CROSS-REFERENCE TO RELATED APPLICATIONS
FIELD OF THE INVENTION
[0002] This invention relates to methods, reaction mixtures and kits for producing multiple
copies of a specific nucleic acid sequence or "target sequence" which may be present
either alone or as a component, large or small, of a homogeneous or heterogeneous
mixture of nucleic acids. The mixture of nucleic acids may be that found in a sample
taken for diagnostic testing, for screening of blood products, for food, water, industrial
or environmental testing, for research studies, for the preparation of reagents or
materials for other processes such as cloning, or for other purposes.
[0003] The selective amplification of specific nucleic acid sequences is of value in increasing
the sensitivity of diagnostic and other detection assays while maintaining specificity;
increasing the sensitivity, convenience, accuracy and reliability of a variety of
research procedures; and providing ample supplies of specific oligonucleotides for
various purposes.
BACKGROUND OF THE INVENTION
[0004] The detection and/or quantitation of specific nucleic acid sequences is an important
technique for identifying and classifying microorganisms, diagnosing infectious diseases,
detecting and characterizing genetic abnormalities, identifying genetic changes associated
with cancer, studying genetic susceptibility to disease, and measuring response to
various types of treatment. Such procedures are also useful in detecting and quantitating
microorganisms in foodstuffs, water, industrial and environmental samples, seed stocks,
and other types of material where the presence of specific microorganisms may need
to be monitored. Other applications are found in the forensic sciences, anthropology,
archaeology, and biology where measurement of the relatedness of nucleic acid sequences
has been used to identify criminal suspects, resolve paternity disputes, construct
genealogical and phylogenetic trees, and aid in classifying a variety of life forms.
[0005] A number of methods to detect and/or quantitate nucleic acid sequences are well known
in the art. These include hybridization to a labeled probe, and various permutations
of the polymerase chain reaction (PCR), coupled with hybridization to a labeled probe.
See, e.g., Mullis
et al., "Process for Amplifying, Detecting and/or Cloning Nucleic Acid Sequences,"
U.S. Patent No. 4,683,195; Mullis, "Process for Amplifying Nucleic Acid Sequences,"
U.S. Patent No. 4,683,202; Mullis
et al., "Process for Amplifying, Detecting and/or Cloning Nucleic Acid Sequences,"
U.S. Patent No. 4,800,159;
Mullis et al. (1987) Meth. Enzymol. 155, 335-350; and
Murakawa et al. (1988) DNA 7, 287-295. The requirement of repeated cycling of reaction temperature between several different
and extreme temperatures is a disadvantage of the PCR procedure. In order to make
PCR convenient, expensive programmable thermal cycling instruments are required.
[0006] Additionally, Transcription-Mediated Amplification (TMA) methods may be used to synthesize
multiple copies of a target nucleic acid sequence autocatalytically under conditions
of substantially constant temperature, ionic strength, and pH in which multiple RNA
copies of the target sequence autocatalytically generate additional copies.
See, e.g., Kacian
et al., "Nucleic Acid Sequence Amplification Methods,"
U.S. Patent No. 5,399,491, and Kacian
et al, "Nucleic Acid Sequence Amplification Methods,"
U.S. Patent No. 5,824,518, the contents of each of which patents are hereby incorporated by reference herein.
TMA is useful for generating copies of a nucleic acid target sequence for purposes
which include assays to quantitate specific nucleic acid sequences in clinical, environmental,
forensic and similar samples, cloning and generating probes. TMA is a robust and highly
sensitive amplification system with demonstrated efficacy. TMA overcomes many of the
problems associated with PCR-based amplification systems. In particular, temperature
cycling is not required. Other transcription-based amplification methods are disclosed
by Malek
et al., "Enhanced Nucleic Acid Amplification Process,"
U.S. Patent No. 5,130,238; Davey
et al., "Nucleic Acid Amplification Process,"
U.S. Patent No. 5,409,818; Davey
et al., "Method for the Synthesis of Ribonucleic Acid (RNA),"
U.S. Patent No. 5,466,586; Davey
et al., "Nucleic Acid Amplification Process,"
U.S. Patent No. 5,554,517; Burg
et al., "Selective Amplification of Target Polynucleotide Sequences,"
U.S. Patent No. 6,090,591; and Burg
et al., "Selective Amplification of Target Polynucleotide Sequences,"
U.S. Patent No. 6,410,276.
[0007] An inherent result of highly sensitive nucleic amplification systems is the emergence
of side-products. Side-products include molecules which may, in some systems, interfere
with the amplification reaction, thereby lowering specificity. This is because limited
amplification resources, including primers and enzymes needed in the formation of
primer extension and transcription products are diverted to the formation of side-products.
In some situations, the appearance of side-products can also complicate the analysis
of amplicon production by various molecular techniques.
[0008] Accordingly, there remains a need in the art for a robust nucleic acid amplification
system to synthesize multiple copies of a target nucleic acid sequence autocatalytically
under conditions of substantially constant temperature, ionic strength, and pH which
reduces the appearance of side-products, thereby increasing specificity and improving
detection and quantitation of amplification products.
SUMMARY OF THE INVENTION
[0009] The present invention is directed to novel methods of synthesizing multiple copies
of a target sequence which are autocatalytic (
i.e., able to cycle automatically without the need to modify reaction conditions such
as temperature, pH, or ionic strength and using the product of one cycle in the next
one). In particular, the present invention discloses a method of nucleic acid amplification
which is robust and efficient, while reducing the appearance of side-products. The
method uses only one primer, the "priming oligonucleotide," a promoter oligonucleotide
modified to prevent the initiation of DNA synthesis therefrom (
e.g., includes a 3'-blocking moiety) and, optionally, a binding molecule and/or a 3'-blocked
extender oligonucleotide, to amplify RNA or DNA molecules
in vitro. The methods of the present invention minimize or substantially eliminate the emergence
of side-products, thus providing a high level of specificity. Furthermore, the appearance
of side-products can complicate the analysis of the amplification reaction by various
molecular detection techniques. The present invention minimizes or substantially eliminates
this problem, thus providing an enhanced level of sensitivity.
[0010] In one embodiment, the present invention is drawn to a method of synthesizing multiple
copies of a target sequence comprising treating a target nucleic acid which comprises
an RNA target sequence with a priming oligonucleotide and a binding molecule (
e.g., terminating oligonucleotide or digestion oligonucleotide), where the priming oligonucleotide
hybridizes to the 3'-end of the target sequence such that a primer extension reaction
can be initiated therefrom, and where the binding molecule binds to the target nucleic
acid adjacent to or near the 5'-end of the target sequence (by "adjacent to" is meant
that the binding molecule binds to a base of the target nucleic acid next to the 5'-terminal
base of the target sequence and fully 5' to the target sequence); extending the priming
oligonucleotide in a primer extension reaction with a DNA polymerase,
e.g., reverse transcriptase, to give a DNA primer extension product complementary to the
target sequence, where the primer extension product has a 3'-end which is determined
by the binding molecule, where the 3'-end of the primer extension product is complementary
to the 5'-end of the target sequence; separating the primer extension product from
the target sequence using an enzyme which selectively degrades the target sequence,
e.g., an enzyme with an RNAse H activity; treating the primer extension product with apromoteroligonucleotide
comprising first and secondregions, where the first region hybridizes to a 3'-region
of the primer extension product to form a promoter oligonucleotide:primer extension
product hybrid, where the second region comprises a promoter for an RNA polymerase
and is situated 5' to the first region, and where the promoter oligonucleotide is
modified to prevent the initiation of DNA synthesis therefrom (
e.g., a blocking moiety is situated at the 3'-terminus of the promoter oligonucleotide
which prevents polymerase extension); extending the 3'-end of the primer extension
product in the promoter oligonucleotide:primer extension product hybrid to add a sequence
complementary to the second region of the promoter oligonucleotide; and transcribing
from the promoter oligonucleotide:primer extension product hybrid multiple RNA products
complementary to the primer extension product using an RNA polymerase which recognizes
the promoter in the promoter oligonucleotide and initiates transcription therefrom.
According to this embodiment, the base sequences of the resulting RNA products are
substantially identical to the base sequence of the target sequence. In a preferred
method according to this embodiment, the activity of the DNA polymerase is substantially
limited to the formation of primer extension products comprising the priming oligonucleotide.
In yet another preferred method according to this embodiment, the formation of side-products
in the method is substantially less than if said promoter oligonucleotide was not
modified to prevent the initiation of DNA synthesis therefrom. According to yet another
preferred method of this embodiment, if an oligonucleotide used in the amplification
reaction comprises a promoter for an RNA polymerase, then that oligonucleotide further
comprises a blocking moiety situated at its 3'-terminus to prevent the initiation
of DNA synthesis therefrom.
[0011] A second embodiment of the present invention is drawn to a method of synthesizing
multiple copies of a target sequence, where the method comprises treating a target
nucleic acid comprising an RNA target sequence with a priming oligonucleotide which
hybridizes to the 3'-end of the target sequence such that a primer extension reaction
can be initiated therefrom; extending the priming oligonucleotide in a primer extension
reaction with a DNA polymerase,
e.g., reverse transcriptase, to give a first DNA primer extension product having an indeterminate
3'-end and comprising a base region complementary to the target sequence; separating
the first primer extension product from the target nucleic acid using an enzyme which
selectively degrades that portion of the target nucleic acid which is complementary
to the first primer extension reaction, e. g., an enzyme with an RNAse H activity;
treating the first primer extension product with a promoter oligonucleotide comprising
first and second regions, where the first region hybridizes to a 3'-region of the
first primer extension product to form a promoter oligonucleotide:first primer extension
product hybrid, where the second region comprises a promoter for an RNA polymerase
and is situated 5' to the first region, and
where the promoter oligonucleotide is modified to prevent the initiation of DNA synthesis
therefrom (
e.g., a blocking moiety is situated at the 3'-terminus of the promoter oligonucleotide
which prevents polymerase extension); and transcribing from the promoter oligonucleotide:first
primer extension product hybrid multiple first RNA products complementary to at least
a portion of the first primer extension product using an RNA polymerase which recognizes
the promoter and initiates transcription therefrom, where the base sequences of the
resulting first RNA products are substantially identical to the base sequence of the
target sequence. In a preferred method according to this embodiment, the activity
of the DNA polymerase in the method is substantially limited to the formation of primer
extension products comprising the priming oligonucleotide. In yet another preferred
method of this embodiment, the formation of side-products in the method is substantially
less than if the promoter oligonucleotide was not modified to prevent the initiation
of DNA synthesis therefrom. According to yet another preferred method of this embodiment,
if an oligonucleotide used in the amplification reaction comprises a promoter for
an RNA polymerase, then that oligonucleotide further comprises a blocking moiety situated
at its 3'-terminus to prevent the initiation of DNA synthesis therefrom.
[0012] This embodiment is preferably drawn to the further steps of treating a first RNA
product transcribed from the promoter oligonucleotide:first primer extension product
with the priming oligonucleotide described above to form a priming oligonucleotide:first
RNA product hybrid such that a primer extension reaction can be initiated from the
priming oligonucleotide; extending the priming oligonucleotide in a primer extension
reaction with a DNA polymerase,
e.g., reverse transcriptase, to give a second DNA primer extension product complementary
to the first RNA product, where the second primer extension product has a 3'-end which
is complementary to the 5'-end of the first RNA product; separating the second primer
extension product from the first RNA product using an enzyme which selectively degrades
the first RNA product,
e.g., an enzyme with an RNAse H activity; treating the second primer extension product
with the promoter oligonucleotide described above to form a promoter oligonucleotide:
second primer extension product hybrid; extending the 3'-end of the second primer
extension product in the promoter oligonucleotide:second primer extension product
hybrid to add a sequence complementary to the second region of the promoter oligonucleotide;
and transcribing from the promoter oligonucleotide:second primer extension product
hybrid multiple second RNA products complementary to the second primer extension product
using an RNA polymerase, where the base sequences of the second RNA products are substantially
identical to the base sequence of the target sequence.
[0013] A third embodiment of the present invention is drawn to a method of synthesizing
multiple copies of a target sequence comprising treating a target nucleic acid comprising
a DNA target sequence with a promoter oligonucleotide comprising first and second
regions, where the first region hybridizes to the 3'-end of the target sequence to
form a promoter oligonucleotide:target nucleic acid hybrid, where the second region
comprises a promoter for an RNA polymerase and is situated 5' to the first region,
and where the promoter oligonucleotide is modified to prevent the initiation of DNA
synthesis therefrom (
e.g., a blocking moiety is situated at the 3'-terminus of the promoter oligonucleotide);
transcribing from the promoter oligonucleotide:target nucleic acid hybrid multiple
first RNA products comprising a base region complementary to the target sequence using
an RNA polymerase which recognizes the promoter and initiates transcription therefrom;
treating the first RNA products with a priming oligonucleotide which hybridizes to
a 3'-region of the first RNA products such that a primer extension reaction may be
initiated therefrom; extending the priming oligonucleotide in the primer extension
reaction with a DNA polymerase,
e.g., reverse transcriptase, to give a DNA primer extension product complementary to
at least a portion of the first RNA products, where the primer extension product has
a 3'-end which is complementary to the 5'-end of the first RNA products; separating
the primer extension product from the first RNA product using an enzyme which selectively
degrades the first RNA product; treating the primer extension product with the promoter
oligonucleotide described above to form a promoter oligonucleotide:primer extension
product hybrid; and transcribing from the promoter oligonucleotide:primer extension
product hybrid multiple second RNA products complementary to the primer extension
product using an RNA polymerase, wherein the base sequences of the second RNA products
are substantially complementary to the base sequence of the target sequence. In a
preferred method according to this embodiment, the activity of the DNA polymerase
in the method is substantially limited to the formation of primer extension products
comprising the priming oligonucleotide. In yet another preferred method according
to this embodiment, the formation of side-products in the method is substantially
less than if the promoter oligonucleotide was not modified to prevent the initiation
of DNA synthesis therefrom. According to yet another preferred method of this embodiment,
if an oligonucleotide used in the amplification reaction comprises a promoter for
an RNA polymerase, then that oligonucleotide further comprises a blocking moiety situated
at its 3'-terminus to prevent the initiation of DNA synthesis therefrom. Furthermore,
any method of this embodiment may include extending the 3'-end of the primer extension
product in the promoter oligonucleotide:primer extension product hybrid described
above to add a sequence complementary to the second region of the promoter oligonucleotide.
[0014] Reagents and conditions suitable for practicing any of the embodiments described
above are set forth in the Examples section.
[0015] The methods of the present invention may be used as a component of assays to detect
and/or quantitate specific nucleic acid target sequences in clinical, food, water,
industrial, environmental, forensic, and similar samples or to produce large numbers
of copies of DNA and/or RNA of specific target sequences for a variety of uses. (As
used herein, the term "copies" refers to amplification products having either the
same or the opposite sense of the target sequence.) These methods may also be used
to produce multiple copies of a target sequence for cloning or to generate probes
or to produce RNA and DNA copies for sequencing.
[0016] The priming oligonucleotide of the embodiments described above optionally has a cap
comprising a base region hybridized to its 3'-end prior to treating a target nucleic
acid or an RNA product with the priming oligonucleotide in order to prevent the initiation
of DNA synthesis from the priming oligonucleotide. The 5'-terminal base (
i.e., the 5'-most base) of the cap hybridizes to the 3'-terminal base (
i.e., the 3'-most base) of the priming oligonucleotide. However, the cap is designed
so as to be preferentially displaced from the priming oligonucleotide by the target
nucleic acid or the RNA product. A cap of the present invention may take the form
of a discrete capping oligonucleotide, or may be attached to the 5'-end of the priming
oligonucleotide via a linker. A preferred capping oligonucleotide is modified to prevent
the initiation of DNA synthesis therefrom (e.g., comprises a blocking moiety at its
3'-terminus).
[0017] To increase the binding affinity of the priming oligonucleotide for the target sequence
or its complement, the 5'-end of the priming oligonucleotide may include one or more
modifications which improve the binding properties (
e.g., hybridization or base stacking) of the priming oligonucleotide to a target sequence
or an RNA product, provided the modifications do not prevent the priming oligonucleotide
from being extended in a primer extension reaction or substantially interfere with
cleavage of an RNA template to which the priming oligonucleotide is hybridized. The
modifications are preferably spaced at least 15 bases from the 3'-terminus of the
priming oligonucleotide, and most preferably affect a region limited to the three
or four 5'-most nucleotides of the priming oligonucleotide. Preferred modifications
include 2'-O-methyl ribonucleotides and "Locked Nucleic Acids" or "Locked Nucleoside
Analogues" (LNAs).
See Becker
et al., "Method for Amplifying Target Nucleic Acids Using Modified Primers,"
U.S. Patent No. 6,130,038; Imanishi
et al., "Bicyclonucleoside and Oligonucleotide Analogues,"
U.S. Patent No. 6,268,490; and Wengel
et al., "Oligonucleotide Analogues,"
U.S. Patent No. 6,670,461. The contents of each of the foregoing references are hereby incorporated by reference
herein.
[0018] The promoter oligonucleotide used in the methods described above may further include
an insertion sequence which is selected to enhance the rate at which RNA products
are formed. The insertion sequence is preferably from 5 to 20 nucleotides in length
and is positioned between or adj acent to the first and second regions of the promoter
oligonucleotide. Preferred insertion sequences of the present invention include the
base sequences of SEQ ID NO: ccacaa and SEQ ID NO:2 acgtagcatcc.
[0019] The rate of amplification may also be affected by the inclusion of an extender oligonucleotide
in any of the above-described methods. An extender oligonucleotide is preferably from
10 to 50 nucleotides in length and is designed to hybridize to a DNA template so that
the 5'-end of the extender oligonucleotide is adjacent to or near the 3'-end of a
promoter oligonucleotide. The extender oligonucleotide is preferably modified to prevent
the initiation of DNA synthesis therefrom (
e.g., includes a 3'-terminal blocking moiety).
[0020] In some applications of the methods described above, the binding molecule may comprise
an oligonucleotide having a 5'-end which overlaps the 5'-end of the first region of
the promoter oligonucleotide. To limit hybridization of the binding molecule to the
promoter oligonucleotide, the 5'-end of the first region may be synthesized to include
a sufficient number of mismatches with the 5'-end of the binding molecule to prevent
the promoter oligonucleotide from hybridizing to the binding molecule. While a single
mismatch generally should be sufficient, the number of destabilizing mismatches needed
in the first region of the promoter oligonucleotide will depend upon the length and
base composition of the overlapping region.
[0021] In an adaptation of the above methods, the blocking moiety may be released from the
promoter oligonucleotide prior to treating the primer extension product or the first
primer extension product with the promoter oligonucleotide. To facilitate release
of the blocking moiety, the promoter oligonucleotide is provided to a reaction mixture
pre-hybridized to an oligodeoxynucleotide. The oligodeoxynucleotide is hybridized
to a 3'-region of the first region of the promoter oligonucleotide which includes
a sufficient number of contiguous ribonucleotides such that the blocking moiety is
released from the promoter oligonucleotide in the presence of an enzymatic activity
capable of cleaving the ribonucleotides of the 3'-region. During cleavage of the ribonucleotides,
the oligodeoxynucleotide is also released from the first region of the promoter oligonucleotide,
and the remaining, uncleaved portion of the first region hybridizes to the primer
extension product or the first primer extension product. The 3'-section of ribonucleotides
preferably includes at least 6 contiguous ribonucleotides, and the oligdeoxyonucleotide
is preferably the same length as and fully complementary to the 3'-section of ribonucleotides.
The oligodeoxynucleotide may be a separate molecule or it may be joined to the promoter
oligonucleotide by means of a linker.
[0022] The present invention further relates to reaction mixtures useful for carrying out
the methods described above. The reaction mixtures of the present invention may contain
each component, or some subcombination of components, necessary for carrying out the
methods described above.
[0023] The materials and/or reagents used in the methods of the present invention may incorporated
as parts of kits, e.g., diagnostic kits for clinical or criminal laboratories, or
nucleic amplification kits for general laboratory use. The present invention thus
includes kits which include some or all of the reagents necessary to carry out the
methods of the present invention,
e.g., oligonucleotides, binding molecules, stock solutions, enzymes, positive and negative
control target sequences, test tubes or plates, detection reagents, and an instruction
manual.
[0024] Certain embodiments of the present invention include one or more detection probes
for determining the presence or amount of the RNA and/orDNA products in the amplification
reaction mixture. Probes may be designed to detect RNA and/or DNA products after the
amplification reaction (
i.e., end-point detection) or, alternatively, during the amplification reaction
(i.e., real-time detection). Thus, the probes may be provided to the reaction mixture prior
to, during or at the completion of the amplification reaction. For real-time detection
of RNA products in the first two methods described above, it may be desirable to provide
the probe to the reaction mixture after the first primer extension reaction has been
initiated (
i.e., addition of amplification enzymes) since probe binding to the target sequence,
rather than RNA product, may slow the rate at which an RNA-dependent DNA polymerase
(
e.g., reverse transcriptase) can extend the priming oligonucleotide. Preferred probes
have one or more associated labels to facilitate detection.
[0025] The present invention is further drawn to various oligonucleotides, including the
priming oligonucleotides, promoter oligonucleotides, terminating oligonucleotides,
capping oligonucleotides, extender oligonucleotides and probes described herein. It
is to be understood that oligonucleotides of the present invention may be DNA or RNA
(and analogs thereof), and in either case, the present invention includes RNA equivalents
of DNA oligonucleotides and DNA equivalents of RNA oligonucleotides. Except for the
preferred priming oligonucleotides and probes described below, the oligonucleotides
described in the following paragraphs are preferably modified to prevent their participation
in a DNA synthesis polymerase (
e.g., include a blocking moiety at their 3'-termini).
[0026] For certain amplification reactions in which the target nucleic acid contains a hepatitis
C virus (HCV) 5' untranslated region, the present invention includes a promoter oligonucleotide
comprising a promoter sequence and a hybridizing sequence up to 40 or 50 bases in
length. The promoter sequence is recognized by an RNA polymerase, such as a T7, T3
or SP6 RNA polymerase, and preferably includes the T7 RNA polymerase promoter sequence
of SEQ ID NO:3 aatttaatacgactcac tatagggaga. The hybridizing sequence of the preferred
promoter oligonucleotide comprises, consists of, consists essentially of, overlaps
with, or is contained within and includes at least 10, 15, 20, 25, 30 or 32 contiguous
bases of a base sequence that is at least 80%, 90% or 100% identical to the base sequence
of SEQ ID NO:4 ctagccatggcgttagtatgagtgtcgtgcag or an equivalent sequence containing
uracil bases substituted for thymine bases, and which hybridizes to the target nucleic
acid under amplification conditions. The promoter oligonucleotide preferably does
not include a region in addition to the hybridizing sequence that hybridizes to the
target nucleic acid under amplification conditions. More preferably, the promoter
oligonucleotide comprises, consists of, or consists essentially of a base sequence
substantially corresponding to the base sequence of SEQ ID NO:5 aatttaatacgactcactatagggagactagccatggcgttagtatgagtgtcgtgcag
or an equivalent sequence containing uracil bases substituted for thymine bases, and
which hybridizes to the target nucleic acid under amplification conditions. The base
sequence of the promoter oligonucleotide preferably consists of a promoter sequence
and a hybridizing sequence consisting of or contained within and including at least
10, 15, 20, 25, 30 or 32 contiguous bases of the base sequence of SEQ ID NO:4 or an
equivalent sequence containing uracil bases substituted for thymine bases, and which
hybridizes to the target nucleic acid under amplification conditions.
[0027] For certain amplification reactions in which the target nucleic acid contains an
HCV 5' untranslated region, the present invention includes a priming oligonucleotide
up to 40 or 50 bases in length. A preferred priming oligonucleotide includes an oligonucleotide
comprising, consisting of, consisting essentially of, overlapping with, or contained
within and including at least 10, 15, 20, 25, 30 or 31 contiguous bases of a base
sequence that is at least 80%, 90% or 100% identical to the base sequence of SEQ ID
NO:6 aggcattgagcgggttgatccaagaaaggac or an equivalent sequence containing uracil bases
substituted for thymine bases, and which hybridizes to the target nucleic acid under
amplification conditions. More preferably, the priming oligonucleotide comprises,
consists of, or consists essentially of abase sequence substantially corresponding
to the base sequence of SEQ ID NO:6 or an equivalent sequence containing uracil bases
substituted for thymine bases, and which hybridizes under amplification conditions
to the target nucleic acid. The base sequence of the priming oligonucleotide preferably
consists of or is contained within and includes at least 10, 15, 20, 25, 30 or 31
contiguous bases of the base sequence of SEQ ID NO:6 or an equivalent sequence containing
uracil bases substituted for thymine bases, and which hybridizes to the target nucleic
acid under amplification conditions.
[0028] For certain amplification reactions in which the target nucleic acid contains an
HCV 5' untranslated region, the present invention is further directed to a detection
probe up to 35, 50 or 100 bases in length. A preferred detection probe includes a
target binding region which comprises, consists of, consists essentially of, overlaps
with, or is contained within and includes at least 10, 13 or 15 contiguous bases of
a base sequence that is at least 80%, 90% or 100% identical to the base sequence of
SEQ ID NO:7 guacucaccgguucc, the complement thereof, or an equivalent sequence containing
thymine bases substituted for uracil bases, and which preferentially hybridizes to
the target nucleic acid or its complement (
e.g., not human nucleic acid) under stringent hybridization conditions. The detection
probe preferably does not include a region in addition to the target binding region
that hybridizes to the target nucleic acid or its complement under stringent hybridization
conditions. More preferably, the detection probe comprises, consists of, or consists
essentially of a base sequence substantially corresponding to the base sequence of
SEQ ID NO:7, the complement thereof, or an equivalent sequence containing thymine
bases substituted for uracil bases, and which preferentially hybridizes to the target
nucleic acid or its complement under stringent hybridization conditions. The base
sequence of the detection probe preferably consists of or is contained within and
includes at least 10, 13 or 15 contiguous bases of the base sequence of SEQ ID NO:7,
the complement thereof, or an equivalent sequence containing thymine bases substituted
for uracil bases, and which preferentially hybridizes to the target nucleic acid or
its complement under stringent hybridization conditions. In certain embodiments the
probe optionally includes one or more detectable labels,
e.g., an AE substituent.
