<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE ep-patent-document PUBLIC "-//EPO//EP PATENT DOCUMENT 1.4//EN" "ep-patent-document-v1-4.dtd">
<ep-patent-document id="EP06826359B9W1" file="EP06826359W1B9.xml" lang="en" country="EP" doc-number="1945659" kind="B9" correction-code="W1" date-publ="20130529" status="c" dtd-version="ep-patent-document-v1-4">
<SDOBI lang="en"><B000><eptags><B001EP>ATBECHDEDKESFRGBGRITLILUNLSEMCPTIESILTLVFIROMKCY..TRBGCZEEHUPLSKBAHRIS......RS......................</B001EP><B003EP>*</B003EP><B005EP>J</B005EP><B007EP>DIM360 Ver 2.40 (30 Jan 2013) -  2999001/0</B007EP></eptags></B000><B100><B110>1945659</B110><B120><B121>CORRECTED EUROPEAN PATENT SPECIFICATION</B121></B120><B130>B9</B130><B132EP>B1</B132EP><B140><date>20130529</date></B140><B150><B151>W1</B151><B155><B1551>de</B1551><B1552>Beschreibung</B1552><B1551>en</B1551><B1552>Description</B1552><B1551>fr</B1551><B1552>Description</B1552></B155></B150><B190>EP</B190></B100><B200><B210>06826359.9</B210><B220><date>20061019</date></B220><B240><B241><date>20080516</date></B241><B242><date>20090409</date></B242></B240><B250>en</B250><B251EP>en</B251EP><B260>en</B260></B200><B300><B310>728449 P</B310><B320><date>20051019</date></B320><B330><ctry>US</ctry></B330><B310>754881 P</B310><B320><date>20051229</date></B320><B330><ctry>US</ctry></B330><B310>759162 P</B310><B320><date>20060114</date></B320><B330><ctry>US</ctry></B330><B310>761451 P</B310><B320><date>20060123</date></B320><B330><ctry>US</ctry></B330><B310>779080 P</B310><B320><date>20060303</date></B320><B330><ctry>US</ctry></B330><B310>409416</B310><B320><date>20060421</date></B320><B330><ctry>US</ctry></B330></B300><B400><B405><date>20130529</date><bnum>201322</bnum></B405><B430><date>20080723</date><bnum>200830</bnum></B430><B450><date>20120815</date><bnum>201233</bnum></B450><B452EP><date>20120305</date></B452EP><B472><B475><date>20120815</date><ctry>AT</ctry><date>20120815</date><ctry>CY</ctry><date>20120815</date><ctry>CZ</ctry><date>20120815</date><ctry>DK</ctry><date>20120815</date><ctry>EE</ctry><date>20120815</date><ctry>FI</ctry><date>20121116</date><ctry>GR</ctry><date>20121215</date><ctry>IS</ctry><date>20120815</date><ctry>LT</ctry><date>20120815</date><ctry>LV</ctry><date>20120815</date><ctry>PL</ctry><date>20121217</date><ctry>PT</ctry><date>20120815</date><ctry>SI</ctry></B475></B472><B480><date>20130529</date><bnum>201322</bnum></B480></B400><B500><B510EP><classification-ipcr sequence="1"><text>C07K  14/11        20060101AFI20080403BHEP        </text></classification-ipcr><classification-ipcr sequence="2"><text>A61K  39/145       20060101ALI20080403BHEP        </text></classification-ipcr><classification-ipcr sequence="3"><text>C12N   7/00        20060101ALI20080403BHEP        </text></classification-ipcr></B510EP><B540><B541>de</B541><B542>INFLUENZA-VIREN, DIE DAZU IN DER LAGE SIND, HUNDEARTIGE TIERE ZU INFIZIEREN, UND ANWENDUNGEN DAVON</B542><B541>en</B541><B542>INFLUENZA VIRUSES ABLE TO INFECT CANIDS, USES THEREOF</B542><B541>fr</B541><B542>VIRUS DE LA GRIPPE SUSCEPTIBLE D'INFECTER LES CANIDES, LEUR UTILISATION</B542></B540><B560><B561><text>WO-A-2004/057021</text></B561><B561><text>WO-A-2006/073436</text></B561><B561><text>WO-A-2006/116082</text></B561><B562><text>CRAWFORD P C ET AL: "Transmission of Equine influenza virus to dogs" SCIENCE, AMERICAN ASSOCIATION FOR THE ADVANCEMENT OF SCIENCE,, US, vol. 310, no. 5747, 21 October 2005 (2005-10-21), pages 482-485, XP003003531 ISSN: 0036-8075 &amp; SCIENCEXPRESS (10.1126/SCIENCE.1117950), 29 September 2005 (2005-09-29), &amp; Retrieved from the Internet: URL:http://www.sciencemag.org/cgi/content/ full/1117950/DC1, published 29 September 2005&gt; [retrieved on 2007-12-07] &amp; DATABASE EMBL 6 December 2005 (2005-12-06), "MATRIX PROTEIN 1" Database accession no. Q30BG2</text></B562><B562><text>PEEK SIMON F ET AL: "Acute respiratory distress syndrome and fatal interstitial pneumonia associated with equine influenza in a neonatal foal" JOURNAL OF VETERINARY INTERNAL MEDICINE, LIPPINCOTT, PHILADELPHIA, US, vol. 18, no. 1, January 2004 (2004-01), pages 132-134, XP008080707 ISSN: 0891-6640 &amp; DATABASE EMBL 8 November 2005 (2005-11-08), "M1" Database accession no. Q3I3U6</text></B562><B562><text>DATABASE BIOSIS [Online] BIOSCIENCES INFORMATION SERVICE, PHILADELPHIA, PA, US; 2003, CATTOLI G ET AL: "Plaque morphology of Italian H7N1 LPAI isolates in MDCK cells and in primary cells of different avian species." XP002461905 Database accession no. PREV200300495526 &amp; AVIAN DISEASES, vol. 47, no. Special Issue, 2003, pages 1161-1163, ISSN: 0005-2086</text></B562><B562><text>DATABASE MEDLINE [Online] US NATIONAL LIBRARY OF MEDICINE (NLM), BETHESDA, MD, US; January 2005 (2005-01), FONI EMANUELA ET AL: "Detection of influenza A virus by RT-PCR and standard methods in experimental infection of Ducks." XP002461906 Database accession no. NLM15782624 &amp; THE NEW MICROBIOLOGICA : OFFICIAL JOURNAL OF THE ITALIAN SOCIETY FOR MEDICAL, ODONTOIATRIC, AND CLINICAL MICROBIOLOGY (SIMMOC) JAN 2005, vol. 28, no. 1, January 2005 (2005-01), pages 31-35, ISSN: 1121-7138</text></B562><B562><text>WOOD J M ET AL: "The standardization of inactivated equine influenza vaccines by single-radial immunodiffusion" JOURNAL OF BIOLOGICAL STANDARDIZATION, ACADEMIC PRESS, LONDON, GB, vol. 11, no. 2, April 1983 (1983-04), pages 133-136, XP002418529 ISSN: 0092-1157</text></B562><B562><text>DATABASE BIOSIS [Online] BIOSCIENCES INFORMATION SERVICE, PHILADELPHIA, PA, US; 1980, HOUSER R E ET AL: "EVIDENCE OF PRIOR INFECTION WITH INFLUENZA A-TEXAS-77 H-3-N-2 VIRUS IN DOGS WITH CLINICAL PARAINFLUENZA" XP002461907 Database accession no. PREV198171055734 &amp; CANADIAN JOURNAL OF COMPARATIVE MEDICINE, vol. 44, no. 4, 1980, pages 396-402, ISSN: 0008-4050</text></B562><B562><text>DATABASE BIOSIS [Online] BIOSCIENCES INFORMATION SERVICE, PHILADELPHIA, PA, US; March 2006 (2006-03), CASTLEMAN WILLIAM L ET AL: "Pathologic findings in dogs infected with newly emerged canine H3N8 influenza virus" XP002442668 Database accession no. PREV200600343510 &amp; FASEB JOURNAL, vol. 20, no. 4, Part 1, March 2006 (2006-03), page A214, EXPERIMENTAL BIOLOGY 2006 MEETING; SAN FRANCISCO, CA, USA; APRIL 01 05, 2006 ISSN: 0892-6638</text></B562><B562><text>DATABASE BIOSIS [Online] BIOSCIENCES INFORMATION SERVICE, PHILADELPHIA, PA, US; April 2007 (2007-04), HANSHAW DAREN ET AL: "Canine H3N8 influenza virus infection in mice" XP002442669 Database accession no. PREV200700333940 &amp; FASEB JOURNAL, vol. 21, no. 5, April 2007 (2007-04), page A406, EXPERIMENTAL BIOLOGY 2007 ANNUAL MEETING; WASHINGTON, DC, USA; APRIL 28 -MAY 02, 2007 ISSN: 0892-6638</text></B562></B560></B500><B600><B620EP><parent><cdoc><dnum><anum>11003016.0</anum><pnum>2407480</pnum></dnum><date>20110411</date></cdoc></parent></B620EP></B600><B700><B720><B721><snm>CRAWFORD, Patti, C.</snm><adr><str>210 NW 79th Drive</str><city>Gainesville, FL 32607</city><ctry>US</ctry></adr></B721><B721><snm>GIBBS, Paul, J.</snm><adr><str>3650 NW 30th Place</str><city>Gainesville, FL 32605</city><ctry>US</ctry></adr></B721><B721><snm>DUBOVI, Edward, J.</snm><adr><str>33 Helseas Walk</str><city>Ithaca, NY 14850-1087</city><ctry>US</ctry></adr></B721><B721><snm>DONIS, Ruben, O.</snm><adr><str>429 Emory Drive NE</str><city>Atlanta, GA 30307</city><ctry>US</ctry></adr></B721><B721><snm>KATZ, Jacqueline</snm><adr><str>447 Hardendorf Ave. N.e.</str><city>Atlanta, Georgia 30307</city><ctry>US</ctry></adr></B721><B721><snm>KLIMOV, Alexander, I.</snm><adr><str>3197 Amblewood Ct</str><city>Atlanta, GA 30345</city><ctry>US</ctry></adr></B721><B721><snm>LAKSHMANAN, Nallakannu, P.</snm><adr><str>P.O. Box 318</str><city>Millsboro, DE 19966</city><ctry>US</ctry></adr></B721><B721><snm>LUM, Melissa, Anne</snm><adr><str>P.O. Box 318</str><city>Millsboro, DE 19966</city><ctry>US</ctry></adr></B721><B721><snm>GOOVAERTS, Daniel, Ghislena, Emiel</snm><adr><str>Wim de Korverstraat 35</str><city>5831 AN Boxmeer</city><ctry>NL</ctry></adr></B721><B721><snm>MELLENCAMP, Mark, William</snm><adr><str>35500 West 91st Street</str><city>Desoto, KS 66018</city><ctry>US</ctry></adr></B721><B721><snm>CASTLEMAN, William L.</snm><adr><str>4330 SW 77th Street</str><city>Gainesville, FL 32608</city><ctry>US</ctry></adr></B721><B721><snm>COX, Nancy J.</snm><adr><str>857 Oakdale Road</str><city>Atlanta, GA 30307</city><ctry>US</ctry></adr></B721></B720><B730><B731><snm>University of Florida Research Foundation, 
Incorporated</snm><iid>100245827</iid><irf>P/60826.EP01</irf><adr><str>223 Grinter Hall</str><city>Gainesville, Florida 32611</city><ctry>US</ctry></adr></B731><B731><snm>THE GOVERNMENT OF THE UNITED STATES OF AMERICA 
as represented by THE SECRETARY OF THE 
DEPARTMENT OF HEALTH AND HUMAN SERVICES</snm><iid>100764011</iid><irf>P/60826.EP01</irf><adr><str>Centers for Disease Control and Prevention 
Technology Transfer Office</str><city>4770 Buford Hwy (K79)
Atlanta, Georgia 30341</city><ctry>US</ctry></adr></B731><B731><snm>Cornell Research Foundation, Inc.</snm><iid>100982763</iid><irf>P/60826.EP01</irf><adr><str>20 Thornwood Drive, Suite 105</str><city>Ithaca, NY 14850</city><ctry>US</ctry></adr></B731></B730><B740><B741><snm>Roberts, Michael Austin</snm><iid>101315962</iid><adr><str>Reddie &amp; Grose LLP 
16 Theobalds Road</str><city>London WC1X 8PL</city><ctry>GB</ctry></adr></B741></B740></B700><B800><B840><ctry>AT</ctry><ctry>BE</ctry><ctry>BG</ctry><ctry>CH</ctry><ctry>CY</ctry><ctry>CZ</ctry><ctry>DE</ctry><ctry>DK</ctry><ctry>EE</ctry><ctry>ES</ctry><ctry>FI</ctry><ctry>FR</ctry><ctry>GB</ctry><ctry>GR</ctry><ctry>HU</ctry><ctry>IE</ctry><ctry>IS</ctry><ctry>IT</ctry><ctry>LI</ctry><ctry>LT</ctry><ctry>LU</ctry><ctry>LV</ctry><ctry>MC</ctry><ctry>NL</ctry><ctry>PL</ctry><ctry>PT</ctry><ctry>RO</ctry><ctry>SE</ctry><ctry>SI</ctry><ctry>SK</ctry><ctry>TR</ctry></B840><B844EP><B845EP><ctry>BA</ctry><date>20080516</date></B845EP><B845EP><ctry>HR</ctry><date>20080516</date></B845EP><B845EP><ctry>MK</ctry><date>20080516</date></B845EP><B845EP><ctry>RS</ctry><date>20080516</date></B845EP></B844EP><B860><B861><dnum><anum>US2006041061</anum></dnum><date>20061019</date></B861><B862>en</B862></B860><B870><B871><dnum><pnum>WO2007047938</pnum></dnum><date>20070426</date><bnum>200717</bnum></B871></B870></B800></SDOBI>
<description id="desc" lang="en"><!-- EPO <DP n="1"> -->
<heading id="h0001">BACKGROUND OF THE INVENTION</heading>
<p id="p0001" num="0001">"Kennel cough" or infectious tracheobronchitis (ITB) is an acute, contagious respiratory infection in dogs characterized mainly by coughing (Ford <i>et al,</i> 1998). Canine ITB is considered one of the most prevalent infectious respiratory diseases of dogs worldwide, and outbreaks can reach epidemic proportions when dogs are housed in high-density population environments such as kennels. Most outbreaks are due to direct dog-to-dog contact or aerosolization of respiratory secretions (Ford <i>et al,</i> 1998). The clinical signs are caused by infection with one or a combination of bacterial and viral agents that colonize the epithelium of the upper and lower respiratory tract. Canine parainfluenza virus (CPIV) and <i>Bordetella bronchiseptica</i> bacteria are the most common organisms isolated from affected dogs, but several other viruses such as canine distemper virus (CDV) and canine adenoviruses-1 and -2 (CAV-1, CAV-2), along with bacteria such as <i>Streptococcus sp., Pasteurella multicoda</i> and <i>Escherichia coli,</i> can influence the clinical course and outcome (Ford <i>et al,</i> 1998). While outbreaks occur most efficiently and rapidly in high-density populations with high morbidity, complicated respiratory infections and death are uncommon. Although life-threatening secondary bacterial pneumonia can develop, the majority of ITB cases are self-limiting and resolve without any treatment (Ford <i>et al,</i> 1998).</p>
<p id="p0002" num="0002">In July 1992, a respiratory infection presumed to be "kennel cough" became epidemic at several greyhound tracks in New England, Florida, West Virginia, Wisconsin, Kansas,<!-- EPO <DP n="2"> --> Colorado, Oklahoma and Arizona. According to veterinarians, most of the affected dogs had a mild cough that resolved, but more than a dozen greyhounds developed an acute hemorrhagic pneumonia followed by rapid death (Greyhound Daily News, 1999).</p>
<p id="p0003" num="0003">In late 1998 to early 1999, several outbreaks of, "kennel cough" occurred in racing greyhound kennels across the country, resulting in mandatory closure of tracks and quarantine of all racing greyhounds in the U.S. for several weeks (Greyhound Daily News, 1999). At one track in Florida (Palm Beach Kennel Club), coughing was recorded in nearly 40% of the dog population on a single day (Personal communication from Dr. William Duggar). Similar to the outbreak in 1992, the coughing resolved in most greyhounds, but 10 dogs in Florida died from a hemorrhagic pneumonia syndrome uncharacteristic of "kennel cough" (Putnam, 1999).</p>
<p id="p0004" num="0004">In March-April 2003, another outbreak of "kennel cough" occurred at greyhound tracks in the eastern U.S. The outbreak is believed to have originated in kennels at four tracks in Florida and caused the suspension of racing and quarantine of dogs for almost three weeks. Nearly 25% of the dogs at the track in West Palm Beach were affected, while almost 50% of the 1400 dogs at Derby Lane in St. Petersburg developed coughing. Again, most dogs recovered, but several dogs have died from the respiratory infection. The estimated economic impact of the respiratory outbreak at the Derby Lane track alone was $2 million.</p>
<p id="p0005" num="0005">There are no published reports documenting the etiology or clinicopathology of the "kennel cough" epidemics in racing greyhound kennels in 1992, 1998-1999, or 2003. The assumption has been that the infections were due to CPiV and/or <i>B. bronchiseptica,</i> the two most common causes of kennel cough. Unsubstantiated communications such as web sites have attributed the fatal hemorrhagic pneumonias reported in some of the coughing dogs to infection with β-hemolytic <i>Streptococcus equi</i> subspecies <i>zooepidemicus,</i> and refer to the syndrome as "canine streptococcal toxic shock."</p>
<p id="p0006" num="0006">Transmission of virus from one host species to another is a crucial feature of the ecology and epidemiology of influenza virus (Webster, 1998). Two basic mechanisms of interspecies transmission of influenza virus are possible (Webster <i>et al.,</i> 1992; Lipatov <i>et al.,</i> 2004). One is the direct transfer of an essentially unaltered virus from one species to another. Examples of this mechanism include the recent human infections with the H5N1 subtype of avian influenza virus (Subbarao <i>et al.,</i> 1998; Peiris <i>et al.,</i> 2004; Guan <i>et al.,</i> 2004) and possibly the pandemic of 1918, known as Spanish flu (Reid <i>et al.,</i> 2004). The second mechanism is a consequence of the segmented nature of the influenza genome. Co-infection<!-- EPO <DP n="3"> --> of a host with viruses from different species can result in reassortment of the segmented viral genes and the generation of a recombinant with the ability to infect other species. For example, novel viruses generated by gene reassortment between avian and human influenza viruses resulted in human influenza pandemics in 1957 and 1968 (Webster <i>et al.,</i> 1992; Lipatov <i>et al.,</i> 2004; Kawaoka <i>et al.,</i> 1989).</p>
<p id="p0007" num="0007">Most direct transmissions of unaltered influenza viruses from the natural host species to a different species are terminal events because sustained transmission between individuals of the new species fails to occur. Multiple virus-host interactions are necessary for replication and horizontal transmission and provide a formidable barrier to perpetuation of influenza viruses in the new host (Webby <i>et al.,</i> 2004). Therefore, establishment of new host-specific lineages of influenza virus is uncommon and has only occurred in domestic poultry, pigs, horses, and humans (Webster <i>et al.,</i> 1992; Lipatov <i>et al.,</i> 2004).</p>
<p id="p0008" num="0008">Because of the serious nature of influenza virus infection, there remains a need for methods for diagnosing, preventing, and treating infection by influenza virus.</p>
<heading id="h0002">BRIEF SUMMARY OF THE INVENTION</heading>
<p id="p0009" num="0009">The subject invention pertains to isolated influenza virus that is capable of infecting canids and causing respiratory disease in the canid.<!-- EPO <DP n="4"> --></p>
<p id="p0010" num="0010">Specifically, the invention is the following:
<ol id="ol0001" ol-style="">
<li>1. An isolated canine influenza virus that is capable of infecting a canid animal, wherein said influenza virus comprises a polynucleotide which encodes a hemagglutinin (HA) polypeptide having an amino acid sequence shown in SEQ ID NO: 78, or a mature sequence thereof where the N-terminal 16 amino acid signal sequence of the full-length sequence has been removed.</li>
<li>2. The influenza virus according to 1, wherein said influenza virus comprises a polynucleotide which encodes a polypeptide having the amino acid sequence shown in any of SEQ ID NOs: 64, 66, 68, 70, 72, 74, or 76, or a functional and/or immunogenic fragment thereof, or said polynucleotide encodes a polypeptide having 95% or greater sequence identity with the amino acid sequence shown in any of SEQ ID NOs: 64, 66, 68, 70, 72, 74, or 76.</li>
<li>3. The influenza virus according to 1, wherein said HA polypeptide of said viral isolate comprises the amino acid sequence of SEQ ID NO: 78.</li>
<li>4. The influenza virus according to 1, wherein said influenza virus comprises a polynucleotide having the nucleotide sequence shown in any of SEQ ID NOs: 63, 65, 67, 69, 71, 73, 75, or 77, or said polynucleotide has 98% or greater sequence identity with the nucleotide sequence shown in any of SEQ ID NOs: 63, 65, 67, 69, 71, 73, 75, or 77.</li>
<li>5. The influenza virus according to 1, wherein said influenza virus is inactivated or attenuated.</li>
<li>6. A composition comprising an immunogen of an influenza virus of 1, wherein said immunogen is capable of inducing an immune response against an influenza virus that is capable of infecting a canid animal, and wherein said immunogen comprises:
<ol id="ol0002" compact="compact" ol-style="">
<li>(a) an HA polypeptide as defined in 1 or 3; and/or</li>
<li>(b) a polynucleotide encoding an HA polypeptide as defined in 1 or 3.</li>
</ol><!-- EPO <DP n="5"> --></li>
<li>7. The composition according to 6, wherein said immunogen comprises cell-free whole virus, or a portion thereof; a viral polynucleotide; a viral protein; a viral polypeptide or peptide; a virus infected cell; a recombinant viral vector based construct; a reassortant virus; or naked nucleic acid of said virus.</li>
<li>8. The composition according to 7, wherein said viral protein, polypeptide, or peptide comprises an amino acid sequence shown in any of SEQ ID NOs: 64, 66, 68, 70, 72, 74, or 76, or a functional and/or immunogenic fragment thereof, or said polynucleotide encodes a polypeptide having 95% or greater sequence identity with the amino acid sequence shown in any of SEQ ID NOs: 64, 66, 68, 70, 72, 74, or 76.</li>
<li>9. The composition according to 7, wherein said viral polynucleotide encodes a polypeptide comprising an amino acid sequence shown in any of SEQ ID NOs: 64, 66, 68, 70, 72, 74, or 76, or a functional and/or immunogenic fragment thereof, or said polynucleotide encodes a polypeptide having 95% or greater sequence identity with the amino acid sequence shown in any of ID NOs: 64, 66, 68, 70, 72, 74, or 76.</li>
<li>10. The composition according to 7, wherein said viral polynucleotide comprises the nucleotide sequence shown in any of SEQ ID NOs: 63, 65, 67, 69, 71, 73, 75, or 77, or a functional fragment thereof.</li>
<li>11. A canine influenza vaccine, wherein the vaccine comprises:
<ul id="ul0001" list-style="none" compact="compact">
<li>a therapeutically effective amount of an antigen of at least one influenza virus of 1, and</li>
<li>at least one pharmaceutically acceptable excipient,</li>
<li>wherein said antigen comprises:
<ol id="ol0003" compact="compact" ol-style="">
<li>(a) an HA polypeptide as defined in 1 or 3; and/or</li>
<li>(b) a polynucleotide encoding an HA polypeptide as defined in 1 or 3.</li>
</ol></li>
</ul></li>
<li>12. The vaccine according to 11, wherein the virus antigen(s) comprises an inactivated virus(es).<!-- EPO <DP n="6"> --></li>
<li>13. The vaccine according to 11, wherein the virus antigen(s) comprises a live attenuated virus(es).</li>
<li>14. An isolated polynucleotide that comprises all or part of a genomic segment or gene of an influenza virus of 1, wherein the polynucleotide comprises a nucleic acid sequence which encodes an HA polypeptide as defined in 1 or 3.</li>
<li>15. The polynucleotide according to 14, wherein said polynucleotide is formulated in a pharmaceutically acceptable carrier or diluent.</li>
<li>16. A polynucleotide expression construct comprising a polynucleotide of 14.</li>
<li>17. An isolated HA polypeptide encoded by a polynucleotide of 14.</li>
<li>18. The polypeptide according to 17, wherein said polypeptide is formulated in a pharmaceutically acceptable carrier or diluent.</li>
</ol><!-- EPO <DP n="7"> --></p>
<p id="p0011" num="0011">Benefits of Applicants' invention will be apparent to one skilled in the art from reading this specification.</p>
<heading id="h0003">BRIEF DESCRIPTION OF THE DRAWINGS</heading>
<p id="p0012" num="0012">
<ul id="ul0002" list-style="none" compact="compact">
<li><figref idref="f0001 f0002"><b>Figures 1A-1B</b></figref> show phylogenetic relationships among the hemagglutinin genes. <figref idref="f0001"><b>Figure 1A</b></figref> shows a tree of HA genes from representative canine, human, avian, swine, and equine isolates, including A/Budgerigar/Hokkaido/1/77 (H4) as outgroup. <figref idref="f0002"><b>Figure 1B</b></figref> shows a tree of the canine influenza virus HA genes with contemporary and older equine HA genes, using A/Duck/Ukraine/63 (H3) as outgroup. Phylogenetic trees were inferred from nucleotide sequences by the neighbor joining method and bootstrap analysis values ≥90% are shown. The bar denotes the number of nucleotide changes per unit length of the horizontal tree branches.</li>
<li><figref idref="f0003"><b>Figures 2A-2B</b></figref> show immunohistochemical detection of influenza H3 antigen in the lungs. Lung tissue sections were probed with a mouse monoclonal antibody to H3 hemagglutinin and binding was detected by immunoperoxidase reaction (brown precipitate). <figref idref="f0003"><b>Figure 2A</b></figref> shows bronchial epithelium from a greyhound with spontaneous disease. Viral H3 antigen was detected in bronchial epithelial cell cytoplasm and in macrophages in airway lumens and in alveolar spaces. <figref idref="f0003"><b>Figure 2B</b></figref> shows bronchial epithelium from a dog 5 days after inoculation with A/canine/Florida/43/2004 (H3N8). Viral H3 antigen was detected in bronchial epithelial cell cytoplasm. Scale bar, 66 µm.</li>
<li><figref idref="f0004"><b>Figure 3</b></figref> shows the characteristic histological changes in the bronchi of greyhounds that died from hemorrhagic pneumonia associated with influenza virus infection. The tissues are stained with H&amp;E. Upper panel: Normal bronchus with ciliated epithelial cells, mucous cells, and basal cells. Lower panel: Bronchus from a greyhound with spontaneous influenza. There is necrosis and erosion of the bronchial ciliated epithelial cells. Scale bar, 100 µm.</li>
<li><figref idref="f0005"><b>Figures 4A-4B</b></figref> shows phylogenetic relationships among the H3 hemagglutinin genes. <figref idref="f0005"><b>Figure 4A</b></figref> shows a phylogenetic tree of the canine influenza virus HA genes with contemporary and older equine HA genes. <figref idref="f0005"><b>Figure 4B</b></figref> shows a phylogenetic tree of the canine influenza virus HA protein with contemporary and older equine HA. Phylogenetic trees were inferred from genetic or amino acid sequences by the neighbor joining method and<!-- EPO <DP n="8"> --> bootstrap analysis values ≥80% are shown. The bar denotes the number of amino acid changes per unit length of the horizontal tree branches.</li>
<li><figref idref="f0006"><b>Figure 5</b></figref> shows Influenza virus H3 protein in epithelial cells of bronchi and bronchial glands in lungs of dogs that died of pneumonia associated with influenza virus infection. Upper panels: Erosion of ciliated bronchial epithelial cells in bronchi. Tissues were stained with H&amp;E. Lower panels: Influenza virus H3 protein in the cytoplasm of bronchial (left) and bronchial gland (right) epithelial cells. Tissues were stained with a monoclonal antibody to influenza H3 detected by immunoperoxidase reaction (brown precipitate) and counterstained with hematoxylin.</li>
<li><figref idref="f0007 f0008"><b>Figures 6A-6D</b></figref> show amplification plots of H3 and Matrix genes (<figref idref="f0007"><b>Figure 6A</b> and <b>Figure 6B</b></figref>) obtained from the amplification of 10-fold serially diluted <i>in vitro</i> transcribed RNA standards. Standard curves of H3 and Matrix genes (<figref idref="f0008"><b>Figure 6C</b> and <b>Figure 6D</b></figref>) constructed by plotting the log of starting RNA concentrations against the threshold cycle (Ct) obtained from each dilution.</li>
<li><figref idref="f0009"><b>Figure 7</b></figref> shows sensitivity of Directigen Flu A was tested with 10-fold serially diluted virus stocks including A/Wyoming/3/2003 and A/canine/FL/242/2003. The purple triangle indicates positive result.</li>
</ul></p>
<heading id="h0004">BRIEF DESCRIPTION OF THE SEQUENCES</heading>
<p id="p0013" num="0013">
<ul id="ul0003" list-style="none" compact="compact">
<li><b>SEQ ID NO: 1</b> is a nucleotide sequence of a canine influenza virus (Florida/43/04) encoding a PB2 protein.</li>
<li><b>SEQ ID NO: 2</b> is the amino acid sequence encoded by SEQ ID NO: 1.</li>
<li><b>SEQ ID NO: 3</b> is a nucleotide sequence of a canine influenza virus (Florida/43/04) encoding a PB 1 protein.</li>
<li><b>SEQ ID NO: 4</b> is the amino acid sequence encoded by SEQ ID NO: 3.</li>
<li><b>SEQ ID NO: 5</b> is a nucleotide sequence of a canine influenza virus (Florida/43/04) encoding a PA protein.</li>
<li><b>SEQ ID NO: 6</b> is the amino acid sequence encoded by SEQ ID NO: 5.</li>
<li><b>SEQ ID NO: 7</b> is a nucleotide sequence of a canine influenza virus (Florida/43/04) encoding an NS protein.</li>
<li><b>SEQ ID NO: 8</b> is the amino acid sequence encoded by SEQ ID NO: 7.</li>
<li><b>SEQ ID NO: 9</b> is a nucleotide sequence of a canine influenza virus (Florida/43/04) encoding an NP protein.<!-- EPO <DP n="9"> --></li>
<li><b>SEQ ID NO: 10</b> is the amino acid sequence encoded by SEQ ID NO: 9.</li>
<li><b>SEQ ID NO: 11</b> is a nucleotide sequence of a canine influenza virus (Florida/43/04) encoding an NA protein.</li>
<li><b>SEQ ID NO: 12</b> is the amino acid sequence encoded by SEQ ID NO: 11.</li>
<li><b>SEQ ID NO: 13</b> is a nucleotide sequence of a canine influenza virus (Florida/43/04) encoding an MA protein.</li>
<li><b>SEQ ID NO: 14</b> is the amino acid sequence encoded by SEQ ID NO: 13.</li>
<li><b>SEQ ID NO: 15</b> is a nucleotide sequence of a canine influenza virus (Florida/43/04) encoding an HA protein.</li>
<li><b>SEQ ID NO: 16</b> is the amino acid sequence encoded by SEQ ID NO: 15.</li>
<li><b>SEQ ID NO: 17</b> is a nucleotide sequence of a canine influenza virus (FL/242/03) encoding a PB2 protein.</li>
<li><b>SEQ ID NO: 18</b> is the amino acid sequence encoded by SEQ ID NO: 17.</li>
<li><b>SEQ ID NO: 19</b> is a nucleotide sequence of a canine influenza virus (FL/242/03) encoding a PB 1 protein.</li>
<li><b>SEQ ID NO: 20</b> is the amino acid sequence encoded by SEQ ID NO: 19.</li>
<li><b>SEQ ID NO: 21</b> is a nucleotide sequence of a canine influenza virus (F/242/03) encoding a PA protein.</li>
<li><b>SEQ ID NO: 22</b> is the amino acid sequence encoded by SEQ ID NO: 21.</li>
<li><b>SEQ ID NO: 23</b> is a nucleotide sequence of a canine influenza virus (F/242/03) encoding an NS protein.</li>
<li><b>SEQ ID NO: 24</b> is the amino acid sequence encoded by SEQ ID NO: 23.</li>
<li><b>SEQ ID NO: 25</b> is a nucleotide sequence of a canine influenza virus (F/242/03) encoding an NP protein.</li>
<li><b>SEQ ID NO: 26</b> is the amino acid sequence encoded by SEQ ID NO: 25.</li>
<li><b>SEQ ID NO: 27</b> is a nucleotide sequence of a canine influenza virus (FL/242/03) encoding an NA protein.</li>
<li><b>SEQ ID NO: 28</b> is the amino acid sequence encoded by SEQ ID NO: 27.</li>
<li><b>SEQ ID NO: 29</b> is a nucleotide sequence of a canine influenza virus (FL/242/03) encoding an MA protein.</li>
<li><b>SEQ ID NO: 30</b> is the amino acid sequence encoded by SEQ ID NO: 29.</li>
<li><b>SEQ ID NO: 31</b> is a nucleotide sequence of a canine influenza virus (FL/242/03) encoding an HA protein.<!-- EPO <DP n="10"> --></li>
<li><b>SEQ ID NO: 32</b> is the amino acid sequence encoded by SEQ ID NO: 31.</li>
<li><b>SEQ ID NO: 33</b> is the mature form of the HA protein shown in SEQ ID NO: 16 wherein the N-terminal 16 amino acid signal sequence has been removed.</li>
<li><b>SEQ ID NO: 34</b> is the mature form of the HA protein shown in SEQ ID NO: 32 wherein the N-terminal 16 amino acid signal sequence has been removed.</li>
<li><b>SEQ ID NO: 35</b> is an oligonucleotide.</li>
<li><b>SEQ ID NO: 36</b> is an oligonucleotide.</li>
<li><b>SEQ ID NO: 37</b> is an oligonucleotide.</li>
<li><b>SEQ ID NO: 38</b> is an oligonucleotide</li>
<li><b>SEQ ID NO: 39</b> is an oligonucleotide.</li>
<li><b>SEQ ID NO: 41</b> is an oligonucleotide.</li>
<li><b>SEQ ID NO: 42</b> is an oligonucleotide.</li>
<li><b>SEQ ID NO: 43</b> is an oligonucleotide.</li>
<li><b>SEQ ID NO: 44</b> is an oligonucleotide.</li>
<li><b>SEQ ID NO: 45</b> is an oligonucleotide.</li>
<li><b>SEQ ID NO: 46</b> is an oligonucleotide.</li>
<li><b>SEQ ID NO: 47</b> is a nucleotide sequence of a canine influenza virus (Miami/2005) encoding a PB2 protein.</li>
<li><b>SEQ ID NO: 48</b> is the amino acid sequence encoded by SEQ ID NO: 47.</li>
<li><b>SEQ ID NO: 49</b> is a nucleotide sequence of a canine influenza virus (Miami/2005) encoding a PB1 protein.</li>
<li><b>SEQ ID NO: 50</b> is the amino acid sequence encoded by SEQ ID NO: 49.<!-- EPO <DP n="11"> --></li>
<li><b>SEQ ID NO: 51</b> is a nucleotide sequence of a canine influenza virus (Miami/2005) encoding a PA protein.</li>
<li><b>SEQ ID NO: 52</b> is the amino acid sequence encoded by SEQ ID NO: 51.</li>
<li><b>SEQ ID NO: 53</b> is a nucleotide sequence of a canine influenza virus (Miami/2005) encoding an NS protein.</li>
<li><b>SEQ ID NO: 54</b> is the amino acid sequence encoded by SEQ ID NO: 53.</li>
<li><b>SEQ ID NO: 55</b> is a nucleotide sequence of a canine influenza virus (Miami/2005) encoding an NP protein.</li>
<li><b>SEQ ID NO: 56</b> is the amino acid sequence encoded by SEQ ID NO: 55.</li>
<li><b>SEQ ID NO: 57</b> is a nucleotide sequence of a canine influenza virus (Miami/2005) encoding an NA protein.</li>
<li><b>SEQ ID NO: 58</b> is the amino acid sequence encoded by SEQ ID NO: 57.</li>
<li><b>SEQ ID NO: 59</b> is a nucleotide sequence of a canine influenza virus (Miami/2005) encoding an MA protein.</li>
<li><b>SEQ ID NO: 60</b> is the amino acid sequence encoded by SEQ ID NO: 59.</li>
<li><b>SEQ ID NO: 61</b> is a nucleotide sequence of a canine influenza virus (Miami/2005) encoding an HA protein.</li>
<li><b>SEQ ID NO: 62</b> is the amino acid sequence encoded by SEQ ID NO: 61.</li>
<li><b>SEQ ID NO: 63</b> is a nucleotide sequence of a canine influenza virus (Jacksonville/2005) encoding a PB2 protein .</li>
<li><b>SEQ ID NO: 64</b> is the amino acid sequence encoded by SEQ ID NO: 63.</li>
<li><b>SEQ ID NO: 65</b> is a nucleotide sequence of a canine influenza virus (Jacksonville/2005) encoding a PB1 protein.</li>
<li><b>SEQ ID NO: 66</b> is the amino acid sequence encoded by SEQ ID NO: 65.</li>
<li><b>SEQ ID NO: 67</b> is a nucleotide sequence of a canine influenza virus (Jacksonville/2005) encoding a PA protein.</li>
<li><b>SEQ ID NO: 68</b> is the amino acid sequence encoded by SEQ ID NO: 67.</li>
<li><b>SEQ ID NO: 69</b> is a nucleotide sequence of a canine influenza virus (Jacksonville/2005) encoding an NS protein.<!-- EPO <DP n="12"> --></li>
<li><b>SEQ ID NO: 70</b> is the amino acid sequence encoded by SEQ ID NO: 69.</li>
<li><b>SEQ ID NO: 71</b> is a nucleotide sequence of a canine influenza virus (Jacksonville/2005) encoding an NP protein.</li>
<li><b>SEQ ID NO: 72</b> is the amino acid sequence encoded by SEQ ID NO: 71.</li>
<li><b>SEQ ID NO: 73</b> is a nucleotide sequence of a canine influenza virus (Jacksonville/2005) encoding an NA protein.</li>
<li><b>SEQ ID NO: 74</b> is the amino acid sequence encoded by SEQ ID NO: 73.</li>
<li><b>SEQ ID NO: 75</b> is a nucleotide sequence of a canine influenza virus (Jacksonville/2005) encoding an MA protein.</li>
<li><b>SEQ ID NO: 76</b> is the amino acid sequence encoded by SEQ ID NO: 75.</li>
<li><b>SEQ ID NO: 77</b> is a nucleotide sequence of a canine influenza virus (Jacksonville/2005) encoding an HA protein that can be used according to the present invention.</li>
<li><b>SEQ ID NO: 78</b> is the amino acid sequence encoded by SEQ ID NO: 77.</li>
<li><b>SEQ ID NO: 79</b> is an oligonucleotide.</li>
<li><b>SEQ ID NO: 80</b> is an oligonucleotide.</li>
<li><b>SEQ ID NO: 81</b> is an oligonucleotide.</li>
<li><b>SEQ ID NO: 82</b> is an oligonucleotide.</li>
<li><b>SEQ ID NO: 83</b> is an oligonucleotide.</li>
<li><b>SEQ ID NO: 84</b> is an oligonucleotide.</li>
<li><b>SEQ ID NO: 85</b> is an oligonucleotide.</li>
<li><b>SEQ ID NO: 86</b> is an oligonucleotide.<!-- EPO <DP n="13"> --></li>
<li><b>SEQ ID NO: 87</b> is an oligonucleotide.</li>
<li><b>SEQ ID NO: 88</b> is an oligonucleotide.</li>
</ul></p>
<heading id="h0005">DETAILED DISCLOSURE</heading>
<p id="p0014" num="0014">The present disclosure concerns isolated influenza virus that is capable of infecting canids and causing respiratory disease. An influenza virus can comprise a polynucleotide which encodes a protein having an amino acid sequence shown in any of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14 , 16, 18, 20, 22, 24, 26, 28, 30, 32, 33, 34, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, or 78, or a functional and/or immunogenic fragment or variant thereof. The polynucleotide can comprise the nucleotide sequence shown in any of SEQ ID Nos: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, or 77, or a fragment or variant thereof. Influenza virus can have an HA subtype of H1, H2, H3, H4, H5, H6, H7, H8, and H9, H10, H11, H12, H13, H14, H15, or H16 or an NA subtype of N1, N2, N3, N4, N5, N6, N7, N8, OR N9. In a specific embodiment, an influenza virus of the present invention is a subtype H3. Virus can be isolated from infected dogs and cultured in cells or eggs according to methods described herein. In an exemplified embodiment, the influenza virus is an influenza A virus.</p>
<p id="p0015" num="0015">The present disclosure also concerns polynucleotides that comprise all or part of a gene or genes or a genomic segment of an influenza virus of the present invention. A polynucleotide can comprise an influenza hemagglutinin (HA) gene, neuraminidase (NA) gene, nucleoprotein (NP) gene, matrix protein (MA or M) gene, polymerase basic (PB) protein gene, polymerase acidic (PA) protein gene, non-structural (NS) protein gene, or a functional fragment or variant of any of these genes. In a specific embodiment, a polynucleotide of the invention comprises the hemagglutinin (HA) gene . In the disclosure, the HA gene encodes a hemagglutinin protein having one or more of the following: a serine at position 83; a leucine at position 222; a threonine at position 328; and/or a threonine at position 483, versus the amino acid sequence of equine H3 consensus sequence. The HA gene can encode a polypeptide having an amino acid sequence shown in SEQ ID NOs: 16, 32, 62, or 78, or a functional and/or immunogenic fragment or variant thereof.<!-- EPO <DP n="14"> --> The HA gene can comprise a nucleotide sequence shown in SEQ ID NOs: 15, 31, 61, or 77.</p>
<p id="p0016" num="0016">A polynucleotide can encode a polypeptide having the amino acid sequence shown in any of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 33, 34, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, or 78, or a functional and/or immunogenic fragment or variant thereof. The polynucleotide can encode the amino acid sequence shown in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 33, 34, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, or 78, comprise the nucleotide sequence shown in SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, or 77, respectively, or a sequence encoding a functional and/or immunogenic fragment or variant of any of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 33, 34, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, or 78. Thus, the subject disclosure concerns polynucleotide sequences comprising the nucleotide sequence shown in any of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, or 77, or a fragment or variant, including a degenerate variant, of any of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, or 77. Polynucleotides of the disclosure can comprise: Nucleotides 1-2271 of SEQ ID NO: 3; Nucleotides 1-2148 of SEQ ID NO: 5; Nucleotides 1-657 of SEQ ID NO: 7; Nucleotides 1-1494 of SEQ ID NO: 9; Nucleotides 1-1410 of SEQ ID NO: 11; Nucleotides 1-756 of SEQ ID NO: 13; Nucleotides 1-1695 of SEQ ID NO: 15; Nucleotides 1-2271 of SEQ ID NO: 19; Nucleotides 1-2148 of SEQ ID NO: 21; Nucleotides 1-657 of SEQ ID NO: 23; Nucleotides 1-1494 of SEQ ID NO: 25; Nucleotides 1-756 of SEQ ID NO: 29; Nucleotides 1-1695 of SEQ ID NO: 31; Nucleotides 1-2277 of SEQ ID NO: 47; Nucleotides 1-2271 of SEQ ID NO: 49; Nucleotides 1-2148 of SEQ ID NO: 51; Nucleotides 1-690 of SEQ ID NO: 53; Nucleotides 1-1494 of SEQ ID NO: 55; Nucleotides 1-1410 of SEQ ID NO: 57; Nucleotides 1-756 of SEQ ID NO: 59; Nucleotides 1-1695 of SEQ ID NO: 61; Nucleotides 1-2277 of SEQ ID NO: 63; Nucleotides 1-2271 of SEQ ID NO: 65; Nucleotides 1-2148 of SEQ ID NO: 67; Nucleotides 1-690 of SEQ ID NO: 69; Nucleotides 1-1494 of SEQ ID NO: 71; Nucleotides 1-1410 of SEQ ID NO: 73; Nucleotides 1-756 of SEQ ID NO: 75; and Nucleotides 1-1695 of SEQ ID NO: 77. Nucleotide and amino acid sequences of viral polynucleotide and polypeptide sequences contemplated within the scope of the present<!-- EPO <DP n="15"> --> disclosure have also been deposited with GenBank at accession Nos. DQ124147 through DQ124161 and DQ124190.</p>
<p id="p0017" num="0017">The subject disclosure also concerns polypeptides encoded by polynucleotides of an influenza virus. The subject disclosure also concerns functional and/or immunogenic fragments and variants of the subject polypeptides. Polypeptides contemplated include HA protein, NA protein, NS protein, nucleoprotein, polymerase basic protein, polymerase acidic protein, and matrix protein of an influenza virus. A polypeptide of the disclosure can have an amino acid sequence shown in any of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 33, 34, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, or 78, or a functional and/or immunogenic fragment or variant thereof.</p>
<p id="p0018" num="0018">The subject disclosure also concerns polynucleotide expression constructs comprising a polynucleotide sequence. An expression construct of the disclosure can comprise a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence shown in any of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 33, 34, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, or 78, or a functional and/or immunogenic fragment or variant thereof. The polynucleotide encoding the amino acid sequence shown in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 33, 34, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, or 78 can comprise the nucleotide sequence shown in SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, or 77, respectively, or a sequence encoding a functional and/or immunogenic fragment or variant of any of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 33, 34, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, or 78. Thus, the subject disclosure concerns expression constructs comprising a polynucleotide sequence comprising the nucleotide sequence shown in any of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, or 77, or a fragment or variant, including a degenerate variant, of any of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 47, 49, 51, 53, S5, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, or 77. An expression construct of the present disclosure provides for overexpression of an operably linked polynucleotide of the disclosure.</p>
<p id="p0019" num="0019">Expression constructs generally include regulatory elements that are functional in the intended host cell in which the expression construct is to be expressed.<!-- EPO <DP n="16"> --> Thus, a person of ordinary skill in the art can select regulatory elements for use in, for example, human host cells, mammalian host cells, insect host cells, yeast host cells, bacterial host cells, and plant host cells. In one embodiment, the regulatory elements are ones that are functional in canine cells. Regulatory elements include promoters, transcription termination sequences, translation termination sequences, enhancers, and polyadenylation elements. As used herein, the term "expression construct" refers to a combination of nucleic acid sequences that provides for transcription of an operably linked nucleic acid sequence. As used herein, the term "operably linked" refers to a juxtaposition of the components described wherein the components are in a relationship that permits them to function in their intended manner. In general, operably linked components are in contiguous relation.</p>
<p id="p0020" num="0020">An expression construct can comprise a promoter sequence operably linked to a polynucleotide sequence encoding a polypeptide of the invention. Promoters can be incorporated into a polynucleotide using standard techniques known in the art. Multiple copies of promoters or multiple promoters can be used in an expression construct. A promoter can be positioned about the same distance from the transcription start site in the expression construct as it is from the transcription start site in its natural genetic environment. Some variation in this distance is permitted without substantial decrease in promoter activity. A transcription start site is typically included in the expression construct. Preferably, the promoter associated with an expression construct of the invention provides for overexpression of an operably linked polynucleotide of the invention.</p>
<p id="p0021" num="0021">Promoters for use with an expression construct in eukaryotic cells can be of viral or cellular origin. Viral promoters include, but are not limited to, cytomegalovirus (CMV) gene promoters, SV40 early or late promoters, or Rous sarcoma virus (RSV) gene promoters. Promoters of cellular origin include, but are not limited to, desmin gene promoter and actin gene promoter Promoters suitable for use with an expression construct of the invention in yeast cells include, but are not limited to, 3-phosphoglycerate kinase promoter, glyceraldehyde-3-phosphate dehydrogenase promoter, metallothionein promoter, alcohol dehydrogenase-2 promoter, and hexokinase promoter.</p>
<p id="p0022" num="0022">If the expression construct is to be provided in or introduced into a plant cell, then plant viral promoters, such as, for example, a cauliflower mosaic virus (CaMV) 35S (including the enhanced CaMV 35S promoter (see, for example <patcit id="pcit0001" dnum="US5106739A"><text>U.S. Patent No. 5,106,739</text></patcit> and An, 1997)) or a CaMV 19S promoter can be used. Other promoters that can be used for expression constructs in plants include, for example, prolifera promoter, Ap3 promoter, heat<!-- EPO <DP n="17"> --> shock promoters, T-DNA 1'- or 2'-promoter of <i>A. tumefaciens,</i> polygalacturonase promoter, chalcone synthase A (CHS-A) promoter from petunia, tobacco PR-1a promoter, ubiquitin promoter, actin promoter, alcA gene promoter, pin2 promoter (Xu <i>et al.,</i> 1993), maize WipI promoter, maize trpA gene promoter (<patcit id="pcit0002" dnum="US5625136A"><text>U.S. Patent No. 5,625,136</text></patcit>), maize CDPK gene promoter, and RUBISCO SSU promoter (<patcit id="pcit0003" dnum="US5034322A"><text>U.S. Patent No. 5,034,322</text></patcit>) can also be used. Root-specific promoters, such as any of the promoter sequences described in <patcit id="pcit0004" dnum="US6455760B"><text>U.S. Patent No. 6,455,760</text></patcit> or <patcit id="pcit0005" dnum="US6696623B"><text>U.S. Patent No. 6,696,623</text></patcit>, or in published <patcit id="pcit0006" dnum="US20040078841A" dnum-type="L"><text>U.S. patent application Nos. 20040078841</text></patcit>; <patcit id="pcit0007" dnum="US20040067506A" dnum-type="L"><text>20040067506</text></patcit>; <patcit id="pcit0008" dnum="US20040019934A" dnum-type="L"><text>20040019934</text></patcit>; <patcit id="pcit0009" dnum="US20030177536A" dnum-type="L"><text>20030177536</text></patcit>; <patcit id="pcit0010" dnum="US20030084486A" dnum-type="L"><text>20030084486</text></patcit>; or <patcit id="pcit0011" dnum="US20040123349A" dnum-type="L"><text>20040123349</text></patcit>, can be used with an expression construct. Constitutive promoters (such as the CaMV, ubiquitin, actin, or NOS promoter), developmentally-regulated promoters, and inducible promoters (such as those promoters than can be induced by heat, light, hormones, or chemicals) are also contemplated for use with polynucleotide expression constructs . Tissue-specific promoters, for example fruit-specific promoters, such as the E8 promoter of tomato (accession number: AF515784; Good <i>et al.</i> (1994)) can also be used. Seed-specific promoters such as the promoter from a β-phaseolin gene (for example, of kidney bean) or a glycinin gene (for example, of soybean), and others, can also be used.</p>
<p id="p0023" num="0023">For expression in prokaryotic systems, an expression construct can comprise promoters such as, for example, alkaline phosphatase promoter, tryptophan (trp) promoter, lambda P<sub>L</sub> promoter, β-lactamase promoter, lactose promoter, phoA promoter, T3 promoter, T7 promoter, or tac promoter (de Boer <i>et al.,</i> 1983).</p>
<p id="p0024" num="0024">Expression constructs may optionally contain a transcription termination sequence, a translation termination sequence, a sequence encoding a signal peptide, and/or enhancer elements. Transcription termination regions can typically be obtained from the 3' untranslated region of a eukaryotic or viral gene sequence. Transcription termination sequences can be positioned downstream of a coding sequence to provide for efficient termination. A signal peptide sequence is a short amino acid sequence typically present at the amino terminus of a protein that is responsible for the relocation of an operably linked mature polypeptide to a wide range of post-translational cellular destinations, ranging from a specific organelle compartment to sites of protein action and the extracellular environment. Targeting gene products to an intended cellular and/or extracellular destination through the use of an operably linked signal peptide sequence is contemplated for use with the polypeptides of the invention. Classical enhancers are cis-acting elements that increase gene transcription and can also be included in the expression construct. Classical enhancer<!-- EPO <DP n="18"> --> elements are known in the art, and include, but are not limited to, the CaMV 35S enhancer element, cytomegalovirus (CMV) early promoter enhancer element, and the SV40 enhancer element. Intron-mediated enhancer elements that enhance gene expression are also known in the art. These elements must be present within the transcribed region and are orientation dependent.</p>
<p id="p0025" num="0025">DNA sequences which direct polyadenylation of mRNA transcribed from the expression construct can also be included in the expression construct, and include, but are not limited to, an octopine synthase or nopaline synthase signal.</p>
<p id="p0026" num="0026">Expression constructs can also include one or more dominant selectable marker genes, including, for example, genes encoding antibiotic resistance and/or herbicide-resistance for selecting transformed cells. Antibiotic-resistance genes can provide for resistance to one or more of the following antibiotics: hygromycin, kanamycin, bleomycin, G418, streptomycin, paromomycin, neomycin, and spectinomycin. Kanamycin resistance can be provided by neomycin phosphotransferase (NPT II). Herbicide-resistance genes can provide for resistance to phosphinothricin acetyltransferase or glyphosate. Other markers used for cell transformation screening include, but are not limited to, genes encoding β-glucuronidase (GUS), β-galactosidase, luciferase, nopaline synthase, chloramphenicol acetyltransferase (CAT), green fluorescence protein (GFP), or enhanced GFP (Yang <i>et al.,</i> 1996).</p>
<p id="p0027" num="0027">The present disclosure also concerns polynucleotide vectors comprising a polynucleotide sequence that encodes a polypeptide of the disclosure. Unique restriction enzyme sites can be included at the 5' and 3' ends of an expression construct or polynucleotide of the invention to allow for insertion into a polynucleotide vector. As used herein, the term "vector" refers to any genetic element, including for example, plasmids, cosmids, chromosomes, phage, virus, and the like, which is capable of replication when associated with proper control elements and which can transfer polynucleotide sequences between cells. Vectors contain a nucleotide sequence that permits the vector to replicate in a selected host cell. A number of vectors are available for expression and/or cloning, and include, but are not limited to, pBR322, pUC series, M13 series, pGEM series, and pBLUESCRIPT vectors (Stratagene, La Jolla, CA and Promega, Madison, WI).</p>
<p id="p0028" num="0028">The present disclosure also concerns oligonucleotide probes and primers, such as polymerase chain reaction (PCR) primers, that can hybridize to a coding or non-coding sequence of a polynucleotide. Oligonucleotide probes can be used in methods for detecting influenza virus nucleic acid sequences.<!-- EPO <DP n="19"> --> Oligonucleotide primers can be used in PCR methods and other methods involving nucleic acid amplification. A probe or primer can hybridize to a polynucleotide under stringent conditions. Probes and primers can optionally comprise a detectable label or reporter molecule, such as fluorescent molecules, enzymes, radioactive moiety, and the like. Probes and primers can be of any suitable length for the method or assay in which they are being employed. Typically, probes and primers will be 10 to 500 or more nucleotides in length. Probes and primers that are 10 to 20, 21 to 30, 31 to 40, 41 to 50, 51 to 60, 61 to 70, 71 to 80, 81 to 90, 91 to 100, or 101 or more nucleotides in length are contemplated. Probes and primers are any of 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. Probes and primers can have complete (100%) nucleotide sequence identity with the polynucleotide sequence, or the sequence identity can be less than 100%. For example, sequence identity between a probe or primer and a sequence can be 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70% or any other percentage sequence identity so long as the probe or primer can hybridize under stringent conditions to a nucleotide sequence of a polynucleotide. Exemplified probes and primers of the invention include those having the nucleotide sequence shown in any of SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, and SEQ ID NO: 46, or a functional fragment or variant of any of the SEQ ID NOs: 35-46.</p>
<p id="p0029" num="0029">As used herein, the terms "nucleic acid," "polynucleotide," and "oligonucleotide" refer to a deoxyribonucleotide, ribonucleotide, or a mixed deoxyribonucleotide and ribonucleotide polymer in either single- or double-stranded form, and unless otherwise limited, would encompass known analogs of natural nucleotides that can function in a similar manner as naturally-occurring nucleotides. Polynucleotide sequences include' the DNA strand sequence that can be transcribed into RNA and the RNA strand that can be translated into protein. The complementary sequence of any nucleic acid, polynucleotide, or oligonucleotide of the present invention is also contemplated within the scope of the invention. Polynucleotide sequences also include both full-length sequences as well as shorter sequences derived from the full-length sequences. The present disclosure also encompasses those polynucleotides that are complementary in sequence to the<!-- EPO <DP n="20"> --> polynucleotides disclosed herein. Polynucleotides and polypeptides can be provided in purified or isolated form.</p>
<p id="p0030" num="0030">Because of the degeneracy of the genetic code, a variety of different polynucleotide sequences can encode a polypeptide. A table showing all possible triplet codons (and where U also stands for T) and the amino acid encoded by each codon is described in Lewin (1985). In addition, it is well within the skill of a person trained in the art to create alternative polynucleotide sequences encoding the same, or essentially the same, polypeptides of the disclosure. These degenerate variant and alternative polynucleotide sequences are within the scope of the disclosure. As used herein, references to "essentially the same" sequence refers to sequences which encode amino acid substitutions, deletions, additions, or insertions which do not materially alter the functional and/or immunogenic activity of the polypeptide encoded by the polynucleotides of the disclosure.</p>
<p id="p0031" num="0031">The disclosure also concerns variants of the polynucleotides of the disclosure that encode polypeptides of the disclosure. Variant sequences include those sequences wherein one or more nucleotides of the sequence have been substituted, deleted, and/or inserted. The nucleotides that can be substituted for natural nucleotides of DNA have a base moiety that can include, but is not limited to, inosine, 5-fluorouracil, 5-bromouracil, hypoxanthine, 1-methylguanine, 5-methylcytosine, and tritylated bases. The sugar moiety of the nucleotide in a sequence can also be modified and includes, but is not limited to, arabinose, xylulose, and hexose. In addition, the adenine, cytosine, guanine, thymine, and uracil bases of the nucleotides can be modified with acetyl, methyl, and/or thio groups. Sequences containing nucleotide substitutions, deletions, and/or insertions can be prepared and tested using standard techniques known in the art.</p>
<p id="p0032" num="0032">Substitution of amino acids other than those specifically exemplified or naturally present in a polypeptide of the disclosure are also contemplated within the scope of the disclosure. For example, non-natural amino acids can be substituted for the amino acids of a polypeptide, so long as the polypeptide having the substituted amino acids retains substantially the same functional activity as the polypeptide in which amino acids have not been substituted. Examples of non-natural amino acids include, but are not limited to, ornithine, citrulline, hydroxyproline, homoserine, phenylglycine, taurine, iodotyrosine, 2,4-diaminobutyric acid, α-amino isobutyric acid, 4-aminobutyric acid, 2-amino butyric acid, y-amino butyric acid, ε-amino hexanoic acid, 6-amino hexanoic acid, 2-amino isobutyric acid,<!-- EPO <DP n="21"> --> 3-amino propionic acid, norleucine, norvaline, sarcosine, homocitrulline, cysteic acid, τ-butylglycine, τ-butylalanine, phenylglycine, cyclohexylalanine, β-alanine, fluoro-amino acids, designer amino acids such as β-methyl amino acids, C-methyl amino acids, N-methyl amino acids, and amino acid analogues in general. Non-natural amino acids also include amino acids having derivatized side groups. Furthermore, any of the amino acids in the protein can be of the D (dextrorotary) form or L (levorotary) form. Allellic variants of a protein sequence of a polypeptide are contemplated.</p>
<p id="p0033" num="0033">Amino acids can be generally categorized in the following classes: non-polar, uncharged polar, basic, and acidic. Conservative substitutions whereby a polypeptide of the present invention having an amino acid of one class is replaced with another amino acid of the same class fall within the scope of the disclosure so long as the polypeptide having the substitution still retains substantially the same functional activity as the polypeptide that does not have the substitution. Polynucleotides encoding a polypeptide having one or more amino acid substitutions in the sequence are contemplated within the scope of the disclosure. Table 11 below provides a listing of examples of amino acids belonging to each class. Single letter amino acid abbreviations are defined in Table 12.</p>
<p id="p0034" num="0034">Fragments and variants of polypeptides of influenza virus can be generated using standard methods known in the art and tested for the presence of function or immunogenecity using standard techniques known in the art. For example, for testing fragments and/or variants of a neuraminidase polypeptide of the invention, enzymatic activity can be assayed. Thus, an ordinarily skilled artisan can readily prepare and test fragments and variants of a polypeptide and determine whether the fragment or variant retains activity relative to full-length or a non-variant polypeptide.</p>
<p id="p0035" num="0035">Polynucleotides and polypeptides contemplated can also be defined in terms of more particular identity and/or similarity ranges with those sequences of the invention specifically exemplified herein. The sequence identity will typically be greater than 60%, preferably greater than 75%, more preferably greater than 80%, even more preferably greater than 90%, and can be greater than 95%. The identity and/or similarity of a sequence can be 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% as compared to a sequence exemplified herein. Unless otherwise specified, as used herein percent sequence identity and/or similarity<!-- EPO <DP n="22"> --> of two sequences can be determined using the algorithm of Karlin and Altschul (1990), modified as in Karlin and Altschul (1993). Such an algorithm is incorporated into the NBLAST and XBLAST programs of Altschul <i>et al.</i> (1990). BLAST searches can be performed with the NBLAST program, score = 100, wordlength = 12, to obtain sequences with the desired percent sequence identity. To obtain gapped alignments for comparison purposes, Gapped BLAST can be used as described in Altschul <i>et al.</i> (1997). When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (NBLAST and XBLAST) can be used. <i>See</i> NCBI/NIH website.</p>
<p id="p0036" num="0036">The disclosure also contemplates those polynucleotide molecules having sequences which are sufficiently homologous with the polynucleotide sequences exemplified herein so as to permit hybridization with that sequence under standard stringent conditions and standard methods (Maniatis <i>et al.,</i> 1982). As used herein, "stringent" conditions for hybridization refers to conditions wherein hybridization is typically carried out overnight at 20-25 C below the melting temperature (Tm) of the DNA hybrid in 6x SSPE, 5x Denhardt's solution, 0.1% SDS, 0.1 mg/ml denatured DNA. The melting temperature, Tm, is described by the following formula (Beltz <i>et al.,</i> 1983): <maths id="math0001" num=""><math display="block"><mi>Tm</mi><mo mathvariant="normal">=</mo><mn mathvariant="normal">81.5</mn><mo>⁢</mo><mi mathvariant="normal">C</mi><mo mathvariant="normal">+</mo><mn mathvariant="normal">16.6</mn><mspace width="1em"/><mi>Log</mi><mfenced open="[" close="]" separators=""><mi>Na</mi><mo mathvariant="normal">+</mo></mfenced><mo mathvariant="normal">+</mo><mn mathvariant="normal">0.41</mn><mo>⁢</mo><mfenced separators=""><mo mathvariant="normal">%</mo><mi mathvariant="normal">G</mi><mo mathvariant="normal">+</mo><mi mathvariant="normal">C</mi></mfenced><mo mathvariant="normal">-</mo><mn mathvariant="normal">0.61</mn><mfenced separators=""><mo mathvariant="normal">%</mo><mi>formamide</mi></mfenced><mo mathvariant="normal">-</mo><mn mathvariant="normal">600</mn><mo mathvariant="normal">/</mo><mi>length of duplex</mi></math><img id="ib0001" file="imgb0001.tif" wi="163" he="13" img-content="math" img-format="tif"/></maths></p>
<p id="p0037" num="0037">Washes are typically carried out as follows:
<ol id="ol0004" compact="compact" ol-style="">
<li>(1) Twice at room temperature for 15 minutes in 1x SSPE, 0.1% SDS (low stringency wash).</li>
<li>(2) Once at Tm-20 C for 15 minutes in 0.2x SSPE, 0.1% SDS (moderate stringency wash).</li>
</ol></p>
<p id="p0038" num="0038">The disclosure also concerns viral proteins and peptides encoded by the genes of an influenza virus of the disclosure. The viral protein can be a mature HA protein. The mature HA protein can comprise one or more of the following: a serine at position 82; a leucine at position 221; a threonine at position 327; and/or a threonine at position 482. The mature HA protein can have an amino acid sequence shown in SEQ ID NO: 33 or SEQ ID NO: 34, or a functional and/or immunogenic fragment or variant of SEQ ID NO: 33 or SEQ ID NO: 34. The viral protein can be an NA protein, NS protein, PB protein, PA protein, or MA protein. Viral proteins and peptides can be used to generate<!-- EPO <DP n="23"> --> antibodies that bind specifically to the protein or peptide. Viral proteins and peptides of the present invention can also be used as immunogens and in vaccine compositions.</p>
<p id="p0039" num="0039">The present disclosure also concerns compositions and methods for inducing an immune response against an influenza virus that is capable of infecting a susceptible host animal and causing respiratory disease. The disclosure can be used to induce an immune response against an influenza virus of any subtype in a susceptible host animal. For example, the influenza virus can be an HA subtype of H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, H15, or H16, and an NA subtype of N1, N2, N3, N4, N5, N6, N7, N8, or N9. In one embodiment, the HA subtype is H3 or H5. The NA subtype may be N7 or N8. An immune response may be induced against an influenza virus of subtype H3N8. The host animal may be a canid. Canines include wild, zoo, and domestic canines, such as wolves, coyotes, and foxes. Canines also include dogs, particularly domestic dogs, such as, for example, pure-bred and/or mongrel companion dogs, show dogs, working dogs, herding dogs, hunting dogs, guard dogs, police dogs, racing dogs, and/or laboratory dogs. The host animal may be a domesticated dog, such as a greyhound. An animal may be administered an effective amount of an immunogenic composition sufficient to induce an immune response against an influenza virus of the invention. The immune response can be a humoral and/or cellular immune response. The immune response may be a protective immune response that is capable of preventing or minimizing viral infection in the immunized host animal for some period of time subsequent to the immunization. Thus, the disclosure also concerns vaccine compositions and methods that can provide a vaccinated animal with a protective immune response to a virus.</p>
<p id="p0040" num="0040">As described herein, vaccine or immunogenic compositions may comprise cell-free whole virus, including attenuated or inactivated virus, or portions of the virus, including subvirion particles (including "split vaccine" wherein a virion is treated to remove some or all viral lipids), viral proteins (including individual proteins and macromolecular complexes of multiple proteins), polypeptides, and peptides, as well as virus-infected cell lines, or a combination of any of these. Vaccine or immunogenic compositions comprising virus-infected cell lines may comprise multiple cell lines, each infected with a different viral strain.</p>
<p id="p0041" num="0041">A canine may be immunized with one or more inactivated (i.e., killed) and/or live attenuated influenza virus vaccines or vaccines<!-- EPO <DP n="24"> --> comprising one or a multiplicity of influenza virus antigens from one or more virus isolates. The influenza virus may be a canine influenza virus. The influenza virus may be an equine influenza virus that encodes or expresses a polypeptide that has at least about 90%, or at least about 95%, or at least about 96%, or 97%, or 98%, or 99% or more amino acid sequence identity with a canine influenza virus polypeptide. An influenza antigen used in a vaccine of the present disclosure may have at least about 96% sequence identity with an HA antigen and/or NA antigen of a canine influenza virus.</p>
<p id="p0042" num="0042">An example of an inactivated vaccine is EQUICINE II<sup>™</sup>, which has been marketed by Intervet Inc. (Millsboro, DE, USA) as a liquid vaccine. EQUICINE II<sup>™</sup> contains inactivated A/Pennsylvania/63 influenza virus ("A/Pa/63") and A/equine/Kentucky/93 influenza virus ("A/KY/93") with carbopol (<i>i.e</i>., HAVLOGEN® (Intervet Inc.)). More specifically, a dose of EQUICINE II<sup>™</sup> contains: inactivated A/Pa/63 at 10<sup>6.0</sup> EID<sub>50</sub>, inactivated A/KY/93 at 10<sup>6.7</sup> EID<sub>50</sub>, 0.25% by volume carbopol, and sufficient PBS to create a total volume of 1 ml.</p>
<p id="p0043" num="0043">Another example of an inactivated vaccine is equine flu virus A/equine/Ohio/03 ("Ohio 03"). In some embodiments, such a vaccine contains CARBIGEN<sup>™</sup>, which is an emulsified polymer-based adjuvant commercially available from MVP Laboratories, Inc. (Ralston, NE). In such vaccines, a dosage unit typically comprises at least about 250 HA units of the virus, from about 250 to about 12,500 HA units of the virus, or from about 1000 to about 6200 HA units of the virus. The recommended concentration of CARBIGEN<sup>™</sup> is from about 5 to about 30% (by mass).</p>
<p id="p0044" num="0044">An example of a live attenuated vaccine is modified live equine/Kentucky/91 ("A/KY/91") influenza in the form of a freeze-dried vaccine that may be reconstituted with water. This reconstitution may be conducted using vaccine-grade water sufficient to bring the vaccine dosage to a total volume of 1 ml. Aspects of such vaccines are discussed in, for example, <patcit id="pcit0012" dnum="US6436408B"><text>U.S. Patent Nos. 6,436,408</text></patcit>; <patcit id="pcit0013" dnum="US6398774B"><text>6,398,774</text></patcit>; and <patcit id="pcit0014" dnum="US6177082B"><text>6,177,082</text></patcit>, which are incorporated by reference in their entirety into this patent. When reconstituted, a dose of such a vaccine may, for example, contain A/KY/91 at 10<sup>7.2</sup> TCID<sub>50</sub> per ml, 0.015 grams N-Z AMINE AS<sup>™</sup> per ml, 0.0025 grams gelatin per ml, and 0.04 grams D lactose per ml. N-Z AMINE AS<sup>™</sup> is a refined source of amino acids and peptides produced by enzymatic hydrolysis of casein. N-Z AMINE AS<sup>™</sup> is marketed by Kerry Bio-Science (Norwich, NY, USA).<!-- EPO <DP n="25"> --></p>
<p id="p0045" num="0045">Vaccines may comprise an H3 influenza antigen having at least about 93% homology with Florida/43/2004 in HA coding sequences, such as, for example, the equine/New Market/79 strain. Preferred homology is at least about 96%, such as, for example, the equine/Alaska/1/91 and equine/Santiago/85 strains. In the examples that follow, the equine/Kentucky/ 91, equine-2/Kentucky/93, equine-1/Pennsylvania/63, and equine Ohio/03 influenza antigens were incorporated into vaccines. Preferred vaccines also include vaccines comprising equine/Wisconsin/03, equine/Kentucky/02, equine/Kentucky/93, and equine/New Market 2/93. In the examples that follow, H3N8 viruses were used. It is believed, however, that other H3 influenza viruses can be used.</p>
<p id="p0046" num="0046">Live attenuated vaccines can be prepared by conventional means. Such means generally include, for example, modifying pathogenic strains by <i>in vitro</i> passaging, cold adaptation, modifying the pathogenicity of the organism by genetic manipulation, preparation of chimeras, insertion of antigens into viral vectors, selecting non-virulent wild type strains, <i>etc.</i></p>
<p id="p0047" num="0047">The live attenuated virus strain may be derived by serial passage of the wild-type virus through cell culture, laboratory animals, non-host animals, or eggs. The accumulation of genetic mutation during such passage(s) typically leads to progressive loss of virulence of the organism to the original host.</p>
<p id="p0048" num="0048">The live attenuated virus strain may be prepared by co-infection of permissible cells with an attenuated mutant virus and pathogenic virus. The desired resultant recombinant virus has the safety of the attenuated virus with genes coding for protective antigens from the pathogenic virus.</p>
<p id="p0049" num="0049">The live attenuated virus strain may be prepared by cold adaptation. A cold-adapted virus has an advantage of replicating only at the temperature found in upper respiratory tract. A method of generation of a cold-adapted equine influenza virus has been described in <patcit id="pcit0015" dnum="US6177082B"><text>U.S. Patent No. 6,177,082</text></patcit>. A desired resulting cold-adapted virus confers one or more of the following phenotypes: cold adaptation, temperature sensitivity, dominant interference, and/or attenuation.</p>
<p id="p0050" num="0050">The live attenuated virus strain may be prepared by molecular means, such as point mutation, deletion, or insertion to convert a pathogenic virus to a non-pathogenic or less-pathogenic virus compared to the original virus, while preserving the protective properties of the original virus.<!-- EPO <DP n="26"> --></p>
<p id="p0051" num="0051">The live attenuated virus may be prepared by cloning the candidate of genes of protective antigens into a genome of a non-pathogenic or less-pathogenic virus or other organism.</p>
<p id="p0052" num="0052">Inactivated (<i>i.e</i>., "killed") virus vaccines may be prepared by inactivating the virus using conventional methods. Typically, such vaccines include excipients that may enhance an immune response, as well as other excipients that are conventionally used in vaccines. For example, in the examples that follow, EQUICINE II™ comprises HAVLOGEN®. Inactivation of the virus can be accomplished by treating the virus with inactivation chemicals (<i>e.g</i>., formalin, beta propiolactone ("BPL"), bromoethylamine ("BEA"), and binary ethylenimine ("BEI")) or by non-chemical methods (<i>e.g</i>., heat, freeze/thaw, or sonication) to disable the replication capacity of the virus.</p>
<p id="p0053" num="0053">In the examples that follow, equine/Ohio/03 was used as a challenge virus. It is known to have about 99% homology with Florida/43/04 isolates, and has been shown to induce symptoms of infection and seroconversion in dogs. Example 18 illustrates the efficacy of equine influenza vaccine in dogs, showing hemagglutination inhibition (or "HI" or "HAI") titers in dogs vaccinated with inactivated Ohio 03 antigen in a vaccine composition comprising CARBIGEN<sup>™</sup> adjuvant. Table 29 shows titers pre-vaccination, post-vaccination, and post-second vaccination, as well as post-challenge. The results indicate HI titers at each stage post-vaccination for the vaccinated dogs, with little or no increase for controls. Table 30 illustrates the clinical signs, virus isolation, and histopathology results from the same study. Although challenged animals did not show clinical signs, virus shedding, or positive histopathology, the positive HI titers (Table 29) indicate significant antibody titers in immunized animals.</p>
<p id="p0054" num="0054">It should be noted that other H3 influenza virus antigen vaccines are encompassed by the present disclosure as well.</p>
<p id="p0055" num="0055">It should further be noted that influenza antigens other than H3 influenza virus antigens may be used in accordance with the present disclosure. Such antigens include, for example, those from equine/PA/63, which is an equine A1 subtype (H7N7). It is contemplated that one or more of such antigens may be used with or without one or more H3 influenza antigens.</p>
<p id="p0056" num="0056">In general, vaccine is administered in a therapeutically effective amount. A "therapeutically effective amount" is an amount sufficient to induce a protective response in<!-- EPO <DP n="27"> --> the canine patient against the target virus. Typically, a dosage is "therapeutically effective" if it prevents, reduces the risk of, delays the onset of, reduces the spread of, ameliorates, suppresses, or eradicates the influenza or one or more (typically two or more) of its symptoms. Typical influenza symptoms include, for example, fever (for dogs, typically ≥103.0°F; ≥39.4°C), cough, sneezing, histopathological lesions, ocular discharge, nasal discharge, vomiting, diarrhea, depression, weight loss, gagging, hemoptysis, and/or audible rales. Other often more severe symptoms may include, for example, hemorrhage in the lungs, mediastanum, or pleural cavity; tracheitis; bronchitis; bronchiolitis; supportive bronchopneumonia; and/or infiltration of the epithelial lining and airway lumens of the lungs with neutrophils and/or macrophages.</p>
<p id="p0057" num="0057">The vaccine may be administered as part of a combination therapy, <i>i.e</i>., a therapy that includes, in addition to the vaccine itself, administering one or more additional active agents, adjuvants, therapies, etc. In that instance, it should be recognized the amount of vaccine that constitutes a "therapeutically effective" amount may be less than the amount of vaccine that would constitute a "therapeutically effective" amount if the vaccine were to be administered alone. Other therapies may include those known in the art, such as, for example, anti-viral medications, analgesics, fever-reducing medications, expectorants, anti-inflammation medications, antihistamines, antibiotics to treat bacterial infection that results from the influenza virus infection, rest, and/or administration of fluids. Vaccines may be administered in combination with a bordetella vaccine, adenovirus vaccine, and/or parainfluenza virus vaccine.</p>
<p id="p0058" num="0058">A typical dose for a live attenuated vaccine may be least about 10<sup>3</sup> pfu/canine; and more typically from about 10<sup>3</sup> to about 10<sup>9</sup> pfu/canine. In this disclosure "pfu" means "plaque forming units". A typical dose for a live attenuated vaccine may be at least about 10<sup>3</sup> TCID<sub>50</sub>/canine, and more typically from about 10<sup>3</sup> to about 10<sup>9</sup> TCID<sub>50</sub>/canine. A typical dose for a live attenuated vaccine may be at least about 10<sup>3</sup> EID<sub>50</sub>/canine, and more typically from about 10<sup>3</sup> to about 10<sup>9</sup> EID<sub>50</sub>/canine. A typical dose for a killed vaccine may be at least about 40 HA units, typically from about 40 to about 10,000 HA units, and more typically from about 500 to about 6200 HA units. The dose may be from about 6100 to about 6200 HA units.</p>
<p id="p0059" num="0059">The vaccine may comprise a live attenuated vaccine at a concentration which is at least about 10<sup>0.5</sup> pfu/canine greater than the immunogenicity level.<!-- EPO <DP n="28"> --> The vaccine may comprise a live attenuated vaccine at a concentration which is at least about 10<sup>0.5</sup> TCID<sub>50</sub>/canine greater than the immunogenicity level. The vaccine may comprise a live attenuated vaccine at a concentration which is at least about 10<sup>0.5</sup> EID<sub>50</sub>/canine greater than the immunogenicity level.</p>
<p id="p0060" num="0060">The immunogenicity level may be determined experimentally by challenge dose titration study techniques generally known in the art. Such techniques typically include vaccinating a number of canines with the vaccine at different dosages, and then challenging the canines with the virulent virus to determine the minimum protective dose.</p>
