TECHNICAL FIELD
[0001] The present invention relates to a process for producing glycolic acid having a high
purity.
BACKGROUND ART
[0002] A glycolic acid (α-hydroxyacetic acid) has hitherto been used as a general purpose
chemical product such as a detergent for boiler scale or the like. However, in recent
years, it has been paid attention to as a raw material of polyglycolic acid useful
as a material for cosmetics, a biodegradable polymer or a polymer for medical applications.
For this reason, there has been increased demand to supply glycolic acid having a
high purity at low cost.
[0003] A glycolic acid of the class which has been currently put on the market and industrially
used is produced by the carbonylation reaction of formaldehyde and water in the presence
of glycolic acid and sulfuric acid. The obtained crude glycolic acid has been purified
through multi-stage steps such as decolorization by activated carbon treatment, removal
of sulfuric acid by an anion exchange resin, removal of low-boiling contaminants by
live steam stripping and removal of metallic contaminants by a cation exchange resin
(Patent Document 1).
[0004] However, the glycolic acid obtained according to the method as described in Patent
Document 1 contains not a little contaminants so that it has a problem as a raw material
for cosmetics or a raw material for polymers in terms of the purity. For example,
organic acids such as oxalic acid, formic acid and the like contaminate in the glycolic
acid in some cases. When the glycolic acid is used as a raw material for polymers,
even though these contaminants are contained in a very small quantity, a dehydrative
condensation reaction of glycolic acid is inhibited and a high molecular weight of
glycolic acid is relatively suppressed. Furthermore, a component for coloring polyglycolic
acid into a black color is also contained in the contaminants. Furthermore, one of
contaminants, methoxyacetic acid, is a compound that is suspected of carcinogenesis,
and it is not desirable that methoxyacetic acid is contained in packing materials
of cosmetics, food or drink.
[0005] In order to enhance the purity of glycolic acid, there has been disclosed a method
including adding glycolic acid having a relatively high purity in a small amount as
a seed crystal to the glycolic acid of an industrial class obtained in the foregoing
purification method and carrying out cooling crystallization at 5 to -18 degree centigrade
for obtaining glycolic acid with a smaller amount of contaminants (Patent Document
2). According to the method described in Patent Document 2, there has been described
that glycolic acid having a purity of 99% or more may be obtained. However, there
is a problem in that the yield is remarkably low (the yield is 6.6% at 5 degree centigrade).
[0006] Meanwhile, there has been described a technology that, when organic acid is produced
according to the fermentation method by a microorganism, electrodialysis is conducted
by an ion exchange membrane, a chelating resin treatment is performed after the electrodialysis,
and a water-splitting electrodialysis is conducted by the ion exchange membrane after
the chelating resin treatment to respectively collect organic acid and alkali (Patent
Document 3).
[0007] However, in the Patent Document, there has been no description on useful polyglycolic
acid as a material for cosmetics, a biodegradable polymer or a polymer for medical
applications, and a raw material glycolic acid for obtaining the polyglycolic acid.
Furthermore, when the glycolic acid obtained according to the method described in
Patent Document 3 is also used as a raw material, the contaminants are not sufficiently
removed, and a high molecular weight of the thus-obtained polyglycolic acid is suppressed.
[0008] Patent Document 4 describes the purification of an α-hydroxy acid prepared by a fermentation
method. The α-hydroxy acid is subjected to at least two crystallization steps.
[0009] Patent Document 5 describes a method for producing high purity glycolic acid. Here,
glycolic acid in an aqueous solution at a specific concentration range is deposited
as glycolic acid crystals, and then the glycolic acid crystals are separated from
the solution.
[0010] Patent Document 6 describes the removal of impurities from organic acid-containing
feed materials using nanofiltration and chelating agents. The organic acid may then
be further purified by electrodialysis.
[0011] Patent Document 7 describes a method for preparing a pure glycolic acid. The method
includes the step of treating glycolic acid with chloroacetic acid and excess alkali
metal hydroxide. After removal of the resulting alkali metal chloride by filtration,
the remaining glycolic acid solution is then subjected to electrodialysis under specified
conditions.
[0012] Patent Document 8 describes a method for preparing α-hydroxy acids using an enzyme
catalyst. Thus, glycolonitrile is reacted in an aqueous mixture with a catalyst having
Acidovorax facilis 72W nitrilase activity to give glycolic acid.
[0013] Patent Document 9 describes a method for prearing an organic acid solution by bipolar
membrane electrodialysis.
[0014] Patent Document 10 describes a method for purifying lactic acid. Lactate is produced
using a lactate salt-producing microorganism. The fermentation broth is electrodialyzed
to recover and concentrate lactate salt, which is then subjected to water-splitting
electrodialysis to form base and a lactic acid product. This acid product is treated
with a strongly acidic ion exchanger and then treated with a weakly basic ion exchanger
to obtain a purified lactic acid product.
[0015] Patent Document 11 describes a method for preparing glycolic acid from ethylene glycol
using a microorganism selected from a strain of
Nocardia,
Rhodococcus or
Escherichia coli B.
[0016] Patent Document 12 describes the preparation of a purified hydroxyacetic acid from
crude hydroxyacetic acid obtained by the carbonylation reaction of formaldehyde and
water in the presence of an organic acid and sulfuric acid. The preparation employs
a crystallization step during the purification of the crude hydroxyacetic acid.
DISCLOSURE OF THE INVENTION
[0018] There have been defects in the conventional methods for producing glycolic acid such
that the purity is low regardless of the fact that the purification step is very complicated
and inefficient, and the yield of the glycolic acid is remarkably lowered for increasing
the cost when high purity glycolic acid is obtained. Furthermore, when glycolic acid
according to the conventional method has been used as a raw material, the physical
properties of the obtained polyglycolic acid could not be satisfied either.
[0019] In order to solve the above object, the present inventors have conducted an extensive
study and as a result, have found that a process for producing glycolic acid obtained
by electrodialysis combined with at least two or more treatments selected from among
activated carbon treatment, ion exchange resin treatment and cooling crystallization
is capable of producing glycolic acid having a much higher purity at low cost and
in large quantities as a raw material of polyglycolic acid useful as a material for
cosmetics, a biodegradable polymer or a polymer for medical applications.
[0020] Furthermore, the present inventors have conducted an extensive study and as a result,
have found the identity of contaminants in the glycolic acid which influence very
badly on the physical properties of the polyglycolic acid and the concentration thereof
when polyglycolic acid is produced from the glycolic acid.
[0021] That is, the present invention is specified by the matters described below.
[1] A process for producing glycolic acid comprising:
a first step of obtaining glycolate by oxidizing an ethylene glycol using a microorganism
having lactoaldehyde reductase and lactoaldehyde dehydrogenase in the presence of
oxygen or by hydrating glycolonitrile using a microorganism having nitrilase activity
or nitrile hydratase activity, and then carrying out the following purification step(s)
(a1) and /or (c) to obtain a solution containing glycolate;
a second step of subjecting the solution containing glycolate to the following step
(a2) to transform glycolate into a glycolic acid and an alkali; and
a third step of subjecting the solution containing the glycolic acid and the alkali
to the following step(s) (b) and/or (d) to remove the alkali and purify the glycolic
acid,
(a1) step for electrodialyzing with an anion exchange membrane and a cation exchange
membrane;
(a2) step for water-splitting electrodialysis;
(b) step for cooling crystallization;
(c) step for treatment with an activated carbon; and
(d) step for treatment with an ion exchange resin,
wherein the kinds and order of the steps are any one of (a1) (a2) (b), (c) (a2) (b),
(c) (a2) (d) (c) or (c) (a2) (c) (d) for the solution containing the glycolate.
[2]. The process for producing glycolic acid as set forth in [1], subsequently carrying
out the step (b) one or two or more times.
[3]. The process for producing glycolic acid as set forth in [1], in which the kinds
and order of the steps are any one of (a1) (c) (a2) (b), (a1) (a2) (d) (b), (a1) (c)
(a2) (d) (b) or (c) (a2) (d) (b) .
[4]. The process for producing glycolic acid as set forth in any one of [1] to [3],
wherein the molar ratio of ethylene glycol to a purified glycolic acid is less than
0.1% after said third step.
[5]. The process for producing glycolic acid as set forth in any one of [1] to [4],
wherein the concentration of ethylene glycol in the solution containing glycolate
obtained in the first step is less than 5% as a molar ratio based on the glycolate.
[6]. The process for producing glycolic acid as set forth in any one of [1] to [5],
wherein the glycolic acid obtained in the third step has the total concentration of
counter cation to the glycolic acid other than hydrogen ion of from 0 to 5 ppm.
[7]. The process for producing glycolic acid as set forth in any one of [1] to [6],
wherein the step (a1) is a step for electrodialyzing with a double-chambered electrodialysis
device comprised an anion exchange membrane and a cation exchange membrane, and the
step (a2) is a step for water-splitting electrodialysis with a double-chambered water-splitting
electrodialysis device.
[0022] According to the process for producing the glycolic acid of the present invention,
the glycolic acid with small contaminants may be produced in less steps and the glycolic
acid having a high purity which may be used as a raw material for polymers may be
industrially produced at low cost. By using the glycolic acid obtained by the process
as a raw material, a (co)polymer of polyglycolic acid having excellent in the physical
properties such as high molecular weight, and color may be obtained.
BRIEF DESCRIPTION OF THE DRAWINGS
[0023] The aforementioned objects and other objects, characteristics and advantages become
further clear by the appropriate embodiments to be described below and the following
drawings accompanied thereto.
[0024]
Fig. 1 is a schematic view of the double-chamber anion/cation exchange membrane electrodialysis
device to be used in the present invention.
Fig. 2 is a schematic view of the double-chamber water-splitting electrodialysis device
to be used in the present invention.
Fig. 3 is a graph illustrating the change with time in the amount of ammonium glycolate
accumulated in a reaction solution in Example 2.
Fig. 4 is a view illustrating the increase of a condensate of glycolic acid and ethylene
glycol, and the decrease of ethylene glycol with time when 0.16 mole% of ethylene
glycol remains in the glycolic acid in Example 15.
BEST MODE FOR CARRYING OUT THE INVENTION
[0025] The present invention will be illustrated in detail below.
(Production of a solution containing a glycolate)
[0026] In the present invention, "a solution containing a glycolate" refers to a state that
a mixture of glycolate or glycolic acid and glycolate is mixed with an optional solvent.
Incidentally, the optional solvent mentioned herein more specifically refers to water.