[0029] For certain amplification reactions in which the target nucleic acid contains an
HCV 5' untranslated region, the present invention is further directed to a detection
probe up to 40 or 50 bases in length. A preferred detection probe includes a target
binding region which comprises, consists of, consists essentially of, overlaps with,
or is contained within and includes at least 18, 20 or 22 contiguous bases of a base
sequence that is at least 80%, 90% or 100% identical to the base sequence of SEQ ID
NO:8 agaccacuauggcucucccggg, the complement thereof, or an equivalent sequence containing
thymine bases substituted for uracil bases, and which preferentially hybridizes to
the target nucleic acid or its complement (e.g., not human nucleic acid) under stringent
hybridization conditions. The detection probe preferably does not include a region
in addition to the target binding region that hybridizes to the target nucleic acid
or its complement under stringent hybridization conditions. More preferably, the detection
probe comprises, consists of, or consists essentially of a base sequence substantially
corresponding to the base sequence of SEQ ID NO: 8, the complement thereof, or an
equivalent sequence containing thymine bases substituted for uracil bases, and which
preferentially hybridizes to the target nucleic acid or its complement under stringent
hybridization conditions. The base sequence of the detection probe preferably consists
of or is contained within and includes at least 18, 20 or 22 contiguous bases of the
base sequence SEQ ID NO: 8, the complement thereof, or an equivalent sequence containing
thymine bases substituted for uracil bases, and which preferentially hybridizes to
the target nucleic acid or its complement under stringent hybridization conditions.
In certain embodiments the probe optionally includes one or more detectable labels,
e.g., an AE substituent.
[0030] For certain amplification reactions in which the target nucleic acid contains a human
immunodeficiency virus (HIV)
pol gene, the present invention includes a promoter oligonucleotide comprising a promoter
sequence and a hybridizing sequence up to 40 or 50 bases in length. The promoter sequence
is recognized by an RNA polymerase, such as a T7, T3 or SP6 RNA polymerase, and preferably
includes the T7 RNA polymerase promoter sequence of SEQ ID NO:3. The hybridizing sequence
of the preferred promoter oligonucleotide comprises, consists of, consists essentially
of, overlaps with, or is contained within and includes at least 10, 15, 20, 25, 30
or 31 contiguous bases of a base sequence that is at least 80%, 90% or 100% identical
to the base sequence of SEQ ID NO:9 acaaatggcagtattcatccacaatttaaaa or an equivalent
sequence containing uracil bases substituted for thymine bases, and which hybridizes
to the target nucleic acid under amplification conditions. The promoter oligonucleotide
preferably does not include a region in addition to the hybridizing sequence that
hybridizes to the target nucleic acid under amplification conditions. More preferably,
the promoter oligonucleotide comprises, consists of, or consists essentially of a
base sequence substantially corresponding to the base sequence of SEQ ID NO:10 aatttaatacgactcactatagggagacta
gccatggcgttagtatgagtgtcgtgcag or an equivalent sequence containing uracil bases substituted
for thymine bases, and which hybridizes to the target nucleic acid under amplification
conditions. The base sequence of the promoter oligonucleotide preferably consists
of a promoter sequence and a hybridizing sequence consisting of or contained within
and including at least 10, 15, 20, 25, 30 or 31 contiguous bases of the base sequence
of SEQ ID NO: 9 or an equivalent sequence containing uracil bases substituted for
thymine bases, and which hybridizes to the target nucleic acid under amplification
conditions.
[0031] For certain amplification reactions in which the target nucleic acid contains an
HIV
pol gene, the present invention includes a priming oligonucleotide up to 40 or 50 bases
in length. A preferred priming oligonucleotide includes an oligonucleotide comprising,
consisting of, consisting essentially of, overlapping with, or contained within and
including at least 10,15, 20, 25 or 27 contiguous bases of a base sequence that is
at least 80%, 90% or 100% identical to the base sequence of SEQ ID NO:11 gtttgtatgtctgttgctattatgtct
or an equivalent sequence containing uracil bases substituted for thymine bases, and
which hybridizes to the target nucleic acid under amplification conditions. More preferably,
the priming oligonucleotide comprises, consists of, or consists essentially of a base
sequence substantially corresponding to the base sequence of SEQ ID NO: 11 or an equivalent
sequence containing uracil bases substituted for thymine bases, and which hybridizes
to the target nucleic acid under amplification conditions. The base sequence of the
priming oligonucleotide preferably consists of or is contained within and includes
at least 10,15, 20, 25 or 27 contiguous bases of the base sequence of SEQ ID NO:11
or an equivalent sequence containing uracil bases substituted for thymine bases, and
which hybridizes to the target nucleic acid under amplification conditions.
[0032] For certain amplification reactions in which the target nucleic acid contains an
HIV
pol gene, the present invention is further directed to a detection probe up to 35, 50
or 100 bases in length. A preferred detection probe includes a target binding region
which comprises, consists of, consists essentially of, overlaps with, or is contained
within and includes at least 13, 15 or 17 contiguous bases of a base sequence that
is at least 80%, 90% or 100% identical to the base sequence of SEQ ID NO:12 acuguaccccccaaucc,
the complement thereof, or an equivalent sequence containing thymine bases substituted
for uracil bases, and which preferentially hybridizes to the target nucleic acid or
its complement (e.g., not human nucleic acid) under stringent hybridization conditions.
The detection probe preferably does not include a region in addition to the target
binding region that hybridizes to the target nucleic acid or its complement under
stringent hybridization conditions. More preferably, the detection probe comprises,
consists of, or consists essentially of a base sequence substantially corresponding
to the base sequence of SEQ ID NO: 12, the complement thereof, or an equivalent sequence
containing thymine bases substituted for uracil bases, and which preferentially hybridizes
to the target nucleic acid or its complement under stringent hybridization conditions.
The base sequence of the detection probe preferably consists of or is contained within
and includes at least 13, 15 or 17 contiguous bases of the base sequence of SEQ ID
NO: 12, the complement thereof, or an equivalent sequence containing thymine bases
substituted for uracil bases, and which preferentially hybridizes under stringent
hybridization conditions to the target nucleic acid or its complement. In certain
embodiments the probe optionally includes one or more detectable labels, e.g., an
AE substituent.
[0033] For certain amplification reactions in which the target nucleic acid contains a human
papilloma virus (HPV) E6 and E7 gene, the present invention includes a promoter oligonucleotide
comprising a promoter sequence and a hybridizing sequence up to 40 or 50 bases in
length. The promoter sequence is recognized by an RNA polymerase, such as a T7, T3
or SP6 RNA polymerase, and preferably includes the T7 RNA polymerase promoter sequence
of SEQ ID NO:3. The hybridizing sequence of the preferred promoter oligonucleotide
comprises, consists of, consists essentially of, overlaps with, or is contained within
and includes at least 10, 15, 20, 25 or 27 contiguous bases of a base sequence that
is at least 80%, 90% or 100% identical to the base sequence of SEQ ID NO:13 gaacagatggggcacacaattcctagt
or an equivalent sequence containing uracil bases substituted for thymine bases, and
which hybridizes to the target nucleic acid under amplification conditions. The promoter
oligonucleotide preferably does not include a region in addition to the hybridizing
sequence that hybridizes to the target nucleic acid under amplification conditions.
More preferably, the promoter oligonucleotide comprises, consists of, or consists
essentially of a base sequence substantially corresponding to the base sequence of
SEQ ID NO: 14 aatttaatacgactcactatagggagagaa cagatggggcacacaattcctagt or an equivalent
sequence containing uracil bases substituted for thymine bases, and which hybridizes
to the target nucleic acid under amplification conditions. The base sequence of the
promoter oligonucleotide preferably consists of a promoter sequence and a hybridizing
sequence consisting of or contained within and including at least 10, 15, 20, 25 or
27 contiguous bases of the base sequence of SEQ ID NO: 13 or an equivalent sequence
containing uracil bases substituted for thymine bases, and which hybridizes to the
target nucleic acid under amplification conditions.
[0034] For certain amplification reactions in which the target nucleic acid contains an
HPV E6 and E7 gene, the present invention includes a priming oligonucleotide up to
40 or 50 bases in length. A preferred priming oligonucleotide includes an oligonucleotide
comprising, consisting of, consisting essentially of, overlapping with, or contained
within and including at least 10, 15 or 19 contiguous bases of a base sequence that
is at least 80%, 90% or 100% identical to the base sequence of SEQ ID NO:15 gacagctcagaggaggagg
or an equivalent sequence containing uracil bases substituted for thymine bases, and
which hybridizes to the target nucleic acid under amplification conditions. More preferably,
the priming oligonucleotide comprises, consists of, or consists essentially of a base
sequence substantially corresponding to the base sequence of SEQ ID NO: 15 or an equivalent
sequence containing uracil bases substituted for thymine bases, and which hybridizes
to the target nucleic acid under amplification conditions. The base sequence of the
priming oligonucleotide preferably consists of or is contained within and includes
at least 10, 15 or 19 contiguous bases of the base sequence of SEQ ID NO:15 or an
equivalent sequence containing uracil bases substituted for thymine bases, and which
hybridizes to the target nucleic acid under amplification conditions.
[0035] For certain amplification reactions in which the target nucleic acid contains an
HPV E6 and E7 gene, the present invention is further directed to a detection probe
up to 35, 50 or 100 bases in length. A preferred detection probe includes a target
binding region which comprises, consists of, consists essentially of, overlaps with,
or is contained within and includes at least 15, 17 or 19 contiguous bases of a base
sequence that is at least 80%, 90% or 100% identical to the base sequence of SEQ ID
NO:16 ggacaagcagaaccggaca or the complement thereof, and which preferentially hybridizes
to the target nucleic acid or its complement (e.g., not human nucleic acid) under
stringent hybridization conditions. The detection probe preferably does not include
a region in addition to the target binding region that hybridizes to the target nucleic
acid or its complement under stringent hybridization conditions. More preferably,
the detection probe comprises, consists of, or consists essentially of a base sequence
substantially corresponding to the base sequence of SEQ ID NO: 16 or the complement
thereof, and which preferentially hybridizes to the target nucleic acid or its complement
under stringent hybridization conditions. The base sequence of the detection probe
preferably consists of or is contained within and includes at least 15, 17 or 19 contiguous
bases of the base sequence of SEQ ID NO:16 or the complement thereof, and which preferentially
hybridizes to the target nucleic acid or its complement under stringent hybridization
conditions. In certain embodiments the probe optionally includes one or more detectable
labels, e.g., an AE substituent.
[0036] For certain amplification reactions in which the target nucleic acid contains a West
Nile Virus (WNV) nonstructural protein 5 gene, the present invention includes a promoter
oligonucleotide comprising a promoter sequence and a hybridizing sequence up to 40
or 50 bases in length. The promoter sequence is recognized by an RNA polymerase, such
as a T7, T3 or SP6 RNA polymerase, and preferably includes the T7 RNA polymerase promoter
sequence of SEQ ID NO:3. The hybridizing sequence of the preferred promoter oligonucleotide
comprises, consists of, consists essentially of, overlaps with, or is contained within
and includes at least 10, 15, 20, 25 or 27 contiguous bases of a base sequence that
is at least 80%, 90% or 100% identical to the base sequence of SEQ ID NO:17 gagtagacggtgctgcctgcgactcaa
or an equivalent sequence containing uracil bases substituted for thymine bases, and
which hybridizes to the target nucleic acid under amplification conditions. The promoter
oligonucleotide preferably does not include a region in addition to the hybridizing
sequence that hybridizes to the target nucleic acid under amplification conditions.
More preferably, the promoter oligonucleotide comprises, consists of, or consists
essentially of a base sequence substantially corresponding to the base sequence of
SEQ ID NO: 18 aatttaatacgactcactcactatagggagagagtagacggtgctgcctgcgactcaa or an equivalent
sequence containing uracil bases substituted for thymine bases, and which hybridizes
to the target nucleic acid under amplification conditions. The base sequence of the
promoter oligonucleotide preferably consists of a promoter sequence and a hybridizing
sequence consisting of or contained within and including at least 10,15, 20, 25 or
27 contiguous bases of the base sequence of SEQ ID NO: 17 or an equivalent sequence
containing uracil bases substituted for thymine bases, and which hybridizes to the
target nucleic acid under amplification conditions.
[0037] For certain amplification reactions in which the target nucleic acid contains a WNV
nonstructural protein 5 gene, the present invention includes a priming oligonucleotide
up to 40 or 50 bases in length. A preferred priming oligonucleotide includes an oligonucleotide
comprising, consisting of, consisting essentially of, overlapping with, or contained
within and including at least 10, 15, 20 or 23 contiguous bases of a base sequence
that is at least 80%, 90% or 100% identical to the base sequence of SEQ ID NO: 19
tccgagacggttctgagggctta or an equivalent sequence containing uracil bases substituted
for thymine bases, and which hybridizes to the target nucleic acid under amplification
conditions. More preferably, the priming oligonucleotide comprises, consists of, or
consists essentially of a base sequence substantially corresponding to the base sequence
of SEQ ID NO: 19 or an equivalent sequence containing uracil bases substituted for
thymine bases, and which hybridizes to the target nucleic acid under amplification
conditions. The base sequence of the priming oligonucleotide preferably consists of
or is contained within and includes at least 10, 15, 20 or 23 contiguous bases of
the base sequence of SEQ ID NO: 19 or an equivalent sequence containing uracil bases
substituted for thymine bases, and which hybridizes to the target nucleic acid under
amplification conditions.
[0038] For certain amplification reactions in which the target nucleic acid contains a WNV
nonstructural protein 5 gene, the present invention is further directed to a detection
probe up to 35, 50 or 100 bases in length. A preferred detection probe includes a
target binding region which comprises, consists of, consists essentially of, overlaps
with, or is contained within and includes at least 14, 16 or 18 contiguous bases of
a base sequence that is at least 80%, 90% or 100% identical to the base sequence of
SEQ ID NO:20 gaucacuucgcggcuuug, the complement thereof, or an equivalent sequence
containing thymine bases substituted for uracil bases, and which preferentially hybridizes
to the target nucleic acid or its complement
(e.g., not human nucleic acid) under stringent hybridization conditions. The detection probe
preferably does not include a region in addition to the target binding region that
hybridizes to the target nucleic acid or its complement under stringent hybridization
conditions. More preferably, the detection probe comprises, consists of, or consists
essentially of a base sequence substantially corresponding to the base sequence of
SEQ ID NO:20, the complement thereof, or an equivalent sequence containing thymine
bases substituted for uracil bases, and which preferentially hybridizes to the target
nucleic acid or its complement under stringent hybridization conditions. The base
sequence of the detection probe preferably consists of or is contained within and
includes at least 14, 16 or 18 contiguous bases of the base sequence of SEQ ID NO:20,
the complement thereof, or an equivalent sequence containing thymine bases substituted
for uracil bases, and which preferentially hybridizes to the target nucleic acid or
its complement under stringent hybridization conditions. In certain embodiments the
probe optionally includes one or more detectable labels, e.g., an AE substituent.
[0039] For certain amplification reactions in which the target nucleic acid contains a 23S
rRNA sequence of
Chlamydia trachomatis, the present invention includes a promoter oligonucleotide comprising a promoter sequence
and a hybridizing sequence up to 40 or 50 bases in length. The promoter sequence is
recognized by an RNA polymerase, such as a T7, T3 or SP6 RNA polymerase, and preferably
includes the T7 RNA polymerase promoter sequence of SEQ ID NO:3. The hybridizing sequence
of the preferred promoter oligonucleotide comprises, consists of, consists essentially
of, overlaps with, or is contained within and includes at least 10, 15, 20, 25 or
30 contiguous bases of a base sequence that is at least 80%, 90% or 100% identical
to the base sequence of SEQ ID NO:21 cggagtaagttaagcacgcggacgattgga or an equivalent
sequence containing uracil bases substituted for thymine bases, and which hybridizes
to the target nucleic acid under amplification conditions. The promoter oligonucleotide
preferably does not include a region in addition to the hybridizing sequence that
hybridizes to the target nucleic acid under amplification conditions. More preferably,
the promoter oligonucleotide comprises, consists of, or consists essentially of a
base sequence substantially corresponding to the base sequence of SEQ ID NO: 22 aatttaatacgactcactatagggagacgg
agtaagttaagcacgcggacgattgga or an equivalent sequence containing uracil bases substituted
for thymine bases, and which hybridizes to the target nucleic acid under amplification
conditions. The base sequence of the promoter oligonucleotide preferably consists
of a promoter sequence and a hybridizing sequence consisting of or contained within
and including at least 10,15, 20, 25 or 30 contiguous bases of the base sequence of
SEQ ID NO:21 or an equivalent sequence containing uracil bases substituted for thymine
bases, and which hybridizes to the target nucleic acid under amplification conditions.
[0040] For certain amplification reactions in which the target nucleic acid contains a 23S
rRNA sequence of
Chlamydia trachomatis, the present invention includes a priming oligonucleotide up to 40 or 50 bases in
length. A preferred priming oligonucleotide includes an oligonucleotide comprising,
consisting of, consisting essentially of, overlapping with, or contained within and
including at least 10, 15, 20, 25 or 29 contiguous bases of a base sequence that is
at least 80%, 90% or 100% identical to the base sequence of SEQ ID NO:23 cccgaagattccccttgatcgcgacctga
or an equivalent sequence containing uracil bases substituted for thymine bases, and
which hybridizes to the target nucleic acid under amplification conditions. More preferably,
the priming oligonucleotide comprises, consists of, or consists essentially of a base
sequence substantially corresponding to the base sequence of SEQ ID NO:23 or an equivalent
sequence containing uracil bases substituted for thymine bases, and which hybridizes
to the target nucleic acid under amplification conditions. The base sequence of the
priming oligonucleotide preferably consists of or is contained within and includes
at least 10, 15, 20, 25 or 29 contiguous bases of the base sequence of SEQ ID NO:23
or an equivalent sequence containing uracil bases substituted for thymine bases, and
which hybridizes to the target nucleic acid under amplification conditions.
[0041] For certain amplification reactions in which the target nucleic acid contains a 23S
rRNA sequence of
Chlamydia trachomatis, the present invention is further directed to a detection probe up to 35, 50 or 100
bases in length. A preferred detection probe includes a target binding region which
comprises, consists of, consists essentially of, overlaps with, or is contained within
and includes at least 19, 22 or 24 contiguous bases of a base sequence that is at
least 80%, 90% or 100% identical to the base sequence of SEQ ID NO: 24 cguucucaucgcucuacggacucu,
the complement thereof, or an equivalent sequence containing thymine bases substituted
for uracil bases, and which preferentially hybridizes to the target nucleic acid or
its complement (
e.g., not
Chlamydia psittaci nucleic acid) under stringent hybridization conditions. The detection probe preferably
does not include a region in addition to the target binding region that hybridizes
to the target nucleic acid or its complement under stringent hybridization conditions.
More preferably, the detection probe comprises, consists of, or consists essentially
of a base sequence substantially corresponding to the base sequence of SEQ ID NO:24,
the complement thereof, or an equivalent sequence containing thymine bases substituted
for uracil bases, and which preferentially hybridizes under stringent hybridization
conditions to the target nucleic acid or its complement. The base sequence of the
detection probe preferably consists of or is contained within and includes at least
19, 22 or 24 contiguous bases of the base sequence of SEQ ID NO:24, the complement
thereof, or an equivalent sequence containing thymine bases substituted for uracil
bases, and which preferentially hybridizes to the target nucleic acid or its complement
under stringent hybridization conditions. In certain embodiments the probe optionally
includes one or more detectable labels,
e.g., an AE substituent.
[0042] For certain amplification reactions in which the target nucleic acid contains a 16S
rRNA sequence of
Mycobacterium tuberculosis, the present invention includes a promoter oligonucleotide comprising a promoter sequence
and a hybridizing sequence up to 40 or 50 bases in length. The promoter sequence is
recognized by an RNA polymerase, such as a T7, T3 or SP6 RNA polymerase, and preferably
includes the T7 RNA polymerase promoter sequence of SEQ ID NO:3. The hybridizing sequence
of the preferred promoter oligonucleotide comprises, consists of, consists essentially
of, overlaps with, or is contained within and includes at least 10,15, 20, 25, 30,
35 or 36 contiguous bases of a base sequence that is at least 80%, 90% or 100% identical
to the base sequence of SEQ ID NO:25 actgggtctaataccggataggaccacgggatgcat or an equivalent
sequence containing uracil bases substituted for thymine bases, and which hybridizes
to the target nucleic acid under amplification conditions. The promoter oligonucleotide
preferably does not include a region in addition to the hybridizing sequence that
hybridizes to the target nucleic acid under amplification conditions. More preferably,
the promoter oligonucleotide comprises, consists of, or consists essentially of a
base sequence substantially corresponding to the base sequence of SEQ ID NO:26 aattctaatacgactcactat
agggagaactgggtctaataccggataggaccacgggatgcat or an equivalent sequence containing uracil
bases substituted for thymine' bases, and which hybridizes to the target nucleic acid
under amplification conditions. The base sequence of the promoter oligonucleotide
preferably consists of a promoter sequence and a hybridizing sequence consisting of
or contained within and including at least 10, 15, 20, 25, 30, 35 or 36 contiguous
bases of the base sequence of SEQ ID NO:25 or an equivalent sequence containing uracil
bases substituted for thymine bases, and which hybridizes to the target nucleic acid
under amplification conditions.
[0043] For certain amplification reactions in which the target nucleic acid contains a 16S
rRNA sequence of
Mycobacterium tuberculosis, the present invention includes a promoter oligonucleotide comprising a promoter sequence
and a hybridizing sequence up to 40 or 50 bases in length. The promoter sequence is
recognized by an RNA polymerase, such as a T7, T3 or SP6 RNA polymerase, and preferably
includes the T7 RNA polymerase promoter sequence of SEQ ID NO:3. The hybridizing sequence
of the preferred promoter oligonucleotide comprises, consists of, consists essentially
of, overlaps with, or is contained within and includes at least 10,15, 20, 25, 30
or 31 contiguous bases of a base sequence that is at least 80%, 90% or 100% identical
to the base sequence of SEQ ID NO:27 actgggtctaataccggataggaccacggga or an equivalent
sequence containing uracil bases substituted for thymine bases, and which hybridizes
to the target nucleic acid under amplification conditions. The promoter oligonucleotide
preferably does not include a region in addition to the hybridizing sequence that
hybridizes to the target nucleic acid under amplification conditions. More preferably,
the promoter oligonucleotide comprises, consists of, or consists essentially of a
base sequence substantially corresponding to the base sequence of SEQ ID NO:28 aattctaatacgactcactat
agggagaactgggtctaataccggataggaccacggga or an equivalent sequence containing uracil
bases substituted for thymine bases, and which hybridizes to the target nucleic acid
under amplification conditions. The base sequence of the promoter oligonucleotide
preferably consists of a promoter sequence and a hybridizing sequence consisting of
or contained within and including at least 10, 15, 20, 25, 30 or 31 contiguous bases
of the base sequence of SEQ ID NO:27 or an equivalent sequence containing uracil bases
substituted for thymine bases, and which hybridizes to the target nucleic acid under
amplification conditions.
[0044] For certain amplification reactions in which the target nucleic acid contains a 16S
rRNA sequence of
Mycobacterium tuberculosis, the present invention includes a priming oligonucleotide up to 40 or 50 bases in
length. A preferred priming oligonucleotide includes an oligonucleotide comprising,
consisting of, consisting essentially of, overlapping with, or contained within and
including at least 10, 15, 20, 25 or 27 contiguous bases of a base sequence that is
at least 80%, 90% or 100% identical to the base sequence of SEQ ID NO:29 gccgtcaccccaccaacaagctgatag
or an equivalent sequence containing uracil bases substituted for thymine bases, and
which hybridizes to the target nucleic acid under amplification conditions. More preferably,
the priming oligonucleotide comprises, consists of, or consists essentially of a base
sequence substantially corresponding to the base sequence of SEQ ID NO:29 or an equivalent
sequence containing uracil bases substituted for thymine bases, and which hybridizes
to the target nucleic acid under amplification conditions. The base sequence of the
priming oligonucleotide preferably consists of or is contained within and includes
at least 10, 15, 20, 25 or 27 contiguous bases of the base sequence of SEQ ID NO:29
or an equivalent sequence containing uracil bases substituted for thymine bases, and
which hybridizes to the target nucleic acid under amplification conditions.
[0045] For certain amplification reactions in which the target nucleic acid contains a 16S
rRNA sequence of
Mycobacterium tuberculosis, the present invention is further directed to a detection probe up to 35, 50 or 100
bases in length. A preferred detection probe includes a target binding region which
comprises, consists of, consists essentially of, overlaps with, or is contained within
and includes at least 18, 20 or 22 contiguous bases of a base sequence that is at
least 80%, 90% or 100% identical to the base sequence of SEQ ID NO:30 gcucaucccacaccgcuaaagc,
the complement thereof, or an equivalent sequence containing thymine bases substituted
for uracil bases, and which preferentially hybridizes to the target nucleic acid or
its complement (
e.g., not nucleic acid from a
Mycobacterium avium complex organism) under stringent hybridization conditions. The detection probe preferably
does not include a region in addition to the target binding region that hybridizes
to the target nucleic acid or its complement under stringent hybridization conditions.