<p id="p0061" num="0061">Factors affecting the preferred dosage regimen may include, for example, the type (e.g., species and breed), age, weight, sex, diet, activity, lung size, and condition of the subject; the route of administration; the efficacy, safety, and duration-of immunity profiles of the particular vaccine used; whether a delivery system is used; and whether the vaccine is administered as part of a drug and/or vaccine combination. Thus, the dosage actually employed can vary for specific animals, and, therefore, can deviate from the typical dosages set forth above. Determining such dosage adjustments is generally within the skill of those in the art using conventional means. It should further be noted that live attenuated viruses are generally self-propagating; thus, the specific amount of such a virus administered is not necessarily critical.</p>
<p id="p0062" num="0062">It is contemplated that the vaccine may be administered to the canine patient a single time; or, alternatively, two or more times over days, weeks, months, or years. The vaccine may be administered at least two times. The vaccine may be administered twice, with the second dose (e.g., the booster) being administered at least about 2 weeks after the first. The vaccine may be administered twice, with the second dose being administered no greater than 8 weeks after the first. The second dose may be administered at from about 2 weeks to about 4 years after the first dose, from about 2 to about 8 weeks after the first dose, or from about 3 to about 4 weeks after the first dose. The second dose may be administered about 4 weeks after the first dose. The first and subsequent dosages may vary, such as, for example, in amount and/or form. Often, however, the dosages are the same as to amount and form. When only a single dose is administered, the amount of vaccine in that dose alone generally comprises a therapeutically effective<!-- EPO <DP n="29"> --> amount of the vaccine. When, however, more than one dose is administered, the amounts of vaccine in those doses together may constitute a therapeutically effective amount.</p>
<p id="p0063" num="0063">The vaccine may be administered before the canine recipient is infected with influenza. The vaccine may, for example, be administered to prevent, reduce the risk of, or delay the onset of influenza or one or more (typically two or more) influenza symptoms.</p>
<p id="p0064" num="0064">The vaccine may be administered after the canine recipient is infected with influenza. The vaccine may, for example, ameliorate, suppress, or eradicate the influenza or one or more (typically two or more) influenza symptoms.</p>
<p id="p0065" num="0065">The preferred composition of the vaccine depends on, for example, whether the vaccine is an inactivated vaccine, live attenuated vaccine, or both. It also depends on the method of administration of the vaccine. It is contemplated that the vaccine will comprise one or more conventional pharmaceutically acceptable carriers, adjuvants, other immune-response enhancers, and/or vehicles (collectively referred to as "excipients"). Such excipients are generally selected to be compatible with the active ingredient(s) in the vaccine. Use of excipients is generally known to those skilled in the art.</p>
<p id="p0066" num="0066">The term "pharmaceutically acceptable" is used adjectivally to mean that the modified noun is appropriate for use in a pharmaceutical product. When it is used, for example, to describe an excipient in a pharmaceutical vaccine, it characterizes the excipient as being compatible with the other ingredients of the composition and not disadvantageously deleterious to the intended recipient canine.</p>
<p id="p0067" num="0067">Vaccines may be administered by conventional means, including, for example, mucosal administration, (such as intranasal, oral, intratracheal, and ocular), and parenteral administration. Mucosal administration is often particularly advantageous for live attenuated vaccines. Parenteral administration is often particularly advantageous for inactivated vaccines.</p>
<p id="p0068" num="0068">Mucosal vaccines may be, for example, liquid dosage forms, such as pharmaceutically acceptable emulsions, solutions, suspensions, syrups, and elixirs. Excipients suitable for such vaccines include, for example, inert diluents commonly used in the art, such as, water, saline, dextrose, glycerol, lactose, sucrose, starch powder, cellulose esters of alkanoic acids, cellulose alkyl esters, talc, stearic acid, magnesium stearate, magnesium oxide, sodium and calcium salts of phosphoric and sulfuric acids, gelatin, acacia gum, sodium alginate,<!-- EPO <DP n="30"> --> polyvinylpyrrolidone, and/or polyvinyl alcohol. Excipients also can comprise various wetting, emulsifying, suspending, flavoring (e.g., sweetening), and/or perfuming agents.</p>
<p id="p0069" num="0069">Oral mucosal vaccines also may, for example, be tableted or encapsulated for convenient administration. Such capsules or tablets can contain a controlled-release formulation. In the case of capsules, tablets, and pills, the dosage forms also can comprise buffering agents, such as sodium citrate, or magnesium or calcium carbonate or bicarbonate. Tablets and pills additionally can be prepared with enteric coatings.</p>
<p id="p0070" num="0070">It is contemplated that vaccines may be administered via the canine patient's drinking water and/or food. It is further contemplated that vaccines may be administered in the form of a treat or toy.</p>
<p id="p0071" num="0071">"Parenteral administration" includes subcutaneous injections, submucosal injections, intravenous injections, intramuscular injections, intrasternal injections, transcutaneous injections, and infusion. Injectable preparations (<i>e.g</i>., sterile injectable aqueous or oleaginous suspensions) can be formulated according to the known art using suitable excipients, such as vehicles, solvents, dispersing, wetting agents, emulsifying agents, and/or suspending agents. These typically include, for example, water, saline, dextrose, glycerol, ethanol, corn oil, cottonseed oil, peanut oil, sesame oil, benzyl alcohol, benzyl alcohol, 1,3-butanediol, Ringer's solution, isotonic sodium chloride solution, bland fixed oils (<i>e.g</i>., synthetic mono- or diglycerides), fatty acids (<i>e.g</i>., oleic acid), dimethyl acetamide, surfactants (<i>e.g</i>., ionic and non-ionic detergents), propylene glycol, and/or polyethylene glycols. Excipients also may include small amounts of other auxiliary substances, such as pH buffering agents.</p>
<p id="p0072" num="0072">Vaccines may include one or more excipients that enhance a canine patient's immune response (which may include an antibody response, cellular response, or both), thereby increasing the effectiveness of the vaccine. Use of such excipients (or "adjuvants") may be particularly beneficial when using an inactivated vaccine. The adjuvant(s) may be a substance that has a direct (<i>e.g</i>., cytokine or Bacillé Calmette-Guerin ("BCG")) or indirect effect (liposomes) on cells of the canine patient's immune system. Examples of often suitable adjuvants include oils (<i>e.g</i>., mineral oils), metallic salts (<i>e.g</i>., aluminum hydroxide or aluminum phosphate), bacterial components (<i>e.g</i>., bacterial liposaccharides, Freund's adjuvants, and/or MDP), plant components (<i>e.g</i>., Quil A), and/or one or more substances that have a carrier effect (<i>e.g</i>., bentonite, latex particles, liposomes, and/or Quil A, ISCOM). As noted above, adjuvants also include, for example, CARBIGEN<sup>™</sup> and carbopol. It should be<!-- EPO <DP n="31"> --> recognized that this disclosure encompasses both vaccines that comprise an adjuvant(s), as well as vaccines that do not comprise any adjuvant.</p>
<p id="p0073" num="0073">It is contemplated that the vaccine may be freeze-dried (or otherwise reduced in liquid volume) for storage, and then reconstituted in a liquid before or at the time of administration. Such reconstitution may be achieved using, for example, vaccine-grade water.</p>
<p id="p0074" num="0074">The present disclosure further comprises kits that are suitable for use in performing the methods described above. The kit comprises a dosage form comprising a vaccine described above. The kit also comprises at least one additional component, and, typically, instructions for using the vaccine with the additional component(s). The additional component(s) may, for example, be one or more additional ingredients (such as, for example, one or more of the excipients discussed above, food, and/or a treat) that can be mixed with the vaccine before or during administration. The additional component(s) may alternatively (or additionally) comprise one or more apparatuses for administering the vaccine to the canine patient. Such an apparatus may be, for example, a syringe, inhaler, nebulizer, pipette, forceps any medically acceptable delivery vehicle. The apparatus may be suitable for subcutaneous administration of the vaccine. The apparatus may be suitable for intranasal administration of the vaccine.</p>
<p id="p0075" num="0075">Other excipients and modes of administration known in the pharmaceutical or biologics arts also may be used.</p>
<p id="p0076" num="0076">The vaccine or immunogenic compositions of the subject disclosure also encompass recombinant viral vector-based constructs that may comprise, for example, genes encoding HA protein, NA protein, nucleoprotein, polymerase basic protein, polymerase acidic protein, and/or matrix protein of an influenza virus of the present disclosure. Any suitable viral vector that can be used to prepare a recombinant vector/virus construct is contemplated for use with the subject disclosure. For example, viral vectors derived from adenovirus, avipox, herpesvirus, vaccinia, canarypox, entomopox, swinepox, West Nile virus and others known in the art can be used with the compositions and methods of the present disclosure. Recombinant polynucleotide vectors that encode and express components can be constructed using standard genetic engineering techniques known in the art. In addition, the various vaccine compositions described herein can be used separately and in combination with each other. For example, primary immunizations of an animal may use recombinant vector-based constructs, having single or multiple strain components, followed by secondary boosts with vaccine compositions comprising inactivated virus or inactivated virus-infected cell lines.<!-- EPO <DP n="32"> --> Other immunization protocols with the vaccine compositions of the disclosure are apparent to persons skilled in the art and are contemplated within the scope of the present disclosure.</p>
<p id="p0077" num="0077">The subject disclosure also concerns reassortant virus comprising at least one gene or genomic segment of an influenza virus of the present invention and the remainder of viral genes or genomic segments from a different influenza virus of the disclosure or from an influenza virus other than a virus of the present disclosure. Reassortant virus can be produced by genetic reassortant of nucleic acid of a donor influenza virus of the present disclosure with nucleic acid of a recipient influenza virus and then selecting for reassortant virus that comprises the nucleic acid of the donor virus. Methods to produce and isolate reassortant virus are well known in the art (Fields <i>et al.,</i> 1996). A reassortant virus can comprise genes or genomic segments of a human, avian, swine, or equine influenza virus. A reassortant virus can include any combination of nucleic acid from donor and recipient influenza virus so long as the reassortant virus comprises at least one gene or genomic segment from a donor influenza virus of the present invention. A recipient influenza virus can be an equine influenza virus.</p>
<p id="p0078" num="0078">Natural, recombinant or synthetic polypeptides of viral proteins, and peptide fragments thereof, can also be used as vaccine compositions according to the subject methods. A vaccine composition may comprise a polynucleotide or a polypeptide of a canine influenza virus. A vaccine composition may comprise a polynucleotide encoding a polypeptide having the amino acid sequence shown in any of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 33, 34, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, or 78, or a functional and/or immunogenic fragment or variant thereof. The polynucleotide encoding the amino acid sequence shown in SEQ ID NOs: 2,4, 6, 8,10,12,14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 33, 34, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, or 78, may comprise the nucleotide sequence shown in SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, or 77, respectively, or a sequence encoding a functional and/or immunogenic fragment or variant of any of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 33, 34, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, or 78. A polynucleotide can comprise: Nucleotides 1-2271 of SEQ ID NO: 3; Nucleotides 1-2148 of SEQ ID NO: 5; Nucleotides 1-657 of SEQ ID NO: 7; Nucleotides 1-1494 of SEQ ID NO: 9; Nucleotides 1-1410 of SEQ ID NO: 11; Nucleotides 1-756 of SEQ ID NO: 13; Nucleotides<!-- EPO <DP n="33"> --> 1-1695 of SEQ ID NO: 15; Nucleotides 1-2271 of SEQ ID NO: 19; Nucleotides 1-2148 of SEQ ID NO: 21; Nucleotides 1-657 of SEQ ID NO: 23; Nucleotides 1-1494 of SEQ ID NO: 25; Nucleotides 1-756 of SEQ ID NO: 29; Nucleotides 1-1695 of SEQ ID NO: 31; Nucleotides 1-2277 of SEQ ID NO: 47; Nucleotides 1-2271 of SEQ ID NO: 49; Nucleotides 1-2148 of SEQ ID NO: 51; Nucleotides 1-690 of SEQ ID NO: 53; Nucleotides 1-1494 of SEQ ID NO: 55; Nucleotides 1-1410 of SEQ ID NO: 57; Nucleotides 1-756 of SEQ ID NO: 59; Nucleotides 1-1695 of SEQ ID NO: 61; Nucleotides 1-2277 of SEQ ID NO: 63; Nucleotides 1-2271 of SEQ ID NO: 65; Nucleotides 1-2148 of SEQ ID NO: 67; Nucleotides 1-690 of SEQ ID NO: 69; Nucleotides 1-1494 of SEQ ID NO: 71; Nucleotides 1-1410 of SEQ ID NO: 73; Nucleotides 1-756 of SEQ ID NO: 75; and Nucleotides 1-1695 of SEQ ID NO: 77. A vaccine composition may comprise a polypeptide having the amino acid sequence shown in any of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 33, 34, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, or 78, or a functional and/or immunogenic fragment or variant thereof. A vaccine composition may comprise a polynucleotide or a polypeptide of an equine influenza virus wherein the polynucleotide or polypeptide has at least about 90%, or at least about 95%, or at least about 96%, or 97%, or 98%, or 99% or more sequence identity with a canine influenza polynucleotide or polypeptide. Viral polypeptides may be derived from multiple strains can be combined in a vaccine composition and are used to vaccinate a host animal. For example, polypeptides based on the viral HA protein from at least two different strains of influenza virus can be combined in the vaccine. The polypeptides may be homologous to one strain or may comprise "hybrid" or "chimeric" polypeptides whose amino acid sequence is derived from joining or linking polypeptides from at least two distinct strains. Procedures for preparing viral polypeptides are well known in the art. For example, viral polypeptides and peptides can be synthesized using solid-phase synthesis methods (Merrifield, 1963). Viral polypeptides and peptides can also be produced using recombinant DNA techniques wherein a polynucleotide molecule encoding an viral protein or peptide is expressed in a host cell, such as bacteria, yeast, or mammalian cell lines, and the expressed protein purified using standard techniques of the art.</p>
<p id="p0079" num="0079">Vaccine compositions of the present disclosure also include naked nucleic acid compositions. A nucleic acid may comprise a nucleotide sequence encoding an HA and/or an NA protein of an influenza virus. Methods for nucleic acid vaccination are known in the art and are described, for example, in<!-- EPO <DP n="34"> --> <patcit id="pcit0016" dnum="US6063385A"><text>U.S. Patent Nos. 6,063,385</text></patcit> and <patcit id="pcit0017" dnum="US6472375A"><text>6,472,375</text></patcit>. The nucleic acid can be in the form of a plasmid or a gene expression cassette. In one embodiment, the nucleic acid is provided encapsulated in a liposome which is administered to an animal.</p>
<p id="p0080" num="0080">Vaccine compositions and immunogens, such as polypeptides and nucleic acids, that can be used in accordance with the present disclosure can be provided with a pharmaceutically-acceptable carrier or diluent. Compounds and compositions useful in the subject disclosure can be formulated according to known methods for preparing pharmaceutically useful compositions. Formulations are described in detail in a number of sources which are well known and readily available to those skilled in the art. For example, <nplcit id="ncit0001" npl-type="b"><text>Remington's Pharmaceutical Science by E.W. Martin, Easton Pennsylvania, Mack Publishing Company, 19th ed., 1995</text></nplcit>, describes formulations which can be used in connection with the subject invention. In general, the compositions of the subject disclosure will be formulated such that an effective amount of an immunogen is combined with a suitable carrier in order to facilitate effective administration of the composition. The compositions used in the present methods can also be in a variety of forms. These include, for example, solid, semi-solid, and liquid dosage forms, such as tablets, pills, powders, liquid solutions or suspension, suppositories, injectable and infusible solutions, and sprays. The preferred form depends on the intended mode of administration' and therapeutic application. The compositions also preferably include conventional pharmaceutically acceptable carriers and diluents which are known to those skilled in the art. Examples of carriers or diluents for use with the subject peptidomimetics include, but are not limited to, water, saline, oils including mineral oil, ethanol, dimethyl sulfoxide, gelatin, cyclodextrans, magnesium stearate, dextrose, cellulose, sugars, calcium carbonate, glycerol, alumina, starch, and equivalent carriers and diluents, or mixtures of any of these. Formulations of an immunogen of the disclosure can also comprise suspension agents, protectants, lubricants, buffers, preservatives, and stabilizers. To provide for the administration of such dosages for the desired therapeutic treatment, pharmaceutical compositions of the disclosure will advantageously comprise between about 0.1% and 45%, and especially, 1 and 15% by weight of the immunogen or immunogens based on the weight of the total composition including carrier or diluent.</p>
<p id="p0081" num="0081">The vaccine and immunogenic compositions of the subject disclosure can be prepared by procedures well known in the art. For example, the vaccine or immunogens are typically prepared as injectables, <i>e.g</i>., liquid solutions or suspensions. The vaccine or immunogens are administered in a manner that is compatible with dosage formulation, and in such amount as<!-- EPO <DP n="35"> --> will be therapeutically effective and immunogenic in the recipient. The optimal dosages and administration patterns for a particular vaccine or immunogens formulation can be readily determined by a person skilled in the art.</p>
<p id="p0082" num="0082">Peptides and/or polypeptides can also be provided in the form of a multiple antigenic peptide (MAP) construct. The preparation of MAP constructs has been described in Tam (1988). MAP constructs utilize a core matrix of lysine residues onto which multiple copies of an immunogen are synthesized (Posnett <i>et al.,</i> 1988). Multiple MAP constructs, each containing the same or different immunogens, can be prepared and administered in a vaccine composition A MAP construct may be provided with and/or administered with one or more adjuvants. Influenza polypeptides of the invention can also be produced and administered as macromolecular protein structures comprising one or more polypeptides. Published U.S. Patent Application <patcit id="pcit0018" dnum="US20050009008A"><text>US2005/0009008</text></patcit> describes methods for producing virus-like particles as a vaccine for influenza virus.</p>
<p id="p0083" num="0083">According to the methods of the subject disclosure, the vaccine and immunogenic compositions described herein are administered to susceptible hosts, typically canids, and more typically domesticated dogs, in an effective amount and manner to induce protective immunity against subsequent challenge or infection of the host by virus. The host animal may be a canid. Canines include wild, zoo, and domestic canines, such as wolves, coyotes, and foxes. Canines also include dogs, particularly domestic dogs, such as, for example, pure-bred and/or mongrel companion dogs, show dogs, working dogs, herding dogs, hunting dogs, guard dogs, police dogs, racing dogs, and/or laboratory dogs. The host animal may be a domesticated dog, such as a greyhound. The vaccines or immunogens are typically administered parenterally, by injection, for example, either subcutaneously, intraperitoneally, or intramuscularly. Other suitable modes of administration include oral or nasal administration. Usually, the vaccines or immunogens are administered to an animal at least two times, with an interval of one or more weeks between each administration. However, other regimens for the initial and booster administrations of the vaccine or immunogens are contemplated, and may depend on the judgment of the practitioner and the particular host animal being treated.</p>
<p id="p0084" num="0084">Virus and virus-infected cells in a vaccine formulation may be inactivated or attenuated using methods known in the art. For example, whole virus and infected cells can be inactivated or attenuated by exposure to paraformaldehyde, formalin, beta propiolactone<!-- EPO <DP n="36"> --> (BPL), bromoethylamine (BEA), binary ethylenimine (BEI), phenol, UV light, elevated temperature, freeze thawing, sonication (including ultrasonication), and the like. The amount of cell-free whole virus in a vaccine dose can be in the range from about 0.1 mg to about 5 mg, and more usually being from about 0.2 mg to about 2 mg. The dosage for vaccine formulations comprising virus-infected cell lines will usually contain from about 10<sup>6</sup> to about 10<sup>8</sup> cells per dose, and more usually from about 5 x 10<sup>6</sup> to about 7.5 x 10<sup>7</sup> cells per dose. The amount of protein or peptide immunogen in a dose for an animal can vary from about 0.1 µg to 10000 µg, or about 1 µg to 5000 µg, or about 10 µg to 1000 µg, or about 25 µg to 750 µg, or about 50 µg to 500 µg, or 100 µg to 250 µg, depending upon the size, age, <i>etc.,</i> of the animal receiving the dose.</p>
<p id="p0085" num="0085">An immunogenic or vaccine composition of the disclosure, such as virus or virus-infected cells or viral proteins or peptides, can be combined with an adjuvant, typically just prior to administration. Adjuvants contemplated for use in the vaccine formulations include threonyl muramyl dipeptide (MDP) (Byars <i>et al.,</i> 1987), saponin, <i>Cornebacterium parvum,</i> Freund's complete and Fruend's incomplete adjuvants, aluminum, or a mixture of any of these. A variety of other adjuvants suitable for use with the methods and vaccines of the present disclosure such as alum, are well known in the art and are contemplated for use with the disclosure.</p>
<p id="p0086" num="0086">The disclosure also concerns antibodies that bind specifically to a protein or a peptide of the present invention. Antibodies of the disclosure include monoclonal and polyclonal antibody compositions. Preferably, the antibodies of the disclosure are monoclonal antibodies. Whole antibodies and antigen binding fragments thereof are contemplated in the disclosure. Thus, for example, suitable antigen binding fragments include Fab<sub>2</sub>, Fab and Fv antibody fragments. Antibodies of the disclosure can be labeled with a detectable moiety, such as a fluorescent molecule (<i>e.g</i>., fluorescein or an enzyme).</p>
<p id="p0087" num="0087">The subject disclosure also concerns methods and compositions for detection and identification of an influenza virus of the invention and for diagnosis of infection of an animal with an influenza virus of the present invention. The methods of the disclosure include detection of the presence of canine influenza, in a biological sample from an animal. The detection of canine influenza in a sample, is useful to diagnose canine influenza in an animal. In turn, this information can provide the ability to determine the prognosis of an animal based on distinguishing levels of canine influenza present over time, and can assist in selection of therapeutic agents and treatments for the animal, and assist in monitoring therapy. The<!-- EPO <DP n="37"> --> method also provides the ability to establish the absence of canine influenza in an animal tested.</p>
<p id="p0088" num="0088">The ability to detect canine influenza in an animal permits assessment of outbreaks of canine influenza in different geographical locations. This information also permits early detection so that infected animals can be isolated, to limit the spread of disease, and allows early intervention for treatment options. In addition, having this information available can provide direction to medical personnel for preparing to treat large numbers of ill animals, including assembling medical supplies, and, if available, vaccines.</p>
<p id="p0089" num="0089">In one embodiment, a method of the present disclosure involves the collection of a biological sample from a test animal, such as a canine. The biological sample may be any biological material, including, cells, tissue, hair, whole blood, serum, plasma, nipple aspirate, lung lavage, cerebrospinal fluid, saliva, sweat and tears.</p>
<p id="p0090" num="0090">The animal test sample may come from an animal suspected of having canine influenza virus, whether or not the animal exhibits symptoms of the disease. Control samples can also be provided or collected from animals known to be free of canine influenza. Additional controls may be provided, e.g., to reduce false positive and false negative results, and verify that the reagents in the assay are actively detecting canine influenza A virus.</p>
<p id="p0091" num="0091">In addition to detecting the presence or absence of canine influenza in a biological sample, the methods of detection used in the disclosure can detect mutations in canine influenza virus, such as changes in nucleic acid sequence, that may result from the environment, drug treatment, genetic manipulations or mutations, injury, change in diet, aging, or any other characteristic(s) of an animal. Mutations may also cause canine influenza A to become resistant to a drug that was formerly effective, or to enable the virus to infect and propagate in a different species of animal, or human. For example, avian influenza A virus has been shown to infect other animals and humans.</p>
<p id="p0092" num="0092">For detecting an influenza virus in an animal, diagnosis is facilitated by the collection of high-quality specimens, their rapid transport to a testing facility, and appropriate storage, before laboratory testing. Virus is best detected in specimens containing infected cells and secretions. Specimens for the direct detection of viral antigens and/or for nucleic acids and/or virus isolation in cell cultures may be taken during the first 3 days after onset of clinical symptoms. A number of types of specimens are suitable to diagnose virus infections of the upper respiratory tract, including, but not limited to, nasal swab, nasopharyngeal swab, nasopharyngeal aspirate, nasal wash and<!-- EPO <DP n="38"> --> throat swabs. In addition to swabs, samples of tissue or serum may be taken, and invasive procedures can also be performed.</p>
<p id="p0093" num="0093">Respiratory specimens may be collected and transported in 1-5 ml of virus transport media. A number of media that are satisfactory for the recovery of a wide variety of viruses are commercially available. Clinical specimens are added to transport medium. Nasal or nasopharyngeal swabs can also be transported in the virus transport medium. One example of a transport medium is 10 gm of veal infusion broth and 2 gm of bovine albumin fraction V, added to sterile distilled water to 400 m. Antibiotics such as 0.8 ml gentamicin sulfate solution (50 mg/ml) and 3.2 ml amphotericin B (250 µg/ml) can also be added. The medium is preferably sterilized by filtration. Nasal washes, such as sterile saline (0.85% NaCl), can also be used to collect specimens of respiratory viruses.</p>
<p id="p0094" num="0094">Sera may be collected in an amount of from 1-5 ml of whole blood from an acute-phase animal, soon after the onset of clinical symptoms, and preferably not later than 7 days. A convalescent-phase serum specimen can also be collected, for example at about 14 days after onset of symptoms. Serum specimens can be useful for detecting antibodies against respiratory viruses in a neutralization test.</p>
<p id="p0095" num="0095">In some instances, samples may be collected from individual animals over a period of time (e.g., once a day, once a week, once a month, biannually or annually). Obtaining numerous samples from an individual animal, over a period of time, can be used to verify results from earlier detections, and/or to identify response or resistance to a specific treatment, e.g., a selected therapeutic drug.</p>
<p id="p0096" num="0096">The methods of the present disclosure can be used to detect the presence of one or more pathological agents in a test sample from an animal, and the level of each pathological agent. Any method for detecting the pathological agent can be used, including, but not limited to, antibody assays including enzyme-linked immunosorbent assays (ELISAs), indirect fluorescent antibody (IFA) tests, hemagglutinating, and inhibition of hemagglutination (HI) assays, and Western Blot. Known cell-culture methods can also be used. Positive cultures can be further identified using immunofluorescence of cell cultures or HI assay of the cell culture medium (supernatant).</p>
<p id="p0097" num="0097">In addition, methods for detecting nucleic acid (DNA or RNA) or protein can be used. Such methods include, but are not limited to, polymerase chain reaction (PCR), and reverse transcriptase (RT) PCR tests and real time tests, and quantitative nuclease protection assays.<!-- EPO <DP n="39"> --> There are commercially available test kits available to perform these assays. For example, QIAGEN (Valencia, CA) sells a one step RT-PCR kit, and viral RNA extraction kit.</p>
<p id="p0098" num="0098">The method may utilize an antibody specific for a virus or viral protein of the disclosure. An antibody specific for an HA protein of a virus of the disclosure may be utilized. An antibody specific for an NP protein of a virus of the disclosure may be used. A suitable sample, such as from the nasal or nasopharyngeal region, is obtained from an animal and virus or viral protein is isolated therefrom. The viral components are then screened for binding of an antibody specific to a protein, such as HA or NP, of a virus of the invention. A serum sample (or other antibody containing sample) may be obtained from an animal and the serum screened for the presence of antibody that binds to a protein of a virus of the disclosure. For example, an ELISA assay can be performed where the plate walls have HA and/or NP protein, or a peptide fragment thereof, bound to the wall. The plate wall is then contacted with serum or antibody from a test animal. The presence of antibody in the animal that binds specifically to the HA and/or NP protein is indicative that the test animal is infected or has been infected with an influenza virus of the present invention.</p>
<p id="p0099" num="0099">The presence of a pathological agent may be detected by determining the presence or absence of antibodies against the agent, in a biological sample. It can take some time (e.g. months) after an animal is infected before antibodies can be detected in a blood test. Once formed, antibodies usually persist for many years, even after successful treatment of the disease. Finding antibodies to canine influenza A may not indicate whether the infection was recent, or sometime in the past.</p>
<p id="p0100" num="0100">Antibody testing can also be done on fluid(s). Antibody assays include enzyme-linked immunosorbent assays (ELISAs), indirect fluorescent antibody (IFA) assays, and Western Blot. Preferably, antibody testing is done using multiple assays, for example ELISA or IFA followed by Western blot. Antibody assays can be done in a two-step process, using either an ELISA or IFA assay, followed by a Western blot assay. ELISA is considered a more reliable and accurate assay than IFA, but IFA may be used if ELISA is not available. The Western blot test (which is a more specific test) can also be done in all animals, particularly those that have tested positive or borderline positive (equivocal) in an ELISA or IFA assay.</p>
<p id="p0101" num="0101">Other antibody-based tests that can be used for detection of influenza virus include hemagglutination inhibition assays. Hemagglutination activity can be detected in a biological<!-- EPO <DP n="40"> --> sample from an animal, using chicken or turkey red blood cells as described (Burleson <i>et al.,</i> 1992) and Kendal <i>et al.,</i> 1982). An influenza or an HA protein or peptide of the disclosure may be contacted with a test sample containing serum or antibody. Red blood cells (RBC) from an animal, such as a bird, are then added. If antibody to HA is present, then the RBC will not agglutinate. If antibody to HA is not present, the RBC will agglutinate in the presence of HA. Variations and modifications to standard hemagglutination inhibition assays are known in the art and contemplated within the scope of the present disclosure.</p>
<p id="p0102" num="0102">Infection of an animal can also be determined by isolation of the virus from a sample, such as a nasal or nasopharyngeal swab. Viral isolation can be performed using standard methods, including cell culture and egg inoculation.</p>
<p id="p0103" num="0103">A nucleic acid-based assay can be used for detection of a virus of the present disclosure. A nucleic acid sample can be obtained from an animal and the nucleic acid subjected to PCR using primers that will generate an amplification product if the nucleic acid contains a sequence specific to an influenza virus of the present disclosure. RT-PCR may be used in an assay for the subject virus. Real-time RT-PCR may be used to assay for an influenza virus of the disclosure PCR, RT-PCR and real-time PCR methods are known in the art and have been described in <patcit id="pcit0019" dnum="US4683202A"><text>U.S. Patent Nos. 4,683,202</text></patcit>; <patcit id="pcit0020" dnum="US4683195A"><text>4,683,195</text></patcit>; <patcit id="pcit0021" dnum="US4800159A"><text>4,800,159</text></patcit>; <patcit id="pcit0022" dnum="US4965188A"><text>4,965,188</text></patcit>; <patcit id="pcit0023" dnum="US5994056A"><text>5,994,056</text></patcit>; <patcit id="pcit0024" dnum="US6814934A"><text>6,814,934</text></patcit>; and in Saiki <i>et al.</i> (1985); Sambrook <i>et al.</i> (1989); Lee <i>et al.</i>(1993); and Livak <i>et al.</i> (1995). The PCR assay may use oligonucleotides specific for an influenza matrix (MA) gene and/or HA gene. The amplification product can also be sequenced to determine if the product has a sequence of an influenza virus of the present disclosure. Other nucleic acid-based assays can be used for detection and diagnosis of viral infection by a virus of the disclosure and such assays are contemplated within the scope of the present disclosure. A sample containing a nucleic acid may be subjected to a PCR-based amplification using forward and reverse primers where the primers are specific for a viral polynucleotide or gene sequence. If the nucleic acid in the sample is RNA, then RT-PCR can be performed. For real-time PCR, a detectable probe is utilized with the primers.</p>
<p id="p0104" num="0104">Primer sets specific for the hemagglutinin (HA) gene of many of the circulating influenza viruses are known, and are continually being developed. The influenza virus genome is single-stranded RNA, and a DNA copy (cDNA) must be made using a reverse transcriptase (RT) polymerase. The amplification of the RNA genome, for example using<!-- EPO <DP n="41"> --> RT-PCR, requires a pair of oligonucleotide primers, typically designed on the basis of the know HA sequence of influenza A subtypes and of neuraminadase (NM)-1. The primers can be selected such that they will specifically amplify RNA of only one virus subtype. DNAs generated by using subtype-specific primers can be further analyzed by molecular genetic techniques such as sequencing. The test is preferably run with a positive control, or products are confirmed by sequencing and comparison with known sequences. The absence of the target PCR products (<i>i.e</i>, a "negative" result) may not rule out the presence of the virus. Results can then be made available within a few hours from either clinical swabs or infected cell cultures. PCR and RT-PCR tests for influenza A virus are described by Fouchier <i>et al</i>., 2000 and Maertzdorf <i>et al</i>., 2004.</p>
<p id="p0105" num="0105">The present disclosure also concerns methods for screening for compounds or drugs that have antiviral activity against a virus of the present disclosure. Cells infected with a virus of the disclosure can be contacted with a test compound or drug. The amount of virus or viral activity following contact is then determined. Those compounds or drugs that exhibit antiviral activity can be selected for further evaluation.</p>
<p id="p0106" num="0106">The present disclosure also concerns isolated cells infected with an influenza virus of the present disclosure. The cell can be a canine cell, such as canine kidney epithelial cells.</p>
<p id="p0107" num="0107">The present disclosure also concerns cells transformed with a polynucleotide of the present disclosure encoding a polypeptide of the disclosure. Preferably, the polynucleotide sequence is provided in an expression construct of the disclosure. More preferably, the expression construct provides for overexpression in the cell of an operably linked polynucleotide of the disclosure. The cell may be transformed with a polynucleotide sequence comprising a sequence encoding the amino acid sequence shown in any of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 33, 34, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, or 78, or a functional fragment or variant thereof. The cell may be transformed with a polynucleotide encoding the amino acid sequence shown in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 33, 34, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, or 78 comprises the nucleotide sequence shown in SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, or 77, respectively, or a sequence encoding a functional fragment or variant of any of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 33, 34, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72,<!-- EPO <DP n="42"> --> 74, 76, or 78. Thus, the present disclosure concerns cells transformed with a polynucleotide sequence comprising the nucleotide sequence shown in any of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13,15,17,19,21,23,25,27,29,31,47,49,51,53,55,57,59,61,63,65,67,69,71,73,75, or 77, or a fragment or variant, including a degenerate variant, of any of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 47, 49, 51, 53, S5, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, or 77.</p>
<p id="p0108" num="0108">The transformed cell can be a eukaryotic cell, for example, a plant cell, including protoplasts, or the transformed cell can be a prokaryotic cell, for example, a bacterial cell such as <i>E</i>. <i>coli</i> or <i>B. subtilis.</i> Animal cells include human cells, mammalian cells, partially canine cells, avian cells, and insect cells. Plant cells include, but are not limited to, dicotyledonous, monocotyledonous, and conifer cells.</p>
<p id="p0109" num="0109">The present disclosure also concerns plants, including transgenic plants that express and produce a viral protein or polypeptide of the present invention. Plants, plant tissues, and plant cells transformed with or bred to contain a polynucleotide of the disclosure are contemplated by the present disclosure. Preferably, a polynucleotide of the disclosure is overexpressed in the plant, plant tissue, or plant cell. Plants can be used to produce influenza vaccine compositions of the present disclosure and the vaccines can be administered through consumption of the plant (see, for example, <patcit id="pcit0025" dnum="US5484719A"><text>U.S. Patent Nos. 5,484,719</text></patcit> and <patcit id="pcit0026" dnum="US6136320A"><text>6,136,320</text></patcit>).</p>
<p id="p0110" num="0110">The present disclosure also concerns kits for detecting a virus or diagnosing an infection by a virus of the present disclosure. A kit can an antibody of the disclosure that specifically binds to an influenza virus of the present disclosure, or an antigenic portion thereof. A kit can comprise one or more polypeptides or peptides of the present disclosure. The polypeptides can have an amino acid sequence shown in any of SEQ ID NOs. 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 33, 34, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, or 78, or a functional and/or immunogenic fragment or variant thereof. A kit can comprise one or more polynucleotides or oligonucleotides of the present disclosure The polynucleotides can have a nucleotide sequence shown in any of SEQ ID NOs. 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, or 77, or a fragment or variant thereof. A kit may optionally comprise one or more control antibody, control polypeptide or peptide, and/or control polynucleotide or oligonucleotide. The antibody, polypeptides, peptides, polynucleotides, and/or oligonucleotides of the kit can be provided in a suitable container or package.<!-- EPO <DP n="43"> --></p>
<p id="p0111" num="0111">The subject disclosure Application also concerns the use of mongrel dogs as a model for infection and pathogenesis of influenza virus. A mongrel dog may be inoculated with an influenza virus, such as a canine influenza virus of the present disclosure. Optionally, the dog can be administered therapeutic agents subsequent to inoculation. The dog can also have been administered a composition for generating an immune response against an influenza virus prior to inoculation with virus. Tissue, blood, serum, and other biological samples can be obtained before and/or after inoculation and examined for the presence of virus and pathogenesis of tissue using methods known in the art including, but not limited to, PCR, RT-PCR, nucleic acid sequencing, and immunohistochemistry.</p>
<p id="p0112" num="0112">Canine influenza virus strains (designated as "A/canine/Florida/43/2004" and "A/canine/Florida/242/2003") were deposited with American Type Culture Collection (ATCC), P.O. Box 1549, Manassas, VA 20108, on October 9, 2006. Canine influenza virus stains (designated as "canine/Jax/05" and "canine/Miami/05"), were deposited with American Type Culture Collection (ATCC), P.O. Box 1549, Manassas, VA 20108, on October 17, 2006. The virus strains have been deposited under conditions that assure that access to the cultures will be available during the pendency of this patent to one determined by the Commissioner of Patents and Trademarks to be entitled thereto under 37 CFR 1.14 and 35 U.S.C. 122. The deposit will be available as required by foreign patent laws in countries wherein counterparts of the subject patent, or its progeny, are filed. However, it should be understood that the availability of a deposit does not constitute a license to practice the subject invention in derogation of patent rights granted by governmental action.</p>
<p id="p0113" num="0113">Further, the virus deposits will be stored and made available to the public in accord with the provisions of the Budapest Treaty for the Deposit of Microorganisms, i.e., it will be stored with all the care necessary to keep it viable and uncontaminated for a period of at least five years after the most recent request for the furnishing of a sample of the deposit, and in any case, for a period of at least thirty (30) years after the date of deposit or for the enforceable life of any patent which may issue disclosing the culture. The depositor acknowledges the duty to replace the deposit should the depository be unable to furnish a sample when requested, due to the condition of the deposit. All restrictions on the availability to the public of the subject culture deposit will be irrevocably removed upon the granting of a patent disclosing it.<!-- EPO <DP n="44"> --></p>
<p id="p0114" num="0114">Table 57 illustrates the similarities among the amino acid sequences encoded by the hemagglutinin (or "HA"), neuraminidase (or "NA"), and nucleoprotein (NP) genes of the canine influenza virus identified as A/canine/Florida/43/2004 (Ca/ Fla/43/04) with H3N8 equine isolates, as well as the canine/Florida/242/2003 isolate.</p>
<p id="p0115" num="0115">In sofar as the following examples relate to the subject matter of the claims, such are illustrative of the present invention. Otherwise, the examples are provided for information purposes only.</p>
<heading id="h0006">MATERIALS AND METHODS FOR EXAMPLES 1-6</heading>
<heading id="h0007"><u>Blood and Nasal Swab Collection from Greyhounds.</u></heading>
<p id="p0116" num="0116">Acute and convalescent blood samples were collected by jugular venipuncture from clinically diseased or normal greyhounds in racing kennels experiencing outbreaks of respiratory disease. Convalescent samples were collected 4 to 12 weeks after the acute sample. Serum was harvested and stored at -80°C. Nasal swabs were collected and placed in Amies transport medium with charcoal (Becton Dickinson Biosciences) pending submission for bacterial isolation.</p>
<heading id="h0008"><u>Postmortem examination of greyhounds.</u></heading>
<p id="p0117" num="0117">Complete postmortem examinations were performed by the Anatomic Pathology Service at the University of Florida College of Veterinary Medicine (UF CVM) on 5 of the 8 greyhounds that died in the January 2004 outbreak at a Florida track. Postmortem examination of another dog was performed at a private veterinary clinic with submission of tissues to the UF CVM for histopathologic diagnosis. Tissues were fixed in 10% neutral buffered formalin, embedded in paraffin, and 5-µm sections were either stained with hematoxylin and eosin for histopathologic diagnosis or processed for immunohistochemistry as described below. Unfixed tissues were submitted for bacterial culture and also stored at - 80°C.</p>
<p id="p0118" num="0118"><u>Serological tests for canine viral respiratory pathogens.</u><!-- EPO <DP n="45"> --></p>
<p id="p0119" num="0119">Paired acute and convalescent serum samples were submitted to the Animal Health Diagnostic Laboratory (AHDL) at the Cornell University College of Veterinary Medicine for serum neutralization assays against canine distemper virus, adenovirus type 2, and parainfluenza virus. Antibody titers were expressed as the last dilution of serum that inhibited viral infection of cell cultures. Seroconversion, defined as a ≥ 4-fold increase in antibody titer between the acute and convalescent sample, indicated viral infection. No seroconversions to these viral pathogens were detected.</p>
<heading id="h0009"><u>Microbial tests for canine bacterial respiratory pathogens.</u></heading>
<p id="p0120" num="0120">Paired nasal swabs and postmortem tissues were submitted to the Diagnostic Clinical Microbiology/Parasitology/Serology Service at the UF CVM for bacterial isolation and identification. The samples were cultured on nonselective media as well as media selective for <i>Bordetella</i> species (Regan-Lowe; Remel) and <i>Mycoplasma</i> species (Remel). All cultures were held for 21 days before reporting no growth. Nasal swabs from some of the greyhounds were also submitted to the Department of Diagnostic Medicine/Pathobiology at the Kansas State University College of Veterinary Medicine for bacterial culture. Of 70 clinically diseased dogs tested, <i>Bordetella bronchiseptica</i> was isolated from the nasal cavity of 1 dog, while <i>Mycoplasma spp.</i> were recovered from the nasal cavity of 33 dogs. <i>Pasteurella multocida</i> was commonly recovered from the nasal cavity of dogs with purulent nasal discharges. Two of the dogs that died in the January 2004 outbreak had scant growth of <i>Escherichia coli</i> in the lungs postmortem, one dog had scant growth of <i>E. coli</i> and <i>Streptococcus canis,</i> and another had scant growth of <i>Pseudomonas aeruginosa</i> and a yeast. Neither <i>Bordetella bronchiseptica</i> nor <i>Mycoplasma</i> was isolated from the trachea or lungs of dogs that died.</p>
<heading id="h0010"><u>Virus isolation from postmortem tissues.</u></heading>
<p id="p0121" num="0121">Frozen tissues were thawed and homogenized in 10 volumes of minimum essential medium (MEM) supplemented with 0.5% bovine serum albumin (BSA) and antibiotics. Solid debris was removed by centrifugation and supernatants were inoculated onto cultured cells or into 10-day old embryonated chicken eggs. Tissue homogenates from greyhounds that died were inoculated into diverse cell cultures that supported the replication of a broad range of viral pathogens. The cell cultures included Vero (African green monkey kidney epithelial cells, ATCC No. CCL-81), A-72 (canine tumor fibroblasts, CRL-1542), HRT-18 (human rectal epithelial cells, CRL-11663), MDCK (canine kidney epithelial cells, CCL-34),<!-- EPO <DP n="46"> --> primary canine kidney epithelial cells (AHDL, Cornell University), primary canine lung epithelial cells (AHDL), and primary bovine testicular cells (AHDL). MDCK and HRT cells were cultured in MEM supplemented with 2.5 ug/mL TPCK-treated trypsin (Sigma); the remaining cell lines were cultured in MEM supplemented with 10% fetal calf serum and antibiotics. Cells were grown in 25 cm<sup>2</sup> flasks at 37°C in a humidified atmosphere containing 5% CO<sub>2</sub>. A control culture was inoculated with the supplemented MEM. The cultures were observed daily for morphologic changes and harvested at 5 days post inoculation. The harvested fluids and cells were clarified by centrifugation and inoculated onto fresh cells as described for the initial inoculation; two blind passages were performed. Hemagglutination activity in the clarified supernatants was determined using chicken or turkey red blood cells as described (Burleson <i>et al.,</i> 1992; Kendal <i>et al.,</i> 1982). For virus isolation in chicken embryos, 0.1 mL of tissue homogenate was inoculated into the allantoic sac and incubated for 48 hours at 35°C. After two blind passages, the hemagglutination activity in the allantoic fluids was determined as described (Burleson <i>et al.,</i> 1992; Kendal <i>et al.,</i> 1982).</p>
<heading id="h0011"><u>RT-PCR, nucleotide sequencing, and phylogenetic analyses.</u></heading>
<p id="p0122" num="0122">Total RNA was extracted from tissue culture supernatant or allantoic fluid using the RNeasy kit (Qiagen, Valencia, CA) according to manufacturer's instructions. The total RNA (10 ng) was reverse transcribed to cDNA using a one-step RT-PCR Kit (Qiagen, Valencia, CA) according to manufacturer's instructions. PCR amplification of the coding region of the 8 influenza viral genes in the cDNA was performed as previously described (Klimov <i>et al.,</i> 1992a), using universal gene-specific primer sets. The resulting DNA amplicons were used as templates for automated sequencing on an Applied Biosystems 3100 automated DNA sequencer using cycle sequencing dye terminator chemistry (ABI). Nucleotide sequences were analyzed using the GCG Package<sup>©</sup>, Version 10.0 (Accelyrs) (Womble, 2000). The Phylogeny Inference Package<sup>©</sup> Version 3.5 was used to estimate phylogenies and calculate bootstrap values from the nucleotide sequences (Felsenstein, 1989). Phylogenetic trees were compared to those generated by neighbor-joining analysis with the Tamura-Nei gamma model implemented in the MEGA<sup>©</sup> program (Kumar <i>et al.,</i> 2004) and confirmed by the PAUP<sup>©</sup> 4.0 Beta program (Sinauer Associates).</p>
<heading id="h0012"><u>Experimental inoculation of dogs.</u></heading><!-- EPO <DP n="47"> -->
<p id="p0123" num="0123">Four 6-month old specific pathogen-free beagles [(2 males and 2 females (Liberty Research)] were used. Physical examination and baseline blood tests including complete blood cell count/differential, serum chemistry panel, and urinalysis determined that the animals were healthy. They were housed together in a BSL 2-enhanced facility accredited by the Association for Assessment and Accreditation of Laboratory Animal Care. Baseline rectal temperatures were recorded twice daily for 7 days. The dogs were anesthetized by intravenous injection of propofol (Diprivan®, Zeneca Pharmaceuticals, 0.4 mg/kg body weight to effect) for intubation with endotracheal tubes. Each dog was inoculated with a total dose of 10<sup>6.6</sup> median tissue culture infectious doses (TCID<sub>50</sub>) of A/Canine/Florida/43/2004 (Canine/FL/04) (H3N8) virus with half the dose administered into the distal trachea through the endotracheal tube and the other half administered into the deep nasal passage through a catheter. Physical examinations and rectal temperature recordings were performed twice daily for 14 days post inoculation (p.i.). Blood samples (4 mL) were collected by jugular venipuncture on days 0, 3, 5, 7, 10, and 14 p.i. Nasal and oropharyngeal specimens were collected with polyester swabs (Fisher Scientific) from each dog on days 0 to 5, 7, 10, and 14 p.i. The swabs were placed in viral transport medium (Remel) and stored at -80°C. Two dogs (1 male and 1 female) were euthanatized by intravenous inoculation of Beuthanasia-D® solution (1 mL/5 kg body weight; Schering-Plough Animal Health Corp) on day 5 p.i. and the remaining 2 dogs on day 14 for postmortem examination. Tissues for histological analysis were processed as described. Tissues for virus culture were stored at -80°C. This study was approved by the University of Florida Institutional Animal Care and Use Committee.</p>
<heading id="h0013"><u>Virus shedding from experimentally inoculated dogs.</u></heading>
<p id="p0124" num="0124">Serial dilutions of lung homogenates and swab extracts, prepared by clarification of the swab transport media by centrifugation, were set up in MEM supplemented with 0.5% BSA and antibiotics. Plaque assays were performed as described (Burleson <i>et al.,</i> 1992) using monolayers of MDCK cells in 6-well tissue culture plates. Inoculated cell monolayers were overlaid with supplemented MEM containing 0.8% agarose and 1.5 ug/mL of TPCK-trypsin. Cells were cultured for 72 hours at 37°C in a humidified atmosphere containing 5%CO<sub>2</sub> prior to fixation and staining with crystal violet. Virus concentration was expressed as plaque forming units (PFU) per gram of tissue or per swab.</p>
<heading id="h0014"><u>Immunohistochemistry.</u></heading><!-- EPO <DP n="48"> -->
<p id="p0125" num="0125">Deparaffinized and rehydrated 5-µm lung tissue sections from the greyhounds and beagles were mounted on Bond-Rite™ slides (Richard-Allan Scientific, Kalamazoo, MI) and subsequently treated with proteinase K (DakoCytomation, Carpenteria, CA) followed by peroxidase blocking reagent (Dako® EnVision™ Peroxidase Kit, Dako Corp.). The sections were incubated with 1:500 dilutions of monoclonal antibodies to canine distemper virus (VMRD, Inc.), canine adenovirus type 2 (VMRD, Inc.), canine parainfluenza virus (VMRD, Inc.), or influenza A H3 (Chemicon International, Inc.) for 2 hours at room temperature. Controls included incubation of the same sections with mouse IgG (1 mg/mL, Serotec, Inc.), and incubation of the monoclonal antibodies with normal canine lung sections. Following treatment with the primary antibodies, the sections were incubated with secondary immunoperoxidase and peroxidase substrate reagents (Dako® EnVision™ Peroxidase Kit, Dako Corp.) according to the manufacturer's instructions. The sections were counterstained with hematoxylin, treated with Clarifier #2 and Bluing Reagent (Richard-Allan Scientific, Kalamazoo, MI), dehydrated, and coverslips applied with Permount (ProSciTech).</p>
<heading id="h0015"><u>Hemagglutination inhibition (HI) assay.</u></heading>
<p id="p0126" num="0126">Serum samples were incubated with receptor destroying enzyme (RDE, Denka) (1 part serum: 3 parts RDE) for 16 hours at 37°C prior to heat inactivation for 60 minutes at 56°C. Influenza A/Canine/FL/04 (H3N8) virus was grown in MDCK cells for 36-48 hr at 37°C. Virus culture supernatants were harvested, clarified by centrifugation, and stored at - 80°C. The HI assay was performed as described previously (Kendal <i>et al.,</i> 1982). Briefly, 4 hemagglutinating units of virus in 25µl were added to an equal volume of serially diluted serum in microtiter wells and incubated at room temperature for 30 minutes. An equal volume of 0.5% v/v turkey erythrocytes was added and the hemagglutination titers were estimated visually after 30 minutes. The endpoint HI titer was defined as the last dilution of serum that completely inhibited hemagglutination. Seroconversion was defined as ≥ 4-fold increase in HI titer between paired acute and convalescent samples. Seropositivity of a single sample was defined as a HI antibody titer ≥1:32.</p>
<heading id="h0016"><u>Microneutralization (MN) assay.</u></heading>
<p id="p0127" num="0127">Neutralizing serum antibody responses to A/Canine/FL/04 (H3N8) were detected by a MN assay as described previously (Rowe <i>et al.,</i> 1999) except that canine sera were RDE-treated<!-- EPO <DP n="49"> --> as described above prior to the assay. The endpoint titer was defined as the highest dilution of serum that gave 50% neutralization of 100 TCID<sub>50</sub> of virus. Seroconversion was defined as ≥ 4-fold increase in MN titer between paired acute and convalescent samples. Seropositivity of a single sample was defined as a MN titer ≥1:80.</p>
<p id="p0128" num="0128">Following are examples which illustrate procedures for practicing the invention and the accompanying disclosure. These examples should not be construed as limiting. All percentages are by weight and all solvent mixture proportions are by volume unless otherwise noted.</p>
<heading id="h0017"><u>EXAMPLE 1</u></heading>
<p id="p0129" num="0129">In January 2004, an outbreak of respiratory disease occurred in 22 racing greyhounds housed in 2 kennels at a Florida track and the local farm that supplied dogs to these kennels. There were approximately 60 dogs in each kennel building and 300 dogs at the farm. The outbreak occurred over a 6-day period after which no new cases were identified. Fourteen of the 22 dogs had fevers of 39.5 to 41.5°C, a soft, gagging cough for 10 to 14 days, and eventual recovery. Of the remaining 8 dogs, 6 apparently healthy dogs died unexpectedly with hemorrhage from the mouth and nose. Two other dogs were euthanatized within 24 hours of onset of hemorrhage from the mouth and nose due to rapid deterioration. Both of these dogs had fevers of 41°C. Four of the 8 deaths occurred in the kennel buildings and 4 occurred at the farm. Fifty percent of the deaths occurred on day 3 of the outbreak. The 22 dogs ranged in age from 17 months to 4 years, but 73% were 17 to 33 months old.</p>
<p id="p0130" num="0130">Two clinical syndromes were evident: a milder illness characterized by initial fever and then cough for 10-14 days (14 dogs) with subsequent recovery, or a peracute death associated with hemorrhage in the respiratory tract (8 dogs for a mortality rate of 36%). Postmortem examinations were performed on 6 of the 8 fatal cases. All dogs had extensive hemorrhage in the lungs, mediastinum, and pleural cavity, Histological examination of the respiratory tract revealed that in addition to pulmonary hemorrhage, all dogs had tracheitis, bronchitis, bronchiolitis, and suppurative bronchopneumonia (<figref idref="f0004">Figure 3</figref>). The epithelial lining and airway lumens in these tissues were infiltrated by neutrophils and macrophages. Lung homogenates prepared from these dogs were inoculated into a variety of monkey, human, bovine, and canine cell lines for virus culture. The lung homogenate from one dog caused cytopathic effects in Madin-Darby canine kidney epithelial cells (MDCK) cultured in the presence of trypsin, and the cell culture supernatant agglutinated chicken red blood cells. Preliminary evidence of an influenza type A virus was provided by a commercial ELISA for<!-- EPO <DP n="50"> --> detection of the nucleoprotein of influenza A and B viruses, and by PCR analysis using primers specific for the matrix gene of influenza A viruses. In addition, the hemagglutinating activity was inhibited by reference antisera to the equine influenza A H3 subtype, but not by antisera specific for human influenza A subtypes H1-H11 and H13 (Table 3). To characterize the molecular properties of the virus, we determined the nucleotide sequences of the 8 RNA segments of the viral genome. Sequence comparisons with known influenza virus genes and phylogenetic analyses indicated that the 8 genes of the canine isolate were most similar to those from contemporary equine influenza A (H3N8) viruses, with which they shared ≥96-97% sequence identity (<figref idref="f0001">Figure 1A</figref>, Table 4). In contrast, representative genes from avian, swine, and human influenza A isolates had ≥94% identity with the canine isolate (Table 4). These data identified the canine isolate A/Canine/Florida/43/2004 (Canine/FL/04) as an influenza A H3N8 virus closely related to contemporary lineages of equine influenza viruses. Since all genes of the canine isolate were of equine influenza virus origin, we concluded that the entire genome of an equine influenza virus had been transmitted to the dog.</p>
<heading id="h0018"><u>EXAMPLE 2</u></heading>
<p id="p0131" num="0131">To investigate the role of the Canine/FL/04 virus in the clinical and pathological observations in the greyhounds, we performed immunohistochemical staining (IHC) on lung tissues using a monoclonal antibody to influenza A H3. Viral H3 antigen was consistently detected in the cytoplasm of bronchial and bronchiolar epithelial cells, bronchial gland epithelial cells, and macrophages in airway lumens and alveolar spaces (<figref idref="f0003">Figure 2A</figref>). These data support a diagnosis of pulmonary infection with influenza virus of the H3 subtype in multiple dogs.</p>
<heading id="h0019"><u>EXAMPLE 3</u></heading>
<p id="p0132" num="0132">To determine involvement of a Canine/FL/04-like virus in the etiology of the respiratory disease outbreak, we analyzed paired acute and convalescent sera from 11 sick dogs and 16 asymptomatic contacts by hemagglutination inhibition (HI) and microneutralization (MN). Seroconversion, defined as a ≥ 4-fold rise in antibody titer to Canine/FL/04 from the acute to convalescent phase, occurred in 8 of 11 (73%) sick dogs in both assays (Table 1). Seroconversion occurred in 6 of 16 (38%) asymptomatic contacts in the HI assay, while 8 of 16 (50%) seroconverted in the MN assay (Table 1). The<!-- EPO <DP n="51"> --> seroconversion data demonstrated infection of the dogs with a Canine/FL/04-like virus which coincided temporally with the onset of respiratory disease in most animals.</p>
<p id="p0133" num="0133">Single serum samples were collected 3 months after the outbreak from an additional 46 asymptomatic dogs housed with the sick dogs. Of these, 43 (93%) were seropositive in both assays. For the total population of 73 dogs tested, 93% were seropositive in both assays, including 82% (9/11) of the sick dogs and 95% (59/62) of the healthy contacts. The high seroprevalence in dogs with no history of respiratory disease indicates that most infections with canine influenza virus are subclinical and suggest efficient spread of the virus among dogs. It is not known if subclinical infections contribute to the spread of the virus.</p>
<heading id="h0020"><u>EXAMPLE 4</u></heading>
<p id="p0134" num="0134">To better understand the capacity of the Canine/FL/04 virus to infect dogs, four 6-month old purpose-bred beagles were each inoculated with 10<sup>6.6</sup> median tissue culture infectious doses (TCID<sub>50</sub>) by the intratracheal and intranasal routes. All dogs developed a fever (rectal temperature ≥39°C) for the first 2 days postinoculation (p.i.), but none exhibited respiratory symptoms such as cough or nasal discharge over a 14 day observation period. Virus shedding was examined by quantification of virus in nasal and oropharyngeal swabs. Only 2 of the 4 dogs shed detectable amounts of virus. One dog shed virus on days 1 and 2 p.i. (1.0-2.5 log<sub>10</sub> PFU per swab), whereas the other dog shed virus for 4 consecutive days after inoculation (1.4-4.5 log<sub>10</sub> PFU per swab). Postmortem examination of 2 dogs on day 5 p.i. revealed necrotizing and hyperplastic tracheitis, bronchitis, and bronchiolitis similar to that found in the spontaneous disease in greyhounds, but there was no pulmonary hemorrhage or bronchopneumonia. Viral H3 antigen was detected in the cytoplasm of epithelial cells of bronchi, bronchioles, and bronchial glands by IHC (<figref idref="f0003">Figure 2B</figref>). Infectious virus was recovered from the lung tissue of one of the dogs. Postmortem examination of the remaining 2 dogs on day 14 p.i. showed minimal histological changes in respiratory tissues, no viral H3 antigen by IHC, and no recovery of virus from lung homogenates. Seroconversion in these latter 2 dogs was detected in MN assays by day 7 p.i., with a further 2-to 3-fold increase in antibody titers by day 14. These results established the susceptibility of dogs to infection with Canine/FL/04, as evidenced by the febrile response, presence of viral antigen and infectious virus in the lung parenchyma, histopathological findings typical for influenza, and seroconversion. The failure to reproduce severe disease and death in the experimentally<!-- EPO <DP n="52"> --> inoculated beagles is not surprising since a large proportion of the naturally infected greyhounds were asymptomatic.</p>
<heading id="h0021"><u>EXAMPLE 5</u></heading>
<p id="p0135" num="0135">To investigate whether a Canine/FL/04-like influenza virus had circulated among greyhound populations in Florida prior to the January 2004 outbreak, archival sera from 65 racing greyhounds were tested for the presence of antibodies to Canine/FL/04 using the HI and MN assays. There were no detectable antibodies in 33 dogs sampled from 1996 to 1999. Of 32 dogs sampled between 2000 and 2003, 9 were seropositive in both assays - 1 in 2000, 2 in 2002, and 6 in 2003 (Table 5). The seropositive dogs were located at Florida tracks involved in outbreaks of respiratory disease of unknown etiology from 1999 to 2003, suggesting that a Canine/FL/04-like virus may have been the causative agent of those outbreaks. To investigate this possibility further, we examined archival tissues from greyhounds that died from hemorrhagic bronchopneumonia in March 2003. Lung homogenates inoculated into MDCK cells and chicken embryos from one dog yielded H3N8 influenza virus, termed A/Canine/Florida/242/2003 (Canine/FL/03). Sequence analysis of the complete genome of Canine/FL/03 revealed &gt;99% identity to Canine/FL/04 (Table 4), indicating that Canine/FL/04-like viruses had infected greyhounds prior to 2004.</p>
<heading id="h0022"><u>EXAMPLE 6</u></heading>
<p id="p0136" num="0136">From June to August 2004, respiratory disease outbreaks occurred in thousands of racing greyhounds at 14 tracks in Florida, Texas, Alabama, Arkansas, West Virginia, and Kansas.</p>
<p id="p0137" num="0137">Officials at some of these tracks estimated that at least 80% of their dog population had clinical disease. Most of the dogs had clinical signs of fever (≥ 39°C) and cough similar to the dogs in the January 2004 outbreak, but many dogs also had a mucopurulent nasal discharge. Multiple deaths were reported but an accurate mortality rate could not be determined.</p>
<p id="p0138" num="0138">We collected paired acute and convalescent sera from 94 dogs located at 4 Florida tracks: 56% of these dogs had ≥4-fold rises in antibody titers to Canine/FL/04, and 100% were seropositive (Table 6). Convalescent sera from 29 dogs in West Virginia and Kansas also had antibodies to Canine/FL/04. We isolated influenza A (H3N8) virus from the lungs of a greyhound that died of hemorrhagic bronchopneumonia at a track in Texas. Sequence<!-- EPO <DP n="53"> --> analysis of the entire genome of this isolate, named A/Canine/Texas/1/2004 (Canine/TX/04), revealed ≥99% identity to Canine/FL/04 (Table 4). The isolation of three closely related influenza viruses from fatal canine cases over a 13-month period and from different geographic locations, together with the substantial serological evidence of widespread infection among racing greyhounds, suggested sustained circulation of a Canine/FL/04-like virus in the dog population.</p>
<p id="p0139" num="0139">Phylogenetic analysis of the HA genes of Canine/FL/03, Canine/FL/04, and Canine/TX/04 showed that they constitute a monophyletic group with robust bootstrap support that was clearly distinct from contemporary H3 genes of equine viruses isolated in 2002 and 2003 (<figref idref="f0002">Figure 1B</figref>). Phylogentic analysis and pairwise nucleotide sequence comparisons of the other 7 genomic segments supported the segregation of the canine genes as a distinct sub-lineage most closely related to the equine virus lineage (data not shown, and Table 4). The clustering of the canine influenza genes as a monophyletic group separate from equine influenza is also supported by the presence of 4 signature amino acid changes in the HA (Table 2). Together with the serological results from 2003 and 2004, these data are consistent with a single virus transmission event from horses to dogs with subsequent horizontal spread of the virus in the greyhound population. However, repeated introductions of this unique lineage of influenza virus from an unidentified reservoir species can not be formally excluded, unlikely as it may be.</p>
<p id="p0140" num="0140">The viral HA is a critical determinant of host species specificity of influenza virus (Suzuki <i>et al.,</i> 2000). To identify residues within HA that may be associated with adaptation to the canine host, we compared the deduced amino acid sequence of canine HAs to those of contemporary equine viruses. Four amino acid changes differentiate the equine and canine mature HA consensus amino acid sequences: N83S, W222L, I328T, and N483T (see Table 2). The canine viruses have an amino acid deletion when compared to the consensus equine sequences. Therefore, amino acid position 7 in the HA equine sequence is position 6 in the HA canine sequence, amino acid position 29 in the HA equine sequence is position 28 in the HA canine sequence, amino acid position 83 in the HA equine sequence is position 82 in the HA canine sequence, <i>etc</i>. Thus, the four substituted amino acids are at position 82, 221, 327, and 482 of the amino acid sequence shown in SEQ ID NO: 33 and SEQ ID NO: 34. The substitution of serine for asparagine at consensus sequence position 83 is a change of unknown functional significance since various polar residues are found in H3 molecules from other species. The strictly conserved isoleucine at consensus sequence position 328 near the<!-- EPO <DP n="54"> --> cleavage site of the H3 HA has been replaced by threonine. The pivotal role of HA cleavage by host proteases in pathogenesis suggests that this change merits further study. The substitution of leucine for tryptophan at consensus sequence position 222 is quite remarkable because it represents a non-conservative change adjacent to the sialic acid binding pocket which could modulate receptor function (Weis <i>et al.,</i> 1988). Interestingly, leucine at position 222 is not unique to canine H3 HA since it is typically found in the H4, H8, H9, and H12 HA subtypes (Nobusawa <i>et al.,</i> 1991; Kovacova <i>et al.,</i> 2002). The leucine substitution may be more compatible with virus specificity for mammalian hosts since infections of swine with subtype H4 (Karasin <i>et al.,</i> 2000) and humans and swine with subtype H9 (Peiris <i>et al.,</i> 1999) viruses have been reported. The substitution of asparagine with threonine at consensus sequence position 483 resulted in the loss of a glycosylation site in the HA2 subunit that is conserved in all HA subtypes (Wagner <i>et al</i>., 2002). Although the importance of these amino acid changes in the HA for adaptation of an equine virus to dogs remains to be determined, similar amino acid changes have been observed previously in association with interspecies transfer (Vines <i>et al.,</i> 1998; Matrosovich <i>et al.,</i> 2000). Amino acid differences between other influenza viral proteins of the invention and equine consensus sequence are shown in Tables 19 to 25.</p>
<p id="p0141" num="0141">The source of the equine influenza virus that initially infected racing greyhounds remains speculative. Kennels at greyhound racetracks are not located near horses or horse racetracks, suggesting that contact between greyhounds and shedding horses is not a sufficient explanation for the multiple outbreaks in different states in 2004. A potential source of exposure to the equine virus is the feeding of horsemeat to greyhounds, whose diet is supplemented with raw meat supplied by packing houses that render carcasses, including horses which could carry influenza. Precedents for this mode of infection include reports of interspecies transmission of H5N1 avian influenza virus to pigs and zoo felids fed infected chicken carcasses (Webster, 1998; Keawcharoen <i>et al.,</i> 2004; Kuiken <i>et al</i>., 2004). Although this is a plausible route for the initial introduction of equine influenza into dogs, it does not explain the recent multiple influenza outbreaks in thousands of dogs in different states. Our experimental inoculation study demonstrated the presence of virus in the nasal passages and oropharynx of dogs, albeit at modest titers. Nevertheless, these results indicate that shedding is possible, and that dog-to-dog transmission of virus by large droplet aerosols, fomites, or direct mucosal contact could play a role in the epizootiology of the disease.<!-- EPO <DP n="55"> --></p>
<p id="p0142" num="0142">The interspecies transfer of a whole mammalian influenza virus to an unrelated mammal species is a rare event. Previous studies have provided limited serological or virological evidence, but not both, of transient infection of dogs with human influenza A (H3N2) viruses (Nikitin <i>et al.,</i> 1972, Kilbourne, <i>et al.,</i> 1975; Chang <i>et al.,</i> 1976; Houser <i>et al</i>., 1980). However, there was no evidence of sustained circulation in the canine host. Although direct transfer of swine influenza viruses from pigs to people is well-documented (Dacso <i>et al.,</i> 1984; Kimura <i>et al</i>., 1998; Patriarca <i>et al.,</i> 1984; Top <i>et al.,</i> 1977), there is no evidence for adaptation of the swine viruses in human hosts. In this report, we provide virological, serological, and molecular evidence for interspecies transmission of an entire equine influenza A (H3N8) virus to another mammalian species, the dog. Unique amino acid substitutions in the canine virus HA, coupled with serological confirmation of infection of dogs in multiple states in the U.S., suggest adaptation of the virus to the canine host. Since dogs are a primary companion animal for humans, these findings have implications for public health; dogs may provide a new source for transmission of novel influenza A viruses to humans.
