<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE ep-patent-document PUBLIC "-//EPO//EP PATENT DOCUMENT 1.4//EN" "ep-patent-document-v1-4.dtd">
<ep-patent-document id="EP08075111B9W1" file="EP08075111W1B9.xml" lang="en" country="EP" doc-number="1947187" kind="B9" correction-code="W1" date-publ="20110921" status="c" dtd-version="ep-patent-document-v1-4">
<SDOBI lang="en"><B000><eptags><B001EP>ATBECHDEDKESFRGBGRITLILUNLSEMCPTIE......FI....CY..TR................................................</B001EP><B005EP>J</B005EP><B007EP>DIM360 Ver 2.15 (14 Jul 2008) -  2999001/0</B007EP></eptags></B000><B100><B110>1947187</B110><B120><B121>CORRECTED EUROPEAN PATENT SPECIFICATION</B121></B120><B130>B9</B130><B132EP>B1</B132EP><B140><date>20110921</date></B140><B150><B151>W1</B151><B154><B1541>de</B1541><B1542>Zahlreiche Schreibfehler geringer Bedeutung</B1542><B1541>en</B1541><B1542>Numerous spelling errors of minor importance</B1542><B1541>fr</B1541><B1542>Nombreuses erreurs mineures d'orthographe</B1542></B154><B155><B1551>de</B1551><B1552>Beschreibung</B1552><B1551>en</B1551><B1552>Description</B1552><B1551>fr</B1551><B1552>Description</B1552></B155></B150><B190>EP</B190></B100><B200><B210>08075111.8</B210><B220><date>20010228</date></B220><B240><B241><date>20090113</date></B241><B242><date>20090312</date></B242></B240><B250>en</B250><B251EP>en</B251EP><B260>en</B260></B200><B300><B310>0004695</B310><B320><date>20000228</date></B320><B330><ctry>GB</ctry></B330><B310>0027675</B310><B320><date>20001113</date></B320><B330><ctry>GB</ctry></B330></B300><B400><B405><date>20110921</date><bnum>201138</bnum></B405><B430><date>20080723</date><bnum>200830</bnum></B430><B450><date>20110330</date><bnum>201113</bnum></B450><B452EP><date>20100910</date></B452EP><B480><date>20110921</date><bnum>201138</bnum></B480></B400><B500><B510EP><classification-ipcr sequence="1"><text>C12N  15/62        20060101AFI20080414BHEP        </text></classification-ipcr><classification-ipcr sequence="2"><text>C07K  14/22        20060101ALI20080414BHEP        </text></classification-ipcr><classification-ipcr sequence="3"><text>C07K  19/00        20060101ALI20080414BHEP        </text></classification-ipcr></B510EP><B540><B541>de</B541><B542>Hybride Expression Neisserscher Proteine</B542><B541>en</B541><B542>Hybrid expression of neisserial proteins</B542><B541>fr</B541><B542>Expression hybride de protéines neisseriales</B542></B540><B560><B561><text>WO-A-92/16643</text></B561><B561><text>WO-A-99/36544</text></B561><B561><text>US-A- 5 547 670</text></B561><B562><text>GUILLEN G ET AL: "EXPRESSION IN ESCHERICHIA COLI AND IMMUNOLOGICAL CHARACTERIZATION OF A HYBRID CLASS 1-P64K PROTEIN FROM NEISSERIA MENINGITIDIS" BIOTECNOLOGIA APLICADA,CU,LA HABANA, vol. 13, no. 4, 1 October 1996 (1996-10-01), pages 271-275, XP000671540 ISSN: 1027-2852</text></B562></B560></B500><B600><B620><parent><pdoc><dnum><anum>01914098.7</anum><pnum>1261723</pnum></dnum><date>20010228</date></pdoc></parent></B620></B600><B700><B720><B721><snm>Arico, Maria Beatrice</snm><adr><str>Novartis Vaccines
Via Fiorentina 1</str><city>53100 Siena</city><ctry>IT</ctry></adr></B721><B721><snm>Comanducci, Maurizio</snm><adr><str>Novartis Vaccines
Via Fiorentina 1</str><city>53100 Siena</city><ctry>IT</ctry></adr></B721><B721><snm>Galeotti, Cesira</snm><adr><str>Novartis Vaccines
Via Fiorentina 1</str><city>53100 Siena</city><ctry>IT</ctry></adr></B721><B721><snm>Masignani, Vega</snm><adr><str>Novartis Vaccines
Via Fiorentina 1</str><city>53100 Siena</city><ctry>IT</ctry></adr></B721><B721><snm>Giuliani, Marzia Monica</snm><adr><str>Novartis Vaccines
Via Fiorentina 1</str><city>53100 Siena</city><ctry>IT</ctry></adr></B721><B721><snm>Pizza, Mariagrazia</snm><adr><str>Novartis Vaccines
Via Fiorentina 1</str><city>53100 Siena</city><ctry>IT</ctry></adr></B721></B720><B730><B731><snm>Novartis Vaccines and Diagnostics S.r.l.</snm><iid>100794225</iid><irf>P048826EP</irf><adr><str>Via Fiorentina 1</str><city>53100 Siena (SI)</city><ctry>IT</ctry></adr></B731></B730><B740><B741><snm>Marshall, Cameron John</snm><sfx>et al</sfx><iid>100045777</iid><adr><str>Carpmaels &amp; Ransford 
One Southampton Row</str><city>London
WC1B 5HA</city><ctry>GB</ctry></adr></B741></B740></B700><B800><B840><ctry>AT</ctry><ctry>BE</ctry><ctry>CH</ctry><ctry>CY</ctry><ctry>DE</ctry><ctry>DK</ctry><ctry>ES</ctry><ctry>FI</ctry><ctry>FR</ctry><ctry>GB</ctry><ctry>GR</ctry><ctry>IE</ctry><ctry>IT</ctry><ctry>LI</ctry><ctry>LU</ctry><ctry>MC</ctry><ctry>NL</ctry><ctry>PT</ctry><ctry>SE</ctry><ctry>TR</ctry></B840><B880><date>20080723</date><bnum>200830</bnum></B880></B800></SDOBI><!-- EPO <DP n="1"> -->
<description id="desc" lang="en">
<heading id="h0001"><b>TECHNICAL FIELD</b></heading>
<p id="p0001" num="0001">This invention is in the field of protein expression. In particular, it relates to the heterologous expression of proteins from <i>Neisseria</i> (<i>e.g. N.gonorrhoeae</i> or, preferably, <i>N.meningitidis</i>).</p>
<heading id="h0002"><b>BACKGROUND ART</b></heading>
<p id="p0002" num="0002">International patent applications <patcit id="pcit0001" dnum="WO9924578A"><text>WO99/24578</text></patcit>, <patcit id="pcit0002" dnum="WO9936544A"><text>WO99/36544</text></patcit>, <patcit id="pcit0003" dnum="WO9957280A"><text>WO99/57280</text></patcit> and <patcit id="pcit0004" dnum="WO0022430A"><text>WO00/22430</text></patcit> disclose proteins from <i>Neisseria meningitidis</i> and <i>Neisseria gonorrhoeae.</i> These proteins are typically described as being expressed in <i>E.coli (i.e.</i> heterologous expression) as either N-terminal GST-fusions or C-terminal His-tag fusions, although other expression systems, including expression in native <i>Neisseria,</i> are also disclosed.</p>
<p id="p0003" num="0003"><nplcit id="ncit0001" npl-type="s"><text>Guillen et al (Biotechnologia Aplicada, 13(4), pg 1027-2852 (1996</text></nplcit>)) discloses a fusion of Neisseria P1.15 protein with Neisseria P64-k protein which is expressed in E.coli.</p>
<p id="p0004" num="0004">It is an object of the present invention to provide alternative and improved approaches for the heterologous expression of these proteins. These approaches will typically affect the level of expression, the ease of purification, the cellular localisation of expression, and/or the immunological properties of the expressed protein.</p>
<heading id="h0003"><b>DISCLOSURE OF THE INVENTION</b></heading>
<p id="p0005" num="0005">In accordance with the invention, two proteins of the invention are expressed as a single hybrid protein. It is preferred that no non-Neisserial fusion partner (<i>e.g.</i> GST or poly-His) is used.</p>
<p id="p0006" num="0006">This offers two advantages. Firstly, a protein that may be unstable or poorly expressed on its own can be assisted by adding a suitable hybrid partner that overcomes the problem. Secondly, commercial manufacture is simplified - only one expression and purification need be employed in order to produce two separately-useful proteins.</p>
<p id="p0007" num="0007">Thus the invention provides a method for the simultaneous heterologous expression of two proteins of the invention, in which said two or more proteins of the invention are fused (<i>i.e.</i> they are translated as a single polypeptide chain).</p>
<p id="p0008" num="0008">The method will typically involve the steps of obtaining a first nucleic acid encoding a first protein of the invention; obtaining a second nucleic acid encoding a second protein of the<!-- EPO <DP n="2"> --> invention; ligating the first and second nucleic acids. The resulting nucleic acid may be inserted into an expression vector, or may already be part of an expression vector.</p>
<p id="p0009" num="0009">The hybrid protein can be represented by the formula NH<sub>2</sub>-A-B-COOH. A comprises protein 287, and B comprises protein 961.</p>
<p id="p0010" num="0010">287, is its poly-glycine deletions (ΔG) form ΔG-287.</p>
<p id="p0011" num="0011">The hybrid protein of the invention is ΔG287-961.<!-- EPO <DP n="3"> --></p>
<p id="p0012" num="0012">287 is used at the N-terminus as a ΔG form of 287 as the N-terminus of a hybrid with 961.</p>
<p id="p0013" num="0013">287 is preferably from strain 2996 or from strain 394/98. Domain forms of 961 may be used.</p>
<p id="p0014" num="0014">Alignments of polymorphic forms of ORF46, 287, 919 and 953 are disclosed in <patcit id="pcit0005" dnum="WO0066741A"><text>WO00/66741</text></patcit>. Any of these polymorphs can be used according to the present invention.</p>
<p id="p0015" num="0015">Preferably, the constituent proteins (A and B) in a hybrid protein according to the invention will be from the same strain.</p>
<p id="p0016" num="0016">The fused proteins in the hybrid are joined directly.</p>
<p id="p0017" num="0017">The fused proteins may lack native leader peptides or may include the leader peptide sequence of the N-terminal fusion partner</p>
<heading id="h0004"><b><i>Host</i></b></heading>
<p id="p0018" num="0018">It is preferred to utilise a heterologous host. The heterologous host may be prokaryotic or eukaryotic. It is preferably <i>E.coli,</i> but other suitable hosts include <i>Bacillus subtilis; Vibrio cholerae, Salmonella typhi, Salmonenna typhimurium, Neisseria meningitidis, Neisseria gonorrhoeae, Neisseria lactamica, Neisseria cinerea, Mycobateria (e.g. M.tuberculosis),</i> yeast etc.<!-- EPO <DP n="4"> --></p>
<heading id="h0005"><i><u>Sequences</u></i></heading>
<p id="p0019" num="0019">The invention also provides a protein comprising the sequences of SEQ ID NO 8.<!-- EPO <DP n="5"> --></p>
<p id="p0020" num="0020">The degree of 'sequence identity' of the proteins is greater than 70%. This includes mutants and allelic variants [<i>e.g.</i> see <patcit id="pcit0006" dnum="WO0066741A"><text>WO00/66741</text></patcit>]. Identity is preferably determined by the Smith-Waterman homology search algorithm as implemented in the MPSRCH program (Oxford Molecular), using an affine gap search with parameters <i>gap open penalty=12 and gap extension penalty=1.</i></p>
<p id="p0021" num="0021">Preferred proteins of the invention are found in <i>N.meningitidis</i> serogroup B.</p>
<p id="p0022" num="0022">Preferred proteins for use according to the invention are those of serogroup B <i>N.meniingitidis</i> strain 2996 or strain 394/98 (a New Zealand strain). Unless otherwise stated, proteins mentioned herein are from <i>N.meningitidis</i> strain 2996. It will be appreciated, however, that the invention is not in general limited by strain. References to a particular protein (<i>e.g.</i> '287', '919' <i>etc.</i>) may be taken to include that protein from any strain.</p>
<heading id="h0006"><b>BRIEF DESCRIPTION OF DRAWINGS</b></heading>
<p id="p0023" num="0023"><figref idref="f0001">Figures 1 and 2</figref> show hybrid proteins according to the invention.</p>
<heading id="h0007"><b>MODES FOR CARRYING OUT THE INVENTION</b></heading><!-- EPO <DP n="6"> -->
<heading id="h0008"><i>Example 1 hybrids of</i> Δ<i>G287</i></heading>
<p id="p0024" num="0024">The deletion of the (Gly)<sub>6</sub> sequence in 287 was found to have a dramatic effect on protein expression. The protein lacking the N-terminal amino acids up to GGGGGG is called 'ΔG287'. In strain MC58, its basic sequence (leader peptide underlined) is:
<img id="ib0001" file="imgb0001.tif" wi="131" he="34" img-content="dna" img-format="tif"/>Δ
 G287, with or without His-tag ('ΔG287-His'and 'ΔG287K', respectively), are expressed at very good levels in comparison with the '287-His' or '287 <sup>untagged</sup>'.</p>
<p id="p0025" num="0025">On the basis of gene variability data, variants of ΔG287-His were expressed in E. coli from a number of MenB strains, in particular from strains 2996, MC58, 1000, and BZ232. The results were also good - each of these gave high ELISA titres and also serum bactericidal titres of &gt;8192. ΔG287K, expressed from pET-24b, gave excellent titres in ELISA and the serum bactericidal assay.</p>