More preferably, the detection probe comprises, consists of, or consists essentially
of a base sequence substantially corresponding to the base sequence of SEQ ID NO:30,
the complement thereof, or an equivalent sequence containing thymine bases substituted
for uracil bases, and which preferentially hybridizes to the target nucleic acid or
its complement under stringent hybridization conditions. The base sequence of the
detection probe preferably consists of or is contained within and includes at least
18, 20 or 22 contiguous bases of the base sequence of SEQ ID NO:30, the complement
thereof, or an equivalent sequence containing thymine bases substituted for uracil
bases, and which preferentially hybridizes to the target nucleic acid or its complement
under stringent hybridization conditions. In certain embodiments the probe optionally
includes one or more detectable labels,
e.g., an AE substituent.
[0046] For certain amplification reactions in which the target nucleic acid contains a 16S
rRNA sequence of
Mycobacterium tuberculosis, the present invention is further directed to a detection probe up to 35, 50 or 100
bases in length. A preferred detection probe includes a target binding region which
comprises, consists of, consists essentially of, overlaps with, or is contained within
and includes at least 22, 25 or 28 contiguous bases of a base sequence that is at
least 80%, 90% or 100% identical to the base sequence of SEQ ID NO:31 ccgagaucccacaccgcuaaagccucgg,
the complement thereof, or an equivalent sequence containing thymine bases substituted
for uracil bases, and which preferentially hybridizes to the target nucleic acid or
its complement (
e.g., not nucleic acid from a
Mycobacterium avium complex organism) under stringent hybridization conditions. The detection probe preferably
does not include a region in addition to the target binding region that hybridizes
to the target nucleic acid or its complement under stringent hybridization conditions.
More preferably, the detection probe comprises, consists of, or consists essentially
of a base sequence substantially corresponding to the base sequence of SEQ ID NO:31,
the complement thereof, or an equivalent sequence containing thymine bases substituted
for uracil bases, and which preferentially hybridizes to the target nucleic acid or
its complement under stringent hybridization conditions. The base sequence of the
detection probe preferably consists of or is contained within and includes at least
22, 25 or 28 contiguous bases of the base sequence of SEQ ID NO:31, the complement
thereof, or an equivalent sequence containing thymine bases substituted for uracil
bases, and which preferentially hybridizes to the target nucleic acid or its complement
under stringent hybridization conditions. In certain embodiments the probe optionally
includes one or more detectable labels,
e.g., a fluorophore/quencher dye pair.
[0047] For certain amplification reactions in which the target nucleic acid contains a 16S
rRNA sequence of
Mycobacterium tuberculosis, the present invention is further directed to a detection probe up to 35, 50 or 100
bases in length. A preferred detection probe includes a target binding region which
comprises, consists of, consists essentially of, overlaps with, or is contained within
and includes at least 18, 20 or 22 contiguous bases of a base sequence that is at
least 80%, 90% or 100% identical to the base sequence of SEQ ID NO:32 gctcatcccacaccgctaaagc,
the complement thereof, or an equivalent sequence containing uracil bases substituted
for thymine bases, and which preferentially hybridizes to the target nucleic acid
or its complement (
e.g., not nucleic acid from a
Mycobacterium avium complex organism) under stringent hybridization conditions. The detection probe preferably
does not include a region in addition to the target binding region that hybridizes
to the target nucleic acid or its complement under stringent hybridization conditions.
More preferably, the detection probe comprises, consists of, or consists essentially
of a base sequence substantially corresponding to the base sequence of SEQ ID NO:32,
the complement thereof, or an equivalent sequence containing uracil bases substituted
for thymine bases, and which preferentially hybridizes to the target nucleic acid
or its complement under stringent hybridization conditions. The base sequence of the
detection probe preferably consists of or is contained within and includes at least
18, 20 or 22 contiguous bases of the base sequence of SEQ ID NO: 32, the complement
thereof, or an equivalent sequence containing uracil bases substituted for thymine
bases, and which preferentially hybridizes to the target nucleic acid or its complement
under stringent hybridization conditions. In certain embodiments the probe optionally
includes one or more detectable labels,
e.g., an AE substituent.
[0048] For amplification reactions which do not form part of the present invention, the
above-described promoter oligonucleotides may be modified to exclude the promoter
sequence and/or the priming oligonucleotides may be modified to include a promoter
sequence. Additionally, where the desired specificity for a target sequence can be
achieved, the promoter oligonucleotides and/or the priming oligonucleotides described
above may be modified and used as detection probes. Also, the above-described detection
probes may be adapted for use as amplification oligonucleotides.
[0049] Other features and advantages of the invention will be apparent from the following
description of the preferred embodiments thereof and from the claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0050]
Figures 1A-1C depict three general methods of the present invention.
Figures 2A-2C depict the general methods of Figures 1A-1C with the further inclusion
of an extender oligonucleotide hybridized to an extension product or target sequence
3' to the blocked promoter oligonucleotide.
FIG. 3 depicts a denaturing agarose gel showing the effect of using a promoter oligonucleotide
with a 3'-blocking moiety.
FIG. 4 shows the real-time accumulation of amplification products in a Mycobacterium tuberculosis system, both in the presence (Figures 4A, 4C and 4E) and in the absence (Figures
4B, 4D and 4F) of a terminating oligonucleotide modified to fully contain 2'-O-methyl
ribonucleotides. The input target nucleic acid for these reactions was 0 copies (Figures
4A and 4B),100 copies (Figures 4C and 4D) and 1000 copies (Figures 4E and 4F).
FIG. 5 illustrates the formation of primer-dependent side-products.
Figures 6A and 6B illustrate the use of caps to limit side-product formation. The
cap and priming oligonucleotide are separate molecules in FIG. 6A, and in FIG. 6B
they are linked to each other.
Figures 7A and 7B depict non-denaturing agarose gels showing the effect of a capping
oligonucleotide on side-product formation. FIG. 7A depicts reactions without added
template, and FIG 7B depicts reactions with added template.
DETAILED DESCRIPTION OF THE INVENTION
[0051] In accordance with the present invention, novel methods, reaction mixtures and compositions
are provided for the amplification of specific nucleic acid target sequences for use
in assays for the detection and/or quantitation of such nucleic acid target sequences
or for the production of large numbers of copies of DNA and/or RNA of specific target
sequences for a variety of uses. In particular, the embodiments of the present invention
provide for amplification of nucleic acid target sequences with enhanced specificity
and sensitivity. Amplification methods of the present invention can be carried out
using only a single primer, with all other oligonucleotides used in the amplification
methods preferably comprising a blocking moiety at their 3'-termini so that they cannot
be extended by a nucleic acid polymerase.
Definitions
[0052] The following terms have the following meanings unless expressly stated to the contrary.
It is to be noted that the term "a" or "an" entity refers to one or more of that entity;
for example, "a nucleic acid," is understood to represent one or more nucleic acids.
As such, the terms "a" (or "an"), "one or more," and "at least one" can be used interchangeably
herein.
1. Nucleic acid
[0053] The term "nucleic acid" is intended to encompass a singular "nucleic acid" as well
as plural "nucleic acids," and refers to any chain of two or more nucleotides, nucleosides,
or nucleobases (
e.g., deoxyribonucleotides or ribonucleotides) covalently bonded together. Nucleic acids
include, but are not limited to, virus genomes, or portions thereof, either DNA or
RNA, bacterial genomes, or portions thereof, fungal, plant or animal genomes, or portions
thereof, messenger RNA (mRNA), ribosomal RNA (rRNA), transfer RNA (tRNA), plasmid
DNA, mitochondrial DNA, or synthetic DNA or RNA. A nucleic acid may be provided in
a linear
(e.g., mRNA), circular (
e.g., plasmid), or branched form, as well as a double-stranded or single-stranded form.
Nucleic acids may include modified bases to alter the function or behavior of the
nucleic acid,
e.g., addition of a 3'-terminal dideoxynucleotide to block additional nucleotides from
being added to the nucleic acid. As used herein, a "sequence" of a nucleic acid refers
to the sequence of bases which make up a nucleic acid. The term "polynucleotide" may
be used herein to denote a nucleic acid chain. Throughout this application, nucleic
acids are designated as having a 5'-terminus and a 3'-terminus. Standard nucleic acids,
e.g., DNA and RNA, are typically synthesized "5'-to-3';"
i.e., by the addition of nucleotides to the 3'-terminus of a growing nucleic acid.
[0054] A "nucleotide" is a subunit of a nucleic acid consisting of a phosphate group, a
5-carbon sugar and a nitrogenous base. The 5-carbon sugar found in RNA is ribose.
In DNA, the 5-carbon sugar is 2'-deoxyribose. The term also includes analogs of such
subunits, such as a methoxy group at the 2' position of the ribose (2'-O-Me). As used
herein, methoxy oligonucleotides containing "T" residues have a methoxy group at the
2' position of the ribose moiety, and a uracil at the base position of the nucleotide.
[0055] A "non-nucleotide unit" is a unit which does not significantly participate in hybridization
of a polymer. Such units must not, for example, participate in any significant hydrogen
bonding with a nucleotide, and would exclude units having as a component one of the
five nucleotide bases or analogs thereof.
2. Oligonucleotide
[0056] As used herein, the term "oligonucleotide" or "oligomer" is intended to encompass
a singular "oligonucleotide" as well as plural "oligonucleotides," and refers to any
polymer of two or more of nucleotides, nucleosides, nucleobases or related compounds
used as a reagent in the amplification methods of the present invention, as well as
subsequent detection methods. The oligonucleotide may be DNA and/or RNA and/or analogs
thereof. The term oligonucleotide does not denote any particular function to the reagent,
rather, it is used generically to cover all such reagents described herein. An oligonucleotide
may serve various different functions,
e.g., it may function as a primer if it is capable of hybridizing to a complementary
strand and can further be extended in the presence of a nucleic acid polymerase, it
may provide a promoter if it contains a sequence recognized by an RNA polymerase and
allows for transcription, and it may function to prevent hybridization or impede primer
extension if appropriately situated and/or modified. Specific oligonucleotides of
the present invention are described in more detail below. As used herein, an oligonucleotide
can be virtually any length, limited only by its specific function in the amplification
reaction or in detecting an amplification product of the amplification reaction.
[0057] Oligonucleotides of a defined sequence and chemical structure may be produced by
techniques known to those of ordinary skill in the art, such as by chemical or biochemical
synthesis, and by
in vitro or
in vivo expression from recombinant nucleic acid molecules,
e.g., bacterial or viral vectors. As intended by this disclosure, an oligonucleotide does
not consist solely of wild-type chromosomal DNA or the
in vivo transcription products thereof.
[0058] Oligonucleotides may be modified in any way, as long as a given modification is compatible
with the desired function of a given oligonucleotide. One of ordinary skill in the
art can easily determine whether a given modification is suitable or desired for any
given oligonucleotide of the present invention. Modifications include base modifications,
sugar modifications or backbone modifications. Base modifications include, but are
not limited to the use of the following bases in addition to adenine, cytidine, guanosine,
thymine and uracil: C-5 propyne, 2-amino adenine, 5-methyl cytidine, inosine, and
dP and dK bases. The sugar groups of the nucleoside subunits may be ribose, deoxyribose
and analogs thereof, including, for example, ribonucleosides having a 2'-O-methyl
substitution to the ribofuranosyl moiety.
See Becker
et al., U.S. Patent No. 6,130,038. Other sugar modifications include, but are not limited to 2'-amino, 2'-fluoro, (L)-alpha-threofuranosyl,
and pentopuranosyl modifications. The nucleoside subunits may by joined by linkages
such as phosphodiester linkages, modified linkages or by non-nucleotide moieties which
do not prevent hybridization of the oligonucleotide to its complementary target nucleic
acid sequence. Modified linkages include those linkages in which a standard phosphodiester
linkage is replaced with a different linkage, such as a phosphorothioate linkage or
a methylphosphonate linkage. The nucleobase subunits may be joined, for example, by
replacing the natural deoxyribose phosphate backbone of DNA with a pseudo peptide
backbone, such as a 2-aminoethylglycine backbone which couples the nucleobase subunits
by means of a carboxymethyl linker to the central secondary amine. (DNA analogs having
a pseudo peptide backbone are commonly referred to as "peptide nucleic acids" or "PNA"
and are disclosed by Nielsen
et al., "Peptide Nucleic Acids,"
U.S. Patent No. 5,539,082.) Other linkage modifications include, but are not limited to, morpholino bonds.
[0059] Non-limiting examples of oligonucleotides or oligomers contemplated by the present
invention include nucleic acid analogs containing bicyclic and tricyclic nucleoside
and nucleotide analogs (LNAs).
See Imanishi
et al., U.S. Patent No. 6,268,490; and Wengel
et al., U.S. Patent No. 6,670,461.) Any nucleic acid analog is contemplated by the present invention provided the modified
oligonucleotide can perform its intended function, e.g., hybridize to a target nucleic
acid under stringent hybridization conditions or amplification conditions, or interact
with a DNA or RNA polymerase, thereby initiating extension or transcription. In the
case of detection probes, the modified oligonucleotides must also be capable of preferentially
hybridizing to the target nucleic acid under stringent hybridization conditions.
[0060] While design and sequence of oligonucleotides for the present invention depend on
their function as described below, several variables must generally be taken into
account. Among the most critical are: length, melting temperature (Tm), specificity,
complementarity with other oligonucleotides in the system, G/C content, polypyrimidine
(T, C) or polypurine (A, G) stretches, and the 3'-end sequence. Controlling for these
and other variables is a standard and well known aspect of oligonucleotide design,
and various computer programs are readily available to screen large numbers of potential
oligonucleotides for optimal ones.
[0061] The 3'-terminus of an oligonucleotide (or other nucleic acid) can be blocked in a
variety of ways using a blocking moiety, as described below. A "blocked" oligonucleotide
cannot be extended by the addition of nucleotides to its 3'-terminus, by a DNA- or
RNA-dependent DNA polymerase, to produce a complementary strand of DNA. As such, a
"blocked" oligonucleotide cannot be a "primer."
[0062] As used in this disclosure, the phrase "an oligonucleotide having a nucleic acid
sequence 'comprising,' 'consisting of,' or 'consisting essentially of a sequence selected
from" a group of specific sequences means that the oligonucleotide, as a basic and
novel characteristic, is capable of stably hybridizing to a nucleic acid having the
exact complement of one of the listed nucleic acid sequences of the group under stringent
hybridization conditions. An exact complement includes the corresponding DNA or RNA
sequence.
[0063] The phrase "an oligonucleotide substantially corresponding to a nucleic acid sequence"
means that the referred to oligonucleotide is sufficiently similar to the reference
nucleic acid sequence such that the oligonucleotide has similar hybridization properties
to the reference nucleic acid sequence in that it would hybridize with the same target
nucleic acid sequence under stringent hybridization conditions.
[0064] One skilled in the art will understand that "substantially corresponding" oligonucleotides
of the invention can vary from the referred to sequence and still hybridize to the
same target nucleic acid sequence. This variation from the nucleic acid may be stated
in terms of a percentage of identical bases within the sequence or the percentage
of perfectly complementary bases between the probe or primer and its target sequence.
Thus, an oligonucleotide of the present invention substantially corresponds to a reference
nucleic acid sequence if these percentages of base identity or complementarity are
from 100% to about 80%. In preferred embodiments, the percentage is from 100% to about
85%. In more preferred embodiments, this percentage can be from 100% to about 90%;
in other preferred embodiments, this percentage is from 100% to about 95%. One skilled
in the art will understand the various modifications to the hybridization conditions
that might be required at various percentages of complementarity to allow hybridization
to a specific target sequence without causing an unacceptable level of non-specific
hybridization.
3. Blocking Moiety
[0065] As used herein, a "blocking moiety" is a substance used to "block" the 3'-terminus
of an oligonucleotide or other nucleic acid so that it cannot be extended by a nucleic
acid polymerase. A blocking moiety may be a small molecule,
e.g., a phosphate or ammonium group, or it may be a modified nucleotide,
e.g., a 3'2' dideoxynucleotide or 3' deoxyadenosine 5'-triphosphate (cordycepin), or
other modified nucleotide. Additional blocking moieties include, for example, the
use of a nucleotide or a short nucleotide sequence having a 3'-to-5' orientation,
so that there is no free hydroxyl group at the 3'-terminus, the use of a 3' alkyl
group, a 3' non-nucleotide moiety
(see, e.g., Arnold
et al., "Non-Nucleotide Linking Reagents for Nucleotide Probes,"
U.S. Patent No. 6,031,091, the contents of which are hereby incorporated by reference herein), phosphorothioate,
alkane-diol residues, peptide nucleic acid (PNA), nucleotide residues lacking a 3'
hydroxyl group at the 3'-terminus, or a nucleic acid binding protein. Preferably,
the 3'-blocking moiety comprises a nucleotide or a nucleotide sequence having a 3'-to-5'
orientation or a 3' non-nucleotide moiety, and not a 3'2'-dideoxynucleotide or a 3'
terminus having a free hydroxyl group. Additional methods to prepare 3'-blocking oligonucleotides
are well known to those of ordinary skill in the art.
4. Binding molecule
[0066] As used herein, a "binding molecule" is a substance which hybridizes to or otherwise
binds to an RNA target nucleic acid adjacent to or near the 5'-end of the desired
target sequence, so as to limit a DNA primer extension product to a desired length,
i.e., a primer extension product having a generally defined 3'-end. As used herein, the
phrase "defined 3'-end" means that the 3'-end of a primer extension product is not
wholly indeterminate, as would be the case in a primer extension reaction which occurs
in the absence of a binding molecule, but rather that the 3'-end of the primer extension
product is generally known to within a small range of bases. In certain embodiments,
a binding molecule comprises a base region. The base region may be DNA, RNA, a DNA:RNA
chimeric molecule, or an analog thereof. Binding molecules comprising a base region
may be modified in one or more ways, as described herein. Exemplary base regions include
terminating and digestion oligonucleotides, as described below. In other embodiments,
a binding molecule may comprise, for example, a protein or drug capable of binding
RNA with sufficient affinity and specificity to limit a DNA primer extension product
to a pre-determined length.
5. Terminating Oligonucleotide
[0067] In the present invention, a "terminating oligonucleotide" is an oligonucleotide comprising
a base sequence that is complementary to a region of the target nucleic acid in the
vicinity of the 5'-end of the target sequence, so as to "terminate" primer extension
of a nascent nucleic acid that includes a priming oligonucleotide, thereby providing
a defined 3'-end for the nascent nucleic acid strand. A terminating oligonucleotide
is designed to hybridize to the target nucleic acid at a position sufficient to achieve
the desired 3'-end for the nascent nucleic acid strand. The positioning of the terminating
oligonucleotide is flexible depending upon its design. A terminating oligonucleotide
may be modified or unmodified. In certain embodiments, terminating oligonucleotides
are synthesized with at least one or more 2'-O-methyl ribonucleotides. These modified
nucleotides have demonstrated higher thermal stability of complementary duplexes.
The 2'-O-methyl ribonucleotides also function to increase the resistance of oligonucleotides
to exonucleases, thereby increasing the half-life of the modified oligonucleotides.
See, e.g., Majlessi et al. (1988) Nucleic Acids Res. 26, 2224-9, the contents of which are hereby incorporated by reference herein. Other modifications
as described elsewhere herein may be utilized in addition to or in place of 2'-O-methyl
ribonucleotides. For example, a terminating oligonucleotide may comprise PNA or an
LNA.
See, e.g., Petersen et al. (2000) J. Mol. Recognit. 13, 44-53, the contents of which are hereby incorporated by reference herein. A terminating
oligonucleotide of the present invention typically includes a blocking moiety at its
3'-terminus to prevent extension. A terminating oligonucleotide may also comprise
a protein or peptide joined to the oligonucleotide so as to terminate further extension
of a nascent nucleic acid chain by a polymerase. A terminating oligonucleotide of
the present invention is typically at least 10 bases in length, and may extend up
to 15, 20, 25, 30, 35, 40, 50 or more nucleotides in length. Suitable and preferred
terminating oligonucleotides are described herein. It should be noted that while a
terminating oligonucleotide typically or necessarily includes a 3'-blocking moiety,
"3'-blocked" oligonucleotides are not necessarily terminating oligonucleotides. Other
oligonucleotides of the present invention,
e.g., promoter oligonucleotides and capping oligonucleotides are typically or necessarily
3'-blocked as well.
6. Modifying Oligonucleotide/Digestion Oligonucleotide
[0068] A modifying oligonucleotide provides a mechanism by which the 3'-terminus of the
primer extension product is determined. A modifying oligonucleotide typically comprises
a motif which hybridizes to one or more bases in the vicinity of the 5'-end of the
RNA target sequence, and which facilitates termination of primer extension by means
of a modifying enzyme,
e.g., a nuclease. Alternatively, a modifying oligonucleotide might comprise a base region
which hybridizes in the vicinity of the 3'-end of the RNA target sequence, and is
tethered to a specific modifying enzyme or to a chemical which can then terminate
primer extension.
[0069] One specific modifying oligonucleotide is a digestion oligonucleotide. A digestion
oligonucleotide is comprised of DNA, preferably a stretch of at least about 6 deoxyribonucleotides.
The digestion oligonucleotide hybridizes to the RNA template and the RNA of the RNA:DNA
hybrid is digested by a selective RNAse as described herein, e.g., by an enzyme having
an RNAse H activity.
7. Promoter Oligonucleotide/Promoter Sequence
[0070] As is well known in the art, a "promoter" is a specific nucleic acid sequence that
is recognized by a DNA-dependent RNA polymerase ("transcriptase") as a signal to bind
to the nucleic acid and begin the transcription of RNA at a specific site. For binding,
it was generally thought that such transcriptases required DNA which had been rendered
double-stranded in the region comprising the promoter sequence via an extension reaction,
however, the present inventors have determined that efficient transcription of RNA
can take place even under conditions where a double-stranded promoter is not formed
through an extension reaction with the template nucleic acid. The template nucleic
acid (the sequence to be transcribed) need not be double-stranded. Individual DNA-dependent
RNA polymerases recognize a variety of different promoter sequences which can vary
markedly in their efficiency in promoting transcription. When an RNA polymerase binds
to a promoter sequence to initiate transcription, that promoter sequence is not part
of the sequence transcribed. Thus, the RNA transcripts produced thereby will not include
that sequence.
[0071] According to the present invention, a "promoter oligonucleotide" refers to an oligonucleotide
comprising first and second regions, and which is modified to prevent the initiation
of DNA synthesis from its 3'-terminus. The "first region" of a promoter oligonucleotide
of the present invention comprises a base sequence which hybridizes to a DNA template,
where the hybridizing sequence is situated 3', but not necessarily adjacent to, a
promoter region. The hybridizing portion of a promoter oligonucleotide of the present
invention is typically at least 10 nucleotides in length, and may extend up to 15,
20, 25, 30, 35, 40, 50 or more nucleotides in length. The "second region" comprises
a promoter for an RNA polymerase. A promoter oligonucleotide of the present invention
is engineered so that it is incapable of being extended by an RNA- or DNA-dependent
DNA polymerase,
e.g., reverse transcriptase, preferably comprising a blocking moiety at its 3'-terminus
as described above. Suitable and preferred promoter oligonucleotides are described
herein.
[0072] Promoter oligonucleotides of the present invention may be provided to a reaction
mixture with an oligodeoxynucleotide bound to a ribonucleotide-containing section
of the first region. The ribonucleotide-containing section preferably comprises at
least 6 contiguous ribonucleotides positioned at or near the 3'-end of the first region,
and the oligodeoxynucleotide is preferably the same length as and fully complementary
to the ribonucleotide-containing section of the first region. Upon exposure to an
enzyme capable of cleaving the RNA of an RNA:DNA duplex (e.g., an RNAse H activity),
a blocking moiety at the 3'-end of the promoter oligonucleotide is released and the
remainder of the first region is in a single-stranded form which is available for
hybridization to a DNA template. The remaining, uncleaved portion of the first region
is preferably 10 to 50 nucleotides in length, as described above.
8. Insertion Sequence
[0073] As used herein, an "insertion sequence" is a sequence positioned between the first
region (
i.e., template binding portion) and the second region of a promoter oligonucleotide.
Insertion sequences are preferably 5 to 20 nucleotides in length, more preferably
6 to 18 nucleotides in length, and most preferably 6 to 12 nucleotides in length.
The inclusion of insertion sequences in promoter oligonucleotides increases the rate
at which RNA amplification products are formed. Exemplary insertion sequences are
described herein.
9. Extender Oligonucleotide
[0074] An extender oligonucleotide is an oligonucleotide which hybridizes to a DNA template
adjacent to or near the 3'-end of the first region of a promoter oligonucleotide.
An extender oligonucleotide preferably hybridizes to a DNA template such that the
5'-terminal base of the extender oligonucleotide is within 3, 2 or 1 bases of the
3'-terminal base of a promoter oligonucleotide. Most preferably, the 5'-terminal base
of an extender oligonucleotide is adjacent to the 3'-terminal base of a promoter oligonucleotide
when the extender oligonucleotide and the promoter oligonucleotide are hybridized
to aDNA template. To prevent extension of an extender oligonucleotide, a 3'-terminal
blocking moiety is typically included. An extender oligonucleotide is preferably 10
to 50 nucleotides in length, more preferably 20 to 40 nucleotides in length, and most
preferably 30 to 35 nucleotides in length.
