosomal spreads,
flow-sorted chromosomal preparations, or artificial chromosome constructions such
as yeast artificial chromosomes (YACs), bacterial artificial chromosomes (BACs), bacterial
P1 constructions or single chromosome cDNA libraries.
[0058] In situ hybridization of chromosomal preparations and physical mapping techniques
such as linkage analysis using established chromosomal markers are invaluable in extending
genetic maps in organisms, including intracellular parasites. The nucleotide sequences
described herein may also be used to detect differences in the chromosomal location
of nucleotide sequences due to translocation, inversion, or recombination.
[0059] Other aspects mentioned herein include use of the disclosed sequences or recombinant
nucleic acids derived therefrom to produce purified peptides. The nucleotide sequences
as disclosed herein maybe used to produce an amino acid sequence using well known
methods of recombinant DNA technology.
Goeddel (Gene Expression Technology, Methods and Enzymology [1990] Vol 185, Academic
Press, San Diego, Calif) is one among many publications which teach expression of an isolated, purified nucleotide
sequence. The amino acid or peptide may be expressed in a variety of host cells, either
prokaryotic or eukaryotic. Some expression vectors are viral vectors such as Vaccinia-based
vectors, avian-pox based vectors, and adeno-associated viral vectors, among others
(
Dunachie et al. (2003) J Exp Biol 206, 3771-9). Host cells may be from the same species from which the nucleotide sequence was
derived, such as fibroblast cells, lymphocytes or the like, or cells or cell lines,
such as P815 cells, from a different species. The disclosed sequences or recombinant
nucleic acids can be introduced into the host cells by a variety of methods, known
to those skilled in the art, such as methods that involve transfection. Transfection
is the process whereby the nucleic acid sequences (as well as proteins and oligonucleotides)
are introduced by either biochemical or physical processes. Biochemical methods include
DEAE-dextran, calcium phosphate, and liposome-mediated transfection methods (such
as lipofection). Physical transfection methods include the direct micro-injection
of materials, biolistic particle delivery,
e.
g. a "gene gun" (both methods deliver materials by mechanically perforating the cell
membrane), and electroporation. Electroporation exposes target cells to brief, defined
electrical pulses to create transient pores that allow nucleic acids and proteins
to cross the cell membrane.
[0060] Still further aspects mentioned herein use these purified peptides to produce antibodies
or other molecules able to bind to the peptides. These antibodies or binding agents
can then be used for the screening of cells in order to localize the cellular distribution
of the peptides or proteins. The antibodies are also useful for the affinity purification
of recombinantly produced peptides or proteins. Such antibodies are also useful as
diagnostic reagents for the qualitative and quantitative detection of protozoan diseases
or in antibody-mediated tests and assays.
[0061] Disclosed
T. parva antigens can also be used as a diagnostic aid or in methods that measure the presence
of
T. parva cytotoxic lymphocytes in immunized or infected animals by co-culturing mononuclear
cells harvested from an animal suspected to have an infection due to
T. parva, with a
T. parva antigen-specific cytotoxic T cell under standard culture conditions for mammalian
cell cultures. Preferably, nononuclear cells are incubated in a culture medium containing
an indicator that is released upon cell death, such as
51Cr. This is a method that is well-known in the art.
[0062] The disclosed nucleotide sequences can be used individually, or in panels, in tests
or assays to detect levels of peptide, polypeptide, or protein expression. The form
of such qualitative or quantitative methods may include northern analysis, dot blot
or other membrane based technologies, dip stick, pin or chip technologies, PCR, ELISAs
or other multiple sample format technologies.
[0063] An "oligonuelcotide" or "oligomer" is a stretch of nucleotide resides which has a
sufficient number of bases to be used in a polymerase chain reaction (PCR). These
short sequences are based on (or designed from) genomic or cDNA sequences and are
used to amplify, confirm, or reveal the presence of an identical, similar or complementary
DNA or RNA in a particular cell or tissue. Oligonucleotides or oligomers comprise
portions of a DNA sequence having at least about 10 nucleotides and as many as about
50 nucleotides, preferably about 15 to 30 nucleotides. They can be chemically synthesized
and may be used as probes.
[0064] A "complementary" DNA or RNA is a sequence that is 100% identical to the strand to
which it is complementary.
[0065] The polynucleotides described herein can themselves be used as probes. Additional
polynucleotide sequences can be added to the ends of (or internally in) the exemplified
polynucleotide sequences so that polynucleotides that are longer than the exemplified
polynucleotides can also be used as probes. Thus, isolated polynucleotides comprising
one or more of the exemplified sequences are within the scope of the description.
Polynucleotides that have fewer nucleotides than the, exemplified polynucleotides
can also be used and are contemplated within the scope of the description For example,
for some purposes, it might be useful to use a conserved sequence from an exemplified
polynucleotide wherein the conserved sequence comprises a portion of an exemplified
sequence. Thus, polynucleotides, described herein can be used to find additional,
homologous (wholly or partially) genes.
[0066] Probes mentioned herein may be composed of DNA, RNA, or PNA (peptide nucleic acid).
The probe will normally have at least about 10 bases, more usually at least about
17 bases, and may have up to about 100 bases or more. Longer probes can readily be
utilized, and such probes can be, for example, several kilobases in length. The probe
sequence is designed to be at least substantially complementary to a portion of a
gene encoding a protein of interest The probe need not have perfect complementarity
to the sequence to which it hybridizes. The probes may be labeled utilizing techniques
that are well known to those skilled in this art.
[0067] One approach for the use as probes entails first identifying DNA segments that are
homologous with the disclosed nucleotide sequences using, for example, Southern blot
analysis of a gene bank. Thus, it is possible, without the aid of biological analysis,
to know in advance the probable activity of many new polynucleotides, and of the individual
gene products expressed by a given polynucleotide. Such an analysis provides a rapid
method for identifying commercially valuable compositions.
[0068] One hybridization procedure useful according to the description typically includes
the initial steps of isolating the DNA sample of interest and purifying it chemically.
Either lysed cells or total fractionated nucleic acid isolated from cells can be used.
Cells can be treated using known techniques to liberate their DNA (and/or RNA). The
DNA sample can be cut into pieces with an appropriate restriction enzyme. The pieces
can be interest can be isolated through electrophoresis in a gel, usually agarose
or acrylamide. The pieces of interest can be transferred to an immobilizing.membrane.
[0069] The particular hybridization technique is not essential to the description. As improvements
are made in hybridization techniques, they can be readily applied.
[0070] The probe and sample can then be combined in a hybridization buffer solution and
held at an appropriate temperature until annealing occurs. Thereafter, the membrane
is washed free of extraneous materials, leaving the sample and bound probe molecules
typically detected and quantified by autoradiography and/or liquid scintillation counting.
As is well known in the art, if the probe molecule and nucleic acid sample hybridize
by forming a strong non-covalent bond between the two molecules, it can be reasonably
assumed that the probe and sample are essentially identical or very similar. The probe's
detectable label provides a means for determining in a known manner whether hybridization
has occurred.
[0071] In the use of the nucleotide segments as probes, the particular probe is labeled
with any suitable label known to those skilled in the art, including radioactive and
non-radioactive labels. Typical radioactive labels include
32P,
35S, or the like. Non-radioactive labels include; for example, ligands such as biotin
or thyroxine, as well as enzymes such as hydrolases or peroxidases, or the various
chemiluminescers such as luciferin, or fluorescent compounds like fluorescein and
its derivatives. In addition, the probes can be made inherently fluorescent as described
in International Application No.
WO 93/16094.
[0072] Various degrees of stringency of hybridization can be employed. The more stringent
the conditions, the greater the complementarity that is required for duplex formation.
Stringency can be controlled by temperature, probe concentration, probe length, ionic
strength, time, and the like. Preferably, hybridization is conducted under moderate
to high stringency conditions by techniques well known in the art, as described, for
example, in
Keller, G. H., M. M. Manak (1987) DNA Probes, Stockton Press, New York, N.Y., pp.
169-170.
[0073] As used herein "moderate to high stringency" conditions for hybridization refers
to conditions that achieve the same, or about the same, degree of specificity of hybridization
as the conditions described herein. Examples of moderate to high stringency conditions
are provided herein. Specifically, hybridization of immobilized DNA on Southern blots
with
32P-labeled gene-specific probes is performed using standard methods (
Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Laboratory Press, NY, Vol. 1, 2, 3). In general, hybridization and subsequent washes are carried out under moderate
to high stringency conditions that allow for detection of target sequences with homology
to sequences exemplified herein. Specific hybridization of a variant under stringent
conditions means that the complementary strand required for duplex formation is such
that a variant can be distinguished. For double-stranded DNA gene probes, hybridization
can be carried out overnight at 20-25° C. below the melting temperature (Tm) of the
DNA hybrid in 6 x SSPE, 5 x Denhardt's solution, 0.1% SDS, 0.1 mg/ml denatured DNA.
The melting temperature is described by the following formula from
Beltz et al. (1983) Methods Enzymol 100, 266-85: Tm=81.5° C.+16.6 Log[Na+]+0.41(% G+C)-0.61(% formamide)-600/length of duplex in
base pairs.
[0074] Washes can typically be carried out as follows:
- (1) Twice at room temperature for 15 minutes in 1.times. SSPE, 0.1% SDS (low stringency
wash).
- (2) Once at Tm-20° C. for 15 minutes in 0.2.times. SSPE, 0.1% SDS (moderate stringency
wash).
[0075] For oligonucleotide probes, hybridization is typically carried out overnight at 10-20°C
below the melting temperature (Tm) of the hybrid in 6xSSPE, 5xDenhardt's solution,
0.1% SDS, 0.1mg/ml denatured DNA. Tm for oligonucleotide probes was determined by
the following formula from Suggs et al. (1981):