<p id="p0026" num="0026">ΔG287 was fused directly in-frame upstream of 961 (sequence shown below)<!-- EPO <DP n="7"> -->
<img id="ib0002" file="imgb0002.tif" wi="156" he="116" img-content="dna" img-format="tif"/>
<img id="ib0003" file="imgb0003.tif" wi="126" he="61" img-content="dna" img-format="tif"/><!-- EPO <DP n="8"> -->
<tables id="tabl0001" num="0001">
<table frame="all">
<tgroup cols="3">
<colspec colnum="1" colname="col1" colwidth="28mm"/>
<colspec colnum="2" colname="col2" colwidth="16mm"/>
<colspec colnum="3" colname="col3" colwidth="24mm"/>
<thead>
<row>
<entry align="center" valign="top"/>
<entry align="center" valign="top"><b>ELISA</b></entry>
<entry align="center" valign="top"><b>Bactericidal</b></entry></row></thead>
<tbody>
<row>
<entry align="center">ΔG287-961-His</entry>
<entry align="center">108627</entry>
<entry align="center">65536</entry></row></tbody></tgroup>
</table>
</tables></p>
<p id="p0027" num="0027">The same hybrid proteins were made using New Zealand strain 394/98 rather than 2996:<!-- EPO <DP n="9"> -->
<img id="ib0004" file="imgb0004.tif" wi="159" he="126" img-content="dna" img-format="tif"/>
<img id="ib0005" file="imgb0005.tif" wi="128" he="71" img-content="dna" img-format="tif"/><!-- EPO <DP n="10"> --></p>
<heading id="h0009"><b><i>Example 2 -hybrids of 287</i></b></heading>
<p id="p0028" num="0028">Expression of 287 as full-length with a C-terminal His-tag, or without its leader peptide but with a C-terminal His-tag, gives fairly low expression levels. Better expression is achieved using a N-terminal GST-fusion.<!-- EPO <DP n="11"> --></p>
<p id="p0029" num="0029">When fused to protein 961 [NH<sub>2</sub>-ΔG287-961-COOH - sequence shown above], the resulting protein is insoluble and must be denatured and renatured for purification. Following denaturation, around 50% of the protein was found to remain insoluble. The soluble and insoluble proteins were compared, and much better bactericidal titres were obtained with the soluble protein (FCA as adjuvant):
<tables id="tabl0002" num="0002">
<table frame="all">
<tgroup cols="7">
<colspec colnum="1" colname="col1" colwidth="20mm"/>
<colspec colnum="2" colname="col2" colwidth="14mm"/>
<colspec colnum="3" colname="col3" colwidth="15mm"/>
<colspec colnum="4" colname="col4" colwidth="14mm"/>
<colspec colnum="5" colname="col5" colwidth="16mm"/>
<colspec colnum="6" colname="col6" colwidth="15mm"/>
<colspec colnum="7" colname="col7" colwidth="15mm"/>
<thead>
<row>
<entry valign="top"/>
<entry valign="top"><b>2996</b></entry>
<entry valign="top"><b>BZ232</b></entry>
<entry valign="top"><b>MC58</b></entry>
<entry valign="top"><b>NGH38</b></entry>
<entry valign="top"><b>F6124</b></entry>
<entry valign="top"><b>BZ133</b></entry></row></thead>
<tbody>
<row>
<entry align="right"><b>Soluble</b></entry>
<entry>65536</entry>
<entry>128</entry>
<entry>4096</entry>
<entry>&gt;2048</entry>
<entry>&gt;2048</entry>
<entry>4096</entry></row>
<row>
<entry align="right"><b>Insoluble</b></entry>
<entry>8192</entry>
<entry>&lt;4</entry>
<entry>&lt;4</entry>
<entry>16</entry>
<entry>n.d.</entry>
<entry>n.d.</entry></row></tbody></tgroup>
</table>
</tables></p>
<p id="p0030" num="0030">Titres with the insoluble form were, however, improved by using alum adjuvant instead:
<tables id="tabl0003" num="0003">
<table frame="all">
<tgroup cols="7" rowsep="0">
<colspec colnum="1" colname="col1" colwidth="20mm"/>
<colspec colnum="2" colname="col2" colwidth="14mm"/>
<colspec colnum="3" colname="col3" colwidth="11mm"/>
<colspec colnum="4" colname="col4" colwidth="12mm"/>
<colspec colnum="5" colname="col5" colwidth="14mm"/>
<colspec colnum="6" colname="col6" colwidth="14mm"/>
<colspec colnum="7" colname="col7" colwidth="12mm"/>
<tbody>
<row rowsep="1">
<entry><b>Insoluble</b></entry>
<entry>32768</entry>
<entry>128</entry>
<entry>4096</entry>
<entry>&gt;2048</entry>
<entry>&gt;2048</entry>
<entry>2048</entry></row></tbody></tgroup>
</table>
</tables></p>
<p id="p0031" num="0031">961c was also used in hybrid proteins (see above). As 961 and its domain variants direct efficient expression, they are ideally suited as the N-terminal portion of a hybrid protein.<!-- EPO <DP n="12"> --></p>
<heading id="h0010"><b>EXPERIMENTAL DETAILS</b></heading>
<heading id="h0011"><b><i>Cloning strategy and oligonucleotide design</i></b></heading>
<p id="p0032" num="0032">Genes coding for antigens of interest were amplified by PCR, using oligonucleotides designed on the basis of the genomic sequence of <i>N. meningitidis</i> B MC58. Genomic DNA from strain 2996 was always used as a template in PCR reactions, unless otherwise specified, and the amplified fragments were cloned in the expression vector pET21b+ (Novagen) to express the protein as C-terminal His-tagged product, or in pET-24b+(Novagen) to express the protein in 'untagged' form (<i>e.g.</i> ΔG287K).</p>
<p id="p0033" num="0033">Where a protein was expressed without a fusion partner and with its own leader peptide (if present), amplification of the open reading frame (ATG to STOP codons) was performed.</p>
<p id="p0034" num="0034">Where a protein was expressed in 'untagged' form, the leader peptide was omitted by designing the 5'-end amplification primer downstream from the predicted leader sequence.</p>
<p id="p0035" num="0035">The melting temperature of the primers used in PCR depended on the number and type of hybridising nucleotides in the whole primer, and was determined using the formulae: <maths id="math0001" num=""><math display="block"><msub><mi mathvariant="normal">T</mi><mrow><mi mathvariant="normal">m</mi><mo>⁢</mo><mn>1</mn></mrow></msub><mo mathvariant="normal">=</mo><mn mathvariant="normal">4</mn><mo>⁢</mo><mfenced separators=""><mi mathvariant="normal">G</mi><mo mathvariant="normal">+</mo><mi mathvariant="normal">C</mi></mfenced><mo mathvariant="normal">+</mo><mn mathvariant="normal">2</mn><mo>⁢</mo><mfenced separators=""><mi mathvariant="normal">A</mi><mo mathvariant="normal">+</mo><mi mathvariant="normal">T</mi></mfenced><mspace width="3em"/><mfenced><mi>tail excluded</mi></mfenced></math><img id="ib0006" file="imgb0006.tif" wi="124" he="9" img-content="math" img-format="tif"/></maths> <maths id="math0002" num=""><math display="block"><msub><mi mathvariant="normal">T</mi><mrow><mi mathvariant="normal">m</mi><mo>⁢</mo><mn mathvariant="normal">2</mn></mrow></msub><mo mathvariant="normal">=</mo><mn mathvariant="normal">64.9</mn><mo mathvariant="normal">+</mo><mn mathvariant="normal">0.41</mn><mfenced separators=""><mo mathvariant="italic">%</mo><mspace width="1em"/><mi>GC</mi></mfenced><mo mathvariant="normal">-</mo><mn mathvariant="normal">600</mn><mo mathvariant="normal">/</mo><mi mathvariant="normal">N</mi><mspace width="4em"/><mfenced><mi>whole primer</mi></mfenced></math><img id="ib0007" file="imgb0007.tif" wi="125" he="8" img-content="math" img-format="tif"/></maths></p>
<p id="p0036" num="0036">The melting temperatures of the selected oligonucleotides were usually 65-70°C for the whole oligo and 50-60°C for the hybridising region alone.</p>
<p id="p0037" num="0037">Oligonucleotides were synthesised using a Perkin Elmer 394 DNA/RNA Synthesizer, eluted from the columns in 2.0ml NH<sub>4</sub>OH, and deprotected by 5 hours incubation at 56°C. The oligos were precipitated by addition of 0.3M Na-Acetate and 2 volumes ethanol. The samples were centrifuged and the pellets resuspended in water.<!-- EPO <DP n="13"> -->
<tables id="tabl0004" num="0004">
<table frame="all">
<tgroup cols="4">
<colspec colnum="1" colname="col1" colwidth="46mm"/>
<colspec colnum="2" colname="col2" colwidth="13mm"/>
<colspec colnum="3" colname="col3" colwidth="107mm"/>
<colspec colnum="4" colname="col4" colwidth="27mm"/>
<thead>
<row>
<entry align="center" valign="top"/>
<entry valign="top"/>
<entry align="center" valign="top"><b>Sequences</b></entry>
<entry align="center" valign="top"><b>Restriction site</b></entry></row></thead>
<tbody>
<row>
<entry morerows="1" align="center"><b>fu (961)-741(MC58)-His</b></entry>
<entry>Fwd</entry>
<entry>CGC<u>GGATCC</u> -GGAGGGGGTGGTGTCG</entry>
<entry>BamHI</entry></row>
<row>
<entry align="center">Rev</entry>
<entry>CCCG<u>CTCGAG</u>-TTGCTTGGCGGCAAGGC</entry>
<entry>XhoI</entry></row>
<row>
<entry morerows="1" align="center"><b>fu (961)-983-His</b></entry>
<entry align="center">Fwd</entry>
<entry>CGC<u>GGATCC</u> - GGCGGAGGCGGCACTT</entry>
<entry>BamHI</entry></row>
<row>
<entry align="center">Rev</entry>
<entry>CCCG<u>CTCGAG</u>-GAACCGGTAGCCTACG</entry>
<entry>XhoI</entry></row>
<row>
<entry morerows="1" align="center"><b>fu (961)-Orf46.1-His</b></entry>
<entry align="center">Fwd</entry>
<entry>CGC<u>GGATCC</u>GGTGGTGGTGGT-TCAGATTTGGCAAACGATTC</entry>
<entry>BamHI</entry></row>
<row>
<entry align="center">Rev</entry>
<entry>CCCG<u>CTCGAG</u>-CGTATCATATTTCACGTGC</entry>
<entry>XhoI</entry></row>
<row>
<entry morerows="1" align="center"><b>fu (961c-L)-741(MC58)</b></entry>
<entry align="center">Fwd</entry>
<entry>CGC<u>GGATCC</u> -GGAGGGGGTGGTGTCG</entry>
<entry>BamHI</entry></row>
<row>
<entry align="center">Rev</entry>
<entry>CCCG<u>CTCGAG</u>-TTATTGCTTGGCGGCAAG</entry>
<entry>XhoI</entry></row>
<row>
<entry morerows="1" align="center"><b>fu (961c-L)-983</b></entry>
<entry align="center">Fwd</entry>
<entry>CGC<u>GGATCC</u> - GGCGGAGGCGGCACTT</entry>
<entry>BamHI</entry></row>
<row>
<entry align="center">Rev</entry>
<entry>CCCG<u>CTCGAG</u>-TCAGAACCGGTAGCCTAC</entry>
<entry>XhoI</entry></row>
<row>
<entry morerows="1" align="center"><b>fu (961c-L)-Orf46.1</b></entry>
<entry align="center">Fwd</entry>
<entry>CGC<u>GGATCC</u>GGTGGTGGTGGT-TCAGATTTGGCAAACGATTC</entry>
<entry>BamHI</entry></row>
<row>
<entry align="center">Rev</entry>
<entry>CCCG<u>CTCGAG</u>-TTACGTATCATATTTCACGTGC</entry>
<entry>XhoI</entry></row>
<row>
<entry morerows="1" align="center"><b>fu-(ΔG287)-919-His</b></entry>
<entry align="center">Fwd</entry>
<entry>CGC<u>GGATCC</u>GGTGGTGGTGGT-CAAAGCAAGAGCATCCAAACC</entry>
<entry>BamHI</entry></row>
<row>
<entry align="center">Rev</entry>
<entry>CCC<u>AAGCTT</u>-TTCGGGCGGTATTCGGGCTTC</entry>
<entry>HindIII</entry></row>
<row>
<entry morerows="1" align="center"><b>fu-(ΔG287)-953-His</b></entry>
<entry align="center">Fwd</entry>
<entry>CGC<u>GGATCC</u>GGTGGTGGTGGT-GCCACCTACAAAGTGGAC</entry>
<entry>BamHI</entry></row>
<row>
<entry align="center">Rev</entry>
<entry>GCCC<u>AAGCTT</u>-TTGTTTGGCTGCCTCGAT</entry>
<entry>HindIII</entry></row>
<row>
<entry morerows="1" align="center"><b>fu-(ΔG287)-961-His</b></entry>
<entry align="center">Fwd</entry>
<entry>CGC<u>GGATCC</u>GGTGGTGGTGGT-ACAAGCGACGACG</entry>
<entry>BamHI</entry></row>
<row>
<entry align="center">Rev</entry>
<entry>GCCC<u>AAGCTT</u>-CCACTCGTAATTGACGCC</entry>
<entry>HindIII</entry></row>
<row>
<entry morerows="1" align="center"><b>fu-(ΔG287)-Orf46.1-His</b></entry>
<entry align="center">Fwd</entry>
<entry>CGC<u>GGATCC</u>GGTGGTGGTGGT-TCAGATTTGGCAAACGATTC</entry>
<entry>BamHI</entry></row>
<row>
<entry align="center">Rev</entry>
<entry>CCC<u>AAGCTT</u>-CGTATCATATTTCACGTGC</entry>
<entry>HindIII</entry></row>
<row>
<entry morerows="1" align="center"><b>fu-(ΔG287-919)-Orf46.1-His</b></entry>
<entry align="center">Fwd</entry>
<entry>CCC<u>AAGCTT</u>GGTGGTGGTGGTGGT-TCAGATTTGGCAAACGATTC</entry>
<entry>HindIII</entry></row>
<row>
<entry align="center">Rev</entry>
<entry>CCCG<u>CTCGAG</u>-CGTATCATATTTCACGTGC</entry>
<entry>XhoI</entry></row>
<row>
<entry morerows="1" align="center"><b>fu-(ΔG287-Orf46.1)-919-His</b></entry>
<entry align="center">Fwd</entry>
<entry>CCC<u>AAGCCT</u>GGTGGTGGTGGTGGT-CAAAGCAAGAGCATCCAAACC</entry>
<entry>HindIII</entry></row>
<row>
<entry align="center">Rev</entry>
<entry>CCCG<u>CTCGAG</u>-CGGGCGGTATTCGGGCTT</entry>
<entry>XhoI</entry></row>
<row>
