REFERENCE TO RELATED APPLICATIONS
BACKGROUND
[0002] Acid alpha-glucosidase (GAA) is a lysosomal enzyme that hydrolyzes the alpha 1-4
linkage in maltose and other linear oligosaccharides, including the outer branches
of glycogen, thereby breaking down excess glycogen in the lysosome (
Hirschhorn et al. (2001) in The Metabolic and Molecular Basis of Inherited Disease,
Scriver, et al., eds. (2001), McGraw-Hill: New York, p. 3389-3420). Like other mammalian lysosomal enzymes, GAA is synthesized in the cytosol and traverses
the ER where it is glycosylated with N-linked, high mannose type carbohydrate. In
the golgi, the high mannose carbohydrate is modified on lysosomal proteins by the
addition of mannose-6-phosphate (M6P) which targets these proteins to the lysosome.
The M6P-modified proteins are delivered to the lysosome via interaction with either
of two M6P receptors. The most favorable form of modification is when two M6Ps are
added to a high mannose carbohydrate.
[0003] Insufficient GAA activity in the lysosome results in Pompe disease, a disease also
known as acid maltase deficiency (AMD), glycogen storage disease type II (GSDII),
glycogenosis type II, or GAA deficiency. The diminished enzymatic activity occurs
due to a variety of missense and nonsense mutations in the gene encoding GAA. Consequently,
glycogen accumulates in the lysosomes of all cells in patients with Pompe disease.
In particular, glycogen accumulation is most pronounced in lysosomes of cardiac and
skeletal muscle, liver, and other tissues. Accumulated glycogen ultimately impairs
muscle function. In the most severe form of Pompe disease, death occurs before two
years of age due to cardio-respiratory failure.
[0004] Presently, there is no approved treatment available to cure or slow the progress
of Pompe disease. Enzyme replacement therapeutics currently in clinical trials require
that administered recombinant GAA be taken up by the cells in muscle and liver tissues
and be transported to the lysosomes in those cells in an M6P-dependent fashion. However,
recombinant GAA produced in engineered CHO cells and in the milk of transgenic rabbits,
two sources of enzymes used in recent Pompe enzyme replacement therapy trials, contains
extremely little M6P (
Van Hove et al. (1996) Proc Natl Acad Sci USA, 93(1):65-70; and
U.S. Patent No. 6,537,785). Therefore, M6P-dependent delivery of recombinant GAA to lysosomes is not efficient,
requiring high dosages and frequent infusions. Accordingly, there remains a need for
new, simpler, more efficient, and more cost-effective methods for targeting therapeutic
GAA enzyme to patient lysosmoes.
SUMMARY OF THE INVENTION
[0005] The present invention permits M6P-independent targeting of human GAA or GAA-like
enzymes to patient lysosomes by using a peptide tag-based targeting strategy. As a
result, the present invention provides efficient delivery of GAA or GAA-like enzymes
into target cells.
[0006] The invention relates, in part, to the discover that GAA can be expressed recombinantly
using a plurality of open reading frames encoding polypeptides representing different
portions of the GAA protein. When provided together, the resulting polypeptides can
cooperate to provide the desired enzymatic activity.
[0007] Accordingly, the present invention in one aspect relates to a targeted therapeutic
fusion protein as defined in the claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0008] Figures 1-1 to 1-14 depict as amino acid sequence alignment of selected members of
family 31 of glycoside hydrolyases.
[0009] Figure 2 is a schematic depiction of the GAA protein.
[0010] Figure 3 depicts exemplary strategies for creating a peptide-tagged GAA.
[0011] Figure 4 depicts an exemplary uptake experiment using wild-type GAA and SS-GAAΔ1-69.
[0012] Figure 5 depicts an exemplary uptake experiment using SS-GAAΔ1-69 and SS-GILTΔ2-7-GAAΔ1-69.
[0013] Figure 6 depicts an exemplary Western blot analysis of 1-87-IGF-II-tagged GAA proteins;
the left panel was probed with an anti-GAA antibody; the right panel was probed with
an anti-IGF-II antibody. Lane 1: pCEP-GILT1-87-GAA56-952; lane 2: pCEP-GILT1-87-R68A-GAA56-952-1;
lane 3: pCEP-GILT1-87-R68A-ΔGS-GAA56-952-1; lane 4: pCEP-GILTΔ2-7-spcr1-GAA70-952-1
; lane 5: pCEP-GAA; lane 6: pCEP-GILT-GAA29-952.
[0014] Figure 7 depicts an exemplary Western blot analysis comparing proteolysis of wild-type
GAA with GAA-791Asc.
[0015] Figure 8 depicts an exemplary Western analysis of wild-type GAA and GAA constructs
with a GILT tag engineered with a downstream Factor X protease site, GAA787GILTXa,
GAA779GILTXa, and GAA796GILTXa. It also depicts a GAA C-terminal processing model.
DETAILED DESCRIPTION OF THE INVENTION
[0017] The C-terminal 160 amino acids are absent from the mature 70 and 76 kDal species.
However, certain Pompe alleles resulting in the complete loss of GAA activity map
to this region, for example Val949Asp (
Becker et al. (1998) J. Hum. Genet. 62:991). The phenotype of this mutant indicates that the C-terminal portion of the protein,
although not part of the 70 or 76 kDal species, plays an important role in the function
of the protein. It has recently been reported that the C-terminal portion of the protein,
although cleaved from the rest of the protein during processing, remains associated
with the major species (
Moreland et al. (Nov. 1, 2004) J. Biol. Chem., Manuscript 404008200). Accordingly, the C-terminal residues could play a direct role in the catalytic
activity of the protein. Alternatively, the C-terminal residues may be involved in
promoting proper folding of the N-terminal portions of the protein.