10. Priming Oligonucleotide
[0075] A priming oligonucleotide is an oligonucleotide, at least the 3'-end of which is
complementary to a nucleic acid template, and which complexes (by hydrogen bonding
or hybridization) with the template to give a primer:template complex suitable for
initiation of synthesis by an RNA- or DNA-dependent DNA polymerase. A priming oligonucleotide
is extended by the addition of covalently bonded nucleotide bases to its 3'-terminus,
which bases are complementary to the template. The result is a primer extension product.
A priming oligonucleotide of the present invention is typically at least 10 nucleotides
in length, and may extend up to 15, 20, 25, 30, 35, 40, 50 or more nucleotides in
length. Suitable and preferred priming oligonucleotides are described herein. Virtually
all DNA polymerases (including reverse transcriptases) that are known require complexing
of an oligonucleotide to a single-stranded template ("priming") to initiate DNA synthesis,
whereas RNA replication and transcription (copying of RNA from DNA) generally do not
require a primer. By its very nature of being extended by a DNA polymerase, a priming
oligonucleotide does not comprise a 3'-blocking moiety.
11. Cap or Capping Oligonucleotide
[0076] As used herein, a "cap" comprises an oligonucleotide complementary to the 3'-end
of a priming oligonucleotide, where the 5'-terminal base of the cap hybridizes to
the 3'-terminal base of the priming oligonucleotide. A cap according to present invention
is designed to preferentially hybridize to the 3'-end of the priming oligonucleotide,
e.g., not with a promoter oligonucleotide, but such that the cap will be displaced by
hybridization of the priming oligonucleotide to the target nucleic acid. A cap may
take the form of a discrete capping oligonucleotide or it may be joined to the 5'-end
of the priming oligonucleotide via a linker region, thereby forming a stem-loop structure
with the priming oligonucleotide under amplification conditions. Such a linker region
can comprise conventional nucleotides, abasic nucleotides or otherwise modified nucleotides,
or a non-nucleotide region. As described in more detail herein, a suitable cap is
at least three bases in length, and is no longer than about 14 bases in length. Typical
caps are about 5 to 7 bases in length.
12. Probe
[0077] By "probe" or "detection probe" is meant a molecule comprising an oligonucleotide
having a base sequence partly or completely complementary to a region of a target
sequence sought to be detected, so as to hybridize thereto under stringent hybridization
conditions. As would be understood by someone having ordinary skill in the art, a
probe comprises an isolated nucleic acid molecule, or an analog thereof, in a form
not found in nature without human intervention (
e.g., recombined with foreign nucleic acid, isolated, or purified to some extent).
[0078] The probes of this invention may have additional nucleosides or nucleobases outside
of the targeted region so long as such nucleosides or nucleobases do not substantially
affect hybridization under stringent hybridization conditions and, in the case of
detection probes, do not prevent preferential hybridization to the target nucleic
acid. A non-complementary sequence may also be included, such as a target capture
sequence (generally a homopolymer tract, such as a poly-A, poly-T or poly-U tail),
promoter sequence, a binding site for RNA transcription, a restriction endonuclease
recognition site, or may contain sequences which will confer a desired secondary or
tertiary structure, such as a catalytic active site or a hairpin structure on the
probe, on the target nucleic acid, or both.
[0079] The probes preferably include at least one detectable label. The label may be any
suitable labeling substance, including but not limited to a radioisotope, an enzyme,
an enzyme cofactor, an enzyme substrate, a dye, a hapten, a chemiluminescent molecule,
a fluorescent molecule, a phosphorescent molecule, an electrochemiluminescent molecule,
a chromophore, a base sequence region that is unable to stably hybridize to the target
nucleic acid under the stated conditions, and mixtures of these. In one particularly
preferred embodiment, the label is an acridinium ester. Probes may also include interacting
labels which emit different signals, depending on whether the probes have hybridized
to target sequences. Examples of interacting labels include enzyme/substrates, enzyme/cofactor,
luminescent/quencher, luminescent/adduct, dye dimers, and Förrester energy transfer
pairs. Certain probes of the present invention do not include a label. For example,
non-labeled "capture" probes may be used to enrich for target sequences or replicates
thereof, which may then be detected by a second "detection" probe.
See, e.g., Weisburg
et al., "Two-Step Hybridization and Capture of a Polynucleotide,"
U.S. Patent No. 6,534,273, the contents of which are hereby incorporated by reference herein. While detection
probes are typically labeled, certain detection technologies do not require that the
probe be labeled.
See, e.g., Nygren
et al., "Devices and Methods for Optical Detection of Nucleic Acid Hybridization,
U.S. Patent No. 6,060,237.
[0080] By "stable" or "stable for detection" is meant that the temperature of a reaction
mixture is at least 2°C below the melting temperature of a nucleic acid duplex. The
temperature of the reaction mixture is more preferably at least 5°C below the melting
temperature of the nucleic acid duplex, and even more preferably at least 10°C below
the melting temperature of the reaction mixture.
[0081] By "preferentially hybridize" is meant that under stringent hybridization conditions,
probes of the present invention hybridize to their target sequences, or replicates
thereof, to form stable probe:target hybrids, while at the same time formation of
stable probe:non-target hybrids is minimized. Thus, a probe hybridizes to a target
sequence or replicate thereof to a sufficiently greater extent than to a non-target
sequence, to enable one having ordinary skill in the art to accurately quantitate
the RNA replicates or complementary DNA (cDNA) of the target sequence formed during
the amplification.
[0082] Probes of a defined sequence may be produced by techniques known to those of ordinary
skill in the art, such as by chemical synthesis, and by
in vitro or
in vivo expression from recombinant nucleic acid molecules. Preferably probes are 10 to 100
nucleotides in length, more preferably 12 to 50 bases in length, and even more preferably
18 to 35 bases in length.
13. Hybridize/Hybridization
[0083] Nucleic acid hybridization is the process by which two nucleic acid strands having
completely or partially complementary nucleotide sequences come together under predetermined
reaction conditions to form a stable, double-stranded hybrid. Either nucleic acid
strand may be a deoxyribonucleic acid (DNA) or a ribonucleic acid (RNA) or analogs
thereof. Thus, hybridization can involve RNA:RNA hybrids, DNA:DNA hybrids, RNA:DNA
hybrids, or analogs thereof. The two constituent strands of this double-stranded structure,
sometimes called a hybrid, are held together by hydrogen bonds. Although these hydrogen
bonds most commonly form between nucleotides containing the bases adenine and thymine
or uracil (A and T or U) or cytosine and guanine (C and G) on single nucleic acid
strands, base pairing can also form between bases which are not members of these "canonical"
pairs. Non-canonical base pairing is well-known in the art.
(See, e.g., ROGER L.P. ADAMS ET AL., THE BIOCHEMISTRY OF THE NUCLEIC ACIDS (11th ed. 1992).)
[0084] "Stringent hybridization conditions" or "stringent conditions" refer to conditions
wherein a specific detection probe is able to hybridize with target nucleic acids
over other nucleic acids present in the test sample. It will be appreciated that these
conditions may vary depending upon factors including the GC content and length of
the probe, the hybridization temperature, the composition of the hybridization reagent
or solution, and the degree of hybridization specificity sought. Specific stringent
hybridization conditions are provided in the disclosure below.
[0085] By "nucleic acid hybrid" or "hybrid" or "duplex" is meant a nucleic acid structure
containing a double-stranded, hydrogen-bonded region wherein each strand is complementary
to the other, and wherein the region is sufficiently stable under stringent hybridization
conditions to be detected by means including, but not limited to, chemiluminescent
or fluorescent light detection, autoradiography, or gel electrophoresis. Such hybrids
may comprise RNA:RNA, RNA:DNA, or DNA:DNA duplex molecules.
[0086] By "complementary" is meant that the nucleotide sequences of similar regions of two
single-stranded nucleic acids, or to different regions of the same single-stranded
nucleic acid have a nucleotide base composition that allow the single-stranded regions
to hybridize together in a stable, double-stranded hydrogen-bonded region under stringent
hybridization or amplification conditions. When a contiguous sequence of nucleotides
of one single-stranded region is able to form a series of "canonical" hydrogen-bonded
base pairs with an analogous sequence of nucleotides of the other single-stranded
region, such that A is paired with U or T and C is paired with G, the nucleotides
sequences are "perfectly" complementary.
[0087] By "preferentially hybridize" is meant that under stringent hybridization conditions,
certain complementary nucleotides or nucleobase sequences hybridize to form a stable
hybrid preferentially over other, less stable duplexes.
14. Nucleic Acid "Identity"
[0088] In certain embodiments, a nucleic acid of the present invention comprises a contiguous
base region that is at least 80%, 90%, or 100% identical to a contiguous base region
of a reference nucleic acid. For short nucleic acids,
e.g., certain oligonucleotides of the present invention, the degree of identity between
a base region of a "query" nucleic acid and a base region of a reference nucleic acid
can be determined by manual alignment. "Identity" is determined by comparing just
the sequence of nitrogenous bases, irrespective of the sugar and backbone regions
of the nucleic acids being compared. Thus, the query:reference base sequence alignment
may be DNA:DNA, RNA:RNA, DNA:RNA, RNA:DNA, or any combinations or analogs thereof.
Equivalent RNA and DNA base sequences can be compared by converting U's (in RNA) to
T's (in DNA).
15. Target Nucleic Acid/Target Sequence
[0089] A "target nucleic acid" is a nucleic acid comprising a "target sequence" to be amplified.
Target nucleic acids may be DNA or RNA as described herein, and may be either single-stranded
or double-stranded. The target nucleic acid may include other sequences besides the
target sequence which may not be amplified. Typical target nucleic acids include virus
genomes, bacterial genomes, fungal genomes, plant genomes, animal genomes, rRNA, tRNA,
or mRNA from viruses, bacteria or eukaryotic cells, mitochondrial DNA, or chromosomal
DNA.
[0090] Target nucleic acids may be isolated from any number of sources based on the purpose
of the amplification assay being carried out. Sources of target nucleic acids include,
but are not limited to, clinical specimens,
e.g., blood, urine, saliva, feces, semen, or spinal fluid, from criminal evidence, from
environmental samples,
e.g., water or soil samples, from food, from industrial samples, from cDNA libraries,
or from total cellular RNA. By "isolated" it is meant that a sample containing a target
nucleic acid is taken from its natural milieu, but the term does not connote any degree
of purification. If necessary, target nucleic acids of the present invention are made
available for interaction with the various oligonucleotides of the present invention.
This may include, for example, cell lysis or cell permeabilization to release the
target nucleic acid from cells, which then may be followed by one or more purification
steps, such as a series of isolation and wash steps.
See, e.g., Clark
et al., "Method for Extracting Nucleic Acids from a Wide Range of Organisms,"
U.S. Patent No. 5,786,208, the contents of which are hereby incorporated by reference herein. This is particularly
important where the sample may contain components that can interfere with the amplification
reaction, such as, for example, heme present in a blood sample.
See Ryder
et al., "Amplification of Nucleic Acids from Mononuclear Cells Using Iron Complexing and
Other Agents,"
U.S. Patent No. 5,639,599, the contents of which are hereby incorporated by reference herein. Methods to prepare
target nucleic acids from various sources for amplification are well known to those
of ordinary skill in the art. Target nucleic acids of the present invention may be
purified to some degree prior to the amplification reactions described herein, but
in other cases, the sample is added to the amplification reaction without any further
manipulations.
[0091] The term "target sequence" refers to the particular nucleotide sequence of the target
nucleic acid which is to be amplified. The "target sequence" includes the complexing
sequences to which oligonucleotides (
e.g., priming oligonucleotides and/or promoter oligonucleotides) complex during the processes
of the present invention. Where the target nucleic acid is originally single-stranded,
the term "target sequence" will also refer to the sequence complementary to the "target
sequence" as present in the target nucleic acid. Where the "target nucleic acid" is
originally double-stranded, the term "target sequence" refers to both the sense (+)
and antisense (-) strands. In choosing a target sequence, the skilled artisan will
understand that a "unique" sequence should be chosen so as to distinguish between
unrelated or closely related target nucleic acids. As will be understood by those
of ordinary skill in the art, "unique" sequences are judged from the testing environment.
At least the sequences recognized by the detection probe (as described in more detail
elsewhere herein) should be unique in the environment being tested, but need not be
unique within the universe of all possible sequences. Furthermore, even though the
target sequence should contain a "unique" sequence for recognition by a detection
probe, it is not always the case that the priming oligonucleotide and/or promoter
oligonucleotide are recognizing "unique" sequences. In some embodiments, it may be
desirable to choose a target sequence which is common to a family of related organisms,
for example, a sequence which is common to all HIV strains that might be in a sample.
In other situations, a very highly specific target sequence, or a target sequence
having at least a highly specific region recognized by the detection probe, would
be chosen so as to distinguish between closely related organisms, for example, between
pathogenic and non-pathogenic E.
coli. A target sequence of the present invention may be of any practical length. A minimal
target sequence includes the region which hybridizes to the priming oligonucleotide
(or the complement thereof), the region which hybridizes to the hybridizing region
of the promoter oligonucleotide (or the complement thereof), and a region used for
detection,
e.g., a region which hybridizes to a detection probe, described in more detail elsewhere
herein. The region which hybridizes with the detection probe may overlap with or be
contained within the region which hybridizes with the priming oligonucleotide (or
its complement) or the hybridizing region of the promoter oligonucleotide (or its
complement). In addition to the minimal requirements, the optimal length of a target
sequence depends on a number of considerations, for example, the amount of secondary
structure, or self-hybridizing regions in the sequence. Determining the optimal length
is easily accomplished by those of ordinary skill in the art using routine optimization
methods. Typically, target sequences of the present invention range from about 100
nucleotides in length to from about 150 to about 250 nucleotides in length. The optimal
or preferred length may vary under different conditions, which can easily be tested
by one of ordinary skill in the art according to the methods described herein. The
term "amplicon" refers to the nucleic acid molecule generated during an amplification
procedure that is complementary or homologous to a sequence contained within the target
sequence.
16. Template
[0092] A "template" is a nucleic acid molecule that is being copied by a nucleic acid polymerase.
A template may be single-stranded, double-stranded or partially double-stranded, depending
on the polymerase. The synthesized copy is complementary to the template or to at
least one strand of a double-stranded or partially double-stranded template. Both
RNA and DNA are typically synthesized in the 5'-to-3' direction and the two strands
of a nucleic acid duplex are aligned so that the 5'-termini of the two strands are
at opposite ends of the duplex (and, by necessity, so then are the 3'-termini). While
according to the present invention, a "target sequence" is always a "template," templates
can also include secondary primer extension products and amplification products.
17. DNA-dependent DNA Polymerase
[0093] A "DNA-dependent DNA polymerase" is an enzyme that synthesizes a complementary DNA
copy from a DNA template. Examples are DNA polymerase I from E.
coli, bacteriophage T7 DNA polymerase, or DNA polymerases from bacteriophages T4, Phi-29,
M2, or T5. DNA-dependent DNA polymerases of the present invention may be the naturally
occurring enzymes isolated from bacteria or bacteriophages or expressed recombinantly,
or may be modified or "evolved" forms which have been engineered to possess certain
desirable characteristics,
e.g., thermostability, or the ability to recognize or synthesize a DNA strand from various
modified templates. All known DNA-dependent DNA polymerases require a complementary
primer to initiate synthesis. It is known that under suitable conditions a DNA-dependent
DNA polymerase may synthesize a complementary DNA copy from an RNA template. RNA-dependent
DNA polymerases (described below) typically also have DNA-dependent DNA polymerase
activity.
18. DNA-dependent RNA Polymerase (Transcriptase)
[0094] A "DNA-dependent RNA polymerase" or "transcriptase" is an enzyme that synthesizes
multiple RNA copies from a double-stranded or partially-double-stranded DNA molecule
having a promoter sequence that is usually double-stranded. The RNA molecules ("transcripts")
are synthesized in the 5'-to-3' direction beginning at a specific position just downstream
of the promoter. Examples of transcriptases are the DNA-dependent RNA polymerase from
E.
coli and bacteriophages T7, T3, and SP6.
19. RNA-dependent DNA polymerase (Reverse Transcriptase)
[0095] An "RNA-dependent DNA polymerase" or "reverse transcriptase" ("RT") is an enzyme
that synthesizes a complementary DNA copy from an RNA template. All known reverse
transcriptases also have the ability to make a complementary DNA copy from a DNA template;
thus, they are both RNA- and DNA-dependent DNA polymerases. RTs may also have an RNAse
H activity. Preferred is reverse transcriptase derived from Maloney murine leukemia
virus (MMLV-RT). A primer is required to initiate synthesis with both RNA and DNA
templates.
20. Selective RNAses
[0096] As used herein, a "selective RNAse" is an enzyme that degrades the RNA portion of
an RNA:DNA duplex but not single-stranded RNA, double-stranded RNA or DNA. An exemplary
selective RNAse is RNAse H. Enzymes other than RNAse H which possess the same or similar
activity are also contemplated in the present invention. Selective RNAses may be endonucleases
or exonucleases. Most reverse transcriptase enzymes contain an RNAse H activity in
addition to their polymerase activities. However, other sources of the RNAse H are
available without an associated polymerase activity. The degradation may result in
separation of RNA from a RNA:DNA complex. Alternatively, a selective RNAse may simply
cut the RNA at various locations such that portions of the RNA melt off or permit
enzymes to unwind portions of the RNA. Other enzymes which selectively degrade RNA
target sequences or RNA products of the present invention will be readily apparent
to those of ordinary skill in the art.
21. Sense/Antisense Strand(s)
[0097] Discussions of nucleic acid synthesis are greatly simplified and clarified by adopting
terms to name the two complementary strands of a nucleic acid duplex. Traditionally,
the strand encoding the sequences used to produce proteins or structural RNAs are
designated as the "sense (+)" strand and its complement the "antisense (-)" strand.
It is now known that in many cases, both strands are functional, and the assignment
of the designation "sense" to one and "antisense" to the other must then be arbitrary.
Nevertheless, the terms are very useful for designating the sequence orientation of
nucleic acids and will be employed herein for that purpose.
22. Specificity of the System
[0098] The term "specificity," in the context of an amplification system, is used herein
to refer to the characteristic of an amplification system which describes its ability
to distinguish between target and non-target sequences dependent on sequence and assay
conditions. In terms of a nucleic acid amplification, specificity generally refers
to the ratio of the number of specific amplicons produced to the number of side-products
(
i.e., the signal-to-noise ratio), described in more detail below.
23. Sensitivity
[0099] The term "sensitivity" is used herein to refer to the precision with which a nucleic
acid amplification reaction can be detected or quantitated. The sensitivity of an
amplification reaction is generally a measure of the smallest copy number of the target
nucleic acid that can be reliably detected in the amplification system, and will depend,
for example, on the detection assay being employed, and the specificity of the amplification
reaction,
i.e., the ratio of specific amplicons to side-products.
24. Amplification Conditions
[0100] By "amplification conditions" is meant conditions permitting nucleic acid amplification
according to the present invention. Amplification conditions may, in some embodiments,
be less stringent than "stringent hybridization conditions" as described herein. Oligonucleotides
used in the amplification reactions of the present invention hybridize to their intended
targets under amplification conditions, but may or may not hybridize under stringent
hybridization conditions. On the other hand, detection probes of the present invention
hybridize under stringent hybridization conditions. While the Examples section
infra provides preferred amplification conditions for amplifying target nucleic acid sequences
according to the present invention, other acceptable conditions to carry out nucleic
acid amplifications according to the present invention could be easily ascertained
by someone having ordinary skill in the art depending on the particular method of
amplification employed.
[0101] The present invention provides an autocatalytic amplification method which synthesizes
large numbers of RNA copies of an RNA or DNA target sequence with high specificity
and sensitivity. An important aspect of the present invention is the minimal production
of side-products during the amplification. Examples of side-products include oligonucleotide
dimers and self-replicating molecules. The target nucleic acid contains the target
sequence to be amplified. The target sequence is that region of the target nucleic
acid which is defined on either end by priming oligonucleotides, promoter oligonucleotides,
and, optionally, a binding molecule,
e.g., a terminating oligonucleotide or a modifying oligonucleotide (described in more
detail below), and/or the natural target nucleic acid termini, and includes both the
sense and antisense strands. Promoter oligonucleotides of the present invention are
modified to prevent the synthesis of DNA therefrom. Preferably, the promoter oligonucleotides
comprise a blocking moiety attached at their 3'-termini to prevent primer extension
in the presence of a polymerase. Indeed, according to the present invention, at least
about 80% of the oligonucleotides present in the amplification reaction which comprise
a promoter further comprise a 3'-blocking moiety. In further embodiments, at least
about 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the oligonucleotides provided to
the amplification reaction which comprise a promoter are further modified to comprise
a 3'-blocking moiety. In a specific embodiment, any oligonucleotide used in an amplification
reaction of the present invention which comprises a promoter sequence must further
comprise a 3'-terminus blocking moiety.
[0102] One embodiment of the present invention comprises amplification of a target nucleic
acid comprising an RNA target sequence. The target nucleic acid has indeterminate
3'- and 5'-ends relative to the desired RNA target sequence. The target nucleic acid
is treated with a priming oligonucleotide which has a base region sufficiently complementary
to a 3'-region of the RNA target sequence to hybridize therewith. Priming oligonucleotides
are designed to hybridize to a suitable region of any desired target sequence, according
to primer design methods well known to those of ordinary skill in the art. Suitable
priming oligonucleotides are described in more detail herein. While a priming oligonucleotide
of the present invention can optionally include a non-hybridizing base region situated
5' to the region which hybridizes with the target sequence, according to the present
invention the 5' region of a priming oligonucleotide does not include a promoter sequence
recognized by an RNA polymerase. Additionally, the 5'-end of the priming oligonucleotide
may include one or modifications which improve the binding properties (
e.g., hybridization or base stacking) of the priming oligonucleotide to a target sequence
or RNA amplification product, as discussed more fully infra, provided the modifications
do not substantially interfere with the priming function of the priming oligonucleotide
or cleavage of a template RNA to which the priming oligonucleotide is hybridized.
The 3'-end of the priming oligonucleotide is extended by an appropriate DNA polymerase,
e.g., an RNA- dependent DNA polymerase ("reverse transcriptase") in an extension reaction
using the RNA target sequence as a template to give a DNA primer extension product
which is complementary to the RNA template.
[0103] The DNA primer extension product is separated (at least partially) from the RNA template
using an enzyme which degrades the RNA template. Suitable enzymes, i.e., "selective
RNAses," are those which act on the RNA strand of an RNA:DNA complex, and include
enzymes which comprise an RNAse H activity. Some reverse transcriptases include an
RNAse H activity, including those derived from Moloney murine leukemia virus and avian
myeloblastosis virus. According to this method, the selective RNAse may be provided
as an RNAse H activity of a reverse transcriptase, or may be provided as a separate
enzyme,
e.g., as an
E.
coli RNAse H or a
T.
thermophilus RNAse H. Other enzymes which selectively degrade RNA present in an RNA:DNA duplex
may also be used.
[0104] In certain specific embodiments, the method of the present invention further comprises
treating the target nucleic acid as described above to limit the length of the DNA
primer extension product to a certain desired length. Such length limitation is typically
carried out through use of a "binding molecule" which hybridizes to or otherwise binds
to the RNA target nucleic acid adjacent to or near the 5'-end of the desired target
sequence. In certain embodiments, a binding molecule comprises a base region. The
base region may be DNA, RNA, a DNA:RNA chimeric molecule, or an analog thereof. Binding
molecules comprising a base region may be modified in one or more ways, as described
elsewhere herein. Suitable binding molecules include, but are not limited to, a binding
molecule comprising a terminating oligonucleotide or a terminating protein that binds
RNA and prevents primer extension past its binding region, or a binding molecule comprising
a modifying molecule, for example, a modifying oligonucleotide such as a "digestion"
oligonucleotide that directs hydrolysis of that portion of the RNA target hybridized
to the digestion oligonucleotide, or a sequence-specific nuclease that cuts the RNA
target.
[0105] A terminating oligonucleotide of the present invention has a 5'-base region sufficiently
complementary to the target nucleic acid at a region adjacent to, near to, or overlapping
with the 5'-end of the target sequence, to hybridize therewith. In certain embodiments,
a terminating oligonucleotide is synthesized to include one or more modified nucleotides.
For example, certain terminating oligonucleotides of the present invention comprise
one or more 2'-O-methyl ribonucleotides, or are synthesized entirely of 2'-O-methyl
ribonucleotides.
See, e.g.,
Majlessi et al. (1998) NucleicAcids Res., 26, 2224-2229. A terminating oligonucleotide of the present invention typically also comprises
a blocking moiety at its 3'-end to prevent the terminating oligonucleotide from functioning
as a primer for a DNA polymerase. In some embodiments, the 5'-end of a terminating
oligonucleotide of the present invention overlaps with and is complementary to at
least about 2 nucleotides of the 5'-end of the target sequence. Typically, the 5'-end
of a terminating oligonucleotide of the present invention overlaps with and is complementary
to at least 3, 4, 5, 6, 7, or 8 nucleotides of the 5'-end of the target sequence,
but no more than about 10 nucleotides of the 5'-end of the target sequence. (As used
herein, the term "end" refers to a 5'- or 3'-region of an oligonucleotide, nucleic
acid or nucleic acid region which includes, respectively, the 5'- or 3'-terminal base
of the oligonucleotide, nucleic acid or nucleic acid region.) Suitable terminating
oligonucleotides are described in more detail herein.