<tables id="tabl0001" num="0001">
<table frame="all">
<tgroup cols="5">
<colspec colnum="1" colname="col1" colwidth="36mm"/>
<colspec colnum="2" colname="col2" colwidth="17mm"/>
<colspec colnum="3" colname="col3" colwidth="17mm"/>
<colspec colnum="4" colname="col4" colwidth="20mm"/>
<colspec colnum="5" colname="col5" colwidth="20mm"/>
<thead>
<row>
<entry namest="col1" nameend="col5" align="center" valign="top"><b>Table 1.</b> Antibody response to A/Canine/Florida/43/2004 (H3N8).</entry></row>
<row>
<entry align="center" valign="top"/>
<entry namest="col2" nameend="col3" align="center" valign="top"><b>Sick Dogs (11)<sup>a</sup></b></entry>
<entry namest="col4" nameend="col5" align="center" valign="top"><b>Healthy Contacts (16)<sup>b</sup></b></entry></row></thead>
<tbody>
<row>
<entry>Response</entry>
<entry align="center">HI<sup>c</sup></entry>
<entry align="center">SN<sup>d</sup></entry>
<entry align="center">HI</entry>
<entry align="center">SN</entry></row>
<row>
<entry>Seroconversion (%)<sup>e</sup></entry>
<entry align="center">73</entry>
<entry align="center">73</entry>
<entry align="center">38</entry>
<entry align="center">50</entry></row>
<row>
<entry>Seropositive (%)<sup>f</sup></entry>
<entry align="center">82</entry>
<entry align="center">82</entry>
<entry align="center">100</entry>
<entry align="center">100</entry></row>
<row>
<entry>Geometric mean titer<sup>g</sup></entry>
<entry align="center">329</entry>
<entry align="center">424</entry>
<entry align="center">268</entry>
<entry align="center">431</entry></row></tbody></tgroup>
<tgroup cols="5" rowsep="0">
<colspec colnum="1" colname="col1" colwidth="36mm"/>
<colspec colnum="2" colname="col2" colwidth="17mm"/>
<colspec colnum="3" colname="col3" colwidth="17mm"/>
<colspec colnum="4" colname="col4" colwidth="20mm"/>
<colspec colnum="5" colname="col5" colwidth="20mm"/>
<tbody>
<row>
<entry namest="col1" nameend="col5" align="justify"><sup>a</sup> Number of dogs with clinical signs of disease.<br/>
<sup>b</sup> Number of asymptomatic dogs housed in contact with clinically diseased dogs.<br/>
<sup>c</sup> Hemagglutination-inhibition (HI) assay using A/Canine/Florida/43/2004 virus.<br/>
<sup>d</sup> Microneutralization (MN) assay using A/Canine/Florida/43/2004 virus.<br/>
<sup>e</sup> Percentage of dogs with at least a 4-fold increase in antibody titer in paired acute and convalescent sera.<br/>
<sup>f</sup> Percentage of dogs with a positive antibody titer (HI titer ≥32: MN titer ≥80) in the convalescent sera.<br/>
<sup>g</sup> Geometric mean antibody titer for the convalescent sera.</entry></row></tbody></tgroup>
</table>
</tables><!-- EPO <DP n="56"> -->
<tables id="tabl0002" num="0002">
<table frame="all">
<tgroup cols="5">
<colspec colnum="1" colname="col1" colwidth="38mm"/>
<colspec colnum="2" colname="col2" colwidth="23mm"/>
<colspec colnum="3" colname="col3" colwidth="25mm"/>
<colspec colnum="4" colname="col4" colwidth="23mm"/>
<colspec colnum="5" colname="col5" colwidth="59mm"/>
<thead>
<row>
<entry namest="col1" nameend="col5" align="center" valign="middle"><b>Table 2.</b> Amino acid differences between the canine and equine H3 hemagglutinins.</entry></row>
<row>
<entry align="center" valign="middle"><b>Equine H3 consensus</b></entry>
<entry align="center" valign="middle"><b>Can/FL/03</b></entry>
<entry align="center" valign="middle"><b>Can/FTL/04</b></entry>
<entry align="center" valign="middle"><b>Can/TX/04</b></entry>
<entry align="center" valign="middle"><b>Potential functional significance</b></entry></row></thead>
<tbody>
<row>
<entry align="center" valign="middle">G7*</entry>
<entry align="center" valign="middle">D</entry>
<entry align="center" valign="middle">-<sup>†</sup></entry>
<entry align="center" valign="middle">-</entry>
<entry valign="middle">D also found in duck and human H3 HA</entry></row>
<row>
<entry align="center" valign="middle">I29</entry>
<entry align="center" valign="middle">-</entry>
<entry align="center" valign="middle">M</entry>
<entry align="center" valign="middle">M</entry>
<entry valign="middle">I is conserved in H3 HAs from all species</entry></row>
<row>
<entry align="center" valign="middle">N83</entry>
<entry align="center" valign="middle">S</entry>
<entry align="center" valign="middle">S</entry>
<entry align="center" valign="middle">S</entry>
<entry valign="middle">Various polar amino acids present at this position in H3 HAs of other species</entry></row>
<row>
<entry align="center" valign="middle">S92</entry>
<entry align="center" valign="middle">-</entry>
<entry align="center" valign="middle">N</entry>
<entry align="center" valign="middle">-</entry>
<entry valign="middle">N is present in some duck H3 HAs</entry></row>
<row>
<entry align="center" valign="middle">L118</entry>
<entry align="center" valign="middle">-</entry>
<entry align="center" valign="middle">-</entry>
<entry align="center" valign="middle">V</entry>
<entry valign="middle">L is conserved in all H3 HAs</entry></row>
<row>
<entry align="center" valign="middle">W222</entry>
<entry align="center" valign="middle">L</entry>
<entry align="center" valign="middle">L</entry>
<entry align="center" valign="middle">L</entry>
<entry valign="middle">W is conserved in most H3 HAs of all species; located near the receptor binding site</entry></row>
<row>
<entry align="center" valign="middle">A272</entry>
<entry align="center" valign="middle">V</entry>
<entry align="center" valign="middle">A</entry>
<entry align="center" valign="middle">V</entry>
<entry valign="middle">V is present in some recent equine isolates</entry></row>
<row>
<entry align="center" valign="middle">I328</entry>
<entry align="center" valign="middle">T</entry>
<entry align="center" valign="middle">T</entry>
<entry align="center" valign="middle">T</entry>
<entry valign="middle">T is strictly conserved in all avian, swine or humans H3 HAs</entry></row>
<row>
<entry align="center" valign="middle">N483</entry>
<entry align="center" valign="middle">T</entry>
<entry align="center" valign="middle">T</entry>
<entry align="center" valign="middle">T</entry>
<entry valign="middle">N occurs in all H3 and other HA subtypes. Replacement results in loss of a glycosylation site.</entry></row>
<row>
<entry align="center" valign="middle">K541</entry>
<entry align="center" valign="middle">-</entry>
<entry align="center" valign="middle">R</entry>
<entry align="center" valign="middle">-</entry>
<entry valign="middle">Basic amino acid conservative change</entry></row></tbody></tgroup>
<tgroup cols="5" rowsep="0">
<colspec colnum="1" colname="col1" colwidth="38mm"/>
<colspec colnum="2" colname="col2" colwidth="23mm"/>
<colspec colnum="3" colname="col3" colwidth="25mm"/>
<colspec colnum="4" colname="col4" colwidth="23mm"/>
<colspec colnum="5" colname="col5" colwidth="59mm"/>
<tbody>
<row>
<entry namest="col1" nameend="col5" align="justify">* Amino acid residue (single letter code) and position in the mature H3 HA. The amino acid code is: A=alanine, D=aspartic acid, G=glycine, I=isoleucine, K=lysine, L=leucine, M=methionine, N=asparagine, R=arginine, S=serine, T=threonine, V=valine, W=tryptophan.<br/>
<sup>†</sup> Denotes no change from the consensus equine H3 HAs.</entry></row></tbody></tgroup>
</table>
</tables><!-- EPO <DP n="57"> -->
<tables id="tabl0003" num="0003">
<table frame="all">
<tgroup cols="3">
<colspec colnum="1" colname="col1" colwidth="64mm"/>
<colspec colnum="2" colname="col2" colwidth="42mm"/>
<colspec colnum="3" colname="col3" colwidth="36mm"/>
<thead>
<row>
<entry namest="col1" nameend="col3" align="center" valign="top"><b>Table 3.</b> Hemagglutination inhibition of a virus isolate by reference antisera to different HA subtypes.</entry></row>
<row>
<entry align="center" valign="top"><b>Reference Antisera</b></entry>
<entry align="center" valign="top"><b>HA Specificity</b></entry>
<entry align="center" valign="top"><b>HI titer<sup>a</sup></b></entry></row></thead>
<tbody>
<row>
<entry align="center">Puerto Rico/8/34</entry>
<entry align="center">H1</entry>
<entry align="center">5</entry></row>
<row>
<entry align="center">Swine/Iowa15/30</entry>
<entry align="center">H1</entry>
<entry align="center">5</entry></row>
<row>
<entry align="center">Singapore/01/57</entry>
<entry align="center">H2</entry>
<entry align="center">5</entry></row>
<row>
<entry align="center">Shanghai/11/87</entry>
<entry align="center">H3<sup>b</sup></entry>
<entry align="center">5</entry></row>
<row>
<entry align="center">Equine/Miami/1/63</entry>
<entry align="center">H3</entry>
<entry align="center">160</entry></row>
<row>
<entry align="center">Duck/Czechoslovakia/56</entry>
<entry align="center">H4</entry>
<entry align="center">5</entry></row>
<row>
<entry align="center">Tern/South Africa/61</entry>
<entry align="center">H5</entry>
<entry align="center">5</entry></row>
<row>
<entry align="center">Turkey/Massachussetts/65</entry>
<entry align="center">H6</entry>
<entry align="center">5</entry></row>
<row>
<entry align="center">Fowl Plague/Dutch/27</entry>
<entry align="center">H7</entry>
<entry align="center">5</entry></row>
<row>
<entry align="center">Fowl Plague/Rostock/34</entry>
<entry align="center">H7</entry>
<entry align="center">5</entry></row>
<row>
<entry align="center">Equine/Prague/1/56</entry>
<entry align="center">H7</entry>
<entry align="center">5</entry></row>
<row>
<entry align="center">Turkey/Ontario/6118/68</entry>
<entry align="center">H8</entry>
<entry align="center">5</entry></row>
<row>
<entry align="center">Quail/Hong Kong/G1/97</entry>
<entry align="center">H9<sup>b</sup></entry>
<entry align="center">5</entry></row>
<row>
<entry align="center">Chicken/Hong Kong/G9/97</entry>
<entry align="center">H9<sup>b</sup></entry>
<entry align="center">5</entry></row>
<row>
<entry align="center">Chicken/Germany/49</entry>
<entry align="center">H10</entry>
<entry align="center">5</entry></row>
<row>
<entry align="center">Duck/England/56</entry>
<entry align="center">H11</entry>
<entry align="center">5</entry></row>
<row>
<entry align="center">Gull/Maryland/704/77</entry>
<entry align="center">H13</entry>
<entry align="center">5</entry></row>
<row>
<entry align="center">Normal sheep serum</entry>
<entry align="center">-</entry>
<entry align="center">5</entry></row>
<row>
<entry align="center">Normal ferret serum</entry>
<entry align="center">-</entry>
<entry align="center">5</entry></row></tbody></tgroup>
<tgroup cols="3" rowsep="0">
<colspec colnum="1" colname="col1" colwidth="64mm"/>
<colspec colnum="2" colname="col2" colwidth="42mm"/>
<colspec colnum="3" colname="col3" colwidth="36mm"/>
<tbody>
<row>
<entry namest="col1" nameend="col3" align="justify"><sup>a</sup> Hemagglutination inhibition titer to virus isolate from dog # 43.<br/>
<sup>b</sup> Polyclonal antisera were produced in ferrets, whereas all other antisera were produced in sheep or goats.</entry></row></tbody></tgroup>
</table>
</tables><!-- EPO <DP n="58"> -->
<tables id="tabl0004" num="0004">
<table frame="all">
<tgroup cols="5">
<colspec colnum="1" colname="col1" colwidth="32mm"/>
<colspec colnum="2" colname="col2" colwidth="33mm"/>
<colspec colnum="3" colname="col3" colwidth="36mm"/>
<colspec colnum="4" colname="col4" colwidth="35mm"/>
<colspec colnum="5" colname="col5" colwidth="33mm"/>
<thead>
<row>
<entry namest="col1" nameend="col5" align="center" valign="top"><b>Table 4.</b> Sequence homology of A/Canine/Florida/43/2004 (H3N8) genes to equine, avian, swine, and human strains of influenza A.</entry></row>
<row>
<entry align="center" valign="top"><b>Gene</b></entry>
<entry align="center" valign="top"><b>Equine</b></entry>
<entry align="center" valign="top"><b>Avian</b></entry>
<entry align="center" valign="top"><b>Swine</b></entry>
<entry align="center" valign="top"><b>Human</b></entry></row></thead>
<tbody>
<row>
<entry align="center">PB2 DQ124147</entry>
<entry align="center">96.9 (98.7)<sup>a</sup> Eq/Kentucky/2/8 M73526</entry>
<entry align="center">88.6 (96.8) Mall/Alberta/98/85 AY633315</entry>
<entry align="center">87.9 (96.8) Sw/Ontario/ 01911-1/99 AF285892</entry>
<entry align="center">86.2 (96.4) PR/8/34 (HK/213/03) AF389115 (AY576381)</entry></row>
<row>
<entry align="center">PB1 DQ124148</entry>
<entry align="center">97.1 (98.8) Eq/Tennessee/5/86 M25929</entry>
<entry align="center">83.9 (97.1) Ck/BritishColumbia/04 (Gull/Md/704/77) AY61675 (M25933)</entry>
<entry align="center">83.9 (97.1) Sw/Korea/S109/04 (Sw/Saskatch/ 18789/02) AY790287 (AY619955)</entry>
<entry align="center">83.9 (97.1) WSN/33 (Sing/1/57) J02178 (M25924)</entry></row>
<row>
<entry align="center">PA DQ124149</entry>
<entry align="center">96.3 (97.5) M26082 Eq/Tennesee/5/86</entry>
<entry align="center">87.0 (94.3) Ck/Chile/4591/02 (Ostrich/SA/08103/95) AY303660(AF508662)</entry>
<entry align="center">84.3 (94.6) Sw/Hong Kong/ 126/02 M26081</entry>
<entry align="center">83.8 (93.4) Taiwan/2/70 (Viet Nam/ 1203/04) AY210199 (AY818132)</entry></row>
<row>
<entry align="center">HA (H3) DQ124190</entry>
<entry align="center">97.4(97.1) Eq/FL/1/93 L39916</entry>
<entry align="center">80.7 (89.0) Dk/Norway/1/03 AJ841293</entry>
<entry align="center">80.0 (87.7) Sw/Ontario/42729a/01 AY619977</entry>
<entry align="center">81.8 (87.9) HK/1/68 AF348176</entry></row>
<row>
<entry align="center">NP DQ124150</entry>
<entry align="center">96.6 (97.9) Eq/Tennesee/5/86 M30758</entry>
<entry align="center">87.9 (95.1) Ck/Chile/176822/02 AY303658</entry>
<entry align="center">85.4 (93.5) Sw/Ontario/42729a/01 (Sw/Fujian/1/2003) AY619974 (AY747611)</entry>
<entry align="center">84.7 (93.0) HK/1073/99 (Hong Kong /538/97) AF255742 (AF255751)</entry></row>
<row>
<entry align="center">NA (N8) DQ124151</entry>
<entry align="center">96.8 (97.0) Eq/Tennesee/5/86 L06583</entry>
<entry align="center">84.0 (85.2) Dk/NJ/2000 L06583</entry>
<entry align="center">na<sup>b</sup></entry>
<entry align="center">na<sup>b</sup></entry></row>
<row>
<entry align="center">M DQ124152</entry>
<entry align="center">97.9 (95.7) Eq/Tennesee/5/86 (Eq/Kentucky/92) M63529 (AF001683)</entry>
<entry align="center">94.1 (94.0) Tky/Mn/833/80 AF001683</entry>
<entry align="center">93.7 (93.5) Sw/Saskatchewan/ 18789/02 M63527</entry>
<entry align="center">91.2 (95.4) WSN/33 (Hong Kong/ 1073/99) J02177 (AJ278646)</entry></row>
<row>
<entry align="center">NS DQ124153</entry>
<entry align="center">97.5 (95.7) Eq/Tn/5/86 (Eq/Kentucky/92) M80973 (AF001671)</entry>
<entry align="center">92.0 (90.4) Mal/NY/6750/78 M80945</entry>
<entry align="center">91.1 (89.1) Sw/China/8/78 (Sw/Korea/s452/04) M80968 (AY790309)</entry>
<entry align="center">91.4 (90.0) Brevig Mission/1/18 AF333238</entry></row></tbody></tgroup>
<tgroup cols="5" rowsep="0">
<colspec colnum="1" colname="col1" colwidth="32mm"/>
<colspec colnum="2" colname="col2" colwidth="33mm"/>
<colspec colnum="3" colname="col3" colwidth="36mm"/>
<colspec colnum="4" colname="col4" colwidth="35mm"/>
<colspec colnum="5" colname="col5" colwidth="33mm"/>
<tbody>
<row>
<entry namest="col1" nameend="col5" align="justify"><sup>a</sup> Percent nucleotide and amino acid (in parentheses) sequence identity of A/Canine/Florida/43/2004 (H3N8) genes to the most homologous gene of influenza virus virus isolates from the species, followed by their Genbank sequence database accession numbers.<br/>
<sup>b</sup> Not applicable: N8 neuraminidase was never reported in human or swine viruses.</entry></row></tbody></tgroup>
</table>
</tables><!-- EPO <DP n="59"> -->
<tables id="tabl0005" num="0005">
<table frame="all">
<tgroup cols="7">
<colspec colnum="1" colname="col1" colwidth="38mm"/>
<colspec colnum="2" colname="col2" colwidth="21mm"/>
<colspec colnum="3" colname="col3" colwidth="21mm"/>
<colspec colnum="4" colname="col4" colwidth="21mm"/>
<colspec colnum="5" colname="col5" colwidth="21mm"/>
<colspec colnum="6" colname="col6" colwidth="22mm"/>
<colspec colnum="7" colname="col7" colwidth="24mm"/>
<thead>
<row>
<entry namest="col1" nameend="col7" align="center" valign="middle"><b>Table 5.</b> Antibody titers to A/canine/Florida/43/2004 (H3N8) in greyhound serum collected from 1996 to 2003.</entry></row>
<row>
<entry rowsep="0" align="center" valign="middle"/>
<entry namest="col2" nameend="col7" align="center" valign="middle">Year<sup>a</sup></entry></row>
<row>
<entry valign="middle"/>
<entry align="center" valign="middle">1996</entry>
<entry align="center" valign="middle">1997</entry>
<entry align="center" valign="middle">1998</entry>
<entry align="center" valign="middle">2000</entry>
<entry align="center" valign="middle">2002</entry>
<entry align="center" valign="middle">2003</entry></row></thead>
<tbody>
<row>
<entry valign="middle">No. of dogs tested</entry>
<entry align="center" valign="middle">8</entry>
<entry align="center" valign="middle">6</entry>
<entry align="center" valign="middle">19</entry>
<entry align="center" valign="middle">4</entry>
<entry align="center" valign="middle">6</entry>
<entry align="center" valign="middle">22</entry></row>
<row>
<entry valign="middle">No. of seropositive dogs</entry>
<entry align="center" valign="middle">0</entry>
<entry align="center" valign="middle">0</entry>
<entry align="center" valign="middle">0</entry>
<entry align="center" valign="middle">1</entry>
<entry align="center" valign="middle">2</entry>
<entry align="center" valign="middle">6</entry></row>
<row>
<entry valign="middle">Antibody titers<sup>b</sup></entry>
<entry align="center" valign="middle"/>
<entry align="center" valign="middle"/>
<entry align="center" valign="middle"/>
<entry align="center" valign="middle">512</entry>
<entry align="center" valign="middle">232,524</entry>
<entry align="center" valign="middle">280-2242</entry></row></tbody></tgroup>
<tgroup cols="7" rowsep="0">
<colspec colnum="1" colname="col1" colwidth="38mm"/>
<colspec colnum="2" colname="col2" colwidth="21mm"/>
<colspec colnum="3" colname="col3" colwidth="21mm"/>
<colspec colnum="4" colname="col4" colwidth="21mm"/>
<colspec colnum="5" colname="col5" colwidth="21mm"/>
<colspec colnum="6" colname="col6" colwidth="22mm"/>
<colspec colnum="7" colname="col7" colwidth="24mm"/>
<tbody>
<row>
<entry namest="col1" nameend="col7" align="justify"><sup>a</sup> The year of serum sample collection from racing greyhounds in Florida.<br/>
<sup>b</sup> Microneutralization assay antibody titers for seropositive dogs, including the range for the six 2003 seropositive dogs.</entry></row></tbody></tgroup>
</table>
</tables>
<tables id="tabl0006" num="0006">
<table frame="all">
<tgroup cols="5">
<colspec colnum="1" colname="col1" colwidth="43mm"/>
<colspec colnum="2" colname="col2" colwidth="31mm"/>
<colspec colnum="3" colname="col3" colwidth="31mm"/>
<colspec colnum="4" colname="col4" colwidth="31mm"/>
<colspec colnum="5" colname="col5" colwidth="31mm"/>
<thead>
<row>
<entry namest="col1" nameend="col5" align="center" valign="middle"><b>Table 6.</b> Antibody response to A/canine/Florida/43/2004 (H3N8) in racing greyhounds at 4 Florida tracks in June 2004.</entry></row>
<row>
<entry valign="middle"><b>Response</b></entry>
<entry align="center" valign="middle"><b>Track A</b></entry>
<entry align="center" valign="middle"><b>Track B</b></entry>
<entry align="center" valign="middle"><b>Track C</b></entry>
<entry align="center" valign="middle"><b>Track D</b></entry></row></thead>
<tbody>
<row>
<entry valign="middle">Number of dogs tested<sup>a</sup></entry>
<entry align="center" valign="middle">37</entry>
<entry align="center" valign="middle">10</entry>
<entry align="center" valign="middle">22</entry>
<entry align="center" valign="middle">25</entry></row>
<row>
<entry valign="middle">Seroconversion (%)<sup>b</sup></entry>
<entry align="center" valign="middle">46</entry>
<entry align="center" valign="middle">90</entry>
<entry align="center" valign="middle">100</entry>
<entry align="center" valign="middle">64</entry></row>
<row>
<entry valign="middle">Seropositive (%)<sup>c</sup></entry>
<entry align="center" valign="middle">100</entry>
<entry align="center" valign="middle">100</entry>
<entry align="center" valign="middle">100</entry>
<entry align="center" valign="middle">100</entry></row>
<row>
<entry valign="middle">Geometric mean titer<sup>d</sup></entry>
<entry align="center" valign="middle">401</entry>
<entry align="center" valign="middle">512</entry>
<entry align="center" valign="middle">290</entry>
<entry align="center" valign="middle">446</entry></row></tbody></tgroup>
<tgroup cols="5" rowsep="0">
<colspec colnum="1" colname="col1" colwidth="43mm"/>
<colspec colnum="2" colname="col2" colwidth="31mm"/>
<colspec colnum="3" colname="col3" colwidth="31mm"/>
<colspec colnum="4" colname="col4" colwidth="31mm"/>
<colspec colnum="5" colname="col5" colwidth="31mm"/>
<tbody>
<row>
<entry namest="col1" nameend="col5" align="justify"><sup>a</sup> Number of clinically diseased dogs tested by HI using A/canine/Florida/43/2004 (H3N8).<br/>
<sup>b</sup> Percentage of dogs with ≥4-fold increase in antibody titer between acute and convalescent sera.<br/>
<sup>c</sup> Percentage of dogs with a positive antibody titer (HI titer&gt;16) in the convalescent sera.<br/>
<sup>d</sup> Geometric mean antibody titer for the convalescent sera.</entry></row></tbody></tgroup>
</table>
</tables></p>
<heading id="h0023">MATERIALS AND METHODS FOR EXAMPLES 7-11</heading>
<heading id="h0024"><u>Canine tissues</u></heading>
<p id="p0143" num="0143">Postmortem examinations were performed by the Anatomic Pathology Service at the University of Florida College of Veterinary Medicine on 6 mixed breed dogs that died in April/May 2005 during an influenza outbreak in a shelter facility in northeast Florida, and on a pet Yorkshire Terrier dog that died in May 2005 during an influenza outbreak in a<!-- EPO <DP n="60"> --> veterinary clinic in southeast Florida. Tissues were fixed in 10% neutral buffered formalin, embedded in paraffin, and 5-µm sections were stained with hematoxylin and eosin for histopathologic diagnosis. Unfixed tissues were stored at -80°C pending virological analyses.</p>
<heading id="h0025"><u>RNA extraction from canine tissue samples</u></heading>
<p id="p0144" num="0144">Frozen lung tissues from each of the 7 dogs were thawed and homogenized in minimum essential medium (MEM) supplemented with 0.5% bovine serum albumin (BSA) and antibiotics (gentamycin and ciprofloxacin) using a disposable tissue grinder (Kendall, Lifeline Medical Inc., Danbury, CT). Total RNA was extracted using a commercial kit (RNeasy<sup>®</sup> Mini Kit, QIAGEN Inc., Valencia, CA) according to manufacturer's instructions and eluted in a final volume of 60 µL of buffer. Total RNA was also extracted from lung tissue collected from dogs without respiratory disease.</p>
<heading id="h0026"><u>Real-time RT-PCR</u></heading>
<p id="p0145" num="0145">A single-step quantitative real-time RT-PCR was performed on total RNA extracted from the canine tissue samples using the QuantiTect<sup>®</sup> Probe RT-PCR Kit containing ROX as a passive reference dye (QIAGEN Inc., Valencia, CA). Briefly, 2 primer-probe sets were used for detection of influenza A sequences in each sample (<b>Table 7</b>). One primer-probe set was selective for canine hemagglutinin (H3) gene sequences. The other primer-probe set targeted a highly conserved region of the matrix (M) gene of type A influenza virus. For each real-time RT-PCR reaction, 5 µL of extracted total RNA were added to a reaction mixture containing 12.5 µL of 2X QuantiTech<sup>®</sup> Probe RT-PCR Master Mix, 0.25 µL of QuantiTech<sup>®</sup> RT Mix, forward and reverse primers (0.4 µM final concentration for each), probe (0.1 µM final concentration) and RNase-free water in a final volume of 25 µL. The TaqMan<sup>®</sup> Ribosomal RNA Control Reagents (Applied Biosystems, Foster City, CA) were used according to manufacturer's instructions for detection of 18S rRNA as an endogenous internal control for the presence of RNA extracted from the canine tissue samples.</p>
<p id="p0146" num="0146">Quantitative one-step real-time RT-PCR was performed on the reaction mixtures in a Mx3000P<sup>®</sup> QPCR System (Stratagene, La Jolla, CA). Cycling conditions included a reverse transcription step at 50°C for 30 minutes, an initial denaturation step at 95°C for 15 minutes to activate the HotStarTaq<sup>®</sup> DNA polymerase, and amplification for 40 cycles. Each amplification cycle included denaturation at 94°C for 15 seconds followed by<!-- EPO <DP n="61"> --> annealing/extension at 60°C for 1 minute. The FAM (emission wavelength 518 nm) and VIC (emission wavelength 554 nm) fluorescent signals were recorded at the end of each cycle. The threshold cycle (Ct) was determined by setting the threshold fluorescence (dR) at 1000 in each individual experiment. The Mx3000P<sup>®</sup> version 2.0 software program (Stratagene, La Jolla, CA) was used for data acquisition and analysis. Samples were considered positive for influenza A virus when the threshold cycle (Ct) for the H3 or M gene was 3 units smaller than the Ct for lung tissues from dogs without respiratory disease. The positive control consisted of amplification of RNA extracted from A/canine/FL/242/03 (H3N8) virus.</p>
<heading id="h0027"><u>Virus isolation in MDCK cells</u></heading>
<p id="p0147" num="0147">Frozen lung tissues from each of the 7 dogs were thawed and homogenized in 10 volumes of Dulbecco's Modified Eagle Medium (DMEM) supplemented with 0.5% (BSA) and antibiotics (gentamycin and ciprofloxacin). Solid debris was removed by centrifugation and supernatants were inoculated onto Madin-Darby canine kidney (MDCK) cells cultured in DMEM supplemented with 1 µg/mL TPCK-treated trypsin (Sigma-Aldrich Corp., St. Louis, MO) and antibiotics (gentamycin and ciprofloxacin). Cells were grown in 25 cm<sup>2</sup> flasks at 37°C in a humidified atmosphere containing 5% CO<sub>2</sub>. The cultures were observed daily for morphologic changes and harvested at 5 days post inoculation. The harvested cultures were clarified by centrifugation and the supernatants inoculated onto fresh MDCK cells as described for the initial inoculation; two additional passages were performed for samples that did not show evidence of influenza virus by hemagglutination or RT-PCR. Hemagglutination activity in the clarified supernatants was determined using 0.5% turkey red blood cells as previously described (Burleson, F. <i>et al.,</i> 1992; Kendal, P. <i>et al.,</i> 1982). RT-PCR was performed as described below.</p>
<heading id="h0028"><u>Virus isolation in embryonated chicken eggs</u></heading>
<p id="p0148" num="0148">Homogenates were prepared from frozen lung tissues as described above for inoculation of MDCK cells. The homogenates (0.2 mL) were inoculated into the allantoic sac of 10-day old embryonated chicken eggs. After 48 hours of incubation at 35°C, the eggs were chilled at 4°C overnight before harvesting the allantoic fluid. Hemagglutination activity in the clarified supernatants was determined using 0.5% turkey red blood cells as previously described (Burleson, F. <i>et al.,</i> 1992; Kendal, P. <i>et al.,</i> 1982). RT-PCR was performed as<!-- EPO <DP n="62"> --> described below. Two additional passages in embryonated eggs were performed for samples that did not show evidence of influenza virus after the initial inoculation.</p>
<heading id="h0029"><u>RT-PCR nucleotide sequencing, and phylogenetic analyses</u></heading>
<p id="p0149" num="0149">Viral RNA was extracted from MDCK supernatant or allantoic fluid using the QIAamp<sup>®</sup> Viral RNA Mini Kit (QIAGEN Inc., Valencia, CA) according to manufacturer's instructions. The viral RNA was reverse transcribed to cDNA using the QIAGEN<sup>®</sup> OneStep RT-PCR Kit (QIAGEN Inc., Valencia, CA) according to manufacturer's instructions. PCR amplification of the coding region of the 8 influenza viral genes in the cDNA was performed as previously described (Klimov, A. <i>et al.,</i> 1992b), using universal gene-specific primer sets (primer sequences available on request). The resulting DNA amplicons were used as templates for automated sequencing in the ABI PRISM<sup>®</sup> 3100 automated DNA sequencer using cycle sequencing dye terminator chemistry (Applied Biosystems, Foster City, CA). Nucleotide sequences were analyzed using the Lasergene 6 Package<sup>®</sup> (DNASTAR, Inc., Madison, WI). The PHYLIP Version 3.5<sup>©</sup> software program was used to estimate phylogenies and calculate bootstrap values from the nucleotide sequences (Felsenstein, J., 1989). Phylogenetic trees were compared to those generated by neighbor-joining analysis with the Tamura-Nei model implemented in the MEGA<sup>©</sup> program (Kumar, S. <i>et al.,</i> 2004) and confirmed by the PAUP<sup>©</sup> 4.0 Beta program (Sinauer Associates, Inc., Sunderland, MA).</p>
<heading id="h0030"><u>Hemagglutination inhibition assay</u></heading>
<p id="p0150" num="0150">Serum samples were incubated with receptor destroying enzyme (RDE, DENKA SEIKEN Co., Ltd., Tokyo, Japan) (1 part serum: 3 parts RDE) for 16 hours at 37°C prior to heat inactivation for 30 minutes at 56°C. Influenza A/Canine/Jacksonville/05 (H3N8) virus was grown in MDCK cells for 72 hrs at 37°C in 5% CO<sub>2</sub>. Virus culture supernatants were harvested, clarified by centrifugation, and stored at -80°C. All other viruses used in the HI assay were grown in 10-day old embryonated chicken eggs from which allantoic fluid was collected and stored at -80°C. The HI assay was performed as described previously (Kendal, P. <i>et al.,</i> 1982). Briefly, 4 hemagglutinating units of virus in 25 µl were added to an equal volume of serially diluted serum in 96-well plastic plates and incubated at room temperature for 30 minutes. An equal volume of 0.5% turkey erythrocytes was added and the hemagglutination titers were estimated visually after 30 minutes. The endpoint HI titer was defined as the last dilution of serum that completely inhibited hemagglutination.<!-- EPO <DP n="63"> --></p>
<heading id="h0031"><u>EXAMPLE 7-CLINICAL CASES</u></heading>
<p id="p0151" num="0151">In April and May 2005, a previously described (Crawford, P.C. <i>et al.,</i> 2005) respiratory disease outbreak occurred in dogs housed in a shelter facility in northeast Florida. The outbreak involved at least 58 dogs ranging in age from 3 months to 9 years, and included purebred dogs as well as mixed breeds. The most common clinical signs were purulent nasal discharge and a cough for 7 to 21 days. Of the 43 dogs that had clinical disease for ≥7 days, 41 had HI antibody titers to canine/FL/04 (H3N8) ranging from 32 to &gt;1024. At least 10 dogs progressed to pneumonia, of which 6 were euthanized. These 6 mixed breed dogs included 3 males and 3 females ranging in age from 4 months to 3 years. The duration of clinical signs ranged from 2 to 10 days at the time of euthanasia. On postmortem examination, these dogs had pulmonary congestion and edema. Histological examination of the respiratory tract revealed rhinitis, tracheitis, bronchitis, bronchiolitis, and suppurative bronchopneumonia. There was epithelial cell necrosis and erosion in the trachea, bronchi, bronchioles, and bronchial glands. The respiratory tissues were infiltrated by neutrophils and macrophages.</p>
<p id="p0152" num="0152">In May 2005, a respiratory disease outbreak occurred in 40 pet dogs at a veterinary clinic in southeast Florida. The most common clinical signs were purulent nasal discharge and a cough for 10 to 30 days. Of the 40 dogs, 17 were seropositive for canine/FL/04 (H3N8) with HI antibody tiers ranging from 32 to &gt;1024. Seroconversion occurred in 10 dogs for which paired acute and convalescent sera were available. Three dogs progressed to pneumonia. One of these dogs, a 9-year old male Yorkshire Terrier, died 3 days after onset of clinical signs. This dog had tracheobronchitis, pulmonary edema and congestion, and severe bronchopneumonia. Similar to the 6 shelter dogs, there was epithelial cell necrosis and erosion of the airways and neutrophilic infiltrates in the tissues.</p>
<heading id="h0032"><u>EXAMPLE 8-REAL-TIME RT-PCR AND VIRAL ISOLATION</u></heading>
<p id="p0153" num="0153">Lung tissues from the 7 dogs were analyzed by quantitative real-time RT-PCR assays that detect the M gene of influenza type A and the H3 gene of canine H3N8 influenza A virus. The lungs from all 7 dogs were positive for both the influenza A M gene and the canine influenza H3 gene (Table 8). After 3 passages in MDCK cells, influenza A subtype H3N8 virus was isolated from the lungs of a shelter dog that died after 3 days of pneumonia. This virus was named A/canine/Jacksonville/05 (H3N8) (canine/Jax/05). After 2 passages in<!-- EPO <DP n="64"> --> embryonated chicken eggs, influenza A subtype H3N8 virus was recovered from the lungs of the pet dog that also died after 3 days of pneumonia. This virus was named A/canine/Miami//05 (H3N8) (canine/Miami/05).</p>
<heading id="h0033"><u>EXAMPLE 9-GENETIC ANALYSES OF THE CANINE INFLUENZA A H3N8 ISOLATES</u></heading>
<p id="p0154" num="0154">Sequence analyses of canine/Jax/05 and canine/Miami/05 revealed that their hemagglutinin (HA) genes were 98% identical to the canine/FL/04, canine/TX/04, and canine/Iowa/05 isolates recovered from the lungs of racing greyhounds that died of pneumonia during influenza outbreaks at tracks in 2004 and 2005 (Crawford, P.C. <i>et al.,</i> 2005; Yoon K-Y. <i>et al.,</i> 2005). In addition, the HA genes of canine/Jax/05 and canine/Miami/05 were 98% identical to contemporary equine influenza viruses isolated after the year 2000. Phylogenetic comparisons of the HA genes showed that the canine/Jax/05 and canine/Miami/05 viruses were clustered with the canine/FL/04, canine/TX/04, and canine/Iowa/05 greyhound isolates and contemporary equine isolates, forming a distinct group from the older equine viruses isolated in the early 1990's (<figref idref="f0005">Figure 4</figref>). Furthermore, the canine/Jax/05, canine/Miami/05, and canine/Iowa/05 isolates were more closely related to canine/Tx/04 than to either canine/FL/04 or canine/FL/03. The 2005 isolates formed a subgroup that appears to branch off from the earlier 2003 and 2004 canine viruses with differences at approximately 10 parsimony-informative sites. These differences support the hypothesis that canine influenza virus is being transmitted horizontally from dog-to-dog as opposed to being reintroduced periodically from an outside source. The accumulation of mutations from 2003 to 2005 illustrates the ongoing process of adaptation that the virus must undergo after being transmitted to a new host, as is expected to have happened for the canine influenza viruses.</p>
<heading id="h0034"><u>EXAMPLE 10-AMINO ACID ANALYSES OF THE CANINE INFLUENZA A H3N8 ISOLATES.</u></heading>
<p id="p0155" num="0155">There were conserved amino acid substitutions in all 6 canine isolates that differentiated them from contemporary equine influenza viruses (Table 9). These conserved substitutions were I15M, N83S, W222L, I328T, and N483T. Phylogenetic comparisons of the mature HA protein showed that the canine/Jax/05, canine/Miami/05, and canine/Iowa/05 viruses formed a subgroup with the canine/TX/04 isolate (<figref idref="f0005">Figure 4</figref>). There were 3 amino<!-- EPO <DP n="65"> --> acid changes (L118V, K261N, and G479E) that differentiated this subgroup from the other canine viruses (Table 9). There were 2 amino acid changes (F79L and G218E) that differentiated the 2005 isolates from their canine/TX/04 root. Furthermore, the 2005 isolates from non-greyhound dogs, canine/Jax/05 and canine/Miami/05, differed from the canine/Iowa/05 greyhound isolate by one amino acid change, R492K. Finally, canine/Jax/05 differed from canine/Miami/05 at a single amino acid, S107P. In all other H3N8 equine and canine viruses, S is conserved at position 107 except for A/Equine/Jilin/1/89 which has a T (Guo Y. <i>et al.,</i> 1992).</p>
<heading id="h0035"><u>EXAMPLE 11 ANTIGENIC ANALYSES OF THE CANINE INFLUENZA A H3N8 ISOLATES</u></heading>
<p id="p0156" num="0156">Hemagglutination inhibition (HI) tests were performed using an antigen panel of older and contemporary equine influenza viruses and the canine influenza viruses, and serum collected in 2005 from horses and dogs that had been infected with influenza virus (<b>Table 10</b>). Serum from ferrets immunized against canine/FL/04 was also included in the analyses. The HI antibody titers in equine serum were 8 to 16-fold higher when tested with contemporary equine viruses compared to older isolates, but decreased by at least 4-fold when tested with the canine viruses. The canine serum was nonreactive with the older equine viruses, but the antibody titers increased 4-fold when tested with contemporary equine isolates and canine isolates. This was also observed for the serum from ferrets immunized against canine influenza virus. These seroreactivity patterns demonstrated the antigenic similarity between the canine influenza viruses and contemporary equine influenza viruses and were consistent with the phylogenetic analyses. The antibody titers in equine, canine, and ferret sera to the canine/Miami/05 isolate were similar to those for the 2003 and 2004 canine isolates. However, the titers were 2 to 4-fold lower for the canine/Jax/05 isolate. This suggests that canine/Jax/05 is antigenically distinct from the other canine isolates, which may in part be related to the single amino acid change at position 107 in the mature HA.<!-- EPO <DP n="66"> -->
<tables id="tabl0007" num="0007">
<table frame="all">
<tgroup cols="4">
<colspec colnum="1" colname="col1" colwidth="32mm"/>
<colspec colnum="2" colname="col2" colwidth="32mm"/>
<colspec colnum="3" colname="col3" colwidth="73mm"/>
<colspec colnum="4" colname="col4" colwidth="31mm"/>
<thead>
<row>
<entry namest="col1" nameend="col4" align="center" valign="top"><b>Table 7.</b> Primers and probes for quantitative real-time RT-PCR analysis for the matrix gene of influenza A virus and the H3 gene of canine influenza A (H3N8).</entry></row>
<row>
<entry align="center" valign="top"><b>Primer</b></entry>
<entry align="center" valign="top"><b>Target</b></entry>
<entry align="center" valign="top"><b>Sequence</b></entry>
<entry align="center" valign="top"><b>Application</b></entry></row></thead>
<tbody>
<row>
<entry>Ca-H3-F387</entry>
<entry>H3 (nt 387-406)</entry>
<entry>5'-tatgcatcgctccgatccat-3' (SEQ ID NO: 79)</entry>
<entry>Forward primer for H3</entry></row>
<row>
<entry>Ca-H3-R487</entry>
<entry>H3 (nt 487-467)</entry>
<entry>5'-gctccacttcttccgttttga-3' (SEQ ID NO: 80)</entry>
<entry>Reverse primer for H3</entry></row>
<row>
<entry>Ca-H3-P430</entry>
<entry>H3 (nt 430-459)</entry>
<entry>FAM-aattcacagcagagggattcacatggacag-BHQ1 (SEQ ID NO: 81)</entry>
<entry>TaqMan® probe</entry></row>
<row>
<entry>FluA-M-F151</entry>
<entry>M (nt 151-174)</entry>
<entry>5'-catgga<u>r</u>tggctaaagacaagacc-3'<sup>a</sup> (SEQ ID NO: 82)</entry>
<entry>Forward primer for M</entry></row>
<row>
<entry>FluA-M-R276</entry>
<entry>M (nt 276-253)</entry>
<entry>5'-agggcattttggacaaa<u>k</u>cgtcta-3' (SEQ ID NO: 83)</entry>
<entry>Reverse primer for M</entry></row>
<row>
<entry>FluA-M-P218</entry>
<entry>M (nt 218-235)</entry>
<entry>FAM-acgcTcaccgTgcccAgt-BHQ1<sup>b</sup> (SEQ ID NO: 84)</entry>
<entry>TaqMan® probe</entry></row></tbody></tgroup><!-- EPO <DP n="67"> -->
<tgroup cols="4" rowsep="0">
<colspec colnum="1" colname="col1" colwidth="32mm"/>
<colspec colnum="2" colname="col2" colwidth="32mm"/>
<colspec colnum="3" colname="col3" colwidth="73mm"/>
<colspec colnum="4" colname="col4" colwidth="31mm"/>
<tbody>
<row>
<entry namest="col1" nameend="col4" align="justify"><sup>a</sup> Underlined letter r represents nucleotide a or g and underlined letter k represents nucleotide g or t.<br/>
<sup>b</sup> Uppercase letters represent locked nucleic acid residues.</entry></row></tbody></tgroup>
</table>
</tables>
<tables id="tabl0008" num="0008">
<table frame="all">
<tgroup cols="6">
<colspec colnum="1" colname="col1" colwidth="17mm"/>
<colspec colnum="2" colname="col2" colwidth="39mm"/>
<colspec colnum="3" colname="col3" colwidth="17mm"/>
<colspec colnum="4" colname="col4" colwidth="14mm"/>
<colspec colnum="5" colname="col5" colwidth="14mm"/>
<colspec colnum="6" colname="col6" colwidth="33mm"/>
<thead>
<row>
<entry namest="col1" nameend="col6" align="center" valign="middle"><b>Table 8.</b> Quantitative real-time RT-PCR and viral isolation performed on lung tissues from dogs that died from pneumonia during respiratory disease outbreaks in a shelter and veterinary clinic in Florida.</entry></row>
<row>
<entry morerows="1" align="center" valign="middle"><b>Dog ID</b></entry>
<entry morerows="1" align="center" valign="middle"><b>Location</b></entry>
<entry morerows="1" align="center" valign="middle"><b>Duration of clinical disease</b></entry>
<entry namest="col4" nameend="col5" align="center" valign="middle"><b>Real-time RT-PCR</b></entry>
<entry morerows="1" align="center" valign="middle"><b>Virus Isolation</b></entry></row>
<row>
<entry align="center" valign="middle"><b>M (Ct)</b></entry>
<entry align="center" valign="middle"><b>HA (Ct)</b></entry></row></thead>
<tbody>
<row>
<entry namest="col1" nameend="col3" align="left" valign="middle">A/canine/FL/242/03 positive control</entry>
<entry align="center" valign="middle">28.15</entry>
<entry align="center" valign="middle">27.36</entry>
<entry align="center" valign="middle"/></row>
<row>
<entry align="center" valign="middle">1079</entry>
<entry valign="middle">Shelter (NE FL)</entry>
<entry align="center" valign="middle">2 days</entry>
<entry align="center" valign="middle">29.81</entry>
<entry align="center" valign="middle">28.84</entry>
<entry align="center" valign="middle">none</entry></row>
<row>
<entry align="center" valign="middle">1078</entry>
<entry valign="middle">Shelter (NE FL)</entry>
<entry align="center" valign="middle">3 days</entry>
<entry align="center" valign="middle">30.37</entry>
<entry align="center" valign="middle">29.71</entry>
<entry align="center" valign="middle">MDCK 3<sup>rd</sup> passage</entry></row>
<row>
<entry align="center" valign="middle">318</entry>
<entry valign="middle">Shelter (NE FL)</entry>
<entry align="center" valign="middle">9 days</entry>
<entry align="center" valign="middle">33.89</entry>
<entry align="center" valign="middle">32.97</entry>
<entry align="center" valign="middle">none</entry></row>
<row>
<entry align="center" valign="middle">320</entry>
<entry valign="middle">Shelter (NE FL)</entry>
<entry align="center" valign="middle">10 days</entry>
<entry align="center" valign="middle">39.44</entry>
<entry align="center" valign="middle">37.09</entry>
<entry align="center" valign="middle">none</entry></row>
<row>
<entry align="center" valign="middle">319</entry>
<entry valign="middle">Shelter (NE FL)</entry>
<entry align="center" valign="middle">6 days</entry>
<entry align="center" valign="middle">33.87</entry>
<entry align="center" valign="middle">32.23</entry>
<entry align="center" valign="middle">none</entry></row>
<row>
<entry align="center" valign="middle">1080</entry>
<entry valign="middle">Shelter (NE FL)</entry>
<entry align="center" valign="middle">6 days</entry>
<entry align="center" valign="middle">38.87</entry>
<entry align="center" valign="middle">38.23</entry>
<entry align="center" valign="middle">none</entry></row>
<row>
<entry align="center" valign="middle">374</entry>
<entry valign="middle">Veterinary clinic (SE FL)</entry>
<entry align="center" valign="middle">3 days</entry>
<entry align="center" valign="middle">24.05</entry>
<entry align="center" valign="middle">22.65</entry>
<entry align="center" valign="middle">Egg 2<sup>nd</sup> passage</entry></row></tbody></tgroup><!-- EPO <DP n="68"> -->
</table>
</tables>
<tables id="tabl0009" num="0009">
<table frame="all">
<tgroup cols="19">
<colspec colnum="1" colname="col1" colwidth="42mm"/>
<colspec colnum="2" colname="col2" colwidth="9mm"/>
<colspec colnum="3" colname="col3" colwidth="9mm"/>
<colspec colnum="4" colname="col4" colwidth="9mm"/>
<colspec colnum="5" colname="col5" colwidth="9mm"/>
<colspec colnum="6" colname="col6" colwidth="9mm"/>
<colspec colnum="7" colname="col7" colwidth="9mm"/>
<colspec colnum="8" colname="col8" colwidth="9mm"/>
<colspec colnum="9" colname="col9" colwidth="10mm"/>
<colspec colnum="10" colname="col10" colwidth="10mm"/>
<colspec colnum="11" colname="col11" colwidth="10mm"/>
<colspec colnum="12" colname="col12" colwidth="10mm"/>
<colspec colnum="13" colname="col13" colwidth="10mm"/>
<colspec colnum="14" colname="col14" colwidth="10mm"/>
<colspec colnum="15" colname="col15" colwidth="10mm"/>
<colspec colnum="16" colname="col16" colwidth="10mm"/>
<colspec colnum="17" colname="col17" colwidth="10mm"/>
<colspec colnum="18" colname="col18" colwidth="10mm"/>
<colspec colnum="19" colname="col19" colwidth="10mm"/>
<thead>
<row>
<entry namest="col1" nameend="col19" align="center" valign="middle"><b>Table 9.</b> Amino acid comparison of the mature HA for canine influenza viruses and contemporary equine influenza viruses.</entry></row>
<row>
<entry valign="middle"/>
<entry namest="col2" nameend="col19" align="center" valign="middle"><b>Amino Acid</b></entry></row>
<row>
<entry valign="middle"/>
<entry align="center" valign="middle">7</entry>
<entry align="center" valign="middle"><b>15</b></entry>
<entry align="center" valign="middle">54</entry>
<entry align="center" valign="middle">78</entry>
<entry align="center" valign="middle">79</entry>
<entry align="center" valign="middle"><b>83</b></entry>
<entry align="center" valign="middle">92</entry>
<entry align="center" valign="middle">107</entry>
<entry align="center" valign="middle">118</entry>
<entry align="center" valign="middle">159</entry>
<entry align="center" valign="middle">218</entry>
<entry align="center" valign="middle"><b>222</b></entry>
<entry align="center" valign="middle">261</entry>
<entry align="center" valign="middle"><b>328</b></entry>
<entry align="center" valign="middle">479</entry>
<entry align="center" valign="middle"><b>483</b></entry>
<entry align="center" valign="middle">492</entry>
<entry align="center" valign="middle">541</entry></row></thead>
<tbody>
<row>
<entry valign="middle"><b>A/equine/KY/5/02</b></entry>
<entry align="center" valign="middle">G</entry>
<entry align="center" valign="middle"><b>I</b></entry>
<entry align="center" valign="middle">N</entry>
<entry align="center" valign="middle">V</entry>
<entry align="center" valign="middle">F</entry>
<entry align="center" valign="middle"><b>N</b></entry>
<entry align="center" valign="middle">S</entry>
<entry align="center" valign="middle">S</entry>
<entry align="center" valign="middle">L</entry>
<entry align="center" valign="middle">N</entry>
<entry align="center" valign="middle">G</entry>
<entry align="center" valign="middle"><b>W</b></entry>
<entry align="center" valign="middle">K</entry>
<entry align="center" valign="middle"><b>I</b></entry>
<entry align="center" valign="middle">G</entry>
<entry align="center" valign="middle"><b>N</b></entry>
<entry align="center" valign="middle">R</entry>
<entry align="center" valign="middle">K</entry></row>
<row>
<entry valign="middle"><b>A/equine/MA/213/03</b></entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">A</entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">S</entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">.</entry></row>
<row>
<entry valign="middle"><b>A/equine/OH/1/03</b></entry>
<entry align="center" valign="middle">D</entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">K</entry>
<entry align="center" valign="middle">A</entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">S</entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">.</entry></row>
<row>
<entry valign="middle"><b>A/canine/FL/242/03</b></entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle"><b>M</b></entry>
<entry align="center" valign="middle">K</entry>
<entry align="center" valign="middle">A</entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle"><b>S</b></entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">S</entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle"><b>L</b></entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle"><b>T</b></entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle"><b>T</b></entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">.</entry></row>
<row>
<entry valign="middle"><b>A/canine/FL/43/04</b></entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle"><b>M</b></entry>
<entry align="center" valign="middle">K</entry>
<entry align="center" valign="middle">A</entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle"><b>S</b></entry>
<entry align="center" valign="middle">N</entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">S</entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle"><b>L</b></entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle"><b>T</b></entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle"><b>T</b></entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">R</entry></row>
<row>
<entry valign="middle"><b>A/canine/TX/1/04</b></entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle"><b>M</b></entry>
<entry align="center" valign="middle">K</entry>
<entry align="center" valign="middle">A</entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle"><b>S</b></entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">V</entry>
<entry align="center" valign="middle">S</entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle"><b>L</b></entry>
<entry align="center" valign="middle">N</entry>
<entry align="center" valign="middle"><b>T</b></entry>
<entry align="center" valign="middle">E</entry>
<entry align="center" valign="middle"><b>T</b></entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">.</entry></row>
<row>
<entry valign="middle"><b>A/canine/Iowa/05</b></entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle"><b>M</b></entry>
<entry align="center" valign="middle">K</entry>
<entry align="center" valign="middle">A</entry>
<entry align="center" valign="middle">L</entry>
<entry align="center" valign="middle"><b>S</b></entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">V</entry>
<entry align="center" valign="middle">S</entry>
<entry align="center" valign="middle">E</entry>
<entry align="center" valign="middle"><b>L</b></entry>
<entry align="center" valign="middle">N</entry>
<entry align="center" valign="middle"><b>T</b></entry>
<entry align="center" valign="middle">E</entry>
<entry align="center" valign="middle"><b>T</b></entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">.</entry></row>
<row>
<entry valign="middle"><b>A/canine/Miami/05</b></entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle"><b>M</b></entry>
<entry align="center" valign="middle">K</entry>
<entry align="center" valign="middle">A</entry>
<entry align="center" valign="middle">L</entry>
<entry align="center" valign="middle"><b>S</b></entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">V</entry>
<entry align="center" valign="middle">S</entry>
<entry align="center" valign="middle">E</entry>
<entry align="center" valign="middle"><b>L</b></entry>
<entry align="center" valign="middle">N</entry>
<entry align="center" valign="middle"><b>T</b></entry>
<entry align="center" valign="middle">E</entry>
<entry align="center" valign="middle"><b>T</b></entry>
<entry align="center" valign="middle">K</entry>
<entry align="center" valign="middle">.</entry></row>
<row>
<entry valign="middle"><b>Alcanine/Jacksonville/05</b></entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle"><b>M</b></entry>
<entry align="center" valign="middle">K</entry>
<entry align="center" valign="middle">A</entry>
<entry align="center" valign="middle">L</entry>
<entry align="center" valign="middle"><b>S</b></entry>
<entry align="center" valign="middle">.</entry>
<entry align="center" valign="middle">P</entry>
<entry align="center" valign="middle">V</entry>
<entry align="center" valign="middle">S</entry>
<entry align="center" valign="middle">E</entry>
<entry align="center" valign="middle"><b>L</b></entry>
<entry align="center" valign="middle">N</entry>
<entry align="center" valign="middle"><b>T</b></entry>
<entry align="center" valign="middle">E</entry>
<entry align="center" valign="middle"><b>T</b></entry>
<entry align="center" valign="middle">K</entry>
<entry align="center" valign="middle">.</entry></row></tbody></tgroup>
</table>
</tables><!-- EPO <DP n="69"> -->
<tables id="tabl0010" num="0010">
<table frame="all">
<tgroup cols="4">
<colspec colnum="1" colname="col1" colwidth="41mm"/>
<colspec colnum="2" colname="col2" colwidth="41mm"/>
<colspec colnum="3" colname="col3" colwidth="42mm"/>
<colspec colnum="4" colname="col4" colwidth="43mm"/>
<thead>
<row>
<entry namest="col1" nameend="col4" align="center" valign="middle"><b>Table 10</b>. Antibody titers in equine, canine, and ferret serum to older and contemporary equine influenza viruses and canine influenza viruses.</entry></row>
<row>
<entry align="center" valign="middle"/>
<entry colsep="0" align="center" valign="middle"><b>Serum</b></entry>
<entry colsep="0" align="center" valign="middle"><b>antibody</b></entry>
<entry align="center" valign="middle"><b>titers<sup>a</sup></b></entry></row>
<row>
<entry align="center" valign="middle"><b>Antigens</b></entry>
<entry align="center" valign="middle"><b>Equine</b></entry>
<entry align="center" valign="middle"><b>Canine</b></entry>
<entry align="center" valign="middle"><b>Ferret<sup>b</sup></b></entry></row></thead>
<tbody>
<row>
<entry valign="middle">equine/Miami/63</entry>
<entry align="center" valign="middle">40</entry>
<entry align="center" valign="middle">&lt;10</entry>
<entry align="center" valign="middle">16</entry></row>
<row>
<entry valign="middle">equine/Ky/86</entry>
<entry align="center" valign="middle">40</entry>
<entry align="center" valign="middle">40</entry>
<entry align="center" valign="middle">32</entry></row>
<row>
<entry valign="middle">equine/KY/92</entry>
<entry align="center" valign="middle">40</entry>
<entry align="center" valign="middle">&lt;10</entry>
<entry align="center" valign="middle">32</entry></row>
<row>
<entry valign="middle">equine/NY/99</entry>
<entry align="center" valign="middle">320</entry>
<entry align="center" valign="middle">40</entry>
<entry align="center" valign="middle">128</entry></row>
<row>
<entry valign="middle">equine/KY/05/02</entry>
<entry align="center" valign="middle">320</entry>
<entry align="center" valign="middle">160</entry>
<entry align="center" valign="middle">256</entry></row>
<row>
<entry valign="middle">equine/MA/213/03</entry>
<entry align="center" valign="middle">640</entry>
<entry align="center" valign="middle">160</entry>
<entry align="center" valign="middle">512</entry></row>
<row>
<entry valign="middle">equhxe/OH/01/03</entry>
<entry align="center" valign="middle">640</entry>
<entry align="center" valign="middle">160</entry>
<entry align="center" valign="middle">512</entry></row>
<row>
<entry valign="middle">canine/FL/03</entry>
<entry align="center" valign="middle">160</entry>
<entry align="center" valign="middle">160</entry>
<entry align="center" valign="middle">512</entry></row>
<row>
<entry valign="middle">canine/FL/04</entry>
<entry align="center" valign="middle">160</entry>
<entry align="center" valign="middle">80</entry>
<entry align="center" valign="middle">512</entry></row>
<row>
<entry valign="middle">canine/Tx/04</entry>
<entry align="center" valign="middle">160</entry>
<entry align="center" valign="middle">160</entry>
<entry align="center" valign="middle">512</entry></row>
<row>
<entry valign="middle">canine/Miami/05</entry>
<entry align="center" valign="middle">160</entry>
<entry align="center" valign="middle">80</entry>
<entry align="center" valign="middle">256</entry></row>
<row>
<entry valign="middle">canine/Jax/05</entry>
<entry align="center" valign="middle">40</entry>
<entry align="center" valign="middle">40</entry>
<entry align="center" valign="middle">128</entry></row></tbody></tgroup>
<tgroup cols="4" rowsep="0">
<colspec colnum="1" colname="col1" colwidth="41mm"/>
<colspec colnum="2" colname="col2" colwidth="41mm"/>
<colspec colnum="3" colname="col3" colwidth="42mm"/>
<colspec colnum="4" colname="col4" colwidth="43mm"/>
<tbody>
<row>
<entry namest="col1" nameend="col4" align="justify"><sup>a</sup> Antibody titers were determined in a hemagglutination inhibition assay performed with serial dilutions of equine, canine, or ferret serum and the viruses listed in the antigen column.<br/>
<sup>b</sup> Serum from ferrets immunized with canine/FL/04 virus.</entry></row></tbody></tgroup>
</table>
</tables></p>
<heading id="h0036">MATERIALS AND EXAMPLES METHODS FOR EXAMPLES 12-15</heading>
<heading id="h0037"><u>Canine influenza virus inoculum.</u></heading>
<p id="p0157" num="0157">The virus inoculum was prepared by inoculation of Madin-Darby canine kidney (MDCK) epithelial cells with a stock of A/canine/FL/43/04 (H3N8) representing passage 3 of<!-- EPO <DP n="70"> --> the original isolate previously described (Crawford <i>et al.,</i> 2005). The inoculated MDCK cells in Dulbecco's Minimal Essential Media (DMEM) supplemented with 1 µg/mL TPCK-treated trypsin (Sigma-Aldrich Corp., St. Louis, MO) and antibiotics (gentamycin and ciprofloxacin) were grown in 250 cm<sup>2</sup> flasks at 37°C in a humidified atmosphere containing 5% CO<sub>2</sub>. The cultures were observed daily for morphologic changes and harvested at 5 days post inoculation. The harvested cultures were clarified by centrifugation and the supernatants were stored at -80°C pending inoculation of dogs. An aliquot of supernatant was used for determination of virus titer by the Reed and Muench method. The titer was 10<sup>7</sup> median tissue culture infectious doses (TCID<sub>50</sub>) of A/canine/Florida/43/2004 (canine/FL/04) per mL.</p>
<heading id="h0038"><u>Experimental inoculation.</u></heading>
<p id="p0158" num="0158">Eight 4-month old colony bred mongrel dogs (Marshall BioResources, North Rose, NY) (4 males and 4 females) were used for the experimental inoculation study approved by the University of Florida Institutional Animal Care and Use Committee. The dogs' body weights ranged from 13 to 17 kg. The dogs were healthy based on physical examinations, baseline blood tests, and recording of body temperatures for 2 weeks prior to inoculation. All dogs were free from prior exposure to canine influenza virus based on serology tests performed on paired serum samples collected at the time of arrival into the facility and 2 weeks later. The dogs were anesthetized by intravenous injection of propofol (Diprivan®, Zeneca Pharmaceuticals, 0.4 mg/kg body weight to effect) for intubation with endotracheal tubes. Six dogs (3 males and 3 females) were each inoculated with 10<sup>7</sup> TCID<sub>50</sub> of canine/FL/04 virus in 5 mL of sterile saline administered into the distal trachea through a small diameter rubber catheter inserted into the endotracheal tube. Two dogs (1 male and 1 female) were sham-inoculated with an equal volume of sterile saline. The sham-inoculated control dogs were housed in a different room from the virus-inoculated dogs and cared for by different personnel. Physical examinations and rectal temperature recordings were performed twice daily for 6 days post inoculation (p.i.).</p>
<heading id="h0039"><u>Pharyngeal and rectal swab collection.</u></heading>
<p id="p0159" num="0159">To monitor for virus shedding, oropharyngeal specimens were collected twice daily from each dog on days 0 to 6 p.i. using polyester swabs (Fisher Scientific International Inc., Pittsburgh, PA). The swabs were placed in 1 mL of sterile phosphate-buffered saline (PBS) containing 0.5% bovine serum albumin (BSA). Rectal swabs were collected from each dog<!-- EPO <DP n="71"> --> daily from days 0 to 6. Swab extracts were prepared by clarification of the swab transport media by centrifugation. An aliquot of swab extract was tested immediately for influenza A virus nucleoprotein using the Directigen™ commercial immunoassay kit (BD, Franklin Lakes, NJ) according to the manufacturer's instructions. The remaining extract was stored at -80°C pending other virological assays.</p>
<heading id="h0040"><u>Postmortem examinations.</u></heading>
<p id="p0160" num="0160">On day 1 p.i., one sham-inoculated dog and one virus-inoculated dog were euthanatized by intravenous inoculation of Beuthanasia-D<sup>®</sup> solution (1 mL/5 kg body weight; Schering-Plough Animal Health Corp). One virus-inoculated dog was similarly euthanatized each day from days 2 to 5 p.i. On day 6 p.i., the remaining sham-inoculated and virus-inoculated dog were euthanatized. Complete postmortem examinations were performed by one of the investigators (WLC). Tissues were fixed in 10% neutral buffered formalin, embedded in paraffin, and 5-µm sections were either stained with hematoxylin and eosin for histopathologic diagnosis or processed for immunohistochemistry as described below. Unfixed lung tissues were submitted to the Diagnostic Clinical Microbiology/Parasitology/ Serology Service at the University of Florida College of Veterinary Medicine for bacterial isolation and identification. , The samples were cultured on nonselective media as well as media selective for <i>Bordetella</i> species (Regan-Lowe; Remel, Lenexa, KS) and <i>Mycoplasma</i> species (Remel). All cultures were held for 21 days before reporting no growth. Unfixed tissues were also stored at -80°C pending virological analyses.</p>
<heading id="h0041"><u>Immunohistochemistry.</u></heading>
<p id="p0161" num="0161">Deparaffinized and rehydrated 5-µm trachea and lung tissue sections were mounted on Bond-Rite™ slides (Richard-Allan Scientific, Kalamazoo, MI) and subsequently treated with proteinase K (DAKOCytomation Inc., Carpenteria, CA) followed by peroxidase blocking reagent (DAKO® EnVision™ Peroxidase Kit, DAKO Corp., Carpenteria, CA ). The sections were incubated with a 1:500 dilution of monoclonal antibody to influenza A H3 (Chemicon International, Inc., Ternecula, CA) for 2 hours at room temperature. Controls included incubation of the same sections with mouse IgG (1 mg/mL, Serotec, Inc. Raleigh, NC), and incubation of the monoclonal antibody with normal-canine lung sections. Following treatment with the primary antibody, the sections were incubated with secondary immunoperoxidase and peroxidase substrate reagents (Dako® EnVision™ Peroxidase Kit,<!-- EPO <DP n="72"> --> Dako Corp.) according to the manufacturer's instructions. The sections were counterstained with hematoxylin, treated with Clarifier #2 and Bluing Reagent (Richard-Allan Scientific, Kalamazoo, MI), dehydrated, and coverslips applied with Permount (ProSciTech, Queensland, Australia).</p>
<heading id="h0042"><u>RNA extraction from swabs and tissues.</u></heading>
<p id="p0162" num="0162">Lung and tracheal tissues from each dog were thawed and homogenized in minimum essential medium (MEM) supplemented with 0.5% bovine serum albumin (BSA) and antibiotics (gentamycin and ciprofloxacin) using a disposable tissue grinder (Kendall, Lifeline Medical Inc., Danbury, CT). Total RNA was extracted from the tissue homogenates as well as orpharyngeal and rectal swab extracts using a commercial kit (RNeasy<sup>®</sup> Mini Kit, QIAGEN Inc., Valencia, CA) according to manufacturer's instructions and eluted in a final volume of 60 µL of buffer.</p>
<heading id="h0043"><u>Real-time RT-PCR.</u></heading>
<p id="p0163" num="0163">A single-step quantitative real-time RT-PCR was performed on the total RNA using the QuantiTect<sup>®</sup> Probe RT-PCR Kit containing ROX as a passive reference dye (QIAGEN Inc., Valencia, CA) and a primer-probe set that targeted a highly conserved region of the matrix (M) gene of type A influenza virus (Payungporn S. <i>et al.,</i> 2006a; Payungporn S. <i>et al.,</i> 2006b). For each real-time RT-PCR reaction, 5 µL of extracted total RNA were added to a reaction mixture containing 12.5 µL of 2X QuantiTech<sup>®</sup> Probe RT-PCR Master Mix, 0.25 µL of QuantiTech<sup>®</sup> RT Mix, forward and reverse primers (0.4 µM final concentration for each), probe (0.1 µM final concentration) and RNase-free water in a final volume of 25 µL. The TaqMan<sup>®</sup> GAPDH Control Reagents (Applied Biosystems, Foster City, CA) were used according to manufacturer's instructions for detection of GAPDH as an endogenous internal control for the presence of RNA extracted from the swab and tissue samples and as a normalization control.</p>
<p id="p0164" num="0164">Quantitative one-step real-time RT-PCR was performed on the reaction mixtures in a Mx3000P<sup>®</sup> QPCR System (Stratagene, La Jolla, CA). Cycling conditions included a reverse transcription step at 50°C for 30 minutes, an initial denaturation step at 95°C for 15 minutes to activate the HotStarTaq<sup>®</sup> DNA polymerase, and amplification for 40 cycles. Each amplification cycle included denaturation at 94°C for 15 seconds followed by<!-- EPO <DP n="73"> --> annealing/extension at 60°C for 1 minute. The FAM (emission wavelength 518 nm) and VIC (emission wavelength 554 nm) fluorescent signals were recorded at the end of each cycle. The threshold cycle (Ct) was determined by setting the threshold fluorescence (dR) at 1000 in each individual experiment. The Mx3000P<sup>®</sup> version 2.0 software program (Stratagene, La Jolla, CA) was used for data acquisition and analysis. The positive control consisted of amplification of RNA extracted from A/canine/FL/242/03 (H3N8) virus. The results were normalized by dividing the M Ct value by the corresponding GAPDH Ct value for each sample.</p>
<heading id="h0044"><u>Virus re-isolation from tissues.</u></heading>
<p id="p0165" num="0165">Frozen lung and trachea tissues from virus-inoculated dogs were thawed and homogenized in 10 volumes of DMEM supplemented with 0.5% BSA and antibiotics. Solid debris was removed by centrifugation and supernatants were inoculated onto MDCK cells cultured in DMEM supplemented with 1 µg/mL TPCK-treated trypsin (Sigma-Aldrich Corp., St. Louis, MO) and antibiotics as described above. Cells were grown in 25 cm<sup>2</sup> flasks at 37°C in a humidified atmosphere containing 5% CO<sub>2</sub>. The cultures were observed daily for morphologic changes and harvested at 5 days post inoculation. The harvested cultures were clarified by centrifugation and the supernatants inoculated onto fresh MDCK cells as described for the initial inoculation; two additional passages were performed for samples that did not show evidence of influenza virus by hemagglutination or RT-PCR. Hemagglutination activity in the clarified supernatants was determined using 0.5% turkey red blood cells as previously described (Crawford <i>et al</i>., 2005). RT-PCR was performed as described below.</p>
<heading id="h0045"><u>RT-PCR, nucleotide sequencing, and phylogenetic analyses</u>.</heading>
<p id="p0166" num="0166">Viral RNA was extracted from MDCK supernatant using the QIAamp<sup>®</sup> Viral RNA Mini Kit (QIAGEN Inc., Valencia, CA) according to manufacturer's instructions. The viral RNA was reverse transcribed to cDNA using the QIAGEN<sup>®</sup> OneStep RT-PCR Kit (QIAGEN Inc., Valencia, CA) according to manufacturer's instructions. PCR amplification of the coding region of the 8 influenza viral genes in the cDNA was performed as previously described (Crawford <i>et al</i>., 2005), using universal gene-specific primer sets (primer sequences available on request). The resulting DNA amplicons were used as templates for automated sequencing in the ABI PRISM<sup>®</sup> 3100 automated DNA sequencer using cycle<!-- EPO <DP n="74"> --> sequencing dye terminator chemistry (Applied Biosystems, Foster City, CA). Nucleotide sequences were analyzed using the Lasergene 6 Package<sup>®</sup> (DNASTAR, Inc., Madison, WI). The nucleotide sequences for viruses recovered from infected dogs were compared to the sequences of the virus in the inoculum to determine if any changes had occurred during replication in the respiratory tract.</p>
<heading id="h0046"><u>EXAMPLE 12-CLINICAL DISEASE</u></heading>
<p id="p0167" num="0167">All 6 virus-inoculated dogs developed a transient fever (rectal temperature ≥39°C) for the first 2 days p.i., but none exhibited respiratory signs such as cough or nasal discharge over the 6-day observation period. The sham-inoculated dogs remained clinically healthy.</p>
<heading id="h0047"><u>EXAMPLE 13-VIRUS SHEDDING</u></heading>
<p id="p0168" num="0168">Influenza A nucleoprotein was detected in the oropharyngeal swab collected from one of the virus-inoculated dogs at 24 hours p.i. The oropharyngeal swabs collected from one dog at 72, 84, and 120 hours p.i., and another dog at 108, 120, and 132 hours p.i., were positive for virus by quantitative real-time RT-PCR (Table 11). The absolute number of influenza M gene copies per µL of swab extract increased with time from 3 to 6 days p.i. No virus was detected in the rectal swabs.</p>
<heading id="h0048"><u>EXAMPLE 14-POSTMORTEM EXAMINATIONS</u></heading>
<p id="p0169" num="0169">In contrast to the previous experimental infection using specific pathogen-free Beagles (Crawford <i>et al</i>., 2005), the virus-inoculated mongrel dogs had pneumonia as evidenced by gross and histological analyses of the lungs from days 1 to 6 p.i. In addition to pneumonia, the dogs had rhinitis, tracheitis, bronchitis, and bronchiolitis similar to that described in naturally infected dogs (Crawford <i>et al</i>., 2005). There was epithelial necrosis and erosion of the lining of the airways and bronchial glands with neutrophil and macrophage infiltration of the submucosal tissues (<figref idref="f0006">Figure 5</figref>, upper panels). Immunohistochemistry detected viral H3 antigen in the epithelial cells of bronchi, bronchioles, and bronchial glands (<figref idref="f0006">Figure 5</figref>, lower panels). No bacterial superinfection was present. The respiratory tissues from the 2 sham-inoculated dogs were normal.<!-- EPO <DP n="75"> --></p>
<heading id="h0049"><u>EXAMPLE 15-VIRUS REPLICATION IN TRACHEA AND LUNGS</u></heading>
<p id="p0170" num="0170">The trachea and lungs were positive for virus by quantitative real-time RT-PCR in all dogs from 1 to 6 days p.i. (Table 12). The absolute number of influenza M gene copies per µL of trachea homogenate increased from 1 to 5 days p.i., then decreased on day 6. The absolute number of M gene copies per µL of lung homogenate decreased from 1 to 6 days p.i. In general, the trachea contained ≥ one log<sub>10</sub> more virus than the lung on each of the 6 days p.i.