<entry morerows="1" align="center"><b>fu ΔG287(394.98)-...</b></entry>
<entry align="center">Fwd</entry>
<entry>CGCGGATCC<u>GCTAGC</u>-CCCGATGTTAAATCGGC</entry>
<entry>NheI</entry></row>
<row>
<entry align="center">Rev</entry>
<entry>CGG<u>GGATCC</u>-ATCCTGCTCTTTTTTGCCGG</entry>
<entry>BamHI</entry></row>
<row>
<entry morerows="1" align="center"><b>fu Orf1-(Orf46.1)-His</b></entry>
<entry align="center">Fwd</entry>
<entry>CGCGGATCC<u>GCTAGC</u>-GGACACACTTATTTCGGCATC</entry>
<entry>NheI</entry></row>
<row>
<entry align="center">Rev</entry>
<entry>CGC<u>GGATCC</u>-CCAGCGGTAGCGTTAATTTGAT</entry>
<entry/></row>
<row>
<entry morerows="1" align="center"><b>fu (Orf1)-Orf46.1-His</b></entry>
<entry align="center">Fwd</entry>
<entry>CGC<u>GGATCC</u>GGTGGTGGTGGT-TCAGATTTGGCAAACGATTC</entry>
<entry>BamHI</entry></row>
<row>
<entry align="center">Rev</entry>
<entry>CCC<u>AAGCTT</u>-CGTATCATATTTCACGTGC</entry>
<entry>HindIII</entry></row>
<row>
<entry morerows="2" align="center"><b>fu (919)-Orf46.1-His</b></entry>
<entry align="center">Fwd1</entry>
<entry>GCGGC<u>GTCGAC</u>GGTGGCGGAGGCACTGGATCCTCAG</entry>
<entry>SalI</entry></row>
<row>
<entry align="center">Fwd2</entry>
<entry>GGAGGCACTGGATCCTCAGATTTGGAAACGATTC</entry>
<entry/></row>
<row>
<entry align="center">Rev</entry>
<entry>CCC<u>GCTCGAG</u>-CGTATCATATTTCACGTGC</entry>
<entry>XhoI</entry></row>
<row>
<entry morerows="1" align="center"><b>Fu (orf46)-287-His</b></entry>
<entry align="center">Fwd</entry>
<entry>CGG<u>GGATCC</u>GGGGGCGGCGGTGGCG</entry>
<entry>BamHI</entry></row>
<row>
<entry align="center">Rev</entry>
<entry>CCC<u>AAGCTT</u>ATCCTGCTCTTTTTTGCCGGC</entry>
<entry>HindIII</entry></row>
<row>
<entry morerows="1" align="center"><b>Fu(orf46)919-His</b></entry>
<entry align="center">Fwd</entry>
<entry><img id="ib0008" file="imgb0008.tif" wi="95" he="8" img-content="dna" img-format="tif"/></entry>
<entry>BamHI</entry></row>
<row>
<entry align="center">Rev</entry>
<entry>CCC<u>AAGCTT</u>GGGCGGTATTCGGGCTTC</entry>
<entry>HindIII</entry></row><!-- EPO <DP n="14"> -->
<row>
<entry morerows="1" align="center"><b>Fu (orf46-919)</b>-<b>287-His</b></entry>
<entry>Fwd</entry>
<entry>CCCC<u>AAGCTT</u>GGGGGCGGCGGTGGCG</entry>
<entry>HindIII</entry></row>
<row>
<entry>Rev</entry>
<entry>CCCG<u>CTCGAG</u>ATCCTGCTCTTTTTTGCCGGC</entry>
<entry>XhoI</entry></row>
<row>
<entry morerows="1" align="center"><b>Fu (orf46-287)-919-His</b></entry>
<entry>Fwd</entry>
<entry><img id="ib0009" file="imgb0009.tif" wi="95" he="9" img-content="dna" img-format="tif"/></entry>
<entry>HindIII</entry></row>
<row>
<entry>Rev</entry>
<entry>CCCG<u>CTCGAG</u>CGGGCGGTATTCGGGCTT</entry>
<entry>XhoI</entry></row>
<row rowsep="0">
<entry morerows="2" rowsep="1" align="center"><b>(ΔG741)-961c-His</b></entry>
<entry>Fwd1</entry>
<entry>GGAGGCACTGGATCCGCAGCCACAAACGACGACGA</entry>
<entry>XhoI</entry></row>
<row>
<entry>Fwd2</entry>
<entry>GCGGC<u>CTCGAG</u>-GGTGGCGGAGGCACTGGATCCGCAG</entry>
<entry/></row>
<row>
<entry>Rev</entry>
<entry>CCCG<u>CTCGAG</u>-ACCCAGCTTGTAAGGTTG</entry>
<entry>XhoI</entry></row>
<row rowsep="0">
<entry morerows="2" rowsep="1" align="center"><b>(ΔG741)-961-His</b></entry>
<entry>Fwd1</entry>
<entry>GGAGGCACTGGATCCGCAGCCACAAACGACGACGA</entry>
<entry>XhoI</entry></row>
<row>
<entry>Fwd2</entry>
<entry>GCGGC<u>CTCGAG</u>-GGTGGCGGAGGCACTGGATCCGCAG</entry>
<entry/></row>
<row>
<entry>Rev</entry>
<entry>CCCG<u>CTCGAG</u>-CCACTCGTAATTGACGCC</entry>
<entry>XhoI</entry></row>
<row>
<entry morerows="1" align="center"><b>(ΔG741)-983-His</b></entry>
<entry>Fwd</entry>
<entry><img id="ib0010" file="imgb0010.tif" wi="70" he="9" img-content="dna" img-format="tif"/></entry>
<entry>XhoI</entry></row>
<row>
<entry>Rev</entry>
<entry>CCCG<u>CTCGAG</u>-GAACCGGTAGCCTACG</entry>
<entry>XhoI</entry></row>
<row rowsep="0">
<entry morerows="2" rowsep="1" align="center"><b>(ΔG741 )-orf46.1-His</b></entry>
<entry>Fwd1</entry>
<entry>GGAGGCACTGGATCCTCAGATTTGGCAAACGATTC</entry>
<entry>SalI</entry></row>
<row>
<entry>Fwd2</entry>
<entry>GCGGC<u>GTCGAC</u>GGTGGCGGAGGCACTGGATCCTCAGA</entry>
<entry/></row>
<row>
<entry>Rev</entry>
<entry>CCCG<u>CTCGAG</u>-CGTATCATATTTCACGTGC</entry>
<entry>XhoI</entry></row>
<row>
<entry morerows="1" align="center"><b>(ΔG983)-741(MC58) -His</b></entry>
<entry>Fwd</entry>
<entry>GCGGC<u>CTCGAG</u>-GGATCCGGAGGGGGTGGTGTCGCC</entry>
<entry>XhoI</entry></row>
<row>
<entry>Rev</entry>
<entry>CCCG<u>CTCGAG</u>-TTGCTTGGCGGCAAG</entry>
<entry>XhoI</entry></row>
<row rowsep="0">
<entry morerows="2" rowsep="1" align="center"><b>(ΔG983)-961c-His</b></entry>
<entry>Fwd1</entry>
<entry>GGAGGCACTGGATCCGCAGCCACAAACGACGACGA</entry>
<entry>Xhol</entry></row>
<row>
<entry>Fwd2</entry>
<entry>GCGGC<u>CTCGAG</u>-GGTGGCGGAGGCACTGGATCCGCAG</entry>
<entry/></row>
<row>
<entry>Rev</entry>
<entry>CCCG<u>CTCGAG</u>-ACCCAGCTTGTAAGGTTG</entry>
<entry>XhoI</entry></row>
<row rowsep="0">
<entry morerows="2" rowsep="1" align="center"><b>(ΔG983)-961-His</b></entry>
<entry>Fwd1</entry>
<entry>GGAGGCACTGGATCCGCAGCCACAAACGACGACGA</entry>
<entry>XhoI</entry></row>
<row>
<entry>Fwd2</entry>
<entry>GCGGC<u>CTCGAG</u>-GGTGGCGGAGGCACTGGATCCGCAG</entry>
<entry/></row>
<row>
<entry>Rev</entry>
<entry>CCCG<u>CTCGAG</u>-CCACTCGTAATTGACGCC</entry>
<entry>XhoI</entry></row>
<row rowsep="0">
<entry morerows="2" rowsep="1" align="center"><b>(ΔG983)- Orf46.1-His</b></entry>
<entry>Fwd1</entry>
<entry>GGAGGCACTGGATCCTCAGATTTGGCAAACGATTC</entry>
<entry>SalI</entry></row>
<row>
<entry>Fwd2</entry>
<entry>GCGGC<u>GTCGAC</u>GGTGGCGGAGGCACTGGATCCTCAGA</entry>
<entry/></row>
<row>
<entry>Rev</entry>
<entry>CCCG<u>CTCGAG</u>-CGTATCATATTTCACGTGC</entry>
<entry>XhoI</entry></row></tbody></tgroup>
<tgroup cols="4" rowsep="0">
<colspec colnum="1" colname="col1" colwidth="46mm"/>
<colspec colnum="2" colname="col2" colwidth="13mm"/>
<colspec colnum="3" colname="col3" colwidth="107mm"/>
<colspec colnum="4" colname="col4" colwidth="27mm"/>
<tbody>
<row>
<entry namest="col1" nameend="col4" align="justify">*This primer was used as a Reverse primer for all the C terminal fusions of 287 to the His-tag.<br/>
§ Forward primers used in combination with the 287-His Reverse primer.<br/>
NB-All PCR reactions use strain 2996 unless otherwise specified (<i>e.g.</i> strain MC58)</entry></row></tbody></tgroup>
</table>
</tables></p>
<p id="p0038" num="0038">In all constructs starting with an ATG not followed by a unique <i>Nhe</i>I site, the ATG codon is part of the <i>Nde</i>I site used for cloning. The constructs made using <i>Nhe</i>I as a cloning site at the 5' end (<i>e.g.</i> all those containing 287 at the N-terminus) have two additional codons (GCT AGC) fused to the coding sequence of the antigen.</p>
<heading id="h0012"><b><i>Preparation of chromosomal DNA templates</i></b></heading>
<p id="p0039" num="0039"><i>N.meningitidis</i> strains 2996, MC58, 394.98, 1000 and BZ232 (and others) were grown to exponential phase in 100ml of GC medium, harvested by centrifugation, and resuspended in 5ml buffer (20% w/v sucrose, 50mM Tris-HCl, 50mM EDTA, pH8). After 10 minutes incubation on ice, the bacteria were lysed by adding 10ml of lysis solution (50mM NaCl, 1% Na-Sarkosyl, 50µg/ml Proteinase K), and the suspension incubated at 37°C for 2 hours. Two<!-- EPO <DP n="15"> --> phenol extractions (equilibrated to pH 8) and one CHCl<sub>3</sub>/isoamylalcohol (24: 1) extraction were performed. DNA was precipitated by addition of 0.3M sodium acetate and 2 volumes of ethanol, and collected by centrifugation. The pellet was washed once with 70%(v/v) ethanol and redissolved in 4.0ml TE buffer (10mM Tris-HCl, 1mM EDTA, pH 8.0). The DNA concentration was measured by reading OD<sub>260</sub>.</p>
<heading id="h0013"><b><i>PCR Amplification</i></b></heading>
<p id="p0040" num="0040">The standard PCR protocol was as follows: 200ng of genomic DNA from 2996, MC581000, or BZ232 strains or 10ng of plasmid DNA preparation of recombinant clones were used as template in the presence of 40µM of each oligonucletide primer, 400-800 µM dNTPs solution, 1x PCR buffer (including 1.5mM MgCl<sub>2</sub>), 2.5 units <i>TaqI</i> DNA polymerase (using Perkin-Elmer AmpliTaQ, Boerhingher Mannheim Expand<sup>™</sup> Long Template).</p>
<p id="p0041" num="0041">After a preliminary 3 minute incubation of the whole mix at 95°C, each sample underwent a two-step amplification: the first 5 cycles were performed using the hybridisation temperature that excluded the restriction enzymes tail of the primer (T<sub>m1</sub>). This was followed by 30 cycles according to the hybridisation temperature calculated for the whole length oligos (T<sub>m2</sub>). Elongation times, performed at 68°C for 72°C, varied according to the length of the Orf to be amplified. In the case of Orf1 the elongation time, starting from 3 minutes, was increased by 15 seconds each cycle. The cycles were completed with a 10 minute extension step at 72°C.</p>
<p id="p0042" num="0042">The amplified DNA was either loaded directly on a 1% agarose gel. The DNA fragment corresponding to the band of correct size was purified from the gel using the Qiagen Gel Extraction Kit, following the manufacturer's protocol.</p>
<heading id="h0014"><b><i>Digestion of PCR fragments and of the cloning vectors</i></b></heading>
<p id="p0043" num="0043">The purified DNA corresponding to the amplified fragment was digested with the appropriate restriction enzymes for cloning into pET-21b+, pET22b+ or pET-24b+. Digested fragments were purified using the QIAquick PCR purification kit (following the manufacturer's instructions) and eluted with either H<sub>2</sub>O or 10mM Tris, pH 8.5. Plasmid vectors were digested with the appropriate restriction enzymes, loaded onto a 1.0% agarose gel and the band corresponding to the digested vector purified using the Qiagen QIAquick Gel Extraction Kit.<!-- EPO <DP n="16"> --></p>
<heading id="h0015"><b><i>Cloning</i></b></heading>
<p id="p0044" num="0044">The fragments corresponding to each gene, previously digested and purified, were ligated into pET21b+, pET22b+ or pET-24b+. A molar ratio of 3:1 fragment/vector was used with T4 DNA ligase in the ligation buffer supplied by the manufacturer.</p>
<p id="p0045" num="0045">Recombinant plasmid was transformed into competent <i>E.coli</i> DH5 or HB101 by incubating the ligase reaction solution and bacteria for 40 minutes on ice, then at 37°C for 3 minutes. This was followed by the addition of 800µl LB broth and incubation at 37°C for 20 minutes. The cells were centrifuged at maximum speed in an Eppendorf microfuge, resuspended in approximately 200µl of the supernatant and plated onto LB ampicillin (100mg/ml) agar.</p>
<p id="p0046" num="0046">Screening for recombinant clones was performed by growing randomly selected colonies overnight at 37°C in 4.0ml of LB broth + 100µg/ml ampicillin. Cells were pelleted and plasmid DNA extracted using the Qiagen QIAprep Spin Miniprep Kit, following the manufacturer's instructions. Approximately 1µg of each individual miniprep was digested with the appropriate restriction enzymes and the digest loaded onto a 1-1.5% agarose gel (depending on the expected insert size), in parallel with the molecular weight marker (1kb DNA Ladder, GIBCO). Positive clones were selected on the basis of the size of insert.</p>
<heading id="h0016"><b><i>Expression</i></b></heading>
<p id="p0047" num="0047">After cloning each gene into the expression vector, recombinant plasmids, were transformed into <i>E.coli</i> strains suitable for expression of the recombinant protein. 1µl of each construct was used to transform <i>E.coli</i> BL21-DE3 as described above. Single recombinant-colonies were inoculated into 2ml LB+Amp (100µg/ml), incubated at 37°C overnight, then diluted 1:30 in 20ml of LB+Amp (100µg/ml) in 100ml flasks, to give an OD<sub>600</sub> between 0.1 and 0.2. The flasks were incubated at 30°C or at 37°C in a gyratory water bath shaker until OD<sub>600</sub> indicated exponential growth suitable for induction of expression (0.4-0.8 OD). Protein expression was induced by addition of 1.0mM IPTG. After 3 hours incubation at 30°C or 37°C the OD<sub>600</sub> was measured and expression examined. 1.0ml of each sample was centrifuged in a microfuge, the pellet resuspended in PBS and analysed by SDS-PAGE and Coomassie Blue straining.</p>
