ATBECHDEDKESFRGBGRITLILUNLSEMCPTIESILTLVFIRO..CY..TRBGCZEEHUPLSK....IS..MT..........................*JDIM360 Ver 2.15 (14 Jul 2008) - 2999001/0201012132046378CORRECTED EUROPEAN PATENT SPECIFICATIONB9B120110223W1deBeschreibungenDescriptionfrDescriptionEP07804998.82007062520090126enenen0629108020060630EP2011022320110820090415200916201003102010102009102120100610BG20110223201108A61K 39/102 20060101AFI20090211BHEP A61P 31/04 20060101ALI20090211BHEP deVERWENDUNG BAKTERIELLER POLYSACCHARIDE FÜR BIOFILMHEMMUNGenUSE OF BACTERIAL POLYSACCHARIDES FOR BIOFILM INHIBITIONfrUTILISATION DE POLYSACCHARIDES BACTÉRIENS POUR EMPÊCHER LA FORMATION D'UN FILM BIOLOGIQUEEP-A2- 0 208 375WO-A-2006/046143US-A1- 2003 165 870WELCH R A ET AL: "Extensive mosaic structure revealed by the complete genome sequence of uropathogenic Escherichia coli" PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, NATIONAL ACADEMY OF SCIENCE, WASHINGTON, DC, US, vol. 99, no. 26, 24 December 2002 (2002-12-24), pages 17020-17024, XP002283177 ISSN: 0027-8424GHIGO, Jean-Marc33 rue des Moulins à Vent92260 Fontenay aux RosesFRVALLE, JaioneSantacruz 95° CZizur MayorESDA RE, Sandra62 rue Théodore Bac87100 LimogesFRInstitut Pasteur101020671WMAedF2260127EP28 rue du Docteur Roux75015 ParisFRCentre National de la Recherche Scientifique100779578WMAedF2260127EP3, rue Michel Ange75016 ParisFRMarcadé, Véroniqueet al100058695Cabinet Ores 36, rue de St Pétersbourg75008 ParisFRATBEBGCHCYCZDEDKEEESFIFRGBGRHUIEISITLILTLULVMCMTNLPLPTROSESISKTRIB200700287520070625enWO200800412820080110200802

The present invention pertains to the field of biolfilm prevention. More particularly, the invention provides novel components which can prevent and/or inhibit bacterial biofilm formation on various surfaces.

A biofilm is an accumulation of microorganisms embedded in a polysaccharide matrix and adherent to a biological or a non-biotic surface. Diverse microorganisms (bacteria, fungi, and/or protozoa, with associated bacteriophages and other viruses) can be found in these biofilms. Biofilms are ubiquitous in nature and are commonly found in a wide range of environments, including domestic and industrial water systems.

Biofilms are also etiologic agents for a number of disease states in mammals. Examples include infections of the oral soft tissues, teeth, middle ear, gastrointestinal tract, urogenital tract, airway/lung tissue, peritoneal membrane and eye. Biofilms also develop on medical indwelling devices, such as dental implants, urinary tract prostheses, peritoneal dialysis catheters, indwelling catheters for hemodialysis and for chronic administration of chemotherapeutic agents (Hickman catheters), cardiac implants such as pacemakers, prosthetic heart valves, ventricular assist devices (VAD), synthetic vascular grafts and stents, prostheses, internal fixation devices, percutaneous sutures, and tracheal and ventilator tubing.

Biofilm development in industrial devices such as water systems or agri-food plants also raises safety problems.

Planktonic bacteria (i.e., single-celled bacteria suspended in liquid media) are usually used as models for research and antibiotics design. However, bacteria in biofilms are far more resistant to antibiotics than their planktonic counterparts, and less accessible to the immune system. Moreover, conjugation occurs at a greater rate between cells in biofilms than between planktonic cells. This increased opportunity for gene transfer among bacteria is important, since bacteria resistant to antimicrobials or chemical biocides can transfer the genes for resistance to neighboring susceptible bacteria. Gene transfer can also convert a previous avirulent commensal organism into a highly virulent pathogen.

Biofilm formation is not limited to the attachment of bacteria to a surface. Indeed, when growing in depth, biofilm bacteria interact more between each other than with the actual physical substratum on which the biofilm initially developed. In a biofilm, bacteria can communicate through chemical signalling mechanisms, so that the community undergoes phenotypic changes when a minimum density (the quorum) is reached in the biofilm. This phenomenon, called "quorum sensing", can be responsible for the expression of virulence factors.

Besides E. coli biofilm-related polysaccharides such as colanic acid polymer, cellulose and (1-6) β-N-acetyl-glucosamine, E. coli isolates also produce two serotype-specific surface polysaccharides: the lipopolysaccharide (LPS) O antigen and capsular polysaccharide K antigen. These two classes of surface exposed polysaccharidic polymers have been shown to play indirect roles in biofilms by shielding of bacterial surface adhesin (Schembri et al., 2004).

The strategies described to date for preventing and/or disrupting biofilms are mainly based on quorum sensing inhibitors (Schachter, 2003).

The present invention provides a novel strategy for inhibiting biofilm formation, since the inventors have demonstrated, using in vitro mixed-species bacterial biofilm, that some bacteria release in the culture supernatant a soluble group II capsular polysaccharide that prevents biofilm formation by a wide range of Gram-negative and Gram-positive bacteria. As described in the experimental part below, these capsule components induce physico-chemical alterations of surface, leading to a reduction of cell-surface and cell-cell contacts that limits both initial adhesion and bacterial biofilm development.

A first object of the present invention is hence the use of a soluble group II-like capsular polysaccharide from a bacterial strain, for the preparation of a composition which prevents or inhibits adhesion of micro-organisms and/or biofilm development, in particular bacterial adhesion and/or bacterial biofilm development. In what follows, the term "polysaccharide", although used in the singular, can designate a mixture of different polysaccharides. The capsular polysaccharides produced by the bacteria are indeed of various sizes. In fact, E. coli capsules, which constitute the outermost protective layer of the cell surface, are classified into four groups based on genetic and biosynthetic criteria. Group II capsule is one of the 4 capsular types described in E. coli, and is constituted of high molecular weight and charged polysaccharidic polymers produced by most uropathogenic Escherichia coli (UPEC) and other extra-intestinal E. coli. Group II capsule displays a conserved modular genetic organization characterized by 3 functional regions. Region I (kpsFEDCUS) and region 3 (kpsMT) are conserved in all group II capsulated bacteria and encode proteins required for ABC-dependent export. Region 2 encodes a diversity of polysaccharidic structural components such as K1, K2 (CFT073), K5 and K96 capsular serotypes (Whitfield, 2006; Whitfield and Roberts, 1999). Group II-like capsules have also been described in Hemophilus influenzae and in Neisseria meningitides (Roberts, 1996).

In a preferred embodiment of the invention, a soluble group II-like capsular polysaccharide is obtained in the supernatant of a culture of bacteria selected amongst Escherichia coli, Hemophilus influenzae and Neisseria meningitidis. However, in the present text, the phrase "group II-like capsular polysaccharides" can designate capsular polysaccharides which are produced by other bacteria, provided they retain the anti-biofilm properties observed for the capsular polysaccharides produced by the above-mentioned strains. For example, capsular polysaccharides produced by the strain 47 of the ECOR collection (Ochman and Selander, 1984) are herein considered as a "group II-like capsular polysaccharide", although this strain apparently produces a hybrid group II/group III capsule.

