FIELD OF THE INVENTION
[0001] The present invention is in the field of fibrosis diagnosis and in particular liver
fibrosis diagnosis, and more particularly, liver fibrosis associated with hepatitis
C virus (HCV) infection. More specifically, the present invention relates to specific
single nucleotide polymorphisms (SNPs) in the human genome, and their association
with liver fibrosis and related pathologies. Based on differences in allele frequencies
in the patient population with advanced or bridging fibrosis/cirrhosis relative to
individuals with no or minimal fibrosis, the naturally-occurring SNPs disclosed herein
can be used as targets for the design of diagnostic reagents and the development of
therapeutic agents, as well as for disease association and linkage analysis. In particular,
the SNPs disclosed herein is useful for identifying an individual who is at an increased
or decreased risk of developing liver fibrosis and for early detection of the disease,
for providing clinically important information for the prevention and/or treatment
of liver fibrosis, and for screening and selecting therapeutic agents. The SNPs disclosed
herein are also useful for human identification applications. Methods, assays, kits,
and reagents for detecting the presence of these polymorphisms and their encoded products
are provided.
BACKGROUND OF THE INVENTION
Fibrosis
[0002] Fibrosis is a quantitative and qualitative change in the extracellular matrix that
surrounds cells as a response to tissue injury. The trauma that generates fibrosis
is varied and includes radiological trauma (
i.e., x-ray, gamma ray, etc.), chemical trauma (
i.e., radicals, ethanol, phenols, etc.) viral infection and physical trauma. Fibrosis
encompasses pathological conditions in a variety of tissues such as pulmonary fibrosis,
retroperitoneal fibrosis, epidural fibrosis, congenital fibrosis, focal fibrosis,
muscle fibrosis, massive fibrosis, radiation fibrosis (
e.g. radiation induced lung fibrosis), liver fibrosis and cardiac fibrosis.
Liver Fibrosis in HCV-Infected Subjects
[0003] HCV affects about 4 million people in the United States and more than 170 million
people worldwide. Approximately 85% of the infected individuals develop chronic hepatitis,
and up to 20% progress to bridging fibrosis/cirrhosis, which is end-stage severe liver
fibrosis and is generally irreversible (
Lauer et al. 2001, N Eng J Med 345: 41-52). HCV infection is the major cause of cirrhosis and hepatocellular carcinoma (HCC),
and accounts for one third of liver transplantations. The interval between infection
and the development of cirrhosis may exceed 30 years but varies widely among individuals.
Based on fibrosis progression rate, chronic HCV patients can be roughly divided into
three groups (
Poynard et al 1997, Lancet 349: 825-832): rapid, median, and slow fibrosers.
[0004] Previous studies have indicated that host factors may play a role in the progression
of fibrosis, and these include age at infection, duration of infection, alcohol consumption,
and gender. However, these host factors account for only 17%-29% of the variability
in fibrosis progression (
Poynard et al., 1997, Lancet 349: 825-832;
Wright et al Gut. 2003, 52(4):574-9). Viral load or viral genotype has not shown significant correlation with fibrosis
progression (
Poynard et al., 1997, Lancet 349: 825-832). Thus, other factors, such as host genetic factors, are likely to play an important
role in determining the rate of fibrosis progression.
[0005] Recent studies suggest that some genetic polymorphisms influence the progression
of fibrosis in patients with HCV infection (
Powell et al. Hepatology 31(4): 828-33, 2000), autoimmune chronic cholestasis (
Tanaka et al. J. Infec. Dis. 187:1822-5, 2003), alcohol induced liver diseases (
Yamauchi et al., J. Hepatology 23(5):519-23, 1995), and nonalcoholic fatty liver diseases (
Bernard et al. Diabetologia 2000, 43(8):995-9). However, none of these genetic polymorphisms have been integrated into clinical
practice for various reasons (
Bataller et al Hepatology. 2003, 37(3):493-503). For example, limitations in study design, such as small study populations, lack
of replication sample sets, and lack of proper control groups have contributed to
contradictory results; an example being the conflicting results reported on the role
of mutations in the hemochromatosis gene (HFE) on fibrosis progression in HCV-infected
patients (
Smith et al., Hepatology. 1998, 27(6):1695-9;
Thorburn et al., Gut. 2002, 50(2):248-52).
[0006] Currently, there is no diagnostic test that can identify patients who are predisposed
to developing liver damage from chronic HCV infection, despite the large variability
in fibrosis progression rate among HCV patients. Furthermore, diagnosis of fibrosis
stage (early, middle or late) and monitoring of fibrosis progression is currently
accomplished by liver biopsy, which is invasive, painful, and costly; and generally
must be performed multiple times to assess fibrosis status. The discovery of genetic
markers which are useful in identifying HCV-infected individuals who are at increased
risk for advancing from early stage fibrosis to cirrhosis and/or HCC may lead to,
for example, better therapeutic strategies, economic models, and health care policy
decisions.
SNPs
[0007] The genomes of all organisms undergo spontaneous mutation in the course of their
continuing evolution, generating variant forms of progenitor genetic sequences (
Gusella, Ann. Rev. Biochem. 55, 831-854 (1986)). A variant form may confer an evolutionary advantage or disadvantage relative to
a progenitor form or may be neutral. In some instances, a variant form confers an
evolutionary advantage to the species and is eventually incorporated into the DNA
of many or most members of the species and effectively becomes the progenitor form.
Additionally, the effects of a variant form may be both beneficial and detrimental,
depending on the circumstances. For example, a heterozygous sickle cell mutation confers
resistance to malaria, but a homozygous sickle cell mutation is usually lethal. In
many cases, both progenitor and variant forms survive and co-exist in a species population.
The coexistence of multiple forms of a genetic sequence gives rise to genetic polymorphisms,
including SNPs.
[0008] Approximately 90% of all polymorphisms in the human genome are SNPs. SNPs are single
base positions in DNA at which different alleles, or alternative nucleotides, exist
in a population. The SNP position (interchangeably referred to herein as SNP, SNP
site, SNP locus, SNP marker, or marker) is usually preceded by and followed by highly
conserved sequences of the allele (e.g., sequences that vary in less than 1/100 or
1/1000. members of the populations). An individual may be homozygous or heterozygous
for an allele at each SNP position. A SNP can, in some instances, be referred to as
a "cSNP" to denote that the nucleotide sequence containing the SNP is an amino acid
coding sequence.
[0009] A SNP may arise from a substitution of one nucleotide for another at the polymorphic
site: Substitutions can be transitions or transversions. A transition is the replacement
of one purine nucleotide by another purine nucleotide, or one pyrimidine by another
pyrimidine. A transversion is the replacement of a purine by a pyrimidine, or vice
versa. A SNP may also be a single base insertion or deletion variant referred to as
an "indel" (
Weber et al., "Human diallelic insertion/deletion polymorphisms", Am J Hum Genet 2002
Oct;71(4):854-62).
[0010] A synonymous codon change, or silent mutation/SNP (terms such as "SNP", "polymorphism",
"mutation", "mutant", "variation", and "variant" are used herein interchangeably),
is one that does not result in a change of amino acid due to the degeneracy of the
genetic code. A substitution that changes a codon coding for one amino acid to a codon
coding for a different amino acid (
i.e., a non-synonymous codon change) is referred to as a missense mutation. A nonsense
mutation results in a type of non-synonymous codon change in which a stop codon is
formed, thereby leading to premature termination of a polypeptide chain and a truncated
protein. A read-through mutation is another type of non-synonymous codon change that
causes the destruction of a stop codon, thereby resulting in an extended polypeptide
product. While SNPs can be bi-, tri-, or tetra- allelic, the vast majority of the
SNPs are bi-allelic, and are thus often referred to as "bi-allelic markers", or "di-allelic
markers".
[0011] As used herein, references to SNPs and SNP genotypes include individual SNPs and/or
haplotypes, which are groups of SNPs that are generally inherited together. Haplotypes
can have stronger correlations with diseases or other phenotypic effects compared
with individual SNPs, and therefore may provide increased diagnostic accuracy in some
cases (
Stephens et al. Science 293, 489-493, 20 July 2001).
[0012] Causative SNPs are those SNPs that produce alterations in gene expression or in the
expression, structure, and/or function of a gene product, and therefore are most predictive
of a possible clinical phenotype. One such class includes SNPs falling within regions
of genes encoding a polypeptide product,
i.e. cSNPs. These SNPs may result in an alteration of the amino acid sequence of the polypeptide
product (
i.e., non-synonymous codon changes) and give rise to the expression of a defective or
other variant protein. Furthermore, in the case of nonsense mutations, a SNP may lead
to premature termination of a polypeptide product. Such variant products can result
in a pathological condition,
e.g., genetic disease. Examples of genes in which a SNP within a coding sequence causes
a genetic disease include sickle cell anemia and cystic fibrosis.
[0013] Causative SNPs do not necessarily have to occur in coding regions; causative SNPs
can occur in, for example, any genetic region that can ultimately affect the expression,
structure, and/or activity of the protein encoded by a nucleic acid. Such genetic
regions include, for example, those involved in transcription, such as SNPs in transcription
factor binding domains, SNPs in promoter regions, in areas involved in transcript
processing, such as SNPs at intron-exon boundaries that may cause defective splicing,
or SNPs in mRNA processing signal sequences such as polyadenylation signal regions.
Some SNPs that are not causative SNPs nevertheless are in close association with,
and therefore segregate with, a disease-causing sequence In this situation, the presence
of a SNP correlates with the presence of, or predisposition to, or an increased risk
in developing the disease. These SNPs, although not causative, are nonetheless also
useful for diagnostics, disease predisposition screening, and other uses.
[0014] An association study of a SNP and a specific disorder involves determining the presence
or frequency of the SNP allele in biological samples from individuals with the disorder
of interest, such as liver fibrosis and related pathologies and comparing the information
to that of controls (
i.e., individuals who do not have the disorder; controls may be also referred to as "healthy"
or "normal" individuals) who are preferably of similar age and race. The appropriate
selection of patients and controls is important to the success of SNP association
studies. Therefore, a pool of individuals with well-characterized phenotypes is extremely
desirable.
[0015] A SNP may be screened in diseased tissue samples or any biological sample obtained
from a diseased individual, and compared to control samples, and selected for its
increased (or decreased) occurrence in a specific pathological condition, such as
pathologies related to liver fibrosis, increased or decreased risk of developing bridging
fibrosis/cirrhosis, and progression of liver fibrosis. Once a statistically significant
association is established between one or more SNP(s) and a pathological condition
(or other phenotype) of interest, then the region around the SNP can optionally be
thoroughly screened to identify the.causative genetic locus/sequence(s) (
e.g., causative SNP/mutation, gene, regulatory region, etc.) that influences the pathological
condition or phenotype. Association studies may be conducted within the general population
and are not limited to studies performed on related individuals in affected families
(linkage studies).
[0016] Clinical trials have shown that patient response to treatment with pharmaceuticals
is often heterogeneous. There is a continuing need to improve pharmaceutical agent
design and therapy. In that regard, SNPs can be used to identify patients most suited
to therapy with particular pharmaceutical agents (this is often termed "pharmacogenomics").
Similarly, SNPs can be used to exclude patients from certain treatment due to the
patient's increased likelihood of developing toxic side effects or their likelihood
of not responding to the treatment. Pharmacogenomics can also be used in pharmaceutical
research to assist the drug development and selection process. (
Linder et al. (1997), Clinical Chemistry, 43, 254;
Marshall (1997), Nature Biotechnology, 15, 1249; International Patent Application
WO 97/40462, Spectra Biomedical; and
Schafer et al. (1998), Nature Biotechnology, 16: 3).
SUMMARY OF THE INVENTION
[0017] The present invention relates to the identification of a SNP, that is associated
with liver fibrosis and in particular the increased or decreased risk of developing
bridging fibrosis/cirrhosis, and the rate of progression of liver fibrosis. The polymorphisms
disclosed herein are directly useful as targets for the design of diagnostic reagents
and the development of therapeutic agents for use in the diagnosis and treatment of
liver fibrosis and related pathologies.
[0018] Based on the identification of an SNP associated with liver fibrosis, the presents
invention also provides methods of detecting this variants as well as the design and
preparation of detection reagents needed to accomplish this task. The invention specifically
provides, for example, a use of a SNP in genetic sequences involved in liver fibrosis
and related pathologies, and isolated nucleic acid molecules (including, for example,
this in a method for identifying an individual having an altered risk for developing
liver fibrosis. DNA and RNA molecules) containing. Described herein are variant proteins
encoded by nucleic acid molecules containing such SNPs, antibodies to the encoded
variant proteins, and computer-based and data storage systems containing the novel
SNP information. The invention provides methods of detecting the SNP in a test sample,
methods of identifying individuals who have an altered (
i.e., increased or decreased) risk of developing liver fibrosis based on the presence
or absence of one particular nucleotide (allele) at one SNP site disclosed herein
or the detection of one or more encoded variant products (
e.g., variant mRNA transcripts. For reference only, the description provides methods of
identifying individuals who are more or less likely to respond to a treatment (or
more or less likely to experience undesirable side effects from a treatment, etc.),
methods of screening for compounds useful in the treatment of a disorder associated
with a variant gene/protein, compounds identified by these methods, and methods of
treating disorders mediated by a variant gene/protein. The present invention provides
methods of using the SNP disclosed herein for human identification.
[0019] In Tables 1-2, the present invention provides gene information, transcript sequences
(SEQ ID NOS:116-119), encoded amino acid sequences (SEQ ID NOS:199, 377,-380, 342,
359, 399 ), genomic sequences (SEQ ID NO:5049), transcript-based context sequences
(SEQ ID NOS:2082, 2134 2185 2237) and genomic-based context sequences (SEQ ID NO:18973
) that contain the SNP disclosed herein , and extensive SNP information that includes
observed alleles, allele frequencies, populations/ethnic groups in which alleles have
been observed, information about the type of SNP and corresponding functional effect,
and, for cSNPs, information about the encoded polypeptide product. The transcript
sequences (SEQ ID NOS:1-261), amino acid sequences (SEQ ID NOS:262-522), genomic sequences
(SEQ ID NOS:4999-5321), transcript-based SNP context sequences (SEQ ID NOS: 523-4998),
and genomic-based SNP context sequences (SEQ ID NOS:5322-34256) are also provided
in the Sequence Listing.
[0020] In a specific embodiment of the present invention, a SNP that occurs naturally in
the human genome is provided as isolated nucleic acid molecule. These SNP is associated
with liver fibrosis and related pathologies. In particular the SNP is associated with
either an increased or decreased risk of developing bridging fibrosis/cirrhosis and
affect the rate of progression of liver fibrosis. As such, it can have a variety of
uses in the diagnosis and/or treatment of liver fibrosis and related pathologies.
One aspect of the present invention relates to the use of an isolated nucleic acid
molecule comprising a nucleotide sequence in which one nucleotide is the SNP of SEQ
ID NO: 18973 in the method of the present invention. In an alternative embodiment,
a nucleic acid of the invention is an amplified polynucleotide, which is produced
by amplification of a SNP-containing nucleic acid template. In another aspect, described
is a variant protein that is encoded by a nucleic acid molecule containing a SNP disclosed
herein.
[0021] In an embodiment of the invention, the use of a reagent for detecting a SNP in the
context of its naturally-occurring flanking nucleotide sequences (which can be,
e.g., either DNA or mRNA) in the method of the present invention is provided. In particular,
such a reagent may be in the form of, for example, a hybridization probe or an amplification
primer that is useful in the specific detection of a SNP of interest. For reference
only, a protein detection reagent is used to detect a variant protein that is encoded
by a nucleic acid molecule containing a SNP disclosed herein. For example, a protein
detection reagent is an antibody or an antigen-reactive antibody fragment.
[0022] In an embodiment the invention provides the use of a Kit comprising a SNP detection
reagent, in the method of the present invention and methods for detecting the SNP
disclosed herein by employing detection reagents. In a specific embodiment, the present
invention provides for a method of identifying an individual having an increased or
decreased risk of developing liver fibrosis by detecting the presence or absence of
one SNP allele disclosed herein. In an aspect, a method for diagnosis of liver fibrosis
and related pathologies by detecting the presence or absence of one or more SNP alleles
disclosed herein is described.
[0023] The nucleic acid molecules described herein of the can be inserted in an expression
vector, such as to produce a variant protein in a host cell. Thus, disclosed herein
is also a vector comprising a SNP-containing nucleic acid molecule, genetically-engineered
host cells containing the vector, and methods for expressing a recombinant variant
protein using such host cells. The described host cells, SNP-containing nucleic acid
molecules, and/or variant proteins can be used as targets in a method for screening
and identifying therapeutic agents or pharmaceutical compounds useful in the treatment
of liver fibrosis and related pathologies.
[0024] An aspect described herein is a method for treating liver fibrosis in a human subject
wherein said human subject harbors a SNP, gene, transcript, and/or encoded protein
identified in Tables 1-2, which method comprises administering to said human subject
a therapeutically or prophylactically effective amount of one or more agents counteracting
the effects of the disease, such as by inhibiting (or stimulating) the activity of
the gene, transcript, and/or encoded protein identified in Tables 1-2.
[0025] Another aspect described herein is a method for identifying an agent useful in therapeutically
or prophylactically treating liver fibrosis and related pathologies in a human subject
wherein said human subject harbors a SNP, gene, transcript, and/or encoded protein
identified in Tables 1-2, which method comprises contacting the gene, transcript,
or encoded protein with a candidate agent under conditions suitable to allow formation
of a binding complex between the gene, transcript, or encoded protein and the candidate
agent and detecting the formation of the binding complex, wherein the presence of
the complex identifies said agent.
[0026] Another aspect described herein is a method for treating liver fibrosis and related
pathologies in a human subject, which method comprises:
- (i) determining that said human subject harbors a SNP, gene, transcript, and/or encoded
protein identified in Tables 1-2, and
- (ii) administering to said subject a therapeutically or prophylactically effective
amount of one or more agents counteracting the effects of the disease.
[0027] Many other uses and advantages of the present invention will be apparent to those
skilled in the art upon review of the detailed description of the preferred embodiments
herein. Solely for clarity of discussion, the invention is described in the sections
below by way of non-limiting examples.
DESCRIPTION OF THE SEQUENCE LISTING
[0028] The Sequence Listing provides the transcript sequences (SEQ ID NOS:1-261) and protein
sequences (SEQ ID NOS:262-522), and genomic sequences (SEQ ID NOS:4999-5321) for each
liver fibrosis-associated gene that contains one or more SNPs of the present description.
Also provided in the Sequence Listing are context sequences flanking each SNP, including
both transcript-based context sequences (SEQ ID NOS:523-4998) and genomic-based context
sequences (SEQ ID NOS:5322-34256). The context sequences generally provide 100bp upstream
(5') and 100bp downstream (3') of each SNP, with the SNP in the middle of the context
sequence, for a total of 200bp of context sequence surrounding each SNP.
DESCRIPTION OF TABLE 1 AND TABLE 2
[0029] Table 1 and Table 2 disclose the SNP and associated gene/transcript/protein information
used in the method of the present invention. For number 51 gene, Table 1 and Table
2 each provide a header containing gene/transcript/protein information, followed by
a transcript and protein sequence (in Table 1) or genomic sequence (in Table 2), and
then SNP information of SNP hCV11722237 of the present invention found in that gene/transcript.
[0030] NOTE: the SNP is included in both Table 1 and Table 2. Table 1 presents the SNP relative
to its transcript sequences and encoded protein sequences, whereas Table 2 presents
the SNPs relative to their genomic sequences (in some instances Table 2 may also include,
after the last gene sequence, genomic sequences of one or more intergenic regions,
as well as SNP context sequences and other SNP information for any SNPs that lie within
these intergenic regions). The SNP can readily be cross-referenced between Tables
based on its hCV identification number.
[0031] The gene/transcript/protein information includes:
- a gene number (1 through n, where n = the total number of genes in the Table)
- a Celera hCG and UID internal identification numbers for the gene
- a Celera hCT and UID internal identification numbers for the transcript (Table 1 only)
- a public Genbank accession number (e.g., RefSeq NM number) for the transcript (Table 1 only)
- a Celera hCP and UID internal identification numbers for the protein encoded by the
hCT transcript (Table 1 only)
- a public Genbank accession number (e.g., RefSeq NP number) for the protein (Table 1 only)
- an art-known gene symbol
- an art-known gene/protein name
- Celera genomic axis position (indicating start nucleotide position-stop nucleotide
position)
- the chromosome number of the chromosome on which the gene is located
- an OMIM (Online Mendelian Inheritance in Man; Johns Hopkins University/NCBI) public
reference number for obtaining further information regarding the medical significance
of each gene
- alternative gene/protein name(s) and/or symbol(s) in the OMIM entry
[0032] NOTE: Due to the presence of alternative splice forms, multiple transcript/protein
entries can be provided for a single gene entry in Table 1;
i.e., for a single Gene Number, multiple entries may be provided in series that differ
in their transcript/protein information and sequences.
[0033] Following the gene/transcript/protein information is a transcript sequence and protein
sequence (in Table 1), or a genomic sequence (in Table 2), for each-gene, as follows:
- transcript sequence (Table 1 only) (corresponding to SEQ ID NOS:116-119 of the Sequence
Listing), with SNP identified by their IUB codes (transcript sequences can include
5' UTR, protein coding, and 3' UTR regions). (NOTE: If there are differences between
the nucleotide sequence of the hCT transcript and the corresponding public transcript
sequence identified by the Genbank accession number, the hCT transcript sequence (and
encoded protein) is provided, unless the public sequence is a RefSeq transcript sequence
identified by an NM number, in which case the RefSeq NM transcript sequence (and encoded
protein) is provided. However, whether the hCT transcript or RefSeq NM transcript
is used as the transcript sequence, the disclosed SNPs are represented by their IUB
codes within the transcript.)
- the encoded protein sequence (Table 1 only) (corresponding to SEQ ID NOS:199, 377-380,
342, 359, 399 of the Sequence Listing)
- the genomic sequence of the gene (Table 2 only), including 6kb on each side of the
gene boundaries (i.e., 6kb on the 5' side of the gene plus 6kb on the 3' side of the gene) (corresponding
to SEQ ID NO:5049 of the Sequence Listing).
[0034] NOTE: The transcript, protein, and transcript-based SNP context sequences are provided
in both Table 1 and in the Sequence Listing. The genomic and genomic-based SNP context
sequences are provided in both Table 2 and in the Sequence Listing. SEQ ID NOS are
indicated in Table 1 for each transcript sequence (SEQ ID NOS:1-261), protein sequence
(SEQ ID NOS:262-522), and transcript-based SNP context sequence (SEQ ID NOS:523-4998),
and SEQ ID NOS are indicated in Table 2 for each genomic sequence (SEQ ID NOS:4999-5321),
and genomic-based SNP context sequence (SEQ ID NOS:5322-34256).
[0035] The SNP information includes:
- context sequence (taken from the transcript sequence in Table 1, and taken from the
genomic sequence in Table 2) with the SNP represented by its IUB code, including 100
bp upstream (5') of the SNP position plus 100 bp downstream (3') of the SNP position
(the transcript-based SNP context sequences in Table 1 are provided in the Sequence
Listing as SEQ ID NOS:2082, 2134, 2185, 2237 the genomic-based SNP context sequences
in Table 2 are provided in the Sequence Listing as SEQ ID NO:18973 ).
- Celera hCV internal identification number for the SNP (in some instances, an "hDV"
number is given instead of an "hCV" number)
- SNP position [position of the SNP within the given transcript sequence (Table 1) or
within the given genomic sequence (Table 2)]
- SNP source (may include any combination of one or more of the following five codes,
depending on which internal sequencing projects and/or public databases the SNP has
been observed in: "Applera" = SNP observed during the re-sequencing of genes and regulatory
regions of 39 individuals, "Celera" = SNP observed during shotgun sequencing and assembly
of the Celera human genome sequence, "Celera Diagnostics" = SNP observed during re-sequencing
of nucleic acid samples from individuals who have a disease, "dbSNP" = SNP observed
in the dbSNP public database, "HGBASE" = SNP observed in the HGBASE public database,
"HGMD" = SNP observed in the Human Gene Mutation Database (HGMD) public database,
"HapMap" = SNP observed in the International HapMap Project public database, "CSNP"
= SNP observed in an internal Applied Biosystems (Foster City, CA) database of coding
SNPS (cSNPs)) (NOTE: multiple "Applera" source entries for a single SNP indicate that
the same SNP was covered by multiple overlapping amplification products and the re-sequencing
results (e.g., observed allele counts) from each of these amplification products is
being provided)
- Population/allele/allele count information in the format of [population1(first_allele,count|second_allele,count)population2(first_allele,count|second_
allele,count) total (first allele,total count|second_allele,total count)]. The information
in this field includes populations/ethnic groups in which particular SNP alleles have
been observed ("cau" = Caucasian, "his" = Hispanic, "chn" = Chinese, and "afr" = African-American,
"jpn" = Japanese, "ind" = Indian, "mex" = Mexican, "ain" = "American Indian, "cra"
= Celera donor, "no_pop" = no population information available), identified SNP alleles,
and observed allele counts (within each population group and total allele counts),
where available ["-" in the allele field represents a deletion allele of an insertion/deletion
("indel") polymorphism (in which case the corresponding insertion allele, which may
be comprised of one or more nucleotides, is indicated in the allele field on the opposite
side of the "|"); "-"in the count field indicates that allele count information is
not available]. For certain SNPs from the public dbSNP database, population/ethnic
information is indicated as follows (this population information is publicly available
in dbSNP): "HISP1" = human individual DNA (anonymized samples) from 23 individuals
of self-described HISPANIC heritage; "PAC1" = human individual DNA (anonymized samples)
from 24 individuals of self-described PACIFIC RIM heritage; "CAUC1" = human individual
DNA (anonymized samples) from 31 individuals of self-described CAUCASIAN heritage;
"AFR1" = human individual DNA (anonymized samples) from 24 individuals of self-described
AFRICAN/AFRICAN AMERICAN heritage; "P1" = human individual DNA (anonymized samples)
from 102 individuals of self-described heritage; "PA130299515"; "SC_12_A" = SANGER
12 DNAs of Asian origin from Corielle cell repositories, 6 of which are male and 6
female; "SC_12_C" = SANGER 12 DNAs of Caucasian origin from Corielle cell repositories
from the CEPH/UTAH library. Six male and 6 female; "SC_12_AA" = SANGER 12 DNAs of
African-American origin from Corielle cell repositories 6 of which are male and 6
female; "SC_95_C" = SANGER 95 DNAs of Caucasian origin from Corielle cell repositories
from the CEPH/UTAH library; and "SC_12_CA" = Caucasians - 12 DNAs from Corielle cell
repositories that are from the CEPH/UTAH library. Six male and 6 female.
[0036] NOTE: For SNPs of "Applera" SNP source, genes/regulatory regions of 39 individuals
(20 Caucasians and 19 African Americans) were re-sequenced and, since each SNP position
is represented by two chromosomes in each individual (with the exception of SNPs on
X and Y chromosomes in males, for which each SNP position is represented by a single
chromosome), up to 78 chromosomes were genotyped for each SNP position. Thus, the
sum of the African-American ("afr") allele counts is up to 38, the sum of the Caucasian
allele counts ("cau") is up to 40, and the total sum of all allele counts is up to
7.8.
[0037] (NOTE: semicolons separate population/allele/count information corresponding to each
indicated SNP source;
i.e., if four SNP sources are indicated, such as "Celera", "dbSNP", "HGBASE", and "HGMD",
then population/allele/count information is provided in four groups which are separated
by semicolons and listed in the same order as the listing of SNP sources, with each
population/allele/count information group corresponding to the respective SNP source
based on order; thus, in this example, the first population/allele/count information
group would correspond to the first listed SNP source (Celera) and the third population/allele/count
information group separated by semicolons would correspond to the third listed SNP
source (HGBASE); if population/allele/count information is not available for any particular
SNP source, then a pair of semicolons is still inserted as a place-holder in order
to maintain correspondence between the list of SNP sources and the corresponding listing
of population/allele/count information)
- SNP type (e.g., location within gene/transcript and/or predicted functional effect) ["MIS-SENSE
MUTATION" = SNP causes a change in the encoded amino acid (i.e., a non-synonymous coding SNP); "SILENT MUTATION" = SNP does not cause a change in
the encoded amino acid (i.e., a synonymous coding SNP); "STOP CODON MUTATION" = SNP is located in a stop codon;
"NONSENSE MUTATION" = SNP creates or destroys a stop codon; "UTR 5" = SNP is located
in a 5' UTR of a transcript; "UTR 3" = SNP is located in a 3' UTR of a transcript;
"PUTATIVE UTR 5" = SNP is located in a putative 5' UTR; "PUTATIVE UTR 3" = SNP is
located in a putative 3' UTR; "DONOR SPLICE STATE" = SNP is located in a donor splice
site (5' intron boundary); "ACCEPTOR SPLICE SITE" = SNP is located in an acceptor
splice site (3' intron boundary); "CODING REGION" = SNP is located in a protein-coding
region of the transcript; "EXON" = SNP is located in an exon; "INTRON" = SNP is located
in an intron; "hmCS" = SNP is located in a human-mouse conserved segment; "TFBS" =
SNP is located in a transcription factor binding site; "UNKNOWN" = SNP type is not
defined; "INTERGENIC" = SNP is intergenic, i.e., outside of any gene boundary]
- Protein coding information (Table 1 only), where relevant, in the format of [protein
SEQ ID NO:#, amino acid position, (amino acid-1, codon1) (amino acid-2, codon2)].
The information in this field includes SEQ ID NO of the encoded protein sequence,
position of the amino acid residue within the protein identified by the SEQ ID NO
that is encoded by the codon containing the SNP, amino acids (represented by one-letter
amino acid codes) that are encoded by the alternative SNP alleles (in the case of
stop codons, "X" is used for the one-letter amino acid code), and alternative codons
containing the alternative SNP nucleotides which encode the amino acid residues (thus,
for example, for missense mutation-type SNPs, at least two different amino acids and
at least two different codons are generally indicated; for silent mutation-type SNPs,
one amino acid and at least two different codons are generally indicated, etc.). In
instances where the SNP is located outside of a protein-coding region (e.g., in a UTR region), "None" is indicated following the protein SEQ ID NO.
DESCRIPTION OF TABLE 5
[0038] Table 5 provides sequences (SEQ ID NOS: 34257-34458) of primers that have been synthesized
and used in the laboratory to carry out allele-specific PCR reactions in order to
assay the SNPs disclosed in Tables 6 and 7 during the course of association studies
to verify the association of these SNPs with liver fibrosis.
[0039] Table 5 provides the following:
- the column labeled "Marker" provides an hCV identification number for each SNP site
- the column labeled "Alleles" designates the two alternative alleles at the SNP site
identified by the hCV identification number that are targeted by the allele-specific
primers (the allele-specific primers are shown as "Sequence A" and "Sequence B") [NOTE:
Alleles may be presented in Table 5 based on a different orientation (i.e., the reverse
complement) relative to how the same alleles are presented in Tables 1, 2, 6, and
7].
- the column labeled "Sequence A (allele-specific primer)" provides an allele-specific
primer that is specific for an allele designated in the "Alleles" column
- the column labeled "Sequence B (allele-specific primer)" provides an allele-specific
primer that is specific for the other allele designated in the "Alleles" column
- the column labeled "Sequence C (common primer)" provides a common primer that is used
in conjunction with each of the allele-specific primers (the "Sequence A" primer and
the "Sequence B" primer) and which hybridizes at a site away from the SNP position.
[0040] All primer sequences are given in the 5' to 3' direction.
Each of the nucleotides designated in the "Alleles" column matches or is the reverse
complement of (depending on the orientation of the primer relative to the designated
allele) the 3' nucleotide of the allele-specific primer (either "Sequence A" or "Sequence
B") that is specific for that allele.
DESCRIPTION OF TABLE 6
[0041] Table 6 provides results of statistical analyses for SNPs disclosed in Tables 1-2
(SNPs can be cross-referenced between tables based on their hCV identification numbers),
and the association of these SNPs with early and late stages of fibrosis (minimal
or moderate to severe fibrosis). The statistical results shown in Table 6 provide
support for the association of a SNP with minimal to severe fibrosis. Table 6 shows
the association of this SNP with fibrosis is supported by p-values < 0.05 in a genotype
association based on ordinal (ord) (major homozygotes, heterozygotes and minor homozygotes)
or dominant/recessive (dom) modes (major homozygotes vs. heterozygotes and minor homozygotes)
of inheritance.
[0042] Table 6 presents statistical associations of the SNP with the trial endpoint. The
column labeled "Marker" presents the SNP as identified by its unique identifier number
and its mode of association with the fibrosis stage endpoint. The column labeled "Gene
symbol" presents the common gene name of the gene containing the SNP. The data obtained
from the individual sample sets are presented in two groups of columns. The groups
of columns labeled "Stanford Samples " means the samples were obtained from patients
at Stanford. This sample set contains samples obtained from patients that had extreme
cases of fibrosis. 62% of the patients had a minimum fibrosis stage (level 0-2) (controls)
and 38% had a severe fibrosis stage (level 3-4) (cases). The groups of columns labeled
"UCSF Samples" means the samples were obtained from a study performed at the University
of California, San Francisco. These samples were obtained from patients that had a
variety of stages of fibrosis including minimal, moderate and severe stages of fibrosis
(46%, 26% and 28% respectively), which reflects the distribution of fibrosis patients
in clinics. The column labeled "OR" indicates the Odds Ratio, an approximation of
the relative risk for an individual for the defined endpoint associated with the SNP.
ORs less than 1 indicate the risk allele is protective for the defined endpoint, and
ORs greater than 1 indicate the risk allele increases the risk of having the defined
endpoint. The columns labeled "LCL" and "UCL" give the lower and upper confidence
levels of the ORs. The column labeled "p val" indicates the results of either the
chi-square test (Dom) or the Fisher Exact test (Ord) to determine if the qualitative
phenotype is a function of the SNP genotype.
DESCRIPTION OF TABLE 7
[0043] Table 7 provides results of statistical analyses for SNPs disclosed in Tables 1-2
(SNPs can be cross-referenced between tables based on their hCV identification numbers),
and the association of these SNPs with mild or severe fibrosis stage.. The statistical
results shown in Table 7 provide support for the association of these SNPs with bridging
fibrosis/cirrhosis. For example, the statistical results provided in Table 7 show
that the association of these SNPs with is supported by p-values < 0.1 in an allelic
association test in the University of California (UCSF) and the Virginia Commonwealth
University (VCU) sample sets in at least one of the following strata; all patients
(A), Caucasian only (C), or other than Caucasian (O). Additional SNP association with
bridging fibrosis/cirrhosis is seen in the sample sets obtained from the University
of Illinois, Chicago (UIC) and Stanford University (Stanford).
[0044] Table 7 presents statistical associations of SNPs with trial endpoints. The column
labeled "Marker" presents each SNP as identified by its unique identifier number.
The column labeled "Risk allele" presents the risk allele for each of the identified
SNPs. The risk allele may also be presented in the Tables 1-2 as the reverse complement
of the allele presented in Table 6. The column labeled "Strata" indicates the group
of individuals in which the association was observed. "A" indicates that the association
was observed in all individuals, "C" indicates that the association was observed in
Caucasians, "O" indicates the association was observed in other than Caucasians. The
groups of columns labeled "UCSF" means the samples were obtained from the University
of California, San Francisco. Among the 537 patients from UCSF, the samples had minimal
(stage 0-1, 52%), moderate (stage 2, 23%) or severe (stage 3-4, 25%) fibrosis. The
groups of columns labeled "VCU" means the samples were obtained from the Virginia
Commonwealth University. These samples were obtained from 483 patients that had minimal
(stage 0-1, 18%), moderate (stage 2, 34%) or severe (stage 3-4, 48%) fibrosis. The
groups of columns labeled "UIC" means the samples were obtained from the University
of Illinois, Chicago. These samples were obtained from 115 patients that had minimal
(stage 0-1, 29%), moderate (stage 2, 30%) or severe (stage 3-4, 41%) fibrosis. The
groups of columns labeled "Stanford" means the samples were obtained from Stanford
University. These samples were obtained from extreme cases, 62% contained minimal
(stage 0-1) fibrosis and 38% contained severe (stage 3-4) fibrosis. The column labeled
"CT AF" gives the control allele frequency of that SNP in that stratum. The column
labeled "CASE AF" gives the case allele frequency of that SNP in that stratum. The
column labeled "OR" indicates an approximation of the relative risk for an individual
for the defined endpoint associated with the SNP. ORs less than 1 indicate the risk
allele is protective for the defined endpoint, and ORs greater than 1 indicate the
risk allele increases the risk of having the defined endpoint. The column labeled
"p_2tail" indicates the p-value generated by the Fisher Exact test (allelic association)
to determine if the qualitative phenotype is a function of the SNP genotype and is
either a protective or risk allele in the UCSF sample set. The column labeled "p_1tail"
indicates the p-value generated by the Fisher Exact test to determine if the qualitative
phenotype is a function of the SNP genotype in the VCU, UIC or Stanford samples and
the OR is going in the same direction as the OR for that SNP in the UCSF sample.
DESCRIPTION OF THE FIGURE
[0045] Figure 1 provides a diagrammatic representation of a computer-based discovery system
containing the SNP information described herein in computer readable form.
DETAILED DESCRIPTION OF THE INVENTION
[0046] The present invention provides a method for identifying an individual having an altered
risk for developing liver fibrosis, comprising detecting the single nucleotide polymorphism
(SNP) in the nucleotide sequence of SEQ ID NO: 18973 in said individual's nucleic
acids, wherein the individual has an increased risk for developing liver fibrosis
due to the presence of C at position 101 1 of SEQ ID NO: 18973 or the presence of
G at position 101 of its complement.
[0047] In another aspect of the invention, provided is a method for identifying an individual
having a risk for progressing rapidly from minimal fibrosis to bridging fibrosis/cirrhosis,
comprising detecting the single nucleotide polymorphism (SNP) in the nucleotide sequence
of SEQ ID NO:18973 in said individual's nucleic acids, wherein the individual has
a risk for a rapid rate of progression to bridging fibrosis/cirrhosis due to the presence
of C at position 101 1 of SEQ ID NO: 18973 or the presence of G at position 101 of
its complement.
[0048] In another embodiment of the invention, provided is a use of an isolated polynucleotide
which specifically hybridizes to a nucleic acid molecule containing a single nucleotide
polymorphism (SNP) at position 101 of the nucleotide sequence of SEQ ID NO:18973 or
its complement in the method according to any one of methods of the present invention.
[0049] The present invention further provides a use of a kit comprising a polynucleotide
which specifically hybridizes to a nucleic acid molecule containing a single nucleotide
polymorphism (SNP) at position 101 of the nucleotide sequence of SEQ ID NO:18973 or
its complement, a buffer, and an enzyme in the method according to any one of methods
of the present invention.
[0050] The present invention provides the use of a SNP associated with liver fibrosis and
related pathologies, and nucleic acid molecules containing the SNP in the method of
the present invention, and methods for the detection of the SNP at position 101 of
nucleotide sequence SEQ ID NO:18973 or its complement, as well as the use of kits
that utilize such reagents in the method of the present invention. For reference only,
uses of the SNPs, for the development of detection reagents are described.
[0051] The liver fibrosis-associated SNPs disclosed herein is useful for diagnosing, screening
for, and evaluating predisposition to liver fibrosis, including an increased or decreased
risk of developing bridging fibrosis/cirrhosis, the rate of progression of fibrosis,
and related pathologies in humans. Furthermore, such SNP and its encoded product is
useful targets for the development of therapeutic agents.
[0052] A large number of SNPs have been identified from re-sequencing DNA from 39 individuals,
and they are indicated as "Applera" SNP source in Tables 1-2. Their allele frequencies
observed in each of the Caucasian and African-American ethnic groups are provided.
Additional SNPs described herein were previously identified during shotgun sequencing
and assembly of the human genome. The information provided in Table 1-2, particularly
the allele frequency information obtained from 39 individuals and the identification
of the precise position of the SNP within each gene/transcript, allows haplotypes
(
i.e., groups of SNPs that are co-inherited) to be readily inferred.
[0053] Described herein are novel SNPs associated with liver fibrosis and related pathologies,
as well as SNPs that were previously known in the art, but were not previously known
to be associated with liver fibrosis. Accordingly, disclosed herein are novel compositions
and methods based on the novel SNPs disclosed herein, and also novel methods of using
the known, but previously unassociated, SNPs in - methods relating to liver fibrosis
(
e.g., for diagnosing liver fibrosis, etc.). In Tables 1-2, the known SNP is identified
based on the public database in which it has been observed, which is indicated as
one or more of the following SNP types: "dbSNP" = SNP observed in dbSNP, "HGBASE"
= SNP observed in HGBASE, and "HGMD" = SNP observed in the Human Gene Mutation Database
(HGMD).
[0054] Particular SNP alleles described herein can be associated with either an increased
risk of having or developing liver fibrosis and relate pathologies, or a decreased
risk of having or developing liver fibrosis. SNP alleles that are associated with
a decreased risk of having or developing liver fibrosis may be referred to as "protective"
alleles, and SNP alleles that are associated with an increased risk of having or developing
liver fibrosis may be referred to as "susceptibility" alleles, "risk" alleles, or
"risk factors". Thus, whereas certain SNPs (or their encoded products) can be assayed
to determine whether an individual possesses a SNP allele that is indicative of an
increased risk of having or developing liver fibrosis (
i.e., a susceptibility allele), other SNPs (or their encoded products) can be assayed
to determine whether an individual possesses a SNP allele that is indicative of a
decreased risk of having or developing liver fibrosis (
i.e., a protective allele). Similarly, particular SNP alleles described herein can be
associated with either an increased or decreased likelihood of responding to a particular
treatment or therapeutic compound, or an increased or decreased likelihood of experiencing
toxic effects from a particular treatment or therapeutic compound. The term "altered"
may be used herein to encompass either of these two possibilities (
e.g., an increased or a decreased risk/likelihood).