<heading id="h0017"><b><i>Purification of His-tagged proteins</i></b></heading>
<p id="p0048" num="0048">Various forms of 287 were cloned from strains 2996 and MC58. They were constructed with a C-terminus His-tagged fusion and included a mature form (aa 18-427), constructs with<!-- EPO <DP n="17"> --> deletion (Δ1, Δ2, Δ3 and Δ4) and clones composed of either B or C domains. For each clone purified as a His-fusion, a single colony was streaked and grown overnight at 37°C on a LB/Amp (100 µg/ml) agar plate. An isolated colony from this plate was inoculated into 20ml of LB/Amp (100 µg/ml) liquid medium and grown overnight at 37°C with shaking. The overnight culture was diluted 1:30 into 1.0 L LB/Amp (100 µg/ml) liquid medium and allowed to grow at the optimal temperature (30 or 37°C) until the OD<sub>550</sub> reached 0.6-0.8. Expression of recombinant protein was induced by addition of IPTG (final concentration 1.0mM) and the culture incubated for a further 3 hours. Bacteria were harvested by centrifugation at 8000g for 15 min at 4°C. The bacterial pellet was resuspended in 7.5 ml of either (i) cold buffer A (300 mM NaCl, 50 mM phosphate buffer, 10 mM imidazole, pH 8.0) for soluble proteins or (ii) buffer B (10mM Tris-HCl, 100 mM phosphate buffer, pH 8.8 and, optionally, 8M urea) for insoluble proteins. Proteins purified in a soluble form included 287-His, Δ1, Δ2, Δ3 and Δ4287-His, Δ4287MC58-His, 287c-His and 287cMC58-His. Protein 287bMC58-His was insoluble and purified accordingly. Cells were disrupted by sonication on ice four times for 30 sec at 40W using a Branson sonifier 450 and centrifuged at 13000xg for 30 min at 4°C. For insoluble proteins, pellets were resuspended in 2.0 ml buffer C (6 M guanidine hydrochloride; 100 mM phosphate buffer, 10 mM Tris- HCl, pH 7.5 and treated with 10 passes of a Dounce homogenizer. The homogenate was centrifuged at 13000g for 30 min and the supernatant retrained. Supernatants for both soluble and insoluble preparations were mixed with 150µl Ni<sup>2+</sup>-resin (previously equilibrated with either buffer A or buffer B, as appropriate) and incubated at room temperature with gentle agitation for 30 min. The resin was Chelating Sepharose Fast Flow (Pharmacia), prepared according to the manufacturer's protocol. The batch-wise preparation was centrifuged at 700g for 5 min at 4°C and the supernatant discarded. The resin was washed twice (batch-wise) with 10ml buffer A or B for 10 min, resuspended in 1.0 ml buffer A or B and loaded onto a disposable column. The resin continued to be washed with either (i) buffer A at 4°C or (ii) buffer B at room temperature, until the OD<sub>280</sub> of the flow-through reached 0.02-0.01. The resin was further washed with either (i) cold buffer C (300mM NaCl, 50mM phosphate buffer, 20mM imidazole, pH 8.0) or (ii) buffer D (10mM Tris-HCl, 100mM phosphate buffer, pH 6.3 and, optionally, 8M urea) until OD<sub>280</sub> of the flow-through reached 0.02-0.01. The His-fusion protein was eluted by addition of 700µl of either (i) cold elution buffer A (300 mM NaCl, 50mM phosphate buffer, 250 mM imidazole, pH 8.0) or (ii) elution buffer B (10 mM Tris-HCl, 100 mM phosphate buffer, pH 4.5 and, optionally, 8M urea) and fractions<!-- EPO <DP n="18"> --> collected until the OD<sub>280</sub> indicated all the recombinant protein was obtained. 20µl aliquots of each elution fraction were analysed by SDS-PAGE. Protein concentrations were estimated using the Bradford assay.</p>
<heading id="h0018"><b><i>Renaturation of denatured His-fusion proteins.</i></b></heading>
<p id="p0049" num="0049">Denaturation was required to solubilize 287bMC8, so a renaturation step was employed prior to immunisation. Glycerol was added to the denatured fractions obtained above to give a final concentration of 10% v/v. The proteins were diluted to 200 µg/ml using dialysis buffer I (10% v/v glycerol, 0.5M arginine, 50 mM phosphate buffer, 5.0 mM reduced glutathione, 0.5 mM oxidised glutathione, 2.0M urea, pH 8.8) and dialysed against the same buffer for 12-14 hours at 4°C. Further dialysis was performed with buffer II (10% v/v glycerol, 0.5M arginine, 50mM phosphate buffer, 5.0mM reduced glutathione, 0.5mM oxidised glutathione, pH 8.8) for 12-14 hours at 4°C. Protein concentration was estimated using the formula: <maths id="math0003" num=""><math display="block"><mi mathvariant="italic">Protein</mi><mfenced separators=""><mi mathvariant="italic">mg</mi><mo mathvariant="italic">/</mo><mi mathvariant="italic">ml</mi></mfenced><mo mathvariant="italic">=</mo><mfenced separators=""><mn mathvariant="italic">1.55</mn><mmultiscripts><msub><mi>x</mi><mspace width="1em"/></msub><mprescripts/><mspace width="1em"/><none/></mmultiscripts><msub><mi mathvariant="italic">OD</mi><mn mathvariant="italic">280</mn></msub></mfenced><mo mathvariant="italic">-</mo><mfenced separators=""><mn mathvariant="italic">0.76</mn><mmultiscripts><mi>x</mi><mprescripts/><mspace width="1em"/><none/></mmultiscripts><mspace width="1em"/><msub><mi mathvariant="italic">OD</mi><mn mathvariant="italic">260</mn></msub></mfenced></math><img id="ib0011" file="imgb0011.tif" wi="95" he="9" img-content="math" img-format="tif"/></maths></p>
<heading id="h0019"><b><i>Immunization</i></b></heading>
<p id="p0050" num="0050">Balb/C mice were immunized with antigens on days 0, 21 and 35 and sera analyzed at day 49.</p>
<heading id="h0020"><b><i>Sera analysis - ELISA</i></b></heading>
<p id="p0051" num="0051">The acapsulated MenB M7 and the capsulated strains were plated on chocolate agar plates and incubated overnight at 37°C with 5% CO<sub>2</sub>. Bacterial colonies were collected from the agar plates using a sterile dracon swab and inoculated into Mueller-Hinton Broth (Difco) containing 0.25% glucose. Bacterial growth was monitored every 30 minutes by following OD<sub>620</sub>. The bacteria were let to grow until the OD reached the value of 0.4-0.5. The culture was centrifuged for 10 minutes at 4000rpm. The supernatant was discarded and bacteria were washed twice with PBS, resuspended in PBS containing 0.025% formaldehyde, and incubated for 1 hour at 37°C and then overnight at 4°C with stirring. 100µl bacterial cells were added to each well of a 96 well Greiner plate and incubated overnight at 4°C. The wells were then washed three times with PBT washing buffer (0.1% Tween-20 in PBS). 200µl of saturation buffer (2.7% polyvinylpyrrolidone 10 in water) was added to each well and the plates incubated for 2 hours at 37°C. Wells were washed three times with PBT. 200µl of diluted sera (Dilution buffer: 1% BSA, 0.1% Tween-20, 0.1% NaN<sub>3</sub> in PBS) were added to each well and the plates incubated for 2 hours at 37°C. Wells were washed three times with PBT. 100µl of HRP-conjugated rabbit anti-mouse (Dako) serum diluted 1:2000 in dilution buffer were added to each well and the plates were incubated for 90 minutes at 37°C. Wells<!-- EPO <DP n="19"> --> were washed three times with PBT buffer. 100µl of substrate buffer for HRP (25ml of citrate buffer pH5, 10mg of O-phenildiamine and 10µl of H<sub>2</sub>O<sub>2</sub>) were added to each well and the plates were left at room temperature for 20 minutes. 100µl 12.5% H<sub>2</sub>SO<sub>4</sub> was added to each well and OD<sub>490</sub> was followed. The ELISA titers were calculated abitrarely as the dilution of sera which gave an OD<sub>490</sub> value of 0.4 above the level of preimmune sera. The ELISA was considered positive when the dilution of sera with OD<sub>490</sub> of 0.4 was higher than 1:400.</p>
<heading id="h0021"><b><i>Sera analysis - FACS Scan bacteria binding assay</i></b></heading>
<p id="p0052" num="0052">The acapsulated MenB M7 strain was plated on chocolate agar plates and incubated overnight at 37°C. with 5% CO<sub>2</sub>. Bacterial colonies were collected from the agar plates using a sterile dracon swab and inoculated into 4 tubes containing 8ml each Mueller-Hinton Broth (Difco) containing 0.25% glucose. Bacterial growth was monitored every 30 minutes by following OD<sub>620</sub>. The bacteria were let to grow until the OD reached the value of 0.35-0.5. The culture was centrifuged for 10 minutes at 4000rpm. The supernatant was discarded and the pellet was resuspended in blocking buffer (1% BSA in PBS, 0.4% NaN<sub>3</sub>) and centrifuged for 5 minutes at 4000rpm. Cells were resuspended in blocking buffer to reach OD<sub>620</sub> of 0.05. 100µl bacterial cells were added to each well of a Costar 96 well plate. 100µl of diluted (1:100, 1:200, 1:400) sera (in blocking buffer) were added to each well and plates incubated for 2 hours at 4°C. Cells were centrifuged for 5 minutes at 4000rpm, the supernatant aspirated and cells washed by addition of 200µl/well of blocking buffet in each well. 100µl of R-Phicoerytrin conjugated F(ab)<sub>2</sub> goat anti-mouse, diluted 1:100, was added to each well and plates incubated for 1 hour at 4°C. Cells were spun down by centrifugation at 4000rpm for 5 minutes and washed by addition of 200µl/well of blocking buffer. The supernatant was aspirated and cells resuspended in 200µl/well of PBS, 0.25% formaldehyde. Samples were transferred to FACScan tubes and read. The condition for FACScan (Laser Power 15mW) setting were: FL2 on; FSC-H threshold:92; FSC PMT Voltage: E 01; SSC PMT: 474; Amp. Gains 6.1; FL-2 PMT: 586; compensation values: 0.</p>
<heading id="h0022"><b><i>Sera analysis - bactericidal assay</i></b></heading>
<p id="p0053" num="0053"><i>N. meningitidis</i> strain 2996 was grown overnight at 37°C on chocolate agar plates (starting from a frozen stock) with 5% CO<sub>2</sub>. Colonies were collected and used to inoculate 7ml Mueller-Hinton broth, containing 0.25% glucose to reach an OD<sub>620</sub> of 0.05-0.08. The culture was incubated for approximately 1.5 hours at 37 degrees with shacking until the OD<sub>620</sub> reached the value of 0.23-0.24. Bacteria were diluted in 50mM Phosphate buffer pH 7.2 containing 10mM MgCl<sub>2</sub>, 10mM CaCl<sub>2</sub> and 0.5% (w/v) BSA (assay buffer) at the working dilution of 10<sup>5</sup> CFU/ml. The total volume of the final reaction mixture was 50 µl with 25 µl<!-- EPO <DP n="20"> --> of serial two fold dilution of test serum, 12.5 µl of bacteria at the working dilution, 12.5 µl of baby rabbit complement (final concentration 25%).</p>
<p id="p0054" num="0054">Controls included bacteria incubated with complement serum, immune sera incubated with bacteria and with complement inactivated by heating at 56°C for 30'. Immediately after the addition of the baby rabbit complement, 10µl of the controls were plated on Mueller-Hinton agar plates using the tilt method (time 0). The 96-wells plate was incubated for 1 hour at 37°C with rotation. 7µl of each sample were plated on Mueller-Hinton agar plates as spots, whereas 10µl of the controls were plated on Mueller-Hinton agar plates using the tilt method (time 1). Agar plates were incubated for 18 hours at 37 degrees and the colonies corresponding to time 0 and time 1 were counted.</p>
<heading id="h0023"><b><i>Sera analysis - western blots</i></b></heading>