However, organic matters such as alcohols, or inorganic salts such as phosphoric acid,
sodium chloride, or third components such as protein, and the micooganism may be present
in water regardless of the size of its abundance ratio. Furthermore, as a counter
ion of the glycolate, an optional cation such as ammonium ion, sodium ion, potassium
ion, magnesium ion, or calcium ion may be present regardless of its concentration.
[0027] The glycolate is obtainde by oxidation of ethylene glycol.
[0028] In particular, a solution containing a glycolic acid and/or a glycolate obtained
by bringing a microorganism producing glycolic acid by oxidation of ethylene glycol
into contact with ethylene glycol in the presence of oxygen is the most suitably used.
[0029] In the present invention, the microorganism producing glycolic acid by oxidation
of ethylene glycol refers to a generic term of a microorganism having the ability
to produce glycolic acid from ethylene glycol or a microorganism having the acquired
or enhanced ability to produce glycolic acid from ethylene glycol by using any means.
[0030] Herein, examples of the microorganism having the acquired or enhanced ability to
produce glycolic acid from ethylene glycol include a microorganism having an enzyme
catalyzing a reaction from ethylene glycol to glycolaldehyde and an enzyme catalyzing
a reaction from glycolaldehyde to glycolic acid, or a microorganism having the imparted
or enhanced activity of such an enzyme by any method. Examples of such an enzyme include
lactoaldehyde reductase and lactoaldehyde dehydrogenase. By imparting the enzyme activity
to the wild-type microorganism without having the enzyme activity at all by a method
such as gene recombination, the enzyme activity is significantly enhanced as compared
to the wild-type microorganism so that the ability to produce glycolic acid from ethylene
glycol is acquired or enhanced. Concrete examples of such a microorganism include,
though not restricted to, gene recombined
Escherichia coli as illustrated in Examples.
[0031] These microorganisms may be produced, for example, by using a process for introducing
a gene coding the enzyme to the wild-type microorganism using a technique of gene
recombination. Methods such as preparation of genome DNA, preparation of plasmid,
cutting and connecting of DNA, transformation, PCR (Polymerase Chain Reaction), design
of oligonucleotide used as a primer, synthesis thereof may be conducted in a usual
method well known to the skilled person in the art. These methods are described in
Sambrook, J., et. al., "Molecular Cloning A Laboratory Manual, Second Edition," Cold
Spring Harbor Laboratory Press, (1989).
[0032] In the present invention, as the medium to be used for the culture of microorganisms,
a medium containing carbon source, nitrogen source, inorganic ion and as needed traces
of other organic components may be used. As the carbon source, saccharides such as
glucose, fructose, and molasses; organic acids such as fumaric acid, citric acid,
succinic acid and; and alcohols such as methanol, ethanol, glycerol and are properly
used. As the nitrogen source, inorganic nitrogen sources 25 such as organic ammonium
salts, inorganic ammonium salts, ammonia gas, and ammonia water; and organic nitrogen
sources such as protein hydrolysates; and others are properly used. As the inorganic
ion, magnesium ion, phosphate ion, potassium ion, iron ion, manganese ion and others
are properly used as required. As traces of organic components, vitamin, or amino
acid and yeast extracts containing these, peptone, corn steep liquor, casein digest
and others are properly used.
[0033] Incidentally, as the medium to be used for the present invention, a liquid medium
is preferably used in the light of the industrial production.
[0034] In the present invention, as the conditions for the culture of microorganisms, for
example, when the microorganism is cultured while properly controlling the pH and
temperature in a pH range of 5 to 8, in a temperature range of 25 to 40 degree centigrade
under aerobic conditions, the time required for the culture may be within 50 hours.
[0035] In the present invention, "bringing a microorganism into contact with ethylene glycol
in the presence of oxygen" refers to a state capable of sufficiently bringing ethylene
glycol, a microorganism and oxygen into contact with one another by adding ethylene
glycol and cultured microorganism to a liquid capable of adding ethylene glycol, for
example, a buffer solution such as a potassium phosphate buffer solution or a medium
used for the culture of the microorganism and pure water, blowing air or oxygen using
a sparger, or a single tube, and stirring by using a stirring blade such as a disc
turbine, or refers to a procedure to achieve the state.
[0036] Herein, in the present invention, according to the aforementioned state or procedure,
an action of obtaining a solution containing a glycolate from ethylene glycol is defined
as a "reaction" hereinafter and a solution containing a glycolate obtained by the
"reaction" is defined as a "reaction solution."
[0037] As the reaction solution to be used for a reaction to produce glycolic acid according
to the present invention, a liquid containing ethylene glycol may be used. Examples
thereof include a buffer solution such as a potassium phosphate buffer solution or
a medium used for the culture of the microorganism and pure water.
[0038] Upon the reaction to produce the glycolic acid of the present invention, as the reaction
condition, for example, the reaction is preferably carried out while appropriately
controlling the pH and temperature in a pH range of 6 to 9, in a temperature range
of 20 to 40 degree centigrade.
[0039] As a method for properly controlling the pH, there may be exemplified a process
for timely feeding an aqueous alkali solution sufficiently capable of neutralizing
the generated glycolic acid.
[0040] Examples of the aqueous alkali solution to be used include an aqueous solution of
sodium hydroxide, an aqueous solution of potassium hydroxide, and an aqueous solution
of ammonia. Furthermore, when the glycolic acid is timely neutralized and reacted
in this manner, the glycolic acid is obtained as a glycolate.
[0041] As a method for removing a microoganism in the reaction solution, for example, a
method for removing the microorganism from the reaction solution by centrifugation
may be adopted.
[0042] In particular, for carrying out the present invention, ethylene glycol is contained
in the solution containing a glycolate in some cases. Even though a purification treatment
to be described later is carried out, depending on concentration of the ethylene glycol,
the ethylene glycol may not be completely removed in some cases. Herein, since ethylene
glycol has two hydroxyl groups as a functional group, when the glycolic acid is polymerized
for obtaining polyglycolic acid, the molar balance between a carboxyl group and a
hydroxyl group before the initiation of polymerization is changed. As a result, the
ethylene glycol functions as a polymerization inhibitor. Accordingly, when polyglycolic
acid having a much higher molecular weight is produced, it is important to reduce
the concentration of ethylene glycol in the solution containing a glycolate as much
as possible and to conduct various purification procedures to be described later using
such ethylene glycol for reducing the concentration of ethylene glycol contained in
the glycolic acid to be obtained after the purification as much as possible. Furthermore,
the present inventors have found a phenomenon that, in the glycolate solution containing
the ethylene glycol, even in the low temperature, a condensate of ethylene glycol
and glycolic acid is spontaneously generated and time-dependendly increased. Since
this condensate of ethylene glycol and glycolic acid also has only two hydroxyl groups
as a functional group, the condensate functions as a polymerization inhibitor as well
as ethylene glycol, when the glycolic acid is polymerized for obtaining polyglycolic
acid.
[0043] From the above fact, in the present invention, the concentration of ethylene glycol
contained in the solution containing a glycolate at a step before various purification
treatments to be described later are performed, and the concentration of ethylene
glycol in the glycolic acid after various purification treatments to be described
later are performed are preferably reduced as much as possible. More specifically,
in the solution containing a glycolate at a step before various purification treatments
to be described later are performed, the molar ratio to the glycolate may be reduced
down to less than 5% and more preferably less than 1%. In the glycolic acid after
various purification treatments to be described later are performed, the molar ratio
to the glycolic acid may be reduced down to less than 0.1% and more preferably less
than 0.02%.
(a1) Step for electrodialyzing with an anion exchange membrane and a cation exchange
membrane
[0044] In the present invention, the "electrodialysis device" refers to an electrodialysis
device formed by alternately arranging any two kinds of a cation exchange membrane,
an anion exchange membrane and a bipolar membrane. In the present invention, the electrodialysis
procedure conducted by using this device is defined as an "step for electrodialysis."
Furthermore, as the electrodialysis device to be used in the present invention, there
is an "anion/cation exchange membrane electrodialysis device" obtained by alternately
arranging cation exchange membranes and anion exchange membranes for forming concentrating
chambers and desalination chambers, and as a typical example, there may be cited a
"double-chambered electrodialysis device comprised an anion exchange membrane and
a cation exchange membrane." Then, in the present invention, the electrodialysis procedure
using the "double-chambered-electrodialysis device comprised an anion exchange membrane
and a cation exchange membrane" is defined as a "step for electrodialyzing with the
anion exchange membrane and the cation exchange membrane." More specifically, a typical
example includes a "step for electrodialyzing with a double-chambered electrodialysis
device comprised the anion exchange membrane and the cation exchange membrane."
[0045] As an electrode of the anion/cation exchange membrane electrodialysis device in the
present invention, any known electrodes may be used. That is, as the anode, platinum,
titanium/platinum, carbon, nickel, ruthenium/titanium, and iridium/titanium may be
used. Furthermore, as the cathode, iron, nickel, platinum, titanium/platinum, carbon,
and stainless steel may be used. Furthermore, as the structure of the electrode, any
known structures may be adopted. Examples of the general structure include a mesh-shaped
structure, and a lattice-shaped structure.
[0046] Furthermore, in the present invention, as the cation exchange membrane and anion
exchange membrane of electrodialysis device with the anion/cation exchange membrane,
any conventionally-known membranes may be used.
[0047] Furthermore, in the present invention, the anion/cation exchange membrane electrodialysis
device is constructed by alternately arranging anion exchange membranes and cation
exchange membranes between a positive electrode and a negative electrode for forming
concentrating chambers and desalination chambers.
[0048] Fig. 1 illustrates a schematic view of the typical embodiment of the anion/cation
exchange membrane electrodialysis device used in the present invention.
[0049] That is, in Fig. 1, the anion/cation exchange membrane electrodialysis device is
constructed such that two kinds of cation exchange membranes C and anion exchange
membranes A are alternately arranged as a membrane between a positive electrode 4
and a negative electrode 5 for forming two chambers of concentrating chambers 8 and
desalination chambers 9. A gap 6 between the cation exchange membrane C and the positive
electrode 4, and a gap 7 between the cation exchange membrane C and the negative electrode
5 are filled with an electrode solution.
[0050] As for the structure of the aforementioned anion/cation exchange membrane electrodialysis
device, any known structures may be adopted.
[0051] In the present invention, as the electrodialysis method using the aforementioned
electrodialysis device comprised the anion exchange membrane and the cation exchange
membrane, a method including conducting electrodialysis by placing an external tank
(not illustrated) to be supplied the solution to respective chambers of the concentrating
chambers 8 and the desalination chambers 9 while circulating the solution between
respective chambers and the external tank may be suitably adopted.