[0055] Those skilled in the art will readily recognize that nucleic acid molecules may be
double-stranded molecules and that reference to a particular site on one strand refers,
as well, to the corresponding site on a complementary strand. In defining a SNP position,
SNP allele, or nucleotide sequence, reference to an adenine, a thymine (uridine),
a cytosine, or a guanine at a particular site on one strand of a nucleic acid molecule
also defines the thymine (uridine), adenine, guanine, or cytosine (respectively) at
the corresponding site on a complementary strand of the nucleic acid molecule. Thus,
reference may be made to either strand in order to refer to a particular SNP position,
SNP allele, or nucleotide sequence. Probes and primers, may be designed to hybridize
to either strand and SNP genotyping methods disclosed herein may generally target
either strand. Throughout the specification, in identifying a SNP position, reference
is generally made to the protein-encoding strand, only for the purpose of convenience.
[0056] For reference only, references to variant peptides, polypeptides, or proteins include
peptides, polypeptides, proteins, or fragments thereof, that contain at least one
amino acid residue that differs from the corresponding amino acid sequence of the
art-known peptide/polypeptide/protein (the art-known protein may be interchangeably
referred to as the "wild-type", "reference", or "normal" protein). Such variant peptides/polypeptides/proteins
can result from a codon change caused by a nonsynonymous nucleotide substitution at
a protein-coding SNP position (
i.e., a missense mutation) . Variant peptides/polypeptides/proteins can also result from
a nonsense mutation,
i.e., a SNP that creates a premature stop codon, a SNP that generates a read-through
mutation by abolishing a stop codon, or due to any SNP disclosed herein that otherwise
alters the structure, function/activity, or expression of a protein, such as a SNP
in a regulatory region (
e.g. a promoter or enhancer) or a SNP that leads to alternative or defective splicing,
such as a SNP in an intron or a SNP at an exon/intron boundary. As used herein the
terms "polypeptide", "peptide", and "protein" are used interchangeably.
ISOLATED NUCLEIC ACID MOLECULES AND SNP DETECTION REAGENTS & KITS
[0057] Tables 1 and 2 provide a variety of information about the SNP used in the method
SNP of the present invention that is associated with liver fibrosis, including the
transcript sequences (SEQ ID NOS 116-119:), genomic sequences (SEQ ID NO : 5049),
and protein sequences (SEQ ID NOS:199, 377-380, 342, 359, 399) of the encoded gene
products (with the SNPs indicated by IUB codes in the nucleic acid sequences). In
addition, Tables 1 and 2 include SNP context sequences, which generally include 100
nucleotide upstream (5') plus 100 nucleotides downstream (3') of each SNP position
(SEQ ID NOS:2082, 2134, 2185, 223 correspond to transcript-based SNP context sequences
disclosed in Table 1, and SEQ ID NO:18973 correspond to genomic-based context sequences
disclosed in Table 2), the alternative nucleotides (alleles) at each SNP position,
and additional information about the variant where relevant, such as SNP type (coding,
missense, splice site, UTR, etc.), human populations in which the SNP was observed,
observed allele frequencies, information about the encoded protein, etc.
Isolated Nucleic Acid Molecules
[0058] The present invention provides the use of isolated nucleic acid molecules that contain
the SNP disclosed Table 1 and Table 2. in the method of the present invention . Isolated
nucleic acid molecules containing the SNPs disclosed herein may be interchangeably
referred to throughout the present text as "SNP-containing nucleic acid molecules".
Isolated nucleic acid molecules may optionally encode a full-length variant protein
or fragment thereof. The isolated nucleic acid molecules described herein also include
probes and primers (which are described in greater detail below in the section entitled
"SNP Detection Reagents"), which may be used for assaying the disclosed SNPs, and
isolated full-length genes, transcripts, cDNA molecules, and fragments thereof, which
may be used for such purposes as expressing an encoded protein.
[0059] As used herein, an "isolated nucleic acid molecule" generally is one that contains
a SNP described or one that hybridizes to such molecule such as a nucleic acid with
a complementary sequence, and is separated from most other nucleic acids present in
the natural source of the nucleic acid molecule. Moreover, an "isolated" nucleic acid
molecule, such as a cDNA molecule containing a SNP as used in the method of the present
invention, can be substantially free of other cellular material, or culture medium
when produced by recombinant techniques, or chemical precursors, or other chemicals
when chemically synthesized. A nucleic acid molecule can be fused to other coding
or regulatory sequences and still be considered "isolated". Nucleic acid molecules
present in non-human transgenic animals, which do not naturally occur in the animal,
are also considered "isolated". For example, recombinant DNA molecules contained in
a vector are considered "isolated". Further examples of "isolated" DNA molecules include
recombinant DNA molecules maintained in heterologous host cells, and purified (partially
or substantially) DNA molecules in solution. Isolated RNA molecules include in vivo
or in vitro RNA transcripts of the isolated SNP-containing DNA molecules described
herein. Isolated nucleic acid molecules described herein further include such molecules
produced synthetically.
[0060] Generally, an isolated SNP-containing nucleic acid molecule comprises one or more
SNP positions disclosed herein with flanking nucleotide sequences on either side of
the SNP positions. A flanking sequence can include nucleotide residues that are naturally
associated with the SNP site and/or heterologous nucleotide sequences. Preferably
the flanking sequence is up to about 500, 300,100, 60, 50, 30, 25, 20, 15,10, 8, or
4 nucleotides (or any other length in-between) on either side of a SNP position, or
as long as the full-length gene or entire protein-coding sequence (or any portion
thereof such as an exon), especially if the SNP-containing nucleic acid molecule is
to be used to produce a protein or protein fragment.
[0061] For full-length genes and entire protein-coding sequences, a SNP flanking sequence
can be, for example, up to about 5KB, 4KB, 3KB, 2KB, 1KB on either side of the SNP.
Furthermore, in such instances, the isolated nucleic acid molecule comprises exonic
sequences (including protein-coding and/or non-coding exonic sequences), but may also
include intronic sequences. Thus, any protein coding sequence may be either contiguous
or separated by introns. The important point is that the nucleic acid is isolated
from remote and unimportant flanking sequences and is of appropriate length such that
it can be subjected to the specific manipulations or uses described herein such as
recombinant protein expression, preparation of probes and primers for assaying the
SNP position, and other uses specific to the SNP-containing nucleic acid sequences.
[0062] An isolated SNP-containing nucleic acid molecule can comprise, for example, a full-length
gene or transcript, such as a gene isolated from genomic DNA (
e.g., by cloning or PCR amplification), a cDNA molecule, or an mRNA transcript molecule.
Polymorphic transcript sequences are provided in Table 1 and in the Sequence Listing
(SEQ ID NOS: 1-261), and polymorphic genomic sequences are provided in Table 2 and
in the Sequence Listing (SEQ ID NOS:4999-5321). Furthermore, the use of fragments
of such full-length genes and transcripts that contain the SNP of SEQ ID NO:18973
in the method of the present invention are also encompassed by the present invention,
and such fragments may be used, for example, to express any part of a protein, such
as a particular functional domain or an antigenic epitope.
[0063] Thus, the present invention also encompasses the use of fragments of the nucleic
acid sequences provided in Tables 1-2 (transcript sequences are provided in Table
1 as SEQ ID NOS:116-119, genomic sequences are provided in Table 2 as SEQ ID NO: 5049,
transcript-based SNP context sequences are provided in Table 1 as SEQ ID NO:2082,
2134, 2185, 2237, and genomic-based SNP context sequences are provided in Table 2.
as SEQ ID NO: 18973) and their complements in the method of the present invention.
A fragment typically comprises a contiguous nucleotide sequence at least about 8 or
more nucleotides, more preferably at least about 12 or more nucleotides, and even
more preferably at least about 16 or more nucleotides. Further, a fragment could comprise
at least about 18, 20, 22, 25, 30, 40, 50, 60, 80,100, 150, 200, 250 or 500 (or any
other number in-between) nucleotides in length. The length of the fragment will be
based on its intended use. For example, the fragment can encode epitope-bearing regions
of a variant peptide or regions of a variant peptide that differ from the normal/wild-type
protein, or can be useful as a polynucleotide probe or primer. Such fragments can
be isolated using the nucleotide sequences provided in Table 1 and/or Table 2 for
the synthesis of a polynucleotide probe. A labeled probe can then be used, for example,
to screen a cDNA library, genomic DNA library, or mRNA to isolate nucleic acid corresponding
to the coding region. Further, primers can be used in amplification reactions, such
as for purposes of assaying one or more SNPs sites or for cloning specific regions
of a gene.
[0064] An isolated nucleic acid molecule as used in the method of the present invention
further encompasses a SNP-containing polynucleotide that is the product of any one
of a variety of nucleic acid amplification methods, which are used to increase the
copy numbers of a polynucleotide of interest in a nucleic acid sample. Such amplification
methods are well known in the art, and they include but are not limited to, polymerase
chain reaction (PCR) (
U.S. Patent Nos. 4,683,195; and
4,683,202;
PCR Technology: Principles and Applications for DNA Amplification, ed. H.A. Erlich,
Freeman Press, NY, NY, 1992), ligase chain reaction (LCR) (
Wu and Wallace, Genomics 4:560, 1989;
Landegren et al., Science 241:1077, 1988), strand displacement amplification (SDA) (
U.S. Patent Nos. 5,270,184; and
5,422,252), transcription-mediated amplification (TMA) (
U.S. Patent No. 5,399,491), linked linear amplification (LLA) (
U.S. Patent No. 6,027,923), and the like, and isothermal amplification methods such as nucleic acid sequence
based amplification (NASBA), and self-sustained sequence replication (
Guatelli et al., Proc. Natl. Acad. Sci. USA 87: 1874, 1990). Based on such methodologies, a person skilled in the art can readily design primers
in any suitable regions 5' and 3' to a SNP disclosed herein. Such primers may be used
to amplify DNA of any length so long that it contains the SNP of interest in its sequence.
[0065] As used herein, an "amplified polynucleotide" is a SNP-containing nucleic acid molecule
whose amount has been increased at least two fold by any nucleic acid amplification
method performed
in vitro as compared to its starting amount in a test sample. In other preferred embodiments,
an amplified polynucleotide is the result of at least ten fold, fifty fold, one hundred
fold, one thousand fold, or even ten thousand fold increase as compared to its starting
amount in a test sample. In a typical PCR amplification, a polynucleotide of interest
is often amplified at least fifty thousand fold in amount over the unamplified genomic
DNA, but the precise amount of amplification needed for an assay depends on the sensitivity
of the subsequent detection method used.
[0066] Generally, an amplified polynucleotide is at least about 16 nucleotides in length.
More typically, an amplified polynucleotide is at least about 20 nucleotides in length.
In a preferred embodiment, an amplified polynucleotide is at least about 30 nucleotides
in length. In a more preferred embodiment, an amplified polynucleotide is at least
about 32, 40, 45, 50, or 60 nucleotides in length. In yet another preferred embodiment,
an amplified polynucleotide is at least about 100, 200, 300, 400, or 500 nucleotides
in length. While the total length of an amplified polynucleotide described herein
can be as long as an exon, an intron or the entire gene where the SNP of interest
resides, an amplified product is typically up to about 1,000 nucleotides in length
(although certain amplification methods may generate amplified products greater than
1000 nucleotides in length). More preferably, an amplified polynucleotide is not greater
than about 600-700 nucleotides in length. It is understood that irrespective of the
length of an amplified polynucleotide, a SNP of interest may be located anywhere along
its sequence.
[0067] In a specific embodiment the amplified product is at least about 201 nucleotides
in length, comprises one of the transcript-based context sequences or the genomic-based
context sequences shown in Tables 1-2. Such a product may have additional sequences
on its 5' end or 3' end or both. In another embodiment, the amplified product is about
101 nucleotides in length, and it contains a SNP disclosed herein. Preferably, the
SNP is located at the middle of the amplified product (e.g., at position 101 in an
amplified product that is 201 nucleotides in length, or at position 51 in an amplified
product that is 101 nucleotides in length), or within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
12, 15, or 20 nucleotides from the middle of the amplified product (however, as indicated
above, the SNP of interest may be located anywhere along the length of the amplified
product).
[0068] The present invention provides the use of an isolated nucleic acid molecules that
comprise, consist of, or consist essentially of one or more polynucleotide sequences
that contain one or more SNPs disclosed herein, complements thereof, and SNP-containing
fragments thereof in the method of the present invention.
[0069] Accordingly, the present invention provides the use of nucleic acid molecules that
consist of any of the nucleotide sequences shown in Table 1 and/or Table 2 (transcript
sequences are provided in Table 1 as SEQ ID NOS: 116-119, genomic sequences are provided
in Table 2 as SEQ ID NO:5049, transcript-based SNP context sequences are provided
in Table 1 as SEQ ID NO.2082, 2134, 2185, 2237, and genomic-based SNP context sequences
are provided in Table 2 as SEQ ID NO:18973), or any nucleic acid molecule that encodes
any of the variant 377-380, 342, 359, 399) in the method of the present invention.
proteins provided in Table 1 (SEQ ID NOS:). A nucleic acid molecule consists of a
nucleotide sequence when the nucleotide sequence is the complete nucleotide sequence
of the nucleic acid molecule.
[0070] The present invention further provides the use of nucleic acid molecules that consist
essentially of any of the nucleotide sequences shown in Table 1 and/or Table 2 (transcript
sequences are provided in Table 1 as SEQ ID NOS :116-119, genomic sequences are provided
in Table 2 as SEQ ID NOS: 5049, transcript-based SNP context sequences are provided
in Table 1 as SEQ ID NO: 2082, 2184, 2185, 2237, and genomic-based SNP context sequences
are provided in Table 2 as SEQ ID NO: 18973), or any nucleic acid molecule that encodes
any of the variant proteins provided in Table 1 (SEQ ID NOS: 199, 377-380, 342, 359,
399) in the method of the present invention. A nucleic acid molecule consists essentially
of a nucleotide sequence when such a nucleotide sequence is present with only a few
additional nucleotide residues in the final nucleic acid molecule.
[0071] The present invention further provides the use of nucleic acid molecules that comprise
any of the nucleotide sequences shown in Table 1 and/or Table 2 or a SNP-containing
fragment thereof (transcript sequences are provided in Table 1 as SEQ ID NOS: 116-119,
genomic sequences are provided in Table 2 as SEQ ID NO:5049, transcript-based SNP
context sequences are provided in Table 1 as SEQ ID NO: 2082, 2184, 2185, 2237, and
genomic-based SNP context sequences are provided in Table 2 as SEQ ID NO. 18973),
or any nucleic acid molecule that encodes any of the variant proteins provided in
Table 1 (SEQ ID NOS:199, 377-380, 342, 359, 399 in the method of the present invention.
A nucleic acid molecule comprises a nucleotide sequence when the nucleotide sequence
is at least part of the final nucleotide sequence of the nucleic acid molecule. In
such a fashion, the nucleic acid molecule can be only the nucleotide sequence or have
additional nucleotide residues, such as residues that are naturally associated with
it or heterologous nucleotide sequences. Such a nucleic acid molecule can have one
to a few additional nucleotides or can comprise many more additional nucleotides.
A brief description of how various types of these nucleic acid molecules can be readily
made and isolated is provided below, and such techniques are well known to those of
ordinary skill in the art (
Sambrook and Russell, 2000, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Press, NY).
[0072] The isolated nucleic acid molecules can encode mature proteins plus additional amino
or carboxyl-terminal amino acids or both, or amino acids interior to the mature peptide
(when the mature form has more than one peptide chain, for instance). Such sequences
may play a role in processing of a protein from precursor to a mature form, facilitate
protein trafficking, prolong or shorten protein half-life, or facilitate manipulation
of a protein for assay or production. As generally is the case
in situ, the additional amino acids may be processed away from the mature protein by cellular
enzymes.
[0073] Thus, the isolated nucleic acid molecules include, but are not limited to, nucleic
acid molecule having a sequence encoding a peptide alone, a sequence encoding a mature
peptide and additional coding sequences such as a leader or secretory sequence (
e.g., a pre-pro or pro-protein sequence), a sequence encoding a mature peptide with or
without additional coding sequences, plus additional non-coding sequences, for example
introns and non-coding 5' and 3' sequences such as transcribed but untranslated sequences
that play a role in, for example, transcription, mRNA processing (including splicing
and polyadenylation signals), ribosome binding, and/or stability of mRNA. In addition,
the nucleic acid molecules may be fused to heterologous marker sequences encoding,
for example, a peptide that facilitates purification.
[0074] Isolated nucleic acid molecules can be in the form of RNA, such as mRNA, or in the
form DNA, including cDNA and genomic DNA, which may be obtained, for example, by molecular
cloning or produced by chemical synthetic techniques or by a combination thereof (
Sambrook and Russell, 2000, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Press, NY). Furthermore, isolated nucleic acid molecules, particularly SNP detection reagents
such as probes and primers, can also be partially or completely in the form of one
or more types of nucleic acid analogs, such as peptide nucleic acid (PNA) (
U.S. Patent Nos. 5,539,082;
5,527,675;
5,623,049;
5,714,331). The nucleic acid, especially DNA, can be double-stranded or single-stranded. Single-stranded
nucleic acid can be the coding strand (sense strand) or the complementary non-coding
strand (anti-sense strand). DNA, RNA, or PNA segments can be assembled, for example,
from fragments of the human genome (in the case of DNA or RNA) or single nucleotides,
short oligonucleotide linkers, or from a series of oligonucleotides, to provide a
synthetic nucleic acid molecule. Nucleic acid molecules can be readily synthesized
using the sequences provided herein as a reference; oligonucleotide and PNA oligomer
synthesis techniques are well known in the art (see,
e.g., Corey, "Peptide nucleic acids: expanding the scope of nucleic acid recognition", Trends
Biotechnol. 1997 Jun; 15(6):224-9, and
Hyrup et al., "Peptide nucleic acids (PNA): synthesis, properties and potential applications",
Bioorg Med Chem. 1996 Jan;4(1):5-23). Furthermore, large-scale automated oligonucleotide/PNA synthesis (including synthesis
on an array or bead surface or other solid support) can readily be accomplished using
commercially available nucleic acid synthesizers, such as the Applied Biosystems (Foster
City, CA) 3900 High-Throughput DNA Synthesizer or Expedite 8909 Nucleic Acid Synthesis
System, and the sequence information provided herein.
[0075] Described herein are nucleic acid analogs that contain modified, synthetic, or non-naturally
occurring nucleotides or structural elements or other alternative/modified nucleic
acid chemistries known in the art. Such nucleic acid analogs are useful, for example,
as detection reagents (e.g., primers/probes) for detecting the SNPs identified in
Table 1 and/or Table 2. Furthermore, kits/systems (such as beads, arrays, etc.) that
include these analogs are also described herein. For example, PNA oligomers that are
based on the polymorphic sequences disclosed herein are specifically contemplated.
PNA oligomers are analogs of DNA in which the phosphate backbone is replaced with
a peptide-like backbone (
Lagriffoul et al., Bioorganic & Medicinal Chemistry Letters, 4: 1081-1082 (1994),
Petersen et al., Bioorganic & Medicinal Chemistry Letters, 6: 793-796 (1996),
Kumar et al., Organic Letters 3(9): 1269-1272 (2001),
WO96/04000). PNA hybridizes to complementary RNA or DNA with higher affinity and specificity
than conventional oligonucleotides and oligonucleotide analogs. The properties of
PNA enable novel molecular biology and biochemistry applications unachievable with
traditional oligonucleotides and peptides;
[0076] Additional examples of nucleic acid modifications that improve the binding properties
and/or stability of a nucleic acid include the use of base analogs such as inosine,
intercalators (
U.S. Patent No. 4,835,263) and the minor groove binders (
U.S. Patent No. 5,801,115). Thus, references herein to nucleic acid molecules, SNP-containing nucleic acid
molecules, SNP detection reagents
(e.g., probes and primers), oligonucleotides/polynucleotides include PNA oligomers and other
nucleic acid analogs. Other examples of nucleic acid analogs and alternative/modified
nucleic acid chemistries known in the art are described in
Current Protocols in Nucleic Acid Chemistry, John Wiley & Sons, N.Y. (2002).
[0077] Described herein are nucleic acid molecules that encode fragments of the variant
polypeptides disclosed herein as well as nucleic acid molecules that encode obvious
variants of such variant polypeptides. Such nucleic acid molecules may be naturally
occurring, such as paralogs (different locus) and orthologs (different organism),
or may be constructed by recombinant DNA methods or by chemical synthesis. Non-naturally
occurring variants may be made by mutagenesis techniques, including those applied
to nucleic acid molecules, cells, or organisms. Accordingly, the variants can contain
nucleotide substitutions, deletions, inversions and insertions (in addition to the
SNP disclosed in Tables 1-2). Variation can occur in either or both the coding and
non-coding regions. The variations can produce conservative and/or non-conservative
amino acid substitutions.
[0078] Further variants of the nucleic acid molecules disclosed in Tables 1-2, such as naturally
occurring allelic variants (as well as orthologs and paralogs) and synthetic variants
produced by mutagenesis techniques, can be identified and/or produced using methods
well known in the art. Such further variants can comprise a nucleotide sequence that
shares at least 70-80%, 80-85%, 85-90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or
99% sequence identity with a nucleic acid sequence disclosed in Table 1 and/or Table
2 (or a fragment thereof) and that includes the SNP allele disclosed in Table 1 and/or
Table 2. Further, variants can comprise a nucleotide sequence that encodes a polypeptide
that shares at least 70-80%, 80-85%, 85-90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%,
or 99% sequence identity with a polypeptide sequence disclosed in Table 1 (or a fragment
thereof) and that includes the novel SNP allele disclosed in Table 1 and/or Table
2. Thus, an aspect of the present invention that is specifically contemplated is the
use of isolated nucleic acid molecules that have a certain degree of sequence variation
compared with the sequences shown in Tables 1-2, but that contain the SNP allele disclosed
herein in the method of the present invention. In other words, as long as an isolated
nucleic acid molecule contains a novel SNP allele disclosed herein, other portions
of the nucleic acid molecule that flank the novel SNP allele can vary to some degree
from the specific transcript, genomic, and context sequences shown in Tables 1-2,
and can encode a polypeptide that varies to some degree from the specific polypeptide
sequences shown in Table 1.
[0079] To determine the percent identity of two amino acid sequences or two nucleotide sequences
of two molecules that share sequence homology, the sequences are aligned for optimal
comparison purposes (
e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic
acid sequence for optimal alignment and non-homologous sequences can be disregarded
for comparison purposes). In a preferred embodiment, at least 30%, 40%, 50%, 60%,
70%, 80%, or 90% or more of the length of a reference sequence is aligned for comparison
purposes. The amino acid residues or nucleotides at corresponding amino acid positions
or nucleotide positions are then compared. When a position in the first sequence is
occupied by the same amino acid residue or nucleotide as the corresponding position
in the second sequence, then the molecules are identical at that position (as used
herein, amino acid or nucleic acid "identity" is equivalent to amino acid or nucleic
acid "homology"). The percent identity between the two sequences is a function of
the number of identical positions shared by the sequences, taking into account the
number of gaps, and the length of each gap, which need to be introduced for optimal
alignment of the two sequences.
[0080] The comparison of sequences and determination of percent identity between two sequences
can be accomplished using a mathematical algorithm.
(Computational Molecular Biology, Lesk, A.M., ed., Oxford University Press, New York,
1988;
Biocomputing: Informatics and Genome Projects, Smith, D.W., ed., Academic Press, New
York,1993;
Computer Analysis of Sequence Data, Part 1, Griffin, A.M., and Griffin, H.G., eds.,
Humana Press, New Jersey, 1994;
Sequence Analysis in Molecular Biology, von Heinje, G, Academic Press, 1987; and
Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New
York, 1991). In a preferred embodiment, the percent identity between two amino acid sequences
is determined using the
Needleman and Wunsch algorithm (J. Mol. Biol. (48):444-453 (1970)) which has been incorporated into the GAP program in the GCG software package, using
either a Blossom 62 matrix or a PAM250 matrix, and a gap weight of 16,14, 12, 10,
8, 6, or 4 and a length weight of 1, 2,3,4,5, or 6.
[0081] In yet another preferred embodiment, the percent identity between two nucleotide
sequences is determined using the GAP program in the GCG software package (
Devereux, J., et al., Nucleic Acids Res. -12(1):387 (1984)), using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length
weight of 1, 2, 3, 4, 5, or 6. In another embodiment, the percent identity between
two amino acid or nucleotide sequences is determined using the algorithm of
E. Myers and W. Miller (CABIOS, 4:11-17 (1989)) which has been incorporated into the ALIGN program (version 2.0), using a PAM120
weight residue table, a gap length penalty of 12, and a gap penalty of 4.
[0082] The nucleotide and amino acid sequences described herein can further be used as a
"query sequence" to perform a search against sequence databases to, for example, identify
other family members or related sequences. Such searches can be performed using the
NBLAST and XBLAST programs (version 2.0) of
Altschul, et al. (J. Mol. Biol. 215:403-10 (1990)). BLAST nucleotide searches can be performed with the NBLAST program, score = 100,
wordlength =12 to obtain nucleotide sequences homologous to the nucleic acid molecules
described herein. BLAST protein searches can be performed with the XBLAST program,
score = 50, wordlength = 3 to obtain amino acid sequences homologous to the proteins
of the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST
can be utilized as described in
Altschul et al. (Nucleic Acids Res. 25(17):3389-3402 (1997)). When utilizing BLAST and gapped BLAST programs, the default parameters of the
respective programs (e.g., XBLAST and NBLAST) can be used. In addition to BLAST, examples
of other search and sequence comparison programs used in the art include, but are
not limited to, FASTA (
Pearson, Methods Mol. Biol. 25, 365-389 (1994)) and KERR (
Dufresne et al., Nat Biotechnol 2002 Dec;20(12):1269-71). For further information regarding bioinformatics techniques, see
Current Protocols in Bioinformatics, John Wiley & Sons, Inc., N.Y.
[0083] For reference only, described herein are non-coding fragments of the nucleic acid
molecules disclosed in Table 1 and/or Table 2. Preferred non-coding fragments include,
but are not limited to, promoter sequences, enhancer sequences, intronic sequences,
5' untranslated regions (UTRs), 3' untranslated regions, gene modulating sequences
and gene termination sequences. Such fragments are useful, for example, in controlling
heterologous gene expression and in developing screens to identify gene-modulating
agents.
SNP Detection Reagents
[0084] In a specific aspect of the present invention, the SNP disclosed in Table 1 and/or
Table 2, and their associated transcript sequences (provided in Table 1 as SEQ ID
NOS: 116-119), genomic sequences (provided in Table 2 as SEQ ID NO: 5049), and context
sequences (transcript-based context sequences are provided in Table 1 as SEQ ID NOS:
2082, 2134, 2185, 2237; genomic-based context sequences are provided in Table 2 as
SEQ ID NO:18973 ), can be used for the design of SNP detection reagents. As used herein,
a "SNP detection reagent" is a reagent that specifically detects a specific target
SNP position disclosed herein, and that is preferably specific for a particular nucleotide
(allele) of the target SNP position (
i.e., the detection reagent preferably can differentiate between different alternative
nucleotides at a target SNP position, thereby allowing the identity of the nucleotide
present at the target SNP position to be determined). Typically, such detection reagent
hybridizes to a target SNP-containing nucleic acid molecule by complementary base-pairing
in a sequence specific manner, and discriminates the target variant sequence from
other nucleic acid sequences such as an art-known form in a test sample. An example
of a detection reagent is a probe that hybridizes to a target nucleic acid containing
the SNP provided in Table 1 and/or Table 2. In a preferred embodiment, such a probe
can differentiate between nucleic acids having a particular nucleotide (allele) at
a target SNP position from other nucleic acids that have a different nucleotide at
the same target SNP position. In addition, a detection reagent may hybridize to a
specific region 5' and/or 3' to a SNP position, particularly a region corresponding
to the context sequences provided in Table 1 and/or Table 2 (transcript-based context
sequences are provided in Table 1 as SEQ ID NOS:2082, 2134, 2185 2237; genomic-based
context sequences are provided in Table 2 as SEQ ID NO: 18973). Another example of
a detection reagent is a primer which acts as an initiation point of nucleotide extension
along a complementary strand of a target polynucleotide. The SNP sequence information
provided herein is also useful for designing primers,
e.g. allele-specific primers, to amplify (
e.g., using PCR) any SNP disclosed herein
[0085] In one preferred embodiment a SNP detection reagent is an isolated or synthetic DNA
or RNA polynucleotide probe or primer or PNA oligomer, or a combination of DNA, RNA
and/or PNA, that hybridizes to a segment of a target nucleic acid molecule containing
a SNP identified in Table 1 and/or Table 2. A detection reagent in the form of a polynucleotide
may optionally contain modified base analogs, intercalators or minor groove binders.
Multiple detection reagents such as probes may be, for example, affixed to a solid
support (
e.g., arrays or beads) or supplied in solution (
e.g., probe/primer sets for enzymatic reactions such as PCR, RT-PCR, TaqMan assays, or
primer-extension reactions) to form a SNP detection kit.
[0086] A probe or primer typically is a substantially purified oligonucleotide or PNA oligomer.
Such oligonucleotide typically comprises a region of complementary nucleotide sequence
that hybridizes under stringent conditions to at least about 8,10, 12,16, 18, 20,
22, 25, 30, 40, 50, 55, 60, 65, 70, 80, 90, 100, 120 (or any other number in-between)
or more consecutive nucleotides in a target nucleic acid molecule. Depending on the
particular assay, the consecutive nucleotides can either include the target SNP position,
or be a specific region in close enough proximity 5' and/or 3' to the SNP position
to carry out the desired assay.
[0087] Other preferred primer and probe sequences can readily be determined using the transcript
sequences (SEQ ID NOS: 116,119), genomic sequences (SEQ ID NO:-5049 ), and SNP context
sequences (transcript-based context sequences are provided in Table 1 as SEQ ID NOS:
2082, 2134, 2185, 2237; genomic-based context sequences are provided in Table 2 as
SEQ ID NO: 18973) disclosed in Tables 1-2. It will be apparent to one of skill in
the art that such primers and probes are directly useful as reagents for genotyping
the SNPs disclosed herein, and can be incorporated into any kit/system format.
[0088] In order to produce a probe or primer specific for a target SNP-containing sequence,
the gene/transcript and/or context sequence surrounding the SNP of interest is typically
examined using a computer algorithm which starts at the 5' or at the 3' end of the
nucleotide sequence. Typical algorithms will then identify oligomers of defined length
that are unique to the gene/SNP context sequence, have a GC content within a range
suitable for hybridization, lack predicted secondary structure that may interfere
with hybridization, and/or possess other desired characteristics or that lack other
undesired characteristics.
[0089] A primer or probe as used in the method of the present invention is typically at
least about 8 nucleotides in length. In one embodiment of the invention, a primer
or a probe is at least about 10 nucleotides in length. In a preferred embodiment,
a primer or a probe is at least about 12 nucleotides in length. In a more preferred
embodiment, a primer or probe is at least about 16, 17, 18, 19, 20, 21, 22, 23, 24
or 25 nucleotides in length. While the maximal length of a probe can be as long as
the target sequence to be detected, depending on the type of assay in which it is
employed, it is typically less than about 50, 60, 65, or 70 nucleotides in length.
In the case of a primer, it is typically less than about 30 nucleotides in length.
In a specific preferred embodiment of the invention, a primer or a probe is within
the length of about 18 and about 28 nucleotides. However, in other embodiments, such
as nucleic acid arrays and other embodiments in which probes are affixed to a substrate,
the probes can be longer, such as on the order of 30-70, 75, 80, 90, 100, or more
nucleotides in length (see the section below entitled "SNP Detection Kits and Systems").
[0090] For analyzing SNPs, it may be appropriate to use oligonucleotides specific for alternative
SNP alleles. Such oligonucleotides which detect single nucleotide variations in target
sequences may be referred to by such terms as "allele-specific oligonucleotides",
"allele-specific probes", or "allele-specific primers". The design and use of allele-specific
probes for analyzing polymorphisms is described in,
e.g., Mutation Detection A Practical Approach, ed. Cotton et al. Oxford University Press,
1998;
Saiki et al., Nature 324, 163-166 (1986);
Dattagupta, EP235,726; and
Saiki, WO 89/11548.
[0091] While the design of each allele-specific primer or probe depends on variables such
as the precise composition of the nucleotide sequences flanking a SNP position in
a target nucleic acid molecule, and the length of the primer or probe, another factor
in the use of primers and probes is the stringency of the condition under which the
hybridization between the probe or primer and the target sequence is performed. Higher
stringency conditions utilize buffers with lower ionic strength and/or a higher reaction
temperature, and tend to require a more perfect match between probe/primer and a target
sequence in order to form a stable duplex. If the stringency is too high, however,
hybridization may not occur at all. In contrast, lower stringency conditions utilize
buffers with higher ionic strength and/or a lower reaction temperature, and permit
the formation of stable duplexes with more mismatched bases between a probe/primer
and a target sequence. By way of example and not limitation, exemplary conditions
for high stringency hybridization conditions using an allele-specific probe are as
follows: Prehybridization with a solution containing 5X standard saline phosphate
EDTA (SSPE), 0.5% NaDodSO
4 (SDS) at 55°C, and incubating probe with target nucleic acid molecules in the same
solution at the same temperature, followed by washing with a solution containing 2X
SSPE, and 0.1%SDS at 55°C or room temperature.
[0092] Moderate stringency hybridization conditions may be used for allele-specific primer
extension reactions with a solution containing, e.g., about 50mM KCl at about 46°C.
Alternatively, the reaction may be carried out at an elevated temperature such as
60°C. In another embodiment, a moderately stringent hybridization condition suitable
for oligonucleotide ligation assay (OLA) reactions wherein two probes are ligated
if they are completely complementary to the target sequence may utilize a solution
of about 100mM KCl at a temperature of 46°C.
[0093] In a hybridization-based assay, allele-specific probes can be designed that hybridize
to a segment of target DNA from one individual but do not hybridize to the corresponding
segment from another individual due to the presence of different polymorphic forms
(
e.g., alternative SNP alleles/nucleotides) in the respective DNA segments from the two
individuals. Hybridization conditions should be sufficiently stringent that there
is a significant detectable difference in hybridization intensity between alleles,
and preferably an essentially binary response, whereby a probe hybridizes to only
one of the alleles or significantly more strongly to one allele. While a probe may
be designed to hybridize to a target sequence that contains a SNP site such that the
SNP site aligns anywhere along the sequence of the probe, the probe is preferably
designed to hybridize to a segment of the target sequence such that the SNP site aligns
with a central position of the probe (
e.g., a position within the probe that is at least three nucleotides from either end
of the probe). This design of probe generally achieves good discrimination in hybridization
between different allelic forms.
[0094] In another embodiment, a probe or primer may be designed to hybridize to a segment
of target DNA such that the SNP aligns with either the 5' most end or the 3' most
end of the probe or primer. In a specific preferred embodiment which is particularly
suitable for use in a oligonucleotide ligation assay (
U.S. Patent No. 4,988,617), the 3'most nucleotide of the probe aligns with the SNP position in the target sequence.
[0095] Oligonucleotide, probes and primers may be prepared by methods well known in the
art. Chemical synthetic methods include, but are limited to, the phosphotriester method
described by
Narang et al., 1979, Methods in Enzymology 68:90; the phosphodiester method described by
Brown et al., 1979, Methods in Enzymology 68:109, the diethylphosphoamidate method described by
Beaucage et al., 1981, Tetrahedron Letters 22:1859; and the solid support method described in
U.S. Patent No. 4,458,066.
[0096] Allele-specific probes are often used in pairs (or, less commonly, in sets of 3 or
4, such as if a SNP position is known to have 3 or 4 alleles, respectively, or to
assay both strands of a nucleic acid molecule for a target SNP allele), and such pairs
may be identical except for a one nucleotide mismatch that represents the allelic
variants at the SNP position. Commonly, one member of a pair perfectly matches a reference
form of a target sequence that has a more common SNP allele (
i.e., the allele that is more frequent in the target population) and the other member of
the pair perfectly matches a form of the target sequence that has a less common SNP
allele (
i.e., the allele that is rarer in the target population). In the case of an array, multiple
pairs of probes can be immobilized on the same support for simultaneous analysis of
multiple different polymorphisms.
[0097] In one type of PCR-based assay, an allele-specific primer hybridizes to a region
on a target nucleic acid molecule that overlaps a SNP position and only primes amplification
of an allelic form to which the primer exhibits perfect complementarity (
Gibbs, 1989, Nucleic Acid Res. 17 2427-2448). Typically, the primer's 3'-most nucleotide is aligned with and complementary to
the SNP position of the target nucleic acid molecule. This primer is used in conjunction
with a second primer that hybridizes at a distal site. Amplification proceeds from
the two primers, producing a detectable product that indicates which allelic form
is present in the test sample. A control is usually performed with a second pair of
primers, one of which shows a single base mismatch at the polymorphic site and the
other of which exhibits perfect complementarity to a distal site. The single-base
mismatch prevents amplification or substantially reduces amplification efficiency,
so that either no detectable product is formed or it is formed in lower amounts or
at a slower pace. The method generally works most effectively when the mismatch is
at the 3'-most position of the oligonucleotide (
i.e., the 3'-most position of the oligonucleotide aligns with the target SNP position)
because this position is most destabilizing to elongation from the primer (see,
e.g.,
WO 93/22456). This PCR-based assay can be utilized as part of the TaqMan assay, described below.
[0098] In a specific embodiment as used in the method, a primer of the invention contains
a sequence substantially complementary to a segment of a target SNP-containing nucleic
acid molecule except that the primer has a mismatched nucleotide in one of the three
nucleotide positions at the 3'-most end of the primer, such that the mismatched nucleotide
does not base pair with a particular allele at the SNP site. In a preferred embodiment;
the mismatched nucleotide in the primer is the second from the last nucleotide at
the 3'-most position of the primer. In a more preferred embodiment, the mismatched
nucleotide in the primer is the last nucleotide at the 3'-most position of the primer.
[0099] In another embodiment , a SNP detection reagent as used in the method of the invention
is labeled with a fluorogenic reporter dye that emits a detectable signal. While the
preferred reporter dye is a fluorescent dye, any reporter dye that can be attached
to a detection reagent such as an oligonucleotide probe or primer is suitable for
use in the invention. Such dyes include, but are not limited to, Acridine, AMCA, BODIPY,
Cascade Blue, Cy2; Cy3, Cy5, Cy7, Dabcyl, Edans, Eosin, Erythrosin, Fluorescein, 6-Fam,
Tet, Joe, Hex, Oregon Green, Rhodamine, Rhodol Green, Tamra, Rox, and Texas Red.
[0100] In yet another embodiment of the invention, the detection reagent may be further
labeled with a quencher dye such as Tamra, especially when the reagent is used as
a self-quenching probe such as a TaqMan (
U.S. Patent Nos. 5,210,015 and
5,538,848) or Molecular Beacon probe (
U.S. Patent Nos. 5,118,801 and
5,312,728), or other stemless or linear beacon probe (
Livak et al., 1995, PCR Method Appl. 4:357-362;
Tyagi, et al., 1996, Nature Biotechnology 14: 303-308;
Nazarenko et al., 1997, Nucl. Acids Res. 25:2516-2521;
U.S. Patent Nos. 5,866,336 and
6,11,7,635).
[0101] The detection reagents as used in the method of the invention may also contain other
labels, including but not limited to, biotin for streptavidin binding, hapten for
antibody binding, and oligonucleotide for binding to another complementary oligonucleotide
such as pairs of zipcodes.
[0102] Described herein are reagents that do not contain (or that are complementary to)
a SNP nucleotide identified herein but that are used to assay one or more SNPs disclosed
herein. For example, primers that flank, but do not hybridize directly to a target
SNP position provided herein are useful in primer extension reactions in which the
primers hybridize to a region adjacent to the target SNP position (
i.e., within one or more nucleotides from the target SNP site). During the primer extension
reaction, a primer is typically not able to extend past a target SNP site if a particular
nucleotide (allele) is present at that target SNP site, and the primer extension product
can be detected in order to determine which SNP allele is present at the target SNP
site. For example, particular ddNTPs are typically used in the primer extension reaction
to terminate primer extension once a ddNTP is incorporated into the extension product
(a primer extension product which includes a ddNTP at the 3'-most end of the primer
extension product, and in which the ddNTP is a nucleotide of a SNP disclosed herein,
is a composition that is described herein). Thus, reagents that bind to a nucleic
acid molecule in a region adjacent to a SNP site and that are used for assaying the
SNP site, even though the bound sequences do not necessarily include the SNP site
itself, are also described herein.
SNP Detection Kits and Systems
[0103] A person skilled in the art will recognize that, based on the SNP and associated
sequence information disclosed herein, detection reagents can be developed and used
to assay any SNP described herein individually or in combination, and such detection
reagents can be readily incorporated into one of the established kit or system formats
which are well known in the art. The terms "kits" and "systems", as used herein in
the context of SNP detection reagents, are intended to refer to such things as combinations
of multiple SNP detection reagents, or one or more SNP detection reagents in combination
with one or more other types of elements or components (
e.g., other types of biochemical reagents, containers, packages such as packaging intended
for commercial sale, substrates to which SNP detection reagents are attached, electronic
hardware components, etc.). Accordingly, the present invention further provides the
use of SNP detection kits and systems, including but not limited to, packaged probe
and primer sets (
e.g., TaqMan probe/primer sets), arrays/microarrays of nucleic acid molecules, and beads
that contain one or more probes, primers, or other detection reagents in the method
of the present invention. The kits/systems can optionally include various electronic
hardware components; for example, arrays ("DNA chips") and microfluidic systems ("lab-on-a-chip"
systems) provided by various manufacturers typically comprise hardware components.
Other kits/systems (
e.g., probe/primer sets) may not include electronic hardware components, but may be comprised
of, for example, one or more SNP detection reagents (along with, optionally, other
biochemical reagents) packaged in one or more containers.