[0018] This latter possibility is supported by the behavior of certain alleles of sucrase-isomaltase,
a related protein. This family includes the sucrase-isomaltase (SI) protein which
contains the two distinct but homologous glycoside hydrolyase catalytic domains in
tandem on a single polypeptide. Each of these is similar to the entire GAA polypeptide
in size and the two domains share 36 and 39% identity with GAA. SI is expressed in
intestinal brush border cells and is localized to the apical membrane of these polarized
cells with the catalytic domains facing the gut lumen due to an amino-terminal trans
membrane domain. Once arriving at the apical membrane, the sucrase domain is cleaved
from the amino-proximal isomaltase domain by trypsin while the isomaltase domain remains
membrane associated. Recent studies indicate that the sucrase domain is required for
proper folding and subsequent transport of the isomaltase domain; sucrase is said
to be an intramolecular chaperone required for the folding of the isomaltase domain
(
Jacob et al. (2002) J. Biol. Chem. 277:32141).
[0019] Analysis of the expression of a number of engineered GAA cassettes has enabled the
identification of two regions that, although cleaved from the mature polypeptide,
are nevertheless required for secretion of functional protein from mammalian cells.
Figure 2 summarizes the organization of GAA as we now understand it. The precursor
polypeptide possesses a signal sequence and an adjacent putative transmembrane domain,
a trefoil domain (PFAM PF00088) which is a cysteine-rich domain of about 45 amino
acids containing 3 disulfide linkages and thought to be involved in protein-protein
or protein carbohydrate interactions (
Thim (1989) FEBS Lett. 250:85), the domain defined by the mature 70/76 kDal polypeptide, and the C-terminal domain.
A mutation in the trefoil domain of SI has an impact on the apical membrane sorting
pattern of SI (
Spodsberg (2001) J. Biol. Chem. 276:23506). Data presented in examples 1 and 2 indicate that both the trefoil domain and the
C-terminal domain are required for the production of functional GAA. It is possible
that the C-terminal domain interacts with the trefoil domain during protein folding
perhaps facilitating appropriate disulfide bond formation in the trefoil domain.
[0021] It is possible that membrane association of GAA via its signal peptide is an important
contributory factor in correct lysosomal targeting of the enzyme. This could happen
in two ways: First, the membrane association could directly steer the protein to the
lysosome. Second, the membrane association could increase the residence time of the
GAA in the Golgi thereby increasing the level of mannose-6-phosphate added to the
protein. This would have the net effect of increasing the proportion of the enzyme
that is sorted to the lysosome. In either case, if this membrane association were
eliminated, then more of the produced enzyme would be secreted and if the latter model
were correct the secreted enzyme would have less mannose-6-phosphate.
[0022] Disruption of the membrane association of GAA can be accomplished by replacing the
GAA signal peptide and adjacent sequence with an alternate signal peptide for GAA.
Subcellular targeting domains
[0023] The present invention permits targeting of a therapeutic agent to a lysosome using
a protein, or an analog of a protein, that specifically binds a cellular receptor
for that protein. The exterior of the cell surface is topologically equivalent to
endosomal, lysosomal, golgi, and endoplasmic reticulum compartments. Thus, endocytosis
of a molecule through interaction with an appropriate receptor(s) permits transport
of the molecule to any of these compartments without crossing a membrane. Should a
genetic deficiency result in a deficit of a particular enzyme activity in any of these
compartments, delivery of a therapeutic protein can be achieved by tagging it with
a ligand for the appropriate receptors(s).
Lysosomal targeting moieties
[0024] The invention permits targeting of a therapeutic agents to a lysosome. Targeting
may occur, for example, through binding of a plasma membrane receptor that later passes
through a lysosome. Alternatively, targeting may occur-through binding of a plasma
receptor that later passes through a late endosome; the therapeutic agent can then
travel from the late endosome to a lysosome. A preferred lysosomal targeting mechanism
involves binding to the cation-independent M6P receptor.
Cation-independent M6P receptor
[0025] The cation-independent M6P receptor is a 275 kDa single chain transmembrane glycoprotein
expressed ubiquitously in mammalian tissues. It is one of two mammalian receptors
that bind M6P: the second referred to as the cation-dependent M6P receptor. The cation-dependent
M6P receptor requires divalent cations for M6P binding; the cation-independent M6P
receptor does not. These receptors play an important role in the trafficking of lysosomal
enzymes through recognition of the M6P moiety on high mannose carbohydrate on lysosomal
enzyme. The extracellular domain of the cation-independent M6P receptor contains 15
homologous domains ("repeats") that bind a diverse group of ligands at discrete locations
on the receptor.
[0026] The cation-independent M6P receptor contains two binding sites for M6P: one located
in repeats 1-3 and the other located in repeats 7-9. The receptor binds monovalent
M6P ligands with a dissociation constant in the µM range while binding divalent M6P
ligands with a dissociation constant in the nM range, probably due to receptor oligomerization.
Uptake of IGF-II by the receptor is enhanced by concomitant binding of multivalent
M6P ligands such as lysosomal enzymes to the receptor.
[0027] The cation-independent M6P receptor also contains binding sites for at least three
distinct ligands that can be used as targeting moieties. The cation-independent M6P
receptor binds IGF-II with a dissociation constant of about 14 nM at or about pH 7.4,
primarily through interactions with repeat 11. Consistent with its function in targeting
IGP-II to the lysosome, the dissociation constant is increased approximately 100-fold
at or about pH 5.5 promoting dissociation of IGP-II in acidic late endosomes. The
receptors is capable of binding high molecular weight O-glycosylated IGF-II forms.
Blood-brain barrier
[0028] One challenge in therapy for lysosomal storage diseases is that many of these diseases
have significant neurological involvement. Therapeutic enzymes administered into the
blood stream generally do not cross the blood brain barrier and therefore cannot relieve
neurological symptoms associated with the diseases. IGF-II, however, has been reported
to promote transport across the blood-brain barrier via transcytosis (
Bickel et al. (2001) Adv. Drug Deliv.Rev. 46(1-3):247-79). Thus, appropriately designed GILT constructs should be capable of crossing the
blood brain barrier, affording for the first time a means of treating neurological
symptoms associated with lysosomal storage diseases. The constructs can be tested
using GUS minus mice as described in Example 12. Further details regarding design,
construction and testing of targeted therapeutics that can coach neuronal tissue from
blood are disclosed in
U.S. Serial No. 60/329,650, filed October 16, 2001. and In
U.S. Serial No. 10/136,639, filed April 30, 2002.