[0052] When the glycolic acid solution is supplied to the desalination chamber 9 for carrying
out the anion/cation exchange membrane electrodialysis, the purified glycolate is
concentrated at the concentrating chamber 8. At this time, there are contaminants
such as protein, amino acid, pigments, organic acids such as oxalic acid, glyoxylic
acid, formic acid, and acetic acid, or inorganic salts present in the glycolic acid
solution. However, the electrodialysis with the anion/cation exchange membrane, those
that are transferred to the concentrating chamber 8 and concentrated are mainly the
glycolate and inorganic salts.
[0053] In the present invention, it is suitable that the temperatures of various solutions
at the time of the step for electrodialyzing with anion exchange membrane and cation
exchange membrane are usually in the range of 5 to 70 degree centigrade and preferably
in the range of 20 to 50 degree centigrade.
(c) Step for treatment with an activated carbon
[0054] In the present invention, as the activated carbon to be used when the activated carbon
treatment is performed for the solution containing a glycolate, any known carbons
may be used. Or, the shape thereof may be a powder-like shape, or a granule-like shape.
The amount of use is preferably reduced as much as possible from the economical point
of view. However, specifically, the amount is preferably not more than 20 weight %
based on the solution containing a glycolate which the activated carbon is added.
Furthermore, the amount is more suitably from 1 to 12.5 weight %. A treatment method
is suitably adopted such that the contact temperature and the time are suitably 10
to 30 degree centigrade and 15 to 60 minutes. As the contact method, for example,
a batch method, or a column filling method is adopted.
(a2) Step for water-splitting electrodialysis
[0055] In the present invention, in order to change from the glycolate to the glycolic acid,
a "water-splitting electrodialysis device" is used. The device is an electrodialysis
device having acid chambers and base chambers which is formed by alternately arranging
bipolar membranes and cation exchange membranes. As a typical example, a "a double-chambered
water-splitting electrodialysis device" may be cited. In the present invention, the
electrodialysis procedure using the "water-splitting electrodialysis device" is defined
as a "step for water-splitting electrodialysis." Then, further specifically, as a
typical treatment, a "step for water-splitting electrodialysis with a double-chambered
water-splitting electrodialysis device" may be typically exemplified.
[0056] In the step for water-splitting electrodialysis, the obtained glycolic acid solution
is subjected to the step for water-splitting electrodialysis using the water-splitting
electrodialysis device for recovering glycolic acid and alkali respectively.
[0057] Namely, the glycolic acid solution is provided to the water-splitting electrodialysis
device using the bipolar membrane and the cation exchange membrane for performing
the step for water-splitting electrodialysis so that glycolic acid is obtained from
the acid chamber and alkali is obtained from the base chamber respectively.
[0058] As the bipolar membrane in the present invention, any conventionally-known bipolar
membranes, that is, any known bipolar membranes having a structure attached the cation
exchange membrane and an anion exchange membrane, may be used.
[0059] Furthermore, in the present invention, as the cation exchange membrane of the water-splitting
electrodialysis device, any known cation exchange membranes may be used.
[0060] In the present invention, the water-splitting electrodialysis device is constructed
by alternately arranging bipolar membranes and cation exchange membranes between a
positive electrode and a negative electrode for forming acid chambers and base chambers.
[0061] Fig. 2 illustrates a schematic view of the typical embodiment of the water-splitting
electrodialysis device used in the present invention.
[0062] That is, in Fig. 2, the water-splitting electrodialysis device is constructed such
that two kinds of bipolar membranes B and cation exchange membranes C are alternately
arranged between a positive electrode 4 and a negative electrode 5 for forming two
chambers of acid chambers 11 and base chambers 10. A gap 6 between the cation exchange
membrane C and the positive electrode 4, and a gap 7 between the cation exchange membrane
C and the negative electrode 5 are filled with an electrode solution. Herein, a chamber
between the anion exchanger side of the bipolar membrane B and the cation exchange
membrane C is the base chamber 10, while a chamber between the cation exchanger side
of the bipolar membrane B and the cation exchange membrane C is the acid chamber 11.
[0063] As for the structure of the aforementioned water-splitting electrodialysis device,
any known structures may be adopted.
[0064] In the present invention, as the step for water-splitting electrodialysis using the
aforementioned water-splitting electrodialysis device, a method including conducting
electrodialysis by placing an external tank (not illustrated) to be supplied the solution
to respective chambers in the acid chambers 11 and the base chambers 10 while circulating
the solution between respective chambers and the external tank may be suitably adopted.
[0065] When the aforementioned glycolic acid solution is supplied to the acid chamber 11
for carrying out electrodialysis, the glycolate of the acid chamber 11 is electrically
connected and at the same time converted to glycolic acid.
[0066] Namely, the cation of the glycolate introduced into the acid chamber 11 passes through
the cation exchange membrane C and transferred to the base chamber 10, and at this
time, is combined with OH ion generated from the bipolar membrane B to be a base.
Furthermore, in the acid chamber 11, proton generated from the bipolar membrane B
and the glycolic acid anion are combined to be a nondissociative glycolic acid which
remains in the acid chamber 11 as it is.
[0067] In the present invention, it is suitable that the temperatures of various solutions
upon the step for water-splitting electrodialysis are usually in the range of 5 to
70 degree centigrade and preferably in the range of 20 to 50 degree centigrade.
[0068] As described above, according to the step for water-splitting electrodialysis, the
glycolate is decomposed so that glycolic acid and alkali may be separated for recovering
the glycolic acid.
[0069] Incidentally, the separated alkali may be reused as a neutralizing agent in an organic
acid fermentation such as glycolic acid.
[0070] According to the aforementioned step for electrodialyzing with anion exchange membrane
and cation exchange membrane and step for water-splitting electrodialysis, glycolic
acid having a higher purity than the commercial/industrial class may be obtained.
[0071] That is, the purity of the glycolic acid of the commercial/industrial class is about
82%, while the purity of the glycolic acid obtained by the step for electrodialyzing
with anion exchange membrane and cation exchange membrane and the step for water-splitting
electrodialysis is about 98%.
(d) Step for treatment with an ion exchange resin
[0072] In the present invention, for the ion exchange resin treatment, any known cation
exchange resins may be used. However, in particular, a cation exchange resin having
a strong acidic ion exchange group is suitably used. As such a strong acidic ion exchange
group, a sulfonic acid group may be cited. The amount of use is from 1 to 10 weight
% and more suitably from 3 to 5 weight % based on the glycolic acid solution which
the cation exchange resin is added. A treatment method is suitably adopted such that
the contact temperature and the time are suitably 10 to 30 degree centigrade and for
15 to 60 minutes. As the contact method, for example, a batch method, or a column
filling method is adopted. According to the procedure, cation such as sodium ion,
potassium ion, ammonium ion, calcium ion, and magnesium ion may be removed by adsorption
so that the concentration of cation remained in the solution after the treatment is
not more than 5 ppm based on the glycolic acid.
(e) Step for concentration
[0073] In the present invention, the concentration step is conducted according to the known
concentration method. For example, the heating may be conducted at 20 to 80 degree
centigrade and more suitably at 30 to 40 degree centigrade under reduced pressure.
However, the present invention is not restricted thereto. According to the concentration
treatment, the glycolic acid solution may be concentrated at any concentration, but
it may be preferably concentrated at not less than 70 weight % and more preferably
from 70 to 85 weight %.
(b) Step for cooling crystallization
[0074] In the present invention, as the cooling crystallization treatment method, any known
methods may be used. However, by performing the concentration treatment mentioned
before and cooling the glycolic acid solution concentrated at 70 to 85 weight % at
a temperature of from 5 to -25 degree centigrade and more suitably from 4 to -20 degree
centigrade, glycolic acid crystals may be obtained with a high yield of 32% to 75%.
In particular, there is no need to add pure glycolic acid as a seed crystal, but the
pure glycolic acid may also be added. Further, by allowing the solution to stand without
stirring during cooling, it is possible to obtain crystals in which a crystal particle
diameter is much larger, the purity is high, and filtering and recovery are easy.
As the material of the vessel used for performing the cooling crystallization, any
known materials such as glass, or SUS may be used.
[0075] As a method for recovering the obtained crystals, known methods for separating crystals
from a mother liquor may be used. For example, the crystals and filtrate may be separated
by using a batch pressure filter represented by a filter press, a vacuum belt filter
or a leaf filter, or a centrifuge represented by a screw demayter, though not restricted
thereto. Furthermore, before the separated crystal cake is dried, it may be washed
with various solvents such as water, and an aqueous glycolic acid solution, alcohol.
[0076] As a method for drying the recovered crystal, any known methods may be used. For
example, however, it is suitable to vacuum dry in a vacuum dryer at 10 to 25 degree
centigrade for 16 to 24 hours.
[0077] Furthermore, the process for producing the glycolic acid of the present invention
is performed in any of the following orders for the solution containing a glycolate:
- (1) step (a1), step (a2), step (b);
- (2) step (c), step (a2), step (b);
- (3) step (c), step (a2), step (d), step (c); and
- (4) step (c), step (a2), step (c), step (d).
[0078] By performing the process for producing the glycolic acid in such an order, the glycolic
acid having a much higher purity may be produced.
[0079] Furthermore, from the viewpoint of producing glycolic acid having a high purity,
it is also preferable that the steps are conducted in the aforementioned order, and
subsequently the (b) step for cooling crystallization is conducted one or two or more
times.
[0080] In the present invention, as an embodiment of performing the (b) step for cooling
crystallization lastly, a solution containing a glycolate is preferably subjected
to any of the following steps in one of the following orders, from the viewpoint of
producing glycolic acid having a high purity:
(5) step (a1), step (c), step (a2), step (b);
(6) step (a1), step (a2), step (d), step (b);
(7) step (a1), step (c), step (a2), step (d), step (b); or
(8) step (c), step (a2), step (d), step (b).
[0081] Furthermore, just before the (b) step for cooling crystallization, it is preferable
to perform the (e) concentration step of the glycolic acid solution. In this manner,
the (b) step for cooling crystallization may be efficiently performed.
[0082] According to the process for producing the glycolic acid including such steps of
the present invention, it is possible to obtain glycolic acid having a high purity
in which the molar ratio of ethylene glycol contained in the glycolic acid to the
glycolic acid is reduced down to less than 0.1% and preferably less than 0.02%. By
using such glycolic acid, it is possible to produce a (co)polymer of polyglycolic
acid in which the molecular weight is higher than the conventional one and coloring
is reduced.