<p id="p0055" num="0055">Purified proteins (500ng/lane), outer membrane vesicles (5µg) and total cell extracts (25µg) derived from MenB strain 2996 were loaded onto a 12% SDS-polyacrylamide gel and transferred to a nitrocellulose membrane. The transfer was performed for 2 hours at 150mA at 4°C, using transfer buffer (0.3% Tris base, 1.44% glycine, 20% (v/v) ethanol). The membrane was saturated by overnight incubation at 4°C in saturation buffer (10% skimmed milk, 0.1% Triton X100 in PBS). The membrane was washed twice with washing buffer (3% skimmed milk, 0.1% Triton X100 in PBS) and incubated for 2 hours at 37°C with mice sera diluted 1:200 in washing buffer. The membrane was washed twice and incubated for 90 minutes with a 1:2000 dilution of horseradish peroxidase labelled anti-mouse Ig. The membrane was washed twice with 0.1% Triton X100 in PBS and developed with the Opti-4CN Substrate Kit (Bio-Rad). The reaction was stopped by adding water.</p>
<p id="p0056" num="0056">The OMVs were prepared as follows: <i>N</i>. <i>meningitidis</i> strain 2996 was grown overnight at 37 degrees with 5% CO<sub>2</sub> on 5 GC plates, harvested with a loop and resuspended in 10 ml of 20mM Tris-HCl pH 7.5, 2 mM EDTA. Heat inactivation was performed at 56°C for 45 minutes and the bacteria disrupted by sonication for 5 minutes on ice (50% duty cycle, 50% output, Branson sonifier 3 mm microtip). Unbroken cells were removed by centrifugation at 5000g for 10 minutes, the supernatant containing the total cell envelope fraction recovered and further centrifuged overnight at 50000g at the temperature of 4°C. The pellet containing the membranes was resuspended in 2% sarkosyl, 20mM Tris-HCl pH 7.5, 2 mM EDTA and incubated at room temperature for 20 minutes to solubilise the inner membranes. The suspension was centrifuged at 10000g for 10 minutes to remove aggregates, the supernatant was further centrifuges at 50000g for 3 hours. The pellet, containing the outer membranes<!-- EPO <DP n="21"> --> was washed in PBS and resuspended in the same buffer. Protein concentration was measured by the D.C. Bio-Rad Protein assay (Modified Lowry method), using BSA as a standard.</p>
<p id="p0057" num="0057">Total cell extracts were prepared as follows: <i>N. meningitidis</i> strain 2996 was grown overnight on a GC plate, harvested with a loop and resuspended in 1ml of 20mM Tris-HCl. Heat inactivation was performed at 56°C for 30 minutes.<!-- EPO <DP n="22"> --></p>
<heading id="h0024">SEQUENCE LISTING</heading>
<p id="p0058" num="0058">
<ul id="ul0001" list-style="none">
<li>&lt;110&gt; Novartis Vaccines and Diagnostics SRL</li>
<li>&lt;120&gt; Hybrid Expression of Neisserial Proteins</li>
<li>&lt;130&gt; P048826EP</li>
<li>&lt;150&gt; <patcit id="pcit0007" dnum="EP01914098A"><text>EP-01914098.7</text></patcit><br/>
&lt;151&gt; 2001-02-28</li>
<li>&lt;150&gt; <patcit id="pcit0008" dnum="WOIB0100420W"><text>PCT/IB01/00420</text></patcit><br/>
&lt;151&gt; 2001-02-28</li>
<li>&lt;150&gt; <patcit id="pcit0009" dnum="GB0004695A"><text>GB 0004695.3</text></patcit><br/>
&lt;151&gt; 2000-02-28</li>
<li>&lt;150&gt; <patcit id="pcit0010" dnum="GB0027675A"><text>GB 0027675.8</text></patcit><br/>
&lt;151&gt; 2000-11-13</li>
<li>&lt;160&gt; 121</li>
<li>&lt;170&gt; SeqWin99, version 1.02</li>
<li>&lt;210&gt; 1<br/>
&lt;211&gt; 608<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Neisseria meningitidis</li>
<li>&lt;400&gt; 1
<img id="ib0012" file="imgb0012.tif" wi="147" he="128" img-content="dna" img-format="tif"/><!-- EPO <DP n="23"> -->
<img id="ib0013" file="imgb0013.tif" wi="139" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="24"> -->
<img id="ib0014" file="imgb0014.tif" wi="146" he="88" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 2<br/>
&lt;211&gt; 464<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; deltaG287</li>
<li>&lt;400&gt; 2
<img id="ib0015" file="imgb0015.tif" wi="146" he="121" img-content="dna" img-format="tif"/><!-- EPO <DP n="25"> -->
<img id="ib0016" file="imgb0016.tif" wi="147" he="231" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 3<br/>
&lt;211&gt; 2505<br/>
<!-- EPO <DP n="26"> -->&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; deltaG287-919</li>
<li>&lt;400&gt; 3
<img id="ib0017" file="imgb0017.tif" wi="163" he="171" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 4<br/>
&lt;211&gt; 832<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; deltaG287-919</li>
<li>&lt;400&gt; 4
<img id="ib0018" file="imgb0018.tif" wi="145" he="13" img-content="dna" img-format="tif"/><!-- EPO <DP n="27"> -->
<img id="ib0019" file="imgb0019.tif" wi="141" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="28"> -->
<img id="ib0020" file="imgb0020.tif" wi="141" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="29"> -->
<img id="ib0021" file="imgb0021.tif" wi="146" he="131" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 5<br/>
&lt;211&gt; 1746<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; deltaG287-953</li>
<li>&lt;400&gt; 5
<img id="ib0022" file="imgb0022.tif" wi="165" he="79" img-content="dna" img-format="tif"/><!-- EPO <DP n="30"> -->
<img id="ib0023" file="imgb0023.tif" wi="165" he="50" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 6<br/>
&lt;211&gt; 579<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; deltaG287-953</li>
<li>&lt;400&gt; 6
<img id="ib0024" file="imgb0024.tif" wi="146" he="163" img-content="dna" img-format="tif"/><!-- EPO <DP n="31"> -->
<img id="ib0025" file="imgb0025.tif" wi="141" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="32"> -->
<img id="ib0026" file="imgb0026.tif" wi="146" he="35" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 7<br/>
&lt;211&gt; 2388<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; deltaG287-961</li>
<li>&lt;400&gt; 7
<img id="ib0027" file="imgb0027.tif" wi="164" he="162" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 8<br/>
<!-- EPO <DP n="33"> -->&lt;211&gt; 793<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; deltaG287-961</li>
<li>&lt;400&gt; 8
<img id="ib0028" file="imgb0028.tif" wi="150" he="215" img-content="dna" img-format="tif"/><!-- EPO <DP n="34"> -->
<img id="ib0029" file="imgb0029.tif" wi="142" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="35"> -->
<img id="ib0030" file="imgb0030.tif" wi="150" he="145" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 9<br/>
&lt;211&gt; 2700<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; deltaG287NZ-919</li>
<li>&lt;400&gt; 9
<img id="ib0031" file="imgb0031.tif" wi="163" he="67" img-content="dna" img-format="tif"/><!-- EPO <DP n="36"> -->
<img id="ib0032" file="imgb0032.tif" wi="165" he="119" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 10<br/>
&lt;211&gt; 897<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; deltaG287NZ-919</li>
<li>&lt;400&gt; 10
<img id="ib0033" file="imgb0033.tif" wi="150" he="93" img-content="dna" img-format="tif"/><!-- EPO <DP n="37"> -->
<img id="ib0034" file="imgb0034.tif" wi="139" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="38"> -->
<img id="ib0035" file="imgb0035.tif" wi="141" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="39"> -->
<img id="ib0036" file="imgb0036.tif" wi="147" he="108" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 11<br/>
&lt;211&gt; 1941<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; deltaG287NZ-953</li>
<li>&lt;400&gt; 11
<img id="ib0037" file="imgb0037.tif" wi="165" he="104" img-content="dna" img-format="tif"/><!-- EPO <DP n="40"> -->
<img id="ib0038" file="imgb0038.tif" wi="165" he="37" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 12<br/>
&lt;211&gt; 644<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; deltaG287NZ-953</li>
<li>&lt;400&gt; 12
<img id="ib0039" file="imgb0039.tif" wi="146" he="177" img-content="dna" img-format="tif"/><!-- EPO <DP n="41"> -->
<img id="ib0040" file="imgb0040.tif" wi="140" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="42"> -->
<img id="ib0041" file="imgb0041.tif" wi="150" he="70" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 13<br/>
&lt;211&gt; 2583<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; deltaG287NZ-961</li>
<li>&lt;400&gt; 13
<img id="ib0042" file="imgb0042.tif" wi="164" he="136" img-content="dna" img-format="tif"/><!-- EPO <DP n="43"> -->
<img id="ib0043" file="imgb0043.tif" wi="165" he="50" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 14<br/>
&lt;211&gt; 858<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; deltaG287NZ-961</li>
<li>&lt;400&gt; 14
<img id="ib0044" file="imgb0044.tif" wi="146" he="163" img-content="dna" img-format="tif"/><!-- EPO <DP n="44"> -->
<img id="ib0045" file="imgb0045.tif" wi="140" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="45"> -->
<img id="ib0046" file="imgb0046.tif" wi="141" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="46"> --></li>
<li>&lt;210&gt; 15<br/>
&lt;211&gt; 1082<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; 983</li>
<li>&lt;400&gt; 15
<img id="ib0047" file="imgb0047.tif" wi="148" he="210" img-content="dna" img-format="tif"/><!-- EPO <DP n="47"> -->
<img id="ib0048" file="imgb0048.tif" wi="137" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="48"> -->
<img id="ib0049" file="imgb0049.tif" wi="142" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="49"> -->
<img id="ib0050" file="imgb0050.tif" wi="146" he="121" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 16<br/>
&lt;211&gt; 1047<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; deltaG983</li>
<li>&lt;400&gt; 16
<img id="ib0051" file="imgb0051.tif" wi="146" he="93" img-content="dna" img-format="tif"/><!-- EPO <DP n="50"> -->
<img id="ib0052" file="imgb0052.tif" wi="143" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="51"> -->
<img id="ib0053" file="imgb0053.tif" wi="142" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="52"> -->
<img id="ib0054" file="imgb0054.tif" wi="151" he="218" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 17<br/>
&lt;211&gt; 4425<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; deltaG983-ORF46.1<!-- EPO <DP n="53"> --></li>
<li>&lt;400&gt; 17
<img id="ib0055" file="imgb0055.tif" wi="161" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="54"> -->
<img id="ib0056" file="imgb0056.tif" wi="165" he="67" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 18<br/>
&lt;211&gt; 1474<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; deltaG983-ORF46.1</li>
<li>&lt;400&gt; 18
<img id="ib0057" file="imgb0057.tif" wi="146" he="146" img-content="dna" img-format="tif"/><!-- EPO <DP n="55"> -->
<img id="ib0058" file="imgb0058.tif" wi="137" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="56"> -->
<img id="ib0059" file="imgb0059.tif" wi="140" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="57"> -->
<img id="ib0060" file="imgb0060.tif" wi="142" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="58"> -->
<img id="ib0061" file="imgb0061.tif" wi="146" he="233" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 19<br/>
<!-- EPO <DP n="59"> -->&lt;211&gt; 3939<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; deltaG983-741</li>
<li>&lt;400&gt; 19
<img id="ib0062" file="imgb0062.tif" wi="163" he="215" img-content="dna" img-format="tif"/><!-- EPO <DP n="60"> -->
<img id="ib0063" file="imgb0063.tif" wi="165" he="58" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 20<br/>
&lt;211&gt; 1312<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; deltaG983-741</li>
<li>&lt;400&gt; 20
<img id="ib0064" file="imgb0064.tif" wi="150" he="157" img-content="dna" img-format="tif"/><!-- EPO <DP n="61"> -->
<img id="ib0065" file="imgb0065.tif" wi="145" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="62"> -->
<img id="ib0066" file="imgb0066.tif" wi="139" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="63"> -->
<img id="ib0067" file="imgb0067.tif" wi="140" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="64"> -->
<img id="ib0068" file="imgb0068.tif" wi="150" he="98" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 21<br/>
&lt;211&gt; 4344<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; deltaG983-961</li>
<li>&lt;400&gt; 21
<img id="ib0069" file="imgb0069.tif" wi="165" he="109" img-content="dna" img-format="tif"/><!-- EPO <DP n="65"> -->
