FIELD OF THE INVENTION
[0001] The present invention relates to a humanized antibody specific for human tumor necrosis
factor-α defined in claim 1.
BACKGROUND OF THE INVENTION
[0002] Human tumor necrosis factor-α (hereinafter, referred to as "hTNF-α") is a homotrimer
consisting of three 17 kDa protein subunits (
Eck M. J. et al., JBC, 267: 2119-2122, 1992;
Smith R. A. et al., JBC, 262: 6951-6954, 1987). HTNF-α is an inflammatory cytokine secreted from macrophages and monocytes, and
functions as a signal transmitter in several cellular reactions such as necrosis and
apoptosis (
Beyaert R. et al., FEBS Lett., 340: 9-16, 1994). hTNF-α causes a pro-inflammatory action leading to tissue destruction, such as
breakdown of the cartilage and bone (
Saklatvala, Nature, 322: 547-549, 1986), induction of an adhesion molecules, induction of procoagulation activity in vascular
endothelial cells (
Pober JS et al., J. Immunol., 136; 1680-1687, 1986), and increase in the adherence of neutrophils and lymphocytes (
Pober et al., J. Immunol. 138: 3319-3324, 1987). In addition, it has been known that hTNF-α plays an important role in at defense
mechanism against infectious disease and tumor (
Fiers W., FEBS Lett., 285: 199-212,1991).
[0003] hTNF-α is involved in inflammatory diseases, autoimmune diseases, bacterial infections,
cancers and degenerative diseases. Among these diseases, hTNF-α has been regarded
as a useful target protein for a specific physiological treatment of rheumatoid arthritis,
Crohn's disease, psoriatic arthritis, and ankylosing spondylitis.
[0004] Meanwhile, it has been also suggested to use a hTNF-α inhibitor for the purpose of
treating rheumatoid arthritis. It has been reported that hTNF-α is overexpressed in
the synovial cells isolated from the early-stage rheumatoid joint (
Buchan G. et al., Clin. Exp. Immunol., 73: 449-455, 1988), and cytokines relating to rheumatoid arthritis lesions are decreased when the above
synovial cells are treated with an anti-hTNF-α monoclonal antibody (
Butler D. M. et al., Eur. Cytokine Netw., 6: 225-230, 1995). Further, it has been found that an anti-hTNF-α antibody or a recombinant soluble
hTNF-α receptor suppresses inflammation and destruction of a joint in a collagen induced
mouse arthritis model (
Piguet P. F. et al., Immunology, 77: 510-514, 1992;
Wooley P. H. et al., J Immunol., 151: 6602-6607, 1993;
Williams R. O. et al., Immunology, 84: 433-439, 1995). Moreover, it has been observed that inflammatory arthritis is induced in a transgenic
mouse overexpressing hTNF-α (
Keffer J. et al., EMBO J., 10: 4025-4031, 1991).
[0005] These results indicate that hTNF-α plays an important role as a direct or indirect
regulator controlling inflammatory cytokines in rheumatoid athritis. Accordingly,
there has been a need to develop a monoclonal antibody having high selectivity and
reactivity to hTNF-α for the purpose of treating rheumatoid arthritis.
[0007] To overcome the undesirable properties of mouse monoclonal antibodies, a humanized
antibody has been developed by replacing the framework regions except for the antigen-binding
site with those of a human antibody. As a method for preparing such humanized antibody,
a CDR (complementarity determining region) grafting method is currently employed,
wherein only the CDRs of a mouse antibody are grafted to a human antibody. The humanized
antibody prepared by CDR grafting has an advantage of reducing
in vivo immune responses (
Riechmann et al., Nature, 332: 323, 1988;
Nakatani et al., Protein Engineering, 7: 435,1994), however, it often loses the high selectivity and reactivity of the original mouse
antibody (
Carter P., et al., Proc. Natl. Acad. Sci. USA, 89: 4285-4289, 1992).
[0009] The present inventors have endeavored to overcome such problems of the conventional
humanized antibody, and developed a novel humanized antibody specifically binding
to hTNF-α which shows an antigen binding affinity similar to that of the original
mouse monoclonal antibody and minimized immunogenicity.
SUMMARY OF THE INVENTION
[0010] Accordingly, the present invention provides:
- 1. A humanized antibody specific for human tumor necrosis factor-α (hTNF-α), comprising:
a) a heavy chain variable region having the amino acid sequence of SEQ ID NO: 36,
37 or 38; b) a light chain variable region having the amino acid sequence of SEQ ID
NO: 39 or 40; c) a heavy chain constant region identical to that of a human antibody;
and d) a light chain constant region identical to that of a human antibody.
- 2. The humanized antibody of 1, wherein the antigen binding affinity (Kd) of the antibody
ranges from 1 x 10-9 M to 1 x 10-13 M.
- 3. The humanized antibody of 1, wherein the dissociation constant (Koff) of the antibody ranges from 1 x 10-6 s-1 to 1 x 10-9 s-1, which is determined by surface plasmon resonance (SPR).
- 4. The humanized antibody of 1, wherein the heavy chain variable region of the antibody
is encoded by a DNA having a nucleotide sequence of SEQ ID NO: 31, 32 or 33.
- 5. The humanized antibody of 1, wherein the light chain variable region of the antibody
is encoded by a DNA having a nucleotide sequence of SEQ ID NO: 34 or 35.
- 6. An expression vector for the humanized antibody specific for hTNF-α of 1, which
comprises a DNA encoding a heavy chain variable region having an amino acid sequence
of SEQ ID NO: 36, 37 or 38 and a DNA encoding a light chain variable region having
an amino acid sequence of SEQ ID NO: 39 or 40.
- 7. A pharmaceutical composition comprising the humanized antibody of any one of 1
to 5, for treating a hTNF-α related disease selected from the group consisting of:
rheumatoid arthritis, Crohn's disease, psoriatic arthritis, psoriasis, septicemia,
asthma, Wegener's granulomatosis, inflammation, and ankylosing spondylitis.
BRIEF DESCRIPTION OF THE DRAWING
[0011] The above and other objects and features of the present invention will become apparent
from the following description of the invention, when taken in conjunction with the
accompanying drawings, which respectively show:
Fig. 1: Comparison of the amino acid sequences of the heavy chain (TSK114 H) variable
region of a mouse monoclonal antibody specifically binding to TNF-α (SEQ ID NO: 47),
heavy chain subgroup 1 (Hh1) of a human antibody (SEQ ID NO: 48), and the heavy chains
(TNHV2, TNHV2k and TNHV1k) of the humanized antibodies of the present invention (SEQ
ID NOs: 36 to 38);
Fig. 2: Comparison of the amino acid sequences of the light chain (TSK114 L) of a
mouse monoclonal antibody specifically binding to TNF-α(SBQ ID NO: 49), light chain
subgroup 1 (Hk1) of a human antibody(SEQ ID NO: 50), and the light chains (TNLV2 and
TNLV2d) of the humanized antibodies of the present invention (SEQ ID NOs: 39 and 40);
Fig. 3: Schematic diagram showing the process for preparing vector pHAB-TNHV2 HF expressing
the heavy chain of the inventive humanized antibody;
Fig. 4: Schematic diagram showing the process for preparing vector pHAB-TNHV2k HF
expressing the heavy chain of the inventive humanized antibody;
Fig. 5: Schematic diagram showing the process for preparing vector pHAB-TNHV1k HF