Structure of IGF-II
[0029] NMR structures of IGP-II have been solved by two groups (
Terasawa et al. (1994) EMBO J.13(23):5590-7;
Torres et al. (1995) J. Mol. Biol. 248(2):385-401) (see,
e.g., Protein Data Bank record IIGL). The general features of the IGF-II structure are
similar to IGF-I and insulin. The A and B domains of IGF-II correspond to the A and
B chains of insulin. Secondary structural features include an alpha helix from residues
11-21 of the B region connected by a reverse turn in residues 22-25 to a short beta
stand in residues 26-28. Residues 25-27 appear to form a small antiparallel beta sheet;
residues 59-61 and residues 26-28 may also participate in intermolecular beta-sheet
formation. In the A domains of IGF-II, alpha helices spanning residues 42-49 and 53-59
are arranged in an antiparallel configuration perpendicular to the B-domain helix.
Hydrophobic clusters formed by two of the three disulfide bridges and conserved hydrophobic
residues stabilize these secondary structure features. The N and C termini remain
poorly defined as is the region between residues 31-40.
[0030] IGF-II binds to the IGF-II/M6P and IGF-I receptors with relatively high affinity
and binds with lower affinity to the insulin receptor. IGF-II also interacts with
a number if serum IGFBPs.
Binding to the IGF-II/M6P receptor
[0031] Substitution of IGF-II residues 48-50 (Phe Arg Ser) with the corresponding residues
from insulin, (Thr Ser Ile), or substitution of residues 54-55 (Ala Leu) with the
corresponding residues from IGF-I (Arg Arg) result in diminished binding to the IGF-II/
M6P receptor but retention of binding to the IGF-I and insulin receptors (
Sakano et al. (1991) J. Biol. Chem. 266(31):20626-35).
[0032] IGF-I and IGF-II share identical sequences and structures in the region of residues
48-50 yet have a 1000-fold difference in affinity for the IGF-II receptor. The NMR
structure reveals a structural difference between IGF-I and IGF-II in the region of
IGF-II residues 53-58 (IGF-I residues 54-59): the alpha-helix is better defined in
IGF-II than in IGF-I and, unlike IGF-I, there is no bend in the backbone around residues
53 and 54 (
Torres et al. (1995) J. Mol. Biol. 248(2):385-401). This structural difference correlates with the substitution of Ala 54 and Leu 55
in IGF-II with Arg 55 and Arg 56 in IGF-I. It is possible either that binding to the
IGF-II receptor is disrupted directly by the presence of charged residues in this
region or that changes in the structure engendered by the charged resides yield the
changes in binding for the IGF-II receptor. In any case, substitution of uncharged
residues for the two Arg residues in IGF-I resulted in higher affinities for the IGF-II
receptor (
Cacciari et al. (1987) Pediatrician 14(3):146-53). Thus the presence of positively charged residues in these positions correlates
with loss of binding to the IGF-II receptor.
[0033] IGF-II binds to repeat 11 of the cation-independent M6P receptor. Indeed, a minireceptor
in which only repeat 11 is fused to the transmembrane and cytoplasmic domains of the
cation-independent M6P receptor is capable of binding IGF-II (with an affinity approximately
one tenth the affinity of the full length receptor) and mediating internalization
of IGF-II and its delivery to lysosomes (
Grimme et al. (2000) J. Biol. Chem. 275(43):33697-33703). The structure of domain 11 of the M6P receptor is known (Protein Data Base entries
1GP0 and 1GP3;
Brown et al. (2002) EMBO J. 21(5):1054-1062). The putative IGF-II binding site is a hydrophobic pocket believed to interact with
hydrophobic amino acids of IGF-II; candidate amino acids of IGF-II include leucine
8, phenylalanine 48, alanine 54, and leucine 55. Although repeat 11 is sufficient
for IGF-II binding, constructs including larger portions of the cation-independent
M6P receptor (
e.g. repeats 10-13, or 1-15) generally bind IGF-II with greater affinity and with increased
pH dependence (see, for example,
Linnell et al. (2001) J. Biol. Chem. 276(26):23986-23991).
Binding to the IGF-I receptor
[0034] Substitution of IGF-II residues Tyr 27 with Leu, Leu 43 with Val or Ser 26 with Phe
diminishes the affinity of IGF-II for the IGF-I receptor by 94-, 56-, and 4-fold respectively
(
Torres et al. (1995) J. Mol. Biol. 248(2):385-401). Deletion of residues 1-7 of human IGF-II resulted in a 30-fold decrease in affinity
for the human IGF-I receptor and a concomitant 12 fold increase in affinity for the
rat IGF-II receptor (
Hashimoto et al. (1995) J. Biol. Chem. 270(30):18013-8). The NMR structure of IGF-II shows that Thr 7 is located near residues 48 Phe and
50 Ser as well as near the 9 Cys-47 Cys disulfide bridge. It is thought that interaction
of Thr 7 with these residues can stabilize the flexible N-terminal hexapeptide required
for IGF-I receptor binding (
Terasawa et al. (1994) EMBO J. 13(23)5590-7). At the same time this interaction can modulate binding to the IGF-II receptor.
Truncation of the C-terminus of IGF-II (residues 62-67) also appear to lower the affinity
of IGF-II for the IGF-I receptor by 5 fold (
Roth et al. (1991) Biochem. Biophys. Res. Commun. 181(2):907-14).
Deletion mutants of IGF-II
-Fusion junctions
[0035] The peptide tag can be fused directly to the GAA polypeptide or can be separated
from the GAA polypeptide by a linker. An amino acid linker incorporates an amino acid
sequence other than that appearing at that position in the natural protein and is
generally designed to be flexible or to interpose a structure, such as an α-helix,
between the two protein moieties. A linker can be relatively short, such as the sequence
Gly-Ala-Pro or Gly-Gly-Gly-Gly-Pro, or can be longer, such as, for example, 10-25
amino acids in length.