The present invention can be performed with polysaccharides having different purification levels. For example, the crude supernatant of a bacterial culture (separated from the bacteria by filter-sterilizing or centrifugation) can be used according to the invention as a composition comprising soluble group 11-like capsular polysaccharides. However, in order to increase the anti-biofilm activity of the composition, as well as its safely, the soluble group II-like capsular polysaccharide can be obtained as a purified fraction. Three levels of purification are described in the experimental part below, as non-limitative examples. Alternatively, a composition according to the invention can be obtained directly from the bacterial culture, for example after lysis of the bacteria.

Another object of the present invention is a composition for inhibiting bacterial adhesion and/or bacterial biofilm development, which comprises a soluble group II-like capsular polysaccharide from a bacterial strain. Such a composition can comprise polysaccharides having different purification levels. In a preferred embodiment, such a composition comprises a purified fraction of the supernatant of a culture of bacteria selected amongst E. coli, H. influenzae and N. meningitidis, comprising soluble group II-like capsular polysaccharides.

The present invention also relates to a process for purifying an anti-biofilm group II-like capsular polysaccharide from a bacterial strain, comprising the following steps:

  1. (i) separating the supernatant of a culture of a bacterial strain expressing a group II-like capsule from the bacterial cells,
  2. (ii) precipitating the polysaccharides present in the obtained supernatant, and
  3. (iii) optionally, resuspending the precipitate.

The above process is preferably performed with a bacterial strain selected amongst E. coli, H. influenzae and N. meningitidis, more preferably with an uropathogenic E. coli.

In this process, step (i) can be carried out by centrifuging and/or filter-sterilizing the bacterial culture, in order to eliminate the bacterial cells. For example, in industrial processes, tangential filtration can be performed without any preliminary centrifugation. Tangential filtration can be performed continuously.

The skilled artisan can use any precipitation process known in the art to perform the second step of the above-described process. For example, the precipitation in step (ii) can be performed with three volumes of ethanol for one volume of supernatant.

In an advantageous variant of the process according to the invention, the precipitate obtained in step (ii) is first resuspended in water, dialyzed against deionised water, and then lyophilized before step (iii).

The resuspension in step (iii) can be done in water or in any buffer suitable for the intended use. An example of buffer which can be used is TrisHCl 20 mM, pH 7.5, with 25% propanol-1.

At the end of step (iii), the anti-biofilm polysaccharides are obtained as a semi-purified product, which can be used as such according to the invention, especially in applications which do not need medical-grade products.

In order to further purify the polysaccharides, the purification process can comprise an additional step (iv) of purification by chromatography, especially ion exchange chromatography, for example using a DEAE-Sepharose column. In this embodiment of the invention, an optional centrifugation step can be performed between step (iii) and step (iv), to discard the insoluble fraction.

The skilled artisan can choose any appropriate buffer for performing step (iv). An example of buffer which can be used is TrisHCl 20 mM, pH 7.5, with 25% propanol-1. According to an advantageous embodiment of the process, the precipitate is resuspended in TrisHCl 20 mM, pH 7.5, with 25% propanol-1 in step (iii), and the column used in step (iv) is equilibrated with the same buffer.

When performing a step of purification by ion-exchange chromatography, the group II-like capsular polysaccharides can be eluted using a salt gradient, for example a NaCl gradient. In an efficient embodiment of the process, described in the experimental part, the group II-like capsular polysaccharides are eluted with 300 mM NaCl in TrisHCl 20 mM, pH 7.5, 25% propanol-1.

Of course, the soluble group II-like capsular polysaccharides obtained through a process as above-described can be used, according to the invention, for the preparation of a composition which prevents or inhibits bacterial adhesion and/or bacterial biofilm development. An anti-biofilm composition comprising such purified polysaccharides is also part of the present invention.

In a particular embodiment, the composition of the present invention is formulated for preventive or therapeutic administration to a subject in need thereof. Non-limitative examples of compositions according to this aspect of the invention are oral solutions, solutions for infusion into the ear, collyrium, toothpaste or therapeutic dentifrice, etc. These compositions can be used, for example, to prevent the (re)-colonization of the gut, the lung, the ear, the sinus or any other organ or cavity, by pathogenic bacteria.

In another embodiment, the composition according to the invention is a liquid or a paste, for example a paint, which can be applied on any kind surfaces in order to prevent biofilm formation on these surfaces.

Another aspect of the present invention is an anti-biofilm coating, comprising a group II-like capsular polysaccharide from a bacterial strain. In such a coating, the group II-like capsular polysaccharide can have different purification levels, as described above. In a preferred embodiment of the coating according to the invention, the group 11-like capsular polysaccharide is from a bacterial strain selected amongst Escherichia coli, Hemophilus influenzae and Neisseria meningitidis. This coating can be obtained, for example, by application of a composition as above-described. It can also be in the form of sheets which can be applied on any kind of device on which biofilm formation must be avoided.

Accordingly, a medical or industrial device, which is at least partly coated with an anti-biofilm coating comprising a group II-like capsular polysaccharide from a bacterial strain, is also part of the present invention. Such an object can be obtained, for example, by dipping part of the device or the whole device, into a liquid composition as described above. The skilled artisan can choose the incubation duration, depending on the material, the concentration of the composition in group II-like capsular polysaccharide, the intended use, and the like. Typically, said incubation can last from 10 seconds to 30 minutes. Short incubations (≤ 1 to 5 minutes) are usually sufficient. If necessary, the coated device can then be sterilized by a variety of treatments, without damaging the coating. For example, it can be intensively washed and/or autoclaved. Any kind of device made of glass, pyrex, PVC, polycarbonate, polypropylene and the like, can advantageously be coated according to this aspect of the invention.

Non-limitative medical devices which can advantageously be coated according to this aspect of the invention are scalpels, burs and other non-disposable surgery and/or dentistry tools, and indwelling devices, such as dental implants, urinary tract prostheses, peritoneal dialysis catheters, indwelling catheters for hemodialysis and for chronic administration of chemotherapeutic agents (Hickman catheters), cardiac implants such as pacemakers, prosthetic heart valves, ventricular assist devices (VAD), synthetic vascular grafts and stents, prostheses, internal fixation devices, percutaneous sutures, and tracheal and ventilator tubing.

Non-limitative examples of industrial devices which can advantageously be coated according to this aspect of the invention are plumbing materials, such as pipes, tubes, valves and the like, air-cooled towers, warm water systems, coolant circuits of nuclear power plant, especially secondary and tertiary circuits, agri-food materials, such as silos, fermenters, colanders, etc., furniture elements such as lab tables, counter tops and the like, especially for clean rooms, etc.

The invention is further illustrated by the following figures and examples.

FIGURE LEGENDS

EXAMPLES Example 1: Methods Bacterial strains, growth conditions and microscopy analysis