[0076] In general, salt and/or temperature can be altered to change stringency. With a labeled
DNA fragment of greater than about 70 or so bases in length, the following conditions
can be used:
1 Low: 1 or 2X SSPE, room temperature Low: 1 or 2X SSPE, 42 °C. Moderate: 0.2X or
1X SSPE, 65° C. High: 0.1X SSPE, 65°C.
[0077] Duplex formation and stability depend on substantial complementarity between the
two strands of a hybrid, and, as noted above, a certain degree of mismatch can be
tolerated. Therefore, polynucleotide sequences described herein include mutations
(both single and multiple), deletions, and insertions in the described sequences,
and combinations thereof, wherein said mutations, insertions, and deletions permit
formation of stable hybrids with a target polynucleotide of interest. Mutations, insertions,
and deletions can be produced in a given polynucleotide sequence using standard methods
known in the art. Other methods may become known in the future.
[0078] The mutational, insertional, and deletional variants of the polypeptide sequences
described herein can be used in the same manner as the exemplified polynucleotide
sequences so long as the variants have substantial sequence similarity with the original
sequence. As used herein, substantial sequence similarity refers to the extent of
nucleotide similarity that is sufficient to enable the variant polynucleotide to function
in the same capacity as the original sequence (
e.g., to encode a polypeptide described herein Preferably, this similarity is greater
than 50%; more preferably, this similarity is greater than 75%; and most preferably,
this similarity is greater than 90%. The degree of similarity needed for the variant
to function in its intended capacity will depend upon the intended use of the sequence.
Mutants, variants, or fragments can include modifications to the peptide backbone,
added moieties, derivatized functional groups, and fragments can have sizes in the
range from the minimal length of about 11 amino acids up to the full-length of 265
amino acids. Active variants of the polypeptide sequences described herein are those
variants that function in a manner similar to the original polypeptide with respect
to stimulating antigen specific CTLs, in stimulating the production of or reacting
With an antibody to the original polynucleotide, or in eliciting protective immunity
against an antigen mentioned herein, such as a
T. parva antigen. It is well within the skill of a person trained in this art to make mutational,
insertional, and deletional mutations that are designed to improve the function of
the sequence or otherwise provide a methodological advantage.
[0079] PCR technology. Polymerase Chain Reaction (PCR) is a repetitive, enzymatic, primed
synthesis of a nucleic acid sequence. This procedure is well known and commonly used
by those skilled in this art (see
U.S. Pat. Nos. 4,683,195,
4,683,202, and
4,800,159;
Saiki et al. (1985) Science 230, 1350-4). PCR is based on the enzymatic amplification of a DNA fragment of interest that
is flanked by two oligonucleotide primers that hybridize to opposite strands of the
target sequence. The primers are oriented with the 3' ends pointing towards each other.
Repeated cycles of heat denaturation of the template, annealing of the primers to
their complementary sequences, and extension of the annealed primers with a DNA polymerase
result in the amplification of the segment defined by the 5' ends of the PCR primers.
Since the extension product of each primer can serve as a template for the other primer,
each cycle essentially doubles the amount of DNA fragment produced in the previous
cycle. This results in the exponential accumulation of the specific target fragment,
up to several million-fold in a few hours. By using a thermostable DNA polymerase
such as Taq polymerase, which is isolated from the thermophilic bacterium
Thermus aquaticus, the amplification process can be completely automated. Other enzymes that can be
used are known to those skilled in the art.
[0080] The polynucleotide sequences described herein (and portions thereof such as conserved
regions and portions that serve to distinguish these sequences from previously-known
sequences) can be used as, and/or used in the design of, primers for PCR amplification.
In performing PCR amplification, a certain degree of mismatch can be tolerated between
primer and template. Therefore, mutations, deletions, and insertions (especially additions
of nucleotides to the 5' end) of the exemplified polynucleotides can be used in this
manner. Mutations, insertions and deletions can be produced in a given primer by methods
known to an ordinarily skilled artisan.
[0082] CLONTECH PCR-Select
™ cDNA Subtraction (Clontech Laboratories, Inc., Palo Alto, Calif.) is yet another
means by which differentially expressed genes may be isolated. The procedure allows
for the isolation of transcripts present in one mRNA population which is absent, or
found in reduced numbers, in a second population of mRNA. Rare transcripts may be
enriched 1000-fold.
[0083] Polynucleotides described herein can be defined according to several parameters.
One characteristic is the biological activity of the protein products as identified
herein. The proteins and genes described herein can be further defined by their amino
acid and nucleotide sequences. The sequences of the molecules can be defined in terms
of homology to certain exemplified sequences as well as in terms of the ability to
hybridize with, or be amplified by, certain exemplified probes and primers. Additional
primers and probes can readily be constructed by those skilled in the art such that
alternate polynucleotide sequences encoding the same amino acid sequences can be used
to identify and/or characterize additional genes. The proteins described herein can
also be identified based on their immunoreactivity with certain antibodies.
[0084] The polynucleotides and proteins described herein include portions, fragments, variants,
and mutants of the full-length sequences as well as fusions and chimerics, so long
as the encoded protein retains a characteristic biological activity of the proteins
identified herein. As used herein, the terms "variants" or "variations" of genes include
nucleotide sequences that encode the same proteins or which encode equivalent proteins
having equivalent biological activity. As used herein, the term "equivalent proteins"
refers to proteins having the same or essentially the same biological activity as
the exemplified proteins.
[0085] Variations of genes may be readily constructed using standard techniques such as
site-directed mutagenesis and other methods of making point mutations and by DNA shuffling,
for example. In addition, gene and protein fragments can be made using commercially
available exonucleases, endonucleases, and proteases according to standard procedures.
For example, enzymes such as Bal31 can be used to systematically cut off nucleotides
from the ends of genes. Also, genes that encode fragments may be obtained using a
variety of restriction enzymes. Proteases may be used to directly obtain active fragments
of these proteins. Of course, molecular techniques for cloning polynucleotides and
producing gene constructs of interest are also well known in the art. In vitro evaluation
techniques, such as MAXYGENs "Molecular Breeding" can also be applied.
[0086] A "selectable marker" is a gene whose expression allows one to identify cells that
have been transformed or transfected with a vector containing the marker gene.
[0087] "Reporter" molecules are chemical moieties used for labeling a nucleic or amino acid
sequence. They include, but are not limited to, radionuclides, enzymes, fluorescent,
chemi-huninescent, or chromogenic agents. Reporter molecules associate with, establish
the presence of, and may allow quantification of a particular nucleic or amino acid
sequence.
[0088] A "portion" or "fragment" of a polynucleotide or nucleic acid comprises all or any
part of the nucleotide sequence having fewer nucleotides than about 6 kb, preferably
fewer than about 1 kb which can be used as a probe. Such probes may be labeled with
reporter molecules using nick translation, Klenow fill-in reaction, PCR or other methods
well known in the art. After pretesting to optimize reaction conditions and to eliminate
false positives, nucleic acid probes may be used in Southern, northern or in situ
hybridizations to determine whether target DNA or RNA is present in a biological sample,
cell type, tissue, organ or organism.
[0089] A "polypeptide," comprises a protein, oligopeptide or peptide fragments thereof.
The terms polypeptide, peptide and protein are used interchangeably herein.
[0090] A "mutant, variant, or modified polypeptide" includes any polypeptide encoded by
a nucleotide sequence that has been mutated through insertions, deletions, substitutions,
or the like.
[0091] "Chimeric" molecules are polynucleotides or polypeptides which are created by combining
one or more nucleotide or peptide sequences (or their parts). In the case of nucleotide
sequences, such combined sequences may be introduced into an appropriate vector and
expressed to give rise to a chimeric polypeptide which may be expected to be different
from the native molecule in one or more of the following characteristics: cellular
location, distribution, ligand-binding affinities, interchain affinities, degradation/turnover
rate, signaling, etc.
[0092] "Active" is that state which is capable of being useful or of carrying out some role.
It specifically refers to those forms, fragments, or domains of an amino acid sequence
which display a biologic and/or immunogenic activity characteristic of the naturally
occurring peptide, polypeptide, or protein. For example, the present description relates
to active fragments of polypeptides (
e.
g., represented by SEQ ID NO: 1-7). Each of these active fragments retains at least
one epitope of the larger polypeptide.
[0093] "Naturally occurring" refers to a polypeptide produced by cells which have not been
genetically engineered or which have been genetically engineered to produce the same
sequence as that naturally produced.
[0094] "Derivative" refers to those polypeptides which have been chemically modified by
such techniques as ubiquitination, labeling, pegylation (derivatization with polyethylene
glycol), and chemical insertion or substitution of amino acids such as ornithine which
do not normally occur in proteins.
[0095] "Recombinant polypeptide variant," refers to any polypeptide which differs from naturally
occurring peptide, polypeptide, or protein by amino acid insertions, deletions and/or
substitutions.
[0096] Amino acid "substitutions" are defined as one for one amino acid replacements. They
are conservative in nature when the substituted amino acid has similar structural
and/or chemical properties. Examples of conservative replacements are substitution
of a leucine with an isoleucine or valine, an aspartate with a glutamate, or a threonine
with a serine.
[0097] Amino acid "insertions" or "deletions" are changes to or within an amino acid sequence.
They typically fall in the range of about 1 to 5 amino acids. The variation allowed
in a particular amino acid sequence may be experimentally determined by producing
the peptide synthetically or by systematically making-insertions, deletions, or substitutions
of nucleotides in the sequence using recombinant DNA techniques.
[0098] An "oligopeptide" is a short stretch of amino acid residues and may be expressed
from an oligonucleotide. Such sequences comprise a stretch of amino acid residues
of at least about 5 amino acids and often about 17 or more amino acids, typically
at least about 9 to 13 amino acids, and of sufficient length to display biologic and/or
immunogenic activity.
[0099] A "standard" is a quantitative or qualitative measurement for comparison. Preferably,
it is based on a statistically appropriate number of samples and is created to use
as a basis of comparison when performing diagnostic assays, running clinical trials,
or following patient treatment profiles. The samples of a particular standard may
be normal or similarly abnormal.
[0100] An antibody or "specific binding parts" means any antibody molecule of fragment of
an antibody molecule that will bind antigen or other ligands such as lectins or other
molecules. "Specific binding parts" is meant to include, but not be limited to antibody
fragments such as Fab fragments, Fab'(2) fragments, Fc region fragments. Complementarity
determining regions (CDRs), Fv fragments, single chain Fv (scFv) fragments, and antigen
binding site fragments.
[0101] An "antigen" is a macromolecule that is recognized by Antibodies or immune cells
and can trigger an immune response. Usually, an antigen is a protein or a polysaccharide,
but it can be any type of molecule, even small molecules if coupled to a large carrier.
[0102] An "antigen specific" cytotoxic T cell is a T lymphocyte that can recognize and kill
another cell that is expressing an antigen, usually in conjunction with a type or
class of molecules referred to by those familiar with the art, as Major Histocompatiblity
Complex (MHC) Class I molecules. Such Cytotoxic T cells are also referred to as "CD8
+" (CD8 positive) or CTLs, by those familiar with the art.
[0103] An "epitope" or "antigenic determinant" is a region or section of an antigen that
is approximately the minimal length of antigenic sequence that will elicit an immune
response, as measured by the development of an antibody response, the development
of T antigen-specific T cells, or other measurable immune cell response. For example,
an epitope could be a site on an antigen recognized by antibody.
[0104] A T cell "epitope" is an antigenic determinant recognized and bound by the T-cell
receptor. Epitopes recognized by the T-cell receptor are often located in the inner,
unexposed side of the antigen, and become accessible to the T-cell receptors after
proteolytic processing of the antigen.
[0105] An "effective" immunization protocol is one in which an animal is protected against
infection, at least to a measurable degree, when exposed to the specific infectious
agent for which it was immunized.
[0106] A "boost"or "booster administration", is an administration of an immunogen or antigen
that is given to an animal at a time period, usually weeks or months, after a first
administration of the same immunogen, in order to stimulate an antigen specific response.
[0107] An "effective" condition or state is a those situation in which a biological process
may take place. Such a process could be, for example, the state in which an immune
response may develop, or a protein could be expressed by a living cell.
[0108] A "pharmaceutically acceptable carrier" is an agent or carrier, often, but not limited
to, a solute or liquid provided for an immunizing agent in order that it can be administered
to an animal. Such a carrier may be water, saline solution, dextrose, glycerols, alcohols,
oils, oil-based substances, to which an immunizing agent is added. A pharmaceutically
acceptable carrier can also be a solid substrate, such as microbeads that absorb the
immunizing agent or a substance that will release the immunizing agent over time,
such as a biodegradable implant. A carrier can also be a combination of the above
mentioned carriers,' but is not limited to such substances.
[0109] An "Elispot Assay" or "elispot assay" is a shorted name for "Enzyme-linked ImmunoSpot
Assay", which refers to an antibody based method to detect secretion of soluble factors
released by cells. Originally developed as a method to detect antibody-secreting B-cells,
later the method was adapted to determine T-cell reaction to a specific antigen, often
represented as number of activated cells per million. ,
[0110] "Effective conditions" for culturing cells or cell lines refers to those culture
conditions that allow the cells to respond in a manner than mimics or is the same
as the response would be if the cells were responding in vivo.
[0111] "Harvesting" cells or other materials means to separate and collect those cells from
a mixture of from one source for use in another protocol.
[0112] An "adjuvant" is a substance mixed with an immunizing agent that increases that ability
of an animal to respond to the immunizing agent in a manner that the immune response
is of a greater degree than if the adjuvant were not present. The immune response
is not to the adjuvant, but to the immunizing agent or antigen that is mixed with
the adjuvant.
[0113] A "protective antibody" is an antibody that, when it is expressed in an animal, puts
that animal in a state whereby it will not contract a disease caused by the agent
to which the antibody binds.
[0114] An "antigen specific" cell, is a cell such as a cytotoxic T cell, that binds only,
or substantially primarily, to the specific molecule or antigen for which it expresses
receptors, usually as a result of an immune response.
[0115] An "immunogenic composition" is a molecule or mixture of molecules that, when administered
to an animal, will cause the immune system of that animal to become activated and
to produce immune molecules or cells. A composition can also be immunogenic in vitro
conditions that are such that they mimic or resemble the conditions that occur in
vitro in an animal.
[0116] To "stimulate" T cells or other cells of the immune system, means that the T cells
or other cells of the immune system of an organism, react to a stimulus in a measurable
way, such as by the secretion of a molecule or hormone, may become activated and kill
or lyse other cells, or by undergoing a change of cell cycle state or the like.
[0117] A "Bovine MHC class II bioassay", means an assay that measures the presence of a
T cell-derived soluble factor, such as interferon (IFN-gamma) release from T cells
responding to specific stimulation through the ability of IFN-gamma to induce and
up-regulate expression of class II molecules on bovine endothelial cells. Bovine endothelial
cells do not constitutively express class II molecules unless triggered by external
signals such as IFN-gamma.
[0118] A "vaccine," is a composition that, when administered to an animal, causes the immune
system of the animal to produce antibody molecules or immune cells, such as antigen-specific
T cells, that react with an antigenic substance that is in the composition and render
that animal resistant to infection or other pathology that is caused by an organism
bearing or producing the antigenic substance.
[0119] A "pharmaceutical composition" is a material that has a measurable effect on an animal
to which it is administered. This effect is of a nature that is normally thought of
as being good or desirable for the animal, such as a healing or protective effect.
A pharmaceutical composition may be a therapeutic composition, or a composition used
for diagnostic purposes.
[0120] Since the list of technical and scientific terms cannot be all encompassing, any
undefined terms shall be construed to have the same meaning as is commonly understood
by one of skill in the art. Furthermore, the singular forms "a", "an" and "the" include
plural referents unless the context clearly dictates otherwise.
[0121] The description is not to be limited only to the particular sequences, variants,
formulations or methods described. The sequences, variants, formulations and methodologies
may vary, and the terminology used herein is for the purpose of describing particular
embodiments. The terminology and definitions are not intended to be limiting.
[0122] Because of the redundancy of the genetic code, a variety of different DNA sequences
can encode the amino acid sequences encoded by the polynucleotide sequences disclosed
herein. It is well within the skill of a person trained in the art to create these
alternative DNA sequences encoding proteins having the same, or essentially the same,
amino acid sequence. These variant DNA sequences are within the scope of the description.
As used herein, reference to "essentially the same" sequence refers to sequences that
have amino acid substitutions, deletions, additions, or insertions that do not materially
affect biological activity. Fragments retaining the characteristic biological activity
are also included in this definition.
[0123] The description comprises variant or equivalent proteins (and nucleotide sequences
coding for equivalent proteins) having the same or similar biological activity of
proteins encoded by the exemplified polynucleotides. Equivalent proteins will have
amino acid similarity with an exemplified protein (or peptide). The amino acid identity
is typically greater than about 60%. Preferably, the amino acid identity will be greater
than 75%. Morse preferably, the amino acid identity is greater than about 80%, and
even more preferably greater than about 90%. Most preferably, amino acid identity
is greater than about 95%. (Likewise, the polynucleotides that encode the subject
polypeptides will also have corresponding identities in these preferred ranges.) These
identities are as determined using standard alignment techniques for determining amino
acid identity. The amino acid identity/similarity/homology will be highest in critical
regions of the protein including those regions that account for biological activity
or that are involved in the determination of three-dimensional configuration that
is ultimately responsible for the biological activity. In this regard, certain amino
acid substitutions are acceptable and can be expected if these substitutions are in
regions which are not critical to activity or are conservative amino acid substitutions
which do not affect the three-dimensional configuration of the molecule. For example,
amino acids may be placed in the following classes: non-polar, uncharged polar, basic,
and acidic. Conservative substitutions whereby an amino acid of one class is replaced
with another amino acid of the same type fall within the scope of the description
so long as the substitution does not materially alter the biological activity of the
compound. Below is a list of examples of amino acids belonging to various classes:
Nonpolar - Ala, Val, Leu, Ile, Pro, Met, Phe, Trp, uncharged polar Gly, Ser, Thr,
Cys, Tyr, Asn, Gln
Acidic - Asp, Glu Basic Lys, His
[0124] In some instances, non-conservative substitutions can also be made.
[0125] As used herein, reference to "isolated" polynucleotides and/or "purified" proteins
refers to these molecules when they are not associated with the other molecules with
which they would be found in nature. Thus, reference to "isolated" and/or "purified"
signifies the involvement of the "hand of man" as described herein. Reference to "heterologous"
proteins, genes, and gene constructs, also signifies the involvement of the "hand
of man."
[0126] There is also provided vectors containing the nucleic acid molecules described herein.
The term "vector" refers to a vehicle, preferably a nucleic acid molecule, which can
transport the nucleic acid molecules. When the vector is a nucleic acid molecule,
the nucleic acid molecules are covalently linked to the vector nucleic acid. With
this aspect, the vector includes a plasmid, single or double stranded phage, a single
or double stranded RNA or DNA viral vector, or artificial chromosomes, such as a BAC,
PAC, YAC, OR MAC.
[0127] A vector can be maintained in the host cell as an extrachromosomal element where
it replicates and produces additional copies of the nucleic acid molecules. Alternatively,
the vector may integrate into the host cell genome and produce additional copies of
the nucleic acid molecules when the host cell replicates.
[0128] There is provided vectors for the maintenance (cloning vectors) or vectors for expression
(expression vectors) of the nucleic acid molecules. The vectors can function in prokaryotic
or eukaryotic cells or in both (shuttle vectors).
[0129] Expression vectors contain cis-acting regulatory regions (expression control sequences)
that are operably linked in the vector to the nucleic acid molecules such that transcription
of the nucleic acid molecules is allowed in a host cell. The nucleic acid molecules
can be introduced into the host cell with a separate nucleic acid molecule capable
of affecting transcription. Thus, the second nucleic acid molecule may provide a trans-acting
factor interacting with the cis-regulatory control region to allow transcription of
the nucleic acid molecules from the vector. Alternatively, a trans-acting factor may
be supplied by the host cell. Finally, a trans-acting factor can be produced from
the vector itself. It is understood, however, that in some embodiments, transcription
and/or translation of the nucleic acid molecules can occur in a cell-free system.
[0130] The regulatory sequence to which the nucleic acid molecules described herein can
be operably linked include promoters for directing mRNA transcription. These include,
but are not limited to, the left promoter from bacteriophage lambda., the lac, TRP,
and TAC promoters from E. Coli, the early and late promoters from SV40, the CMV immediate