expressing the heavy chain of the inventive humanized antibody;
Fig. 6: Schematic diagram showing the process for preparing vector pHAB-TNLV2 LF expressing
the light chain of the inventive humanized antibody;
Fig. 7: Schematic diagram showing the process for preparing vector pHAB-TNLV2d LF
expressing the light chain of the inventive humanized antibody;
Fig. 8: SDS-PAGE result of the inventive humanized antibody produced in an animal
cell and purified thereafter; and
Fig. 9: Graph showing the binding affinities for TNF-α of a mouse monoclonal antibody
and the inventive humanized antibodies.
DETAILED DESCRIPTION OF THE INVENTION
[0012] In the humanized antibodies of the present invention, the CDRs in the heavy and light
chain variable regions thereof are derived from a mouse monoclonal antibody, and the
framework regions except for the CDRs as well as the heavy and light chain constant
regions are derived from a human antibody. Preferably, the inventive humanized antibody
exhibits an antigen binding affinity (Kd) ranging from 1 × 10
-9 M to 1 × 10
-13 M. Further, the dissociation constant (K
off) of the inventive humanized antibody ranges from 1 x 10
-6 s
-1 to 1 x 10
-9 s
-1, when determined by surface plasmon resonance (SPR).
[0013] The humanized antibody of the present invention can be prepared by a CDR grafting
method from the mouse monoclonal antibody TSK114 (Deposit Accession Nos: KCTC 10514BP
and KCTC 10515BP) specific for hTNF-α, wherein the heavy chain variable region of
the mouse monoclonal antibody TSK114 comprises three CDRs of SEQ ID NOs: 41 to 43,
and the light chain variable region, three CDRs of SEQ ID NOs: 44 to 46.
[0014] First, the amino acid sequences of the light chain and heavy chain variable regions
of mouse monoclonal antibody are compared with human sequences in the GenBank database,
and selected are the human heavy chain variable region subgroup 1 (Hh1) as defined
by Kabat having the greatest sequence similarity to the mouse antibody heavy chain
and the human light chain kappa variable region subgroup 1 (Hk1) having the most similarity
to the mouse antibody light chain (
Harris L. & Bajorath J., Protein Science, 4; 306-310, 1995).
[0015] The genes encoding heavy and light chains of the humanized antibody can be amplified
by using these selected human genes as templates. In this procedure, each of the nucleotide
sequences encoding the heavy and light chains of the humanized antibody may be modified
based on the information of well-known genetic studies and antibody structural analyses.
Further, if certain amino acid residues of the mousse monoclonal antibody affect the
antigen binding affinity or they are important for maintaining the antibody structure,
it is preferable to preserve the nucleotide sequences encoding the amino acid residues
without modification (Kabat E.A. et al.,
D.H.H.S. Publication number (NIH) 91-3242, 1991;
Chothia C. et al., Nature, 342; 877-883, 1989;
Studnicka G.M. et al., Protein Engineering, 7; 805-814, 1994 ;
Harris L. & Bajorath J., Protein Science, 4; 306-310, 1995).
[0016] A gene encoding the heavy chain variable region of the humanized antibody may be
prepared by replacing the framework regions except for the antigen-binding site in
the heavy chain variable region of the mouse monoclonal antibody TSK114 specifically
binding to hTNF-α with the heavy chain subgroup 1 (Hh1) of a human antibody. Such
a gene encoding the heavy chain variable region of the humanized antibody can be prepared
by the steps of: designing primers for humanizing the mouse monoclonal antibody using
the gene encoding the heavy chain of mouse monoclonal antibody TSK114 as a template;
performing PCR (polymerase chain reaction) using the corresponding primers; and ligating
the so-amplified PCR products to each other using restriction enzymes and DNA ligase.
The genes encoding the heavy chain variable region of the humanized antibody thus
prepared have been designated TNHV2 (SEQ ID NO: 31), TNHV2k (SEQ ID NO: 32), and TNHV1k
(SEQ ID NO: 33), which encode the polypeptides having the amino acid sequences of
SEQ ID NOs: 36, 37 and 38, respectively (see Fig. 1).
[0017] In order to prepare a gene encoding the full-length heavy chain of the humanized
antibody including the gene encoding the humanized heavy chain variable region, gene
TNHV2, TNHV2k or TNHV1K is inserted into an appropriate vector, e.g., TOPO vector
(TOPO TA cloning kit, Invitrogen, US), to prepare expression vectors pCR-TNHV2 Hv,
pCR-TNHV2k Hv and pCR-TNHV1k Hv. A gene fragment encoding the heavy chain variable
region of the humanized antibody is isolated from the expression vector pCR-TNHV2
Hv, pCR-TNHV2k Hv or pCR-TNHV1k Hv, and inserted into vector pHAB-HC (Deposit Accession
No: KCTC 10229BP; Korean Patent Laid-open Publicaiton No:
2004-12266) containing the gene encoding the heavy chain constant region of a human antibody,
to obtain expression vector of the humanized antibody heavy chain. Expression vectors
thus prepared have been designated pHAB-TNHV2 HF, pHAB-TNHV2k HF, and pHAB-TNHV1k
HF.
[0018] E. coli TOP10F' transformants transformed with the expression vectors pHAB-TNHV2 HF and pHAB-TNHV2k
HF were deposited on September 1, 2004 with the Korean Collection for Type Cultures
(KCTC)(Address: Korea Research Institute of Bioscience and Biotechnology (KRIBB),
#52, Oun-dong, Yusong-ku, Taejon, 305-333, Republic of Korea) under the accession
numbers KCTC 10691BP and KCTC 10692BP, respectively, and an E.
coli TOP10F' transformant transformed with the expression vector pHAB-TNHV1k HF was deposited
on June 13, 2005 with KCTC under the accession number KCTC 10818BP, in accordance
with the terms of Budapest Treaty on the International Recognition of the Deposit
of Microorganisms for the Purpose of Patent Procedure.
[0019] The genes encoding the full-length heavy chain of the humanized antibody can be isolated
from the heavy chain expression vectors pHAB-TNHV2 HF, pHAB-TNHV2k HF, and pHAB-TNHV1k
HF, and have been designated TNHV2 HF, TNHV2k HF and TNHV1k HF, respectively.
[0020] A gene encoding the light chain variable region of the humanized antibody may be
prepared by replacing the framework regions except for the antigen-binding site in
the light chain variable region of the mouse monoclonal antibody TSK114 specifically
binding to hTNF-α with the light chain subgroup 1 (Hk1) of a human antibody. Such
a gene encoding the light chain variable region of the humanized antibody can be prepared
by the steps of: designing primers for humanizing the mouse monoclonal antibody using
the gene encoding the light chain of mouse monoclonal antibody TSK114 as a template;
performing PCR using the corresponding primers; and ligating the so-amplified PCR
products to each other using restriction enzymes and DNA ligase. The genes encoding
the light chain variable region of the humanized antibody thus prepared have been
designated TNLV2 and TNLV2d, which encode the polypeptides having the amino acid sequences
of SEQ ID NOs: 39 and 40, respectively (see Fig. 2).