Bacterial strains are listed in Table 1 below. Gram-negative bacteria were grown at 37°C in M63B1 minimal medium with 0.4% glucose (M63B1glu) or in LB rich medium. Gram-positive bacteria were grown in TSB with 0.25% glucose (TSBglu) at 37°C. The effect of CFT073 supernatant on bacterial growth and viability rate was evaluated using growth curve determination, colony forming unit count on LB plate and BacLight Live/Dead viability stain (Molecular Probes). Ferritin-staining and Scanning Electronic Microscopy was performed as described in (Bahrani-Mougeot et al., 2002). Epifluorescence and transmitted light microscopy were acquired using a Nikon E400 microscope. Autoaggregation assays were performed as described in (Beloin et al., 2006). <b>TABLE 1:</b> Strains used in this study Strains Relevant characteristics References E. coli strains CFT073 UPEC group II capsule (K2) (Mobley et al., 1990) MG1655F' MG1655 F'tet-ΔfraD plasmid (Ghigo, 2001) KS272 Commensal E. coli K-12 (Strauch and Beckwith, 1988) 1091 Commensal E. coli C. Le Bouguenec 1092 Commensal E. coli C. Le Bouguenec 1094 Commensal E. coli (Da Re and Ghigo, 2006) 1096 Commensal E. coli C. Le Bouguenec 1097 Commensal E. coli C. Le Bouguenec 1102 Commensal E. coli C. Le Bouguenec 1103 Commensal E. coli C. Le Bouguenec 1110 Commensal E. coli C. Le Bouguenec 1125 Commensal E. coli C. Le Bouguenec 1127 Commensal E. coli C. Le Bouguenec U-1 UPEC group II capsule C. Forestier U-2 UPEC group II capsule (K2) C. Forestier U-3 UPEC non-group II capsule C. Forestier U-4 UPEC group II capsule C. Forestier U-5 UPEC group 11 capsule C. Forestier U-6 UPEC group II capsule (K2) C. Forestier U-7 UPEC non-group II capsule C. Forestier U-8 UPEC group II capsule C. Forestier U-9 UPEC group 11 capsule C. Forestier U-10 UPEC group II capsule C. Forestier U-11 UPEC non-goup II capsule C. Forestier U-12 UPEC group II capsule C. Forestier U-13 UPEC group II capsule C. Forestier U-14 UPEC non-group 11 capsule C. Forestier U-15 UPEC group II capsule C. Forestier U-16 UPEC group II capsule C. Forestier U-17 UPEC non-group II capsule C. Forestier U-18 UPEC non-goup II capsule C. Forestier U-19 UPEC group II capsule C. Forestier U-20 UPEC group II capsule C. Forestier U-21 UPEC group II capsule (K2) C. Forestier 984 Commensal E. coli group II capsule (K1) M.C. Ploy 988 Commensal E. coli group II capsule (K1) M.C. Ploy 999 Commensal E. coli group II capsule (K1) M.C. Ploy 1007 Commensal E. coli goup II capsule (K1) M.C. Ploy 1014 Commensal E. coli group II capsule (K1) M.C. Ploy 1HE3034 E. coli causing meningitis group II capsule (K1) (Meier et al., 1996) EcoR strains E. coli Reference Collection (72 strains) (Ochman and Selander, 1984) Other bacteria 15981 S. aureus clinical strain (Valle et al., 2003) V329 S. aureus bovine mastitis subclinical isolate (Cucarella et al., 2001) O-47 S. epidermidis clinical strain (Heilmann et al., 1996) CH845 S. epidermidis clinical strain BM94314 (Galdbart et al., 2000) 54 E. faecalis clinical strain (Toledo-Arana et al., 2001) 11279 E. faecalis clinical strain (Toledo-Arana et al., 2001) KP21 Klebsiella pneumoniae strain C. Forestier PAK Pseudomonas aeruginosa (Vasseur et al., 2005) 8013 Neisseria meningitidis strain, serogroup C, class 1 (Deghmane et al., 2002) Mutants 44H3 CFT073 kpsD::TnSC189 This study 25F11 CFT073 kpsD::TnSC189 This study 23D5 CFT073 kpsU::TnSC189 This study 16B9 CFT073 kpsU::TnSC189 This study 14E12 CFT073 kpsC::TnSC189 This study 76H11 CFT073 kpsS::TnSC189 This study 30H8 CFT073 kpsM::TnSC189 This study ΔkpsD CFT073 kpsD::km This study ΔkpsC CFT073 kpsC::km This study ΔkpsU CFT073 kpsU::km This study ΔkpsS CFT073 kpsD::km This study ΔkpsM CFT073 kpsM::km This study Δ3692 CFT073 Δ3692::km This study Δ3693 CFT073 Δ3693::km This study Δ3694 CFT073 Δ3694::km This study Δ3695-96 CFT073 Δ3695Δ3696::km This study ΔR1 CFT073 with a deletion from kpsD to kpsS This study Δ2 CFT073 with a deletion from c3692 to c3696 This study ΔR3 CFT073 with a deletion from kpsT to kpsM This study U-9 ΔkpsD U-9 kpsD::km This study U-15 ΔkpsD U-15 kpsD::km This study IHE3034 ΔkpsD IHE3034 kpsD::km This study ΔluxS CFT073 ΔluxS This study CFT073gfp CFT073λATTgfp This study ΔR1gfp ΔR1λATTgfp This study ΔoxyR MG1655 oxyR::km (Beloin et al., 2006) ompR234 MG1655 ompR234 malA::km (Vidal et al., 1998)

Biofilm formation procedures

Microfermentors experiments: Biofilm was performed as described previously (Ghigo, 2001). Mixed biofilm cultures: an 8 hours MG1655F' biofilm formed in the internal microfermentors glass slide was infected with 1 OD600nm equivalent of CFT073-gfp overnight culture. After 24 hours of continuous culture in M63B1glu, pictures of the glass slides were taken. Biofilm biomass was estimated by determining the OD600nm of the resuspension of the biofilm formed on the internal glass slide (Ghigo, 2001). Biofilm inhibition assays: the incoming medium was mixed in a 1:1 ratio with filtered supernatants and brought into the microfermentors at different time after bacteria inoculation (0, 1, 6 or 24 hours). The biofilm was further cultivated for an additional 24 hours before biomass determination. Analysis of bacterial interaction with treated surfaces: the glass slides were incubated I min with filtered CFT073 supernatant and rinsed once in deionised water prior to inoculation in microfermentors. Biofilm formation on the slide was determined after 24 hours.

Microtiter plate experiments. Static biofilm formation assay were performed in 96-well PVC microtiter plates (Falcon) as described in (O'Toole and Kolter, 1998). Biofilm inhibition assays: overnight cultures were adjusted to OD600=0.04 before inoculating 100 µl in 96-well plates in the presence or absence of 50 µl of supernatant. Flow-chamber experiments. Biofilms were performed in M63B1glu at 37°C in 3 x channels flow-cells (1 × 4 × 40 mm). The flow system was assembled and prepared as described in (Christensen et al., 1999). Inocula were prepared as follows: 16-20 hours old overnight cultures in M63B1glu were harvested and resuspended as normalized dilutions (OD600=0.005). 300 µl were injected into each flow channel. Input medium was mixed in a 1:1 ratio with filtered supernatant. Flow was started 1 h after inoculation at a constant rate of 3 ml h-1 using a Watson Marlow 205S peristaltic pump. All Assays were at least performed in triplicate.

Purification of CFT073 or other group II capsulated strain supernatants displaying anti-biofilm activity

Three levels of purification have been tested:

  1. (i) Filtration (sterilization) of the active supernatants (S.CFT, used in all the experiments on microtiter plates or in microfermentors)
    • Overnight cultures in M63B1glucose 0.4% were centrifuged for 30 min at 5000 rpm at 4°C and filtered through 0.25 µm filter to eliminate bacteria.
  2. (ii) Precipitation of polysaccharides contained in active supernatants
    • The polysaccharides contained in the filtered supernatant were precipitated with 3 volumes of ethanol, resuspended in deionized water and dialyzed against deionized water in 10 kDa cut-off dialysis cassettes (Pierce biochemical).
  3. (iii) purification of the capsular polysaccharides active fraction (capsular active fraction FR2)
    • the partially purified supernatant active fraction obtained in step (ii) was lyophilized and resuspended in 80 ml of buffer Tris HCl 20 mM pH 7.5 containing 25% de propanol-1.
    • This resuspension was centrifuged for 10 minutes at 3000 rpm to eliminate the insoluble particles.
    • the soluble supernatant was loaded on a DEAE-Sepharose column (30 ml, 2.6 x 6 cm, Amersham) and equilibrated with Tris HCl 20 mM pH 7.5, 25% de propanol-1 buffer.
    • the column was washed with Tris HCl 20 mM pH 7.5, 25% propanol-1 buffer at the rate of 20 ml/h.
    • After the wash, the column was eluted with a NaCl gradient (0 to 1 M in 400 ml) and the polysaccharide concentration of each eluted fractions (4.5 ml) was tested by the Dubois method (Dubois et al., 1956): 100 µl of phenol at 5% and 500 µl of concentrated sulfuric acid followed by vortex agitation and read at 492 nm)
    • The positive fractions (about 10 fractions of 4.5 ml) were pooled together and dialyzed against deionized water and lyophilized
    • 1 mg of the lyophilysate was resuspended in 1 ml of deionized water