<img id="ib0070" file="imgb0070.tif" wi="165" he="191" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 22<br/>
&lt;211&gt; 1447<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; deltaG983-961</li>
<li>&lt;400&gt; 22
<img id="ib0071" file="imgb0071.tif" wi="145" he="20" img-content="dna" img-format="tif"/><!-- EPO <DP n="66"> -->
<img id="ib0072" file="imgb0072.tif" wi="137" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="67"> -->
<img id="ib0073" file="imgb0073.tif" wi="141" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="68"> -->
<img id="ib0074" file="imgb0074.tif" wi="140" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="69"> -->
<img id="ib0075" file="imgb0075.tif" wi="139" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="70"> -->
<img id="ib0076" file="imgb0076.tif" wi="147" he="98" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 23<br/>
&lt;211&gt; 4179<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; deltaG963-961c</li>
<li>&lt;400&gt; 23
<img id="ib0077" file="imgb0077.tif" wi="165" he="113" img-content="dna" img-format="tif"/><!-- EPO <DP n="71"> -->
<img id="ib0078" file="imgb0078.tif" wi="165" he="178" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 24<br/>
&lt;211&gt; 1392<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; deltaG983-961c</li>
<li>&lt;400&gt; 24
<img id="ib0079" file="imgb0079.tif" wi="146" he="36" img-content="dna" img-format="tif"/><!-- EPO <DP n="72"> -->
<img id="ib0080" file="imgb0080.tif" wi="142" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="73"> -->
<img id="ib0081" file="imgb0081.tif" wi="140" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="74"> -->
<img id="ib0082" file="imgb0082.tif" wi="137" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="75"> -->
<img id="ib0083" file="imgb0083.tif" wi="143" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="76"> -->
<img id="ib0084" file="imgb0084.tif" wi="148" he="40" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 25<br/>
&lt;211&gt; 274<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; 741</li>
<li>&lt;400&gt; 25
<img id="ib0085" file="imgb0085.tif" wi="150" he="167" img-content="dna" img-format="tif"/><!-- EPO <DP n="77"> -->
<img id="ib0086" file="imgb0086.tif" wi="146" he="46" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 26<br/>
&lt;211&gt; 248<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; deltaG741</li>
<li>&lt;400&gt; 26
<img id="ib0087" file="imgb0087.tif" wi="150" he="164" img-content="dna" img-format="tif"/><!-- EPO <DP n="78"> -->
<img id="ib0088" file="imgb0088.tif" wi="146" he="34" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 27<br/>
&lt;211&gt; 1947<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; deltaG741-961</li>
<li>&lt;400&gt; 27
<img id="ib0089" file="imgb0089.tif" wi="165" he="135" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 28<br/>
&lt;211&gt; 648<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; deltaG791-961</li>
<li>&lt;400&gt; 28
<img id="ib0090" file="imgb0090.tif" wi="145" he="8" img-content="dna" img-format="tif"/><!-- EPO <DP n="79"> -->
<img id="ib0091" file="imgb0091.tif" wi="137" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="80"> -->
<img id="ib0092" file="imgb0092.tif" wi="141" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="81"> --></li>
<li>&lt;210&gt; 29<br/>
&lt;211&gt; 1782<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; deltaG741-961c</li>
<li>&lt;400&gt; 29
<img id="ib0093" file="imgb0093.tif" wi="164" he="123" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 30<br/>
&lt;211&gt; 593<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; deltaG741-961c</li>
<li>&lt;400&gt; 30
<img id="ib0094" file="imgb0094.tif" wi="148" he="49" img-content="dna" img-format="tif"/><!-- EPO <DP n="82"> -->
<img id="ib0095" file="imgb0095.tif" wi="140" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="83"> -->
<img id="ib0096" file="imgb0096.tif" wi="146" he="161" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 31<br/>
&lt;211&gt; 3939<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; deltaG741-983</li>
<li>&lt;400&gt; 31
<img id="ib0097" file="imgb0097.tif" wi="164" he="49" img-content="dna" img-format="tif"/><!-- EPO <DP n="84"> -->
<img id="ib0098" file="imgb0098.tif" wi="165" he="223" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 32<br/>
&lt;211&gt; 1312<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence<!-- EPO <DP n="85"> --> &lt;220&gt;<br/>
<br/>
&lt;223&gt; deltaG741-983</li>
<li>&lt;400&gt; 32
<img id="ib0099" file="imgb0099.tif" wi="147" he="227" img-content="dna" img-format="tif"/><!-- EPO <DP n="86"> -->
<img id="ib0100" file="imgb0100.tif" wi="140" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="87"> -->
<img id="ib0101" file="imgb0101.tif" wi="137" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="88"> -->
<img id="ib0102" file="imgb0102.tif" wi="142" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="89"> -->
<img id="ib0103" file="imgb0103.tif" wi="148" he="25" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 33<br/>
&lt;211&gt; 2028<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; deltaG741-ORF46.1</li>
<li>&lt;400&gt; 33
<img id="ib0104" file="imgb0104.tif" wi="163" he="139" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 34<br/>
&lt;211&gt; 675<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; deltaG741-ORF46.1</li>
<li>&lt;400&gt; 34
<img id="ib0105" file="imgb0105.tif" wi="145" he="7" img-content="dna" img-format="tif"/><!-- EPO <DP n="90"> -->
<img id="ib0106" file="imgb0106.tif" wi="140" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="91"> -->
<img id="ib0107" file="imgb0107.tif" wi="143" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="92"> -->
<img id="ib0108" file="imgb0108.tif" wi="145" he="25" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 35<br/>
&lt;211&gt; 2019<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; ORF46.1-741</li>
<li>&lt;400&gt; 35
<img id="ib0109" file="imgb0109.tif" wi="165" he="136" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 36<br/>
&lt;211&gt; 672<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; ORF46.1-791</li>
<li>&lt;400&gt; 36
<img id="ib0110" file="imgb0110.tif" wi="146" he="14" img-content="dna" img-format="tif"/><!-- EPO <DP n="93"> -->
<img id="ib0111" file="imgb0111.tif" wi="143" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="94"> -->
<img id="ib0112" file="imgb0112.tif" wi="140" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="95"> -->
<img id="ib0113" file="imgb0113.tif" wi="162" he="10" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 37<br/>
&lt;211&gt; 2421<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; ORF46.1-961</li>
<li>&lt;400&gt; 37
<img id="ib0114" file="imgb0114.tif" wi="164" he="167" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 38<br/>
&lt;211&gt; 806<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; ORF46.1-961<!-- EPO <DP n="96"> --></li>
<li>&lt;400&gt; 38
<img id="ib0115" file="imgb0115.tif" wi="143" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="97"> -->
<img id="ib0116" file="imgb0116.tif" wi="142" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="98"> -->
<img id="ib0117" file="imgb0117.tif" wi="146" he="131" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 39<br/>
&lt;211&gt; 2256<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; ORF46.1-961c</li>
<li>&lt;400&gt; 39
<img id="ib0118" file="imgb0118.tif" wi="165" he="79" img-content="dna" img-format="tif"/><!-- EPO <DP n="99"> -->
<img id="ib0119" file="imgb0119.tif" wi="165" he="79" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 40<br/>
&lt;211&gt; 751<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; ORF46.1-961c</li>
<li>&lt;400&gt; 40
<img id="ib0120" file="imgb0120.tif" wi="147" he="130" img-content="dna" img-format="tif"/><!-- EPO <DP n="100"> -->
<img id="ib0121" file="imgb0121.tif" wi="142" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="101"> -->
<img id="ib0122" file="imgb0122.tif" wi="146" he="193" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 41<br/>
&lt;211&gt; 2421<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; 961-ORF46.1</li>
<li>&lt;400&gt; 41
<img id="ib0123" file="imgb0123.tif" wi="161" he="19" img-content="dna" img-format="tif"/><!-- EPO <DP n="102"> -->
<img id="ib0124" file="imgb0124.tif" wi="164" he="152" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 42<br/>
&lt;211&gt; 806<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; 961-ORF46.1</li>
<li>&lt;400&gt; 42
<img id="ib0125" file="imgb0125.tif" wi="146" he="62" img-content="dna" img-format="tif"/><!-- EPO <DP n="103"> -->
<img id="ib0126" file="imgb0126.tif" wi="143" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="104"> -->
<img id="ib0127" file="imgb0127.tif" wi="140" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="105"> -->
<img id="ib0128" file="imgb0128.tif" wi="147" he="70" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 43<br/>
&lt;211&gt; 1938<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; 961-741</li>
<li>&lt;400&gt; 43
<img id="ib0129" file="imgb0129.tif" wi="165" he="135" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 44<br/>
<!-- EPO <DP n="106"> -->&lt;211&gt; 645<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; 961-741</li>
<li>&lt;400&gt; 44
<img id="ib0130" file="imgb0130.tif" wi="150" he="215" img-content="dna" img-format="tif"/><!-- EPO <DP n="107"> -->
<img id="ib0131" file="imgb0131.tif" wi="142" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="108"> -->
<img id="ib0132" file="imgb0132.tif" wi="150" he="36" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 45<br/>
&lt;211&gt; 4335<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; 961-983</li>
<li>&lt;400&gt; 45
<img id="ib0133" file="imgb0133.tif" wi="164" he="176" img-content="dna" img-format="tif"/><!-- EPO <DP n="109"> -->
<img id="ib0134" file="imgb0134.tif" wi="165" he="125" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 46<br/>
&lt;211&gt; 1444<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; 961-983</li>
<li>&lt;400&gt; 46
<img id="ib0135" file="imgb0135.tif" wi="148" he="83" img-content="dna" img-format="tif"/><!-- EPO <DP n="110"> -->
<img id="ib0136" file="imgb0136.tif" wi="141" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="111"> -->
<img id="ib0137" file="imgb0137.tif" wi="139" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="112"> -->
<img id="ib0138" file="imgb0138.tif" wi="141" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="113"> -->
<img id="ib0139" file="imgb0139.tif" wi="140" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="114"> -->
<img id="ib0140" file="imgb0140.tif" wi="148" he="30" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 47<br/>
&lt;211&gt; 2256<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; 961c-ORF46.1</li>
<li>&lt;400&gt; 47
<img id="ib0141" file="imgb0141.tif" wi="165" he="154" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 48<br/>
&lt;211&gt; 751<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence<!-- EPO <DP n="115"> --></li>
<li>&lt;220&gt;<br/>
&lt;223&gt; 961c-ORF46.1</li>
<li>&lt;400&gt; 48
<img id="ib0142" file="imgb0142.tif" wi="148" he="229" img-content="dna" img-format="tif"/><!-- EPO <DP n="116"> -->
<img id="ib0143" file="imgb0143.tif" wi="142" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="117"> -->
<img id="ib0144" file="imgb0144.tif" wi="150" he="93" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 49<br/>
&lt;211&gt; 1773<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; 961c-741</li>
<li>&lt;400&gt; 49
<img id="ib0145" file="imgb0145.tif" wi="165" he="117" img-content="dna" img-format="tif"/><!-- EPO <DP n="118"> -->