[0036] The site of a fusion junction is selected to promote proper folding and activity
of both fusion partners and to prevent premature separation of a peptide tag from
a GAA polypeptide. Figure 3 illustrates four exemplary strategies for creating a GILT-tagged
GAA, based on the model for the organisation of GAA protein as illustrated in Figure
2.
- 1. Fusion of the tag at the amino terminus.
- 2. Insertion of the tag between the trefoil domain and the mature region.
- 3. Insertion of the tag between the mature region and the C-terminal domain.
- 4. Fusion of the tag to the C-terminus of a truncated GAA and co-expressing the C-terminal
domain.
The targeting domain is fused, directly or by a spacer, to amino acid 70 of GAA, a
position permitting expression of the protein, catalytic activity of the GAA moiety,
and proper targeting by the targeting moiety as described in Example 4.
Administration
[0037] The targeted therapeutics produced according to the present invention can be administered
to a mammalian host by any route. Thus, as appropriate, administration can be oral
or parenteral, including intravenous and intraperitoneal routes of administration.
In addition, administration can be by periodic injections of a bolus of the therapeutic
or can be made more continuous by intravenous or intraperitoneal administration from
a reservoir which is external (e.g., an i.v. bag). In certain embodiments, the therapeutics
of the instant invention can be pharmaceutical-grade. That is, certain embodiments
comply with standards of purity and quality control, required for administration to
humans. Veterinary applications are also within the intended meaning as used herein.
[0038] The formulations, both for veterinary and for human medical use, of the therapeutics
according to the present invention typically include such therapeutics in association
with a pharmaceutically acceptable carrier therefor and optionally other ingredient(s).
The carriers) can be "acceptable" in the sense of being compatible with the other
ingredients of the formulations and not deleterious to the recipient thereof. Pharmaceutically
acceptable carriers, in this regard, are intended to include any and all solvents,
dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption
delaying agents, and the like, compatible with pharmaceutical administration. The
use of such media and agents for pharmaceutically active substance is known in the
art. Except insofar as any conventional media or agent is incompatible with the active
compound, use thereof in the compositions is contemplated. Supplementary active compounds
(identified according to the invention and/or known in the art) also can be incorporated
into the composition The formulations can conveniently be presented in dosage unit
form and can be prepared by any of the methods well known in the art of pharmacy/microbiology.
In general, some formulations are prepared by bringing the therapeutic into association
with a liquid carrier or a finely divided solid carrier or both, and then, if necessary,
shaping the product into the desired formulation.
[0039] A pharmaceutical composition of the invention is formulated to be compatible with
its intended route of administration. Examples of routes of administration include
oral or parenteral, e.g., intravenous, intradermal, inhalation, transdermal (topical),
transmucosal, and rectal administration. Solutions or suspensions used for parenteral,
intradermal, or subcutaneous application can include the following components: a sterile
diluent such as water for injection, saline solution, fixed oils, polyethylene glycols,
glycerine, propylene glycol or other synthetic solvents; antibacterial agents such
as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium
bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such
as acetates, citrates or phosphates and agents for the adjustment of tonicity such
as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric
acid or sodium hydroxide.
[0040] Useful solutions for oral or parenteral administration can be prepared by any of
the methods well known in the pharmaceutical art, described, for example, in
Remington's Pharmaceutical Sciences, (Gennaro, A., ed.), Mack Pub., 1990. Formulations for parenteral administration also can include glycocholate for buccal
administration, methoxysalicylate for rectal administration, or cutric acid for vaginal
administration. The parenteral preparation can be enclosed in ampoules, disposable
syringes or multiple dose vials made of glass or plastic. Suppositories for rectal
administration also can be prepared by mixing the drug with a nonirritating excipient
such as cocoa butter, other glycerides, or other compositions that are solid at room
temperature and liquid at body temperatures. Formulations also can include, for example,
polyalkylene glycols such as polyethylene glycol, oils of vegetable origin, hydrogenated
naphthalenes, and the like. Formulations for direct administration can include glycerol
and other compositions of high viscosity. Other potentially useful parenteral carriers
for these therapeutics include ethylene-vinyl acetate copolymer particles, osmotic
pumps, implantable infusion systems, and liposomes. Formulations for inhalation administration
can contain as excipients, for example, lactose, or can be aqueous solutions containing,
for example, polyoxyethylene-9-lauryl ether, glycocholate and deoxycholate, or oily
solutions for administration in the form of nasal drops, or as a gel to be applied
intranasally. Retention enemas also can be used for rectal delivery.
[0041] Formulations of the present invention suitable for oral administration can be in
the form of discrete units such as capsules, gelatin capsules, sachets, tablets, troches,
or lozenges, each containing a predetermined amount of the drug; in the form of a
powder or granules; in the form of a solution or a suspension in an aqueous liquid
or non-aqueous liquid; or in the form of an oil-in-water emulsion or a water-in-oil
emulsion. The therapeutic can also be administered in the form of a bolus, electuary
or paste. A tablet can be made by compressing or moulding the drug optionally with
one or more accessory ingredients. Compressed tablets can be prepared by compressing,
in a suitable machine, the drug in a free-flowing form such as a powder or granules,
optionally mixed by a binder, lubricant, inert diluent, surface active or dispersing
agent. Molded tablets can be made by molding, in a suitable machine, a mixture of
the powdered drug and suitable carrier moistened with an inert liquid diluent.
[0042] Oral compositions generally include an inert diluent or an edible carrier. For the
purpose of oral therapeutic administration, the active compound can be incorporated
with excipients. Oral compositions prepared using a fluid carrier for use as a mouthwash
include the compound in the fluid carrier and are applied orally and swished and expectorated
or swallowed. Pharmaceutically compatible binding agents, and/or adjuvant materials
can be included as part of the composition. The tablets, pills, capsules, troches
and the like can contain any of the following ingredients, or compounds of a similar
nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an
excipient such as starch or lactose; a disintegrating agent such as alginic acid,
Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant
such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin;
or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.