Handling of culture supernatants and polysaccharide analysis

Overnight cultures in M63B1glu at 37°C were centrifuged 30 minutes at 5000 rpm at 4°C. After filtration of the supernatant with a 0.2 µm filter, macromolecules were precipitated with 3 volumes of ethanol and dialysed against deionised water using 10kDa cassettes (Pierce). Total amounts of phosphate and neutral sugars were determined by ammonium molybdate/ascorbic acid and phenol/sulfuric acid methods, respectively. Polysaccharide composition was determined by HPLC (ion-exclusion column) and by gas liquid chromatography as in (d'Enfert and Fontaine, 1997; Fontaine et al., 2000). CFT073 supernatant active fraction, FR2, was purified using a DEAE-Sepharose column (Amersham) and eluted with 300 mM NaCl in 25% propanol-1,20 mM TrisHCl pH7.5. Molecular weight of the polymer was estimated by gel filtration chromatography on Superdex-200 (Amersham) using dextran as standard. Polysaccharide degradations were done by total acid hydrolysis (trifluoroacetic acid, 4N, 4H, 100°C) or by aqueous hydrofluoric acid (48% aq. HF, 2 days on water-ice).

Mutagenesis and molecular techniques

Mariner transposon mutagenesis of E. coli CFT073 was performed as described in (Da Re and Ghigo, 2006). The supernatants of 10,000 transposon mutants incubated 24h, in LB at 37°C in 96-well microtiter plates were extracted after centrifugation of the plates 15 min at 10000rpm and their effect on MG1655F' biofilm formation was analysed. Transposon insertion sites were determined as described in (Da Re and Ghigo, 2006). Homology searches were performed using Blast 2.0. Deletion mutants were generated as detailed at http://www.pasteur.fr/recherche/unites/Ggb/3SPCRprotocol.html, using primers presented in Table 2. <b>TABLE 2:</b> Primers used in this study. Target gene Primer name Sequence SEQ ID No: Primers used to generate deletion mutants kpsD KpsD.500-5 gaccagcttgcctttgcagaaacg 1 KpsD.500-3 ctttttcagcattacgcggatagg 2 KpsD.GB.L-5 TGCTCGATGAGTTTTTCTAAGGAGTTGAAatgagcaa 3 KpsD.GB.L-3 gattttgagacacaacgtggctttCATcacAAACTCATTCAGCGACA 4 KpsD.ext-5 ttgcgcttaagtttaaccaaaccg 5 KpsD.ext-3 gctctggcatggactccggtaact 6 kpsU KpsU.500-5 atgaacgcagttcagctttatcgcc 7 KpsU.500-3 ccaaatttcggcttgaggattttc 8 KpsU.GB.L-5 TGCTCGATGAGTTTTTCTAAcaggaactggctgaaaacgcatga 9 KpsU.GB.L-3 gattttgagacacaacgtggctttCATTTCAACTCCttacaaagacaga 10 KpsU.ext-5 tgcagaacggcgataccttaatcg 11 KpsU.ext-3 ctcggcaatcaaacgtactcgttg 12 kpsC KpsC.500-5 gaggcagatatcaacattaacc 13 KpsC.500-3 gttgaaggttttaagttctcaac 14 KpsC.GB.L-5 TGCTCGATGAGTTTTTCTAAACAATTTCATAGTTGACTATTAC 15 KpsC.GB.L-3 gattttgagacacaacgtggctttgagtaaatgccaatcatgcgttttc 16 KpsC.ext-5 cgactcacattacgattatgcg 17 KpsC.ext-3 gaaaatgatttgtggtggcggtagc 18 kpsS KpsS.500-5 agagcaaccttgagttattacg 19 KpsS.500-3 aaagacaagggatagctttagg 20 KpsS.GB.L-5 TGCTCGATGAGTTTTTCTAATTTATTCTAAATTATCAACG 21 KpsS.GB.L-3 gattttgagacacaacgtggcttCATAAATAATCTGTGTAATAGTCAA 22 KpsS.ext-5 agcgactggttgaaagcaaactg 23 KpsS.ext-3 ttcgatgagtcaagactattgg 24 kpsM KpsM.500-5 TTACTACGCATAAAATTCATGG 25 KpsM.500-3 aatgccatgcttaaaccaaagcc 26 KpsM.GB.L-5 TGCTCGATGAGTTTTTCTAAcaatgctgacatcatgattaagattg 27 KpsM.GB.L-3 gattttgagacacaacgtggctttcttgccatTTGGTGATGTGATCCT 28 KpsM.ext-5 TCGCATGCGTTCTGGTTTGAG 29 KpsM.ext-3 cacatcacaaaactctttcaatg 30 Kps KpsD.500-5 gaccagcttgcctttgcagaaacg 31 KpsS.500-3 aaagacaagggatagctttagg 32 KpsD.GB.L-3 gattttgagacacaacgtggctttCATcacAAACTCATTCAGCGACA 33 KpsS.GB.L-3 gattttgagacacaacgtggctttCATAAATAATCTGTGTAATAGTCAA 34 KpsD.ext-5 ttgcgcttaagtttaaccaaaccg 35 KpsS.ext-3 ttcgatgagtcaagactattgg 36 Kps KpsR2.500-5 atataggagtatggagcgaaac 37 KpsR2.500-3 ttgagtaaggaatatggcttag 38 KpsR2.GB-L5 TGCTCGATGAGTTTTTCTAAGAAATCAGACGAGTTTTC 39 KpsR2.GB-L3 gattttgagacacaacgtggctttcataacatACTATGTCCCCATGATTATT 40 KpsR2.ext-5 catgtactcattttcacgtaaag 41 KpsR2.ext-3 tgctaaaattgcattattaggtc 42 Kps KpsM.500-5 TTACTACGCATAAAATTCATGG 43 KpsR3.500-3 AATTAACCATATCTTTTGATTTGAG 44 KpsR3.GB-L5 TGCTCGATGAGTTTTTCTAAatcagacttgtctttatcag 45 KpsM.GB.L-3 gattttgagacacaacgtggctttcttgccatTTGGTGATGTGATCCT 46 KpsM.ext-5 TCGCATGCGTTCTGGTTTGAG 47 KpsR3.ext-3 cctagcaacaaaatatttagcgac 48 Kp95- Kps95-96.500-aaacaatatcatggccagtcgg 49 Kps95-96.500- aataacgttcaggtattgaagg 50 Kps95-96.GB- TGCTCGATGAGTTTTTCTAAccttgaGGTCTATATAACTGAA 51 Kps95-96.GB- gattttgagacacaacgtggctttcatcaaatgtaccaaaggtgataac 52 Kps95-96.ext- taaatcaacgttactgagaatg 53 Kps95-96.ext- gaatatccgagtgcataatacc 54 Kps95-96-500- aaacaatatcatggccagtcgg 55 C3694 c3694.500-5 aagcattagaattggaaccc 56 c3694.500-3 ctttccatgtattcctctccaag 57 c3694.GB.L-5 TGCTCGATGAGTTTTTCTAAgtgcaagtatttcttgtaaccc 58 c3694.GB.L-3 GATTTTGAGACACAACGTGGCTTTCATatacgcatcaatagccttagccc 59 c3694.ext-5 gcggagagctattttaaagcagg 60 c3694.ext-3 cggaaaacgatatgacaatcctg 61 C3693 c3693.500-5 gtttattgttgcaggcatccaag 62 c3693.500-3 atgccgttagatagttttattcc 63 c3693.GB.L-5 TGCTCGATGAGTTTTTCTAAatggatgctcaaaaggaggtacg 64 c3693.GB.L-3 GATTTTGAGACACAACGTGGCTTTCATcagcattggttggtaatgcatttg 65 c3693.ext-5 acatattaacagtaatataacc 66 c3693.ext-3 ctacaaatttggatactgcaaatc 67 C3692 c3692.500-5 ttatacttgcggtgatttgcag 68 c3692.500-3 ATGACTCATAAAAATATATTCC 69 c3692.GB.L-5 TGCTCGATGAGTTTTTCTAAtatttacagaataattattctgg 70 c3692.GB.L-3 GATTTTGAGACACAACGTGGCTTTCATtaagccaatagtcttgactcatcg 71 c3692.ext-5 aattcatatgattgtagcaatg 72 c3692.ext-3 CAACGTAGAATAAAAGCATTACC 73 luxS LuxS.500-5 AAACTGCGCAGTTCCCGTTACC 74 LuxS.500-3 CCTGATTTTGTTCCCTGGGAGG 75 LuxS.GB-L5 TGCTCGATGAGTTTTTCTAATCAGTGGAACAAAAGAAG 76 LuxS.GB-L3 gattttgagacacaacgtggctttcatTTAGCCACCTCCGGTAATTT 77 LuxS.ext-5 CTGGAACCGGGTGATCCTCGAAG 78 LuxS.ext-3 AGCAACAATGCTGGGGAAAAATGC 79 Primers used for Kps95-F aacgaaaattgcttgctctggc 80 Kps94-R cggtgccaagtttgaaataacg 81 Kps94-F gaaaatagtgtagacggtctcttc 82 Kps92-R tttggatactgcaaatcaccgc 83 KpsIIf GCGCATTTGCTGATACTGTTG 84 KpsK2r AGGTAGTTCAGACTCACACCT 85 Primers used to check KmGB.verif-5 TGGCTCCCTCACTTTCTGGC 86 KmGB.verif- 3 ATATGGCTCATAACACCCCTTG 87 Primers used for ARB1 ggCCACgCgTCgACTAgTAC,'NNNNNNNNNNgATAT 88 ARB6 ggCCACgCgTCgACTAgTACNNNNNNNNNNACgCC 89 ARB2 ggCCACgCgTCgACTAgTAC 90 IR2 CTgACCgCTTCCTCgTgCTTTACgg 91 IR2-60-5 TTCTGAgcgggactctggggtacg 92