[0104] In some embodiments, a SNP detection kit typically contains one or more detection
reagents and other components (
e.g., a buffer, enzymes such as DNA polymerases or ligases, chain extension nucleotides
such as deoxynucleotide triphosphates, and in the case of Sanger-type DNA sequencing
reactions, chain terminating nucleotides, positive control sequences, negative control
sequences, and the like) necessary to carry out an assay or reaction, such as amplification
and/or detection of a SNP-containing nucleic acid molecule. A kit may further contain
means for determining the amount of a target nucleic acid, and means for comparing
the amount with a standard, and can comprise instructions for using the kit to detect
the SNP-containing nucleic acid molecule of interest. In one embodiment of the present
invention, the use of kits is provided which contain the necessary reagents to carry
out one or more assays to detect the SNP disclosed herein in the method of the present
invention. In a preferred embodiment of the present invention, SNP detection kits/systems
are in the form of nucleic acid arrays, or compartmentalized kits, including microfluidic/lab-on-a-chip
systems.
[0105] SNP detection kits/systems may contain, for example, one or more probes, or pairs
of probes, that hybridize to a nucleic acid molecule at or near each target SNP position.
Multiple pairs of allele-specific probes may be included in the kit/system to simultaneously
assay large numbers of SNPs, at least one of which is a SNP disclosed herein. In some
kits/systems, the allele-specific probes are immobilized to a substrate such as an
array or bead. For example, the same substrate can comprise allele-specific probes
for detecting at least 1; 10; 100; 1000; 10,000; 100,000 (or any other number in-between)
or substantially all of the SNPs described herein.
[0106] The terms "arrays", "microarrays", and "DNA chips" are used herein interchangeably
to refer to an array of distinct polynucleotides affixed to a substrate, such as glass,
plastic, paper, nylon or other type of membrane, filter, chip, or any other suitable
solid support. The polynucleotides can be synthesized directly on the substrate, or
synthesized separate from the substrate and then affixed to the substrate. In one
embodiment, the microarray is prepared and used according to the methods described
in
U.S. Patent No. 5,837,832, Chee et al.,
PCT application W095/11995 (Chee et al.),
Lockhart, D. J. et al. (1996; Nat. Biotech. 14: 1675-1680) and
Schena, M. et al. (1996; Proc. Natl. Acad. Sci. 93: 10614-10619), . In other embodiments, such arrays are produced by the methods described by
Brown et al., U.S. Patent No. 5,807,522.
[0107] Nucleic acid arrays are reviewed in the following references:
Zammatteo et al., "New chips for molecular biology and diagnostics", Biotechnol Annu Rev. 2002;8:85-101; Sosnowski et al., "Active microelectronic array system for DNA hybridization, genotyping
and pharmacogenomic applications,", Psychiatr Genet. 2002 Dec; 12(4):181-92; Heller, "DNA microarray technology: devices, systems, and applications", Annu Rev
Biomed Eng. 2002;4:129-53. Epub 2002 Mar 22; Kolchinsky et al., "Analysis of SNPs and other genomic variations using gel-based
chips", Hum Mutat. 2002 Apr;19(4):343-60; and McGall et al., "High-density genechip oligonucleotide probe arrays", Adv Biochem Eng
Biotechnol. 2002;77:21-42.
[0108] Any number of probes, such as allele-specific probes, may be implemented in an array,
and each probe or pair of probes can hybridize to a different SNP position. In the
case of polynucleotide probes, they can be synthesized at designated areas (or synthesized
separately and then affixed to designated areas) on a substrate using a light-directed
chemical process. Each DNA chip can contain, for example, thousands to millions of
individual synthetic polynucleotide probes arranged in a grid-like pattern and miniaturized
(
e.g., to the size of a dime). Preferably, probes are attached to a solid support in an
ordered, addressable array.
[0109] A microarray can be composed of a large number of unique, single-stranded polynucleotides,
usually either synthetic antisense polynucleotides or fragments of cDNAs, fixed to
a solid support. Typical polynucleotides are preferably about 6-60 nucleotides in
length, more preferably about 15-30 nucleotides in length, and most preferably about
18-25 nucleotides in length. For certain types of microarrays or other detection kits/systems,
it may be preferable to use oligonucleotides that are only about 7-20 nucleotides
in length. In other types of arrays, such as arrays used in conjunction with chemiluminescent
detection technology, preferred probe lengths can be, for example, about 15-80 nucleotides
in length, preferably about 50-70 nucleotides in length, more preferably about 55-65
nucleotides in length, and most preferably about 60 nucleotides in length. The microarray
or detection kit can contain polynucleotides that cover the known 5' or 3' sequence
of a gene/transcript or target SNP site, sequential polynucleotides that cover the
full-length sequence of a gene/transcript; or unique polynucleotides selected from
particular areas along the length of a target gene/transcript sequence, particularly
areas corresponding to the SNP disclosed in Table 1 and/or Table 2. Polynucleotides
used in the microarray or detection kit are specific to a SNP or SNPs of interest
(
e.g., specific to a particular SNP allele at a target SNP site, or specific to particular
SNP alleles at multiple different SNP sites), or specific to a polymorphic gene/transcript
or genes/transcripts of interest.
[0110] Hybridization assays based on polynucleotide arrays rely on the differences in hybridization
stability of the probes to perfectly matched and mismatched target sequence variants.
For SNP genotyping, it is generally preferable that stringency conditions used in
hybridization assays are high enough such that nucleic acid molecules that differ
from one another at as little as a single SNP position can be differentiated (
e.g., typical SNP hybridization assays are designed so that hybridization will occur
only if one particular nucleotide is present at a SNP position, but will not occur
if an alternative nucleotide is present at that SNP position). Such high stringency
conditions may be preferable when using, for example, nucleic acid arrays of allele-specific
probes for SNP detection. Such high stringency.conditions are described in the preceding
section, and are well known to those skilled in the art and can be found in, for example,
Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6.
[0112] In one embodiment of the invention, a nucleic acid array can comprise an array of
probes of about 15-25 nucleotides in length. In further embodiments, a nucleic acid
array can comprise any number of probes, in which at least one probe is capable of
detecting the SNP disclosed in Table 1 and/or Table 2, and/or at least one probe comprises
a fragment of one of the sequences selected from the group consisting of those disclosed
in Table 1, Table 2, the Sequence Listing, and sequences complementary thereto, said
fragment comprising at least about 8 consecutive nucleotides, preferably 10, 12, 15,
16, 18, 20, more preferably 22, 25, 30, 40, 47, 50, 55, 60, 65, 70, 80, 90,100, or
more consecutive nucleotides (or any other number in-between) and containing (or being
complementary to) a novel SNP allele disclosed in Table 1 and/or Table 2. In some
embodiments, the nucleotide complementary to the SNP site is within 5, 4, 3, 2, or
1 nucleotide from the center of the probe, more preferably at the center of said probe.
[0113] A polynucleotide probe can be synthesized on the surface of the substrate by using
a chemical coupling procedure and an ink jet application apparatus, as described in
PCT application W095/251116 (Baldeschweiler et al.) . In another aspect, a "gridded" array analogous to a dot (or slot) blot may be
used to arrange and link cDNA fragments or oligonucleotides to the surface of a substrate
using a vacuum system, thermal, UV, mechanical or chemical bonding procedures. An
array, such as those described above, may be produced by hand or by using available
devices (slot blot or dot blot apparatus), materials (any suitable solid support),
and machines (including robotic instruments), and may contain 8, 24, 96, 384,1536,
6144 or more polynucleotides, or any other number which lends itself to the efficient
use of commercially available instrumentation.
[0114] Using such arrays or other kits/systems the present invention provides methods of
identifying the SNP at position 101 of nucleotide sequence SEQ ID NO:18973 or ist
complement in an individual's nucleic acids in a test sample. Such methods typically
involve incubating a test sample of nucleic acids with an array comprising one or
more probes corresponding to he SNP at position 101 of nucleotide sequence SEQ ID
NO:18973, and assaying for binding of a nucleic acid from the test sample with one
or more of the probes. Conditions for incubating a SNP detection reagent (or a kit/system
that employs one or more such SNP detection reagents) with a test sample vary. Incubation
conditions depend on such factors as the format employed in the assay, the detection
methods employed, and the type and nature of the detection reagents used in the assay.
One skilled in the art will recognize that any one of the commonly available hybridization,
amplification and array assay formats can readily be adapted to detect the SNPs disclosed
herein.
[0115] A SNP detection kit/system as used in the method of the present invention may include
components that are used to prepare nucleic acids from a test sample for the subsequent
amplification and/or detection of a SNP-containing nucleic acid molecule. Such sample
preparation components can be used to produce nucleic acid extracts (including DNA
and/or RNA), proteins or membrane extracts from any bodily fluids (such as blood,
serum, plasma, urine, saliva, phlegm, gastric juices, semen, tears, sweat, etc.),
skin, hair, cells (especially nucleated cells), biopsies, buccal swabs or tissue specimens.
The test samples used in the above-described methods will vary based on such factors
as the assay format, nature of the detection method, and the specific tissues, cells
or extracts used as the test sample to be assayed. Methods of preparing nucleic acids,
proteins, and cell extracts are well known in the art and can be readily adapted to
obtain a sample that is compatible with the system utilized. Automated sample preparation
systems for extracting nucleic acids from a test sample are commercially available,
and examples are Qiagen's BioRobot 9600, Applied Biosystems' PRISM™ 6700 sample preparation
system, and Roche Molecular Systems' COBAS AmpliPrep System.
[0116] Another form of kit disclosed herein is a compartmentalized kit. A compartmentalized
kit includes any kit in which reagents are contained in separate containers. Such
containers include, for example, small glass containers, plastic containers, strips
of plastic, glass or paper, or arraying material such as silica. Such containers allow
one to efficiently transfer reagents from one compartment to another compartment such
that the test samples and reagents are not cross-contaminated, or from one container
to another vessel not included in the kit, and the agents or solutions of each container
can be added in a quantitative fashion from one compartment to another or to another
vessel. Such containers may include, for example, one or more containers which will
accept the test sample, one or more containers which contain at least one probe or
other SNP detection reagent for detecting one or more SNPs disclosed herein one or
more containers which contain wash reagents (such as phosphate buffered saline, Tris-buffers,
etc.), and one or more containers which contain the reagents used to reveal the presence
of the bound probe or other SNP detection reagents. The kit can optionally further
comprise compartments and/or reagents for, for example, nucleic acid amplification
or other enzymatic reactions such as primer extension reactions, hybridization, ligation,
electrophoresis (preferably capillary electrophoresis), mass spectrometry, and/or
laser-induced fluorescent detection. The kit may also include instructions for using
the kit. Exemplary compartmentalized kits include microfluidic devices known in the
art (see,
e.g.,
Weigl et al., "Lab-on-a-chip for drug development", Adv Drug Deliv Rev. 2003 Feb 24;55(3):349-77). In such microfluidic devices, the containers may be referred to as, for example,
microfluidic "compartments", "chambers", or "channels".
[0117] Microfluidic devices, which may also be referred to as "lab-on-a-chip" systems, biomedical
micro-electro-mechanical systems (bioMEMs), or multicomponent integrated systems,
are exemplary kits/systems of the present invention for analyzing SNPs. Such systems
miniaturize and compartmentalize processes such as probe/target hybridization, nucleic
acid amplification, and capillary electrophoresis reactions in a single functional
device. Such microfluidic devices typically utilize detection reagents in at least
one aspect of the system, and such detection reagents may be used to detect one or
more SNPs disclosed herein . One example of a microfluidic system is disclosed in
U.S. Patent No. 5,589,136, which describes the integration of PCR amplification and capillary electrophoresis
in chips. Exemplary microfluidic systems comprise a pattern of microchannels designed
onto a glass, silicon, quartz, or plastic wafer included on a microchip. The movements
of the samples may be controlled by electric, electroosmotic or hydrostatic forces
applied across different areas of the microchip to create functional microscopic valves
and pumps with no moving parts. Varying the voltage can be used as a means to control
the liquid flow at intersections between the micro-machined channels and to change
the liquid flow rate for pumping across different sections of the microchip. See,
for example,
U.S. Patent Nos. 6,153,073, Dubrow et al., and
6,156,181, Parce et al.
[0118] For genotyping SNPs, an exemplary microfluidic system may integrate, for example,
nucleic acid amplification, primer extension, capillary electrophoresis, and a detection
method such as laser induced fluorescence detection. In a first step of an exemplary
process for using such an exemplary system, nucleic acid samples are amplified, preferably
by PCR. Then, the amplification products are subjected to automated primer extension
reactions using ddNTPs (specific fluorescence for each ddNTP) and the appropriate
oligonucleotide primers to carry out primer extension reactions which hybridize just
upstream of the targeted SNP. Once the extension at the 3' end is completed, the primers
are separated from the unincorporated fluorescent ddNTPs by capillary electrophoresis.
The separation medium used in capillary electrophoresis can be, for example, polyacrylamide,
polyethyleneglycol or dextran. The incorporated ddNTPs in the single nucleotide primer
extension products are identified by laser-induced fluorescence detection. Such an
exemplary microchip can be used to process, for example, at least 96 to 384 samples,
or more, in parallel.
USES OF NUCLEIC ACID MOLECULES
[0119] The nucleic acid molecules as used in the method of the present invention have a
variety of uses, especially in the diagnosis and treatment of liver fibrosis and related
pathologies. For example, the nucleic acid molecules are useful as hybridization probes,
such as for genotyping SNPs in messenger RNA, transcript, cDNA, genomic DNA, amplified
DNA or other nucleic acid molecules, and for isolating full-length cDNA and genomic
clones encoding the variant peptides disclosed in Table 1 as well as their orthologs.
[0120] A probe can hybridize to any nucleotide sequence along the entire length of a nucleic
acid molecule provided in Table 1 and/or Table 2. Preferably, a probe as used in the
method of the present invention hybridizes to a region of a target sequence that encompasses
a SNP position indicated in Table 1 and/or Table 2. More preferably, a probe hybridizes
to a SNP-containing target sequence in a sequence-specific manner such that it distinguishes
the target sequence from other nucleotide sequences which vary from the target sequence
only by which nucleotide is present at the SNP site. Such a probe is particularly
useful for detecting the presence of a SNP-containing nucleic acid in a test sample,
or for determining which nucleotide (allele) is present at a particular SNP site (
i.e., genotyping the SNP site).
[0121] A nucleic acid hybridization probe may be used for determining the presence, level,
form, and/or distribution of nucleic acid expression. The nucleic acid whose level
is determined can be DNA or RNA. Accordingly, probes specific for the SNPs described
herein can be used to assess the presence, expression and/or gene copy number in a
given cell, tissue, or organism. These uses are relevant for diagnosis of disorders
involving an increase or decrease in gene expression relative to normal levels.
In vitro techniques for detection of mRNA include, for example, Northern blot hybridizations
and
in situ hybridizations.
In vitro techniques for detecting DNA include Southern blot hybridizations and
in situ hybridizations (
Sambrook and Russell, 2000, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Press, Cold Spring Harbor, NY).
[0122] Probes can be used as part of a diagnostic test kit for identifying cells or tissues
in which a variant protein is expressed, such as by measuring the level of a variant
protein-encoding nucleic acid (
e.g., mRNA) in a sample of cells from a subject or determining if a polynucleotide contains
a SNP of interest.
[0123] Thus, the nucleic acid molecules disclosed herein can be used in the method of the
present invention a hybridization probes to detect the SNPs disclosed herein, thereby
determining whether an individual with the polymorphisms is at risk for liver fibrosis
and related pathologies or has developed early stage liver fibrosis. Detection of
a SNP associated with a disease phenotype provides a diagnostic tool for an active
disease and/or genetic predisposition to the disease.
[0124] Furthermore, the nucleic acid molecules disclosed herein are therefore useful for
detecting a gene (gene information is disclosed in Table 2, for example) which contains
a SNP disclosed herein and/or products of such genes, such as expressed mRNA transcript
molecules (transcript information is disclosed in Table 1, for example), and are thus
useful for detecting gene expression. The nucleic acid molecules can optionally be
implemented in, for example, an array or kit format for use in detecting gene expression.
[0125] The nucleic acid molecules disclosed herein are also useful as primers to amplify
any given region of a nucleic acid molecule, particularly a region containing a SNP
identified in Table 1 and/or Table 2.
[0126] The nucleic acid molecules disclosed herein are also useful for constructing recombinant
vectors (described in greater detail below). Such vectors include expression vectors
that express a portion of, or all of, any of the variant peptide sequences provided
in Table 1. Vectors also include insertion vectors, used to integrate into another
nucleic acid molecule sequence, such as into the cellular genome, to alter
in situ expression of a gene and/or gene product. For example, an endogenous coding sequence
can be replaced via homologous recombination with all or part of the coding region
containing one or more specifically introduced SNPs.
[0127] The nucleic acid molecules disclosed herein are also useful for expressing antigenic
portions of the variant proteins, particularly antigenic portions that contain a variant
amino acid sequence (
e.g., an amino acid substitution) caused by a SNP disclosed in Table 1 and/or Table 2.
[0128] The nucleic acid molecules disclosed herein are also useful for constructing vectors
containing a gene regulatory region of the nucleic acid molecules disclosed herein.
[0129] The nucleic acid molecules disclosed herein are also useful for designing ribozymes
corresponding to all, or a part, of an mRNA molecule expressed from a SNP-containing
nucleic acid molecule described herein.
[0130] The nucleic acid molecules disclosed herein are also useful for constructing host
cells expressing a part, or all, of the nucleic acid molecules and variant peptides.
[0131] The nucleic acid molecules disclosed herein are also useful for constructing transgenic
animals expressing all, or a part, of the nucleic acid molecules and variant peptides.
The production of recombinant cells and transgenic animals having nucleic acid molecules
which contain the SNPs disclosed in Table 1 and/or Table 2 allow, for example, effective
clinical design of treatment compounds and dosage regimens.
[0132] The nucleic acid molecules disclosed herein are also useful in assays for drug screening
to identify compounds that, for example, modulate nucleic acid expression.
[0133] The nucleic acid molecules disclosed herein are also useful in gene therapy in patients
whose cells have aberrant gene expression. Thus, recombinant cells, which include
a patient's cells that have been engineered
ex vivo and returned to the patient, can be introduced into an individual where the recombinant
cells produce the desired protein to treat the individual.
SNP Genotyping Methods
[0134] The process of determining which specific nucleotide (
i.e., allele) is present at each of one or more SNP positions, such as a SNP position
in a nucleic acid molecule disclosed in Table 1 and/or Table 2, is referred to as
SNP genotyping. The present invention provides methods of SNP genotyping, such as
for use in screening for liver fibrosis or related pathologies, or determining predisposition
thereto, or determining responsiveness to a form of treatment, or in genome mapping
or SNP association analysis, etc.
[0135] Nucleic acid samples can be genotyped to determine which allele(s) is/are present
at any given genetic region (
e.g., SNP position) of interest by methods well known in the art. The neighboring sequence
can be used to design SNP detection reagents such as oligonucleotide probes, which
may optionally be implemented in a kit format. Exemplary SNP genotyping methods are
described in
Chen et al., "Single nucleotide polymorphism genotyping: biochemistry, protocol, cost
and throughput", Pharmacogenomics J. 2003;3(2):77-96;
Kwok et al., "Detection of single nucleotide polymorphisms", Curr Issues Mol Biol.
2003 Apr;5(2):43-60;
Shi, "Technologies for individual genotyping: detection of genetic polymorphisms in
drug targets and disease genes", Am J Pharmacogenomics. 2002;2(3):197-205; and
Kwok, "Methods for genotyping single nucleotide polymorphisms", Annu Rev Genomics
Hum Genet 2001;2:235-58. Exemplary techniques for high-throughput SNP genotyping are described in
Marnellos, "High-throughput SNP analysis for genetic association studies", Curr Opin
Drug Discov Devel. 2003 May;6(3):317-21. Common SNP genotyping methods include, but are not limited to, TaqMan assays, molecular
beacon assays, nucleic acid arrays, allele-specific primer extension, allele-specific
PCR, arrayed primer extension, homogeneous primer extension assays, primer extension
with detection by mass spectrometry, pyrosequencing, multiplex primer extension sorted
on genetic arrays, ligation with rolling circle amplification, homogeneous ligation,
OLA (
U.S. Patent No. 4,988,167), multiplex ligation reaction sorted on genetic arrays, restriction-fragment length
polymorphism, single base extension-tag assays, and the Invader assay. Such methods
may be used in combination with detection mechanisms such as, for example, luminescence
or chemiluminescence detection, fluorescence detection, time-resolved fluorescence
detection, fluorescence resonance energy transfer, fluorescence polarization, mass
spectrometry, and electrical detection.
[0136] Various methods for detecting polymorphisms include, but are not limited to, methods
in which protection from cleavage agents is used to detect mismatched bases in RNA/RNA
or RNA/DNA duplexes (
Myers et al., Science 230:1242 (1985);
Cotton et al., PNAS 85:4397 (1988); and
Saleeba et al., Meth. Enzymol. 217:286-295 (1992)), comparison of the electrophoretic mobility of variant and wild type nucleic acid
molecules (
Orita et al., PNAS 86:2766 (1989);
Cotton et al., Mutat. Res. 285:125-144 (1993); and
Hayashi et al., Genet. Anal. Tech. Appl. 9:73-79 (1992)), and assaying the movement of polymorphic or wild-type fragments in polyacrylamide
gels containing a gradient of denaturant using denaturing gradient gel electrophoresis
(DGGE) (
Myers et al., Nature 313:495 (1985)). Sequence variations at specific locations can also be assessed by nuclease protection
assays such as RNase and S protection or chemical cleavage methods.
[0137] In a preferred embodiment, SNP genotyping is performed using the TaqMan assay, which
is also known as the 5' nuclease assay (
U.S. Patent Nos. 5,210,015 and
5,538,848). The TaqMan assay detects the accumulation of a specific amplified product during
PCR. The TaqMan assay utilizes an oligonucleotide probe labeled with a fluorescent
reporter dye and a quencher dye. The reporter dye is excited by irradiation at an
appropriate wavelength, it transfers energy to the quencher dye in the same probe
via a process called fluorescence resonance energy transfer (FRET). When attached
to the probe, the excited reporter dye does not emit a signal. The proximity of the
quencher dye to the reporter dye in the intact probe maintains a reduced fluorescence
for the reporter. The reporter dye and quencher dye may be at the 5' most and the
3' most ends, respectively, or vice versa. Alternatively, the reporter dye may be
at the 5' or 3' most end while the quencher dye is attached to an internal nucleotide,
or vice versa. In yet another embodiment, both the reporter and the quencher may be
attached to internal nucleotides at a distance from each other such that fluorescence
of the reporter is reduced.
[0138] During PCR, the 5' nuclease activity of DNA polymerase cleaves the probe, thereby
separating the reporter dye and the quencher dye and resulting in increased fluorescence
of the reporter. Accumulation of PCR product is detected directly by monitoring the
increase in fluorescence of the reporter dye. The DNA polymerase cleaves the probe
between the reporter dye and the quencher dye only if the probe hybridizes to the
target SNP-containing template which is amplified during PCR, and the probe is designed
to hybridize to the target SNP site only if a particular SNP allele is present.
[0139] Preferred TaqMan primer and probe sequences can readily be determined using the SNP
and associated nucleic acid sequence information provided herein. A number of computer
programs, such as Primer Express (Applied Biosystems, Foster City, CA), can be used
to rapidly obtain optimal primer/probe sets. It will be apparent to one of skill in
the art that such primers and probes for detecting the SNPs disclosed herein are useful
in diagnostic assays for liver fibrosis and related pathologies, and can be readily
incorporated into a kit format. The present invention also includes modifications
of the Taqman assay well known in the art such as the use of Molecular Beacon probes
(
U.S. Patent Nos. 5,118,801 and
5,312,728) and other variant formats (
U.S. Patent Nos. 5,866,336 and
6,117,635).
[0140] Another preferred embodiment of the method of the present invention for genotyping
the SNPs disclosed herein is the use of two oligonucleotide probes in an OLA (see,
e.g.,
U.S. Patent No. 4,988,617). In this method, one probe hybridizes to a segment of a target nucleic acid with
its 3' most end aligned with the SNP site. A second probe hybridizes to an adjacent
segment of the target nucleic acid molecule directly 3' to the first probe. The two
juxtaposed probes hybridize to the target nucleic acid molecule, and are ligated in
the presence of a linking agent such as a ligase if there is perfect complementarity
between the 3' most nucleotide of the first probe with the SNP site. If there is a
mismatch, ligation would not occur. After the reaction, the ligated probes are separated
from the target nucleic acid molecule, and detected as indicators of the presence
of a SNP.
[0141] The following patents, patent applications, and published international patent applications,
provide additional information pertaining to techniques for carrying out various types
of OLA:
U.S. Patent Nos. 6027889,
6268148,
5494810,
5830711, and
6054564 describe OLA strategies for performing SNP detection;
WO 97/31256 and
WO 00/56927 describe OLA strategies for performing SNP detection using universal arrays, wherein
a zipcode sequence can be introduced into one of the hybridization probes, and the
resulting product, or amplified product, hybridized to a universal zip code array;
U.S. application
US01/17329 (and
09/584,905), describes OLA (or LDR) followed by PCR, wherein zipcodes are incorporated into
OLA probes, and amplified PCR products are determined by electrophoretic or universal
zipcode array readout;
U.S. applications 60/427818,
60/445636, and
60/445494 describe SNPlex methods and software for multiplexed SNP detection using OLA followed
by PCR, wherein zipcodes are incorporated into OLA probes, and amplified PCR products
are hybridized with a zipchute reagent, and the identity of the SNP determined from
electrophoretic readout of the zipchute. In some embodiments, OLA is carried out prior
to PCR (or another method of nucleic acid amplification). In other embodiments, PCR
(or another method of nucleic acid amplification) is carried out prior to OLA.
[0142] Another method for SNP genotyping is based on mass spectrometry. Mass spectrometry
takes advantage of the unique mass of each of the four nucleotides of DNA. SNPs can
be unambiguously genotyped by mass spectrometry by measuring the differences in the
mass of nucleic acids having alternative SNP alleles. MALDI-TOF (Matrix Assisted Laser
Desorption Ionization - Time of Flight) mass spectrometry technology is preferred
for extremely precise determinations of molecular mass, such as SNPs. Numerous approaches
to SNP analysis have been developed based on mass spectrometry. Preferred mass spectrometry-based
methods of SNP genotyping include primer extension assays, which can also be utilized
in combination with other approaches, such as traditional gel-based formats and microarrays.
[0143] Typically, the primer extension assay involves designing and annealing a primer to
a template PCR amplicon upstream (5') from a target SNP position. A mix of dideoxynucleotide
triphosphates (ddNTPs) and/or deoxynucleotide triphosphates (dNTPs) are added to a
reaction mixture containing template (
e.g., a SNP-containing nucleic acid molecule which has typically been amplified, such
as by PCR), primer, and DNA polymerase. Extension of the primer terminates at the
first position in the template where a nucleotide complementary to one of the ddNTPs
in the mix occurs. The primer can be either immediately adjacent (
i.e., the nucleotide at the 3' end of the primer hybridizes to the nucleotide next to
the target SNP site) or two or more nucleotides removed from the SNP position. If
the primer is several nucleotides removed from the target SNP position, the only limitation
is that the template sequence between the 3' end of the primer and the SNP position
cannot contain a nucleotide of the same type as the one to be detected, or this will
cause premature termination of the extension primer. Alternatively, if all four ddNTPs
alone, with no dNTPs, are added to the reaction mixture, the primer will always be
extended by only one nucleotide, corresponding to the target SNP position. In this
instance, primers are designed to bind one nucleotide upstream from the SNP position
(
i.e., the nucleotide at the 3' end of the primer hybridizes to the nucleotide that is
immediately adjacent to the target SNP site on the 5' side of the target SNP site).
Extension by only one nucleotide is preferable, as it minimizes the overall mass of
the extended primer, thereby increasing the resolution of mass differences between
alternative SNP nucleotides. Furthermore, mass-tagged ddNTPs can be employed in the
primer extension reactions in place of unmodified ddNTPs. This increases the mass
difference between primers extended with these ddNTPs, thereby providing increased
sensitivity and accuracy, and is particularly useful for typing heterozygous base
positions. Mass-tagging also alleviates the need for intensive sample-preparation
procedures and decreases the necessary resolving power of the mass spectrometer.
[0144] The extended primers can then be purified and analyzed by MALDI-TOF mass spectrometry
to determine the identity of the nucleotide present at the target SNP position. In
one method of analysis, the products from the primer extension reaction are combined
with light absorbing crystals that form a matrix. The matrix is then hit with an energy
source such as a laser to ionize and desorb the nucleic acid molecules into the gas-phase.
The ionized molecules are then ejected into a flight tube and accelerated down the
tube towards a detector. The time between the ionization event, such as a laser pulse,
and collision of the molecule with the detector is the time of flight of that molecule.
The time of flight is precisely correlated with the mass-to-charge ratio (m/z) of
the ionized molecule. Ions with smaller m/z travel down the tube faster than ions
with larger m/z and therefore the lighter ions reach the detector before the heavier
ions. The time-of-flight is then converted into a corresponding, and highly precise,
m/z. In this manner, SNPs can be identified based on the slight differences in mass,
and the corresponding time of flight differences, inherent in nucleic acid molecules
having different nucleotides at a single base position. For further information regarding
the use of primer extension assays in conjunction with MALDI-TOF mass spectrometry
for SNP genotyping, see,
e.g.,
Wise et al., "A standard protocol for single nucleotide primer extension in the human
genome using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry",
Rapid Commun Mass Spectrom. 2003;17(11):1195-202.
[0146] SNPs can also be scored by direct DNA sequencing. A variety of automated sequencing
procedures can be utilized ((
1995) Biotechniques 19:448), including sequencing by mass spectrometry (see,
e.g.,
PCT International Publication No. WO94/16101;
Cohen et al., Adv. Chromatogr. 36:127-162 (1996); and
Griffin et al., Appl. Biochem. Biotechnol. 38:147-159 (1993)). The nucleic acid sequences disclosed herein enable one of ordinary skill in the
art to readily design sequencing primers for such automated sequencing procedures.
Commercial instrumentation, such as the Applied Biosystems 377, 3100, 3700, 3730,
and 3730x1 DNA Analyzers (Foster City, CA), is commonly used in the art for automated
sequencing.
[0147] Other methods that can be used to genotype the SNPs disclosed herein include single-strand
conformational polymorphism (SSCP), and denaturing gradient gel electrophoresis (DGGE)
(
Myers et al., Nature 313:495 (1985)). SSCP identifies base differences by alteration in electrophoretic migration of
single stranded PCR products, as described in
Orita et al., Proc. Nat. Acad Single-stranded PCR products can be generated by heating or otherwise denaturing
double stranded PCR products. Single-stranded nucleic acids may refold or form secondary
structures that are partially dependent on the base sequence. The different electrophoretic
mobilities of single-stranded amplification products are related to base-sequence
differences at SNP positions. DGGE differentiates SNP alleles based on the different
sequence-dependent stabilities and melting properties inherent in polymorphic DNA
and the corresponding differences in electrophoretic migration patterns in a denaturing
gradient gel (
Erlich, ed., PCR Technology, Principles and Applications for DNA Amplification, W.H.
Freeman and Co, New York, 1992, Chapter 7).
[0148] Sequence-specific ribozymes (
U.S.Patent No. 5,498,531) can also be used to score SNPs based on the development or loss of a ribozyme cleavage
site. Perfectly matched sequences can be distinguished from mismatched sequences by
nuclease cleavage digestion assays or by differences in melting temperature. If the
SNP affects a restriction enzyme cleavage site, the SNP can be identified by alterations
in restriction enzyme digestion patterns, and the corresponding changes in nucleic
acid fragment lengths determined by gel electrophoresis
[0149] SNP genotyping can include the steps of, for example, collecting a biological sample
from a human subject (
e.g., sample of tissues, cells, fluids, secretions, etc.), isolating nucleic acids (
e.g., genomic DNA, mRNA or both) from the cells of the sample, contacting the nucleic
acids with one or more primers which specifically hybridize to a region of the isolated
nucleic acid containing a target SNP under conditions such that hybridization and
amplification of the target nucleic acid region occurs, and determining the nucleotide
present at the SNP position of interest, or, in some assays, detecting the presence
or absence of an amplification product (assays can be designed so that hybridization
and/or amplification will only occur if a particular SNP allele is present or absent).
In some assays, the size of the amplification product is detected and compared to
the length of a control sample; for example, deletions and insertions can be detected
by a change in size of the amplified product compared to a normal genotype.
[0150] SNP genotyping is useful for numerous practical applications, as described below.
Examples of such applications include, but are not limited to, SNP-disease association
analysis, disease predisposition screening, disease diagnosis, disease prognosis,
disease progression monitoring, determining therapeutic strategies based on an individual's
genotype ("pharmacogenomics"), developing therapeutic agents based on SNP genotypes
associated with a disease or likelihood of responding to a drug, stratifying a patient
population for clinical trial for a treatment regimen, predicting the likelihood that
an individual will experience toxic side effects from a therapeutic agent, and human
identification applications such as forensics.
Analysis of Genetic Association Between SNPs and Phenotypic Traits
[0151] SNP genotyping for disease diagnosis, disease predisposition screening, disease prognosis,
determining drug responsiveness (pharmacogenomics), drug toxicity screening, and other
uses described herein, typically relies on initially establishing a genetic association
between one or more specific SNPs and the particular phenotypic traits of interest.
[0152] Different study designs may be used for genetic association studies (
Modern Epidemiology, Lippincott Williams & Wilkins (1998), 609-622). Observational studies are most frequently carried out in which the response of
the patients is not interfered with. The first type of observational study identifies
a sample of persons in whom the suspected cause of the disease is present and another
sample of persons in whom the suspected cause is absent, and then the frequency of
development of disease in the two samples is compared. These sampled populations are
called cohorts, and the study is a prospective study. The other type of observational
study is case-control or a retrospective study. In typical case-control studies, samples
are collected from individuals with the phenotype of interest (cases) such as certain
manifestations of a disease, and from individuals without the phenotype (controls)
in a population (target population) that conclusions are to be drawn from. Then the
possible causes of the disease are investigated retrospectively. As the time and costs
of collecting samples in case-control studies are considerably less than those for
prospective studies, case-control studies are the more commonly used study design
in genetic association studies, at least during the exploration and discovery stage.
[0153] In both types of observational studies, there may be potential confounding factors
that should be taken into consideration. Confounding factors are those that are associated
with both the real cause(s) of the disease and the disease itself, and they include
demographic information such as age, gender, ethnicity as well as environmental factors.
When confounding factors are not matched in cases and controls in a study, and are
not controlled properly, spurious association results can arise. If potential confounding
factors are identified, they should be controlled for by analysis methods explained
below.
[0154] In a genetic association study, the cause of interest to be tested is a certain allele
or a SNP or a combination of alleles or a haplotype from several SNPs. Thus, tissue
specimens (
e.g., whole blood) from the sampled individuals may be collected and genomic DNA genotyped
for the SNP(s) of interest. In addition to the phenotypic trait of interest, other
information such as demographic (
e.g., age, gender, ethnicity, etc.), clinical, and environmental information that may
influence the outcome of the trait can be collected to further characterize and define
the sample set. In many cases, these factors are known to be associated with diseases
and/or SNP allele frequencies. There are likely gene-environment and/or gene-gene
interactions as well. Analysis methods to address gene-environment and gene-gene interactions
(for example, the effects of the presence of both susceptibility alleles at two different
genes can be greater than the effects of the individual alleles at two genes combined)
are discussed below.
[0155] After all the relevant phenotypic and genotypic information has been obtained, statistical
analyses are carried out to determine if there is any significant correlation between
the presence of an allele or a genotype with the phenotypic characteristics of an
individual. Preferably, data inspection and cleaning are first performed before carrying
out statistical tests for genetic association. Epidemiological and clinical data of
the samples can be summarized by descriptive statistics with tables and graphs. Data
validation is preferably performed to check for data completion, inconsistent entries,
and outliers. Chi-squared tests and t-tests (Wilcoxon rank-sum tests if distributions
are not normal) may then be used to check for significant differences between cases
and controls for discrete and continuous variables, respectively. To ensure genotyping
quality, Hardy-Weinberg disequilibrium tests can be performed on cases and controls
separately. Significant deviation from Hardy-Weinberg equilibrium (HWE) in both cases
and controls for individual markers can be indicative of genotyping errors. If HWE
is violated in a majority of markers, it is indicative of population substructure
that should be further investigated. Moreover, Hardy-Weinberg disequilibrium in cases
only can indicate genetic association of the markers with the disease (
Genetic Data Analysis, Weir B., Sinauer (1990)).
[0156] To test whether an allele of a single SNP is associated with the case or control
status of a phenotypic trait, one skilled in the art can compare allele frequencies
in cases and controls. Standard chi-squared tests and Fisher exact tests can be carried
out on a 2x2 table (2 SNP alleles x 2 outcomes in the categorical trait of interest).
To test whether genotypes of a SNP are associated, chi-squared tests can be carried
out on a 3x2 table (3 genotypes x 2 outcomes). Score tests are also carried out for
genotypic association to contrast the three genotypic frequencies (major homozygotes,
heterozygotes and minor homozygotes) in cases and controls, and to look for trends
using 3 different modes of inheritance, namely dominant (with contrast coefficients
2, -1, -1), additive (with contrast coefficients 1, 0, -1) and recessive (with contrast
coefficients 1,1,-2). Odds ratios for minor versus major alleles, and odds ratios
for heterozygote and homozygote variants versus the wild type genotypes are calculated
with the desired confidence limits, usually 95%.
[0157] In order to control for confounders and to test for interaction and effect modifiers,
stratified analyses may be performed using stratified factors that are likely to be
confounding, including demographic information such as age, ethnicity, and gender,
or an interacting element or effect modifier, such as a known major gene (
e.g., APOE for Alzheimer's disease or HLA genes for autoimmune diseases), or environmental
factors such as smoking in lung cancer. Stratified association tests may be carried
out using Cochran-Mantel-Haenszel tests that take into account the ordinal nature
of genotypes with 0, '1', and 2 variant alleles. Exact tests by StatXact may also
be performed when computationally possible. Another way to adjust for confounding
effects and test for interactions is to perform stepwise multiple logistic regression
analysis using statistical packages such as SAS or R. Logistic regression is a model-building
technique in which the best fitting and most parsimonious model is built to describe
the relation between the dichotomous outcome (for instance, getting a certain disease
or not) and a set of independent variables (for instance, genotypes of different associated
genes, and the associated demographic and environmental factors). The most common
model is one in which the logit transformation of the odds ratios is expressed as
a linear combination of the variables (main effects) and their cross-product terms
(interactions) (
Applied Logistic Regression, Hosmer and Lemeshow, Wiley (2000)). To test whether a certain variable or interaction is significantly associated
with the outcome, coefficients in the model are first estimated and then tested for
statistical significance of their departure from zero.
[0158] In addition to performing association tests one marker at a time, haplotype association
analysis may also be performed to study a number of markers that are closely linked
together. Haplotype association tests can have better power than genotypic or allelic
association tests when the tested markers are not the disease-causing mutations themselves
but are in linkage disequilibrium with such mutations. The test will even be more
powerful if the disease is indeed caused by a combination of alleles on a haplotype
(
e.g., APOE is a haplotype formed by 2 SNPs that are very close to each other). In order
to perform haplotype association effectively, marker-marker linkage disequilibrium
measures, both D' and R
2, are typically calculated for the markers within a gene to elucidate the haplotype
structure. Recent studies (
Daly et al, Nature Genetics, 29, 232-235, 2001) in linkage disequilibrium indicate that SNPs within a gene are organized in block
pattern, and a high degree of linkage disequilibrium exists within blocks and very
little linkage disequilibrium exists between blocks. Haplotype association with the
disease status can be performed using such blocks once they have been elucidated.
[0159] Haplotype association tests can be carried out in a similar fashion as the allelic
and genotypic association tests. Each haplotype in a gene is analogous to an allele
in a multi-allelic marker. One skilled in the art can either compare the haplotype
frequencies in cases and controls or test genetic association with different pairs
of haplotypes. It has been proposed (
Schaid et al, Am. J. Hum. Genet., 70, 425-434, 2002) that score tests can be done on haplotypes using the program "haplo.score". In that
method, haplotypes are first inferred by EM algorithm and score tests are carried
out with a generalized linear model (GLM) framework that allows the adjustment of
other factors.
[0160] An important decision in the performance of genetic association tests is the determination
of the significance level at which significant association can be declared when the
p-value of the tests reaches that level. In an exploratory analysis where positive
hits will be followed up in subsequent confirmatory testing, an unadjusted p-value
<0.2 (a significance level on the lenient side), for example, may be used for generating
hypotheses for significant association of a SNP with certain phenotypic characteristics
of a disease. It is preferred that a p-value < 0.05 (a significance level traditionally
used in the art) is achieved in order for a SNP to be considered to have an association
with a disease. It is more preferred that a p-value <0.01 (a significance level on
the stringent side) is achieved for an association to be declared When hits are followed
up in confirmatory analyses in more samples of the same source or in different samples
from different sources, adjustment for multiple testing will be performed as to avoid
excess number of hits while maintaining the experiment-wise error rates at 0.05. While
there are different methods to adjust for multiple testing to control for different
kinds of error rates, a commonly used but rather conservative method is Bonferroni
correction to control the experiment-wise or family-wise error rate (
Multiple comparisons and multiple tests, Westfall et al, SAS Institute (1999)). Permutation tests to control for the false discovery rates, FDR, can be more powerful
(
Benjamini and Hochberg, Journal of the Royal Statistical Society, Series B 57, 1289-1300,
1995,
Resampling-based Multiple Testing, Westfall and Young, Wiley (1993)). Such methods to control for multiplicity would be preferred when the tests are
dependent and controlling for false discovery rates is sufficient as opposed to controlling
for the experiment-wise error rates.
[0161] In replication studies using samples from different populations after statistically
significant markers have been identified in the exploratory stage, meta-analyses can
then be performed by combining evidence of different studies (
Modern Epidemiology, Lippincott Williams & Wilkins,1998, 643-673). If available, association results known in the art for the same SNPs can be included
in the meta-analyses.
[0162] Since both genotyping and disease status classification can involve errors, sensitivity
analyses may be performed to see how odds ratios and p-values would change upon various
estimates on genotyping and disease classification error rates.