[0083] Furthermore, in the glycolic acid obtained by the process for producing the glycolic
acid of the present invention, the total concentration of a counter cation other than
hydrogen ion such as ammonium ion is reduced down to not more than 5 ppm and preferably
0 to 1 ppm based on the glycolic acid. Therefore, coloring of the polyglycolic acid
obtained by using the glycolic acid as a raw material is reduced and the transmittance
is enhanced.
[0084] By using the glycolic acid obtained in the production process of the present invention
and performing the polymerization according to the method to be described later, a
polyglycolic acid or glycolic acid copolymer with less coloring and having a high
molecular weight may be obtained.
[0085] One example of the processes for producing polyglycolic acid include a polymerization
method of glycolic acid in which includes a two-stage step of,
[first step]: a step for obtaining an oligomer by dehydrating the aqueous glycolic
acid solution in an ordinary pressure or under reduced pressure at a temperature of
from 100 degree centigrade or more to 160 degree centigrade or less and having a weight
average molecular weight of from 1,000 to 10,000; and
[second step]: a step for drying in the air the oligomer obtained in the first step,
and solid polymerization in an inert gas flow, at a temperature of from 180 degree
centigrade or more to 230 degree centigrade or less to obtain polymer having a weight
average molecular weight of not less than 30, 000. But the present invention is not
restricted thereto.
[0086] Further, the glycolic acid copolymer may be produced by a known method, or it may
be obtained by subjecting glycolic acid and a compound having one each of a hydroxyl
group and a carboxylic acid group or any of two groups thereof as a functional group
in a molecule as a raw material to polycondensation. Examples of the aforementioned
compound include isophthalic acid, ethylene glycol, and diethylene glycol.
[0087] The present invention is now illustrated in detail below with reference to Examples.
Incidentally, in Examples 1 to 8, a series of steps to obtain glycolic acid from ammonium
glycolate are explained.
[0088] As for a method for measuring the concentration of each component according to the
present invention, the following method may be cited as a typical example.
[Concentration of glycolic acid and concentration of ethylene glycol]
[0089] Using high performance liquid chromatography (HPLC) manufactured by Hitachi Ltd.,
the concentrations were quantitatively analyzed with the following settings: column;
ULTRON PS-80H (a product of Shinwa Chemical Industries Ltd.), eluent; aqueous perchloric
acid solution (pH=2.1), flow rate; 1.0 mL/min. The glycolic acid was detected at a
wavelength of 210 nm using UV as a detector. Furthermore, ethylene glycol was detected
with the same HPLC at the same settings using a differential thermal refractometer
(RI) as a detector.
[Concentration of cation]
[0090] Using ion chromatography manufactured by JASCO Corp., it was quantitatively analyzed
with the following settings: column; Shodex IC YK-421 (a product of Showa Denko K.K.),
eluent; 3mM aqueous phosphoric acid solution, flow rate; 1.0 mL/min. Furthermore,
an electric conductivity meter was used as a detector.
Example 1
Construction of lactaldehyde reductase and lactoaldehyde dehydrogenase co-expression
vector and a transformant of the expression vector
[0091] The amino acid sequence of lactaldehyde reductase of
Escherichia coli and the base sequence of its gene (hereinafter may be simply referred to as fucO)
have been already reported (GenBank accession number: M31059). Furthermore, the amino
acid sequence of lactoaldehyde dehydrogenase of
Escherichia coli and the base sequence of a gene (hereinafter may be simply referred to as aldA) have
been already reported (GenBank accession number: M64541). In order to acquire fucO,
GCTCTAGACGGAGAAAGTCTTATGATGGCTAACAGAATGATTCTG (Sequence No. 1) and GTGAAGCTTGCATTTACCAGGCGGTATGG
(Sequence No. 2) were amplified with a PCR method using the genome DNA of
Escherichia coli MG1655 strain as a template, and the obtained DNA fragments were digested with restriction
enzymes XbaI and HindIII to obtain a fucO fragment of-about 1.2 kbp. Furthermore,
in order to acquire aldA, CGAATTCCGGAGAAAGTCTTATGTCAGTACCCGTTCAACATCC (Sequence No.
3) and GCTCTAGACTCTTTCACTCATTAAGACTG (Sequence No. 4) were amplified with a PCR method
using the genome DNA of
Escherichia coli MG1655 strain as a template, and the obtained DNA fragments were digested with restriction
enzymes EcoRI and XbaI to obtain an aldA fragment of about 1.5 kbp. Furthermore, in
order to acquire a glyceraldehyde 3-phosphate dehydrogenase (GAPDH) promoter, AACGAATTCTCGCAATGATTGACACGATTC
(Sequence No. 5) and ACAGAATTCGCTATTTGTTAGTGAATAAAAGG (Sequence No. 6) were amplified
with a PCR method using the genome DNA of
Escherichia coli as a template, and the obtained DNA fragments were digested with a restriction enzyme
EcoRI to obtain DNA fragments of about 100 bp which encodes a GAPDH promoter (in the
base sequence information of GenBank accession number X02662, described in 397-400).
The above-mentioned three DNA fragments were mixed with the fragment obtained by digestion
of plasmid pUC18 using restriction enzymes EcoRI and HindIII, ligated using a ligase,
and then transformed to an
Escherichia coli DH5α strain to obtain a transformant which grows on an LB agar plate containing 50
µg/mL of ampicillin. The obtained colony was cultured in an LB liquid medium containing
50 µg/mL of ampicillin at 37 degree centigrade overnight, and a plasmid pGAPfucO-aldA
was recovered from the obtained microorganism. This plasmid pGAPfucO-aldA was transformed
to an
Escherichia coli MG1655 strain, and cultured on an LB agar plate containing 50 µg/mL of ampicillin
at 37 degree centigrade overnight to obtain a MG1655/pGAPfucO-aldA strain.
[0092] Incidentally, the
Escherichia coli MG1655 strain and
Escherichia coli DH5α strain may be available from the Amerimay Type Culture Collection.
Example 2
Production of ammonium glycolate by Escherichia coli MG1655/pGAPfucO-aldA strain
[0093] The
Escherichia coli MG1655/pGAPfucO-aldA strain obtained in Example 1 was inoculated into 25 mL of LB
Broth, Miller medium (Difco244620) contained in a conical flask, and the overnight
culture was carried out with stirring with 120 rpm at a culture temperature of 35
degree centigrade as preculture. Then, the whole amount of the preculture solution
was transferred to a 1L-fermentor (BMJ-01, culture apparatus manufactured by ABLE
Corporation) containing 475 g of the medium of the composition shown in Table 1 to
carry out the culture. The culture was carried out under the conditions including
atmospheric pressure, an aeration rate of 1 vvm, an agitation rate of 800 rpm, a culture
temperature of 35 degree centigrade and pH of 7.2 (adjusted with an aqueous ammonia
solution). After 24 hours from initiating the culture, ethylene glycol was added thereto
at a rate of 5 g/hr for 22 hours. The amount of ammonium glycolate accumulated in
the culture was measured with HPLC according to an established method. The results
are shown in Fig. 3.
[0094] It was confirmed that 129 g/L of ammonium glycolate was accumulated in the
Escherichia coli MG1655/pGAPfucO-aldA strain for 22 hours. Further, the concentration of the remained
ethylene glycol was less than 0.002 mole% based on ammonium glycolate.
[Table 1]
| Medium Composition |
| Polypepton |
7 g/L |
| Glucose |
30 g/L |
| Fe2SO4 |
0.09 g/L |
| K2HPO4 |
2 g/L |
| KH2PO4 |
2 g/L |
| MgSO4·7H2O |
2 g/L |
| (NH4)2SO4 |
1.5 g/L |
Example 3
Preparation of the glycolic acid solution by electrodialyzing with a double-chambered
electrodialysis device comprised the anion exchange membrane and the cation exchange
membrane
[0095] As the double-chambered electrodialysis device comprised the anion exchange membrane
and the cation exchange membrane, it was used a filter press type electrodialysis
device in which 10 membranes (total effective membrane area: 550 cm
2) each of anion exchange membranes (a product of Astom Co., Ltd., product name: Neosepta
ACS) and cation exchange membranes (a product of Astom Co., Ltd., Neosepta CMX) were
respectively arranged by turns for forming desalination chambers and concentrating
chambers. A tank used for supplying 3 kg of the ammonium glycolate solution obtained
in Example 2 to the desalination chambers and a tank used for supplying 1.2 kg of
pure water to the concentrating chambers were placed, the ammonium glycolate solution
and pure water were supplied and circulated. Incidentally, as an electrode solution,
1.5 kg of a 2% aqueous solution of sulfuric acid was used. Using these devices, electrodialysis
was performed at room temperature (about 25 degree centigrade), at a constant voltage
of 15V for 11 hours. As a result, 2.3 kg of an ammonium glycolate solution having
a concentration of ammonium glycolate of 16.2 weight % was obtained from the concentrating
chamber.
Example 4
[0096] Activated carbon treatment of a glycolic acid solution 119 g of activated carbon
Lewatit AF5 (a product of LANXESS) in which moisture was easily wiped up after washing
with water was taken in a 1L beaker. To the beaker was added 5 kg of the ammonium
glycolate solution obtained in Example 3. The resulting mixture was stirred at 25
degree centigrade for 15 minutes, and then a supernatant treated by decantation was
transferred to another vessel. The recovered supernatant was vacuum filtered for removing
powdered activated carbon particles. By the procedure, organic acid, an organic acid
salt, impure protein and a coloring component other than the glycolate were removed.
Furthermore, the recovery rate of ammonium glycolate according to the procedure was
98.8%.
Example 5
Preparation of the glycolic acid solution from the glycolate solution by double-chambered
water-splitting electrodialysis device
[0097] As the double-chambered water-splitting electrodialysis device, it was used a filter
press type electrodialysis device in which 10 membranes (total effective membrane
area: 550 cm
2) each of cation exchange membranes (a product of Astom Co., Ltd., product name: Neosepta
CMX) and bipolar membranes (a product of Astom Co., Ltd., Neosepta BP-1) were respectively
arranged by turns for forming acid chambers and base chambers. A tank used for supplying
2.5 kg of the ammonium glycolate solution obtained in Example 4 to the acid chambers
and a tank used for supplying 2.5 kg of pure water to the base chambers were placed,
the ammonium glycolate solution and pure water were supplied and circulated. Incidentally,
as an electrode solution, 2 kg of a 2% aqueous solution of sulfuric acid was used.