<tables id="tabl0011" num="0011">
<table frame="all">
<tgroup cols="4">
<colspec colnum="1" colname="col1" colwidth="41mm"/>
<colspec colnum="2" colname="col2" colwidth="42mm"/>
<colspec colnum="3" colname="col3" colwidth="42mm"/>
<colspec colnum="4" colname="col4" colwidth="43mm"/>
<thead>
<row>
<entry namest="col1" nameend="col4" align="center" valign="middle"><b>Table 11.</b> Detection of virus shedding in the oropharynx of mongrel dogs inoculated with canine influenza virus by quantitative real-time RT-PCR.</entry></row>
<row>
<entry align="center" valign="middle"><b>Dog ID</b></entry>
<entry align="center" valign="middle"><b>Time p.i. (hours)<sup>a</sup></b></entry>
<entry align="center" valign="middle"><b>M/GAPDH ratio<sup>b</sup></b></entry>
<entry align="center" valign="middle"><b>Matrix gene (copies / uL)<sup>c</sup></b></entry></row></thead>
<tbody>
<row>
<entry morerows="2" align="center" valign="middle">860</entry>
<entry align="center">72</entry>
<entry align="char" char="." charoff="5">1.20</entry>
<entry align="center">1.57E+02</entry></row>
<row>
<entry align="center">84</entry>
<entry align="char" char="." charoff="5">1.30</entry>
<entry align="center">8.25E+02</entry></row>
<row>
<entry align="center">120</entry>
<entry align="char" char="." charoff="5">1.23</entry>
<entry align="center">1.47E+03</entry></row>
<row>
<entry morerows="2" align="center" valign="middle">894</entry>
<entry align="center">108</entry>
<entry align="char" char="." charoff="5">1.17</entry>
<entry align="center">1.17E+02</entry></row>
<row>
<entry align="center">120</entry>
<entry align="char" char="." charoff="5">1.41</entry>
<entry align="center">1.37E+02</entry></row>
<row>
<entry align="center">132</entry>
<entry align="char" char="." charoff="5">1.27</entry>
<entry align="center">3.74E+02</entry></row></tbody></tgroup>
<tgroup cols="4" rowsep="0">
<colspec colnum="1" colname="col1" colwidth="41mm"/>
<colspec colnum="2" colname="col2" colwidth="42mm"/>
<colspec colnum="3" colname="col3" colwidth="42mm"/>
<colspec colnum="4" colname="col4" colwidth="43mm"/>
<tbody>
<row>
<entry namest="col1" nameend="col4" align="justify"><sup>a</sup> Time that oropharyngeal swabs were collected from the dogs following inoculation with A/canine/FL/43/04 (H3N8) virus.<br/>
<sup>b</sup> Normalization ratios were calculated by dividing the M (Ct) by the GAPDH (Ct) for each swab extract.<br/>
<sup>c</sup> The absolute number of matrix gene copies per uL of swab extract.</entry></row></tbody></tgroup>
</table>
</tables><!-- EPO <DP n="76"> -->
<tables id="tabl0012" num="0012">
<table frame="all">
<tgroup cols="6">
<colspec colnum="1" colname="col1" colwidth="28mm"/>
<colspec colnum="2" colname="col2" colwidth="27mm"/>
<colspec colnum="3" colname="col3" colwidth="29mm"/>
<colspec colnum="4" colname="col4" colwidth="28mm"/>
<colspec colnum="5" colname="col5" colwidth="28mm"/>
<colspec colnum="6" colname="col6" colwidth="28mm"/>
<thead>
<row>
<entry namest="col1" nameend="col6" align="center" valign="top"><b>Table 12.</b> Detection of virus replication in the trachea and lung of mongrel dogs inoculated with canine influenza virus by quantitative real-time RT-PCR.</entry></row>
<row>
<entry rowsep="0" align="center" valign="top"/>
<entry rowsep="0" align="center" valign="top"/>
<entry namest="col3" nameend="col4" align="center" valign="top"><b>M/GAPDH ratio<sup>b</sup></b></entry>
<entry namest="col5" nameend="col6" align="center" valign="top"><b>Matrix gene (copies / uL)<sup>c</sup></b></entry></row>
<row>
<entry align="center" valign="top"><b>Dog ID</b></entry>
<entry align="center" valign="top"><b>Time p.i. (hours)<sup>a</sup></b></entry>
<entry align="center" valign="top"><b>Lung</b></entry>
<entry align="center" valign="top"><b>Trachea</b></entry>
<entry align="center" valign="top"><b>Lung</b></entry>
<entry align="center" valign="top"><b>Trachea</b></entry></row></thead>
<tbody>
<row>
<entry align="center">797</entry>
<entry align="center">24</entry>
<entry align="char" char=".">1.20</entry>
<entry align="char" char="." charoff="7">1.43</entry>
<entry align="center">8.22E+05</entry>
<entry align="center">3.11E+04</entry></row>
<row>
<entry align="center">801</entry>
<entry align="center">48</entry>
<entry align="char" char=".">1.33</entry>
<entry align="char" char="." charoff="7">0.99</entry>
<entry align="center">1.15E+05</entry>
<entry align="center">6.52E+06</entry></row>
<row>
<entry align="center">789</entry>
<entry align="center">72</entry>
<entry align="char" char=".">1.44</entry>
<entry align="char" char="." charoff="7">1.12</entry>
<entry align="center">2.39E+04</entry>
<entry align="center">1.56E+05</entry></row>
<row>
<entry align="center">819</entry>
<entry align="center">96</entry>
<entry align="char" char=".">1.40</entry>
<entry align="char" char="." charoff="7">1.27</entry>
<entry align="center">3.19E+04</entry>
<entry align="center">1.43E+05</entry></row>
<row>
<entry align="center">860</entry>
<entry align="center">120</entry>
<entry align="char" char=".">1.59</entry>
<entry align="char" char="." charoff="7">1.04</entry>
<entry align="center">3.48E+03</entry>
<entry align="center">1.17E+06</entry></row>
<row>
<entry align="center">894</entry>
<entry align="center">144</entry>
<entry align="char" char=".">1.70</entry>
<entry align="char" char="." charoff="7">1.15</entry>
<entry align="center">4.78E+02</entry>
<entry align="center">1.50E+03</entry></row></tbody></tgroup>
<tgroup cols="6" rowsep="0">
<colspec colnum="1" colname="col1" colwidth="28mm"/>
<colspec colnum="2" colname="col2" colwidth="27mm"/>
<colspec colnum="3" colname="col3" colwidth="29mm"/>
<colspec colnum="4" colname="col4" colwidth="28mm"/>
<colspec colnum="5" colname="col5" colwidth="28mm"/>
<colspec colnum="6" colname="col6" colwidth="28mm"/>
<tbody>
<row>
<entry namest="col1" nameend="col6" align="justify"><sup>a</sup> Time that tissues were collected from the dogs following inoculation with A/canine/FL/43/04 (H3N8) virus.<br/>
<sup>b</sup> Normalization ratios were calculated by dividing the M (Ct) by the GAPDH (Ct) for each tissue homogenate.<br/>
<sup>c</sup> The absolute number of matrix gene copies per uL of tissue homogenate.</entry></row></tbody></tgroup>
</table>
</tables></p>
<heading id="h0050">MATERIALS AND EXAMPLES METHODS FOR EXAMPLE 16</heading>
<heading id="h0051"><u>Virus strains</u></heading>
<p id="p0171" num="0171">Canine influenza virus strains as well as those of avian, equine and human origin (listed in Table 15) were propagated in embryonated eggs or MDCK cells and their infectivity was titrated by endpoint dilution in chicken embryos, or plaque assay. Rapid virus quantification was performed by hemagglutination assay using turkey red blood cell erythrocytes.</p>
<heading id="h0052"><u>Diagnostic specimens</u></heading>
<p id="p0172" num="0172">A Total of 60 canine's lung tissues collected from suspect cases of viral respiratory disease during the year of 2005 were tested for the presence of canine influenza virus.<!-- EPO <DP n="77"> --></p>
<heading id="h0053"><u>RNA extraction from canine tissue samples</u></heading>
<p id="p0173" num="0173">Blocks of lung tissue weighing between 20 and 30 mg were homogenized in a disposable tissue grinder (Kendal). Total RNA was extracted using a commercial kit (RNeasy Mini Kit, Qiagen, Valencia, CA) and eluted in a final volume of 60 µL, following the manufacturer's recommendations.</p>
<heading id="h0054"><u>Primers and probes design</u></heading>
<p id="p0174" num="0174">Multiple sequence alignments of the H3 and M genes from various subtypes and from diverse species were performed using the CLUSTAL X program (Version 1.8). Matrix (M) primers and probe were selected from the conserved regions of over the known sequences corresponding to different subtypes of influenza A virus, whereas the H3 hemagglutinin gene-specific primers and probe set were selected to specifically match equine and canine influenza A virus genes and mismatch the homologous avian and human genes (Table 13). Primer design software (OLIGOS Version 9.1) and the web based analysis tools provided by EXIQON (http://lnatools.com) was used for Tm calculation and prediction of secondary structure as well as self hybridization. A conserved region of an 18S rRNA gene was used as endogenous internal control for the presence of RNA extracted from canine tissue sample. The Pre-Developed TaqMan® Assay Reagents for Eukaryotic 18S rRNA (VIC/TAMRA) (Applied Biosystems) was used for the real-time detection of 18S rRNA in tissue samples.</p>
<heading id="h0055"><u>Real-time RT-PCR condition</u></heading>
<p id="p0175" num="0175">A single-step real-time RT-PCR was performed by using the Quantitect Probe RT-PCR Kit containing ROX as a passive reference dye (Qiagen, Valencia, CA). In each realtime RT-PCR reaction, 5 µL of RNA sample were used as a template to combine with a reaction mixture containing 10 µL of 2X QuantiTech Probe RT-PCR Master Mix, 0.2 µL of QuantiTech RT Mix, primers (0.4 µM final conc. for H3 gene or 0.6 µM final conc. for M gene), probe (0.1 µM final conc. for H3 gene or 0.2 µM final conc. for M gene) and RNase-free water in a final volume of 20 µL. One-step real-time RT-PCR was performed in the Mx3005P Real-Time QPCR System (Stratagene). Cycling conditions included a reverse transcription step at 50°C for 30 minutes. After an initial denaturation step at 95°C for 15 minutes in order to activate the HotStarTaq DNA polymerase, amplification was performed during 40 cycles including denaturation (94°C for 15 seconds) and annealing/extension (60°C<!-- EPO <DP n="78"> --> for 30 seconds). The FAM (emission wavelength 516 nm for H3 and M detection) and VIC (emission wavelength 555 nm for 18S rRNA detection) fluorescent signals were obtained once per cycle at the end of the extension step. Data acquisition and analysis of the real-time PCR assay were performed using the Mx3005P software version 2.02 (Stratagene).</p>
<heading id="h0056"><u>Specificity of H3 primers/ probe set for canine influenza (H3N8) and universality of M primers/probe set for type A influenza virus</u></heading>
<p id="p0176" num="0176">In order to test the specificity of each primers/probe set, RNA extracted from several known subtypes of influenza A viruses were used as a template in the real-time RT-PCR assay (Table 15).</p>
<heading id="h0057"><u>RNA standard for determination of the real-timer RT-PCR performance</u></heading>
<p id="p0177" num="0177">The genes of canine influenza A virus (A/canine/Florida/242/2003(H3N8)) were used to generate the PCR amplicons for H3 (nt 1-487) and M (nt 1-276) by using primers linked with T7 promoter (Table 13). Then the purified PCR amplicons of H3 and M genes were used as templates for <i>in vitro</i> transcription by using Riboprobe <i>in vitro</i> Transcription System-T7 (Promega) following the manufacturer's recommendations. The concentration of the transcribed RNAs was calculated by measuring absorbance at 260 nm. The RNAs were then serially diluted 10-fold, ranging from 10<sup>8</sup> to 10 copies/ µL to perform sensitivity tests. Moreover, a standard curve was generated by plotting the log of initial RNA template concentrations (copies/ µL) against the threshold cycle (Ct) obtained from each dilution in order to determine the overall performance of real-time RT-PCR.</p>
<heading id="h0058"><u>Comparative sensitivity tests between real-time RT-PCR and Directigen Flu A test kit</u></heading>
<p id="p0178" num="0178">Stock viruses of two viral strains including A/Wyoming/3/2003 (H3N2) at 10<sup>6.67</sup> EID<sub>50</sub>/mL (HA=64) and A/canine/Florida/242/2003(H3N8) at 10<sup>7.17</sup> EID<sub>50</sub>/mL (HA=16) were used for the detection threshold assay. Logarithmic dilution of specimens in phosphate-buffered saline (PBS) (125 µL) were used in a rapid influenza A antigen detection kit, Directigen Flu A, (Becton, Dickinson and Company) following the manufacturer's instructions. Each Directigen Flu A test device has an H1N1 influenza antigen spot in the center of the membrane which develops as a purple dot and indicates the integrity of the test, which is based on a monoclonal antibody to the nucleoprotein (NP). The development of a<!-- EPO <DP n="79"> --> purple triangle surrounding the dot is indicative of the presence of influenza NP in the tested specimen. The intensity of the purple signal from the triangle was scored as + (outline of triangle), ++ (lightly colored triangle), +++ (dark-purple triangle) and ++++ (very dark-purple triangle). Viral RNA was extracted 125 µL aliquots of each virus dilution by using QIAamp Viral RNA Mini Kit (Qiagen, Valencia, CA) and eluting in a final volume of 50 µL. A volume of 5 uL of the extracted viral RNAs were tested by real-time RT-PCR for comparative sensitivity test with Directigen Flu A kit.</p>
<heading id="h0059"><u>EXAMPLE 16</u></heading>
<p id="p0179" num="0179">The real-time RT-PCR assay for canine influenza relies on information from three molecular probes which target 18S rRNA from host cell was well as M and H3 from the influenza A virus genome (Table 14). Amplification of the host gene is a reporter of specimen quality and integrity. Clinical, necropsy or laboratory samples containing canine influenza (H3N8) virus are expected to yield amplification signal with the three probes. Specimens yielding amplification signal with M and 18S rRNA probes but negative for H3 would be indicative of an influenza virus subtype H3 from human, swine or avian origin or from non-H3 subtypes. These rare cases could be resolved by RT-PCR using HA universal primers to generate amplicon cDNA that can be analyzed by sequencing. Properly collected and handled specimens lacking influenza A virus yield 18S rRNA amplification signal only. Situations in which only the 18S rRNA probe and the H3 probes yield amplification signal are indicative of faulty technique, unless proven otherwise; either a false negative with M probes or false positive for H3 need to be demostrated. Finally, specimens failing to yield amplification signals with the three probes are indicative of defective sample collection, degradation, faulty RNA extraction or the presence of inhibitors the polymerases used in PCR.</p>
<p id="p0180" num="0180">In order to test the specificity of the H3 primers/probe set for canine influenza A virus (H3N8) and the universality of M primers/probe set for type A influenza, several subtypes of influenza A viruses were tested by real-time RT-PCR. The results show that H3 primers/probe set yielded a positive amplification signal only with canine influenza (H3N8). No significant false positive or non-specific amplification signals were observed in other subtypes or human H3 strains. The M primers/probe set yielded positive amplification signal with all of the strains tested (Table 15). These results indicated that H3 primers/probe<!-- EPO <DP n="80"> --> specifically detects canine influenza A virus (H3N8) whereas M primers/probe detect multiple subtypes of type A influenza viruses.</p>
<p id="p0181" num="0181">The performance of real-time RT-PCR assays was evaluated by endpoint dilution of M and H3 <i>in vitro</i> transcribed RNAs. As expected, the threshold cycle (Ct) increased in direct correlation with the dilution of the RNA standards. The fluorescent signals can be detected at RNA standard dilutions of M and H3 as low as 10<sup>3</sup> and 102 copies/µL, respectively (<figref idref="f0007">Figure 6A and 6B</figref>). The standard curves of M and H3 genes were constructed by plotting the log of starting RNA concentrations against the threshold cycle (Ct) obtained from each dilution (<figref idref="f0008">Figure 6C and 6D</figref>). The slope of the standard curve is used to determine the PCR reaction efficiency, which is theoretically exponential; 100% amplification efficiency would imply doubling of amplicon cocentration each cycle. The standard curves with a slope between approximately -3.1 and -3.6 are typically acceptable for most applications requiring accurate quantification (90-110 % reaction efficiency). An Rsq value is the fit of all data to the standard curve plot. If all the data lie perfectly on the line, the Rsq will be 1.00. As the data fall further from the line, the Rsq decreases. An Rsq value ≥ 0.985 is acceptable for most assays. The M standard curve revealed a slope of -3.576 (efficiency= 90.4 %) and Rsq= 1.00 whereas H3 standard curve yielded a slope of -3.423 (efficiency= 95.9%) and Rsq= 0.999. These values indicate satisfactory amplification efficiency and overall performance of the real-time RT-PCR assays. We attribute the lower efficiency and sensitivity of M primers/probe set as compared to H3 primers/probe set to the N-fold degeneracy of M primer sequences required to ensure broad coverage of M gene sequences variability across viruses of multiple subtypes, hosts and lineages.</p>
<p id="p0182" num="0182">The sensitivity of real-time RT-PCR assay was also compared with the commercial rapid antigen detection assay (Directigen Flu A). Logarithmic dilutions of A/Wyoming/3/2003 (H3N2) and A/canine/Florida/242/2003(H3N8) were analyzed with Directigen Flu A and by real-time RT-PCR. The results of Directigen Flu A showed that the sensitivities against both viral strains are approximately 100-fold dilution from the stock viruses used in these experiments (<figref idref="f0009">Figure 7</figref>). The signals (purple color) generated by the canine virus (A/canine/Florida/242/2003: 10<sup>6.x</sup> PFU/ml) samples were much weaker than those found in human virus (A/Wyoming/3/2003: 10<sup>7.x</sup> PFU/ml), in agreement with the lower' virus concentration in these samples. Alternatively, lower signal for canine influenza could<!-- EPO <DP n="81"> --> be attributed to the molecular specificity of monoclonal antibodies against the NP; <i>i.e.</i> poor conservation of the amino acids within the NP epitope of canine influenza A viruses.</p>
<p id="p0183" num="0183">Real-time RT-PCR of the M gene yielded Ct values above threshold with virus 10 and 30 PFU equivalents per reaction of A/canine/Florida/242/2003 and A/Wyoming/3/2003, respectively (Table 16). The differences between the sensitivity value of 2 viral strains because the differences in the original viral titers. The H3 gene detection comparison between canine and human influenza viruses was not performed because the H3 primers/probe in our realtime RT-PCR assay amplifies exclusively canine influenza A virus. RT-PCR was 10<sup>5</sup> times more sensitive than the rapid antigen detection kit.</p>
<p id="p0184" num="0184">To evaluate the performance of the RT-PCR test in necropsy specimens from dogs with acute respiratory disease, sixty canine lung tissue samples submitted during the year of 2005 were tested for the presence of canine influenza A virus by real-time RT-PCR. A total of 12 out of 60 samples (20%) were positive with both M and H3 genes whereas the remaining 48 samples yielded negative result for both M and H3 gene. Virus isolation attempts were conducted by egg and MDCK cell inoculation, to evaluate the specificity of the realtime assay; 2 out 12 samples that were positive for canine influenza by RT-PCR yielded canine influenza virus (data not shown, manuscript in preparation). Although all of the tissues were collected from dogs with a history of severe respiratory disease, most of the samples yielded no canine influenza virus by either realtime PCR or conventional isolation, suggesting a high incidence of other respiratory pathogens such as <i>Bordetella bronchiseptica,</i> canine distemper or parainfluenza virus. The single step real-time RT-PCR assay herein provides a rapid, sensitive and cost-effective approach for canine influenza A virus (H3N8) detection. Rapid laboratory diagnosis of canine influenza A virus (H3N8) infections in the early stage of the disease can yield information relevant to clinical patient and facility management.<!-- EPO <DP n="82"> -->
<tables id="tabl0013" num="0013">
<table frame="all">
<tgroup cols="5">
<colspec colnum="1" colname="col1" colwidth="27mm"/>
<colspec colnum="2" colname="col2" colwidth="20mm"/>
<colspec colnum="3" colname="col3" colwidth="21mm"/>
<colspec colnum="4" colname="col4" colwidth="73mm"/>
<colspec colnum="5" colname="col5" colwidth="26mm"/>
<thead>
<row>
<entry namest="col1" nameend="col5" align="left" valign="top"><b>Table 13:</b> Primers and probes used for real-time RT-PCR detection and in vitro transcription</entry></row>
<row>
<entry align="center" valign="top"><b>Oligo name</b></entry>
<entry align="center" valign="top"><b>Type</b></entry>
<entry align="center" valign="top"><b>Target</b></entry>
<entry align="center" valign="top"><b>Sequence</b></entry>
<entry align="center" valign="top"><b>Application</b></entry></row></thead>
<tbody>
<row>
<entry>Ca-H3-F387</entry>
<entry>Forward primer</entry>
<entry>H3 (nt 387-406)</entry>
<entry>5'-tatgcatcgctccgatccat-3' (SEQ ID NO: 79)</entry>
<entry morerows="2">Real-time PCR</entry></row>
<row>
<entry>Ca-H3-R487</entry>
<entry>Reverse primer</entry>
<entry>H3 (nt 487-467)</entry>
<entry>5'-gctccacttcttccgttttga-3' (SEQ ID NO: 80)</entry></row>
<row>
<entry>Ca-H3-P430</entry>
<entry>TaqMan probe</entry>
<entry>H3 (nt 430-459)</entry>
<entry>FAM-aattcacagcagagggattcacatggacag-BHQ1 (SEQ ID NO: 81)</entry></row>
<row>
<entry>FluA-M-F151</entry>
<entry>Forward primer</entry>
<entry>M (nt 151-174)</entry>
<entry>5'-catggartggctaaagacaagacc-3' (SEQ ID NO: 82)</entry>
<entry morerows="2">Real-time PCR</entry></row>
<row>
<entry>FluA-M-R276</entry>
<entry>Reverse primer</entry>
<entry>M (nt 276-253)</entry>
<entry>5'-agggcattttggacaaakcgtcta-3' (SEQ ID NO: 83)</entry></row>
<row>
<entry>FluA-M-P218</entry>
<entry>LNA TaqMan probe</entry>
<entry>M (nt 218-235)</entry>
<entry>FAM-acgcTcaccgTgcccAgt-BHQ1 (SEQ ID NO: 84)</entry></row>
<row>
<entry>H3-F1</entry>
<entry>Forward primer</entry>
<entry>H3 (nt 1-14)</entry>
<entry>5'-tattcgtctcagggagcaaaagcagggg-3' (SEQ ID NO: 85)</entry>
<entry morerows="1"><i>In vitro</i> transcription</entry></row>
<row>
<entry>T7/H3-R490</entry>
<entry>Reverse primer</entry>
<entry>T7/H3 (nt 487-467)</entry>
<entry>5'-tg<u>taatacgactcactatagg</u>gctccacttcttccgttttga-3' (SEQ ID NO: 86)</entry></row>
<row>
<entry>M-F1</entry>
<entry>Forward primer</entry>
<entry>M (nt 1-15)</entry>
<entry>5'-gatcgctcttcagggagcaaaagcaggtag-3' (SEQ ID NO: 87)</entry>
<entry morerows="1"><i>In vitro</i> transcription</entry></row>
<row>
<entry>T7/M-R276</entry>
<entry>Reverse primer</entry>
<entry>M (nt 276-253)</entry>
<entry>5'-tg<u>taatacgactcactataggg</u>cattttggacaaagcgtc-3' (SEQ ID NO: 88)</entry></row></tbody></tgroup><!-- EPO <DP n="83"> -->
<tgroup cols="5" rowsep="0">
<colspec colnum="1" colname="col1" colwidth="27mm"/>
<colspec colnum="2" colname="col2" colwidth="20mm"/>
<colspec colnum="3" colname="col3" colwidth="21mm"/>
<colspec colnum="4" colname="col4" colwidth="73mm"/>
<colspec colnum="5" colname="col5" colwidth="26mm"/>
<tbody>
<row>
<entry namest="col1" nameend="col5" align="justify">* Note: Uppercases = LNA (Locked Nucleic Acid) residues, r = a or g, k= g or t, underline= T7 promoter sequence</entry></row></tbody></tgroup>
</table>
</tables>
<tables id="tabl0014" num="0014">
<table frame="all">
<tgroup cols="4">
<colspec colnum="1" colname="col1" colwidth="76mm"/>
<colspec colnum="2" colname="col2" colwidth="18mm"/>
<colspec colnum="3" colname="col3" colwidth="18mm"/>
<colspec colnum="4" colname="col4" colwidth="19mm"/>
<thead>
<row>
<entry namest="col1" nameend="col4" align="left" valign="top"><b>Table 14:</b> Interpretation of the real-time RT-PCR assay</entry></row>
<row>
<entry rowsep="0" align="center" valign="top"><b>Interpretation</b></entry>
<entry namest="col2" nameend="col4" align="center" valign="top"><b>Results</b></entry></row>
<row>
<entry valign="top"/>
<entry align="center" valign="top"><b>M</b></entry>
<entry align="center" valign="top"><b>H3</b></entry>
<entry align="center" valign="top"><b>18S rRNA</b></entry></row></thead>
<tbody>
<row>
<entry>Positive for canine influenza A virus (H3N8)</entry>
<entry align="center">+</entry>
<entry align="center">+</entry>
<entry align="center">+</entry></row>
<row>
<entry>Positive for influenza A virus (unknown subtype)</entry>
<entry align="center">+</entry>
<entry align="center">-</entry>
<entry align="center">+</entry></row>
<row>
<entry>Negative for influenza A virus</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">+</entry></row>
<row>
<entry>Error in RNA extraction or presence of PCR inhibitor</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry></row></tbody></tgroup><!-- EPO <DP n="84"> -->
</table>
</tables>
<tables id="tabl0015" num="0015">
<table frame="all">
<tgroup cols="5">
<colspec colnum="1" colname="col1" colwidth="28mm"/>
<colspec colnum="2" colname="col2" colwidth="52mm"/>
<colspec colnum="3" colname="col3" colwidth="29mm"/>
<colspec colnum="4" colname="col4" colwidth="29mm"/>
<colspec colnum="5" colname="col5" colwidth="29mm"/>
<thead>
<row>
<entry namest="col1" nameend="col5" align="center" valign="middle"><b>Table 15:</b> Specificity test of canine H3 primers/probe set and universality test of M primers/probe set with several subtypes of influenza A viruses</entry></row>
<row>
<entry morerows="1" align="center" valign="middle"><b>Subtypes</b></entry>
<entry morerows="1" align="center" valign="middle"><b>Strain Name</b></entry>
<entry morerows="1" align="center" valign="middle"><b>Host</b></entry>
<entry namest="col4" nameend="col5" align="center" valign="middle"><b>Real-time RT-PCR detection</b></entry></row>
<row>
<entry align="center" valign="middle"><b>H3 gene (Ct)</b></entry>
<entry align="center" valign="middle"><b>M gene (Ct)</b></entry></row></thead>
<tbody>
<row>
<entry morerows="1" align="center" valign="middle">H1</entry>
<entry>A/Ohio/1983</entry>
<entry align="center">Human</entry>
<entry align="center">No Ct</entry>
<entry align="char" char="." charoff="13">15.40</entry></row>
<row>
<entry>A/WSN/1933</entry>
<entry align="center">Human</entry>
<entry align="center">No Ct</entry>
<entry align="char" char="." charoff="13">20.09</entry></row>
<row>
<entry morerows="2" align="center" valign="middle">H3</entry>
<entry>A/Wyoming/3/2003</entry>
<entry align="center">Human</entry>
<entry align="center">No Ct</entry>
<entry align="char" char="." charoff="13">28.85</entry></row>
<row>
<entry>A/Victoria/3/1975</entry>
<entry align="center">Human</entry>
<entry align="center">No Ct</entry>
<entry align="char" char="." charoff="13">16.62</entry></row>
<row>
<entry>A/canine/FL/242/2003</entry>
<entry align="center">Canine</entry>
<entry align="center">28.43</entry>
<entry align="char" char="." charoff="13">29.25</entry></row>
<row>
<entry morerows="1" align="center" valign="middle">H4</entry>
<entry>Turkey/MN/1066/1980</entry>
<entry align="center">Avian</entry>
<entry align="center">No Ct</entry>
<entry align="char" char="." charoff="13">17.49</entry></row>
<row>
<entry>Clinical sample*</entry>
<entry align="center">Avian</entry>
<entry align="center">No Ct</entry>
<entry align="char" char="." charoff="13">20.87</entry></row>
<row>
<entry morerows="1" align="center" valign="middle">H5</entry>
<entry>AChicken/Thailand/CUK2/2004</entry>
<entry align="center">Avian</entry>
<entry align="center">No Ct</entry>
<entry align="char" char="." charoff="13">20.13</entry></row>
<row>
<entry>A/Pheasant/NJ/1335/1998</entry>
<entry align="center">Avian</entry>
<entry align="center">No Ct</entry>
<entry align="char" char="." charoff="13">16.64</entry></row>
<row>
<entry align="center" valign="middle">H6</entry>
<entry>Clinical sample*</entry>
<entry align="center">Avian</entry>
<entry align="center">No Ct</entry>
<entry align="char" char="." charoff="13">19.52</entry></row>
<row>
<entry morerows="1" align="center" valign="middle">H10</entry>
<entry>Clinical sample*</entry>
<entry align="center">Avian</entry>
<entry align="center">No Ct</entry>
<entry align="char" char="." charoff="13">25.64</entry></row>
<row>
<entry>Clinical sample*</entry>
<entry align="center">Avian</entry>
<entry align="center">No Ct</entry>
<entry align="char" char="." charoff="13">19.59</entry></row>
<row>
<entry morerows="1" align="center" valign="middle">H11</entry>
<entry>Clinical sample*</entry>
<entry align="center">Avian</entry>
<entry align="center">No Ct</entry>
<entry align="char" char="." charoff="13">15.72</entry></row>
<row>
<entry>Clinical sample*</entry>
<entry align="center">Avian</entry>
<entry align="center">No Ct</entry>
<entry align="char" char="." charoff="13">24.55</entry></row></tbody></tgroup><!-- EPO <DP n="85"> -->
<tgroup cols="5" rowsep="0">
<colspec colnum="1" colname="col1" colwidth="28mm"/>
<colspec colnum="2" colname="col2" colwidth="52mm"/>
<colspec colnum="3" colname="col3" colwidth="29mm"/>
<colspec colnum="4" colname="col4" colwidth="29mm"/>
<colspec colnum="5" colname="col5" colwidth="29mm"/>
<tbody>
<row>
<entry namest="col1" nameend="col5" align="justify">* Note that subtypes of clinical samples were confirmed by nucleotide sequencing.</entry></row></tbody></tgroup>
</table>
</tables>
<tables id="tabl0016" num="0016">
<table frame="all">
<tgroup cols="5">
<colspec colnum="1" colname="col1" colwidth="27mm"/>
<colspec colnum="2" colname="col2" colwidth="35mm"/>
<colspec colnum="3" colname="col3" colwidth="34mm"/>
<colspec colnum="4" colname="col4" colwidth="35mm"/>
<colspec colnum="5" colname="col5" colwidth="37mm"/>
<thead>
<row>
<entry namest="col1" nameend="col5" align="center" valign="top"><b>Table 16:</b> Comparative sensitivity tests for influenza A virus detection between real-time RT-PCR and Directigen Flu A</entry></row>
<row>
<entry morerows="1" align="center" valign="top"><b>Virus dilutions</b></entry>
<entry namest="col2" nameend="col3" align="center" valign="top"><b>Directigen Flu A</b></entry>
<entry namest="col4" nameend="col5" align="center" valign="top"><b>Real-time RT-PCR of M (Ct)</b></entry></row>
<row>
<entry align="center" valign="top"><b>A/canine/242/03</b></entry>
<entry align="center" valign="top"><b>A/Wyoming/3/03</b></entry>
<entry align="center" valign="top"><b>A/canine/242/03</b></entry>
<entry align="center" valign="top"><b>A/Wyoming/3/2003</b></entry></row></thead>
<tbody>
<row>
<entry align="center">10<sup>-1</sup></entry>
<entry align="center">++</entry>
<entry align="center">++++</entry>
<entry align="center">22.42</entry>
<entry align="center">19.48</entry></row>
<row>
<entry align="center">10<sup>-1</sup></entry>
<entry align="center">+</entry>
<entry align="center">+++</entry>
<entry align="center">25.85</entry>
<entry align="center">22.66</entry></row>
<row>
<entry align="center">10<sup>-3</sup></entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">29.27</entry>
<entry align="center">25.76</entry></row>
<row>
<entry align="center">10<sup>-4</sup></entry>
<entry align="center">Not done</entry>
<entry align="center">Not done</entry>
<entry align="center">32.66</entry>
<entry align="center">28.66</entry></row>
<row>
<entry align="center">10<sup>-5</sup></entry>
<entry align="center">Not done</entry>
<entry align="center">Not done</entry>
<entry align="center">35.48</entry>
<entry align="center">33.14</entry></row>
<row>
<entry align="center">10<sup>-6</sup></entry>
<entry align="center">Not done</entry>
<entry align="center">Not done</entry>
<entry align="center">37.51</entry>
<entry align="center">35.06</entry></row>
<row>
<entry align="center">10<sup>-7</sup></entry>
<entry align="center">Not done</entry>
<entry align="center">Not done</entry>
<entry align="center">39.09</entry>
<entry align="center">36.44</entry></row>
<row>
<entry align="center">10<sup>-8</sup></entry>
<entry align="center">Not done</entry>
<entry align="center">Not done</entry>
<entry align="center">No Ct</entry>
<entry align="center">38.93</entry></row></tbody></tgroup>
</table>
</tables>
<tables id="tabl0017" num="0017">
<table frame="all">
<tgroup cols="2" colsep="0">
<colspec colnum="1" colname="col1" colwidth="33mm"/>
<colspec colnum="2" colname="col2" colwidth="54mm" colsep="1"/>
<thead>
<row>
<entry namest="col1" nameend="col2" align="center" valign="middle"><b>Table 17.</b></entry></row>
<row>
<entry align="center" valign="middle">Class of Amino Acid</entry>
<entry align="center" valign="middle">Examples of Amino Acids</entry></row></thead>
<tbody>
<row rowsep="0">
<entry align="center" valign="middle">Nonpolar</entry>
<entry align="center" valign="middle">Ala, Val, Leu, Ile, Pro, Met, Phe, Trp</entry></row>
<row rowsep="0">
<entry align="center" valign="middle">Uncharged Polar</entry>
<entry align="center" valign="middle">Gly, Ser, Thr, Cys, Tyr, Asn, Gln</entry></row>
<row rowsep="0">
<entry align="center" valign="middle">Acidic</entry>
<entry align="center" valign="middle">Asp, Glu</entry></row>
<row>
<entry align="center" valign="middle">Basic</entry>
<entry align="center" valign="middle">Lys, Arg, His</entry></row></tbody></tgroup><!-- EPO <DP n="86"> -->
</table>
</tables>
<tables id="tabl0018" num="0018">
<table frame="all">
<tgroup cols="4">
<colspec colnum="1" colname="col1" colwidth="27mm"/>
<colspec colnum="2" colname="col2" colwidth="42mm"/>
<colspec colnum="3" colname="col3" colwidth="27mm"/>
<colspec colnum="4" colname="col4" colwidth="42mm"/>
<thead>
<row>
<entry namest="col1" nameend="col4" align="center" valign="middle"><b>Table 18.</b></entry></row>
<row>
<entry align="center" valign="middle"><b>Letter Symbol</b></entry>
<entry align="center" valign="middle"><b>Amino Acid</b></entry>
<entry align="center" valign="middle"><b>Letter Symbol</b></entry>
<entry align="center" valign="middle"><b>Amino Acid</b></entry></row></thead>
<tbody>
<row>
<entry align="center" valign="middle">A</entry>
<entry align="center" valign="middle">Alanine</entry>
<entry align="center" valign="middle">M</entry>
<entry align="center" valign="middle">Methionine</entry></row>
<row>
<entry align="center" valign="middle">B</entry>
<entry align="center" valign="middle">Asparagine or aspartic acid</entry>
<entry align="center" valign="middle">N</entry>
<entry align="center" valign="middle">Asparagine</entry></row>
<row>
<entry align="center" valign="middle">C</entry>
<entry align="center" valign="middle">Cysteine</entry>
<entry align="center" valign="middle">P</entry>
<entry align="center" valign="middle">Proline</entry></row>
<row>
<entry align="center" valign="middle">D</entry>
<entry align="center" valign="middle">Aspartic Acid</entry>
<entry align="center" valign="middle">Q</entry>
<entry align="center" valign="middle">Glutamine</entry></row>
<row>
<entry align="center" valign="middle">E</entry>
<entry align="center" valign="middle">Glutamic Acid</entry>
<entry align="center" valign="middle">R</entry>
<entry align="center" valign="middle">Arginine</entry></row>
<row>
<entry align="center" valign="middle">F</entry>
<entry align="center" valign="middle">Phenylalanine</entry>
<entry align="center" valign="middle">S</entry>
<entry align="center" valign="middle">Serine</entry></row>
<row>
<entry align="center" valign="middle">G</entry>
<entry align="center" valign="middle">Glycine</entry>
<entry align="center" valign="middle">T</entry>
<entry align="center" valign="middle">Threonine</entry></row>
<row>
<entry align="center" valign="middle">H</entry>
<entry align="center" valign="middle">Histidine</entry>
<entry align="center" valign="middle">V</entry>
<entry align="center" valign="middle">Valine</entry></row>
<row>
<entry align="center" valign="middle">I</entry>
<entry align="center" valign="middle">Isoleucine</entry>
<entry align="center" valign="middle">W</entry>
<entry align="center" valign="middle">Tryptophan</entry></row>
<row>
<entry align="center" valign="middle">K</entry>
<entry align="center" valign="middle">Lysine</entry>
<entry align="center" valign="middle">Y</entry>
<entry align="center" valign="middle">Tyrosine</entry></row>
<row>
<entry align="center" valign="middle">L</entry>
<entry align="center" valign="middle">Leucine</entry>
<entry align="center" valign="middle">Z</entry>
<entry align="center" valign="middle">Glutamine or glutamic acid</entry></row></tbody></tgroup>
</table>
</tables>
<tables id="tabl0019" num="0019">
<table frame="all">
<tgroup cols="4">
<colspec colnum="1" colname="col1" colwidth="31mm"/>
<colspec colnum="2" colname="col2" colwidth="35mm"/>
<colspec colnum="3" colname="col3" colwidth="38mm"/>
<colspec colnum="4" colname="col4" colwidth="38mm"/>
<thead>
<row>
<entry namest="col1" nameend="col4" align="center" valign="middle"><b>Table 19.</b> Amino acid differences between PB2 proteins of H3N8 equine and canine influenza viruses</entry></row>
<row>
<entry align="center" valign="middle">Position</entry>
<entry align="center" valign="middle">Equine Consensus *</entry>
<entry align="center" valign="middle">Canine/FL/03</entry>
<entry align="center" valign="middle">Canine/FL/04</entry></row></thead>
<tbody>
<row>
<entry align="center" valign="middle">5</entry>
<entry align="center" valign="middle">K</entry>
<entry align="center" valign="middle">K</entry>
<entry align="center" valign="middle">E</entry></row>
<row>
<entry align="center" valign="middle">12</entry>
<entry align="center" valign="middle">S</entry>
<entry align="center" valign="middle">L</entry>
<entry align="center" valign="middle">L</entry></row>
<row>
<entry align="center" valign="middle">37</entry>
<entry align="center" valign="middle">G</entry>
<entry align="center" valign="middle">G</entry>
<entry align="center" valign="middle">E</entry></row>
<row>
<entry align="center" valign="middle">175</entry>
<entry align="center" valign="middle">R</entry>
<entry align="center" valign="middle">R</entry>
<entry align="center" valign="middle">I</entry></row>
<row>
<entry align="center" valign="middle">374</entry>
<entry align="center" valign="middle">L</entry>
<entry align="center" valign="middle">I</entry>
<entry align="center" valign="middle">I</entry></row>
<row>
<entry align="center" valign="middle">375</entry>
<entry align="center" valign="middle">R</entry>
<entry align="center" valign="middle">R</entry>
<entry align="center" valign="middle">K</entry></row>
<row>
<entry align="center" valign="middle">447</entry>
<entry align="center" valign="middle">Q</entry>
<entry align="center" valign="middle">Q</entry>
<entry align="center" valign="middle">H</entry></row></tbody></tgroup>
</table>
</tables>
<tables id="tabl0020" num="0020">
<table frame="all">
<tgroup cols="4">
<colspec colnum="1" colname="col1" colwidth="31mm"/>
<colspec colnum="2" colname="col2" colwidth="35mm"/>
<colspec colnum="3" colname="col3" colwidth="38mm"/>
<colspec colnum="4" colname="col4" colwidth="38mm"/>
<thead>
<row>
<entry namest="col1" nameend="col4" align="center" valign="middle"><b>Table 20.</b> Amino acid differences between PB1 proteins of H3N8 equine and canine influenza viruses</entry></row>
<row>
<entry align="center" valign="middle">Position</entry>
<entry align="center" valign="middle">Equine Consensus *</entry>
<entry align="center" valign="middle">Canine/FL/03</entry>
<entry align="center" valign="middle">Canine/FL/04</entry></row></thead>
<tbody>
<row>
<entry align="center" valign="middle">114</entry>
<entry align="center" valign="middle">V</entry>
<entry align="center" valign="middle">I</entry>
<entry align="center" valign="middle">I</entry></row>
<row>
<entry align="center" valign="middle">154</entry>
<entry align="center" valign="middle">D</entry>
<entry align="center" valign="middle">G</entry>
<entry align="center" valign="middle">G</entry></row>
<row>
<entry align="center" valign="middle">221</entry>
<entry align="center" valign="middle">A</entry>
<entry align="center" valign="middle">T</entry>
<entry align="center" valign="middle">T</entry></row>
<row>
<entry align="center" valign="middle">317</entry>
<entry align="center" valign="middle">M</entry>
<entry align="center" valign="middle">I</entry>
<entry align="center" valign="middle">I</entry></row>
<row>
<entry align="center" valign="middle">459</entry>
<entry align="center" valign="middle">I</entry>
<entry align="center" valign="middle">I</entry>
<entry align="center" valign="middle">V</entry></row>
<row>
<entry align="center" valign="middle">682</entry>
<entry align="center" valign="middle">I</entry>
<entry align="center" valign="middle">I</entry>
<entry align="center" valign="middle">V</entry></row></tbody></tgroup><!-- EPO <DP n="87"> -->
</table>
</tables>
<tables id="tabl0021" num="0021">
<table frame="all">
<tgroup cols="4">
<colspec colnum="1" colname="col1" colwidth="30mm"/>
<colspec colnum="2" colname="col2" colwidth="35mm"/>
<colspec colnum="3" colname="col3" colwidth="38mm"/>
<colspec colnum="4" colname="col4" colwidth="39mm"/>
<thead>
<row>
<entry namest="col1" nameend="col4" align="center" valign="middle"><b>Table 21.</b> Amino acid differences between PA proteins of H3N8 equine and canine influenza viruses</entry></row>
<row>
<entry align="center" valign="middle">Position</entry>
<entry align="center" valign="middle">Equine Consensus *</entry>
<entry align="center" valign="middle">Canine/FL/03</entry>
<entry align="center" valign="middle">Canine/FL104</entry></row></thead>
<tbody>
<row>
<entry align="center" valign="middle">27</entry>
<entry align="center" valign="middle">D</entry>
<entry align="center" valign="middle">N</entry>
<entry align="center" valign="middle">N</entry></row>
<row>
<entry align="center" valign="middle">62</entry>
<entry align="center" valign="middle">I</entry>
<entry align="center" valign="middle">V</entry>
<entry align="center" valign="middle">V</entry></row>
<row>
<entry align="center" valign="middle">213</entry>
<entry align="center" valign="middle">R</entry>
<entry align="center" valign="middle">K</entry>
<entry align="center" valign="middle">K</entry></row>
<row>
<entry align="center" valign="middle">337</entry>
<entry align="center" valign="middle">A</entry>
<entry align="center" valign="middle">T</entry>
<entry align="center" valign="middle">T</entry></row>
<row>
<entry align="center" valign="middle">343</entry>
<entry align="center" valign="middle">A</entry>
<entry align="center" valign="middle">E</entry>
<entry align="center" valign="middle">E</entry></row>
<row>
<entry align="center" valign="middle">345</entry>
<entry align="center" valign="middle">L</entry>
<entry align="center" valign="middle">I</entry>
<entry align="center" valign="middle">I</entry></row>
<row>
<entry align="center" valign="middle">353</entry>
<entry align="center" valign="middle">K</entry>
<entry align="center" valign="middle">R</entry>
<entry align="center" valign="middle">R</entry></row>
<row>
<entry align="center" valign="middle">400</entry>
<entry align="center" valign="middle">T</entry>
<entry align="center" valign="middle">T</entry>
<entry align="center" valign="middle">A</entry></row>
<row>
<entry align="center" valign="middle">450</entry>
<entry align="center" valign="middle">V</entry>
<entry align="center" valign="middle">I</entry>
<entry align="center" valign="middle">I</entry></row>
<row>
<entry align="center" valign="middle">460</entry>
<entry align="center" valign="middle">M</entry>
<entry align="center" valign="middle">M</entry>
<entry align="center" valign="middle">I</entry></row>
<row>
<entry align="center" valign="middle">673</entry>
<entry align="center" valign="middle">R</entry>
<entry align="center" valign="middle">R</entry>
<entry align="center" valign="middle">K</entry></row>
<row>
<entry align="center" valign="middle">675</entry>
<entry align="center" valign="middle">N</entry>
<entry align="center" valign="middle">D</entry>
<entry align="center" valign="middle">D</entry></row></tbody></tgroup>
<tgroup cols="4" rowsep="0">
<colspec colnum="1" colname="col1" colwidth="30mm"/>
<colspec colnum="2" colname="col2" colwidth="35mm"/>
<colspec colnum="3" colname="col3" colwidth="38mm"/>
<colspec colnum="4" colname="col4" colwidth="39mm"/>
<tbody>
<row>
<entry namest="col1" nameend="col4" align="justify">*Based on available genes of viruses isolated between 1963 and 1998.</entry></row></tbody></tgroup>
</table>
</tables>
<tables id="tabl0022" num="0022">
<table frame="all">
<tgroup cols="4">
<colspec colnum="1" colname="col1" colwidth="31mm"/>
<colspec colnum="2" colname="col2" colwidth="35mm"/>
<colspec colnum="3" colname="col3" colwidth="38mm"/>
<colspec colnum="4" colname="col4" colwidth="38mm"/>
<thead>
<row>
<entry namest="col1" nameend="col4" align="center" valign="middle"><b>Table 22.</b> Amino acid differences between NP proteins of H3N8 equine and canine influenza viruses</entry></row>
<row>
<entry align="center" valign="middle">Position</entry>
<entry align="center" valign="middle">Equine Consensus *</entry>
<entry align="center" valign="middle">Canine/FL/03</entry>
<entry align="center" valign="middle">Canine/FL/04</entry></row></thead>
<tbody>
<row>
<entry align="center" valign="middle">16</entry>
<entry align="center" valign="middle">G</entry>
<entry align="center" valign="middle">D</entry>
<entry align="center" valign="middle">D</entry></row>
<row>
<entry align="center" valign="middle">157</entry>
<entry align="center" valign="middle">A</entry>
<entry align="center" valign="middle">T</entry>
<entry align="center" valign="middle">T</entry></row>
<row>
<entry align="center" valign="middle">214</entry>
<entry align="center" valign="middle">R</entry>
<entry align="center" valign="middle">R</entry>
<entry align="center" valign="middle">K</entry></row>
<row>
<entry align="center" valign="middle">285</entry>
<entry align="center" valign="middle">V</entry>
<entry align="center" valign="middle">V</entry>
<entry align="center" valign="middle">I</entry></row>
<row>
<entry align="center" valign="middle">286</entry>
<entry align="center" valign="middle">A</entry>
<entry align="center" valign="middle">T</entry>
<entry align="center" valign="middle">T</entry></row>
<row>
<entry align="center" valign="middle">359</entry>
<entry align="center" valign="middle">A</entry>
<entry align="center" valign="middle">T</entry>
<entry align="center" valign="middle">T</entry></row>
<row>
<entry align="center" valign="middle">375</entry>
<entry align="center" valign="middle">D</entry>
<entry align="center" valign="middle">D</entry>
<entry align="center" valign="middle">N</entry></row>
<row>
<entry align="center" valign="middle">384</entry>
<entry align="center" valign="middle">R</entry>
<entry align="center" valign="middle">K</entry>
<entry align="center" valign="middle">K</entry></row>
<row>
<entry align="center" valign="middle">452</entry>
<entry align="center" valign="middle">R</entry>
<entry align="center" valign="middle">K</entry>
<entry align="center" valign="middle">K</entry></row></tbody></tgroup>
</table>
</tables><!-- EPO <DP n="88"> -->
<tables id="tabl0023" num="0023">
<table frame="all">
<tgroup cols="4">
<colspec colnum="1" colname="col1" colwidth="31mm"/>
<colspec colnum="2" colname="col2" colwidth="35mm"/>
<colspec colnum="3" colname="col3" colwidth="38mm"/>
<colspec colnum="4" colname="col4" colwidth="38mm"/>
<thead>
<row>
<entry namest="col1" nameend="col4" align="center" valign="middle"><b>Table 23.</b> Amino acid differences between NA proteins of H3N8 equine and canine influenza viruses</entry></row>
<row>
<entry align="center" valign="middle">Position</entry>
<entry align="center" valign="middle">Equine Consensus *</entry>
<entry align="center" valign="middle">Canine/FL/03</entry>
<entry align="center" valign="middle">Canine/FL/04</entry></row></thead>
<tbody>
<row>
<entry align="center" valign="middle">9</entry>
<entry align="center" valign="middle">A/T</entry>
<entry align="center" valign="middle">T</entry>
<entry align="center" valign="middle">A</entry></row>
<row>
<entry align="center" valign="middle">12</entry>
<entry align="center" valign="middle">S</entry>
<entry align="center" valign="middle">F</entry>
<entry align="center" valign="middle">F</entry></row>
<row>
<entry align="center" valign="middle">20</entry>
<entry align="center" valign="middle">L</entry>
<entry align="center" valign="middle">I</entry>
<entry align="center" valign="middle">I</entry></row>
<row>
<entry align="center" valign="middle">40</entry>
<entry align="center" valign="middle">G</entry>
<entry align="center" valign="middle">R</entry>
<entry align="center" valign="middle">R</entry></row>
<row>
<entry align="center" valign="middle">42</entry>
<entry align="center" valign="middle">G</entry>
<entry align="center" valign="middle">D</entry>
<entry align="center" valign="middle">D</entry></row>
<row>
<entry align="center" valign="middle">46</entry>
<entry align="center" valign="middle">N</entry>
<entry align="center" valign="middle">K</entry>
<entry align="center" valign="middle">K</entry></row>
<row>
<entry align="center" valign="middle">52</entry>
<entry align="center" valign="middle">E</entry>
<entry align="center" valign="middle">E</entry>
<entry align="center" valign="middle">K</entry></row>
<row>
<entry align="center" valign="middle">61</entry>
<entry align="center" valign="middle">R</entry>
<entry align="center" valign="middle">K</entry>
<entry align="center" valign="middle">K</entry></row>
<row>
<entry align="center" valign="middle">69</entry>
<entry align="center" valign="middle">N</entry>
<entry align="center" valign="middle">S</entry>
<entry align="center" valign="middle">S</entry></row>
<row>
<entry align="center" valign="middle">72</entry>
<entry align="center" valign="middle">E</entry>
<entry align="center" valign="middle">K</entry>
<entry align="center" valign="middle">K</entry></row>
<row>
<entry align="center" valign="middle">201</entry>
<entry align="center" valign="middle">V</entry>
<entry align="center" valign="middle">I</entry>
<entry align="center" valign="middle">I</entry></row>
<row>
<entry align="center" valign="middle">261</entry>
<entry align="center" valign="middle">I</entry>
<entry align="center" valign="middle">V</entry>
<entry align="center" valign="middle">V</entry></row>
<row>
<entry align="center" valign="middle">301</entry>
<entry align="center" valign="middle">I</entry>
<entry align="center" valign="middle">I</entry>
<entry align="center" valign="middle">V</entry></row>
<row>
<entry align="center" valign="middle">396</entry>
<entry align="center" valign="middle">N</entry>
<entry align="center" valign="middle">D</entry>
<entry align="center" valign="middle">D</entry></row>
<row>
<entry align="center" valign="middle">397</entry>
<entry align="center" valign="middle">L</entry>
<entry align="center" valign="middle">P</entry>
<entry align="center" valign="middle">P</entry></row></tbody></tgroup>
</table>
</tables>
<tables id="tabl0024" num="0024">
<table frame="all">
<tgroup cols="4">
<colspec colnum="1" colname="col1" colwidth="31mm"/>
<colspec colnum="2" colname="col2" colwidth="35mm"/>
<colspec colnum="3" colname="col3" colwidth="38mm"/>
<colspec colnum="4" colname="col4" colwidth="38mm"/>
<thead>
<row>
<entry namest="col1" nameend="col4" align="center" valign="middle"><b>Table 24.</b> Amino acid differences between M1 proteins of H3N8 equine and canine influenza viruses</entry></row>
<row>
<entry align="center" valign="middle">Position</entry>
<entry align="center" valign="middle">Equine Consensus *</entry>
<entry align="center" valign="middle">Canine/FL/03</entry>
<entry align="center" valign="middle">Canine/FL/04</entry></row></thead>
<tbody>
<row>
<entry align="center" valign="middle">M1 161</entry>
<entry align="center" valign="middle">S</entry>
<entry align="center" valign="middle">S</entry>
<entry align="center" valign="middle">A</entry></row>
<row>
<entry align="center" valign="middle">M1 208</entry>
<entry align="center" valign="middle">K/Q</entry>
<entry align="center" valign="middle">R</entry>
<entry align="center" valign="middle">R</entry></row></tbody></tgroup>
<tgroup cols="4" rowsep="0">
<colspec colnum="1" colname="col1" colwidth="31mm"/>
<colspec colnum="2" colname="col2" colwidth="35mm"/>
<colspec colnum="3" colname="col3" colwidth="38mm"/>
<colspec colnum="4" colname="col4" colwidth="38mm"/>
<tbody>
<row>
<entry namest="col1" nameend="col4" align="justify">*Based on available genes of viruses isolated between 1963 and 1998.</entry></row></tbody></tgroup>
</table>
</tables>
<tables id="tabl0025" num="0025">
<table frame="all">
<tgroup cols="4">
<colspec colnum="1" colname="col1" colwidth="28mm"/>
<colspec colnum="2" colname="col2" colwidth="43mm"/>
<colspec colnum="3" colname="col3" colwidth="36mm"/>
<colspec colnum="4" colname="col4" colwidth="36mm"/>
<thead>
<row>
<entry namest="col1" nameend="col4" align="center" valign="middle"><b>Table 25.</b> Amino acid differences between NS1 proteins of H3N8 equine and canine influenza viruses</entry></row>
<row>
<entry align="center" valign="middle">Position</entry>
<entry align="center" valign="middle">Equine.Consensus *</entry>
<entry align="center" valign="middle">Canine/FL/03</entry>
<entry align="center" valign="middle">Canine/FL/04</entry></row></thead>
<tbody>
<row>
<entry valign="middle">44</entry>
<entry valign="middle">K</entry>
<entry valign="middle">R</entry>
<entry valign="middle">R</entry></row>
<row>
<entry valign="middle">59</entry>
<entry valign="middle">R</entry>
<entry valign="middle">H</entry>
<entry valign="middle">H</entry></row>
<row>
<entry valign="middle">71</entry>
<entry valign="middle">E</entry>
<entry valign="middle">K</entry>
<entry valign="middle">K</entry></row>
<row>
<entry valign="middle">86</entry>
<entry valign="middle">A</entry>
<entry valign="middle">T</entry>
<entry valign="middle">T</entry></row>
<row>
<entry valign="middle">88</entry>
<entry valign="middle">R</entry>
<entry valign="middle">R</entry>
<entry valign="middle">L</entry></row>
<row>
<entry valign="middle">140</entry>
<entry valign="middle">R</entry>
<entry valign="middle">G</entry>
<entry valign="middle">G</entry></row>
<row>
<entry valign="middle">216</entry>
<entry valign="middle">P</entry>
<entry valign="middle">S</entry>
<entry valign="middle">S</entry></row></tbody></tgroup>
<tgroup cols="4" rowsep="0">
<colspec colnum="1" colname="col1" colwidth="28mm"/>
<colspec colnum="2" colname="col2" colwidth="43mm"/>
<colspec colnum="3" colname="col3" colwidth="36mm"/>
<colspec colnum="4" colname="col4" colwidth="36mm"/>
<tbody>
<row>
<entry namest="col1" nameend="col4" align="justify">* Based on available genes of viruses isolated between 1963 and 1998.</entry></row></tbody></tgroup>
</table>
</tables><!-- EPO <DP n="89"> --></p>
<heading id="h0060"><u>EXAMPLE 17 - CANINE INFLUENZA CHALLENGE MODEL DEVELOPMENT.</u></heading>
<p id="p0185" num="0185">The canine influenza (canine flu) virus, which was isolated from flu outbreaks in Florida, was observed to be a H3N8 type influenza virus, and closely related to equine flu virus strain, A/equine/Ohio/03 (<nplcit id="ncit0002" npl-type="s"><text>Crawford et al., SCIENCE Vol. 309, September 2005</text></nplcit>, incorporated by reference in its entirety into this patent). The potential of using the equine flu virus strain A/equine/Ohio/03 to induce influenza-like disease in dogs was investigated in this study.</p>
<heading id="h0061"><u>Procedure:</u></heading>
<p id="p0186" num="0186">Ten 13-week-old beagles of mixed sex were obtained from a commercial supplier, and housed in individual cages in a BSL-2 facility. The dogs were randomly assigned to two groups of 5 dogs each. As shown in Table 26, one group was subjected to a intratracheal challenge, and the other group was subjected to an oronasal challenge. The dogs were challenged at 14 weeks-of-age.