[0163] It has been well known that subpopulation-based sampling bias between cases and controls
can lead to spurious results in case-control associations studies (
Ewens and Spielman, Am. J. Hum. Genet. 62, 450-458, 1995) when prevalence of the disease is associated with different subpopulation groups.
Such bias can also lead to a loss of statistical power in genetic association studies.
To detect population stratification, Pritchard and Rosenberg (
Pritchard et al. Am. J. Hum. Gen. 1999, 65:220-228) suggested typing markers that are unlinked to the disease and using results of association
tests on those markers to determine whether there is any population stratification.
When stratification is detected, the genomic control (GC) method as proposed by Devlin
and Roeder (
Devlin et al. Biometrics 1999, 55:997-1004) can be used to adjust for the inflation of test statistics due to population stratification.
GC method is robust to changes in population structure levels as well as being applicable
to DNA pooling designs (
Devlin et al. Genet. Epidem. 20001, 21:273-284).
[0164] While Pritchard's method recommended using 15-20 unlinked microsatellite markers,
it suggested using more than 30 biallelic markers to get enough power to detect population
stratification. For the GC method, it has been shown (
Bacanu et al. Am. J. Hum. Genet. 2000, 66:1933-1944) that about 60-70 biallelic markers are sufficient to estimate the inflation factor
for the test statistics due to population stratification. Hence, 70 intergenic SNPs
can be chosen in unlinked regions as indicated in a genome scan (
Kehoe et al. Hum. Mol. Genet. 1999, 8:237-245).
[0165] Once individual risk factors, genetic or non-genetic, have been found for the predisposition
to disease, the next step is to set up a classification/prediction scheme to predict
the category (for instance, disease or no-disease) that an individual will be in depending
on his genotypes of associated SNPs and other non-genetic risk factors. Logistic regression
for discrete trait and linear regression for continuous trait are standard techniques
for such tasks (
Applied Regression Analysis, Draper and Smith, Wiley (1998)). Moreover, other techniques can also be used for setting up classification. Such
techniques include, but are not limited to, MART, CART, neural network, and discriminant
analyses that are suitable for use in comparing the performance of different methods
(
The Elements of Statistical Learning, Hastie, Tibshirani & Friedman, Springer (2002)).
Disease Diagnosis and Predisposition Screening
[0166] Information on association/correlation between genotypes and disease-related phenotypes
can be exploited in several ways. For example, in the case of a highly statistically
significant association between one or more SNPs with predisposition to a disease
for which treatment is available, detection of such a genotype pattern in an individual
may justify immediate administration of treatment, or at least the institution of
regular monitoring of the individual. Detection of the susceptibility alleles associated
with serious disease in a couple contemplating having children may also be valuable
to the couple in their reproductive decisions. In the case of a weaker but still statistically
significant association between a SNP and a human disease, immediate therapeutic intervention
or monitoring may not be justified after detecting the susceptibility allele or SNP.
Nevertheless, the subject can be motivated to begin simple life-style changes (
e.g., diet, exercise) that can be accomplished at little or no cost to the individual
but would confer potential benefits in reducing the risk of developing conditions
for which that individual may have an increased risk by virtue of having the susceptibility
allele(s).
[0167] The SNPs disclosed herein may contribute to liver fibrosis and related pathologies
in an individual in different ways. Some polymorphisms occur within a protein coding
sequence and contribute to disease phenotype by affecting protein structure. Other
polymorphisms occur in noncoding regions but may exert phenotypic effects indirectly
via influence on, for example, replication, transcription, and/or translation. A single
SNP may affect more than one phenotypic trait. Likewise, a single phenotypic trait
may be affected by multiple SNPs in different genes.
[0168] As used herein, the terms "diagnose", "diagnosis", and "diagnostics" include, but
are not limited to any of the following: detection of liver fibrosis that an individual
may presently have, predisposition/susceptibility screening (
i.e., determining the increased risk of an individual in developing liver fibrosis in
the future, or determining whether an individual has a decreased risk of developing
liver fibrosis in the future, determining the rate of progression of fibrosis to bridging
fibrosis/cirrhosis), determining a particular type or subclass of liver fibrosis in
an individual known to have liver fibrosis, confirming or reinforcing a previously
made diagnosis of liver fibrosis, pharmacogenomic evaluation of an individual to determine
which therapeutic strategy that individual is most likely to positively respond to
or to predict whether a patient is likely to respond to a particular treatment, predicting
whether a patient is likely to experience toxic effects from a particular treatment
or therapeutic compound, and evaluating the future prognosis of an individual having
liver fibrosis. Such diagnostic uses are based on the SNPs individually or in a unique
combination or SNP haplotypes disclosed herein.
[0169] Haplotypes are particularly useful in that, for example, fewer SNPs can be genotyped
to determine if a particular genomic region harbors a locus that influences a particular
phenotype, such as in linkage disequilibrium-based SNP association analysis.
[0170] Linkage disequilibrium (LD) refers to the co-inheritance of alleles (
e.g., alternative nucleotides) at two or more different SNP sites at frequencies greater
than would be expected from the separate frequencies of occurrence of each allele
in a given population. The expected frequency of co-occurrence of two alleles that
are inherited independently is the frequency of the first allele multiplied by the
frequency of the second allele. Alleles that co-occur at expected frequencies are
said to be in "linkage equilibrium". In contrast, LD refers to any non-random genetic
association between allele(s) at two or more different SNP sites, which is generally
due to the physical proximity of the two loci along a chromosome. LD can occur when
two or more SNPs sites are in close physical proximity to each other on a given chromosome
and therefore alleles at these SNP sites will tend to remain unseparated for multiple
generations with the consequence that a particular nucleotide (allele) at one SNP
site will show a non-random association with a particular nucleotide (allele) at a
different SNP site located nearby. Hence, genotyping one of the SNP sites will give
almost the same information as genotyping the other SNP site that is in LD.
[0171] Various degrees of LD can be encountered between two or more SNPs with the result
being that some SNPs are more closely associated (
i.e., in stronger LD) than others. Furthermore, the physical distance over which LD extends
along a chromosome differs between different regions of the genome, and therefore
the degree of physical separation between two or more SNP sites necessary for LD to
occur can differ between different regions of the genome.
[0172] For diagnostic purposes and similar uses, if a particular SNP site is found to be
useful for diagnosing liver fibrosis and related pathologies (
e.g., has a significant statistical association with the condition and/or is recognized
as a causative polymorphism for the condition), then the skilled artisan would recognize
that other SNP sites which are in LD with this SNP site would also be useful for diagnosing
the condition. Thus, polymorphisms (
e.g., SNPs and/or haplotypes) that are not the actual disease-causing (causative) polymorphisms,
but are in LD with such causative polymorphisms, are also useful. In such instances,
the genotype of the polymorphism(s) that is/are in LD with the causative polymorphism
is predictive of the genotype of the causative polymorphism and, consequently, predictive
of the phenotype (
e.g., liver fibrosis) that is influenced by the causative SNP(s). Therefore, polymorphic
markers that are in LD with causative polymorphisms are useful as diagnostic markers,
and are particularly useful when the actual causative polymorphism(s) is/are unknown.
[0173] Examples of polymorphisms that can be in LD with one or more causative polymorphisms
(and/or in LD with one or more polymorphisms that have a significant statistical association
with a condition) and therefore useful for diagnosing the same condition that the
causative/associated SNP(s) is used to diagnose, include, for example, other SNPs
in the same gene, protein-coding, or mRNA transcript-coding region as the causative/associated
SNP, other SNPs in the same exon or same intron as the causative/associated SNP, other
SNPs in the same haplotype block as the causative/associated SNP, other SNPs in the
same intergenic region as the causative/associated SNP, SNPs that are outside but
near a gene (
e.g., within 6kb on either side, 5' or 3', of a gene boundary) that harbors a causative/associated
SNP, etc. Such useful LD SNPs can be selected from among the SNPs disclosed herein
.
[0175] The contribution or association of particular SNPs and/or SNP haplotypes with disease
phenotypes, such as liver fibrosis, enables the SNPs described herein to be used to
develop superior diagnostic tests capable of identifying individuals who express a
detectable trait, such as liver fibrosis, as the result of a specific genotype, or
individuals whose genotype places them at an increased or decreased risk of developing
a detectable trait at a subsequent time as compared to individuals who do not have
that genotype. As described herein, diagnostics may be based on a single SNP or a
group of SNPs. Combined detection of a plurality of SNPs (for example, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 24, 25, 30, 32, 48, 50, 64,
96, 100, or any other number in-between, or more, of the SNPs disclosed herein) typically
increases the probability of an accurate diagnosis. For example, the presence of a
single SNP known to correlate with liver fibrosis might indicate a probability of
20% that an individual has or is at risk of developing liver fibrosis, whereas detection
of five SNPs, each of which correlates with liver fibrosis, might indicate a probability
of 80% that an individual has or is at risk of developing liver fibrosis. To further
increase the accuracy of diagnosis or predisposition screening, analysis of the SNPs
described herein can be combined with that of other polymorphisms or other risk factors
of liver fibrosis, such as disease symptoms, pathological characteristics, family
history, diet, environmental factors or lifestyle factors.
[0176] It will, of course, be understood by practitioners skilled in the treatment or diagnosis
of liver fibrosis that the present invention generally does not intend to provide
an absolute identification of individuals who are at risk (or less at risk) of developing
liver fibrosis, and/or pathologies related to liver fibrosis, but rather to indicate
a certain increased (or decreased) degree or likelihood of developing the disease
based on statistically significant association results. However, this information
is extremely valuable as it can be used to, for example, initiate preventive treatments
or to allow an individual carrying one or more significant SNPs or SNP haplotypes
to foresee warning signs such as minor clinical symptoms, or to have regularly scheduled
physical exams to monitor for appearance of a condition in order to identify and begin
treatment of the condition at an early stage. Particularly with diseases that are
extremely debilitating or fatal if not treated on time, the knowledge of a potential
predisposition, even if this predisposition is not absolute, would likely contribute
in a very significant manner to treatment efficacy.
[0177] For reference only, the diagnostic techniques described herein may employ a variety
of methodologies to determine whether a test subject has a SNP or a SNP pattern associated
with an increased or decreased risk of developing a detectable trait or whether the
individual suffers from a detectable trait as a result of a particular polymorphism/mutation,
including, for example, methods which enable the analysis of individual chromosomes
for haplotyping, family studies, single sperm DNA analysis, or somatic hybrids. The
trait analyzed using the diagnostics of the invention may be any detectable trait
that is commonly observed in pathologies and disorders related to liver fibrosis.
[0178] Another aspect of the present invention relates to a method of determining whether
an individual is at risk (or less at risk) of developing one or more traits or whether
an individual expresses one or more traits as a consequence of possessing a particular
trait-causing or trait-influencing allele. These methods generally involve obtaining
a nucleic acid sample from an individual and assaying the nucleic acid sample to determine
which nucleotide(s) is/are present at one or more SNP positions, wherein the assayed
nucleotide(s) is/are indicative of an increased or decreased risk of developing the
trait or indicative that the individual expresses the trait as a result of possessing
a particular trait-causing or trait-influencing allele.
[0179] In another embodiment, the SNP detection reagents as used in the method of the present
invention are used to determine whether an individual has one or more SNP allele(s)
affecting the level (
e.g., the concentration of mRNA or protein in a sample, etc.) or pattern (
e.g., the kinetics of expression, rate of decomposition, stability profile, Km, Vmax,
etc.) of gene expression (collectively, the "gene response" of a cell or bodily fluid).
Such a determination can be accomplished by screening for mRNA or protein expression
(
e.g., by using nucleic acid arrays, RT-PCR, TaqMan assays, or mass spectrometry), identifying
genes having altered expression in an individual, genotyping the SNP disclosed in
Table 1 and/or Table 2 that could affect the expression of the genes having altered
expression (
e.g., SNPs that are in and/or around the gene(s) having altered expression, SNPs in regulatory/control
regions, SNPs in and/or around other genes that are involved in pathways that could
affect the expression of the gene(s) having altered expression, or all SNPs could
be genotyped), and correlating SNP genotypes with altered gene expression. In this
manner, specific SNP alleles at particular SNP sites can be identified that affect
gene expression.
Pharmacogenomics and Therapeutics/Drug Development
[0180] For reference only, disclosed herein are methods for assessing the pharmacogenomics
of a subject harboring particular SNP alleles or haplotypes to a particular therapeutic
agent or pharmaceutical compound, or to a class of such compounds. Pharmacogenomics
deals with the roles which clinically significant hereditary variations (
e.g., SNPs) play in the response to drugs due to altered drug disposition and/or abnormal
action in affected persons. See,
e.g.,
Roses, Nature 405, 857-865 (2000);
Gould Rothberg, Nature Biotechnology 19, 209-211 (2001);
Eichelbaum, Clin. Exp. Pharmacol. Physiol. 23(10-11):983-985 (1996); and
Linder, Clin. Chem. 43(2):254-266 (1997). The clinical outcomes of these variations can result in severe toxicity of therapeutic
drugs in certain individuals or therapeutic failure of drugs in certain individuals
as a result of individual variation in metabolism. Thus, the SNP genotype of an individual
can determine the way a therapeutic compound acts on the body or the way the body
metabolizes the compound. For example, SNPs in drug metabolizing enzymes can affect
the activity of these enzymes, which in turn can affect both the intensity and duration
of drug action, as well as drug metabolism and clearance.
[0181] The discovery of SNPs in drug metabolizing enzymes, drug transporters, proteins for
pharmaceutical agents, and other drug targets has explained why some patients do not
obtain the expected drug effects, show an exaggerated drug effect, or experience serious
toxicity from standard drug dosages. SNPs can be expressed in the phenotype of the
extensive metabolizer and in the phenotype of the poor metabolizer. Accordingly, SNPs
may lead to allelic variants of a protein in which one or more of the protein functions
in one population are different from those in another population. SNPs and the encoded
variant peptides thus provide targets to ascertain a genetic predisposition that can
affect treatment modality. For example, in a ligand-based treatment, SNPs may give
rise to amino terminal extracellular domains and/or other ligand-binding regions of
a receptor that are more or less active in ligand binding, thereby affecting subsequent
protein activation. Accordingly, ligand dosage would necessarily be modified to maximize
the therapeutic effect within a given population containing particular SNP alleles
or haplotypes.
[0182] As an alternative to genotyping, specific variant proteins containing variant amino
acid sequences encoded by alternative SNP alleles could be identified. Thus, pharmacogenomic
characterization of an individual permits the selection of effective compounds and
effective dosages of such compounds for prophylactic or therapeutic uses based on
the individual's SNP genotype, thereby enhancing and optimizing the effectiveness
of the therapy. Furthermore, the production of recombinant cells and transgenic animals
containing particular SNPs/haplotypes allow effective clinical design and testing
of treatment compounds and dosage regimens. For example, transgenic animals can be
produced that differ only in specific SNP alleles in a gene that is orthologous to
a human disease susceptibility gene.
[0183] For reference only, pharmacogenomic uses of the SNPs described herein provide several
significant advantages for patient care, particularly in treating liver fibrosis.
Pharmacogenomic characterization of an individual, based on an individual's SNP genotype,
can identify those individuals unlikely to respond to treatment with a particular
medication and thereby allows physicians to avoid prescribing the ineffective medication
to those individuals. On the other hand, SNP genotyping of an individual may enable
physicians to select the appropriate medication and dosage regimen that will be most
effective based on an individual's SNP genotype. This information increases a physician's
confidence in prescribing medications and motivates patients to comply with their
drug regimens. Furthermore, pharmacogenomics may identify patients predisposed to
toxicity and adverse reactions to particular drugs or drug dosages. Adverse drug reactions
lead to more than 100,000 avoidable deaths per year in the United States alone and
therefore represent a significant cause of hospitalization and death, as well as a
significant economic burden on the healthcare system (
Pfost et. al., Trends in Biotechnology, Aug. 2000.). Thus, pharmacogenomics based on the SNPs disclosed herein has the potential to
both save lives and reduce healthcare costs substantially.
[0184] Pharmacogenomics in general is discussed further in
Rose et al., "Pharmacogenetic analysis of clinically relevant genetic polymorphisms",
Methods Mol Med. 2003;85:225-37. Pharmacogenomics as it relates to Alzheimer's disease and other neurodegenerative
disorders is discussed in
Cacabelos, "Pharmacogenomics for the treatment of dementia", Ann Med. 2002;34(5):357-79,
Maimone et al., "Pharmacogenomics of neurodegenerative diseases", Eur J Pharmacol.
2001 Feb 9;413(1):11-29, and
Poirier, "Apolipoprotein E: a pharmacogenetic target for the treatment of Alzheimer's
disease", Mol Diagn. 1999 Dec;4(4):335-41. Pharmacogenomics as it relates to cardiovascular disorders is discussed in
Siest et al., "Pharmacogenomics of drugs affecting the cardiovascular system", Clin
Chem Lab Med. 2003 Apr;41(4):590-9,
Mukherjee et al., "Pharmacogenomics in cardiovascular diseases", Prog Cardiovasc Dis.
2002 May-Jun;44(6):479-98, and
Mooser et al., "Cardiovascular pharmacogenetics in the SNP era", J Thromb Haemost.
2003 Jul;1(7):1398-402. Pharmacogenomics as it relates to cancer is discussed in
McLeod et al., "Cancer pharmacogenomics: SNPs, chips, and the individual patient",
Cancer Invest. 2003;21(4):630-40 and
Watters et al., "Cancer pharmacogenomics: current and future applications", Biochim
Biophys Acta. 2003 Mar 17;1603(2):99-111.
[0185] For reference only, the SNPs described herein also can be used to identify novel
therapeutic targets for liver fibrosis. For example, genes containing the disease-associated
variants ("variant genes") or their products, as well as genes or their products that
are directly or indirectly regulated by or interacting with these variant genes or
their products, can be targeted for the development of therapeutics that, for example,
treat the disease or prevent or delay disease onset. The therapeutics may be composed
of, for example, small molecules, proteins, protein fragments or peptides, antibodies,
nucleic acids, or their derivatives or mimetics which modulate the functions or levels
of the target genes or gene products.
[0186] The SNP-containing nucleic acid molecules disclosed herein, and their complementary
nucleic acid molecules, may be used as antisense constructs to control gene expression
in cells, tissues, and organisms. Antisense technology is well established in the
art and extensively reviewed in
Antisense Drug Technology: Principles, Strategies, and Applications, Crooke (ed.),
Marcel Dekker, Inc.: New York (2001). An antisense nucleic acid molecule is generally designed to be complementary to
a region of mRNA 'expressed by a gene so that the antisense molecule hybridizes to
the mRNA and thereby blocks translation of mRNA into protein. Various classes of antisense
oligonucleotides are used in the art, two of which are cleavers and blockers. Cleavers,
by binding to target RNAs, activate intracellular nucleases (
e.g., RNaseH or RNase L) that cleave the target RNA. Blockers, which also bind to target
RNAs, inhibit protein translation through steric hindrance of ribosomes. Exemplary
blockers include peptide nucleic acids, morpholinos, locked nucleic acids, and methylphosphonates
(see,
e.g.,
Thompson, Drug Discovery Today, 7 (17): 912-917 (2002)). Antisense oligonucleotides are directly useful as therapeutic agents, and are
also useful for determining and validating gene function (
e.g., in gene knock-out or knock-down experiments).
[0187] Antisense technology is further reviewed in:
Lavery et al., "Antisense and RNAi: powerful tools in drug target discovery and validation",
Curr Opin Drug Discov Devel. 2003 Jul;6(4):561-9;
Stephens et al., "Antisense oligonucleotide therapy in cancer", Curr Opin Mol Ther.
2003 Apr;5(2):118-22;
Kurreck, "Antisense technologies. Improvement through novel chemical modifications",
Eur J Biochem. 2003 Apr;270(8):1628-44;
Dias et al., "Antisense oligonucleotides: basic concepts and mechanisms", Mol Cancer
Ther. 2002 Mar;1(5):347-55;
Chen, "Clinical development of antisense oligonucleotides as anti-cancer therapeutics",
Methods Mol Med. 2003;75:621-36;
Wang et al., "Antisense anticancer oligonucleotide therapeutics", Curr Cancer Drug
Targets. 2001. Nov;1(3):177-96; and
Bennett, "Efficiency of antisense oligonucleotide drug discovery", Antisense Nucleic
Acid Drug Dev. 2002 Jun;12(3):215-24.
[0188] The SNPs disclosed herein are particularly useful for designing antisense reagents
that are specific for particular nucleic acid variants. Based on the SNP information
disclosed herein, antisense oligonucleotides can be produced that specifically target
mRNA molecules that contain one or more particular SNP nucleotides. In this manner,
expression of mRNA molecules that contain one or more undesired polymorphisms (
e.g., SNP nucleotides that lead to a defective protein such as an amino acid substitution
in a catalytic domain) can be inhibited or completely blocked. Thus, antisense oligonucleotides
can be used to specifically bind a particular polymorphic form (
e.g.,
a SNP allele that encodes a defective protein), thereby inhibiting translation of this
form, but which do not bind an alternative polymorphic form (
e.g., an alternative SNP nucleotide that encodes a protein having normal function).
[0189] Antisense molecules can be used to inactivate mRNA in order to inhibit gene expression
and production of defective proteins. Accordingly, these molecules can be used to
treat a disorder, such as liver fibrosis, characterized by abnormal or undesired gene
expression or expression of certain defective proteins. This technique can involve
cleavage by means of ribozymes containing nucleotide sequences complementary to one
or more regions in the mRNA that attenuate the ability of the mRNA to be translated.
Possible mRNA regions include, for example, protein-coding regions and particularly
protein-coding regions corresponding to catalytic activities, substrate/ligand binding,
or other functional activities of a protein.
[0190] The SNPs disclosed herein is also useful for designing RNA interference reagents
that specifically target nucleic acid molecules having particular SNP variants. RNA
interference (RNAi), also referred to as gene silencing, is based on using double-stranded
RNA (dsRNA) molecules to turn genes off. When introduced into a cell, dsRNAs are processed
by the cell into short fragments (generally about 21, 22, or 23 nucleotides in length)
known as small interfering RNAs (siRNAs) which the cell uses in a sequence-specific
manner to recognize and destroy complementary RNAs (
Thompson, Drug Discovery Today, 7 (17): 912-917 (2002)). Accordingly, an aspect of the present invention specifically contemplates isolated
nucleic acid molecules that are about 18-26 nucleotides in length, preferably 19-25
nucleotides in length, and more preferably 20, 21, 22, or 23 nucleotides in length,
and the use of these nucleic acid molecules for RNAi. Because RNAi molecules, including
siRNAs, act in a sequence-specific manner, the SNPs disclosed herein can be used to
design RNAi reagents that recognize and destroy nucleic acid molecules having specific
SNP alleles/nucleotides (such as deleterious alleles that lead to the production of
defective proteins), while not affecting nucleic acid molecules having alternative
SNP alleles (such as alleles that encode proteins having normal function). As with
antisense reagents, RNAi reagents may be directly useful as therapeutic agents (
e.g., for turning off defective, disease-causing genes), and are also useful for characterizing
and validating gene function (
e.g., in gene knock-out or knock-down experiments).
[0191] The following references provide a further review of RNAi:
Reynolds et al., "Rational siRNA design for RNA interference", Nat Biotechnol. 2004
Mar;22(3):326-30. Epub 2004 Feb 01;
Chi et al., "Genomewide view of gene silencing by small interfering RNAs", PNAS 100(11):6343-6346,
2003;
Vickers et al., "Efficient Reduction of Target RNAs by Small Interfering RNA and RNase
H-dependent Antisense Agents", J. Biol. Chem. 278: 7108-7118, 2003;
Agami, "RNAi and related mechanisms and their potential use for therapy", Curr Opin
Chem Biol. 2002 Dec;6(6):829-34;
Lavery et al., "Antisense and RNAi: powerful tools in drug target discovery and validation",
Curr Opin Drug Discov Devel. 2003 Jul;6(4):561-9;
Shi, "Mammalian RNAi for the masses", Trends Genet 2003 Jan;19(1):9-12),
Shuey et al., "RNAi: gene-silencing in therapeutic intervention", Drug Discovery Today
2002 Oct;7(20):1040-1046;
McManus et al., Nat Rev Genet 2002 Oct;3(10):737-47;
Xia et al., Nat Biotechnol 2002 Oct;20(10):1006-10;
Plasterk et al., Curr Opin Genet Dev 2000 Oct;10(5):562-7;
Bosher et al., Nat Cell Biol 2000 Feb;2(2):E31-6; and
Hunter, Curr Biol 1999 Jun 17;9(12):R440-2).
[0192] A subject suffering from a pathological condition, such as liver fibrosis, ascribed
to a SNP may be treated so as to correct the genetic defect (see
Kren et al., Proc. Natl. Acad. Sci. USA 96:10349-10354 (1999)). Such a subject can be identified by any method that can detect the polymorphism
in a biological sample drawn from the subject. Such a genetic defect may be permanently
corrected by administering to such a subject a nucleic acid fragment incorporating
a repair sequence that supplies the normal/wild-type nucleotide at the position of
the SNP. This site-specific repair sequence can encompass an RNA/DNA oligonucleotide
that operates to promote endogenous repair of a subject's genomic DNA. The site-specific
repair sequence is administered in an appropriate vehicle, such as a complex with
polyethylenimine, encapsulated in anionic liposomes, a viral vector such as an adenovirus,
or other pharmaceutical composition that promotes intracellular uptake of the administered
nucleic acid. A genetic defect leading to an inborn pathology may then be overcome,
as the chimeric oligonucleotides induce incorporation of the normal sequence into
the subject's genome. Upon incorporation, the normal gene product is expressed, and
the replacement is propagated, thereby engendering a permanent repair and therapeutic
enhancement of the clinical condition of the subject.
[0193] In cases in which a cSNP results in a variant protein that is ascribed to be the
cause of, or a contributing factor to, a pathological condition, a method of treating
such a condition can include administering to a subject experiencing the pathology
the wild-type/normal cognate of the variant protein. Once administered in an effective
dosing regimen, the wild-type cognate provides complementation or remediation of the
pathological condition.
[0194] For reference only, described is the invention further provides a method for identifying
a compound or agent that can be used to treat liver fibrosis. The SNPs disclosed herein
are useful as targets for the identification and/or development of therapeutic agents.
A method for identifying a therapeutic agent or compound typically includes assaying
the ability of the agent or compound to modulate the activity and/or expression of
a SNP-containing nucleic acid or the encoded product and thus identifying an agent
or a compound that can be used to treat a disorder characterized by undesired activity
or expression of the SNP-containing nucleic acid or the encoded product. The assays
can be performed in cell-based and cell-free systems. Cell-based assays can include
cells naturally expressing the nucleic acid molecules of interest or recombinant cells
genetically engineered to express certain nucleic acid molecules.
[0195] Variant gene expression in a liver fibrosis patient can include, for example, either
expression of a SNP-containing nucleic acid sequence (for instance, a gene that contains
a SNP can be transcribed into an mRNA transcript molecule containing the SNP, which
can.in turn be translated into a variant protein) or altered expression of a normal/wild-type
nucleic acid sequence due to one or more SNPs (for instance, a regulatory/control
region can contain a SNP that affects the level or pattern of expression of a normal
transcript).
[0196] Assays for variant gene expression can involve direct assays of nucleic acid levels
(
e.g., mRNA levels), expressed protein levels, or of collateral compounds involved in
a signal pathway. Further, the expression of genes that are up- or down-regulated
in response to the signal pathway can also be assayed. In this embodiment, the regulatory
regions of these genes can be operably linked to a reporter gene such as luciferase.
[0197] Modulators of variant gene expression can be identified in a method wherein, for
example, a cell is contacted with a candidate compound/agent and the expression of
mRNA determined. The level of expression of mRNA in the presence of the candidate
compound is compared to the level of expression of mRNA in the absence of the candidate
compound. The candidate compound can then be identified as a modulator of variant
gene expression based on this comparison and be used to treat a disorder such as liver
fibrosis that is characterized by variant gene expression (
e.g., either expression of a SNP-containing nucleic acid or altered expression of a normal/wild-type
nucleic acid molecule due to one or more SNPs that affect expression of the nucleic
acid molecule) due to one or more SNPs disclosed herein. When expression of mRNA is
statistically significantly greater in the presence of the candidate compound than
in its absence, the candidate compound is identified as a stimulator of nucleic acid
expression. When nucleic acid expression is statistically significantly less in the
presence of the candidate compound than in its absence, the candidate compound is
identified as an inhibitor of nucleic acid expression.
[0198] Described herein are methods of treatment, with the SNP or associated nucleic acid
domain (
e.g., catalytic domain, ligand/substrate-binding domain, regulatory/control region, etc.)
or gene, or the encoded mRNA transcript, as a target, using a compound identified
through drug screening as a gene modulator to modulate variant nucleic acid expression.
Modulation can include either up-regulation (
i.e., activation or agonization) or down-regulation (
i.e., suppression or antagonization) of nucleic acid expression.
[0199] Expression of mRNA transcripts and encoded proteins, either wild type or variant,
may be altered in individuals with a particular SNP allele in a regulatory/control
element, such as a promoter or transcription factor binding domain, that regulates
expression. In this situation, methods of treatment and compounds can be identified,
as discussed herein, that regulate or overcome the variant regulatory/control element,
thereby generating normal, or healthy, expression levels of either the wild type or
variant protein.
[0200] For reference only, the SNP-containing nucleic acid molecules described herein are
also useful for monitoring the effectiveness of modulating compounds on the expression
or activity of a variant gene, or encoded product, in clinical trials or in a treatment
regimen. Thus, the gene expression pattern can serve as an indicator for the continuing
effectiveness of treatment with the compound, particularly with compounds to which
a patient can develop resistance, as well as an indicator for toxicities. The gene
expression pattern can also serve as a marker indicative of a physiological response
of the affected cells to the compound. Accordingly, such monitoring would allow either
increased administration of the compound or the administration of alternative compounds
to which the patient has not become resistant. Similarly, if the level of nucleic
acid expression falls below a desirable level, administration of the compound could
be commensurately decreased.
[0201] For reference only, described herewith is a pharmaceutical pack comprising a therapeutic
agent (
e.g., a small molecule drug, antibody, peptide, antisense or RNAi nucleic acid molecule,
etc.) and a set of instructions for administration of the therapeutic agent to humans
diagnostically tested for one or more SNPs or SNP haplotypes described herein.
[0202] For reference only, the SNPs/haplotypes of the present description are also useful
for improving many different aspects of the drug development process. For instance,
an aspect of the present description includes selecting individuals for clinical trials
based on their SNP genotype. For example, individuals with SNP genotypes that indicate
that they are likely to positively respond to a drug can be included in the trials,
whereas those individuals whose SNP genotypes indicate that they are less likely to
or would not respond to the drug, or who are at risk for suffering toxic effects or
other adverse reactions, can be excluded from the clinical trials. This not only can
improve the safety of clinical trials, but also can enhance the chances that the trial
will demonstrate statistically significant efficacy. Furthermore, the SNPs of the
present description may explain why certain previously developed drugs performed poorly
in clinical trials and may help identify a subset of the population that would benefit
from a drug that had previously performed poorly in clinical trials, thereby "rescuing"
previously developed drugs, and enabling the drug to be made available to a particular
liver fibrosis patient population that can benefit from it.
[0203] SNPs have many important uses in drug discovery, screening, and development. A high
probability exists that, for any gene/protein selected as a potential drug target;
variants of that gene/protein will exist in a patient population. Thus, determining
the impact of gene/protein variants on the selection and delivery of a therapeutic
agent should be an integral aspect of the drug discovery and development process.
(
Jazwinska, A Trends Guide to Genetic Variation and Genomic Medicine, 2002 Mar; S30-S36).
[0204] Knowledge of variants (
e.g., SNPs and any corresponding amino acid polymorphisms) of a particular therapeutic
target (
e.g., a gene, mRNA transcript, or protein) enables parallel screening of the variants
in order to identify therapeutic candidates (
e.g., small molecule compounds, antibodies, antisense or RNAi nucleic acid compounds,
etc.) that demonstrate efficacy across variants (
Rothberg, Nat Biotechnol 2001 Mar;19(3):209-11). Such therapeutic candidates would be expected to show equal efficacy across a larger
segment of the patient population, thereby leading to a larger potential market for
the therapeutic candidate.
[0205] Furthermore, identifying variants of a potential therapeutic target enables the most
common form of the target to be used for selection of therapeutic candidates, thereby
helping to ensure that the experimental activity that is observed for the selected
candidates reflects the real activity expected in the largest proportion of a patient
population (
Jazwinska, A Trends Guide to Genetic Variation and Genomic Medicine, 2002 Mar; S30-S36).
[0206] Additionally, screening therapeutic candidates against all known variants of a target
can enable the early identification of potential toxicities and adverse reactions
relating to particular variants. For example, variability in drug absorption, distribution,
metabolism and excretion (ADME) caused by, for example, SNPs in therapeutic targets
or drug metabolizing genes, can be identified, and this information can be utilized
during the drug development process to minimize variability in drug disposition and
develop For reference only, the therapeutic agents that are safer across a wider range
of a patient population. For reference only, the SNPs described herein, including
the variant proteins and encoding polymorphic nucleic acid molecules, are useful in
conjunction with a variety of toxicology methods established in the art, such as those
set forth in
Current Protocols in Toxicology, John Wiley & Sons, Inc., N.Y.
[0207] Furthermore, therapeutic agents that target any art-known proteins (or nucleic acid
molecules, either RNA or DNA) may cross-react with the variant proteins (or polymorphic
nucleic acid molecules) described herein thereby significantly affecting the pharmacokinetic
properties of the drug. Consequently, the protein variants and the SNP-containing
nucleic acid molecules disclosed herein are useful in developing, screening, and evaluating
therapeutic agents that target corresponding art-known protein forms (or nucleic acid
molecules). Additionally, as discussed above, knowledge of all polymorphic forms of
a particular drug target enables the design of therapeutic agents that are effective
against most or all such polymorphic forms of the drug target.
Pharmaceutical Compositions and Administration Thereof
[0208] Any of the liver fibrosis-associated proteins, and encoding nucleic acid molecules,
disclosed herein can be used as therapeutic targets (or directly used themselves as
therapeutic compounds) for treating liver fibrosis and related pathologies, and the
present disclosure enables therapeutic compounds (
e.g., small molecules, antibodies, therapeutic proteins, RNAi and antisense molecules,
etc.) to be developed that target (or are comprised of) any of these therapeutic targets.
[0209] In general, a therapeutic compound will be administered in a therapeutically effective
amount by any of the accepted modes of administration for agents that serve similar
utilities. The actual amount of the therapeutic compound of this description,
i.e., the active ingredient, will depend upon numerous factors such as the severity of
the disease to be treated, the age and relative health of the subject, the potency
of the compound used, the route and form of administration, and other factors.
[0210] Therapeutically effective amounts of therapeutic compounds may range from, for example,
approximately 0.01-50 mg per kilogram body weight of the recipient per day; preferably
about 0.1-20 mg/kg/day. Thus, as an example, for administration to a 70 kg person,
the dosage range would most preferably be about 7 mg to 1.4 g per day.
[0211] In general, therapeutic compounds will be administered as pharmaceutical compositions
by any one of the following routes: oral, systemic (
e.g., transdermal, intranasal, or by suppository), or parenteral (
e.g., intramuscular, intravenous, or subcutaneous) administration. The preferred manner
of administration is oral or parenteral using a convenient daily dosage regimen, which
can be adjusted according to the degree of affliction. Oral compositions can take
the form of tablets, pills, capsules, semisolids, powders, sustained release formulations,
solutions, suspensions, elixirs, aerosols, or any other appropriate compositions.
[0212] The choice of formulation depends on various factors such as the mode of drug administration
(
e.g., for oral administration, formulations in the form of tablets, pills, or capsules
are preferred) and the bioavailability of the drug substance. Recently, pharmaceutical
formulations have been developed especially for drugs that show poor bioavailability
based upon the principle that bioavailability can be increased by increasing the surface
area,
i.e., decreasing particle size. For example,
U.S. Patent No. 4,107,288 describes a pharmaceutical formulation having particles in the size range from 10
to 1,000 nm in which the active material is supported on a cross-linked matrix of
macromolecules.
U.S. Patent No. 5,145,684 describes the production of a pharmaceutical formulation in which the drug substance
is pulverized to nanoparticles (average particle size of 400 nm) in the presence of
a surface modifier and then dispersed in a liquid medium to give a pharmaceutical
formulation that exhibits remarkably high bioavailability.
[0213] Pharmaceutical compositions are comprised of, in general, a therapeutic compound
in combination with at least one pharmaceutically acceptable excipient. Acceptable
excipients are non-toxic, aid administration, and do not adversely affect the therapeutic
benefit of the therapeutic compound. Such excipients may be any solid, liquid, semi-solid
or, in the case of an aerosol composition, gaseous excipient that is generally available
to one skilled in the art.
[0214] Solid pharmaceutical excipients include starch, cellulose, talc, glucose, lactose,
sucrose, gelatin, malt, rice, flour, chalk, silica gel, magnesium stearate, sodium
stearate, glycerol monostearate, sodium chloride, dried skim milk and the like. Liquid
and semisolid excipients may be selected from glycerol, propylene glycol, water, ethanol
and various oils, including those of petroleum, animal, vegetable or synthetic origin,
e.g., peanut oil, soybean oil, mineral oil, sesame oil, etc. Preferred liquid carriers,
particularly for injectable solutions, include water, saline, aqueous dextrose, and
glycols.
[0215] Compressed gases may be used to disperse a compound of this description in aerosol
form. Inert gases suitable for this purpose are nitrogen, carbon dioxide, etc.
[0217] The amount of the therapeutic compound in a formulation can vary within the full
range employed by those skilled in the art. Typically, the formulation will contain,
on a weight percent (wt %) basis, from about 0.01-99.99 wt % of the therapeutic compound
based on the total formulation, with the balance being one or more suitable pharmaceutical
excipients. Preferably, the compound is present at a level of about 1-80 wt %.
[0218] Therapeutic compounds can be administered alone or in combination with other therapeutic
compounds or in combination with one or more other active ingredient(s). For example,
an inhibitor or stimulator of a liver fibrosis-associated protein can be administered
in combination with another agent that inhibits or stimulates the activity of the
same or a different liver fibrosis-associated protein to thereby counteract the affects
of liver fibrosis.
Human Identification Applications
[0220] For reference only in addition to their diagnostic and therapeutic uses in liver
fibrosis and related pathologies, the SNPs provided herein are also useful as human
identification markers for such applications as forensics, paternity testing, and
biometrics (see,
e.g.,
Gill, "An assessment of the utility of single nucleotide polymorphisms (SNPs) for
forensic purposes", Int J Legal Med. 2001;114(4-5):204-10). Genetic variations in the nucleic acid sequences between individuals can be used
as genetic markers to identify individuals and to associate a biological sample with
an individual. Determination of which nucleotides occupy a set of SNP positions in
an individual identifies a set of SNP markers that distinguishes the individual. The
more SNP positions that are analyzed, the lower the probability that the set of SNPs
in one individual is the same as that in an unrelated individual. Preferably, if multiple
sites are analyzed, the sites are unlinked (
i.e., inherited independently). Thus, preferred sets of SNPs can be selected from among
the SNPs disclosed herein, which may include SNPs on different chromosomes, SNPs on
different chromosome arms, and/or SNPs that are dispersed over substantial distances
along the same chromosome arm.
[0221] Furthermore, among the SNPs disclosed herein, preferred SNPs for use in certain forensic/human
identification applications include SNPs located at degenerate codon positions (
i.e., the third position in certain codons which can be one of two or more alternative
nucleotides and still encode the same amino acid), since these SNPs do not affect
the encoded protein. SNPs that do not affect the encoded protein are expected to be
under less selective pressure and are therefore expected to be more polymorphic in
a population, which is typically an advantage for forensic/human identification applications.
However, for certain forensics/human identification applications, such as predicting
phenotypic characteristics (
e.g., inferring ancestry or inferring one or more physical characteristics of an individual)
from a DNA sample, it may be desirable to utilize SNPs that affect the encoded protein.
[0222] For the SNP disclosed in Tables 1-2 Tables 1-2 provide the SNP allele frequency obtained
by re-sequencing the DNA of chromosomes from 39 individuals . The allele frequencies
provided in Tables 1-2 enable the SNP to be readily used for human identification
applications. The closer that the frequency of the minor allele at a particular SNP
site is to 50%, the greater the ability of that SNP to discriminate between different
individuals in a population since it becomes increasingly likely that two randomly
selected individuals would have different alleles at that SNP site. Using the SNP
allele frequency provided in Tables 1-2, one of ordinary skill in the art could readily
select a subset of SNPs for which the frequency of the minor allele is, for example,
at least 1%, 2%, 5%, 10%, 20%, 25%, 30%, 40%, 45%, or 50%, or any other frequency
in-between. Thus, since allele frequencies are based on the re-sequencing of the chromosomes
from 39 individuals, a subset of SNPs could readily be selected for human identification
in which the total allele count of the minor allele at a particular SNP site is, for
example, at least 1, 2, 4, 8, 10, 16, 20, 24, 30, 32, 36, 38, 39, 40, or any other
number in-between.
[0223] For reference only, Tables 1-2 also provide population group (interchangeably referred
to herein as ethnic or racial groups) information coupled with the extensive allele
frequency information. For example, the group of 39 individuals whose DNA was re-sequenced
was made-up of 20 Caucasians and 19 African-Americans. This population group information
enables further refinement of SNP selection for human identification. For example,
preferred SNPs for human identification are SNPs that have similar allele frequencies
in both the Caucasian and African-American populations; thus, for example, preferred
SNPs have equally high discriminatory power in both populations. Alternatively, SNPs
can be selected for which there is a statistically significant difference in allele
frequencies between the Caucasian and African-American populations (as an extreme
example, a particular allele may be observed only in either the Caucasian or the African-American
population group but not observed in the other population group); such SNPs are useful,
for example, for predicting the race/ethnicity of an unknown perpetrator from a biological
sample such as a hair or blood stain recovered at a crime scene. For a discussion
of using SNPs to predict ancestry from a DNA sample, including statistical methods,
see
Frudakis et al., "A Classifier for the SNP-Based Inference of Ancestry", Journal of
Forensic Sciences 2003; 48(4):771-782.