early promoter, the adenovirus early and late promoters, and retrovirus long-terminal
repeats.
[0131] In addition to control regions that promote transcription, expression vectors may
also include regions that modulate transcription, such as repressor binding sites
and enhances. Examples include the SV40 enhancer, the cytomegalovirus immediate early
enhancer, polyoma enhancer, adenovirus enhancers, and retrovirus LTR enhancers.
[0132] In addition to containing sites for transcription initiation and control, expression
vectors can also contain sequences necessary for transcription termination and, in
the transcribed region a ribosome binding site for translation. Other regulatory control
elements for expression include initiation and termination codons as well as polyadenylation
signals. The person of ordinary skill in the art would be aware of the numerous regulatory
sequences that are useful in expression vectors. Such regulatory sequences are described,
for example, in
Sambrook et al., Molecular Cloning: A Laboratory Manual. 2nd. ed., Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y., (1989).
[0133] A variety of expression vectors can be used to express a nucleic acid molecule. Such
vectors include chromosomal, episomal, and virus-derived vectors, for example vectors
derived from bacterial plasmids, from bacteriophage, from yeast episomes, from yeast
chromosomal elements, including yeast artificial chromosomes, from viruses such as
baculoviruses, papovaviruses such as SV40, Vaccinia viruses including the modified
vaccinia virus Ankara strain (MVA), adenoviruses, poxviruses including fowlpox virus
(FP9) and canary pox, pseudorabies viruses, and retroviruses. Vectors may also be
derived from combinations of these sources such as those derived from plasmid and
bacteriophage genetic elements, e.g. cosmids and phagemids. Appropriate cloning and
expression vectors for prokaryotic and eukaryotic hosts are described in
Sambrook et al., Molecular Cloning: A Laboratory Manual. 2nd. ed., Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y., (1989).
[0134] The regulatory sequence may provide constitutive expression in one or more host cells
(i.e. tissue specific) or may provide for inducible expression in one or more cell
types such as by temperature, nutrient additive, or exogenous factor such as a hormone
or other ligand. A variety of vectors providing for constitutive and inducible expression
in prokaryotic and eukaryotic hosts are well known to those of ordinary skill in the
art.
[0135] The nucleic acid molecules can be inserted into the vector nucleic acid by well-known
methodology. Generally, the DNA sequence that will ultimately be expressed is joined
to an expression vector by cleaving the DNA sequence and the expression vector with
one or more restriction enzymes and then ligating the fragments together. Procedures
for restriction enzyme digestion and ligation are well known to those of ordinary
skill in the art.
[0136] The vector containing the appropriate nucleic acid molecule can be introduced into
an appropriate host cell for propagation or expression using well-known techniques.
Bacterial cells include, but are not limited to;
E. coli, Streptomyces sp., and
Salmonella typhimurium. Eukaryotic cells include, but are not limited to, yeast, insect cells such as Drosophila,
animal cells such as COS and CHO cells, fibroblast, skin fibroblast, immortalized
skin fibroblast and plant cells.
[0137] As described herein, it may be desirable to express the peptide as a fusion protein.
Accordingly, the description provides fusion vectors that allow for the production
of the peptides. Fusion vectors can increase the expression of a recombinant protein,
increase the solubility of the recombinant protein, and aid in the purification of
the protein by acting for example as a ligand for affinity purification. A proteolytic
cleavage site may be introduced at the junction of the fusion moiety so that the desired
peptide can ultimately be separated from the fusion moiety. Proteolytic enzymes include,
but are not limited to, factor Xa, thrombin, and enteroenzyme. Typical fusion expression
vectors include pGEX (
Smith et al., Gene 67:31-40 (1988)), pMAL (New England Biolabs, Beverly, Mass.) and pRIT5 (Pharmacia, Piscataway, N.J.)
which fuse glutathione S-transferase (GST), maltose E binding protein, or protein
A, respectively, to the target recombinant protein. Examples of suitable inducible
non-fusion
E.
coli expression vectors include pTrc (
Amann et al, Gene 69:301-315 (1988)) and pET 11d (
Studier et al, Gene Expression Technology: Methods in Enzymology 185:60-89 (1990)).
[0139] The nucleic acid molecules can also be expressed by expression vectors that are operative
in yeast. Examples of vectors for expression in yeast e.g.,
S.
cerevisiae include pYepSecl (
Baldari, et al, EMBO J. 6:229-234 (1987)), pMFa (
Kujan et al, Cell 30:933-943(1982)), pJRY88 (
Schultz et al, Gene 54:113-123 (1987)), and pYES2 (Invitrogen Corporation, San Diego, Calf.).
[0142] The expression vectors listed herein are provided by way of example only of the well-known
vectors available to those of ordinary skill in the art that would be useful to express
the nucleic acid molecules. The person of ordinary skill in the art would be aware
of other vectors suitable for maintenance propagation or expression of the nucleic
acid molecules described herein. These are found for example in
Sambrook, J., Fritsh, E. F., and Maniatis, T. Molecular Cloning: A Laboratory Manual.
2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, N.Y., 1989.
[0143] The description also encompasses vectors in which the nucleic acid sequences described
herein are cloned into the vector in reverse orientation, but operably linked to a
regulatory sequence that permits transcription of antisense RNA. Thus, an antisense
transcript can be produced to all, or to a portion, of the nucleic acid molecule sequences
described herein, including both coding and non-coding regions. Expression of this
antisense RNA is subject to each of the parameters described above in relation to
expression of the sense RNA (regulatory sequences, constitutive or inducible expression,
tissue-specific expression).
[0144] The description also relates to recombinant host cells containing the vectors described
herein. Host cells therefore include prokaryotic cells, lower eukaryotic cells such
as yeast, other eukaryotic cells such as insect cells, and higher eukaryotic cells
such as mammalian cells.
[0145] The recombinant host cells are prepared by introducing the vector constructs described
herein into the cells by techniques readily available to the person of ordinary skill
in the art. These include, but are not limited to, calcium phosphate transfection,
DEAE-dextran-mediated transfection, cationic lipid-mediated transfection, electroporation,
transduction, infection, lipofection, and other techniques such as those found in
Sambrook, et al. (Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor
Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989).
[0146] Host cells can contain more than one vector. Thus, different nucleotide sequences
can be introduced on different vectors of the same cell. Similarly, the nucleic acid
molecules can be introduced either alone or with other nucleic acid molecules that
are not related to the nucleic acid molecules such as those providing trans-acting
factors for expression vectors. When more than one vector is introduced into a cell,
the vectors can be introduced independently, co-introduced or joined to the nucleic
acid molecule vector.
[0147] In the case of bacteriophage and viral vectors, these can be introduced into cells
as packaged or encapsulated virus by standard procedures for infection and transduction.
Viral vectors can be replication-competent or replication-defective. In the case in
which viral replication is defective, replication will occur in host cells providing
functions that complement the defects.
[0148] Vectors generally include selectable markers that enable the selection of the subpopulation
of cells that contain the recombinant vector constructs. The marker can be contained
in the same vector that contains the nucleic acid molecules described herein or may
be on a separate vector. Markers include tetracycline or ampicillin-resistance genes
for prokaryotic host cells and dihydrofolate reductase or neomycin resistance for
eukaryotic host cells. However, any marker that provides selection for a phenotypic
trait will be effective.
[0149] While the mature proteins can be produced in bacteria, yeast, mammalian cells, and
other cells under the control of the appropriate regulatory sequences, cell- free
transcription and translation systems can also be used to produce these proteins using
RNA derived from the DNA constructs described herein.
[0150] Where secretion of the peptide is desired, which is difficult to achieve with multi-transmembrane
domain containing proteins such as MHC Class I-binding peptides, appropriate secretion
signals are incorporated into the vector. The signal sequence can be endogenous to
the peptides or heterologous to these peptides.
[0151] The expressed protein can be isolated from the host cell by standard disruption procedures,
including freeze thaw, sonication, mechanical disruption, use of lysing agents and
the like. The peptide can then be recovered and purified by well-known purification
methods including ammonium sulfate precipitation, acid extraction, anion or cationic
exchange chromatography, phosphocellulose chromatography, hydrophobic-interaction
chromatography, affinity chromatography, hydroxylapatite chromatography, lectin chromatography,
or high performance liquid chromatography.
[0152] It is also understood that depending upon the host cell in recombinant production
of the peptides described herein, the peptides can have various glycosylation patterns,
depending upon the cell, or maybe non-glycosylated as when produced in bacteria. In
addition, the peptides may include an initial modified methionine in some cases as
a result of a host-mediated process.
[0153] There are many methods for introducing a heterologous gene or polynucleotide into
a host cell or cells under conditions that allow for stable maintenance and expression
of the gene or polynucleotide. These methods are well known to those skilled in the
art. Synthetic genes, such as, for example, those genes modified to enhance expression
in a heterologous host (such as by preferred codon usage or by the use of adjoining,
downstream, or upstream enhancers) that are functionally equivalent to the genes (and
which encode equivalent proteins) can also be used to transfect hosts. Methods for
the production of synthetic genes are known in the art. Recombinant, hosts can be
used for the expression or propagation of genes and polynucleotide described herein.
The genes and polynucleotides within the scope of the description can be introduced
into a wide variety of microbial or plant hosts, such as bacterial cells, yeast, insect
cells, plant cell cultures or plants, mammalian cells. For example,
T. parva nucleic acids can be expressed in a recombinant baculovirus (BV) possessing an optimized
promoter and translation initiation region operably linked to the
T. parva nucleic acid. In a preferred embodiment, an optimized promoters and translation initiation
region are operably linked to the
T. parva nucleic acid. In one embodiment, insect host cells can be transformed with baculovirus
expressing
T. parva nucleic acids. In still another embodiment, Tn5 (Trichoplusiani or High Five
™) host cells can be transformed with baculovirus expressing
T. parva nucleic acids.
[0154] T. parva "recombinant protein", is a protein made using recombinant techniques, i.e. through
the expression of a recombinant nucleic acid as depicted above. A recombinant protein
is distinguished from naturally occurring protein by at least one or more characteristics.
For example, the protein may be isolated or purified away from some or all of the
proteins and compounds with which it is normally associated in its wild type host,
and thus may be substantially pure. For example, an isolated protein is unaccompanied
by at least some of the material with which it is normally associated in its natural
state, preferably constituting at least about 0.5%, more preferably at least about
5% by weight of the total protein in a given sample. A substantially pure protein
comprises at least about 75% by weight of the total protein, with at least about 80%
being preferred, and at least about 90% being particularly preferred. The definition
includes the production of a protein from one organism in a different organism or
host cell. Alternatively, the protein may be made at a significantly higher concentration
than is normally seen, through the use of an inducible promoter or high expression
promoter, such that the protein is made at increased concentration levels. Alternatively,
the protein may be in a form not normally found in nature, as in the addition of an
epitope tag or amino acid substitutions, insertions and/or deletions, as discussed
below.
[0155] Included in "
T. parva antigen polypeptides" are
T. parva polypeptide variants. These variants fall into one or more of three classes: substitutional,
insertional or deletional variants. These variants ordinarily are prepared by site
specific mutagenesis of nucleotides in the DNA encoding a
T. parva antigen polypeptide, using cassette or PCR mutagenesis, scanning mutagenesis, gene
shuffling or other techniques well known in the art, to produce DNA encoding the variant,
and thereafter expressing the DNA in recombinant cell culture as outlined above. However,
variant
T. parva polypeptide fragments having up to about 100-150 residues may be prepared by in vitro
synthesis using established techniques. Amino acid sequence variants are characterized
by the predetermined nature of the variation, a feature that sets them apart from
naturally occurring allelic or interspecies variation of the
T. parva antigen polypeptide amino acid sequence.
[0156] While the site or region for introducing an amino acid sequence variation is predetermined,
the mutation per se need not be predetermined. For example, in order to optimize the
performance of a mutation at a given site, random mutagenesis may be conducted at
the target codon or region and the expressed
T. parva antigen polypeptide variants can be screened for the optimal combination of desired
activity. Techniques for making mutations at predetermined sites in DNA having a known
sequence are well known. For example, the variations can be made using oligonucleotide-mediated
site-directed mutagenesis, [
Carter et al., Nucl. Acids Res., 13:4331 (1986);
Zoller et at., Nucl. Acids Res., 10:6487 (1987)], cassette mutagenesis [
Wells et al., Gene, 34:315 (1985)], restriction selection mutagenesis [
Wells et al., Philos. Trans. R. Soc. London SerA, 317:415 (1986)] PCR mutagenesis, or other known techniques can be performed on the cloned DNA to
produce
T. parva antigen polypeptide variant DNA. Scanning amino acid analysis can also be employed
to identify one or more amino acids along a contiguous sequence. Among the preferred
scanning amino acids are relatively small, neutral amino acids. Such amino acids include
alanine, glycine, serine, and cysteine. Alanine is typically a preferred scanning
amino acid among this group because it eliminates the side-chain beyond the beta-carbon
and is less likely to alter the main-chain confirmation of the variant [
Cunningham and Wells, Science, 244: 1081-1085 (1989)]. Alanine is also typically preferred because it is the most common amino acid.
Further, it is frequently found in both buried and exposed positions [
Creighton, The Proteins, (W.H. Freeman & Co., N.Y.);
Chothia, J. Mol. Biol; 150:1 (1976)]. If alanine substitution does not yield adequate amounts of variant, an isoteric
amino acid can be used. Screening of the mutants or variants is done using elispot
and/or bioassays of
T. parva antigen Polypeptide activities and/or properties as described herein.
[0157] The description further provides fragments of the antigen peptides, in addition to
proteins and peptides that comprise and consist of such fragments, particularly those
comprising the residues identified in SEQ ID NO: 4-7. The fragments to which the invention
pertains, however, are not to be construed as encompassing fragments that may be disclosed
publicly prior to the present invention.
[0158] As used herein, a fragment comprises at least about 8, 10, 12, 14, 16, or more contiguous
amino acid residues from an antigen peptide. Such fragments can be chosen based on
the ability to retain one or more of the biological activities of the antigen peptide
or could be chosen for the ability to perform a function, e.g. bind a substrate or
act as an immunogen. Particularly important fragments are biologically active fragments,
peptides that are, for example, about 8 or more amino acids in length. Such fragments
will typically comprise a domain or motif of the antigen peptide, e.g., active site,
a transmembrane domain or a substrate-binding domain. Further, possible fragments
include, but are not limited to, domain or motif containing fragments, soluble peptide
fragments, and fragments containing immunogenic structures. Predicted domains and
functional sites are readily identifiable by computer programs well known and readily
available to those of skill in the art (e.g., PROSITE analysis).
[0159] The software, "Glimmer" ver 1.0 and 2.0 (Gene Locator and Interpolated Markov Modeler),
is used to find genes in DNA, using interpolated Markov models (IMMs) to identify
the coding regions and distinguish them from noncoding DNA. The IMM approach, described
in
Salzburg et al., 1998, NAR 26:544, and
Delcher et al, 1999, NAR 27:4636 use a combination of Markov models from 1st through 8th-order, weighting each model
according to its predictive power. Glimmer 1.0 and 2.0 use 3-periodic nonhomogenous
Markov models in their IMMs. Glimmer and other software applications that use IMM
such as GlimmerM and GlimmerHMM, (
Pertea, M., and Salzberg, S.L. Current Protocols in Bioinformatics, 2002.) have been used to find the genes in chromosome 2 of the malaria parasite,
P. falciparum. GlimmerM is described in
S.L. Salzberg, M. Pertea, A.L. Delcher, M.J. Gardner, and H. Tettelin, "Interpolated
Markov models for eukaryotic gene finding," Genomics 59 (1999), 24-31. The Glimmer system consists of two main programs. The first of these is the training
program,
build-imm that takes an input set of sequences and builds and outputs the IMM for them. These
sequences can be complete genes or just partial orfs. For a new genome, this training
data can consist of those genes with strong database hits as well as very long open
reading frames that are statistically almost certain to be genes. The second program
is
glimmer, which uses this IMM to identify putative genes in an entire genome. A Perl program
is available that will use Glimmer's predictions as to call the BLAST program and
search any locally-installed protein database.
[0160] "Combiner" (
J. E. Allen, M. Pertea, S. L. Salzberg, Genome Research, 14(1), 2004. is a program that uses the output from gene finders, splice site prediction programs
and sequence alignments to predict gene models. The program provides an automated
way to take advantage of the many successful methods for computational gene prediction
and can provide substantial improvements in accuracy over an individual gene prediction
program. These software applications can incorporate information that will allow one
skilled in the art to identify sequences that are candidates for encoding polypeptides
of interest.
[0161] Polypeptides often contain amino acids other than the 20 amino acids commonly referred
to as the 20 naturally occurring amino acids. Further, many amino acids, including
the terminal amino acids, may be modified by natural processes, such as processing
and other post-translational modifications, or by chemical modification techniques
well known in the art. Common modifications that occur naturally in antigen peptides
are described in basic texts, detailed monographs, and the research literature, and
they are well known to those of skill in the art.
[0162] Known modifications include, but are not limited to, acetylation, acylation, ADP-ribosylation,
amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent
attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid
or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization,
disulfide bond formation, demethylation, formation of covalent crosslinks, formation
of cystine, formation of pyroglutamate, formylation, gamma carboxylation, glycosylation,
GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation,
proteolytic processing, phosphorylation, prenylation, racemization, selenoylation,
sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginylation,
and ubiquitination.
[0163] Such modifications are well known to those of skill in the art and have been described
in great detail in the scientific literature. Several particularly common modifications,
glycosylation, lipid attachment, sulfation, gamma-carboxylation of glutamic acid residues,
hydroxylation and ADP-nbosylation, for instance, are described in most basic texts,
such as
Proteins-Structure and Molecular Properties, 2-sup.nd Ed., T. E. Creighton, W. H.
Freeman and Company, New York (1993). Many detailed reviews are available on this subject, such as by
Wold, F., Posttranslational Covalent Modification of Proteins, B. C. Johnson, Ed.,
Academic Press, New York 1-12 (1983);
Seifter et al. (Meth. Enzymol. 182: 626-646 (1990)) and
Rattan et al. (Ann. N.Y Acad. Sci. 663:48-6,2 (1992)).
[0164] Accordingly, the antigen peptides mentioned herein also encompass derivatives or
analogs in which a substituted amino acid residue is not one encoded by the genetic
code, in which a substituent group is included, in which the mature antigen peptide
is fused with another compound, such as a compound to increase the half-life of the
antigen peptide (for example, polyethylene glycol), or in which the additional amino
acids are fused to the mature antigen peptide, such as a leader or secretory sequence
or a sequence for purification of the mature antigen peptide or a pro-protein sequence.
[0165] Although an amino acid sequence or oligopeptide used for antibody induction does
not require biological activity, it must be immunogenic. A peptide, polypeptide, or
protein used to induce specific antibodies may have an amino acid sequence consisting
of at least five amino acids and preferably at least 10 amino acids. Short stretches
of amino acid sequence may be genetically or chemically fused with those of another
protein such as keyhole limpet hemocyanin, and the chimeric peptide used for antibody
production. Alternatively, the oligopeptide may be of sufficient length to contain
an entire domain.
[0166] Antibodies specific for peptides, polypeptides, or proteins may be produced by inoculation
of an appropriate non-human animal with an antigenic fragment of the peptide, polypeptide,
or protein. Antibody production includes not only the stimulation of an immune response
by injection into non-human animals, but also analogous processes such as the production
of synthetic antibodies, the screening of recombinant immunoglobulin libraries for
specific-binding molecules (
Orlandi R. et al. [1989] PNAS 86:3833-3837, or
Huse W. D. et al. [1989] Science 256:1275-1281), or the in vitro stimulation of lymphocyte populations. Current technology (
Winter G. and Milstein C. [1991] Nature 349:293-299) provides for a number of highly. specific binding reagents based on the principles
of antibody formation. These techniques may be adapted to produce molecules which
specifically bind antigen peptides. Antibodies or other appropriate molecules generated
against a specific immunogenic peptide fragment or oligopeptide can be used in Western
analysis, enzyme-linked immunosorbent assays (ELISA) or similar tests to establish
the presence of or to quantitate amounts of peptide, polypeptide, or protein in normal,
diseased, or transformed cells, tissues, organs, or organisms as well as liquid suspensions
containing said peptide, polypeptide, or protein.
[0167] The description also provides for antibodies that selectively bind to one of the
peptides described herein, a proteins comprising such a peptide, as well as variants
and fragments thereof. As used herein, an antibody selectively binds a target peptide
when it binds the target peptide and does not significantly bind to unrelated proteins.
An antibody is still considered to selectively bind a peptide even if it also binds
to other proteins that are not substantially homologous with the target peptide so
long as such proteins share homology with a fragment or domain of the peptide target
of the antibody. In this case, it would be understood that antibody binding to the
peptide is still selective despite some degree of cross-reactivity.