[0106] To the extent that a terminating oligonucleotide has a 5' base region which overlaps
with the target sequence, it may be desirable to introduce one or more base mismatches
into the 5'-end of the first region of a promoter oligonucleotide in order to minimize
or prevent hybridization of the terminating oligonucleotide to the promoter oligonucleotide,
as the formation of terminating oligonucleotide:promoter oligonucleotide hybrids may
negatively affect the rate of an amplification reaction. While one base mismatch in
the region of overlap generally should be sufficient, the exact number needed will
depend upon factors such as the length and base composition of the overlapping region,
as well as the conditions of the amplification reaction. Despite the possible benefits
of a modified promoter oligonucleotide, it should be noted that mutations in the first
region of the promoter oligonucleotide could render it a poorer template for amplification.
Moreover, it is entirely possible that in a given amplification system the formation
of terminating oligonucleotide:promoter oligonucleotide hybrids advantageously prevents
or interferes with the formation of priming oligonucleotide:promoter oligonucleotides
hybrids with a 3'-end available for primer extension.
See FIG. 5 (formation of primer-dependent side-products).
[0107] A modifying oligonucleotide provides a mechanism by which the 3'-terminus of the
primer extension product is determined. A modifying oligonucleotide may provide a
motif comprising one or more bases in the vicinity of the 5'-end of the RNA target
sequence which facilitates termination of primer extension by means of a modifying
enzyme, e.g., a nuclease. Alternatively, a modifying oligonucleotide might be tethered
to a specific modifying enzyme or to a chemical which can then terminate primer extension.
[0108] One specific modifying oligonucleotide is a digestion oligonucleotide. A digestion
oligonucleotide is comprised of DNA, preferably a stretch of at least about 6 deoxyribonucleotides.
The digestion oligonucleotide hybridizes to the RNA template and the RNA of the RNA:DNA
hybrid is digested by a selective RNAse as described herein, e.g., by an RNAse H activity.
[0109] The single-stranded DNA primer extension product, or "first" DNA primer extension
product, which has either a defined 3'-end or an indeterminate 3'-end, is then treated
with a promoter oligonucleotide which comprises a first region sufficiently complementary
to a 3'-region of the DNA primer extension product to hybridize therewith, a second
region comprising a promoter for an RNA polymerase, e.g., T7 polymerase, which is
situated 5' to the first region,
e.g., immediately 5' to or spaced from the first region, and modified to prevent the
promoter oligonucleotide from functioning as a primer for a DNA polymerase (
e.g., the promoter oligonucleotide includes a blocking moiety attached at its 3'-terminus).
Upon identifying a desired hybridizing "first region," suitable promoter oligonucleotides
can be constructed by one of ordinary skill in the art using only routine procedures.
Those of ordinary skill in the art will readily understand that a promoter region
has certain nucleotides which are required for recognition by a given RNA polymerase.
In addition, certain nucleotide variations in a promoter sequence might improve the
functioning of the promoter with a given enzyme, including the use of insertion sequences.
[0110] Insertion sequences are positioned between the first and second regions of promoter
oligonucleotides and function to increase amplification rates. The improved amplification
rates may be attributable to several factors. First, because an insertion sequence
increases the distance between the 3'-end and the promoter sequence of a promoter
oligonucleotide, it is less likely that a polymerase,
e.g., reverse transcriptase, bound at the 3'-end of the promoter oligonucleotide will
interfere with binding of the RNA polymerase to the promoter sequence, thereby increasing
the rate at which transcription can be initiated. Second, the insertion sequence selected
may itself improve the transcription rate by functioning as a better template for
transcription than the target sequence. Third, since the RNA polymerase will initiate
transcription at the insertion sequence, the primer extension product synthesized
by the priming oligonucleotide, using the RNA transcription product as a template,
will contain the complement of the insertion sequence toward the 3'-end of the primer
extension product. By providing a larger target binding region,
i.e., one which includes the complement of the insertion sequence, the promoter oligonucleotide
may bind to the primer extension product faster, thereby leading to the production
of additional RNA transcription products sooner. Insertion sequences are preferably
5 to 20 nucleotides in length and should be designed to minimize intramolecular folding
and intermolecular binding with other oligonucleotides present in the amplification
reaction mixture. Programs which aid in minimizing secondary structure are well known
in the art and include Michael Zucker's
mfold software for predicting RNA and DNA secondary structure using nearest neighbor thermodynamic
rules. The latest version of Michael Zucker's
mfold software can be accessed on the Web at www.bioinfo.rpi.edu/applications/mfold using
a hypertext transfer protocol (http) in the URL. Currently preferred insertion sequences
include the nucleotide sequences of SEQ ID Nos. 1 and 2 in combination with the T7
RNA polymerase promoter sequence of SEQ ID NO:3.
See Ikeda et al. (1992) J. Biol. Chem. 267, 2640-2649. Other useful insertion sequences may be identified using
in vitro selection methods well known in the art without engaging in anything more than routine
experimentation.
[0111] Assaying promoter oligonucleotides with variations in the promoter sequences is easily
carried out by the skilled artisan using routine methods. Furthermore, if it is desired
to utilize a different RNA polymerase, the promoter sequence in the promoter oligonucleotide
is easily substituted by a different promoter. Substituting different promoter sequences
is well within the understanding and capabilities of those of ordinary skill in the
art. It is important to note that according to the present invention, promoter oligonucleotides
provided to the amplification reaction mixture are modified to prevent the initiation
of DNA synthesis from their 3'-termini, and preferably comprise a blocking moiety
attached at their 3'-termini. Furthermore, terminating oligonucleotides and capping
oligonucleotides, and even probes used in the methods of the present invention also
optionally comprise a blocking moiety attached at their 3'-termini.
[0112] Where a terminating oligonucleotide is used, the first region of the promoter oligonucleotide
is designed to hybridize with a desired 3'-end of the DNA primer extension product
with substantial, but not necessarily exact, precision. Subsequently, the second region
of the promoter oligonucleotide may act as a template, allowing the first DNA primer
extension product to be further extended to add a base region complementary to the
second region of the promoter oligonucleotide,
i.e., the region comprising the promoter sequence, rendering the promoter double-stranded.
See FIG. 1A. An RNA polymerase which recognizes the promoter binds to the promoter sequence,
and initiates transcription of multiple RNA copies complementary to the DNA primer
extension product, which copies are substantially identical to the target sequence.
By "substantially identical" it is meant that the multiple RNA copies may have additional
nucleotides either 5' or 3' relative to the target sequence, or may have fewer nucleotides
either 5' or 3' relative to the target sequence, depending on, e.g., the boundaries
of "the target sequence," the transcription initiation point, or whether the priming
oligonucleotide comprises additional nucleotides 5' of the primer region (
e.g., a linked "cap" as described herein). Where a target sequence is DNA, the sequence
of the RNA copies is described herein as being "substantially identical" to the target
sequence. It is to be understood, however, that an RNA sequence which has uridine
residues in place of the thymidine residues of the DNA target sequence still has a
"substantially identical" sequence. The RNA transcripts so produced may automatically
recycle in the above system without further manipulation. Thus, this reaction is autocatalytic.
In those embodiments where a binding molecule or other means for terminating a primer
extension reaction is not used, the first region of the promoter oligonucleotide is
designed to hybridize with a selected region of the first DNA primer extension product
which is expected to be 5' to the 3'-terminus of the first DNA primer extension product,
but since the 3'-terminus of the first DNA primer extension product is indeterminate,
the region where the promoter oligonucleotide hybridizes probably will not be at the
actual 3'-end of the first DNA primer extension product. According to this embodiment,
it is generally the case that at least the 3'-terminal base of the first DNA primer
extension product does not hybridize to the promoter oligonucleotide.
See FIG 1B. Thus, according to this embodiment the first DNA primer extension product
will likely not be further extended to form a double-stranded promoter.
[0113] Surprisingly, the inventors discovered that the formation of a double-stranded promoter
sequence through extension of a template nucleic acid is not necessary to permit initiation
of transcription of RNA complementary to the first DNA primer extension product. The
resulting "first" RNA products are substantially identical to the target sequence,
having a 5'-end defined by the transcription initiation point, and a 3'-end defined
by the 5'-end of the first DNA primer extension product.
See FIG. 1B. As illustrated in FIG. 1B, a sufficient number of first RNA products are
produced to automatically recycle in the system without further manipulation. The
priming oligonucleotide hybridizes to the 3'-end of the first RNA products, and is
extended by a DNA polymerase to form a second DNA primer extension product. Unlike
the first DNA primer extension product formed without the use of a terminating oligonucleotide
or other binding molecule, the second DNA primer extension product has a defined 3'-end
which is complementary to the 5'-ends of the first RNA products.
See FIG 1B. The second DNA primer extension product is separated (at least partially)
from the RNA template using an enzyme which selectively degrades the RNA template.
The single-stranded second DNA primer extension product is then treated with a promoter
oligonucleotide as described above, and the second region of the promoter oligonucleotide
acts as a template, allowing the second DNA primer extension product to be further
extended to add a base region complementary to the second region of the promoter oligonucleotide,
i.e., the region comprising the promoter sequence, rendering the promoter double-stranded.
An RNA polymerase which recognizes the promoter binds to the promoter sequence, and
initiates transcription of multiple "second" RNA products complementary to the second
DNA primer extension product, and substantially identical to the target sequence.
The second RNA transcripts so produced automatically recycle in the above system without
further manipulation. Thus, this reaction is autocatalytic.
[0114] In another embodiment, the present invention is drawn to a method of synthesizing
multiple copies of a target sequence from a target nucleic acid comprising a DNA target
sequence. This embodiment is diagramed in FIG 1C. The target nucleic acid may be either
single-stranded, partially single-stranded, or double-stranded DNA. When the DNA is
double-stranded, it is denatured, or partially denatured, prior to amplification.
The DNA target nucleic acid need not have a defined 3'-end. The single-stranded, partially
single-stranded, or denatured DNA target nucleic acid is treated with a promoter oligonucleotide
as described above. The first region of the promoter oligonucleotide is designed to
hybridize with a selected region of the target nucleic acid in the 3'-region of the
desired target sequence, but since the 3'-end of the target nucleic acid need not
be coterminal with the 3'-end of the target sequence, the region where the promoter
oligonucleotide hybridizes will likely not be at or near the 3'-end of the target
nucleic acid sequence.
See FIG. 1C. Thus, the promoter region of the promoter oligonucleotide will likely remain
single-stranded.
[0115] As noted above, the inventors surprisingly discovered that it is not necessary for
the single-stranded promoter sequence on the promoter oligonucleotide to form a double-stranded
promoter through extension of a template nucleic acid in order for the promoter sequence
to be recognized by the corresponding RNA polymerase and, in this case, initiate transcription
of RNA complementary to the DNA target sequence. The resulting "first RNA products"
have a 5'-end defined by the transcription initiation point for the promoter, however,
the 3'-region will remain indeterminate.
See FIG 1C. These first RNA products are then treated with a priming oligonucleotide.
The priming oligonucleotide hybridizes to a region of the first RNA products at a
position complementary to a 5' region of the desired target sequence, and is extended
by a DNA polymerase to form a DNA primer extension product. This DNA primer extension
product has a 5'-end coinciding with the 5'-end of the priming oligonucleotide, and
a 3'-end coinciding with the 5'-end of the first RNA products.
See FIG. 1C. The DNA primer extension product is separated (at least partially) from
its RNA template using an enzyme which selectively degrades the RNA template, as described
above. The DNA primer extension product is then treated with the promoter oligonucleotide,
as described above, and the second region of the promoter oligonucleotide acts as
a template, allowing the DNA primer extension product to be further extended to add
a base region complementary to the second region of the promoter oligonucleotide,
i.e., the region comprising the promoter, rendering the promoter double-stranded.
An RNA polymerase which recognizes the promoter binds to the promoter sequence, and
initiates transcription of multiple RNA products complementary to the DNA primer extension
product. The sequence of these "second RNA products" is substantially complementary
to the desired target sequence. The RNA products so produced automatically recycle
in the above system without further manipulation. Thus, this reaction is autocatalytic.
[0116] The inventors also discovered that the rate of amplification could be enhanced by
providing an extender oligonucleotide to a reaction mixture, as diagramed in Figures
2A-2C. An extender oligonucleotide is generally 10 to 50 nucleotides in length and
hybridizes to a DNA template (
i.e., the DNA target sequence or any of the DNA primer extension products described herein)
downstream from a promoter oligonucleotide. When included, the 5'-terminal base of
the extender oligonucleotide is positioned near or adjacent to the 3'-terminal base
of the promoter oligonucleotide when both oligonucleotides are hybridized to a DNA
template. (By "adjacent to" is meant that the DNA template has no unbound bases situated
between the 3'-terminal base of the promoter oligonucleotide and the 5'-terminal base
of the extender oligonucleotide when both oligonucleotides are hybridized to the DNA
template.) Most preferably, the extender oligonucleotide hybridizes to a DNA template
such that the 5'-terminal base of the extender oligonucleotide is spaced no more than
three nucleotides from the 3'-terminal base of the promoter oligonucleotide relative
to the DNA template (
i.e., the DNA template has a maximum of three, contiguous unbound nucleotides situated
between the 3'-terminal base of the promoter oligonucleotide and the 5'-terminal base
of the extender oligonucleotide when both oligonucleotides are hybridized to the DNA
template). To prevent the extender oligonucleotide from functioning as a primer in
a primer extension reaction, the extender oligonucleotide preferably includes a 3'-terminal
blocking moiety. While not wishing to be bound by theory, it is believed that the
phosphate at the 3'-end of the extender oligonucleotide functions to draw the DNA-dependent
DNA polymerase (
e.g., reverse transcriptase) farther away from the promoter sequence of the promoter
oligonucleotide, thereby minimizing interference with the binding and progress of
the RNA polymerase in transcription. It is also possible that the extender oligonucleotide
facilitates faster trancription reactions by limiting secondary structure within the
target sequence.
[0117] In one aspect, the present invention relates to minimizing side-product formation
in nucleic acid amplification reactions. One type of side-product is referred to herein
as an "oligonucleotide dimer." This side-product occurs when a priming oligonucleotide
base-pairs non-specifically with another nucleic acid in the amplification reaction,
e.g., the promoter oligonucleotide. Since the priming oligonucleotide can be extended
via a DNA polymerase, a double-stranded form of the promoter oligonucleotide can result,
which can be transcribed into non-specific, amplifiable side-products. To prevent
priming oligonucleotides from participating in the formation of oligonucleotide dimers,
one option is to add a short complementary nucleotide "cap" to the 3'-end of the priming
oligonucleotide.
See Figures 6A and 6B. A cap is thought to reduce non-specific hybridization between
the priming oligonucleotide and other nucleic acids in the reaction, e.g., the promoter
oligonucleotide, thereby eliminating or substantially reducing the production of "oligonucleotide-dimer"
side-products as compared to amplification reactions carried out under identical conditions,
but without the use of a cap. As used herein, a cap comprises a base region complementary
to a region at the 3'-end of the priming oligonucleotide which is preferably pre-hybridized
to the priming oligonucleotide prior to its introduction into an amplification reaction
mixture. A suitable cap length will vary based on base content, stringency conditions,
etc., but will typically hybridize to up to 3, 6, 9,12,15,18, or 20 contiguous or
non-contiguous nucleotides at the '3-end of the priming oligonucleotide. Suitable
caps preferably range from 5 to 10 bases in length. The length of the complementary
cap region is dependent on several variables, for example, the melting temperature
of the double-stranded hybrid formed with the 3 '-end of the priming oligonucleotide.
In general, an efficient cap will specifically hybridize to a region at the 3'-end
of the priming oligonucleotide more strongly than any non-specific reactions with
other oligonucleotides present in the amplification reaction, but will be readily
displaced in favor of specific hybridization of the priming oligonucleotide with the
desired template. Exemplary caps comprise, or alternately consist essentially of,
or alternately consist of an oligonucleotide from 5 to 7 bases in length which hybridizes
to a region at the 3'-end of the priming oligonucleotide, such that the 5'-terminal
base of the cap hybridizes to the 3'-terminal base of the priming oligonucleotide.
Typically, a cap will hybridize to no more than 8, 9, or 10 nucleotides of a region
at the 3'-end of the priming oligonucleotide.
[0118] A cap may take the form of a capping oligonucleotide or a base region attached to
the 5'-end of the priming oligonucleotide, either directly or through a linker.
See Figures 6A and 6B. A capping oligonucleotide is synthesized as a separate oligonucleotide
from the priming oligonucleotide, and normally comprises a blocking moiety at its
3'-terminus to prevent primer extension by a DNA polymerase, as illustrated in FIG.
6A. Alternatively, the cap comprises a base region complementary to a region at the
3'-end of the priming oligonucleotide, which is connected to the 5'-end of the priming
oligonucleotide via a linking region comprising, alternately consisting essentially
of, or alternately consisting of 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides.
See FIG. 6B. Typically, the nucleotides in the linking region are abasic nucleotides.
By "abasic nucleotide" is meant a nucleotide comprising a phosphate group and a sugar
group, but not a base group. Constructing a priming oligonucleotide with a cap attached
to its 5'-end simplifies oligonucleotide synthesis by requiring the synthesis of only
a single oligonucleotide comprising both the priming portion and the cap.
[0119] In any of the embodiments described above, once a desired region for the target sequence
is identified, that region can be analyzed to determine where selective RNAse degradation
will optimally cause cuts or removal of sections of RNA from the RNA:DNA duplex. Analyses
can be conducted to determine the effect of the RNAse degradation of the target sequence
by RNAse H activity present in AMV reverse transcriptase or MMLV reverse transcriptase,
by an exogenously added selective enzyme with an RNAse activity,
e.g., E. coli RNAse H, or selective enzymes with an RNAse activity from other sources, and by combinations
thereof. Following such analyses, the priming oligonucleotide can be selected for
so that it will hybridize to a section of RNA which is substantially nondegraded by
the selective RNAse present in the reaction mixture, because substantial degradation
at the binding site for the priming oligonucleotide could inhibit initiation of DNA
synthesis and prevent optimal extension of the primer. In other words, a priming oligonucleotide
is typically selected to hybridize with a region of the RNA target nucleic acid or
the complement of the DNA target nucleic acid, located so that when the RNA is subjected
to selective RNAse degradation, there is no substantial degradation which would prevent
formation of the primer extension product.
[0120] Conversely, the site for hybridization of the promoter oligonucleotide may be chosen
so that sufficient degradation of the RNA strand occurs to permit efficient hybridization
of the promoter oligonucleotide to the DNA strand. Typically, only portions of RNA
are removed from the RNA:DNA duplex through selective RNAse degradation and, thus,
some parts of the RNA strand will remain in the duplex. Selective RNAse degradation
on the RNA strand of an RNA:DNA hybrid results in the dissociation of small pieces
of RNA from the hybrid. Positions at which RNA is selectively degraded may be determined
through standard hybridization analyses. Thus, a promoter oligonucleotide may be selected
which will more efficiently bind to the DNA after selective RNAse degradation, i.e.,
will bind at areas where RNA fragments are selectively removed.
[0121] Figures 1A-1C and 2A-2C do not show the RNA portions which may remain after selective
RNAse degradation. It is to be understood, however, that even though Figures 1A-1C
and 2A-2C show complete removal of RNA from the DNA:RNA duplex, under certain conditions
only partial removal actually occurs. Indeed, amplification as depicted in Figures
1A-1C and 2A-2C may be inhibited if a substantial portion of the RNA strand of an
RNA:DNA hybrid remains undegraded, thus preventing hybridization of the promoter oligonucleotide
and/or the optional extender oligonucleotide. However, based upon principles and methods
disclosed in this application, as well as those disclosed by Kacian
et al,
U.S. Patent No. 5,339,491, routine modifications can be made by those skilled in the art according to the teachings
of this invention to provide an effective and efficient procedure for amplification
of RNA.
[0122] In summary, the present invention provides methods for autocatalytically synthesizing
multiple copies of a target sequence from a target nucleic acid without repetitive
manipulation of reaction conditions such as temperature, ionic strength and pH, which
comprises combining into a reaction mixture a target nucleic acid which comprises
either an RNA target sequence, or a single-stranded or partially single-stranded DNA
target sequence or a double-stranded DNA sequence which has been rendered at least
partially single-stranded; a priming oligonucleotide, a promoter oligonucleotide,
and, optionally, an extender oligonucleotide and/or a binding molecule or other means
for terminating a primer extension reaction, all as described above; a reverse transcriptase
or an RNA-dependent DNA polymerase and a DNA-dependent DNA polymerase; an enzyme activity
which selectively degrades the RNA strand of an RNA:DNA complex (such as an RNAse
H activity); and an RNA polymerase which recognizes the promoter sequence in the promoter
oligonucleotide. The reaction mixture also includes the necessary building blocks
for nucleic acid amplification,
e.g., ribonucleotide triphosphates and/or deoxyribonucleotide triphosphates, buffers,
salts, and stabilizing agents. The components of the reaction mixture may be combined
stepwise or at once. The reaction mixture is incubated under conditions whereby an
oligonucleotide:target nucleic acid is formed, and DNA priming and nucleic acid synthesis
can occur for a period of time sufficient to allow multiple copies of the target sequence
or its complement to be produced. The reaction advantageously takes place under conditions
suitable for maintaining the stability of reaction components, such as the enzymes,
and without requiring modification or manipulation of reaction conditions during the
course of the amplification reaction. Accordingly, the reaction may take place under
conditions that are substantially isothermal and include substantially constant ionic
strength and pH.
[0123] As such, the amplification methods of the present invention do not require repeated
denaturation steps to separate the RNA:DNA complexes produced upon extension of the
priming oligonucleotide. A denaturation step would require manipulation of reaction
conditions, such as by substantially increasing the temperature of the reaction mixture
(generally from ambient temperature to a temperature between about 80°C and about
105°C), reducing its ionic strength (generally by 10X or more) or changing pH (usually
increasing pH to 10 or greater). Such manipulations of the reaction conditions often
deleteriously affect enzyme activities, requiring addition of additional enzyme and
also necessitate further manipulations of the reaction mixture to return it to conditions
suitable for further nucleic acid synthesis. In those embodiments where the target
nucleic acid is double-stranded DNA, an initial denaturation step is required. Denaturation
may be carried out by altering temperature, ionic strength, and/or pH as described
above, prior to adding the remaining components of the reaction mixture. Once the
remaining components are added, no additional manipulations of the reaction mixture
are needed.
[0124] The methods of the present invention are designed to decrease, diminish, or substantially
eliminate side-product formation in the amplification reactions. For example, side-products
are decreased, diminished, or substantially eliminated through the utilization of
promoter oligonucleotides modified to prevent primer extension by a DNA polymerase,
generally by including a blocking moiety at the 3'-termini of the promoter oligonucleotides.
Further embodiments decrease, diminish, or substantially eliminate side-products through
the use of a cap which hybridizes to a region at the 3'-end of the priming oligonucleotide,
thereby preventing oligonucleotide dimer formation. According to the present invention,
most,
e.g., at least about 90%, of the oligonucleotides present in the amplification reaction
which comprise a promoter further comprise a 3'-blocking moiety to prevent primer
extension. In a specific embodiment, any oligonucleotide used in the amplification
reaction which comprises a promoter, not just the promoter oligonucleotide, further
comprises a 3'-blocking moiety. In certain preferred embodiments, most,
e.g., at least about 80%, 90%, 95%, 96%, 97%, 98% or 99%, or all oligonucleotides required
for the amplification reaction, other than the priming oligonucleotide, comprise a
3'-blocking moiety. Thus, in certain embodiments, most if not all DNA polymerase activity
in the amplification reactions is limited to the formation of DNA primer extension
products which comprise the priming oligonucleotide.
[0125] Promoters or promoter sequences suitable for incorporation in promoter oligonucleotides
used in the methods of the present invention are nucleic acid sequences (either naturally
occurring, produced synthetically or a product of a restriction digest) that are specifically
recognized by an RNA polymerase that recognizes and binds to that sequence and initiates
the process of transcription, whereby RNA transcripts are produced. Typical, known
and useful promoters include those which are recognized by certain bacteriophage polymerases,
such as those from bacteriophage T3, T7, and SP6, and a promoter from
E. coli. The sequence may optionally include nucleotide bases extending beyond the actual
recognition site for the RNA polymerase which may impart added stability or susceptibility
to degradation processes or increased transcription efficiency. Promoter sequences
for which there is a known and available polymerase that is capable of recognizing
the initiation sequence are particularly suitable to be employed.
[0126] Suitable DNA polymerases include reverse transcriptases. Particularly suitable DNA
polymerases include AMV reverse transcriptase and MMLV reverse transcriptase. Some
of the reverse transcriptases suitable for use in the methods of the present invention,
such as AMV and MMLV reverse transcriptases, have an RNAse H activity. Indeed, according
to certain embodiments of the present invention, the only selective RNAse activity
in the amplification reaction is provided by the reverse transcriptase -- no additional
selective RNAse is added. However, in some situations it may also be useful to add
an exogenous selective RNAse, such as
E. coli RNAse H. Although the addition of an exogenous selective RNAse is not required, under
certain conditions, the RNAse H activity present in,
e.g., AMV reverse transcriptase may be inhibited or inactivated by other components present
in the reaction mixture. In such situations, addition of an exogenous selective RNAse
may be desirable. For example, where relatively large amounts of heterologous DNA
are present in the reaction mixture, the native RNAse H activity of the AMV reverse
transcriptase may be somewhat inhibited and thus the number of copies of the target
sequence produced accordingly reduced. In situations where the target nucleic acid
comprises only a small portion of the nucleic acid present (
e.g., where the sample contains significant amounts of heterologous DNA and/or RNA), it
is particularly useful to add an exogenous selective RNAse.
See, e.g., Kacian
et al,
U.S. Patent No. 5,399,491, the contents of which are hereby incorporated by reference herein (
see Example 8).