Using these devices, electrodialysis was performed at room temperature (about 25 degree
centigrade), at a constant voltage of 20V for 10.5 hours. As a result, 2.3 kg of a
glycolic acid solution having a concentration of the glycolic acid of 12.3 weight
% and a concentration of ammonium ion of 800 ppm was obtained from the acid chamber,
while 2.7 kg of ammonia water was obtained from the base chamber.
Example 6
Treatment of a glycolic acid solution by cation exchange resin
[0098] 80 mL of a cation exchange resin (Dowex 50W-X8-200) was suspended in pure water,
filled in a column having a diameter of 2.5 cm, and washed with pure water of 10 times
or more in volume. After washed, the glycolic acid solution obtained in Example 5
was penetrated into the column at a flow rate of 7 mL/min by using a constant flow
rate pump. The recovered glycolic acid solution was analyzed by ion chromatography
and as a result, the concentration of ammonium ion was reduced down to less than the
limit of detection (1 ppm) from 800 ppm. Furthermore, the recovery rate of the glycolic
acid according to the procedure was 100%.
Example 7
Concentration of the glycolic acid solution
[0099] 4.5 kg of the glycolic acid solution obtained in Example 6 was concentrated under
reduced pressure at 100 mbar, at 30 degree centigrade for 12 hours using a rotary
vacuum evaporator (a product of EYELA Co., Ltd.) and as a result, 663 g of a glycolic
acid solution having a concentration of the glycolic acid of 78.9 weight % and a concentration
of ammonium ion of less than the limit of detection (1 ppm) was obtained.
Example 8
Preparation of glycolic acid by cooling crystallization
[0100] 446 g of the glycolic acid solution obtained in Example 7 was maintained at -20 degree
centigrade for 16 hours. In the meantime, a large number of hexagonal crystals were
generated. A buchner funnel equipped with 5A filter paper (a product of Advantec MFS,
Inc.) was attached to a suck bottle, and the crystals were sucked up with a vacuum
pump and recovered by suction filtration. The recovered crystals were transferred
to a plastic Petri dish having a diameter of 10 cm, and dried under reduced pressure
at 26 degree centigrade for 24 hours. The crystals were analyzed and as a result,
254 g of glycolic acid crystals (yield: 72.4%) having a concentration of the glycolic
acid of 99.99 weight % and a concentration of ammonium ion of less than the limit
of detection (1 ppm) was obtained.
Example 9
Polymerization evaluation of glycolic acid obtained by combining treatment with double-chambered
electrodialysis device, treatment with activated carbon treatment, concentration treatment
and cooling crystallization
[0101] Using the
Escherichia coli MG1655/pGAPfucO-aldA strain described in Example 1, 2 kg of the ammonium glycolate
solution (concentration of ammonium glycolate: 12.9 weight %) obtained by the method
as described in Example 2 was subjected to treatment with double-chambered electrodialysis
device comprised the anion exchange membrane and the cation exchange membrane described
in Example 3 to obtain 1.5 kg of an ammonium glycolate solution (concentration of
ammonium glycolate: 16.8 weight %). Subsequently, the activated carbon treatment described
in Example 4 was conducted to obtain 1.6 kg of an ammonium glycolate solution (concentration
of ammonium glycolate: 15.8 weight %), and then the water-splitting electrodialysis
with a double-chambered water-splitting electrodialysis device described in Example
5 was performed to obtain 1.5 kg of a glycolic acid solution (concentration of glycolic
acid: 12.2 weight %). Furthermore, the concentration treatment described in Example
7 was performed, whereby 226 g of a 80 weight % glycolic acid solution was obtained
and subsequently the glycolic acid solution was subjected to the cooling crystallization
described in Example 8 to obtain 131 g of glycolic acid. 280 ppm of ammonium ion remained
in the obtained glycolic acid. Using the glycolic acid as a raw material, a polycondensation
reaction was carried out to prepare polyglycolic acid. The polymerization procedure
was conducted in the following manner.
First Step
[0102] To a 4-necked flask equipped with a stirring device, a thermometer, a dewatering
conduit and a cock without bottom 100.0 g of the foregoing aqueous glycolic acid solution
adjusted to 70 weight % with distilled water was introduced.
[0103] After repeating degassing and nitrogen substitution 3 times while stirring, the resulting
material was heated in an ordinary pressure from room temperature to 140 degree centigrade
for 2 hours for roughly dehydrating moisture contained in the aqueous glycolic acid
solution. Thereafter, by maturing in an ordinary pressure at 140 degree centigrade
for 1 hour and subsequently decompressing from ordinary pressure to 70 kPa at 140
degree centigrade little by little, remained moisture and condensed water were removed.
In this stage, the viscosity of the solution in the flask was a little increased.
Furthermore, the solution was matured at 70 kPa, at 140 degree centigrade for 30 minutes,
and then returned to ordinary pressure, and the content was taken out from the cock
without bottom of the reaction flask. By taking the content out and rapidly cooling
it, the content became an oligomer of a white crystal solid. The yield of the obtained
white crystal solid oligomer was 50.9 g. In this stage, the molecular weight of the
polyglycolic acid oligomer was 6,000 in terms of the weight average molecular weight
(Mw).
Second Step
[0104] The above obtained polyglycolic acid oligomer solid was pulverized and classified
to give a pellet having a particle diameter of 2.36 to 1.00 mm. 20 g of this pellet
was filled in a SUS column having an inner volume of 100 cc capable of nitrogen circulation.
This column was fixed in an inert oven, and the resulting material was subjected to
a solid polymerization step by step at each temperature of 120, 180, 200, 210 and
220 degree centigrade for 20 hours respectively under the condition of a nitrogen
gas flow rate, that is, a specific velocity (hereinafter referred to as Sv) of 200
ml/hr/g. After the last solid polymerization at 220 degree centigrade, a pellet of
the polyglycolic acid was recovered. To evaluate the quality of the obtained polyglycolic
acid, the color and the molecular weight were evaluated. For the color, 1.9 g of 1N
sodium hydroxide was added to 0.1 g of the obtained polyglycolic acid, and the resulting
solution was incubated in a thermostatic bath at 50 degree centigrade for 20 hours,
hydrolyzed and then diluted with 3.0 g of distilled water to give a sample. The transmittance
of the sample was measured at 300 nm using a UV/Vis absorption spectrophotometer.
3 mg of the obtained polyglycolic acid was heated using an oven at 250 degree centigrade
for 2 minutes to obtain an amorphous polymer and the resulting amorphous polymer was
dissolved in hexafluoroisopropanol for measuring the molecular weight using GPC. The
results were shown in Table 2.
[Table 2]
| Color (Transmittance %) |
Molecular weight (Mw) |
| 68.1 |
87000 |
Example 10
Polymerization evaluation of glycolic acid produced by combining activated carbon
treatment with a double-chambered electrodialysis device, concentration treatment
and cooling crystallization
[0105] Using the
Escherichia coli MG1655/pGAPfucO-aldA strain described in Example 1, 2 kg of the ammonium glycolate
solution (concentration of ammonium glycolate: 12.9 weight %) obtained by the method
as described in Example 2 was subjected to the activated carbon treatment described
in Example 4 to obtain 2 kg of ammonium glycolate (concentration of ammonium glycolate:
12.8 weight %). Subsequently, the treatment with double-chambered water-splitting
electrodialysis device described in Example 5 was conducted to obtain 1.4 kg of a
glycolic acid solution (concentration of glycolic acid: 13.0 weight %). Thereafter,
the concentration treatment described in Example 7 was performed, whereby 230 g of
a 80 weight % glycolic acid solution was obtained, and then the glycolic acid solution
was subjected to the cooling crystallization described in Example 8 to obtain 133
g of glycolic acid. In the obtained glycolic acid, the concentration of ammonium ion
was 300 ppm. Using the glycolic acid as a raw material, a polycondensation reaction
was conducted to produce polyglycolic acid. The evaluation of the color and evaluation
of the molecular weight of the polyglycolic acid obtained by the polymerization procedure
and polymerization were conducted in the same manner as in Example 9. The results
were shown in Table 3.
[Table 3]
| Color (Transmittance %) |
Molecular weight (Mw) |
| 63.0 |
89000 |
Example 11
Polymerization evaluation of glycolic acid produced by combining treatment with the
double-chambered electrodialysis device, treatment with cation exchange resin, concentration
treatment and cooling crystallization
[0106] Using the
Escherichia coli MG1655/pGAPfucO-aldA strain described in Example 1, 2 kg of the ammonium glycolate
solution (concentration of ammonium glycolate: 12.9 weight %) obtained by the method
as described in Example 2 was subjected to the double-chamber anion/cation exchange
membrane electrodialysis described in Example 3 to obtain 1.5 kg of an ammonium glycolate
solution (concentration of ammonium glycolate: 16.8 weight %). Subsequently, the double-chamber
water-splitting electrodialysis described in Example 5 was conducted to obtain 1.4
kg of a glycolic acid solution (concentration of glycolic acid: 13.0 weight %), and
then the cation exchange resin treatment described in Example 6 was performed to obtain
1.5 kg of a glycolic acid solution (concentration of glycolic acid: 12.3 weight %).
Furthermore, the concentration treatment described in Example 7 was performed, whereby
230 g of a 80 weight % glycolic acid solution was obtained, and subsequently the glycolic
acid solution was subjected to the cooling crystallization described in Example 8
to obtain 133 g of glycolic acid. In the obtained glycolic acid, the concentration
of ammonium ion was less than the limit of detection (1 ppm). Using the glycolic acid
as a raw material, a polycondensation reaction was conducted to produce polyglycolic
acid. The evaluation of the color and evaluation of the molecular weight of the polyglycolic
acid obtained by the polymerization procedure and polymerization were conducted in
the same manner as in Example 9. The results were shown in Table 4.
[Table 4]
| Color (Transmittance %) |
Molecular weight (Mw) |
| 90.4 |
92000 |
Example 12
Polymerization evaluation of glycolic acid produced by combining treatment with the
double-chambered electrodialysis device comprised the anion exchange membrane and
the cation exchange membrane, concentration treatment and cooling crystallization
[0107] Using the
Escherichia coli MG1655/pGAPfucO-aldA strain described in Example 1, 2 kg of the ammonium glycolate
solution (concentration of ammonium glycolate: 12.9 weight %) obtained by the method
as described in Example 2 was subjected to the electrodialyzing with a double-chambered
electrodialysis device comprised the anion exchange membrane and the cation exchange
membrane described in Example 3 to obtain 1.5 kg of an ammonium glycolate solution
(concentration of ammonium glycolate: 16.8 weight %). Then, the water-splitting electrodialysis
with a double-chambered water-splitting electrodialysis device described in Example
5 was conducted to obtain 1.4 kg of a glycolic acid solution (concentration of glycolic
acid: 13.0 weight %), and then the concentration treatment described in Example 7
was performed to obtain 230 g of a 80 weight % glycolic acid solution. Subsequently,
the glycolic acid solution was subjected to the cooling crystallization described
in Example 8, and the obtained crystals were washed with 130 g of the 80 weight %
glycolic acid solution separately prepared 5 times to obtain 110 g of glycolic acid.