[0021] In order to prepare a gene encoding the full-length light chain of the humanized
antibody including the gene encoding the humanized light chain variable region, gene
TNLV2 or TNLV2d is inserted into an appropriate vector, e.g., TOPO vector, to prepare
expression vectors pCR-TNLV2 Lv and pCR-TNLV2d Lv. A gene fragment encoding the light
chain variable region of the humanized antibody is isolated from the expression vector
pCR-TNLV2 Lv or pCR-TNLV2d Lv, and inserted into vector pHAB-KC (Deposit Accession
No: KCTC 10230BP; Korean Patent Laid-open Publication No:
2004-12268) containing the gene encoding the light chain constant region of a human antibody,
to obtain expression vector of the humanized antibody light chain. Expression vectors
thus prepared have been designated pHAB-TNLV2 LF and pHAB-TNLV2d LF.
[0022] An
E.
coli TOP10F' transformant transformed with the expression vector pHAB-TNLV2 LF was deposited
on September 1, 2004 with KCTC under the accession number KCTC 10690BP, and an
E.
coli TOP10F' transformant transformed with the expression vector pHAB-TNLV2d LF was deposited
on June 13, 2005 with KCTC under the accession number KCTC 10817BP, in accordance
with the terms of Budapest Treaty on the International Recognition of the Deposit
of Microorganisms for the Purpose of Patent Procedure.
[0023] The genes encoding the full-length light chain of the humanized antibody can be isolated
from the light chain expression vectors pHAB-TNLV2 LF and pHAB-TNLV2d LF, and have
been designated TNLV2 LF and TNLV2d LF, respectively.
[0024] CHO cell lines may be transformed with humanized heavy chain expression vector pHAB-TNHV2
HF and humanized light chain expression vector pHAB-TNLV2 LF by using an appropriate
transformation solution such as GenePORTER (GTS, US) to obtain a transformant producing
the humanized antibody specific for hTNF-α, and the transformant has been designated
CHO-YHB1406. Further, another transformant may be prepared by using humanized heavy
chain expression vector pHAB-TNHV2k HF and humanized light chain expression vector
pHAB-TNLV2 LF or pHAB-TNLV2d LF according to the same method as described above. These
transformants have been designated CHO-YHB1411 and CHO-YHB1411-2. In addition, another
transformant may be prepared by using humanized heavy chain expression vector pHAB-TNHV1k
HF and humanized light chain expression vector pHAB-TNLV2d LF according to the same
method as described above, and has been designated CHO-YHB 1406-2.
[0025] To purify the humanized antibody of the present invention from the transformant cell
lines, the transformant CHO-YHB 1406, CHO-YHB 1411, CHO-YHB1411-2 or CHO-YHB1406-2
may be cultured in an appropriate culture medium, and the culture supernatant may
be subjected to column chromatography using Protein-A (Amersham Bioscience, Sweden)
or goat anti-human immunoglobulin G (Zymed Laboratories Inc., USA). The humanized
antibodies thus purified have been designated YHB1406, YHB1411, YHB1411-2 and YHB1406-2,
respectively.
[0026] The antigen binding affinity of the humanized antibody may be determined by, e.g.,
competitive ELISA, solid phase ELISA or surface plasma resonance. Humanized antibodies
YHB1406, YHB1411, YHB1411-2 and YHB1406-2 specifically binding to hTNF-α show antigen-binding
affinities ranging from 1 × 10
-9 M to 1 × 10
-13 M, which demonstrates that the humanized antibodies of the present invention have
antigen-binding activities similar to that of the original mouse monoclonal antibody,
while showing significantly decreased immunogenicity, and therefore, may be effectively
used for treating hTNF-α related diseases. Further, the dissociation constant (K
off) of the inventive humanized antibody determined by SPR ranges from 1 x 10
-6 s
-1 to 1 x 10
-9 s
-1, which reflects a very low degree of dissociation of the antigen-antibody complex.
[0027] For this purpose, the humanized antibody of the present invention may be used as
an effective ingredient in a pharmaceutical composition to treat a hTNF-α related
disease such as rheumatoid arthritis, Crohn's disease, psoriatic arthritis, psoriasis,
septicemia, asthma, Wegener's granulomatosis, inflammation and ankylosing spondylitis.
[0028] The compositions of the present invention may be formulated so as to provide quick,
sustained or delayed release of the effective ingredient after administration to a
patient by employing any one of the procedures well known in the art. The composition
may comprise pharmaceutically acceptable excipients, diluents, fillers, disintegrants,
sweeteners, lubricants, and flavors. The pharmaceutical composition is preferably
formulated for intravenous administration, either by bolus injection or sustained
drip, or for release from an implanted capsule. A typical formulation for intravenous
administration utilizes physiological saline as a diluent.
[0029] The dose of the antibody actually administered to a patient ought to be determined
in light of various relevant factors including the specific antibody to be administered,
administration time and formulation of the composition, route of administration, the
disease to be treated, and body weight, age, gender, state of health and diet of a
patient. A typical dose may range from 0.01 mg/kg/day to 1,000 mg/kg/day. More typically,
the dose may range from 0.1 mg/kg/day to 10 mg/kg/day.
[0030] The following Examples are intended to further illustrate the present invention without
limiting its scope.
Example 1: construction of a gene encoding a heavy chain variable region of a humanized
antibody
[0031] PCR was conducted using a gene encoding the heavy chain variable region of the mouse
monoclonal antibody TSK114 (Deposit Accession Nos: KCTC 10514BP and KCTC 10515BP)
specific for TNF-α as a template and a primer pair of SEQ ID NOs: 1 and 14, to amplify
gene A encoding the heavy chain variable region of the humanized antibody carrying
a leader sequence. The amplified PCR product was electrophoresed on an agarose gel
and recovered from the gel using QIAgel extraction kit (Qiagen, USA).
[0032] Gene A thus obtained was subjected to PCR with a primer pair of SEQ ID NOs: 1 and
7 or SEQ ID NOs: 6 and 14 to amplify DNA fragments, and overlapping PCR was performed
using the resulting DNA fragments with a primer pair of SEQ ID NOs: 1 and 14. The
amplified PCR product was incubated with TOPO vector (TOPO TA cloning kit, Invitrogen
Inc., USA) at room temperature for 45 min to be cloned, and the cloned vector was
transformed into
E.
coli TOP10F' (Invitrogen Inc., USA). After incubating the transformed
E.
coli in LB media containing 100 µg/ml of ampicilline, plasmid was isolated from the
E.
coli, and digested with EcoRI (BioLabs Inc., USA) to prepare about 450 bp gene B encoding
the heavy chain variable region.
[0033] PCR was performed using gene B as a template and a primer pair of SEQ ID NOs: 1 and
9 or SEQ ID NOs: 8 and 14 to amplify DNA fragments, and overlapping PCR was performed
using the resulting DNA fragments with a primer pair of SEQ ID NOs: 1 and 14. In the
same manner as described above, the amplified PCR product was cloned in TOPO vector,