[0043] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions
(where water soluble) or dispersions and sterile powders for the extemporaneous preparation
of sterile injectable solutions or dispersion. For intravenous administration, suitable
carriers include physiological saline, bacteriostatic water, Cremophor ELTM (BASF,
Parsippany, NJ) or phosphate buffered saline (PBS). In all cases, the composition
can be sterile and can be fluid to the extent that easy syringability exists. It can
be stable under the conditions of manufacture and storage and can be preserved against
the contaminating action of microorganisms such as bacteria and fungi. The carrier
can be a solvent or dispersion medium containing, for example, water, ethanol, polyol
(for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the
like), and suitable mixtures thereof. The proper fluidity can be maintained, for example,
by the use of a coating such as lecithin, by the maintenance of the required particle
size in the case of dispersion and by the use of surfactants. Prevention of the action
of microorganisms can be achieved by various antibacterial and antifungal agents,
for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like.
In many cases, it will be preferable to include isotonic agents, for example, sugars,
polyalcohols such as manitol, sorbitol, and sodium chloride in the composition. Prolonged
absorption of the injectable compositions can be brought about by including in the
composition an agent which delays absorption, for example, aluminum monostearate and
gelatin.
[0044] Sterile injectable solutions can be prepared by incorporating the active compound
in the required amount in an appropriate solvent with one or a combination of ingredients
enumerated above, as required, followed by filtered sterilization. Generally, dispersions
are prepared by incorporating the active compound into a sterile vehicle which contains
a basic dispersion medium and the required other ingredients from those enumerated
above. In the case of sterile powders for the preparation of sterile injectable solutions,
methods of preparation include vacuum drying and freeze-drying which yields a powder
of the active ingredient plus any additional desired ingredient from a previously
sterile-filtered solution thereof.
[0045] Formulations suitable for intra-articular administration can be in the form of a
sterile aqueous preparation of the therapeutic which can be in microcrystalline form,
for example, in the form of an aqueous microcrystalline suspension. Liposomal formulations
or biodegradable polymer systems can also be used to present the therapeutic for both
intra-articular and ophthalmic administration.
[0046] Formulations suitable for topical administration, including eye treatment, include
liquid or semi-liquid preparations such as liniments, lotions, gels, applicants, oil-in-water
or water-in-oil emulsions such as creams, ointments or pasts; or solutions or suspensions
such as drops. Formulations for topical administration to the skin surface can be
prepared by dispersing the therapeutic with a dermatologically acceptable carrier
such as a lotion, cream, ointment or soap. In some embodiments, useful are carriers
capable of forming a film or layer over the skin to localize application and inhibit
removal. Where adhesion to a tissue surface is desired the composition can include
the therapeutic dispersed in a fibrinogen-thrombin composition or other bioadhesive.
The therapeutic then can be painted, sprayed or otherwise applied to the desired tissue
surface. For topical administration to internal tissue surfaces, the agent can be
dispersed in a liquid tissue adhesive or other substance known to enhance adsorption
to a tissue surface. For example, hydroxypropylcellulose or fibrinogen/thrombin solutions
can be used to advantage. Alternatively, tissue-coating solutions, such as pectin-containing
formulations can be used.
[0047] For inhalation treatments, such as for asthma, inhalation of powder (self-propelling
or spray formulations) dispensed with a spray can, a nebulizer, or an atomizer can
be used. Such formulations can be in the form of a finely comminuted powder for pulmonary
administration from a powder inhalation device or self-propelling powder-dispensing
formulations. In the case of self-propelling solution and spray formulations, the
effect can be achieved either by choice of a valve having the desired spray characteristics
(i.e., being capable of producing a spray having the desired particle size) or by
incorporating the active ingredient as a suspended powder in controlled particle size.
For administration by inhalation, the therapeutics also can be delivered in the form
of an aerosol spray from a pressured container or dispenser which contains a suitable
propellant, e.g., a gas such as carbon dioxide, or a nebulizer. Nasal drops also can
be used.
[0048] Systemic administration also can be by transmucosal or transdermal means. For transmucosal
or transdermal administration, penetrants appropriate to the barrier to be permeated
are used in the formulation. Such penetrants generally are known in the art, and include,
for example, for transmucosal administration, detergents, bile salts, and filsidic
acid derivatives. Transmucosal administration can be accomplished through the use
of nasal sprays or suppositories. For transdermal administration, the therapeutics
typically are formulated into ointments, salves, gels, or creams as generally known
in the art.
[0049] In one embodiment, the therapeutics are prepared with carriers that will protect
against rapid elimination from the body, such as a controlled release formulation,
including implants and microencapsulated delivery systems. Biodegradable, biocompatible
polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic
acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such
formulations will be apparent to those skilled in the art. The materials also can
be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal
suspensions can also be used as pharmaceutically acceptable carriers. These can be
prepared according to methods known to those skilled in the art, for example, as described
in
U.S. Pat. No. 4,522,811. Microsomes and microparticles also can be used.
[0050] Oral or parenteral compositions can be formulated in dosage unit form for ease of
administration and uniformity of dosage. Dosage unit form refers to physically discrete
units suited as unitary dosages for the subject to be treated; each unit containing
a predetermined quantity of active compound calculated to produce the desired therapeutic
effect in association with the required pharmaceutical carrier. The specification
for the dosage unit forms of the invention are dictated by and directly dependent
on the unique characteristics of the active compound and the particular therapeutic
effect to be achieved, and the limitations inherent in the art of compounding such
an active compound for the treatment of individuals.
[0051] Generally, the therapeutics identified according to the invention can be formulated
for parenteral or oral administration to humans or other mammals, for example, in
therapeutically effective amounts, e.g., amounts which provide appropriate concentrations
of the drug to target tissue for a time sufficient to induce the desired effect. Additionally,
the therapeutics of the present invention can be administered alone or in combination
with other molecules known to have a beneficial effect on the particular disease or
indication of interest. By way of example only, useful cofactors include symptom-alleviating
cofactors, including antiseptics, antibiotics, antiviral and antifungal agents and
analgesics and anesthetics.