<img id="ib0146" file="imgb0146.tif" wi="165" he="9" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 50<br/>
&lt;211&gt; 590<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; 961c-741</li>
<li>&lt;400&gt; 50
<img id="ib0147" file="imgb0147.tif" wi="148" he="203" img-content="dna" img-format="tif"/><!-- EPO <DP n="119"> -->
<img id="ib0148" file="imgb0148.tif" wi="143" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="120"> --></li>
<li>&lt;210&gt; 51<br/>
&lt;211&gt; 4170<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence &lt;220&gt;<br/>
<br/>
&lt;223&gt; 961c-983</li>
<li>&lt;400&gt; 51
<img id="ib0149" file="imgb0149.tif" wi="165" he="211" img-content="dna" img-format="tif"/><!-- EPO <DP n="121"> -->
<img id="ib0150" file="imgb0150.tif" wi="165" he="79" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 52<br/>
&lt;211&gt; 1389<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; 961c-983</li>
<li>&lt;400&gt; 52
<img id="ib0151" file="imgb0151.tif" wi="148" he="131" img-content="dna" img-format="tif"/><!-- EPO <DP n="122"> -->
<img id="ib0152" file="imgb0152.tif" wi="140" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="123"> -->
<img id="ib0153" file="imgb0153.tif" wi="141" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="124"> -->
<img id="ib0154" file="imgb0154.tif" wi="147" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="125"> -->
<img id="ib0155" file="imgb0155.tif" wi="151" he="181" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 53<br/>
&lt;211&gt; 2304<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; 961cL-ORF46.1</li>
<li>&lt;400&gt; 53
<img id="ib0156" file="imgb0156.tif" wi="163" he="31" img-content="dna" img-format="tif"/><!-- EPO <DP n="126"> -->
<img id="ib0157" file="imgb0157.tif" wi="165" he="132" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 54<br/>
&lt;211&gt; 765<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; 961cL-ORF46.1</li>
<li>&lt;400&gt; 54
<img id="ib0158" file="imgb0158.tif" wi="147" he="79" img-content="dna" img-format="tif"/><!-- EPO <DP n="127"> -->
<img id="ib0159" file="imgb0159.tif" wi="141" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="128"> -->
<img id="ib0160" file="imgb0160.tif" wi="142" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="129"> -->
<img id="ib0161" file="imgb0161.tif" wi="165" he="14" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 55<br/>
&lt;211&gt; 1839<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; 961cL-741</li>
<li>&lt;400&gt; 55
<img id="ib0162" file="imgb0162.tif" wi="165" he="127" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 56<br/>
&lt;211&gt; 612<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; 961cL-741</li>
<li>&lt;400&gt; 56
<img id="ib0163" file="imgb0163.tif" wi="146" he="35" img-content="dna" img-format="tif"/><!-- EPO <DP n="130"> -->
<img id="ib0164" file="imgb0164.tif" wi="145" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="131"> -->
<img id="ib0165" file="imgb0165.tif" wi="147" he="194" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 57<br/>
&lt;211&gt; 4218<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; 961cL-983</li>
<li>&lt;400&gt; 57
<img id="ib0166" file="imgb0166.tif" wi="162" he="20" img-content="dna" img-format="tif"/><!-- EPO <DP n="132"> -->
<img id="ib0167" file="imgb0167.tif" wi="155" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="133"> -->
<img id="ib0168" file="imgb0168.tif" wi="164" he="30" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 58<br/>
&lt;211&gt; 1403<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; 961cL-983</li>
<li>&lt;400&gt; 58
<img id="ib0169" file="imgb0169.tif" wi="146" he="182" img-content="dna" img-format="tif"/><!-- EPO <DP n="134"> -->
<img id="ib0170" file="imgb0170.tif" wi="141" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="135"> -->
<img id="ib0171" file="imgb0171.tif" wi="136" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="136"> -->
<img id="ib0172" file="imgb0172.tif" wi="146" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="137"> -->
<img id="ib0173" file="imgb0173.tif" wi="150" he="146" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 59<br/>
&lt;211&gt; 25<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 59<br/>
cgcggatccg gagggggtgg tgtcg    25</li>
<li>&lt;210&gt; 60<br/>
&lt;211&gt; 27<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 60<br/>
cccgctcgag ttgcttggcg gcaaggc    27</li>
<li>&lt;210&gt; 61<br/>
&lt;211&gt; 25<br/>
&lt;212&gt; DNA<br/>
<!-- EPO <DP n="138"> -->&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 61<br/>
cgcggatccg gcggaggcgg cactt    25</li>
<li>&lt;210&gt; 62<br/>
&lt;211&gt; 26<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 62<br/>
cccgctcgag gaaccggtag cctacg    26</li>
<li>&lt;210&gt; 63<br/>
&lt;211&gt; 41<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 63<br/>
cgcggatccg gtggtggtgg ttcagatttg gcaaacgatt c    41</li>
<li>&lt;210&gt; 64<br/>
&lt;211&gt; 29<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 64<br/>
cccgctcgag cgtatcatat ttcacgtgc    29</li>
<li>&lt;210&gt; 65<br/>
&lt;211&gt; 25<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 65<br/>
cgcggatccg gagggggtgg tgtcg       25</li>
<li>&lt;210&gt; 66<br/>
&lt;211&gt; 28<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 66<br/>
<!-- EPO <DP n="139"> -->cccgctcgag ttattgcttg gcggcaag    28</li>
<li>&lt;210&gt; 67<br/>
&lt;211&gt; 25<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 67</li>
<li>cgcggatccg gcggaggcgg cactt    25</li>
<li>&lt;210&gt; 68<br/>
&lt;211&gt; 28<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 68<br/>
cccgctcgag tcagaaccgg tagcctac    28</li>
<li>&lt;210&gt; 69<br/>
&lt;211&gt; 41<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 69<br/>
cgcggatccg gtggtggtgg ttcagatttg gcaaacgatt c    41</li>
<li>&lt;210&gt; 70<br/>
&lt;211&gt; 32<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 70<br/>
cccgctcgag ttacgtatca tatttcacgt gc    32</li>
<li>&lt;210&gt; 71<br/>
&lt;211&gt; 42<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 71<br/>
cgcggatccg gtggtggtgg tcaaagcaag agcatccaaa cc    42</li>
<li>&lt;210&gt; 72<br/>
&lt;211&gt; 30<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence<!-- EPO <DP n="140"> --></li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 72<br/>
cccaagcttt tcgggcggta ttcgggcttc    30</li>
<li>&lt;210&gt; 73<br/>
&lt;211&gt; 39<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 73<br/>
cgcggatccg gtggtggtgg tgccacctac aaagtggac    39</li>
<li>&lt;210&gt; 74<br/>
&lt;211&gt; 28<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 74<br/>
gcccaagctt ttgtttggct gcctcgat    28</li>
<li>&lt;210&gt; 75<br/>
&lt;211&gt; 34<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 75<br/>
cgcggatccg gtggtggtgg tacaagcgac gacg    34</li>
<li>&lt;210&gt; 76<br/>
&lt;211&gt; 28<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 76<br/>
gcccaagctt ccactcgtaa ttgacgcc    28</li>
<li>&lt;210&gt; 77<br/>
&lt;211&gt; 41<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 77<br/>
cgcggatccg gtggtggtgg ttcagatttg gcaaacgatt c    41<!-- EPO <DP n="141"> --></li>
<li>&lt;210&gt; 78<br/>
&lt;211&gt; 28<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 78<br/>
cccaagcttc gtatcatatt tcacgtgc    28</li>
<li>&lt;210&gt; 79<br/>
&lt;211&gt; 44<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 79<br/>
cccaagcttg gtggtggtgg tggttcagat ttggcaaacg attc    44</li>
<li>&lt;210&gt; 80<br/>
&lt;211&gt; 29<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 80<br/>
cccgctcgag cgtatcatat ttcacgtgc    29</li>
<li>&lt;210&gt; 81<br/>
&lt;211&gt; 45<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 81<br/>
cccaagcttg gtggtggtgg tggtcaaagc aagagcatcc aaacc    45</li>
<li>&lt;210&gt; 82<br/>
&lt;211&gt; 28<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 82<br/>
cccgctcgag cgggcggtat tcgggctt    28</li>
<li>&lt;210&gt; 83<br/>
&lt;211&gt; 32<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence<!-- EPO <DP n="142"> --></li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 83<br/>
cgcggatccg ctagccccga tgttaaatcg gc    32</li>
<li>&lt;210&gt; 84<br/>
&lt;211&gt; 29<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 84<br/>
cggggatcca tcctgctctt ttttgccgg    29</li>
<li>&lt;210&gt; 85<br/>
&lt;211&gt; 36<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 85<br/>
cgcggatccg ctagcggaca cacttatttc ggcatc    36</li>
<li>&lt;210&gt; 86<br/>
&lt;211&gt; 30<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 86<br/>
cgcggatccc cagcggtagc ctaatttgat    30</li>
<li>&lt;210&gt; 87<br/>
&lt;211&gt; 41<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 87<br/>
cgcggatccg gtggtggtgg ttcagatttg gcaaacgatt c    41</li>
<li>&lt;210&gt; 88<br/>
&lt;211&gt; 28<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 88<br/>
cccaagcttc gtatcatatt tcacgtgc    28<!-- EPO <DP n="143"> --></li>
<li>&lt;210&gt; 89<br/>
&lt;211&gt; 36<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 89<br/>
gcggcgtcga cggtggcgga ggcactggat cctcag    36</li>
<li>&lt;210&gt; 90<br/>
&lt;211&gt; 35<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 90<br/>
ggaggcactg gatcctcaga tttggcaaac gattc    35</li>
<li>&lt;210&gt; 91<br/>
&lt;211&gt; 29<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 91<br/>
cccgctcgag cgtatcatat ttcacgtgc    29</li>
<li>&lt;210&gt; 92<br/>
&lt;211&gt; 25<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 92<br/>
cggggatccg ggggcggcgg tggcg    25</li>
<li>&lt;210&gt; 93<br/>
&lt;211&gt; 30<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 93<br/>
cccaagctta tcctgctctt ttttgccggc    30</li>
<li>&lt;210&gt; 94<br/>
&lt;211&gt; 42<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
<!-- EPO <DP n="144"> -->&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 94<br/>
cgcggatccg gtggtggtgg tcaaagcaag agcatccaaa cc    42</li>
<li>&lt;210&gt; 95<br/>
&lt;211&gt; 28<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 95<br/>
cccaagcttc gggcggtatt cgggcttc    28</li>
<li>&lt;210&gt; 96<br/>
&lt;211&gt; 26<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 96<br/>
ccccaagctt gggggcggcg gtggcg    26</li>
<li>&lt;210&gt; 97<br/>
&lt;211&gt; 31<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 97<br/>
cccgctcgag atcctgctct tttttgccgg c    31</li>
<li>&lt;210&gt; 98<br/>
&lt;211&gt; 45<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 98<br/>
cccaagcttg gtggtggtgg tggtcaaagc aagagcatcc aaacc    45</li>
<li>&lt;210&gt; 99<br/>
&lt;211&gt; 28<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 99<br/>
cccgctcgag cgggcggtat tcgggctt    28</li>
<li>&lt;210&gt; 100<br/>
<!-- EPO <DP n="145"> -->&lt;211&gt; 35<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 100<br/>
ggaggcactg gatccgcagc cacaaacgac gacga    35</li>
<li>&lt;210&gt; 101<br/>
&lt;211&gt; 36<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 101<br/>
gcggcctcga gggtggcgga ggcactggat ccgcag    36</li>
<li>&lt;210&gt; 102<br/>
&lt;211&gt; 28<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 102<br/>
cccgctcgag acccaqcttg taaggttg    28</li>
<li>&lt;210&gt; 103<br/>
&lt;211&gt; 35<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide &lt;400&gt; 103<br/>
<br/>
ggaggcactg gatccgcagc cacaaacgac gacga    35</li>
<li>&lt;210&gt; 104<br/>
&lt;211&gt; 36<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 104<br/>
gcggcctcga gggtggcgga ggcactggat ccgcag    36</li>
<li>&lt;210&gt; 105<br/>
&lt;211&gt; 28<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide<!-- EPO <DP n="146"> --></li>
<li>&lt;400&gt; 105<br/>
cccgctcgag ccactcgtaa ttgacgcc    28</li>
<li>&lt;210&gt; 106<br/>
&lt;211&gt; 38<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 106<br/>
gcggcctcga gggatccggc ggaggcggca cttctgcg    38</li>
<li>&lt;210&gt; 107<br/>
&lt;211&gt; 26<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 107<br/>
cccgctcgag gaaccggtag cctacg    26</li>