and digested with EcoRI to prepare gene C encoding the heavy chain variable region.
[0034] In the same manner as described above, gene C was subjected to PCR with a primer
pair of SEQ ID NOs: 1 and 11 or SEQ ID NOs: 10 and 14 to amplify DNA fragments, and
overlapping PCR was performed using the resulting DNA fragments with a primer pair
of SEQ ID NOs: 1 and 14. The PCR product thus amplified was cloned in TOPO vector
to obtain gene D encoding the heavy chain variable region. Gene D was subjected to
PCR with a primer pair of SEQ ID NOs: 4 and 14 or SEQ ID NOs: 1 and 5 to amplify DNA
fragments, and overlapping PCR was performed using the resulting DNA fragments with
a primer pair of SEQ ID NOs: 1 and 14. In the same manner as described above, the
PCR product thus amplified was cloned in TOPO vector obtain gene E encoding the heavy
chain variable region.
[0035] Further, PCR was conducted using gene E as a template and a primer pair of SEQ ID
NOs: 1 and 3 or SEQ ID NOs: 2 and 14 to amplify DNA fragments, and overlapping PCR
was performed using the resulting DNA fragments with a primer pair of SEQ ID NOs:
1 and 14. In the same manner as described above, the PCR product was cloned in TOPO
vector to obtain gene TNHV2 (SEQ ID NO: 31) encoding the heavy chain variable region,
and the TOPO vector inserted with TNHV2 was designated pCR-TNHV2 Hv.
[0036] In the same manner as described above, PCR was conducted using TNHV2 as a template
and a primer pair of SEQ ID NOs: 1 and 13 or SEQ ID NO: 12 and 14 to amplify DNA fragments,
and overlapping PCR was performed using the resulting DNA fragments with a primer
pair of SEQ ID NOs: 1 and 14. The PCR product was cloned in TOPO vector to obtain
another gene encoding the heavy chain variable region. The gene was designated TNHV2k
(SEQ ID NO: 32), and the TOPO vector inserted with gene TNHV2k was designated pCR-TNHV2K
Hv.
[0037] Further, in the same manner as described above, PCR was conducted using gene TNHV2k
as a template and a primer pair of SEQ ID NOs: 1 and 15, and the PCR product was cloned
in TOPO vector to obtain still another gene encoding the heavy chain variable region.
The gene was designated TNHV1k (SEQ ID NO: 33), and the TOPO vector inserted with
TNHV1k was designated pCR-TNHV1k Hv.
[0038] The primer pairs and reaction conditions employed in each PCR reaction are shown
in Table 1. Each PCR reaction was conducted under the following conditions of 30 cycles
as shown in Table 1 after initial denaturation of 7 min at 95°C, and final extension
of 10 min at 72°C.
<Table 1>
| Primer pair |
Gene |
PCR condition |
| Denaturation |
Annealing |
Extension |
| SEQ ID NOs: 1 and 14 |
A |
95°C, 2 min |
58°C, 1.5 min |
72°C, 2 min |
| SEQ ID NOs: 6 and 14 |
B |
95°C, 2 min |
58°C, 1.5 min |
72°C, 2 min |
| SEQ ID NOs: 1 and 7 |
95°C, 2 min |
58°C, 1.5 min |
72°C, 2 min |
| SEQ ID NOs: 8 and14 |
C |
95°C, 2 min |
58°C,1.5 min |
72°C, 2 min |
| SEQ ID NOs: 1 and 9 |
95°C, 2 min |
58°C, 1.5 min |
72°, 2 min |
| SEQ ID NOs: 10 and 14 |
D |
95°C, 2 min |
58°C, 1.5 min |
72°C, 2 min |
| SEQ ID NOs: 1 and 11 |
95°C, 2 min |
58°C, 1.5 min |
72°C, 2 min |
| SEQ ID NOs: 4 and 14 |
E |
95°C, 2 min |
58°C, 1.5 min |
72°C, 2 min. |
| SEQ ID NOs: 1 and 5 |
95°C, 2 min |
58°C, 1.5 min |
72°C, 2 min |
| SEQ ID NOs: 2 and 14 |
TNHV2 |
95°C, 2 min |
58°C, 1.5 min |
72°C, 2 min |
| SEQ ID NOs: 1 and 3 |
95°C, 2 min |
58°C, 1.5 min |
72°C, 2 min |
| SEQ ID NOs: 12 and 14 |
TNHV2k |
95°C, 2 min |
58°C, 1.5 min |
72°C, 2 min |
| SEQ ID NOs: 1 and 13 |
95°C, 2 min |
58°C, 1.5min |
72°C, 2 min |
| SEQ ID NOs: 1 and 15 |
TNHV1k |
95°C, 2 min |
58°C, 1.5 min |
72°C, 2 min |
Example 2: Construction of a full-length heavy chain gene of a humanized antibody
and an expression vector thereof
[0039] In order to construct the gene encoding the humanized full-length heavy chain using
the gene encoding the heavy chain variable region inserted in pCR-TNHV2 Hv vector
prepared in Example 1, pHAB-HC (KCTC 10229BP, Korean Patent Laid-open Publication
No.
2004-12266) vector containing the gene encoding the heavy chain constant region of the human
antibody was employed.
[0040] First, in order to insert gene TNHV2 encoding the heavy chain variable region of
the humanized antibody into expression vector pHAB-HC, pCR- TNHV2 Hv was treated with
HindIII/ApaI (BioLabs, Inc., USA) at 37°C for 2 hrs, electrophoresed on a 1.5% agarose
gel and stained with etidium bromide (EtBr), and an about 450 bp fragment of the gene
was observed.
[0041] Also, pHAB-HC was treated with HindIII/ApaI, eletrophoresed and stained, and an about
6.5 kb fragment of the digested vector was observed. After then, the gene fragments
observed were recovered from the gels using a QIAgel extraction kit (Qiagen, USA),
treated with T4 DNA ligase (BioLabs, Inc., USA) at 16°C overnight, and transformed
into
E. coli TOP10F' to obtain a transformant. The transformant was cultured in an LB medium supplemented
with 100 µg/mℓ of ampicillin overnight, and a plasmid was isolated therefrom. The
isolated plasmid was treated with HindIII/NotI and subjected to agarose gel electrophoresis,
to obtain an about 1.4 kb full-length heavy chain gene of the humanized antibody.
[0042] The full-length heavy chain gene of the humanized antibody thus prepared was designated
TNHV2 HF. Further, the expression vector inserted with TNHV2 HF was designated pHAB-TNHV2
HF (Fig. 3), and transformed into
E. coli TOP10F' to obtain a transformant, which was deposited on September 1, 2004 with the
Korean Collection for Type Cultures (KCTC)(Address: Korea Research Institute of Bioscience
and Biotechnology (KRIBB), #52, Oun-dong, Yusong-ku, Taejon, 305-333, Republic of
Korea) under the accession number KCTC 10691BP.
[0043] In the same manner as described above, the full-length heavy chain gene of the humanized
antibody was also prepared using TNHV2k or TNHV1k genes, and the full-length heavy
chain genes of the humanized antibody thus prepared were designated TNHV2k HF or TNHV1k
HF, respectively. Further, the heavy chain expression vector of the humanized antibody
inserted with the full-length heavy chain gene, TNHV2k HF or TNHV1k HF, was designated
pHAB-TNHV2k HF or pHAB-TNHV1k HF (Figs. 4 and 5), respectively, and the
E.
coli TOP10F' transformed with pHAB-TNHV2k HF or pHAB-TNHV1k HF was deposited on September
1, 2004 or June 13, 2005, respectively, with the Korean Collection for Type Cultures
(KCTC) under the accession numbers KCTC 10692BP and KCTC 10818BP, respectively.
Example 3: Construction of a gene encoding a light chain variable region of a humanized
antibody
[0044] PCR was conducted using the gene encoding the light chain variable region of mouse
monoclonal antibody TSK114 specifically recognizing TNF-α as a template and a primer
pair of SEQ ID NOs: 16 and 30, to amplify gene A encoding the light chain variable
region containing a leader sequence. Gene A was subjected to agarose gel electrophoresis
and EtBr staining, and recovered from the gel using a QIAgel extraction kit.