Analysis of the physico-chemical properties of the active fractions

Zeta potential was measured as in (Caruso et al., 1999) after 20 minutes of incubation of 10 µm in diameter cationic colloids latex particles with dialyzed precipitated supernatants (i.e., the level (ii) of purification indicated above). The latex particles bear permanent net positive charge due to their polyethylenimine (PEI) coating. The layer of PEI is a branched 6400 dalton molecular weight polymer bearing approximatively 50% of methylated quaternary functions which confer a stable positive charge to the molecule. This polymer was deposited in aqueous phase on the initially carboxylated particles (Decher, 1997). Hydrophilic properties of the supernatants were investigated by determining the contact angle formed by a 2.5 µl ultrapure water droplet with a glass plane surface previously incubated in the supernatants for 20 minutes. Surface interactions were analyzed by monitoring the adsorption of propidium iodide on supernatant-treated cationic colloids. The affinity of the treated surfaces for the fluorescent probe was tested using flow cytometry (Leboeuf and Henry, 2006) and fluorescence microscopy. All incubations of particles with supernatant were performed at low particle/volume fraction (ca. 0.2%) likely leading to surface saturation by the active species.

In vivo mice experiments

CFT073 and CFT073ΔR1 in vivo colonization were performed as described previously (Maroncle et al., 2006). Mice were intragastrically fed with 1010 CFU. Bacteria contained in fecal samples were numbered on agar plates. For examination of bacterial growth in the host, mice were sacrificed at various times after inoculation; colon and caecum were homogenized in physiological water, and plated to determine cfu per gram of tissue.

Example 2: anti-biofilm activity of CFT073 supernatant

In order to study UPEC interactions within multicellular biofilm (Hall-Stoodley et al., 2004) bacterial communities, an in vitro mixed bacterial biofilm model in microfermentors was developed (Ghigo, 2001). Using this model, a 8 hours biofilm formed by the commensal strain of E. coli K12 MG1655 F' was inoculated with different titers of the UPEC strain CFT073, and further cultivated for 24 hours. Upon increasing titers of CFT073, a strong reduction of the E. coli K12 MG1655 F' biofilm development was observed, which was not observed when the commensal E. coli strain KS272 was used (Fig. 1A). This suggested that CFT073 could prevent MG1655 F' biofilm formation either by direct contact or by secretion of an inhibitory molecule. To distinguish between these two possibilities, the supernatant of CFT073 stationary phase culture was filter-sterilized and its effect on E. coli biofilm formation was tested. In the presence of CFT073 supernatant, MG1655 F' biofilm was severely affected (Fig. 1B,C). This biofilm inhibition did not result from a growth defect due to a bactericidal or bacteriostatic activity, since MG1655 F' growth rate and cell viability were not affected by the CFT073 supernatant (Fig. 1D,E).

In order to determine the spectrum of the anti-biofilm activity of CFT073 supernatant, its effect was tested on several adherent bacteria (E. coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, Staphylococcus aureus, S. epidermidis and Enterococcus faecalis). This analysis showed that CFT073 supernatant was active against a surprisingly wide range of bacteria, even in mixed cultures (Fig. 1F and Fig. 2).

Example 3: Correlation between anti-biofilm activity and type-II capsule

To elucidate the genetic basis of the anti-biofilm effect, the supernatant activity of ca. 10,000 CFT073 random mariner transposon insertion mutants was tested. The inventors identified seven candidates impaired in their ability to inhibit MG1655 F' biofilm formation. All these mutants mapped in genes involved in the expression of the group II capsular polysaccharide, the outermost bacterial cell surface structure (Whitfield and Roberts, 1999). Group II capsule displays a conserved modular genetic organization characterized by 3 functional regions (Roberts, 1996) (Fig. 3A). Region 1 (kpsFEDCUS) and region 3 (kpsMT) are conserved in all group 11 capsulated bacteria and encode proteins required for the ABC-dependent polysaccharide export. Region 2 is variable and encodes polysaccharide serotypes such as K1, K2 (CFT073), K5, K96 (Roberts, 1996). The R1, R2 or R3 region, or each individual kps gene was deleted and it was observed that, except for kpsU, c3692 and c3693, all the mutants lost the ability to inhibit E. coli biofilm formation, which correlated with a reduced amount of precipitated sugars in the supernatant (Fig. 3B, 3C). While a ferritin-stained capsule could still be detected around CFT073 cells (Fig. 3D), these results indicated that the CFT073 capsule nevertheless undergoes a significant release into the medium supernatant that is responsible for the observed anti-biofilm effect.