[0168] As used herein, an antibody is defined in terms consistent with that recognized within
the art: they are multi-subunit proteins produced by a mammalian organism in response
to an antigen challenge. The antibodies mentioned herein include polyclonal antibodies
and monoclonal antibodies, as well as fragments of such antibodies, including, but
not limited to, Fab or F(ab')
2, and Fv fragments.
[0170] In general, to generate antibodies, an isolated peptide is used as an immunogen and
is administered to a mammalian organism, such as a rat, rabbit or mouse. The full-length
protein, an antigenic peptide fragment or a fusion protein can be used. Particularly
important fragments are those covering functional domains, such as the domains identified
in the figures, and domain of sequence homology or divergence amongst the family,
such as those that can readily be identified using protein alignment methods and as
presented in the Figures.
[0171] Antibodies are preferably prepared from regions or discrete fragments of the antigen
proteins. Antibodies can be prepared from any region of the peptide as described herein.
However, preferred regions will include those involved in function/activity and/or
antigen/binding partner interaction.
[0172] An antigenic fragment will typically comprise at least 8 contiguous amino acid residues.
The antigenic peptide can comprise, however, at least 10, 12, 14, 16 or more amino
acid residue. Such fragments can be selected on a physical property, such as fragments
correspond to regions that are located on the surface of the protein, e.g., hydrophilic
regions or can be selected based on sequence uniqueness. '
[0173] Detection on an antibody or peptide described herein can be facilitated by coupling
(i.e., physically linking) the antibody or peptide to a detectable substance. Examples
of detectable substances include various enzymes, prosthetic groups, fluorescent materials,
luminescent materials, bioluminescent materials, and radioactive materials. Examples
of suitable enzymes include horseradish peroxidase, alkaline phosphatase, beta-galactosidase,
or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin/biotin
and avidin/biotin; examples of suitable fluorescent materials include umbelliferone,
fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein,
dansyl chloride or phycoerythrin, an example of a luminescent material includes luminol;
examples of bioluminescent materials include luciferase, luciferin, and aequorin,
and examples of suitable radioactive material include
125I,
131I,
35S or
3H.
[0174] The antibodies can be used to isolate one of the proteins described herein by standard
techniques, such as affinity chromatography or immunoprecipitation. The antibodies
can facilitate the purification of the natural protein from cells and recombinantly
produced protein expressed in host cells. In addition, such antibodies are useful
to detect the presence of one of the proteins described herein in cells or tissues
to determine the pattern of expression of the protein among various tissues in an
organism and over the course of schizont development. Such antibodies can be used
to detect protein in situ, in vitro, or in a cell lysate or supernatant in order to
evaluate the abundance and pattern of expression. Also, such antibodies can be used
to assess abnormal tissue distribution or abnormal expression during development or
progression of a protozoan infection. Antibody detection of circulating fragments
of the full length protein can be used to identify turnover.
[0175] Further, the antibodies can be used to assess expression in disease states such as
in active stages of the disease or in lymphocytes harvested from infected animals.
Experimental data has shown expression of
T. parva antigens, using antibodies directed against such antigens, in bovine lymphocytes,
infected with
T. parva. If a disease is characterized by a specific mutation in the protein, antibodies
specific for this mutant protein can be used to assay for the presence of the specific
mutant protein.
[0176] The diagnostic uses can be applied, not only in genetic testing, but also in monitoring
a treatment modality. Accordingly, where treatment is ultimately aimed at preventing
or controlling infection; antibodies directed against the protein or relevant fragments
can be used to monitor therapeutic efficacy.
[0177] The antibodies are also useful for inhibiting protein function, for example, blocking
the binding of the antigenic peptide to a binding partner such as a substrate. These
uses can also be applied in a therapeutic context in which treatment involves inhibiting
the protein's function. An antibody can be used, for example, to block binding, thus
modulating (agonizing or antagonizing) the peptides activity. Antibodies can be prepared
against specific fragments containing sites required for function or against intact
protein that is associated with a cell or cell membrane. See SEQ ID NO: 1-7 for structural
information relating to the proteins described herein
[0178] The description also encompasses kits for using antibodies to detect the presence
of a protein in a biological sample. The kit can comprise antibodies such as a labeled
or labelable antibody and a compound or agent for detecting protein in a biological
sample; means for determining the amount of protein in the sample; means for comparing
the amount of protein in the sample with a standard; and instructions for use. Such
a kit can be supplied to detect a single protein or epitope or can be configured to
detect one of a multitude of epitopes, such as in an antibody detection array. Arrays
are described in detail below for nucleic acid arrays and similar methods have been
developed for antibody arrays.
[0179] The proteins described herein can be used in assays related to the functional information
provided in the Figures; for example, to stimulate CD8+ cytotoxic T cell lines, to
raise antibodies or to elicit another immune response; as a reagent (including the
labeled reagent) in assays designed to quantitatively determine levels of the protein
(or its binding partner or ligand) in biological fluids; and as markers for tissues
in which the corresponding protein is preferentially expressed (either constitutively
or at a particular stage of tissue differentiation or development or in a disease
state). Where the protein binds or potentially binds to another protein or ligand
(such as, for example, in an enzyme-effector protein interaction or enzyme-ligand
interaction), the protein can be used to identify the binding partner/ligand so as
to develop a system to identify inhibitors of the binding interaction. Any or all
of these uses are capable of being developed into reagent grade or kit format for
commercialization as commercial products.
[0180] Methods for performing the uses listed above are well known to those skilled in the
art. References disclosing such methods include "
Molecular Cloning: A Laboratory Manual", 2d ed., Cold Spring Harbor Laboratory Press,
Sambrook, J., E. F. Fritsch and T. Maniatis eds., 1989, and "
Methods in Enzymology. Guide to Molecular Cloning Techniques", Academic Press, Berger,
S. L. and A. R. Kimmel eds., 1997.
[0181] The potential uses of the peptides described herein are based primarily on the source
of the protein as well as the class/action of the protein. For example, antigens isolated
from
T. parva and their protozoan orthologs serve as targets for identifying agents for use in
mammalian therapeutic applications, e.g. an animal drug, particularly in modulating
a biological or pathological response in a cell, tissue, or protozoan that expresses
an immunogenic antigen. Experimental data has shown that the antigens described herein
are expressed in infected host lymphocytes, as indicated by flow cytometric analysis.
Such uses can readily be determined using the information provided herein, that which
is known in the art, and routine experimentation.
[0182] Lymphoblastosis is a condition that describes the multiplication or the proliferation
of lymphocytes. Often lymphoblastosis occurs when certain lineages of lymphocytes,
such as those in the T-cell mediated immunological pathways, are stimulated by an
antigen. At other times, lymphoblastosis can be the result of pathological processes
such as viral or other pathogenic infection or as a result of tumorgenesis.
[0183] To perform assays mentioned herein, such as assays to detect a pathogen,
e.g., by detecting the presence and/or expression of a polypeptide described herein in
the pathogen, it is sometimes desirable to immobilize either the antigen protein,
or fragment, or its target molecule to facilitate separation of complexes from uncomplexed
forms of one or both of the proteins, as well as to accommodate automation of the
assay.
[0184] Techniques for immobilizing proteins on matrices can be used in assays mentioned
herein. In one embodiment, a fusion protein can be provided which adds a domain that
allows the protein to be bound to a matrix. For example, glutathione-S-transferase
fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical,
St. Louis, Mo.) or glutathione derivatized microtitre plates, which are then combined
with the cell lysates (e.g.,
35S-labeled) and the candidate compound, and the mixture incubated under conditions
conducive to complex formation (e.g., at physiological conditions for salt and pH).
Following incubation, the beads are washed to remove any unbound label, and the matrix
immobilized and radiolabel determined directly, or in the supernatant after the complexes
are dissociated. Alternatively, the complexes can be dissociated from the matrix,
separated by SDS-PAGE, and the level of antigen-binding protein found in the bead
fraction quantitated from the gel using standard electrophoretic techniques. For example,
either the polypeptide or its target molecule can be immobilized utilizing conjugation
of biotin and streptavidin using techniques well known in the art. Alternatively,
antibodies reactive with the protein but which do not interfere with binding of the
protein to its target molecule can be derivatized to the wells of the plate, and the
protein trapped in the wells by antibody conjugation. Preparations of an antigen-binding
protein and a candidate compound are incubated in the antigen protein-presenting wells
and the amount of complex trapped in the well can be quantitated. Methods for detecting
such complexes, in addition to those described above for the GST-immobilized complexes,
include immunodetection, of complexes using antibodies reactive with the antigen protein
target molecule, or which are reactive with antigen protein and compete with the target
molecule, as well as enzyme-linked assays which rely on detecting an enzymatic activity
associated with the presence of the target molecule.
[0185] The antigen proteins mentioned herein are also useful to provide a target for diagnosing
a disease or a disease mediated by the peptide. Accordingly, the description provides
methods for detecting the presence, or levels of, the protein (or encoding mRNA) in
a cell, tissue, or organism. Experimental data has shown expression in
T. parva-infected bovine lymphocytes. The method involves contacting a biological sample with
a compound capable of interacting with the antigen protein such that the interaction
can be detected. Such an assay can be provided in a single detection format or a multi-detection
format such as an antibody chip array.
[0186] One agent for detecting a protein in a sample is an antibody capable of selectively
binding to protein. A biological sample includes tissues, cells and biological fluids
isolated from a subject, as well as tissue, cells and fluids present within a subject.
[0187] Another aspect mentioned herein is a kit for purifying
T. parva from a sample containing
T. parva, comprising an antibody mentioned herein. The kit may further comprise means for performing
an enzyme-linked or Western blot assay to detect the presence of
T. parva; and/or means for binding the antibody to
T. parva in the sample, and for releasing the organism from the antibody.
[0188] The peptides described herein also provide targets for diagnosing active parasite
activity or disease, in an animal having a variant peptide, particularly activities
and conditions that are known for other members of the family of proteins to which
the present one belongs. Thus, the peptide can be isolated from a biological sample
and assayed for the presence of a genetic mutation that results in aberrant peptide.
This includes amino acid substitution, deletion, insertion, rearrangement, (as the
result of aberrant splicing events), and inappropriate post-translational modification.
Analytic methods include altered electrophoretic mobility, altered tryptic peptide
digest, altered enzyme activity in cell-based or cell-free assay, alteration in substrate
or antibody-binding pattern, altered isoelectric point, direct amino acid sequencing,
and any other of the known assay techniques useful for detecting mutations in a protein.
Such an assay can be provided in a single detection format or a multi-detection format
such as an antibody chip array.
[0189] In vitro techniques for detection of peptide include enzyme linked immunosorbent
assays (ELISAs), Western blots, immunoprecipitations and immunofluorescence using
a detection reagent, such as an antibody or protein binding agent, as well as the
methods that represent embodiments described herein . Alternatively, the peptide can
be detected in vivo in a subject by introducing into the subject a labeled anti-peptide
antibody or other types of detection agent. For example, the antibody can be labeled
with a radioactive marker whose presence and location in a subject can be detected
by standard imaging techniques. Such methods can be used to detect the allelic variant
of a peptide expressed in an infected subject and methods which detect fragments of
a peptide in a sample.
[0190] The diagnostic uses can be applied, not only in genetic testing, but also in monitoring
a treatment modality. Accordingly, where treatment is ultimately aimed at preventing
or controlling infection, antibodies directed against the protein or relevant fragments
can be used to monitor therapeutic efficacy.
[0191] The description also encompasses kits for using antibodies to detect the presence
of a protein in a biological sample. The kit can comprise antibodies such as a labeled
or labelable antibody and a compound or agent for detecting protein in a biological
sample; means for determining the amount of protein in the sample; means for comparing
the amount of protein in the sample with a standard; and instructions for use. Such
a kit can be supplied to detect a single protein or epitope or can be configured to
detect one of a multitude of epitopes, such as in an antibody detection array. Arrays
are described in detail below for nucleic acid arrays and similar methods have been
developed for antibody arrays.
[0192] The present description further provides isolated nucleic acid molecules that encode
a
T. parva antigen peptide for protein described herein (cDNA, transcript and genomic sequence).
Such nucleic acid molecules will consist of, consist essentially of, or comprise a
nucleotide sequence that encodes one of the enzyme peptides described herein, an allelic
variant thereof, or an ortholog or paralog thereof.
[0193] As used herein, an "isolated" nucleic acid molecule is one that is separated from
other nucleic acid present in the natural source of the nucleic acid. Preferably,
an "isolated" nucleic acid is free of sequences which naturally flank the nucleic
acid (i.e., sequences located at the 5' and 3' ends of the nucleic acid) in the genomic
DNA of the organism from which the nucleic acid is derived. However, there can be
some flanking nucleotide sequences, for example up to about 5KB, 4KB, 3KB, 2KB, or
1KB or less, particularly contiguous peptide encoding sequences and peptide encoding
sequences within the same gene but separated by introns in the genomic sequence. The
important point is that the nucleic acid is isolated from remote and unimportant flanking
sequences such that it can be subjected to the specific manipulations described herein
such as recombinant expression, preparation of probes and primers, and other uses
specific to the nucleic acid sequences.
[0194] Moreover, an "isolated" nucleic acid molecule, such as a transcript/cDNA molecule,
can be substantially free of other cellular material, or culture medium when produced
by recombinant techniques, or chemical precursors or other chemicals when chemically
synthesized. However, the nucleic acid molecule can be fused to other coding or regulatory
sequences and still be considered isolated.
[0195] For example, recombinant DNA molecules contained in a vector are considered isolated.
Further examples of isolated DNA molecules include recombinant DNA molecules maintained
in heterologous host cells or purified (partially or substantially) DNA molecules
in solution. Isolated RNA molecules include in vivo or in vitro RNA transcripts of
the isolated DNA molecules described herein. Isolated nucleic acid molecules described
herein further include such molecules produced synthetically.
[0196] The nucleic acid may be double stranded, single stranded, or contain portions of
both double stranded or single stranded sequence. As will be appreciated by those
in the art, the depiction of a single strand ("Watson") also defines the sequence
of the other strand ("Crick"); thus the sequences depicted in the figures also include
the complement of the sequence.
[0197] As disclosed herein, 100% sequence identity between the RNA and the target gene is
not required to practice the present invention. Thus the invention has the advantage
of being able to tolerate sequence variations that might be expected due to genetic
mutation, strain polymorphism, or evolutionary divergence. RNAi molecules mentioned
herein are not limited to those that are targeted to the full-length polynucleotide
or gene. Gene product can be inhibited with an RNAi molecule that is targeted to a
portion or fragment of the exemplified polynucleotides; high homology (90-95%) or
greater identity is also preferred, but not necessarily essential, for such applications.
[0198] Accordingly, the description provides nucleic acid molecules that consist of, consist
essentially of, or comprise, the nucleotide sequence shown in SEQ ID NO: 25-31 or
any nucleic acid molecule that encodes a protein encoded by SEQ ID NO: 25-31.
[0199] The term "consisting essentially of," when used in the context of biopolymers, refers
to a sequence which is intermediate between the number of residues (amino acids or,
in the present case, nucleotides) encompassed by the term "consisting of" and the
longer length encompassed by the term "comprising." Residues in addition to the residues
encompassed by "consisting of" language do not affect the basic and novel characteristics
(
e.g., in the case of a polynucleotide, the ability to encode a functional peptide, or
to bind specifically to a nucleic acid of interest) of the molecule encompassed by
the "consisting of" language.
[0200] The description further provides nucleic acid molecules that encode fragments of
the peptides described herein as well as nucleic acid molecules that encode obvious
variants of the enzyme proteins mentioned herein that are described above. Such nucleic
acid molecules may be naturally occurring, such as allelic variants (same locus),
paralogs (different locus), and orthologs (different organism), or may be constructed
by recombinant DNA methods or by chemical synthesis. Such non-naturally occurring
variants may be made by mutagenesis techniques, including those applied to nucleic
acid molecules, cells, or organisms. Accordingly, as discussed above, the variants
can contain nucleotide substitutions, deletions, inversions and insertions. Variation
can occur in either or both the coding and non-coding regions. The variations can
produce conservative and non-conservative amino acid substitutions.
[0201] The description further provides epitope fragments of the antigen proteins and the
nucleic acid molecules encoding the antigens, provided in the description of epitope-mapping
experiments described below. An epitope coding region comprises a contiguous nucleotide
sequence greater than 12 or more nucleotides. Further, a fragment could at least 30,
40, 50, 100, 250 or 500 nucleotides in length. The length of the fragment will be
based on its intended use. For example, the fragment can encode epitope bearing regions
of the peptide, or can be useful as DNA probes and primers. Such fragments can be
isolated using the known nucleotide sequence to synthesize an oligonucleotide probe.
A labeled probe can then be used to screen a cDNA library, genomic DNA library, or
mRNA to isolate nucleic acid corresponding to the coding region. Further, primers
can be used in PCR reactions to clone specific regions of gene.
[0202] A probe/primer typically comprises substantially a purified oligonucleotide or oligonucleotide
pair. The oligonucleotide typically comprises a region of nucleotide sequence that
hybridizes under stringent conditions to at least about 12, 20, 25, 40, 50 or more
consecutive nucleotides.
[0203] Orthologs, homologs, and allelic variants can be identified using methods well known
in the art. As described in the Peptide Section, these variants comprise a nucleotide
sequence encoding a peptide that is typically 60-70%, 70-80%, 80-90%, and more typically
at least about 90-95% or more homologous to the nucleotide sequence shown in the Figure
sheets or a fragment of this sequence. Such nucleic acid molecules can readily be
identified as being able to hybridize under moderate to stringent conditions, to the
nucleotide sequence shown in the Figure sheets or a fragment of the sequence. Allelic
variants can readily be determined by genetic locus of the encoding gene. The gene
encoding the novel enzyme described herein is located on a genome component that has
been mapped to the
T. parva chromosome1 and 2 which is supported by multiple lines of evidence, such as STS and
BAC map data.
[0204] The nucleic acid molecules described herein are useful as probes, primers, chemical
intermediates, and in biological assays. The nucleic acid molecules are useful as
a hybridization probe for messenger RNA, transcript/cDNA and genomic DNA to isolate
full-length cDNA and genomic clones encoding the peptide described in SEQ ID NO:4-7
and to isolate cDNA and genomic clones that correspond to variants (alleles, orthologs,
etc.) producing the same or related peptides shown in SEQ ID NO:1-7.
[0205] The probe can correspond to any sequence along the entire length of the nucleic acid
molecules provided in the SEQ ID information. Accordingly, it could be derived from
5' noncoding regions, the coding region, and 3' noncoding regions. However, as discussed,
fragments are not to be construed as encompassing fragments disclosed prior to the
present invention.
[0206] The nucleic acid molecules are also useful as primers for PCR to amplify any given
region of a nucleic acid molecule and are useful to synthesize antisense molecules
of desired length and sequence.
[0207] The nucleic acid molecules are also useful for constructing recombinant vectors.
Such vectors include expression vectors that express a portion of, or all of, the
peptide sequences. Vectors also include insertion vectors, used to integrate into
another nucleic acid molecule sequence, such as into the cellular genome, to alter
in situ expression of a gene and/or gene product. For example, an endogenous coding
sequence can be replaced via homologous recombination with all or part of the coding
region containing one or more specifically introduced mutations.
[0208] The nucleic acid molecules are also useful for expressing antigenic portions of the
proteins.
[0209] The nucleic acid molecules are also useful as probes for determining the chromosomal
positions of the nucleic acid molecules by means of in situ hybridization methods.
The genes encoding the novel antigens described herein are located on a genome component
that has been mapped to
T. parva chromosomes 1 (Tp2).
[0210] The nucleic acid molecules are also useful in making vectors containing the gene
regulatory regions of the nucleic acid molecules described herein
[0211] The nucleic acid molecules are also useful for designing antigens corresponding to
all, or a part, of the mRNA produced from the nucleic acid molecules described herein.
[0212] The nucleic acid molecules are also useful for making vectors that express part,
or all, of the peptides.
[0213] The nucleic acid molecules are also useful for constructing host cells expressing
a part, or all, of the nucleic acid molecules and peptides.
[0214] The nucleic acid molecules are also useful as hybridization probes for determining
the presence, level, form and distribution of nucleic acid expression. Such probes
could be used to detect the presence of, or to determine levels of, a specific nucleic