[0045] Gene A thus purified was subjected to PCR with a primer pair of SEQ ID NOs: 16 and
25 or SEQ ID NOs: 24 and 30 to amplify DNA fragments, and overlapping PCR was performed
using the resulting DNA fragments with a primer pair of SEQ ID NOs: 16 and 30. The
amplified PCR product was incubated with TOPO vector (TOPO TA cloning kit, Invitrogen
Inc., USA) at room temperature for 45 min, and the cloned vector was transformed into
E.
coli TOP10F' to obtain a transformant. After incubating the transformant in LB media containing
100 µg/ml of ampicilline overnight, plasmid was isolated from the
E.
coli, and digested with EcoRI (BioLabs Inc., USA) to obtain about 400 bp gene B encoding
the light chain variable region.
[0046] PCR was conducted using gene B as a template and a primer pair of SEQ ID NOs: 26
and 30 or SEQ ID NOs: 16 and 27 to amplify DNA fragments, and overlapping PCR was
performed using the resulting DNA fragments with a primer pair of SEQ ID NOs: 16 and
30. In the same manner as described above, the amplified PCR product was cloned in
TOPO vector, and digested with EcoRI to prepare gene, C encoding the light chain variable
region.
[0047] In the same manner as described above, gene C was subjected to PCR with a primer
pair of SEQ ID NOs: 16 and 23 or SEQ ID NOs: 22 and 30 to amplify DNA fragments, and
overlapping PCR was performed using the resulting DNA fragments with a primer pair
of SEQ ID NOs: 16 and 30. In the same manner as described above, the PCR product thus
amplified was cloned in TOPO vector to obtain gene D encoding the light chain variable
region.
[0048] Gene E encoding the light chain variable region was obtained by performing PCR using
gene D as a template with a primer pair of SEQ ID NOs: 18 and 30 or SEQ ID NOs: 16
and 19 to amplify DNA fragments, and overlapping PCR was performed using the resulting
DNA fragments with a primer pair of SEQ ID NOs: 16 and 30. In the same manner as described
above, the PCR product thus amplified was cloned in TOPO vector.
[0049] Gene F encoding the light chain variable region was obtained by performing PCR using
gene E as a template with a primer pair of SEQ ID NOs: 20 and 30 or SEQ ID NOs: 16
and 21 to amplify DNA fragments, and overlapping PCR was performed using the resulting
DNA fragments with a primer pair of SEQ ID NOs: 16 and 30. In the same manner as described
above, the PCR product thus amplified was cloned in TOPO vector.
[0050] Further, PCR was conducted using gene F as a template and a primer pair of SEQ ID
NOs: 28 and 30 or SEQ ID NOs: 16 and 29 to amplify DNA fragments, and overlapping
PCR was performed using the resulting DNA fragments with a primer pair of SEQ ID NOs:
16 and 30. In the same manner as described above, the PCR product was cloned in TOPO
vector to obtain gene TNLV2 (SEQ ID NO: 34) encoding the light chain variable region,
and the TOPO vector inserted with gene TNLV2 was designated pCR-TNLV2 Lv.
[0051] Further, in the same manner as described above, PCR was conducted using TNHV2 as
a template and a primer pair of SEQ ID NOs: 16 and 17 to amplify DNA fragment, and
the fragment was subjected to PCR using a primer of SEQ ID NOs: 30 as a megaprimer
to obtain a gene encoding the light chain variable region of the humanized antibody.
The gene was designated TNLV2d (SEQ ID NO: 35), and the TOPO vector inserted with
TNLV2d was desinated pCR-TNLV2d Lv.
[0052] The primer pairs and PCR conditions employed in the above PCR reactions are described
in the following Table 2. Each of the PCR reactions was conducted under the conditions
of 30 cycles as shown in Table 2 after initial denaturation of 7 min at 95°C , and
final extension of 10 minutes at 72°C.
<Table 2>
| Primer pair |
Gene |
PCR condition |
| Denaturation |
Annealing |
Extension |
| SEQ ID NOs: 16 and 30 |
A |
95°C, 2 min |
58°C, 1.5 min |
72°C, 2 min |
| SEQ ID NOs: 24 and 30 |
B |
95°C, 2 min |
58°C, 1.5 min |
72°C, 2 min |
| SEQ ID NOs: 25 and 16 |
95°C, 2 min |
58°C, 1.5 min |
72°C, 2 min |
| SEQ ID NOs: 26 and 30 |
C |
95°C, 2 min |
58°C, 1.5 min |
72°C, 2 min |
| SEQ ID NOs: 27 and 16 |
95°C, 2 min |
58°C, 1.5 min |
72°C, 2 min |
| 22 and 30 22 and 30 |
D |
95°C, 2 min |
58°C, 1.5 min |
72°C, 2 min |
| SEQ ID NOs: 23 and 16 |
95°C, 2min |
58°C, 1.5 mm |
72°C, 2 min |
| SEQ ID NOs: 18 and 30 |
E |
95°C, 2 min |
58°C, 1.5 min |
72°C, 2 min |
| SEQ ID NOs: 19 and 16 |
95°C, 2 min |
58°C, 1.5 min |
72°C, 2 min |
| SEQ ID NOs: 20 and 30 |
F |
95°C, 2 min |
58°C, 1.5 min |
72°C, 2 min |
| SEQ ID NOs: 21 and 16 |
95°C, 2 min |
58°C, 1.5 min |
72°C, 2 min |
| SEQ ID NOs: 28 and 30 |
TNLV2 |
95°C, 2 min |
58°C, 1.5 min |
72°C, 2 min |
| SEQ ID NOs: 29 and 16 |
95°C, 2 min |
58°C, 1.5 min |
72°C, 2 min |
| SEQ ID NOs: 16 and 17 |
TNLV2d |
95°C, 2 min |
58°C, 1.5 min |
72°C, 2 min |
| SEQ ID NO: 30 |
95°C, 2 min |
58°C, 1.5 min |
72°C, 2 min |
Example 4: Construction of a full-length light chain gene of a humanized antibody
and an expression vector thereof
[0053] In order to construct the gene encoding the humanized full-length light chain using
the gene encoding the light chain variable region inserted in pCR-TNLV2 Lv vector
prepared in Example 3, pHAB-KC (KCTC 10230BP, Korean Patent Laid-open Publication
No.
2004-12268) expression vector containing the gene encoding the light chain constant region of
the human antibody was employed.
[0054] First, in order to insert gene TNLV2 encoding the light chain variable region of
the humanized antibody into expression vector pHAB-KC, pCR- TNLV2 Lv was treated with
HindIII/
BsiWI (BioLabs, Inc., USA) at 37°C for 2 hrs, electrophoresed on a 1.5% agarose gel and
stained with etidium bromide (EtBr), and an about 400 bp fragment of the gene was
observed.
[0055] In the same manner as described above, expression vector pHAB-KC was also treated
with
HindIII/
BsiWI
, and an about 6.5 kb fragment of the digested vector was observed. After then, the
gene fragments observed were recovered from the gels using QIAgel extraction kit (Qiagen,
USA), treated with T4 DNA ligase (BioLabs, Inc., USA) at 16°C overnight, and transformed
into
E.
coli TOP10F' to obtain a transformant. The transformant was cultured in an LB medium supplemented
with 100 µg/mℓ of ampicillin overnight, and a plasmid was isolated from the culture
medium. The isolated plasmid was treated with
HindIII/
NotI (BioLabs, Inc., USA) and subjected to agarose gel electrophoresis, to obtain an
about 0.7 kb full-length light chain gene of the humanized antibody.
[0056] The full-length light chain gene of the humanized antibody thus prepared was designated
TNLV2 LF. Further, the expression vector inserted with TNLV2 LF was designated pHAB-TNLV2
LF (Fig. 6), and transformed into
E. coli TOP10F' to obtain a transformant, which was deposited on September 1, 2004 with the
Korean Collection for Type Cultures (KCTC) under the accession number KCTC 10690BP.
[0057] In the same manner as described above, a full-length light chain gene of the humanized
antibody was prepared using TNLV2d gene, and the full-length light chain gene of the
humanized antibody thus prepared was designated TNLV2d LF. Further, the expression