[0127] RNA amplification products produced by the methods described above may serve as templates
to produce additional amplification products related to the target sequence through
the above-described mechanisms. The system is autocatalytic and amplification by the
methods of the present invention occurs without the need for repeatedly modifying
or changing reaction conditions such as temperature, pH, ionic strength and the like.
These methods do not require an expensive thermal cycling apparatus, nor do they require
several additions of enzymes or other reagents during the course of an amplification
reaction.
[0128] The methods of the present invention are useful in assays for detecting and/or quantitating
specific nucleic acid target sequences in clinical, environmental, forensic, and similar
samples or to produce large numbers of RNA amplification products from a specific
target sequence for a variety of uses. For example, the present invention is useful
to screen clinical samples (
e.g., blood, urine, feces, saliva, semen, or spinal fluid), food, water, laboratory and/or
industrial samples for the presence of specific nucleic acids. The present invention
can be used to detect the presence of, for example, viruses, bacteria, fungi, or parasites.
The present invention is also useful for the detection of human, animal, or plant
nucleic acids for genetic screening, or in criminal investigations, archeological
or sociological studies.
[0129] In a typical assay, a sample containing a target nucleic acid to be amplified is
mixed with a buffer concentrate containing the buffer, salts, magnesium, triphosphates,
oligonucleotides,
e.g., a priming oligonucleotide, a promoter oligonucleotide, and, optionally, an extender
oligonucleotide and/or a binding molecule,
e.g., a terminating oligonucleotide or a digestion oligonucleotide, and/or a capping oligonucleotide,
and other reagents. The reaction may optionally be incubated at a temperature,
e.g., 60-100°C, for a period of time sufficient to denature any secondary structures in
the target nucleic acid or to denature a double-stranded DNA target nucleic acid.
After cooling, reverse transcriptase, an RNA polymerase, and, if desired, a separate
selective RNAse,
e.g., RNAse H, are added and the reaction is incubated for a specified amount of time,
e.g., from about 10 minutes to about 120 minutes, at an optimal temperature,
e.g., from about 20 °C to about 55°C, or more, depending on the reagents and other reaction
conditions.
[0130] The amplification product can be detected by hybridization with a detectably labeled
probe and measurement of the resulting hybrids can be performed in any conventional
manner. Design criteria in selecting probes for detecting particular target sequences
are well known in the art and are described in, for example, Hogan
et al., "Methods for Making Oligonucleotide Probes for the Detection and/or Quantitation
of Non-Viral Organisms,"
U.S. Patent No. 6,150,517, the contents of which are hereby incorporated by reference herein. Hogan teaches
that probes should be designed to maximize homology for the target sequence(s) and
minimize homology for possible non-target sequences. To minimize stability with non-target
sequences, Hogan instructs that guanine and cytosine rich regions should be avoided,
that the probe should span as many destabilizing mismatches as possible, and that
the length of perfect complementarity to a non-target sequence should be minimized.
Contrariwise, stability of the probe with the target sequence(s) should be maximized,
adenine and thymine rich regions should be avoided, probe:target hybrids are preferably
terminated with guanine and cytosine base pairs, extensive self-complementarity is
generally to be avoided, and the melting temperature of probe:target hybrids should
be about 2-10°C higher than the assay temperature.
[0131] In particular, the amplification product can be assayed by the Hybridization Protection
Assay ("HPA"), which involves hybridizing a chemiluminescent oligonucleotide probe
to the target sequence,
e.g., an acridinium ester-labeled ("AE") probe, selectively hydrolyzing the chemiluminescent
label present on unhybridized probe, and measuring the chemiluminescence produced
from the remaining probe in a luminometer.
See, e.g., Arnold
et al., "Homogenous Protection Assay,"
U.S. Patent No. 5,283,174 and NORMAN C. NELSON ET AL., NONISOTOPIC PROBING, BLOTTING, AND SEQUENCING, ch. 17
(Larry J. Kricka ed., 2d ed. 1995), each of which is hereby incorporated by reference
in its entirety. Particular methods of carrying out HPA using AE probes are disclosed
in the Examples section hereinbelow.
[0132] In further embodiments, the present invention provides quantitative evaluation of
the amplification process in real-time by methods described herein. Evaluation of
an amplification process in "real-time" involves determining the amount of amplicon
in the reaction mixture either continuously or periodically during the amplification
reaction, and the determined values are used to calculate the amount of target sequence
initially present in the sample. There are a variety of methods for determining the
amount of initial target sequence present in a sample based on real-time amplification.
These include those disclosed by Wittwer
et al., "Method for Quantification of an Analyte,"
U.S. Patent No. 6, 303,305, and Yokoyama
et al., "Method for Assaying Nucleic Acid,"
U.S. Patent No. 6,541,205, each of which is hereby incorporated by reference herein in its entirety. Another
method for determining the quantity of target sequence initially present in a sample,
but which is not based on a real-time amplification, is disclosed by Ryder
et al., "Method for Determining Pre-Amplification Levels of a Nucleic Acid Target Sequence
from Post-Amplification Levels of Product,"
U.S. Patent No. 5,710,029, the contents of which are hereby incorporated by reference herein. The present invention
is particularly suited to real-time evaluation, because the production of side-products
is decreased, diminished, or substantially eliminated.
[0133] Amplification products may be detected in real-time through the use of various self-hybridizing
probes, most of which have a stem-loop structure. Such self-hybridizing probes are
labeled so that they emit differently detectable signals, depending on whether the
probes are in a self-hybridized state or an altered state through hybridization to
a target sequence. By way of example, "molecular torches" are a type of self-hybridizing
probe which includes distinct regions of self-complementarity (referred to as "the
target binding domain" and "the target closing domain") which are connected by a joining
region (
e.g., non-nucleotide linker) and which hybridize to each other under predetermined hybridization
assay conditions. In a preferred embodiment, molecular torches contain single-stranded
base regions in the target binding domain that are from 1 to about 10 bases in length
and are accessible for hybridization to a target sequence present in an amplification
product under strand displacement conditions. The single-stranded region may be, for
example, a terminal region or an internal region, such as a loop region. Alternatively,
the strand displacement conditions may cause "breathing" in a double-stranded terminal
region of the molecular torch, thereby resulting in a transient single-stranded region
of the terminal region which is accessible for hybridization to the target sequence.
Under strand displacement conditions, hybridization of the two complementary regions
(which may be fully or partially complementary) of the molecular torch is favored,
except in the presence of the target sequence, which will bind to the single-stranded
region present in the target binding domain and displace all or a portion of the target
closing domain. The target binding domain and the target closing domain of a molecular
torch include a detectable label or a pair of interacting labels (
e.g., luminescent/quencher) positioned so that a different signal is produced when the
molecular torch is self-hybridized than when the molecular torch is hybridized to
the target sequence, thereby permitting detection of probe:target duplexes in a test
sample in the presence of unhybridized molecular torches. Molecular torches and a
variety of types of interacting label pairs are disclosed by Becker
et al., "Molecular Torches,"
U.S. Patent No. 6,534,274, the contents of which are hereby incorporated by reference herein.
[0134] Another example of a detection probe having self-complementarity is a "molecular
beacon." Molecular beacons include nucleic acid molecules having a target complement
sequence, an affinity pair (or nucleic acid arms) holding the probe in a closed conformation
in the absence of a target sequence present in an amplification product, and a label
pair that interacts when the probe is in a closed conformation. Hybridization of the
target sequence and the target complement sequence separates the members of the affinity
pair, thereby shifting the probe to an open conformation. The shift to the open conformation
is detectable due to reduced interaction of the label pair, which may be, for example,
a fluorophore and a quencher (
e.g., DABCYL and EDANS). Molecular beacons are disclosed by Tyagi
et al., "Detectably Labeled Dual Confirmation Oligonucleotide Probes, Assays and Kits,"
U.S. Patent No. 5,925,517, and Tyagi
et al., "Nucleic Acid Detection Probes Having Non-FRET Fluorescence Quenching and Kits and
Assays Including Such Probes,"
U.S. Patent No. 6,150,097, each of which is hereby incorporated by reference herein in its entirety.
[0135] Other self-hybridizing probes for use in the present invention are well known to
those of ordinary skill in the art. By way of example, probe binding pairs having
interacting labels, such as those disclosed by Morrison, "Competitive Homogenous Assay,"
U.S. Patent No. 5,928,862 (the contents of which are hereby incorporated by reference herein), might be adapted
for use in the present invention. Probe systems used to detect single nucleotide polymorphisms
(snps) might also be utilized in the present invention. Additional detection systems
include "molecular switches," as disclosed by Arnold
et al., "Oligonucleotides Comprising a MolecularSwitch,"
U.S. Provisional Application No. 60/467,517, which enjoys common ownership with the present application and is hereby incorporated
by reference herein in its entirety. And other probes, such as those comprising intercalating
dyes and/or fluorochromes, might be useful for detection of amplification products
in the present invention. See,
e.g., Ishiguro
et al., "Method of Detecting Specific Nucleic Acid Sequences,"
U.S. Patent No. 5,814,447, the contents of which are hereby incorporated by reference herein.
[0136] In those methods of the present invention where the initial target sequence and the
RNA transcription product share the same sense, it may be desirable to initiate amplification
before adding probe for real-time detection. Adding probe prior to initiating an amplification
reaction may slow the rate of amplification since probe which binds to the initial
target sequence has to be displaced or otherwise remove during the primer extension
step to complete a primer extension product having the complement of the target sequence.
The initiation of amplification is judged by the addition of amplification enzymes
(
e.g., a reverse transcriptase and an RNA polymerase).
[0137] In addition to the methods described herein, the present invention is drawn to kits
comprising one or more of the reagents required for carrying out the methods of the
present invention. Kits comprising various components used in carrying out the present
invention may be configured for use in any procedure requiring amplification of nucleic
acid target molecules, and such kits can be customized for various different end-users.
Suitable kits may be prepared, for example, for blood screening, disease diagnosis,
environmental analysis, criminal investigations or other forensic analyses, genetic
analyses, archeological or sociological analyses, or for general laboratory use. Kits
of the present invention provide one or more of the components necessary to carry
out nucleic acid amplifications according to the invention. Kits may include reagents
suitable for amplifying nucleic acids from one particular target or may include reagents
suitable for amplifying multiple targets. Kits of the present invention may further
provide reagents for real-time detection of one or more nucleic acid targets in a
single sample, for example, one or more self-hybridizing probes as described above.
Kits may comprise a carrier that may be compartmentalized to receive in close confinement
one or more containers such as vials, test tubes, wells, and the like. Preferably
at least one of such containers contains one or more components or a mixture of components
needed to perform the amplification methods of the present invention.
[0138] A kit according to the present invention can include, for example, in one or more
containers, a priming oligonucleotide, a promoter oligonucleotide modified to prevent
primer extension by a DNA polymerase (
e.g., modified to include a 3'-blocking moiety), a binding molecule or other means for
terminating a primer extension reaction, and, optionally, an extender oligonucleotide
and/or a capping oligonucleotide as described herein. If real-time detection is used,
the one or more containers may include one or more reagents for real-time detection
of at least one nucleic acid target sequence in a single sample, for example, one
or more self-hybridizing probes as described above. Another container may contain
an enzyme reagent, for example a mixture of a reverse transcriptase (either with or
without RNAse H activity), an RNA polymerase, and optionally an additional selective
RNAse enzyme. These enzymes may be provided in concentrated form or at working concentration,
usually in a form which promotes enzyme stability. The enzyme reagent may also be
provided in a lyophilized form.
See Shen
et al., "Stabilized Enzyme Compositions for Nucleic Acid Amplification,"
U.S. Patent No. 5,834,254, the contents of which are hereby incorporated by reference herein. Another one or
more containers may contain an amplification reagent in concentrated form,
e.g., 10X, 50X, or 100X, or at working concentration. An amplification reagent will contain
one or more of the components necessary to run the amplification reaction,
e.g., a buffer, MgCl
2, KCl, dNTPs, rNTPs, EDTA, stabilizing agents,
etc. Certain of the components,
e.g., MgCl
2 and rNTPs, may be provided separately from the remaining components, allowing the
end user to titrate these reagents to achieve more optimized amplification reactions.
Another one or more containers may include reagents for detection of amplification
products, including one or more labeled oligonucleotide probes. Probes may be labeled
in a number of alternative ways,
e.g., with radioactive isotopes, fluorescent labels, chemiluminescent labels, nuclear
tags, bioluminescent labels, intercalating dyes, or enzyme labels. In some embodiments,
a kit of the present invention will also include one or more containers containing
one or more positive and negative control target nucleic acids which can be utilized
in amplification experiments in order to validate the test amplifications carried
out by the end user. In some instances, one or more of the reagents listed above may
be combined with an internal control. Of course, it is also possible to combine one
or more of these reagents in a single tube or other containers.
[0139] Supports suitable for use with the invention,
e.g., test tubes, multi-tube units, multi-well plates, etc., may also be supplied with
kits of the invention. Finally a kit of the present invention may include one or more
instruction manuals. Kits of the invention may contain virtually any combination of
the components set out above or described elsewhere herein. As one skilled in the
art would recognize, the components supplied with kits of the invention will vary
with the intended use for the kits, and the intended end user. Thus, kits may be specifically
designed to perform various functions set out in this application and the components
of such kits will vary accordingly.
[0140] The present invention is also directed to oligonucleotides useful as priming oligonucleotides,
promoter oligonucleotides, or terminating oligonucleotides.
[0141] The present invention is further drawn to various oligonucleotides, including the
priming oligonucleotides, promoter oligonucleotides, terminating oligonucleotides,
capping oligonucleotides and probes described herein. It is to be understood that
oligonucleotides of the present invention may be DNA, RNA, DNA:RNA chimerics and analogs
thereof, and, in any case, the present invention includes RNA equivalents of DNA oligonucleotides
and DNA equivalents of RNA oligonucleotides. Except for the preferred priming oligonucleotides
and probes described below, the oligonucleotides described in the following paragraphs
preferably comprise a blocking moiety at their 3'-termini.
[0142] Detection probes of the present invention may include, for example, an acridinium
ester label, or labeled, self-hybridizing regions flanking the sequence which hybridizes
to the target sequence. In various embodiments, these labeled oligonucleotide probes
optionally or preferably are synthesized to include at least one modified nucleotide,
e.g., a 2'-O-methyl ribonucleotide; or these labeled oligonucleotide probes optionally
or preferably are synthesized entirely of modified nucleotides,
e.g., 2'-O-methyl ribonucleotides.
[0143] It will be understood by one of ordinary skill in the relevant arts that other suitable
modifications and adaptations to the methods and compositions described herein are
readily apparent from the description of the invention contained herein in view of
information known to the ordinarily skilled artisan, and may be made without departing
from the scope of the invention or any embodiment thereof. Having now described the
present invention in detail, the same will be more clearly understood by reference
to the following examples, which are included herewith for purposes of illustration
only and are not intended to be limiting of the invention.
EXAMPLES
[0144] Examples are provided below illustrating different aspects and embodiments of the
invention. It is believed that these examples accurately reflect the details of experiments
actually performed, however, it is possible that some minor discrepancies may exist
between the work actually performed and the experimental details set forth below which
do not affect the conclusions of these experiments. Skilled artisans will appreciate
that these examples are not intended to limit the invention to the specific embodiments
described therein. Additionally, those skilled in the art, using the techniques, materials
and methods described herein, could easily devise and optimize alternative amplification
systems for detecting and/or quantifying any target sequence.
[0145] The practice of the present invention will employ, unless otherwise indicated, conventional
techniques of molecular biology, recombinant DNA, and chemistry, which are within
the skill of the art. Such techniques are explained fully in the literature.
See, for example,
Molecular Cloning A Laboratory Manual, 2nd Ed., Sambrook et al., ed., Cold Spring
Harbor Laboratory Press: (1989);
DNA Cloning, Volumes I and II (D. N. Glover ed., 1985);
Oligonucleotide Synthesis (M. J. Gaited., 1984); Mullis
et al.
U.S. Pat. No: 4,683,195;
Nucleic Acid Hybridization (B. D. Hames & S. J. Higgins eds. 1984);
B. Perbal, A Practical Guide To Molecular Cloning (1984); the treatise,
Methods In Enzymology (Academic Press, Inc., N.Y); and in
Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore,
Maryland (1989).
[0146] Unless otherwise indicated, oligonucleotides and modified oligonucleotides in the
following examples were synthesized using standard phosphoramidite chemistry, various
methods of which are well known in the art. See
e.g.,
Carruthers, et al., 154 Methods in Enzymology, 287 (1987), the contents of which are hereby incorporated by reference herein. Unless otherwise
stated herein, modified nucleotides were 2'-O-methyl ribonucleotides, which were used
in the synthesis as their phosphoramidite analogs. Applicant prepared the oligonucleotides
using an Expedite
™ 8909 DNA Synthesizer (PerSeptive Biosystems, Framingham, Mass.).
[0147] Various reagents are identified in the examples below, which include an amplification
reagent, an enzyme reagent, a hybridization reagent, a selection reagent, and detection
reagents. The formulations and pH values (where relevant) of these reagents were as
follows.
[0148] Amplification Reagent. The "Amplification Reagent" comprised 11.6 mMTrizma
® base buffer, 15 mM Trizma
® hydrochloride buffer, 22.7 mM MgCl
2, 23.3 mM KCl
2, 3.33% (v/v) glycerol, 0.05 mM zinc acetate, 0.665 mM dATP, 0.665 mM dCTP, 0.665
mM dGTP, 0.665 mM dTTP, 0.02% (v/v) ProClin 300 Preservative (Supelco, Bellefonte,
PA; Cat. No. 48126), 5.32 mM ATP, 5.32 mM CTP, 5.32 mM GTP, 5.32 mM UTP, and 6 M HCl
to pH 7.81 to 8.0 at 22 °C.
[0149] Enzyme Reagent. The "Enzyme Reagent" comprised 70 mM N-acetyl-L-cysteine, 10% (v/v) TRITON
® X-102 detergent, 16 mM HEPES, 3 mM EDTA, 0.05% (w/v) sodium azide, 20 mM Trizma
® base buffer, 50 mM KCl
2, 20% (v/v) glycerol, 150 mM trehalose, 4M NaOH to pH 7, and containing 224 RTU/µL
Moloney murine leukemia virus ("MMLV") reverse transcriptase and 140 U/µL T7 RNA polymerase,
where one unit (
i.e., RTU or U) of activity is defined as the synthesis and release of 5.75 fmol cDNA
in 15 minutes at 37 °C for MMLV reverse transcriptase, and the production of 5.0 fmol
RNA transcript in 20 minutes at 37 °C for T7 RNA polymerase.
[0150] Hybridization Reagent. The "Hybridization Reagent" comprised 100 mM succinic acid, 2% (w/v) lithium lauryl
sulfate, 230 mM LiOH, 15 mM aldrithiol-2,1.2 M LiCl, 20 mM EDTA, 20 mM EGTA, 3.0%
(v/v) ethyl alcohol, and 2M LiOH to pH 4.7.
[0151] Selection Reagent. The "Selection Reagent" comprised 600 mM H
3BO
3, 182 mM NaOH, 1% (v/v) TRITON
® X-100 detergent, and 4 M NaOH to pH 8.5.
[0152] Detection Reagent I. "Detection Reagent
I' comprised 1 mM HNO
3 and 30 mM H
2O
2.
[0153] Detection Reagent II. "Detection Reagent II" comprised 1 M NaOH and 2% (w/v) Zwittergent
® 3-14 detergent.
[0154] Oil Reagent: The "Oil Reagent" comprised a silicone oil (United Chemical Technologies, Inc., Bristol,
PA; Cat. No. PS038).
Example 1
Comparison of Blocked and Unblocked Promoter Oligonucleotides
[0155] This experiment was conducted to evaluate the specificity of an amplification method
according to the present invention in which a region ("the target region") of a cloned
transcript derived from the 5' untranslated region of the hepatitis C virus ("the
transcript") was targeted for amplification. For this experiment we prepared two sets
of priming and promoter oligonucleotides having identical base sequences. The two
sets of oligonucleotides differed by the presence or absence of a 3'-terminal blocking
moiety on the promoter oligonucleotide. The promoter oligonucleotide in each set targeted
the complement of a sequence contained within the 5'-end of the target region and
had the base sequence of SEQ ID NO:5
aatttaatacgactcactatagggagactagccatg gcgttagtatgagtgtcgtgcag, where the underlined portion of the promoter oligonucleotide
constitutes a T7 promoter sequence (SEQ ID NO:3) and the non-underlined portion represents
a hybridizing sequence (SEQ ID NO:4). The priming oligonucleotide in each set targeted
a sequence contained within the 3'-end of the target region and had the base sequence
of SEQ ID NO:6. Also included in the amplification method was a terminating oligonucleotide
made up of 2'-O-methyl ribonucleotides having the base sequence of SEQ ID NO:33 ggcuagacgcuuucugcgugaaga.
The terminating oligonucleotide had a 3'-terminal blocking moiety and targeted a region
of the transcript just 5' to the target region. The 5'-ends of the terminating oligonucleotide
and of the hybridizing sequence of the promoter oligonucleotide overlapped by six
bases. The 3'-terminal blocking moiety of both the promoter oligonucleotide and the
terminating oligonucleotide consisted of a 3'-to-3' linkage prepared using 3'-dimethyltrityl-N-benzoyl-2'-deoxycytidine,
5'-succinoyl-long chain alkylamino-CPG (Glen Research Corporation, Sterling, VA; Cat.
No. 20-0102-01).
[0156] For amplification, 75 µL of the Amplification Reagent was added to each of eight
reaction tubes. The Amplification Reagent was then combined with 30 pmol of a promoter
oligonucleotide, 30 pmol of the priming oligonucleotide and 5 pmol of the terminating
oligonucleotide. One set of four of the tubes was provided with 30 pmol of the unblocked
promoter oligonucleotide (group I), and another set of four tubes was provided with
30 pmol of the blocked promoter oligonucleotide (group II). Next, 1 µL of a 0.1 %
(w/v) lithium lauryl sulfate ("LLS") buffer containing 1000 copies/µL of the transcript
was added to two of the tubes in each group, while the remaining two tubes in each
group served as negative controls. The reaction mixtures were overlaid with 200 µL
of the Oil Reagent, and the tubes were then sealed and hand-shaken horizontally for
5 to 10 seconds before the tubes were incubated in a 60°C water bath for 10 minutes.
The tubes were then transferred to a 41.5 °C water bath and incubated for 15 minutes
before adding 25 µL of the Enzyme Reagent to each tube. After adding the Enzyme Reagent,
the tubes were sealed, removed from the water bath and hand-shaken horizontally for
5 to 10 seconds to fully mix the components of the reaction mixtures. The tubes were
returned to the 41.5°C water bath and incubated for an additional 60 minutes to facilitate
amplification of the target region in the presence of MMLV reverse transcriptase and
T7 RNA polymerase. Following amplification, the tubes were removed from the 41.5°C
water bath and allowed to cool at room temperature for 10 to 15 minutes.
[0157] A 5 µL aliquot of each reaction mixture was taken from the tubes, diluted 1:1 with
a 2X Novex
® TBE-Urea Sample Buffer (Invitrogen Corporation, Carlsbad, CA; Cat. No. LC6876), and
loaded onto a Novex
® TBE-Urea Denaturing Gel (Invitrogen; Cat. No. EC6865BOX). The gel was held by an
Xcell Surelock
™ Mini-Cell (Invitrogen; Cat. No. EI0001) and run at 180 volts for 50 minutes using
a 5X Novex
® TBE Running Buffer (Invitrogen; Cat. No. LC6675) diluted 1:4 with deionized water.
Afterwards, the gel was stained with 0.5 µg/mL of ethidium bromide in a 1X TBE (Tris-Borate-EDTA)
solution, visualized on a FisherBiotech
® Ultraviolet Transilluminator (Fisher Scientific International Inc., Hampton, NH;
Model No. FB-TIV-816A), and photographed with a handheld camera using Polaroid 667
film.
[0158] The results of this experiment are illustrated in the photographed gel of FIG. 3.
Each number above the pictured gel represents a distinct lane, where lane 1 is an
RNA ladder of 100, 200, 300, 400, 500, 750 and 1000 base oligonucleotides, and the
remainder of the lanes correspond to the following reaction mixtures: (i) lanes 2
and 3 correspond to the transcript-containing replicates of group I (unblocked promoter
oligonucleotide); (ii) lanes 4 and 5 correspond to the transcript-containing replicates
of group II (blocked promoter oligonucleotide); (iii) lanes 6 and 7 correspond to
the transcript-negative replicates of group I; and (iv) lanes 8 and 9 correspond to
the transcript-negative replicates of group II. The first visible band in lanes 2-5
constitutes amplicon derived from amplification of the target region. The remainder
of the bands in lanes 2, 3, 6 and 7 constitute non-specific amplification products.
Thus, the results indicate that only amplification using the fully blocked promoter
oligonucleotides was specific, as there was no visible side-product formation in either
the transcript-containing or transcript negative reaction mixtures containing blocked
promoter oligonucleotides, whereas visible side-products were formed in both the transcript-containing
and transcript-negative reaction mixtures containing unblocked promoter oligonucleotides.
Example 2
Reduction in the Formation of Replicating Molecules
[0159] This experiment was designed to evaluate whether the use of a blocked promoter oligonucleotide
in an amplification method of the present invention would lead to a reduction in the
formation of replicating molecules over a standard transcription-based amplification
procedure. Replicating molecules are generally believed to form when the 3'-end of
a promoter oligonucleotide forms a hairpin structure and is extended in the presence
of a polymerase, thereby forming a double-stranded promoter sequence. Transcription
initiated from the double-stranded promoter sequence results in the formation of amplicon
containing an antisense version of the promoter sequence.