[0224] SNPs have numerous advantages over other types of polymorphic markers, such as short
tandem repeats (STRs). For example, SNPs can be easily scored and are amenable to
automation, making SNPs the markers of choice for large-scale forensic databases.
SNPs are found in much greater abundance throughout the genome than repeat polymorphisms.
Population frequencies of two polymorphic forms can usually be determined with greater
accuracy than those of multiple polymorphic forms at multi-allelic loci. SNPs are
mutationaly more stable than repeat polymorphisms. SNPs are not susceptible to artefacts
such as stutter bands that can hinder analysis. Stutter bands are frequently encountered
when analyzing repeat polymorphisms, and are particularly troublesome when analyzing
samples such as crime scene samples that may contain mixtures of DNA from multiple
sources. Another significant advantage of SNP markers over STR markers is the much
shorter length of nucleic acid needed to score a SNP. For example, STR markers are
generally several hundred base pairs in length. A SNP, on the other hand, comprises
a single nucleotide, and generally a short conserved region on either side of the
SNP position for primer and/or probe binding. This makes SNPs more amenable to typing
in highly degraded or aged biological samples that are frequently encountered in forensic
casework in which DNA may be fragmented into short pieces.
[0225] SNPs also are not subject to microvariant and "off-ladder" alleles frequently encountered
when analyzing STR loci. Microvariants are deletions or insertions within a repeat
unit that change the size of the amplified DNA product so that the amplified product
does not migrate at the same rate as reference alleles with normal sized repeat units.
When separated by size, such as by electrophoresis on a polyacrylamide gel, microvariants
do not align with a reference allelic ladder of standard sized repeat units, but rather
migrate between the reference alleles. The reference allelic ladder is used for precise
sizing of alleles for allele classification; therefore alleles that do not align with
the reference allelic ladder lead to substantial analysis problems. Furthermore, when
analyzing multi-allelic repeat polymorphisms, occasionally an allele is found that
consists of more or less repeat units than has been previously seen in the population,
or more or less repeat alleles than are included in a reference allelic ladder. These
alleles will migrate outside the size range of known alleles in a reference allelic
ladder, and therefore are referred to as "off-ladder" alleles. In extreme cases, the
allele may contain so few or so many repeats that it migrates well out of the range
of the reference allelic ladder. In this situation, the allele may not even be observed,
or, with multiplex analysis, it may migrate within or close to the size range for
another locus, further confounding analysis.
[0226] SNP analysis avoids the problems of microvariants and off-ladder alleles encountered
in STR analysis. Importantly, microvariants and off-ladder alleles may provide significant
problems, and may be completely missed, when using analysis methods such as oligonucleotide
hybridization arrays, which utilize oligonucleotide probes specific for certain known
alleles. Furthermore, off-ladder alleles and microvariants encountered with STR analysis,
even when correctly typed, may lead to improper statistical analysis, since their
frequencies in the population are generally unknown or poorly characterized, and therefore
the statistical significance of a matching genotype may be questionable. All these
advantages of SNP analysis are considerable in light of the consequences of most DNA
identification cases, which may lead to life imprisonment for an individual; or re-association
of remains to the family of a deceased individual.
[0227] DNA can be isolated from biological samples such as blood, bone, hair, saliva, or
semen, and compared with the DNA from a reference source at particular SNP positions.
Multiple SNP markers can be assayed simultaneously in order to increase the power
of discrimination and the statistical significance of a matching genotype. For example,
oligonucleotide arrays can be used to genotype a large number of SNPs simultaneously.
The SNPs provided herein can be assayed in combination with other polymorphic genetic
markers, such as other SNPs known in the art or STRs, in order to identify an individual
or to associate an individual with a particular biological sample.
[0228] Furthermore, the SNPs provided herein can be genotyped for inclusion in a database
of DNA genotypes, for example, a criminal DNA databank such as the FBI's Combined
DNA Index System (CODIS) database. A genotype obtained from a biological sample of
unknown source can then be queried against the database to find a matching genotype,
with the SNPs of the present invention providing nucleotide positions at which to
compare the known and unknown DNA sequences for identity. Accordingly, described herein
a database comprising novel SNPs or SNP alleles of the present description (
e.g., the database can comprise information indicating which alleles are possessed by
individual members of a population at one or more novel SNP sites described herein),
such as for use in forensics, biometrics, or other human identification applications.
Such a database typically comprises a computer-based system in which the SNPs or SNP
alleles described herein are recorded on a computer readable medium (see the section
of the present specification entitled "Computer-Related Embodiments").
[0229] For reference only, the SNPs described herein can also be assayed for use in paternity
testing. The object of paternity testing is usually to determine whether a male is
the father of a child. In most cases, the mother of the child is known and thus, the
mother's contribution to the child's genotype can be traced. Paternity testing investigates
whether the part of the child's genotype not attributable to the mother is consistent
with that of the putative father. Paternity testing can be performed by analyzing
sets of polymorphisms in the putative father and the child, with the SNPs of the present
description providing nucleotide positions at which to compare the putative father's
and child's DNA sequences for identity. If the set of polymorphisms in the child attributable
to the father does not match the set of polymorphisms of the putative father, it can
be concluded, barring experimental error, that the putative father is not the father
of the child. If the set of polymorphisms in the child attributable to the father
match the set of polymorphisms of the putative father, a statistical calculation can
be performed to determine the probability of coincidental match, and a conclusion
drawn as to the likelihood that the putative fathers the true biological father of
the child.
[0231] For reference only, the use of the SNPs described herein for human identification
further extends to various authentication systems, commonly referred to as biometric
systems, which typically convert physical characteristics of humans (or other organisms)
into digital data. Biometric systems include various technological devices that measure
such unique anatomical or physiological characteristics as finger, thumb, or palm
prints; hand geometry; vein patterning on the back of the hand; blood vessel patterning
of the retina and color and texture of the iris; facial characteristics; voice patterns;
signature and typing dynamics; and DNA. Such physiological measurements can be used
to verify identity and, for example, restrict or allow access based on the identification.
Examples of applications for biometrics include physical area security, computer and
network security, aircraft passenger check-in and boarding, financial transactions,
medical records access, government benefit distribution, voting, law enforcement,
passports, visas and immigration, prisons, various military applications, and for
restricting access to expensive or dangerous items, such as automobiles or guns (see,
for example, O'Connor,
Stanford Technology Law Review and
U.S. Patent No. 6,119,096),
[0232] For reference only, groups of SNPs, particularly the SNPs described herein, can be
typed to uniquely identify an individual for biometric applications such as those
described above. Such SNP typing can readily be accomplished using, for example, DNA
chips/arrays. Preferably, a minimally invasive means for obtaining a DNA sample is
utilized. For example, PCR amplification enables sufficient quantities of DNA for
analysis to be obtained from buccal swabs or fingerprints, which contain DNA-containing
skin cells and oils that are naturally transferred during contact.
VARIANT PROTEINS, ANTIBODIES, VECTORS & HOST CELLS, & USES THEREOF
Variant Proteins Encoded by SNP-Containing Nucleic Acid Molecules
[0234] Described herein are SNP-containing nucleic acid molecules, many of which encode
proteins having variant amino acid sequences as compared to the art-known (
i.e., wild-type) proteins. Amino acid sequences encoded by the polymorphic nucleic acid
molecules described herein are provided as SEQ ID NOS:262-522 in Table 1 and the Sequence
Listing. These variants will generally be referred to herein as variant proteins/peptides/polypeptides,
or polymorphic proteins/peptides/polypeptides of the present description. The terms
"protein", "peptide", and "polypeptide" are used herein interchangeably.
[0235] For reference only, a variant protein of the present description may be encoded by,
for example, a nonsynonymous nucleotide substitution at any one of the cSNP positions
disclosed herein. In addition, variant proteins may also include proteins whose expression,
structure, and/or function is altered by a SNP disclosed herein, such as a SNP that
creates or destroys a stop codon, a SNP that affects splicing, and a SNP in control/regulatory
elements, e.g. promoters, enhancers, or transcription factor binding domains.
[0236] As used herein, a protein or peptide is said to be "isolated" or "purified" when
it is substantially free of cellular material or chemical precursors or other chemicals.
The variant proteins of the present description can be purified to homogeneity or
other lower degrees of purity. The level of purification will be based on the intended
use. The key feature is that the preparation allows for the desired function of the
variant protein, even if in the presence of considerable amounts of other components.
[0237] As used herein, "substantially free of cellular material" includes preparations of
the variant protein having less than about 30% (by dry weight) other proteins (i.e.,
contaminating protein), less than about 20% other proteins, less than about 10% other
proteins, or less than about 5% other proteins. When the variant protein is recombinantly
produced, it can also be substantially free of culture medium, i.e., culture medium
represents less than about 20% of the volume of the protein preparation.
[0238] The language "substantially free of chemical precursors or other chemicals" includes
preparations of the variant protein in which it is separated from chemical precursors
or other chemicals that are involved in its synthesis. In one embodiment, the language
"substantially free of chemical precursors or other chemicals" includes preparations
of the variant protein having less than about 30% (by dry weight) chemical precursors
or other chemicals, less than about 20% chemical precursors or other chemicals, less
than about 10% chemical precursors or other chemicals, or less than about 5% chemical
precursors or other chemicals.
[0239] An isolated variant protein may be purified from cells that naturally express it,
purified from cells that have been altered to express it (recombinant host cells),
or synthesized using known protein synthesis methods. For example, a nucleic acid
molecule containing SNP(s) encoding the variant protein can be cloned into an expression
vector, the expression vector introduced into a host cell, and the variant protein
expressed in the host cell. The variant protein can then be isolated from the cells
by any appropriate purification scheme using standard protein purification techniques.
Examples of these techniques are described in detail below (
Sambrook and Russell, 2000, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY).
[0240] Described herein are isolated variant proteins that comprise, consist of or consist
essentially of amino acid sequences that contain one or more variant amino acids encoded
by one or more codons which contain a SNP of the present description.
[0241] Accordingly, described herein are variant proteins that consist of amino acid sequences
that contain one or more amino acid polymorphisms (or truncations or extensions due
to creation or destruction of a stop codon, respectively) encoded by the SNPs provided
in Table 1 and/or Table 2. A protein consists of an amino acid sequence when the amino
acid sequence is the entire amino acid sequence of the protein.
[0242] Further, described herein are variant proteins that consist essentially of amino
acid sequences that contain one or more amino acid polymorphisms (or truncations or
extensions due to creation or destruction of a stop codon, respectively) encoded by
the SNPs provided in Table 1 and/or Table 2. A protein consists essentially of an
amino acid sequence when such an amino acid sequence is present with only a few additional
amino acid residues in the final protein.
[0243] Further, described herein are variant proteins that comprise amino acid sequences
that contain one or more amino acid polymorphisms (or truncations or extensions due
to creation or destruction of a stop codon, respectively) encoded by the SNP provided
in Table 1 and/or Table 2. A protein comprises an amino acid sequence when the amino
acid sequence is at least part of the final amino acid sequence of the protein. In
such a fashion, the protein may contain only the variant amino acid sequence or have
additional amino acid residues, such as a contiguous encoded sequence that is naturally
associated with it or heterologous amino acid residues. Such a protein can have a
few additional amino acid residues or can comprise many more additional amino acids.
A brief description of how various types of these proteins can be made and isolated
is provided below.
[0244] For reference only, the variant proteins described herein can be attached to heterologous
sequences to form chimeric or fusion proteins. Such chimeric and fusion proteins comprise
a variant protein operatively linked to a heterologous protein having an amino acid
sequence not substantially homologous to the variant protein. "Operatively linked"
indicates that the coding sequences for the variant protein and the heterologous protein
are ligated in-frame. The heterologous protein can be fused to the N-terminus or C-terminus
of the variant protein. In another aspect, the fusion protein is encoded by a fusion
polynucleotide that is synthesized by conventional techniques including automated
DNA synthesizers. Alternatively, PCR amplification of gene fragments can be carried
out using anchor primers which give rise to complementary overhangs between two consecutive
gene fragments which can subsequently be annealed and re-amplified to generate a chimeric
gene sequence (see
Ausubel et al., Current Protocols in Molecular Biology, 1992). Moreover, many expression vectors are commercially available that already encode
a fusion moiety (
e.g., a GST protein). A variant protein-encoding nucleic acid can be cloned into such
an expression vector such that the fusion moiety is linked in-frame to the variant
protein.
[0245] In many uses, the fusion protein does not affect the activity of the variant protein.
The fusion protein can include, but is not limited to, enzymatic fusion proteins,
for example, beta-galactosidase fusions, yeast two-hybrid GAL fusions, poly-His fusions,
MYC-tagged, HI-tagged and Ig fusions. Such fusion proteins, particularly poly-His
fusions, can facilitate their purification following recombinant expression. In certain
host cells (
e.g., mammalian host cells), expression and/or secretion of a protein can be increased
by using a heterologous signal sequence. Fusion proteins are further described in,
for example,
Terpe, "Overview of tag protein fusions: from molecular and biochemical fundamentals
to commercial systems", Appl Microbiol Biotechnol. 2003 Jan;60(5):523-33. Epub 2002
Nov 07;
Graddis et al., "Designing proteins that work using recombinant technologies", Curr
Pharm Biotechnol. 2002 Dec;3(4):285-97; and
Nilsson et al., "Affinity fusion strategies for detection, purification, and immobilization
of recombinant proteins", Protein Expr Purif. 1997 Oct;11(1):1-16.
[0246] The present disclosure also relates to further obvious variants of the variant polypeptides
described herein, such as naturally-occurring mature forms (
e.g., alleleic variants), non-naturally occurring recombinantly-derived variants, and
orthologs and paralogs of such proteins that share sequence homology. Such variants
can readily be generated using art-known techniques in the fields of recombinant nucleic
acid technology and protein biochemistry. It is understood, however, that variants
exclude those known in the prior art before the present disclosure.
[0247] Further variants of the variant polypeptides disclosed in Table 1 can comprise an
amino acid sequence that shares at least 70-80%, 80-85%, 85-90%, 91%, 92%, 93%, 94%,
95%, 96%, 97%, 98%, or 99% sequence identity with an amino acid sequence disclosed
in Table 1 (or a fragment thereof) and that includes a novel amino acid residue (allele)
disclosed in Table 1 (which is encoded by a novel SNP allele). Thus, an aspect described
herein are polypeptides that have a certain degree of sequence variation compared
with the polypeptide sequences shown in Table 1, but that contain a novel amino acid
residue (allele) encoded by a novel SNP allele disclosed herein. In other words, as
long as a polypeptide contains a novel amino acid residue disclosed herein, other
portions of the polypeptide that flank the novel amino acid residue can vary to some
degree from the polypeptide sequences shown in Table 1.
[0248] For reference only, full-length pre-processed forms, as well as mature processed
forms, of proteins that comprise one of the amino acid sequences disclosed herein
can readily be identified as having complete sequence identity to one of the variant
proteins described herein as well as being encoded by the same genetic locus as the
variant proteins described herein.
[0249] Orthologs of a variant peptide can readily be identified as having some degree of
significant sequence homology/identity to at least a portion of a variant peptide
as well as being encoded by a gene from another organism. Preferred orthologs will
be isolated from non-human mammals, preferably primates, for the development of human
therapeutic targets and agents. Such orthologs can be encoded by a nucleic acid sequence
that hybridizes to a variant peptide-encoding nucleic acid molecule under moderate
to stringent conditions depending on the degree of relatedness of the two organisms
yielding the homologous proteins.
[0250] For reference only, variant proteins include, but are not limited to, proteins containing
deletions, additions and substitutions in the amino acid sequence caused by the SNPs
described herein invention. One class of substitutions is conserved amino acid substitutions
in which a given amino acid in a polypeptide is substituted for another amino acid
of like characteristics. Typical conservative substitutions are replacements, one
for another, among the aliphatic amino acids Ala, Val, Leu, and Ile; interchange of
the hydroxyl residues Ser and Thr; exchange of the acidic residues Asp and Glu; substitution
between the amide residues Asn and Gln; exchange of the basic residues Lys and Arg;
and replacements among the aromatic residues Phe and Tyr. Guidance concerning which
amino acid changes are likely to be phenotypically silent are found in, for example,
Bowie et al., Science 247:1306-1310 (1990).
[0251] Variant proteins can be fully functional or can lack function in one or more activities,
e.g. ability to bind another molecule, ability to catalyze a substrate, ability to
mediate signaling, etc. Fully functional variants typically contain only conservative
variations or variations in non-critical residues or in non-critical regions. Functional
variants can also contain substitution of similar amino acids that result in no change
or an insignificant change in function. Alternatively, such substitutions may positively
or negatively affect function to some degree. Non-functional variants typically contain
one or more non-conservative amino acid substitutions, deletions, insertions, inversions,
truncations or extensions, or a substitution, insertion, inversion, or deletion of
a critical residue or in a critical region.
[0252] Amino acids that are essential for function of a protein can be identified by methods
known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis
(
Cunningham et al., Science 244:1081-1085 (1989)), particularly using the amino acid sequence and polymorphism information provided
in Table 1. The latter procedure introduces single alanine mutations at every residue
in the molecule. The resulting mutant molecules are then tested for biological activity
such as enzyme activity or in assays such as an
in vitro proliferative activity. Sites that are critical for binding partner/substrate binding
can also be determined by structural analysis such as crystallization, nuclear magnetic
resonance or photoaffinity labeling (
Smith et al., J. Mol. Biol. 224:899-904 (1992);
de Vos et al. Science 255:306-312 (1992)).
[0253] Polypeptides can contain amino acids other than the 20 amino acids commonly referred
to as the 20 naturally occurring amino acids. Further, many amino acids, including
the terminal amino acids, may be modified by natural processes, such as processing
and other post-translational modifications, or by chemical modifications techniques
well known in the art. Accordingly, the variant proteins described herein also encompass
derivatives or analogs in which a substituted amino acid residue is not one encoded
by the genetic code, in which a substituent group is included, in which the mature
polypeptide is fused with another compound, such as a compound to increase the half-life
of the polypeptide (
e.g., polyethylene glycol), or in which additional amino acids are fused to the mature
polypeptide, such as a leader or secretory sequence or a sequence for purification
of the mature polypeptide or a pro-protein sequence.
[0254] Known protein modifications include, but are not limited to, acetylation, acylation,
ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of
a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent
attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol,
cross-linking, cyclization, disulfide bond formation, demethylation, formation of
covalent crosslinks, formation of cystine, formation of pyroglutamate, formylation,
gamma carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination,
methylation, myristoylation, oxidation; proteolytic processing, phosphorylation, prenylation,
racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids
to proteins such as arginylation, and ubiquitination.
[0255] Such protein modifications are well known to those of skill in the art and have been
described in great detail in the scientific literature. Several particularly common
modifications, glycosylation, lipid attachment, sulfation, gamma-carboxylation of
glutamic acid residues, hydroxylation and ADP-ribosylation, for instance, are described
in most basic texts, such as
Proteins - Structure and Molecular Properties, 2nd Ed., T.E. Creighton, W. H. Freeman
and Company, New York (1993);
Wold, F., Posttranslational Covalent Modification of Proteins, B.C. Johnson, Ed.,
Academic Press, New York 1-12 (1983);
Seifter et al., Meth. Enzymol. 182: 626-646 (1990); and
Rattan et al., Ann. N.Y. Acad. Sci. 663:48-62 (1992).
[0256] For reference only, described herein are fragments of the variant proteins in which
the fragments contain one or more amino acid sequence variations (
e.g., substitutions, or truncations or extensions due to creation or destruction of a
stop codon) encoded by one or more SNPs disclosed herein. The fragments however, are
not to be construed as encompassing fragments that have been disclosed in the prior
art before the present disclosure.
[0257] As used herein, a fragment may comprise at least about 4, 8, 10, 12, 14, 16, 18,
20, 25, 30, 50, 100 (or any other number in-between) or more contiguous amino acid
residues from a variant protein, wherein at least one amino acid residue is affected
by a SNP of the present description,
e.g., a variant amino acid residue encoded by a nonsynonymous nucleotide substitution
at a cSNP position described herein. The variant amino acid encoded by a cSNP may
occupy any residue position along the sequence of the fragment. Such fragments can
be chosen based on the ability to retain one or more of the biological activities
of the variant protein or the ability to perform a function, e.g., act as an immunogen.
Particularly important fragments are biologically active fragments. Such fragments
will typically comprise a domain or motif of a variant protein described herein
e.g., active site, transmembrane domain, or ligand/substmte binding domain. Other fragments
include, but are not limited to, domain or motif-containing fragments, soluble peptide
fragments, and fragments containing immunogenic structures. Predicted domains and
functional sites are readily identifiable by computer programs well known to those
of skill in the art (
e.g., PROSITE analysis) (
Current Protocols in Protein Science, John Wiley & Sons, N.Y. (2002)).
Uses of Variant Proteins
[0258] For reference only, the variant proteins described herein herein can be used in a
variety of ways, including but not limited to, in assays to determine the biological
activity of a variant protein, such as in a panel of multiple proteins for high-throughput
screening; to raise antibodies or to elicit another type of immune response; as a
reagent (including the labeled reagent) in assays designed to quantitatively determine
levels of the variant protein (or its binding partner) in biological fluids; as a
marker for cells or tissues in which it is preferentially expressed (either constitutively
or at a particular stage of tissue differentiation or development or in a disease
state); as a target for screening for a therapeutic agent; and as a direct therapeutic
agent to be administered into a human subject. Any of the variant proteins disclosed
herein may be developed into reagent grade or kit format for commercialization as
research products. Methods for performing the uses listed above are well known to
those skilled in the art (see,
e.g.,
Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Sambrook
and Russell, 2000, and
Methods in Enzymology: Guide to Molecular Cloning Techniques, Academic Press, Berger,
S. L. and A. R. Kimmel eds., 1987).
[0259] For reference only, the methods described herein include detection of one or more
variant proteins disclosed herein. Variant proteins are disclosed in Table 1 and in
the Sequence Listing as SEQ ID NOS: 262-522. Detection of such proteins can be accomplished
using, for example, antibodies, small molecule compounds, aptamers, ligands/substrates,
other proteins or protein fragments, or other protein-binding agents. Preferably,
protein detection agents are specific for a variant protein described herein and can
therefore discriminate between a variant protein described herein and the wild-type
protein or another variant form. This can generally be accomplished by, for example,
selecting or designing detection agents that bind to the region of a protein that
differs between the variant and wild-type protein, such as a region of a protein that
contains one or more amino acid substitutions that is/are encoded by a non-synonymous
cSNP described herein, or a region of a protein that follows a nonsense mutation-type
SNP that creates a stop codon thereby leading to a shorter polypeptide, or a region
of a protein that follows a read-through mutation-type SNP that destroys a stop codon
thereby leading to a longer polypeptide in which a portion of the polypeptide is present
in one version of the polypeptide but not the other.
[0260] In another specific aspect, the variant proteins described herein are used as targets
for diagnosing liver fibrosis or for determining predisposition to liver fibrosis
in a human. Accordingly, described herein are methods for detecting the presence of,
or levels of, one or more variant proteins described herein in a cell, tissue, or
organism. Such methods typically involve contacting a test sample with an agent (
e.g., an antibody, small molecule compound, or peptide) capable of interacting with the
variant protein such that specific binding of the agent to the variant protein can
be detected. Such an assay can be provided in a single detection format or a multi-detection
format such as an array, for example, an antibody or aptamer array (arrays for protein
detection may also be referred to as "protein chips"). The variant protein of interest
can be isolated from a test sample and assayed for the presence of a variant amino
acid sequence encoded by one or more SNPs disclosed herein. The SNPs may cause changes
to the protein and the corresponding protein function/activity, such as through non-synonymous
substitutions in protein coding regions that can lead to amino acid substitutions,
deletions, insertions, and/or rearrangements; formation or destruction of stop codons;
or alteration of control elements such as promoters. SNPs may also cause inappropriate
post-translational modifications.
[0261] One preferred agent for detecting a variant protein in a sample is an antibody capable
of selectively binding to a variant form of the protein (antibodies are described
in greater detail in the next section). Such samples include, for example, tissues,
cells, and biological fluids isolated from a subject, as well as tissues, cells and
fluids present within a subject.
[0262] In vitro methods for detection of the variant proteins associated with liver fibrosis that
are disclosed herein and fragments thereof include, but are not limited to, enzyme
linked immunosorbent assays (ELISAs), radioimmunoassays (RIA), Western blots, immunoprecipitations,
immunofluorescence, and protein arrays/chips (
e.g., arrays of antibodies or aptamers). For further information regarding immunoassays
and related protein detection methods, see
Current Protocols in Immunology, John Wiley & Sons, N.Y., and
Hage, "Immunoassays", Anal Chem. 1999 Jun 15;71(12):294R-304R.
[0263] Additional analytic methods of detecting amino acid variants include, but are not
limited to, altered electrophoretic mobility, altered tryptic peptide digest, altered
protein activity in cell-based or cell-free assay, alteration in ligand or antibody-binding
pattern, altered isoelectric point, and direct amino acid sequencing.
[0264] Alternatively, variant proteins can be detected in vivo in a subject by introducing
into the subject a labeled antibody (or other type of detection reagent) specific
for a variant protein. For example, the antibody can be labeled with a radioactive
marker whose presence and location in a subject can be detected by standard imaging
techniques.
[0265] For reference only, other uses of the variant peptides described herein are based
on the class or action of the protein. For example, proteins isolated from humans
and their mammalian orthologs serve as targets for identifying agents (
e.g., small molecule drugs or antibodies) for use in therapeutic applications; particularly
for modulating a biological or pathological response in a cell or tissue that expresses
the protein. Pharmaceutical agents can be developed that modulate protein activity.
[0266] As an alternative to modulating gene expression, therapeutic compounds can be developed
that modulate protein function. For example, many SNPs disclosed herein affect the
amino acid sequence of the encoded protein (
e.g., non-synonymous cSNPs and nonsense mutation-type SNPs). Such alterations in the
encoded amino acid sequence may affect protein function, particularly if such amino
acid sequence variations occur in functional protein domains, such as catalytic domains,
ATP-binding domains, or ligand/substrate binding domains. It is well established in
the art that variant proteins having amino acid sequence variations in functional
domains can cause or influence pathological conditions. In such instances, compounds
(
e.g., small molecule drugs or antibodies) can be developed that target the variant protein
and modulate (
e.g., up- or down-regulate) protein function/activity.
[0267] For reference only, the therapeutic methods described herein further include methods
that target one or more variant proteins disclosed herein. Variant proteins can be
targeted using, for example, small molecule compounds, antibodies, aptamers, ligands/substrates,
other proteins, or other protein-binding agents. Additionally, the skilled artisan
will recognize that the novel protein variants (and polymorphic nucleic acid molecules)
disclosed in Table 1 may themselves be directly used as therapeutic agents by acting
as competitive inhibitors of corresponding art-known proteins (or nucleic acid molecules
such as mRNA molecules).
[0268] The variant proteins described herein are particularly useful in drug screening assays,
in cell-based or cell-free systems. Cell-based systems can utilize cells that naturally
express the protein, a biopsy specimen, or cell cultures. In one embodiment, cell-based
assays involve recombinant host cells expressing the variant protein. Cell-free assays
can be used to detect the ability of a compound to directly bind to a variant protein
or to the corresponding SNP-containing nucleic acid fragment that encodes the variant
protein.
[0269] A variant protein described herein, as well as appropriate fragments thereof, can
be used in high-throughput screening assays to test candidate compounds for the ability
to bind and/or modulate the activity of the variant protein. These candidate compounds
can be further screened against a protein having normal function (
e.g., a wild-type/non-variant protein) to further determine the effect of the compound
on the protein activity. Furthermore, these compounds can be tested in animal or invertebrate
systems to determine
in vivo activity/effectiveness. Compounds can be identified that activate (agonists) or inactivate
(antagonists) the variant protein, and different compounds can be identified that
cause various degrees of activation or inactivation of the variant protein.
[0270] Further, the variant proteins can be used to screen a compound for the ability to
stimulate or inhibit interaction between the variant protein and a target molecule
that normally interacts with the protein. The target can be a ligand, a substrate
or a binding partner that the protein normally interacts with (for example, epinephrine
or norepinephrine). Such assays typically include the steps of combining the variant
protein with a candidate compound under conditions that allow the variant protein,
or fragment thereof, to interact with the target molecule, and to detect the formation
of a complex between the protein and the target or to detect the biochemical consequence
of the interaction with the variant protein and the target, such as any of the associated
effects of signal transduction.
[0271] Candidate compounds include, for example, 1) peptides such as soluble peptides, including
Ig-tailed fusion peptides and members of random peptide libraries (see,
e.g., Lam et al., Nature 354:82-84 (1991);
Houghten et al., Nature 354:84-86 (1991)) and combinatorial chemistry-derived molecular libraries made of D- and/or L- configuration
amino acids; 2) phosphopeptides (
e.g., members of random and partially degenerate, directed phosphopeptide libraries,
see,
e.g.,
Songyang et al., Cell 72:767-778 (1993)); 3) antibodies (
e.g., polyclonal, monoclonal, humanized, anti-idiotypic, chimeric, and single chain antibodies
as well as Fab, F(ab')
2, Fab expression library fragments, and epitope-binding fragments of antibodies);
and 4) small organic and inorganic molecules (
e.g., molecules obtained from combinatorial and natural product libraries).
[0272] One candidate compound is a soluble fragment of the variant protein that competes
for ligand binding. Other candidate compounds include mutant proteins or appropriate
fragments containing mutations that affect variant protein function and thus compete
for ligand. Accordingly, a fragment that competes for ligand, for example with a higher
affinity, or a fragment that binds ligand but does not allow release, is encompassed
by the disclosure.
[0273] For reference only, the description further includes other end point assays to identify
compounds that modulate (stimulate or inhibit) variant protein activity. The assays
typically involve an assay of events in the signal transduction pathway that indicate
protein activity. Thus, the expression of genes that are up or down-regulated in response
to the variant protein dependent signal cascade can be assayed. In one embodiment,
the regulatory region of such genes can be operably linked to a marker that is easily
detectable, such as luciferase. Alternatively, phosphorylation of the variant protein,
or a variant protein target, could also be measured. Any of the biological or biochemical
functions mediated by the variant protein can be used as an endpoint assay. These
include all of the biochemical or biological events described herein, in the references
cited herein, for these endpoint assay targets, and other functions known to those
of ordinary skill in the art.
[0274] Binding and/or activating compounds can also be screened by using chimeric variant
proteins in which an amino terminal extracellular domain or parts thereof, an entire
transmembrane domain or subregions, and/or the carboxyl terminal intracellular domain
or parts thereof, can be replaced by heterologous domains or subregions. For example,
a substrate-binding region can be used that interacts with a different substrate than
that which is normally recognized by a variant protein. Accordingly, a different set
of signal transduction components is available as an end-point assay for activation.
This allows for assays to be performed in other than the specific host cell from which
the variant protein is derived.
[0275] The variant proteins are also useful in competition binding assays in methods designed
to discover compounds that interact with the variant protein. Thus, a compound can
be exposed to a variant protein under conditions that allow the compound to bind or
to otherwise interact with the variant protein. A binding partner, such as ligand,
that normally interacts with the variant protein is also added to the mixture. If
the test compound interacts with the variant protein or its binding partner, it decreases
the amount of complex formed or activity from the variant protein. This type of assay
is particularly useful in screening for compounds that interact with specific regions
of the variant protein (
Hodgson, Bio/technology, 1992, Sept 10(9), 973-80).
[0276] To perform cell-free drug screening assays, it is sometimes desirable to immobilize
either the variant protein or a fragment thereof, or its target molecule, to facilitate
separation of complexes from uncomplexed forms of one or both of the proteins, as
well as to accommodate automation of the assay. Any method for immobilizing proteins
on matrices can be used in drug screening assays. In one embodiment, a fusion protein
containing an added domain allows the protein to be bound to a matrix. For example,
glutathione-S-transferase/
125I fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical,
St. Louis, MO) or glutathione derivatized microtitre plates, which are then combined
with the cell lysates (
e.g., 35S-labeled) and a candidate compound, such as a drug candidate, and the mixture incubated
under conditions conducive to complex formation (
e.g., at physiological conditions for salt and pH). Following incubation, the beads can
be washed to remove any unbound label, and the matrix immobilized and radiolabel determined
directly, or in the supernatant after the complexes are dissociated. Alternatively,
the complexes can be dissociated from the matrix, separated by SDS-PAGE, and the level
of bound material found in the bead fraction quantitated from the gel using standard
electrophoretic techniques.
[0277] Either the variant protein or its target molecule can be immobilized utilizing conjugation
of biotin and streptavidin. Alternatively, antibodies reactive with the variant protein
but which do not interfere with binding of the variant protein to its target molecule
can be derivatized to the wells of the plate, and the variant protein trapped in the
wells by antibody conjugation. Preparations of the target molecule and a candidate
compound are incubated in the variant protein-presenting wells and the amount of complex
trapped in the well can be quantitated. Methods for detecting such complexes, in addition
to those described above for the GST-immobilized complexes, include immunodetection
of complexes using antibodies reactive with the protein target molecule, or which
are reactive with variant protein and compete with the target molecule, and enzyme-linked
assays that rely on detecting an enzymatic activity associated with the target molecule.
[0278] Modulators of variant protein activity identified according to these drug screening
assays can be used to treat a subject with a disorder mediated by the protein pathway,
such as liver fibrosis. These methods of treatment typically include the steps of
administering the modulators of protein activity in a pharmaceutical composition to
a subject in need of such treatment.
[0279] For reference only, the variant proteins, or fragments thereof, disclosed herein
can themselves be directly used to treat a disorder characterized by an absence of,
inappropriate, or unwanted expression or activity of the variant protein. Accordingly,
methods for treatment include the use of a variant protein disclosed herein or fragments
thereof.
[0281] The two-hybrid system is based on the modular nature of most transcription factors,
which typically consist of separable DNA-binding and activation domains. Briefly,
the assay typically utilizes two different DNA constructs. In one construct, the gene
that codes for a variant protein is fused to a gene encoding the DNA binding domain
of a known transcription factor (
e.g., GAL-4). In the other construct, a DNA sequence, from a library of DNA sequences,
that encodes an unidentified protein ("prey" or "sample") is fused to a gene that
codes for the activation domain of the known transcription factor. If the "bait" and
the "prey" proteins are able to interact,
in vivo, forming a variant protein-dependent complex, the DNA-binding and activation domains
of the transcription factor are brought into close proximity. This proximity allows
transcription of a reporter gene (
e.g., LacZ) that is operably linked to a transcriptional regulatory site responsive to
the transcription factor. Expression of the reporter gene can be detected, and cell
colonies containing the functional transcription factor can be isolated and used to
obtain the cloned gene that encodes the protein that interacts with the variant protein.
Antibodies Directed to Variant Proteins
[0282] For reference only, described herein are antibodies that selectively bind to the
variant proteins disclosed herein and fragments thereof. Such antibodies may be used
to quantitatively or qualitatively detect the variant proteins described herein. As
used herein, an antibody selectively binds a target variant protein when it binds
the variant protein and does not significantly bind to non-variant proteins, i.e.,
the antibody does not significantly bind to normal, wild-type, or art-known proteins
that do not contain a variant amino acid sequence due to one or more SNPs described
herein (variant amino acid sequences may be due to, for example, nonsynonymous cSNPs,
nonsense SNPs that create a stop codon, thereby causing a truncation of a polypeptide
or SNPs that cause read-through mutations resulting in an extension of a polypeptide).
[0283] As used herein, an antibody is defined in terms consistent with that recognized in
the art: they are multi-subunit proteins produced by an organism in response to an
antigen challenge. The antibodies described herein include both monoclonal antibodies
and polyclonal antibodies, as well as antigen-reactive proteolytic fragments of such
antibodies, such as Fab, F(ab)'
2, and Fv fragments. In addition, an antibody of the present description further includes
any of a variety of engineered antigen-binding molecules such as a chimeric antibody
(
U.S. Patent Nos. 4,816,567 and
4,816,397;
Morrison et al., Proc. Natl. Acad. Sci. USA, 81:6851,1984;
Neuberger et al., Nature 312:604,1984), a humanized antibody (
U.S. Patent Nos. 5,693,762;
5,585,089; and
5,565,332), a single-chain Fv (
U.S. Patent No. 4,946,778;
Ward et al., Nature 334:544,1989), a bispecific antibody with two binding specificities (
Segal et al., J. Immunol. Methods 248:1, 2001;
Carter, J. Immunol. Methods 248:7,2001), a diabody, a triabody, and a tetrabody (
Todorovska et al., J. Immunol. Methods, 248:47, 2001), as well as a Fab conjugate (dimer or trimer), and a minibody.
[0284] Many methods are known in the art for generating and/or identifying antibodies to
a given target antigen (
Harlow, Antibodies, Cold Spring Harbor Press, (1989)). In general, an isolated peptide (
e.g., a variant protein described herein is used as an immunogen and is administered
to a mammalian organism, such as a rat, rabbit, hamster or mouse. Either a full-length
protein, an antigenic peptide fragment (
e.g., a peptide fragment containing a region that varies between a variant protein and
a corresponding wild-type protein), or a fusion protein can be used. A protein used
as an immunogen may be naturally-occurring, synthetic or recombinantly produced, and
may be administered in combination with an adjuvant, including but not limited to,
Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface
active substance such as lysolecithin, pluronic polyols, polyanions, peptides, oil
emulsions, keyhole limpet hemocyanin, dinitrophenol, and the like.
[0285] Monoclonal antibodies can be produced by hybridoma technology (
Kohler and Milstein, Nature, 256: 495, 1975), which immortalizes cells secreting a specific monoclonal antibody. The immortalized
cell lines can be created
in vitro by fusing two different cell types, typically lymphocytes, and tumor cells. The hybridoma
cells may be cultivated
in vitro or
in vivo. Additionally, fully human antibodies can be generated by transgenic animals (
He et al., J. Immunol., 169:595, 2002). Fd phage and Fd phagemid technologies may be used to generate and select recombinant
antibodies
in vitro (
Hoogenboom and Chames, Immunol. Today 21:371, 2000;
Liu et al., J. Mol. Biol. 315:1063, 2002). The complementarity-determining regions of an antibody can be identified, and synthetic
peptides corresponding to such regions may be used to mediate antigen binding (
U.S. Patent No. 5,637,677).
[0286] Antibodies are preferably prepared against regions or discrete fragments of a variant
protein containing a variant amino acid sequence as compared to the corresponding
wild-type protein (
e.g., a region of a variant protein that includes an amino acid encoded by a nonsynonymous
cSNP, a region affected by truncation caused by a nonsense SNP that creates a stop
codon, or a region resulting from the destruction of a stop codon due to read-through
mutation caused by a SNP). Furthermore, preferred regions will include those involved
in function/activity and/or protein/binding partner interaction. Such fragments can
be selected on a physical property, such as fragments corresponding to regions that
are located on the surface of the protein,
e.g., hydrophilic regions, or can be selected based on sequence uniqueness, or based
on the position of the variant amino acid residue(s) encoded by the SNPs described
herein. An antigenic fragment will typically comprise at least about 8-10 contiguous
amino acid residues in which at least one of the amino acid residues is an amino acid
affected by a SNP disclosed herein. The antigenic peptide can comprise, however, at
least 12, 14, 16, 20, 25, 50, 100 (or any other number in-between) or more amino acid
residues, provided that at least one amino acid is affected by a SNP disclosed herein.
[0287] For reference only, detection of an antibody described herein can be facilitated
by coupling (
i.e., physically linking) the antibody or an antigen-reactive fragment thereof to a detectable
substance. Detectable substances include, but are not limited to, various enzymes,
prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials,
and radioactive materials. Examples of suitable enzymes include horseradish peroxidase,
alkaline phosphatase, β-galactosidase, or acetylcholinesterase; examples of suitable
prosthetic group complexes include streptaviclin/biotin and avidin/biotin; examples
of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein
isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or
phycoerythrin; an example of a luminescent material includes luminol; examples of
bioluminescent materials include luciferase, luciferin, and aequorin, and examples
of suitable radioactive material include
12I,
131I,
35S or
3H.
[0288] Antibodies, particularly the use of antibodies as therapeutic agents, are reviewed
in:
Morgan, "Antibody therapy for Alzheimer's disease", Expert Rev Vaccines. 2003 Feb;2(1):53-9;
Ross et al., "Anticancer antibodies", Am J Clim Pathol. 2003 Apr;119(4):472-85;
Goldenberg, "Advancing role of radiolabeled antibodies in the therapy of cancer",
Cancer Immunol Immunother. 2003 May;52(5):281-96. Epub 2003 Mar 11;
Ross et al., "Antibody-based therapeutics in oncology", Expert Rev Anticancer Ther.
2003 Feb;3(1):107-21;
Cao et al., "Bispecific antibody conjugates in therapeutics", Adv Drug Deliv Rev.
2003 Feb 10;55(2):171-97; von
Mehren et al., "Monoclonal antibody therapy for cancer", Annu Rev Med. 2003;54:343-69.
Epub 2001 Dec 03;
Hudson et al., "Engineered antibodies", Nat Med. 2003 Jan;9(1):129-34;
Brekke et al., "Therapeutic antibodies for human diseases at the dawn of the twenty-first
century", Nat Rev Drug Discov. 2003 Jan;2(1):52-62 (
Erratum in: Nat Rev Drug Discov. 2003 Mar;2(3):240); Houdebine, "
Antibody manufacture in transgenic animals and comparisons with other systems", Curr
Opin Biotechnol. 2002 Dec;13(6):625-9;
Andreakos et al., "Monoclonal antibodies in immune and inflammatory diseases", Curr
Opin Biotechnol. 2002 Dec;13(6):615-20;
Kellermann et al., "Antibody discovery: the use of transgenic mice to generate human
monoclonal antibodies for therapeutics", Curr Opin Biotechnol. 2002 Dec;13(6):593-7;
Pini et al., "Phage display and colony filter screening for high-throughput selection
of antibody libraries", Comb Chem High Throughput Screen. 2002 Nov;5(7):503-10;
Batra et al., "Pharmacokinetics and biodistribution of genetically engineered antibodies";
Curr Opin Biotechnol. 2002 Dec;13(6):603-8; and
Tangri et al., "Rationally engineered proteins or antibodies with absent or reduced
immunogenicity", Curr Med Chem. 2002 Dec;9(24):2191-9.