In order to determine whether biofilm inhibition was an exclusive property of E. coli CFT073 supernatant, the inventors screened several clinical uropathogenic bacterial isolates of Klebsiella, Proteus, Enterobacter, Morganella, Citrobacter and Serratia, as well as a collection of 110 E. coli strains of diverse origins. They found that only the filtered supernatant of 40 E. coli, including 17 UPEC, inhibited biofilm formation on a wide range of bacteria without affecting growth rate (Fig. 4A). Moreover, as CFT073 E.coli strain, all active strains are able to inhibit biofilm formation of adherent bacteria other than E.coli (in Fig. 4A see 15981 S. aureus biofilm data). Using specific PCR probes (Johnson and O'Bryan, 2004), they showed that 39 of the 40 active E. coli strains carried group II capsule genes. The 40th bacterium, EcoR47, seems in fact to produce a hybrid group II/group III capsule. This strain has been shown to carry group II KPS genes (Boyd and Hartl, 1998). Consistently, the introduction of a kpsD mutation into the clinical UPEC isolates U-9 and U-15 abolished the biofilm-inhibitory effect of their supernatants (Fig. 4B). Interestingly, although CFT073, U-9 and U-15 strains displayed a very limited ability to form biofilm in the microfermentor biofilm model, their respective kpsD mutants displayed an increased biofilm phenotype. This phenotype could be reverted upon the addition of CFT073 supernatant, suggesting that these strains could also self-inhibit their own adhesion (Fig. 4C).

A biofilm formation inhibition test was also performed with a strain of Neisseria meningitidis, the capsule of which is biochemically very similar to the group II capsule of E. coli. Interestingly, the results show that the supernatant of N. meningitidis also inhibits the biofilm formation of E. coli MG1655F' (Fig. 5), demonstrating that anti-biofilm activity is a property not only of the group II capsule from E. coli but also of capsules known to be similar to the latter (i.e., group II- like capsules).

Example 4: Physico-chemical properties of the CFT073 supernatant

When the inventors analyzed the composition of the polysaccharidic fractions precipitated from the active supernatants of different group II capsule E. coli serotypes, including CFT073 (K2), U-9 (non-K2) and IHE3034 (K1), they observed, in agreement with previous studies (Jann et al., 1980; Silver and Vimr, 1984), that these fractions displayed significantly different compositions (data not shown). This suggested that, although biochemically distinct, group II capsules released by these strains could share a similar mode of action leading to biofilm inhibition. To further study the mechanisms by which group II capsule inhibit bacterial biofilm formation, these fractions were brought into contact with cationic colloids composed of 10 µm in diameter latex particles bearing permanent net positive charge due to their polyethylenimine coating. The determination of the interface ζ (Zeta) potential showed that the wild-type supernatants induced a strong charge inversion of the cationic colloids, indicative of their highly anionic nature as compared to the supernatants of their respective capsule mutants (Fig. 6a). Moreover, the treatment of acid-cleaned glass slides with active supernatant lowered the water-slide interfacial energy, which is indicative of their hydrophilic nature (Fig. 6b).

To analyze whether group II capsule could induce surface modifications and affect intermolecular forces on the treated surfaces, the inventors monitored the adsorption of propidium iodide, a fluorescent amphiphillic cationic ion, on colloids coated with active or inactive supernatants. They first showed that anionic but inactive supernatant of the non-group II capsulated E. coli EcoR72 displayed strong affinity for the cationic fluorescent probe (Fig. 6c). Despite their high negative charge, active supernatants displayed significantly lower probe affinity than inactive but less negatively charged capsule mutant supernatants (Fig. 6c and 6d). This effect was even more pronounced with the 500 kDa K2 capsular active fraction (FR2) purified from CFT073 by anion exchange-chromatography containing galactose, glycerol, phosphate and acetate in the molar ratio of 1: 2: 1: 1 (Jann et al., 1980) (Fig. 6c and 6d). Therefore, these results showed that, besides strong electrostatic modifications, active supernatants also induced a profound remodelling of the colloid surface properties, possibly including surface hydration and steric repulsion. These analyses confirm that the surface modifications induced by group 11 capsule are more critical for the biofilm inhibition activity than the capsule primary composition.

Example 5: Prevention of biofilm development

The physico-chemical properties displayed by group II capsule might deeply alter bacterial ability to interact with surfaces and therefore drastically reduce adhesion (Neu, 1996). To test this hypothesis, the capacity of both MG1655 F' and S. aureus to adhere to glass surfaces pre-treated with CFT073 supernatant was analysed. After I hour of incubation, E. coli MG1655 F' and S. aureus 15981 exhibited a 3-fold reduction in their initial adhesion on treated surface (data not shown). Consistently, pretreatment of the internal microfermentor glass slide with CFT073 supernatant drastically reduced biofilm formation by E. coli and a wide range of Gram-positive and Gram-negative bacteria (Fig. 7). The same effect was observed when CFT073 supernatant was perfused in the microfermentor (Fig. 2B). No effect was observed when a similar treatment was performed with CFT073ΔkpsD supernatant (Fig. 7). These results therefore suggested that the surface modifications induced by capsular polysaccharides released in the CFT073 supernatant could interfere with biofilm formation by impairing initial bacterial-surface interactions.

Remarkably, the anti-biofilm effect of the CFT073 supernatant persisted even after drastic treatments of the glass slide (Fig. 8), which suggests that the group II capsule could be used in applications which necessitate a sterilisation step (such as agro-industrial or medical applications).

In order to investigate the effect of CFT073 supernatant on already existing biofilms, microfermentors inoculated with MG1655 F' at different stages of biofilm maturation were supplemented with filtered CFT073 supernatant. This analysis showed that, whereas the treatment of a mature 24 h biofilm did not induce biofilm dispersal, addition of the CFT073 supernatant at 0, 1 and 6 h after MG1655 F' biofilm initiation blocked its further development (Fig. 9A). The inventors then examined the in vitro biofilm characteristics of a GFP-tagged MG1655F' after addition of CFT073 supernatant and confocal laser scanning microscopy (CLSM). After 3h post initial inoculation, the adddition of active CFT073 exogenous supernatant on a regularly covered surface profoundly affected MG1655F' mature biofilm structure development (Fig 9B). This effect was not observed upon control KS272 supernatant treatment.

The direct contribution of bacterial surface structures to the tridimensional E. coli biofilm structure has been amply demonstrated (Beloin et al., 2005). These structures have also been shown to mediate bacterial aggregation and clumping in standing cultures. To further characterize the role of group II capsule in biofilm maturation, the inventors tested its effects on bacterial aggregation mediated by several different surface-exposed factors also involved in biofilm formation. It was shown that CFT073 supernatant prevents formation of bacterial aggregates induced by different types of bacterial surface structures (Fig. 9C).

The anti-biofilm activity of different concentrations of the FR2 fraction was tested in microtiter plate assays. This showed that the purified FR2 fraction is active at concentrations starting from 50 µg/ml (Fig. 10).

Taken together, these results suggest that the physico-chemical properties of the group II capsular polysaccharides affect biofilm formation by weakening cell-surface contacts (initial adhesion) but also by reducing cell-cell interactions (biofilm maturation).

In conclusion, the inventors demonstrated that group II-like capsular polysaccharides are released in the culture supernatant and display anti-adhesion properties against a wide range of bacteria, including important nosocomial pathogens. This study reveals a novel property of the group II capsular polysaccharides that are commonly expressed by extra-intestinal E. coli, but also by other pathogens such as Neisseria meningitides (Kaijser, 1973; Sandberg et al., 1988), which supernatant could also inhibit E. coli biofilm formation (data not shown). Group II capsule has been shown to be involved in UPEC virulence by increasing their resistance to phagocytosis and to the bactericidal effects of human serum (Cross et al., 1986; Kaper et al., 2004; Pluschke et al., 1983; Russo et al., 1995). Capsule could also play an important biological role in UPEC interactions with living and inert surfaces. In particular, besides bacterial competition, the inhibition of UPEC own adhesion by group II capsule secretion may contribute to gastrointestinal tract colonisation by reducing bacteria-bacteria interactions (Schembri et al., 2004), thus avoiding bacterial clearance due to clump formation (Favre-Bonte et al., 1999). Consistently, it was observed that an uncapsulated CFT073ΔRI mutant is unable to colonize the mouse intestine (Fig. 11).

