Technical Field
[0001] The present invention relates to G-protein-coupled receptors (GPCRs) having modified
ligand affinity and use thereof and, more particularly, the present invention relates
to a GPCR having ligand affinity modified by forming a complex with a particular protein
and use thereof.
Background Art
[0002] Many reactions in living organisms are caused by entrance of extracellular information
into cells and by propagation of the information in the cells. Membrane receptors
serve as mediators through which extracellular information is transmitted into cells.
Among them, GPCRs having seven transmembrane domains is well known as a major category
of membrane receptors.
[0003] When a ligand (such as amino acids, peptides or amines) binds to a GPCR, the GPCR
transmits its information into a cell via a trimeric G protein. G proteins coupled
to GPCRs are classified into Gs, Gi, Gq, and the like, which activate/inactivate different
effector pathways (e.g., cAMP pathway, cGMP pathway, and phospholipase C pathway),
respectively. For example, α
1-adrenergic receptor is mainly coupled to Gq protein to promote phospholipase C system,
which produces diacylglycerol and inositol trisphosphate, thus increasing intracellular
Ca
2+. α
2-adrenergic receptor is mainly coupled to Gi protein to suppress adenylate cyclase
system, thus decreasing cAMP. Further, β-adrenergic receptor is mainly coupled to
Gs protein to promote adenylate cyclase system, which thus increases cAMP.
[0004] GPCRs widely occur and function in our body. For example, α
1-adrenergic receptors exist peripherally in blood vessel, prostate, and produce the
contractions. Further, α
1-adrenergic receptors are known to function in central nervous system. β-adrenergic
receptors in heart and fat tissue play important roles in heart rate and lipolysis.
[0005] GPCRs and their signal transduction systems are known not only to control the physiological
homeostasis in our body but also to be involved in pathophysiological status of various
diseases. Therefore, in order to treat the diseases it will be very significant to
identify the GPCRs which are related to the diseases and then to develop their specific
drugs (such as agonists or antagonists).
Non Patent Literature 1
Muramatsu, I. et al. Br. J. Pharmacol., 99: 197 (1990)
Non Patent Literature 2
Muramatsu, I. et al. Pharmacol. Commun., 6: 23 (1995)
Non Patent Literature 3
Morishima, S. et al. J. Urol. 177: 377-381 (2007)
Non Patent Literature 4
Molenaar, P. and Parsonage, W.A. Trends Pharmacol. Sci., 26: 368-375 (2005)
Non Patent Literature 5
Samaha, A.N. et al., J. Neurosci. 27: 2979-2986 (2007)
Summary of Invention
[0006] There has been significant progress in GPCR research, whereby a large number of GPCRs
have been identified. However, there still exist several putative GPCRs whose phenotypes
are identified but whose entities are yet unknown. For example, α
1-adrenergic receptors are now classified into three subtypes (α
1A, α
1B and α
1D) based on their distinct genes. However, in addition to the classical α
1-adrenergic receptors, the presence of an additional subtype (α
1L) which shows different pharmacological profile (phenotype) from the classical subtypes
has been proposed. The α
1L-subtype has significantly lower affinity for a representative α
1 blocker (prazosin) than α
1A-, α
1B- and α
1D-subtypes, The α
1L-subtype can be detected only in intact strips or segments of native tissues but not
be identified in their tissue homogenates (see Non Patent Literatures 1 to 3). Further,
subtypes of β
1 adrenaline receptor (β
1H and β
1L) that differ in phenotype are known to be expressed from the same genes (see Non
Patent Literature 4). Such a subtype only has its phenotype known, and has its entity
unknown. The similar cases may be also pointed out for dopamine receptors, muscarinic
receptors, or endothelin receptors (see Non Patent Literature 5 and the like). However,
the underlying mechanisms for different phenotype formation of the same gene product
have not yet known.
[0007] The present invention has been made in view of this problem, and it is an object
of the present invention to provide a technique for analyzing the function of a G-protein-coupled
receptor whose entity has not been clarified.