Uses of Antibodies
[0289] For reference only, antibodies can be used to isolate the variant proteins described
herein from a natural cell source or from recombinant host cells by standard techniques,
such as affinity chromatography or immunoprecipitation. In addition, antibodies are
useful for detecting the presence of a variant protein described herein in cells or
tissues to determine the pattern of expression of the variant protein among various
tissues in an organism and over the course of normal development or disease progression.
Further, antibodies can be used to detect variant protein
in situ, in vitro, in a bodily fluid, or in a cell lysate or supernatant in order to evaluate the amount
and pattern of expression. Also, antibodies can be used to assess abnormal tissue
distribution, abnormal expression during development, or expression in an abnormal
condition, such as liver fibrosis. Additionally, antibody detection of circulating
fragments of the full-length variant protein can be used to identify turnover.
[0290] For reference only, antibodies to the variant proteins described herein are also
useful in pharmacogenomic analysis. Thus, antibodies against variant proteins encoded
by alternative SNP alleles can be used to identify individuals that require modified
treatment modalities.
[0291] Further, antibodies can be used to assess expression of the variant protein in disease
states such as in active stages of the disease or in an individual with a predisposition
to a disease related to the protein's function, particularly liver fibrosis. For reference
only, antibodies specific for a variant protein encoded by a SNP-containing nucleic
acid molecule described herein can be used to assay for the presence of the variant
protein, such as to screen for predisposition to liver fibrosis as indicated by the
presence of the variant protein.
[0292] Antibodies are also useful as diagnostic tools for evaluating the variant proteins
in conjunction with analysis by electrophoretic mobility, isoelectric point, tryptic
peptide digest, and other physical assays well known in the art.
[0293] Antibodies are also useful for tissue typing. Thus, where a specific variant protein
has been correlated with expression in a specific tissue, antibodies that are specific
for this protein can be used to identify a tissue type.
[0294] Antibodies can also be used to assess aberrant subcellular localization of a variant
protein in cells in various tissues. The diagnostic uses can be applied, not only
in genetic testing, but also in monitoring a treatment modality. Accordingly, where
treatment is ultimately aimed at correcting the expression level or the presence of
variant protein or aberrant tissue distribution or developmental expression of a variant
protein, antibodies directed against the variant protein or relevant fragments can
be used to monitor therapeutic efficacy.
[0295] The antibodies are also useful for inhibiting variant protein function, for example,
by blocking the binding of a variant protein to a binding partner. These uses can
also be applied in a therapeutic context in which treatment involves inhibiting a
variant protein's function. An antibody can be used, for example, to block or competitively
inhibit binding, thus modulating (agonizing or antagonizing) the activity of a variant
protein. Antibodies can be prepared against specific variant protein fragments containing
sites required for function or against an intact variant protein that is associated
with a cell or cell membrane. For
in vivo administration, an antibody may be linked with an additional therapeutic payload
such as a radionuclide, an enzyme, an immunogenic epitope, or a cytotoxic agent. Suitable
cytotoxic agents include, but are not limited to, bacterial toxin such as diphtheria,
and plant toxin such as ricin: The
in vivo half-life of an antibody or a fragment thereof may be lengthened by pegylation through
conjugation to polyethylene glycol (
Leong et al., Cytokine 16:106, 2001).
[0296] For reference only, described herein are kits for using antibodies, such as kits
for detecting the presence of a variant protein in a test sample. An exemplary kit
can comprise antibodies such as a labeled or labelable antibody and a compound or
agent for detecting variant proteins in a biological sample; means for determining
the amount, or presence/absence of variant protein in the sample; means for comparing
the amount of variant protein in the sample with a standard; and instructions for
use.
Vectors and Host Cells
[0297] Also disclosed herein are vectors containing the SNP-containing nucleic acid molecules
described herein. The term "vector" refers to a vehicle, preferably a nucleic acid
molecule, which can transport a SNP-containing nucleic acid molecule. When the vector
is a nucleic acid molecule, the SNP-containing nucleic acid molecule can be covalently
linked to the vector nucleic acid. Such vectors include, but are not limited to, a
plasmid, single or double stranded phage, a single or double stranded RNA or DNA viral
vector, or artificial chromosome, such as a BAC, PAC, YAC, or MAC.
[0298] A vector can be maintained in a host cell as an extrachromosomal element where it
replicates and produces additional copies of the SNP-containing nucleic acid molecules.
Alternatively, the vector may integrate into the host cell genome and produce additional
copies of the SNP-containing nucleic acid molecules when the host cell replicates.
[0299] Described are vectors for the maintenance (cloning vectors) or vectors for expression
(expression vectors) of the SNP-containing nucleic acid molecules. The vectors can
function in prokaryotic or eukaryotic cells or in both (shuttle vectors).
[0300] Expression vectors typically contain cis-acting regulatory regions that are operably
linked in the vector to the SNP-containing nucleic acid molecules such that transcription
of the SNP-containing nucleic acid molecules is allowed in a host cell. The SNP-containing
nucleic acid molecules can also be introduced into the host cell with a separate nucleic
acid molecule capable of affecting transcription. Thus, the second nucleic acid molecule
may provide a trans-acting factor interacting with the cis-regulatory control region
to allow transcription of the SNP-containing nucleic acid molecules from the vector.
Alternatively, a trans-acting factor may be supplied by the host cell. Finally, a
trans-acting factor can be produced from the vector itself. It is understood, however,
that in some embodiments, transcription and/or translation of the nucleic acid molecules
can occur in a cell-free system.
[0301] The regulatory sequences to which the SNP-containing nucleic acid molecules described
herein can be operably linked include promoters for directing mRNA transcription.
These include, but are not limited to, the left promoter from bacteriophage λ, the
lac, TRP, and TAC promoters from
E.
coli, the early and late promoters from SV40, the CMV immediate early promoter, the adenovirus
early and late promoters, and retrovirus long-terminal repeats.
[0302] In addition to control regions that promote transcription, expression vectors may
also include regions that modulate transcription, such as repressor binding sites
and enhancers. Examples include the SV40 enhancer, the cytomegalovirus immediate early
enhancer, polyoma enhancer, adenovirus enhancers, and retrovirus LTR enhancers.
[0303] In addition to containing sites for transcription initiation and control, expression
vectors can also contain sequences necessary for transcription termination and, in
the transcribed region, a ribosome-binding site for translation. Other regulatory
control elements for expression include initiation and termination codons as well
as polyadenylation signals. A person of ordinary skill in the art would be aware of
the numerous regulatory sequences that are useful in expression vectors (see,
e.g.,
Sambrook and Russell, 2000, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY).
[0304] A variety of expression vectors can be used to express a SNP-containing nucleic acid
molecule. Such vectors include chromosomal, episomal, and virus-derived vectors, for
example, vectors derived from bacterial plasmids, from bacteriophage, from yeast episomes,
from yeast chromosomal elements, including yeast artificial chromosomes, from viruses
such as baculoviruses, papovaviruses such as SV40, Vaccinia viruses, adenoviruses,
poxviruses, pseudorabies viruses, and retroviruses. Vectors can also be derived from
combinations of these sources such as those derived from plasmid and bacteriophage
genetic elements,
e.g., cosmids and phagemids. Appropriate cloning and expression vectors for prokaryotic
and eukaryotic hosts are described in
Sambrook and Russell, 2000, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY.
[0305] The regulatory sequence in a vector may provide constitutive expression in one or
more host cells (
e.g., tissue specific expression) or may provide for inducible expression in one or more
cell types such as by temperature, nutrient additive, or exogenous factor,
e.g., a hormone or other ligand. A variety of vectors that provide constitutive or inducible
expression of a nucleic acid sequence in prokaryotic and eukaryotic host cells are
well known to those of ordinary skill in the art.
[0306] A SNP-containing nucleic acid molecule can be inserted into the vector by methodology
well-known in the art. Generally, the SNP-containing nucleic acid molecule that will
ultimately be expressed is joined to an expression vector by cleaving the SNP-containing
nucleic acid molecule and the expression vector with one or more restriction enzymes
and then ligating the fragments together. Procedures for restriction enzyme digestion
and ligation are well known to those of ordinary skill in the art.
[0307] The vector containing the appropriate nucleic acid molecule can be introduced into
an appropriate host cell for propagation or expression using well-known techniques.
Bacterial host cells include, but are not limited to,
E.
coli, Streptomyces, and
Salmonella typhimurium. Eukaryotic host cells include, but are not limited to, yeast, insect cells such as
Drosophila, animal cells such as COS and CHO cells, and plant cells.
[0308] As described herein, it may be desirable to express the variant peptide as a fusion
protein. Accordingly, disclosed herein are fusion vectors that allow for the production
of the variant peptides. Fusion vectors can, for example, increase the expression
of a recombinant protein, increase the solubility of the recombinant protein, and
aid in the purification of the protein by acting, for example, as a ligand for affinity
purification. A proteolytic cleavage site may be introduced at the junction of the
fusion moiety so that the desired variant peptide can ultimately be separated from
the fusion moiety. Proteolytic enzymes suitable for such use include, but are not
limited to, factor Xa, thrombin, and enterokinase. Typical fusion expression vectors
include pGEX (
Smith et al., Gene 67:31-40 (1988)), pMAL (New England Biolabs, Beverly, MA) and pRIT5 (Pharmacia, Piscataway, NJ)
which fuse glutathione S-transferase (GST), maltose E binding protein, or protein
A, respectively, to the target recombinant protein. Examples of suitable inducible
non-fusion
E. coli expression vectors include pTrc (
Amann et al., Gene 69:301-315 (1988)) and pET 11d (
Studier et al., Gene Expression Technology: Methods in Enzymology 185:60-89 (1990)).
[0310] The SNP-containing nucleic acid molecules can also be expressed by expression vectors
that are operative in yeast. Examples of vectors for expression in yeast (
e.g., S.
cerevisiae) include pYepSec1 (
Baldari, et al., EMBO J. 6:229-234 (1987)), pMFa (
Kurjan et al., Cell 30:933-943(1982)), pJRY88 (
Schultz et al., Gene 54:113-123 (1987)), and pYES2 (Invitrogen Corporation, San Diego, CA).
[0313] Also disclosed herein are vectors in which the SNP-containing nucleic acid molecules
described herein are cloned into the vector in reverse orientation, but operably linked
to a regulatory sequence that permits transcription of antisense RNA. Thus, an antisense
transcript can be produced to the SNP-containing nucleic acid sequences described
herein, including both coding and non-coding regions. Expression of this antisense
RNA is subject to each of the parameters described above in relation to expression
of the sense RNA (regulatory sequences, constitutive or inducible expression, tissue-specific
expression).
[0314] For reference only, described herein are recombinant host cells containing the vectors
described herein. Host cells therefore include, for example, prokaryotic cells, lower
eukaryotic cells such as yeast, other eukaryotic cells such as insect cells, and higher
eukaryotic cells such as mammalian cells.
[0315] The recombinant host cells can be prepared by introducing the vector constructs described
herein into the cells by techniques readily available to persons of ordinary skill
in the art. These include, but are not limited to, calcium phosphate transfection,
DEAE-dextran-mediated transfection, cationic lipid-mediated transfection, electroporation,
transduction, infection, lipofection, and other techniques such as those described
in
Sambrook and Russell, 2000, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY).
[0316] Host cells can contain more than one vector. Thus, different SNP-containing nucleotide
sequences can be introduced in different vectors into the same cell. Similarly, the
SNP-containing nucleic acid molecules can be introduced either alone or with other
nucleic acid molecules that are not related to the SNP-containing nucleic acid molecules,
such as those providing trans-acting factors for expression vectors. When more than
one vector is introduced into a cell, the vectors can be introduced independently,
co-introduced, or joined to the nucleic acid molecule vector.
[0317] In the case of bacteriophage and viral vectors, these can be introduced into cells
as packaged or encapsulated virus by standard procedures for infection and transduction.
Viral vectors can be replication-competent or replication-defective. In the case in
which viral replication is defective, replication can occur in host cells that provide
functions that complement the defects.
[0318] Vectors generally include selectable markers that enable the selection of the subpopulation
of cells that contain the recombinant vector constructs. The marker can be inserted
in the same vector that contains the SNP-containing nucleic acid molecules described
herein or may be in a separate vector. Markers include, for example, tetracycline
or ampicillin-resistance genes for prokaryotic host cells, and dihydrofolate reductase
or neomycin resistance genes for eukaryotic host cells. However, any marker that provides
selection for a phenotypic trait can be effective.
[0319] While the mature variant proteins can be produced in bacteria, yeast, mammalian cells,
and other cells under the control of the appropriate regulatory sequences, cell-free
transcription and translation systems can also be used to produce these variant proteins
using RNA derived from the DNA constructs described herein.
[0320] Where secretion of the variant protein is desired, which is difficult to achieve
with multi-transmembrane domain containing proteins such as G-protein-coupled receptor
(GPCRs), appropriate secretion signals can be incorporated into the vector. The signal
sequence can be endogenous to the peptides or heterologous to these peptides.
[0321] Where the variant protein is not secreted into the medium, the protein can be isolated
from the host cell by standard disruption procedures, including freeze/thaw, sonication,
mechanical disruption, use of lysing agents, and the like. The variant protein can
then be recovered and purified by well-known purification methods including, for example,
ammonium sulfate precipitation, acid extraction, anion or cationic exchange chromatography,
phosphocellulose chromatography, hydrophobic-interaction chromatography, affinity
chromatography, hydroxylapatite chromatography, lectin chromatography, or high performance
liquid chromatography.
[0322] It is also understood that, depending upon the host cell in which recombinant production
of the variant proteins described herein occurs, they can have various glycosylation
patterns, or may be non-glycosylated, as when produced in bacteria. In addition, the
variant proteins may include an initial modified methionine in some cases as a result
of a host-mediated process.
Uses of Vectors and Host Cells, and Transgenic Animals
[0324] Recombinant host cells that express the variant proteins described herein have a
variety of uses. For example, the cells are useful for producing a variant protein
that can be further purified into a preparation of desired amounts of the variant
protein or fragments thereof. Thus, host cells containing expression vectors are useful
for variant protein production.
[0325] Host cells are also useful for conducting cell-based assays involving the variant
protein or variant protein fragments, such as those described above as well as other
formats known in the art. Thus, a recombinant host cell expressing a variant protein
is useful for assaying compounds that stimulate or inhibit variant protein function.
Such an ability of a compound to modulate variant protein function may not be apparent
from assays of the compound on the native/wild-type protein, for from cell-free assays
of the compound. Recombinant host cells are also useful for assaying functional alterations
in the variant proteins as compared with a known function.
[0326] Genetically-engineered host cells can be further used to produce non-human transgenic
animals. A transgenic animal is preferably a non-human mammal, for example, a rodent,
such as a rat or mouse, in which one or more of the cells of the animal include a
transgene. A transgene is exogenous DNA containing a SNP described herein which is
integrated into the genome of a cell from which a transgenic animal develops and which
remains in the genome of the mature animal in one or more of its cell types or tissues.
Such animals are useful for studying the function of a variant protein
in vivo, and identifying and evaluating modulators of variant protein activity. Other examples
of transgenic animals include, but are not limited to, non-human primates, sheep,
dogs, cows, goats, chickens, and amphibians. Transgenic non-human mammals such as
cows and goats can be used to produce variant proteins which can be secreted in the
animal's milk and then recovered.
[0327] A transgenic animal can be produced by introducing a SNP-containing nucleic acid
molecule into the male pronuclei of a fertilized oocyte, e.g., by microinjection or
retroviral infection, and allowing the oocyte to develop in a pseudopregnant female
foster animal. Any nucleic acid molecules that contain one or more SNPs disclosed
herein can potentially be introduced as a transgene into the genome of a non-human
animal.
[0328] Any of the regulatory or other sequences useful in expression vectors can form part
of the transgenic sequence. This includes intronic sequences and polyadenylation signals,
if not already included. A tissue-specific regulatory sequence(s) can be operably
linked to the transgene to direct expression of the variant protein in particular
cells or tissues.
[0329] Methods for generating transgenic animals via embryo manipulation and microinjection,
particularly animals such as mice, have become conventional in the art and are described
in, for example,
U.S. Patent Nos. 4,736,866 and
4,870,009, both by
Leder et al., U.S. Patent No. 4,873,191 by Wagner
et al., and in
Hogan, B., Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, N.Y., 1986). Similar methods are used for production of other transgenic animals. A transgenic
founder animal can be identified based upon the presence of the transgene in its genome
and/or expression of transgenic mRNA in tissues or cells of the animals. A transgenic
founder animal can the be used to breed additional animals carrying the transgene.
Moreover, transgenic animals carrying a transgene can further be bred to other transgenic
animals carrying other transgenes. A transgenic animal also includes a non-human animal
in which the entire animal or tissues in the animal have been produced using the homologously
recombinant host cells described herein.
[0330] In another aspect, transgenic non-human animals can be produced which contain selected
systems that allow for regulated expression of the transgene. One example of such
a system is the cre/loxP recombinase system of bacteriophage P1 (
Lakso et al. PNAS 89:6232-6236 (1992)). Another example of a recombinase system is the FLP recombinase system of
S.
cerevisiae (
O'Gorman et al. Science 251:1351-1355 (1991)). If a cre/loxP recombinase system is used to regulate expression of the transgene,
animals containing transgenes encoding both the Cre recombinase and a selected protein
are generally needed Such animals can be provided through the construction of "double"
transgenic animals,
e.g., by mating two transgenic animals, one containing a transgene encoding a selected
variant protein and the other containing a transgene encoding a recombinase.
[0331] Clones of the non-human transgenic animals described herein can also be produced
according to the methods described in, for example,
Wilmut, I. et al. Nature 385:810-813 (1997) and
PCT International Publication Nos. WO 97/07668 and
WO 97/07669. In brief, a cell (e.g., a somatic cell) from the transgenic animal can be isolated
and induced to exit the growth cycle and enter Go phase. The quiescent cell can then
be fused,
e.g., through the use of electrical pulses, to an enucleated oocyte from an animal of
the same species from which the quiescent cell is isolated. The reconstructed oocyte
is then cultured such that it develops to morula or blastocyst and then transferred
to pseudopregnant female foster animal. The offspring born of this female foster animal
will be a clone of the animal from which the cell (
e.g., a somatic cell) is isolated.
[0332] Transgenic animals containing recombinant cells that express the variant proteins
described herein are useful for conducting the assays described herein in an
in vivo context. Accordingly, the various physiological factors that are present
in vivo and that could influence ligand or substrate binding, variant protein activation,
signal transduction, or other processes or interactions, may not be evident from
in vitro cell-free or cell-based assays. For reference only, non-human transgenic animals
described herein may be used to assay
in vivo variant protein function as well as the activities of a therapeutic agent or compound
that modulates variant protein function/activity or expression. Such animals are also
suitable for assessing the effects of null mutations (
i.e., mutations that substantially or completely eliminate one or more variant protein
functions).
[0333] For further information regarding transgenic animals, see
Houdebine, "Antibody manufacture in transgenic animals and comparisons with other
systems", Curr Opin Biotechnol. 2002 Dec;13(6):625-9;
Petters et al., "Transgenic animals as models for human disease", Transgenic Res.
2000;9(4-5):347-51; discussion 345-6;
Wolf et al., "Use of transgenic animals in understanding molecular mechanisms of toxicity",
J Pharm Pharmacol. 1998 Jun;50(6):56.7-74;
Echelard, "Recombinant protein production in transgenic animals", Curr Opin Biotechnol.1996
Oct;7(5):536-40;
Houdebine, "Transgenic animal bioreactors", Transgenic. Res. 2000;9(4-5):305-20;
Pirity et al., embryonic stem cells, creating transgenic animals", Methods Cell Biol.
1998;57:279-93; and
Robl et al., "Artificial chromosome vectors and expression of complex proteins in
transgenic animals", Theriogenology. 2003 Jan 1;59(1):107-13.
COMPUTER-RELATED EMBODIMENTS
[0334] For reference only, the SNPs described herein may be "provided" in a variety of mediums
to facilitate use thereof. As used in this section, "provided" refers to a manufacture,
other than an isolated nucleic acid molecule, that contains SNP information described
herein. Such a manufacture provides the SNP information in a form that allows a skilled
artisan to examine the manufacture using means not directly applicable to examining
the SNPs or a subset thereof as they exist in nature or in purified form. The SNP
information that may be provided in such a form includes any of the SNP information
described herein such as, for example, polymorphic nucleic acid and/or amino acid
sequence information such as SEQ ID NOS:1-261, SEQ ID NOS:262-522, SEQ ID NOS:4999-5321,
SEQ ID NOS:523-4998, and SEQ ID NOS:5322-34256; information about observed SNP alleles,
alternative codons, populations, allele frequencies, SNP types, and/or affected proteins;
or any other information provided by the present invention in Tables 1-2 and/or the
Sequence Listing.
[0335] In one application of this embodiment, the SNPs disclosed herein can be recorded
on a computer readable medium. As used herein, "computer readable medium" refers to
any medium that can be read and accessed directly by a computer. Such media include,
but are not limited to: magnetic storage media, such as floppy discs, hard disc storage
medium, and magnetic tape; optical storage media such as CD-ROM; electrical storage
media such as RAM and ROM; and hybrids of these categories such as magnetic/optical
storage media. A skilled artisan can readily appreciate how any of the presently known
computer readable media can be used to create a manufacture comprising computer readable
medium having recorded thereon a nucleotide sequence of the present invention. One
such medium, a computer readable medium (CD-R) that has nucleic acid sequences (and
encoded protein sequences) containing SNPs provided/recorded thereon in ASCII text
format in a Sequence Listing along with accompanying Tables that contain detailed
SNP and sequence information (transcript sequences are provided as SEQ ID NOS:1-261,
protein sequences are provided as SEQ ID NOS:262-522, genomic sequences are provided
as SEQ ID NOS:4999-5321, transcript-based context sequences are provided as SEQ ID
NOS:523-4998, and genomic-based context sequences are provided as SEQ ID NOS:5322-34256).
[0336] As used herein, "recorded" refers to a process for storing information on computer
readable medium. A skilled artisan can readily adopt any of the presently known methods
for recording information on computer readable medium to generate manufactures comprising
the SNP information described herein.
[0337] A variety of data storage structures are available to a skilled artisan for creating
a computer readable medium having recorded thereon a nucleotide or amino acid sequence
described herein. The choice of the data storage structure will generally be based
on the means chosen to access the stored information. In addition, a variety of data
processor programs and formats can be used to store the nucleotide/amino acid sequence
information disclosed herein on computer readable medium. For example, the sequence
information can be represented in a word processing text file, formatted in commercially-available
software such as WordPerfect and Microsoft Word, represented in the form of an ASCII
file, or stored in a database application, such as OB2, Sybase, Oracle, or the like.
A skilled artisan can readily adapt any number of data processor structuring formats
(
e.g., text file or database) in order to obtain computer readable medium having recorded
thereon the SNP information disclosed herein.
[0338] By providing the SNPs described herein in computer readable form, a skilled artisan
can routinely access the SNP information for a variety of purposes. Computer software
is publicly available which allows a skilled artisan to access sequence information
provided in a computer readable medium. Examples of publicly available computer software
include BLAST (
Altschul et al., J. Mol. Biol. 215:403-410 (1990)) and BLAZE (
Brutlag et al., Comp. Chem. 17:203-207 (1993)) search algorithms.
[0339] For reference only, described herein are systems, particularly computer-based systems,
which contain the SNP information described herein. Such systems may be designed to
store and/or analyze information on, for example, a large number of SNP positions,
or information on SNP genotypes from a large number of individuals. The SNP information
of disclosed herein represents a valuable information source. The SNP information
of disclosed herein stored/analyzed in a computer-based system may be used for such
computer-intensive applications as determining or analyzing SNP allele frequencies
in a population, mapping disease genes, genotype-phenotype association studies, grouping
SNPs into haplotypes, correlating SNP haplotypes with response to particular drugs,
or for various other bioinformatic, pharmacogenomic, drug development, or human identification/forensic
applications.
[0340] As used herein, "a computer-based system" refers to the hardware means, software
means, and data storage means used to analyze the SNP information described herein.
hardware means of the computer-based systems described herein typically comprises
a central processing unit (CPU), input means, output means, and data storage means.
A skilled artisan can readily appreciate that any one of the currently available computer-based
systems are suitable for use in the described system. Such a system can be changed
into a system described herein by utilizing the SNP information provided in Tables
1 and 2, or a subset thereof, without any experimentation.
[0341] For reference only, the computer-based systems described herein comprise a data storage
means having stored therein SNPs disclosed herein and the necessary hardware means
and software means for supporting and implementing a search means. As used herein,
"data storage means" refers to memory which can store SNP information disclosed herein
, or a memory access means which can access manufactures having recorded thereon the
SNP information disclosed herein.
[0342] As used herein, "search means" refers to one or more programs or algorithms that
are implemented on the computer-based system to identify or analyze SNPs in a target
sequence based on the SNP information stored within the data storage means. Search
means can be used to determine which nucleotide is present at a particular SNP position
in the target sequence. As used herein, a "target sequence" can be any DNA sequence
containing the SNP position(s) to be searched or queried.
[0343] As used herein, "a target structural motif," or "target motif," refers to any rationally
selected sequence or combination of sequences containing a SNP position in which the
sequence(s) is chosen based on a three-dimensional configuration that is formed upon
the folding of the target motif. There are a variety of target motifs known in the
art. Protein target motifs include, but are not limited to, enzymatic active sites
and signal sequences. Nucleic acid target motifs include, but are not limited to,
promoter sequences, hairpin structures, and inducible expression elements (protein
binding sequences).
[0344] A variety of structural formats for the input and output means can be used to input
and output the information in the computer-based systems described herein. An exemplary
format for an output means is a display that depicts the presence or absence of specified
nucleotides (alleles) at particular SNP positions of interest. Such presentation can
provide a rapid, binary scoring system for many SNPs simultaneously.
[0345] One exemplary embodiment of a computer-based system comprising SNP information disclosed
herein is provided in Figure 1. Figure 1 provides a block diagram of a computer system
102 that can be used to implement the present disclosure. The computer system 102
includes a processor 106 connected to a bus 104. Also connected to the bus 104 are
a main memory 108 (preferably implemented as random access memory, RAM) and a variety
of secondary storage devices 110, such as a hard drive 112 and a removable medium
storage device 114. The removable medium storage device 114 may represent, for example,
a floppy disk drive, a CD-ROM drive, a magnetic tape-drive, etc. A removable storage
medium 116 (such as a floppy disk, a compact disk, a magnetic tape, etc.) containing
control logic and/or data recorded therein may be inserted into the removable medium
storage device 114. The computer system 102 includes appropriate software for reading
the control logic and/or the data from the removable storage medium 116 once inserted
in the removable medium storage device 114.
[0346] The SNP information described herein may be stored in a well-known manner in the
main memory 108, any of the secondary storage devices 110, and/or a removable storage
medium 116. Software for accessing and processing the SNP information (such as SNP
scoring tools, search tools, comparing tools, etc.) preferably resides in main memory
108 during execution.
EXAMPLES
[0347] The following examples are offered to illustrate, but not to limit the claimed invention.
STATISTICAL ANALYSIS OF SNP ASSOCIATION WITH LIVER FIBROSIS IN HCV-INFECTED INDIVIDUALS
Example 1:
[0348] A case-control genetic study was performed to determine the association of SNPs in
the human genome with liver fibrosis and in particular the increased or decreased
risk of developing bridging fibrosis/cirrhosis, and the rate of progression of fibrosis
in HCV infected patients. The study involved genotyping SNPs in DNA samples obtained
from >500 HCV-infected patients. The study population came from 2 clinic sites, the
University of California, San Francisco (UCSF) and Stanford University (Stanford).
Among the 435 patients from UCSF, the percentage for minimal, moderate, and severe
fibrosis was 46%, 26%, and 28%, respectively, which reflects the distribution of HCV
patients in their clinics. The 100 samples obtained from Stanford were intentionally
collected on extreme cases, and therefore comprised 62% minimal fibrosers and 38%
severe fibrosers. Samples were divided into a case group or a control group. The cases
comprised those samples obtained from individuals determined to have severe fibrosis
(bridging fibrosis/cirrhosis) and the controls comprised those samples obtained from
individuals with minimal and moderate fibrosis. The stage of fibrosis in each individual
was determined according to the system of
Batts et al., Am J. Surg. Pathol. 19:1409-1417 (1995) as reviewed by
Brunt Hepatology 31:241-246 (2000). All patients who donated samples had signed informed, written consent, and the
study protocols were approved by the respective Institutional Review Boards (IRB).
[0349] DNA was extracted from individual blood samples using conventional DNA extraction
methods or by using commercially available kits according to manufacturer's suggested
conditions, such as the QIA-amp kit from Qiagen (Valencia, CA). SNP markers in the
extracted DNA samples were analyzed by genotyping using primers such as those presented
in Table 5. While some samples were individually genotyped, the same samples and any
remaining samples were also used for pooling studies, in which DNA samples from about
50 individuals were pooled and allele frequencies were obtained using a PRISM® 7900
HT Sequence Detection System (Applied Biosystems, Foster City, CA) by kinetic allele-specific
PCR similar to the method described by
Germer et al., Genome Research 10:258-266 (2000).
[0350] The results of statistical analysis of association of a SNP with a decreased risk
of developing bridging fibrosis/cirrhosis are presented in Table 6. For statistical
analysis, the outcomes include only fibrosis stage (categorized into 0+1, 2, for controls
and 3+4 for cases) (and identified as "stage" in Table 6). Genotypes were categorized
into ordinal (three groups, including major homozygotes, heterozygotes, and minor
homozygotes) as well as using a dominant model assumption (two groups, including major
homozygotes versus heterozygotes + minor homozygotes). Multiple logistic regression
as well as proportional logistic regression analysis was used to generate age-adjusted
odds ratios and 95% confidence intervals to assess the association between the genotypes
and fibrosis stage. All reported p-values are two-sided.
[0351] A marker having an odds ratio (OR) < 1.0 is protective (
e.g., an individual is less likely to develop severe liver fibrosis), whereas a marker
having an odds ratio (OR) > 1.0 is associated with an increased risk (e.g., an individual
is more likely to develop severe liver fibrosis).
[0352] Among the 120 SNPs tested in the two sample sets, hCV11638783 is a marker that is
associated with decreased risk for severe fibrosis. hCV11638783 is a replicated marker
because it shows significant association with severe fibrosis in both the UCSF and
Stanford sample sets(p-values of 0.0014 and 0.0175 respectively in the ordinal analyses
and 0.0055 and 0.0071 respectively in the dominant analyses). The odds ratio in both
sample sets was less than 1.0 (in the UCSF sample set, for ordinal, the odds ratio
was 0.583 for fibrosis stage, and, for dominant, the odds ratio was 0.586 for fibrosis
stage. In the Stanford sample set, for ordinal, the odds ratio was 0.408 for fibrosis
stage; in "Sample Set 2", for dominant, the odds ratio was 0.291 for fibrosis stage).
Thus, this SNP may be used to identify individuals with a decreased risk of developing
fibrosis, especially bridging fibrosis/cirrhosis.
Example 2
Sample Set Description
[0353] In a second case control study, DNA samples obtained from the University of California
San Francisco (UCSF) were used as a discovery sample set to initially identify SNPs
in association with severe fibrosis. Among the 537 patients in the discovery sample
set, the percentage for minimal stage 0-1, moderate stage 2, and severe stage 3-4
fibrosers was 52%, 23%, and 25%, respectively, which reflects the typical distribution
of HCV infected patients in clinics.
[0354] In addition sample sets were collected from 3 additional but different clinic sites
for use in replication studies: Virginia Commonwealth University (VCU), University
of Illinois, Chicago (UIC) and Stanford University (Stanford). Among the approximately
483 patients in the sample set from VCU, the percentage for minimal, moderate, and
severe fibrosis was approximately 18%, 34%, and 48%, respectively. Among the 115 patients
in the sample set from UIC, the percentage for minimal, moderate, and severe fibrosis
was 29%, 30%, and 41%, respectively. Samples from the Stanford sample set were intentionally
collected on extreme cases, which contained 62% minimal stage 0-1 fibrosers and 38%
severe stage 3-4 fibrosers. The stage of fibrosis in each individual in the VCU sample
set was determined according to the system of
Knodell et al., Hepatology 1:431-435 (1981). The stage of fibrosis in individuals in the UCSF, UIC and Stanford sample sets
was determined according to the system of
Batts et al., Am J. Surg. Pathol. 19:1409-1417 (1995). Both scoring systems are reviewed by
Brunt Hepatology 31:241-246 (2000). All patients who donated samples had signed informed, written consent, and the
study protocols were approved by their respective IRBs.
[0355] All patients in the sample sets met the inclusion/exclusion criteria in the study
protocol as follows:
Inclusion criteria:
- Adults (Age 18~75).
- HCV positive patients who have undergone a full course (at least 24 weeks) of Interferon
(IFN) treatment (any formulation +/- ribavirin) and for whom six month follow-up viral
load data was available/potentially available.
Exclusion criteria:
- Discontinuation of IFN treatment secondary to poor tolerance of side effects
- Evidence of other chronic active viral hepatitis including positive hepatitis antigen,
- Evidence of co-infection with human immunodeficiency virus (HIV), e.g. Positive anti-HIV
antibody.
- Evidence of other serious liver disease: e.g. Wilson's Hemachromatosis, etc
- Other serious medical conditions: Rheumatic/renal/lung diseases, cardiovascular disease,
cancer
Additional information used for data analysis:
- Age
- Race
- Gender
- HCV genotype
- Viral load
- Ethanol use
- Intravenous drug use
- Other medications
- Exact treatment regimen
- Alanine amino transferase levels
- Response to IFN treatment
- Other medical history, including serious medical illness such as kidney disease, cardiovascular
disease, autoimmune disease, and cancer
Pooling and whole genome scan on discovery sample set
[0356] Association of SNP alleles in the human genome with fibrosis stage in HCV patients
was tested in the discovery sample set. DNA was extracted from blood samples using
a standard protocol or DNA extraction kits as described above. DNA samples from patients
were pooled based on similar clinical phenotypes of the patients. While some samples
were individually genotyped, the same samples were also used for pooling studies,
in which DNA samples from about 50 individuals were pooled and allele frequencies
in the pools were obtained using primers such as those presented in Table 5. Genotypes
and pool allele frequencies were measured using a PRISM® 7900HT Sequence Detection
PCR System (Applied Biosystems) by kinetic allele-specific PCR, similar to the method
described by Germer
et al. (
Germer S., Holland M.J., Higuchi R. 2000, Genome Res. 10: 258-266).
Data analysis on whole genome scan using pooled DNA
[0357] Approximately 21,470 SNPs throughout the genome were genotyped in the discovery sample
set. Allele odds ratios and p-values were generated comparing the advanced or high
fibrosis stage group (case group) (also known as bridging fibrosis/cirrhosis) vs medium
and low groups (mild or no fibrosis) (control group). Results were stratified by ethnicity
(all ethnic groups (A) Caucasian (C) and other than Caucasian (O)) for the stage outcome
to assess any confounding by these factors.
Data analysis of individual genotyping results on replication sample sets
[0358] About 175 SNPs were selected from a study using the discovery sample set based on
their association with severe fibrosis. These SNPs were then retested by individual
genotyping in the UCSF sample set to confirm the initial results and in the VCU, UIC
or Stanford sample sets. The data obtained from the VCU sample set was used to replicate
the results obtained from the UCSF sample set. The UIC and Stanford sample sets provided
additional replication data. The Allelic Association, Fischer Exact Test was used
to analyze the association of a SNP with fibrosis stage. In replication studies, a
SNP was considered a replicated marker only if it had a significant p-value <0.1 for
a particular stage in the UCSF sample set and the VCU sample set, and the Odds Ratio
(OR) had to go in the same direction - that is, the regression coefficient had to
have the same sign in each of the UCSF and VCU sample sets. 67 markers were replicated
in these two sample sets in showing statistically significant association with severe
fibrosis (Table 7). For example, marker hCV7450990 is a replicated marker when all
patients as well as patients other than Caucasian populations (but not the Caucasian
only population were analyzed, whereas marker hCV11935588, is a replicated marker
when all patients as well as Caucasian-only population were analyzed. Both of these
SNPs are protective alleles with ORs <1.
[0359] hCV7450990 a missense SNP in DDX5, which encodes a DEAD (Asp-Glu-Ala-Asp) box polypeptide
5, and it is shown to have an association with severe fibrosis in both the UCSF and
VCU sample sets. Previous studies in the art have shown that this gene is expressed
in multiple tissues including the liver. A recent report indicates that DDX5, an RNA
helicase also known as p68, interacts with HCV NS5B (HCV RNA-dependent RNA polymerase),
suggesting that DDX5 is a human cellular factor involved in HCV RNA replication (
Goh et al., J Virol., 2004, 78: 5288-98). Therefore, SNPs in the DDX5 gene, particularly missense SNPs such as hCV7450990,
might render a protective effect by affecting the ability of HCV to replicate.
[0360] SNP (hCV11935588), which is located in a gene on chromosome 16, is an example of
a marker associated with severe fibrosis in Caucasians in all four sample sets.
[0361] In addition, hCV15851335 also showed association with severe fibrosis when all patients
as well as a Caucasian-only population were analyzed in the UCSF and VCU sample sets
(Table 7). hCV15851335 is a missense SNP in CPT1A (carnitine palmitoyltransferase
1A, liver). CPTIA is a key enzyme in camitine-dependent transport across the mitochondrial
inner membrane, and its deficiency results in a decreased rate of fatty acid beta-oxidation,
which causes fatty liver diseases.
[0362] The SNPs disclosed herein could be used to identify other markers that are associated
with and increased risk of developing bridging fibrosis/cirrhosis, and progression
of fibrosis in HCV-infected individuals and other liver disease patients. For example,
the markers listed in Tables 6-7 can be used to identify other mutations (preferably
SNPs), such as those that exhibit similar or enhanced predictive value, in the identified
genes or surrounding nucleotide sequence (
e.g., 500 Kb upstream to 500 Kb downstream of the marker) through database searches or
through sequencing of DNA, samples. Specifically, marker hCV7450990 is an A480S change
in DDX5, a DEAD-Box RNA helicase. DEAD-Box proteins are characterized by an Asp-Glu-Ala-Asp
motif. DDX5 is located on the long arm of chromosome 17, 17q24.1. The sex-averaged
recombination rate in the region is estimated to be 0.6 cM/Mb. The SNP appears to
fall within a region of high linkage disequilibrium that extends roughly 20Kb centromeric
of the SNP and extends roughly 244Kb telomeric to the SNP. Other SNPs in these two
regions may be associated with fibrosis progression rate or inflammation. Given the
high homology within the DEAD-Box protein family, all DEAD-box genes and SNPs in those
genes are likely to play a role in advanced fibrosis stage.
[0363] Marker hCV11935588 is located in a gene on chromosome 16. The following genes are
located in the region and may also play a role in advanced fibrosis stage: 1) CTRB1
(chymotrypsinogen B1) is located within roughly 10kb of marker hCV11935588. CTRB1
is a zymogen secreted by the pancreas (highly expressed in the pancreas) and cleaved
by trypsin to become a protease in the small intestine. It is also expressed in the
liver. 2) BCAR1 (breast cancer antiestrogen resistance) is within 50kb of marker hCV11935588
and is involved in apoptosis. 3) LDHD (lactate dehydrogenase D) is roughly 100kb away
from marker hCV11935588. LDHD is in the electron transport chain and highly expressed
in the liver. It's also expressed in the kidneys. Two isoforms of LDHD exist. 4) KARS
(lysyl-tRNA synthetase) is within 400kb of marker hCV11935588. KARS is expressed in
many immune cells (NK, T-cells, B cells, etc.), and is also expressed in BM tissue.
A p-value of 0.01 was observed in Sample Set 1 at a SNP in the KARS gene. KARS has
been shown to play a role in autoimmune diseases and is a target for autoantibodies
in polymyositis and dermatomyositis.
[0364] The SNPs disclosed herein, alone, or in combination with other risk factors, such
as age, gender, and alcohol consumption, can provide a non-invasive test that enables
physicians to assess the fibrosis risk in HCV-infected individuals. Such a test offers
several advantages, such as: 1) enabling better treatment strategies (for example,
individuals with a higher fibrosis risk can be given higher priority for treatment,
while treatment for individuals with a lower fibrosis risk can be delayed, thereby
alleviating them from the side effects and high cost of treatment); and 2) reducing
the need for repeated liver biopsies for all patients.
[0365] Furthermore, the SNPs disclosed herein could be used in diagnostic kits to assess
the increased or decreased risk of developing bridging fibrosis/cirrhosis and progression
of fibrosis for patients with other liver diseases, such as hepatitis B, any co-infection
with other viruses (such as HIV, etc.), non-alcoholic fatty liver diseases (NAFLD),
drug-induced liver diseases, alcoholic liver diseases (ALD), primary biliary cirrhosis
(PBC), primary sclerosing cholangitis (PSC), autoimmune hepatitis (AIH) and cryptogenic
cirrhosis. Depending on the genotypes of one or multiple markers disclosed in any
of Tables 6-7, alone or in combination with other risk factors, physicians could categorize
these patients into slow, median, or rapid fibrosers.
[0366] Various modifications and variations of the described compositions, methods and systems
of the invention will be apparent to those skilled in the art without departing from
the scope and spirit of the invention. Although the invention has been described in
connection with specific preferred embodiments and certain working examples, it should
be understood that the invention as claimed should not be unduly limited to such specific
embodiments. Indeed, various modifications of the above-described modes for carrying
out the invention that are obvious to those skilled in the field of molecular biology,
genetics and related fields are intended to be within the scope of the following claims.