<tables id="tabl0026" num="0026">
<table frame="all">
<tgroup cols="3">
<colspec colnum="1" colname="col1" colwidth="14mm"/>
<colspec colnum="2" colname="col2" colwidth="28mm"/>
<colspec colnum="3" colname="col3" colwidth="29mm"/>
<thead>
<row>
<entry namest="col1" nameend="col3" align="left" valign="top"><b>Table 26:</b> Experimental Design</entry></row>
<row>
<entry valign="top">Group</entry>
<entry valign="top">Number of Dogs</entry>
<entry valign="top">Challenge Route</entry></row></thead>
<tbody>
<row>
<entry>1</entry>
<entry>5</entry>
<entry>Intratracheal</entry></row>
<row>
<entry>2</entry>
<entry>5</entry>
<entry>Oronasal</entry></row></tbody></tgroup>
</table>
</tables></p>
<p id="p0187" num="0187">A cell culture grown equine flu virus A/equine/Ohio/03 was used as the challenge virus. For intratracheal challenge, the challenge virus was administered via a delivery tube, which consisted of a cuffed tracheal tube (Size 4.0/4.5, Sheridan, USA) and feeding tube (size 5Fr, 1.7 mm, /16 inches in length, Kendall, USA) in 0.5 to 1.0 ml volume. For oronasal challenge, the challenge virus (10<sup>7</sup> to 10<sup>8</sup> TCID50 per dog) was administered as a mist using a nebulizer (DeVilbiss Ultra-Neb®99 ultrasonic nebulizer, Sunrise Medical, USA) in a 2 to 3 ml volume.</p>
<p id="p0188" num="0188">The dogs were observed for flu related clinical signs for 14 days post-challenge. Serum samples were collected from each dog on day zero (before challenge), and days 7 and 14 post-challenge for determining the HI titer using a H3N8 equine influenza virus with a standard protocol (SAM 124, CVB, USDA, Ames, IA). All dogs were humanely euthanized and lung tissues were collected in 10% buffered formalin for histopathological evaluation.<!-- EPO <DP n="90"> --></p>
<heading id="h0062"><u>Results:</u></heading>
<p id="p0189" num="0189">The results of this experiment are summarized in Table 27. Influenza related clinical signs were observed in a few dogs after challenge. These signs included fever (&gt;103°F; &gt;39.4°C) and cough. Two of 5 dogs <i>(i.e.,</i> 40%) had fevers (&gt;103°F; &gt;39.4oC) in Group 1, compared to 1 of 5 (<i>i.e.,</i> 20%) dogs in Group 2. One dog from the oronasal challenge group had sneezing, and another had cough following the challenge. An HI titer range from 10 to 80, with a geometric mean titer (GMT) of 20, was observed for Group 1. A titer range of 40 to 160, with a GMT of 86, was observed for Group 2. One dog from each group had histopathological lesions compatible with or pathognomic for influenza.<!-- EPO <DP n="91"> -->
<tables id="tabl0027" num="0027">
<table frame="all">
<tgroup cols="10">
<colspec colnum="1" colname="col1" colwidth="16mm"/>
<colspec colnum="2" colname="col2" colwidth="27mm"/>
<colspec colnum="3" colname="col3" colwidth="25mm"/>
<colspec colnum="4" colname="col4" colwidth="24mm"/>
<colspec colnum="5" colname="col5" colwidth="22mm"/>
<colspec colnum="6" colname="col6" colwidth="21mm"/>
<colspec colnum="7" colname="col7" colwidth="34mm"/>
<colspec colnum="8" colname="col8" colwidth="30mm"/>
<colspec colnum="9" colname="col9" colwidth="24mm"/>
<colspec colnum="10" colname="col10" colwidth="24mm"/>
<thead>
<row>
<entry namest="col1" nameend="col10" align="left" valign="top"><b>Table 27.</b> Canine flu challenge - clinical signs, virus isolation, histopathology results and serology results</entry></row>
<row>
<entry morerows="1" valign="top"><b>Dog* ID</b></entry>
<entry morerows="1" valign="top"><b>Challenge method*</b></entry>
<entry morerows="1" valign="top"><b>Clinical signs</b></entry>
<entry namest="col4" nameend="col6" align="center" valign="top"><b>Virus isolation</b></entry>
<entry morerows="1" valign="top"><b>Microscopic lesion (histopathology)</b></entry>
<entry namest="col8" nameend="col10" align="center" valign="top"><b>Serology (HI titer)</b></entry></row>
<row>
<entry valign="top"><b>Nasal/oral swab</b></entry>
<entry valign="top"><b>Tracheal scraping</b></entry>
<entry valign="top"><b>Lung tissues</b></entry>
<entry valign="top"><b>Pre-challenge</b></entry>
<entry valign="top"><b>7-days post challenge</b></entry>
<entry valign="top"><b>14-days post challenge</b></entry></row></thead>
<tbody>
<row>
<entry>AAH</entry>
<entry>Intratracheal</entry>
<entry>none</entry>
<entry>negative</entry>
<entry>negative</entry>
<entry>negative</entry>
<entry align="center">negative</entry>
<entry>10</entry>
<entry>10</entry>
<entry>20</entry></row>
<row>
<entry>ADB</entry>
<entry>Intratracheal</entry>
<entry>none</entry>
<entry>negative</entry>
<entry>negative</entry>
<entry>negative</entry>
<entry align="center">negative</entry>
<entry>10</entry>
<entry>80</entry>
<entry>20</entry></row>
<row>
<entry>ADC</entry>
<entry>Intratracheal</entry>
<entry>Fever*</entry>
<entry>negative</entry>
<entry>negative</entry>
<entry>negative</entry>
<entry align="center">negative</entry>
<entry>10</entry>
<entry>20</entry>
<entry>20</entry></row>
<row>
<entry>AEB</entry>
<entry>Intratracheal</entry>
<entry>Fever</entry>
<entry>negative</entry>
<entry>negative</entry>
<entry>negative</entry>
<entry align="center">positive</entry>
<entry>10</entry>
<entry>40</entry>
<entry>20</entry></row>
<row>
<entry>AEE</entry>
<entry>Intratracheal</entry>
<entry>none</entry>
<entry>negative</entry>
<entry>negative</entry>
<entry>negative</entry>
<entry align="center">inconclusive</entry>
<entry>10</entry>
<entry>20</entry>
<entry>10</entry></row>
<row>
<entry colsep="0"/>
<entry colsep="0"/>
<entry colsep="0"/>
<entry colsep="0"/>
<entry colsep="0"/>
<entry colsep="0"/>
<entry colsep="0"/>
<entry colsep="0"/>
<entry colsep="0"/>
<entry/></row>
<row>
<entry>AAE</entry>
<entry>Oronasal</entry>
<entry>none</entry>
<entry>negative</entry>
<entry>negative</entry>
<entry>negative</entry>
<entry align="center">negative</entry>
<entry>10</entry>
<entry>80</entry>
<entry>80</entry></row>
<row>
<entry>AAG</entry>
<entry>Oronasal</entry>
<entry>none</entry>
<entry>negative</entry>
<entry>negative</entry>
<entry>negative</entry>
<entry align="center">negative</entry>
<entry>10</entry>
<entry>40</entry>
<entry>80</entry></row>
<row>
<entry>ABY</entry>
<entry>Oronasal</entry>
<entry>Occasional sneeze, occasional cough</entry>
<entry>negative</entry>
<entry>negative</entry>
<entry>negative</entry>
<entry align="center">positive</entry>
<entry>10</entry>
<entry>80</entry>
<entry>160</entry></row>
<row>
<entry>ADY</entry>
<entry>Oronasal</entry>
<entry>Fever, occasional sneeze</entry>
<entry>negative</entry>
<entry>negative</entry>
<entry>negative</entry>
<entry align="center">negative</entry>
<entry>10</entry>
<entry>80</entry>
<entry>80</entry></row>
<row>
<entry>ADZ</entry>
<entry>Oronasal</entry>
<entry>none</entry>
<entry>negative</entry>
<entry>negative</entry>
<entry>negative</entry>
<entry align="center">negative</entry>
<entry>10</entry>
<entry>80</entry>
<entry>160</entry></row></tbody></tgroup>
<tgroup cols="10" rowsep="0">
<colspec colnum="1" colname="col1" colwidth="16mm"/>
<colspec colnum="2" colname="col2" colwidth="27mm"/>
<colspec colnum="3" colname="col3" colwidth="25mm"/>
<colspec colnum="4" colname="col4" colwidth="24mm"/>
<colspec colnum="5" colname="col5" colwidth="22mm"/>
<colspec colnum="6" colname="col6" colwidth="21mm"/>
<colspec colnum="7" colname="col7" colwidth="34mm"/>
<colspec colnum="8" colname="col8" colwidth="30mm"/>
<colspec colnum="9" colname="col9" colwidth="24mm"/>
<colspec colnum="10" colname="col10" colwidth="24mm"/>
<tbody>
<row>
<entry namest="col1" nameend="col10" align="justify">* The animals were challenged with an Equine flu isolate Ohio 03.<br/>
** Rectal temperature ≥103°F; ≥39.4°C</entry></row></tbody></tgroup>
</table>
</tables><!-- EPO <DP n="92"> --></p>
<heading id="h0063"><u>EXAMPLE 18 - EFFICACY OF AN EQUINE INFLUENZA VIRUS VACCINE FOR DOGS.</u></heading>
<p id="p0190" num="0190">The canine influenza (canine flu) virus isolated from flu outbreaks in Florida was observed to be a H3N8 type influenza virus, and was closely related to equine flu virus, A/equine/Ohio/03 based on the sequence similarity. The following study was conducted to determine the efficacy of an experimental inactivated equine influenza virus vaccine.</p>
<heading id="h0064"><u>Procedure:</u></heading>
<p id="p0191" num="0191">Nine 7-week-old beagles of mixed sex were obtained from a commercial supplier, and housed in individual cages in a BSL-2 facility. These dogs were randomly assigned to two groups, as summarized in Table 28:
<tables id="tabl0028" num="0028">
<table frame="all">
<tgroup cols="3">
<colspec colnum="1" colname="col1" colwidth="14mm"/>
<colspec colnum="2" colname="col2" colwidth="28mm"/>
<colspec colnum="3" colname="col3" colwidth="19mm"/>
<thead>
<row>
<entry namest="col1" nameend="col3" align="left" valign="top">Table 28: Experimental Design</entry></row>
<row>
<entry valign="top">Group</entry>
<entry valign="top">Number of Dogs</entry>
<entry valign="top">Treatment</entry></row></thead>
<tbody>
<row>
<entry>1</entry>
<entry>5</entry>
<entry>Vaccine</entry></row>
<row>
<entry>2</entry>
<entry>4</entry>
<entry>Control</entry></row></tbody></tgroup>
</table>
</tables></p>
<p id="p0192" num="0192">The first group consisted of 5 dogs, which were vaccinated with an inactivated, CARBIGEN<sup>™</sup> adjuvanted, equine flu virus A/equine/Ohio/03 vaccine at 8 and 12 weeks-of-age via subcutaneous (SQ) route. The A/equine/Ohio/03 was inactivated by binary ethylenimine ("BEI") using a standard method. Each dose of the vaccine contained 5% by mass CARBIGEN<sup>™</sup>, 4096 HA units of the inactivated virus, sufficient PBS to bring the total volume of the dose to 1 ml, and sufficient NaOH to adjust the pH to between 7.2 and 7.4. Serum samples were collected from all dogs on the day of first and second vaccination and day 7 and 14, post-first and -second vaccination, and at pre-challenge for determining the HI titer using a H3N8 equine influenza virus a standard protocol (SAM 124, CVB, USDA, Ames, IA). At 3 weeks post-second vaccination, the 5 vaccinated dogs and the second group (<i>i.e</i>., the control group) consisting of 4 age-matched dogs were challenged oronasally with a cell-culture-grown equine influenza virus A/equine/Ohio/03 (10<sup>7</sup> to 10<sup>8</sup> TCID50 per dog) in a 1-2 ml volume per dose. The challenge virus was administered to the dogs as a mist using a nebulizer (DeVilbiss Ultra-Neb®99 ultrasonic nebulizer, Sunrise<!-- EPO <DP n="93"> --></p>
<p id="p0193" num="0193">Medical, USA). The dogs were observed for flu-related clinical signs for 14 days post-challenge. Five dogs (3 vaccinates and 2 controls) 7 days post-challenge and 4 dogs (2 controls and 2 vaccinates) 14 days post-challenge were humanely euthanized for collection of lung tissues in 10% buffered formalin for histopathological evaluation.</p>
<heading id="h0065"><u>Results:</u></heading>
<p id="p0194" num="0194">The results of this experiment are summarized in Tables 29 and 30. All vaccinated dogs seroconverted following the vaccination. An HI titer range from 40 to 640, with the GMT of 129, was observed during the post-vaccination period with equine influenza virus A/equine/Ohio/03, and a HI titer of 160 to 320, with a geometric mean titer of 211, was observed with canine flu isolate, A/canine/Florida/242/03. Two of 6 vaccinates had a fever of &gt;103°F (&gt;39.4°C) for one day and no other clinical signs were observed in any of the dogs following challenge.</p>
<heading id="h0066"><u>Conclusion:</u></heading>
<p id="p0195" num="0195">All the vaccinated dogs responded to the inactivated, CARBIGEN<sup>™</sup> adjuvanted equine influenza vaccine. The HI titer results with a canine influenza virus isolate suggest that the inactivated equine influenza vaccine did induce a detectable level of cross reactive antibody to canine influenza virus. Even though the challenge virus used in this did not induce any noticeable clinical disease in beagle dogs, based on the HI titer with a canine influenza virus isolate, it was concluded that inactivated equine vaccine could be used in dogs to induce cross reactive antibodies, which could potentially protect dogs against "canine flu" disease caused by H3N8 type canine influenza viruses.<!-- EPO <DP n="94"> -->
<tables id="tabl0029" num="0029">
<table frame="all">
<tgroup cols="10">
<colspec colnum="1" colname="col1" colwidth="14mm"/>
<colspec colnum="2" colname="col2" colwidth="23mm"/>
<colspec colnum="3" colname="col3" colwidth="30mm"/>
<colspec colnum="4" colname="col4" colwidth="15mm"/>
<colspec colnum="5" colname="col5" colwidth="15mm"/>
<colspec colnum="6" colname="col6" colwidth="12mm"/>
<colspec colnum="7" colname="col7" colwidth="13mm"/>
<colspec colnum="8" colname="col8" colwidth="13mm"/>
<colspec colnum="9" colname="col9" colwidth="18mm"/>
<colspec colnum="10" colname="col10" colwidth="18mm"/>
<thead>
<row>
<entry namest="col1" nameend="col10" align="center" valign="top"><b>Table 29.</b> Serology - Pre- and post-vaccination and post-challenge HI titers</entry></row>
<row>
<entry morerows="2" align="center" valign="middle"><b>Dog*</b></entry>
<entry morerows="2" align="center" valign="middle"><b>Group</b></entry>
<entry namest="col3" nameend="col10" align="center" valign="middle"><b>HI titers</b></entry></row>
<row>
<entry morerows="1" align="center" valign="middle"><b>Pre-vaccination</b></entry>
<entry namest="col4" nameend="col5" align="center" valign="middle"><b>Post-1<sup>st</sup> vaccination</b></entry>
<entry namest="col6" nameend="col8" align="center" valign="middle"><b>Post-2<sup>nd</sup> vaccination</b></entry>
<entry namest="col9" nameend="col10" align="center" valign="middle"><b>Post-challenge*</b></entry></row>
<row>
<entry align="center" valign="middle"><b>7-d</b></entry>
<entry align="center" valign="middle"><b>14-d</b></entry>
<entry align="center" valign="middle"><b>7-d</b></entry>
<entry align="center" valign="middle"><b>14-d</b></entry>
<entry align="center" valign="middle"><b>21-d</b></entry>
<entry align="center" valign="middle"><b>7-d</b></entry>
<entry align="center" valign="middle"><b>14-d</b></entry></row></thead>
<tbody>
<row>
<entry align="center" valign="middle">AKT</entry>
<entry align="center" valign="middle">Vaccinate**</entry>
<entry align="center" valign="middle">&lt;10</entry>
<entry align="center" valign="middle">40</entry>
<entry align="center" valign="middle">80</entry>
<entry align="center" valign="middle">640</entry>
<entry align="center" valign="middle">640</entry>
<entry align="center" valign="middle">640</entry>
<entry align="center" valign="middle">320</entry>
<entry align="center" valign="middle">320</entry></row>
<row>
<entry align="center" valign="middle">ALH</entry>
<entry align="center" valign="middle">Vaccinate**</entry>
<entry align="center" valign="middle">&lt;10</entry>
<entry align="center" valign="middle">40</entry>
<entry align="center" valign="middle">80</entry>
<entry align="center" valign="middle">320</entry>
<entry align="center" valign="middle">160</entry>
<entry align="center" valign="middle">160</entry>
<entry align="center" valign="middle">80</entry>
<entry align="center" valign="middle">***</entry></row>
<row>
<entry align="center" valign="middle">ALU</entry>
<entry align="center" valign="middle">Vaccinate**</entry>
<entry align="center" valign="middle">&lt;10</entry>
<entry align="center" valign="middle">40</entry>
<entry align="center" valign="middle">80</entry>
<entry align="center" valign="middle">320</entry>
<entry align="center" valign="middle">160</entry>
<entry align="center" valign="middle">160</entry>
<entry align="center" valign="middle">80</entry>
<entry align="center" valign="middle">80</entry></row>
<row>
<entry align="center" valign="middle">ANJ</entry>
<entry align="center" valign="middle">Vaccinate**</entry>
<entry align="center" valign="middle">&lt;10</entry>
<entry align="center" valign="middle">40</entry>
<entry align="center" valign="middle">80</entry>
<entry align="center" valign="middle">320</entry>
<entry align="center" valign="middle">160</entry>
<entry align="center" valign="middle">80</entry>
<entry align="center" valign="middle">320</entry>
<entry align="center" valign="middle">***</entry></row>
<row>
<entry align="center" valign="middle">ANU</entry>
<entry align="center" valign="middle">Vaccinate**</entry>
<entry align="center" valign="middle">&lt;10</entry>
<entry align="center" valign="middle">40</entry>
<entry align="center" valign="middle">80</entry>
<entry align="center" valign="middle">320</entry>
<entry align="center" valign="middle">160</entry>
<entry align="center" valign="middle">80</entry>
<entry align="center" valign="middle">160</entry>
<entry align="center" valign="middle">***</entry></row>
<row>
<entry align="center" valign="middle">AJW</entry>
<entry align="center" valign="middle">Control</entry>
<entry align="center" valign="middle">&lt;10</entry>
<entry align="center" valign="middle">&lt;10</entry>
<entry align="center" valign="middle">&lt;10</entry>
<entry align="center" valign="middle">&lt; 10</entry>
<entry align="center" valign="middle">&lt; 10</entry>
<entry align="center" valign="middle">&lt; 10</entry>
<entry align="center" valign="middle">10</entry>
<entry align="center" valign="middle">***</entry></row>
<row>
<entry align="center" valign="middle">AKR</entry>
<entry align="center" valign="middle">Control</entry>
<entry align="center" valign="middle">&lt;10</entry>
<entry align="center" valign="middle">&lt;10</entry>
<entry align="center" valign="middle">&lt;10</entry>
<entry align="center" valign="middle">&lt; 10</entry>
<entry align="center" valign="middle">&lt; 10</entry>
<entry align="center" valign="middle">&lt; 10</entry>
<entry align="center" valign="middle">10</entry>
<entry align="center" valign="middle">***</entry></row>
<row>
<entry align="center" valign="middle">ALZ</entry>
<entry align="center" valign="middle">Control</entry>
<entry align="center" valign="middle">&lt;10</entry>
<entry align="center" valign="middle">&lt;10</entry>
<entry align="center" valign="middle">&lt;10</entry>
<entry align="center" valign="middle">&lt; 10</entry>
<entry align="center" valign="middle">&lt; 10</entry>
<entry align="center" valign="middle">&lt; 10</entry>
<entry align="center" valign="middle">20</entry>
<entry align="center" valign="middle">20</entry></row>
<row>
<entry align="center" valign="middle">ARC</entry>
<entry align="center" valign="middle">Control</entry>
<entry align="center" valign="middle">&lt;10</entry>
<entry align="center" valign="middle">&lt;10</entry>
<entry align="center" valign="middle">&lt;10</entry>
<entry align="center" valign="middle">&lt; 10</entry>
<entry align="center" valign="middle">&lt; 10</entry>
<entry align="center" valign="middle">&lt; 10</entry>
<entry align="center" valign="middle">10</entry>
<entry align="center" valign="middle">10</entry></row></tbody></tgroup>
<tgroup cols="10" rowsep="0">
<colspec colnum="1" colname="col1" colwidth="14mm"/>
<colspec colnum="2" colname="col2" colwidth="23mm"/>
<colspec colnum="3" colname="col3" colwidth="30mm"/>
<colspec colnum="4" colname="col4" colwidth="15mm"/>
<colspec colnum="5" colname="col5" colwidth="15mm"/>
<colspec colnum="6" colname="col6" colwidth="12mm"/>
<colspec colnum="7" colname="col7" colwidth="13mm"/>
<colspec colnum="8" colname="col8" colwidth="13mm"/>
<colspec colnum="9" colname="col9" colwidth="18mm"/>
<colspec colnum="10" colname="col10" colwidth="18mm"/>
<tbody>
<row>
<entry namest="col1" nameend="col10" align="justify">* The animals were challenged with an equine flu isolate Ohio 03<br/>
** CARBIGEN<sup>™</sup> adjuvanted inactivated equine flu virus Ohio 03 vaccine was used for vaccination<br/>
*** Euthanized 7-days post-challenge</entry></row></tbody></tgroup>
</table>
</tables><!-- EPO <DP n="95"> -->
<tables id="tabl0030" num="0030">
<table frame="all">
<tgroup cols="7">
<colspec colnum="1" colname="col1" colwidth="14mm"/>
<colspec colnum="2" colname="col2" colwidth="26mm"/>
<colspec colnum="3" colname="col3" colwidth="24mm"/>
<colspec colnum="4" colname="col4" colwidth="22mm"/>
<colspec colnum="5" colname="col5" colwidth="27mm"/>
<colspec colnum="6" colname="col6" colwidth="24mm"/>
<colspec colnum="7" colname="col7" colwidth="31mm"/>
<thead>
<row>
<entry namest="col1" nameend="col7" align="left" valign="top"><b>Table 30.</b> Canine flu challenge* - clinical signs, virus isolation, histopathology results</entry></row>
<row>
<entry morerows="1" valign="top">Dog ID</entry>
<entry morerows="1" valign="top">Treatment group</entry>
<entry morerows="1" valign="top">Clinical signs</entry>
<entry namest="col4" nameend="col6" align="center" valign="top">Virus isolation</entry>
<entry morerows="1" valign="top">Microscopic lesion (histopathology)</entry></row>
<row>
<entry valign="top">Nasal swab</entry>
<entry valign="top">Tracheal scraping</entry>
<entry valign="top">Lung tissues</entry></row></thead>
<tbody>
<row>
<entry>AKT</entry>
<entry>Vaccinate**</entry>
<entry>none</entry>
<entry>negative</entry>
<entry>negative</entry>
<entry>negative</entry>
<entry align="center">negative</entry></row>
<row>
<entry>ALH</entry>
<entry>Vaccinate*</entry>
<entry>none</entry>
<entry>negative</entry>
<entry>negative</entry>
<entry>negative</entry>
<entry align="center">negative</entry></row>
<row>
<entry>ALU</entry>
<entry>Vaccinate**</entry>
<entry>none</entry>
<entry>negative</entry>
<entry>negative</entry>
<entry>negative</entry>
<entry align="center">negative</entry></row>
<row>
<entry>ANJ</entry>
<entry>Vaccinate**</entry>
<entry>none</entry>
<entry>negative</entry>
<entry>negative</entry>
<entry>negative</entry>
<entry align="center">negative</entry></row>
<row>
<entry>ANU</entry>
<entry>Vaccinate**</entry>
<entry>none</entry>
<entry>negative</entry>
<entry>negative</entry>
<entry>negative</entry>
<entry align="center">negative</entry></row>
<row>
<entry colsep="0"/>
<entry colsep="0"/>
<entry colsep="0"/>
<entry colsep="0"/>
<entry colsep="0"/>
<entry colsep="0"/>
<entry/></row>
<row>
<entry>AJW</entry>
<entry>Control</entry>
<entry>none</entry>
<entry>negative</entry>
<entry>negative</entry>
<entry>negative</entry>
<entry align="center">negative</entry></row>
<row>
<entry>AKR</entry>
<entry>Control</entry>
<entry>none</entry>
<entry>negative</entry>
<entry>negative</entry>
<entry>negative</entry>
<entry align="center">negative</entry></row>
<row>
<entry>ALZ</entry>
<entry>Control</entry>
<entry>none</entry>
<entry>negative</entry>
<entry>negative</entry>
<entry>negative</entry>
<entry align="center">negative</entry></row>
<row>
<entry>ARC</entry>
<entry>Control</entry>
<entry>none</entry>
<entry>negative</entry>
<entry>negative</entry>
<entry>negative</entry>
<entry align="center">negative</entry></row></tbody></tgroup>
<tgroup cols="7" rowsep="0">
<colspec colnum="1" colname="col1" colwidth="14mm"/>
<colspec colnum="2" colname="col2" colwidth="26mm"/>
<colspec colnum="3" colname="col3" colwidth="24mm"/>
<colspec colnum="4" colname="col4" colwidth="22mm"/>
<colspec colnum="5" colname="col5" colwidth="27mm"/>
<colspec colnum="6" colname="col6" colwidth="24mm"/>
<colspec colnum="7" colname="col7" colwidth="31mm"/>
<tbody>
<row>
<entry namest="col1" nameend="col7" align="justify">* The animals were challenged with an Equine flu isolate Ohio 03<br/>
** CARBIGEN<sup>™</sup> adjuvanted inactivated equine flu virus Ohio 03 vaccine was used for vaccination</entry></row></tbody></tgroup>
</table>
</tables><!-- EPO <DP n="96"> --></p>
<p id="p0196" num="0196">EXAMPLE 19 - EFFICACY OF AN EQUINE INFLUENZA VIRUS VACCINE FOR DOGS.</p>
<p id="p0197" num="0197">The canine influenza virus isolated from flu outbreaks in Florida was characterized is closely related to a number of H3N8 type equine influenza virus isolates. By DNA and amino acid sequence similarity analysis it was demonstrated that the canine influenza virus is very similar to an equine influenza virus, A/equine/Ohio/03. The following study was conducted in dogs to determine the efficacy of commercially available equine influenza vaccines in dogs.</p>
<heading id="h0067"><u>Procedure:</u></heading>
<p id="p0198" num="0198">Approximately 16 month old, 20 mongrels and 20 beagles of mixed sex were used in the study. The dogs were randomly assigned to 6 groups (Table 31) of 6-7 dogs each. Dogs in groups 1 and 4 were vaccinated with a commercially available inactivated, adjuvanted equine influenza vaccine (EQUICINE II<sup>™</sup>, Intervet Inc., Millsboro, DE) at 16 and 17 months of age via subcutaneous (SQ) route. The dogs in groups 2 and 5 were vaccinated with a modified live equine/Kentucky/91 influenza vaccine in a 1 ml volume via intranasal route (single nostril). Blood samples were collected on the day of vaccination, day 7 and 14 post first vaccination (groups 1, 2, 4, and 5) and post second vaccination (groups 1 and 4) for determining the HI titer using an H3N8 equine influenza virus and a canine influenza virus using per a standard protocol (SAM 124, CVB, USDA, Ames, IA).</p>
<p id="p0199" num="0199">Vaccinates (at 72 days post final vaccination) and the controls were challenged oronasally with a cell-culture grown equine influenza virus strain A/equine/Ohio/03 (10<sup>7</sup> to 10<sup>8</sup> TCID50 per dog) in a 1-2 ml volume. The challenge virus was administered to the dogs as mist using a nebulizer (DeVilbiss Ultra-Neb®99 ultrasonic nebulizer, Sunrise Medical, USA). The dogs were observed for influenza-related clinical signs for 12 days post-challenge. The nasal and oropharyngeal swabs were collected in Earl's MEM medium with antibiotics (neomycin and polymyxin B) daily from day -1 to day 12 post challenge for virus isolation. The presence of virus in the swabs indicates that the animal is excreting the virus in nasal/oral secretions. All dogs were humanely euthanized on day 12 post-challenge and lung tissues were collected in 10% buffered formalin for histopathological evaluation.<!-- EPO <DP n="97"> -->
<tables id="tabl0031" num="0031">
<table frame="all">
<tgroup cols="6">
<colspec colnum="1" colname="col1" colwidth="14mm"/>
<colspec colnum="2" colname="col2" colwidth="29mm"/>
<colspec colnum="3" colname="col3" colwidth="16mm"/>
<colspec colnum="4" colname="col4" colwidth="27mm"/>
<colspec colnum="5" colname="col5" colwidth="31mm"/>
<colspec colnum="6" colname="col6" colwidth="36mm"/>
<thead>
<row>
<entry namest="col1" nameend="col6" align="left" valign="top"><b>Table 31.</b> Experimental design</entry></row>
<row>
<entry valign="top"><b>Group</b></entry>
<entry valign="top"><b>Number of dogs</b></entry>
<entry valign="top"><b>Breed</b></entry>
<entry valign="top"><b>Treatment</b></entry>
<entry valign="top"><b>Number of doses</b></entry>
<entry valign="top"><b>Route of vaccination</b></entry></row></thead>
<tbody>
<row>
<entry>1</entry>
<entry>7</entry>
<entry>Beagle</entry>
<entry>EQUICINE II<sup>™**</sup></entry>
<entry>2</entry>
<entry>Subcutaneous</entry></row>
<row>
<entry>2</entry>
<entry>7</entry>
<entry>Beagle</entry>
<entry>A/KY/91***</entry>
<entry>1</entry>
<entry>Intranasal</entry></row>
<row>
<entry>3</entry>
<entry>6</entry>
<entry>Beagle</entry>
<entry>Control</entry>
<entry>N/A*</entry>
<entry>N/A*</entry></row>
<row>
<entry>4</entry>
<entry>7</entry>
<entry>Mongrel</entry>
<entry>EQUICINE II<sup>™</sup></entry>
<entry>2</entry>
<entry>Subcutaneous</entry></row>
<row>
<entry>5</entry>
<entry>7</entry>
<entry>Mongrel</entry>
<entry>A/KY/91</entry>
<entry>1</entry>
<entry>Intranasal</entry></row>
<row>
<entry>6</entry>
<entry>6</entry>
<entry>Mongrel</entry>
<entry>Control</entry>
<entry>N/A*</entry>
<entry>N/A*</entry></row></tbody></tgroup>
<tgroup cols="6" rowsep="0">
<colspec colnum="1" colname="col1" colwidth="14mm"/>
<colspec colnum="2" colname="col2" colwidth="29mm"/>
<colspec colnum="3" colname="col3" colwidth="16mm"/>
<colspec colnum="4" colname="col4" colwidth="27mm"/>
<colspec colnum="5" colname="col5" colwidth="31mm"/>
<colspec colnum="6" colname="col6" colwidth="36mm"/>
<tbody>
<row>
<entry namest="col1" nameend="col6" align="justify">* Not applicable<br/>
** EQUICINE II<sup>™</sup> is marketed by Intervet Inc. as a liquid vaccine. EQUICINE II<sup>™</sup> contains inactivated A/Pennsylvania/63 influenza (or "A/Pa/63") virus and A/equine/Kentucky/93 influenza (or "A/KY/93") virus with carbopol (i.e., HALOGEN® (Intervet Inc.)). More specifically, a dose of EQUICINE II<sup>™</sup> contains: inactivated A/Pa/63 at 10<sup>6.0</sup> EID<sub>50</sub>, inactivated A/KY/93 at 10<sup>6.7</sup> EID<sub>50</sub>, 0.25% by volume carbopol, and sufficient PBS to create a total volume of 1 ml.<br/>
*** A/KY/91 is a freeze-dried vaccine that was reconstituted with water. Such reconstitution was conducted using vaccine-grade water sufficient to bring the vaccine dosage to a total volume of 1 ml. The vaccine contained equine/Kentucky/91 influenza (or "A/KY/91") virus, and is discussed in, for example, <patcit id="pcit0027" dnum="us6436408b"><text>U.S. Patent Nos. 6,436,408</text></patcit>; <patcit id="pcit0028" dnum="us6398774b"><text>6,398,774</text></patcit>; and <patcit id="pcit0029" dnum="us6177082b"><text>6,177,082</text></patcit>, which are incorporated by reference in their entirety into this patent. When reconstituted, a dose of the vaccine contained A/KY/91 at 10<sup>7.2</sup> TCID<sub>50</sub> per ml, 0.015 grams N-Z AMINE AS<sup>™</sup> per ml, 0.0025 grams gelatin per ml, and 0.04 grams D lactose per ml. N-Z AMINE AS<sup>™</sup> is a refined source of amino acids and peptides produced by enzymatic hydrolysis of casein. N-Z AMINE AS<sup>™</sup> is marketed by Kerry Bio-Science (Norwich, NY, USA).</entry></row></tbody></tgroup>
</table>
</tables></p>
<heading id="h0068"><u>Results:</u></heading>
<p id="p0200" num="0200">All vaccinated dogs seroconverted following the vaccination and the HI titers ranged from 10 to 80 for EQUICINE II<sup>™</sup> vaccine group dogs compared to 10 to 40 for the A/KY/91 vaccine group dogs using an equine influenza virus (H3N8 type).</p>
<p id="p0201" num="0201">The samples collected at 2 weeks post vaccination (post second vaccination for EQUICINE II<sup>™</sup> vaccine) were analyzed for HI titer determination with a canine influenza as well as with an equine influenza virus (H3N8 type). The HI results are shown in Table 32. The clinical signs include fever (&gt;103°F; &gt;39.4oC), occasional cough, and mild nasal discharge observed following the challenge.<!-- EPO <DP n="98"> -->
<tables id="tabl0032" num="0032">
<table frame="all">
<tgroup cols="8">
<colspec colnum="1" colname="col1" colwidth="14mm"/>
<colspec colnum="2" colname="col2" colwidth="29mm"/>
<colspec colnum="3" colname="col3" colwidth="16mm"/>
<colspec colnum="4" colname="col4" colwidth="22mm"/>
<colspec colnum="5" colname="col5" colwidth="20mm"/>
<colspec colnum="6" colname="col6" colwidth="20mm"/>
<colspec colnum="7" colname="col7" colwidth="20mm"/>
<colspec colnum="8" colname="col8" colwidth="20mm"/>
<thead>
<row>
<entry namest="col1" nameend="col8" align="left" valign="top"><b>Table 32.</b> Serology - HI titers at 2 weeks post vaccination</entry></row>
<row>
<entry valign="top"><b>Group</b></entry>
<entry valign="top"><b>Number of dogs</b></entry>
<entry valign="top"><b>Breed</b></entry>
<entry valign="top"><b>Treatment</b></entry>
<entry namest="col5" nameend="col8" align="center" valign="top"><b>HI titer with</b></entry></row>
<row>
<entry valign="top"/>
<entry valign="top"/>
<entry valign="top"/>
<entry valign="top"/>
<entry namest="col5" nameend="col6" align="left" valign="top"><b>Equine influenza virus</b></entry>
<entry namest="col7" nameend="col8" align="left" valign="top"><b>Canine influenza virus</b></entry></row>
<row>
<entry valign="top"/>
<entry valign="top"/>
<entry valign="top"/>
<entry valign="top"/>
<entry valign="top">Range</entry>
<entry valign="top">GMT</entry>
<entry valign="top">Range</entry>
<entry valign="top">GMT</entry></row></thead>
<tbody>
<row>
<entry>1</entry>
<entry>7</entry>
<entry>Beagle</entry>
<entry>Equicine II<sup>™</sup></entry>
<entry>10-80</entry>
<entry>36</entry>
<entry>10-80</entry>
<entry>33</entry></row>
<row>
<entry>2</entry>
<entry>7</entry>
<entry>Beagle</entry>
<entry>A/KY/91</entry>
<entry>10-20</entry>
<entry>12</entry>
<entry>20-160</entry>
<entry>54</entry></row>
<row>
<entry>3</entry>
<entry>6</entry>
<entry>Beagle</entry>
<entry>Control</entry>
<entry>N/A*</entry>
<entry>N/A*</entry>
<entry>N/A*</entry>
<entry>N/A*</entry></row>
<row>
<entry>4</entry>
<entry>7</entry>
<entry>Mongrel</entry>
<entry>Equicine II<sup>™</sup></entry>
<entry>40-80</entry>
<entry>54</entry>
<entry>40-80</entry>
<entry>50</entry></row>
<row>
<entry>5</entry>
<entry>7</entry>
<entry>Mongrel</entry>
<entry>A/KY/91</entry>
<entry>10-40</entry>
<entry>24</entry>
<entry>40-80</entry>
<entry>49</entry></row>
<row>
<entry>6</entry>
<entry>6</entry>
<entry>Mongrel</entry>
<entry>Control</entry>
<entry>N/A*</entry>
<entry>N/A*</entry>
<entry>N/A*</entry>
<entry>N/A*</entry></row></tbody></tgroup>
<tgroup cols="8" rowsep="0">
<colspec colnum="1" colname="col1" colwidth="14mm"/>
<colspec colnum="2" colname="col2" colwidth="29mm"/>
<colspec colnum="3" colname="col3" colwidth="16mm"/>
<colspec colnum="4" colname="col4" colwidth="22mm"/>
<colspec colnum="5" colname="col5" colwidth="20mm"/>
<colspec colnum="6" colname="col6" colwidth="20mm"/>
<colspec colnum="7" colname="col7" colwidth="20mm"/>
<colspec colnum="8" colname="col8" colwidth="20mm"/>
<tbody>
<row>
<entry namest="col1" nameend="col8" align="justify">* Not applicable</entry></row></tbody></tgroup>
</table>
</tables></p>
<p id="p0202" num="0202">Among beagles, 2 of 6 dogs in the EQUICINE II™ vaccine group (Group 1), 1 of 7 dogs in the A/KY/91 vaccine group (Group 2) and 2 of 6 dogs in the control group (Group 3) had fever. One of 6 dogs in Group 3 (control) was positive for virus in the cell culture supernatant of nasal swab material by hemagglutination assay with 0.25% chicken red blood cells (CRBC). One of 6 dogs in the control group (Group 3) and 1 of 7 dogs in the A/KY/91 vaccine group (Group 2) had mild nasal discharge during the post challenge observation period. There was no statistical significant difference (P &gt; 0.05) between control and vaccine groups for beagle dogs.</p>
<p id="p0203" num="0203">Among mongrels, 5 of 7 dogs in the EQUICINE II™ vaccine group (Group 4), 1 of 7 dogs in the A/KY/91 vaccine group (Group 5) and 5 of 6 dogs in the control group (Group 6) had fever. One dog from each of Group 4 and 6 had a mild nasal discharge, and one dog from Group 5 had an occasional cough. Two of 7 dogs in the EQUICINE II™ vaccine group (Group 4) and 3 of 6 dogs in the control group (Group 6) were positive for influenza virus in the nasal swab by HA assay. None of the dogs from the A/KY/91 group (Group 5) were positive for influenza virus in the nasal swab materials.</p>
<heading id="h0069"><u>Conclusion:</u></heading>
<p id="p0204" num="0204">By serology, it was demonstrated that vaccination of dogs with commercially available equine influenza vaccines stimulated a moderate level influenza antibody response. There may be some breed difference in development of influenza-related clinical signs in dogs following a challenge with H3N8 type influenza virus. The live attenuated equine influenza vaccine (A/KY/91) provided a significant (P&lt; 0.05) protection<!-- EPO <DP n="99"> --> from clinical disease development in rectal temperature in mongrels. Also, the live attenuated viral vaccine prevented the shedding of influenza virus in the nasal secretions.</p>
<heading id="h0070">EXAMPLE 20 - CANINE INFLUENZA CHALLENGE MODEL DEVELOPMENT</heading>
<p id="p0205" num="0205">In view of reports that inducing disease in canines for purposes of study had not proven successful, the potential for using a canine influenza virus, H3N8, to develop a canine influenza challenge model in dogs was investigated in the following study.</p>
<heading id="h0071"><u>Procedure:</u></heading>
<p id="p0206" num="0206">Ten mongrels of mixed sex were obtained from a commercial supplier, and housed in cages in a BSL-2 facility. The dogs were randomly assigned to two groups of 5 dogs each. As shown in Table 33, one group was subjected to an intratracheal/intranasal challenge, and the other group was subjected.
<tables id="tabl0033" num="0033">
<table frame="all">
<tgroup cols="3">
<colspec colnum="1" colname="col1" colwidth="14mm"/>
<colspec colnum="2" colname="col2" colwidth="29mm"/>
<colspec colnum="3" colname="col3" colwidth="37mm"/>
<thead>
<row>
<entry namest="col1" nameend="col3" align="left" valign="top"><b>Table 33.</b> Experimental design</entry></row>
<row>
<entry valign="top"><b>Group</b></entry>
<entry valign="top"><b>Number of dogs</b></entry>
<entry valign="top"><b>Challenge route</b></entry></row></thead>
<tbody>
<row>
<entry>1</entry>
<entry>5</entry>
<entry>Intratracheal/intranasal</entry></row>
<row>
<entry>2</entry>
<entry>5</entry>
<entry>Oronasal</entry></row></tbody></tgroup>
</table>
</tables>
The dogs were challenged at approximately 12 weeks-of-age. Embryonated-chicken-egg grown canine influenza virus (A/canine/Florida/242/03) virus was used as challenge virus. Each dog received a total of approximately 10<sup>7.2</sup> TCID50 of virus in either 2 ml (for oronasal route) or 4 ml (intratracheal/intranasal route) volume.</p>
<p id="p0207" num="0207">For intratracheal/intranasal challenge, 3 ml of the challenge virus was administered into the trachea first, followed by 5 ml of PBS using a delivery tube, which consisted of a cuffed tracheal tube (Size 4.5/5.0, Sheridan, USA) and feeding tube (size 5Fr, 1.7 mm; 16 inches (41 cm) in length, Kendall, USA), and a 1 ml challenge virus, followed by 3 ml of atmospheric air was administered into nostrils using a syringe.</p>
<p id="p0208" num="0208">For oronasal challenge, the challenge virus was administered as a mist using a nebulizer (Nebulair™, DVM Pharmaceuticals, Inc., Miami, FL) in approximately 2 ml volume. The dogs were observed for flu-related clinical signs for 14 days post-challenge. The dogs were euthanized at day 14 post challenge, and tissue (lung and trachea) samples were collected in 10% buffered formalin for histopathological examination.<!-- EPO <DP n="100"> --></p>
<heading id="h0072"><u>Results:</u></heading>
<p id="p0209" num="0209">All dogs in groups 1 and 2 developed canine influenza clinical signs within 24 to 48 hours. Each dog had 2 or more of the following clinical signs: fever (&gt;103.0°F; &gt;39.4°C), cough, serous or mucopurulent ocular discharge, serous or mucopurulent nasal discharge, vomiting, diarrhea, depression, weight loss, gagging, hemoptysis, and audible rales. Lung tissues from 5 of 5 dogs from group 1 and 4 of 5 dogs from group 2 had histopathological lesions which included one or more of the following: diffuse suppurative bronchopneumonia, bronchitis/bronchoiolitis with plugs of neutrophilic exudate in the lumina and marked mononuclear cell aggregation in mucosa and peribronchiolar tissue, mixed exudate within alveoli with large numbers of foamy macrophages, lymphocellular and plasma cellular as well as granulocytic cell infiltration, and thickening of alveolar septa with proliferation of type II pneumocytes compatible with or pathognomic to an influenza virus infection. The trachea tissue samples were normal.</p>
<heading id="h0073"><u>Conclusion:</u></heading>
<p id="p0210" num="0210">An H3N8 canine influenza isolate such as the one used in this study may be used for inducing canine influenza disease in dogs using one of the methods described in this study or a similar method.</p>
<heading id="h0074">EXAMPLE 21 - CANINE INFLUENZA CHALLENGE MODEL DEVELOPMENT.</heading>
<p id="p0211" num="0211">The potential for using a canine influenza virus, H3N8, to develop a canine influenza challenge model in dogs was further investigated in the following study.</p>
<heading id="h0075"><u>Procedure:</u></heading>
<p id="p0212" num="0212">Fifteen 17- to 18-week-old mongrels and five 15-week-old beagles were obtained from commercial suppliers, and were housed in cages in a BSL-2 facility. The mongrels were randomly assigned to 3 groups (Groups 1 to 3) of 5 dogs each. All beagles were assigned to one group (Group 4) as shown in Table 34:
<tables id="tabl0034" num="0034">
<table frame="all">
<tgroup cols="4">
<colspec colnum="1" colname="col1" colwidth="14mm"/>
<colspec colnum="2" colname="col2" colwidth="18mm"/>
<colspec colnum="3" colname="col3" colwidth="29mm"/>
<colspec colnum="4" colname="col4" colwidth="36mm"/>
<thead>
<row>
<entry namest="col1" nameend="col4" align="left" valign="top"><b>Table 34.</b> Experimental design</entry></row>
<row>
<entry valign="top"><b>Group</b></entry>
<entry valign="top"><b>Breed</b></entry>
<entry valign="top"><b>Number of dogs</b></entry>
<entry valign="top"><b>Challenge virus dose</b></entry></row></thead>
<tbody>
<row>
<entry>1</entry>
<entry>Mongrels</entry>
<entry>5</entry>
<entry>10<sup>6.8</sup> TCID<sub>50</sub></entry></row>
<row>
<entry>2</entry>
<entry>Mongrels</entry>
<entry>5</entry>
<entry>10<sup>5.8</sup> TCID<sub>50</sub></entry></row>
<row>
<entry>3</entry>
<entry>Mongrels</entry>
<entry>5</entry>
<entry>10<sup>4.8</sup> TCID<sub>50</sub></entry></row>
<row>
<entry>4</entry>
<entry>Beagles</entry>
<entry>5</entry>
<entry>10<sup>6.8</sup> TCID<sub>50</sub></entry></row></tbody></tgroup>
</table>
</tables><!-- EPO <DP n="101"> -->
The dogs were challenged oronasally with a virulent canine influenza virus, A/Canine/Florida/242/2003 (isolated from lung of a greyhound dog with canine influenza disease (provided by Dr. Cynda Crawford at the University of Florida)). The challenge virus was administered as a mist using a nebulizer (Nebulair™) in approximately 2 ml volume. The dogs were observed for flu-related clinical signs for 14 days post-challenge.</p>
<heading id="h0076"><u>Results:</u></heading>
<p id="p0213" num="0213">Eighty percent (4 of 5) of the dogs in Group 1 and 4, 100% of the dogs in Group 2 and 3, developed canine influenza clinical signs within 48 hours. Each dog had one or more of the following clinical signs: fever (&gt;103.0°F; &gt;39.4°C), cough, serous or mucopurulent ocular discharge, serous or mucopurulent nasal discharge, vomiting, diarrhea, depression, weight loss, gagging, and rales. The clinical signs observed in beagles were generally milder and short-course compared to mongrels.</p>
<heading id="h0077"><u>Conclusion:</u></heading>
<p id="p0214" num="0214">An H3N8 canine influenza isolate such as the one used in this study may be used for inducing canine-influenza-like or kennel-cough-like disease in dogs using method described in this study or a similar method with a challenge dose range from 10<sup>4.8</sup> to 10<sup>6.8</sup> TCID50. There were some differences in clinical signs observed in mongrels and beagles. In general, beagles tend to have milder flu-related clinical signs compared to mongrels.</p>
<heading id="h0078">EXAMPLE 22 - CANINE INFLUENZA VACCINE EFFICACY STUDY.</heading>
<p id="p0215" num="0215">The following study was conducted to assess the efficacy of an H3N8 equine influenza vaccine in dogs against canine influenza virus.</p>
<heading id="h0079"><u>Procedure:</u></heading>
<p id="p0216" num="0216">Seventeen 14-week-old mongrels and ten 8-week-old beagles were obtained from commercial suppliers. The dogs were randomly assigned to 5 groups as shown in Table 35, and housed in a research facility.<!-- EPO <DP n="102"> -->
<tables id="tabl0035" num="0035">
<table frame="all">
<tgroup cols="6">
<colspec colnum="1" colname="col1" colwidth="14mm"/>
<colspec colnum="2" colname="col2" colwidth="18mm"/>
<colspec colnum="3" colname="col3" colwidth="27mm"/>
<colspec colnum="4" colname="col4" colwidth="19mm"/>
<colspec colnum="5" colname="col5" colwidth="28mm"/>
<colspec colnum="6" colname="col6" colwidth="42mm"/>
<thead>
<row>
<entry namest="col1" nameend="col6" align="left" valign="top"><b>Table 35.</b> Experimental design</entry></row></thead>
<tbody>
<row>
<entry align="center" valign="middle"><u>Group</u></entry>
<entry align="center" valign="middle"><u>Age</u></entry>
<entry align="center" valign="middle"><u>Number of dogs</u></entry>
<entry align="center" valign="middle"><u>Treatment</u></entry>
<entry align="center"><u>Number of</u> <u>doses</u></entry>
<entry align="center"><u>Age at</u> <u>Vaccination</u> (weeks)</entry></row>
<row>
<entry align="center" valign="middle">1</entry>
<entry align="center" valign="middle">14 weeks</entry>
<entry align="center" valign="middle">7</entry>
<entry align="center" valign="middle">Vaccinate</entry>
<entry align="center" valign="middle">2</entry>
<entry align="center" valign="middle">14 &amp; 18</entry></row>
<row>
<entry align="center" valign="middle">2</entry>
<entry align="center" valign="middle">14 weeks</entry>
<entry align="center" valign="middle">5</entry>
<entry align="center" valign="middle">Vaccinate</entry>
<entry align="center" valign="middle">1</entry>
<entry align="center" valign="middle">18</entry></row>
<row>
<entry align="center" valign="middle">3</entry>
<entry align="center" valign="middle">14 weeks</entry>
<entry align="center" valign="middle">5</entry>
<entry align="center" valign="middle">Control</entry>
<entry align="center" valign="middle">--</entry>
<entry align="center" valign="middle">--</entry></row>
<row>
<entry align="center" valign="middle">4</entry>
<entry align="center" valign="middle">8 weeks</entry>
<entry align="center" valign="middle">5</entry>
<entry align="center" valign="middle">Vaccinate</entry>
<entry align="center" valign="middle">2</entry>
<entry align="center" valign="middle">8 &amp; 12</entry></row>
<row>
<entry align="center" valign="middle">5</entry>
<entry align="center" valign="middle">8 weeks</entry>
<entry align="center" valign="middle">5</entry>
<entry align="center" valign="middle">Control</entry>
<entry align="center" valign="middle">--</entry>
<entry align="center" valign="middle">--</entry></row></tbody></tgroup>
</table>
</tables></p>
<p id="p0217" num="0217">The vaccine used in this study was a HAVLOGEN®-adjuvanted, inactivated equine influenza virus (A/equine/KY/02) vaccine. To prepare this vaccine, the virus was inactivated by binary ethylenimine (BEI) using a standard method. Each vaccine dose contained HAVLOGEN® (10% v/v), 6144 HA units of the inactivated virus, 0.1% (v/v) of 10% thimerosal, 0.1 % (v/v) of phenol red, sufficient NaOH to adjust the pH to from 6.8 to 7.2, and sufficient PBS to bring the total dose volume to 1 ml.</p>
<p id="p0218" num="0218">The dogs in Groups 1 and 4 were vaccinated with 2 doses of the vaccine. The second dose (<i>i.e.</i>, the booster) was administered 4 weeks after the first. The dogs in Group 2 were vaccinated with 1 dose at 18 weeks-of-age. Blood samples were collected to assess HI titer using a standard protocol (<i>e.g.</i>, SAM 124, CVB, USDA, Ames, IA) with an H3N8 canine influenza isolate on days zero (before vaccination), 7, and 14 post first and second vaccinations. Approximately 5 days before challenge, the dogs were moved to a BSL-2 facility and housed in individual cages.</p>
<p id="p0219" num="0219">All vaccinates and age-matched control dogs were challenged oronasally with a virulent canine influenza virus (10<sup>7.7</sup> TCID50 of A/Canine/Florida/242/2003 per dog) at 2 weeks post second vaccination of Groups 1 and 4 and first vaccination of Group 2. The challenge virus was administered as a mist using a nebulizer (Nebulair™) at 2 ml per dog. The dogs were observed for influenza-related clinical signs for 17 days post-challenge. Nasal and oropharygeal swabs were collected in tubes containing 2 ml of virus transport medium for virus isolation from day -1 (<i>i.e</i>., one day before challenge) to day 17 days post-challenge. All dogs were euthanized at day 17 post-challenge and lung and tracheal samples were collected in 10% buffered formalin for histopathology. Blood samples were collected on days 7 and 14 post challenge for HI titer determination. The clinical sign score assignments used for the post challenge observation are shown in Table 36.<!-- EPO <DP n="103"> --></p>
<heading id="h0080"><u>Results:</u></heading>
<p id="p0220" num="0220">All dogs in 2-dose vaccination groups (Group 1 and 4) developed HI antibody titer responses to the canine influenza virus isolate (Table 37). Following the challenge, approximately a 4-fold increase in titer on day 14 post challenge in all groups indirectly indicated that all dogs were exposed to the challenge virus. All dogs exhibited one or more of the following signs of canine influenza: fever (&gt;103.0°F; &gt;39.4°C), cough, serous or mucopurulent ocular discharge, serous or mucopurulent nasal discharge, vomiting, diarrhea, depression, weight loss, and dyspnea. Vaccinates had less severe clinical signs, compared to age-matched controls (Table 38). There was a significant reduction in clinical signs due to the 2-dose vaccination in both 8-week-old (P = 0.040) and 14-week-old (P = 0.003) dogs (Groups 4 and 1 respectively). In this experiment, one-dose vaccination did not provide a significant (P = 0.294) reduction in clinical signs (Group 2)</p>
<p id="p0221" num="0221">Virus isolation results are shown in Table 39. Among 14-week-old dogs, canine influenza virus was isolated from swab samples collected from 2 of 7 dogs (29%) from the 2-dose vaccine group (Group 1), 3 of 5 dogs (60%) from the 1-dose vaccine group (Group 2), and 5 of 5 dogs (100%) from the control group (Group 3). Among 8-week-old dogs, the virus was isolated from 1 of 5 dogs (20%) from the 2-dose vaccine group (Group 4), and 4 of 5 dogs (80%) from the control group (Group 5). There was a significant reduction (P = 0.003) in the number of dogs positive for canine influenza virus in swab samples due to 2-dose vaccination (Groups 1 and 4) compared to unvaccinated controls (Groups 3 and 5). Although there was a reduction in the number of dogs (60% vs. 100%) positive for canine influenza virus in swab samples between 1-dose vaccine group (Group 2) and the control group (Group 3), the difference was not statistically significant (P = 0.222).</p>
<p id="p0222" num="0222">Histopathological evaluation of lung and tracheal tissue samples for lesions was conducted to identify lesions compatible with or pathognomic to canine influenza disease. This includes, for example, determination of whether one or more of the following exist: areas with suppurative bronchopneumonia; peribronchitis/peribronchiolitis with mononuclear cell aggregation (lymphocytes, plasma cells); presence of plugs of granulocytic cellular debris in the lumina; hyperplasia of respiratory epithelium; mixed exudate in the alveoli with large amount of granulocytic cells and cell debris; aggregates of (foamy) macrophages, plasma cells, and lymphocytes; and thickening of alveolar septa with proliferation of type II pneumocytes.<!-- EPO <DP n="104"> --></p>
<p id="p0223" num="0223">Table 40 provides a summary of the extent of lesions in this experiment for the dogs. Among 14-week-old dogs, the lung lesions were less extensive and less severe in 5 of 7 dogs in the 2-dose vaccination group (Group 2), and 4 of 5 dogs in the 1-dose vaccination group (Group 1). All controls dogs (Group 3) had severe and extensive lesions suggestive of no protection. There was no difference in tracheal lesions due to 1-or 2-dose vaccination among 14- week-old dogs. Among 8-week-old dogs, there was no difference in lung lesions between 2-dose vaccinates and control dogs. None of the dogs had any tracheal lesions.</p>
<heading id="h0081"><u>Conclusion:</u></heading>
<p id="p0224" num="0224">The results from this study demonstrate that: (1) inactivated H3N8 equine influenza virus can induce canine influenza virus cross reactive HI antibody responses in vaccinated dogs, (2) use of an H3N8 equine influenza virus vaccine can reduce the severity of canine influenza virus disease in dogs, and (3) use of an H3N8 equine influenza virus vaccine can reduce virus excretion in nasal and/or oral secretions.
<tables id="tabl0036" num="0036">
<table frame="all">
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="45mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry namest="col1" nameend="col2" align="left" valign="top"><b>Table 36.</b> Clinical signs and scoring system</entry></row>
<row>
<entry valign="top"><b><u>Clinical signs</u></b></entry>
<entry valign="top"><b><u>Score per day</u></b></entry></row>
<row>
<entry namest="col1" nameend="col2" align="left" valign="top"><b>Temp</b></entry></row></thead>
<tbody>
<row>
<entry>&lt;103.0°F (&lt;39.4°C)</entry>
<entry>0</entry></row>
<row>
<entry>103.0 -103.9°F (39.4-</entry>
<entry>2</entry></row>
<row>
<entry>104.0-104.9°F (40.0-40.5°C)</entry>
<entry>3</entry></row>
<row>
<entry>&gt;105.0°F (&gt;40.6°C)</entry>
<entry>4</entry></row></tbody></tgroup>
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="45mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry namest="col1" nameend="col2" align="left" valign="top"><b>Coughing</b></entry></row></thead>
<tbody>
<row>
<entry>No coughing</entry>
<entry>0</entry></row>
<row>
<entry>Occasional</entry>
<entry>2</entry></row>
<row>
<entry>Paroxysmal</entry>
<entry>4</entry></row></tbody></tgroup>
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="45mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry namest="col1" nameend="col2" align="left" valign="top"><b>Sneezing</b></entry></row></thead>
<tbody>
<row>
<entry>No sneezing</entry>
<entry>0</entry></row>
<row>
<entry>Occasional</entry>
<entry>1</entry></row>
<row>
<entry>Paroxysmal</entry>
<entry>2</entry></row></tbody></tgroup>
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="45mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry namest="col1" nameend="col2" align="left" valign="top"><b>Nasal discharge</b></entry></row></thead>
<tbody>
<row>
<entry>No discharge</entry>
<entry>0</entry></row>
<row>
<entry>Serous -slight</entry>
<entry>1</entry></row>
<row>
<entry>Serous -copious</entry>
<entry>1</entry></row>
<row>
<entry>Mucopurulent-slight</entry>
<entry>2</entry></row>
<row>
<entry>Mucopurulent-copious</entry>
<entry>3</entry></row></tbody></tgroup><!-- EPO <DP n="105"> -->
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="45mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry namest="col1" nameend="col2" align="left" valign="top"><b>Ocular discharge</b></entry></row></thead>
<tbody>
<row>
<entry>No discharge</entry>
<entry>0</entry></row>
<row>
<entry>Serous -slight</entry>
<entry>1</entry></row>
<row>
<entry>Serous -copious</entry>
<entry>1</entry></row>
<row>
<entry>Mucopurulent-slight</entry>
<entry>2</entry></row>
<row>
<entry>Mucopurulent-copious</entry>
<entry>3</entry></row></tbody></tgroup>
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="45mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry namest="col1" nameend="col2" align="left" valign="top"><b>Hemoptysis</b></entry></row></thead>
<tbody>
<row>
<entry>No</entry>
<entry>0</entry></row>
<row>
<entry>Yes</entry>
<entry>5</entry></row></tbody></tgroup>
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="45mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry namest="col1" nameend="col2" align="left" valign="top"><b>Depression</b></entry></row></thead>
<tbody>
<row>
<entry>No</entry>
<entry>0</entry></row>
<row>
<entry>Yes</entry>
<entry>1</entry></row></tbody></tgroup>
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="45mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry namest="col1" nameend="col2" align="left" valign="top"><b>Anorexia</b></entry></row></thead>
<tbody>
<row>
<entry>No</entry>
<entry>0</entry></row>
<row>
<entry>Yes</entry>
<entry>1</entry></row></tbody></tgroup>
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="45mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry valign="top"><b>Respiratory signs</b></entry>
<entry valign="top"/></row></thead>
<tbody>
<row>
<entry>None</entry>
<entry>0</entry></row>
<row>
<entry>Rales</entry>
<entry>3</entry></row>
<row>
<entry>Dyspnea</entry>
<entry>4</entry></row>
<row>
<entry>Gasping</entry>
<entry>5</entry></row></tbody></tgroup>
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="45mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry namest="col1" nameend="col2" align="left" valign="top"><b>Mucous expectorate</b></entry></row></thead>
<tbody>
<row>
<entry>No</entry>
<entry>0</entry></row>
<row>
<entry>Yes</entry>
<entry>2</entry></row></tbody></tgroup>
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="45mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry valign="top"><b>Vomiting</b></entry>
<entry valign="top"/></row></thead>
<tbody>
<row>
<entry>No</entry>
<entry>0</entry></row>
<row>
<entry>Yes</entry>
<entry>1</entry></row></tbody></tgroup>
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="45mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry valign="top"><b>Fecal abnormalities</b></entry>
<entry valign="top"/></row></thead>
<tbody>
<row>
<entry>No</entry>
<entry>0</entry></row>
<row>
<entry>Yes</entry>
<entry>1</entry></row></tbody></tgroup>
</table>
</tables><!-- EPO <DP n="106"> -->
<tables id="tabl0037" num="0037">
<table frame="all">
<tgroup cols="13">
<colspec colnum="1" colname="col1" colwidth="14mm"/>
<colspec colnum="2" colname="col2" colwidth="11mm"/>
<colspec colnum="3" colname="col3" colwidth="15mm"/>
<colspec colnum="4" colname="col4" colwidth="20mm"/>
<colspec colnum="5" colname="col5" colwidth="17mm"/>
<colspec colnum="6" colname="col6" colwidth="11mm"/>
<colspec colnum="7" colname="col7" colwidth="11mm"/>
<colspec colnum="8" colname="col8" colwidth="11mm"/>
<colspec colnum="9" colname="col9" colwidth="12mm"/>
<colspec colnum="10" colname="col10" colwidth="11mm"/>
<colspec colnum="11" colname="col11" colwidth="13mm"/>
<colspec colnum="12" colname="col12" colwidth="12mm"/>
<colspec colnum="13" colname="col13" colwidth="13mm"/>
<thead>
<row>
<entry namest="col1" nameend="col13" align="left" valign="top"><b>Table 37.</b> Serology - Hemagglutination inhibition titers</entry></row>
<row>
<entry morerows="2" align="center" valign="top">Group No</entry>
<entry morerows="2" align="center" valign="top">Dog ID</entry>
<entry morerows="2" align="center" valign="top">Age (week)</entry>
<entry morerows="2" align="center" valign="top">Treatment</entry>
<entry morerows="2" align="center" valign="top">Number of doses</entry>
<entry namest="col6" nameend="col13" align="center" valign="top">HI titer</entry></row>
<row>
<entry namest="col6" nameend="col11" align="center" valign="top">Days post first vaccination of Groups 1 and 4</entry>
<entry namest="col12" nameend="col13" align="center" valign="top">Days post challenge</entry></row>
<row>
<entry align="center" valign="top">0*</entry>
<entry align="center" valign="top">7</entry>
<entry align="center" valign="top">14</entry>
<entry align="center" valign="top">28**</entry>
<entry align="center" valign="top">35</entry>
<entry align="center" valign="top">42***</entry>
<entry align="center" valign="top">7</entry>
<entry align="center" valign="top">14</entry></row></thead>
<tbody>
<row>
<entry align="center">1</entry>
<entry align="center">921</entry>
<entry align="center">14</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">10</entry>
<entry align="center">20</entry>
<entry align="center">40</entry>
<entry align="center">20</entry>
<entry align="center">160</entry>
<entry align="center">320</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">926</entry>
<entry align="center">14</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">40</entry>
<entry align="center">40</entry>
<entry align="center">80</entry>
<entry align="center">80</entry>
<entry align="center">&gt; 640</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">931</entry>
<entry align="center">14</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">10</entry>
<entry align="center">20</entry>
<entry align="center">20</entry>
<entry align="center">80</entry>
<entry align="center">&gt; 640</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">955</entry>
<entry align="center">14</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">10</entry>
<entry align="center">40</entry>
<entry align="center">40</entry>
<entry align="center">160</entry>
<entry align="center">320</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">011</entry>
<entry align="center">14</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">10</entry>
<entry align="center">20</entry>
<entry align="center">40</entry>
<entry align="center">160</entry>
<entry align="center">320</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">013</entry>
<entry align="center">14</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">20</entry>
<entry align="center">40</entry>
<entry align="center">40</entry>
<entry align="center">160</entry>
<entry align="center">320</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">019</entry>
<entry align="center">14</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">10</entry>
<entry align="center">20</entry>
<entry align="center">40</entry>
<entry align="center">80</entry>
<entry align="center">&gt; 640</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">922</entry>
<entry align="center">14</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">1</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&gt; 640</entry>
<entry align="center">&gt;640</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">953</entry>
<entry align="center">14</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">1</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">320</entry>
<entry align="center">&gt; 40</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">015</entry>
<entry align="center">14</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">1</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">320</entry>
<entry align="center">&gt;640</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">016</entry>
<entry align="center">14</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">1</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">160</entry>
<entry align="center">320</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">017</entry>
<entry align="center">14</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">1</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">320</entry>
<entry align="center">&gt;640</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">923</entry>
<entry align="center">14</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">40</entry>
<entry align="center">160</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">012</entry>
<entry align="center">14</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">40</entry>
<entry align="center">320</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">014</entry>
<entry align="center">14</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">40</entry>
<entry align="center">160</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">018</entry>
<entry align="center">14</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">40</entry>
<entry align="center">160</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">01A</entry>
<entry align="center">14</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">40</entry>
<entry align="center">160</entry></row>
<row>
<entry align="center">4</entry>
<entry align="center">406</entry>
<entry align="center">8</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">10</entry>
<entry align="center">40</entry>
<entry align="center">80</entry>
<entry align="center">80</entry>
<entry align="center">160</entry>
<entry align="center">&gt; 640</entry></row>
<row>
<entry align="center">4</entry>
<entry align="center">407</entry>
<entry align="center">8</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">&lt;10</entry>
<entry align="center">20</entry>
<entry align="center">20</entry>
<entry align="center">40</entry>
<entry align="center">40</entry>
<entry align="center">40</entry>
<entry align="center">320</entry>
<entry align="center">&gt;640</entry></row>
<row>
<entry align="center">4</entry>
<entry align="center">504</entry>
<entry align="center">8</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">10</entry>
<entry align="center">20</entry>
<entry align="center">20</entry>
<entry align="center">80</entry>
<entry align="center">160</entry>
<entry align="center">&gt;640</entry></row>
<row>
<entry align="center">4</entry>
<entry align="center">704</entry>
<entry align="center">8</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">10</entry>
<entry align="center">40</entry>
<entry align="center">80</entry>
<entry align="center">160</entry>
<entry align="center">160</entry>
<entry align="center">&gt; 640</entry></row>
<row>
<entry align="center">4</entry>
<entry align="center">705</entry>
<entry align="center">8</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">40</entry>
<entry align="center">80</entry>
<entry align="center">160</entry>
<entry align="center">160</entry>
<entry align="center">&gt; 640</entry></row>
<row>
<entry align="center">5</entry>
<entry align="center">404</entry>
<entry align="center">8</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">80</entry>
<entry align="center">160</entry></row>
<row>
<entry align="center">5</entry>
<entry align="center">405</entry>
<entry align="center">8</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">80</entry>
<entry align="center">80</entry></row>
<row>
<entry align="center">5</entry>
<entry align="center">610</entry>
<entry align="center">8</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">20</entry>
<entry align="center">40</entry></row>
<row>
<entry align="center">5</entry>
<entry align="center">702</entry>
<entry align="center">8</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">80</entry>
<entry align="center">160</entry></row>
<row>
<entry align="center">5</entry>
<entry align="center">703</entry>
<entry align="center">8</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">40</entry>
<entry align="center">160</entry></row></tbody></tgroup>
<tgroup cols="13" rowsep="0">
<colspec colnum="1" colname="col1" colwidth="14mm"/>
<colspec colnum="2" colname="col2" colwidth="11mm"/>
<colspec colnum="3" colname="col3" colwidth="15mm"/>
<colspec colnum="4" colname="col4" colwidth="20mm"/>
<colspec colnum="5" colname="col5" colwidth="17mm"/>
<colspec colnum="6" colname="col6" colwidth="11mm"/>
<colspec colnum="7" colname="col7" colwidth="11mm"/>
<colspec colnum="8" colname="col8" colwidth="11mm"/>
<colspec colnum="9" colname="col9" colwidth="12mm"/>
<colspec colnum="10" colname="col10" colwidth="11mm"/>
<colspec colnum="11" colname="col11" colwidth="13mm"/>
<colspec colnum="12" colname="col12" colwidth="12mm"/>
<colspec colnum="13" colname="col13" colwidth="13mm"/>
<tbody>
<row>
<entry namest="col1" nameend="col13" align="justify">*First vaccination - Groups 1 and 4<br/>
**Second vaccination - Groups 1 and 4; First vaccination - Group 2<br/>
***Day of challenge</entry></row></tbody></tgroup>
</table>
</tables><!-- EPO <DP n="107"> -->
<tables id="tabl0038" num="0038">
<table frame="all">
<tgroup cols="6">
<colspec colnum="1" colname="col1" colwidth="14mm"/>
<colspec colnum="2" colname="col2" colwidth="19mm"/>
<colspec colnum="3" colname="col3" colwidth="34mm"/>
<colspec colnum="4" colname="col4" colwidth="33mm"/>
<colspec colnum="5" colname="col5" colwidth="33mm"/>
<colspec colnum="6" colname="col6" colwidth="34mm"/>
<thead>
<row>
<entry namest="col1" nameend="col6" align="left" valign="top"><b>Table 38.</b> Analysis of total canine influenza disease clinical scores</entry></row>
<row>
<entry align="center" valign="top"><u>Group</u></entry>
<entry align="center" valign="top"><u>Treatment</u></entry>
<entry align="center" valign="top"><u>Number of doses</u> <u>of vaccine</u></entry>
<entry align="center" valign="top"><u>Age at first vaccination</u> <u>of Groups 1 and 4</u></entry>
<entry align="center" valign="top"><u>Average total</u> <u>Score per dog</u></entry>
<entry align="center" valign="top"><u>P-value*</u></entry></row></thead>
<tbody>
<row>
<entry align="center">1</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">14 weeks</entry>
<entry align="center">8.7</entry>
<entry align="center">0.003 (Group 1 vs. 3)</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">1</entry>
<entry align="center">14 weeks (these dogs were vaccinated once, when they were 18 weeks old)</entry>
<entry align="center">21.8</entry>
<entry align="center">0.294 (Group 2 vs. 3)</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">Control</entry>
<entry align="center">--</entry>
<entry align="center">14 weeks (these dogs were not vaccinated)</entry>
<entry align="center">25.4</entry>
<entry align="center">--</entry></row>
<row>
<entry align="center">4</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">8 weeks</entry>
<entry align="center">2.0</entry>
<entry align="center">0.040 (Group 4 vs. 5)</entry></row>
<row>
<entry align="center">5</entry>
<entry align="center">Control</entry>
<entry align="center">--</entry>
<entry align="center">8 weeks (these dogs were not vaccinated)</entry>
<entry align="center">5.4</entry>
<entry align="center">--</entry></row></tbody></tgroup>
<tgroup cols="6" rowsep="0">
<colspec colnum="1" colname="col1" colwidth="14mm"/>
<colspec colnum="2" colname="col2" colwidth="19mm"/>
<colspec colnum="3" colname="col3" colwidth="34mm"/>
<colspec colnum="4" colname="col4" colwidth="33mm"/>
<colspec colnum="5" colname="col5" colwidth="33mm"/>
<colspec colnum="6" colname="col6" colwidth="34mm"/>
<tbody>
<row>
<entry namest="col1" nameend="col6" align="justify">*Analyzed using a NPARIWAY procedure of SAS® Version 8.2 (the vaccine groups were compared using the Wilcoxon rank sum test)</entry></row></tbody></tgroup>
</table>
</tables><!-- EPO <DP n="108"> -->
<tables id="tabl0039" num="0039">
<table frame="all">
<tgroup cols="24">
<colspec colnum="1" colname="col1" colwidth="16mm"/>
<colspec colnum="2" colname="col2" colwidth="12mm"/>
<colspec colnum="3" colname="col3" colwidth="16mm"/>
<colspec colnum="4" colname="col4" colwidth="22mm"/>
<colspec colnum="5" colname="col5" colwidth="18mm"/>
<colspec colnum="6" colname="col6" colwidth="9mm"/>
<colspec colnum="7" colname="col7" colwidth="9mm"/>
<colspec colnum="8" colname="col8" colwidth="9mm"/>
<colspec colnum="9" colname="col9" colwidth="9mm"/>
<colspec colnum="10" colname="col10" colwidth="9mm"/>
<colspec colnum="11" colname="col11" colwidth="9mm"/>
<colspec colnum="12" colname="col12" colwidth="9mm"/>
<colspec colnum="13" colname="col13" colwidth="9mm"/>
<colspec colnum="14" colname="col14" colwidth="9mm"/>
<colspec colnum="15" colname="col15" colwidth="9mm"/>
<colspec colnum="16" colname="col16" colwidth="9mm"/>
<colspec colnum="17" colname="col17" colwidth="10mm"/>
<colspec colnum="18" colname="col18" colwidth="10mm"/>
<colspec colnum="19" colname="col19" colwidth="10mm"/>
<colspec colnum="20" colname="col20" colwidth="10mm"/>
<colspec colnum="21" colname="col21" colwidth="9mm"/>
<colspec colnum="22" colname="col22" colwidth="9mm"/>
<colspec colnum="23" colname="col23" colwidth="9mm"/>
<colspec colnum="24" colname="col24" colwidth="10mm"/>
<thead>
<row>
<entry namest="col1" nameend="col24" align="left" valign="top"><b>Table 39. Virus shedding</b></entry></row>
<row>
<entry morerows="1" align="center" valign="top"><b>Group No</b></entry>
<entry morerows="1" align="center" valign="top"><b>Dog ID</b></entry>
<entry morerows="1" align="center" valign="top"><b>Age (week)</b></entry>
<entry morerows="1" align="center" valign="top"><b>Treatment</b></entry>
<entry morerows="1" align="center" valign="top"><b>Number of vaccine doses</b></entry>
<entry namest="col6" nameend="col24" align="center" valign="top"><b>Days post-challenge</b></entry></row>
<row>
<entry align="center" valign="top"><b>-1</b></entry>
<entry align="center" valign="top"><b>0</b></entry>
<entry align="center" valign="top"><b>1</b></entry>
<entry align="center" valign="top"><b>2</b></entry>
<entry align="center" valign="top"><b>3</b></entry>
<entry align="center" valign="top"><b>4</b></entry>
<entry align="center" valign="top"><b>5</b></entry>
<entry align="center" valign="top"><b>6</b></entry>
<entry align="center" valign="top"><b>7</b></entry>
<entry align="center" valign="top"><b>8</b></entry>
<entry align="center" valign="top"><b>9</b></entry>
<entry align="center" valign="top"><b>10</b></entry>
<entry align="center" valign="top"><b>11</b></entry>
<entry align="center" valign="top"><b>12</b></entry>
<entry align="center" valign="top"><b>13</b></entry>
<entry align="center" valign="top"><b>1 4</b></entry>
<entry align="center" valign="top"><b>1 5</b></entry>
<entry align="center" valign="top"><b>1 6</b></entry>
<entry align="center" valign="top"><b>17</b></entry></row></thead>
<tbody>
<row>
<entry align="center">1</entry>
<entry align="center">921</entry>
<entry align="center">14</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">926</entry>
<entry align="center">14</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">931</entry>
<entry align="center">14</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">955</entry>
<entry align="center">14</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">011</entry>
<entry align="center">14</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">013</entry>
<entry align="center">14</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">019</entry>
<entry align="center">14</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">922</entry>
<entry align="center">14</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">1</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">953</entry>
<entry align="center">14</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">1</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">015</entry>
<entry align="center">14</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">1</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">016</entry>
<entry align="center">14</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">1</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">017</entry>
<entry align="center">14</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">1</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">923</entry>
<entry align="center">14</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">012</entry>
<entry align="center">14</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">014</entry>
<entry align="center">14</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">018</entry>
<entry align="center">14</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">P</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">01A</entry>
<entry align="center">14</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">P</entry>
<entry align="center">P</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">4</entry>
<entry align="center">406</entry>
<entry align="center">8</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">4</entry>
<entry align="center">407</entry>
<entry align="center">8</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">4</entry>
<entry align="center">504</entry>
<entry align="center">8</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">4</entry>
<entry align="center">704</entry>
<entry align="center">8</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">4</entry>
<entry align="center">705</entry>
<entry align="center">8</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">5</entry>
<entry align="center">404</entry>
<entry align="center">8</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">5</entry>
<entry align="center">405</entry>
<entry align="center">8</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">5</entry>
<entry align="center">610</entry>
<entry align="center">8</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">5</entry>
<entry align="center">702</entry>
<entry align="center">8</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">5</entry>
<entry align="center">703</entry>
<entry align="center">8</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row></tbody></tgroup>
</table>
</tables><!-- EPO <DP n="109"> -->
<tables id="tabl0040" num="0040">
<table frame="all">
<tgroup cols="7">
<colspec colnum="1" colname="col1" colwidth="20mm"/>
<colspec colnum="2" colname="col2" colwidth="14mm"/>
<colspec colnum="3" colname="col3" colwidth="22mm"/>
<colspec colnum="4" colname="col4" colwidth="19mm"/>
<colspec colnum="5" colname="col5" colwidth="28mm"/>
<colspec colnum="6" colname="col6" colwidth="28mm"/>
<colspec colnum="7" colname="col7" colwidth="28mm"/>
<thead>
<row>
<entry namest="col1" nameend="col7" align="left" valign="top"><b>Table 40.</b> Histopathological evaluation of tissue samples</entry></row>
<row>
<entry morerows="1" align="center" valign="top">Group No</entry>
<entry morerows="1" align="center" valign="top">Dog ID</entry>
<entry morerows="1" align="center" valign="top">Age (week)</entry>
<entry morerows="1" align="center" valign="top">Treatment</entry>
<entry morerows="1" align="center" valign="top">number of doses</entry>
<entry namest="col6" nameend="col7" align="center" valign="top">Microscopic lesion (Histopathology)</entry></row>
<row>
<entry align="center" valign="top">Lungs</entry>
<entry align="center" valign="top">Trachea</entry></row></thead>
<tbody>
<row>
<entry align="center">1</entry>
<entry align="center">921</entry>
<entry align="center">14</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">+/-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">926</entry>
<entry align="center">14</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">-</entry>
<entry align="center">+/-</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">931</entry>
<entry align="center">14</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">955</entry>
<entry align="center">14</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">+/-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">011</entry>
<entry align="center">14</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">+/-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">013</entry>
<entry align="center">14</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">+/-</entry>
<entry align="center">+/-</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">019</entry>
<entry align="center">14</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">+/-</entry>
<entry align="center">+/-</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">922</entry>
<entry align="center">14</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">1</entry>
<entry align="center">+/-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">953</entry>
<entry align="center">14</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">1</entry>
<entry align="center">+/-</entry>
<entry align="center">+/-</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">015</entry>
<entry align="center">14</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">1</entry>
<entry align="center">+/-</entry>
<entry align="center">+</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">016</entry>
<entry align="center">14</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">1</entry>
<entry align="center">-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">017</entry>
<entry align="center">14</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">1</entry>
<entry align="center">+/-</entry>
<entry align="center">+/-</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">923</entry>
<entry align="center">14</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">+</entry>
<entry align="center">+/-</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">012</entry>
<entry align="center">14</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">+</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">014</entry>
<entry align="center">14</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">+</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">018</entry>
<entry align="center">14</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">+</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">01A</entry>
<entry align="center">14</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">+</entry>
<entry align="center">+/-</entry></row>
<row>
<entry align="center">4</entry>
<entry align="center">406</entry>
<entry align="center">8</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">+/-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">4</entry>
<entry align="center">407</entry>
<entry align="center">8</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">4</entry>
<entry align="center">504</entry>
<entry align="center">8</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">+/-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">4</entry>
<entry align="center">704</entry>
<entry align="center">8</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">4</entry>
<entry align="center">705</entry>
<entry align="center">8</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">5</entry>
<entry align="center">404</entry>
<entry align="center">8</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">5</entry>
<entry align="center">405</entry>
<entry align="center">8</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">5</entry>
<entry align="center">610</entry>
<entry align="center">8</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">+/-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">5</entry>
<entry align="center">702</entry>
<entry align="center">8</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">+/-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">5</entry>
<entry align="center">703</entry>
<entry align="center">8</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">-</entry>
<entry align="center">-</entry></row></tbody></tgroup>
<tgroup cols="7" rowsep="0">
<colspec colnum="1" colname="col1" colwidth="20mm"/>
<colspec colnum="2" colname="col2" colwidth="14mm"/>
<colspec colnum="3" colname="col3" colwidth="22mm"/>
<colspec colnum="4" colname="col4" colwidth="19mm"/>
<colspec colnum="5" colname="col5" colwidth="28mm"/>
<colspec colnum="6" colname="col6" colwidth="28mm"/>
<colspec colnum="7" colname="col7" colwidth="28mm"/>
<tbody>
<row>
<entry namest="col1" nameend="col7" align="justify">"+" Severe lesion consistent or pathognomic to an influenza infection<br/>
"+/-" Mild lesion (inconclusive)<br/>
"-" Normal</entry></row></tbody></tgroup>
</table>
</tables></p>
<heading id="h0082">EXAMPLE 23 - CANINE INFLUENZA VACCINE EFFICACY STUDY</heading>
<p id="p0225" num="0225">The following study was conducted to determine the efficacy of a multivalent H3N8 equine influenza vaccine against canine influenza virus in dogs.</p>
<heading id="h0083"><u>Procedure:</u></heading><!-- EPO <DP n="110"> -->
<p id="p0226" num="0226">Seventeen 15-week-old beagles were obtained from a commercial supplier. The dogs were randomly assigned to 3 groups as shown in Table 41, and housed in a research facility.