[0008] A protein complex according to the present invention is characterized by binding
of a GPCR to (1) a polypeptide consisting of an amino-acid sequence of SEQ ID NO:
1; (2) a polypeptide (i) consisting of an amino-acid sequence of SEQ ID NO: 1 with
a deletion, insertion, substitution, or addition of one or several amino acids, and
(ii) having activity to modify ligand affinity of a GPCR with which the polypeptide
has formed a complex; (3) a polypeptide encoded by a polynucleotide consisting of
a nucleotide sequence of SEQ ID NO: 2; (4) a polypeptide (i) encoded by a polynucleotide
consisting of a nucleotide sequence of SEQ ID NO: 2 with a deletion, insertion, substitution,
or addition of one or several nucleotides, and (ii) having activity to modify ligand
affinity of a GPCR with which the polypeptide has formed a complex; (5) a polypeptide
(i) encoded by a polynucleotide capable of hybridizing under stringent conditions
with a polynucleotide consisting of a sequence complementary to a nucleotide sequence
of SEQ ID NO: 2 and (ii) having activity to modify ligand affinity of a GPCR with
which the polypeptide has formed a complex; or (6) a polypeptide (i) coded for by
a polynucleotide having a sequence identity of 70% or higher with a polynucleotide
consisting of a nucleotide sequence of SEQ ID NO: 2 and (ii) having activity to modify
ligand affinity of a GPCR with which the polypeptide has formed a complex.
[0009] A method according to the present invention for producing a protein complex is characterized
by including the step of causing a GPCR and a polypeptide to coexist on a lipid membrane,
the polypeptide being (1) a polypeptide consisting of an amino-acid sequence of SEQ
ID NO: 1; (2) a polypeptide (i) consisting of an amino-acid sequence of SEQ ID NO:
1 with a deletion, insertion, substitution, or addition of one or several amino acids,
and (ii) having activity to modify ligand affinity of a GPCR with which the polypeptide
has formed a complex; (3) a polypeptide encoded by a polynucleotide consisting of
a nucleotide sequence of SEQ ID NO: 2; (4) a polypeptide (i) encoded by a polynucleotide
consisting of a nucleotide sequence of SEQ ID NO: 2 with a deletion, insertion, substitution,
or addition of one or several nucleotides, and (ii) having activity to modify ligand
affinity of a GPCR with which the polypeptide has formed a complex; (5) a polypeptide
(i) encoded by a polynucleotide capable of hybridizing under stringent conditions
with a polynucleotide consisting of a sequence complementary to a nucleotide sequence
of SEQ ID NO: 2 and (ii) having activity to modify ligand affinity of a GPCR with
which the polypeptide has formed a complex; or (6) a polypeptide (i) coded for by
a polynucleotide having a sequence identity of 70% or higher with a polynucleotide
consisting of a nucleotide sequence of SEQ ID NO: 2 and (ii) having activity to modify
ligand affinity of a GPCR with which the polypeptide has formed a complex.
[0010] With this feature, the present invention can modify the ligand affinity of a GPCR.
That is, the method according to the present invention for producing a protein complex
can also be a method for modifying the affinity of a GPCR for its ligands.
[0011] A lipid membrane according to the present invention is characterized by containing
the protein complex. A method according to the present invention for producing the
lipid membrane is characterized by including the step of causing a GPCR and a polypeptide
to coexist on the lipid membrane, the polypeptide being (1) a polypeptide consisting
of an amino-acid sequence of SEQ ID NO: 1; (2) a polypeptide (i) consisting of an
amino-acid sequence of SEQ ID NO: 1 with a deletion, insertion, substitution, or addition
of one or several amino acids, and (ii) having activity to modify ligand affinity
of a G-protein-coupled receptor with which the polypeptide has formed a complex; (3)
a polypeptide encoded by a polynucleotide consisting of a nucleotide sequence of SEQ
ID NO: 2; (4) a polypeptide (i) encoded by a polynucleotide consisting of a nucleotide
sequence of SEQ ID NO: 2 with a deletion, insertion, substitution, or addition of
one or several nucleotides, and (ii) having activity to modify ligand affinity of
a GPCR with which the polypeptide has formed a complex; (5) a polypeptide (i) encoded
by a polynucleotide capable of hybridizing under stringent conditions with a polynucleotide
consisting of a sequence complementary to a nucleotide sequence of SEQ ID NO: 2 and
(ii) having activity to modify ligand affinity of a GPCR with which the polypeptide
has formed a complex; or (6) a polypeptide (i) coded for by a polynucleotide having
a sequence identity of 70% or higher with a polynucleotide consisting of a nucleotide
sequence of SEQ ID NO: 2 and (ii) having activity to modify ligand affinity of a GPCR
with which the polypeptide has formed a complex.