[0160] In this experiment, we compared the production of replicating molecules in amplification
reactions containing promoter oligonucleotides that were either blocked or unblocked
at their 3'-terminal ends in the presence or absence of purified rRNA from
Mycobacterium tuberculosis (ATCC No. 25177) using one of two detection probes targeting a region ("the target
region") of the 16S rRNA of
Mycobacterium tuberculosis ("the target nucleic acid"). The blocked and unblocked promoter oligonucleotides
targeted sequences contained within the complement of the 5'-end of the target region.
The blocked promoter oligonucleotide had the base sequence of SEQ ID NO:26
aattctaatacgactcactatagggagaactgggtctaataccggataggaccacgggatgcat, and the unblocked promoter oligonucleotide had
the base sequence of SEQ ID NO:28
aattctaatacgactcactatagggagaactgggtctaat accggataggaccacggga, where the underlined portion of each promoter oligonucleotide
constitutes a T7 promoter sequence (SEQ ID NO:3) and the non-underlined portion represents
a hybridizing sequence (SEQ ID NO:25 and SEQ ID NO:27). The priming oligonucleotide
targeted a sequence contained within the 3'-end of the target region and had the base
sequence of SEQ ID NO:29. Also included was a terminating oligonucleotide made up
of 2'-O-methyl ribonucleotides having the base sequence of SEQ ID NO:34 cccaguuucccaggcuuauc
cc. The terminating oligonucleotide targeted a region of the target nucleic acid just
5' to the target region and had a 3'-terminal blocking moiety. The 5'-ends of the
terminating oligonucleotide and the hybridizing sequence of the promoter oligonucleotide
overlapped by six bases. The 3'-terminal blocking moiety of both the blocked promoter
oligonucleotide and the terminating oligonucleotide consisted of the 3'- to-3'linkage
described in Example 1. And for detection, two detection probes were synthesized.
The first detection probe ("detection probe I") comprised 2'-O-methyl ribonucleotides
targeted a sequence contained within the target region and had the base sequence of
SEQ ID NO:30 gcucauccca*caccgcuaaagc. The second detection probe ("detection probe
II") targeted the antisense of a region contained within the T7 promoter sequence
and had the base sequence of SEQ ID NO:35 atacgactc*actata. The asterisk in both detection
probe sequences indicates the position of a 4-(2-succinimidyloxycarbonyl ethyl)-phenyl-10-methylacridinium-9-carboxylate
fluorosulfonate acridinium ester label ("standard AE") joined to the probe by means
of a non-nucleotide linker, as described by Arnold
et al., "Linking Reagents for Nucleotide Probes,"
U.S. Patent No. 5,585,481, the contents of which are hereby incorporated by reference herein.
[0161] A total of eight different amplification reactions were performed in replicates of
five. All of the reaction tubes used for the amplification reactions were provided
with 75 µL of the Amplification Reagent, followed by 5 pmol each of either the blocked
or unblocked promoter oligonucleotide, the priming oligonucleotide, and the terminating
oligonucleotide. Two sets of the tubes received 2 µL each of a 0.2% (w/v) LLS buffer
containing 250 copies/µL of the target nucleic acid, and the other two sets of tubes
received no target nucleic acid. The reaction mixtures were overlaid with 200 µL of
the Oil Reagent, and the tubes were then sealed and hand-shaken horizontally for 5
to 10 seconds before being incubated in a 60°C water bath for 10 minutes. The tubes
were then transferred to a 41.5°C water bath and incubated for 10 minutes before adding
25 µL of the Enzyme Reagent to each tube. After adding the Enzyme Reagent, the tubes
were sealed, removed from the water bath and hand-shaken horizontally for 5 to 10
seconds to fully mix the components of the reaction mixtures. The tubes were returned
to the 41.5C water bath and incubated for an additional 60 minutes to permit amplification
of the target sequences. Following amplification, the tubes were removed from the
41.5°C water bath and allowed to cool at room temperature for 10 to 15 minutes.
[0162] The detection step was performed in accordance with the Hybridization Protection
Assay disclosed by Arnold
et al., "Homogenous Protection Assay,"
U.S. Patent No. 5,283,174. In this step, 100 µL of the Hybridization Reagent containing either 52 fmol of detection
probe I or 10.2 fmol of detection probe II was added to each tube. After adding the
detection probes, the tubes were sealed, hand-shaken horizontally for 5 to 10 seconds,
and incubated in a 60°C water bath for 15 minutes to permit hybridization of the detection
probes to their corresponding target sequences. Following hybridization, 250 µL of
the Selection Reagent was added to the tubes and the tubes were sealed and hand-shaken
horizontally for 5 to 10 seconds before being incubated in a 60°C water bath for 10
minutes to hydrolyze acridinium ester labels associated with unhybridized probe. The
samples were cooled at room temperature for at least 10 minutes before being analyzed
in a LEADER
® HC+ Luminometer (Gen-Probe Incorporated, San Diego, CA; Cat. No. 4747) equipped with
automatic injection of Detection Reagent I, followed by automatic injection of Detection
Reagent II. Signal emitted from the tubes was measured in relative light units ("RLU"),
which is a measure of chemiluminescence.
[0163] The results were averaged for each set of reaction conditions and are presented in
Table 1 below. From these results, it can be seen that those amplification reactions
containing the blocked promoter oligonucleotide performed as well as those amplification
reactions containing the unblocked promoter oligonucleotide at amplifying a targeted
region of the target nucleic acid. However, those amplification reactions containing
the blocked promoter oligonucleotide produced substantially fewer replicating molecules
than did those amplification reactions containing the unblocked promoter oligonucleotide,
both in the presence and in the absence of the transcript.
Table 1
| Effect of 3'-Blocking Promoter Oligonucleotides on the Formation of Replicating Molecules |
| |
Detection Probe I |
Detection Probe II |
| Target Nucleic Acid |
No Target Nucleic Acid |
Target Nucleic Acid |
No Target Nucleic Acid |
| Blocked Promoter Oligonucleotide |
1,047,084 |
4,222 |
64,874 |
10,063 |
| Unblocked Promoter Oligonucleotide |
976,156 |
98,067 |
526,657 |
456,130 |
Example 3
Sensitivity of Amplification Assay Using Blocked Promoter Oligonucleotide and Terminating
Oligonucleotide
[0164] This experiment examined the sensitivity of an amplification system according to
the present invention in which a region ("the target region") of purified 23S rRNA
from
Chlamydia trachomatis (ATCC No. VR-878) ("the target nucleic acid") was targeted for amplification. Included
in this experiment was a promoter oligonucleotide having a 3'-terminal blocking moiety,
a priming oligonucleotide, a terminating oligonucleotide having a 3'-terminal blocking
moiety, and a labeled detection probe. The promoter oligonucleotide targeted the complement
of a sequence contained within the 5'-end of the target region and had the base sequence
of SEQ ID NO:22
aatttaatacgactcactatagggagacggagtaagttaagcacgcggac gattgga, where the underlined portion of the promoter oligonucleotide
constitutes a T7 promoter sequence (SEQ ID NO:3) and the non-underlined portion represents
a hybridizing sequence (SEQ ID NO:21). The priming oligonucleotide targeted a sequence
contained within the 3'-end of the target region and had the base sequence of SEQ
ID NO:23. The terminating oligonucleotide was made up of 2'-O-methyl ribonucleotides
having the base sequence of SEQ ID NO:36 uccgucauuccuucgcuauagu and targeted a region
of the target nucleic acid just 5' to the target region. The 5'-ends of the terminating
oligonucleotide and the hybridizing sequence of the promoter oligonucleotide overlapped
by four bases. The 3'-terminal blocking moiety of both the promoter oligonucleotide
and the terminating oligonucleotide consisted of the 3'-to-3' linkage described in
Example 1. The detection probe targeted a sequence contained within the target region
and was made up of 2'-O-methyl ribonucleotides having the base sequence of SEQ ID
NO:24 cguucucaucgcucu*acggacucu, where the asterisk indicates the position of a standard
AE label joined to the probe by means of a non-nucleotide linker.
See Arnold
et al., U.S. Patent No. 5,585,481.
[0165] Amplification in this experiment was carried out essentially as described in Example
1. Each amplification reaction was performed in replicates of 3, and the target nucleic
acid was added to each reaction tube in each set of replicates in copy numbers of
10, 100, 1000 or 10,000 from a 0.1% (w/v) LLS buffer containing 10, 100, 1000 or 10,000
copies/µL, respectively. The promoter and priming oligonucleotides were each added
to the tubes in 30 pmol/reaction amounts, and 5 pmol of the terminating oligonucleotide
was added to each tube. Using the
Chlamydia trachomatis probe of this experiment, detection was carried out essentially as described in Example
2. The results of this experiment are set forth in Table 2 below and indicate 100
copy sensitivity for this amplification system, where an average RLU value of above
10,000 constituted a positive result.
Table 2
| Sensitivity of Chlamydia trachomatis Amplification System |
| Copy Number |
Avg. RLU |
| 10 |
8504 |
| 100 |
51,574 |
| 1000 |
1,578,416 |
| 10,000 |
6,092,697 |
Example 4
Amplification of a Double-Stranded Target Sequence
[0166] This example examines an amplification system according to the present invention
in which a region ("the target region") of a cloned, double-stranded transcript derived
from the E6 and E7 genes of human papilloma virus type 16 ("HPV-16") ("the transcript")
was targeted for amplification.
See FIG. 1C. This experiment included a promoter oligonucleotide having a 3'-terminal
blocking moiety, a priming oligonucleotide and a labeled detection probe. The promoter
oligonucleotide targeted the complement of a sequence contained within the 5'-end
of the target region and had the base sequence of SEQ ID NO:14
aatttaatacgactcactatagggagagaacagatggggcacacaattcctagt, where the underlined portion of the promoter oligonucleotide
constitutes a T7 promoter sequence (SEQ ID NO:3) and the non-underlined portion represents
a hybridizing sequence (SEQ ID NO:13). The 3'-terminal blocking moiety of the promoter
oligonucleotide consisted of the 3'-to-3' linkage described in Example 1. The priming
oligonucleotide targeted a sequence contained within the 3'-end of the target region
and had the base sequence of SEQ ID NO:15. The detection probe, which was comprised
of 2'-O-methyl ribonucleotides, had the base sequence of SEQ ID NO:16 ggacaa*gcagaaccggaca
and targeted a sequence contained within the target region. The asterisk indicates
the position of a standard AE label joined to the probe by means of a non- , nucleotide
linker.
See Arnold
et al., U.S. Patent No. 5,585,481.
[0167] The amplification reactions of this experiment were performed in replicates of 5,
and each tube included 75 µL of the Amplification Reagent containing 0, 50, 100, 500,
1000 or 5000 copies of the transcript. Each tube was also provided with 40 pmol of
the promoter oligonucleotide and 15 pmol of the priming oligonucleotide. The reaction
mixtures were overlaid with 200 µL of the Oil Reagent, and the tubes were then sealed
and hand-shaken horizontally for 5 to 10 seconds. To separate the complementary strands
of the double-stranded transcript, the tubes were incubated in a heat block for 10
minutes at 95°C. At the end of this incubation, the tubes were removed from the heat
block and rapidly cooled on ice for 5 minutes to promote association of the priming
oligonucleotide and the targeted region of the transcript. The tubes were then incubated
in a 41.5°C water bath for 10 minutes. To initiate amplification, 25 µL of the Enzyme
Reagent was added to the tubes, which were then sealed and hand-shaken horizontally
for 5 to 10 seconds to fully mix the Amplification and Enzyme Reagents. Amplification
was then carried out by returning the tubes to the 41.5°C water bath for a 1 hour
incubation.
[0168] Following amplification, detection of the amplification products was performed in
the manner described in Example 2 using 100 fmol/reaction of the detection probe.
The results of this experiment are set forth in Table 3 below and indicate 500 copy
sensitivity for this amplification system, where an RLU value of 10,000 or greater
constituted a positive result.
Table 3
| Sensitivity of HPV-16 Amplification System |
| Copy Number |
Avg. RLU |
% Positive Amplifications |
| 0 |
5410 |
0 |
| 50 |
5647 |
0 |
| 100 |
6018 |
0 |
| 500 |
19,928 |
80 |
| 1000 |
200,072 |
80 |
| 5000 |
371,641 |
100 |
Example 5
Comparison of Blocked and Unblocked Promoter Oligonucleotides
[0169] The purpose of this experiment was to evaluate the benefit of including a terminating
oligonucleotide in the HCV amplification system of Example 1.
See FIG. 1A. For this experiment, four different reaction mixtures were set up in replicates
of 10 containing either 0 or 10 copies of the transcript of Example 1 in the presence
or absence of a terminating oligonucleotide. The promoter, priming and terminating
oligonucleotides were identical to those used in Example 1. Unlike Example 1, this
experiment included two detection probes, both of which were made up of 2'-O-methyl
ribonucleotides and targeted a sequence contained within the region of the transcript
targeted for amplification. The first detection probe had the base sequence of SEQ
ID NO:7 guacu*caccgguucc, and the second detection probe had the base sequence of
SEQ ID NO:8 agaccacua*uggcucucccggg. Each detection probe had a "cold," or unlabeled
version, and a "hot," or labeled version. (Cold probes were used in this experiment
to prevent saturation of the hot probes in the presence of a vast excess of amplicon,
thereby permitting the extent of amplification to be evaluated.) The asterisks indicate
the positions of standard AE labels joined to the hot probes by means of non-nucleotide
linkers.
See Arnold
et al.,
U.S. Patent No. 5,585,481.
[0170] The amplification reactions were essentially carried out in the manner described
in Example 2 using 30 pmol/reaction of the promoter oligonucleotide and 15 pmol/reaction
of each of the priming and terminating oligonucleotides. Detection was performed as
described in Example 2 using 100 fmol/reaction of each of the two hot probes and each
of the two cold probes in amounts corresponding to the ratios indicated in Table 4
below. The averaged results are set forth in Table 4 in relative light units ("RLU")
and demonstrate that only those reaction mixtures containing the terminating oligonucleotide
had 10 copy level sensitivity in the HCV amplification system. The coefficient of
variation values ("%CV") appearing in Table 4 for the different copy levels tested
constitute the standard deviation of the replicates over the mean of the replicates
as a percentage.
Table 4
| Sensitivity of the HCV Amplification System in the Presence and Absence of a Terminating
Oligonucleotide |
| Copy Number |
Terminating Oligonucleotide |
Cold Prot/Hot Probe Ratio |
Avg. RLU |
% CV |
| 0 |
+ |
25:1 |
15,813 |
7.5 |
| 10 |
+ |
25:1 |
635,695 |
83.5 |
| 0 |
- |
5:1 |
15,378 |
14.3 |
| 10 |
- |
5:1 |
20,730 |
37.5 |
Example 6
Varying Length of Base Overlap Between Promoter Oligonucleotide and Terminating Oligonucleotide
[0171] In this experiment, we studied the effect of varying the length of overlap between
a blocked promoter oligonucleotide and a terminating oligonucleotide on amplification
efficiency in the HCV amplification system of Example 1. The reaction mixtures were
set up in replicates of four and each set was provided with 0 or 50 copies of the
transcript of Example 1. The amount of overlap between the promoter oligonucleotide
and the terminating oligonucleotide, if present, was 2, 4 or 6 bases for each set
of reaction mixtures. The promoter oligonucleotide, the priming oligonucleotide, and
the detection probes were identical to those used in Example 5. The cold probes and
hot probes were used at a ratio of 4:1. The three terminating oligonucleotides of
this experiment were made up of 2'-O-methyl ribonucleotides and had the following
base sequences: (i) SEQ ID NO:37 agacgcuuucugcgugaagacagu (2 base overlap); (ii) SEQ
ID NO:38 cuagacgcuuucugcgugaagaca (4 base overlap); and (iii) SEQ ID NO:33 (6 base
overlap).
[0172] The amplification reactions were carried out in reaction tubes in the manner described
in Example 5 using 30 pmol/reaction of the promoter oligonucleotide and 15 pmol/reaction
each of the priming oligonucleotide and the terminating oligonucleotides. Detection
was performed as described in Example 2 using 100 fmol/reaction of each of the two
hot probes and 400 fmol/reaction of each of the two cold probes. The averaged results
are set forth in Table 5 in relative light units ("RLU") and indicate that under the
conditions tested, six bases of overlap between the promoter oligonucleotide and the
terminating oligonucleotide is optimal for the HCV amplification system. The skilled
artisan could apply this method to any amplification system to determine the optimal
amount of overlap between a promoter oligonucleotide and a terminating oligonucleotide
using nothing more than routine experimentation.
Table 5
| Effect of Terminating Oligonucleotide/Promoter Oligonucleotide Base Overlap on Amplification
Efficiency |
| Copy Number |
Terminating Oligonucleotide |
Base Overlap |
Avg. RLU |
| 0 |
- |
N/A |
29,593 |
| + |
2 |
25,430 |
| + |
4 |
27,128 |
| + |
6 |
27,732 |
| 50 |
- |
N/A |
265,250 |
| + |
2 |
339,833 |
| + |
4 |
253,577 |
| + |
6 |
1,904,911 |
Example 7
Comparison of Real-Time Amplification Assays in the Presence or Absence of a Terminating
Oligonucleotide
[0173] This experiment was conducted to determine whether a terminating oligonucleotide
improves amplification performance in a real-time amplification assay. For this experiment,
we used the
Mycobacterium tuberculosis amplification system of Example 2, which included the unblocked promoter oligonucleotide
having the base sequence of SEQ ID NO:28, the priming oligonucleotide having the base
sequence of SEQ ID NO:29, and the blocked terminating oligonucleotide having the base
sequence of SEQ ID NO:34. Also included was a molecular beacon detection probe having
the base sequence of SEQ ID NO:31. The detection probe was synthesized to include
a BHQ-2 Black Hole Quencher
™ Dye joined to its 3'-end using a BHQ-2 Glycolate CPG (Biosearch Technologies, Inc.,
Novato, CA; Cat No. CG5-5042G-1) and a Cy
™5 Dye joined to its 5'-end using a Cy
™5-CE phosphoramidite (Glen Research; Cat. No. 105915-90). The reactions were run in
the wells of a Thermo Labsystems White Cliniplate 96 (VWR International, Inc., West
Chester, PA; Cat. No. 28298-610), and each reaction well contained 0, 100 or 1000
copies of the target nucleic acid of Example 2. For each copy number tested, there
were four replicates which included the terminating oligonucleotide and four replicates
which did not.
[0174] For amplification and detection, 75 µL of the Amplification Reagent was added to
each reaction well, followed by the addition of 2 µL of a 0.1% (w/v) LLS buffer containing
50 copies/µL to each tube of one set of replicates and 2 µL of a 0.1% (w/v) LLS buffer
containing 500 copies/µL to each tube of another set of replicates. The promoter oligonucleotide,
the priming oligonucleotide and, when included, the terminating oligonucleotide were
each added to the tubes in 5 pmol/reaction amounts, and 2 pmol/reaction of the detection
probe was added to each tube. Target nucleic acid was provided to the reaction wells
in the amounts indicated, and the reactions mixtures were overlaid with 80 µL of the
Oil Reagent. The plate was sealed with a ThermalSeal RT
™ Film (Sigma-Aldrich Corporation, St. Louis, MO; Product No. Z369675) and the contents
of the plate were subjected to a 60°C incubation for 15 minutes in a Solo HT Microplate
Incubator (Thermo Electron Corporation, Waltham, MA; Model No. 5161580), followed
by a 42°C incubation for 10 minutes in the Solo HT Microplate Incubator. Next, 25
µL of the Enzyme Reagents (pre-heated to 42°C) was added to each well and the contents
were mixed several times using a pipette. The contents of the plate were then incubated
at 42°C for 120 minutes in a Biolumin
™ 960 Micro Assay Reader (Molecular Dynamics Inc., Sunnyvale, CA) and fluorescence
from the Cy
™5 Dye channel was monitored as a function of time in one minute intervals. The results
of this monitoring, which are graphically presented in Figures 4A-F, indicate that
the terminating oligonucleotide dramatically enhanced amplification of the target
sequence in the
Mycobacterium tuberculosis real-time amplification assay.
Example 8
Terminating Oligonucleotides Versus Digestion Oligonucleotides
[0175] This experiment compared levels of amplification in the
Mycobacterium tuberculosis amplification system of Example 2 using either a terminating oligonucleotide or a
digestion oligonucleotide in the presence of a blocked or unblocked promoter oligonucleotide.
The terminating oligonucleotide of this experiment was designed to bind to the targeted
RNA and physically block the activity of the reverse transcriptase enzyme, while the
digestion oligonucleotide, which was composed of DNA, was designed to bind to the
targeted RNA and direct digestion of the substrate RNA by an RNAse H activity. Use
of the terminating or digestion oligonucleotide results in the formation of a template-complementary
strand, or cDNA, having a defined 3'-end. The promoter oligonucleotide is designed
so that its template-binding portion hybridizes to a 3'-terminal sequence present
in the template-complementary strand, thereby facilitating the formation of a double-stranded
promoter sequence in the presence of the reverse transcriptase enzyme.
[0176] As in Example 2, the promoter oligonucleotide of this experiment had the base sequence
of SEQ ID NO:28 and the priming oligonucleotide had the base sequence of SEQ ID NO:29.
The terminating oligonucleotide was made up of 2'-O-methyl ribonucleotides having
the base sequence of SEQ ID NO:39 caguuucccaggcuuauccc, and the digestion oligonucleotide
had the base sequence of SEQ ID NO:40 gtattagacccagtttcccaggct. The 5'-ends of the
terminating oligonucleotide the hybridizing sequence of the promoter oligonucleotide
identified in Example 2 overlapped by four bases, and the first 14 bases extending
from the 5'-end of the digestion oligonucleotide overlapped with the 5'-most 14 bases
of the hybridizing sequence of the promoter oligonucleotide. The blocked promoter
oligonucleotide, the terminating oligonucleotide, and the digestion oligonucleotide
all included a 3'-terminal blocking moiety consisting of the 3'-to-3'linkage described
in Example 1. And the detection probe had the base sequence of SEQ ID NO:32 gctcatccca*caccgctaaagc,
where the asterisk indicates the position of a standard AE label joined to the probe
by means of a non-nucleotide linker.
See Arnold
et al.,
U.S. Patent No. 5,585,481.
[0177] A total of six different reactions were performed in replicates of two, as set forth
in Table 6 below. Template positive reactions were each provided with 1 µL of a 0.1%
(w/v) LLS buffer containing 50 copies/µL of the
Mycobacterium tuberculosis target nucleic acid of Example 2, and template negative reactions included no target
nucleic acid. Amplification and detection were essentially carried out as in Example
2 using 30 pmol/reaction each of the promoter and priming oligonucleotides, 5 pmol/reaction
of the terminating oligonucleotide, 30 pmol/reaction of the digestion oligonucleotide,
and 10 fmol/reaction of the detection probe. The results of these reactions, which
were measured in relative light units ("RLU"), are presented in Table 6 and indicate
that amplification in this amplification system was similar in the presence of either
the terminating or the digestion oligonucleotide, although performance was somewhat
better using the digestion oligonucleotide. Additionally, the results indicate that
the level of amplification in this amplification system at this copy number was enhanced
in the presence of the digestion oligonucleotide.
Table 6
| Amplicon Production Using Terminating or Digestion Oligonucleotide |
| Reaction |
Template |
Terminating (T) or Digestion (D) Oligonucleotide |
Promoter Oligonucleotide |
RLU |
| 1 |
Positive |
T |
Blocked |
319,449 |
| 2 |
T |
Blocked |
254,181 |
| 3 |
T |
Unblocked |
20,915 |
| 4 |
T |
Unblocked |
3767 |
| 5 |
D |
Blocked |
472,786 |
| 6 |
D |
Blocked |
422,818 |
| 7 |
D |
Unblocked |
162,484 |
| 8 |
D |
Unblocked |
136,134 |
| 9 |
None |
Blocked |
10,007 |
| 10 |
None |
Blocked |
5052 |
| 11 |
Negative |
D |
Blocked |
27,594 |
| 12 |
D |
Blocked |
5157 |
Example 9
Capped Priming Oligonucleotides
[0178] This experiment studied the effect of including a priming oligonucleotide cap on
side-product formation using the
Mycobacterium tuberculosis amplification system of Example 2. A "cap" is a short oligonucleotide complementary
to the 3'-terminal end of a priming oligonucleotide and includes a 3'-terminal blocking
moiety to prevent extension from a terminal 3'-OH group. The cap is included to prevent
the priming oligonucleotide from forming an oligonucleotide dimer with the promoter
oligonucleotide, which could result in the formation of a functional double-stranded
promoter sequence if the priming oligonucleotide is extended in the presence of a
reverse transcriptase enzyme. As illustrated in FIG 5A, the formation of an oligonucleotide
dimer having a functional double-stranded promoter sequence could lead to the production
of unwanted side-products in the presence of an RNA polymerase. While the cap inhibits
oligonucleotide dimer formation, the cap can be readily displaced from the priming
oligonucleotide through specific hybridization with the template sequence. A diagram
of cap usage is shown in FIG 6A.