[0052] The effective concentration of the therapeutics identified according to the invention
that is to be delivered in a therapeutic composition will vary depending upon a number
of factors, including the final desired dosage of the drug to be administered and
the route of administration. The preferred dosage to be administered also is likely
to depend on such variables as the type and extent of disease or indication to be
treated, the overall health status of the particular patient, the relative biological
efficacy of the therapeutic delivered, the formulation of the therapeutic, the presence
and types of excipients in the formulation, and the route of administration. In some
embodiments, the therapeutics of this invention can be provided to an individual using
typical dose units deduced from the earlier-described mammalian studies using non-human
primates and rodents. As described above, a dosage unit refers to a unitary, i.e.
a single dose which is capable of being administered to a patient, and which can be
readily handled and packed, remaining as a physically and biologically stable unit
dose comprising either the therapeutic as such or a mixture of it with solid or liquid
pharmaceutical diluents or carriers.
[0053] In certain embodiment organisms are engineered to produce the therapeutics identified
according to the inventions. These organisms can release the therapeutic for harvesting
or can be introduced directly to a patient. In another series of embodiments, cells
can be utilized to serve as a carrier of the therapeutics identified according to
the invention.
[0054] Therapeutics of the invention also include the "prodrug" derivatives. The term prodrug
refers to a pharmacologically inactive (or partially inactive) derivative of a parent
molecule that requires biotransformation, either spontaneous or enzymatic, within
the organism to release or activate the active component. Prodrugs are variations
or derivatives of the therapeutics of the invention which have groups cleavable under
metabolic conditions. Prodrugs become the therapeutics of the invention which are
pharmaceutically active in vivo, when they undergo solvolysis under physiological
conditions or undergo enzymatic degradation. Prodrug of this invention can be called
single, double, triple, and so on, depending on the number of biotransformation steps
required to release or activate the active drug component within the organism, and
indicating the number of functionalities present in a precursor-type form. Prodrug
forms often offer advantages of solubility, tissue compatibility, or delayed release
in the mammalian organism (see,
Bundgard, Design of Prodrugs, pp. 7-9, 21-24, Elsevier, Amsterdam 1985 and
Silverman, The Organic Chemistry of Drug Design and Drug Action, pp. 352-401, Academic
Press, San Diego, Calif., 1992). Moreover, the prodrug derivatives according to this invention can be combined with
other features to enhance bioavailability.
Examples, including comparative examples
Example 1: Trans expression of GAA.
[0055] The following primers were used to generate a gene cassette containing the human
IGF-II signal sequence fused to human GAA residues 791-952 (the C-terminal domain).
GAA41: GGAATTCAGGCGCGCCGGCAGCTCCCCGTGAGCCAGCC GAA 27: GCTCTAGACTAACACCAGCTGACGAGAAACTGC
GAA41 and GAA27 were used to amplify the C-terminal domain of GAA by PCR. The amplified
fragment contains an Asc I site at the 5'terminus. The SS N-tag encoding the IGF-II
signal sequence (residues 1-25) with an AscI site at the 3' end was then fused at
the Asc I site to the GAA C-terminal domain and the cassette was cloned in pCEP4 to
generate plasmid pCEP-SS-GAA-791-952. The SS N-tag nucleic acid sequence is shown
as below.
DNA sequence of the SS N-tag:

[0056] The following additional plasmids were generated similarly: pCEP-GAA Δ 817-952 that
lacks C-terminal GAA residues 817-952 and pCEP-GAA Δ 817-952-GILT Δ 1-7 that is similar
to pCEP-GAA Δ 817-952 except for the addition of a C-terminal GILTΔ1-7 tag. GAA Δ
817-952 was generated by introducing a stop codon after amino acid residue 816. To
facilitate the cloning process, the stop codon was followed by 3' end XbaI restriction
site and 5' end contains an EcoRI restriction site. DNA and amino acid sequences of
GAA Δ 817-952 are shown below.
DNA sequence of GAA Δ 817-952.

Amino acid sequence of GAA Δ 817-952.

[0057] To determine if the GAA C-terminal region functions when expressed in
trans, pCEP-SS-GAA-791-952 was transfected into HEK293 cells alone as well as in combination
with either plasmid pCEP-GAA Δ 817-952 or with pCEP-GAA Δ 817-952-GILT Δ 1-7. As controls,
pCEP-GAA Δ 817-952 and pCEP-GAA Δ 817-952-GILT Δ 1-7 were also transfected into HEK293
cells alone. Standard transfection methods were used for the experiments. For single
plasmid transfections, 1 µg of plasmid DNA was used. For co-tansfections, 0.5 µg of
each plasmid were used. 1 µg of total DNA was mixed with 96 µL of HEK293 growth media
lacking serum and 4 µL FuGene6 (Roche) as directed by the manufacturer. 50 µL of the
mixture were added to each duplicate well of HEK293 cells growing in 12-well plates
in 1 mL Dulbecco's Modified Eagles Media supplemented with 1.5 g/L sodium bicarbonate,
10% heat-inactivated FBS, and 4 mM L-glutamine: Cells were incubated 2-3 days at 37°C
in 5% CO
2.
[0058] Growth media were collected and assayed to determine GAA activities as described
(
Reuser, A.J., et al. (1978) Am. J. Hum. Genet 30:132-143). No GAA activity was detected in the media collected from HEK293 cells transfected
with single plasmids. By contrast, GAA activities were present in the growth media
collected from HEK293 cells co-transfected with pCEP-SS-GAA-791-952 and either pCEP-GAAA817-952
or pCEP-GAA0817-952-GILTΔ1-7 (Table 1).
[0059] Therefore, the two C-terminal deletion constructs pCEP-GAAΔ817-952 and pCEP-GAAΔ817-952-GILTΔ1-7
only express functional proteins when co-expressed with the C-terminal domain plasmid,
pCEP-SS-GAA-791-952. This experiment demonstrated that the C-terminal GAA region cooperates
with the mature, N-terminal region when coexpressed
in trans.