[0012] Furthermore, a transformant according to the present invention is characterized by
containing the protein complex. A method according to the present invention for producing
the transformant is characterized by including the step of expressing the protein
complex, and preferably includes the step of introducing, into a cell, a gene encoding
a GPCR and a gene encoding the polypeptide.
[0013] With this feature, the present invention makes it easy to analyze the function of
a GPCR having modified ligand affinity.
[0014] A method according to the present invention for screening agonists or antagonists
of a GPCR having modified ligand affinity is characterized by including the steps
of: [I] generating a protein complex by causing a GPCR and a polypeptide to coexist
on a lipid membrane; and [II] incubating the protein complex together with a candidate
factor, the polypeptide being (1) a polypeptide consisting of an amino-acid sequence
of SEQ ID NO: 1; (2) a polypeptide (i) consisting of an amino-acid sequence of SEQ
ID NO: 1 with a deletion, insertion, substitution, or addition of one or several amino
acids, and (ii) having activity to modify ligand affinity of a GPCR with which the
polypeptide has formed a complex; (3) a polypeptide encoded by a polynucleotide consisting
of a nucleotide sequence of SEQ ID NO: 2; (4) a polypeptide (i) encoded by a polynucleotide
consisting of a nucleotide sequence of SEQ ID NO: 2 with a deletion, insertion, substitution,
or addition of one or several nucleotides, and (ii) having activity to modify ligand
affinity of a GPCR with which the polypeptide has formed a complex; (5) a polypeptide
(i) encoded by a polynucleotide capable of hybridizing under stringent conditions
with a polynucleotide consisting of a sequence complementary to a nucleotide sequence
of SEQ ID NO: 2 and (ii) having activity to modify ligand affinity of a GPCR with
which the polypeptide has formed a complex; or (6) a polypeptide (i) coded for by
a polynucleotide having a sequence identity of 70% or higher with a polynucleotide
consisting of a nucleotide sequence of SEQ ID NO: 2 and (ii) having activity to modify
ligand affinity of a GPCR with which the polypeptide has formed a complex.
[0015] A method according to the present invention for producing a transformant expressing
a GPCR having modified ligand affinity is characterized by including the step of inhibiting
expression of a polypeptide in the cell in which a GPCR has been expressed, the polypeptide
being (1) a polypeptide consisting of an amino-acid sequence of SEQ ID NO: 1; (2)
a polypeptide (i) consisting of an amino-acid sequence of SEQ ID NO: 1 with a deletion,
insertion, substitution, or addition of one or several amino acids, and (ii) having
activity to modify ligand affinity of a GPCR with which the polypeptide has formed
a complex; (3) a polypeptide encoded by a polynucleotide consisting of a nucleotide
sequence of SEQ ID NO: 2; (4) a polypeptide (i) encoded by a polynucleotide consisting
of a nucleotide sequence of SEQ ID NO: 2 with a deletion, insertion, substitution,
or addition of one or several nucleotides, and (ii) having activity to modify ligand
affinity of a GPCR with which the polypeptide has formed a complex; (5) a polypeptide
(i) encoded by a polynucleotide capable of hybridizing under stringent conditions
with a polynucleotide consisting of a sequence complementary to a nucleotide sequence
of SEQ ID NO: 2 and (ii) having activity to modify ligand affinity of a GPCR with
which the polypeptide has formed a complex; or (6) a polypeptide (i) coded for by
a polynucleotide having a sequence identity of 70% or higher with a polynucleotide
consisting of a nucleotide sequence of SEQ ID NO: 2 and (ii) having activity to modify
ligand affinity of a GPCR with which the polypeptide has formed a complex.