acid molecule in cells, tissues, and in organisms. The nucleic acid whose level is
determined can be DNA or RNA. Accordingly, probes corresponding to the peptides described
herein can be used to assess expression and/or gene copy number in a given cell, tissue,
or organism. These uses are relevant for diagnosis of disorders involving an increase
or decrease in antigen protein expression relative to normal results.
[0215] In vitro techniques for detection of mRNA include Northern hybridizations and in
situ hybridizations. In vitro techniques for detecting DNA include Southern hybridizations
and in situ hybridization.
[0216] Probes can be used as a part of a diagnostic test kit for identifying cells or tissues
that express an
T. parva antigen protein, such as by measuring a level of an antigen-encoding nucleic acid
in a sample of cells from a subject e.g., mRNA or genomic DNA, or determining if an
antigen gene has been mutated.
[0217] The description encompasses kits for detecting the presence of an antigen nucleic
acid in a biological sample. For example, the kit can comprise reagents such as a
labeled or labelable nucleic acid or agent capable of detecting antigen nucleic acid
in a biological sample; means for determining the amount of antigen nucleic acid in
the sample; and means for comparing the amount of antigen nucleic acid in the sample
with a standard. The compound or agent can be packaged in a suitable container. The
kit can further comprise instructions for using the kit to detect antigen protein
mRNA or DNA.
[0218] The description further provides nucleic acid detection kits, such as arrays or microarrays
of nucleic acid molecules that are based on the sequence information provided in SEQ
ID NO: 25-31.
[0219] As used herein "Arrays" or "Microarrays" refers to an array of distinct polynucleotides
or oligonucleotides synthesized on a substrate, such as paper, nylon or other type
of membrane, filter, chip, glass slide, or any other suitable solid support. In one
embodiment, the microarray is prepared and used according to the methods described
in
U.S. Pat. No. 5,837,832, Chee et al.,
PCT application W095/11995 (Chee et al.),
Lockhart, D. J. et al. (1996; Nat. Biotech. 14: 1675-1680) and
Schena, M. et al. (1996; Proc. Natl. Acad. Sci. 93: 10614-10619). In other embodiments, such arrays are produced by the methods described by
Brown et al., U.S. Pat. No. 5,807,522.
[0220] The microarray or detection kit is preferably composed of a large number of unique,
single-stranded nucleic acid sequences, usually either synthetic antisense oligonucleotides
or fragments of cDNAs, fixed to a solid support. The oligonucleotides are preferably
about 6-60 nucleotides in length, more preferably 15-30 nucleotides in length, and
most preferably about 20-25 nucleotides in length. For a certain type of microarray
or detection kit, it may be preferable to use oligonucleotides that are only 7-20
nucleotides in length. The microarray or detection kit may contain oligonucleotides
that cover the known 5', or 3', sequence, sequential oligonucleotides which cover
the full length sequence; or unique oligonucleotides selected from particular areas,
along the length of the sequence. Polynucleotides used in the microarray or detection
kit may be oligonucleotides that are specific to a gene or genes of interest.
[0221] In order to produce oligonucleotides to a known sequence for a microarray or detection
kit, the gene(s) of interest (or an ORF identified in the description) is typically
examined using a computer algorithm which starts at the 5' or at the 3' end of the
nucleotide sequence. Typical algorithms will then identify oligomers of defined length
that are unique to the gene, have a GC content within a range suitable for hybridization,
and lack predicted secondary structure that may interfere with hybridization. In certain
situations it may be appropriate to use pairs of oligonucleotides on a microarray
or detection kit. The "pairs" will be identical, except for one nucleotide that preferably
is located in the center of the sequence. The second oligonucleotide in the pair (mismatched
by one) serves as a control. The number of oligonucleotide pairs may range from two
to one million. The oligomers are synthesized at designated areas on a substrate using
a light-directed chemical process. The substrate may be paper, nylon or other type
of membrane, filter, chip, glass slide or any other suitable solid support.
[0222] In another aspect, an oligonucleotide may be synthesized on the surface of the substrate
by using a chemical coupling procedure and an ink jet application apparatus, as described
in
PCT application W095/251116 (Baldeschweiler et al.). In another aspect, a "gridded" array analogous to a dot (or slot) blot may be used
to arrange and link cDNA fragments or oligonucleotides to the surface of a substrate
using a vacuum system, thermal, UV, mechanical or chemical bonding procedures. An
array, such as those described above, may be produced by hand or by using available
devices (slot blot or dot blot apparatus), materials (any suitable solid support),
and machines (including robotic instruments), and may contain 8, 24, 96, 384, 1536,
6144 or more oligonucleotides, or any other number between two and one million which
lends itself to the efficient use of commercially available instrumentation.
[0223] In order to conduct sample analysis using a microarray or detection kit, the RNA
or DNA from a biological sample is made into hybridization probes. The mRNA is isolated,
and cDNA is produced and used as a template to make antisense RNA (aRNA). The aRNA
is amplified in the presence of fluorescent nucleotides, and labeled probes are incubated
with the microarray or detection kit so that the probe sequences hybridize to complementary
oligonucleotides of the microarray or detection kit. Incubation conditions are adjusted
so that hybridization occurs with precise complementary matches or with various degrees
of less complementarity. After removal of nonhybridized probes, a scanner is used
to determine the levels and patterns of fluorescence. The scanned images are examined
to determine degree of complementarity and the relative abundance of each oligonucleotide
sequence on the microarray or detection kit. The biological samples may be obtained
from any bodily fluids (such as blood, urine, saliva, phlegm, gastric juices, etc.),
cultured cells, biopsies, or other tissue preparations. A detection system may be
used to measure the absence, presence, and amount of hybridization for all of the
distinct sequences simultaneously. This data may be used for large-scale correlation
studies on the sequences, expression patterns, mutations, variants, or polymorphisms
among samples.
[0224] Using such arrays, the description provides methods to identify the presence or expression
of the antigen proteins/peptides described herein . In detail, such methods comprise
incubating a test sample with one or more nucleic acid molecules and assaying for
binding of the nucleic acid molecule with components within the test sample. Such
assays will typically involve arrays comprising many genes, at least one of which
is a gene described herein and or alleles of the enzyme gene described herein. The
figures and associated information below provide information on epitope sequence and
micro-variation in strains of
T. parva that have been found in the gene encoding the antigen described herein.
[0225] Conditions for incubating a nucleic acid molecule with a test sample vary. Incubation
conditions depend on the format employed in the assay, the detection methods employed,
and the type and nature of the nucleic acid molecule used in the assay. One skilled
in the art will recognize that any one of the commonly available hybridization, amplification
or array assay formats can readily be adapted to employ the novel fragments of the
T. parva genome disclosed herein. Examples of such assays can be found in
Chard, T, An Introduction to Radioimmunoassay and Related Techniques, Elsevier Science
Publishers, Amsterdam, The Netherlands (1986);
Bullock, G. R. et al., Techniques in Immunocytochemistry, Academic Press, Orlando,
Fla. Vol. 1 (1982),
Vol. 2 (1983),
Vol. 3 (1985);
Tijssen, P., Practice and Theory of Enzyme Immunoassays: Laboratory Techniques in
Biochemistry and Molecular Biology, Elsevier Science Publishers, Amsterdam, The Netherlands
(1985).
[0226] The test samples described herein include cells, protein or membrane extracts of
cells. The test sample used in the above-described method will vary based on the assay
format, nature of the detection method and the tissues, cells or extracts used as
the sample to be assayed. Methods for preparing nucleic acid extracts or of cells
are well known in the art and can be readily be adapted in order to obtain a sample
that is compatible with the system utilized.
[0227] In another embodiment, kits are provided which contain the necessary reagents to
carry out the assays described herein.
[0228] Specifically, the description provides a compartmentalized kit to receive, in close
confinement, one or more containers which comprises: (a) a first container comprising
one of the nucleic acid molecules that can bind to a fragment of the
T. parva genome disclosed herein; and (b) one or more other containers comprising one or more
of the following: wash reagents, reagents capable of detecting presence of a bound
nucleic acid.
[0229] In detail, a compartmentalized kit includes any kit in which reagents are contained
in separate containers. Such containers include small glass containers, plastic containers,
strips of plastic, glass or paper, or arraying material such as silica. Such containers
allows one to efficiently transfer reagents from one compartment to another compartment
such that the samples and reagents are not cross-contaminated, and the agents or solutions
of each container can be added in a quantitative fashion from one compartment to another.
Such containers will include a container which will accept the test sample, a container
which contains the nucleic acid probe, containers which contain wash reagents (such
as phosphate buffered saline, Tris-buffers, etc.), and containers which contain the
reagents used to detect the bound probe. One skilled in the art will readily recognize
that the previously unidentified enzyme gene described herein can be routinely identified
using the sequence information disclosed herein can be readily incorporated into one
of the established kit formats which are well known in the art, particularly expression
arrays.
[0230] The
T.
parva antigens mentioned herein can induce,
in vivo, antigen-specific CD8+ cytotoxic T cells for prophylactic immunization of cattle
for the prevention of East Coast Fever disease. In addition, CTLs specific to the
following metazoan parasites may also be induced by compositions identified in accordance
with the methods mentioned herein :
Plasmodium falciparum (which causes, malaria),
Schistosoma mansoni (which causes schistosomiasis), and
Trypanosoma cruzi (which causes Chagas disease),
Giardia lamblia,
Entoemeba histolytica,
Cryptospiridium spp.,
Leishmania spp.,
Brugia spp.,
Wuchereria spp.,
Onchocerca spp.,
Strongyloides spp.,
Coccidia,
Haemanchus spp.,
Ostertagia spp.,
Trichomonas spp.,
Dirofilaria spp.,
Toxocara spp.,
Naegleria spp.,
Pneumocystis carinii,
Ascaris spp., other
Trypanosoma spp., other
Schistosome spp., other
Plasmodium spp.,
Babesia spp.,
Theileria spp., including but not limited to
T.
parva.
T. lawrencei,
T. annulata,
T. hirci,
T. ovis,
T. lastoguardi,
T. orientalis,
T. buffeli and
T. taurotragi;, Babesia spp., including, but not limited to
B. bigemina,
B. divergens,
B. major,
B.
bovis,
B. motasi, B. ovis,
B. cabelli, B. equii,
B. traumani. B. canis. B. gibsoni, B. felis, and B. microfti; Adelina app., including, but not limited to
A. delina, A. castana, A. picei, A. palori, and A, triboli, Anisakis and Isospora
beli.
[0231] Following are examples which illustrate procedures for practicing the invention.
These examples should not be construed as limiting. All percentages are by weight
and all solvent mixture proportions are by volume unless otherwise noted. As used
herein and further defined below, "nucleic acid" may refer to either DNA or RNA, or
molecules which contain both deoxy- and ribonucleotides. The nucleic acids include
genomic DNA, cDNA, and oligonucleotides including sense and anti-sense nucleic acids.
Such nucleic acids may also contain modifications in the ribose-phosphate backbone
to increase stability and half life of such molecules in physiological environments.
EXAMPLES
Genome sequencing, preliminary annotation, selection of genes encoding candidate antigens
[0232] The Theileria parva nuclear genome consists of 4 chromosomes and is approximately
8.2 Mb in length. Tp2, Tp3, and Tp6 loci are located on Chromosome 1. The
T. parva genome was sequenced using a conventional whole genome shotgun strategy.
T. parva genomic DNA (Muguga clone) was sheared and cloned into plasmid vectors. Both ends
of randomly selected clones were sequenced. A total of 152,226 sequences with an average
read length of 623 nt were obtained, equivalent to 9.48X coverages assuming a genome
size of 10 Mb. Assembly of the sequences with "TIGR Assembler" produced a set of preliminary
contigs represent 95% of the genome sequence.
[0233] The preliminary contigs were loaded into an annotation database and subjected to
an automated process that searched the
T. parva contigs against a nonredundant database of proteins extracted from GenBank (called
nraa). The search results were used to produce a set of
T. parva gene models that encoded proteins similar to those in other organisms. This set of
gene models was used to train the gene finding programs "GlimmerM" and "phat", which
were subsequently run against all of the preliminary contigs to produce gene models
for the entire preliminary genome sequence.
[0234] The proteins encoded by the predicted
T. parva genes were subjected to a variety of analyses such as database searched ("blastp"),
predictions of signal peptides and signal anchors ("SignalP 2.0"), and transmembrane
domains ("TMHMM"). The results were reviewed and a set of ~55 genes encoding candidate
antigens were selected for screening for immunogenicity. These gene sequences were
screened and this led to the identification of antigens known as Tp2, Tp3, and Tp6.
Cloning of selected genes for screening for candidate antigens
1.1 RNA Extraction:
[0235] One million of
T. parva (Muguga strain)-infected cells were washed with 1 ml of Phosphate Buffered Saline
(PBS) and were centrifuged at 15,000rpm for 10 seconds. After removing the supernatant,
the cells were resuspended in 1ml of RNAzol
® by pipetting. Then 100µl of chloroform were added and mixed briefly by vortex. The
tube was spun at, 15,000rpm for 15min at 4°C and 400µl of the upper aqueous phase
were transferred to a new Eppendorf
™ tube. 0.7 volume of Iso-propanol was added, vortex mixed and microfuged again at
15,000rpm for 10min at 4°C. After removing the supernatant, the pellet was washed
with 300µl of 70% ethanol. After centrifugation at 15,000rpm for 5min at 4°C, 70%
ethanol was aspirated and the pellet was resolved in 60µl of RNase free water. The
concentration of the RNA was determined by a spectrophotometer.
1.2 One-step RT-PCR:
[0236] A Qiagen
® One-step RT-PCR kit was used to amplify selected genes using RNA obtained above.
Primers were designed to amplify the coding region of the selected schizont genes.
Forward primers (FW) are listed in Table 1 and reverse primers (RV) are listed in
Table 2, and Internal forward primers are listed in Table 3. The components mixed
for a 50µl reaction for each set of primers. A master mix (5x RT-PCR buffer 10µl;
dNTP mix 2µl; Enzyme mix 2µl; RNase inhibitor 1µl; RNA template 1µl; Water 32µl) was
made less the primers and dispensed in labeled tubes, and then 1µl each of the corresponding
FW1 and RV1 primers were added. The mixture was overlaid with mineral oil and placed
in an MJ Research minicycler and the following programs were applied:
50°C 30 minutes; 95°C 15 minutes; 94°C 30 seconds; 55°C 30 seconds; 72°C 1minute;
35 times from 94°C cycle and finally 72°C 10minutes, or
50°C 30 minutes; 95°C 15 minutes; 94°C minute; 55°C 1 minute; 72°C 1 minute; 35 times
from 94°C cycle and finally 72°C 10minutes, or
45°C 30 minutes; 95°C 15 minutes; 94°C 10 seconds; 55°C 1 minute; 68°C 3 minutes;
3.5 times from 94°C cycle and finally 68°C 10minutes.
Table 1.
| Gene |
Forward Primer |
| (Antigen) |
|
| SEQ IN NO:1; Tp2 |
SEQ IN NO:34: GCCGCCACCATGAAATTGGCCGCCAGATTAATTAGCC |
| SEQ IN NO:2; Tp3 |
SEQ IN NO:35: GCCGCCACCATGAAATTAAATACTATCGCAATAGCCTTT |
| SEQ IN NO:3; Tp6 |
SEQ IN NO:36: GCCGCCACCATGGCTCAGATTCCTGTTGATAAATTCG |
Table 2:
| Gene |
Reverse Primers for gene cloning |
| (Antigen) |
|
| SEQ IN NO:1; Tp2 |
SEQ IN NO:37: CTATGAAGTGCCGGAGGCTTCTCC |
| SEQ IN NO:2; Tp3 |
SEQ IN NO:38: TTAGGATTTTTTATTATCGTCTGGACTC |
| SEQ IN NO:3; Tp6 |
SEQ IN NO:39: TTATTTATCAGTTGAGAGTAAGAGAGTATTA |
Table 3:
| Gene |
Internal Forward Primers for gene cloning |
| (Antigen) |
|
| SEQ IN NO: 1; Tp2 |
SEQ IN NO:40: TCCATGTAAATGGAAAGAAGATTATC |
| SEQ IN NO:2; Tp3 |
SEQ IN NO:41: GGAACTCAGGCAGGTTGAATCTCTTC |
| SEQ IN NO:3; Tp6 |
SEQ IN NO:42: CCGCTAAGGAAGTGGCTAACATTC |
1.3 Electrophoresis, Isolation and Purification of PCR products:
[0237] To the completed PCR reaction, 10µl of 6x loading dye was added and loaded onto 0.7%
agarose gel containing 0.5ug/ml of Ethidium bromide. Electrophoresis was done at 150
volts for 30minutes. The DNA was visualized over an Ultraviolet light illuminator
and expected sizes of fragments were excised from the gel and transferred to appropriately
labeled tubes. Fragment DNA was extracted from gel by QIAquick Gel Extraction Kit
from Qiagen. To the excised gel piece,
buffer QG (three volume of the gel weight) was added and incubated at 50°C with intermittent
shaking until dissolved. The dissolved gel was transferred to a QIAquick spin column
in a provided 2ml collection tube, then 750µl at a time applied and spun for 1 minute
to bind the column until all the gel solution were applied. The flow-through was discarded
and the column replaced to the emptied collection tube: The column was washed with
750ul of wash buffer PE and spun for 1minute. The flow-through was discarded and spun
again for 1 minute to dry. The column was transferred to a 1.5ml EppendorfTM tube
containing 5ul of 3M Sodium Acetate and then 50µl of buffer EB was pipetted into the
column and left to stand for 1 minute before being spun for another minute. The eluted
DNA was precipitated by addition of 150ul of ethanol, mixed well and incubated at
-20°C for 20minutes. The tube was then spun in a microfuge at 15,000rpm for 15min
at 4°C. The supernatant was aspirated then the residual pellet was washed with 300ul
of 70% ethanol. The tube was spun again in a cooled microfuge at 15,000rpm for 10min
at 4°C. The supernatant was aspirated again and the pellet dried. The DNA was resuspended
in 8ul of water and 1µl run on a gel for quality and quantity assessment.
1.4 Ligation:
[0238] After determination the concentration of the fragments, an adjustment was made such
that a ligation mix was set up at a molar ratio of 1:10 (vector: insert); -- (pTargeT
vector (Promega, 20ng/ul) 1ul; fragment 1-7ul (depending upon the concentration of
the fragments); 10x ligation buffer 1ul; T4 DNA ligase 1ul; water to make up final
vol. to 10ul). After incubation at 4°C overnight, ligase was inactivated by incubation
of the tube at 70°C for 30 minutes and then ethanol precipitated. Pellets were reconstituted
in 10µl of water.
1.5 Transformation:
[0239] JM109 strain of
E.coli electro-competent cells were used for transformation with the ligated samples. Preparation
for electroporation was done by cooling the BIO-RAD® 0.2cm
E.coli Pulser
® Cuvette on ice, thawing the competent cells on ice, setting the electroporator equipment
at 2.5KV, 2000mega and 25µF. Five µl of the ligation mixture was added to 50µl of
the competent cells, and then quickly transferred into cold cuvettes on ice, tapping
firmly onto tissue paper to ensure that all cells went to the bottom without leaving
any spaces. The cuvette was wiped dry and pulsed till the PLS signal and an alarm
signified successful pulsing. Pulsed cells were resuspended in 1ml of 2xYT medium
immediately and then transferred into a Falcon 2059 tube and incubated for 1 hour
at 37°C with shaking. When the incubation finished, the cells were plated on 2xYT
plates containing 60ug/ml Xgal, 0.1mM IPTG, and 50ug/ml Ampicillin at a various dilutions.
The plates were incubated at 37oC for overnight.
1.6 Colony screening by PCR:
[0240] V-bottom 96 microtiter plates were used for screening of the colonies. The PCR master
mix was prepared such that each well has a total of 25µl of [1x PCR buffer mix 23.75µl;
gene specific-forward primer 0.5µl; vector specific-reverse primer 0.5µl; Taq polymerase
0.25µl]. To screen the selected gene-containing plasmids, gene-specific primers (IF1,
Table3) were used. The vector-specific reverse primer was SEQ ID NO: 44, (5'GAGCGGATAACATCACACAGG3').
Using a sterile tip, a colony was touched, then touched the master plate with the
same tip at a place that is numbered (for identification purpose) and finally placed
in the corresponding well, leaving it there until all the wells were completed. Using
a pipette, the well contents were mixed then the tip was discarded and then followed
with a drop of mineral oil in each well. The plate was placed in a MJ Research minicycler
and run using the following cycles. 95°C 5 minutes; 94°C20 seconds; 55°C 20 seconds;
72°C 30 seconds; then to step two 34 more times; 72oC 5 minutes; and finally at 10°C
for a holding time. At the end of the PCR, the plate was removed and 5ul of 6X loading
dye was added to each well. The products were run on a 2% agarose gel. The positive
clones on the master plates were identified and a sample taken for a 25ml overnight
culture.
1.7 Midi-prep:
[0241] After the overnight growth of the 25ml culture, cells were spun down in a falcon
tube at 3,000rpm for 10min at 4°C and processed as per QIAGEN® HiSpeed
™ plasmid purification kit protocol. The pellet was resuspended in 4ml of buffer P1,
added 4ml buffer P2, mixed well by inverting six times and left at room temperature
for 5min. QIAfilter cartridges were prepared by screwing the cap onto the outlet nozzle
and placing in a convenient tube. 4ml of chilled buffer P3 was added into the lysate
and mixed immediately but gently by inverting 6 times. The neutralized lysate was
poured into the barrel of the cartridge and incubated for 10mm. Meanwhile, a Speed
midi tip was equilibrated by adding 4ml of buffer QBT and allowing the column to empty,
by gravity flow. The cap was removed from the outlet nozzle and the plunger gently
inserted to filter through into the equilibrated HiSpeed tip. The cleared lysate was
allowed to enter the resin by gravity flow then washed with 20ml buffer QC. DNA was
eluted with 5ml buffer QF into a clean Falcon tube, followed by 3.5ml of 100% Iso-propanol
and mixed well. This was then spun at 3500rpm for 30minutes at 4°C, the supernatant
discarded, the residual pellet resuspended in 1.5ml 70% ethanol and then transferred
into a labeled 2ml EppendorfTM tube. The tube was spun at 15000rpm for 10minutes at
4°C, aspirated and dried then reconstituted in 50µl water. A 1µl sample was run on
an agarose gel for quantification and another 10µl were submitted for sequencing and
in vitro assay (Elispot and bioassay).
1.8 Sequencing:
[0242] Nucleotide sequence of pTargeT plasmids were determined by ABI PRISM® 3700 DNA Analyzer
(Applied Biosystems) using a vector-specific forward primer SEQ ID NO:43; 5'ACGCCAGGATTTTCCCAGTCACG3'
and a vector-specific reverse primer SEQ ID.NO:44; 5'GAGCGGATAACATCACACAGG3'.
Immunization & details of cattle
[0243] The 11 cattle used in this example were pure bred
Bos indicus (Boran) pure bred
Bos taurus (Friesian) or crossbreeds. Details of the animals are shown in Table 4. Seronegative
cattle, as measured by the presence of serum Antibodies to
T. parva, were immunized by infection and treatment' against the Muguga.stock of
T. parva by simultaneous inoculation of sporozoites and long-acting oxytetracycline at 20mg/kg
BW (
Radley et al (1975) Vet Rec 96, 525-7). Cryopreserved sporozoites (Stabilate # 4133) were thawed and diluted 1/20 as previously
described. Animals were given a subcutaneous injection of 1ml of diluted sporozoites
2cm above the right parotid lymph node. Animals were monitored daily for changes in
rectal temperature and from day 5 post challenge lymph node biopsies were taken using
a 21 G needle. Giemsa stained biopsy smears were examined for the presence of schizont
infected cells and scored on a scale of 1-3. Animals suffering from moderate reactions
were treated with Buparvaquone (Butalex, Mallinckrodt Veterinary Ltd, UK).
Table 4.
| Animal # |
Breed |
Date of birth |
Sire# |
Dam# |
| BV050 |
Boran |
09/12/99 |
291 |
2772 |
| BV057 |
Boran/Jersey |