Table 1. Transient co-transfection of GAA C-terminal and N-terminal domains.
| Plasmid 1 |
Plasmid 2 |
GAA activity |
| |
|
(nmol/hr-ml) |
| pCEP-SS-GAA-791-952 |
None |
0 |
| pCEP-GAAΔ817-952 |
None |
0 |
| pCEP-GAAΔ817-952-GILTΔ1-7 |
None |
0 |
| PCEP-SS-GAA-791-952 |
pCEP-GAAA817-952 |
14 |
| PCEP-SS-GAA-791-952 |
pCEP-GAAΔ817-952-GILTΔ1-7 |
3 |
Example 2. Region required for efficient GAA trans-expression.
[0060] In the transient co-transfection experiment described in Example 1, the GAA region
including amino acid residues 792-817 is present in both halves of the trans-expression
constructs. In order to determine if the overlap of this region is necessary for efficient
trans-expression, a pair of constructs, pCEP-GAAΔ791-952-GILTΔ1-7 and PCEP-SS-GAA-791-952,
were designed with no overlap and the GILT tag was fused at position 791. As indicated
in Table 2, transient co-transfection experiments demonstrated that the presence of
amino acid residues 792-817 within the C-terminal domain is required for efficient
GAA trans-expression.
Table 2. Amino acid residues 792-817 is required for efficient GAA trans-expression.
| Plasmid 1 |
Plasmid 2 |
GAA activity |
| |
|
(nmol/hr-ml) |
| PCEP-GAA |
|
58 |
| PCEP-SS-GAA-791-952 |
|
1 |
| PCEP-GAAA817-952-GILTΔ1-7 |
|
1 |
| pCEP-GAAA791-952-GELTΔ1-7 |
|
1 |
| pCEP-SS-GAA-817-952 |
|
1 |
| PCEP-SS-GAA-791-952 |
pCEP-GAAΔ791-952-GILTΔ1-7 |
2 |
| PCEP-SS-GAA-791-952 |
PCEP-GAAA817-952-GILTΔ1-7 |
16 |
| pCEP-SS-GAA-817-952 |
pCEP-GAAΔ791-952-GILTΔ1-7 |
1 |
| pCEP-SS-GAA-817-952 |
PCPP-GAAΔ817-952-GILTΔ1-7 |
1 |
Example 3. Construction of a GAA protein with an internal GILT tag.
[0061] PCR was used to first generate an insertion of the nucleotide sequence GGCGCGCCG
(SEQ ID NO:
11) after nucleotide 2370 of the complete human GAA sequence (SEQ ID NO:
9). This insertion forms an AscI restriction site preceding Ala791. The GILT tag was
PCR-amplified with the following DNA oligos:
IGF7: gctctagaggcgcgccCTCGGACTTGGCGGGGGTAGC
IGF8: ggaattcaggcgcgcgccgGCTTACCGCCCCAGTGAGAC
The amplified GILT tag contains an AscI restriction site at each terminus. This GILT
tag was digested with AscI and inserted into the AscI site preceding GAA Ala791 as
described above. DNA sequencing confirmed the in-frame orientation of the GILT insertion.
This GALA cassette containing an internal GILT tag preceding Ala791 was expressed
in vector pCEP4 in a plasmid named pCEP-GAA-IRGILT-4. pCEP-GAA-IRGILT-4 was found
to contain a PCR-generated mutation T1712C within the GAA coding sequence. This construct
produced functional GAA protein.
Example 4. GAA deletion constructs with N-terminal GILT tag.
[0062] A set of five tags suitable for N-terminal GAA expression (N-tags) were generated
by PCR amplification using primers indicated in Table 3. The GILT N-tag contains the
native IGF-II signal sequence and complete GILT epitope. The SS N-tag contains only
theIGF-II signal sequence.
[0063] For example, the GILTΔ1-7 N-tag contains the IGF-II signal sequence and GILT epitope
residues 8-67. It was generated with three PCR reactions; (1) PCR amplification from
Human IGF-II DNA template using primers IGF1 and IGF4; (2) PCR amplification from
human IGF-II DNA template using primers IGF2 and IGF7; and (3) PCR amplification from
the products of the first two PCR reactions using primers IGF1 and IGF7.
[0064] The GILTΔ2-7 N-tag of the invention contains the IGF-II signal sequence, and GILT
epitope residue 1 followed by residues 8-67. It was generated with three PCR reactions:
(1) PCR amplification from human IGF-II DNA template using primers IGF1 and IGF5;
(2) PCR amplification from human IGF-II DNA template using primers IGF3 and IGF7;
and (3) PCR amplification from the products of the first two PCR reactions using primers
IGF1 and IGF7.
[0065] The SSGAA-GILT N-tag contains the GAA signal sequence within residues 1-69, followed
by the complete GILT epitope. It was generated with three PCR reactions: (1) PCR amplification
from human GAA DNA template using primers GAA13 and GI1; (2) PCR amplification from
human IF-11 template using primers GI2 and IGF7; and (3) PCR amplification from the
products of the first two PCR reactions using primers GAA13 and IGF7.
[0066] Each N-tag contains a 5' EcoRI restriction site and 3' AscI and XbaI sites. The AscI
site was used to fuse each tag to the GAA N-terminal deletion constructs described
below.
[0067] Portions of the N-terminal human GAA DNA sequence were deleted and replaced with
an AscI restriction site using PCR techniques. 5' DNA oligos used to define the site
of deletion are listed below (Table 4). 5' oligos were paired with various 3' oligos
within the GAA coding sequence, and the resulting DNA fragments were subsequently
fused to the complete C-terminal GAA coding sequence. The N-terminal AscI sites were
fused to one of the five N-terminal tags (N-tags) listed above to complete the expression
cassettes (Table 4).