<tables id="tabl0041" num="0041">
<table frame="all">
<tgroup cols="5">
<colspec colnum="1" colname="col1" colwidth="14mm"/>
<colspec colnum="2" colname="col2" colwidth="29mm"/>
<colspec colnum="3" colname="col3" colwidth="20mm"/>
<colspec colnum="4" colname="col4" colwidth="31mm"/>
<colspec colnum="5" colname="col5" colwidth="45mm"/>
<thead>
<row>
<entry namest="col1" nameend="col5" align="left" valign="top"><b>Table 41.</b> Experimental design</entry></row>
<row>
<entry align="center" valign="middle"><b><u>Group</u></b></entry>
<entry align="center" valign="middle"><b><u>Number of dogs</u></b></entry>
<entry align="center" valign="middle"><b><u>Treatment</u></b></entry>
<entry align="center" valign="top"><b><u>Number of</u> <u>doses</u></b></entry>
<entry align="center" valign="top"><b><u>Age at</u> <u>Vaccination</u> <u>(weeks)</u></b></entry></row></thead>
<tbody>
<row>
<entry align="center" valign="middle">1</entry>
<entry align="center" valign="middle">7</entry>
<entry align="center" valign="middle">Vaccinate</entry>
<entry align="center" valign="middle">2</entry>
<entry align="center" valign="middle">15 &amp; 19</entry></row>
<row>
<entry align="center" valign="middle">2</entry>
<entry align="center" valign="middle">5</entry>
<entry align="center" valign="middle">Vaccinate</entry>
<entry align="center" valign="middle">1</entry>
<entry align="center" valign="middle">19</entry></row>
<row>
<entry align="center" valign="middle">3</entry>
<entry align="center" valign="middle">5</entry>
<entry align="center" valign="middle">Control</entry>
<entry align="center" valign="middle">--</entry>
<entry align="center" valign="middle">--</entry></row></tbody></tgroup>
</table>
</tables></p>
<p id="p0227" num="0227">The vaccine used in this study was a HAVLOGEN® adjuvanted, inactivated equine influenza (A/equine/KY/02, A/equine/KY/93, and A/equine/NM/2/93) vaccine. To prepare this vaccine, the viruses were inactivated by binary ethylenimine (BEI) using a standard method. Each vaccine dose contained HAVLOGEN® (10% v/v), 2048 HA units of each of the inactivated virus, 0.1% (v/v) of 10% thimerosal, 0.1 % (v/v) of phenol red, sufficient NaOH to adjust the pH to 6.8 to 7.2, and sufficient PBS to bring the total dose volume to 1 ml.</p>
<p id="p0228" num="0228">The dogs in Group 1 were vaccinated with 2 doses of the vaccine. The second (i.e., booster) dose was administered 4 weeks after the first dose. The dogs in Group 2 were vaccinated with 1 dose of vaccine at 19 weeks-of-age. Blood samples were collected to assess HI titer using a standard protocol with an H3N8 canine influenza isolate on days zero (before vaccination), 7, and 14 post first and second vaccinations. Seven days before challenge, the dogs were moved to a BSL-2 facility and housed in individual cages.</p>
<p id="p0229" num="0229">All vaccinates and age-matched control dogs were challenged oronasally with a virulent canine influenza virus (10<sup>7.3</sup> TCID50 of A/Canine/Florida/242/2003 per dog) at 2 weeks post second vaccination of Group 1 and first vaccination of Group 2. The challenge virus was administered as a mist using a nebulizer (Nebulair™) at 2 ml per dog. The dogs were observed for influenza-related clinical signs for 14 days post challenge. All dogs were euthanized at day 14 post-challenge, and lung and trachea samples were collected in 10% buffered formalin for histopathology. Blood samples were collected on days 7 and 14 post challenge for HI titer determination. The clinical sign score assignments used for the post challenge observation are shown in Table 42.<!-- EPO <DP n="111"> --></p>
<heading id="h0084"><u>Results:</u></heading>
<p id="p0230" num="0230">All vaccinated dogs developed HI antibody titer responses to the canine influenza virus isolate (Table 43). Following the challenge, approximately a 4 fold increase in HI titer on day 14 post challenge compared to the pre-challenge HI titer in all groups indirectly indicate that all dogs were exposed to the challenge virus. All dogs exhibited signs canine influenza disease with each dog demonstrating one or more of the following clinical signs: fever (&gt;103.0°F; &gt;39.4°C), cough, serous or mucopurulent ocular discharge, serous or mucopurulent nasal discharge, vomiting, diarrhea, depression, weight loss, and dyspnea. Vaccinates had less severe clinical signs, compared to age-matched controls (Table 44). There was a significant (P = 0.028) reduction in clinical signs due to the 2-dose vaccination in dogs (Group 1). One dose vaccination did not provide a significant (P = 0.068) reduction in clinical signs (Group 2).</p>
<p id="p0231" num="0231">As in Example 22, histopathological evaluation of lung and tracheal tissue samples for lesions was conducted to identify lesions compatible with or pathognomic to canine influenza disease. Table 45 provides a summary of the extent of lesions in this experiment for the dogs. Among 15-week-old dogs, vaccination of dogs with either 1 dose or 2 doses prevented the lung lesions in all dogs. Four of 5 control dogs (80%) had severe suppurative bronchopneumonia consistent with an influenza disease. One of 7 dogs from the 2-dose vaccine group (Group 1) and 1 of 5 dogs from the control group (Group 3) had mild trachea lesions suggestive of tracheitis which could be attributed to influenza disease.</p>
<heading id="h0085"><u>Conclusion:</u></heading>
<p id="p0232" num="0232">The results from this study demonstrate that 1) inactivated H3N8 equine influenza virus can induce canine influenza virus cross reactive HI antibody responses in vaccinated dogs, and 2) Use of a H3N8 equine influenza virus vaccine can reduce the severity of canine influenza virus disease in dogs.
<tables id="tabl0042" num="0042">
<table frame="all">
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="43mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry namest="col1" nameend="col2" align="left" valign="top"><b>Table 42.</b> Clinical signs and scoring system</entry></row>
<row>
<entry valign="top"><b><u>Clinical signs</u></b></entry>
<entry valign="top"><b><u>Score per day</u></b></entry></row>
<row>
<entry namest="col1" nameend="col2" align="left" valign="top"><b>Temp</b></entry></row></thead>
<tbody>
<row>
<entry>&lt;103.0°F (&lt;39.4°C)</entry>
<entry>0</entry></row>
<row>
<entry>103.0 -103.9°F (39.4-</entry>
<entry>2</entry></row>
<row>
<entry>104.0-104.9°F (40.0-</entry>
<entry>3</entry></row>
<row>
<entry>&gt;105.0°F (&gt;40.6°C)</entry>
<entry>4</entry></row></tbody></tgroup><!-- EPO <DP n="112"> -->
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="43mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry namest="col1" nameend="col2" align="left" valign="top"><b>Coughing</b></entry></row></thead>
<tbody>
<row>
<entry>No coughing</entry>
<entry>0</entry></row>
<row>
<entry>Occasional</entry>
<entry>2</entry></row>
<row>
<entry>Paroxysmal</entry>
<entry>4</entry></row></tbody></tgroup>
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="43mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry namest="col1" nameend="col2" align="left" valign="top"><b>Sneezing</b></entry></row></thead>
<tbody>
<row>
<entry>No sneezing</entry>
<entry>0</entry></row>
<row>
<entry>Occasional</entry>
<entry>1</entry></row>
<row>
<entry>Paroxysmal</entry>
<entry>2</entry></row></tbody></tgroup>
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="43mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry namest="col1" nameend="col2" align="left" valign="top"><b>Nasal discharge</b></entry></row></thead>
<tbody>
<row>
<entry>No discharge</entry>
<entry>0</entry></row>
<row>
<entry>Serous -slight</entry>
<entry>1</entry></row>
<row>
<entry>Serous -copious</entry>
<entry>1</entry></row>
<row>
<entry>Mucopurulent-slight</entry>
<entry>2</entry></row>
<row>
<entry>Mucopurulent-copious</entry>
<entry>3</entry></row></tbody></tgroup>
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="43mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry namest="col1" nameend="col2" align="left" valign="top"><b>Ocular discharge</b></entry></row></thead>
<tbody>
<row>
<entry>No discharge</entry>
<entry>0</entry></row>
<row>
<entry>Serous -slight</entry>
<entry>1</entry></row>
<row>
<entry>Serous -copious</entry>
<entry>1</entry></row>
<row>
<entry>Mucopurulent-slight</entry>
<entry>2</entry></row>
<row>
<entry>Mucopurulent-copious</entry>
<entry>3</entry></row></tbody></tgroup>
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="43mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry namest="col1" nameend="col2" align="left" valign="top"><b>Hemoptysis</b></entry></row></thead>
<tbody>
<row>
<entry>No</entry>
<entry>0</entry></row>
<row>
<entry>Yes</entry>
<entry>5</entry></row></tbody></tgroup>
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="43mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry namest="col1" nameend="col2" align="left" valign="top"><b>Depression</b></entry></row></thead>
<tbody>
<row>
<entry>No</entry>
<entry>0</entry></row>
<row>
<entry>Yes</entry>
<entry>1</entry></row></tbody></tgroup>
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="43mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry namest="col1" nameend="col2" align="left" valign="top"><b>Anorexia</b></entry></row></thead>
<tbody>
<row>
<entry>No</entry>
<entry>0</entry></row>
<row>
<entry>Yes</entry>
<entry>1</entry></row></tbody></tgroup>
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="43mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry valign="top"><b>Respiratory signs</b></entry>
<entry valign="top"/></row></thead>
<tbody>
<row>
<entry>None</entry>
<entry>0</entry></row>
<row>
<entry>Rales</entry>
<entry>3</entry></row>
<row>
<entry>Dyspnea</entry>
<entry>4</entry></row>
<row>
<entry>Gasping</entry>
<entry>5</entry></row></tbody></tgroup>
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="43mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry namest="col1" nameend="col2" align="left" valign="top"><b>Mucous expectorate</b></entry></row></thead>
<tbody>
<row>
<entry>No</entry>
<entry>0</entry></row>
<row>
<entry>Yes</entry>
<entry>2</entry></row></tbody></tgroup>
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="43mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry valign="top"><b>Vomiting</b></entry>
<entry valign="top"/></row></thead>
<tbody>
<row>
<entry>No</entry>
<entry>0</entry></row>
<row>
<entry>Yes</entry>
<entry>1</entry></row></tbody></tgroup>
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="43mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry valign="top"><b>Fecal abnormalities</b></entry>
<entry valign="top"/></row></thead>
<tbody>
<row>
<entry>No</entry>
<entry>0</entry></row>
<row>
<entry>Yes</entry>
<entry>1</entry></row></tbody></tgroup>
</table>
</tables><!-- EPO <DP n="113"> -->
<tables id="tabl0043" num="0043">
<table frame="all">
<tgroup cols="12">
<colspec colnum="1" colname="col1" colwidth="16mm"/>
<colspec colnum="2" colname="col2" colwidth="14mm"/>
<colspec colnum="3" colname="col3" colwidth="21mm"/>
<colspec colnum="4" colname="col4" colwidth="18mm"/>
<colspec colnum="5" colname="col5" colwidth="12mm"/>
<colspec colnum="6" colname="col6" colwidth="12mm"/>
<colspec colnum="7" colname="col7" colwidth="12mm"/>
<colspec colnum="8" colname="col8" colwidth="13mm"/>
<colspec colnum="9" colname="col9" colwidth="12mm"/>
<colspec colnum="10" colname="col10" colwidth="14mm"/>
<colspec colnum="11" colname="col11" colwidth="14mm"/>
<colspec colnum="12" colname="col12" colwidth="14mm"/>
<thead>
<row>
<entry namest="col1" nameend="col12" align="left" valign="top"><b>Table 43.</b> Serology - Hemagglutination inhibition titers</entry></row>
<row>
<entry morerows="2" align="center" valign="top">Group No</entry>
<entry morerows="2" align="center" valign="top">Dog ID</entry>
<entry morerows="2" align="center" valign="top">Treatment</entry>
<entry morerows="2" align="center" valign="top">Number of doses</entry>
<entry namest="col5" nameend="col12" align="center" valign="top">HI titer</entry></row>
<row>
<entry namest="col5" nameend="col10" align="center" valign="top">Days post first vaccination of Group 1</entry>
<entry namest="col11" nameend="col12" align="center" valign="top">Days post challenge</entry></row>
<row>
<entry align="center" valign="top">0*</entry>
<entry align="center" valign="top">7</entry>
<entry align="center" valign="top">14</entry>
<entry align="center" valign="top">28**</entry>
<entry align="center" valign="top">35</entry>
<entry align="center" valign="top">42***</entry>
<entry align="center" valign="top">7</entry>
<entry align="center" valign="top">14</entry></row></thead>
<tbody>
<row>
<entry align="center">1</entry>
<entry align="center">ALK</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">20</entry>
<entry align="center">20</entry>
<entry align="center">80</entry>
<entry align="center">40</entry>
<entry align="center">160</entry>
<entry align="center">320</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">AMF</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">10</entry>
<entry align="center">20</entry>
<entry align="center">20</entry>
<entry align="center">40</entry>
<entry align="center">160</entry>
<entry align="center">320</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">AKY</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">&lt;10</entry>
<entry align="center">20</entry>
<entry align="center">20</entry>
<entry align="center">20</entry>
<entry align="center">40</entry>
<entry align="center">40</entry>
<entry align="center">160</entry>
<entry align="center">80</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">ALC</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">&lt;10</entry>
<entry align="center">10</entry>
<entry align="center">10</entry>
<entry align="center">10</entry>
<entry align="center">40</entry>
<entry align="center">40</entry>
<entry align="center">160</entry>
<entry align="center">160</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">ALL</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">10</entry>
<entry align="center">10</entry>
<entry align="center">40</entry>
<entry align="center">20</entry>
<entry align="center">160</entry>
<entry align="center">320</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">ALM</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">10</entry>
<entry align="center">20</entry>
<entry align="center">40</entry>
<entry align="center">40</entry>
<entry align="center">80</entry>
<entry align="center">160</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">AMU</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">&lt;10</entry>
<entry align="center">20</entry>
<entry align="center">40</entry>
<entry align="center">40</entry>
<entry align="center">40</entry>
<entry align="center">40</entry>
<entry align="center">40</entry>
<entry align="center">160</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">ALA</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">1</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">10</entry>
<entry align="center">320</entry>
<entry align="center">160</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">AMA</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">1</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">20</entry>
<entry align="center">&gt;640</entry>
<entry align="center">80</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">APD</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">1</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">10</entry>
<entry align="center">&gt;640</entry>
<entry align="center">320</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">APG</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">1</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">10</entry>
<entry align="center">320</entry>
<entry align="center">80</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">APT</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">1</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">10</entry>
<entry align="center">320</entry>
<entry align="center">320</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">ALT</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">40</entry>
<entry align="center">160</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">AMS</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">80</entry>
<entry align="center">160</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">AKX</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">20</entry>
<entry align="center">80</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">ALX</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">80</entry>
<entry align="center">80</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">AMI</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">40</entry>
<entry align="center">80</entry></row></tbody></tgroup>
<tgroup cols="12" rowsep="0">
<colspec colnum="1" colname="col1" colwidth="16mm"/>
<colspec colnum="2" colname="col2" colwidth="14mm"/>
<colspec colnum="3" colname="col3" colwidth="21mm"/>
<colspec colnum="4" colname="col4" colwidth="18mm"/>
<colspec colnum="5" colname="col5" colwidth="12mm"/>
<colspec colnum="6" colname="col6" colwidth="12mm"/>
<colspec colnum="7" colname="col7" colwidth="12mm"/>
<colspec colnum="8" colname="col8" colwidth="13mm"/>
<colspec colnum="9" colname="col9" colwidth="12mm"/>
<colspec colnum="10" colname="col10" colwidth="14mm"/>
<colspec colnum="11" colname="col11" colwidth="14mm"/>
<colspec colnum="12" colname="col12" colwidth="14mm"/>
<tbody>
<row>
<entry namest="col1" nameend="col12" align="justify">*First vaccination - Group 1<br/>
**Second vaccination - Group 1; First vaccination - Group 2<br/>
***Day of challenge</entry></row></tbody></tgroup>
</table>
</tables><!-- EPO <DP n="114"> -->
<tables id="tabl0044" num="0044">
<table frame="all">
<tgroup cols="6">
<colspec colnum="1" colname="col1" colwidth="14mm"/>
<colspec colnum="2" colname="col2" colwidth="19mm"/>
<colspec colnum="3" colname="col3" colwidth="28mm"/>
<colspec colnum="4" colname="col4" colwidth="35mm"/>
<colspec colnum="5" colname="col5" colwidth="37mm"/>
<colspec colnum="6" colname="col6" colwidth="34mm"/>
<thead>
<row>
<entry namest="col1" nameend="col6" align="left" valign="top"><b>Table 44.</b> Analysis of total canine influenza disease clinical scores</entry></row>
<row>
<entry align="center" valign="top">Group</entry>
<entry align="center" valign="top">Treatment</entry>
<entry align="center" valign="top">Number of doses</entry>
<entry align="center" valign="top">Age at first vaccination of Group 1</entry>
<entry align="center" valign="top">Average total Score per dog</entry>
<entry align="center" valign="top">P-value*</entry></row></thead>
<tbody>
<row>
<entry align="center">1</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">15 weeks</entry>
<entry align="center">6.3</entry>
<entry align="center">0.028 (Group 1 vs. 3)</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">1</entry>
<entry align="center">15 weeks (these dogs were vaccinated once, when they were 19 weeks old)</entry>
<entry align="center">14.2</entry>
<entry align="center">0.068 (Group 2 vs. 3)</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">Control</entry>
<entry align="center">--</entry>
<entry align="center">15 weeks (these dogs were not vaccinated)</entry>
<entry align="center">24.4</entry>
<entry align="center">--</entry></row></tbody></tgroup>
<tgroup cols="6" rowsep="0">
<colspec colnum="1" colname="col1" colwidth="14mm"/>
<colspec colnum="2" colname="col2" colwidth="19mm"/>
<colspec colnum="3" colname="col3" colwidth="28mm"/>
<colspec colnum="4" colname="col4" colwidth="35mm"/>
<colspec colnum="5" colname="col5" colwidth="37mm"/>
<colspec colnum="6" colname="col6" colwidth="34mm"/>
<tbody>
<row>
<entry namest="col1" nameend="col6" align="justify">* Analyzed using a NPARIWAY procedure of SAS® Version 8.2 (the vaccine groups were compared using the Wilcoxon rank sum test)</entry></row></tbody></tgroup>
</table>
</tables><!-- EPO <DP n="115"> -->
<tables id="tabl0045" num="0045">
<table frame="all">
<tgroup cols="6">
<colspec colnum="1" colname="col1" colwidth="20mm"/>
<colspec colnum="2" colname="col2" colwidth="14mm"/>
<colspec colnum="3" colname="col3" colwidth="19mm"/>
<colspec colnum="4" colname="col4" colwidth="28mm"/>
<colspec colnum="5" colname="col5" colwidth="28mm"/>
<colspec colnum="6" colname="col6" colwidth="28mm"/>
<thead>
<row>
<entry namest="col1" nameend="col6" align="left" valign="top"><b>Table 45.</b> Histopathological evaluation of tissue samples</entry></row>
<row>
<entry morerows="1" align="center" valign="top">Group No</entry>
<entry morerows="1" align="center" valign="top">Dog ID</entry>
<entry morerows="1" align="center" valign="top">Treatment</entry>
<entry morerows="1" align="center" valign="top">Number of doses</entry>
<entry namest="col5" nameend="col6" align="center" valign="top">Microscopic lesion (Histopathology)</entry></row>
<row>
<entry align="center" valign="top">Lung</entry>
<entry align="center" valign="top">Trachea</entry></row></thead>
<tbody>
<row>
<entry align="center">1</entry>
<entry align="center">ALK</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">-</entry>
<entry align="center">+/-</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">AMF</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">AKY</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">ALC</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">ALL</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">ALM</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">AMU</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">2</entry>
<entry align="center">-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">ALA</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">1</entry>
<entry align="center">-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">AMA</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">1</entry>
<entry align="center">-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">APD</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">1</entry>
<entry align="center">-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">APG</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">1</entry>
<entry align="center">-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">APT</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">1</entry>
<entry align="center">-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">ALT</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">+/-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">AMS</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">+</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">AKX</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">+</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">ALX</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">+</entry>
<entry align="center">+/-</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">AMI</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">-</entry>
<entry align="center">-</entry></row></tbody></tgroup>
<tgroup cols="6" rowsep="0">
<colspec colnum="1" colname="col1" colwidth="20mm"/>
<colspec colnum="2" colname="col2" colwidth="14mm"/>
<colspec colnum="3" colname="col3" colwidth="19mm"/>
<colspec colnum="4" colname="col4" colwidth="28mm"/>
<colspec colnum="5" colname="col5" colwidth="28mm"/>
<colspec colnum="6" colname="col6" colwidth="28mm"/>
<tbody>
<row>
<entry namest="col1" nameend="col6" align="justify">"+" Severe lesion consistent or pathognomic to an influenza infection<br/>
"+/-" Mild lesions (inconclusive)<br/>
"-" Normal</entry></row></tbody></tgroup>
</table>
</tables><!-- EPO <DP n="116"> --></p>
<heading id="h0086">EXAMPLE 24 - CANINE INFLUENZA VACCINE EFFICACY STUDY</heading>
<p id="p0233" num="0233">The following study was conducted to determine: (1) the efficacy of monovalent versus multivalent H3N8 equine influenza vaccines against canine influenza virus in dogs, and (2) the effect of route of administration on vaccine efficacy.</p>
<heading id="h0087"><u>Procedure:</u></heading>
<p id="p0234" num="0234">Thirty 10-week old mongrels were obtained from a commercial supplier. The dogs were randomly assigned to 6 groups as shown in Table 46, and housed in a research facility.
<tables id="tabl0046" num="0046">
<table frame="all">
<tgroup cols="6">
<colspec colnum="1" colname="col1" colwidth="14mm"/>
<colspec colnum="2" colname="col2" colwidth="27mm"/>
<colspec colnum="3" colname="col3" colwidth="19mm"/>
<colspec colnum="4" colname="col4" colwidth="33mm"/>
<colspec colnum="5" colname="col5" colwidth="28mm"/>
<colspec colnum="6" colname="col6" colwidth="42mm"/>
<thead>
<row>
<entry namest="col1" nameend="col6" align="left" valign="top"><b>Table 46.</b> Experimental design</entry></row></thead>
<tbody>
<row>
<entry align="center" valign="middle">Group</entry>
<entry align="center" valign="middle">Number of dogs</entry>
<entry align="center" valign="middle">Treatment</entry>
<entry align="center">Route of vaccination</entry>
<entry align="center">Number of doses</entry>
<entry align="center">Age at Vaccination (weeks)</entry></row>
<row>
<entry align="center" valign="middle">1</entry>
<entry align="center" valign="middle">5</entry>
<entry align="center" valign="middle">VAX-1</entry>
<entry align="center" valign="middle">IN</entry>
<entry align="center" valign="middle">2</entry>
<entry align="center" valign="middle">10 &amp; 14</entry></row>
<row>
<entry align="center" valign="middle">2</entry>
<entry align="center" valign="middle">5</entry>
<entry align="center" valign="middle">VAX-2</entry>
<entry align="center" valign="middle">SQ</entry>
<entry align="center" valign="middle">2</entry>
<entry align="center" valign="middle">10 &amp; 14</entry></row>
<row>
<entry align="center" valign="middle">3</entry>
<entry align="center" valign="middle">5</entry>
<entry align="center" valign="middle">VAX-2</entry>
<entry align="center" valign="middle">IN</entry>
<entry align="center" valign="middle">2</entry>
<entry align="center" valign="middle">10 &amp; 14</entry></row>
<row>
<entry align="center" valign="middle">4</entry>
<entry align="center" valign="middle">5</entry>
<entry align="center" valign="middle">VAX-3</entry>
<entry align="center" valign="middle">SQ</entry>
<entry align="center" valign="middle">2</entry>
<entry align="center" valign="middle">10 &amp; 14</entry></row>
<row>
<entry align="center" valign="middle">5</entry>
<entry align="center" valign="middle">5</entry>
<entry align="center" valign="middle">VAX-3</entry>
<entry align="center" valign="middle">IN</entry>
<entry align="center" valign="middle">2</entry>
<entry align="center" valign="middle">10 &amp; 14</entry></row>
<row>
<entry align="center" valign="middle">6</entry>
<entry align="center" valign="middle">5</entry>
<entry align="center" valign="middle">Control</entry>
<entry align="center" valign="middle">--</entry>
<entry align="center" valign="middle">--</entry>
<entry align="center" valign="middle">--</entry></row></tbody></tgroup>
</table>
</tables></p>
<p id="p0235" num="0235">Three types of vaccines (VAX-1, VAX-2, and VAX-3) were used. The VAX-1 was a HAVLOGEN®-adjuvanted, inactivated equine influenza virus (A/equine/KY/02) monovalent vaccine, and each dose contained HAVLOGEN® (10% v/v), 6144 HA units of the inactivated virus, 0.1% (v/v) of 10% thimerosal, 0.1 % (v/v) of phenol red, sufficient NaOH to adjust the pH to 6.8 to 7.2, and sufficient PBS to bring the total dose volume to 1 ml. The VAX-2 was a HAVLOGEN®-adjuvanted, inactivated equine influenza virus (A/equine/KY/02) monovalent vaccine, and each dose of vaccine contained HAVLOGEN® (10% v/v), 4096 HA units of the inactivated virus, 0.1% (v/v) of 10% thimerosal, 0.1 % (v/v) of phenol red, sufficient NaOH to adjust the pH to 6.8 to 7.2, and sufficient PBS to bring the total dose volume to 1 ml. The VAX-3 was a HAVLOGEN®-adjuvanted, inactivated equine influenza (A/equine/KY/02, A/equine/KY/93, and A/equine/NM/2/93 ) multivalent vaccine, and contained HAVLOGEN® (10% v/v), 2048 HA units of inactivated virus per strain, 0.1% (v/v) of 10% thimerosal, 0.1 % (v/v) of phenol red, sufficient NaOH to adjust the pH to 6.8 to 7.2, and sufficient PBS to bring the total dose volume to 1 ml. All influenza viruses used for<!-- EPO <DP n="117"> --> the vaccine formulation were inactivated by binary ethylenimine (BEI) using a standard method.</p>
<p id="p0236" num="0236">The vaccines and routes of administration for each group are described in Table 46. All dogs in the vaccinated groups were vaccinated either via the intranasal (IN) or the subcutaneous (SQ) route, and each dog received 2 doses. The second (i.e., booster) dose was administered 4 weeks after the first dose. Blood samples were collected to assess HI titer using a standard protocol with an H3N8 canine influenza isolate on days zero (before vaccination), 7, and 14 post first and second vaccinations. Seven days before challenge, the dogs were moved to a BSL-2 facility and housed in individual cages.</p>
<p id="p0237" num="0237">All vaccinates and age-matched control dogs were challenged oronasally with a virulent canine influenza virus (10<sup>7.4</sup> TCID50 of A/Canine/Florida/242/2003 per dog) at 2 weeks post second vaccination. The challenge virus was administered as a mist using a nebulizer (Nebulair™) in a 2 ml volume per day. The dogs were observed for influenza-related clinical signs for 14 days post-challenge. Blood samples were collected on days 7 and 14 post challenge for HI titer determination. All dogs were euthanized at day 14 post-challenge, and lung and trachea samples were collected in 10% buffered formalin for histopathology. The clinical sign score assignments used for the post challenge observation are shown in Table 47.</p>
<heading id="h0088"><u>Results:</u></heading>
<p id="p0238" num="0238">All dogs vaccinated via the SQ route developed HI antibody titer responses to the canine influenza virus isolate, regardless of the vaccine type (Table 48). None of the dogs from the IN vaccination groups (<i>i.e</i>., Groups 1, 3, and 5) developed HI antibody titer responses to the canine influenza virus isolate, regardless of the vaccine type, during the post vaccination period. There was, however, a 4-fold increase in titer by day 14 post challenge in all dogs indirectly, indicating that all dogs were exposed to the challenge virus (Table 47).</p>
<p id="p0239" num="0239">All dogs exhibited one or more of the following clinical signs of canine influenza: fever (&gt;103.0°F; &gt;39.4°C), cough, serous or mucopurulent ocular discharge, serous or mucopurulent nasal discharge, vomiting, diarrhea, depression, weight loss, and dyspnea. Vaccinates had less severe clinical signs, compared to age-matched controls (Table 49). There was a significant reduction in clinical signs in dogs vaccinated with VAX-3 via the SQ route (Group 4). In this experiment, IN administration of either VAX-1, VAX-2, or VAX-3 did not provide a significant reduction in clinical signs of canine influenza virus.<!-- EPO <DP n="118"> --></p>
<p id="p0240" num="0240">As in Examples 22 and 23, histopathological evaluation of lung and tracheal tissue samples for lesions was conducted to identify lesions compatible with or pathognomic to canine influenza disease. Table 50 provides a summary of the extent of lesions in this experiment for the dogs. Five of 5 control dogs (Group 6) had lung lesions consistence with an influenza infection. Two of 5 dogs vaccinated with VAX-2 via the SC route (Group 2) and 3 of 5 dogs vaccinated with VAX-3 via the SC route (Group 4) were free of any influenza-related lung lesions. All the dogs that received the vaccine via the intranasal route, irrespective of the vaccine type, had severe lung lesions consistent with an influenza infection. The trachea lesions observed in this study were very mild.</p>
<heading id="h0089"><u>Conclusion:</u></heading>
<p id="p0241" num="0241">The results from this study demonstrate that: (1) inactivated H3N8 equine influenza virus can induce canine influenza virus cross reactive HI antibody responses in dogs vaccinated via the SQ route, (2) intranasal administration of either monovalent (VAX-1 and VAX-2) or multivalent vaccine (VAX-3) was not efficacious in dogs, and (3) subcutaneous administration of multivalent vaccine (VAX-3) provided a significant (P=0.016) reduction in severity of canine influenza virus disease in dogs.<!-- EPO <DP n="119"> -->
<tables id="tabl0047" num="0047">
<table frame="all">
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="43mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry namest="col1" nameend="col2" align="left" valign="top"><b>Table 47.</b> Clinical signs and scoring system</entry></row>
<row>
<entry valign="top"><b><u>Clinical signs</u></b></entry>
<entry valign="top"><b><u>Score per day</u></b></entry></row>
<row>
<entry namest="col1" nameend="col2" align="left" valign="top"><b>Temp</b></entry></row></thead>
<tbody>
<row>
<entry>&lt;103.0°F (&lt;39.4°C)</entry>
<entry>0</entry></row>
<row>
<entry>103.0 -103.9°F (39.4-</entry>
<entry>2</entry></row>
<row>
<entry>104.0-104.9°F (40.0-</entry>
<entry>3</entry></row>
<row>
<entry>&gt;105.0°F (&gt;40.6°C)</entry>
<entry>4</entry></row></tbody></tgroup>
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="43mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry namest="col1" nameend="col2" align="left" valign="top"><b>Coughing</b></entry></row></thead>
<tbody>
<row>
<entry>No coughing</entry>
<entry>0</entry></row>
<row>
<entry>Occasional</entry>
<entry>2</entry></row>
<row>
<entry>Paroxysmal</entry>
<entry>4</entry></row></tbody></tgroup>
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="43mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry namest="col1" nameend="col2" align="left" valign="top"><b>Sneezing</b></entry></row></thead>
<tbody>
<row>
<entry>No sneezing</entry>
<entry>0</entry></row>
<row>
<entry>Occasional</entry>
<entry>1</entry></row>
<row>
<entry>Paroxysmal</entry>
<entry>2</entry></row></tbody></tgroup>
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="43mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry namest="col1" nameend="col2" align="left" valign="top"><b>Nasal discharge</b></entry></row></thead>
<tbody>
<row>
<entry>No discharge</entry>
<entry>0</entry></row>
<row>
<entry>Serous -slight</entry>
<entry>1</entry></row>
<row>
<entry>Serous -copious</entry>
<entry>1</entry></row>
<row>
<entry>Mucopurulent-slight</entry>
<entry>2</entry></row>
<row>
<entry>Mucopurulent-copious</entry>
<entry>3</entry></row></tbody></tgroup>
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="43mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry namest="col1" nameend="col2" align="left" valign="top"><b>Ocular discharge</b></entry></row></thead>
<tbody>
<row>
<entry>No discharge</entry>
<entry>0</entry></row>
<row>
<entry>Serous -slight</entry>
<entry>1</entry></row>
<row>
<entry>Serous -copious</entry>
<entry>1</entry></row>
<row>
<entry>Mucopurulent-slight</entry>
<entry>2</entry></row>
<row>
<entry>Mucopurulent-copious</entry>
<entry>3</entry></row></tbody></tgroup>
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="43mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry namest="col1" nameend="col2" align="left" valign="top"><b>Hemoptysis</b></entry></row></thead>
<tbody>
<row>
<entry>No</entry>
<entry>0</entry></row>
<row>
<entry>Yes</entry>
<entry>5</entry></row></tbody></tgroup>
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="43mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry namest="col1" nameend="col2" align="left" valign="top"><b>Depression</b></entry></row></thead>
<tbody>
<row>
<entry>No</entry>
<entry>0</entry></row>
<row>
<entry>Yes</entry>
<entry>1</entry></row></tbody></tgroup>
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="43mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry namest="col1" nameend="col2" align="left" valign="top"><b>Anorexia</b></entry></row></thead>
<tbody>
<row>
<entry>No</entry>
<entry>0</entry></row>
<row>
<entry>Yes</entry>
<entry>1</entry></row></tbody></tgroup>
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="43mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry valign="top"><b>Respiratory signs</b></entry>
<entry valign="top"/></row></thead>
<tbody>
<row>
<entry>None</entry>
<entry>0</entry></row>
<row>
<entry>Rales</entry>
<entry>3</entry></row>
<row>
<entry>Dyspnea</entry>
<entry>4</entry></row>
<row>
<entry>Gasping</entry>
<entry>5</entry></row></tbody></tgroup>
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="43mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry namest="col1" nameend="col2" align="left" valign="top"><b>Mucous expectorate</b></entry></row></thead>
<tbody>
<row>
<entry>No</entry>
<entry>0</entry></row>
<row>
<entry>Yes</entry>
<entry>2</entry></row></tbody></tgroup><!-- EPO <DP n="120"> -->
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="43mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry valign="top"><b>Vomiting</b></entry>
<entry valign="top"/></row></thead>
<tbody>
<row>
<entry>No</entry>
<entry>0</entry></row>
<row>
<entry>Yes</entry>
<entry>1</entry></row></tbody></tgroup>
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="43mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry valign="top"><b>Fecal abnormalities</b></entry>
<entry valign="top"/></row></thead>
<tbody>
<row>
<entry>No</entry>
<entry>0</entry></row>
<row>
<entry>Yes</entry>
<entry>1</entry></row></tbody></tgroup>
</table>
</tables><!-- EPO <DP n="121"> -->
<tables id="tabl0048" num="0048">
<table frame="all">
<tgroup cols="13">
<colspec colnum="1" colname="col1" colwidth="14mm"/>
<colspec colnum="2" colname="col2" colwidth="11mm"/>
<colspec colnum="3" colname="col3" colwidth="20mm"/>
<colspec colnum="4" colname="col4" colwidth="18mm"/>
<colspec colnum="5" colname="col5" colwidth="17mm"/>
<colspec colnum="6" colname="col6" colwidth="11mm"/>
<colspec colnum="7" colname="col7" colwidth="11mm"/>
<colspec colnum="8" colname="col8" colwidth="11mm"/>
<colspec colnum="9" colname="col9" colwidth="11mm"/>
<colspec colnum="10" colname="col10" colwidth="11mm"/>
<colspec colnum="11" colname="col11" colwidth="13mm"/>
<colspec colnum="12" colname="col12" colwidth="13mm"/>
<colspec colnum="13" colname="col13" colwidth="13mm"/>
<thead>
<row>
<entry namest="col1" nameend="col13" align="left" valign="top"><b>Table 48.</b> Serology - Hemagglutination inhibition titers</entry></row>
<row>
<entry morerows="2" align="center" valign="top">Group No</entry>
<entry morerows="2" align="center" valign="top">Dog ID</entry>
<entry morerows="2" align="center" valign="top">Treatment</entry>
<entry morerows="2" align="center" valign="top">Route of vaccinati on</entry>
<entry morerows="2" align="center" valign="top">Number of doses</entry>
<entry namest="col6" nameend="col13" align="center" valign="top">HI titer</entry></row>
<row>
<entry namest="col6" nameend="col11" align="center" valign="top">Days post vaccination</entry>
<entry namest="col12" nameend="col13" align="center" valign="top">Days post challenge</entry></row>
<row>
<entry align="center" valign="top">0*</entry>
<entry align="center" valign="top">7</entry>
<entry align="center" valign="top">14</entry>
<entry align="center" valign="top">28**</entry>
<entry align="center" valign="top">35</entry>
<entry align="center" valign="top">42***</entry>
<entry align="center" valign="top">7</entry>
<entry align="center" valign="top">14</entry></row></thead>
<tbody>
<row>
<entry align="center">1</entry>
<entry align="center">248</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IN</entry>
<entry align="center">2</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">80</entry>
<entry align="center">40</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">501</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IN</entry>
<entry align="center">2</entry>
<entry align="center">&lt;10</entry>
<entry align="center">10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">160</entry>
<entry align="center">160</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">502</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IN</entry>
<entry align="center">2</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">80</entry>
<entry align="center">160</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">469</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IN</entry>
<entry align="center">2</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">80</entry>
<entry align="center">160</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">46A</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IN</entry>
<entry align="center">2</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">80</entry>
<entry align="center">80</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">232</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">SQ</entry>
<entry align="center">2</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">20</entry>
<entry align="center">20</entry>
<entry align="center">40</entry>
<entry align="center">320</entry>
<entry align="center">640</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">511</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">SQ</entry>
<entry align="center">2</entry>
<entry align="center">&lt;10</entry>
<entry align="center">10</entry>
<entry align="center">10</entry>
<entry align="center">20</entry>
<entry align="center">20</entry>
<entry align="center">20</entry>
<entry align="center">160</entry>
<entry align="center">640</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">514</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">SQ</entry>
<entry align="center">2</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">40</entry>
<entry align="center">40</entry>
<entry align="center">80</entry>
<entry align="center">40</entry>
<entry align="center">160</entry>
<entry align="center">320</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">461</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">SQ</entry>
<entry align="center">2</entry>
<entry align="center">&lt;10</entry>
<entry align="center">10</entry>
<entry align="center">10</entry>
<entry align="center">20</entry>
<entry align="center">20</entry>
<entry align="center">20</entry>
<entry align="center">&gt;640</entry>
<entry align="center">&gt;640</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">463</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">SQ</entry>
<entry align="center">2</entry>
<entry align="center">&lt;10</entry>
<entry align="center">10</entry>
<entry align="center">40</entry>
<entry align="center">80</entry>
<entry align="center">80</entry>
<entry align="center">40</entry>
<entry align="center">80</entry>
<entry align="center">320</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">246</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IN</entry>
<entry align="center">2</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">40</entry>
<entry align="center">40</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">505</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IN</entry>
<entry align="center">2</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">80</entry>
<entry align="center">80</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">506</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IN</entry>
<entry align="center">2</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">80</entry>
<entry align="center">160</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">464</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IN</entry>
<entry align="center">2</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">80</entry>
<entry align="center">80</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">465</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IN</entry>
<entry align="center">2</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">80</entry>
<entry align="center">160</entry></row>
<row>
<entry align="center">4</entry>
<entry align="center">23B</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">SQ</entry>
<entry align="center">2</entry>
<entry align="center">&lt;10</entry>
<entry align="center">10</entry>
<entry align="center">10</entry>
<entry align="center">40</entry>
<entry align="center">40</entry>
<entry align="center">20</entry>
<entry align="center">160</entry>
<entry align="center">160</entry></row>
<row>
<entry align="center">4</entry>
<entry align="center">247</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">SQ</entry>
<entry align="center">2</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">20</entry>
<entry align="center">20</entry>
<entry align="center">20</entry>
<entry align="center">160</entry>
<entry align="center">320</entry></row>
<row>
<entry align="center">4</entry>
<entry align="center">508</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">SQ</entry>
<entry align="center">2</entry>
<entry align="center">&lt;10</entry>
<entry align="center">10</entry>
<entry align="center">40</entry>
<entry align="center">40</entry>
<entry align="center">80</entry>
<entry align="center">80</entry>
<entry align="center">320</entry>
<entry align="center">320</entry></row>
<row>
<entry align="center">4</entry>
<entry align="center">512</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">SQ</entry>
<entry align="center">2</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">20</entry>
<entry align="center">20</entry>
<entry align="center">80</entry>
<entry align="center">80</entry>
<entry align="center">320</entry>
<entry align="center">160</entry></row>
<row>
<entry align="center">4</entry>
<entry align="center">516</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">SQ</entry>
<entry align="center">2</entry>
<entry align="center">&lt;10</entry>
<entry align="center">10</entry>
<entry align="center">10</entry>
<entry align="center">20</entry>
<entry align="center">80</entry>
<entry align="center">80</entry>
<entry align="center">160</entry>
<entry align="center">&gt; 640</entry></row>
<row>
<entry align="center">5</entry>
<entry align="center">503</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IN</entry>
<entry align="center">2</entry>
<entry align="center">&lt;10</entry>
<entry align="center">10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">80</entry>
<entry align="center">160</entry></row>
<row>
<entry align="center">5</entry>
<entry align="center">513</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IN</entry>
<entry align="center">2</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">80</entry>
<entry align="center">80</entry></row>
<row>
<entry align="center">5</entry>
<entry align="center">462</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IN</entry>
<entry align="center">2</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">80</entry>
<entry align="center">320</entry></row></tbody></tgroup>
</table>
</tables><!-- EPO <DP n="122"> -->
<tables id="tabl0049" num="0049">
<table frame="all">
<tgroup cols="13">
<colspec colnum="1" colname="col1" colwidth="14mm"/>
<colspec colnum="2" colname="col2" colwidth="11mm"/>
<colspec colnum="3" colname="col3" colwidth="20mm"/>
<colspec colnum="4" colname="col4" colwidth="18mm"/>
<colspec colnum="5" colname="col5" colwidth="17mm"/>
<colspec colnum="6" colname="col6" colwidth="11mm"/>
<colspec colnum="7" colname="col7" colwidth="11mm"/>
<colspec colnum="8" colname="col8" colwidth="11mm"/>
<colspec colnum="9" colname="col9" colwidth="11mm"/>
<colspec colnum="10" colname="col10" colwidth="11mm"/>
<colspec colnum="11" colname="col11" colwidth="13mm"/>
<colspec colnum="12" colname="col12" colwidth="12mm"/>
<colspec colnum="13" colname="col13" colwidth="12mm"/>
<thead>
<row>
<entry namest="col1" nameend="col13" align="left" valign="top"><b>Table 48.</b> Serology - Hemagglutination inhibition titers</entry></row>
<row>
<entry morerows="2" align="center" valign="top">Group No</entry>
<entry morerows="2" align="center" valign="top">Dog ID</entry>
<entry morerows="2" align="center" valign="top">Treatment</entry>
<entry morerows="2" align="center" valign="top">Route of vaccinati on</entry>
<entry morerows="2" align="center" valign="top">Number of doses</entry>
<entry namest="col6" nameend="col13" align="center" valign="top">HI titer</entry></row>
<row>
<entry namest="col6" nameend="col11" align="center" valign="top">Days post vaccination</entry>
<entry namest="col12" nameend="col13" align="center" valign="top">Days post challenge</entry></row>
<row>
<entry align="center" valign="top">0*</entry>
<entry align="center" valign="top">7</entry>
<entry align="center" valign="top">14</entry>
<entry align="center" valign="top">28**</entry>
<entry align="center" valign="top">35</entry>
<entry align="center" valign="top">42***</entry>
<entry align="center" valign="top">7</entry>
<entry align="center" valign="top">14</entry></row></thead>
<tbody>
<row>
<entry align="center">5</entry>
<entry align="center">466</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IN</entry>
<entry align="center">2</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">80</entry>
<entry align="center">80</entry></row>
<row>
<entry align="center">5</entry>
<entry align="center">46B</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IN</entry>
<entry align="center">2</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">80</entry>
<entry align="center">160</entry></row>
<row>
<entry align="center">6</entry>
<entry align="center">236</entry>
<entry align="center">Control</entry>
<entry align="center">--</entry>
<entry align="center">2</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">80</entry>
<entry align="center">160</entry></row>
<row>
<entry align="center">6</entry>
<entry align="center">504</entry>
<entry align="center">Control</entry>
<entry align="center">--</entry>
<entry align="center">2</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">160</entry>
<entry align="center">160</entry></row>
<row>
<entry align="center">6</entry>
<entry align="center">507</entry>
<entry align="center">Control</entry>
<entry align="center">--</entry>
<entry align="center">2</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">80</entry>
<entry align="center">160</entry></row>
<row>
<entry align="center">6</entry>
<entry align="center">515</entry>
<entry align="center">Control</entry>
<entry align="center">--</entry>
<entry align="center">2</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">80</entry>
<entry align="center">160</entry></row>
<row>
<entry align="center">6</entry>
<entry align="center">468</entry>
<entry align="center">Control</entry>
<entry align="center">--</entry>
<entry align="center">2</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">80</entry>
<entry align="center">160</entry></row></tbody></tgroup>
<tgroup cols="13" rowsep="0">
<colspec colnum="1" colname="col1" colwidth="14mm"/>
<colspec colnum="2" colname="col2" colwidth="11mm"/>
<colspec colnum="3" colname="col3" colwidth="20mm"/>
<colspec colnum="4" colname="col4" colwidth="18mm"/>
<colspec colnum="5" colname="col5" colwidth="17mm"/>
<colspec colnum="6" colname="col6" colwidth="11mm"/>
<colspec colnum="7" colname="col7" colwidth="11mm"/>
<colspec colnum="8" colname="col8" colwidth="11mm"/>
<colspec colnum="9" colname="col9" colwidth="11mm"/>
<colspec colnum="10" colname="col10" colwidth="11mm"/>
<colspec colnum="11" colname="col11" colwidth="13mm"/>
<colspec colnum="12" colname="col12" colwidth="12mm"/>
<colspec colnum="13" colname="col13" colwidth="12mm"/>
<tbody>
<row>
<entry namest="col1" nameend="col13" align="justify">* First vaccination<br/>
** Second vaccination<br/>
*** Day of challenge</entry></row></tbody></tgroup>
</table>
</tables><!-- EPO <DP n="123"> -->
<tables id="tabl0050" num="0050">
<table frame="all">
<tgroup cols="5">
<colspec colnum="1" colname="col1" colwidth="16mm"/>
<colspec colnum="2" colname="col2" colwidth="21mm"/>
<colspec colnum="3" colname="col3" colwidth="33mm"/>
<colspec colnum="4" colname="col4" colwidth="43mm"/>
<colspec colnum="5" colname="col5" colwidth="34mm"/>
<thead>
<row>
<entry namest="col1" nameend="col5" align="left" valign="top"><b>Table 49.</b> Analysis of total canine influenza disease clinical scores</entry></row>
<row>
<entry align="center" valign="top">Group</entry>
<entry align="center" valign="top">Treatment</entry>
<entry align="center" valign="top">Route of vaccination</entry>
<entry align="center" valign="top">Average total Score per dog</entry>
<entry align="center" valign="top">P-value*</entry></row></thead>
<tbody>
<row>
<entry align="center">1</entry>
<entry align="center">VAX-1</entry>
<entry align="center">IN</entry>
<entry align="char" char="." charoff="9">35.2</entry>
<entry align="center">0.500 (Group 1 vs. 6)</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">VAX-2</entry>
<entry align="center">SQ</entry>
<entry align="char" char="." charoff="9">31.0</entry>
<entry align="center">0.345 (Group 2 vs. 6)</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">VAX-2</entry>
<entry align="center">IN</entry>
<entry align="char" char="." charoff="9">39.4</entry>
<entry align="center">0.631 (Group 3 vs. 6)</entry></row>
<row>
<entry align="center">4</entry>
<entry align="center">VAX-3</entry>
<entry align="center">SQ</entry>
<entry align="char" char="." charoff="9">13.0</entry>
<entry align="center">0.016 (Group 4 vs. 6)</entry></row>
<row>
<entry align="center">5</entry>
<entry align="center">VAX-3</entry>
<entry align="center">IN</entry>
<entry align="char" char="." charoff="9">42.6</entry>
<entry align="center">0.790 (Group 4 vs. 6)</entry></row>
<row>
<entry align="center">6</entry>
<entry align="center">Control</entry>
<entry align="center">--</entry>
<entry align="char" char="." charoff="9">36.8</entry>
<entry align="center">--</entry></row></tbody></tgroup>
<tgroup cols="5" rowsep="0">
<colspec colnum="1" colname="col1" colwidth="16mm"/>
<colspec colnum="2" colname="col2" colwidth="21mm"/>
<colspec colnum="3" colname="col3" colwidth="33mm"/>
<colspec colnum="4" colname="col4" colwidth="43mm"/>
<colspec colnum="5" colname="col5" colwidth="34mm"/>
<tbody>
<row>
<entry namest="col1" nameend="col5" align="justify">* Analyzed using a NPARIWAY procedure of SAS® Version 8.2 (the vaccine groups were compared using the Wilcoxon rank sum test)</entry></row></tbody></tgroup>
</table>
</tables><!-- EPO <DP n="124"> -->
<tables id="tabl0051" num="0051">
<table frame="all">
<tgroup cols="7">
<colspec colnum="1" colname="col1" colwidth="20mm"/>
<colspec colnum="2" colname="col2" colwidth="14mm"/>
<colspec colnum="3" colname="col3" colwidth="19mm"/>
<colspec colnum="4" colname="col4" colwidth="31mm"/>
<colspec colnum="5" colname="col5" colwidth="28mm"/>
<colspec colnum="6" colname="col6" colwidth="28mm"/>
<colspec colnum="7" colname="col7" colwidth="28mm"/>
<thead>
<row>
<entry namest="col1" nameend="col7" align="left" valign="top"><b>Table 50.</b> Histopathological evaluation of tissue samples</entry></row>
<row>
<entry morerows="1" align="center" valign="top">Group No</entry>
<entry morerows="1" align="center" valign="top">Dog ID</entry>
<entry morerows="1" align="center" valign="top">Treatment</entry>
<entry morerows="1" align="center" valign="top">Route of vaccination</entry>
<entry morerows="1" align="center" valign="top">Number of doses</entry>
<entry namest="col6" nameend="col7" align="center" valign="top">Microscopic lesion (Histopathology)</entry></row>
<row>
<entry align="center" valign="top">Lung</entry>
<entry align="center" valign="top">Trachea</entry></row></thead>
<tbody>
<row>
<entry align="center">1</entry>
<entry align="center">248</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IN</entry>
<entry align="center">2</entry>
<entry align="center">+</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">501</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IN</entry>
<entry align="center">2</entry>
<entry align="center">+</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">502</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IN</entry>
<entry align="center">2</entry>
<entry align="center">+</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">469</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IN</entry>
<entry align="center">2</entry>
<entry align="center">+</entry>
<entry align="center">+</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">46A</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IN</entry>
<entry align="center">2</entry>
<entry align="center">+</entry>
<entry align="center">+</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">232</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">SQ</entry>
<entry align="center">2</entry>
<entry align="center">+</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">511</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">SQ</entry>
<entry align="center">2</entry>
<entry align="center">+</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">514</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">SQ</entry>
<entry align="center">2</entry>
<entry align="center">-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">461</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">SQ</entry>
<entry align="center">2</entry>
<entry align="center">+</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">463</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">SQ</entry>
<entry align="center">2</entry>
<entry align="center">-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">246</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IN</entry>
<entry align="center">2</entry>
<entry align="center">+</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">505</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IN</entry>
<entry align="center">2</entry>
<entry align="center">+</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">506</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IN</entry>
<entry align="center">2</entry>
<entry align="center">+</entry>
<entry align="center">+</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">464</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IN</entry>
<entry align="center">2</entry>
<entry align="center">+</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">465</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IN</entry>
<entry align="center">2</entry>
<entry align="center">+</entry>
<entry align="center">+</entry></row>
<row>
<entry align="center">4</entry>
<entry align="center">23B</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">SQ</entry>
<entry align="center">2</entry>
<entry align="center">-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">4</entry>
<entry align="center">247</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">SQ</entry>
<entry align="center">2</entry>
<entry align="center">+/-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">4</entry>
<entry align="center">508</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">SQ</entry>
<entry align="center">2</entry>
<entry align="center">-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">4</entry>
<entry align="center">512</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">SQ</entry>
<entry align="center">2</entry>
<entry align="center">-</entry>
<entry align="center">+/-</entry></row>
<row>
<entry align="center">4</entry>
<entry align="center">516</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">SQ</entry>
<entry align="center">2</entry>
<entry align="center">+</entry>
<entry align="center">+</entry></row>
<row>
<entry align="center">5</entry>
<entry align="center">503</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IN</entry>
<entry align="center">2</entry>
<entry align="center">+</entry>
<entry align="center">+/-</entry></row>
<row>
<entry align="center">5</entry>
<entry align="center">513</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IN</entry>
<entry align="center">2</entry>
<entry align="center">+</entry>
<entry align="center">+</entry></row>
<row>
<entry align="center">5</entry>
<entry align="center">462</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IN</entry>
<entry align="center">2</entry>
<entry align="center">+</entry>
<entry align="center">+/-</entry></row>
<row>
<entry align="center">5</entry>
<entry align="center">466</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IN</entry>
<entry align="center">2</entry>
<entry align="center">+</entry>
<entry align="center">+</entry></row>
<row>
<entry align="center">5</entry>
<entry align="center">46B</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IN</entry>
<entry align="center">2</entry>
<entry align="center">+</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">6</entry>
<entry align="center">236</entry>
<entry align="center">Control</entry>
<entry align="center">--</entry>
<entry align="center">2</entry>
<entry align="center">+</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center">6</entry>
<entry align="center">504</entry>
<entry align="center">Control</entry>
<entry align="center">--</entry>
<entry align="center">2</entry>
<entry align="center">+</entry>
<entry align="center">+</entry></row>
<row>
<entry align="center">6</entry>
<entry align="center">507</entry>
<entry align="center">Control</entry>
<entry align="center">--</entry>
<entry align="center">2</entry>
<entry align="center">+</entry>
<entry align="center">+</entry></row>
<row>
<entry align="center">6</entry>
<entry align="center">515</entry>
<entry align="center">Control</entry>
<entry align="center">--</entry>
<entry align="center">2</entry>
<entry align="center">+</entry>
<entry align="center">+/-</entry></row>
<row>
<entry align="center">6</entry>
<entry align="center">468</entry>
<entry align="center">Control</entry>
<entry align="center">--</entry>
<entry align="center">2</entry>
<entry align="center">+</entry>
<entry align="center">+</entry></row></tbody></tgroup>
<tgroup cols="7" rowsep="0">
<colspec colnum="1" colname="col1" colwidth="20mm"/>
<colspec colnum="2" colname="col2" colwidth="14mm"/>
<colspec colnum="3" colname="col3" colwidth="19mm"/>
<colspec colnum="4" colname="col4" colwidth="31mm"/>
<colspec colnum="5" colname="col5" colwidth="28mm"/>
<colspec colnum="6" colname="col6" colwidth="28mm"/>
<colspec colnum="7" colname="col7" colwidth="28mm"/>
<tbody>
<row>
<entry namest="col1" nameend="col7" align="justify">"+" Severe lesion consistent or pathognomic to an influenza infection<br/>
"+/-" Mild lesion (inconclusive)<br/>
"-" Normal</entry></row></tbody></tgroup>
</table>
</tables></p>
<heading id="h0090">EXAMPLE 25 - CANINE INFLUENZA VACCINE EFFICACY STUDY</heading>
<p id="p0242" num="0242">Canine influenza disease is caused by an H3N8 influenza virus (CIV). CIV is very closely related to equine H3N8 viruses (Crawford <i>et al</i>., 2005) and infects all exposed dogs.<!-- EPO <DP n="125"> --> Approximately 80% of exposed dogs develop clinical signs. In the following study the efficacy of an inactivated H3N8 equine influenza virus vaccine and a canine influenza virus vaccine were determined.</p>
<heading id="h0091"><u>Procedure:</u></heading>
<p id="p0243" num="0243">Thirty-five beagles and five mongrels were used in this study. Beagles were randomly assigned to three groups (Table 51). All mongrels were assigned to control group (Group 3). All dogs were fed with a standard growth diet and water was available as libitum.