[0179] For this experiment, we tested three different reaction conditions in replicates
of two in the presence or absence of the
Mycobacterium tuberculosis target nucleic acid of Example 2. The components of the three reaction conditions
differed as follows: (i) the first set of reaction conditions included an unblocked
promoter oligonucleotide, an uncapped priming oligonucleotide and a blocked terminating
oligonucleotide; (ii) the second set of reaction conditions included a blocked promoter
oligonucleotide, an uncapped priming oligonucleotide, and a blocked terminating oligonucleotide;
and (iii) the third set of reaction conditions included a blocked promoter oligonucleotide,
a priming oligonucleotide hybridized to a blocked cap at its 3'-terminal end, and
a blocked terminating oligonucleotide. As in Example 2, the promoter oligonucleotide
had the base sequence of SEQ ID NO:28 and the priming oligonucleotide had the base
sequence of SEQ ID NO:29. The cap had the base sequence of SEQ ID NO:41 ctatc. The
terminating oligonucleotide was made up of 2'-O-methyl ribonucleotides having the
base sequence of SEQ ID NO:39 caguuucccaggcuuauccc. And the terminating oligonucleotide,
the promoter oligonucleotide, when blocked, and the cap all included a 3'-terminal
blocking moiety consisting of the 3'-to-3' linkage described in Example 1.
[0180] Prior to initiating amplification, the priming oligonucleotide and the cap were pre-hybridized
in a 10 mM NaCl solution containing the priming oligonucleotide and the cap at a 1:1
ratio. The facilitate hybridization, the reaction tubes containing the solution were
incubated in a 95°C water bath for 10 minutes and then cooled at room temperature
for 2 hours. Following this pre-hybridization step, amplification was carried out
as in Example 2 using 30 pmol/reaction each of the promoter oligonucleotide and the
capped priming oligonucleotide and 5 pmol/reaction of the terminating oligonucleotide,
where each reaction mixture was also provided with 1 µL of a 0.1% (w/v) LLS buffer
containing 10,000 copies/µL of the target nucleic acid. After amplification, a 5 µL
sample was taken from each tube, diluted 1:1 with a 10X BlueJuice
™ Gel Loading Buffer (Invitrogen; Cat. No. 10816-015) which was diluted to 2X with
TBE (Tris-Borate-EDTA), and loaded onto an E-Gel
® Single Comb Gel (4% high resolution agarose) which was pre-stained with ethidium
bromide (Invitrogen; Cat. No. G5018-04). The gels were run on an E-Gel
® Base (Invitrogen; Cat. No. G5100-01) at 80 volts for 30 minutes. The gels were then
visualized on a FisherBiotech
® Ultraviolet Transilluminator and photographed with a handheld camera using Polaroid
667 film.
[0181] The results of this experiment are illustrated in the photographed gels of FIG 7A
(template negative gel) and FIG. 7B (template positive gel). The numbers above the
pictured gels indicate distinct lanes, where lane 7 is blank, lane 8 is a 100 base
pair RNA ladder, lane 9 is a 20 base pair RNA ladder, and the remainder of the lanes
contain products from the following reaction mixtures: (i) lanes 1 and 2 correspond
to reaction mixtures containing the unblocked promoter oligonucleotide, the uncapped
priming oligonucleotide, and the blocked terminating oligonucleotide; (ii) lanes 3
and 4 correspond to reaction mixtures containing the blocked promoter oligonucleotide,
the uncapped priming oligonucleotide, and the terminating oligonucleotide; and (iii)
lanes 5 and 6 correspond to reaction mixtures containing the blocked promoter oligonucleotide,
the capped priming oligonucleotide, and the terminating oligonucleotide. The results
clearly show that capping the priming oligonucleotide resulted in a further reduction
in side-product formation (the side-products, which are oligonucleotide dimers in
these reactions, are in the 20-mer to 60-mer range, whereas the amplicon would be
greater than 100 bases in length).
Example 10
Looped Priming Oligonucleotides
[0182] In this experiment, the effect of looped priming oligonucleotides on amplification
in the
Mycobacterium tuberculosis amplification system of Example 2 was examined. Looped priming oligonucleotides are
a variety of the priming oligonucleotides and caps evaluated in Example 9. A looped
priming oligonucleotide includes a cap which is joined at its 3'-end to the 5'-end
of the priming oligonucleotide by means of a non-nucleotide linker (
e.g., abasic nucleotides). One advantage of a looped priming oligonucleotide is that reassociation
of the priming oligonucleotide and the cap, in the absence of the targeted template,
is faster when the two oligonucleotides are maintained in close proximity to each
other. Another advantage of a looped priming oligonucleotide is that the priming oligonucleotide
and the cap can be generated in a single synthesis procedure, as opposed to the time
intensive syntheses of separate priming and cap oligonucleotides.
[0183] Comparison was made between an uncapped priming oligonucleotide and looped priming
oligonucleotides having caps of varying lengths. The promoter, priming and terminating
oligonucleotides were the same as those used in Example 9, and the detection probe
was the same as detection probe I used in Example 2. The detection probe was provided
to the reaction mixtures in both "cold" and "hot" forms, for the reasons described
in Example 5, and the cold:hot probe ratio of each reaction mixture was 250:1. The
looped priming oligonucleotides had the following sequences, where each "n" represents
an abasic nucleotide (Glen Research; Cat. No. 10-1924-xx):
Looped Priming Oligonucleotide I (LPO I): SEQ ID NO:42 ctatttnngccgtcaccccaccaaca
agctgatag;
Looped Priming Oligonucleotide II (LPO II): SEQ ID NO:43 ctatcnnnnngccgtcacccca ccaacaagctgatag;
Looped Priming Oligonucleotide III (LPO III): SEQ ID NO:44 ctatnnnnngccgtcacccca ccaacaagctgatag;
Looped Priming Oligonucleotide IV (LPO IV): SEQ ID NO:45 ctatcannnnngccgtcaccc caccaacaagctgatag;
Looped Priming Oligonucleotide V (LPO V): SEQID NO:46 ctatcnnnngccgtcaccccac caacaagctgatag;
Looped Priming Oligonucleotide VI (LPO VI): SEQID NO:47 ctatcannnngccgtcacccc accaacaagctgatag;
and
Looped Priming Oligonucleotide VII (LPO VII]: SEQ ID NO:48 ctatcagcttgttggnnnnn gccgtcaccccaccaacaagctgatag.
[0184] A different reaction mixture was prepared for each priming oligonucleotide, and the
reaction mixtures were tested in replicates of three using 1000 copies of the
Mycobacterium tuberculosis target nucleic acid of Example 2 obtained from 0.1% (w/v) LLS buffer containing 1000
copies/µL of the target nucleic acid. The amplification and detection steps were carried
out as in Example 2 using 30 pmol/reaction each of the promoter and priming oligonucleotides,
5 pmol/reaction of the terminating oligonucleotide, 10 fmol/reaction of the hot probe,
and 2.5 pmol/reaction of the cold probe. Signal from the tubes was measured in relative
light units ("RLU") and the average RLU values are presented in Table 7 below. The
results indicate that the template can be amplified using a looped priming oligonucleotide,
and that a looped priming oligonucleotide having four abasic groups and a five base
cap is optimal for the
Mycobacterium tuberculosis amplification system.
Table 7
| Effect of Looped Priming Oligonucleotides on Amplification |
| Priming Oligonucleotide |
Avg. RLU |
| Uncapped |
430,060 |
| LPO I |
292,541 |
| LPO II |
260,559 |
| LPO III |
281,304 |
| LPO IV |
136,398 |
| LPO V |
372,119 |
| LPO VI |
171,382 |
| LPO VII |
20,045 |
Example 11
Comparison of Looped Priming Oligonucleotides and Caps
[0185] This experiment evaluated the ability of looped priming oligonucleotides to inhibit
primer-dependent side-product formation. For this experiment, looped priming oligonucleotides
LPO V and LPO VII of Example 10 were compared with an uncapped priming oligonucleotide
and a priming oligonucleotide having a 14 base cap. The uncapped and capped priming
oligonucleotides were the same as the uncapped priming oligonucleotide used in Example
10, and the cap had the base sequence of SEQ ID NO:49 ctatcagcttgttg (the cap and
the priming oligonucleotide were pre-hybridized as in Example 9). The terminating
oligonucleotide was the same as the terminating oligonucleotide used in Example 10,
and the detection probe targeted the complement of the priming oligonucleotide and
had the base sequence of SEQ ID NO:29 gccgtcacccc*accaacaagctgatag, where the asterisk
indicates the position of a standard AE label joined to the probe by means of a non-nucleotide
linker.
See Arnold
et al., U.S. Patent No. 5,585,481. The detection probe was provided to the reaction mixtures in both "cold" and "hot"
forms, for the reasons described in Example 5, and the cold:hot probe ratio of each
reaction mixture was 4000:1. As with the promoter and terminating oligonucleotides,
the cap had a 3'-terminal blocking moiety consisting of the 3' to 3' linkage described
in Example 1.
[0186] The reaction mixtures were all template-free and tested in replicates of three, with
a different set of reaction mixtures being prepared for each priming oligonucleotide.
The amplification and detection steps were carried out as in Example 2 using 30 pmol/reaction
each of the promoter and priming oligonucleotides, 5 pmol/reaction of the terminating
oligonucleotide, 20 fmol/reaction of the hot probe, and 80 pmol/reaction of the cold
probe. Signal from the tubes was measured in relative light units ("RLU") and the
averages of those RLU values are set forth in Table 9 below. The results indicate
that the capped priming oligonucleotide inhibited primer-dependent side-product formation
to a greater extent than did the looped priming oligonucleotides, although use of
the looped priming oligonucleotides resulted in less primer-dependent side-product
formation than when the uncapped priming oligonucleotide was used in this amplification
system.
Table 8
| Inhibition of Primer-Dependent Side-product Formation Using Looped Priming Oligonucleotides
and Caps |
| Priming Oligonucleotide |
Avg. RLU |
| Uncapped |
2,246,565 |
| LPO V |
1,497,699 |
| LPO VII |
1,040,960 |
| Capped |
106,134 |
Example 12
Comparison of RNA Transcript Production in the Presence and Absence of Extender Oligonucleotides
[0187] This experiment examined the effect of extender oligonucleotides on amplicon production
in amplification reaction mixtures containing a blocked promoter oligonucleotide.
The extender oligonucleotides of this experiment were either blocked or unblocked
and had the base sequence of SEQ ID NO:50 cctccaggaccccccctcccgggagagccata. A 3'-end
blocked terminating oligonucleotide was included that was made up of 2'-O-methyl ribonucleotides
having the base sequence of SEQ ID NO:51 auggcuagacgcuuucugcgugaaga. The target nucleic
acid ("target"), priming oligonucleotide and promoter oligonucleotide were the same
as those used in Example 1. The blocking moiety of each blocked oligonucleotide used
in this experiment was a 3'-terminal blocking moiety consisting of the 3'-to-3' linkage
described in Example 1. Cold and hot probes were used for detection of transcription
products and had the sequence of SEQ ID NO:7. The hot probe of this experiment was
identical to the first detection probe used in Example 5.
[0188] Six groups of amplification reaction mixtures were tested in replicates of four as
follows: (i) no extender oligonucleotide and no target (group I); (ii) no extender
oligonucleotide and 100 copies of target (group II); (iii) blocked extender oligonucleotide
and no target (group III); (iv) blocked extender oligonucleotide and 100 copies of
target (group IV); (v) unblocked extender oligonucleotide and no target (group V);
(iv) unblocked extender oligonucleotide and 100 copies of target (group VI). Reaction
tubes from the six groups were set-up with 30 µL Amplification Reagent containing
6 pmol of the priming oligonucleotide, 4 pmol of the promoter oligonucleotide and
0.8 pmol of the terminating oligonucleotide. The reaction tubes of groups III and
IV contained 4 pmol of the blocked extender oligonucleotide, and the reaction tubes
of groups V and VI contained 4 pmol of the unblocked extender oligonucleotide. As
indicated above, the reaction tubes of groups II, IV and VI further contained 100
copies of target, while those of groups I, III and V contained no target. The reaction
mixtures were overlaid with 200 µL Oil Reagent, and the tubes were then sealed and
vortexed for 10 seconds before being incubated in a 60°C water bath for 10 minutes.
The tubes were then transferred to a 41.5°C water bath and incubated for 15 minutes
before adding 10 µL Enzyme Reagent. After adding Enzyme Reagent, the tubes were again
sealed and hand-shaken horizontally for 5 to 10 seconds to fully mix the components
of the reaction mixtures. The tubes were returned to the 41.5°C water bath and incubated
for an additional 60 minutes to permit amplification of the target sequence. Following
amplification, the tubes were removed from the 41.5°C water bath and placed in an
ice water bath for two minutes.
[0189] Detection of RNA transcription products was performed essentially as described in
Example 2 (reaction tubes were vortexed rather than hand-shaken) using 100 fmol/reaction
of the hot probe and 300 pmol/reaction of the cold probe. The averaged results are
set forth in Table 9 in relative light units ("RLU") and demonstrate that the extender
oligonucleotides of this experiment contributed to faster rates of amplification.
The coefficient of variation values ("%CV") appearing in Table 9 for the different
reaction conditions tested constitute the standard deviation of the replicates over
the mean of the replicates as a percentage.
Table 9
| Effect of Extender Oligonucleotides on Amplicon Production |
| Copy Number |
Extender Oligonucleotide |
Avg. RLU |
% CV |
| 0 |
None |
4239 |
13 |
| 100 |
None |
70,100 |
28 |
| 0 |
Blocked |
4721 |
30 |
| 100 |
Blocked |
337,964 |
12 |
| 0 |
Unblocked |
13,324 |
76 |
| 100 |
Unblocked |
869,861 |
12 |
[0190] While the present invention has been described and shown in considerable detail with
reference to certain preferred embodiments, those skilled in the art will readily
appreciate other embodiments of the present invention. Accordingly, the present invention
is deemed to include all modifications and variations encompassed within the spirit
and scope of the following appended claims.
Further aspects of the present invention are set forth in the following numbered paragraphs.
- 1. A method of synthesizing multiple copies of a target sequence, said method comprising
the steps of:
- (a) treating a target nucleic acid comprising an RNA target sequence with:
(i) a priming oligonucleotide which hybridizes to the 3'-end of said target sequence
such that a primer extension reaction can be initiated therefrom; and
(ii) a binding molecule which binds to said target nucleic acid adjacent to or near
the 5'-end of said target sequence;
- (b) extending said priming oligonucleotide in a primer extension reaction with a DNA
polymerase to give a DNA primer extension product complementary to said target sequence,
said DNA primer extension product having a 3'-end which is determined by said binding
molecule and which is complementary to the 5'-end of said target sequence;
- (c) separating said DNA primer extension product from said target sequence using an
enzyme which selectively degrades said target sequence;
- (d) treating said DNA primer extension product with a promoter oligonucleotide comprising
first and second regions, said first region hybridizing to a 3'-region of said DNA
primer extension product to form a promoter oligonucleotide:DNA primer extension product
hybrid, and said second region being a promoter for an RNA polymerase and situated
5' to said first region, wherein said promoter oligonucleotide is modified to prevent
the initiation of DNA synthesis therefrom;
- (e) extending the 3'-end of said DNA primer extension product in said promoter oligonucleotide:DNA
primer extension product hybrid to add a sequence complementary to said second region
of said promoter oligonucleotide; and
- (f) transcribing from said promoter oligonucleotide:DNA primer extension product hybrid
multiple RNA products complementary to said DNA primer extension product using an
RNA polymerase which recognizes said promoter and initiates transcription therefrom,
wherein the base sequences of said RNA products are substantially identical to the
base sequence of said target sequence.
- 2. A method of synthesizing multiple copies of a target sequence, said method comprising
the steps of:
- (a) treating a target nucleic acid comprising an RNA target sequence with a priming
oligonucleotide which hybridizes to the 3'-end of said target sequence, such that
a primer extension reaction can be initiated therefrom;
- (b) extending said priming oligonucleotide in a primer extension reaction with a DNA
polymerase to give a first DNA primer extension product having an undefined 3'-end
and comprising a base region complementary to said target sequence;
- (c) separating said first DNA primer extension product from said target nucleic acid
using an enzyme which selectively degrades that portion of said target nucleic acid
which is complementary to said first DNA primer extension product;
- (d) treating said first DNA primer extension product with a promoter oligonucleotide
comprising first and second regions, said first region hybridizing to a 3'-region
of said first DNA primer extension product to form a promoter oligonucleotide:first
DNA primer extension product hybrid, said second region being a promoter for an RNA
polymerase and situated 5' to said first region, and wherein said promoter oligonucleotide
is modified to prevent the initiation of DNA synthesis therefrom; and
- (e) transcribing from said promoter oligonucleotide: first DNA primer extension product
hybrid multiple first RNA products complementary to at least a portion of said first
DNA primer extension product using an RNA polymerase which recognizes said promoter
and initiates transcription therefrom, wherein the base sequences of said first RNA
products are substantially identical to the base sequence of said target sequence.
- 3. The method of paragraph 2 further comprising the steps of:
(f) treating one of said first RNA products produced in step (e) with said priming
oligonucleotide to form a priming oligonucleotide:f[iota]rst RNA product hybrid such
that a primer extension reaction can be initiated from said priming oligonucleotide;
(g) extending said priming oligonucleotide of step (f) in a primer extension reaction
with said DNA polymerase to give a second DNA primer extension product complementary
to said first RNA product, said second DNA primer extension product having a 3'-end
which is complementary to the 5'-end of said first RNA product;
(h) separating said second DNA primer extension product from said first RNA product
using an enzyme which selectively degrades said first RNA product;
(i) treating said second DNA primer extension product with said promoter oligonucleotide
to form a promoter oligonucleotide: second DNA primer extension product hybrid;
(j) extending the 3'-end of said second DNA primer extension product in said promoter
oligonucleotide: second DNA primer extension product hybrid of step (i) to add a sequence
complementary to said second region of said promoter oligonucleotide; and
(k) transcribing from said promoter oligonucleotide: second DNA primer extension product
hybrid of step (j) multiple second RNA products complementary to said second DNA primer
extension product using said RNA polymerase, wherein the base sequences of said second
RNA products are substantially identical to the base sequence of said RNA target sequence.
- 4. A method of synthesizing multiple copies of a target sequence, said method comprising
the steps of:
- (a) treating a target nucleic acid comprising a DNA target sequence with a promoter
oligonucleotide comprising first and second regions, said first region hybridizing
to the 3'-end of said target sequence to form a promoter oligonucleotide:target nucleic
acid hybrid, and said second region being a promoter for an RNA polymerase and situated
5' to said first region, wherein said promoter oligonucleotide is modified to prevent
the initiation of DNA synthesis therefrom, and
wherein said target nucleic acid is not treated with a restriction endonuclease prior
to step (a);
- (b) transcribing from said promoter oligonucleotide:target nucleic acid hybrid multiple
first RNA products comprising a base region complementary to said target sequence
using an RNA polymerase which recognizes said promoter and initiates transcription
therefrom;
- (c) treating one of said first RNA products with a priming oligonucleotide which hybridizes
to a 3 '-region of said first RNA product such that a primer extension reaction can
be initiated therefrom;
- (d) extending said priming oligonucleotide in a primer extension reaction with a DNA
polymerase to give a DNA primer extension product complementary to at least a portion
of said first RNA product, said DNA primer extension product having a 3'-end which
is complementary to the 5'-end of said first RNA product;
- (e) separating said DNA primer extension product from said first RNA product using
an enzyme which selectively degrades said first RNA product;
- (f) treating said DNA primer extension product with said promoter oligonucleotide
to form a promoter oligonucleotide:DNA primer extension product hybrid; and
- (g) transcribing from said promoter oligonucleotide:DNA primer extension product hybrid
multiple second RNA products complementary to said DNA primer extension product using
said RNA polymerase, wherein the base sequences of said second RNA products are substantially
complementary to the base sequence of said target sequence.
- 5. A reaction mixture for use in synthesizing and detecting multiple copies of an
RNA target sequence, said reaction mixture comprising:
a priming oligonucleotide which hybridizes to the 3'-end of said RNA target sequence
and primes the synthesis of a first DNA primer extension product complementary to
said RNA target sequence; and
a detection probe having an oligonucleotide which hybridizes to a region of said RNA
target sequence or its complement to give a detectable signal,
wherein said reaction mixture comprises said detection probe prior to synthesizing
multiple copies of said RNA target sequence, and
wherein said reaction mixture does not include an oligonucleotide which hybridizes
to a region of said first DNA primer extension product and primes the synthesis of
a second DNA primer extension product complementary to said first DNA primer extension
product.
- 6. A reaction mixture for use in synthesizing multiple copies of an RNA target sequence,
said reaction mixture comprising:
a priming oligonucleotide which hybridizes to the 3'-end of said RNA target sequence
and primes the synthesis of a first DNA primer extension product complementary to
said RNA target sequence;
comprising a promoter oligonucleotide comprising a first region which hybridizes to
a 3'-region of said first DNA primer extension product and a second region which is
a promoter for an RNA polymerase, said promoter oligonucleotide being modified to
prevent the initiation of DNA synthesis therefrom; and
an extender oligonucleotide which hybridizes to said first DNA primer extension product
3' to said promoter oligonucleotide.
- 7. A reaction mixture for use in synthesizing multiple copies of an RNA target sequence,
said reaction mixture comprising:
a priming oligonucleotide which hybridizes to the 3'-end of said RNA target sequence
and primes the synthesis of a first DNA primer extension product complementary to
said RNA target sequence;
a binding molecule which binds to a target nucleic acid comprising said RNA target
sequence adjacent to or near the 5'-end of said RNA target sequence; and
a promoter oligonucleotide comprising a first region which hybridizes to a 3'-region
of said first DNA primer extension product and a second region which is a promoter
for an RNA polymerase, said promoter oligonucleotide being modified to prevent the
initiation of DNA synthesis therefrom.
- 8. A reaction mixture for use in synthesizing multiple copies of an RNA target sequence,
said reaction mixture comprising:
a priming oligonucleotide which hybridizes to the 3 '-end of said RNA target sequence
and primes the synthesis of a first DNA primer extension product complementary to
said RNA target sequence; and
a cap which hybridizes to a region at the 3 '-end of said priming oligonucleotide,
wherein the 5'-terminal base of said cap is complementary to the 3'-terminal base
of said priming oligonucleotide, and wherein said cap is modified to prevent the initiation
of DNA synthesis therefrom.
- 9. A kit for use in synthesizing and detecting multiple copies of an RNA target sequence,
said kit comprising in packaged combination:
a priming oligonucleotide which hybridizes to the 3'-end of said RNA target sequence
and primes the synthesis of a first DNA primer extension product complementary to
said RNA target sequence;
a promoter oligonucleotide comprising a first region which hybridizes to a 3'-region
of said first DNA primer extension product and a second region which is a promoter
for an RNA polymerase, said promoter oligonucleotide being modified to prevent the
initiation of DNA synthesis therefrom; and
a self-hybridizing detection probe having an oligonucleotide which hybridizes to said
RNA target sequence or its complement to give a detectable signal,
wherein an oligonucleotide which hybridizes to a region of said first DNA primer extension
product and primes the synthesis of a second DNA primer extension product complementary
to said first DNA primer extension product is not included in said kit.
- 10. A kit for use in synthesizing and detecting multiple copies of a DNA target sequence,
said kit comprising in packaged combination:
a promoter oligonucleotide comprising a first region which hybridizes to a 3'-region
of said DNA target sequence present in a target nucleic acid to form a promoter oligonucleotide:
target nucleic acid hybrid and a second region which is a promoter for an RNA polymerase,
said promoter oligonucleotide being modified to prevent the initiation of DNA synthesis
therefrom;
a priming oligonucleotide which hybridizes to the 3 '-end of an RNA product transcribed
from said promoter oligonucleotide:target nucleic acid hybrid and primes the synthesis
of a first DNA primer extension product complementary to said RNA product, wherein
said RNA product comprises a base region complementary to said DNA target sequence;
and
a self -hybridizing detection probe having an oligonucleotide which hybridizes to
said DNA target sequence or its complement to give a detectable signal, wherein an
oligonucleotide which hybridizes to a region of said target nucleic acid and primes
the synthesis of a primer extension product complementary to said DNA target sequence
is not included in said kit.
- 11. A kit for use in synthesizing multiple copies of an RNA target sequence, said
kit comprising in packaged combination:
a priming oligonucleotide which hybridizes to the 3 '-end of said RNA target sequence
and primes the synthesis of a first DNA primer extension product complementary to
said RNA target sequence;
a promoter oligonucleotide comprising a first region which hybridizes to a 3'-region
of said first DNA primer extension product and a second region which is a promoter
for an RNA polymerase, said promoter oligonucleotide being modified to prevent the
initiation of DNA synthesis therefrom; and
an extender oligonucleotide which hybridizes to said first DNA primer extension product
3' to said promoter oligonucleotide.
- 12. A kit for use in synthesizing multiple copies of an RNA target sequence, said
kit comprising in packaged combination:
a priming oligonucleotide which hybridizes to the 3 '-end of said RNA target sequence
and primes the synthesis of a first DNA primer extension product complementary to
said RNA target sequence;
a binding molecule which binds to a target nucleic acid comprising said RNA target
sequence adjacent to or near the 5'-end of said RNA target sequence; and
a promoter oligonucleotide comprising a first region which hybridizes to a 3'-region
of said first DNA primer extension product and a second region which is a promoter
for an RNA polymerase, said promoter oligonucleotide being modified to prevent the
initiation of DNA synthesis therefrom.
- 13. A kit for use in synthesizing multiple copies of an RNA target sequence, said
kit comprising in packaged combination:
a priming oligonucleotide which hybridizes to the 3 '-end of said RNA target sequence
and primes the synthesis of a first DNA primer extension product complementary to
said RNA target sequence; and
a cap which hybridizes to a region at the 3 '-end of said priming oligonucleotide,
wherein the 5'-terminal base of said cap is complementary to the 3'-terminal base
of said priming oligonucleotide, and wherein said cap is modified to prevent the initiation
of DNA synthesis therefrom.