vectors inserted with TNLV2d LF was designated pHAB-TNLV2d LF (Fig. 7), and transformed
into
E. coli TOP10F' to obtain a transformant, which was deposited on June 13, 2005, with the
Korean Collection for Type Cultures (KCTC) under the accession number KCTC 10817BP.
Example 5: Transformation of a humanized antibody into CHO cell lines
[0058] In order to measure the humanized antibody activity in animal cells, heavy chain
expression vector pHAB-TNHV2 HF prepared in Example 2 and light chain expression vector
pHAB-TNLV2 LF prepared in Example 4 were transfected into CHO cell line (ATCC CRL-9096,
USA) as follows.
[0059] First, CHO cells were grown in DMEM/F12 medium (JRH Inc., USA) supplemented with
2.0 g/ℓ of sodium bicarbonate (Sigma, USA) and 10% heat inactivated FBS (Gibco BRL,
USA) in a 37°C humidified CO
2 incubator for 2 to 3 days. The cultured cells were harvested by centrifuging the
culture solution at 1,200 rpm and room temperature (25°C) for 5 min, stained with
0.4% trypan blue (Gibco BRL, USA), and counted with a hematocytometer. The cells were
seeded to a T-75 flask in an amount of about 3 × 10
5 cells to be sub-cultured.
[0060] The seeded CHO cells were allowed to proliferate until they occupied the flask's
surface by a density of 60 to 90%. 10 µg of pHAB-TNHV2 HF, 10 µg of pHAB-TNLV2 LF
and 80 µℓ of GenePORTER solution (GTS, USA) for transfection were mixed with 5 mℓ
of DMEM/F12 (serum-free) medium. After the mixture was kept at room temperature for
10 to 45 min, the culture medium was removed from the flask, and the sub-cultured
CHO cells were incubated with the mixture in a 37°C humidified CO
2 incubator for about 3 to 5 hrs, to obtain a transfectant designated CHO-YHB 1406.
[0061] In accordance with the same manner as described above, heavy chain expression vector
pHAB-TNHV2k HF and light chain expression vector pHAB-TNLV2 LF, heavy chain expression
vector pHAB-TNHV2k HF and light chain expression vector pHAB-TNLV2d LF, or heavy chain
expression vector pHAB-TNHV1k HF and light chain expression vector pHAB-TNLV2d LF,
which were prepared in Examples 2 and 4, respectively, were transfected into CHO cells
to obtain transfectants, which were designated CHO-YHB1411, CHO-YHB1411-2, and CHO-YHB
1406-2, respectively.
Example 6: Purification of a humanized antibody
[0062] The transfectant CHO-YHB 1406 cells obtained in Example 5 were seeded to a T-75 flask
containing a DMEM/F12 medium supplemented with 10% fetal bovine serum in an amount
of 2 × 10
5 cells, and the flask was incubated in a 37°C humidified CO
2 incubator for 7 days to express the humanized antibody. The culture medium was harvested,
centrifuged and filterred to obtain a cell-free culture solution comprising antibodies.
[0063] In order to purify the humanized antibody from the solution, sepharose 4 Fast flow
columns conjugated with protein-A (Pharmacia) and goat anti-human Immunoglobulin G
(Zymed Laboratories Inc., USA), respectively, were employed. The culture medium comprising
antibodies was applied to protein-A conjugated sepharose 4 Fast flow column to allow
the humanized antibody to bind with protein-A, and a glycine buffer (pH 2.5) was introduced
into the column to elute the humanized antibody. Then, the eluate was neutralized
by mixing with 1 M Tris-Cl (pH 8.0) at a volume ratio of 1:10, and subjected to sepharose
4 Fast flow column conjugated with goat anti-human IgG to allow the column to specifically
capture the antibody protein.
[0064] The humanized antibody was eluted according to the same method as described above,
and the purified humanized antibody was designated YHB 1406.
[0065] In accordance with the same manner as described above, the transfectants, CHO-YHB1411,
CHO-YHB1411-2 and CHO-YHB 1406-2, prepared in Example 5 were cultured and the produced
antibodies therefrom were purified, respectively, to obtain the purified humanized
antibodies designated YHB1411, YHB1411-2 and YMB1406-2, respectively.
[0066] As a result of analyzing the purified humanized antibodies with SDS-PAGE, bands of
about 50 kDa and about 25 kDa were observed, which were identified as the heavy chain
and light chain of the humanized antibody, respectively (Fig. 8).
Example 7: Measurement of antigen binding affinity of a humanized antibody to hTNF-α
[0067] The humanized antibodies purified in Example 6 were quantified with competitive ELISA,
and their antigen-binding activities were analyzed by using a recombinant hTNF-α (Biosource,
USA). For antibody quantification, 100 ng of goat anti-human immunoglobulin G.A.M
(Zymed Laboratories Inc., USA) was distributed into each well of a microplate (Dynatech
Laboratories Inc., USA) and the well plate was kept at 4°C overnight to coat it with
the immunoglobulin. At this time, mouse monoclonal antibody TSK114 was used as a control.
[0068] In order to measure an antigen-binding affinity of the humanized antibody to recombinant
hTNF-α antigen, antigen solutions (100 µℓ each) having various concentrations ranging
from 10
-11 to 10
-7 M were mixed with 5 ng of mouse monoclonal antibody TSK114, humanized antibodies
YHB1406, YHB1411, YHB 1406-2, and YHB1411-2, respectively, and reacted at 37 °C for
2 hrs. Each of the reactants was added to the well plate coated with 0.4 µg of the
antigen and the well plate was kept at 37°C for about 1.5 hrs. A goat anti-human polyclonal
antibody (BioRad, USA) conjugated with horseradish peroxidase was diluted at a ratio
of 1:1000 and 100 µℓ of the diluted antibody solution was added to each well. The
well plate was kept at 37°C for 1 hr. After the reaction was completed, the optical
density of each well was measured using a horseradish peroxidase substrate kit (BioRad,
USA).
[0069] Concentrations of the antibody bound to the antigen and the unbound antibody were
calculated from the measured optical density, and antigen-binding affinity of the
humanized antibodies were determined therefrom (
Friguet B. et al., J. Immunol. Meth., 77: 305-319, 1985). The results are shown in Table 3 and Fig. 9.
<Table 3>
| Antigen |
Antigen binding affinity (Kd) |
| Mouse antibody TSK114 |
1.4 × 10-11 M |
| Humanized antibody YHB 1406 |
2.2 × 10-11 M |
| Humanized antibody YHB1411 |
2.0 × 10-10 M |
| Humanized antibody YHB1411-2 |
2.0 × 10-10 M |
| Humanized antibody YHB 1406-2 |
2.9 × 10-10 M |
[0070] As can be seen in Table 3 and Fig. 9, the antigen binding affinities of humanized
antibodies YHB1406, YHB1411, YHB1411-2, and YHB1406-2 were similar to that of mouse
monoclonal antibody TSK114.
Example 8: Test of in vitro antigen neutralization capability of the humanized antibody
[0072] Mouse monoclonal antibody TSK 114, and humanized antibodies YHB 1406, YHB1411, YHB1411-2
and YHB1406-2 were diluted in PBS buffer to various concentrations ranging from 0.024
ng/mL to 1.0 ug/mL, respectively, and each 100 ul of the resulting dilutions was added
to the wells of a 96-well culture plate. 50 ul of hTNF-α solution (100 pg/mL) was
added to each well and a reaction was carried out at 37°C for 1 hr. Then, 50 ul of
WHEI 164 cell lines (1 x 10