<tables id="tabl0052" num="0052">
<table frame="all">
<tgroup cols="6">
<colspec colnum="1" colname="col1" colwidth="14mm"/>
<colspec colnum="2" colname="col2" colwidth="19mm"/>
<colspec colnum="3" colname="col3" colwidth="30mm"/>
<colspec colnum="4" colname="col4" colwidth="27mm"/>
<colspec colnum="5" colname="col5" colwidth="42mm"/>
<colspec colnum="6" colname="col6" colwidth="19mm"/>
<thead>
<row>
<entry namest="col1" nameend="col6" align="left" valign="top"><b>Table 51.</b> Experimental design</entry></row>
<row>
<entry align="center" valign="middle">Group</entry>
<entry align="center" valign="middle">Treatment</entry>
<entry align="center" valign="top">Vaccination route</entry>
<entry align="center" valign="middle">Number of dogs</entry>
<entry align="center" valign="middle">Age at vaccination (weeks)</entry>
<entry align="center" valign="middle">Challenge</entry></row></thead>
<tbody>
<row>
<entry align="center" valign="middle">1</entry>
<entry align="center" valign="middle">VAX-1</entry>
<entry align="center" valign="middle">IM</entry>
<entry align="center" valign="middle">15</entry>
<entry align="center" valign="middle">8 &amp; 12</entry>
<entry align="center" valign="middle">Yes</entry></row>
<row>
<entry align="center" valign="middle">2</entry>
<entry align="center" valign="middle">VAX-2</entry>
<entry align="center" valign="middle">SC</entry>
<entry align="center" valign="middle">5</entry>
<entry align="center" valign="middle">- 8&amp;12</entry>
<entry align="center" valign="middle">Yes</entry></row>
<row>
<entry align="center" valign="middle">3</entry>
<entry align="center" valign="middle">Control</entry>
<entry align="center" valign="middle">N/A</entry>
<entry align="center" valign="middle">20</entry>
<entry align="center" valign="middle">N/A</entry>
<entry align="center" valign="middle">Yes</entry></row></tbody></tgroup>
</table>
</tables>
The dogs in Groups 1 and 2 were vaccinated with either VAX-1 or VAX-2 (Table 51). VAX-1 was a HAVLOGEN® adjuvanted, inactivated equine influenza virus (A/equine/KY/02) vaccine. For vaccine preparation, the vaccine virus was inactivated by binary ethylenimine (BEI) using a standard method. Each dose of vaccine contained HAVLOGEN® (10% v/v), 6144 HA units of the inactivated virus, 0.1% (v/v) of 10% thimerosal, 0.1 % (v/v) of phenol red and sufficient PBS to bring the total dose volume to 1 ml and sufficient NaOH to adjust the pH to 6.8 to 7.2.</p>
<p id="p0244" num="0244">VAX-2 was an inactivated, CARBIGENTM adjuvanted, canine influenza antigen vaccine (A/canine/F1/43/2004). The A/canine/Fl/43/2004 was inactivated by binary ethylenimine ("BEI") using a standard method. Each dose of the vaccine contained 5% by mass CARBIGENTM, approximately1280 HA units of the inactivated virus, sufficient PBS to bring the total volume of the dose to 1 ml, and sufficient NaOH to adjust the pH to between 7.2 and 7.4. Serum samples were collected from all dogs on the day of first and second vaccination, days 7 and 14 post first and second vaccinations, and at pre-challenge to determine the HI titers using an H3N8 equine influenza virus standard protocol (SAM 124, CVB, USDA, Ames, IA). Seven days before challenge, the dogs were moved to a ABSL-2 facility and housed in individual cages.<!-- EPO <DP n="126"> --></p>
<p id="p0245" num="0245">All vaccinates and age-matched control dogs were challenged oronasally with virulent canine influenza virus (10<sup>7.2</sup> TCID50 of A/Canine/Florida/242/2003 per dog) at 2 weeks post second vaccination. The challenge virus was administered as a mist (2ml/dog) using a nebulizer (Nebulair™). The dogs were observed for influenza-related clinical signs for 14 days post-challenge. Nasal and oropharyngeal swabs were collected daily in tubes containing 2 ml of virus transport medium for virus isolation from day -1 (<i>i.e</i>., one day before challenge) through day 14 post-challenge. Blood samples were collected on days 7 and 14 post challenge for HI titer determination. The clinical sign score assignments used for post challenge observation are shown in Table 52.</p>
<heading id="h0092"><u>Results:</u></heading>
<p id="p0246" num="0246">All vaccinated dogs (Groups 1 and 2) developed HI antibody titer responses to the canine influenza virus isolate (Table 53). All dogs exhibited one or more of the following signs of canine influenza: fever (&gt;103.0°F; &gt;39.4°C), cough, serous or mucopurulent ocular discharge, serous or mucopurulent nasal discharge, vomiting, diarrhea, depression, and anorexia. Vaccinates had less severe clinical signs, compared to age-matched controls (Table 54). There was a significant (P &lt; 0.001) reduction in clinical signs in dogs vaccinated with either VAX-1 (Group 1) or VAX-2 (Group 2).</p>
<p id="p0247" num="0247">Virus isolation results are shown in Tables 55 and 56. Following a virulent canine influenza virus challenge, the canine influenza virus was isolated from 5 of 15 (33%) dogs from Group 1 (VAX-1), 0 of 5 (0%) dogs from Group 2 (VAX-2) and 17 of 20 (85%) controls (Group 3). Both inactivated equine influenza vaccine (VAX-1) and canine influenza virus (VAX-2) vaccinates demonstrated a significant (P = 0.004) reduction in virus shedding in nasal or oral secretions or both (Table 55) compared to controls.</p>
<heading id="h0093"><u>Conclusion:</u></heading>
<p id="p0248" num="0248">The results from this study demonstrate that: (1) inactivated H3N8 equine influenza virus and canine influenza virus vaccines can induce canine influenza virus reactive HI antibody responses in vaccinated dogs, (2) use of an H3N8 equine influenza virus or canine influenza virus vaccine can reduce the severity of canine influenza virus disease in dogs, and (3) use of an H3N8 equine influenza virus or canine influenza virus vaccine can reduce virus excretion in nasal and/or oral secretions.<!-- EPO <DP n="127"> -->
<tables id="tabl0053" num="0053">
<table frame="all">
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="45mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry namest="col1" nameend="col2" align="left" valign="top"><b>Table 52.</b> Clinical signs and scoring system</entry></row>
<row>
<entry valign="top"><b><u>Clinical signs</u></b></entry>
<entry valign="top"><b><u>Score per day</u></b></entry></row>
<row>
<entry namest="col1" nameend="col2" align="left" valign="top"><b>Temp</b></entry></row></thead>
<tbody>
<row>
<entry>&lt;103.0°F (&lt;39.4°C)</entry>
<entry>0</entry></row>
<row>
<entry>103.0 -103.9°F (39.4-</entry>
<entry>2</entry></row>
<row>
<entry>104.0-104.9°F (40.0-40.5°C)</entry>
<entry>3</entry></row>
<row>
<entry>&gt;105.0°F (&gt;40.6°C)</entry>
<entry>4</entry></row></tbody></tgroup>
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="45mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry namest="col1" nameend="col2" align="left" valign="top"><b>Coughing</b></entry></row></thead>
<tbody>
<row>
<entry>No coughing</entry>
<entry>0</entry></row>
<row>
<entry>Occasional</entry>
<entry>2</entry></row>
<row>
<entry>Paroxysmal</entry>
<entry>4</entry></row></tbody></tgroup>
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="45mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry namest="col1" nameend="col2" align="left" valign="top"><b>Sneezing</b></entry></row></thead>
<tbody>
<row>
<entry>No sneezing</entry>
<entry>o</entry></row>
<row>
<entry>Occasional</entry>
<entry>1</entry></row>
<row>
<entry>Paroxysmal</entry>
<entry>2</entry></row></tbody></tgroup>
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="45mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry namest="col1" nameend="col2" align="left" valign="top"><b>Nasal discharge</b></entry></row></thead>
<tbody>
<row>
<entry>No discharge</entry>
<entry>0</entry></row>
<row>
<entry>Serous -slight</entry>
<entry>1</entry></row>
<row>
<entry>Serous -copious</entry>
<entry>1</entry></row>
<row>
<entry>Mucopurulent-slight</entry>
<entry>2</entry></row>
<row>
<entry>Mucopurulent-copious</entry>
<entry>3</entry></row></tbody></tgroup>
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="45mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry namest="col1" nameend="col2" align="left" valign="top"><b>Ocular discharge</b></entry></row></thead>
<tbody>
<row>
<entry>No discharge</entry>
<entry>0</entry></row>
<row>
<entry>Serous -slight</entry>
<entry>1</entry></row>
<row>
<entry>Serous -copious</entry>
<entry>1</entry></row>
<row>
<entry>Mucopurulent-slight</entry>
<entry>2</entry></row>
<row>
<entry>Mucopurulent-copious</entry>
<entry>3</entry></row></tbody></tgroup>
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="45mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry namest="col1" nameend="col2" align="left" valign="top"><b>Hemoptysis</b></entry></row></thead>
<tbody>
<row>
<entry>No</entry>
<entry>0</entry></row>
<row>
<entry>Yes</entry>
<entry>5</entry></row></tbody></tgroup>
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="45mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry namest="col1" nameend="col2" align="left" valign="top"><b>Depression</b></entry></row></thead>
<tbody>
<row>
<entry>No</entry>
<entry>0</entry></row>
<row>
<entry>Yes</entry>
<entry>1</entry></row></tbody></tgroup>
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="45mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry namest="col1" nameend="col2" align="left" valign="top"><b>Anorexia</b></entry></row></thead>
<tbody>
<row>
<entry>No</entry>
<entry>0</entry></row>
<row>
<entry>Yes</entry>
<entry>1</entry></row></tbody></tgroup>
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="45mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry valign="top"><b>Respiratory signs</b></entry>
<entry valign="top"/></row></thead>
<tbody>
<row>
<entry>None</entry>
<entry>0</entry></row>
<row>
<entry>Rales</entry>
<entry>3</entry></row>
<row>
<entry>Dyspnea</entry>
<entry>4</entry></row>
<row>
<entry>Gasping</entry>
<entry>5</entry></row></tbody></tgroup>
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="45mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry namest="col1" nameend="col2" align="left" valign="top"><b>Mucous expectorate</b></entry></row></thead>
<tbody>
<row>
<entry>No</entry>
<entry>0</entry></row>
<row>
<entry>Yes</entry>
<entry>2</entry></row>
<row>
<entry><b>Vomiting</b></entry>
<entry/></row>
<row>
<entry>No</entry>
<entry>0</entry></row>
<row>
<entry>Yes</entry>
<entry>1</entry></row></tbody></tgroup><!-- EPO <DP n="128"> -->
<tgroup cols="2">
<colspec colnum="1" colname="col1" colwidth="45mm"/>
<colspec colnum="2" colname="col2" colwidth="25mm"/>
<thead>
<row>
<entry valign="top"><b>Fecal abnormalities</b></entry>
<entry valign="top"/></row></thead>
<tbody>
<row>
<entry>No</entry>
<entry>0</entry></row>
<row>
<entry>Yes</entry>
<entry>1</entry></row></tbody></tgroup>
</table>
</tables><!-- EPO <DP n="129"> -->
<tables id="tabl0054" num="0054">
<table frame="all">
<tgroup cols="12">
<colspec colnum="1" colname="col1" colwidth="15mm"/>
<colspec colnum="2" colname="col2" colwidth="13mm"/>
<colspec colnum="3" colname="col3" colwidth="21mm"/>
<colspec colnum="4" colname="col4" colwidth="23mm"/>
<colspec colnum="5" colname="col5" colwidth="12mm"/>
<colspec colnum="6" colname="col6" colwidth="12mm"/>
<colspec colnum="7" colname="col7" colwidth="12mm"/>
<colspec colnum="8" colname="col8" colwidth="12mm"/>
<colspec colnum="9" colname="col9" colwidth="12mm"/>
<colspec colnum="10" colname="col10" colwidth="14mm"/>
<colspec colnum="11" colname="col11" colwidth="12mm"/>
<colspec colnum="12" colname="col12" colwidth="13mm"/>
<thead>
<row>
<entry namest="col1" nameend="col12" align="left" valign="top"><b>Table 53.</b> Serology - Hemagglutination inhibition titers</entry></row>
<row>
<entry morerows="2" align="center" valign="top">Group No</entry>
<entry morerows="2" align="center" valign="top">Dog ID</entry>
<entry morerows="2" align="center" valign="top">Treatment</entry>
<entry morerows="2" align="center" valign="top">Vaccination route</entry>
<entry namest="col5" nameend="col12" align="center" valign="top">HI titer</entry></row>
<row>
<entry namest="col5" nameend="col8" align="center" valign="top">Days post vaccination</entry>
<entry namest="col9" nameend="col12" align="center" valign="top">Days post challenge</entry></row>
<row>
<entry align="center" valign="top">0*</entry>
<entry align="center" valign="top">7</entry>
<entry align="center" valign="top">14</entry>
<entry align="center" valign="top">28**</entry>
<entry align="center" valign="top">35</entry>
<entry align="center" valign="top">42***</entry>
<entry align="center" valign="top">7</entry>
<entry align="center" valign="top">14</entry></row></thead>
<tbody>
<row>
<entry align="center">1</entry>
<entry align="center">AYS</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IM</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">20</entry>
<entry align="center">40</entry>
<entry align="center">40</entry>
<entry align="center">80</entry>
<entry align="center">≥640</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">AZV</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IM</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">20</entry>
<entry align="center">40</entry>
<entry align="center">40</entry>
<entry align="center">160</entry>
<entry align="center">≥640</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">BAD</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IM</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">40</entry>
<entry align="center">40</entry>
<entry align="center">80</entry>
<entry align="center">80</entry>
<entry align="center">320</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">BAE</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IM</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">10</entry>
<entry align="center">20</entry>
<entry align="center">20</entry>
<entry align="center">20</entry>
<entry align="center">40</entry>
<entry align="center">320</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">BAH</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IM</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">10</entry>
<entry align="center">10</entry>
<entry align="center">40</entry>
<entry align="center">40</entry>
<entry align="center">160</entry>
<entry align="center">≥640</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">BAJ</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IM</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">10</entry>
<entry align="center">20</entry>
<entry align="center">80</entry>
<entry align="center">80</entry>
<entry align="center">40</entry>
<entry align="center">320</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">BAN</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IM</entry>
<entry align="center">&lt;10</entry>
<entry align="center">10</entry>
<entry align="center">10</entry>
<entry align="center">20</entry>
<entry align="center">40</entry>
<entry align="center">40</entry>
<entry align="center">40</entry>
<entry align="center">320</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">BBN</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IM</entry>
<entry align="center">&lt;10</entry>
<entry align="center">10</entry>
<entry align="center">10</entry>
<entry align="center">20</entry>
<entry align="center">80</entry>
<entry align="center">80</entry>
<entry align="center">40</entry>
<entry align="center">320</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">BBT</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IM</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">20</entry>
<entry align="center">40</entry>
<entry align="center">40</entry>
<entry align="center">40</entry>
<entry align="center">160</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">BBY</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IM</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">20</entry>
<entry align="center">80</entry>
<entry align="center">80</entry>
<entry align="center">160</entry>
<entry align="center">≥ 640</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">BCS</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IM</entry>
<entry align="center">&lt;10</entry>
<entry align="center">10</entry>
<entry align="center">40</entry>
<entry align="center">40</entry>
<entry align="center">160</entry>
<entry align="center">160</entry>
<entry align="center">160</entry>
<entry align="center">160</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">BCZ</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IM</entry>
<entry align="center">&lt;10</entry>
<entry align="center">10</entry>
<entry align="center">10</entry>
<entry align="center">20</entry>
<entry align="center">80</entry>
<entry align="center">40</entry>
<entry align="center">160</entry>
<entry align="center">160</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">BDP</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IM</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">20</entry>
<entry align="center">40</entry>
<entry align="center">40</entry>
<entry align="center">80</entry>
<entry align="center">≥640</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">BEE</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IM</entry>
<entry align="center">&lt;10</entry>
<entry align="center">10</entry>
<entry align="center">20</entry>
<entry align="center">40</entry>
<entry align="center">80</entry>
<entry align="center">80</entry>
<entry align="center">160</entry>
<entry align="center">320</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">BEY</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IM</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">10</entry>
<entry align="center">10</entry>
<entry align="center">40</entry>
<entry align="center">40</entry>
<entry align="center">160</entry>
<entry align="center">160</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">AZH</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">SC</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">10</entry>
<entry align="center">20</entry>
<entry align="center">80</entry>
<entry align="center">80</entry>
<entry align="center">160</entry>
<entry align="center">160</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">AZT</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">sc</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">10</entry>
<entry align="center">10</entry>
<entry align="center">40</entry>
<entry align="center">80</entry>
<entry align="center">320</entry>
<entry align="center">≥640</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">BBC</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">sc</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">20</entry>
<entry align="center">40</entry>
<entry align="center">160</entry>
<entry align="center">160</entry>
<entry align="center">80</entry>
<entry align="center">160</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">BCM</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">SC</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">10</entry>
<entry align="center">20</entry>
<entry align="center">80</entry>
<entry align="center">40</entry>
<entry align="center">80</entry>
<entry align="center">160</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">BEB</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">SC</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">10</entry>
<entry align="center">20</entry>
<entry align="center">40</entry>
<entry align="center">80</entry>
<entry align="center">160</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">AYT</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">40</entry>
<entry align="center">320</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">AZJ</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">20</entry>
<entry align="center">160</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">AZL</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">40</entry>
<entry align="center">160</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">AZN</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">160</entry>
<entry align="center">160</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">BAB</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">40</entry>
<entry align="center">320</entry></row></tbody></tgroup>
</table>
</tables><!-- EPO <DP n="130"> -->
<tables id="tabl0055" num="0055">
<table frame="all">
<tgroup cols="12">
<colspec colnum="1" colname="col1" colwidth="15mm"/>
<colspec colnum="2" colname="col2" colwidth="13mm"/>
<colspec colnum="3" colname="col3" colwidth="21mm"/>
<colspec colnum="4" colname="col4" colwidth="23mm"/>
<colspec colnum="5" colname="col5" colwidth="12mm"/>
<colspec colnum="6" colname="col6" colwidth="12mm"/>
<colspec colnum="7" colname="col7" colwidth="12mm"/>
<colspec colnum="8" colname="col8" colwidth="13mm"/>
<colspec colnum="9" colname="col9" colwidth="12mm"/>
<colspec colnum="10" colname="col10" colwidth="14mm"/>
<colspec colnum="11" colname="col11" colwidth="12mm"/>
<colspec colnum="12" colname="col12" colwidth="12mm"/>
<thead>
<row>
<entry namest="col1" nameend="col12" align="left" valign="top"><b>Table 53.</b> Serology - Hemagglutination inhibition titers</entry></row>
<row>
<entry morerows="2" align="center" valign="top">Group No</entry>
<entry morerows="2" align="center" valign="top">Dog ID</entry>
<entry morerows="2" align="center" valign="top">Treatment</entry>
<entry morerows="2" align="center" valign="top">Vaccination route</entry>
<entry namest="col5" nameend="col12" align="center" valign="top">HI titer</entry></row>
<row>
<entry namest="col5" nameend="col8" align="center" valign="top">Days post vaccination</entry>
<entry namest="col9" nameend="col12" align="center" valign="top">Days post challenge</entry></row>
<row>
<entry align="center" valign="top">0*</entry>
<entry align="center" valign="top">7</entry>
<entry align="center" valign="top">14</entry>
<entry align="center" valign="top">28**</entry>
<entry align="center" valign="top">35</entry>
<entry align="center" valign="top">42***</entry>
<entry align="center" valign="top">7</entry>
<entry align="center" valign="top">14</entry></row></thead>
<tbody>
<row>
<entry align="center">3</entry>
<entry align="center">BBD</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">320</entry>
<entry align="center">≥ 640</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">BBU</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">160</entry>
<entry align="center">160</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">BBZ</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">20</entry>
<entry align="center">160</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">BCC</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">40</entry>
<entry align="center">320</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">BCD</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">80</entry>
<entry align="center">≥ 640</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">BCG</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;14</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">40</entry>
<entry align="center">≥ 640</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">BCI</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt; 10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">20</entry>
<entry align="center">320</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">BCL</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">80</entry>
<entry align="center">≥ 640</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">BCV</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">40</entry>
<entry align="center">320</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">BDU</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">80</entry>
<entry align="center">≥ 640</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">MFI</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">NT</entry>
<entry align="center">NT</entry>
<entry align="center">NT</entry>
<entry align="center">NT</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">80</entry>
<entry align="center">320</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">MFJ</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">NT</entry>
<entry align="center">NT</entry>
<entry align="center">NT</entry>
<entry align="center">NT</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">40</entry>
<entry align="center">320</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">MFK</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">NT</entry>
<entry align="center">NT</entry>
<entry align="center">NT</entry>
<entry align="center">NT</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">80</entry>
<entry align="center">320</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">MFR</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">NT</entry>
<entry align="center">NT</entry>
<entry align="center">NT</entry>
<entry align="center">NT</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">80</entry>
<entry align="center">320</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">MFS</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">NT</entry>
<entry align="center">NT</entry>
<entry align="center">NT</entry>
<entry align="center">NT</entry>
<entry align="center">&lt;10</entry>
<entry align="center">&lt;10</entry>
<entry align="center">160</entry>
<entry align="center">≥ 640</entry></row></tbody></tgroup>
<tgroup cols="12" rowsep="0">
<colspec colnum="1" colname="col1" colwidth="15mm"/>
<colspec colnum="2" colname="col2" colwidth="13mm"/>
<colspec colnum="3" colname="col3" colwidth="21mm"/>
<colspec colnum="4" colname="col4" colwidth="23mm"/>
<colspec colnum="5" colname="col5" colwidth="12mm"/>
<colspec colnum="6" colname="col6" colwidth="12mm"/>
<colspec colnum="7" colname="col7" colwidth="12mm"/>
<colspec colnum="8" colname="col8" colwidth="13mm"/>
<colspec colnum="9" colname="col9" colwidth="12mm"/>
<colspec colnum="10" colname="col10" colwidth="14mm"/>
<colspec colnum="11" colname="col11" colwidth="12mm"/>
<colspec colnum="12" colname="col12" colwidth="12mm"/>
<tbody>
<row>
<entry namest="col1" nameend="col12" align="justify">* First vaccination<br/>
** Second vaccination<br/>
*** Day of challenge</entry></row></tbody></tgroup>
</table>
</tables><!-- EPO <DP n="131"> -->
<tables id="tabl0056" num="0056">
<table frame="all">
<tgroup cols="4">
<colspec colnum="1" colname="col1" colwidth="22mm"/>
<colspec colnum="2" colname="col2" colwidth="26mm"/>
<colspec colnum="3" colname="col3" colwidth="43mm"/>
<colspec colnum="4" colname="col4" colwidth="36mm"/>
<thead>
<row>
<entry namest="col1" nameend="col4" align="left" valign="top"><b>Table 54.</b> Analysis of total canine influenza disease clinical scores</entry></row>
<row>
<entry align="center" valign="top">Group</entry>
<entry align="center" valign="top">Treatment</entry>
<entry align="center" valign="top">Average total Score per dog</entry>
<entry align="center" valign="top">P-value*</entry></row></thead>
<tbody>
<row>
<entry align="center">1</entry>
<entry align="center">VAX-1</entry>
<entry align="center">9.1</entry>
<entry align="center">&lt; 0.001 (Group 1 vs. 3)</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">VAX-2</entry>
<entry align="center">5.4</entry>
<entry align="center">&lt; 0.001 (Group 2 vs. 3)</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">Control</entry>
<entry align="center">24.1</entry>
<entry align="center">--</entry></row></tbody></tgroup>
<tgroup cols="4" rowsep="0">
<colspec colnum="1" colname="col1" colwidth="22mm"/>
<colspec colnum="2" colname="col2" colwidth="26mm"/>
<colspec colnum="3" colname="col3" colwidth="43mm"/>
<colspec colnum="4" colname="col4" colwidth="36mm"/>
<tbody>
<row>
<entry namest="col1" nameend="col4" align="justify">* Analyzed using a NPARIWAY procedure of SAS® Version 9.1 (the vaccine groups were compared using the GLM procedure)</entry></row></tbody></tgroup>
</table>
</tables>
<tables id="tabl0057" num="0057">
<table frame="all">
<tgroup cols="4">
<colspec colnum="1" colname="col1" colwidth="14mm"/>
<colspec colnum="2" colname="col2" colwidth="19mm"/>
<colspec colnum="3" colname="col3" colwidth="49mm"/>
<colspec colnum="4" colname="col4" colwidth="34mm"/>
<thead>
<row>
<entry namest="col1" nameend="col4" align="left" valign="top"><b>Table 55.</b> Post-challenge virus shedding</entry></row>
<row>
<entry align="center" valign="top">Group</entry>
<entry align="center" valign="top">Treatment</entry>
<entry align="center" valign="top">Percent dogs excreted the virus</entry>
<entry align="center" valign="top">P-value*</entry></row></thead>
<tbody>
<row>
<entry align="center">1</entry>
<entry align="center">VAX-1</entry>
<entry align="center">33% (5/15)</entry>
<entry align="center">0.004 (Group 1 vs. 3)</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">VAX-2</entry>
<entry align="center">0% (0/5)</entry>
<entry align="center">0.004 (Group 2 vs. 3)</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">Control</entry>
<entry align="center">85% (17/20)</entry>
<entry align="center">--</entry></row></tbody></tgroup>
<tgroup cols="4" rowsep="0">
<colspec colnum="1" colname="col1" colwidth="14mm"/>
<colspec colnum="2" colname="col2" colwidth="19mm"/>
<colspec colnum="3" colname="col3" colwidth="49mm"/>
<colspec colnum="4" colname="col4" colwidth="34mm"/>
<tbody>
<row>
<entry namest="col1" nameend="col4" align="justify">* Analyzed using a FREQ procedure of SAS® (Version 9.1) and P-value associated with Fisher's exact test</entry></row></tbody></tgroup>
</table>
</tables><!-- EPO <DP n="132"> -->
<tables id="tabl0058" num="0058">
<table frame="all">
<tgroup cols="20">
<colspec colnum="1" colname="col1" colwidth="20mm"/>
<colspec colnum="2" colname="col2" colwidth="15mm"/>
<colspec colnum="3" colname="col3" colwidth="20mm"/>
<colspec colnum="4" colname="col4" colwidth="31mm"/>
<colspec colnum="5" colname="col5" colwidth="9mm"/>
<colspec colnum="6" colname="col6" colwidth="9mm"/>
<colspec colnum="7" colname="col7" colwidth="9mm"/>
<colspec colnum="8" colname="col8" colwidth="9mm"/>
<colspec colnum="9" colname="col9" colwidth="9mm"/>
<colspec colnum="10" colname="col10" colwidth="9mm"/>
<colspec colnum="11" colname="col11" colwidth="9mm"/>
<colspec colnum="12" colname="col12" colwidth="9mm"/>
<colspec colnum="13" colname="col13" colwidth="9mm"/>
<colspec colnum="14" colname="col14" colwidth="9mm"/>
<colspec colnum="15" colname="col15" colwidth="9mm"/>
<colspec colnum="16" colname="col16" colwidth="9mm"/>
<colspec colnum="17" colname="col17" colwidth="9mm"/>
<colspec colnum="18" colname="col18" colwidth="9mm"/>
<colspec colnum="19" colname="col19" colwidth="9mm"/>
<colspec colnum="20" colname="col20" colwidth="9mm"/>
<thead>
<row>
<entry namest="col1" nameend="col20" align="left" valign="top"><b>Table 56.</b> Serology - Hemagglutination inhibition titers</entry></row>
<row>
<entry morerows="1" align="center" valign="top"><b>Group No</b></entry>
<entry morerows="1" align="center" valign="top"><b>Dog ID</b></entry>
<entry morerows="1" align="center" valign="top"><b>Treatment</b></entry>
<entry morerows="1" align="center" valign="top"><b>Vaccination route</b></entry>
<entry namest="col5" nameend="col20" align="center" valign="top"><b>Days post-challenge</b></entry></row>
<row>
<entry align="center" valign="top"><b>-1</b></entry>
<entry align="center" valign="top"><b>0</b></entry>
<entry align="center" valign="top"><b>1</b></entry>
<entry align="center" valign="top"><b>2</b></entry>
<entry align="center" valign="top"><b>3</b></entry>
<entry align="center" valign="top"><b>4</b></entry>
<entry align="center" valign="top"><b>5</b></entry>
<entry align="center" valign="top"><b>6</b></entry>
<entry align="center" valign="top"><b>7</b></entry>
<entry align="center" valign="top"><b>8</b></entry>
<entry align="center" valign="top"><b>9</b></entry>
<entry align="center" valign="top"><b>10</b></entry>
<entry align="center" valign="top"><b>11</b></entry>
<entry align="center" valign="top"><b>12</b></entry>
<entry align="center" valign="top"><b>13</b></entry>
<entry align="center" valign="top"><b>14</b></entry></row></thead>
<tbody>
<row>
<entry align="center">1</entry>
<entry align="center">AYS</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IM</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">AZV</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IM</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">BAD</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IM</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">BAE</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IM</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">BAH</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IM</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">BAJ</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IM</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">BAN</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IM</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">BBN</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IM</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">BBT</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IM</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">BBY</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IM</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">BCS</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IM</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">BCZ</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IM</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">BDP</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IM</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">BEE</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IM</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">1</entry>
<entry align="center">BEY</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">IM</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">AZH</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">SC</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">AZT</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">SC</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">BBC</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">SC</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">BCM</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">SC</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">2</entry>
<entry align="center">BEB</entry>
<entry align="center">Vaccinate</entry>
<entry align="center">SC</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">AYT</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">AZJ</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">AZL</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">AZN</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">BAB</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row><!-- EPO <DP n="133"> -->
<row>
<entry align="center">3</entry>
<entry align="center">BBD</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">BBU</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">BBZ</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">BCC</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">BCD</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">BCG</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">BCI</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">P</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">BCL</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">BCV</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">BDU</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">MFI</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">P</entry>
<entry align="center">P</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">MFJ</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">MFK</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">MFR</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row>
<row>
<entry align="center">3</entry>
<entry align="center">MFS</entry>
<entry align="center">Control</entry>
<entry align="center">N/A</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">P</entry>
<entry align="center">P</entry>
<entry align="center">P</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry>
<entry align="center">N</entry></row></tbody></tgroup><!-- EPO <DP n="134"> -->
<tgroup cols="20" rowsep="0">
<colspec colnum="1" colname="col1" colwidth="20mm"/>
<colspec colnum="2" colname="col2" colwidth="15mm"/>
<colspec colnum="3" colname="col3" colwidth="20mm"/>
<colspec colnum="4" colname="col4" colwidth="31mm"/>
<colspec colnum="5" colname="col5" colwidth="9mm"/>
<colspec colnum="6" colname="col6" colwidth="9mm"/>
<colspec colnum="7" colname="col7" colwidth="9mm"/>
<colspec colnum="8" colname="col8" colwidth="9mm"/>
<colspec colnum="9" colname="col9" colwidth="9mm"/>
<colspec colnum="10" colname="col10" colwidth="9mm"/>
<colspec colnum="11" colname="col11" colwidth="9mm"/>
<colspec colnum="12" colname="col12" colwidth="9mm"/>
<colspec colnum="13" colname="col13" colwidth="9mm"/>
<colspec colnum="14" colname="col14" colwidth="9mm"/>
<colspec colnum="15" colname="col15" colwidth="9mm"/>
<colspec colnum="16" colname="col16" colwidth="9mm"/>
<colspec colnum="17" colname="col17" colwidth="9mm"/>
<colspec colnum="18" colname="col18" colwidth="9mm"/>
<colspec colnum="19" colname="col19" colwidth="9mm"/>
<colspec colnum="20" colname="col20" colwidth="9mm"/>
<tbody>
<row>
<entry namest="col1" nameend="col20" align="justify">N- No virus isolated from oral or nasal swabs<br/>
P - Virus isolated from nasal or oral or nasal and oral swabs.</entry></row></tbody></tgroup>
</table>
</tables>
<tables id="tabl0059" num="0059">
<table frame="all">
<tgroup cols="3">
<colspec colnum="1" colname="col1" colwidth="57mm"/>
<colspec colnum="2" colname="col2" colwidth="52mm"/>
<colspec colnum="3" colname="col3" colwidth="57mm"/>
<thead>
<row>
<entry namest="col1" nameend="col3" align="left" valign="top"><b>Table 57. Hemagglutinin, neuraminidase and nucleoprotein gene amino acid sequence similarities among influenza viruses</b></entry></row>
<row>
<entry valign="top"><b>Gene (Canine /Florida/43/2004)</b></entry>
<entry valign="top"><b>Amino acid sequence similarity</b></entry>
<entry valign="top"><b>Gene of influenza virus used for comparison</b></entry></row></thead>
<tbody>
<row>
<entry>Hemagglutinin</entry>
<entry>88</entry>
<entry>equine/Algiers/72</entry></row>
<row>
<entry>HA</entry>
<entry>90</entry>
<entry>equine/Sao paulo/6/69</entry></row>
<row>
<entry>HA</entry>
<entry>91</entry>
<entry>equine/Miami/1/63</entry></row>
<row>
<entry>HA</entry>
<entry>93</entry>
<entry>equine/Newmarket/79</entry></row>
<row>
<entry>HA</entry>
<entry>94</entry>
<entry>equine/Kentucky/1/81</entry></row>
<row>
<entry>HA</entry>
<entry>95</entry>
<entry>Equi-2/Ludhiana/87</entry></row>
<row>
<entry>HA</entry>
<entry>96</entry>
<entry>Equine/Alaska/1/91</entry></row>
<row>
<entry>HA</entry>
<entry>97</entry>
<entry>equine/Tennessee/5/86</entry></row>
<row>
<entry>HA</entry>
<entry>98</entry>
<entry>equine/Kentucky/5/02</entry></row>
<row>
<entry>HA</entry>
<entry>99</entry>
<entry>equine/Ohio/1/2003</entry></row>
<row>
<entry>HA</entry>
<entry>99</entry>
<entry>canine/Florida/242/2003</entry></row>
<row>
<entry/>
<entry/>
<entry/></row>
<row>
<entry>Neuraminidase</entry>
<entry>88</entry>
<entry>Eq/Algiers/72</entry></row>
<row>
<entry>NA</entry>
<entry>90</entry>
<entry>equine/Sao Paulo/6/69</entry></row>
<row>
<entry>NA</entry>
<entry>91</entry>
<entry>equme/Miami/1/63</entry></row>
<row>
<entry>NA</entry>
<entry>93</entry>
<entry>equine/Newmarket/79</entry></row>
<row>
<entry>NA</entry>
<entry>94</entry>
<entry>equine/Kentucky/1/81</entry></row>
<row>
<entry>NA</entry>
<entry>95</entry>
<entry>Equi-2/Ludhiana/87</entry></row>
<row>
<entry>NA</entry>
<entry>96</entry>
<entry>equine/Santiago/85</entry></row>
<row>
<entry>NA</entry>
<entry>97</entry>
<entry>equine/Tennessee/5/86</entry></row>
<row>
<entry>NA</entry>
<entry>98</entry>
<entry>equine/Kentucky/5/2002</entry></row>
<row>
<entry>NA</entry>
<entry>99</entry>
<entry>equine/Ohio/1/2003</entry></row>
<row>
<entry>NA</entry>
<entry>99</entry>
<entry>canine/Florida/242/2003</entry></row>
<row>
<entry/>
<entry/>
<entry/></row>
<row>
<entry>Nucleoprotein ("NP")</entry>
<entry>94</entry>
<entry>equi/Miami/1/63</entry></row>
<row>
<entry>NP</entry>
<entry>97</entry>
<entry>equine/Kentucky/1/81</entry></row>
<row>
<entry>NP</entry>
<entry>99</entry>
<entry>equine/Kentucky/5/02</entry></row>
<row>
<entry>NP</entry>
<entry>99</entry>
<entry>equine/Ohio/1/2003</entry></row>
<row>
<entry>NP</entry>
<entry>99</entry>
<entry>canine/Florida/242/2003</entry></row></tbody></tgroup>
</table>
</tables></p>
<p id="p0249" num="0249">The words "comprise," "comprises," and "comprising" in this patent (including the claims) are to be interpreted inclusively rather than exclusively.</p>
<p id="p0250" num="0250">The above detailed description of preferred embodiments is intended only to acquaint others skilled in the art with the invention, its principles, and its practical application so that<!-- EPO <DP n="135"> --> others skilled in the art may adapt and apply the invention in its numerous forms, as they may be best suited to the requirements of a particular use. This invention, therefore, is not limited to the above embodiments, and may be variously modified.<!-- EPO <DP n="136"> --></p>
<heading id="h0094">REFERENCES</heading>
<p id="p0251" num="0251">
<ul id="ul0004" list-style="none">
<li><patcit id="pcit0030" dnum="US5106739A"><text>U.S. Patent No. 5,106,739</text></patcit></li>
<li><patcit id="pcit0031" dnum="US5034322A"><text>U.S. Patent No. 5,034,322</text></patcit></li>
<li><patcit id="pcit0032" dnum="US6455760B"><text>U.S. Patent No. 6,455,760</text></patcit></li>
<li><patcit id="pcit0033" dnum="US6696623B"><text>U.S. Patent No. 6,696,623</text></patcit></li>
<li><patcit id="pcit0034" dnum="US4683202A"><text>U.S. Patent No. 4,683,202</text></patcit></li>
<li><patcit id="pcit0035" dnum="US4683195A"><text>U.S. Patent No. 4,683,195</text></patcit></li>
<li><patcit id="pcit0036" dnum="US4800159A"><text>U.S. Patent No. 4,800,159</text></patcit></li>
<li><patcit id="pcit0037" dnum="US4965188A"><text>U.S. Patent No. 4,965,188</text></patcit></li>
<li><patcit id="pcit0038" dnum="US5994056A"><text>U.S. Patent No. 5,994,056</text></patcit></li>
<li><patcit id="pcit0039" dnum="US6814934B"><text>U.S. Patent No. 6,814,934</text></patcit></li>
<li><patcit id="pcit0040" dnum="US6436408B"><text>U.S. Patent No. 6,436,408</text></patcit></li>
<li><patcit id="pcit0041" dnum="US6398774B"><text>U.S. Patent No. 6,398,774</text></patcit></li>
<li><patcit id="pcit0042" dnum="US6177082B"><text>U.S. Patent No. 6,177,082</text></patcit></li>
<li>Published <patcit id="pcit0043" dnum="US20040078841A" dnum-type="L"><text>U.S. Application No. 20040078841</text></patcit></li>
<li>Published <patcit id="pcit0044" dnum="US20040067506A" dnum-type="L"><text>U.S. Application No. 20040067506</text></patcit></li>
<li>Published <patcit id="pcit0045" dnum="US20040019934A" dnum-type="L"><text>U.S. Application No. 20040019934</text></patcit></li>
<li>Published <patcit id="pcit0046" dnum="US20030177536A" dnum-type="L"><text>U.S. Application No. 20030177536</text></patcit></li>
<li>Published <patcit id="pcit0047" dnum="US20030084486A" dnum-type="L"><text>U.S. Application No. 20030084486</text></patcit></li>
<li>Published <patcit id="pcit0048" dnum="US20040123349A" dnum-type="L"><text>U.S. Application No. 20040123349</text></patcit></li>
<li>Greyhound Daily News, 1/28/99. National Greyhound Association (NGA), Abilene, Kansas. <u>http://www.NGAgreyhounds.com</u>.</li>
<li>Personal communication, Dr. William Duggar, veterinarian at Palm Beach Kennel Club, West Palm Beach, Florida.</li>
<li><nplcit id="ncit0003" npl-type="s"><text>Altschul, S. F. et al. (1990) "Basic Local Alignment Search Tool" J. Mol. Biol. 215:402-410</text></nplcit>.<!-- EPO <DP n="137"> --></li>
<li><nplcit id="ncit0004" npl-type="s"><text>Altschul, S. F. et al. (1997) "Gapped BLAST and PSI-BLAST: A New Generation of Protein Database Search Programs" Nucl. Acids Res. 25:3389-3402</text></nplcit>.</li>
<li><nplcit id="ncit0005" npl-type="s"><text>An, G. (1987) "Binary Ti vectors for plant transformation and promoter analysis" Methods Enzymol. 153:292-305</text></nplcit>.</li>
<li><nplcit id="ncit0006" npl-type="b"><text>Beltz, G. A., Jacobs, K. A., Eickbush, T. H., Cherbas, P. T., Kafatos, F. C. (1983) "Isolation of multigene families and determination of homologies by filter hybridization methods" Methods of Enzymology, R. Wu, L. Grossman and K. Moldave [eds.] Academic Press, New York 100:266-285</text></nplcit>.</li>
<li><nplcit id="ncit0007" npl-type="b"><text>Burleson, F. et al. (1992) Virology: A Laboratory Manual (Academic Press</text></nplcit>).</li>
<li><nplcit id="ncit0008" npl-type="s"><text>Byars, N.E., A.C. Allison (1987) "Adjuvant formulation for use in vaccines to elicit both cell-mediated and humoral immunity" Vaccine 5:223-228</text></nplcit>.</li>
<li><nplcit id="ncit0009" npl-type="s"><text>Crawford, P.C. et al. (2005) "Transmission of equine influenza virus to dogs" Science 310:482-485</text></nplcit>.</li>
<li><nplcit id="ncit0010" npl-type="s"><text>Chang, C.P. et al. (1976) "Influenza virus isolations from dogs during a human epidemic in Taiwan" Int J Zoonoses 3:61-64</text></nplcit>.</li>
<li><nplcit id="ncit0011" npl-type="s"><text>Dacso, C.C. et al. (1984) "Sporadic occurrence of zoonotic swine influenza virus infections" J Clin Microbiol 20:833-835</text></nplcit>.</li>
<li><nplcit id="ncit0012" npl-type="s"><text>de Boer, H. A., Comstock, L. J., Vasser, M. (1983) "The tac promoter: a functional hybrid derived from the trp and lac promoters" Proc. Natl. Acad. Sci. USA 80(1):21-25</text></nplcit>.</li>
<li><nplcit id="ncit0013" npl-type="s"><text>Felsenstein, J. (1989) Cladistics 5:164</text></nplcit>.</li>
<li><nplcit id="ncit0014" npl-type="b"><text>Fields et al. (1946) Fields Virology, 3rd ed., Lippincott-Raven publishers</text></nplcit>.</li>
<li><nplcit id="ncit0015" npl-type="b"><text>Ford, R.B., Vaden, S.L. (1998) "Canine infectious tracheobronchitis" In Infectious Diseases of the Dog and Cat, 2nd edition, C.E. Greene, editor, W.B. Saunders Co., Philadelphia, PA, pp. 33-38</text></nplcit>.</li>
<li><nplcit id="ncit0016" npl-type="s"><text>Fouchier et al., (2000) Journal of Clinical Microbiology 38 (11):4096-4101</text></nplcit>.</li>
<li><nplcit id="ncit0017" npl-type="s"><text>Good, X. et al. (1994) "Reduced ethylene synthesis by transgenic tomatoes expressing S-adenosylmethionine hydrolase" Plant Molec. Biol. 26:781-790</text></nplcit>.</li>
<li><nplcit id="ncit0018" npl-type="s"><text>Guan, Y. et al. (2004) "H5N1 influenza: a protean pandemic threat" Proc Natl Acad Sci U S A 101:8156-8161</text></nplcit>.</li>
<li><nplcit id="ncit0019" npl-type="s"><text>Guo, Y. et al. (1992) "Characterization of a new avian-like influenza A virus from horses in China" Virology 188:245-255</text></nplcit>.</li>
<li><nplcit id="ncit0020" npl-type="s"><text>Houser, R.E. et al. (1980) "Evidence of prior infection with influenza A/Texas/77 (H3N2) virus in dogs with clinical parainfluenza" Can J Comp Med 44:396-402</text></nplcit>.<!-- EPO <DP n="138"> --></li>
<li><nplcit id="ncit0021" npl-type="s"><text>Karasin, A.I. et al. (2000) "Isolation and characterization of H4N6 avian influenza viruses from pigs with pneumonia in Canada" J Virol 74:9322-9327</text></nplcit>.</li>
<li><nplcit id="ncit0022" npl-type="s"><text>Karlin S. and Altschul, S. F. (1990) "Methods for Assessing the Statistical Significance of Molecular Sequence Features by Using General Scoring Schemes" Proc. Natl. Acad. Sci. USA 87:2264-2268</text></nplcit>.</li>
<li><nplcit id="ncit0023" npl-type="s"><text>Karlin S. and Altschul, S. F. (1993) "Applications and Statistics for Multiple High-Scoring Segments in Molecular Sequences" Proc. Natl. Acad. Sci. USA 90:5873-5877</text></nplcit>.</li>
<li><nplcit id="ncit0024" npl-type="s"><text>Kawaoka, Y. et al., (1989) "Avian-to-human transmission of the PB1 gene of influenza A viruses in the 1957 and 1968 pandemics" J Virol 63:4603-4608</text></nplcit>.</li>
<li><nplcit id="ncit0025" npl-type="s"><text>Keawcharoen, J. et al. (2004) "Avian influenza H5N1 in tigers and leopards" Emerg infect Dis 10:2189-2191</text></nplcit>.</li>
<li><nplcit id="ncit0026" npl-type="b"><text>Kendal, A. P. et al. (1982) In Concepts and Procedures for Laboratory-based Influenza Surveillance. A. P. Kendal, M. S. Pereira, J. J. Skehel, Eds. (U.S. Department of Health and Human Services, Centers for Disease Control and Prevention and Pan-American Health Organization, Atlanta, GA, United States) pp. B17-B35</text></nplcit>.</li>
<li><nplcit id="ncit0027" npl-type="s"><text>Kilbourne, E.D. et al. (1975) "Demonstration of antibodies to both hemagglutinin and neuraminidase antigens of H3N2 influenza A virus in domestic dogs" Intervirology 6:315-318</text></nplcit>.</li>
<li><nplcit id="ncit0028" npl-type="s"><text>Kimura, K. et al. (1998) "Fatal case of swine influenza virus in an immunocompetent host" Mayo Clin Proc 73:243-245</text></nplcit>.</li>
<li><nplcit id="ncit0029" npl-type="s"><text>Klimov, A. I. et al. (1992a) "Sequence changes in the live attenuated, cold-adapted variants of influenza A/Leningrad/134/57 (H2N2) virus" Virology 186:795-797</text></nplcit>.</li>
<li><nplcit id="ncit0030" npl-type="s"><text>Klimov A. et al. (1992b) "Subtype H7 influenza viruses: comparative antigenic and molecular analysis of the HA-, M-, and NS-genes." Arch Virol. 122:143-161</text></nplcit>.</li>
<li><nplcit id="ncit0031" npl-type="s"><text>Kovacova, A. et al. (2002) "Sequence similarities and evolutionary relationships of influenza virus A hemagglutinins" Virus Genes 24:57-63</text></nplcit>.</li>
<li><nplcit id="ncit0032" npl-type="s"><text>Kuiken, T. et al. (2004) "Avian H5N1 influenza in cats" Science 306:241</text></nplcit>.</li>
<li><nplcit id="ncit0033" npl-type="s"><text>Kumar, S. et al. (2004) "MEGA3: Integrated software for Molecular Evolutionary Genetics Analysis and sequence alignment" Brief Bioinform 5:150-163</text></nplcit>.</li>
<li><nplcit id="ncit0034" npl-type="s"><text>Lee, L.G. et al. (1993) "Allelic discrimination by nick-translation PCR with fluorogenic probes" Nucleic Acids Res. 21(16):3761-3766</text></nplcit>.</li>
<li><nplcit id="ncit0035" npl-type="b"><text>Lewin, B. (1985) Genes II, John Wiley &amp; Sons, Inc., p. 96</text></nplcit>.</li>
<li><nplcit id="ncit0036" npl-type="s"><text>Lipatov, A.S. et al. (2004) "Influenza: emergence and control" J Virol 78:8951-8959</text></nplcit>.<!-- EPO <DP n="139"> --></li>
<li><nplcit id="ncit0037" npl-type="s"><text>Livak, K. J. et al. (1995) "Oligonucleotides with fluorescent dyes at opposite ends provide a quenched probe system useful for detecting PCR product and nucleic acid hybridization" PCR Methods Appl. 4(6):357-362</text></nplcit>.</li>
<li><nplcit id="ncit0038" npl-type="b"><text>Maniatis, T., E.F. Fritsch, J. Sambrook (1982) "Nuclease Bal31" Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY</text></nplcit>.</li>
<li><nplcit id="ncit0039" npl-type="s"><text>Matrosovich, M. et al. (2000) "Early alterations of the receptor-binding properties of H1, H2, and H3 avian influenza virus hemagglutinins after their introduction into mammals" J Virol 74:8502-8512</text></nplcit><i>.</i></li>
<li><nplcit id="ncit0040" npl-type="s"><text>Maertzdorf et al., (2004) Clin Microbiol. 42(3):981-986</text></nplcit>.</li>
<li><nplcit id="ncit0041" npl-type="s"><text>Merrifield, R.B. (1963) "Solid Phase Peptide Synthesis. I. The Synthesis of a Tetrapeptide" J. Amer. Chem. Soc. 85:2149-2154</text></nplcit>.</li>
<li><nplcit id="ncit0042" npl-type="s"><text>Nikitin, A. et al. (1972) "Epidemiological studies of A-Hong Kong-68 virus infection in dogs" Bull World Health Organ 47:471-479</text></nplcit>.</li>
<li><nplcit id="ncit0043" npl-type="s"><text>Nobusawa, E. et al. (1991) "Comparison of complete amino acid sequences and receptor-binding properties among 13 serotypes of hemagglutinins of influenza A viruses" Virology 182:475-485</text></nplcit>.</li>
<li><nplcit id="ncit0044" npl-type="s"><text>Patriarca, P.A. et al. (1984) "Lack of significant person-to person spread of swine influenza-like virus following fatal infection in an immunocompromised child" Am J Epidemiol 119:152-158</text></nplcit>.</li>
<li><nplcit id="ncit0045" npl-type="s"><text>Payungporn S. et al. (2006a) "Detection of canine influenza A virus (H3N8) RNA by realtime RT-PCR" (in preparation for Journal of Clinical Microbiology</text></nplcit>).</li>
<li><nplcit id="ncit0046" npl-type="s"><text>Payungporn S, et al. (2006b) "Isolation and characterization of influenza A subtype H3N8 viruses from dogs with respiratory disease in a shelter and veterinary clinic in Florida" (in preparation for Emerging Infectious Diseases</text></nplcit>).</li>
<li><nplcit id="ncit0047" npl-type="s"><text>Peiris, M. et al. (1999) "Human infection with influenza H9N2" Lancet 354:916-917</text></nplcit>.</li>
<li><nplcit id="ncit0048" npl-type="s"><text>Peiris, J.S. et al. (2004) "Re-emergence of fatal human influenza A subtype H5N1 disease" Lancet 363:617-619</text></nplcit>.</li>
<li><nplcit id="ncit0049" npl-type="s"><text>Posnett, D. N. et al. (1988) "A Novel Method for Producing Anti-peptide Antibodies" J. Biol. Chem. 263(4):1719-1725</text></nplcit>.</li>
<li><nplcit id="ncit0050" npl-type="s"><text>Putnam, Bob (February 10, 1999) "Two illnesses seen in death of dogs" St. Petersburg Times</text></nplcit><i>.</i></li>
<li><nplcit id="ncit0051" npl-type="s"><text>Reid, A.H. et al. (2004) "Evidence of an absence: the genetic origins of the 1918 pandemic influenza virus" Nat Rev Microbioll2:909-914</text></nplcit>.<!-- EPO <DP n="140"> --></li>
<li><nplcit id="ncit0052" npl-type="s"><text>Rowe, T. et al. (1999) "Detection of antibody to avian influenza A (H5N1) virus in human serum by using a combination of serologic assays" J Clin Microbiol 37: 937-943</text></nplcit>.</li>
<li><nplcit id="ncit0053" npl-type="s"><text>Saiki, R. (1985) "Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia" Science 230:1350-1354</text></nplcit>.</li>
<li><nplcit id="ncit0054" npl-type="b"><text>Sambrook, J. et al. (1989) "Plasmid Vectors" In: Molecular Cloning: A Laboratory Manual, 2d Edition, pp. 1.82-1.104. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York</text></nplcit>.</li>
<li><nplcit id="ncit0055" npl-type="s"><text>Subbarao, K. et al. (1998) "Characterization of an avian influenza A (H5N1) virus isolated from a child with a fatal respiratory illness" Science 279:393-396</text></nplcit>.</li>
<li><nplcit id="ncit0056" npl-type="s"><text>Suzuki, Y. et al. (2000) "Sialic acid species as a determinant of the host range of influenza A viruses" J Virol 74:11825-11831</text></nplcit>.</li>
<li><nplcit id="ncit0057" npl-type="s"><text>Tam, J. P. (1988) "Synthetic Peptide Vaccine Design: Synthesis and Properties of a High-Density Multiple Antigenic Peptide System" PNAS USA 85(15):5409-5413</text></nplcit>.</li>
<li><nplcit id="ncit0058" npl-type="s"><text>Top, Jr., F.H. et al. (1977) "Swine influenza A at Fort Dix, New Jersey (January-February 1976). IV. Summary and speculation" J Infect Dis 136 Suppl:S376-S380</text></nplcit>.</li>
<li><nplcit id="ncit0059" npl-type="s"><text>Vines, A. et al. (1998) "The role of influenza A virus hemagglutinin residues 226 and 228 in receptor specificity and host range restriction" J Virol 72:7626-7631</text></nplcit>.</li>
<li><nplcit id="ncit0060" npl-type="s"><text>Wagner, R. et al. (2002) "N-Glycans attached to the stem domain of haemagglutinin efficiently regulate influenza A virus replication" J Gen Virol 83:601-609</text></nplcit>.</li>
<li><nplcit id="ncit0061" npl-type="s"><text>Webby, R. et al. (2004) "Molecular constraints to interspecies transmission of viral pathogens" Nat Med 10:S77-S81</text></nplcit>.</li>
<li><nplcit id="ncit0062" npl-type="s"><text>Webster, R.G. (1998) "Influenza: an emerging disease" Emerg Infect Dis 4:436-441</text></nplcit>.</li>
<li><nplcit id="ncit0063" npl-type="s"><text>Webster, R.G. et al. (1992) "Evolution and, ecology of influenza A viruses" Microbiol Rev 56 :152-179</text></nplcit>.</li>
<li><nplcit id="ncit0064" npl-type="s"><text>Weis, W. et al. (1988) "Structure of the influenza virus haemagglutinin complexed with its receptor, sialic acid" Nature 333:426-431</text></nplcit>.</li>
<li><nplcit id="ncit0065" npl-type="s"><text>Womble, D.D. (2000) "GCG: The Wisconsin Package of sequence analysis programs" Methods Mol Biol 132:3-22</text></nplcit>.</li>
<li><nplcit id="ncit0066" npl-type="s"><text>Xu, D., McElroy, D., Thornburg, R. W., Wu, R. et al. (1993) "Systemic induction of a potato pin2 promoter by wounding, methyl jasmonate, and abscisic acid in transgenic rice plants" Plant Molecular Biology 22:573-588</text></nplcit>.</li>
<li><nplcit id="ncit0067" npl-type="s"><text>Yang, T. T. et al. (1996) "Optimized Codon Usage and Chromophore Mutations Provide Enhanced Sensitivity with the Green Fluorescent Protein" Nucleic Acid Research 24(22):4592-4593</text></nplcit>.<!-- EPO <DP n="141"> --></li>
<li><nplcit id="ncit0068" npl-type="s"><text>Yoon K-Y. et al. (2005) "Influenza virus infection in racing greyhounds" Emerg Infect Dis. 11:1974-1975</text></nplcit>.</li>
</ul><!-- EPO <DP n="142"> --></p>
<heading id="h0095">SEQUENCE LISTING</heading>
<p id="p0252" num="0252">
<ul id="ul0005" list-style="none">
<li>&lt;110&gt; Crawford, Patti Cynthia Gibbs, E. Paul J. Dubovi, Edward J. Donis, Ruben Omar Katz, Jacqueline M. Klimov, Alexander I. Lakshmanan, Nallakannu P. Lum, Melissa Anne Goovaerts, Daniel Ghislena Emiel Mellencamp, Mark William</li>
<li>&lt;120&gt; Materials and Methods for Respiratory Disease Control in Canines</li>
<li>&lt;130&gt; UF-445XC2</li>
<li>&lt;150&gt; <patcit id="pcit0049" dnum="US11409416B"><text>US 11/409,416</text></patcit><br/>
&lt;151&gt; 2006-04-21</li>
<li>&lt;150&gt; <patcit id="pcit0050" dnum="US60728449B"><text>US 60/728,449</text></patcit><br/>
&lt;151&gt; 2005-10-19</li>
<li>&lt;150&gt; <patcit id="pcit0051" dnum="US60754881B"><text>US 60/754,881</text></patcit><br/>
&lt;151&gt; 2005-12-29</li>
<li>&lt;150&gt; <patcit id="pcit0052" dnum="US60759162B"><text>US 60/759,162</text></patcit><br/>
&lt;151&gt; 2006-01-14</li>
<li>&lt;150&gt; <patcit id="pcit0053" dnum="US60761451B"><text>US 60/761,451</text></patcit><br/>
&lt;151&gt; 2006-01-23</li>
<li>&lt;150&gt; <patcit id="pcit0054" dnum="US60779080B"><text>US 60/779,080</text></patcit><br/>
&lt;151&gt; 2006-03-03</li>
<li>&lt;160&gt; 88</li>
<li>&lt;170&gt; PatentIn version 3.3</li>
<li>&lt;210&gt; 1<br/>
&lt;211&gt; 2277<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;220&gt;<br/>
&lt;221&gt; CDS<br/>
&lt;222&gt; (1)..(2277)</li>
<li>&lt;400&gt; 1
<img id="ib0002" file="imgb0002.tif" wi="157" he="40" img-content="dna" img-format="tif"/><!-- EPO <DP n="143"> -->
<img id="ib0003" file="imgb0003.tif" wi="164" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="144"> -->
<img id="ib0004" file="imgb0004.tif" wi="156" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="145"> -->
<img id="ib0005" file="imgb0005.tif" wi="161" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="146"> -->
<img id="ib0006" file="imgb0006.tif" wi="8" he="3" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 2<br/>
&lt;211&gt; 759<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 2
<img id="ib0007" file="imgb0007.tif" wi="141" he="199" img-content="dna" img-format="tif"/><!-- EPO <DP n="147"> -->
<img id="ib0008" file="imgb0008.tif" wi="140" he="231" img-content="dna" img-format="tif"/><!-- EPO <DP n="148"> -->
<img id="ib0009" file="imgb0009.tif" wi="142" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="149"> -->
<img id="ib0010" file="imgb0010.tif" wi="139" he="72" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 3<br/>
&lt;211&gt; 2274<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;220&gt;<br/>
&lt;221&gt; CDS<br/>
&lt;222&gt; (1)..(2274)</li>
<li>&lt;400&gt; 3
<img id="ib0011" file="imgb0011.tif" wi="158" he="109" img-content="dna" img-format="tif"/><!-- EPO <DP n="150"> -->
<img id="ib0012" file="imgb0012.tif" wi="157" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="151"> -->
<img id="ib0013" file="imgb0013.tif" wi="160" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="152"> -->
<img id="ib0014" file="imgb0014.tif" wi="158" he="171" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 4<br/>
&lt;211&gt; 757<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 4
<img id="ib0015" file="imgb0015.tif" wi="140" he="24" img-content="dna" img-format="tif"/><!-- EPO <DP n="153"> -->
<img id="ib0016" file="imgb0016.tif" wi="144" he="231" img-content="dna" img-format="tif"/><!-- EPO <DP n="154"> -->
<img id="ib0017" file="imgb0017.tif" wi="141" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="155"> -->
<img id="ib0018" file="imgb0018.tif" wi="139" he="231" img-content="dna" img-format="tif"/><!-- EPO <DP n="156"> -->
<img id="ib0019" file="imgb0019.tif" wi="42" he="8" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 5<br/>
&lt;211&gt; 2151<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;220&gt;<br/>
&lt;221&gt; CDS<br/>
&lt;222&gt; (1) .. (2151)</li>
<li>&lt;400&gt; 5
<img id="ib0020" file="imgb0020.tif" wi="162" he="171" img-content="dna" img-format="tif"/><!-- EPO <DP n="157"> -->
<img id="ib0021" file="imgb0021.tif" wi="161" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="158"> -->
<img id="ib0022" file="imgb0022.tif" wi="163" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="159"> -->
<img id="ib0023" file="imgb0023.tif" wi="158" he="60" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 6<br/>
&lt;211&gt; 716<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 6
<img id="ib0024" file="imgb0024.tif" wi="140" he="135" img-content="dna" img-format="tif"/><!-- EPO <DP n="160"> -->
<img id="ib0025" file="imgb0025.tif" wi="141" he="231" img-content="dna" img-format="tif"/><!-- EPO <DP n="161"> -->
<img id="ib0026" file="imgb0026.tif" wi="140" he="231" img-content="dna" img-format="tif"/><!-- EPO <DP n="162"> -->
<img id="ib0027" file="imgb0027.tif" wi="139" he="88" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 7<br/>
&lt;211&gt; 838<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;220&gt;<br/>
&lt;221&gt; CDS<br/>
&lt;222&gt; (1)..(657)</li>
<li>&lt;400&gt; 7
<img id="ib0028" file="imgb0028.tif" wi="161" he="100" img-content="dna" img-format="tif"/><!-- EPO <DP n="163"> -->
<img id="ib0029" file="imgb0029.tif" wi="157" he="144" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 8<br/>
&lt;211&gt; 219<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 8
<img id="ib0030" file="imgb0030.tif" wi="139" he="56" img-content="dna" img-format="tif"/><!-- EPO <DP n="164"> -->
<img id="ib0031" file="imgb0031.tif" wi="140" he="151" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 9<br/>
&lt;211&gt; 1497<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;220&gt;<br/>
&lt;221&gt; CDS<br/>
&lt;222&gt; (1)..(1497)</li>
<li>&lt;400&gt; 9
<img id="ib0032" file="imgb0032.tif" wi="157" he="29" img-content="dna" img-format="tif"/><!-- EPO <DP n="165"> -->
<img id="ib0033" file="imgb0033.tif" wi="158" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="166"> -->
<img id="ib0034" file="imgb0034.tif" wi="162" he="231" img-content="dna" img-format="tif"/><!-- EPO <DP n="167"> --></li>
<li>&lt;210&gt; 10<br/>
&lt;211&gt; 498<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 10
<img id="ib0035" file="imgb0035.tif" wi="140" he="199" img-content="dna" img-format="tif"/><!-- EPO <DP n="168"> -->
<img id="ib0036" file="imgb0036.tif" wi="140" he="232" img-content="dna" img-format="tif"/><!-- EPO <DP n="169"> -->
<img id="ib0037" file="imgb0037.tif" wi="139" he="52" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 11<br/>
&lt;211&gt; 1413<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;220&gt;<br/>
&lt;221&gt; CDS<br/>
&lt;222&gt; (1)..(1413)</li>
<li>&lt;400&gt; 11
<img id="ib0038" file="imgb0038.tif" wi="158" he="131" img-content="dna" img-format="tif"/><!-- EPO <DP n="170"> -->
<img id="ib0039" file="imgb0039.tif" wi="157" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="171"> -->
<img id="ib0040" file="imgb0040.tif" wi="161" he="104" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 12<br/>
&lt;211&gt; 470<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 12
<img id="ib0041" file="imgb0041.tif" wi="140" he="100" img-content="dna" img-format="tif"/><!-- EPO <DP n="172"> -->
<img id="ib0042" file="imgb0042.tif" wi="136" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="173"> -->
<img id="ib0043" file="imgb0043.tif" wi="139" he="131" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 13<br/>
&lt;211&gt; 982<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;220&gt;<br/>
&lt;221&gt; CDS<br/>
&lt;222&gt; (1) .. (756)</li>
<li>&lt;400&gt; 13
<img id="ib0044" file="imgb0044.tif" wi="157" he="57" img-content="dna" img-format="tif"/><!-- EPO <DP n="174"> -->
<img id="ib0045" file="imgb0045.tif" wi="158" he="227" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 14<br/>
<!-- EPO <DP n="175"> -->&lt;211&gt; 252<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 14
<img id="ib0046" file="imgb0046.tif" wi="139" he="215" img-content="dna" img-format="tif"/><!-- EPO <DP n="176"> -->
<img id="ib0047" file="imgb0047.tif" wi="139" he="24" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 15<br/>
&lt;211&gt; 1698<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;220&gt;<br/>
&lt;221&gt; CDS<br/>
&lt;222&gt; (1)..(1698)</li>
<li>&lt;400&gt; 15
<img id="ib0048" file="imgb0048.tif" wi="157" he="156" img-content="dna" img-format="tif"/><!-- EPO <DP n="177"> -->
<img id="ib0049" file="imgb0049.tif" wi="163" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="178"> -->
<img id="ib0050" file="imgb0050.tif" wi="160" he="171" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 16<br/>
&lt;211&gt; 565<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 16
<img id="ib0051" file="imgb0051.tif" wi="139" he="24" img-content="dna" img-format="tif"/><!-- EPO <DP n="179"> -->
<img id="ib0052" file="imgb0052.tif" wi="141" he="231" img-content="dna" img-format="tif"/><!-- EPO <DP n="180"> -->
<img id="ib0053" file="imgb0053.tif" wi="141" he="231" img-content="dna" img-format="tif"/><!-- EPO <DP n="181"> -->
<img id="ib0054" file="imgb0054.tif" wi="139" he="56" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 17<br/>
&lt;211&gt; 2277<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;220&gt;<br/>
&lt;221&gt; CDS<br/>
&lt;222&gt; (1) .. (2277)</li>
<li>&lt;220&gt;<br/>
&lt;221&gt; misc_feature<br/>
&lt;222&gt; (731)..(731)<br/>
&lt;223&gt; The 'Xaa' at location 731 stands for Val, or Ile</li>
<li>&lt;400&gt; 17
<img id="ib0055" file="imgb0055.tif" wi="158" he="108" img-content="dna" img-format="tif"/><!-- EPO <DP n="182"> -->
<img id="ib0056" file="imgb0056.tif" wi="160" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="183"> -->
<img id="ib0057" file="imgb0057.tif" wi="157" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="184"> -->
<img id="ib0058" file="imgb0058.tif" wi="157" he="173" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 18<br/>
&lt;211&gt; 759<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;220&gt;<br/>
&lt;221&gt; misc_feature<br/>
&lt;222&gt; (731)..(731)<br/>
&lt;223&gt; The 'Xaa' at location 731 stands for Val, or Ile.</li>
<li>&lt;400&gt; 18
<img id="ib0059" file="imgb0059.tif" wi="139" he="8" img-content="dna" img-format="tif"/><!-- EPO <DP n="185"> -->
<img id="ib0060" file="imgb0060.tif" wi="140" he="231" img-content="dna" img-format="tif"/><!-- EPO <DP n="186"> -->
<img id="ib0061" file="imgb0061.tif" wi="141" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="187"> -->
<img id="ib0062" file="imgb0062.tif" wi="141" he="231" img-content="dna" img-format="tif"/><!-- EPO <DP n="188"> -->
<img id="ib0063" file="imgb0063.tif" wi="139" he="24" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 19<br/>
&lt;211&gt; 2274<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;220&gt;<br/>
&lt;221&gt; CDS<br/>
&lt;222&gt; (1)..(2274)</li>
<li>&lt;400&gt; 19
<img id="ib0064" file="imgb0064.tif" wi="157" he="156" img-content="dna" img-format="tif"/><!-- EPO <DP n="189"> -->
<img id="ib0065" file="imgb0065.tif" wi="157" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="190"> -->
<img id="ib0066" file="imgb0066.tif" wi="157" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="191"> -->
<img id="ib0067" file="imgb0067.tif" wi="158" he="126" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 20<br/>
&lt;211&gt; 757<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 20
<img id="ib0068" file="imgb0068.tif" wi="144" he="72" img-content="dna" img-format="tif"/><!-- EPO <DP n="192"> -->
<img id="ib0069" file="imgb0069.tif" wi="140" he="231" img-content="dna" img-format="tif"/><!-- EPO <DP n="193"> -->
<img id="ib0070" file="imgb0070.tif" wi="140" he="231" img-content="dna" img-format="tif"/><!-- EPO <DP n="194"> -->
<img id="ib0071" file="imgb0071.tif" wi="139" he="199" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 21<br/>
&lt;211&gt; 2151<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;220&gt;<br/>
<!-- EPO <DP n="195"> -->&lt;221&gt; CDS<br/>
&lt;222&gt; (1)..(2151)</li>
<li>&lt;400&gt; 21
<img id="ib0072" file="imgb0072.tif" wi="161" he="219" img-content="dna" img-format="tif"/><!-- EPO <DP n="196"> -->
<img id="ib0073" file="imgb0073.tif" wi="160" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="197"> -->
<img id="ib0074" file="imgb0074.tif" wi="157" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="198"> -->
<img id="ib0075" file="imgb0075.tif" wi="157" he="14" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 22<br/>
&lt;211&gt; 716<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 22
<img id="ib0076" file="imgb0076.tif" wi="139" he="183" img-content="dna" img-format="tif"/><!-- EPO <DP n="199"> -->
<img id="ib0077" file="imgb0077.tif" wi="140" he="231" img-content="dna" img-format="tif"/><!-- EPO <DP n="200"> -->
<img id="ib0078" file="imgb0078.tif" wi="146" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="201"> -->
<img id="ib0079" file="imgb0079.tif" wi="139" he="40" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 23<br/>
&lt;211&gt; 838<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;220&gt;<br/>
&lt;221&gt; CDS<br/>
&lt;222&gt; (1) .. (657)</li>
<li>&lt;400&gt; 23.