<li>&lt;210&gt; 108<br/>
&lt;211&gt; 35<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 108<br/>
ggaggcactg gatcctcaga tttggcaaac gattc    35</li>
<li>&lt;210&gt; 109<br/>
&lt;211&gt; 37<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 109<br/>
gcggcgtcga cggtggcgga ggcactggat cctcaga    37</li>
<li>&lt;210&gt; 110<br/>
&lt;211&gt; 29<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 110<br/>
cccgctcgag cgtatcatat ttcacgtgc    29</li>
<li>&lt;210&gt; 111<br/>
&lt;211&gt; 35<br/>
<!-- EPO <DP n="147"> -->&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 111<br/>
gcggcctcga gggatccgga gggggtggtg tcgcc    35</li>
<li>&lt;210&gt; 112<br/>
&lt;211&gt; 25<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 112<br/>
cccgctcgag ttgcttggcg gcaag    25</li>
<li>&lt;210&gt; 113<br/>
&lt;211&gt; 35<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 113<br/>
ggaggcactg gatccgcagc cacaaacgac gacga    35</li>
<li>&lt;210&gt; 114<br/>
&lt;211&gt; 36<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 114<br/>
gcggcctcga gggtggcgga ggcactggat ccgcag    36</li>
<li>&lt;210&gt; 115<br/>
&lt;211&gt; 28<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 115<br/>
cccgctcgag acccagcttg taaggttg    28</li>
<li>&lt;210&gt; 116<br/>
&lt;211&gt; 35<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide<!-- EPO <DP n="148"> --></li>
<li>&lt;400&gt; 116<br/>
ggaggcactg gatccgcagc cacaaacgac gacga    35</li>
<li>&lt;210&gt; 117<br/>
&lt;211&gt; 36<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 117<br/>
gcggcctcga gggtggcgga ggcactggat ccgcag    36</li>
<li>&lt;210&gt; 118<br/>
&lt;211&gt; 28<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 118<br/>
cccgctcgag ccactcgtaa ttgacgcc    28</li>
<li>&lt;210&gt; 119<br/>
&lt;211&gt; 35<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 119<br/>
ggaggcactg gatcctcaga tttggcaaac gattc    35</li>
<li>&lt;210&gt; 120<br/>
&lt;211&gt; 37<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 120<br/>
gcggcgtcga cggtggcgga ggcactggat cctcaga    37</li>
<li>&lt;210&gt; 121<br/>
&lt;211&gt; 29<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Oligonucleotide</li>
<li>&lt;400&gt; 121<br/>
cccgctcgag cgtatcatat ttcacgtgc    29</li>
</ul><!-- EPO <DP n="149"> --><!-- EPO <DP n="150"> --><!-- EPO <DP n="151"> --><!-- EPO <DP n="152"> --><!-- EPO <DP n="153"> --><!-- EPO <DP n="154"> --><!-- EPO <DP n="155"> --><!-- EPO <DP n="156"> --><!-- EPO <DP n="157"> --><!-- EPO <DP n="158"> --><!-- EPO <DP n="159"> --><!-- EPO <DP n="160"> --><!-- EPO <DP n="161"> --><!-- EPO <DP n="162"> --><!-- EPO <DP n="163"> --><!-- EPO <DP n="164"> --><!-- EPO <DP n="165"> --><!-- EPO <DP n="166"> --><!-- EPO <DP n="167"> --><!-- EPO <DP n="168"> --><!-- EPO <DP n="169"> --><!-- EPO <DP n="170"> --><!-- EPO <DP n="171"> --><!-- EPO <DP n="172"> --><!-- EPO <DP n="173"> --><!-- EPO <DP n="174"> --><!-- EPO <DP n="175"> --><!-- EPO <DP n="176"> --><!-- EPO <DP n="177"> --><!-- EPO <DP n="178"> --><!-- EPO <DP n="179"> --><!-- EPO <DP n="180"> --><!-- EPO <DP n="181"> --><!-- EPO <DP n="182"> --><!-- EPO <DP n="183"> --><!-- EPO <DP n="184"> --><!-- EPO <DP n="185"> --><!-- EPO <DP n="186"> --><!-- EPO <DP n="187"> --><!-- EPO <DP n="188"> --><!-- EPO <DP n="189"> --><!-- EPO <DP n="190"> --><!-- EPO <DP n="191"> --><!-- EPO <DP n="192"> --><!-- EPO <DP n="193"> --><!-- EPO <DP n="194"> --><!-- EPO <DP n="195"> --><!-- EPO <DP n="196"> --><!-- EPO <DP n="197"> --><!-- EPO <DP n="198"> --><!-- EPO <DP n="199"> --><!-- EPO <DP n="200"> --><!-- EPO <DP n="201"> --><!-- EPO <DP n="202"> --><!-- EPO <DP n="203"> --><!-- EPO <DP n="204"> --><!-- EPO <DP n="205"> --><!-- EPO <DP n="206"> --><!-- EPO <DP n="207"> --><!-- EPO <DP n="208"> --><!-- EPO <DP n="209"> --><!-- EPO <DP n="210"> --><!-- EPO <DP n="211"> --><!-- EPO <DP n="212"> --><!-- EPO <DP n="213"> --><!-- EPO <DP n="214"> --><!-- EPO <DP n="215"> --><!-- EPO <DP n="216"> --><!-- EPO <DP n="217"> --><!-- EPO <DP n="218"> --><!-- EPO <DP n="219"> --><!-- EPO <DP n="220"> --><!-- EPO <DP n="221"> --><!-- EPO <DP n="222"> --><!-- EPO <DP n="223"> --><!-- EPO <DP n="224"> --><!-- EPO <DP n="225"> --><!-- EPO <DP n="226"> --><!-- EPO <DP n="227"> --><!-- EPO <DP n="228"> --><!-- EPO <DP n="229"> --><!-- EPO <DP n="230"> --><!-- EPO <DP n="231"> --><!-- EPO <DP n="232"> --><!-- EPO <DP n="233"> --><!-- EPO <DP n="234"> --><!-- EPO <DP n="235"> --><!-- EPO <DP n="236"> --><!-- EPO <DP n="237"> --><!-- EPO <DP n="238"> --><!-- EPO <DP n="239"> --><!-- EPO <DP n="240"> --><!-- EPO <DP n="241"> --><!-- EPO <DP n="242"> --><!-- EPO <DP n="243"> --><!-- EPO <DP n="244"> --><!-- EPO <DP n="245"> --><!-- EPO <DP n="246"> --><!-- EPO <DP n="247"> --><!-- EPO <DP n="248"> --><!-- EPO <DP n="249"> --><!-- EPO <DP n="250"> --><!-- EPO <DP n="251"> --><!-- EPO <DP n="252"> --><!-- EPO <DP n="253"> --><!-- EPO <DP n="254"> --><!-- EPO <DP n="255"> --><!-- EPO <DP n="256"> --><!-- EPO <DP n="257"> --><!-- EPO <DP n="258"> --><!-- EPO <DP n="259"> --><!-- EPO <DP n="260"> --><!-- EPO <DP n="261"> --><!-- EPO <DP n="262"> --><!-- EPO <DP n="263"> --><!-- EPO <DP n="264"> --><!-- EPO <DP n="265"> --><!-- EPO <DP n="266"> --><!-- EPO <DP n="267"> --><!-- EPO <DP n="268"> --><!-- EPO <DP n="269"> --><!-- EPO <DP n="270"> --><!-- EPO <DP n="271"> --><!-- EPO <DP n="272"> --><!-- EPO <DP n="273"> --><!-- EPO <DP n="274"> --></p>
</description><!-- EPO <DP n="275"> -->
<claims id="claims01" lang="en"><!-- EPO <DP n="276"> -->
<claim id="c-en-01-0001" num="0001">
<claim-text>A hybrid protein of formula NH<sub>2</sub>-A-B-COOH, wherein A comprises the Neisserial protein ΔG287 and B comprises the Neisserial protein 961, and wherein the amino acid sequence of the hybrid protein is as disclosed in SEQ ID NO: 8 or is a sequence having greater than 70% sequence identity thereto.</claim-text></claim>
<claim id="c-en-01-0002" num="0002">
<claim-text>The protein of claim 1, wherein ΔG287 is from strain 2996 or 394/98.</claim-text></claim>
<claim id="c-en-01-0003" num="0003">
<claim-text>The protein of claim 1, wherein 961 is from strain 2996 or 394/98.</claim-text></claim>
<claim id="c-en-01-0004" num="0004">
<claim-text>The protein of claim 1, wherein A and B are from the same strain.</claim-text></claim>
<claim id="c-en-01-0005" num="0005">
<claim-text>The hybrid protein of claim 1, comprising the amino acid sequence recited in SEQ ID NO: 8.</claim-text></claim>
</claims><!-- EPO <DP n="277"> -->
<claims id="claims02" lang="de">
<claim id="c-de-01-0001" num="0001">
<claim-text>Ein Hybridprotein mit der Formel NH<sub>2</sub>-A-B-COOH, wobei A das Neisseriale Protein ΔG287 und B das Neisseriale Protein 961 umfasst, und wobei die Aminosäuresequenz des Hybridproteins wie in SEQ ID Nr. 8 geoffenbart oder eine Sequenz, welche eine mehr als 70% Sequenzidentität dazu hat, ist.</claim-text></claim>
<claim id="c-de-01-0002" num="0002">
<claim-text>Das Protein gemäß Anspruch 1, wobei ΔG287 vom Stamm 2996 oder 394/98 ist.</claim-text></claim>
<claim id="c-de-01-0003" num="0003">
<claim-text>Das Protein gemäß Anspruch 1, wobei 961 vom Stamm 2996 oder 394/98 ist.</claim-text></claim>
<claim id="c-de-01-0004" num="0004">
<claim-text>Das Protein gemäß Anspruch 1, wobei A und B vom selben Stamm sind.</claim-text></claim>
<claim id="c-de-01-0005" num="0005">
<claim-text>Das Hybridprotein gemäß Anspruch 1, umfassend die in SEQ ID Nr. 8 angegebene Aminosäuresequenz.</claim-text></claim>
</claims><!-- EPO <DP n="278"> -->
<claims id="claims03" lang="fr">
<claim id="c-fr-01-0001" num="0001">
<claim-text>Protéine hybride de formule NH<sub>2</sub>-A-B-COOH, dans laquelle A comprend la protéine ΔG287 de Neisseria et B comprend la protéine 961 de Neisseria, et dans laquelle la séquence d'acides aminés de la protéine hybride est telle que décrite par SÉQ ID NO : 8 ou est une séquence présentant une identité de séquence supérieure à 70 % avec celle-ci.</claim-text></claim>
<claim id="c-fr-01-0002" num="0002">
<claim-text>Protéine selon la revendication 1, dans laquelle ΔG287 provient de la souche 2996 ou 394/98.</claim-text></claim>
<claim id="c-fr-01-0003" num="0003">
<claim-text>Protéine selon la revendication 1, dans laquelle 961 provient de la souche 2996 ou 394/98.</claim-text></claim>
<claim id="c-fr-01-0004" num="0004">
<claim-text>Protéine selon la revendication 1, dans laquelle A et B proviennent de la même souche.</claim-text></claim>
<claim id="c-fr-01-0005" num="0005">
<claim-text>Protéine hybride selon la revendication 1, comprenant la séquence d'acides aminés représentée par SÉQ ID NO : 8.</claim-text></claim>
</claims>
<drawings id="draw" lang="en">
<figure id="f0001" num="1"><img id="if0001" file="imgf0001.tif" wi="158" he="74" img-content="drawing" img-format="tif"/></figure>
</drawings>
<ep-reference-list id="ref-list">
<heading id="ref-h0001"><b>REFERENCES CITED IN THE DESCRIPTION</b></heading>
<p id="ref-p0001" num=""><i>This list of references cited by the applicant is for the reader's convenience only. It does not form part of the European patent document. Even though great care has been taken in compiling the references, errors or omissions cannot be excluded and the EPO disclaims all liability in this regard.</i></p>
<heading id="ref-h0002"><b>Patent documents cited in the description</b></heading>
<p id="ref-p0002" num="">
<ul id="ref-ul0001" list-style="bullet">
<li><patcit id="ref-pcit0001" dnum="WO9924578A"><document-id><country>WO</country><doc-number>9924578</doc-number><kind>A</kind></document-id></patcit><crossref idref="pcit0001">[0002]</crossref></li>
<li><patcit id="ref-pcit0002" dnum="WO9936544A"><document-id><country>WO</country><doc-number>9936544</doc-number><kind>A</kind></document-id></patcit><crossref idref="pcit0002">[0002]</crossref></li>
<li><patcit id="ref-pcit0003" dnum="WO9957280A"><document-id><country>WO</country><doc-number>9957280</doc-number><kind>A</kind></document-id></patcit><crossref idref="pcit0003">[0002]</crossref></li>
<li><patcit id="ref-pcit0004" dnum="WO0022430A"><document-id><country>WO</country><doc-number>0022430</doc-number><kind>A</kind></document-id></patcit><crossref idref="pcit0004">[0002]</crossref></li>
<li><patcit id="ref-pcit0005" dnum="WO0066741A"><document-id><country>WO</country><doc-number>0066741</doc-number><kind>A</kind></document-id></patcit><crossref idref="pcit0005">[0014]</crossref><crossref idref="pcit0006">[0020]</crossref></li>
<li><patcit id="ref-pcit0006" dnum="EP01914098A"><document-id><country>EP</country><doc-number>01914098</doc-number><kind>A</kind><date>20010228</date></document-id></patcit><crossref idref="pcit0007">[0058]</crossref></li>
<li><patcit id="ref-pcit0007" dnum="WOIB0100420W"><document-id><country>WO</country><doc-number>IB0100420</doc-number><kind>W</kind><date>20010228</date></document-id></patcit><crossref idref="pcit0008">[0058]</crossref></li>
<li><patcit id="ref-pcit0008" dnum="GB0004695A"><document-id><country>GB</country><doc-number>0004695</doc-number><kind>A</kind><date>20000228</date></document-id></patcit><crossref idref="pcit0009">[0058]</crossref></li>
<li><patcit id="ref-pcit0009" dnum="GB0027675A"><document-id><country>GB</country><doc-number>0027675</doc-number><kind>A</kind><date>20001113</date></document-id></patcit><crossref idref="pcit0010">[0058]</crossref></li>
</ul></p>
<heading id="ref-h0003"><b>Non-patent literature cited in the description</b></heading>
<p id="ref-p0003" num="">
<ul id="ref-ul0002" list-style="bullet">
<li><nplcit id="ref-ncit0001" npl-type="s"><article><author><name>Guillen et al.</name></author><atl/><serial><sertitle>Biotechnologia Aplicada</sertitle><pubdate><sdate>19960000</sdate><edate/></pubdate><vid>13</vid><ino>4</ino></serial><location><pp><ppf>1027</ppf><ppl>2852</ppl></pp></location></article></nplcit><crossref idref="ncit0001">[0003]</crossref></li>
</ul></p>
</ep-reference-list>
</ep-patent-document>