1 ppm of ammonium ion remained in the obtained glycolic acid. Further, when the crystals
were washed with 80 weight % glycolic acid 3 times, 120 g of glycolic acid was obtained.
5 ppm of ammonium ion remained in the obtained glycolic acid. Furthermore, when the
crystals were not washed with 80 weight % glycolic acid, 130 g of the glycolic acid
was recovered and 380 ppm of ammonium ion remained therein. Using the glycolic acid
as a raw material, a polycondensation reaction was conducted to produce polyglycolic
acid. The evaluation of the color and evaluation of the molecular weight of the polyglycolic
acid obtained by the polymerization procedure and polymerization were conducted in
the same manner as in Example 9. The results were shown in Table 5.
[Table 5]
| Washing procedure |
Ammonium ion (ppm) |
Color (Transmittance %) |
Molecular weight (Mw) |
| Yes (5 times) |
1 |
88.0 |
72000 |
| Yes (3 times) |
5 |
80.0 |
72000 |
| No |
380 |
61.0 |
72000 |
Example 13
Polymerization evaluation of glycolic acid produced by combining double-chamber electrodialysis
with activated carbon treatment, cation exchange resin treatment, concentration treatment
and cooling crystallization
[0108] Using the
Escherichia coli MG1655/pGAPfucO-aldA strain described in Example 1, 2 kg (concentration of ammonium
glycolate: 12.9 weight %) of the ammonium glycolate solution obtained by the method
as described in Example 2 was subjected to the double-chamber anion/cation exchange
membrane electrodialysis described in Example 3 to obtain 1.5 kg of an ammonium glycolate
solution (concentration of ammonium glycolate: 16.8 weight %). Subsequently, the activated
carbon treatment described in Example 4 was conducted to obtain 1.6 kg of an ammonium
glycolate solution (concentration of ammonium glycolate: 15.8 weight %), and then
the double-chamber water-splitting electrodialysis described in Example 5 was performed
to obtain 1.5 kg of a glycolic acid solution (concentration of glycolic acid: 12.2
weight %). Furthermore, the cation exchange resin treatment described in Example 6
was performed, whereby 1.6 kg of a glycolic acid solution (concentration of glycolic
acid: 11.4 weight %) was obtained, while the concentration treatment described in
Example 7 was performed, whereby 226 g of a 80 weight % glycolic acid solution was
obtained. Next, the glycolic acid solution was subjected to the cooling crystallization
described in Example 8 to obtain 131 g of glycolic acid. In the obtained glycolic
acid, the concentration of ammonium ion was less than the limit of detection (1 ppm).
Using the glycolic acid as a raw material, a polycondensation reaction was conducted
to produce polyglycolic acid. The evaluation of the color and evaluation of the molecular
weight of the polyglycolic acid obtained by the polymerization procedure and polymerization
were conducted in the same manner as in Example 9. The results were shown in Table
6.
[Table 6]
| Color (Transmittance %) |
Molecular weight (Mw) |
| 88.8 |
83000 |
Example 14
Polymerization evaluation of glycolic acid produced by combining activated carbon
treatment with the double-chambered electrodialysis device, treatment with the cation
exchange resin, concentration treatment and cooling crystallization
[0109] Using the
Escherichia coli MG1655/pGAPfucO-aldA strain described in Example 1, 2 kg of an ammonium glycolate
solution (concentration of ammonium glycolate: 12.9 weight %) obtained by the method
as described in Example 2 was subjected to the activated carbon treatment described
in Example 4 to obtain 2 kg of an ammonium glycolate solution (concentration of ammonium
glycolate: 12.8 weight %). Subsequently, the water-splitting electrodialysis with
a double-chambered water-splitting electrodialysis device described in Example 5 was
conducted to obtain 1.5 kg of a glycolic acid solution (concentration of glycolic
acid: 12.2 weight %). The cation exchange resin treatment described in Example 6 was
performed to obtain 1.6 kg of a glycolic acid solution (concentration of glycolic
acid: 11.4 weight %), while the concentration treatment described in Example 7 was
performed to obtain 226 g of a 80 weight % glycolic acid solution. Next, the glycolic
acid solution was subjected to the cooling crystallization described in Example 8
to obtain 131 g of glycolic acid. In the obtained glycolic acid, the concentration
of ammonium ion was less than the limit of detection (1 ppm). Using the glycolic acid
as a raw material, a polycondensation reaction was conducted to produce polyglycolic
acid. The evaluation of the color and evaluation of the molecular weight of the polyglycolic
acid obtained by the polymerization procedure and polymerization were conducted in
the same manner as in Example 9. The results were shown in Table 7.
[Table 7]
| Color (Transmittance %) |
Molecular weight (Mw) |
| 90.0 |
84000 |
Example 15
Polymerization evaluation of glycolic acid obtained by purifying a glycolate solution
in which 10 mole% of ethylene glycol based on glycolate remained
[0110] Using the
Escherichia coli MG1655/pGAPfucO-aldA strain described in Example 1, an ammonium glycolate solution
(concentration of ammonium glycolate: 11.6 weight %) was obtained by the method as
described in Example 2 by changing an aeration rate to 0.2 vvm and an agitation rate
to 500 rpm. 10 mole% of ethylene glycol based on ammonium glycolate remained in this
solution. 2 kg of the ammonium glycolate solution was subjected to the electrodialysis
with a double-chambered electrodialysis device comprised the anion exchange membrane
and the cation exchange membrane described in Example 3 to obtain 1.5 kg of an ammonium
glycolate solution (concentration of ammonium glycolate: 15.0 weight %, concentration
of ethylene glycol: 1.0 mole% based on ammonium glycolate). Subsequently, the water-splitting
electrodialysis with a double-chambered water-splitting electrodialysis device described
in Example 5 was conducted to obtain 1.4 kg of a glycolic acid solution (concentration
of glycolic acid: 11.6 weight %, concentration of ethylene glycol: 1.15 mole% based
on glycolic acid), and then the cation exchange resin treatment described in Example
6 was performed to obtain 1.5 kg of a glycolic acid solution (concentration of glycolic
acid: 11.0 weight %, concentration of ethylene glycol: 1.15 mole% based on glycolic
acid). Furthermore, the concentration treatment described in Example 7 was performed,
whereby 207 g of a 80 weight % glycolic acid solution (concentration of ethylene glycol:
1.15 mole% based on glycolic acid) was obtained. Subsequently, the glycolic acid solution
was subjected to the cooling crystallization described in Example 8 to obtain 120
g of glycolic acid (concentration of ethylene glycol: 0.16 mole% based on glycolic
acid). In the obtained glycolic acid, the concentration of ammonium ion was less than
the limit of detection (1 ppm). Using the glycolic acid as a raw material, a polycondensation
reaction was conducted to produce polyglycolic acid. The evaluation of the color and
evaluation of the molecular weight of the polyglycolic acid obtained by the polymerization
procedure and polymerization were conducted in the same manner as in Example 9. The
results were shown in Table 8.
[Table 8]
| Color (Transmittance %) |
Molecular weight (Mw) |
| 89.2 |
20000 |
[0111] In Example 15, to produce polyglycolic acid, there was no problem in the color, but
since the remaining concentration of ethylene glycol was high, it was obvious that
the molecular weight was lowered. Accordingly, it was shown that the concentration
of ethylene glycol was preferably less than 0.1% as a molar ratio based on the purified
glycolic acid. Furthermore, the compositional changes when the glycolic acid was kept
at 25 degree centigrade for 10 days were observed with time and the results thereof
were shown in Fig. 4. As shown in Fig. 4, when 0.16 mole% of ethylene glycol based
on the glycolic acid remained in the glycolic acid, it was shown that the glycolic
acid and ethylene glycol were spontaneously reacted with each other so that the condensate
thereof was increased with time. Further, when the polymerization evaluation was performed
using this as a raw material, it was obvious that polyglycolic acid having a small
molecular weight was obtained as shown in the results of Table 8. Incidentally, in
Fig. 4, a black square indicates the concentration (mole%) of ethylene glycol, while
a circle indicates the concentration of the condensate of glycolic acid and ethylene
glycol.
Example 16
Polymerization evaluation of glycolic acid obtained by purifying the glycolate solution
in which 4.9 mole% of ethylene glycol based on glycolate remained
[0112] Using the
Escherichia coli MG1655/pGAPfucO-aldA strain described in Example 1, an ammonium glycolate solution
(concentration of ammonium glycolate: 12.3 weight %) was obtained by the method as
described in Example 2 by changing an aeration rate to 0.5 vvm and an agitation rate
to 600 rpm. 4.9 mole% of ethylene glycol based on ammonium glycolate remained in this
solution. 2 kg of the ammonium glycolate solution was subjected to the electrodialysis
with a double-chambered electrodialysis device comprised the anion exchange membrane
and the cation exchange membrane described in Example 3 to obtain 1.5 kg of an ammonium
glycolate solution (concentration of ammonium glycolate: 15.9 weight %, concentration
of ethylene glycol: 0.49 mole% based on ammonium glycolate). Subsequently, the water-splitting
electrodialysis with a double-chambered water-splitting electrodialysis device described
in Example 5 was conducted to obtain 1.4 kg of a glycolic acid solution (concentration
of glycolic acid: 12.3 weight %, concentration of ethylene glycol: 0.55 mole% based
on glycolic acid), and then the cation exchange resin treatment described in Example
6 was performed to obtain 1.5 kg of a glycolic acid solution (concentration of glycolic
acid: 11.6 weight %, concentration of ethylene glycol: 0.55 mole% based on glycolic
acid). Furthermore, the concentration treatment described in Example 7 was performed,
whereby 219 g of a 80 weight % glycolic acid solution (concentration of ethylene glycol:
0.55 mole% based on glycolic acid) was obtained. Subsequently, the glycolic acid solution
was subjected to the cooling crystallization described in Example 8 to obtain 127
g of glycolic acid (concentration of ethylene glycol: 0.076 mole% based on glycolic
acid). In the obtained glycolic acid, the concentration of ammonium ion was less than
the limit of detection (1 ppm). Using the glycolic acid as a raw material, a polycondensation
reaction was conducted to produce polyglycolic acid. The evaluation of the color and
evaluation of the molecular weight of the polyglycolic acid obtained by the polymerization
procedure and polymerization were conducted in the same manner as in Example 9. The
results were shown in Table 9.