[0016] With this feature, the present invention makes it easy to analyze the function of
a GPCR having modified ligand affinity, and can modify the ligand affinity of a GPCR.
That is, the present invention can also be a method for modifying the affinity of
a GPCR for its ligands.
[0017] The producing method according to the present invention is preferably such that the
polypeptide is an endogenous protein, and that the step of inhibiting the expression
of the polypeptide is performed according to an RNAi method. Further, the cell may
be a transformant expressing an exogenous GPCR.
[0018] A method according to the present invention for screening agonists or antagonists
of a GPCR having modified ligand affinity is characterized by including the steps
of: [I] inhibiting expression of a polypeptide in the cell in which a GPCR has been
expressed; and [II] incubating the cell together with a candidate factor, the polypeptide
being (1) a polypeptide consisting of an amino-acid sequence of SEQ ID NO: 1; (2)
a polypeptide (i) consisting of an amino-acid sequence of SEQ ID NO: 1 with a deletion,
insertion, substitution, or addition of one or several amino acids, and (ii) having
activity to modify ligand affinity of a GPCR with which the polypeptide has formed
a complex; (3) a polypeptide encoded by a polynucleotide consisting of a nucleotide
sequence of SEQ ID NO: 2; (4) a polypeptide (i) encoded by a polynucleotide consisting
of a nucleotide sequence of SEQ ID NO: 2 with a deletion, insertion, substitution,
or addition of one or several nucleotides, and (ii) having activity to modify ligand
affinity of a GPCR with which the polypeptide has formed a complex; (5) a polypeptide
(i) encoded by a polynucleotide capable of hybridizing under stringent conditions
with a polynucleotide consisting of a sequence complementary to a nucleotide sequence
of SEQ ID NO: 2 and (ii) having activity to modify ligand affinity of a GPCR with
which the polypeptide has formed a complex; or (6) a polypeptide (i) coded for by
a polynucleotide having a sequence identity of 70% or higher with a polynucleotide
consisting of a nucleotide sequence of SEQ ID NO: 2 and (ii) having activity to modify
ligand affinity of a GPCR with which the polypeptide has formed a complex. It is preferable
that the screening method according to the present invention further include the step
of measuring an intracellular Ca
2+ concentration or the step of measuring metabolism of intracellular inositol phosphate.
[0019] In the present invention, it is preferable that the GPCR constituting the protein
complex be an adrenergic receptor, a dopamine receptor, a muscarinic receptor, or
an endothelin receptors, and the adrenergic receptors may be α-receptor or β-receptor.
Further, it is preferable that the dopamine receptor be a D2 receptor. It is preferable
that the α-receptor be an α
1-receptor, and it is more preferable that the α
1-receptor be an α
1A-subtype. In a preferred embodiment, a protein complex according to the present invention
is α
1L-subtype or β
1L-subtype of adrenergic receptors.
[0020] For a fuller understanding of the nature and advantages of the invention, reference
should be made to the ensuing detailed description taken in conjunction with the accompanying
drawings.
Brief Description of Drawings
[0021]
Fig. 1
Fig. 1 shows saturation binding curves for [3H]-silodosin in α1L cells (whole cell binding experiment).
Fig. 2
(a) of Fig. 2 shows competition-binding curves for prazosin in α1L cells and α1A cells (whole cell binding experiment). (b) of Fig. 2 shows competition-binding curves
for prazosin in homogenates of α1L cells and α1A cells. Dashed line with closed squares: A competition-binding curve for prazosin
in whole α1L cells was described for comparison against the curves in homogenates.
Description of Embodiments
[1: Protein Complex]
[0022] The present invention provides a protein complex of a GPCR and a particular polypeptide.