6 cells/ml) treated with 2 ug/ml actinomycin D (Sigma, USA) was added to each well.
[0073] The cells were cultured at 37°C for 24 hrs, and 100 ul of the culture solution was
removed. 20 ul of a solution of methyl thiazole tetrazolium (MTT, Sigma, USA) diluted
in PBS buffer to a concentration of 5 mg/mL was added to each well of the culture
plate, and the plate was incubated at 37°C for 4 hrs for color development. Then,
100 ul of 0.1N HCl-10% SDS solution (Sigma, USA) was added to each well to completely
dissolve the colored precipitate, and the absorbance of each well was measured at
595 nm.
[0074] From the absorbance dated obtained above, a curve of survival rate of WHEI 164 cell
lines versus antibody concentration was drawn. The concentration of the antibodies
inhibiting cell death by 50 % (IC
50) was calculated from the curve, and the result is shown in Table 4.
<Table 4> Antigen neutralization capabilities of the antibodies
| Antigen |
IC50 (ng/mL) |
| Mouse monoclonal antibody TSK114 |
4.7 |
| Humanized antibody YHB 1406 |
9.2 |
| Humanized antibody YHB 1411 |
6.7 |
| Humanized antibody YHB1411-2 |
5.5 |
| Humanized antibody YHB 1406-2 |
6.5 |
[0075] As shown in Table 4, IC
50 of mouse monoclonal antibody (TSK114) was 4.7 ng/mL, and those of the inventive humanized
antibodies YHB1406, YHB11411, YHB1411-2 and YHB 1406-2 were 9.2 ng/mL, 6.7 ng/mL,
5.5 ng/mL and 6.5 ng/mL, respectively. This result shows that the humanized antibodies
have
in vitro antigen neutralization capabilities similar to the mouse monoclonal antibody.
Example 9: Measurement of antigen binding affinity of a humanized antibody to hTNF-α
by SPR
[0076] The binding affinities to hTNF-α of a mouse monoclonal antibody and a humanized antibody
were measured by surface plasmon resonance (SPR) method. Specifically, hTNF-α (Biosource,
USA) was immobilized on a sensor chip CM5 (Biacore, Sweden) at a concentration of
200 ug/ml, and reacted with 25, 50, 100, 200 and 400 nM of mouse monoclonal antibody
TSK 114 or humanized antibody YHB1411-2, respectively. Then, association and dissociation
constants of the reactions were measured by Biacore2000 (Biacore, Sweden).
[0077] From the association and dissociation constants measured above, antigen binding affinities
of the antibodies were calculated, and the results are shown in Table 5.
<Table 5> Comparison of the binding affinities to hTNF-α of the mouse monoclonal antibody
and humanized antibody
| Antibody |
Association constant
(kon, M-1s-1) |
Dissociation constant
(koff, s-1) |
Antigen binding affinity
(Kd, M) |
| TSK 114 |
4.12×104 |
2.39×10-7 |
5.79×10-12 |
| YHB1411-2 |
3.96×104 |
6.80×10-8 |
1.71×10-12 |
[0078] As shown in Table 5, the inventive humanized antibody YHB1411-2 exhibited a high
antigen binding affinity of picomole level (10
-12M) and a low dissociation constant. Further, the antigen binding affinity of humanized
antibody YHB1411-2 was higher by about 3 folds than that of mouse monoclonal antibody
TSK114.
SEQUENCE LISTING
[0079]
<110> YUHAN CORPORATION
<120> Humanized antibody specific for tumor necrosis factor-alpha
<130> EP52431HV12pau
<140> EP 05 823 880.9
<141> 2005-12-29
<150> PCT/KR2005/004634
<151> 2005-12-29
<150> KR 10-2004-0115709
<151> 2004-12-29
<160> 50
<170> KopatentIn 1.71
<210> 1
<211> 40
<212> DNA
<213> Artificial sequence
<220>
<223> primer
<400> 1
aaagcttatg gattgggtgt ggaacttgct attcctgatg 40
<210> 2
<211> 33
<212> DNA
<213> Artificial sequence
<220>
<223> primer
<400> 2
cctggagcgt cagtcaaggt ctcctgcaag gct 33
<210> 3
<211> 36
<212> DNA
<213> Artificial Sequence
<220>
<223> primer
<400> 3
cttgcaggag accttgactg acgctccagg cttctt 36
<210> 4
<211> 39
<212> DNA
<213> Artificial sequence
<220>
<223> primer
<400> 4
gtgaggcagg ctccaggaca gggtttagag tggatgggc 39
<210> 5
<211> 45
<212> DNA
<213> Artificial sequence
<220>
<223> primer
<400> 5
gcccatccac tctaaaccct gtcctggagc ctgcctcacc cagtt 45
<210> 6
<211> 39
<212> DNA
<213> Artificial sequence
<220>
<223> primer
<400> 6
ggacgggtta ccatgactag ggacacctct gccagcact 39
<210> 7
<211> 36
<212> DNA
<213> Artificial sequence
<220>
<223> primer
<400> 7
ggcagaggtg tccctagtca tggtaacccg tccctt 36
<210> 8
<211> 39
<212> DNA
<213> Artificial sequence
<220>
<223> primer
<400> 8
gcctatatgg agctcagcag cctcagaagt gaggacacg 39
<210> 9
<211> 42
<212> DNA
<213> Artificial sequence
<220>
<223> primer
<400> 9
cgtgtcctca cttctgaggc tgctgagctc catataggca gt 42
<210> 10
<211> 36
<212> DNA
<213> Artificial Sequence
<220>
<223> primer
<400> 10
gacacggctg tatattactg tgcaagatat gattcc 36
<210> 11
<211> 36
<212> DNA
<213> Artificial sequence
<220>
<223> primer
<400> 11
atcatatctt gcacagtaat atacagccgt gtcctc 36
<210> 12
<211> 27
<212> DNA
<213> Artificial sequence
<220>
<223> primer
<400> 12
gtgaggcagg ctccaggaaa gggttta 27
<210> 13
<211> 27
<212> DNA
<213> Artificial sequence
<220>
<223> primer
<400> 13
gcccatccac tctaaaccct ttcctgg 27
<210> 14
<211> 38
<212> DNA
<213> Artificial sequence
<220>
<223> primer
<400> 14
tgggcccttg gtggaggctg aggagactgt gacagtgg 38
<210> 15
<211> 39
<212> DNA
<213> Artificial sequence
<220>
<223> primer
<400> 15
tgggcccttg gtggaggctg aggagactgt gagagtggt 39
<210> 16
<211> 43
<212> DNA
<213> Artificial sequence
<220>
<223> primer
<400> 16
aaagcttatg gatttacaag tgcagattttcagcttcctg cta 43
<210> 17
<211> 29
<212> DNA
<213> Artificial sequence
<220>
<223> primer
<400> 17
cataacaata tctcctctgg acattatga 29
<210> 18
<211> 36
<212> DNA
<213> Artificial sequence
<220>
<223> primer
<400> 18
gttatgaccc agtctccatc aagcctgtct gcatct 36
<210> 19
<211> 36
<212> DNA
<213> Artificial sequence
<220>
<223> primer
<400> 19
agacaggctt gatggagact gggtcataac aatttg 36
<210> 20
<211> 33
<212> DNA
<213> Artificial Sequence
<220>
<223> primer
<400> 20
gcatctgtag gggaacgggt caccatcacc tgc 33
<210> 21
<211> 33
<212> DNA
<213> Artificial sequence
<220>
<223> primer
<400> 21
ggtgatggtg acccgttccc ctacagatgc aga 33
<210> 22
<211> 33
<212> DNA
<213> Artificial sequence
<220>
<223> primer
<400> 22
cagcagaagc caggatccgc ccccaaactc tgg 33
<210> 23
<211> 33
<212> DNA
<213> Artificial sequence
<220>
<223> primer
<400> 23
gagtttgggg gcggatcctg gcttctgctg ata 33
<210> 24
<211> 33
<212> DNA
<213> Artificial sequence
<220>
<223> primer
<400> 24
tctgggaccg atttcacttt cacaatcagc agc 33
<210> 25
<211> 33
<212> DNA
<213> Artificial sequence
<220>
<223> primer
<400> 25
gctgctgatt gtgaaagtga aatcggtccc aga 33
<210> 26
<211> 33
<212> DNA
<213> Artificial sequence
<220>
<223> primer
<400> 26
agcagcctgc agcctgaaga tattgccact tat 33
<210> 27
<211> 33
<212> DNA
<213> Artificial sequence
<220>
<223> primer
<400> 27
agtggcaata tcttcaggct gcaggctgct gat 33
<210> 28
<211> 27
<212> DNA
<213> Artificial sequence
<220>
<223> primer
<400> 28
ggagtcccat ctcgcttcag tggcagt 27
<210> 29
<211> 30
<212> DNA
<213> Artificial sequence
<220>
<223> primer
<400> 29
cccactgcca ctgaagcgag atgggactcc 30
<210> 30
<211> 29
<212> DNA
<213> Artificial sequence
<220>
<223> primer
<400> 30
gccaccgtac gtttgatttc caccttggt 29
<210> 31
<211> 351
<212> DNA
<213> Artificial sequence
<220>
<223> variable region of humanized heavy chain, TNHV2
<400> 31