[Table 9]
| Color (Transmittance %) |
Molecular weight (Mw) |
| 89.2 |
71000 |
Example 17
Polymerization evaluation of glycolic acid obtained by purifying the glycolate solution
in which 1.0 mole% of ethylene glycol based on glycolate remained
[0113] Using the
Escherichia coli MG1655/pGAPfucO-aldA strain described in Example 1, an ammonium glycolate solution
(concentration of ammonium glycolate: 12.7 weight %) was obtained by the method as
described in Example 2 by changing an aeration rate to 0.8 vvm and an agitation rate
to 700 rpm. 1.0 mole% of ethylene glycol based on ammonium glycolate remained in this
solution. 2 kg of the ammonium glycolate solution was subjected to the electrodialysis
with a double-chambered electrodialysis device comprised the anion exchange membrane
and the cation exchange membrane described in Example 3 to obtain 1.5 kg of an ammonium
glycolate solution (concentration of ammonium glycolate: 16.5 weight %, concentration
of ethylene glycol: 0.1 mole% based on ammonium glycolate). Subsequently, the water-splitting
electrodialysis with a double-chambered water-splitting electrodialysis device described
in Example 5 was conducted to obtain 1.4 kg of a glycolic acid solution (concentration
of glycolic acid: 12.7 weight %, concentration of ethylene glycol: 0.11 mole% based
on glycolic acid), and then the cation exchange resin treatment described in Example
6 was performed to obtain 1.5 kg of a glycolic acid solution (concentration of glycolic
acid: 12.0 weight %, concentration of ethylene glycol: 0.55 mole% based on glycolic
acid). Furthermore, the concentration treatment described in Example 7 was performed,
whereby 226 g of a 80 weight % glycolic acid solution (concentration of ethylene glycol:
0.11 mole% based on glycolic acid) was obtained. Subsequently, the glycolic acid solution
was subjected to the cooling crystallization-described in Example 8 to obtain 131
g of glycolic acid (concentration of ethylene glycol: 0.015 mole% based on glycolic
acid). In the obtained glycolic acid, the concentration of ammonium ion was less than
the limit of detection (1 ppm). Using the glycolic acid as a raw material, a polycondensation
reaction was conducted to produce polyglycolic acid. The evaluation of the color and
evaluation of the molecular weight of the polyglycolic acid obtained by the polymerization
procedure and polymerization were conducted in the same manner as in Example 9. The
results were shown in Table 10.
[Table 10]
| Color (Transmittance %) |
Molecular weight (Mw) |
| 90.2 |
90000 |
Example 18
Polymerization evaluation of glycolic acid produced by combining activated carbon
treatment, electrodialysis with a double-chambered electrodialysis device, cation
exchange resin treatment and activated carbon treatment
[0114] Using the
Escherichia coli MG1655/pGAPfucO-aldA strain described in Example 1, 2 kg of an ammonium glycolate
solution (concentration of ammonium glycolate: 12.9 weight %) obtained by the method
as described in Example 2 was subjected to the activated carbon treatment described
in Example 4 to obtain 2 kg of an ammonium glycolate solution (concentration of ammonium
glycolate: 12.8 weight %). Subsequently, the water-splitting electrodialysis with
a double-chambered water-splitting electrodialysis device described in Example 5 was
conducted to obtain 1.5 kg of a glycolic acid solution (concentration of glycolic
acid: 12.2 weight %). The cation exchange resin treatment described in Example 6 was
performed to obtain 1.6 kg of a glycolic acid solution (concentration of glycolic
acid: 11.4 weight %). Furthermore, the activated carbon treatment described in Example
4 was performed, whereby 1.6 g of a glycolic acid solution (concentration of glycolic
acid: 11.3 weight %) was obtained. Using the glycolic acid as a raw material, a polycondensation
reaction was conducted to produce polyglycolic acid. The evaluation of the color and
evaluation of the molecular weight of the polyglycolic acid obtained by the polymerization
procedure and polymerization were conducted in the same manner as in Example 9. The
results were shown in Table 11.
[Table 11]
| Color (Transmittance %) |
Molecular weight (Mw) |
| 89.9 |
89000 |
Example 19
Polymerization evaluation of glycolic acid produced by combining activated carbon
treatment, electrodialysis with a double-chambered electrodialysis device, activated
carbon treatment and cation exchange resin treatment
[0115] Using the
Escherichia coli MG1655/pGAPfucO-aldA strain described in Example 1, 2 kg of an ammonium glycolate
solution (concentration of ammonium glycolate: 12.9 weight %) obtained by the method
as described in Example 2 was subjected to the activated carbon treatment described
in Example 4 to obtain 2 kg of an ammonium glycolate solution (concentration of ammonium
glycolate: 12.8 weight %). Subsequently, the water-splitting electrodialysis with
a double-chambered water-splitting electrodialysis device described in Example 5 was
conducted to obtain 1.5 kg of a glycolic acid solution (concentration of glycolic
acid: 12.2 weight %). Furthermore, the activated carbon treatment described in Example
4 was performed, whereby 1.5 kg of a glycolic acid solution (concentration of glycolic
acid: 12.1 weight %) was obtained. The cation exchange resin treatment described in
Example 6 was performed to obtain 1.5 kg of a glycolic acid solution (concentration
of glycolic acid: 12.1 weight %). Using the glycolic acid as a raw material, a polycondensation
reaction was conducted to produce polyglycolic acid. The evaluation of the color and
evaluation of the molecular weight of the polyglycolic acid obtained by the polymerization
procedure and polymerization were conducted in the same manner as in Example 9. The
results were shown in Table 12.
[Table 12]
| Color (Transmittance %) |
Molecular weight (Mw) |
| 90.0 |
90000 |
Comparative Example 1
Polymerization evaluation using glycolic acid of a commercial/industrial class as
a raw material
[0116] Using glycolic acid (a product of Wako Pure Chemical Industries, Ltd.) of a commercial/industrial
class produced in according with
U.S. Patent No. 3,859,349 as a raw material, a polycondensation reaction was conducted to produce polyglycolic
acid. The evaluation of the color and evaluation of the molecular weight of the polyglycolic
acid obtained by the polymerization procedure and polymerization were conducted in
the same manner as in Example 9. The results were shown in Table 13.
[Table 13]
| Color (Transmittance %) |
Molecular weight (Mw) |
| 20.7 |
49000 |
[0117] As shown in Table 13, when glycolic acid of a commercial/industrial class was used.,
the transmittance was low, that is, polyglycolic acid with a high color was obtained
as compared to the case where the glycolic acid obtained by the production process
illustrated in the present invention was used.
Comparative Example 2
Polymerization -evaluation using commercial glycolic acid having a high purity as
a raw material
[0118] Using commercial glycolic acid (a product of Tokyo Kasei Kogyo Co., Ltd.) having
a high purity produced in according with Japanese Patent Laid-open No.
1994-501268 as a raw material, a polycondensation reaction was conducted to produce polyglycolic
acid. The evaluation of the color and evaluation of the molecular weight of the polyglycolic
acid obtained by the polymerization procedure and polymerization were conducted in
the same manner as in Example 9. The results were shown in Table 14.
[Table 14]
| Color (Transmittance %) |
Molecular weight (Mw) |
| 52.1 |
71000 |
[0119] As shown in Table 14, even when commercial glycolic acid having a high purity was
used, the transmittance was low, that is, polyglycolic acid with a high color was
obtained as compared to the case where the glycolic acid obtained by the production
process illustrated in the present invention was used.
Comparative Example 3
Polymerization evaluation of glycolic acid obtained by electrodialysis and concentration
treatment
[0120] Using the
Escherichia coli MG1655/pGAPfucO-aldA strain described in Example 1, 2 kg of an ammonium glycolate
solution (concentration of ammonium glycolate: 12.9 weight %) obtained by the method
as described in Example 2 was subjected to the electrodialysis with a double-chambered
electrodialysis device comprised the anion exchange membrane and the cation exchange
membrane described in Example 3 to obtain 1.5 kg of an ammonium glycolate solution
(concentration of ammonium glycolate: 16.8 weight %). Subsequently, the water-splitting
electrodialysis with a double-chambered water-splitting electrodialysis device described
in Example 5 was conducted to obtain 1.4 kg of a glycolic acid solution (concentration
of glycolic acid: 13.0 weight %), and then the concentration treatment described in
Example 7 was performed to obtain 231 g of a 80 weight % glycolic acid solution. 4,900
ppm of ammonium ion remained in the obtained glycolic acid. Using the glycolic acid
as a raw material, a polycondensation reaction was conducted to produce polyglycolic
acid. The evaluation of the color and evaluation of the molecular weight of the polyglycolic
acid obtained by the polymerization procedure and polymerization were conducted in
the same manner as in Example 9. The results were shown in Table 15.
[Table 15]
| Color (Transmittance %) |
Molecular weight (Mw) |
| 26.8 |
72000 |
[0121] As shown in Table 15, when glycolic acid was purified only by the electrodialysis
and concentration treatment, ammonium ion remained in high concentration. As shown
in Examples 9 to 19, the transmittance was low, that is, polyglycolic acid with a
high color was obtained as compared to the case where the activated carbon treatment
was combined with the cation exchange resin treatment and the cooling crystallization
for purification.
Example 20
Production of glycolic acid using the glycolic acid solution produced by using glycolonitrile
as a raw material and polymerization evaluation using the same as a raw material
[0122] Using the method as described in Example 1 of International Publication No.