When used in the present specification, the term "complex" means an integrated combination
of a plurality of substances, and "complex formation" and "integration" are used interchangeably.
It should be noted that a plurality of substances forming a complex only need to interact
with each other in close proximity and may or may not bind to each other. In a preferred
embodiment, a protein complex according to the present invention is such a state that
a GPCR, and a particular polypeptide interact with each other in close proximity and,
as a result, functions as a GPCR having modified ligand affinity.
[0023] The present specification describes the present invention by taking an adrenergic
receptor (in particular, of α
1A-subtype) as an example of a GPCR whose ligand affinity is modified by interacting
with a particular polypeptide. However, a person skilled in the art who has read the
present specification would easily understand that a GPCR constituting the present
invention is not limited to an adrenergic receptor. Further, a person skilled in the
art could easily obtain information on the sequence of a GPCR constituting the present
invention.
[0024] Adrenergic receptors are well known to mediate the functions of the autonomic nervous
system (sympathetic nervous system). Binding of adrenaline, noradrenaline, or the
like to the adrenergic receptor causes various physiological responses such as contractions
of vascular smooth muscle, increases in blood pressure and heart rate, dilation of
the pupil, and an increase in blood glucose level.
[0025] The progress in research and the development of a new variety of drugs have made
clear that adrenergic receptors are classified into various types. In the past, adrenergic
receptors were classified into α-receptor and β-receptor according to their difference
in reactivity to drugs such as isoproterenol and phentolamine, and further classified
into pharmacological subtypes (α
1-receptor, α
2-receptor, and β-receptor). These receptors are known to exhibit different distributions
in each tissue and to play different functions. For example, the α
1-adrenergic receptors are known to play as an important mediator causing contractions
of vascular smooth muscle, prostate, and the like, and also known to be involved in
the regulation of consciousness and emotion in central nervous system.
[0026] Now that the mapping of the human genome has been finished, the structures and functions
of many proteins can be shown on a genetic level. In α
1-adrenergic receptors, three subtypes (α
1A, α
1B, and α
1D) were identified according to their distinct genes. These classical subtypes are
known to coincide well with pharmacologically identified subtypes. In this way, it
may be considered that one receptor subtype is basically originated from one distinct
gene.
[0027] However, it has been long pointed out that a unique α
1-adrenergic receptor occurs and functions in some tissues of our body. Because of
its low affinity for a representative α
1 blocker (prazosin), the unique subtype has been called "α
1L-subtype", although the corresponding gene has not been yet cloned.
[0028] Table 1 shows the classification and drug selectivity of α
1-adrenergic receptors.
[Table 1]
| Classification and Drug Selectivity of α1-adrenergic Receptors |
| Subtypes |
Affinity (pKb) |
| silodosin1,3,4,5 |
tamsulosin1,3,4 |
prazosin1,2,3,4,5 |
RS- 170532,4 |
BMY 73784,5 |
| α1A |
10.7-9.5 |
10.4-9.9 |
10.6-9.3 |
9.1-8.4 |
6.9-5.6 |
| α1L |
10.7-9.5 |
10.4-9.9 |
8.3-7.6 |
6.3 |
6.9-5.6 |
| α1B |
8.1 |
9.3 |
10.6-10.1 |
7.8 |
7.4 |
| α1D |
8.6 |
9.9 |
10.1-9.9 |
7.8 |
9.1 |
[0029] The effects of the compounds shown in Table 1 are based on the following literatures:
- 1. Muramatsu, I. et al. Pharmacol. Commun., 6: 23 (1995)
- 2. Ford, AP. et al. Mol. Pharmacol., 49: 209 (1996)
- 3. Murata, S. et al. J. Urol., 164: 578 (2000)
- 4. Hiraizumi-Hiraoka, Y. et al. J. Pharmacol. Exp. Ther., 310: 995 (2004)
- 5. Murata, S. et al. Br. J. Pharmacol., 127: 19 (1999)
[0030] In bioassay studies, the α
1L-subtype has been clearly demonstrated as a functional receptor in the lower urinary
tract systems of human and other mammals. The α
1L-subtype was also identified, if the intact segments of native tissues (e.g. human
prostate). However, the α
1L-subtype was not detected by a conventional binding experiment conducted with homogenized
tissue. The fact that α
1L-subtype is not detected in homogenized tissue means that purification of the α
1L-subtype from tissue is very difficult. Unless the entity of the α
1L-subtype is clarified, it will be very difficult to analyze the function of α
1L-adrenergic receptor, in particular, to develop α
1L-selective drugs (such as agonists or antagonists).