03/07/00 |
NK |
AT230 |
| BV115 |
Friesian |
NK |
NK |
NK |
| BW002 |
Jersey |
NK |
NK |
NK |
| BW012 |
Boran/Friesian |
18/08/00 |
Mystig |
1507 |
| BW013 |
Guernsey/Ayshire |
08/09/00 |
D14 |
D646 |
| BW014 |
Guemsey/Ayshire |
15/09/00 |
D14 |
D638 |
| BX063 |
Boran |
11/04/01 |
282 |
BN59 |
| BX065 |
Boran |
03/04/01 |
282 |
BN59 |
| D409 |
Guernsey |
06/12/85 |
1422 |
D23 |
| F100 |
Boran |
17/03/88 |
103 |
1130 |
Establishment of TpM
[0244] Prior to immunization, venous blood was collected from the eleven animals, , listed
in Table 3 and peripheral blood monocytes , (PBMC), were prepared as described previously
(Godeeris & Morrison, 1986. Purified PBMC were adjusted to 4x10
6/ml in CTL medium (RPMI-1640 without HEPES supplemented with 10% fetal bovine serum
(FBS); tested for BVDV and mycoplasma spp.). 2mML-glutamine, 5x10
-5 M 2-mercaptoethanol and antibiotics were added to the culture medium and 1ml/well
added to 24-well plates (Costar, Corning, NY). and infected
in vitro with
T. parva (Muguga) sporozoites). Infected cell lines were maintained in TpM medium (RPMI-1640
supplemented with 10% Fetaclone II (Hyclone, UK; tested for BVDV&
Mycoplamsa spp.), 100iU/ml Penicillin, 100mg/ml Streptomycin, 50mg/ml Gentamycin, 5x10
-5 M 2-mercaptoethanol and 2mM L-Glutamine) and passaged1/5 three times a week.
Generation of T. parva specific Bulk CTL Cultures
[0245] Venous blood from immunized animals was collected from .4 weeks post-immunization.
PBMC were prepared as described previously (Goddeeris & Morrison, 1988). PBMC were
adjusted to 4x10
6/ml in CTL medium (RPMI-1640 without HEPES supplemented with 10% FBS (HyClone; tested
for BVDV & mycoplamsa spp.), L-glutamine, 2-mercaptoethanol and antibiotics as described
above) and 1ml/well added to 24 well plates (Costar, Corning, NY, USA). PBMC were
co-cultured with irradiated (50Gy) autologous
T. parva infected cells (TpM) at 2 x 10
5 /well and incubated for 7 days at 37°C in a 5% CO
2 humidified atmosphere. Cells were harvested by aspiration and dead cells removed
by centrifugation over Ficoll-Paque Plus (Amersham Pharmacia Biotech, Uppsala, Sweden).
After washing in CTL medium, cells were added to 24 well plates (3x10
6/well) and co-cultured with irradiated PBMC (filler cells) at 1 x10
6/well and TpM at 2 x10
5/well for 7 days as before. Viable cells were harvested as described above, adjusted
to 2 x10
6/well and stimulated with 4 x 10
5/well irradiated TpM and 2 x10
6/well irradiated autologous PBMC as filler cells.
51Chromium Release Assay:
[0246] Autologous and allogeneic TpM in log phase of growth were resuspended at 2x10
7/ml cytotoxicity medium (RPMI-1640 medium with 5% Fetaclone II). 100µl of the target
cells were mixed with 100
µl (100
µCi) of
51Cr-sodium chromate and incubated for 1 hour at 37°C. Cells were washed 3 times in
7ml of cytotoxicity medium by centrifugation at 1500 rpm for 7 min at RT and resuspended
at 1X10
6/ml. Viable cells were harvested from TpM stimulated lines 7 days post-stimulation
(effector cells) and resuspended in cytotoxicity medium at 2x10
7/ml. Two-fold doubling dilutions of effector cells were distributed in duplicate (100µl/well)
to 96-well half area (A/2) flat-bottom culture plates (Costar, Corning, NY, USA) resulting
in a range of effector cell concentrations of 4x10
6 to 2.5x10
5/well. Target cells were added to each well containing effector cells (50
µl/well) resulting in target cell ratios ranging from 80:1 to 5:1. In separate triplicate
wells target cells were added to 100µl cytotoxicity medium or 1% Tween20 to measure
spontaneous and maximal release of the label respectively. Plates were incubated for
4hours at 37°C in 5% CO
2 humidified atmosphere. Cells were resuspended in wells by repeated pipetting and
pelleted by centrifugation at 180X
g at room temperature. 75
µl of supernatant was transferred from each well into sample vials (Milian, Geneva,
Switzerland) and gamma emissions counted in a gamma counter (Micromedic MEplus, TiterTek,
Huntsville, AL, USA). Results were calculated and expressed as percent cytotoxicity
(= 100 x (test release - spontaneous release) / (maximum release - spontaneous release).
[0247] Evidence for MHC class I restricted lysis was assessed by the capacity of monoclonal
antibodies recognizing bovine MHC class I to inhibit lysis. Cells were prepared for
the cytotoxicity assay as described above except that target cells were resuspended
at double the density (2x10
6/ml) and 25
µl added first to the plate. 25
µl of either cytotoxicity medium or monoclonal antibody (mAb; IL-A88 diluted 1/15 in
cytotoxicity medium was added to target cells and incubated for 30min at room temperature.
Serial dilutions of effector cells were then added as described above.
Generation of T. parva specific CD8+ CTL Polyclonal Lines and Clones
[0248] Viable cells from TpM stimulated cultures were harvested day 7 post-infection and
CD8
+ T cells were isolated either by positive selection using flow cytometry (FACStar
Plus, BD Biosciences, San Jose, CA, USA) or negative selection using Dynabeads (Dynal
Biotech, Bromborough, UK).
[0249] Positive selection: Cells were adjusted to 2x10
7/ml in sterile monoclonal antibody IL-A105 (specific for bovine CD8) diluted 1/100
and incubated for 30 minutes at 4°C. Cells were washed twice in cold culture medium
and resuspended at 2x10
7/ml in sterile goat anti-mouse polyvalent immunoglobulins conjugated to FITC (Sigma).
Cells were washed twice in cold medium before being run through a FACStar plus cell-sorter
and CD8
+FITC
+ cells collected.
[0250] Negative selection: Cells were adjusted to 2x10
7/ml in sterile mAbs IL-A12 (specific for bovine CD4) and GB21A (specific for bovine
gamma-delta-TCR) diluted 1/100 and incubated for 30 minutes at 4°C. Cells were washed
twice in cold PBS and resuspended 1.4x10
7/ml in sterile PBS containing washed sheep anti-mouse IgG Dynabeads according to the
manufacturers instructions Cells and beads were rotated for 30 min at 4°C and Dynabead
rosetted cells were collected by placing the sample tube in a Dynal Magnetic Particle
Concentrator (MPC) for 5 min, the supernatant was removed, transferred to another
sample tube and residual Dynabead rosetted cells removed by another incubation in
a Dynal MHC. The supernatant was removed and cells washed twice in complete medium.
[0251] Cloning: CD8+ T cells enriched by either of the methods described above were adjusted
to 30, 10, and 3 cell/ml and distributed into 96-well, round bottom culture plates
containing 2x10
4 irradiated autologous TpM, 5x10
3 irradiated autologous PBMC and 5U/ml recombinant human IL-2 (HuIL-2; Sigma, Poole,
UK) in a final volume of 200
µl/well. Plates were incubated at 37°C in humidified incubator containing 5% CO
2 in air. Wells showing significant cell growth were selected for analysis of lysis
of autologous TpM in an (
111In) Indium oxine release assay. The
111In release assay was performed as described above for
51Cr release assay except that targets cells were labeled by addition of 5µCi
111In/1 x 10
6 cells and incubation for 15 minutes at 37°C. Cells were washed five times with cytotoxicity
medium and resuspended at 1x10
5/ml and added 50µl/well to 96-well V-bottom 96 well plates. 100µl cells from wells
showing significant growth were transferred to 96-well V-bottom culture plates (Greiner)
and centrifuged (180xg) for 5 min. Cells were resuspended 100µl/well in cytotoxicity
medium and transferred to wells containing labeled target cells. Plates were centrifuged
as described above to pellet cells before being incubated for 4 hours at 37°C in 5%
CO
2 humidified atmosphere.
[0252] CTL populations that exhibited lytic activity on autologous infected cells and originated
from cell dilutions that gave rise to cell growth in less than 30% of the wells, as
they have high probability of being clones, were selected for expansion. The remaining
cells were harvested from each well and resuspended them in culture medium (without
HEPES) at a concentration estimated to be between 500 and 5000 cells/ml. 100
µl of cell suspension was distributed into 96 well, round bottom culture plates. 100
µl of autologous irradiated TpM at 5 x10
4 autologous irradiated TpM in medium containing 5U/ml HuIL-2. Between day 14 and 21.
post-stimulation clones and polyclonal CTL lines were subcultured in 96 well, round
bottom culture plates by co-culturing 5000 CTL/well with 25,000 autologous irradiated
TpM and 5U/ml HuIL-2 in a final volume of 200µl/well.
Establishment and maintenance of bovine skin fibroblasts
[0253] A skin biopsy was taken aseptically from the ears of cattle and placed in a 50ml
falcon tube containing Elsevier's solution. In the laboratory laminar flow hood, the
biopsy was placed into sterile petri dishes (Sterilin) containing 1ml of 0.25% Trypsin-EDTA.
Using a sterile scalpel blade, the sample was cut into small pieces and placed into
a 50 ml falcon tube containing Trypsin-EDTA. The preparation was placed in a shaking
incubator for 1-1.5 hr at 37°C with gentle continuous shaking. This facilitates detachment
of cells. This digestion was stopped by addition of 1ml heat-inactivated FBS. The
cell suspension was centrifuged for 10 min at 200×
g and the cell pellet re-suspended in 6 ml of Dulbecco's minimum essential medium,
DMEM (Gibco-BRL, Paisley, UK) supplemented with 10% heat-inactivated fetal bovine
serum (FBS) (Hyclone, Logan, UT), 400 IU/ml penicillin, 300 µg/ml streptomycin and
2 mM L-glutamine. This cell suspension was seeded in 5ml amounts into 25-cm
2 flasks and incubated at 37°C in a 5% CO
2 humidified atmosphere. Cultures were examined microscopically after every 4 days
for growth and half the medium was replaced with fresh one until growing colonies
were evident. Once positive colonies were identified they were rinsed with Ca
2+- and Mg
2+-free PBS/EDTA (0.02% EDTA) and detached by 2 min incubation at 37°C with Trypsin-EDTA
solution containing 2.5 mg/ml Trypsin and 0.2 mg/ml EDTA in HBSS (Sigma). Following
a wash in complete DMEM containing 10% FBS the skin fibroblasts (SF) were passaged
into 25-cm
2 tissue culture flasks (Costar). Cells were maintained in complete DMEM containing
10% FBS, 200 IU/ml penicillin, 100 µg/ml streptomycin and 2 mM L-glutamine and passaged
every 3 days at a ratio of 1:3. Cells were expanded in 75-cm
2 tissue culture flasks (Costar) until confluent yielding 3-4×10
6 cells/flask. For consistency a liquid nitrogen cell bank was prepared with 2×10
6 cells/freezing vial in 10% DMSO in FBS.
Establishment and maintenance of bovine testicular endothelial cells
[0254] Bovine testicular vein or pulmonary artery EC lines were established as described
by
Byrom and Yunker (1990) Cytotechnology 4, 285-90) with the modifications of
Mwangi et al (1998) Vet Parasitol. 79, 1-17). Briefly, the vein was placed in wash buffer consisting of Ca
2+- and Mg
2+-free PBS supplemented with 400 IU/ml penicillin, 400 µg/ml streptomycin and 5µg/ml
fungizone. The vessel was then slit longitudinally, washed twice before being cut
into 1-cm
2 pieces and then placed lumen side down on a drop of collagenase (1 mg/ml) and incubated
for 1 h at 37°C. The cell suspension was centrifuged for 5 min at 200×
g and resuspended in 24 ml 2× complete DMEM (Gibco-BRL, Paisley, UK) supplemented with
20% heat-inactivated fetal bovine serum (FBS) (Hyclone, Logan, UT), 400 IU/ml penicillin,
300 µg/ml streptomycin, 5 mg/ml fungizone, 300 µg/ml endothelial growth supplement
(Sigma, St Louis, MO) and 2 mM L-glutamine. One ml of the cell suspension was seeded
in each well of a 24-well tissue culture plate (Costar, Cambridge, MA, USA). Once
confluent, monolayers in each well were rinsed with Ca
2+- and Mg
2+-free PBS/EDTA (0.02% EDTA) and detached by 2 min incubation at 37°C with 0.25% bypsin/EQTA
solution containing 2.5mg/ml trypsin and 0.2 mg/ml EDTA in HBSS (Sigma). Following
a wash in DMEM containing 10% FBS the cells were passaged into 25-cm
2 tissue culture flasks (Costar). Cells were maintained in complete DMEM containing
10% FBS, 200 IU/ml penicillin, 100 µg/ml streptomycin, 2.5 mg/ml fungizone, 2 mM L-glutamine
and passaged every 3 days at a ratio of 1:3. Cells were expanded in 75-cm
2 tissue culture flasks (Costar) until confluent yielding between 3×10
6 and 4×10
6 cells per flask. For consistency a liquid nitrogen cell bank was prepared with 2x
10
6 cells per freezing vial. Cells were raised from nitrogen into 75-cm
2 flasks and used between the fourth and tenth passages.
Immortalization of bovine skin fibroblasts and endothelial cells
[0255] Cells were immortalized with the SV40 early region gene by transfection of an expression
plasmid psvNeo (ATCC code 37150). The product is supplied as a freeze dried to which
300ul of 2XYT with ampicillin was added and fully resuspended. The 300ul suspension
was sub-cultured into 6mls and divided into 3mls each. The cultures were incubated
overnight at 37°C and then subcultured again into 50mls of 2XYT with ampicillin overnight
at 37°C. Maxiprep of psvNeo plasmid were made for use in immortalizations. Plasmid
DNA for transfection was standardized to 2mg/ml.
[0256] The DNA mix was prepared by mixing 5µl DNA with 495µl of DMEM with antibiotics but
no serum. A working dilution of Fugene 6 transfection reagent (Roche) was prepared
by mixing 15µl of Fugene with 485µl of DMEM. Mixing was done using the 2ml sterile
non-pyrogenic, DNAse and RNase free cryopreservation tubes. The diluted Fugene was
added to the diluted DNA drop wise with constant tapping at the end of the tube. The
Fugene-DNA complex was allowed to form at room temperature for 30 min.
[0257] Cells were cultured in 6-well plates (Costar) at a density of 2 x 10
5 cells per well and grown to confluence overnight at 37°C, 5% CO
2 in a humidified incubator. Culture medium was removed completely from the monolayers
to be transfected. The Fugene-DNA complex was then added gently onto the monolayer.
Plates were incubated at 37°C, 5% CO
2 in a humidified atmosphere for 3-4 hours. The transfection complex was removed; fresh
DMEM medium containing 10% fetal calf serum was added and then cultured for a further
72h. Cells from each well were rinsed with PBS/EDTA, detached with Trypsin/EDTA, washed
and re-suspended in complete DMEM and sub-cultured into one T-25 flask (Costar). After
incubation for 2-3h, normal DMEM medium was removed and replaced with a selection
DMEM medium containing 10% FCS and 0.5µg/ml of G418 (2.5µg/ml G418 for endothelial
cells) and incubated further. Upon observation of high death rate of cells, half the
medium was replaced with fresh selection medium until growing colonies were evident.
This process took 3-4 weeks depending on the cell lines. Positive colonies were the
sub-cultured into 24 well plates and then to T-25 flasks. Immortalization was confirmed
by checking for expression of large T-antigen using an anti-SV40 antibody conjugated
to HRP. Further expansion and maintenance of the cells was carried out using complete
DMEM.
Transfection of COS-7 cells and immortalized skin fibroblasts with schizont cDNA library
[0258] COS-7 cells and iSF were maintained in T75 and T150 TC flasks with DMEM supplemented
with 10% FCS, 2mM L-glutamine and antibiotics (TC medium) as described above. Cells
are split 1:4 every 3 days. The day prior to transfection, cells were harvested by
the removal of medium, washing in PBS and incubation in 0.25% Trypsin-EDTA for 5 min
at 37°C. Once cells had detached TC medium was added and cells removed. Cells were
washed by centrifugation at 1200 rpm for 10min and resuspended in TC medium. A viable
cell count taken, density adjusted to 2.0x10
5/ml, cells dispensed, 100µl/well, into 96 well flat-bottom TC plates and incubated
for overnight at 37°C in a CO
2 (5%) humidified incubator.
[0259] DNA was prepared for either single transfections of SF or double transfections (co-transfection
of schizont cDNA and BoLA class I cDNA) of COS cells. 6µl of schizont cDNA and 6µl
of BoLA class I cDNA (for co-transfection) at 50ng/µl in dH
2O were added to 150µl unsupplemented DMEM in wells of a 96-well round-bottom plate.
FuGENE 6 transfection reagent was pre-warmed to 37°C. 0.9µl or 0.45µl FuGENE 6 was
added to each well for double and single transfections respectively. The well contents
mixed by shaking on a Dynatech Varishaker for 1 min and incubated at RT for 20 min.
The medium from the 96 well plates containing adherent COS cells and SF was removed
and each transfection complex added to triplicate wells (50µl/well). The cells were
then incubated for 4 hours at 37°C in a CO
2 (5%) humidified incubator. The transfection complex was removed and replaced with
200µl/well DMEM supplemented as described above and incubate for 24 or 48 hours at
37°C in a CO
2 (5%) humidified incubator.
Detection of CTL recognition of transfected SF and COS-7 cells by IFN-gammaγ Elispot
[0260] 24 hours post-transfection, medium was removed from wells containing transfected
cells, cells were washed cells with PBS (200µl/well) and detached by the addition
of 100µl/well Trypsin-EDTA as described above. Once the cells had detached the contents
of each well were transferred to a 96 well round-bottom plates containing 100µl/well
cold RPMI with no HEPES supplemented with 10% FCS (CTL medium). The cells were centrifuged
at 1200 rpm for 3 min; supernatant removed and resuspended 50µl/well in CTL medium
Schizont specific CTL, generated and maintained as described above, were harvested
7-14 days post-stimulation, transferred to polycarbonate tubes, pelleted at 1200 rpm
for 10min and resuspended at 2x10
5/ml in CTL medium supplemented with 5U/ml HuIL-2 (Sigma). Elispot plates (Millipore
Corporation, Bedford, MA, USA) were coated 50µl/well with 2µg/ml of murine anti-bovine
IFN-gamma mAb (CC302; Serotec, UK) and incubated overnight at 4°C. Wells were washed
twice with unsupplemented RPMI-1640 and blocked 200µl/well with RPMI-1640 supplemented
with 10% FBS by incubating at 37°C for 2 hours. The blocking medium was removed and
replaced with 50µl/well CTL and 100µl/well transfected cells. As a positive control,
irradiated TpM are serially diluted in COS cells or SF with each at a density of 4x10
5/ml. and populations containing 32, 16, 8, 4, 2, 1% TpM are added 50µl/well to wells
containing CTL. Plates were incubated in a humidified incubator at 37°C for 20 hours.
After incubation, the contents of wells were removed and wells washed four times with
sterile distilled water supplemented with 0.05% Tween 20 per well and the plate shaken
on a shaker for 30 seconds between washes. The process was repeated an additional
four times, using PBS supplemented with Tween 20 (PBS-T). Wells were then incubated
with 100µl/well rabbit anti-bovine IFN-gamma antisera diluted 1/1500 in PBS-T supplemented
with 0.2% BSA (PBS/BSA) for 1 hour at room temperature. Wells were washed 4 times
with PBS-T before being incubated for 1 hour at room temperature with 100µl/well murine
monoclonal anti-rabbit IgG conjugated to alkaline phosphatase (Sigma) diluted 1/2000
in PBS-T/BSA. Sigma Fast BCIP/NBT buffered substrate (Sigma) was by dissolving 1 tablet/10ml
dH
2O and passing it through a 0.2µm filter. Plates were washed six times as described
above with PBS-T, 100µl/well BCIP/NBT substrate added and plates incubated for 10minutes
at room temperature in the dark. The substrate was then removed, wells washed with
copious amounts of H
2O and plates air-dried at room temperature in the dark. Plates were finally read on
an automated elispot reader (AID Diagnostica, Strasberg, Germany).
Bioassay for CTL activation based on rapid induction of class II MHC expression by
constitutively negative bovine endothelial cells
[0261] Endothelial cells were detached from confluent 75-cm
2 tissue culture flasks by treatment with trypsin/EDTA as described. 2.5×10
4 cells were seeded into each well of a 48-well plate in 1 ml of complete DMEM and
incubated overnight. Cell-free test supernatants derived from either co-culture of
T.
parva-specific CD8
+ T cell lines and SF transfected with test genes or recombinant bovine IFN-gammaγ
(rBoIFN-gammaγ, the kind gift of Ciba-Geigy, Basel, Switzerland) were dispensed in
duplicate wells in a final volume of 160 µl per well. Following 48 h at 37oC, culture
supernatants were discarded and the monolayers were washed 3X in FACS medium (RPMI
1640 supplemented with 2%-globulin-free horse serum and 0.1% sodium azide). Endothelial
cells ere labeled on ice for 30 mini with 100 ul of an antibody cocktail comprising
equal volumes of bovine class II MHC-specific monoclonal antibodies (mAbs) J11, R1
and IL-A21 (each at a 1/500 dilution of ascitic fluid). After 3 washed in FACS medium,
100 ul of FITC-conjugated goat anti-mouse Ig (Sigma) diluted 1/200 in FACS medium
were added. After incubation at 4°C for 30 min and a further three washes in FACS
medium, cells were detached as described previously and cell surface class II MHC
expression determined by flow cytometry, using a FACScan (Becton-Dickinson, Sunnyvale,
CA, USA). The percentage of class II MHC-expressing cells was determined by comparison
with unstimulated EC labeled in an identical manner.
T. parva-specific CD8
+ CTL lines were generated and maintained using methods initially described. Test supernatants
were collected from 96-well flat-bottomed microtitre plates (Costar) 48 hours after
restimulation of resting T cell lines (2×10
4 per well) with 4×10
5 COS-7 cells co-transfected with the KN104 gene and test gene(s) or confluent autologous
SF transfected with the test gene(s) in a final volume of 200 µl for 24 h. These tests
were set-up at least in duplicates. Where indicated, class I MHC was blocked using
a specific antibody (IL-A88) to check for MHC class I restriction of the CTL lines.
Additional negative control supernatants were derived from co-culture of CTL with
untransfected immortalized SF or COS-7 cells. Positive control supernatants were obtained
from co-culture of CTL with varying proportions of irradiated autologous TpM.
Detection of CTL lysis of transfected iSF and COS-7 cells
[0262] Autologous iSF or COS-7 cells were seeded in 6-well plates (Costar) at a density
of 2.5x10
5 /well and incubated for 2 hours at 37°C to allow cells to adhere. For single transfections
of iSF, 2µg of test or control cDNA was added to 1ml unsupplemented DMEM containing
3µl FuGENE 6 transfection reagent and incubated for 40min. For COS-7 cells, 2µg of
test or control cDNA was added with 2µg of BoLA class I cDNA to 1ml DMEM containing
6µul FuGENE. 1ml of DNA/Fugene complex was added per well of adherent COS-7 or iSF.
Plates were incubated for 4 hours at 37°C, the transfection complex was removed and
replaced with 2ml/well of complete DMEM and the plates incubated for a further 20
hours at 37°C. Transfected cells were harvested by removal of medium, washing in PBS,
detachment by Trypsin-EDTA and washing in complete DMEM. Transfected cells and TpM
were labeled with
51Chromium and the ability of schizont-specific CTL lines (day 6-8 post-stimulation)
to lyse these targets was assessed as described above.
Optimization of IFN-gamma Elispot for the recognition of target antigens by schizont
specific CTL
[0263] The ability of the IFN-gamma elispot to detect the recognition of TpM by CTL was
first assessed using a CD8+ polyclonal CTL line from animal F100. Fourteen days post-stimulation,
CTL were added (5000/well) to coated/blocked elispot wells containing 25,000 irradiated
autologous schizont and the formation of IFN-gamma spots assessed after a 20-hour
incubation (FIG. 1). Pre-incubating the TpM for 30 min with a mAb against BoLA class
I completely inhibited the IFN-gamma response whilst mAbs against MHC class II or
the irrelevant CD21 antigen had no effect (FIG. 1). Significantly, there was almost
no spontaneous release of IFN-gamma from CTL cultured without TpM. This TpM line did
not constitutively express TpM and no IFN-gamma spots could be attributed to the TpM
(Data not shown).
[0264] In an attempt to replicate the transient transfection situation, where CTL would
be co-cultured with COS-7 or iSF of which only a small proportion of cells would be
expressing the target antigen, TpM were titrated in COS-7 or iSF and co-cultured with
CTL in IFN-gamma elispot plates (FIG. 2A, FIG 2B and FIG. 2C). The stimulator population
was fixed at an input of 40,000/well, with only the proportions of TpM and COS-7/SF
varying. This cell input was adopted since it was thought to mirror the numbers of
APC that would be co-cultured with CTL after transient transfection. Initially different
CTL inputs were tried against TpM titrations with the aim of identifying the minimum
CTL input required to detect significant responses to 1-3% TpM (FIG 2A). A CTL input
of 10,000/well was determined to be optimal since it could elicited significant responses
to less than 1% TpM and it was practically feasible.
to raise such CTL numbers for screening experiments. Further titration experiments
were performed with CTL clones from F100 to confirm that with these CTL and APC inputs
the IFN-gamma elispot was meeting or exceeding the desired sensitivity level (FIG.