Table 1
| Gene number :51 / Celera Gene: hCG27399 - 14600022031-2482 / Celera Transcript: hCT18539
- 146000220312504 / Public Transcript Accession: NM_003266 / Celera Protein: hCP43686
-197000064928737 / Public Protein Accession: NP_003257 / Gene Symbol: TLR4 / Protein
Name: toll-like receptor 4 / Celera Genomic Axis: GA_x5YUV32W1V9(4596116..4621277)
/ Chromosome: 9 / OMIM NUMBER: 603030 /OMIM Information: Endotoxin hyporesponsiveness
(3) / / Transcript Sequence (SEQ ID NO: 116) / Protein Sequence (SEQ ID NO:377) /
SNP Information / Context (SEQ ID NO:2082) / Celera SNP ID: HCV11722237 / SNP Position
Transcript: 1429 / SNP Source: Applera / Population(Allele,Count): caucasian(C,37|T,3)
african american(C,36|T,2) total(C,73|T,5) / SNP Type: Missense Mutation / Protein
Coding: SEQ ID NO:377, 399,(T,ACC) (I,ATC) / SNP Source: HGMD; dbSNP; Nickerson /
Population(Allele,Count): no_pop(C,-|T,-) ; no_pop(C,-|T,-) ; no_pop(C,436|T,26) /
SNP Type: Missense Mutation / Protein Coding: SEQ ID NO:377, 399,(T,ACC) (I,ATC) |
| |
| Gene number : 51 / Celera Gene: hCG27399 - 146000220312482 / Celera Transcript: hCT1961394
- 146000220312489 / Public Transcript Accession: NM_003266 / Celera Protein: hCP1774277
- 197000064928735 / Public Protein Accession: NP_003257 / Gene Symbol: TLR4 / Protein
Name: toll-like receptor 4 / Celera Genomic Axis: GA_x5YUV32W1V9(4596116..4621277)
/ Chromosome: 9 / OMIM NUMBER: 603030 / OMIM Information: Endotoxin hyporesponsiveness
(3) / / Transcript Sequence (SEQ ID NO:117) / Protein Sequence (SEQ ID NO:378) / SNP
Information / Context (SEQ ID NO:2134) / Celera SNP ID: hCV11722237 / SNP Position
Transcript: 1549 / SNP Source: Applera / Population(Allele,Count): caucasian(C,37|T,3)
african american(C,36|T,2) total(C,73|T,5) / SNP Type: Missense Mutation / Protein
Coding: SEQ ID NO:378, 359,(T,ACC) (I,ATC) / SNP Source: HGMD; dbSNP; Nickerson /
Population(Allele,Count): no_pop(C,-|T,-) ; no_pop(C,-|T,-) ; no_pop(C,436|T,26) /
SNP Type: Missense Mutation / Protein Coding: SEQ ID NO:378, 359,(T,ACC) (I,ATC) |
| |
| Gene number : 51 / Celera Gene: hCG27399 - 146000220312482 / Celera Transcript: hCT1961395
- 146000220312483 / Public Transcript Accession: NM_138554 / Celera Protein: hCP1774243
- 197000064928734 / Public Protein Accession: NP_612564 / Gene Symbol: TLR4 / Protein
Name: toll-like receptor 4 / Celera Genomic Axis: GA_x5YUV32W1V9(4596116..4621277)
/ Chromosome: 9 / OMIM NUMBER: 603030 / OMIM Information: Endotoxin hyporesponsiveness
(3) / / Transcript Sequence (SEQ ID NO:118) / Protein Sequence (SEQ ID NO:379) / SNP
Information / Context (SEQ ID NO:2185) / Celera SNP ID: hCV11722237 / SNP Position
Transcript: 1262 / SNP Source: Applera / Population(Allele,Count): caucasian(C,37|T,3)
african american(C,36|T,2) total(C,73|T,5) / SNP Type: Missense Mutation / Protein
Coding: SEQ ID NO:379, 199,(T,ACC) (I,ATC) / SNP Source: HGMD; dbSNP; Nickerson /
Population(Allele,Count): no_pop(C,-|T,-); no_pop(C,-|T,-) ; no_pop(C,436|T,26) /
SNP Type: Missense Mutation / Protein Coding: SEQ ID NO:379, 199,(T,ACC) (I,ATC) |
| |
| Gene number : 51 / Celera Gene: hCG27399 - 146000220312482 / Celera Transcript: hCT2316295
- 146000220312497 / Public Transcript Accession: NM_138554 / Celera Protein: hCP1796095
- 197000064928736 / Public Protein Accession: NP_612564 / Gene Symbol: TLR4 |
| / Protein Name: toll-like receptor 4 / Celera Genomic Axis: GA_x5YUV32W1V9(4596116..4621277)
/ Chromosome: 9 / OMIM NUMBER: 603030 / OMIM Information: Endotoxin hyporesponsiveness
(3) / / Transcript Sequence (SEQ ID NO:119) / Protein Sequence (SEQ ID NO:380) / SNP
Information / Context (SEQ ID NO:2237) / Celera SNP ID: hCV11722237 / SNP Position
Transcript: 1382 / SNP Source: Applera / Population(Allele,Count): caucasian(C,37|T,3)
african american(C,36|T,2) total(C,73|T,5) / SNP Type: Missense Mutation / Protein
Coding: SEQ ID NO:380, 342,(T,ACC) (I,ATC) / SNP Source: HGMD; dbSNP; Nickerson /
Population(Allele,Count): no_pop(C,-|T,-) ; no_pop(C,-|T,-) ; no_pop(C,436|T,26) /
SNP Type: Missense Mutation / Protein Coding: SEQ ID NO:380, 342,(T,ACC) (I,ATC) |
Table 2
| Gene Number: 51 / Celera Gene: hCG27399 - 146000220312482 / Gene Symbol: TLR4 / Protein
Name: toll-like receptor 4 / Celera Genomic Axis: GA_x5YUV32W1V9(4596116..4621277)
/ Chromosome: 9 / OMIM NUMBER: 603030 / OMIM Information: Endotoxin hyporesponsiveness
(3) / Genomic Sequence (SEQ ID NO:5049): / SNP Information / Context (SEQ ID NO:18973)
/ Celera SNP ID: hCV11722237 / SNP Position Genomic: -4596117 / SNP Source: Applera
/ Population(Allele,Count): caucasian(C,37|T,3) african american(C,36|T,2) total(C,73|T,5)
/ SNP Type: MISSENSE MUTATION;HUMAN-MOUSE SYNTENIC REGION / SNP Source: HGMD; dbSNP;
Nickerson / Population(Allele,Count): no_pop(C,-|T,-) ; no_pop(C,-|T,-) ; no_pop(C,436|T,26)
/ SNP Type: MISSENSE MUTATION;HUMAN-MOUSE SYNTENIC REGION / |
TABLE 5, page 1 of 2
| Marker |
Alleles |
Sequence A (allele-specific primer) |
Sequence B (allele-specific primer) |
Sequence C (common primer) |
| hCV11176866 |
C/T |
TCAGTTCCCAATTGTATATGTCTC(SEQ ID NO:34257) |
TCAGTTCCGAATTCTATATGTCTT(SEQ ID NO:94258) |
TTGCTCCATCAAACTCTGTGAA SEQ ID NO:34259) |
| hCV11291454 |
A/G |
AAACCAGCCAAATTCCTTC (SEQ ID NO:34280) |
AAACCAGCCAAATTCCTTT (SEQ ID NO:34261) |
ACACCCACGGTGATTGAT (SEQ ID NO:34262) |
| hCV11466078 |
C/G |
AGCCCCAGAACGTGC (SEQ ID NO:34263) |
AGCCCCAGAACCTGG (SEQ ID NO:34264) |
GGGCTGGGCTTGTAGAATA (SEQ ID NO:34265) |
| ACV11611200 |
A/G |
CGGGATTTCAGGTGTGAGT (SEQ ID.NO:34268) |
GGGATTTC4GGTGTGAGC (SEQ ID NO:34267) |
CTGCTCTTTGGAGGMGTGMAGATAAT (SEQ ID NO:34266) |
| hCV11611201 |
A/G |
CTTCCTGAGAAGTCAAGAAGT (SEQ ID NO:34269) |
TTCCTGAGAAGTCAAGAAGC (SEQ ID NO:34270) |
TCTCTGGCTTTCTCAGCACTCA (SEQ ID NO:34271) |
| hCV11838783 |
A/G |
AAGGGCTTCGGGGTAC (SEQ ID NO:34272) |
AAGGGCTTCGGGGTAT (SEQ ID NO:34273) |
ACCGTGCAGGGTCTTCT (SEQ ID NO:34274) |
| hCV11722237 |
C/T |
CAAAGTGATTTTGGGGACAAC SEQ ID NO:34276). |
CAAAGTGATTTTGGGACAAT (SEQ ID NO:34278) |
GAATACTGAAAACTCACTCATTTGT (SEQ ID NO:34277) |
| hCV11743295 |
A/G |
CATCATTTCCTTACAATACTGTCT (SEQ ID NO:34278) |
ATCATTTCCTTACAATACTGTCC (SEQ ID NO:34279) |
CCATTAACAAGCATTGTACTGTTAGT (SEQ ID NO:34280) |
| hCV44745746 |
C/G |
GGGAGGTTATTGTGAACTAGG (SEQ ID NO:34281) |
GGGAGGTTATTGTGAACTAGC (SEQ ID NO:34282) |
AGACAGATCGATGACAGATTAAGT (SEQ ID NO:34283) |
| hCV11749854 |
C/G |
GCTCATCTGCATCCGC (SEG ID NO:34284) |
GCTCATCTGCATCCGG (SEQ ID NO:34285) |
CCCATGCCTTCATCACAT (SEQ ID NO:34288) |
| hCV11884038 |
A/G |
CTTATGAAAGATTTCAAATCCTCTA (SEQ ID NO:34287) |
TATGAAAGATTTCAAATCCTG (SEQ ID NO:34288) |
CTGAAGAGGGTCTCTTCCA (SEQ ID NO:34289) |
| hCV11835588 |
A/T |
ATTTCTGCCTGGTCTGTGT (SEQ ID NO:34290) |
TTTCTGGCTGGTCTGTGA (SEQ ID NO:34291) |
CTCACTTTGCACAGGTTGTACT (SEQ ID NO:34292) |
| hCV11944682 |
C/T |
TGAAAACATTTAAAGTTTCCTCAC (SEQ ID NO:34289) |
TGAAAACATTTAAAGTTTCCTCAT (SEQ ID NO:34294) |
TTCACTGAAGGGCTCACTATTA (SEQ ID NO:34285) |
| hCV11955738 |
A/G |
CACTACCTCCCTCTAGGAGAAA (SEQ ID NO:34288) |
CACTACCTCCCTCTAGGAGAAG (SEQ ID NO:34297) |
GATCTCATGGCTTCTGTTCAG (SEQ ID NO:34288) |
| hCV1188608 |
G/T |
AGTTAAATGAATACACTGATGGAC (SEQ ID NO:34299) |
AGTTAAATGAATAGACTGATGGAA (SEQ ID NO:34300) |
TTGCTGCTGATGACTTTAGAGT (SEQ ID NO:34301) |
| hCV11986235 |
G/T |
GCCACTGGCCATCACT (SEQ ID NO:34302) |
CCACTGGCCATCACG (SEQ ID NO:34303) |
CCTTTGTAGACCTGTTCCTCTATC (SEQID NO:34304) |
| hCV12591EB |
C/T |
GCTTAAGAGCAACCTCAGAGAC (SEQ ID NO:34305) |
GCTTAAGAGCAACCTCAGAGAT (SEQ ID NO:34308) |
AACTGGCTGAACTGACAC (SEQ ID NO:34307) |
| hCV1289127 |
C/G |
CACGCATGAGATTGAAAC (SEQ ID NO:34308) |
CAGGCATGACATTGAAAG (SEQ ID NO:34309) |
CAGAATSTAGTCTCGATTCTTCTTC (SEQ ID NO:34310) |
| hCV1478S83 |
A/G |
AGGTAGGTACCCGTGTTTACA (SEQ ID NO:34311) |
GGTAGGTACCCGTGTTACG (SEQ ID NO:34312) |
ACAGGAGAGTAACATGAGAGTATGT (SEQ ID NO:34313) |
| hCV15851335 |
C/T |
GATGGCATGGATGGC (SEQ ID NO:34314) |
GGATGGCATGGATGGT (SEQ ID NO:34315) |
GCAGGATGTGCTGTGATTAT (SEQ ID NO:34318) |
| hCV15853499 |
C/T |
GCAGTCATGGAGAGCATG (SEQ ID NO:34317) |
GAGCAGTCATGGAGAGCATA (SEQ ID NO:34318) |
ACACCAGAATGAGAAAGGTAAGTA (SEQ ID NO:34319) |
| hCV15884780 |
G/T |
GCAGTATCTCTCTCCATCCC (SEQ ID NO:34320) |
GCAGTATCTCTCTCCATCCA (SEQ ID NO:34321) |
CTGACTCTGATGAGAAGTTTATCAC (SEQ ID NO:34322) |
| hCV16166459 |
C/T |
GTCAGAATTTCATTTACTAGAATCCAC (SEQ ID NO:34323) |
TGTCAGAATTTCATTTACTAGAATCCAT (SEQ ID NO:34324) |
GATGAGCTGCCTAAATTTGAGAAGA (SEQ ID NO:34325) |
| hCV18167920 |
C/T |
GAGATTACAAAGGGTCCAGTA (SEQ ID NO:34326) |
AGATTACAAAGGGTCCAGTG (SEQ ID NO:34927) |
CTGCAGCTCTTTCAGAGAGTT (SEQ ID NO:34328) |
| hCV1728296 |
A/G |
CTATGGTAGGTGCTGAGAATATATA (SEQ ID NO:34328) |
TATGGTAGGTGCTGAGAATATATG (SEQ ID NO:34330) |
AAGGAGTGAGGAAGCAAAGATT (SEQ ID NO:34331) |
| hGV1801154 |
A/G |
TCCTCTTTTACTTCTTTCCTGA (SEQ ID NO:34332) |
CCTGTTTTACTTCTTTCCTCG (SEQ ID NO:34333) |
GTCACACTGAAGAGTCAATCACTAT (SEQ ID NO:34334) |
| hCV1896513 |
C/T |
ACTTGAATAAAGCTGTATGACCTAC (SEQ ID NO:34335) |
ACTTGAATAAAGCTGTATGACCTAT (SEQ ID NO:34338) |
CCACCATCTGGATTGTTTAAG (SEQ ID NO:34337) |
| hCV192738 |
C/G |
TGCCCGTGGTCAGC (SEQ ID NO:34338) |
TGCCCGTGGTCAGG (SEQ ID NO:34339) |
GCTGCATCCGTGTATCTGT (SEQ ID NO:34340) |
| hCV22211827 |
C/T |
GATGTTTTTCTTGAATACACC (SEQ ID NO:34341) |
TTGATGTTTTTCTTGAATACACT (SEQ ID NO:34342) |
AGAGTGAAATTTTTTCTTTTGTCTTA (SEQ ID NO:34343) |
| hCV22272687 |
C/T |
CAGGCAAAAAAGTCTTGAAT (SEQ ID NO:34344) |
CAGGCAAAAAAGTCTTGAAC (SEQ ID NO:34345) |
CCCCCCATAACATTCAGATAT (SEQ ID NO:34346) |
| hCV22272823 |
G/T |
GCGCTGGTGAGACCCT (SEQ ID NO:34347) |
CGCTGGTGAGACCCG (SEQ ID NO:34348) |
GGAGCGCGCTTCTGT (SEQ ID NO:34349) |
| hCV22274307 |
C/T |
GACCTACGCTCCTTCATCTAAC SEQ ID NO:34350) |
GACCTACGCTCCTTCATCTAAT (SEQ ID NO:34351) |
CAATGTGATTACCTCAAAATAATATCTAC (SEQ ID NO:34352) |
| hCV22274712 |
C/G |
CTTACAGAAGBACATCCTTTACAG (SEQ ID NO:34353) |
CTTACAGAAGGACATCCTTTACAC (SEQ ID NO:34364) |
GCAGGCCCAAGATTGAT (SEQ ID N0:94955) |
| hCV2231920 |
A/G |
CACTCCAGCACATAGAGGAT (SEQ ID NO:34358) |
CACTCCAGCACATAGAGGAC (SEQ ID NO:34357) |
CAGCAGCTTTTGTCTGTGTG (SEQ ID NO:34358) |
| hCV2231945 |
C/T |
GCCTGCTCCCTCATCC (SEQ ID NO:35359) |
GCCTGCTCCCTCATCT (SEQ ID NO:34380) |
TGGTGAAGCAGACAGGAACTA (SEQ ID NO:34361) |
| hCV235160 |
A/G |
CCACCAGTGGCTATCA (SEQ ID NO:34382) |
CCACCAGTTGGCTATCG (SEQ ID NO:34363) |
GGCAAGCAGGCTTGAGAA (SEQ ID NO:34364) |
| hCV2384392 |
C/T |
AAATGCTAGCAGCCCC (SED ID NO:34366) |
CAAATGCTAGCAGCCCT (SEQ ID NO:34366) |
TCCCAGAGAGGAAGAGACTG (SEQ ID NO:34367) |
| hCV2478345 |
C/G |
CTCCTGAAAGGGTTGAACTC (SEQ ID NO:34368) |
TCCTGAAAGGGTTGAACTG (SEQ ID NO:34369) |
CAACTCCTGGGCTGAATG (SEQ ID NO:34370) |
| hCV25600642 |
C/G |
CGCGGCCGAAGC (SEQ ID NO:34371) |
CGCGGCCGAAGG (SEQ ID NO:34372) |
GATGACCCGGACGACTAC (SEQ ID NO:34373) |
| hCV25609481 |
A/G |
CTGCTGAGGCAATTAACTAAATA(SEQ ID NO:34374) |
TGCTGAGGCAATTAACTAAATG (SEQ ID NO:34375) |
TGGAACAACTCTATTCGAAGTAAG (SEQ ID NO:34376) |
| hCV25839681 |
A/G |
TTCACAGGGACGCTCAT (SEQ ID NO:34377) |
TTCACAGGGACGCTCAC (SEQ ID NO:34378) |
GGTTAATTCTGGATCAAGTATG (SEQ ID NO:34379) |
| hCV25741844 |
C/T |
CTAATGCTCTGATGTTGCTACTAAC (SEQ iD N0:34380) |
CTAATGCTCTGATGTTGCTACTAAT (SEQ ID NO:34381) |
CGAGAAAAGGCTGAGTTTATAG (SEQ ID NO:34382) |
| hCV25760908 |
C/T |
CCTGATTGGGGGAACAAC (SEQ ID NO:34383) |
CCTGATTGGGGGAACAAT (SEQ ID NO:34384) |
CATGTGCAACCCTCTAGATATAC (SEQ ID NO:33385) |
| HCV25766820 |
A/G |
TCGAAGTCCTAAGCTCAAGT (SEQ ID NO:34388) |
CGAAGTCCTAAGCTCAAGC (SEQ ID NO:34387) |
GGGACCACAGGTTGCTGATTA (SEQ ID 00:34388) |
| hCV25992158 |
A/G |
GCCGTGATAAACCTCTGT (SEQ ID NO:34389) |
CCGTGATAAACCTCTGC (SEQ ID NO:34390) |
TTTGATTGGCAATGTTTACAA (SEQ ID NO:34391) |
| hGV25934437 |
C/T |
GATAGAGGAGTTAGAGCACTTGG (SEQ ID NO:34392) |
AGATAGAGGAGTTAGAGCACTTGA (SEQ ID NO:34393) |
CTGAAGCTGAAGAAGAGATAAG (SEQ ID NO:34394) |
| hCV25957240 |
C/T |
TGAAGAACACCATTGCCA (SEQ ID NO:34395) |
GAAGAACACCATTGCCG (SEQ ID NO:34396) |
GTGGGAGAGGAAAGACAGTAAT (SEQ ID NO:34397) |
| hCV25984261 |
A/G |
AAAAGTAATAACCACCAATTTCAT (SEQ ID NO:34398) |
AAAAGTAATAACCACCAATTTCAC (SEQ ID NO:34399) |
CACCTTCCCCGTTGACTA (SEQ ID NO:34400) |
| hCV2729190 |
A/C |
CCTGGAGTACAGCTTGAGGT (SEQ ID NO:34401) |
CTGGAGTACAGCTTGAGGG (SEQ ID NO:34402) |
CCAGGTCTCGGACACTGA (SEQ ID NO:34403) |
| hCV2730005 |
A/C |
CCATTTGAGGTATGTTTTTAAAAGT (SEQ ID NO:34404) |
CATTTGAGGTATGTTTTTAAAAGG (SEQ ID NO:34405) |
GCTGCCTGCTGTCTTTTAAC (SEQ ID NO:34406) |
| hCV27915384 |
A/G |
TGAGAAAGAGAAGAGTGCCAT (SEQ ID NO:34407) |
TGAGAAAGAGAAGAGTGCCAC (SEQ ID NO:34408) |
CTTCCACCTTCCAGCTTACT (SEQ ID NO:34409) |
| hCV2821340 |
A/G |
CCGGAAAGACTTCTCTCCA (SEQ ID NO:34410) |
CGGAAAGACTTCTCTCCG (SEQ ID NO:34411) |
TTGTATCTGGTGAATCTGAACTAAG (SEQ ID NO:34412) |
| hCV2917913 |
A/C |
CAGAAGTTAGCTGAGGTCATAA (SEQ ID NO:34413) |
CAGAAGTTAGCTGAGGTCATAC (SEQ ID NO:34414) |
GCCTGCCCAAATTAATTTCTTTCT (SEQ ID NO:34415) |
| hCV2844794 |
C/G |
GCTTACTTACGTGGAAAGACTC (SEQ ID NO:34416) |
GCTTACTTACGTGGAAAGACTG (SEQ ID NO:34417) |
TC TTTCTGATGGTTGCTCTACTC (SEQ ID NO:34418) |
| hCV3113082 |
G/T |
TTCAGAAAGAGGCGTCG (SEQ ID NO:34419) |
AGATTCAGAAAGAGGCGTCT (SEQ ID NO:34420) |
GGCCGAAAGCTGTTCAC(SEQID N0:34421) |
| hCV3161768 |
A/G |
TCCCAGACCTCAGCCTA (SEQ ID NO:34422) |
CCCAGACCTCAGCCTG (SEQ ID NO:34423) |
TGTGGCCACTCAGGTTCATAT (SEQ ID NO:34424) |
| hCV3277068 |
C/T |
AGATGTTACAACTTGATCAGTCG (SEQ ID NO:34425) |
CAGATGTTACAACTTGATCAGTCA (SEQ ID NO:34426) |
CGGCAGGATGGTTCTGTA (SEO ID NO:34427) |
| hCV335227 |
G/T |
GCATGGGATGGAGGAG (SEQ ID NO:34428) |
GCATGGGATGGAGGAT (SEQ ID NO:34429) |
GCGATGGATGGTCTGAGTTA (SEQ ID NO:34430) |
| hCV674099 |
C/T |
GCTACAAATGCTCACACCAG (SEQ ID NO:34431) |
GCTACAAATGCTCACACCAA (SEQ ID NO:34432) |
GCCAGAATTTTGTTAATTTCATACT (SEQ ID NO:34433) |
| hCV7241 |
C/G |
TGGTATGTTCCTGCTTCATC (SEQ ID NO:34434) |
TGGTATGTTCCTGCTTCATG (SEQ ID NO:34435) |
CAGGCAGGAGATGTGTGAG (SEQ ID NO:34436) |
| hCV7450990 |
A/C |
TGGTCGAAGACAGAGGTG (SEQ ID NO:34437) |
TTGGTCGAAGACAGAGGTT (SEQ ID NO:34438) |
GTTTTCACATTCAAGGTTTTACTC (SEQ ID NO:34439) |
| hCV7466465 |
C/T |
CAACAGGCCCAAATACTTC (SEQ ID NO:34440) |
CAACAGGCCCAAATACTTT (SEQ ID NO:34441) |
CGTGGTAAACAATGCAGTAACT (SEQ ID NO:34442) |
| hCV7882185 |
A/G |
TCTGCATCTCATGCATCAGA (SEQ ID NO:34443) |
CTGCATCTCATGCATCAGG (SEQ ID NO:34444) |
GGACTAGACCCAGGATTTAGTTGT (SEQ ID NO:34445) |
| hCV8761599 |
C/T |
GGGATGGTGAGCAACG (SEQ ID NO:34446) |
AGGGATGGTGAGCAACA (SEQ ID NO:34447) |
GAACTTGAGGCTTGCAAAGGTTAAG (SEQ ID NO:34448) |
| hCV8853894 |
G/T |
GAACCCCGCGTGTG(SEQ ID NO:34449) |
GAACCCCGCGTGTT (SEQ ID NO:34450) |
CCAGTGGTCCTGTCTCTGTA (SEQ ID NO:34451) |
| hCV8902345 |
C/T |
GGGGAATTAGTCATAGGGTATC (SEQ ID NO:34452) |
GGGGAATTAGTCATAGGGTATT (SEQ ID NO:34453) |
GCTTACCCAGACTTTAAAAATACAC (SEQ ID NO:34454) |
| hCV8934089 |
G/T |
ATTTAAACTGTTAATTCATACCACC (SEQ ID NO:34455) |
AATTTAAACTGTTAATTCATACCACA(SEQ ID NO:34456) |
TTTGCTCCAACCTCATACAG(SEQ ID NO:34457) |
| hCV9725216 |
A/T |
GTGGCATGGGTTGGTT (SEQ ID NO:34458) |
TGTGGCATGGGTTGGTA (SEQ ID NO:34459) |
GAGATACAGGCCAAGGAGAAT (SEQ ID NO:34460) |
TABLE 6
| Markers replicated between "Stanford Samples" and "UCSF Samples": Stage analysis |
|
| Marker |
Gene symbol |
"Stanford Samples" (stage) |
"UCSFSamples" (stage) |
|
| |
|
OR |
LCL |
UCL |
p-val |
OR |
LCL |
UCL |
p-val |
|
| 11638783 ord |
EPHX1 |
0.408 |
0.195 |
0.855 |
0.0175 |
0.583 |
0.419 |
0.811 |
0.0014 |
|
| 11638783 dom |
EPHX1 |
0.291 |
0.118 |
0.715 |
0.0071 |
0.586 |
0.402 |
0.855 |
0.0055 |
|
TABLE 7 page 1 of 4
| Marker |
Risk |
Strata |
UCSF |
VCU |
UIC |
Stanford |
| |
allele |
|
CTAF |
CASE AF |
OR |
P_2tail |
CTAF |
CASE AF |
OR |
P _1tail |
CTAF |
CASEAP |
OR |
P _1tail |
CT AF |
CASE AF |
OR |
P1tail |
| hCV11176855 |
T |
A |
29.5% |
36.3% |
1.37 |
0.0337026 |
24.9% |
31.8% |
1.40 |
0.0093974 |
23.5% |
29.8% |
1.39 |
0.1411424 |
32.0% |
34.2% |
1.08 |
0.4074309 |
| hCV11176855 |
T |
C |
27.9% |
34.6% |
1.36 |
0.0954968 |
26.5% |
32.5% |
1.34 |
0.0464593 |
27.8% |
29.5% |
1.09 |
0.5 |
30.6% |
25.0% |
0.76 |
0.6729877 |
| HCV11176855 |
T |
O |
32.7% |
40.2% |
1.39 |
0.2313618 |
21.4% |
30.0% |
1.57 |
0.0513496 |
20.0% |
30.0% |
1.71 |
0.1050528 |
34.8% |
44.7% |
1.52 |
0.1889789 |
| hCV11291454 |
A |
A |
58.5% |
71.6% |
1.81 |
0.0001649 |
63.6% |
61.5% |
1.87 |
0.0116582 |
50.7% |
51.1% |
0.89 |
0.6622838 |
66.9% |
67.1% |
1.24 |
0.2590044 |
| hCV11291454 |
A |
C |
68.0% |
78.2% |
1.69 |
0.0091148 |
64.0% |
70.7% |
1.36 |
0.0305606 |
67.3% |
70.5% |
1.16 |
0.4132722 |
75.0% |
80.6% |
1.38 |
0.3156947 |
| hCV11291454 |
A |
O |
38.7% |
56.3% |
2.04 |
0.0065569 |
30.5% |
37.7% |
1.38 |
0.1053468 |
41.3% |
34.0% |
0.73 |
0.7692901 |
52.1% |
55.3% |
1.14 |
0.4147957 |
| hCV11486078 |
G |
A |
89.8% |
93.3% |
1.58 |
0.0893912 |
88.4% |
94.0% |
2.02 |
0.0016633 |
89.7% |
77.7% |
0.37 |
0.9968868 |
93.4% |
92.1% |
0.89 |
0.5860968 |
| hCV11486078 |
G |
C |
91.0% |
94.1% |
1.59 |
0.2170872 |
93.6% |
95.9% |
1.58 |
0.1154633 |
88.6% |
88.6% |
0.98 |
0.5 |
95.8% |
91.7% |
0.48 |
0.800957 |
| hCV11486078 |
G |
O |
87.3% |
91.5% |
1.56 |
0.4301119 |
76.6% |
89.2% |
2.53 |
0.0037163 |
91.3% |
68.0% |
0.20 |
0.9991939 |
89.1% |
92.1% |
1.42 |
0.3618481 |
| hCV11611200 |
G |
A |
74.4% |
68.9% |
0.76 |
0.0796464 |
77.9% |
74.4% |
0.82 |
0.096288 |
77.2% |
78.7% |
1.09 |
0.6076692 |
78.2% |
75.0% |
0.82 |
0.2847136 |
| hCV11611200 |
G |
C |
74.3% |
68.6% |
0.76 |
0.15363 |
77.6% |
75.1% |
0.87 |
0.2356728 |
70.4% |
79.5% |
1.54 |
0.8219494 |
69.4% |
72.2% |
1.14 |
0.5869379 |
| HCV11611200 |
G |
O |
74.6% |
69.5% |
0.78 |
0.3907832 |
78.6% |
72.3% |
0.71 |
0.1333211 |
82.5% |
78.0% |
0.75 |
0.3240005 |
89.6% |
78.9% |
0.44 |
0.1143356 |
| hCV11611201 |
G |
A |
64.6% |
63.7% |
0.98 |
0.8635623 |
67.3% |
67.8% |
1.07 |
0.6903024 |
70.1% |
60.6% |
0.70 |
0.1101368 |
57.3% |
51.3% |
0.79 |
0.2124562 |
| hCV11611201 |
G |
C |
58.6% |
63.3% |
1.22 |
0.300442 |
56.7% |
61.0% |
1.20 |
0.1377058 |
57.4% |
45.5% |
0.62 |
0.8450457 |
65.5% |
55.6% |
0.75 |
0.732363 |
| hCV11611201 |
G |
O |
76.9% |
64.6% |
0.55 |
0.0308725 |
90.9% |
85.4% |
0.58 |
0.0964825 |
78.2% |
74.0% |
0.79 |
0.3350385 |
52.1% |
47.4% |
0.83 |
0.41414 |
| HCV11722237 |
T |
A |
6.1% |
3.3% |
0.52 |
0.0706133 |
5.0% |
2.8% |
0.53 |
0.031106 |
2.9% |
4.3% |
1.29 |
0.6355253 |
8.1% |
3.9% |
0.35 |
0.0813783 |
| hCV11722237 |
T |
C |
8.1% |
3.7% |
0.44 |
0.0457985 |
6.1% |
3.3% |
0.52 |
0.0511311 |
5.8% |
9.1% |
1.70 |
0.6513772 |
11.1% |
5.6% |
0.47 |
0.2453536 |
| hCV11722237 |
T |
O |
1.9% |
2.4% |
1.28 |
0.6747832 |
2.6% |
1.5% |
0.58 |
0.6550289 |
1.3% |
0.0% |
0.52 |
0.6 |
4.2% |
0.0% |
0.24 |
0.7495212 |
| hCV11743295 |
G |
A |
88.1% |
92.2% |
1.60 |
0.0626577 |
88.0% |
91.0% |
1.37 |
0.0687578 |
81.6% |
89.4% |
1.66 |
0.1068476 |
87.1% |
93.4% |
2.51 |
0.051189 |
| hCV11743295 |
G |
C |
89.7% |
93.6% |
1.68 |
0.144084 |
88.7% |
92.9% |
1.67 |
0.0320542 |
88.9% |
95.5% |
2.63 |
0.1449274 |
84.7% |
91.7% |
1.98 |
0.1887544 |
| hCV11743295 |
G |
O |
84.6% |
89.0% |
1.47 |
0.3702058 |
86.4% |
86.2% |
0.98 |
0.5 |
78.8% |
84.0% |
1.42 |
0.2509382 |
89.6% |
97.4% |
4.30 |
0.110807 |
| hCV11745746 |
G |
A |
90.0% |
95.2% |
2.20 |
0.0097508 |
83.7% |
91.2% |
2.20 |
0.000318 |
78.7% |
79.8% |
0.97 |
0.5336522 |
88.7% |
96.1% |
332 |
0.018827 |
| hCV11746746 |
G |
C |
97.4% |
97.3% |
0.97 |
1 |
95.9% |
89.4% |
7.13 |
0.9981004 |
90.7% |
100.0% |
9.89 |
0.0312801 |
95.8% |
94.4% |
0.74 |
0.5 |
| hCV11745746 |
G |
O |
74.4% |
90.2% |
3.18 |
0.0019923 |
56.5% |
70.0% |
1.80 |
0.0099604 |
70.0% |
62.0% |
0.70 |
0.7781595 |
77.1% |
97.4% |
11.00 |
0.004977 |
| hCV11749854 |
G |
A |
81.8% |
77.0% |
0.75 |
0.0996729 |
85.9% |
78.8% |
0.62 |
0.0031343 |
84.6% |
87.2% |
1.34 |
0.7685416 |
79.0% |
73.7% |
0.78 |
0.2459388 |
| hCV11749854 |
G |
C |
77.4% |
72.9% |
0.78 |
0.2330053 |
81.7% |
72.8% |
0.60 |
0.0030488 |
79.6% |
81.8% |
1.15 |
0.5 |
80.6% |
77.8% |
0.84 |
0.4008579 |
| hCV11749854 |
G |
O |
91.2% |
86.6% |
0.63 |
0.2883911 |
95.5% |
94.6% |
0.84 |
0.3942691 |
67.5% |
92.0% |
1.64 |
0.7177247 |
77.1% |
71.1% |
0.73 |
0.3104902 |
| hCV11894038 |
G |
A |
42.3% |
51.5% |
1.43 |
0.011397 |
38.3% |
44.4% |
1.27 |
0.0353759 |
29.4% |
35.1% |
1.22 |
0.2469908 |
41.1% |
47.4% |
1.53 |
0.0790408 |
| hCV11894038 |
G |
C |
47.4% |
55.3% |
1.37 |
0.063105 |
42.2% |
50.0% |
1.37 |
0.0228613 |
40.7% |
40.9% |
1.01 |
0.5 |
52.8% |
52.8% |
1.00 |
0.5 |
| hCV11894038 |
G |
O |
31.6% |
42.5% |
1.60 |
0.0803792 |
29.6% |
30.0% |
1.02 |
0.5 |
22.5% |
30.0% |
1.48 |
0.2042361 |
22.9% |
44.7% |
2.72 |
0.0195193 |
| hCV11935588 |
T |
A |
60.9% |
83.2% |
0.50 |
0.0005557 |
89.8% |
85.5% |
0.69 |
0.030135 |
94.1% |
89.4% |
0.50 |
0.0915285 |
95.2% |
89.5% |
0.45 |
0.0624204 |
| hCV11935588 |
T |
C |
89.3% |
81.2% |
0.51 |
0.0051002 |
86.9% |
81.7% |
0.67 |
0.0365598 |
90.7% |
79.5% |
0.40 |
0.0750036 |
97.2% |
83.3% |
0.14 |
0.007968 |
| hCV11935588 |
T |
O |
94.2% |
87.8% |
0.44 |
0.0845845 |
98.1% |
95.4% |
0.84 |
0.388138 |
97.5% |
98.0% |
1.26 |
0.5 |
91.7% |
94.7% |
1.64 |
0.6551712 |
| hCV11944682 |
T |
A |
69.7% |
78.5% |
1.60 |
0.0046925 |
71.2% |
75.6% |
1.26 |
0.0576985 |
71.3% |
71.3% |
0.94 |
0.6844489 |
69.4% |
78.9% |
1.80 |
0.0464023 |
| hCV11944682 |
T |
C |
67.8% |
78.7% |
1.75 |
0.0052231 |
70.6% |
75.7% |
1.30 |
0.0711081 |
74.1% |
72.7% |
0.93 |
0.5 |
68.1% |
77.8% |
1.64 |
0.184608 |
| hCV11944582 |
T |
O |
73.5% |
78.0% |
1.28 |
0.1683295 |
72.4% |
75.4% |
1.17 |
0.2947384 |
71.3% |
70.0% |
0.94 |
0.5 |
68.8% |
81.6% |
2.01 |
0.1089093 |
| hCV11955739 |
G |
A |
91.5% |
84.8% |
0.52 |
0.0018691 |
92.5% |
89.1% |
0.68 |
0.0435773 |
93.4% |
88.3% |
0.54 |
0.0978022 |
87.9% |
88.2% |
1.12 |
0.5975364 |
| hCV11955739 |
G |
C |
90.4% |
79.8% |
0.42 |
0.000265 |
90.1% |
86.7% |
0.72 |
0.094331 |
96.3% |
84.1% |
0.20 |
0.0369249 |
86.1% |
86.1% |
1.00 |
0.5 |
| hCV11955739 |
G |
O |
93.8% |
96.3% |
1.73 |
0.5809754 |
98.0% |
95.4% |
0.42 |
0.8449941 |
91.3% |
92.0% |
1.10 |
0.5 |
89.6% |
92.1% |
1.36 |
0.5 |
| hCV1198809 |
T |
A |
6.4% |
11.5% |
2.14 |
0.0024034 |
2.8% |
5.6% |
2.19 |
0.0096633 |
8.1% |
9.6% |
1.27 |
0.3063578 |
9.7% |
11.6% |
0.99 |
0.5218036 |
| hCV1198609 |
T |
C |
2.6% |
2.7% |
1.03 |
1 |
1.5% |
2.7% |
1.84 |
0.1471146 |
3.7% |
4.5% |
1.24 |
0.5 |
0.0% |
5.6% |
10.51 |
0.9454829 |
| hCV1198609 |
T |
O |
14.3% |
31.7% |
2.77 |
0.0009268 |
5.8% |
13.1% |
2.42 |
0.0200566 |
11.3% |
14.0% |
1.28 |
0.3923433 |
25.0% |
18.4% |
0.88 |
0.6987978 |
| hCV11986235 |
G |
A |
96.2% |
93.3% |
0.55 |
0.0517609 |
96.8% |
94.4% |
0.58 |
0.0435025 |
96.3% |
97.9% |
1.46 |
0.6625662 |
98.4% |
98.7% |
1.19 |
0.5530895 |
| hCV11986235 |
G |
C |
95.2% |
91.5% |
0.54 |
0.0697466 |
96.2% |
93.2% |
0.54 |
0.0438543 |
98.1% |
95.5% |
0.40 |
0.2930123 |
97.2% |
100.0% |
2.59 |
0.2757009 |
| hCV11986235 |
G |
O |
98.4% |
97.5% |
0.62 |
0.6311623 |
98.1% |
97.7% |
0.84 |
0.5 |
96.3% |
100.0% |
4.56 |
0.1422182 |
100.0% |
97.4% |
0.26 |
0.2209302 |
| hCV1259266 |
T |
A |
43.2% |
51.1% |
1.37 |
0.0323507 |
36.5% |
47.4% |
1.58 |
0.0005479 |
31.6% |
29.8% |
0.78 |
0.7841436 |
46.0% |
50.0% |
1.21 |
0.265858 |
| hCV1259266 |
T |
C |
50.6% |
60.1% |
1.47 |
0.0273133 |
47.4% |
58.3% |
1.56 |
0.0022566 |
55.6% |
45.5% |
0.67 |
0.7916225 |
55.6% |
50.0% |
0.80 |
0.6584099 |
| hCV1259266 |
T |
O |
27.7% |
30.0% |
1.12 |
0.7761833 |
12.3% |
19.2% |
1.69 |
0.0691347 |
16.3% |
16.0% |
0.98 |
0.5 |
31.3% |
47.4% |
1.98 |
0.0901214 |
| hCV1283127 |
G |
A |
33.1% |
27.0% |
0.75 |
0.008346 |
34.1% |
29.5% |
0.81 |
0.067913 |
33.8% |
30.9% |
0.90 |
0.3580695 |
29.8% |
27.6% |
0.91 |
0,3811914 |
| hCV1283127 |
G |
C |
32.0% |
24.5% |
0.69 |
0.0533312 |
32.3% |
28.1% |
0.82 |
0.1220061 |
31.5% |
25.0% |
0.73 |
0.2545188 |
26.4% |
30.6% |
1.23 |
0.6724109 |
| hCV1283127 |
G |
O |
33.4% |
32.9% |
0.90 |
0.7904387 |
38.3% |
33.1% |
0.80 |
0.1932143 |
35.0% |
38.0% |
1.04 |
0.5 |
36.4% |
26.3% |
0.65 |
0.2417924 |
| hCV1478583 |
G |
A |
86.7% |
91.1% |
1.57 |
0.0662621 |
79.7% |
88.2% |
2.05 |
0.0002096 |
77.9% |
81.9% |
1.18 |
0.3232367 |
87.9% |
85.5% |
0.99 |