<img id="ib0080" file="imgb0080.tif" wi="157" he="147" img-content="dna" img-format="tif"/><!-- EPO <DP n="202"> -->
<img id="ib0081" file="imgb0081.tif" wi="157" he="97" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 24<br/>
&lt;211&gt; 219<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 24
<img id="ib0082" file="imgb0082.tif" wi="139" he="104" img-content="dna" img-format="tif"/><!-- EPO <DP n="203"> -->
<img id="ib0083" file="imgb0083.tif" wi="140" he="104" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 25<br/>
&lt;211&gt; 1497<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;220&gt;<br/>
&lt;221&gt; CDS<br/>
&lt;222&gt; (1)..(1497)</li>
<li>&lt;400&gt; 25
<img id="ib0084" file="imgb0084.tif" wi="157" he="76" img-content="dna" img-format="tif"/><!-- EPO <DP n="204"> -->
<img id="ib0085" file="imgb0085.tif" wi="155" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="205"> -->
<img id="ib0086" file="imgb0086.tif" wi="158" he="183" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 26<br/>
&lt;211&gt; 498<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 26
<img id="ib0087" file="imgb0087.tif" wi="139" he="8" img-content="dna" img-format="tif"/><!-- EPO <DP n="206"> -->
<img id="ib0088" file="imgb0088.tif" wi="144" he="231" img-content="dna" img-format="tif"/><!-- EPO <DP n="207"> -->
<img id="ib0089" file="imgb0089.tif" wi="141" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="208"> -->
<img id="ib0090" file="imgb0090.tif" wi="18" he="4" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 27<br/>
&lt;211&gt; 1410<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;220&gt;<br/>
&lt;221&gt; CDS<br/>
&lt;222&gt; (1)..(1410)</li>
<li>&lt;400&gt; 27
<img id="ib0091" file="imgb0091.tif" wi="158" he="179" img-content="dna" img-format="tif"/><!-- EPO <DP n="209"> -->
<img id="ib0092" file="imgb0092.tif" wi="155" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="210"> -->
<img id="ib0093" file="imgb0093.tif" wi="157" he="56" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 28<br/>
&lt;211&gt; 470<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 28
<img id="ib0094" file="imgb0094.tif" wi="139" he="148" img-content="dna" img-format="tif"/><!-- EPO <DP n="211"> -->
<img id="ib0095" file="imgb0095.tif" wi="136" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="212"> -->
<img id="ib0096" file="imgb0096.tif" wi="139" he="83" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 29<br/>
&lt;211&gt; 982<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;220&gt;<br/>
&lt;221&gt; CDS<br/>
&lt;222&gt; (1) .. (756)</li>
<li>&lt;400&gt; 29
<img id="ib0097" file="imgb0097.tif" wi="157" he="104" img-content="dna" img-format="tif"/><!-- EPO <DP n="213"> -->
<img id="ib0098" file="imgb0098.tif" wi="157" he="179" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 30<br/>
&lt;211&gt; 252<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 30
<img id="ib0099" file="imgb0099.tif" wi="139" he="24" img-content="dna" img-format="tif"/><!-- EPO <DP n="214"> -->
<img id="ib0100" file="imgb0100.tif" wi="153" he="216" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 31<br/>
&lt;211&gt; 1698<br/>
<!-- EPO <DP n="215"> -->&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;220&gt;<br/>
&lt;221&gt; CDS<br/>
&lt;222&gt; (1)..(1698)</li>
<li>&lt;400&gt; 31
<img id="ib0101" file="imgb0101.tif" wi="164" he="203" img-content="dna" img-format="tif"/><!-- EPO <DP n="216"> -->
<img id="ib0102" file="imgb0102.tif" wi="160" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="217"> -->
<img id="ib0103" file="imgb0103.tif" wi="157" he="124" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 32<br/>
&lt;211&gt; 565<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 32
<img id="ib0104" file="imgb0104.tif" wi="139" he="72" img-content="dna" img-format="tif"/><!-- EPO <DP n="218"> -->
<img id="ib0105" file="imgb0105.tif" wi="140" he="231" img-content="dna" img-format="tif"/><!-- EPO <DP n="219"> -->
<img id="ib0106" file="imgb0106.tif" wi="141" he="231" img-content="dna" img-format="tif"/><!-- EPO <DP n="220"> -->
<img id="ib0107" file="imgb0107.tif" wi="44" he="8" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 33<br/>
&lt;211&gt; 549<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 33
<img id="ib0108" file="imgb0108.tif" wi="141" he="183" img-content="dna" img-format="tif"/><!-- EPO <DP n="221"> -->
<img id="ib0109" file="imgb0109.tif" wi="144" he="231" img-content="dna" img-format="tif"/><!-- EPO <DP n="222"> -->
<img id="ib0110" file="imgb0110.tif" wi="141" he="120" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 34<br/>
&lt;211&gt; 549<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 34
<img id="ib0111" file="imgb0111.tif" wi="139" he="84" img-content="dna" img-format="tif"/><!-- EPO <DP n="223"> -->
<img id="ib0112" file="imgb0112.tif" wi="143" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="224"> -->
<img id="ib0113" file="imgb0113.tif" wi="140" he="226" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 35<br/>
<!-- EPO <DP n="225"> -->&lt;211&gt; 9<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 35<br/>
gagagttgg    9</li>
<li>&lt;210&gt; 36<br/>
&lt;211&gt; 9<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 36<br/>
ccgttggtc 9</li>
<li>&lt;210&gt; 37<br/>
&lt;211&gt; 9<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 37<br/>
caaaccaga    9</li>
<li>&lt;210&gt; 38<br/>
&lt;211&gt; 9<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 38<br/>
agaactggg    9</li>
<li>&lt;210&gt; 39<br/>
&lt;211&gt; 15<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 39<br/>
tatgagagtt gggac    15</li>
<li>&lt;210&gt; 40<br/>
&lt;211&gt; 15<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 40<br/>
agaccgttgg tcaga    15</li>
<li>&lt;210&gt; 41<br/>
&lt;211&gt; 15<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 41<br/>
aagcaaacca gagga    15<!-- EPO <DP n="226"> --></li>
<li>&lt;210&gt; 42<br/>
&lt;211&gt; 15<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 42<br/>
ataagaactg ggaca    15</li>
<li>&lt;210&gt; 43<br/>
&lt;211&gt; 9<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 43<br/>
acaatgagt    9</li>
<li>&lt;210&gt; 44<br/>
&lt;211&gt; 15<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus ,</li>
<li>&lt;400&gt; 44<br/>
aaaacaatga gtgat    15</li>
<li>&lt;210&gt; 45<br/>
&lt;211&gt; 9<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 45<br/>
gatgtaccc    9</li>
<li>&lt;210&gt; 46<br/>
&lt;211&gt; 15<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 46<br/>
tcagatgtac ccata    15</li>
<li>&lt;210&gt; 47<br/>
&lt;211&gt; 2280<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;220&gt;<br/>
&lt;221&gt; CDS<br/>
&lt;222&gt; (1) .. (2280)</li>
<li>&lt;400&gt; 47
<img id="ib0114" file="imgb0114.tif" wi="157" he="8" img-content="dna" img-format="tif"/><!-- EPO <DP n="227"> -->
<img id="ib0115" file="imgb0115.tif" wi="157" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="228"> -->
<img id="ib0116" file="imgb0116.tif" wi="155" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="229"> -->
<img id="ib0117" file="imgb0117.tif" wi="156" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="230"> -->
<img id="ib0118" file="imgb0118.tif" wi="158" he="35" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 48<br/>
&lt;211&gt; 759<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 48
<img id="ib0119" file="imgb0119.tif" wi="146" he="167" img-content="dna" img-format="tif"/><!-- EPO <DP n="231"> -->
<img id="ib0120" file="imgb0120.tif" wi="141" he="231" img-content="dna" img-format="tif"/><!-- EPO <DP n="232"> -->
<img id="ib0121" file="imgb0121.tif" wi="139" he="231" img-content="dna" img-format="tif"/><!-- EPO <DP n="233"> -->
<img id="ib0122" file="imgb0122.tif" wi="139" he="105" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 49<br/>
&lt;211&gt; 2274<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;220&gt;<br/>
&lt;221&gt; CDS<br/>
&lt;222&gt; (1) .. (2274)</li>
<li>&lt;400&gt; 49
<img id="ib0123" file="imgb0123.tif" wi="157" he="77" img-content="dna" img-format="tif"/><!-- EPO <DP n="234"> -->
<img id="ib0124" file="imgb0124.tif" wi="161" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="235"> -->
<img id="ib0125" file="imgb0125.tif" wi="158" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="236"> -->
<img id="ib0126" file="imgb0126.tif" wi="158" he="203" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 50<br/>
&lt;211&gt; 757<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 50<!-- EPO <DP n="237"> -->
<img id="ib0127" file="imgb0127.tif" wi="139" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="238"> -->
<img id="ib0128" file="imgb0128.tif" wi="139" he="231" img-content="dna" img-format="tif"/><!-- EPO <DP n="239"> -->
<img id="ib0129" file="imgb0129.tif" wi="148" he="231" img-content="dna" img-format="tif"/><!-- EPO <DP n="240"> -->
<img id="ib0130" file="imgb0130.tif" wi="139" he="40" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 51<br/>
&lt;211&gt; 2151<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;220&gt;<br/>
&lt;221&gt; CDS<br/>
&lt;222&gt; (1) .. (2151)</li>
<li>&lt;400&gt; 51
<img id="ib0131" file="imgb0131.tif" wi="157" he="140" img-content="dna" img-format="tif"/><!-- EPO <DP n="241"> -->
<img id="ib0132" file="imgb0132.tif" wi="165" he="232" img-content="dna" img-format="tif"/><!-- EPO <DP n="242"> -->
<img id="ib0133" file="imgb0133.tif" wi="158" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="243"> -->
<img id="ib0134" file="imgb0134.tif" wi="158" he="92" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 52<br/>
&lt;211&gt; 716<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 52
<img id="ib0135" file="imgb0135.tif" wi="139" he="104" img-content="dna" img-format="tif"/><!-- EPO <DP n="244"> -->
<img id="ib0136" file="imgb0136.tif" wi="139" he="231" img-content="dna" img-format="tif"/><!-- EPO <DP n="245"> -->
<img id="ib0137" file="imgb0137.tif" wi="142" he="231" img-content="dna" img-format="tif"/><!-- EPO <DP n="246"> -->
<img id="ib0138" file="imgb0138.tif" wi="139" he="120" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 53<br/>
&lt;211&gt; 844<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;220&gt;<br/>
&lt;221&gt; CDS<br/>
&lt;222&gt; (1)..(690)</li>
<li>&lt;400&gt; 53
<img id="ib0139" file="imgb0139.tif" wi="157" he="68" img-content="dna" img-format="tif"/><!-- EPO <DP n="247"> -->
<img id="ib0140" file="imgb0140.tif" wi="158" he="190" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 54<br/>
&lt;211&gt; 230<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 54
<img id="ib0141" file="imgb0141.tif" wi="139" he="8" img-content="dna" img-format="tif"/><!-- EPO <DP n="248"> -->
<img id="ib0142" file="imgb0142.tif" wi="139" he="215" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 55<br/>
&lt;211&gt; 1497<br/>
&lt;212&gt; DNA<br/>
<!-- EPO <DP n="249"> -->&lt;213&gt; Influenza virus</li>
<li>&lt;220&gt;<br/>
&lt;221&gt; CDS<br/>
&lt;222&gt; (1)..(1497)</li>
<li>&lt;400&gt; 55
<img id="ib0143" file="imgb0143.tif" wi="160" he="203" img-content="dna" img-format="tif"/><!-- EPO <DP n="250"> -->
<img id="ib0144" file="imgb0144.tif" wi="157" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="251"> -->
<img id="ib0145" file="imgb0145.tif" wi="158" he="56" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 56<br/>
&lt;211&gt; 498<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 56
<img id="ib0146" file="imgb0146.tif" wi="140" he="135" img-content="dna" img-format="tif"/><!-- EPO <DP n="252"> -->
<img id="ib0147" file="imgb0147.tif" wi="140" he="231" img-content="dna" img-format="tif"/><!-- EPO <DP n="253"> -->
<img id="ib0148" file="imgb0148.tif" wi="141" he="116" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 57<br/>
&lt;211&gt; 1413<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;220&gt;<br/>
&lt;221&gt; CDS<br/>
&lt;222&gt; (1)..(1413)</li>
<li>&lt;400&gt; 57
<img id="ib0149" file="imgb0149.tif" wi="157" he="68" img-content="dna" img-format="tif"/><!-- EPO <DP n="254"> -->
<img id="ib0150" file="imgb0150.tif" wi="156" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="255"> -->
<img id="ib0151" file="imgb0151.tif" wi="157" he="169" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 58<br/>
&lt;211&gt; 470<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 58
<img id="ib0152" file="imgb0152.tif" wi="139" he="36" img-content="dna" img-format="tif"/><!-- EPO <DP n="256"> -->
<img id="ib0153" file="imgb0153.tif" wi="136" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="257"> -->
<img id="ib0154" file="imgb0154.tif" wi="140" he="195" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 59<br/>
&lt;211&gt; 981<br/>
&lt;212.&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;220&gt;<br/>
&lt;221&gt; CDS<br/>
&lt;222&gt; (1).. (756)<!-- EPO <DP n="258"> --></li>
<li>&lt;400&gt; 59
<img id="ib0155" file="imgb0155.tif" wi="162" he="231" img-content="dna" img-format="tif"/><!-- EPO <DP n="259"> -->
<img id="ib0156" file="imgb0156.tif" wi="161" he="52" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 60<br/>
&lt;211&gt; 252<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 60
<img id="ib0157" file="imgb0157.tif" wi="148" he="151" img-content="dna" img-format="tif"/><!-- EPO <DP n="260"> -->
<img id="ib0158" file="imgb0158.tif" wi="139" he="88" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 61<br/>
&lt;211&gt; 1698<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;220&gt;<br/>
&lt;221&gt; CDS<br/>
&lt;222&gt; (1)..(1698)</li>
<li>&lt;400&gt; 61
<img id="ib0159" file="imgb0159.tif" wi="162" he="92" img-content="dna" img-format="tif"/><!-- EPO <DP n="261"> -->
<img id="ib0160" file="imgb0160.tif" wi="162" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="262"> -->
<img id="ib0161" file="imgb0161.tif" wi="158" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="263"> --></li>
<li>&lt;210&gt; 62<br/>
&lt;211&gt; 565<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 62
<img id="ib0162" file="imgb0162.tif" wi="141" he="204" img-content="dna" img-format="tif"/><!-- EPO <DP n="264"> -->
<img id="ib0163" file="imgb0163.tif" wi="141" he="231" img-content="dna" img-format="tif"/><!-- EPO <DP n="265"> -->
<img id="ib0164" file="imgb0164.tif" wi="139" he="120" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 63<br/>
&lt;211&gt; 2280<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;220&gt;<br/>
&lt;221&gt; CDS<br/>
&lt;222&gt; (1) .. (2280)</li>
<li>&lt;400&gt; 63
<img id="ib0165" file="imgb0165.tif" wi="157" he="63" img-content="dna" img-format="tif"/><!-- EPO <DP n="266"> -->
<img id="ib0166" file="imgb0166.tif" wi="157" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="267"> -->
<img id="ib0167" file="imgb0167.tif" wi="162" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="268"> -->
<img id="ib0168" file="imgb0168.tif" wi="160" he="219" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 64<br/>
&lt;211&gt; 759<br/>
&lt;212&gt; PRT<br/>
<!-- EPO <DP n="269"> -->&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 64
<img id="ib0169" file="imgb0169.tif" wi="141" he="215" img-content="dna" img-format="tif"/><!-- EPO <DP n="270"> -->
<img id="ib0170" file="imgb0170.tif" wi="142" he="231" img-content="dna" img-format="tif"/><!-- EPO <DP n="271"> -->
<img id="ib0171" file="imgb0171.tif" wi="141" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="272"> -->
<img id="ib0172" file="imgb0172.tif" wi="139" he="56" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 65<br/>
&lt;211&gt; 2274<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;220&gt;<br/>
&lt;221&gt; CDS<br/>
&lt;222&gt; (1) .. (2274)</li>
<li>&lt;400&gt; 65
<img id="ib0173" file="imgb0173.tif" wi="158" he="131" img-content="dna" img-format="tif"/><!-- EPO <DP n="273"> -->
<img id="ib0174" file="imgb0174.tif" wi="155" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="274"> -->
<img id="ib0175" file="imgb0175.tif" wi="157" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="275"> -->
<img id="ib0176" file="imgb0176.tif" wi="158" he="151" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 66<br/>
&lt;211&gt; 757<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 66
<img id="ib0177" file="imgb0177.tif" wi="139" he="54" img-content="dna" img-format="tif"/><!-- EPO <DP n="276"> -->
<img id="ib0178" file="imgb0178.tif" wi="136" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="277"> -->
<img id="ib0179" file="imgb0179.tif" wi="135" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="278"> -->
<img id="ib0180" file="imgb0180.tif" wi="141" he="226" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 67<br/>
<!-- EPO <DP n="279"> -->&lt;211&gt; 2151<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;220&gt;<br/>
&lt;221&gt; CDS<br/>
&lt;222&gt; (1).. (2151)</li>
<li>&lt;400&gt; 67
<img id="ib0181" file="imgb0181.tif" wi="165" he="199" img-content="dna" img-format="tif"/><!-- EPO <DP n="280"> -->
<img id="ib0182" file="imgb0182.tif" wi="157" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="281"> -->
<img id="ib0183" file="imgb0183.tif" wi="155" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="282"> -->
<img id="ib0184" file="imgb0184.tif" wi="157" he="36" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 68<br/>
&lt;211&gt; 716<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 68
<img id="ib0185" file="imgb0185.tif" wi="146" he="167" img-content="dna" img-format="tif"/><!-- EPO <DP n="283"> -->
<img id="ib0186" file="imgb0186.tif" wi="141" he="231" img-content="dna" img-format="tif"/><!-- EPO <DP n="284"> -->
<img id="ib0187" file="imgb0187.tif" wi="140" he="231" img-content="dna" img-format="tif"/><!-- EPO <DP n="285"> -->
<img id="ib0188" file="imgb0188.tif" wi="139" he="56" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 69<br/>
&lt;211&gt; 844<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;220&gt;<br/>
&lt;221&gt; CDS<br/>
&lt;222&gt; (1)..(690)</li>
<li>&lt;400&gt; 69
<img id="ib0189" file="imgb0189.tif" wi="157" he="124" img-content="dna" img-format="tif"/><!-- EPO <DP n="286"> -->
<img id="ib0190" file="imgb0190.tif" wi="157" he="131" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 70<br/>
&lt;211&gt; 230<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 70
<img id="ib0191" file="imgb0191.tif" wi="139" he="68" img-content="dna" img-format="tif"/><!-- EPO <DP n="287"> -->
<img id="ib0192" file="imgb0192.tif" wi="140" he="162" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 71<br/>
&lt;211&gt; 1497<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;220&gt;<br/>
&lt;221&gt; CDS<br/>
&lt;222&gt; (1) .. (1497)</li>
<li>&lt;400&gt; 71
<img id="ib0193" file="imgb0193.tif" wi="157" he="29" img-content="dna" img-format="tif"/><!-- EPO <DP n="288"> -->
<img id="ib0194" file="imgb0194.tif" wi="152" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="289"> -->
<img id="ib0195" file="imgb0195.tif" wi="152" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="290"> --></li>
<li>&lt;210&gt; 72<br/>
&lt;211&gt; 498<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 72
<img id="ib0196" file="imgb0196.tif" wi="148" he="199" img-content="dna" img-format="tif"/><!-- EPO <DP n="291"> -->
<img id="ib0197" file="imgb0197.tif" wi="139" he="231" img-content="dna" img-format="tif"/><!-- EPO <DP n="292"> -->
<img id="ib0198" file="imgb0198.tif" wi="139" he="52" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 73<br/>
&lt;211&gt; 1413<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;220&gt;<br/>
&lt;221&gt; CDS<br/>
&lt;222&gt; (1) .. (1413)</li>
<li>&lt;400&gt; 73
<img id="ib0199" file="imgb0199.tif" wi="158" he="124" img-content="dna" img-format="tif"/><!-- EPO <DP n="293"> -->
<img id="ib0200" file="imgb0200.tif" wi="165" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="294"> -->
<img id="ib0201" file="imgb0201.tif" wi="157" he="108" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 74<br/>
&lt;211&gt; 470<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 74
<img id="ib0202" file="imgb0202.tif" wi="139" he="88" img-content="dna" img-format="tif"/><!-- EPO <DP n="295"> -->
<img id="ib0203" file="imgb0203.tif" wi="140" he="231" img-content="dna" img-format="tif"/><!-- EPO <DP n="296"> -->
<img id="ib0204" file="imgb0204.tif" wi="139" he="139" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 75<br/>
&lt;211&gt; 981<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;220&gt;<br/>
&lt;221&gt; CDS<br/>
&lt;222&gt; (1)..(756)</li>
<li>&lt;400&gt; 75
<img id="ib0205" file="imgb0205.tif" wi="158" he="45" img-content="dna" img-format="tif"/><!-- EPO <DP n="297"> -->
<img id="ib0206" file="imgb0206.tif" wi="162" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="298"> --></li>
<li>&lt;210&gt; 76<br/>
&lt;211&gt; 252<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 76
<img id="ib0207" file="imgb0207.tif" wi="140" he="199" img-content="dna" img-format="tif"/><!-- EPO <DP n="299"> -->
<img id="ib0208" file="imgb0208.tif" wi="139" he="40" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 77<br/>
&lt;211&gt; 1698<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;220&gt;<br/>
&lt;221&gt; CDS<br/>
&lt;222&gt; (1)..(1698)</li>
<li>&lt;400&gt; 77
<img id="ib0209" file="imgb0209.tif" wi="158" he="148" img-content="dna" img-format="tif"/><!-- EPO <DP n="300"> -->
<img id="ib0210" file="imgb0210.tif" wi="157" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="301"> -->
<img id="ib0211" file="imgb0211.tif" wi="157" he="183" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 78<br/>
&lt;211&gt; 565<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 78
<img id="ib0212" file="imgb0212.tif" wi="139" he="24" img-content="dna" img-format="tif"/><!-- EPO <DP n="302"> -->
<img id="ib0213" file="imgb0213.tif" wi="135" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="303"> -->
<img id="ib0214" file="imgb0214.tif" wi="135" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="304"> -->
<img id="ib0215" file="imgb0215.tif" wi="139" he="67" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 79<br/>
&lt;211&gt; 20<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 79<br/>
tatgcatcgc tccgatccat    20</li>
<li>&lt;210&gt; 80<br/>
&lt;211&gt; 21<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 80<br/>
gctccacttc ttccgttttg a    21</li>
<li>&lt;210&gt; 81<br/>
&lt;211&gt; 30<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 81<br/>
aattcacagc agagggattc acatggacag    30</li>
<li>&lt;210&gt; 82 .<br/>
&lt;211&gt; 24<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza Virus</li>
<li>&lt;220&gt;<br/>
&lt;221&gt; variation<br/>
&lt;222&gt; (7) .. (7)<br/>
&lt;223&gt; r = a or g</li>
<li>&lt;400&gt; 82<br/>
catggartgg ctaaagacaa gacc    24<!-- EPO <DP n="305"> --></li>
<li>&lt;210&gt; 83<br/>
&lt;211&gt; 24<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;220&gt;<br/>
&lt;221&gt; variation<br/>
&lt;222&gt; (18)..(18)<br/>
&lt;223&gt; k = g or t</li>
<li>&lt;400&gt; 83<br/>
agggcatttt ggacaaakcg tcta    24</li>
<li>&lt;210&gt; 84<br/>
&lt;211&gt; 18<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 84<br/>
acgctcaccg tgcccagt    18</li>
<li>&lt;210&gt; 85<br/>
&lt;211&gt; 28<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 85<br/>
tattcgtctc agggagcaaa agcagggg    28</li>
<li>&lt;210&gt; 86<br/>
&lt;211&gt; 42<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 86<br/>
tgtaatacga ctcactatag ggctccactt cttccgtttt ga    42</li>
<li>&lt;210&gt; 87<br/>
&lt;211&gt; 30<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 87<br/>
gatcgctctt cagggagcaa aagcaggtag    30</li>
<li>&lt;210&gt; 88<br/>
&lt;211&gt; 40<br/>
&lt;212&gt; &gt; DNA<br/>
&lt;213&gt; Influenza virus</li>
<li>&lt;400&gt; 88<br/>
tgtaatacga ctcactatag ggcattttgg acaaagcgtc    40</li>
</ul></p>
</description>
<claims id="claims01" lang="en"><!-- EPO <DP n="306"> -->
<claim id="c-en-01-0001" num="0001">
<claim-text>An isolated canine influenza virus that is capable of infecting a canid animal, wherein said influenza virus comprises a polynucleotide which encodes a hemagglutinin (HA) polypeptide having an amino acid sequence shown in SEQ ID NO: 78, or a mature sequence thereof where the N-terminal 16 amino acid signal sequence of the full-length sequence has been removed.</claim-text></claim>
<claim id="c-en-01-0002" num="0002">
<claim-text>The influenza virus according to claim 1, wherein said influenza virus comprises a polynucleotide which encodes a polypeptide having the amino acid sequence shown in any of SEQ ID NOs: 64, 66, 68, 70, 72, 74, or 76, or a functional and/or immunogenic fragment thereof, or said polynucleotide encodes a polypeptide having 95% or greater sequence identity with the amino acid sequence shown in any of SEQ ID NOs: 64, 66, 68, 70, 72, 74, or 76.</claim-text></claim>
<claim id="c-en-01-0003" num="0003">
<claim-text>The influenza virus according to claim 1, wherein said HA polypeptide of said viral isolate comprises the amino acid sequence of SEQ ID NO: 78.</claim-text></claim>
<claim id="c-en-01-0004" num="0004">
<claim-text>The influenza virus according to claim 1, wherein said influenza virus comprises a polynucleotide having the nucleotide sequence shown in any of SEQ ID NOs: 63, 65, 67, 69, 71, 73, 75, or 77, or said polynucleotide has 98% or greater sequence identity with the nucleotide sequence shown in any of SEQ ID NOs: 63, 65, 67, 69, 71, 73, 75, or 77.</claim-text></claim>
<claim id="c-en-01-0005" num="0005">
<claim-text>The influenza virus according to claim 1, wherein said influenza virus is inactivated or attenuated.</claim-text></claim>
<claim id="c-en-01-0006" num="0006">
<claim-text>A composition comprising an immunogen of an influenza virus of claim 1, wherein said immunogen is capable of inducing an immune response against an influenza virus that is capable of infecting a canid animal, and wherein said immunogen comprises:
<claim-text>(a) an HA polypeptide as defined in claim 1 or claim 3; and/or</claim-text>
<claim-text>(b) a polynucleotide encoding an HA polypeptide as defined in claim 1 or claim 3.</claim-text><!-- EPO <DP n="307"> --></claim-text></claim>
<claim id="c-en-01-0007" num="0007">
<claim-text>The composition according to claim 6, wherein said immunogen comprises cell-free whole virus, or a portion thereof; a viral polynucleotide; a viral protein; a viral polypeptide or peptide; a virus infected cell; a recombinant viral vector based construct; a reassortant virus; or naked nucleic acid of said virus.</claim-text></claim>
<claim id="c-en-01-0008" num="0008">
<claim-text>The composition according to claim 7, wherein said viral protein, polypeptide, or peptide comprises an amino acid sequence shown in any of SEQ ID NOs: 64, 66, 68, 70, 72, 74, or 76, or a functional and/or immunogenic fragment thereof, or said polynucleotide encodes a polypeptide having 95% or greater sequence identity with the amino acid sequence shown in any of SEQ ID NOs: 64, 66, 68, 70, 72, 74, or 76.</claim-text></claim>
<claim id="c-en-01-0009" num="0009">
<claim-text>The composition according to claim 7, wherein said viral polynucleotide encodes a polypeptide comprising an amino acid sequence shown in any of SEQ ID NOs: 64, 66, 68, 70, 72, 74, or 76, or a functional and/or immunogenic fragment thereof, or said polynucleotide encodes a polypeptide having 95% or greater sequence identity with the amino acid sequence shown in any of ID NOs: 64, 66, 68, 70, 72, 74, or 76.</claim-text></claim>
<claim id="c-en-01-0010" num="0010">
<claim-text>The composition according to claim 7, wherein said viral polynucleotide comprises the nucleotide sequence shown in any of SEQ ID NOs: 63, 65, 67, 69, 71, 73, 75, or 77, or a functional fragment thereof.</claim-text></claim>
<claim id="c-en-01-0011" num="0011">
<claim-text>A canine influenza vaccine, wherein the vaccine comprises:
<claim-text>a therapeutically effective amount of an antigen of at least one influenza virus of claim 1, and</claim-text>
<claim-text>at least one pharmaceutically acceptable excipient,</claim-text>
<claim-text>wherein said antigen comprises:
<claim-text>(a) an HA polypeptide as defined in claim 1 or claim 3; and/or</claim-text>
<claim-text>(b) a polynucleotide encoding an HA polypeptide as defined in claim 1 or claim 3.</claim-text></claim-text></claim-text></claim>
<claim id="c-en-01-0012" num="0012">
<claim-text>The vaccine according to claim 11, wherein the virus antigen(s) comprises an inactivated virus(es).<!-- EPO <DP n="308"> --></claim-text></claim>
<claim id="c-en-01-0013" num="0013">
<claim-text>The vaccine according to claim 11, wherein the virus antigen(s) comprises a live attenuated virus(es).</claim-text></claim>
<claim id="c-en-01-0014" num="0014">
<claim-text>An isolated polynucleotide that comprises all or part of a genomic segment or gene of an influenza virus of claim 1, wherein the polynucleotide comprises a nucleic acid sequence which encodes an HA polypeptide as defined in claim 1 or claim 3.</claim-text></claim>
<claim id="c-en-01-0015" num="0015">
<claim-text>The polynucleotide according to claim 14, wherein said polynucleotide is formulated in a pharmaceutically acceptable carrier or diluent.</claim-text></claim>
<claim id="c-en-01-0016" num="0016">
<claim-text>A polynucleotide expression construct comprising a polynucleotide of claim 14.</claim-text></claim>
<claim id="c-en-01-0017" num="0017">
<claim-text>An isolated HA polypeptide encoded by a polynucleotide of claim 14.</claim-text></claim>
<claim id="c-en-01-0018" num="0018">
<claim-text>The polypeptide according to claim 17, wherein said polypeptide is formulated in a pharmaceutically acceptable carrier or diluent.</claim-text></claim>
</claims>
<claims id="claims02" lang="de"><!-- EPO <DP n="309"> -->
<claim id="c-de-01-0001" num="0001">
<claim-text>Isoliertes Hundeinfluenzavirus, das ein hundeartiges Tier infizieren kann, wobei das genannte Influenzavirus ein Polynucleotid umfasst, das ein Hämagglutinin-(HA)-Polypeptid mit der in SEQ ID Nr. 78 gezeigten Aminosäuresequenz oder eine reife Sequenz davon kodiert, wobei die N-terminale 16-Aminosäure-Signalsequenz der Volllängen-Sequenz entfernt wurde.</claim-text></claim>
<claim id="c-de-01-0002" num="0002">
<claim-text>Influenzavirus nach Anspruch 1, wobei das genannte Influenzavirus ein Polynucleotid umfasst, das ein Polypeptid mit der in einer der SEQ ID Nr. 64, 66, 68, 70, 72, 74 oder 76 gezeigten Aminosäuresequenz oder ein funktionelles und/oder immunogenes Fragment davon kodiert, oder das genannte Polynucleotid ein Polypeptidmit einer Sequenzidentität mit der in einer der SEQ ID Nr. 64, 66, 68, 70, 72, 74 oder 76 gezeigten Aminosäuresequenz von 95 % oder mehr kodiert.</claim-text></claim>
<claim id="c-de-01-0003" num="0003">
<claim-text>Influenzavirus nach Anspruch 1, wobei das genannte HA-Polypeptid des genannten viralen Isolats die Aminosäuresequenz der SEQ ID Nr. 78 umfasst.</claim-text></claim>
<claim id="c-de-01-0004" num="0004">
<claim-text>Influenzavirus nach Anspruch 1, wobei das genannte Influenzavirus ein Polynucleotid mit der in einer der SEQ ID Nr. 63, 65, 67, 69, 71, 73, 75 oder 77 gezeigten Nucleotidsequenz umfasst oder das genannte Polynucleotid eine Sequenzidentität mit der in einer der SEQ ID Nr. 63, 65, 67, 69, 71, 73, 75 oder 77 gezeigten Nucleotidsequenz von 98 % oder mehr hat.</claim-text></claim>
<claim id="c-de-01-0005" num="0005">
<claim-text>Influenzavirus nach Anspruch 1, wobei das genannte Influenzavirus inaktiviert oder attenuiert ist.<!-- EPO <DP n="310"> --></claim-text></claim>
<claim id="c-de-01-0006" num="0006">
<claim-text>Zusammensetzung, die ein Immunogen eines Influenzavirus nach Anspruch 1 umfasst, wobei das genannte Immunogen in der Lage ist, eine Immunreaktion gegen ein Influenzavirus zu induzieren, das ein hundeartiges Tier infizieren kann, wobei das genannte Immunogen Folgendes umfasst:
<claim-text>(a) ein HA-Polypeptid nach Anspruch 1 oder Anspruch 3; und/oder</claim-text>
<claim-text>(b) ein Polynucleotid, das ein HA-Polypeptid nach Anspruch 1 oder Anspruch 3 kodiert.</claim-text></claim-text></claim>
<claim id="c-de-01-0007" num="0007">
<claim-text>Zusammensetzung nach Anspruch 6, wobei das genannte Immunogen Folgendes umfasst: zellfreies Vollvirus oder einen Teil davon; ein virales Polynucleotid; ein virales Protein; ein virales Polypeptid oder Peptid; eine virusinfizierte Zelle; ein auf einem rekombinanten viralen Vektor basierendes Konstrukt; ein neu sortiertes Virus; oder nackte Nucleinsäure des genannten Virus.</claim-text></claim>
<claim id="c-de-01-0008" num="0008">
<claim-text>Zusammensetzung nach Anspruch 7, wobei das genannte virale Protein, Polypeptid oder Peptid eine in einer der SEQ ID Nr. 64, 66, 68, 70, 72, 74 oder 76 gezeigte Aminosäuresequenz oder ein funktionelles und/oder immunogenes Fragment davon umfasst oder das genannte Polynucleotid ein Polypeptid mit einer Sequenzidentität mit der in einer der SEQ ID Nr. 64, 66, 68, 70, 72, 74 oder 76 gezeigten Aminosäuresequenz von 95 % oder mehr kodiert.</claim-text></claim>
<claim id="c-de-01-0009" num="0009">
<claim-text>Zusammensetzung nach Anspruch 7, wobei das genannte virale Polynucleotid ein Polypeptid kodiert, das eine in einer der SEQ ID Nr. 64, 66, 68, 70, 72, 74 oder 76 gezeigte Aminosäuresequenz oder ein funktionelles und/oder immunogenes Fragment davon umfasst, oder das genannte Polynucleotid ein Polypeptid mit einer Sequenzidentität mit<!-- EPO <DP n="311"> --> der in einer der ID Nr. 64, 66, 68, 70, 72, 74 oder 76 gezeigten Aminosäuresequenz von 95 % oder mehr kodiert.</claim-text></claim>
<claim id="c-de-01-0010" num="0010">
<claim-text>Zusammensetzung nach Anspruch 7, wobei das genannte virale Polynucleotid die in einer der SEQ ID Nr. 63, 65, 67, 69, 71, 73, 75 oder 77 gezeigte Nucleotidsequenz oder ein funktionelles Fragment davon umfasst.</claim-text></claim>
<claim id="c-de-01-0011" num="0011">
<claim-text>Hundeinfluenzavirus-Impfstoff, wobei der Impfstoff Folgendes umfasst:
<claim-text>eine therapeutisch wirksame Menge eines Antigens von wenigstens einem Influenzavirus nach Anspruch 1, und</claim-text>
<claim-text>wenigstens einen pharmazeutisch akzeptablen Exzipienten,</claim-text>
<claim-text>wobei das genannte Antigen Folgendes umfasst:
<claim-text>(a) ein HA-Polypeptid nach Anspruch 1 oder Anspruch 3; und/oder</claim-text>
<claim-text>(b) ein Polynucleotid, das ein HA-Polypeptid nach Anspruch 1 oder Anspruch 3 kodiert.</claim-text></claim-text></claim-text></claim>
<claim id="c-de-01-0012" num="0012">
<claim-text>Impfstoff nach Anspruch 11, wobei das/die Virusantigen(e) (ein) inaktivierte(s) Virus/Viren umfasst/umfassen.</claim-text></claim>
<claim id="c-de-01-0013" num="0013">
<claim-text>Impfstoff nach Anspruch 11, wobei das/die Virusantigen(e) (ein) lebende(s) attenuierte(s) Virus/Viren umfasst/umfassen.</claim-text></claim>
<claim id="c-de-01-0014" num="0014">
<claim-text>Isoliertes Polynucleotid, das das genomische Segment oder Gen eines Influenzavirus nach Anspruch 1 ganz oder teilweise umfasst, wobei das Polynucleotid eine Nucleinsäuresequenz umfasst, die ein HA-Polypeptid nach Anspruch 1 oder Anspruch 3 kodiert.<!-- EPO <DP n="312"> --></claim-text></claim>
<claim id="c-de-01-0015" num="0015">
<claim-text>Polynucleotid nach Anspruch 14, wobei das genannte Polynucleotid in einem pharmazeutisch akzeptablen Träger oder Verdünnungsmittel formuliert ist.</claim-text></claim>
<claim id="c-de-01-0016" num="0016">
<claim-text>Polynucleotidexpressionskonstrukt, das ein Polynucleotid nach Anspruch 14 umfasst.</claim-text></claim>
<claim id="c-de-01-0017" num="0017">
<claim-text>Isoliertes HA-Polypeptid, das durch ein Polynucleotid aus Anspruch 14 kodiert ist.</claim-text></claim>
<claim id="c-de-01-0018" num="0018">
<claim-text>Polypeptid nach Anspruch 17, wobei das genannte Polypeptid in einem pharmazeutisch akzeptablen Träger oder Verdünnungsmittel formuliert ist.</claim-text></claim>
</claims>
<claims id="claims03" lang="fr"><!-- EPO <DP n="313"> -->
<claim id="c-fr-01-0001" num="0001">
<claim-text>Virus de la grippe canine isolé qui est capable d'infecter un canidé, dans lequel ledit virus de la grippe comprend un polynucléotide codant pour un polypeptide de l'hémagglutinine (HA) dont la séquence d'acides aminés est représentée par la SÉQ ID N° : 78 ou une séquence mature de celui-ci où la séquence signal de 16 acides aminés à l'extrémité N-terminale de la séquence complète a été éliminée.</claim-text></claim>
<claim id="c-fr-01-0002" num="0002">
<claim-text>Virus de la grippe selon la revendication 1, dans lequel ledit virus de la grippe comprend un polynucléotide codant pour un polypeptide dont la séquence d'acides aminés est représentée par l'une quelconque des SÉQ ID N° : 64, 66, 68, 70, 72, 74 ou 76 ou un fragment fonctionnel et/ou immunogène de celui-ci, ou où ledit polynucléotide code pour un polypeptide dont l'identité de séquence avec la séquence d'acides aminés représentée par l'une quelconque des SÉQ ID N° : 64, 66, 68, 70, 72, 74 ou 76 est égale ou supérieure à 95%.</claim-text></claim>
<claim id="c-fr-01-0003" num="0003">
<claim-text>Virus de la grippe selon la revendication 1, dans lequel ledit polypeptide de l'HA dudit isolat viral comprend la séquence d'acides aminés représentée par la SÉQ ID N° : 78.</claim-text></claim>
<claim id="c-fr-01-0004" num="0004">
<claim-text>Virus de la grippe selon la revendication 1, dans lequel ledit virus de la grippe comprend un polynucléotide ayant la séquence de nucléotides représentée par l'une quelconque des SÉQ ID N° : 63, 65, 67, 69, 71, 73, 75 ou 77 ou où l'identité de séquence entre ledit polynucléotide et la séquence de nucléotides représentée par l'une quelconque des SÉQ ID N° : 63, 65, 67, 69, 71, 73, 75 ou 77 est égale ou supérieure à 98 %.</claim-text></claim>
<claim id="c-fr-01-0005" num="0005">
<claim-text>Virus de la grippe selon la revendication 1, dans lequel ledit virus de la grippe est inactivé ou atténué.</claim-text></claim>
<claim id="c-fr-01-0006" num="0006">
<claim-text>Composition comprenant un immunogène du virus de la grippe selon la revendication 1, dans lequel ledit immunogène est capable d'induire une réponse immunitaire contre un virus de la grippe qui est capable d'infecter un canidé et dans lequel ledit immunogène comprend :
<claim-text>(a) un polypeptide de l'HA tel que défini à la revendication 1 ou à la revendication 3 ; et/ou</claim-text>
<claim-text>(b) un polynucléotide codant pour un polypeptide de l'HA tel que défini à la revendication 1 ou à la revendication 3.</claim-text><!-- EPO <DP n="314"> --></claim-text></claim>
<claim id="c-fr-01-0007" num="0007">
<claim-text>Composition selon la revendication 6, dans lequel ledit immunogène comprend un virus entier acellulaire ou une portion d'un tel virus ; un polynucléotide viral ; une protéine virale ; un polypeptide ou un peptide viral ; une cellule infectée par un virus ; un construit basé sur un vecteur viral recombinant ; un virus réassorti ; ou un acide nucléique nu dudit virus.</claim-text></claim>
<claim id="c-fr-01-0008" num="0008">
<claim-text>Composition selon la revendication 7, dans lequel le(a)dit(e) protéine, polypeptide ou peptide viral(e) comprend une séquence d'acides aminés représentée par l'une quelconque des SÉQ ID N° : 64, 66, 68, 70, 72, 74 ou 76 ou un fragment fonctionnel et/ou immunogène de celle-ci, ou où ledit polynucléotide code pour un polypeptide dont l'identité de séquence avec la séquence d'acides aminés représentée par l'une quelconque des SÉQ ID N° : 64, 66, 68, 70, 72, 74 ou 76 est égale ou supérieure à 95 %.</claim-text></claim>
<claim id="c-fr-01-0009" num="0009">
<claim-text>Composition selon la revendication 7, dans lequel ledit polynucléotide viral code pour un polypeptide comprenant une séquence d'acides aminés représentée par l'une quelconque des SÉQ ID N° : 64, 66, 68, 70, 72, 74 ou 76 ou un fragment fonctionnel et/ou immunogène de celui-ci, ou où ledit polynucléotide code pour un polypeptide dont l'identité de séquence avec la séquence d'acides aminés représentée par l'une quelconque des SÉQ ID N° : 64, 66, 68, 70, 72, 74 ou 76 est égale ou supérieure à 95 %.</claim-text></claim>
<claim id="c-fr-01-0010" num="0010">
<claim-text>Composition selon la revendication 7, où ledit polynucléotide viral comprend la séquence de nucléotides représentée par l'une quelconque des SÉQ ID N° : 63, 65, 67, 69, 71, 73, 75 ou 77 ou un fragment fonctionnel et/ou immunogène de celle-ci.</claim-text></claim>
<claim id="c-fr-01-0011" num="0011">
<claim-text>Vaccin contre la grippe canine, dans lequel le vaccin comprend :
<claim-text>une quantité thérapeutiquement efficace d'un antigène d'au moins un virus de la grippe de la revendication 1 et</claim-text>
<claim-text>au moins un excipient pharmaceutiquement acceptable,</claim-text>
<claim-text>dans lequel ledit antigène comprend :
<claim-text>(a) un polypeptide de l'HA tel que défini à la revendication 1 ou à la revendication 3 ; et/ou</claim-text>
<claim-text>(b) un polynucléotide codant pour un polypeptide de l'HA tel que défini à la revendication 1 ou à la revendication 3.</claim-text></claim-text></claim-text></claim>
<claim id="c-fr-01-0012" num="0012">
<claim-text>Vaccin selon la revendication 11, dans lequel le(s) antigène(s) viral(ux) comprend(ent) un(des) virus inactivé(s).<!-- EPO <DP n="315"> --></claim-text></claim>
<claim id="c-fr-01-0013" num="0013">
<claim-text>Vaccin selon la revendication 11, dans lequel le(s) antigène(s) viral(ux) comprend(ent) un(des) virus vivant(s) atténué(s).</claim-text></claim>
<claim id="c-fr-01-0014" num="0014">
<claim-text>Polynucléotide isolé qui comprend l'ensemble ou une partie d'un segment génomique ou gène d'un virus de la grippe selon la revendication 1, dans lequel le polynucléotide comprend une séquence d'acide nucléique codant pour un peptide de l'HA tel que défini à la revendication 1 ou à la revendication 3.</claim-text></claim>
<claim id="c-fr-01-0015" num="0015">
<claim-text>Polynucléotide selon la revendication 14, dans lequel ledit polynucléotide est formulé dans un véhicule ou diluant pharmaceutiquement acceptable.</claim-text></claim>
<claim id="c-fr-01-0016" num="0016">
<claim-text>Construit d'expression polynucléotidique comprenant un polynucléotide selon la revendication 14.</claim-text></claim>
<claim id="c-fr-01-0017" num="0017">
<claim-text>Polypeptide de l'HA isolé codé par un polynucléotide selon revendication 14.</claim-text></claim>
<claim id="c-fr-01-0018" num="0018">
<claim-text>Polypeptide selon la revendication 17, dans lequel ledit polypeptide est formulé dans un véhicule ou diluant pharmaceutiquement acceptable.</claim-text></claim>
</claims>
<drawings id="draw" lang="en">
<figure id="f0001" num="1A"><img id="if0001" file="imgf0001.tif" wi="153" he="115" img-content="drawing" img-format="tif"/></figure><!-- EPO <DP n="316"> -->
<figure id="f0002" num="1B"><img id="if0002" file="imgf0002.tif" wi="155" he="139" img-content="drawing" img-format="tif"/></figure><!-- EPO <DP n="317"> -->
<figure id="f0003" num="2A,2B"><img id="if0003" file="imgf0003.tif" wi="165" he="126" img-content="drawing" img-format="tif"/></figure><!-- EPO <DP n="318"> -->
<figure id="f0004" num="3A,3B"><img id="if0004" file="imgf0004.tif" wi="150" he="161" img-content="drawing" img-format="tif"/></figure><!-- EPO <DP n="319"> -->
<figure id="f0005" num="4A,4B"><img id="if0005" file="imgf0005.tif" wi="165" he="228" img-content="drawing" img-format="tif"/></figure><!-- EPO <DP n="320"> -->
<figure id="f0006" num="5"><img id="if0006" file="imgf0006.tif" wi="147" he="116" img-content="drawing" img-format="tif"/></figure><!-- EPO <DP n="321"> -->
<figure id="f0007" num="6A,6B"><img id="if0007" file="imgf0007.tif" wi="118" he="233" img-content="drawing" img-format="tif"/></figure><!-- EPO <DP n="322"> -->
<figure id="f0008" num="6C,6D"><img id="if0008" file="imgf0008.tif" wi="105" he="233" img-content="drawing" img-format="tif"/></figure><!-- EPO <DP n="323"> -->
<figure id="f0009" num="7"><img id="if0009" file="imgf0009.tif" wi="157" he="77" img-content="drawing" img-format="tif"/></figure>
</drawings>
<ep-reference-list id="ref-list">
<heading id="ref-h0001"><b>REFERENCES CITED IN THE DESCRIPTION</b></heading>
<p id="ref-p0001" num=""><i>This list of references cited by the applicant is for the reader's convenience only. It does not form part of the European patent document. Even though great care has been taken in compiling the references, errors or omissions cannot be excluded and the EPO disclaims all liability in this regard.</i></p>
<heading id="ref-h0002"><b>Patent documents cited in the description</b></heading>
<p id="ref-p0002" num="">
<ul id="ref-ul0001" list-style="bullet">
<li><patcit id="ref-pcit0001" dnum="US5106739A"><document-id><country>US</country><doc-number>5106739</doc-number><kind>A</kind></document-id></patcit><crossref idref="pcit0001">[0022]</crossref><crossref idref="pcit0030">[0251]</crossref></li>
<li><patcit id="ref-pcit0002" dnum="US5625136A"><document-id><country>US</country><doc-number>5625136</doc-number><kind>A</kind></document-id></patcit><crossref idref="pcit0002">[0022]</crossref></li>
<li><patcit id="ref-pcit0003" dnum="US5034322A"><document-id><country>US</country><doc-number>5034322</doc-number><kind>A</kind></document-id></patcit><crossref idref="pcit0003">[0022]</crossref><crossref idref="pcit0031">[0251]</crossref></li>
<li><patcit id="ref-pcit0004" dnum="US6455760B"><document-id><country>US</country><doc-number>6455760</doc-number><kind>B</kind></document-id></patcit><crossref idref="pcit0004">[0022]</crossref><crossref idref="pcit0032">[0251]</crossref></li>
<li><patcit id="ref-pcit0005" dnum="US6696623B"><document-id><country>US</country><doc-number>6696623</doc-number><kind>B</kind></document-id></patcit><crossref idref="pcit0005">[0022]</crossref><crossref idref="pcit0033">[0251]</crossref></li>
<li><patcit id="ref-pcit0006" dnum="US20040078841A" dnum-type="L"><document-id><country>US</country><doc-number>20040078841</doc-number><kind>A</kind></document-id></patcit><crossref idref="pcit0006">[0022]</crossref><crossref idref="pcit0043">[0251]</crossref></li>
<li><patcit id="ref-pcit0007" dnum="US20040067506A" dnum-type="L"><document-id><country>US</country><doc-number>20040067506</doc-number><kind>A</kind></document-id></patcit><crossref idref="pcit0007">[0022]</crossref><crossref idref="pcit0044">[0251]</crossref></li>
<li><patcit id="ref-pcit0008" dnum="US20040019934A" dnum-type="L"><document-id><country>US</country><doc-number>20040019934</doc-number><kind>A</kind></document-id></patcit><crossref idref="pcit0008">[0022]</crossref><crossref idref="pcit0045">[0251]</crossref></li>
<li><patcit id="ref-pcit0009" dnum="US20030177536A" dnum-type="L"><document-id><country>US</country><doc-number>20030177536</doc-number><kind>A</kind></document-id></patcit><crossref idref="pcit0009">[0022]</crossref><crossref idref="pcit0046">[0251]</crossref></li>
<li><patcit id="ref-pcit0010" dnum="US20030084486A" dnum-type="L"><document-id><country>US</country><doc-number>20030084486</doc-number><kind>A</kind></document-id></patcit><crossref idref="pcit0010">[0022]</crossref><crossref idref="pcit0047">[0251]</crossref></li>
<li><patcit id="ref-pcit0011" dnum="US20040123349A" dnum-type="L"><document-id><country>US</country><doc-number>20040123349</doc-number><kind>A</kind></document-id></patcit><crossref idref="pcit0011">[0022]</crossref><crossref idref="pcit0048">[0251]</crossref></li>
<li><patcit id="ref-pcit0012" dnum="US6436408B"><document-id><country>US</country><doc-number>6436408</doc-number><kind>B</kind></document-id></patcit><crossref idref="pcit0012">[0044]</crossref><crossref idref="pcit0027">[0199]</crossref><crossref idref="pcit0040">[0251]</crossref></li>
<li><patcit id="ref-pcit0013" dnum="US6398774B"><document-id><country>US</country><doc-number>6398774</doc-number><kind>B</kind></document-id></patcit><crossref idref="pcit0013">[0044]</crossref><crossref idref="pcit0028">[0199]</crossref><crossref idref="pcit0041">[0251]</crossref></li>
<li><patcit id="ref-pcit0014" dnum="US6177082B"><document-id><country>US</country><doc-number>6177082</doc-number><kind>B</kind></document-id></patcit><crossref idref="pcit0014">[0044]</crossref><crossref idref="pcit0015">[0049]</crossref><crossref idref="pcit0029">[0199]</crossref><crossref idref="pcit0042">[0251]</crossref></li>
<li><patcit id="ref-pcit0015" dnum="US6063385A"><document-id><country>US</country><doc-number>6063385</doc-number><kind>A</kind></document-id></patcit><crossref idref="pcit0016">[0079]</crossref></li>
<li><patcit id="ref-pcit0016" dnum="US6472375A"><document-id><country>US</country><doc-number>6472375</doc-number><kind>A</kind></document-id></patcit><crossref idref="pcit0017">[0079]</crossref></li>
<li><patcit id="ref-pcit0017" dnum="US20050009008A"><document-id><country>US</country><doc-number>20050009008</doc-number><kind>A</kind></document-id></patcit><crossref idref="pcit0018">[0082]</crossref></li>
<li><patcit id="ref-pcit0018" dnum="US4683202A"><document-id><country>US</country><doc-number>4683202</doc-number><kind>A</kind></document-id></patcit><crossref idref="pcit0019">[0103]</crossref><crossref idref="pcit0034">[0251]</crossref></li>
<li><patcit id="ref-pcit0019" dnum="US4683195A"><document-id><country>US</country><doc-number>4683195</doc-number><kind>A</kind></document-id></patcit><crossref idref="pcit0020">[0103]</crossref><crossref idref="pcit0035">[0251]</crossref></li>
<li><patcit id="ref-pcit0020" dnum="US4800159A"><document-id><country>US</country><doc-number>4800159</doc-number><kind>A</kind></document-id></patcit><crossref idref="pcit0021">[0103]</crossref><crossref idref="pcit0036">[0251]</crossref></li>
<li><patcit id="ref-pcit0021" dnum="US4965188A"><document-id><country>US</country><doc-number>4965188</doc-number><kind>A</kind></document-id></patcit><crossref idref="pcit0022">[0103]</crossref><crossref idref="pcit0037">[0251]</crossref></li>
<li><patcit id="ref-pcit0022" dnum="US5994056A"><document-id><country>US</country><doc-number>5994056</doc-number><kind>A</kind></document-id></patcit><crossref idref="pcit0023">[0103]</crossref><crossref idref="pcit0038">[0251]</crossref></li>
<li><patcit id="ref-pcit0023" dnum="US6814934A"><document-id><country>US</country><doc-number>6814934</doc-number><kind>A</kind></document-id></patcit><crossref idref="pcit0024">[0103]</crossref></li>
<li><patcit id="ref-pcit0024" dnum="US5484719A"><document-id><country>US</country><doc-number>5484719</doc-number><kind>A</kind></document-id></patcit><crossref idref="pcit0025">[0109]</crossref></li>
<li><patcit id="ref-pcit0025" dnum="US6136320A"><document-id><country>US</country><doc-number>6136320</doc-number><kind>A</kind></document-id></patcit><crossref idref="pcit0026">[0109]</crossref></li>
<li><patcit id="ref-pcit0026" dnum="US6814934B"><document-id><country>US</country><doc-number>6814934</doc-number><kind>B</kind></document-id></patcit><crossref idref="pcit0039">[0251]</crossref></li>
<li><patcit id="ref-pcit0027" dnum="US11409416B"><document-id><country>US</country><doc-number>11409416</doc-number><kind>B</kind><date>20060421</date></document-id></patcit><crossref idref="pcit0049">[0252]</crossref></li>
<li><patcit id="ref-pcit0028" dnum="US60728449B"><document-id><country>US</country><doc-number>60728449</doc-number><kind>B</kind></document-id></patcit><crossref idref="pcit0050">[0252]</crossref></li>
<li><patcit id="ref-pcit0029" dnum="US60754881B"><document-id><country>US</country><doc-number>60754881</doc-number><kind>B</kind><date>20051229</date></document-id></patcit><crossref idref="pcit0051">[0252]</crossref></li>
<li><patcit id="ref-pcit0030" dnum="US60759162B"><document-id><country>US</country><doc-number>60759162</doc-number><kind>B</kind><date>20060114</date></document-id></patcit><crossref idref="pcit0052">[0252]</crossref></li>
<li><patcit id="ref-pcit0031" dnum="US60761451B"><document-id><country>US</country><doc-number>60761451</doc-number><kind>B</kind><date>20060123</date></document-id></patcit><crossref idref="pcit0053">[0252]</crossref></li>
<li><patcit id="ref-pcit0032" dnum="US60779080B"><document-id><country>US</country><doc-number>60779080</doc-number><kind>B</kind><date>20060303</date></document-id></patcit><crossref idref="pcit0054">[0252]</crossref></li>
</ul></p>
<heading id="ref-h0003"><b>Non-patent literature cited in the description</b></heading>
<p id="ref-p0003" num="">
<ul id="ref-ul0002" list-style="bullet">
<li><nplcit id="ref-ncit0001" npl-type="b"><article><atl/><book><author><name>E.W. MARTIN</name></author><book-title>Remington's Pharmaceutical Science</book-title><imprint><name>Mack Publishing Company</name><pubdate>19950000</pubdate></imprint></book></article></nplcit><crossref idref="ncit0001">[0080]</crossref></li>
<li><nplcit id="ref-ncit0002" npl-type="s"><article><author><name>CRAWFORD et al.</name></author><atl/><serial><sertitle>SCIENCE</sertitle><pubdate><sdate>20050900</sdate><edate/></pubdate><vid>309</vid></serial></article></nplcit><crossref idref="ncit0002">[0185]</crossref></li>
<li><nplcit id="ref-ncit0003" npl-type="s"><article><author><name>ALTSCHUL, S. F. et al.</name></author><atl>Basic Local Alignment Search Tool</atl><serial><sertitle>J. Mol. Biol.</sertitle><pubdate><sdate>19900000</sdate><edate/></pubdate><vid>215</vid></serial><location><pp><ppf>402</ppf><ppl>410</ppl></pp></location></article></nplcit><crossref idref="ncit0003">[0251]</crossref></li>
<li><nplcit id="ref-ncit0004" npl-type="s"><article><author><name>ALTSCHUL, S. F. et al.</name></author><atl>Gapped BLAST and PSI-BLAST: A New Generation of Protein Database Search Programs</atl><serial><sertitle>Nucl. Acids Res.</sertitle><pubdate><sdate>19970000</sdate><edate/></pubdate><vid>25</vid></serial><location><pp><ppf>3389</ppf><ppl>3402</ppl></pp></location></article></nplcit><crossref idref="ncit0004">[0251]</crossref></li>
<li><nplcit id="ref-ncit0005" npl-type="s"><article><author><name>AN, G.</name></author><atl>Binary Ti vectors for plant transformation and promoter analysis</atl><serial><sertitle>Methods Enzymol.</sertitle><pubdate><sdate>19870000</sdate><edate/></pubdate><vid>153</vid></serial><location><pp><ppf>292</ppf><ppl>305</ppl></pp></location></article></nplcit><crossref idref="ncit0005">[0251]</crossref></li>
<li><nplcit id="ref-ncit0006" npl-type="b"><article><atl>Isolation of multigene families and determination of homologies by filter hybridization methods</atl><book><author><name>BELTZ, G. A.</name></author><author><name>JACOBS, K. A.</name></author><author><name>EICKBUSH, T. H.</name></author><author><name>CHERBAS, P. T.</name></author><author><name>KAFATOS, F. C.</name></author><book-title>Methods of Enzymology</book-title><imprint><name>Academic Press</name><pubdate>19830000</pubdate></imprint><vid>100</vid><location><pp><ppf>266</ppf><ppl>285</ppl></pp></location></book></article></nplcit><crossref idref="ncit0006">[0251]</crossref></li>
<li><nplcit id="ref-ncit0007" npl-type="b"><article><atl/><book><author><name>BURLESON, F. et al.</name></author><book-title>Virology: A Laboratory Manual</book-title><imprint><name>Academic Press</name><pubdate>19920000</pubdate></imprint></book></article></nplcit><crossref idref="ncit0007">[0251]</crossref></li>
<li><nplcit id="ref-ncit0008" npl-type="s"><article><author><name>BYARS, N.E.</name></author><author><name>A.C. ALLISON</name></author><atl>Adjuvant formulation for use in vaccines to elicit both cell-mediated and humoral immunity</atl><serial><sertitle>Vaccine</sertitle><pubdate><sdate>19870000</sdate><edate/></pubdate><vid>5</vid></serial><location><pp><ppf>223</ppf><ppl>228</ppl></pp></location></article></nplcit><crossref idref="ncit0008">[0251]</crossref></li>
<li><nplcit id="ref-ncit0009" npl-type="s"><article><author><name>CRAWFORD, P.C. et al.</name></author><atl>Transmission of equine influenza virus to dogs</atl><serial><sertitle>Science</sertitle><pubdate><sdate>20050000</sdate><edate/></pubdate><vid>310</vid></serial><location><pp><ppf>482</ppf><ppl>485</ppl></pp></location></article></nplcit><crossref idref="ncit0009">[0251]</crossref></li>
<li><nplcit id="ref-ncit0010" npl-type="s"><article><author><name>CHANG, C.P. et al.</name></author><atl>Influenza virus isolations from dogs during a human epidemic in Taiwan</atl><serial><sertitle>Int J Zoonoses</sertitle><pubdate><sdate>19760000</sdate><edate/></pubdate><vid>3</vid></serial><location><pp><ppf>61</ppf><ppl>64</ppl></pp></location></article></nplcit><crossref idref="ncit0010">[0251]</crossref></li>
<li><nplcit id="ref-ncit0011" npl-type="s"><article><author><name>DACSO, C.C. et al.</name></author><atl>Sporadic occurrence of zoonotic swine influenza virus infections</atl><serial><sertitle>J Clin Microbiol</sertitle><pubdate><sdate>19840000</sdate><edate/></pubdate><vid>20</vid></serial><location><pp><ppf>833</ppf><ppl>835</ppl></pp></location></article></nplcit><crossref idref="ncit0011">[0251]</crossref></li>
<li><nplcit id="ref-ncit0012" npl-type="s"><article><author><name>DE BOER, H. A.</name></author><author><name>COMSTOCK, L. J.</name></author><author><name>VASSER, M.</name></author><atl>The tac promoter: a functional hybrid derived from the trp and lac promoters</atl><serial><sertitle>Proc. Natl. Acad. Sci. USA</sertitle><pubdate><sdate>19830000</sdate><edate/></pubdate><vid>80</vid><ino>1</ino></serial><location><pp><ppf>21</ppf><ppl>25</ppl></pp></location></article></nplcit><crossref idref="ncit0012">[0251]</crossref></li>
<li><nplcit id="ref-ncit0013" npl-type="s"><article><author><name>FELSENSTEIN, J.</name></author><atl/><serial><sertitle>Cladistics</sertitle><pubdate><sdate>19890000</sdate><edate/></pubdate><vid>5</vid></serial><location><pp><ppf>164</ppf><ppl/></pp></location></article></nplcit><crossref idref="ncit0013">[0251]</crossref></li>
<li><nplcit id="ref-ncit0014" npl-type="b"><article><atl/><book><author><name>FIELDS et al.</name></author><book-title>Fields Virology</book-title><imprint><name>Lippincott-Raven publishers</name><pubdate>19460000</pubdate></imprint></book></article></nplcit><crossref idref="ncit0014">[0251]</crossref></li>
<li><nplcit id="ref-ncit0015" npl-type="b"><article><atl>Canine infectious tracheobronchitis</atl><book><author><name>FORD, R.B.</name></author><author><name>VADEN, S.L.</name></author><book-title>Infectious Diseases of the Dog and Cat</book-title><imprint><name>W.B. Saunders Co.</name><pubdate>19980000</pubdate></imprint><location><pp><ppf>33</ppf><ppl>38</ppl></pp></location></book></article></nplcit><crossref idref="ncit0015">[0251]</crossref></li>
<li><nplcit id="ref-ncit0016" npl-type="s"><article><author><name>FOUCHIER et al.</name></author><atl/><serial><sertitle>Journal of Clinical Microbiology</sertitle><pubdate><sdate>20000000</sdate><edate/></pubdate><vid>38</vid><ino>11</ino></serial><location><pp><ppf>4096</ppf><ppl>4101</ppl></pp></location></article></nplcit><crossref idref="ncit0016">[0251]</crossref></li>
<li><nplcit id="ref-ncit0017" npl-type="s"><article><author><name>GOOD, X. et al.</name></author><atl>Reduced ethylene synthesis by transgenic tomatoes expressing S-adenosylmethionine hydrolase</atl><serial><sertitle>Plant Molec. Biol.</sertitle><pubdate><sdate>19940000</sdate><edate/></pubdate><vid>26</vid></serial><location><pp><ppf>781</ppf><ppl>790</ppl></pp></location></article></nplcit><crossref idref="ncit0017">[0251]</crossref></li>
<li><nplcit id="ref-ncit0018" npl-type="s"><article><author><name>GUAN, Y. et al.</name></author><atl>H5N1 influenza: a protean pandemic threat</atl><serial><sertitle>Proc Natl Acad Sci U S A</sertitle><pubdate><sdate>20040000</sdate><edate/></pubdate><vid>101</vid></serial><location><pp><ppf>8156</ppf><ppl>8161</ppl></pp></location></article></nplcit><crossref idref="ncit0018">[0251]</crossref></li>
<li><nplcit id="ref-ncit0019" npl-type="s"><article><author><name>GUO, Y. et al.</name></author><atl>Characterization of a new avian-like influenza A virus from horses in China</atl><serial><sertitle>Virology</sertitle><pubdate><sdate>19920000</sdate><edate/></pubdate><vid>188</vid></serial><location><pp><ppf>245</ppf><ppl>255</ppl></pp></location></article></nplcit><crossref idref="ncit0019">[0251]</crossref></li>
<li><nplcit id="ref-ncit0020" npl-type="s"><article><author><name>HOUSER, R.E. et al.</name></author><atl>Evidence of prior infection with influenza A/Texas/77 (H3N2) virus in dogs with clinical parainfluenza</atl><serial><sertitle>Can J Comp Med</sertitle><pubdate><sdate>19800000</sdate><edate/></pubdate><vid>44</vid></serial><location><pp><ppf>396</ppf><ppl>402</ppl></pp></location></article></nplcit><crossref idref="ncit0020">[0251]</crossref></li>
<li><nplcit id="ref-ncit0021" npl-type="s"><article><author><name>KARASIN, A.I et al.</name></author><atl>Isolation and characterization of H4N6 avian influenza viruses from pigs with pneumonia in Canada</atl><serial><sertitle>J Virol</sertitle><pubdate><sdate>20000000</sdate><edate/></pubdate><vid>74</vid></serial><location><pp><ppf>9322</ppf><ppl>9327</ppl></pp></location></article></nplcit><crossref idref="ncit0021">[0251]</crossref></li>
<li><nplcit id="ref-ncit0022" npl-type="s"><article><author><name>KARLIN S.</name></author><author><name>ALTSCHUL, S. F.</name></author><atl>Methods for Assessing the Statistical Significance of Molecular Sequence Features by Using General Scoring Schemes</atl><serial><sertitle>Proc. Natl. Acad. Sci. USA</sertitle><pubdate><sdate>19900000</sdate><edate/></pubdate><vid>87</vid></serial><location><pp><ppf>2264</ppf><ppl>2268</ppl></pp></location></article></nplcit><crossref idref="ncit0022">[0251]</crossref></li>
<li><nplcit id="ref-ncit0023" npl-type="s"><article><author><name>KARLIN S.</name></author><author><name>ALTSCHUL, S. F.</name></author><atl>Applications and Statistics for Multiple High-Scoring Segments in Molecular Sequences</atl><serial><sertitle>Proc. Natl. Acad. Sci. USA</sertitle><pubdate><sdate>19930000</sdate><edate/></pubdate><vid>90</vid></serial><location><pp><ppf>5873</ppf><ppl>5877</ppl></pp></location></article></nplcit><crossref idref="ncit0023">[0251]</crossref></li>
<li><nplcit id="ref-ncit0024" npl-type="s"><article><author><name>KAWAOKA, Y. et al.</name></author><atl>Avian-to-human transmission of the PB1 gene of influenza A viruses in the 1957 and 1968 pandemics</atl><serial><sertitle>J Virol</sertitle><pubdate><sdate>19890000</sdate><edate/></pubdate><vid>63</vid></serial><location><pp><ppf>4603</ppf><ppl>4608</ppl></pp></location></article></nplcit><crossref idref="ncit0024">[0251]</crossref></li>
<li><nplcit id="ref-ncit0025" npl-type="s"><article><author><name>KEAWCHAROEN, J. et al.</name></author><atl>Avian influenza H5N1 in tigers and leopards</atl><serial><sertitle>Emerg infect Dis</sertitle><pubdate><sdate>20040000</sdate><edate/></pubdate><vid>10</vid></serial><location><pp><ppf>2189</ppf><ppl>2191</ppl></pp></location></article></nplcit><crossref idref="ncit0025">[0251]</crossref></li>
<li><nplcit id="ref-ncit0026" npl-type="b"><article><atl/><book><author><name>KENDAL, A. P. et al.</name></author><book-title>Concepts and Procedures for Laboratory-based Influenza Surveillance</book-title><imprint><name>U.S. Department of Health and Human Services, Centers for Disease Control and Prevention and Pan-American Health Organization</name><pubdate>19820000</pubdate></imprint><location><pp><ppf>B17</ppf><ppl>B35</ppl></pp></location></book></article></nplcit><crossref idref="ncit0026">[0251]</crossref></li>
<li><nplcit id="ref-ncit0027" npl-type="s"><article><author><name>KILBOURNE, E.D. et al.</name></author><atl>Demonstration of antibodies to both hemagglutinin and neuraminidase antigens of H3N2 influenza A virus in domestic dogs</atl><serial><sertitle>Intervirology</sertitle><pubdate><sdate>19750000</sdate><edate/></pubdate><vid>6</vid></serial><location><pp><ppf>315</ppf><ppl>318</ppl></pp></location></article></nplcit><crossref idref="ncit0027">[0251]</crossref></li>
<li><nplcit id="ref-ncit0028" npl-type="s"><article><author><name>KIMURA, K. et al.</name></author><atl>Fatal case of swine influenza virus in an immunocompetent host</atl><serial><sertitle>Mayo Clin Proc</sertitle><pubdate><sdate>19980000</sdate><edate/></pubdate><vid>73</vid></serial><location><pp><ppf>243</ppf><ppl>245</ppl></pp></location></article></nplcit><crossref idref="ncit0028">[0251]</crossref></li>
<li><nplcit id="ref-ncit0029" npl-type="s"><article><author><name>KLIMOV, A. I. et al.</name></author><atl>Sequence changes in the live attenuated, cold-adapted variants of influenza A/Leningrad/134/57 (H2N2) virus</atl><serial><sertitle>Virology</sertitle><pubdate><sdate>19920000</sdate><edate/></pubdate><vid>186</vid></serial><location><pp><ppf>795</ppf><ppl>797</ppl></pp></location></article></nplcit><crossref idref="ncit0029">[0251]</crossref></li>
<li><nplcit id="ref-ncit0030" npl-type="s"><article><author><name>KLIMOV A. et al.</name></author><atl>Subtype H7 influenza viruses: comparative antigenic and molecular analysis of the HA-, M-, and NS-genes</atl><serial><sertitle>Arch Virol.</sertitle><pubdate><sdate>19920000</sdate><edate/></pubdate><vid>122</vid></serial><location><pp><ppf>143</ppf><ppl>161</ppl></pp></location></article></nplcit><crossref idref="ncit0030">[0251]</crossref></li>
<li><nplcit id="ref-ncit0031" npl-type="s"><article><author><name>KOVACOVA, A. et al.</name></author><atl>Sequence similarities and evolutionary relationships of influenza virus A hemagglutinins</atl><serial><sertitle>Virus Genes</sertitle><pubdate><sdate>20020000</sdate><edate/></pubdate><vid>24</vid></serial><location><pp><ppf>57</ppf><ppl>63</ppl></pp></location></article></nplcit><crossref idref="ncit0031">[0251]</crossref></li>
<li><nplcit id="ref-ncit0032" npl-type="s"><article><author><name>KUIKEN, T. et al.</name></author><atl>Avian H5N1 influenza in cats</atl><serial><sertitle>Science</sertitle><pubdate><sdate>20040000</sdate><edate/></pubdate><vid>306</vid></serial><location><pp><ppf>241</ppf><ppl/></pp></location></article></nplcit><crossref idref="ncit0032">[0251]</crossref></li>
<li><nplcit id="ref-ncit0033" npl-type="s"><article><author><name>KUMAR, S. et al.</name></author><atl>MEGA3: Integrated software for Molecular Evolutionary Genetics Analysis and sequence alignment</atl><serial><sertitle>Brief Bioinform</sertitle><pubdate><sdate>20040000</sdate><edate/></pubdate><vid>5</vid></serial><location><pp><ppf>150</ppf><ppl>163</ppl></pp></location></article></nplcit><crossref idref="ncit0033">[0251]</crossref></li>
<li><nplcit id="ref-ncit0034" npl-type="s"><article><author><name>LEE, L.G. et al.</name></author><atl>Allelic discrimination by nick-translation PCR with fluorogenic probes</atl><serial><sertitle>Nucleic Acids Res.</sertitle><pubdate><sdate>19930000</sdate><edate/></pubdate><vid>21</vid><ino>16</ino></serial><location><pp><ppf>3761</ppf><ppl>3766</ppl></pp></location></article></nplcit><crossref idref="ncit0034">[0251]</crossref></li>
<li><nplcit id="ref-ncit0035" npl-type="b"><article><atl/><book><author><name>LEWIN, B.</name></author><book-title>Genes II</book-title><imprint><name>John Wiley &amp; Sons, Inc.</name><pubdate>19850000</pubdate></imprint><location><pp><ppf>96</ppf><ppl/></pp></location></book></article></nplcit><crossref idref="ncit0035">[0251]</crossref></li>
<li><nplcit id="ref-ncit0036" npl-type="s"><article><author><name>LIPATOV, A.S. et al.</name></author><atl>Influenza: emergence and control</atl><serial><sertitle>J Virol</sertitle><pubdate><sdate>20040000</sdate><edate/></pubdate><vid>78</vid></serial><location><pp><ppf>8951</ppf><ppl>8959</ppl></pp></location></article></nplcit><crossref idref="ncit0036">[0251]</crossref></li>
<li><nplcit id="ref-ncit0037" npl-type="s"><article><author><name>LIVAK, K. J. et al.</name></author><atl>Oligonucleotides with fluorescent dyes at opposite ends provide a quenched probe system useful for detecting PCR product and nucleic acid hybridization</atl><serial><sertitle>PCR Methods Appl.</sertitle><pubdate><sdate>19950000</sdate><edate/></pubdate><vid>4</vid><ino>6</ino></serial><location><pp><ppf>357</ppf><ppl>362</ppl></pp></location></article></nplcit><crossref idref="ncit0037">[0251]</crossref></li>
<li><nplcit id="ref-ncit0038" npl-type="b"><article><atl>Nuclease Bal31</atl><book><author><name>MANIATIS, T.</name></author><author><name>E.F. FRITSCH</name></author><author><name>J. SAMBROOK</name></author><book-title>Molecular Cloning: A Laboratory Manual</book-title><imprint><name>Cold Spring Harbor Laboratory</name><pubdate>19820000</pubdate></imprint></book></article></nplcit><crossref idref="ncit0038">[0251]</crossref></li>
<li><nplcit id="ref-ncit0039" npl-type="s"><article><author><name>MATROSOVICH, M. et al.</name></author><atl>Early alterations of the receptor-binding properties of H1, H2, and H3 avian influenza virus hemagglutinins after their introduction into mammals</atl><serial><sertitle>J Virol</sertitle><pubdate><sdate>20000000</sdate><edate/></pubdate><vid>74</vid></serial><location><pp><ppf>8502</ppf><ppl>8512</ppl></pp></location></article></nplcit><crossref idref="ncit0039">[0251]</crossref></li>
<li><nplcit id="ref-ncit0040" npl-type="s"><article><author><name>MAERTZDORF et al.</name></author><atl/><serial><sertitle>Clin Microbiol.</sertitle><pubdate><sdate>20040000</sdate><edate/></pubdate><vid>42</vid><ino>3</ino></serial><location><pp><ppf>981</ppf><ppl>986</ppl></pp></location></article></nplcit><crossref idref="ncit0040">[0251]</crossref></li>
<li><nplcit id="ref-ncit0041" npl-type="s"><article><author><name>MERRIFIELD, R.B.</name></author><atl>Solid Phase Peptide Synthesis. I. The Synthesis of a Tetrapeptide</atl><serial><sertitle>J. Amer. Chem. Soc.</sertitle><pubdate><sdate>19630000</sdate><edate/></pubdate><vid>85</vid></serial><location><pp><ppf>2149</ppf><ppl>2154</ppl></pp></location></article></nplcit><crossref idref="ncit0041">[0251]</crossref></li>
<li><nplcit id="ref-ncit0042" npl-type="s"><article><author><name>NIKITIN, A. et al.</name></author><atl>Epidemiological studies of A-Hong Kong-68 virus infection in dogs</atl><serial><sertitle>Bull World Health Organ</sertitle><pubdate><sdate>19720000</sdate><edate/></pubdate><vid>47</vid></serial><location><pp><ppf>471</ppf><ppl>479</ppl></pp></location></article></nplcit><crossref idref="ncit0042">[0251]</crossref></li>
<li><nplcit id="ref-ncit0043" npl-type="s"><article><author><name>NOBUSAWA, E. et al.</name></author><atl>Comparison of complete amino acid sequences and receptor-binding properties among 13 serotypes of hemagglutinins of influenza A viruses</atl><serial><sertitle>Virology</sertitle><pubdate><sdate>19910000</sdate><edate/></pubdate><vid>182</vid></serial><location><pp><ppf>475</ppf><ppl>485</ppl></pp></location></article></nplcit><crossref idref="ncit0043">[0251]</crossref></li>
<li><nplcit id="ref-ncit0044" npl-type="s"><article><author><name>PATRIARCA, P.A. et al.</name></author><atl>Lack of significant person-to person spread of swine influenza-like virus following fatal infection in an immunocompromised child</atl><serial><sertitle>Am J Epidemiol</sertitle><pubdate><sdate>19840000</sdate><edate/></pubdate><vid>119</vid></serial><location><pp><ppf>152</ppf><ppl>158</ppl></pp></location></article></nplcit><crossref idref="ncit0044">[0251]</crossref></li>
<li><nplcit id="ref-ncit0045" npl-type="s"><article><author><name>PAYUNGPORN S. et al.</name></author><atl>Detection of canine influenza A virus (H3N8) RNA by realtime RT-PCR</atl><serial><sertitle>Journal of Clinical Microbiology</sertitle><pubdate><sdate>20060000</sdate><edate/></pubdate></serial></article></nplcit><crossref idref="ncit0045">[0251]</crossref></li>
<li><nplcit id="ref-ncit0046" npl-type="s"><article><author><name>PAYUNGPORN S et al.</name></author><atl>Isolation and characterization of influenza A subtype H3N8 viruses from dogs with respiratory disease in a shelter and veterinary clinic in Florida</atl><serial><sertitle>Emerging Infectious Diseases</sertitle><pubdate><sdate>20060000</sdate><edate/></pubdate></serial></article></nplcit><crossref idref="ncit0046">[0251]</crossref></li>
<li><nplcit id="ref-ncit0047" npl-type="s"><article><author><name>PEIRIS, M. et al.</name></author><atl>Human infection with influenza H9N2</atl><serial><sertitle>Lancet</sertitle><pubdate><sdate>19990000</sdate><edate/></pubdate><vid>354</vid></serial><location><pp><ppf>916</ppf><ppl>917</ppl></pp></location></article></nplcit><crossref idref="ncit0047">[0251]</crossref></li>
<li><nplcit id="ref-ncit0048" npl-type="s"><article><author><name>PEIRIS, J.S. et al.</name></author><atl>Re-emergence of fatal human influenza A subtype H5N1 disease</atl><serial><sertitle>Lancet</sertitle><pubdate><sdate>20040000</sdate><edate/></pubdate><vid>363</vid></serial><location><pp><ppf>617</ppf><ppl>619</ppl></pp></location></article></nplcit><crossref idref="ncit0048">[0251]</crossref></li>
<li><nplcit id="ref-ncit0049" npl-type="s"><article><author><name>POSNETT, D. N. et al.</name></author><atl>A Novel Method for Producing Anti-peptide Antibodies</atl><serial><sertitle>J. Biol. Chem.</sertitle><pubdate><sdate>19880000</sdate><edate/></pubdate><vid>263</vid><ino>4</ino></serial><location><pp><ppf>1719</ppf><ppl>1725</ppl></pp></location></article></nplcit><crossref idref="ncit0049">[0251]</crossref></li>
<li><nplcit id="ref-ncit0050" npl-type="s"><article><author><name>PUTNAM, BOB</name></author><atl/><serial><sertitle>Two illnesses seen in death of dogs</sertitle><pubdate><sdate>19990210</sdate><edate/></pubdate></serial></article></nplcit><crossref idref="ncit0050">[0251]</crossref></li>
<li><nplcit id="ref-ncit0051" npl-type="s"><article><author><name>REID, A.H. et al.</name></author><atl>Evidence of an absence: the genetic origins of the 1918 pandemic influenza virus</atl><serial><sertitle>Nat Rev Microbiol</sertitle><pubdate><sdate>20040000</sdate><edate/></pubdate><vid>l2</vid></serial><location><pp><ppf>909</ppf><ppl>914</ppl></pp></location></article></nplcit><crossref idref="ncit0051">[0251]</crossref></li>
<li><nplcit id="ref-ncit0052" npl-type="s"><article><author><name>ROWE, T. et al.</name></author><atl>Detection of antibody to avian influenza A (H5N1) virus in human serum by using a combination of serologic assays</atl><serial><sertitle>J Clin Microbiol</sertitle><pubdate><sdate>19990000</sdate><edate/></pubdate><vid>37</vid></serial><location><pp><ppf>937</ppf><ppl>943</ppl></pp></location></article></nplcit><crossref idref="ncit0052">[0251]</crossref></li>
<li><nplcit id="ref-ncit0053" npl-type="s"><article><author><name>SAIKI, R.</name></author><atl>Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia</atl><serial><sertitle>Science</sertitle><pubdate><sdate>19850000</sdate><edate/></pubdate><vid>230</vid></serial><location><pp><ppf>1350</ppf><ppl>1354</ppl></pp></location></article></nplcit><crossref idref="ncit0053">[0251]</crossref></li>
<li><nplcit id="ref-ncit0054" npl-type="b"><article><atl>Plasmid Vectors</atl><book><author><name>SAMBROOK, J. et al.</name></author><book-title>Molecular Cloning: A Laboratory Manual</book-title><imprint><name>Cold Spring Harbor Laboratory Press</name><pubdate>19890000</pubdate></imprint><location><pp><ppf>1.82</ppf><ppl>1.104</ppl></pp></location></book></article></nplcit><crossref idref="ncit0054">[0251]</crossref></li>
<li><nplcit id="ref-ncit0055" npl-type="s"><article><author><name>SUBBARAO, K. et al.</name></author><atl>Characterization of an avian influenza A (H5N1) virus isolated from a child with a fatal respiratory illness</atl><serial><sertitle>Science</sertitle><pubdate><sdate>19980000</sdate><edate/></pubdate><vid>279</vid></serial><location><pp><ppf>393</ppf><ppl>396</ppl></pp></location></article></nplcit><crossref idref="ncit0055">[0251]</crossref></li>
<li><nplcit id="ref-ncit0056" npl-type="s"><article><author><name>SUZUKI, Y. et al.</name></author><atl>Sialic acid species as a determinant of the host range of influenza A viruses</atl><serial><sertitle>J Virol</sertitle><pubdate><sdate>20000000</sdate><edate/></pubdate><vid>74</vid></serial><location><pp><ppf>11825</ppf><ppl>11831</ppl></pp></location></article></nplcit><crossref idref="ncit0056">[0251]</crossref></li>
<li><nplcit id="ref-ncit0057" npl-type="s"><article><author><name>TAM, J. P</name></author><atl>Synthetic Peptide Vaccine Design: Synthesis and Properties of a High-Density Multiple Antigenic Peptide System</atl><serial><sertitle>PNAS USA</sertitle><pubdate><sdate>19880000</sdate><edate/></pubdate><vid>85</vid><ino>15</ino></serial><location><pp><ppf>5409</ppf><ppl>5413</ppl></pp></location></article></nplcit><crossref idref="ncit0057">[0251]</crossref></li>
<li><nplcit id="ref-ncit0058" npl-type="s"><article><author><name>TOP, JR., F.H. et al.</name></author><atl>Swine influenza A at Fort Dix, New Jersey (January-February 1976). IV. Summary and speculation</atl><serial><sertitle>J Infect Dis</sertitle><pubdate><sdate>19770000</sdate><edate/></pubdate><vid>136</vid></serial><location><pp><ppf>S376</ppf><ppl>S380</ppl></pp></location></article></nplcit><crossref idref="ncit0058">[0251]</crossref></li>
<li><nplcit id="ref-ncit0059" npl-type="s"><article><author><name>VINES, A. et al.</name></author><atl>The role of influenza A virus hemagglutinin residues 226 and 228 in receptor specificity and host range restriction</atl><serial><sertitle>J Virol</sertitle><pubdate><sdate>19980000</sdate><edate/></pubdate><vid>72</vid></serial><location><pp><ppf>7626</ppf><ppl>7631</ppl></pp></location></article></nplcit><crossref idref="ncit0059">[0251]</crossref></li>
<li><nplcit id="ref-ncit0060" npl-type="s"><article><author><name>WAGNER, R. et al.</name></author><atl>N-Glycans attached to the stem domain of haemagglutinin efficiently regulate influenza A virus replication</atl><serial><sertitle>J Gen Virol</sertitle><pubdate><sdate>20020000</sdate><edate/></pubdate><vid>83</vid></serial><location><pp><ppf>601</ppf><ppl>609</ppl></pp></location></article></nplcit><crossref idref="ncit0060">[0251]</crossref></li>
<li><nplcit id="ref-ncit0061" npl-type="s"><article><author><name>WEBBY, R. et al.</name></author><atl>Molecular constraints to interspecies transmission of viral pathogens</atl><serial><sertitle>Nat Med</sertitle><pubdate><sdate>20040000</sdate><edate/></pubdate><vid>10</vid></serial><location><pp><ppf>S77</ppf><ppl>S81</ppl></pp></location></article></nplcit><crossref idref="ncit0061">[0251]</crossref></li>
<li><nplcit id="ref-ncit0062" npl-type="s"><article><author><name>WEBSTER, R.G.</name></author><atl>Influenza: an emerging disease</atl><serial><sertitle>Emerg Infect Dis</sertitle><pubdate><sdate>19980000</sdate><edate/></pubdate><vid>4</vid></serial><location><pp><ppf>436</ppf><ppl>441</ppl></pp></location></article></nplcit><crossref idref="ncit0062">[0251]</crossref></li>
<li><nplcit id="ref-ncit0063" npl-type="s"><article><author><name>WEBSTER, R.G. et al.</name></author><atl>Evolution and, ecology of influenza A viruses</atl><serial><sertitle>Microbiol Rev</sertitle><pubdate><sdate>19920000</sdate><edate/></pubdate><vid>56</vid></serial><location><pp><ppf>152</ppf><ppl>179</ppl></pp></location></article></nplcit><crossref idref="ncit0063">[0251]</crossref></li>
<li><nplcit id="ref-ncit0064" npl-type="s"><article><author><name>WEIS, W. et al.</name></author><atl>Structure of the influenza virus haemagglutinin complexed with its receptor, sialic acid</atl><serial><sertitle>Nature</sertitle><pubdate><sdate>19880000</sdate><edate/></pubdate><vid>333</vid></serial><location><pp><ppf>426</ppf><ppl>431</ppl></pp></location></article></nplcit><crossref idref="ncit0064">[0251]</crossref></li>
<li><nplcit id="ref-ncit0065" npl-type="s"><article><author><name>WOMBLE, D.D.</name></author><atl>GCG: The Wisconsin Package of sequence analysis programs</atl><serial><sertitle>Methods Mol Biol</sertitle><pubdate><sdate>20000000</sdate><edate/></pubdate><vid>132</vid></serial><location><pp><ppf>3</ppf><ppl>22</ppl></pp></location></article></nplcit><crossref idref="ncit0065">[0251]</crossref></li>
<li><nplcit id="ref-ncit0066" npl-type="s"><article><author><name>XU, D.</name></author><author><name>MCELROY, D.</name></author><author><name>THORNBURG, R. W.</name></author><author><name>WU, R. et al.</name></author><atl>Systemic induction of a potato pin2 promoter by wounding, methyl jasmonate, and abscisic acid in transgenic rice plants</atl><serial><sertitle>Plant Molecular Biology</sertitle><pubdate><sdate>19930000</sdate><edate/></pubdate><vid>22</vid></serial><location><pp><ppf>573</ppf><ppl>588</ppl></pp></location></article></nplcit><crossref idref="ncit0066">[0251]</crossref></li>
<li><nplcit id="ref-ncit0067" npl-type="s"><article><author><name>YANG, T. T. et al.</name></author><atl>Optimized Codon Usage and Chromophore Mutations Provide Enhanced Sensitivity with the Green Fluorescent Protein</atl><serial><sertitle>Nucleic Acid Research</sertitle><pubdate><sdate>19960000</sdate><edate/></pubdate><vid>24</vid><ino>22</ino></serial><location><pp><ppf>4592</ppf><ppl>4593</ppl></pp></location></article></nplcit><crossref idref="ncit0067">[0251]</crossref></li>
<li><nplcit id="ref-ncit0068" npl-type="s"><article><author><name>YOON K-Y. et al.</name></author><atl>Influenza virus infection in racing greyhounds</atl><serial><sertitle>Emerg Infect Dis.</sertitle><pubdate><sdate>20050000</sdate><edate/></pubdate><vid>11</vid></serial><location><pp><ppf>1974</ppf><ppl>1975</ppl></pp></location></article></nplcit><crossref idref="ncit0068">[0251]</crossref></li>
</ul></p>
</ep-reference-list>
</ep-patent-document>