The in vitro analyses indicate that group II capsule can induce surface modifications such as charge inversion of cationic surface, increased surface wettability and molecular repulsion, leading to non-specific anti-adhesion properties. Since this inhibitory effect was observed in both exponential and stationary growth phase supernatants as well as in a quorum-sensing ΔluxS mutant of CFT073 (Fig. 12), this suggests that the anti-biofilm effect does not involve cell-signaling (Waters and Bassler, 2005), but rather acts through physico-chemical alteration, of either abiotic or bacterial surfaces. Polymers assembling on surfaces are known to cause strong physical repulsion depending on their density, size, solvation and structure (de Gennes, 1987). Such repulsive forces created by capsule polymers could limit initial bacterial adhesion and biofilm development by interfering with subsequent cell-cell contacts. Finally, the inventors showed that the application of group II capsular polysaccharides on abiotic surfaces reduces bacterial initial adhesion, and has enough long-lasting effect to significantly inhibit mature biofilm development of a broad-spectrum of bacteria. This finding may have far reaching implications in the design of therapeutic strategies to limit the formation of pathogenic biofilms, for example, on medical implants.

REFERENCES

SEQUENCE LISTING

Use of a soluble group II-like capsular polysaccharide from a bacterial strain, for the preparation of a composition which prevents or inhibits bacterial adhesion and/or bacterial biofilm development. The use of claim 1, wherein said soluble group II-like capsular polysaccharide is obtained in the supernatant of a culture of bacteria selected amongst Escherichia coli, Hemophilus influenzae and Neisseria meningitidis. The use of claim 1 or claim 2, wherein said soluble group II-like capsular polysaccharide is obtained as a purified fraction. A composition for inhibiting bacterial adhesion and/or bacterial biofilm development, characterized in that it comprises a soluble group II-like capsular polysaccharide from a bacterial strain The composition of claim 4, which comprises a purified fraction of the supernatant of a culture of bacteria selected amongst E. coli, H. influenzae and N. meningitidis. A process for purifying an anti-biofilm group II-like capsular polysaccharide from a bacterial strain, comprising the following steps: (i) separating the supernatant of a culture of a bacterial strain expressing a group II-like capsule from the bacterial cells, (ii) precipitating the polysaccharides present in the obtained supernatant, and (iii) optionally resuspending the precipitate. The process of claim 6, wherein said bacterial strain expressing a group II-like capsule is selected amongst E. coli, H. influenzae and N. meningitidis. The process of claim 6 or claim 7, wherein said bacterial strain is an uropathogenic E. coli. The process of any of claims 6 to 8, wherein the separation in step (i) is performed by filter-sterilization and/or by centrifugation of the culture The process of any of claims 6 to 9, wherein the precipitation in step (ii) is performed with three volumes of ethanol for one volume of supernatant. The process of any of claims 6 to 10, wherein the precipitate obtained in step (ii) is resuspended in water, dialyzed against deionised water, and then lyophilized before step (iii). The process of any of claims 6 to 11, further comprising an additional step (iv) of purification by ion exchange chromatography. The process of claim 12, wherein step (iv) is performed using a DEAE-Sepharose column. The process of claim 12 or claim 13, wherein the resuspension in step (iii) is done in TrisHCl 20 mM, pH 7.5, with 25% propanol-1, and the column used in step (iv) is equilibrated with the same buffer. The process of any of claims 12 to 14, wherein a centrifugation step is performed between step (iii) and step (iv) to discard the insoluble fraction. The process of any of claims 12 to 15, wherein said group II-like capsular polysaccharide is eluted with 300 mM NaCl in TrisHCl 20 mM, pH 7.5, 25% propanol-1. The use of any of claims 1 to 3, or the composition of claim 4 or 5, wherein said soluble group II-like capsular polysaccharide is obtained through a process according to any of claims 6 to 16. The composition of any of claims 4, 5 and 17, which is formulated for preventive or therapeutic administration to a subject in need thereof. An anti-biofilm coating, characterized in that it comprises a group II-like capsular polysaccharide from a bacterial strain. The anti-biofilm coating of claim 19, characterized in that said group II-like capsular polysaccharide is from a bacterial strain selected amongst Escherichia coli, Hemophilus influenzae and Neisseria meningitidis. The anti-biofilm coating of claim 19 or claim 20, characterized in that it has been obtained by application of a composition of any one of claims 4, 5 and 17. A medical or industrial device, characterized in that it is at least partly coated with an anti-biofilm coating according to any of claims 19, 20 and 21. Verwendung eines löslichen Gruppe II-ähnlichen Kapselpolysaccharids aus einem Bakterienstamm für die Herstellung einer Zusammensetzung, welche eine bakterielle Adhäsion und/oder die Entwicklung eines bakteriellen Biofilms verhindert oder inhibiert. Die Verwendung nach Anspruch 1, wobei das lösliche Gruppe II-ähnliche Kapselpolysaccharid enthalten ist in dem Überstand aus einer Bakterienkultur, ausgewählt aus Escherichia coli, Hemophilus influenzae und Neisseria meningitidis. Die Verwendung nach Anspruch 1 oder Anspruch 2, wobei das lösliche Gruppe II-ähnliche Kapselpolysaccharid erhalten wird als eine gereinigte Fraktion. Eine Zusammensetzung zum Inhibieren der bakteriellen Adhäsion und/oder einer bakteriellen Biofilmentwicklung, dadurch gekennzeichnet, dass sie ein lösliches Gruppe II-ähnliches Kapselpolysaccharid aus einem Bakterienstamm umfasst. Die Zusammensetzung nach Anspruch 4, welche eine gereinigte Fraktion aus dem Überstand einer Bakterienkultur, ausgewählt aus E. coli, H. influenzae und N. meningitidis, umfasst. Ein Verfahren zum Reinigen eines Gruppe II-ähnlichen Kapsel-Anti-Biofilm-Polysaccharids aus einem Bakterienstamm, welcher die folgenden Schritte umfasst: (i) Trennen des Überstands einer Kultur aus einem Bakterienstamm, welcher eine Gruppe II-ähnliche Kapsel aus den Bakterienzellen bildet, (ii) Präzipitieren des Polysaccharids, welches in dem erhaltenen Überstand vorliegt, und (iii) gegebenenfalls Resuspendieren des Niederschlags. Das Verfahren nach Anspruch 6, wobei der Bakterienstamm, der eine Gruppe II-ähnliche Kapsel bildet, ausgewählt wird aus E. coli, H. influenzae und N. meningitidis. Das Verfahren nach Anspruch 6 oder Anspruch 7, wobei der Bakterienstamm ein uropathogener E. coli ist. Das Verfahren nach irgendeinem der Ansprüche 6 bis 8, wobei die Trennung in Schritt (i) durchgeführt wird durch Filtersterilisation und/oder durch Zentrifugation der Kultur. Das Verfahren nach irgendeinem der Ansprüche 6 bis 9, wobei die Präzipitation in Schritt (ii) durchgeführt wird mit drei Volumina an Ethanol auf ein