2 B). With all the clones tested the IFN-gamma elispot could still detect recognition
of target cells when they constituted only 0.1% of the total cell population. The
Elispot assay worked well with little background noise and met the sensitivity requirements
when TpM were titrated in COS-7 cells but it was important to determine that the assay
performed as well when the TpM were titrated in autologous iSF. FIG 2C shows the results
of co-culturing F100 CD8+ polyclonal CTL line with TpM diluted in COS-7 cells, autologous
primary SF and iSF. Neither primary nor iSF significantly affected the background
levels or the sensitivity of the elispot assay.
[0265] The conclusions that iSF were appropriate APC and that the elispot had been sufficiently
optimized using TpM were rapidly validated by the identification of CTL target schizont
antigens initially with Tp1 and COS-7 cells and then Tp2 with iSF. The effect of reduced
DNA input upon subsequent recognition of target antigen transfected COS-7 cells and
iSF were compared using Tp1 and Tp2 and the results showed recognition of target antigen
transfected COS-7 or BW014 when only 1ng/well if target antigen DNA is used to transfect.
The response increased with the concentration of target DNA peaking at peaking at
50ng/well. This result validated the use of test genes or cDNA pools at 100ng/well
for transfection of both COS-7 and iSF.
Identification of Tp2 following the screening of selected genes with BW002, BW013,
and BW014 CD8+ CTL and D409 CTL clone #10.
[0266] Tp2 was identified through the screening of selected gene transfected autologous
iSF with CTL from BW002 (BW2), BW014 (BW14) and D409 (Figure 3). Selected gene #5
was specifically recognized by all CTL and was named Tp2. Tp2 transfected iSF were
also specifically lysed by CTL as assessed by
51Chromium release assays (Figure 4). MHC restriction of Tp2 recognition was assessed
by the introduction of blocking anti-BoLA class I mAbs. Anti-class I mAb resulted
in the inhibition of lysis. The introduction of a mAb (IL-A13) that specifically binds
to the BoLA class I molecule w7 also inhibited the lysis of Tp2 transfected targets
by a CTL clone from D409, suggesting that the recognition was restricted by w7.
Identification of CTL target T. parva schizont antigens
[0267] The identification of CTL target schizont antigen Tp2 was performed using the assay
that employs immortalized skin fibroblast (iSF) cell lines. The effect of reduced
DNA input upon subsequent recognition of target antigen transfected COS-7 cells and
iSF were compared using Tp1 and Tp2. The results, show recognition of target antigen
transfected COS-7 or BW014 when only 1ng/well if target antigen DNA is used to transfect.
The response increased with the concentration of target DNA peaking at peaking at
50ng/well. This result validated the use of test genes or cDNA pools at 100ng/well
for transfection of both COS-7 and iSF. Testing of Tp2-transfected autologous BW002
and Tp2-transfected allogeneic, BV050 iSF, suing the schizont-specific BW002 polyclonal
CD8+ CTL line, indicated lysis of the Tp2-transfected BW002 line . In addition, when
the Tp2 transfected target cells were pre-incubated with an anti-BoLA, Class I monoclonal
antibody (mAb), no lysis occurred; indicating the MHC Class I restriction of CTL-mediated
killing of the transfected iSF (Fig. 4).
Detection of Tp2 Specific Ex Vivo CD8+ T Cell Responses from Immune Cattle after Challenging
with T. parva Sporozoites
[0268] Cattle, BW002, BW013 and BW014, whose schizont specific CTL lines had been shown
to recognize Tp2, were challenged with a lethal dose of
T. parva (Muguga) sporozoites. Cry preserved sporozoites (Stabilate # 4133) were thawed and
diluted 1/20 as previously described. Animals were challenged by subcutaneous injection
of 1ml of diluted sporozoites 2cm above the right parotid lymph node. Animals were
monitored daily for changes in rectal temperature and from day 5 post challenge lymph
node biopsies were taken using a 21G needle. Giemsa stained biopsy smears were examined
for the presence of schizont infected cells and scored on a scale of 1-3. Animals
were bled on day 2 and daily from day 6 to 13 and PBMC were isolated as described
above. CD8+ T cells and CD14+ monocytes were purified from PBMC by MACS magnetic cell
sorting according to the manufacturer's instructions (Miltenyi Biotec, Gergisch Gladbach,
Germany). CD8+ T cells were sorted indirectly using a monoclonal antibody specific
for bovine CD8 (IL-A105) followed by incubation with goat anti-mouse IgG microbeads
(Miltenyi Biotec). CD14 monocytes were sorted directly by incubation with CD14 microbeads
(Miltenyi Biotec). PBMC and CD8+ T cells were added to wells (2.5x105/well) of coated/blocked
Elispot plates and stimulated with autologous TpM (2.5x104/well) or Tp2 peptides (1mg/ml
final concentration). Purified monocytes were additionally added (2.5x104/well) to
wells containing peptide and CD8+ T cells. Elispot plates were incubated and developed
as described above. In order to recall Tp2 peptide specific CTL responses, PBMC were
stimulated with autologous TpM 14 days post-challenge as described above. Viable cells
were harvested 7 days post-stimulation and lytic activity against TpM and Tp2 peptide
pulsed autologous iSF assessed as described above. FIG. 5A, FIG. 5B, and FIG. 5C illustrate
Tp2 specific CD8
+ T cell responses following challenge of immune cattle. Three ECF immune cattle (BW002,
BW013, BW014), from which schizont specific CTL lines had been generated and shown
to recognize Tp2, were challenged with a lethal dose of
T.
parva (Muguga) sporozoites. Peripheral blood was collected daily between day 7 - 13 post-challenge,
and CD8+ T cells and monocytes purified. Responses to Tp2 peptides containing previously
identified CTL epitopes or control peptides were assessed by co-culturing CD8+ T cells
and monocytes in the presence of 1□g/ml peptide and measuring the release of IFN-gamma
elispot. Responses to autologous TpM were included as a positive control.
Mapping of the Tp2 CTL epitopes
[0269] A cleaved PepSet library of 84 peptides was synthesized to cover the full length
of the Tp2 protein (Mimotopes). Recognition of Tp2 peptides was assessed by IFN-gamma
elispot using autologous iSF as antigen-presenting cells. FIG. 6 shows the results
of screening the Tp2 PepSet with BW002, BW013, BW014 CD8+ polyclonal CTL lines and
D409 CTL clone#10. The BW002 polyclonal line responded to a single peptide #43; (SEQ
ID NO:8 CSHEELKKLGML) when the peptides were used at a concentration of 1pg/ml. BW0013
CTL responded significantly to two pairs of overlapping peptides; peptides #53 and
54 (SEQ ID NO: 9 (FKSSHGMGKVGKRY) and peptides #78 and 79 (SEQ ID NO: 11 FAQSLVCVLMKCRG).
BW014 CTL also responded to peptides #78 and 79 suggesting a common epitope. This
was not perhaps surprising since BW013 and BW014 shared a sire. The w7 restricted
D409 CTL clone responded to peptides #77 and 78, SEQ ID NO: 12 (KCFAQSLVCVLMKC), suggesting
an overlapping epitope. In order to define the minimal length epitope for the shared
BW013 and BW014 CTL epitope, all possible 9, 10 and 11mers covering SEQ ID NO: 9 (FKSSHGMGKVGKRY)
and SEQ ID NO: 11 (FAQSLVCVLMKCRG) were synthesized and screened by IFN-gamma elispot.
BW013 responded to the 11mer SEQ ID NO: 6 (KSSHGMGKVGK) and not to any shorter sequence
suggesting this was the epitope. The results of screening the six possible 9mers of
SEQ ID NO: 11 (FAQSLVCVLMKCRG) are shown in FIG 7. The results revealed that both
BW013 and BW014 CTL responded to only the 9mer SEQ ID NO: 4 (QSLVCVLMK) suggesting
that this was the minimal length epitope. The peptides were also screened with D409
clone #10 and found that only the 9mer peptide SEQ ID NO:5 (FAQSLVCVL) was recognized.
This epitope was named Tp2 epitope 2 (Tp2.2).
51Chromium-release assays were performed with peptide pulsed autologous iSF. FIG. 8
and FIG. 9 illustrate that both BW014 and D409 CTL lysed Tp2 peptide pulsed iSF with
levels of lysis comparable to TpM. The lysis was very specific with almost 100% lysis
of iSF pulsed with Tp2 peptide 75B SEQ ID NO: 4 (QSLVCVLMK) and background levels
of lysis of iSF pulsed with Tp2 peptide 76B SEQ ID NO: 17 (SLVCVLMKC). SEQ ID NO:
4 (QSLVCVLMK) was named Tp2 epitope 1 (Tp2.1). Subsequent screening using similar
experiments with sets of peptides also identified Tp2 epitope 4 (Tp2.4), SEQ ID NO:
7 (SHEELKKLGML) and Tp2 epitope 3 (Tp2.3), SEQ ID NO: 6, (KSSHGMGKVGK). Peptide-pulsed
iSF and BoLA class I P815 transfectants were prepared as targets for
51Chromium release assays by incubating 2x106 iSF or P815 cells overnight in T25 tissue
culture flasks (Costar) with Tp2 peptides diluted to 1mg/ml in complete DMEM. Cells
were harvested, labeled and assayed as described above.
Identification of Minimal Tp2 CTL Epitopes with Synthetic Peptide Libraries
[0270] Peptide libraries (Cleaved PepSets; Mimotopes, Clayton, Australia) were generated
for the Tp2- HD6 restricted CTL epitope. The PepSet libraries contained every 12mer,
11mer, 10mer and 9mer offset by 2 amino acids from the protein sequences. However,
the peptides were prepared by truncations of the 12mers at the N-teminus and were
supplied lyophilized with each tube containing a nominal 12mer and the 9, 10, 11 mer
truncations with the same C terminus. Peptides were dissolved in 400ml 50% (v/v) DNA
synthesis grade acetonitrile/water (Applied Biosystems, Warrington, UK). To aid the
dissolution, tubes were held in a sonicator water bath for 2 x 10 min. Peptides were
aliquoted into labeled cryopreservation tubes (Greiner) and stored at ―20oC. For screening
with CTL, peptides were prepared at 10mg/ml in complete RPMI-1640 and 10ml added to
triplicate wells of an Elispot plate, coated, washed and blocked as described above.
Autologous iSF or P815 cells stably expressing the BoLA class I HD6 (P815-HD6) or-JSP-1
(P815-JSP-1) were adjusted to a density of 4x105/ml and 50ml added to wells containing
peptides. The plates were incubated at 37oC for 1 hour before CTL, prepared as described
above for screening transfectants, were added 50ml/well. Plates were incubated for
20 hours at 37oC and then developed as described above. Based on the results of the
screening with the Tp2 PepSets, individual 9, 10 and 11mer peptides were synthesized
in order to define the CTL epitopes of Tp2, figures 10, 11, 12, and 13. Peptides were
prepared and screened using the IFN-gamma elispot as described above. Table 5 summarizes
that minimal length epitopes of Tp2, both in terms of amino acid sequence information
and corresponding nucleotide sequences.
Table 5.
T. parva antigenic
polypeptides |
CTL (antigen)epitopes |
| aa sequence |
DNA sequence |
| Tp2 \(SEQ ID NO: 1) |
|
|
| (Tp2.1) |
SEQ. ID. NO:4 QSLVCVLMK |
SEQ. ID. NO:28 CAAAGCCTAGTGTGCGTATTAATGAAA |
| (Tp2.2) |
SEQ ID. NO:5 FAQSLVCVL |
SEQ. ID. NO:29 TTTGCACAAAGCCTAGTGTGCGTATTA |
| (Tp2.3) |
SEQ. ID. NO:6 KSSHGMGKVGK |
SEQ. ID. NO:30 AAATCATCACATGGTATGGGAAAGGTAGGAAAA |
| (Tp2.4) |
SEQ. ID. NO:7 SHEELKKLGML |
SEQ. ID. NO:31 AGTCATGAAGAACTAAAAAAATTGGGAATGCTA |
Kinetics of Tp2 specific CD8+ T cell responses from immune cattle following challenge with T. parva sporozoites
[0271] Cattle BW002, BW013 and BW014, whose CTL lines had recognized Tp2, were challenged
with a lethal dose of
T. parva (Muguga) sporozoites and the responses of PBMC and purified CD8+ T cells to TpM and
Tp2 peptides were measured longitudinally. All animals were solidly resistant to challenge
with none experiencing fever or detectable parasitosis (data not shown). FIG 5A, FIG.
5B, and FIG. 5C, show the TpM and Tp2 specific CD8+ T cell responses of BW002, BW014
and BW013. From day 9 post-challenge, CD8+ T cells responded specifically to the Tp2
peptides containing the previously identified CTL epitopes. The responses increased
rapidly exceeding the response to TpM and were sustained over the period of observation
(day 13 post-infection). The frequency of Tp2 epitope responding CD8+ cells peaked
around 1:500 for both BW002 (FIG. 5A) and BW014 (FIG. 5B), the Tp2 specific response
of BW013 was significantly weaker (FIG. 5C). The kinetics of this response is comparable
to that previously described for schizont specific CTL in efferent lymph following
challenge of immune cattle with
T. parva sporozoites.
[0272] Attempts were made to detect Tp2 specific lytic responses directly in peripheral
blood post-challenge but these failed (Data not shown). An experiment was instigated
to first expand schizont specific CTL numbers by a single in vitro stimulation with
TpM and then to assess Tp2 specific lysis. Stimulated cells exhibited extremely high
cytotoxic activity against both TpM and fibroblasts pulsed with a Tp2 peptide known
to contain a CTL epitope (FIG. 14). These results provide the first evidence direct
from immune animals that Tp2 may be involved in protection against ECF.
Optimization of INF-gammaγ Elispot for the recognition of target antigens by schizont
specific CTL
[0273] The ability of the IFN-gamma elispot to detect the recognition of TpM by CTL was
first assessed using a CD8
+ polyclonal CTL line from animal F100. Fourteen days post-stimulation, CTL were added
(5000/well) to coated/blocked elispot wells containing 25,000 irradiated autologous
schizont and the formation of IFN-gamma elispot assessed after a 20-hour incubation.
CO-culture of CTL with TpM resulted in significant release of IFN-gamma. Pre-incubating
the CTL for 30 min with a mAb against BoLA class I completely inhibited the IFN-gamma
response whilst mAbs against MHC class II or the irrelevant CD21 antigen had no effect.
Significantly, there was almost no spontaneous release of IFN-gamma from CTL cultured
without TpM. This TpM line did not constitutively express TpM and no IFN-gammaγ spots
could be attributed to the TpM.
[0274] In an attempt to replicate the transient transfection situation, where CTL would
be co-cultured with COS-7 or iSF of which only a small proportion of cells would be
expressing the target antigen, TpM were titrated in COS-7 or iSF and co-cultured with
CTL in IFN-gamma elispot plates. The stimulator population was fixed at an input of
40,000/well, with only the proportions of TpM and COS-7/SF varying. This cell input
was adopted since it was thought to mirror the numbers of APC that would be co-cultured
with CTL after transient transfection. Initially different CTL inputs were tried against
TpM titrations with the aim of identifying the minimum CTL input required to detect
significant responses to 1-3% TpM. A CTL input of 10,000/well was determined to be
optimal since it could elicit significant responses to less than 1% TpM and it was
practically feasible to raise such CTL numbers for screening experiments. Further
titration experiments were performed with CTL clones from F100 to confirm that with
these CTL and APC inputs the IFN-gamma elispot was meeting or exceeding the desired
sensitivity level. With all the clones tested the IFN-gamma elispot could still detect
recognition of target cells when they constituted only 0.1 % of the total cell population.
The elispot assay worked well with little background noise and met the sensitivity
requirements when TpM were titrated in COS-7 cells but it was important to determine
that the assay performed as well when the TpM were titrated in autologous SF. Neither
primary nor iSF significantly affected the background levels or the sensitivity of
the elispot assay.
[0275] In advance of the initiation of screening for CTL target antigens by the transient
transfection of COS-7 cells and iSF, the efficiencies of COS-7 and iSF transfection
in 96 well TC plates was assessed using GFP as a reporter gene. Whilst there was considerable
variation in transfection efficiencies between cell lines and between experiments,
COS-7 consistently transfected better than iSF with efficiencies varying from 5-50%
whereas for iSF transfection efficiency ranged between 0.5 - 20%. The transfection
efficiency of iSF was assessed to be good enough to allow the presentation and identification
of transfected schizont cDNA.
Evaluation of IFN-gamma Elispot Bioassay as a complementary read-out system for CTL
recognition of target antigens
[0276] Bovine vascular EC were stained for surface class II MHC expression following culture
for 48 h in the presence of media containing recombinant IFN-gamma The sensitivity
to rBoIFN-gammaγ was determined and found to be between 100 and 10 pg/ml. Comparisons
were made between IFN-gamma bioassay and elispot by co-culturing
T.parva-specific CTL with fixed number of autologous iSF containing varying proportions of
target autologous TpM and skin fibroblasts. There was a good correlation between the
two assays. Both assays detected production of IFN-gamma in co-cultures containing
as low as 1% TpM.
Nucleotide and deduced amino acid sequences and putative identity of the 5 candidate
antigens
[0277] Following confirmation of the candidates as CTL target antigens, the individual cDNA
were sequenced and confirmed to be of
T. parva origin by interrogating the
T. parva genome sequence database. BLAST searches (Altschul
et al 1990) of DNA and protein database were performed and homologues of some of the antigens
identified. SignalP (
Nielsen et al (1997) Int J Neural Syst. 8, 581-99) and Tmpred (http://www.ch.embnet.org/software/TMPRED_form.html) analyses were conducted
to predict the presence of a signal peptide and transmembrane domain. SEQ ID NO: 25-31
indicate the DNA and SEQ ID NO: 1-7, the deduced protein sequences of the five candidate
antigens.
Expression of Tp2, Tp3, and Tp6 protein from recombinant DNA plasmids
[0278] The reading frames of
T. parva candidate antigen genes were amplified by PCR using Taq polymerase (Promega, Madison,
WI USA 53711) from the original full-length genes in their respective plasmids in
pcDNA3. Both the forward and reverse primers contained restriction enzyme sites (Table
6). The product of the amplification of Tp2 was .8 Kb in size, as measured by PAGE
electrohoresis. The PCR products were digested with the respective restriction enzymes,
and ligated into bacterial His-tag expression vectors, pQE30 (Qiagen, 28159 Avenue
Stanford, Valencia, CA91355) or PET28 (Novagen, Madison, WI 53719 USA). Primer sequences
for the cloning are given in Table 6 (primers for cloning Tp gene sequences), Table
7 (primers for adding "Tag"-expression sequences), and Table 8 (primers for amplifying
Tp3tag sequences and Tp6tag sequences).
Table 6.
| Gene |
Forward Primer |
Reverse Primer |
| (Plasmid) |
|
|
| Tp2 (pTargeT) |
SEQ ID NO: 32: GGTAATTGTAGTCATGAAGAAC |
SEQ ID NO: 33: TTTACTAATACCACCAAGACCGTG |
| Tp3 (pTargeT) |
SEQ ID NO: 45: CGCGGATCCGCCACCATGAAATTAAATACTATC |
SEQ ID NO: 46: CGCCTCGAGGGATTTTTTATTATCGTCTGGAC |
| Tp6 (pTargeT) |
SEQ ID NO: 47: CGCGCTAGCGCCGCCACCATGGCTCAGATTCCT |
SEQ ID NO: 48: GCGCTCGAGTTTATCAGTTGAGAGTAAGAGAG |
Table 7.
| To Add |
Forward Primer |
Reverse Primer |
| Tag |
|
|
| |
SEQ ID NO: 49: SEQ ID NO: 50. CGCCTCGAGTCCTACATACCATCTGCCGAAAAG CGCAAGCTTTCAGTCTAGTCCTAGCAAAGGGTTAG |
Table 8.
| Gene |
Forward Primer |
Reverse Primer |
| Amplifica tion |
|
|
| Tp3 |
SEQ ID NO: 51: CGCGGATCCGCCACCATGAAATTAAATACTATC |
|
| Tp6 |
SEQ ID NO: 53: CGCGCTAGCGCCGCCACCATGGCTCAGATTCCT |
|
| pTargeT |
|
SEQ ID NO: 52: CGCAAGCTTTCAGTCTAGTCCTAGCAAAGGGTTAG |
The plasmids were transformed into
E. coli strain DH5α (Life Technologies, Carlsbad, CA 92008, USA). All the plasmids were sequenced
to ensure that they harbored no substitutions compared to the original genes. Purified
plasmids were then used to transform competent BL21 DE3 bacterial cells.
[0279] Single BL21 DE3 bacterial colonies bearing the recombinant plasmids were isolated
and cultured in 2XYT (formula) at 37°C to an OD
600 of 0.6, and protein expression induced by addition of IPTG to a final concentration
of 1mM, and further cultured for 4 h. The cells were harvested by centrifugation at
4000 g for 20 min. Recombinant proteins were isolated by either the native or denaturing
nickel-nitrilotriacetic (Ni-NTA) agarose according to the manufacturer's protocol
(Qiagen, 28159 Avenue Stanford, Valencia, CA91355), dialyzed against PBS and stored
at -20 °C. Purified proteins were checked by checked on 12% SDS-PAGE gels (Laemmli,
1970) and western blot. Protein concentration was determined by the BCA Protein Assay
reagent (PIERCE, Rockford, IL 61105, USA). Bacterial cells or purified proteins were
applied to a 12% SDS-PAGE gel under denaturing conditions (Laemmli, 1970). Proteins
were electroblotted onto nitrocellulose sheets (Schleicher and Schull, Dassel, Germany).
Mouse His-tag antibody (SIGMA) was used as the primary antibody, while anti mouse
horse-radish peroxidase conjugate (SIGMA) was used as the secondary antibody followed
detection with 3, 3'-Diamnobenzidine and hydrogen peroxide. The reading frame of the
segments of Tp2 amplified and cloned into the bacterial expression vector harbored
no substitutions compared to the original gene sequences (not shown). The recombinant
protein Tp2 containing His-tag was produced from the construct, and can be determined
by immunoblotting using His-tag antibody. Figure 15A indicates total protein from
an aliquot of lysate and Figure 15B shows the presence of the Tp2-His-tag product
as stained by the His-tag-labeled antibody. Expression of Tp3 (16) and Tp6 (FIG 17)
has been demonstrated using SDS-PAGE gel electrophoresis of protein from cultures
oftransfected
E. coli.
Vaccination strategy
[0280] Cattle trials were performed to assess the vaccine potential of identified CTL target
antigens utilizing a recombinant canary pox virus (patented by Merial Ltd) and modified
Vaccinia Virus Ankara (MVA) as an antigen delivery method. FIG. 18 indicates the level
of CTL responses to several Tp antigens, following CP (Canary Pox mediated)/MVA (modified
Vaccinia Virus Ankara-vector mediated) immunization protocols. The data indicates
the production of
T. parva antigen-specific CD8 (CTLs) in animals following immunization protocols with Canary
Pox viral vectors, expressing
T. parva antigen. Note that at day 7, the response to Tp2 shows an increase in the number
of spot forming cells (SFC)/well, over that shown in FIG. 20 (representing the phosphate
buffered saline (PBS) control), for Day 7.
[0281] In FIG. 19 the level of CTL responses to Tp2 antigen, following DNA/MVA immunization
protocols is plotted. The data indicates the production of
T. parva antigen-specific CD8 (CTLs) in animals following immunization protocols with modified
Vaccinia (Ankara) viral vectors, expressing
T. parva antigen. Note that at day 7 and at DAY 28, after a second, booster administration,
the response to Tp2 shows an increase in the number of spot forming cells (SFC)/well,
over that shown in FIG. 20 (representing the phosphate buffered saline (PBS) control),
for Day 7 and Day 28.
[0282] The data in FIG. 20 represent control data for CP/MVA (FIG. 18) and DNA/MVA (FIG.
19) immunization protocols, where cattle were given phosphate buffered saline injections
rather than Tp antigens. The control experimental data for measuring the development
of CTLs following immunization indicates a lack of
T parva, antigen-specific CD8+ cells in PBS immunized animals. These trials tested the Tp2
antigen and involved use of 16 cattle in order to evaluate antigen-specific CTL responses
and relate these to the outcome to challenge. Animals were inoculated intramuscularly
with 1 ml of vaccine (1x10
8 pfu of virus) and boosted similarly after 4 weeks.
[0283] Additional immunization trials to test cattle Following a further 4 weeks, cattle
are subjected to an LD
100 challenge with
T. parva sporozoites by administering subcutaneously 1 ml of diluted stabilated infective
material four weeks after immunization with the T. parva antigens, using Canary Pox
and MVA vectors, and the DNA/MVA system. Animals are monitored parasitologically and
clinically over a period of 2-3 weeks to determine whether the vaccine has protected.
It is expected that the vaccines are protective. Additional immunological assays are
performed following immunization and challenge.
[0284] Various modifications and variations of the described method and system of the invention
will be apparent to those skilled in the art without departing from the scope and
spirit of the invention. Although the invention has been described in connection with
specific preferred embodiments, it should be understood that the invention as claimed
should not be unduly limited to such specific embodiments. Indeed, various modifications
of the above-described modes for carrying out the invention which are obvious to those
skilled in the field of molecular biology or related fields are intended to be within
the scope of the following claims.
SEQUENCE LISTING
[0285]
<110> INTERNATIONAL LIVESTOCK RESEARCH INSTITUTE THE INSTITUTE FOR GENOMIC RESEARCH
<120> EAST COAST FEVER VACCINE BASED ON CTL-SPECIFIC SCHIZONT ANTIGENS
<130> 41860-205199
<140>
<141>
<150> 60/504,428
<151> 2003-09-22
<160> 53
<170> PatentIn Ver. 3.2
<210> 1
<211> 174
<212> PRT
<213> Theileria parva
<220>
<223> Amino acid sequence of Tp2:
<400> 1