Table 4. GAA N-terminal deletion constructs. Sequnces complementary to GAA coding
sequence are in upper case. EcoRI and AscI restriction sites are in lower case.
| Deletion Name |
5' DNA Oligos |
| GAAA1-24 |
GAA32: ggaattcaggcgcgccgGCACTCCTGGGGCACATCC |
| GAAΔ1-28 |
GAA28: ggaaacaggcgcgccgCACATCCTACTCCATGATTTC |
| GAAA1-55 |
GAA29: ggaattcaggcgcgccgCACCAGCAGGGAGCCAGCAG |
| GAAΔ1-69 |
GAA30: ggaaacaggcgcgccgGCACACCCCGGCCGTCCCAG |
| GAAΔ1-80 |
GAA39: ggaattcaggcgcgccgCAGTGCGACGTCCCaCCCAAC |
| GAAΔ1-122 |
GAA33: ggaaacaggcgcgccgGGGCAGCCCTGGTGCTTCTTC |
| GAAA1-203 |
GAA34: ggaaacaggcgcgccgGCACCGTCCCCACTCTACAG |
[0068] The expression cassettes listed in Table 4 contain an N-terminal tag (N-tag) fused
to an N-terminal GAA deletion at a mutual AscI site. The cassettes were cloned into
the multiple cloning site of expression vector pCEP4 and transfected into HEK293 cells
using the FuGene6 transfection reagent (Roche): Media from transient expression were
collected 2-3 days post transfection and assayed for secreted GAA activity using a
standard enzymatic assay (
Reuser, A.J., et al. (1978) Am. J. Hum. Genet. 30:132-143).
Table 5. Relative transient expression of N-tagged GAA constructs.
| Plasmid Name |
Relative Transient Expression |
| Vector |
N-tag |
GAA Deletion |
| PCEP |
GILT |
GAAΔ1-24 |
+ |
| PCEP |
SS |
GAAΔ1-24 |
++ |
| PCEP |
GILTΔ1-7 |
GAAΔ1-24 |
- |
| PCEP |
GILTΔ2-7 |
GAAΔ1-24 |
- |
| PCEP |
SSGAA-GILT |
GAAΔ1-24 |
- |
| PCEP |
GILT |
GAAΔ1-28 |
++ |
| PCEP |
SS |
GAAΔ1-28 |
++ |
| PCEP |
GILTΔ1-7 |
GAAΔ1-28 |
+ |
| PCEP |
GILTΔ2-7 |
GAAΔ1-28 |
++ |
| PCEP |
SSGAA-GILT |
GAAΔ1-28 |
++ |
| PCEP |
GILT |
GAAΔ1-55 |
++ |
| PCEP |
SS |
GAAΔ1-55 |
++++ |
| PCEP |
GILTΔ1-7 |
GAAΔ1-55 |
++ |
| PCEP |
GELTΔ2-7 |
GAAΔ1-55 |
++ |
| PCEP |
SSGAA-GILT |
GAAΔ1-55 |
++ |
| PCEP |
GILT |
GAAΔ1-69 |
++ |
| PCEP |
SS |
GAAΔ1-69 |
++++ |
| PCEP |
GILTΔ2-7 |
GAAΔ1-69 |
++ |
| PCEP |
SSGAA-GILT |
GAAΔ1-69 |
+ |
| PCEP |
GILT |
GAAΔ1-80 |
++ |
| PCEP |
SS |
GAAΔ1-80 |
++++ |
| PCEP |
GILTΔ1-7 |
GAAΔ1-80 |
++ |
| PCEP |
GILT2-7 |
GAAΔ1-80 |
++ |
| PCEP |
SSGAA-GILT |
GAAΔ1-80 |
+ |
| PCEP |
GILT |
GAAΔ1-122 |
- |
| PCEP |
SS |
GAAΔ1-122 |
- |
| PCEP |
GILTΔ1-7 |
GAAΔ1-122 |
- |
| PCEP |
GILTΔ2-7 |
GAAΔ1-122 |
- |
| PCEP |
SSGAA-GILT |
GAAΔ1-122 |
- |
| PCEP |
GILT |
GAAΔ1-203 |
- |
| PCEP |
SS |
GAAΔ1-203 |
- |
| PCEP |
GILTΔ1-7 |
GAAΔ1-203 |
- |
| PCEP |
GELTΔ2-7 |
GAAΔ1-203 |
- |
| PCEP |
SSGAA-GILT |
GAAΔ1-203 |
- |
| PCEP |
|
GAA |
++ |
[0069] As these data indicated, the N-terminal portion of GAA including residues 1-80 is
dispensable for transient expression, but deletions that disrupt or eliminate the
trefoil domain do not produce functional protein.
[0070] Furthermore, as indicated in Table 6, the secretion of GAA can be improved by appropriately
positioning a heterologous signal peptide, in this case the IGF-II signal peptide.
Positioning the IGF-II signal peptide at either residue 56 or 70 of GAA gave a three
fold increase in GAA secretion compared to native GAA, while positioning the IGF-II
signal peptide at position 29 did not. This may be due to the retention of a putative
trans-membrane domain adjacent to the GAA signal peptide.
Table 6. Changing GAA signal sequence positions affects GAA secretion
| |
Transient GAA Activity (nmol/hr-mL) |
| Plasmid |
Experiment 1 |
Experiment 2 |
| pCEP-GAA |
121 |
111 |
| PCEP-SS-GAAΔ1-28 |
NA |
89 |
| pCEP-SS-GAAΔ1-55 |
402 |
NA |
| pCEP-SS-GAAΔ1-69 |
325 |
NA |
[0071] However, replacement of the native GAA signal peptide and trans-membrane domain with
a heterologous signal peptide lowers the level of mannose-6-phosphate dependant cellular
uptake associated with the protein (Figure 4). Uptake experiment was described in
U.S. Patent Application Nos. 20040005309 and
20040006008, the contents of which are hereby incorporated by reference. As illustrated in Figure
4, pCEP-SS-GAAΔ1-69 had one third the amount of uptake into Pompe fibroblasts as did
wild-type pCEP-GAA.
[0072] In contrast, as illustrated in Figure 5, by comparing uptake of pCEP-SS-GAAΔ1-69
with a construct with GILT tag, pCEP-SS-GILTΔ2-7-GAAΔ1-69, it was evident that the
GILT tag promotes specific uptake that can be competed by IGF-II. Thus, placement
of the peptide tag at position 70 not only permits efficient expression of the fusion
protein and GAA activity, but also provides a peptide tag that is properly folded
and accessible, permitting receptor-mediated uptake into target cells.