0.5208237 |
| hCV1478583 |
G |
C |
94.7% |
96.3% |
1.46 |
0.4396698 |
94.8% |
98.2% |
1.38 |
0.231632 |
96.3% |
97.7% |
1.65 |
0.5 |
97.2% |
91.7% |
0.31 |
0.8346649 |
| hCV1478583 |
G |
O |
70.0% |
79.3% |
1.64 |
0.1201572 |
46.1% |
67.7% |
2.45 |
0.0001557 |
65.0% |
68.0% |
1.14 |
0.4246091 |
72.9% |
78.9% |
1.39 |
0.3083447 |
| hCV15851335 |
T |
A |
5.8% |
1.9% |
0.30 |
0.0072754 |
7.0% |
4.3% |
0.58 |
0.0227685 |
2.2% |
2.1% |
0.85 |
0.4338886 |
6.5% |
0.0% |
0.09 |
0.0148288 |
| hCV15851335 |
T |
C |
7.2% |
2.1% |
0.28 |
0.010777 |
9.6% |
5.6% |
0.56 |
0.0301776 |
3.7% |
4.5% |
1.24 |
0.5 |
8.3% |
0.0% |
0.14 |
0.0877683 |
| hCV15851935 |
T |
O |
3.1% |
1.2% |
0.39 |
0.6924577 |
1.3% |
0.8% |
0.59 |
0.5 |
1.3% |
0.0% |
0.52 |
0.5 |
4.2% |
0.0% |
0.24 |
0.2504788 |
| hCV15863499 |
T |
A |
95.5% |
92.6% |
0.59 |
0.0618752 |
98.4% |
94.0% |
0.01 |
0.0520397 |
96.3% |
90.4% |
0.38 |
0.0385316 |
88.7% |
90.8% |
1.20 |
0.6425593 |
| hCV15853499 |
T |
C |
94.9% |
94.1% |
0.87 |
0.7081211 |
95.3% |
92.3% |
0.59 |
0.056015 |
94.4% |
90.9% |
0.69 |
0.3486228 |
90.3% |
81.7% |
1.18 |
0.5 |
| hCV15853499 |
T |
O |
96.8% |
89.0% |
0.26 |
0.0077447 |
98.7% |
98.5% |
0.84 |
0.5 |
97.5% |
90.0% |
0.23 |
0.0532156 |
87.5% |
89.5% |
1.21 |
0.6 |
| hCV16964790 |
T |
A |
93.6% |
88.1% |
0.51 |
0.0037912 |
93.6% |
81.2% |
0.73 |
0.1032006 |
91.9% |
91.5% |
1.07 |
0.5545812 |
88.3% |
84.7% |
3.29 |
0.9750382 |
| hCV15964790 |
T |
C |
93.3% |
88.7% |
0.47 |
0.008645 |
92.2% |
89.1% |
0.69 |
0.0947529 |
85.2% |
84.1% |
0.92 |
0.5 |
84.7% |
91.7% |
1.98 |
0.8112456 |
| hCV15964790 |
T |
O |
94.1% |
91.3% |
0.65 |
0.4359617 |
96,8% |
96.9% |
1.08 |
0.5 |
96.3% |
98.0% |
1.91 |
0.5 |
89.6% |
100.0% |
9.74 |
0.0317899 |
| hCV16166459 |
T |
A |
21.0% |
14.1% |
0.61 |
0.0134207 |
25.5% |
19.4% |
0.70 |
0.0235762 |
37.5% |
34.0% |
1.00 |
0.5191415 |
14.5% |
6.6% |
0.31 |
0.013379 |
| hCV/16166459 |
T |
C |
.9.2% |
8.5% |
0.92 |
0.8629064 |
9.3% |
7.1% |
0.75 |
0.1650372 |
5.6% |
9.1% |
1.70 |
0.6513772 |
42% |
2.8% |
0.66 |
0.5 |
| hCV16166459 |
T |
O |
45.8% |
28.8% |
0.43 |
0.0029464 |
61.7% |
51.5% |
0.66 |
0.0465309 |
58.8% |
56.0% |
0.89 |
0.4277638 |
31.3% |
10.5% |
0.28 |
0.0173445 |
| hCV16167920 |
C |
A |
10.8% |
6.7% |
0.59 |
0.0660072 |
12.4% |
8.0% |
0.72 |
0.0885388 |
18.4% |
14.9% |
0 88 |
0.3461091 |
11.3% |
10.5% |
0.87 |
0.3817314 |
| hCV16167920 |
C |
C |
4.4% |
1.1% |
0.23 |
0.0374108 |
6.4% |
3.0% |
0.45 |
0.0225512 |
7.4% |
6.8% |
0.91 |
0.5 |
4.2% |
8.3% |
2.09 |
0.800967 |
| hCV16167920 |
C |
O |
24.2% |
20.0% |
0.78 |
0.5440817 |
28.0% |
24.6% |
0.93 |
0.4456023 |
25.0% |
22.0% |
0.85 |
0.4165074 |
20.5% |
13.2% |
0,58 |
0.201779 |
| hCV1728298 |
G |
A |
47.4% |
47.0% |
0.97 |
0.8217364 |
44.4% |
47.2% |
1.08 |
0.7041888 |
32.4% |
37.2% |
1.18 |
0.7177985 |
45.2% |
55.6% |
1.79 |
0.974872 |
| hCV1728298 |
G |
C |
57.2% |
51.1% |
0.78 |
0.1489372 |
58.1% |
56.5% |
0.94 |
0.3494331 |
50.0% |
45.5% |
0.83 |
0.3442489 |
59.7% |
58.3% |
0.94 |
0.5 |
| hCV1728298 |
G |
O |
26.6% |
37.8% |
1.68 |
0.0692913 |
13.6% |
23.1% |
1.90 |
0.0221246 |
20.0% |
30.0% |
1.71 |
0.1050529 |
20.8% |
52.% |
4.22 |
0.0014959 |
| hCV1801164 |
G |
A |
42.8% |
48.9% |
1.28 |
0.0859458 |
44.5% |
50.9% |
1.30 |
0.022824 |
51.5% |
54.3% |
1.14 |
0.3116424 |
45.2% |
50.0% |
1.23 |
0.2453778 |
| hCV1801154 |
G |
C |
41.1% |
50.5% |
1.47 |
0.0313319 |
42.7% |
50.3% |
1.36 |
0.027081 |
53.7% |
40.9% |
0.60 |
0.8857355 |
48.6% |
55.6% |
1.32 |
0.2721597 |
| hCV1801154 |
G |
O |
48.7% |
45.0% |
0.93 |
0.7976721 |
48.7% |
62.3% |
1.16 |
0.7244534 |
50.0% |
66.0% |
1.94 |
0.9491307 |
41.7% |
44.7% |
1.13 |
0.5857485 |
| hCV1895513 |
T |
A |
21.8% |
16.7% |
0.71 |
0.0639765 |
24.1% |
20.1% |
0.79 |
0.0876873 |
17.6% |
23.4% |
1.40 |
0.8437975 |
21.0% |
7.9% |
0.32 |
0.0076906 |
| hCV1896513 |
T |
C |
23.7% |
18.6% |
0.74 |
0.1567194 |
22.7% |
21.3% |
0.92 |
0.3556691 |
16.5% |
22.7% |
1.29 |
0.6679993 |
23.6% |
5.6% |
0.19 |
0.0148618 |
| hCV1895513 |
T |
O |
17.6% |
12.2% |
0.64 |
0.3048613 |
27.3% |
16.9% |
0.54 |
0.0228026 |
17.8% |
24.0% |
1.49 |
0.8114331 |
18.8% |
10.5% |
0.51 |
0.1854525 |
| hCT192738 |
G |
A |
19.0% |
12.6% |
0.60 |
0.0132259 |
19.7% |
16.0% |
0.76 |
0.0546488 |
17.8% |
19.1% |
1.10 |
0.8029358 |
18.5% |
14.5% |
0.74 |
0.2226355 |
| hCV192738 |
G |
C |
21.7% |
14.9% |
0.03 |
0.0448195 |
23.3% |
17.8% |
0.71 |
0.0438758 |
14.8% |
20.5% |
1.48 |
0.7033718 |
16.7% |
19.4% |
1.21 |
0.6046873 |
| hCV192738 |
G |
O |
13.5% |
7.3% |
0.51 |
0.1725374 |
11.7% |
11.5% |
0.99 |
0.5 |
20.0% |
18.0% |
0.88 |
0.4115959 |
22.9% |
10.5% |
0.40 |
0.0805099 |
| hCV222T1827 |
T |
A |
92.5% |
97.8% |
3.73 |
0.001979 |
85.7% |
91.7% |
1.93 |
0.0031921 |
81.6% |
80.9% |
0.73 |
0.7960624 |
92.7% |
94.7% |
1.98 |
0.1465974 |
| hCV22271827 |
T |
C |
98.9% |
100.0% |
4.58 |
0.3472479 |
98.0% |
99.7% |
7.00 |
0.9656028 |
98.1% |
100.0% |
2.50 |
0.5 |
100.0% |
100.0% |
0.50 |
0.5 |
| hCV22271827 |
T |
O |
78.9% |
92.5% |
3.30 |
0.0043726 |
58.4% |
70.8% |
1.72 |
0.0175525 |
72.5% |
64.0% |
0.67 |
0.8332934 |
81.3% |
89.5% |
1.96 |
0.1854525 |
| hCV22212667 |
G |
A |
67.5% |
72.0% |
1.23 |
0.1909831 |
65.9% |
72.1% |
1.32 |
0.0263995 |
61.9% |
69.6% |
0.86 |
0.7122417 |
66.9% |
71.1% |
1.34 |
0.1860041 |
| hCV22272667 |
G |
C |
71.1% |
77.7% |
1.41 |
0.0872495 |
71.8% |
76.8% |
1.30 |
0.0801687 |
77.8% |
63.6% |
0.50 |
0.9114728 |
68.1% |
72.2% |
1.22 |
0.4124901 |
| hCV22272667 |
G |
O |
69.8% |
58.8% |
0.96 |
0.8966358 |
52.6% |
60.0% |
1.35 |
0.8843551 |
51.3% |
56.0% |
1.21 |
0.6415703 |
62.5% |
71.1% |
1.47 |
0.7534556 |
| hCV22272823 |
G |
A |
81.8% |
73.1% |
0.60 |
0.0022798 |
84.5% |
80.9% |
0.78 |
0.0691569 |
83.1% |
87.2% |
1.46 |
0.8358282 |
80.0% |
77.6% |
0.75 |
0.2130584 |
| hCV22272823 |
G |
C |
82.4% |
73.4% |
0.59 |
0.010691 |
85.8% |
79.2% |
0.83 |
0.0131899 |
79.8% |
84.1% |
1.35 |
0.6947045 |
81.9% |
76.0% |
0.66 |
0.2255004 |
| hCV22272823 |
G |
O |
80.5% |
72.5% |
0.64 |
0.1594207 |
81.8% |
85.4% |
1.30 |
0.7390766 |
85.0% |
80.0% |
1.59 |
0.7030736 |
81.3% |
79.9% |
0.87 |
0.3963098 |
| hCV22274307 |
T |
A |
69.2% |
77.8% |
1.67 |
0.006257 |
70.7% |
74.2% |
1.20 |
0.1086048 |
69.1% |
71.3% |
1.04 |
0.4469958 |
89.4% |
78.9% |
1.60 |
0.0464023 |
| hCV22274307 |
T |
C |
67.5% |
77.7% |
1.68 |
0.009554 |
70.1% |
76.0% |
1.28 |
0.0846705 |
74.1% |
72.7% |
0.93 |
0.5 |
68.1% |
77.8% |
1.64 |
0.184606 |
| hCV22274307 |
T |
O |
72.7% |
78.0% |
1.34 |
0.3676749 |
72.1% |
72.3% |
1.01 |
0.5 |
67.5% |
70.0% |
1.12 |
0.4236004 |
68.8% |
81.6% |
2.01 |
0.1089093 |
| hCV22274712 |
G |
A |
50.0% |
42.4% |
0.74 |
0.0389661 |
52.4% |
48.7% |
0.89 |
0.1941063 |
52.9% |
48.9% |
0.56 |
0.3178886 |
41.0% |
30.3% |
0.60 |
0.0543973 |
| hCV22274712 |
G |
C |
43.0% |
40.2% |
0.89 |
0.5448381 |
40.1% |
40.5% |
1.02 |
0.5310999 |
35.2% |
38.6% |
1.16 |
0.5831574 |
38.9% |
25.0% |
0.52 |
0.0989716 |
| hCV22274712 |
G |
O |
64.7% |
47.5% |
0.49 |
0.0084196 |
79.9% |
70.0% |
0.59 |
0.0359988 |
66.3% |
58.0% |
0.70 |
0.178439 |
45.8% |
36.8% |
0.69 |
0.2549187 |
| hCV2231920 |
G |
A |
71.6% |
75.2% |
1.21 |
0.2247586 |
76.2% |
77.9% |
1.14 |
0.1982516 |
79.9% |
79.8% |
1.08 |
0.4084657 |
78.6% |
67.1% |
0.61 |
0.9343178 |
| hCV2231920 |
G |
C |
66.4% |
75.0% |
1.52 |
0.0288903 |
68.7% |
74.7% |
1.34 |
0.0443199 |
73.1% |
70.5% |
0.88 |
0.5887958 |
76.4% |
58.3% |
0.43 |
0.9633293 |
| hCV2231920 |
G |
O |
82.7% |
75.6% |
0.66 |
0.1957481 |
92.9% |
86.2% |
0.48 |
0.0384883 |
83.8% |
88.0% |
1.42 |
0.6930522 |
77.1% |
76.3% |
0.98 |
0.5 |
| hCV2231945 |
T |
A |
53.7% |
60.7% |
1.33 |
0.0486449 |
50.4% |
55.8% |
1.23 |
0.0579431 |
47.0% |
48.8% |
1.06 |
0.4103812 |
50.8% |
53 9% |
1.19 |
0.2768125 |
| hCV2231945 |
T |
C |
55.3% |
63.8% |
1.42 |
0.0489138 |
53.8% |
58.8% |
1.22 |
0.108711 |
51.8% |
52.3% |
1.02 |
0.6 |
54.2% |
50.0% |
0.85 |
0.65555572 |
| hCV2231945 |
T |
O |
50.4% |
53.7% |
1.14 |
0.5149383 |
42.9% |
485% |
1.25 |
0.2012655 |
43.6% |
48.0% |
1.10 |
0.4280525 |
43.8% |
57.9% |
1.77 |
0.1387843 |
| hCV2361150 |
G |
A |
31.2% |
23.3% |
0.67 |
0.0167009 |
38.6% |
31.8% |
0.76 |
0.0275758 |
47.8% |
47.9% |
1.13 |
0.6655958 |
29.8% |
25.0% |
0.70 |
0.1323782 |
| hCV2351160 |
G |
C |
23.2% |
18.1% |
0.73 |
0.1532795 |
28.2% |
20.7% |
0.74 |
0.0519376 |
29.6% |
31.6% |
1.11 |
0.5854141 |
18.1% |
25.0% |
1.51 |
0.7744996 |
| hCV2351160 |
G |
O |
48.1% |
35.4% |
0.59 |
0.05586 |
66.2% |
60.8% |
0.79 |
0.1931171 |
58.8% |
62.0% |
1.15 |
0.6729245 |
60.0% |
26.3% |
0.36 |
0.0144927 |
| hCV2364392 |
T |
A |
7.0% |
3.4% |
0.46 |
0.0305408 |
8.0% |
5.6% |
0.67 |
0.05966828 |
2.2% |
4.3% |
2.07 |
0.8362451 |
9.8% |
3.9% |
0.42 |
0.0874284 |
| hCV2384392 |
T |
C |
6.6% |
4.3% |
0.63 |
0.28825 |
8.1% |
6.5% |
0.79 |
0.231934 |
1.9% |
0.0% |
0.40 |
0.5 |
12.9% |
8.3% |
0.62 |
0.3736625 |
| hCV23843A2 |
T |
O |
7.8% |
1.2% |
0.15 |
0.0335213 |
7.8% |
3.1% |
0.38 |
0.0602507 |
2.6% |
8.0% |
3.39 |
0.6982428 |
6.3% |
0.0% |
0.17 |
0.1257182 |
| hCV2479345 |
G |
A |
39.8% |
47.0% |
1.34 |
0.0437608 |
38.2% |
43.6% |
1.23 |
0.0640699 |
39.0% |
41.5% |
1.11 |
0.3523926 |
46.0% |
48.7% |
1.17 |
0.2993821 |
| hCV2479345 |
G |
C |
44.1% |
64.8% |
1.50 |
0.0176633 |
44.8% |
50.6% |
1.25 |
0.072576 |
48.1% |
47.7% |
0.98 |
0.5 |
47.2% |
44.4% |
0.89 |
0.5802075 |
| hCV2479345 |
G |
O |
30.8% |
30.5% |
0.99 |
1 |
23.4% |
25.4% |
1.12 |
0.6092964 |
31.3% |
36.0% |
1.24 |
06490884 |
43.8% |
55.3% |
1.59 |
0.8073852 |
| hCV25600642 |
C |
A |
9.5% |
5.9% |
0.60 |
0.0692833 |
9.4% |
5.6% |
0.55 |
0.0082676 |
6.1% |
8.5% |
1.65 |
0.8233932 |
8.1% |
7.9% |
1.30 |
0.8763239 |
| hCV25800642 |
C |
C |
10.5% |
6.4% |
0.68 |
0,1115538 |
11.9% |
6.5% |
0.51 |
0.0085046 |
1.9% |
15.9% |
10.03 |
0.9895562 |
8.3% |
8.3% |
1.00 |
0.5 |
| hCV25500642 |
C |
O |
7.3% |
4.9% |
0.65 |
0.614311 |
3.9% |
31% |
0.78 |
0.3792678 |
7.5% |
2.0% |
0.25 |
0.1243315 |
4.2% |
7.9% |
1.97 |
0.6745676 |
| hCV25609481 |
G |
A |
77.3% |
85.9% |
1.83 |
0.0023178 |
73.6% |
80.0% |
1.46 |
0.0205478 |
61.8% |
64.9% |
0.98 |
0.5280967 |
83.1% |
92.1% |
3.04 |
0.0123415 |
| hCV25809481 |
G |
C |
88.8% |
91.0% |
1.29 |
0.416313 |
88.5% |
92.1% |
1.38 |
0.1418109 |
94.4% |
88.6% |
0.46 |
0.7894846 |
91.7% |
97.2% |
3.18 |
0.2102158 |
| hCV25608481 |
G |
O |
53.5% |
74.4% |
2.53 |
0.0008009 |
39.0% |
49.2% |
1.52 |
0.0460B03 |
40.0% |
44.0% |
1.18 |
0.3579197 |
68.8% |
88.8% |
3.00 |
0.0356764 |
| hCV25639661 |
G |
A |
80.9% |
74.4% |
0.71 |
0.0362201 |
81.7% |
76.3% |
0.69 |
0.0108558 |
91.9% |
81.9% |
0.43 |
0.00190075 |
83.9% |
82.9% |
0.79 |
0.2748191 |
| hCV25639661 |
G |
C |
78.5% |
69.7% |
0.63 |
0.0170137 |
77.6% |
71.7% |
0.73 |
0.0392889 |
85.2% |
75.0% |
0.52 |
0.1521165 |
81.9% |
69.4% |
0.50 |
0.0749799 |
| hCV25639661 |
G |
O |
85.0% |
85.4% |
1.03 |
1 |
90.9% |
84.6% |
0.66 |
0.9292928 |
96.3% |
88.0% |
0.29 |
0.95688833 |
87.5% |
94.7% |
2.57 |
0.1467277 |
| hCV25741844 |
T |
A |
17.4% |
28.5% |
1.88 |
8.38E-05 |
17.9% |
21.8% |
1.25 |
0.083091 |
16.9% |
20.2% |
1.18 |
0.317384 |
18.5% |
23.7% |
1.37 |
0.1912076 |
| hCV25741844 |
T |
C |
18.9% |
28.2% |
1.88 |
0.0096562 |
23.3% |
24.0% |
1.04 |
0.4265581 |
22.2% |
25.0% |
1.17 |
0.406462 |
15.3% |
22.2% |
1.58 |
0.212713 |
| hCV25741844 |
T |
O |
14.2% |
29.3% |
2.49 |
0.0028723 |
5.8% |
16.2% |
3.10 |
0.0031024 |
13.8% |
16.0% |
1.19 |
0.4002202 |
22.9% |
26.3% |
1.20 |
0.4012361 |
| hCV25750908 |
T |
A |
8.4% |
7.1% |
0.86 |
0.5005308 |
10.9% |
9.0% |
0.85 |
0.2349871 |
13.2% |
13.8% |
1.23 |
0.6896759 |
8.9% |
9.2% |
0.95 |
0.4587783 |
| hCV25760908 |
T |
C |
4.3% |
6.9% |
1.67 |
0.1708664 |
2.6% |
5.3% |
2.09 |
0.0393616 |
1.9% |
6.8% |
3.88 |
0.181557 |
6.9% |
5.6% |
0.79 |
0.5 |
| hCV25750908 |
T |
O |
17.2% |
75% |
0.39 |
0.0320676 |
29.6% |
18.5% |
0.54 |
0.0184656 |
20.0% |
20.0% |
1.00 |
0.5 |
12.5% |
13.2% |
1.06 |
0.5 |
| hCV25766820 |
G |
A |
22.6% |
14.4% |
0.57 |
0.0045595 |
28.7% |
20.1% |
0.68 |
0.0143452 |
37.5% |
36.1% |
1.08 |
0.6731106 |
16.9% |
7.9% |
0.33 |
0.0123415 |
| hCV25766820 |
G |
C |
11.1% |
9.0% |
0.80 |
0.4925196 |
10.8% |
7.7% |
0.69 |
0.0934248 |
5.6% |
11.4% |
2.18 |
0.7694848 |
8.3% |
2.8% |
0.31 |
0.2102168 |
| hCV25766820 |
G |
O |
46.5% |
26.8% |
0.42 |
0.0019532 |
62.3% |
52.3% |
0.66 |
0.048492 |
58.8% |
56.0% |
0.89 |
0.4277638 |
31.3% |
13.2% |
0.33 |
0.0356784 |
| hCV25932158 |
G |
A |
65.1% |
50.4% |
0.55 |
2.56E-05 |
70.3% |
62.4% |
0.71 |
0.0083249 |
73.5% |
66.0% |
0.77 |
0.2080726 |
60.5% |
59.2% |
1.02 |
0.5340583 |
| hCV25932158 |
G |
C |
57.6% |
46.9% |
0.71 |
0.0413369 |
61.3% |
55.3% |
0.78 |
0.0602454 |
46.3% |
47.7% |
1.06 |
0.5 |
54.2% |
58.3% |
1.18 |
0.5812691 |
| hCV25932158 |
G |
O |
80.9% |
63.8% |
0.26 |
3.59E-06 |
90.3% |
80.8% |
0.45 |
0.0130339 |
91.3% |
82.0% |
0.44 |
0.0845516 |
66.7% |
63.2% |
0.88 |
0.4105438 |
| hCV25934437 |
T |
A |
4.5% |
1.5% |
0.32 |
0.0257952 |
6.8% |
3.2% |
0.46 |
0.0064385 |
3.7% |
4.3% |
1.27 |
0.6304862 |
5.6% |
3.9% |
0.47 |
0.1565493 |
| hCV25934497 |
T |
C |
3.9% |
0.0% |
0.06 |
0.003668 |
6.1% |
1.8% |
0.28 |
0.0025302 |
0.0% |
4.5% |
6.41 |
0.0995161 |
42% |
5.6% |
1.35 |
0.5 |
| hCV25934437 |
T |
O |
6.8% |
4.9% |
0.84 |
1 |
8.4% |
8.9% |
0.81 |
0.3317227 |
6.3% |
4.2% |
0.85 |
0.355304 |
8.3% |
0.0% |
0.13 |
0.0631947 |
| hCV25957240 |
C |
A |
58.6% |
68.1% |
1.65 |
0.000971 |
49.0% |
55.3% |
1.26 |
0.0441171 |
47.8% |
51.1% |
1.10 |
0.3693534 |
56.5% |
57.9% |
1.13 |
0.3449201 |
| hCV26857240 |
C |
C |
64.9% |
75.5% |
1.67 |
0.0086116 |
61.5% |
66.1% |
1.16 |
0.191056 |
61.1% |
70.6% |
1.52 |
0.198139 |
59.7% |
51.1% |
1.08 |
0.5 |
| hCV25957240 |
C |
O |
39.2% |
51.2% |
1.63 |
0.072138 |
20.8% |
30.0% |
1.53 |
0.0492322 |
37.5% |
34.0% |
0.66 |
0.644143 |
47.9% |
52.6% |
1.21 |
0.41414 |
| hCV25984261 |
C |
A |
2.8% |
0.7% |
0.27 |
0.0806644 |
3.6% |
1.1% |
0.30 |
0.0071254 |
5.1% |
4.3% |
0.89 |
0.4248321 |
24% |
0.0% |
0.23 |
0.0742667 |
| hCV25984261 |
C |
C |
1.7% |
0.0% |
15.00 |
0.1213053 |
1.5% |
0.0% |
0.09 |
0.0308162 |
1.9% |
0.0% |
0.40 |
0.6 |
1.4% |
0.0% |
0.65 |
0.5 |
| hCV26984261 hCV2729190 |
C |
O |
5.1% |
2.5% |
0.48 |
0.5353937 |
8.4% |
3.8% |
0.43 |
0.0721085 |
7.5% |
8.0% |
1.07 |
0.5 |
42% |
0.0% |
0.24 |
0.2504788 |
| hCV2729190 |
C |
A |
59.8% |
53.7% |
0.78 |
0.0837914 |
63.5% |
57.5% |
0.78 |
0.0301542 |
60.3% |
58.5% |
0.90 |
0.354065 |
50.0% |
54.5% |
1.76 |
0.9684743 |
| hCV2729780 |
C |
C |
59.1% |
53.7% |
0.80 |
0.2301474 |
63.4% |
56.5% |
0.75 |
0.0362308 |
64.8% |
63.6% |
0.85 |
0.5 |
47.2% |
61.1% |
1.76 |
0.8893847 |
| hCV2729190 |
C |
O |
61.3% |
53.8% |
0.73 |
0.2421394 |
83.0% |
60.0% |
0.88 |
0.2709783 |
57.5% |
54.0% |
0.87 |
0.9597702 |
52.1% |
56.8% |
1.77 |
0.684224 |
| hCV2730005 |
C |
A |
56.4% |
63.8% |
1.35 |
0.0433036 |
48.2% |
58.3% |
1.52 |
0.0013326 |
45.6% |
50.0% |
1.12 |
0.3403385 |
57.3% |
55.3% |
0.94 |
0.5833889 |
| hC2730005C |
C |
C |
63.1% |
71.8% |
1.49 |
0.0328832 |
59.8% |
70.1% |
1.69 |
0.0024798 |
59.3% |
68.2% |
1.47 |
0.2023347 |
65.3% |
72.2% |
1.38 |
0.2595748 |
| hCV2730005 |
C |
O |
42.2% |
45.0% |
1.12 |
0.6985973 |
22.4% |
27.7% |
1.33 |
0.1871633 |
38.3% |
34.0% |
0.91 |
0.6740851 |
47.9% |
36.8% |
0.63 |
0.8091472 |
| hCV27915384 |
G |
A |
21.1% |
18.7% |
0.65 |
0.3876027 |
21.5% |
19.7% |
0.89 |
0.2385044 |
25.7% |
23.4% |
0.73 |
0.1562376 |
17.7% |
17.1% |
0.97 |
0.4678049 |
| hCV27915384 |
G |
C |
23.7% |
17.6% |
0.69 |
0.0836062 |
23.5% |
18.0% |
0.72 |
0.0447214 |
35.2% |
22.7% |
0.54 |
0.0958734 |
19.4% |
19.4% |
1.00 |
0.5 |
| hCV27915384 |
G |
O |
15.6% |
21.3% |
1.48 |
0.2375873 |
16.9% |
23.8% |
1.54 |
0.0903208 |
25.0% |
24.0% |
0.96 |
0.5 |
16.7% |
15.8% |
0.94 |
0.5 |
| hCV2821340 |
G |
A |
45.5% |
41A% |
0.86 |
0.2603912 |
52.2% |
40.6% |
0.63 |
0.0002727 |
55.1% |
58.5% |
1.28 |
0.815011 |
41.1% |
44.7% |
1.02 |
0.5309518 |
| hCV2821340 |
G |
C |
36.6% |
39.2% |
1.03 |
0.8818654 |
43.0% |
34.6% |
0.70 |
0.9861062 |
33.3% |
50.0% |
2.00 |
0.0519241 |
38.9% |
33.3% |
0.79 |
0.6629824 |
| hCV282134o |
G |
O |
60.2% |
46.3% |
0.57 |
0.0381479 |
72.7% |
56.2% |
0.48 |
0.0020341 |
88.8% |
66.0% |
0.88 |
0.4237325 |
47.9% |
55.3% |
1.34 |
0.7386864 |
| hCV2917913 |
C |
A |
27.7% |
35.2% |
1.41 |
0.0225682 |
17.5% |
29.3% |
1.94 |
1.201E-05 |
19.1% |
16.0% |
0.74 |
0.7943893 |
22.6% |
22.4% |
1.06 |
0.4465787 |
| hCV2917913 |
C |
C O |
30.6% |
38.3% |
1.41 |
0.0577141 |
21.2% |
34.0% |
1.91 |
0.00011 |
33.3% |
25.0% |
0.67 |
0.8074125 |
33.3% |
30.6% |
0.88 |
0.5849791 |
| hCV2944794 |
C |
O |
21.7% |
25.0% |
1.41 |
0.2341711 |
91% |
16.9% |
2.04 |
0.0258357 |
8.8% |
8.0% |
0.91 |
0.5 |
8.3% |
13.2% |
1.67 |
0.2500131 |
| hCV2944794 |
G |
A |
59.2% |
66.1% |
1.46 |
0.0109708 |
49.0% |
56.8% |
1.37 |
0.0142538 |
39.0% |
44.7% |
1.14 |
0.3270483 |
65.3% |
71.1% |
1.60 |
0.0705768 |
| hCV2944794 |
G |
C |
69.7% |
70.7% |
1.06 |
0.8536804 |
64.8% |
68.6% |
1.19 |
0.1461785 |
61.1% |
63.6% |
1.11 |
0.4182628 |
77.8% |
75.0% |
0.86 |
0.5947856 |
| hCV2944794 |
G |
O |
37.3% |
62.2% |
2.76 |
0.0001101 |
13.6% |
26.2% |
2.24 |
0.0050606 |
25.0% |
28.0% |
1.17 |
0.4188608 |
43.8% |
68.4% |
2.79 |
0.0148206 |
| hCV3113062 hCV31130062 |
T |
A |
35.8% |
46.7% |
1.56 |
0.0016782 |
33.9% |
40.3% |
1.29 |
0.0319129 |
22.1% |
36.2% |
2.00 |
0.010507 |
43.6% |
48.4% |
1.03 |
0.4608034 |
| hCV3113062 |
T |
C |
40.1% |
52.7% |
1.66 |
0.0028426 |
42.2% |
48.2% |
1.28 |
0.0016715 |
25.9% |
43.2% |
2.17 |
0.0435725 |
47.2% |
44.4% |
0.89 |
0.5802075 |
| hCV3161768 |
G |
O |
25.9% |
32.9% |
1.33 |
0.2256496 |
15.6% |
20.0% |
1.35 |
0.1787042 |
18.8% |
30.0% |
1.86 |
0.0893253 |
37.5% |
42.1% |
121 |
0.4122427 |
| hCV3181768 |
G |
A |
63.0% |
52.2% |
0.98 |
0.8731043 |
61.4% |
57.7% |
0.88 |
0.1788584 |
72.8% |
55.3% |
0.48 |
0.00663 |
48.4% |
55.3% |
1.26 |
0.7859074 |
| hCV3161768 |
G |
C |
48.2% |
52.7% |
1.20 |
0.9081399 |
50.6% |
50.6% |
1.00 |
0.5 |
57.4% |
38.6% |
0.47 |
0.9642231 |
44.4% |
61.1% |
1.96 |
0.076287 |
| hCV277088 |
T |
O |
63.1% |
51.2% |
0.61 |
0.0697402 |
85.7% |
76.2% |
0.53 |
0.0234812 |
82.5% |
70.0% |
0.49 |
0.0646164 |
56.3% |
50.0% |
0.78 |
0.3322375 |
| hCV3277068 |
T |
A |
34.0% |
38.9% |
1.24 |
0.1389598 |
34.3% |
38.0% |
1.21 |
0.0806907 |
41.9% |
35.1% |
0.80 |
0.7852856 |
29.0% |
30.9% |
0.97 |
0.5359553 |
| hCV3277068 |
T |
C |
31.6% |
49.1% |
1.64 |
0.0057287 |
23.9% |
35.8% |
1.60 |
0.0030836 |
31.5% |
31.8% |
1.02 |
0.5 |
22.2% |
30.6% |
1.54 |
0.1779704 |
| hCV3277068 |
T |
O |
38.8% |
29.3% |
0.65 |
0.1477092 |
53.2% |
43.8% |
0.69 |
0.0813871 |
47.5% |
38.0% |
0.68 |
0.1820258 |
39.6% |
28.9% |
0.62 |
0.1828149 |
| hCV335227 |
T |
A |
73.5% |
83.0% |
0.61 |
0.0008623 |
75.1% |
68.6% |
0.73 |
0.0140747 |
71.3% |
67.0% |
0.82 |
0.2355535 |
62.1% |
88.4% |
1.46 |
0.6661633 |
| hCV335227 |
T |
C |
75.0% |
64.9% |
0.62 |
0.0104322 |
73.0% |
67.8% |
0.78 |
0.0769509 |
59.3% |
79.5% |
2.67 |
0.9757051 |
63.9% |
69.4% |
1.28 |
0.6655937 |
| hCV335227 |
T |
O |
70.4% |
58.5% |
0.59 |
0.0578774 |
79.9% |
70.8% |
0.61 |
0.0476561 |
80.0% |
56.0% |
0.32 |
0.0026143 |
56.3% |
68.4% |
1.69 |
0.8635952 |
| hCV674099 |
T |
A |
71.1% |
73.9% |
1.15 |
0.3678151 |
71.3% |
74.4% |
1.17 |
0.1451126 |
721% |
63.8% |
0.66 |
0.9230096 |
73.4% |
71.1% |
0.93 |
0.5809076 |
| hCV674099 |
T |
C |
68.9% |
75.5% |
1.39 |
0.0944191 |
70.6% |
75.7% |
1.30 |
0.0711081 |
66.7% |
63.6% |
0.88 |
0.5838947 |
68.1% |
72.2% |
1.22 |
0.4124901 |
| HCV674099 |
T |
O |
75.8% |
70.0% |
0.75 |
0.3072016 |
72.7% |
70.8% |
0.91 |
0.3956819 |
77.5% |
64.0% |
0.52 |
0.054748 |
81.3% |
73.7% |
0.65 |
0.2206983 |
| hCV7241 |
G |
A |
24.0% |
31.7% |
1.48 |
0.0113192 |
19.9% |
27.6% |
1.62 |
0.0029709 |
22.1% |
18.1% |
0.75 |
0.6021354 |
26.6% |
35.5% |
1.41 |
0.1418487 |
| hCV7241 |
G |
C |
22.4% |
30.3% |
1.51 |
0.0382331 |
21.8% |
28.7% |
1.44 |
0.0212809 |
22.2% |
26.0% |
1.17 |
0.408482 |
20.8% |
33.3% |
1.90 |
0.0831837 |
| hCV7241 |
G |
O |
27.3% |
35.0% |
1.43 |
0.2057864 |
15.6% |
24.6% |
1.77 |
0.0360397 |
22.5% |
12.0% |
0.47 |
0.9168906 |
35.4% |
36.8% |
1.06 |
0.5 |
| hCV7450990 |
A |
A |
94.3% |
90.7% |
0.59 |
0.0391687 |
96.2% |
92.3% |
0.49 |
0.0061715 |
94.1% |
95.7% |
1.74 |
0.803836 |
96.0% |
97.4% |
2.76 |
0.8330422 |
| hCV7450990 |
A |
C |
93.0% |
90.9% |
0.75 |
0.339284 |
94.8% |
90.8% |
0.55 |
0.0268948 |
85.2% |
80.9% |
1.74 |
0.7306021 |
94.4% |
97.2% |
2.06 |
0.6685363 |
| hCV7450990 |
A |
O |
97.2% |
90.2% |
0.26 |
0.0129737 |
99.4% |
98.2% |
0.16 |
0.0483577 |
100.0% |
100.0% |
0.63 |
0.5 |
97.9% |
100.0% |
2.43 |
0.5 |
| hCV7466465 |
T |
A |
5.5% |
4.4% |
0.81 |
0.5215258 |
4.8% |
3.8% |
0.84 |
0.2959541 |
2.9% |
3.2% |
1.07 |
0.5379254 |
4.0% |
6.6% |
1.65 |
0.7958127 |
| hCV7466465 |
T |
C |
5.9% |
1.6% |
0.26 |
0.016351 |
4.7% |
2.4% |
0.50 |
0.0723592 |
3.7% |
23% |
0.60 |
0.5 |
26% |
11.1% |
4.38 |
0.9530579 |
| hCV7466465 |
T |
O |
4.6% |
11.0% |
255 |
0.0601169 |
4.5% |
7.7% |
1.75 |
0.159673 |
2.5% |
4.0% |
1.63 |
0.3191723 |
6.3% |
2.6% |
0.41 |
0.6867114 |
| hCV7882185 |
G |
A |
17.7% |
20.5% |
1.21 |
0.2830687 |
19.1% |
25.4% |
1.48 |
0.0072586 |
23.5% |
17.0% |
0.66 |
0.867871 |
15.3% |
18.4% |
0.99 |
0.5205225 |
| hCV7882185 |
G |
C |
16.0% |
21.8% |
1.47 |
0.0752876 |
17.4% |
23.7% |
1.47 |
0.0234103 |
20.4% |
20.5% |
1.01 |
0.5 |
5.6% |
16.7% |
3.40 |
0.0403162 |
| hCV7882185 |
G |
O |
21.2% |
17.5% |
0.79 |
0.528216 |
22.7% |
30.0% |
1.46 |
0.9116229 |
25.0% |
14.0% |
0.49 |
0.0912612 |
31.3% |
18.4% |
0.50 |
0.1069093 |
| hCV8761599 |
T |
A |
85.4% |
80.4% |
0.70 |
0.0515777 |
86.9% |
83.8% |
0.79 |
0.0966237 |
91.2% |
85.1% |
0.58 |
0.0951258 |
81.5% |
77.6% |
0.80 |
0.2765724 |
| hCV8761599 |
T |
C |
84.0% |
79.8% |
0.75 |
0.2158783 |
84.3% |
82.0% |
0.85 |
0.2078402 |
90.7% |
79.5% |
0.40 |
0.0750036 |
76.4% |
75.0% |
0.93 |
0.5 |
| hCV8761599 |
T |
O |
88.5% |
81.7% |
0.58 |
0.133722 |
92.9% |
88.5% |
0.59 |
0.1102352 |
91.3% |
90.0% |
0.86 |
0.5 |
87.5% |
81.6% |
0.63 |
0.2744203 |
| hCV8853894 |
T |
A |
87.3% |
93.3 % |
2.02 |
0.0077809 |
83.3% |
88.2% |
1.46 |
0.0250629 |
81.6% |
85.1% |
1.15 |
0.3540533 |
91.1% |
91.9% |
1.15 |
0.3878615 |
| hCV8853894 |
T |
C |
92.6% |
95.2% |
1.58 |
0.3089678 |
90.4% |
93.8% |
1.60 |
0.0594588 |
96.3% |
90.9% |
0.38 |
0.7981508 |
94.4% |
88.2% |
0.44 |
0.8671687 |
| hCV8853894 |
T |
O |
76.2% |
89.0% |
2.54 |
0.0122277 |
67.5% |
73.8% |
1.36 |
0.1482903 |
72.5% |
80.0% |
1.52 |
0.2025485 |
85.4% |
94.7% |
3.07 |
0.1438192 |
| hCV8902345 |
T |
A |
55.2% |
43.7% |
0.62 |
0.0012654 |
56.6% |
51.3% |
0.83 |
0.0820887 |
63.2% |
60.6% |
0.95 |
0.4336586 |
48.4% |
55.3% |
1.12 |
0.6414179 |
| hCV8902345 |
T |
C |
46.9% |
34.6% |
0.60 |
0.003695 |
45.3% |
41.7% |
0.86 |
0.1772925 |
46.3% |
47.7% |
1.06 |
0.5 |
31.9% |
47.2% |
1.91 |
0.9290083 |
| hCV8902345 |
T |
O |
72.7% |
64.6% |
0.69 |
0.1665025 |
81.8% |
76.2% |
0.71 |
0.1225128 |
76.0% |
72.0% |
0.86 |
0.4188609 |
75.0% |
63.2% |
0.57 |
0.1243548 |
| hCV8934089 |
T |
A |
30.1% |
21.1% |
0.62 |
0.0040434 |
28.5% |
24.4% |
0.81 |
0.0724643 |
28.7% |
29.7% |
1.07 |
0.5844489 |
30.6% |
19.7% |
0.51 |
0.0278846 |
| hCV8934089 |
T |
C |
31.8% |
21.3% |
0.58 |
0.0067997 |
28.8% |
24.0% |
0.78 |
0.0824734 |
25.9% |
27.3% |
1.07 |
0.5 |
31.9% |
19.4% |
0.51 |
0.1271185 |
| hCV8934089 |
T |
O |
20.5% |
20.7% |
0.72 |
0.3110768 |
27.9% |
25.4% |
0.88 |
0.3436329 |
28.8% |
30.0% |
1.06 |
0.5 |
31.3% |
18.4% |
0.50 |
0.1089093 |
| hCV9725216 |
T |
A |
84.5% |
92.6% |
2.29 |
0.0007704 |
82.9% |
89.5% |
1.73 |
0.0023665 |
77.9% |
85.1% |
1.56 |
0.112737 |
88.7% |
86.8% |
0.85 |
0.6413995 |
| hCV9725216 |
T |
C |
85.3% |
94.1% |
2.77 |
0.0012136 |
89.2% |
92.0% |
1.40 |
0.1187954 |
88.9% |
95.5% |
2.63 |
0.1449274 |
90.3% |
83.3% |
0.54 |
0.8242458 |
| hCV9725216 |
T |
O |
62.7% |
89.0% |
1.70 |
0.2236532 |
68.8% |
83.1% |
2.22 |
0.0029086 |
70.0% |
78.0% |
1.36 |
0.2736323 |
85.4% |
89.5% |
1.45 |
0.374111 |
| Strata |
| O = other than Caucasian |
| A=all ethnic groups |
| C = Caucasian |