<210> 2
<211> 265
<212> PRT
<213> Theileria parva
<220>
<223> Amino acid sequence of Tp3
<400> 2


<210> 3
<211> 277
<212> PRT
<213> Theileria parva
<220>
<223> Amino acid sequence of Tp6
<400> 3


<210> 4
<211> 9
<212> PRT
<213> Theileria parva
<220>
<223> Amino acid sequence of Tp2 Epitope 1 (Tp2.4)
<400> 4

<210> 5
<211> 9
<212> PRT
<213> Theileria parva
<220>
<223> Amino acid sequence of Tp2 Epitope 2 (Tp2.2)
<400> 5

<210> 6
<211> 11
<212> PRT
<213> Theileria parva
<220>
<223> Amino acid sequence of Tp2 Epitope 3 (Tp2.3)
<400> 6

<210> 7
<211> 11
<212> PRT
<213> Theileria parva
<220>
<223> Amino acid sequence of Tp2 Epitope 4 (Tp2.4)
<400> 7

<210> 8
<211> 12
<212> PRT
<213> Theileria parva
<220>
<223> Amino acid sequence of peptide of Tp2
<400> 8

<210> 9
<211> 14
<212> PRT
<213> Theileria parva
<220>
<223> Amino acid sequence of peptide #43 of Tp2
<400> 9

<210> 10
<211> 14
<212> PRT
<213> Theileria parva
<220>
<223> Amino acid sequence of peptide #53/54 of Tp2
<400> 10

<210> 11
<211> 14
<212> PRT
<213> Theileria parva
<220>
<223> Amino acid sequence of peptide #78/79 of Tp2
<400> 11

<210> 12
<211> 14
<212> PRT
<213> Theileria parva
<220>
<223> Amino acid sequence of peptide #77/78 of Tp2
<400> 12

<210> 13
<211> 10
<212> PRT
<213> Theileria parva
<220>
<223> Amino acid sequence of peptide of Tp2
<400> 13

<210> 14
<211> 12
<212> PRT
<213> Theileria parva
<220>
<223> Amino acid sequence of peptide #77 of Tp2
<400> 14

<210> 15
<211> 12
<212> PRT
<213> Theileria parva
<220>
<223> Amino acid sequence of peptide #36 used as an experimental control
<400> 15

<210> 16
<211> 9
<212> PRT
<213> Theileria parva
<220>
<223> Amino acid sequence of synthesized peptide named #75, representing amino acid
residues 97 through 105 of Tp2
<400> 16

<210> 17
<211> 9
<212> PRT
<213> Theileria parva
<220>
<223> Amino acid sequence OF PEPTIDE #76 of Tp2
<400> 17

<210> 18
<211> 8
<212> PRT
<213> Theileria parva
<220>
<223> Amino acid sequence representing amino acid residues numbers 98 through 105
of Tp2
<400> 18

<210> 19
<211> 9
<212> PRT
<213> Theileria parva
<220>
<223> Amino acid sequence representing amino acid residues numbers 99 through 107
of Tp2
<400> 19

<210> 20
<211> 10
<212> PRT
<213> Theileria parva
<220>
<223> Amino acid sequence for peptide fragment of A.A.#49-A.A.#58 of Tp2
<400> 20

<210> 21
<211> 8
<212> PRT
<213> Theileria parva
<220>
<223> Amino acid sequence for peptide fragment of A.A.#97-A.A.#164 of Tp2
<400> 21

<210> 22
<211> 12
<212> PRT
<213> Theileria parva
<220>
<223> Amino acid sequence for peptide fragment of A.A.#97-A.A.#104 of Tp2
<400> 22

<210> 23
<211> 12
<212> PRT
<213> Theileria parva
<220>
<223> Amino acid sequence for peptide fragment of A.A.#28-A.A.#39 of Tp2
<400> 23

<210> 24
<211> 8
<212> PRT
<213> Theileria parva
<220>
<223> Amino acid sequence for peptide fragment of Tp1 representing amino acid residues
#96 to amino acid #103
<400> 24

<210> 25
<211> 525
<212> DNA
<213> Theileria parva
<220>
<223> Nucleotide sequence of Tp2
<400> 25

<210> 26
<211> 798
<212> DNA
<213> Theileria parva
<220>
<223> Nucleotide sequence of Tp3
<400> 26

<210> 27
<211> 834
<212> DNA
<213> Theileria parva
<220>
<223> Nucleotide sequence of Tp6
<400> 27

<210> 28
<211> 27
<212> DNA
<213> Theileria parva
<220>
<223> Nucleotide sequence Tp2 Epitope 1 (Tp2.1)
<400> 28
caaagcctag tgtgcgtatt aatgaaa 27
<210> 29
<211> 27
<212> DNA
<213> Theileria parva
<220>
<223> Nucleotide sequence of Tp2 Epitope 2 (Tp2.2)
<400> 29
tttgcacaaa gcctagtgtg cgtatta 27
<210> 30
<211> 33
<212> DNA
<213> Theileria parva
<220>
<223> Nucleotide sequence of Tp2 Epitope 3 (Tp2.3)
<400> 30
aaatcatcac atggtatggg aaaggtagga aaa 33
<210> 31
<211> 33
<212> DNA
<213> Theileria parva
<220>
<223> Nucleotide sequence of Tp2 Epitope 4 (Tp2.4)
<400> 31
agtcatgaag aactaaaaaa attgggaatg cta 33
<210> 32
<211> 22
<212> DNA
<213> Theileria parva
<220>
<223> Nucleotide sequence Tp2 forward primer for expression cloning
<400> 32
ggtaattgta gtcatgaaga ac 22
<210> 33
<211> 24
<212> DNA
<213> Theileria parva
<220>
<223> Nucleotide sequence Tp2 reverse primer for expression cloning
<400> 33
tttactaata ccaccaagac cgtg 24
<210> 34
<211> 37
<212> DNA
<213> Theileria parva
<220>
<223> Nucleotide sequence Tp2 forward primer for gene cloning
<400> 34
gccgccacca tgaaattggc cgccagatta attagcc 37
<210> 35
<211> 39
<212> DNA
<213> Theileria parva
<220>
<223> Nucleotide sequence Tp3 forward primer for gene cloning
<400> 35
gccgccacca tgaaattaaa tactatcgca atagccttt 39
<210> 36
<211> 37
<212> DNA
<213> Theileria parva
<220>
<223> Nucleotide sequence Tp6 forward primer for gene cloning
<400> 36
gccgccacca tggctcagat tcctgttgat aaattcg 37
<210> 37
<211> 24
<212> DNA
<213> Theileria parva
<220>
<223> Nucleotide sequence Tp2 reverse primer for gene cloning
<400> 37
ctatgaagtg ccggaggctt ctcc 24
<210> 38
<211> 28
<212> DNA
<213> Theileria parva
<220>
<223> Nucleotide sequence Tp3 reverse primer for gene cloning
<400> 38
ttaggatttt ttattatcgt ctggactc 28
<210> 39
<211> 31
<212> DNA
<213> Theileria parva
<220>
<223> Nucleotide sequence Tp6 reverse primer for gene cloning
<400> 39
ttatttatca gttgagagta agagagtatt a 31
<210> 40
<211> 26
<212> DNA
<213> Theileria parva
<220>
<223> Nucleotide sequence Tp2 internal forward primer for gene cloning
<400> 40
tccatgtaaa tggaaagaag attatc 26
<210> 41
<211> 26
<212> DNA
<213> Theileria parva
<220>
<223> Nucleotide sequence Tp2 forward primer for gene cloning
<400> 41
ggaactcagg caggttgaat ctcttc 26
<210> 42
<211> 24
<212> DNA
<213> Theileria parva
<220>
<223> Nucleotide sequence Tp2 forward primer for gene cloning
<400> 42
ccgctaagga agtggctaac attc 24
<210> 43
<211> 23
<212> DNA
<213> Theileria parva
<220>
<223> Nucleotide sequence of vector-specific forward primer
<400> 43
acgccaggat tttcccagtc acg 23
<210> 44
<211> 21
<212> DNA
<213> Theileria parva
<220>
<223> Nucleotide sequence of vector-specific reverse primer
<400> 44
gagcggataa catcacacag g 21
<210> 45
<211> 33
<212> DNA
<213> Theileria parva
<220>
<223> Nucleotide sequence of Tp3-specific forward primer
<400> 45
cgcggatccg ccaccatgaa attaaatact atc 33
<210> 46
<211> 32
<212> DNA
<213> Theileria parva
<220>
<223> Nucleotide sequence of Tp3-specific reverse primer
<400> 46
cgcctcgagg gattttttat tatcgtctgg ac 32
<210> 47
<211> 33
<212> DNA
<213> Theileria parva
<220>
<223> Nucleotide sequence of Tp6-specific forward primer
<400> 47
cgcgctagcg ccgccaccat ggctcagatt cct 33
<210> 48
<211> 32
<212> DNA
<213> Theileria parva
<220>
<223> Nucleotide sequence of Tp6-specific reverse primer
<400> 48
gcgctcgagt ttatcagttg agagtaagag ag 32
<210> 49
<211> 33
<212> DNA
<213> Theileria parva
<220>
<223> Nucleotide sequence of specific forward primer for adding a tag (HIS) to gene
sequences
<400> 49
cgcctcgagt cctacatacc atctgccgaa aag 33
<210> 50
<211> 35
<212> DNA
<213> Theileria parva
<220>
<223> Nucleotide sequence of specific reverse primer for adding a tag (HIS) to gene
sequences
<400> 50
cgcaagcttt cagtctagtc ctagcaaagg gttag 35
<210> 51
<211> 33
<212> DNA
<213> Theileria parva
<220>
<223> Nucleotide sequence of specific forward primer for PCR amplification of Tp3
sequences
<400> 51
cgcggatccg ccaccatgaa attaaatact atc 33
<210> 52
<211> 35
<212> DNA
<213> Theileria parva
<220>
<223> Nucleotide sequence of specific reverse primer for PCR amplification of Tp3-pTargeT
sequences
<400> 52
cgcaagcttt cagtctagtc ctagcaaagg gttag 35
<210> 53
<211> 33
<212> DNA
<213> Theileria parva
<220>
<223> Nucleotide sequence of specific forward primer for PCR amplification of Tp6
sequences
<400> 53
cgcgctagcg ccgccaccat ggctcagatt cct 33