WO 2002/068658, an ammonium glycolate solution was produced. Specifically, it was produced in the
following manner. 938 mL of 0.1M potassium phosphate solution (pH: 7.0) in which 62
g of
Acidovorax facilis 72W (ATCC55746) in an aqueous supension was heated at 50 degree centigrade for 1
hour for deactivation of nitrile hydratase activity and amidase activity, and then
cooled using a water bath at 25 degree centigrade. The resulting material was subjected
to the centrifugation for removing a supernatant, and then re-dispersed in 948 mL
of 0.02M potassium phosphate solution (pH: 6.-0) and further subjected to the centrifugation
for removing the supernatant. The obtained microoganism was re-dispersed in 938 mL
of 0.02M potassium phosphate solution (pH: 6.0) and 106 mL of an aqueous solution
of 55 weight % glycolonitrile was added thereto, and the resulting mixture was stirred
at 25 degree centigrade for 2 hours. After stirring, the solution was subjected to
the centrifugation for recovering the supernatant. According to the procedure, the
added glycolonitrile was completely changed to ammonium glycolate. The above procedure
was repeated several times and 3.3 kg of the obtained ammonium glycolate solution
(concentration of ammonium glycolate: 8.4 weight %) was subjected to the electrodialysis
with a double-chambered electrodialysis device comprised the anion exchange membrane
and the cation exchange membrane described in Example 3 to obtain 2.5 kg of an ammonium
glycolate solution (concentration of ammonium glycolate: 10.8 weight %). Subsequently,
the activated carbon treatment described in Example 4 was performed to obtain 2.6
kg of an ammonium glycolate solution (concentration of ammonium glycolate: 10.2 weight
%), and then the water-splitting electrodialysis with a double-chambered water-splitting
electrodialysis device described in Example 5 was performed to obtain 2.5 kg of a
glycolic acid solution (concentration of glycolic acid: 7.9 weight %). The cation
exchange resin treatment described in Example 6 was performed to obtain 2.6 kg of
a glycolic acid solution (concentration of glycolic acid: 7.5 weight %), and the concentration
treatment described in Example 7 was further performed to obtain 243 g of a 80 weight
% glycolic acid solution. Next, the glycolic acid solution was subjected to the cooling
crystallization described in Example 8 to obtain 141 g of glycolic acid. In the obtained
glycolic acid, the concentration of ammonium ion was less than the limit of detection
(1 ppm). Using the glycolic acid as a raw material, a polycondensation reaction was
conducted to produce polyglycolic acid. The evaluation of the color and evaluation
of the molecular weight of the polyglycolic acid obtained by the polymerization procedure
and polymerization were conducted in the same manner as in Example 9. The results
were shown in Table 16. Incidentally, the aforementioned ATCC number refers to a deposit
number in the Amerimay Type Culture Collection, while the aforementioned strain is
requested to the Amerimay Type Culture Collection so that it is available to any person
upon payment.
[Table 16]
| Color (Transmittance %) |
Molecular weight (Mw) |
| 89.2 |
95000 |
[0123] As shown in Table 16, the purification method according to the present invention
was suitable even to an ammonium glycolate solution obtained by using glycolonitrile
as a raw material, while the polyglycolic acid obtained by the polymerization of the
obtained glycolic acid exhibited that coloring was small and the molecular weight
was great.
Example 21
Polymerization evaluation of glycolic acid by producing a glycolic acid copolymer
[0124] Using the glycolic acid obtained in Example 17, a glycolic acid copolymer was produced.
Specifically, 100 weight parts of glycolic acid, 29.7 weight parts of isophthalic
acid, 38.9 weight parts of ethylene glycol and 0.08 weight parts of trimethylolethane
were introduced to a reaction bath. The resulting material was subjected to an esterification
reaction for about 24 hours while removing water generated in an ordinary pressure
of nitrogen atmosphere, under stirring at 130 to 200 degree centigrade until it became
transparent. The obtained polyester oligomer was introduced to a glass reactor equipped
with a stirring device and an outflow tube. The outflow tube was connected to a vacuum
device consisting of a vacuum pump and a vacuum regulator, forming a structure such
that an evaporant could be removed. 0.6 weight parts of a germanium catalyst (6.7
weight % of germanium dioxide contained) were added thereto. First, the resulting
mixture was reacted in a nitrogen flow under stirring at 200 degree centigrade for
30 minutes. Thereafter, the reactor was maintained at 200 degree centigrade and decompressed
down to near 0.8 torr for about 1 hour, and then the reaction was performed by heating
up to 225 degree centigrade while stirring under the condition of about 0.8 to 0.5
torr for about 10 hours for removing generated ethylene glycol from the reactor. Compositions
of respective component units of glycolic acid, isophthalic acid, ethylene glycol
and diethylene glycol in the polycondensate were respectively 71.0 mole%, 14.5 mole%,
10.1 mole% and 4.4 mole%. The polyester resin was dried under reduced pressure at
about 40 degree centigrade for about 20 hours, and then interposed between two brass
plates, aluminum plates and mold release films in a predetermined amount. The resulting
material was melted at 200 degree centigrade, compressed at 10 MPa for 1 minute, and
then compressed again at 10 MPa using a compression molding machine set at a temperature
of 20 degree centigrade for cooling to prepare a press film having a thickness of
about 70 µm. The obtained film was transparent and the Δb value was 6.7%.
Comparative Example 4
Polymerization evaluation of glycolic acid by producing a glycolic acid copolymer
using commercial glycolic acid having a high purity as a raw material
[0125] Using glycolic acid (a product of Wako Pure Chemical Industries, Ltd.) of a commercial/industrial
class produced in according with
U.S. Patent No. 3,859,349 as a raw material, a polycondensation reaction was conducted to produce a glycolic
acid copolymer. The evaluation of the color of the polyglycolic acid obtained by the
polymerization procedure and polymerization was conducted in the same manner as in
Example 21. As a result, the obtained film was a little colored and the Δb value was
12.8%. Even when the glycolic acid copolymer was produced and the glycolic acid produced
by the production process described in the present invention was used, a glycolic
acid copolymer having a low color was obtained as compared to the case where a commercial
glycolic acid having a high purity was used.
[0126] The physical properties of glycolic acids and polyglycolic acids obtained according
to Examples 3 to 20 and Comparative Examples 1 to 3 are shown in Table 17, while the
physical properties of glycolic acids and glycolic acid copolymers obtained according
to Example 21 and Comparative Example 4 are shown in Table 18 below. Incidentally,
the concentration of the glycolic acid in each glycolic acid, the molar ratio of ethylene
glycol and concentration of ammonium ion are values obtained when moisture is removed.
[Table 17]
| Production No. |
|
Order of steps |
Glycolic acid |
Polyglycolic acid |
| Concentration of glycolic acid (wt%) |
Molar ratio of ethylene glycol (%) * |
Concentration of ammonium ion (ppm) * |
Color (transmittance: %) |
Molecular weight (Mw) |
| 1 |
Examples 3 to 8 |
a1 |
c |
a2 |
d |
e |
b |
99.99 |
0.010 |
less than 1 ppm |
- |
- |
| 2 |
Example 9 |
a1 |
c |
a2 |
e |
b |
|
99.99 |
0.012 |
280 |
68.1 |
87000 |
| 3 |
Example 10 |
c |
a2 |
e |
b |
|
|
99.99 |
0.012 |
300 |
63.0 |
89000 |
| 4 |
Example 11 |
a1 |
a2 |
d |
e |
b |
|
99.99 |
0.010 |
less than 1 ppm |
90.4 |
92000 |
| 5 |
Example 12 |
a1 |
a2 |
e |
b |
|
|
99.94 |
0.075 |
1 |
88.0 |
72000 |
| 5 |
80.0 |
72000 |
| 380 |
61.0 |
72000 |
| 6 |
Example 13 |
a1 |
c |
a2 |
d |
e |
b |
99.99 |
0.012 |
less than 1 ppm |
88.8 |
83000 |
| 7 |
Example 14 |
c |
a2 |
d |
e |
b |
|
99.99 |
0.011 |
less than 1 ppm |
90.0 |
84000 |
| 8 |
Example 15 |
a1 |
a2 |
d |
e |
b |
|
99.87 |
0.160 |
less than 1 ppm |
89.2 |
20000 |
| 9 |
Example 16 |
a1 |
a2 |
d |
e |
b |
|
99.94 |
0.076 |
less than 1 ppm |
89.2 |
71000 |
| 10 |
Example 17 |
a1 |
a2 |
d |
e |
b |
|
99.99 |
0.015 |
less than 1 ppm |
90.2 |
90000 |
| 11 |
Example 18 |
c |
a2 |
d |
c |
|
|
99.99 |
0.012 |
less than 1 ppm |
89.9 |
89000 |
| 12 |
Example 19 |
c |
a2 |
c |
d |
|
|
99.99 |
0.013 |
less than 1 ppm |
90.0 |
90000 |
| 13 |
Comparative Example 1 |
Commercial products used |
82.00 |
- |
- |
20.7 |
49000 |
| 14 |
Comparative Example 2 |
Commercial products used |
99.90 |
- |
- |
52.1 |
71000 |
| 15 |
Comparative Example 3 |
a1 |
a2 |
e |
|
|
|
98.14 |
0.075 |
4900 |
26.8 |
72000 |
| 16 |
Example 20 |
a1 |
c |
a2 |
d |
e |
b |
99.99 |
0.007 |
less than 1 ppm |
89.2 |
95000 |
| * Value based on the glycolic acid |
[Table 18]
| Production No. |
|
Order of steps |
Glycolic acid |
Glycolic acid copolymer |
| Concentration of glycolic acid (wt%) |
Molar ratio of ethylene glycol (%) * |
Concentration of ammonium ion (ppm) * |
Color (Δb: %) |
| 17 |
Example 21 |
a1 |
a2 |
d |
e |
b |
|
99.99 |
0.010 |
less than 1 ppm |
6.7 |
| 18 |
Comparative Example 4 |
Commercial products used |
99.99 |
- |
- |
12.8 |
| * Value based on the glycolic acid |
SEQUENCE LISTING
[0127]
<110> Mitsui Chemicals, Inc.
<120> Process for producing of glycolate
<130> F000637
<150> JP2005-311323
<151> 2005-10-26
<160> 6
<170> PatentIn version 3.3
<210> 1
<211> 45
<212> DNA
<213> Artificial
<220>
<223> Primer for PCR
<400> 1
gctctagacg gagaaagtct tatgatggct aacagaatga ttctg 45
<210> 2
<211> 29
<212> DNA
<213> Artificial
<220>
<223> Primer for PCR
<400> 2
gtgaagcttg catttaccag gcggtatgg 29
<210> 3
<211> 43
<212> DNA
<213> Artificial
<220>
<223> Primer for PCR
<400> 3
cgaattccgg agaaagtctt atgtcagtac ccgttcaaca tcc 43
<210> 4
<211> 29
<212> DNA
<213> Artificial
<220>
<223> Primer for PCR
<400> 4
gctctagact ctttcactca ttaagactg 29
<210> 5
<211> 30
<212> DNA
<213> Artificial
<220>
<223> Primer for PCR
<400> 5
aacgaattct cgcaatgatt gacacgattc 30
<210> 6
<211> 32
<212> DNA
<213> Artificial
<220>
<223> Primer for PCR
<400> 6
acagaattcg ctatttgtta gtgaataaaa gg 32