Volumen Überstand. Das Verfahren nach irgendeinem der Ansprüche 6 bis 10, wobei das Präzipitat, welches in Schritt (ii) erhalten wird, in Wasser resuspendiert wird, gegen deionisiertes Wasser dialysiert wird und dann vor Schritt (iii) lyophilisiert wird. Das Verfahren nach irgendeinem der Ansprüche 6 bis 11, ferner umfassend einen zusätzlichen Schritt (iv) des Reinigens durch lonenaustauschchromatografie. Das Verfahren nach Anspruch 12, wobei Schritt (iv) durchgeführt wird unter Verwendung einer DEAE-Sepharosesäule. Das Verfahren nach Anspruch 12 oder Anspruch 13, wobei die Resuspendierung in Schritt (iii) durchgeführt wird in TrisHCl 20 mM, pH 7,5, mit 25 % Propanol-1 und die Säule, die in Schritt (iv) verwendet wird, mit demselben Puffer äquilibriert wird. Das Verfahren nach irgendeinem der Ansprüche 12 bis 14, wobei ein Zentrifugationsschritt durchgeführt wird zwischen dem Schritt (iii) und dem Schritt (iv), um die unlösliche Fraktion zu verwerfen. Das Verfahren nach irgendeinem der Ansprüche 12 bis 15, wobei das Gruppe II-ähnliche Kapselpolysaccharid mit 300 mM NaCl in TrisHCl 20 mM, pH 7,5, 25 % Propanol-1 eluiert wird. Die Verwendung nach irgendeinem der Ansprüche 1 bis 3 oder die Zusammensetzung nach Anspruch 4 oder 5, wobei das lösliche Gruppe II-ähnliche Kapselpolysaccharid erhalten wird durch ein Verfahren gemäß irgendeinem der Ansprüche 6 bis 16. Die Zusammensetzung nach irgendeinem der Ansprüche 4, 5 und 17, welche formuliert ist zur vorbeugenden oder therapeutischen Anwendung bei einem Probanden, welcher es benötigt. Eine Anti-Biofilmbeschichtung, dadurch gekennzeichnet, dass sie ein Gruppe II-ähnliches Kapselpolysaccharid aus einem Bakterienstamm umfasst. Die Anti-Biofilmbeschichtung gemäß Anspruch 19, dadurch gekennzeichnet, dass das Gruppe II-ähnliche Kapselpolysaccharid aus einem Bakterienstamm stammt, der ausgewählt wird aus Escherichia coli, Hemophilus influenzae und Neisseria meningitidis. Die Anti-Biofilmbeschichtung nach Anspruch 19 oder 20, dadurch gekennzeichnet, dass sie erhalten wird durch Anwenden einer Zusammensetzung aus irgendeinem der Ansprüche 4, 5 und 17. Eine medizinische oder industrielle Vorrichtung, dadurch gekennzeichnet, dass sie wenigstens teilweise mit einer Anti-Biofilmbeschichtung gemäß einem der Ansprüche 19, 20 und 21 beschichtet ist. Utilisation d'un polysaccharide capsulaire de type groupe II soluble provenant d'une souche bactérienne, pour la préparation d'une composition qui prévient ou inhibe l'adhérence bactérienne et/ou le développement d'un biofilm bactérien. Utilisation selon la revendication 1, où ledit polysaccharide capsulaire de type groupe II soluble est obtenu dans le surnageant d'une culture de bactéries choisies parmi Escherichia coli, Haemophilus influenzae et Neisseria meningitidis. Utilisation selon la revendication 1 ou la revendication 2, où ledit polysaccharide capsulaire de type groupe II soluble est obtenu sous la forme d'une fraction purifiée. Composition destinée à l'inhibition de l'adhérence bactérienne et/ou du développement d'un biofilm bactérien, caractérisée en ce qu'elle comprend un polysaccharide capsulaire de type groupe II soluble provenant d'une souche bactérienne. Composition selon la revendication 4, qui comprend une fraction purifiée du surnageant d'une culture de bactéries choisies parmi E. coli, H. influenzae et N. meningitidis. Procédé de purification d'un polysaccharide capsulaire de type groupe II anti-biofilm provenant d'une souche bactérienne, comprenant les étapes suivantes : (i) la séparation du surnageant d'une culture d'une souche bactérienne exprimant une capsule de type groupe II à partir des cellules bactériennes, (ii) la précipitation des polysaccharides présents dans le surnageant obtenu, et (iii) éventuellement la remise en suspension du précipité. Procédé selon la revendication 6, dans lequel ladite souche bactérienne exprimant une capsule de type groupe II est choisie parmi E. coli, H. influenzae et N. meningitidis. Procédé selon la revendication 6 ou la revendication 7, dans lequel ladite souche bactérienne est un E. coli uropathogène. Procédé selon l'une quelconque des revendications 6 à 8, dans lequel la séparation dans l'étape (i) est réalisée par stérilisation sur filtre et/ou par centrifugation de la culture. Procédé selon l'une quelconque des revendications 6 à 9, dans lequel la précipitation dans l'étape (ii) est réalisée avec trois volumes d'éthanol pour un volume de surnageant. Procédé selon l'une quelconque des revendications 6 à 10, dans lequel le précipité obtenu dans l'étape (ii) est remis en suspension dans de l'eau, dialysé contre de l'eau désionisée et ensuite lyophilisé avant l'étape (iii). Procédé selon l'une quelconque des revendications 6 à 11, comprenant en outre une étape (iv) supplémentaire de purification par chromatographie par échange d'ions. Procédé selon la revendication 12, dans lequel l'étape (iv) est réalisée en utilisant une colonne DEAE-Sepharose. Procédé selon la revendication 12 ou la revendication 13, dans lequel la remise en suspension dans l'étape (iii) est réalisée dans du Tris-HCl 20 mM, pH 7,5, avec 25 % de propan-1-ol, et la colonne utilisée dans l'étape (iv) est équilibrée avec le même tampon. Procédé selon l'une quelconque des revendications 12 à 14, dans lequel une étape de centrifugation est réalisée entre l'étape (iii) et l'étape (iv) pour éliminer la fraction insoluble. Procédé selon l'une quelconque des revendications 12 à 15, dans lequel ledit polysaccharide capsulaire de type groupe II est élué avec 300 mM de NaCl dans du Tris-HCl 20 mM, pH 7,5, 25 % de propan-1-ol. Utilisation selon l'une quelconque des revendications 1 à 3, ou composition selon la revendication 4 ou 5, où ledit polysaccharide capsulaire de type groupe II soluble est obtenu par l'intermédiaire d'un procédé selon l'une quelconque des revendications 6 à 16. Composition selon l'une quelconque des revendications 4, 5 et 17, qui est formulée pour une administration préventive ou thérapeutique à un sujet en ayant besoin. Revêtement anti-biofilm, caractérisé en ce qu'il comprend un polysaccharide capsulaire de type groupe II provenant d'une souche bactérienne. Revêtement anti-biofilm selon la revendication 19, caractérisé en ce que ledit polysaccharide capsulaire de type groupe II provient d'une souche bactérienne choisie parmi Escherichia coli, Haemophilus influenzae et Neisseria meningitidis. Revêtement anti-biofilm selon la revendication 19 ou la revendication 20, caractérisé en ce qu'il a été obtenu par application d'une composition selon l'une quelconque des revendications 4, 5 et 17. Dispositif médical ou industriel, caractérisé en ce qu'il est au moins partiellement revêtu d'un revêtement anti-biofilm selon l'une quelconque des revendications 19, 20 et 21.
REFERENCES CITED IN THE DESCRIPTION

This list of references cited by the applicant is for the reader's convenience only. It does not form part of the European patent document. Even though great care has been taken in compiling the references, errors or omissions cannot be excluded and the EPO disclaims all liability in this regard.

Non-patent literature cited in the description