<210> 32
<211> 351
<212> DNA
<213> Artificial sequence
<220>
<223> variable region of humanized heavy chain, TNHV2k
<400> 32

<210> 33
<211> 351
<212> DNA
<213> Artificial sequence
<220>
<223> variable region of humanized heavy chain, TNHV1k
<400> 33

<210> 34
<211> 327
<212> DNA
<213> Artificial sequence
<220>
<223> variable region of humanized light chain, TNLV2
<400> 34

<210> 35
<211> 327
<212> DNA
<213> Artificial sequence
<220>
<223> Variable region of humanized light chain, TNLV2d
<400> 35

<210> 36
<211> 117
<212> PRT
<213> Artificial sequence
<220>
<223> Variable region of humanized heavy chain, TNHV2
<400> 36


<210> 37
<211> 117
<212> PRT
<213> Artificial sequence
<220>
<223> variable region of humanized heavy chain, TNHV2k
<400> 37

<210> 38
<211> 117
<212> PRT
<213> Artificial sequence
<220>
<223> variable region of humanized heavy chain, TNHV1k
<400> 38


<210> 39
<211> 109
<212> PRT
<213> Artificial sequence
<220>
<223> variable region of humanized light chain, TNLV2
<400> 39

<210> 40
<211> 109
<212> PRT
<213> Artificial Sequence
<220>
<223> Variable region of humanized light chain, TNLV2d
<400> 40


<210> 41
<211> 5
<212> PRT
<213> Mus musculus
<400> 41
<210> 42
<211> 17
<212> PRT
<213> Mus musculus
<400> 42

<210> 43
<211> 8
<212> PRT
<213> Mus musculus
<400> 43

<210> 44
<211> 12
<212> PRT
<213> Mus musculus
<400> 44

<210> 45
<211> 7
<212> PRT
<213> Mus musculus
<400> 45

<210> 46
<211> 9
<212> PRT
<213> Mus musculus
<400> 46

<210> 47
<211> 117
<212> PRT
<213> Mus musculus
<400> 47

<210> 48
<211> 98
<212> PRT
<213> Homo sapiens
<400> 48

<210> 49
<211> 109
<212> PRT
<213> Mus musculus
<400> 49


<210> 50
<211> 95
<212> PRT
<213> Homo sapiens
<400> 50