[0031] The inventors assumed that the α
1L-subtype, whose entity is unknown, is constituted by binding of some sort of ancillary
molecule to an already known subtype (probably, α
1A-subtype). That is, the inventors assumed that the interaction between the subtype
molecule and the molecule ancillary thereto, which constitute the α
1L-subtype together, is dissolved by homogenizing tissue and, as a result, the α
1L-subtype changes its properties into those of the α
1A-subtype. In the result, the inventors found that the pharmacological profile of α
1L-subtype was converted to that of α
1A-subtype upon tissue homogenization. Furthermore, as a result of their diligent studies,
the inventors confirmed that a particular protein binds to the α
1A-subtype, and that coexpression of the protein with the α
1A-subtype in a cultured cell leads to expression of a phenotype of α
1L-subtype. That is, the inventors found that the α
1L-subtype consists of a protein complex, identified a protein constituting the complex,
and thereby accomplished the present invention.
[0032] In one embodiment, the present invention provides a protein complex that forms an
α
1L-subtype of adrenergic receptor. That is, a protein complex according to the present
embodiment is an α
1L-subtype of adrenergic receptor. The present embodiment makes it possible to provide
treatment for any disease associated with an α
1L-subtype whose entity has been clarified.
[0033] A polypeptide constituting the protein complex according to the present embodiment
is already publicly known as a CRELD (cysteine-rich with EGF-like domains) 1α protein,
whose missense mutation is pointed out as being associated with an atrioventricular
septal defect (
Gene 293: 47-57 (2002),
Am. J. Hum. Genet. 72: 1047-1052 (2003)). Information on the sequence of the polypeptide is provided as NCBI Accession No.
NM_015513 and, in the present specification, represented as SEQ ID NO: 1 (amino-acid
sequence) and SEQ ID NO: 2 (nucleotide sequence). That is, the polypeptide constituting
the protein complex according to the present embodiment may be a polypeptide consisting
of an amino-acid sequence of SEQ ID NO: 1, or may be a polypeptide coded for by a
polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 2.
[0034] The polypeptide constituting the protein complex according to the present embodiment
is not limited to a polypeptide consisting of an amino-acid sequence of SEQ ID NO:
1, and may be a mutant polypeptide retaining the activity of the original polypeptide.
An example of such a mutant polypeptide is a polypeptide (i) consisting of an amino-acid
sequence of SEQ ID NO: 1 with a deletion, insertion, substitution, or addition of
one or several amino acids, and (ii) having the activity to form a complex with a
GPCR and modify the ligand affinity of the GPCR.
[0035] With technical common sense in the field, a person skilled in the art could easily
produce a mutant polypeptide, in the amino-acid sequence of a particular polypeptide
with a deletion, insertion, substitution, or addition of one or several amino acids.
Further, based on the descriptions in the present specification and the technical
common sense, a person skilled in the art could easily confirm whether or not the
mutant polypeptide retains the same activity as the original polypeptide.
[0036] Further, the polynucleotide encoding the polypeptide constituting the protein complex
according to the present embodiment is not limited to a polynucleotide consisting
of a nucleotide sequence of SEQ ID NO: 2, and only needs to be a mutant polynucleotide
encoding a polypeptide retaining the activity to modify the ligand affinity of a GPCR
with which the polypeptide has formed a complex. An example of such a mutant polynucleotide
is, but is not limited to, (1) a polynucleotide consisting of a nucleotide sequence
of SEQ ID NO: 2 with a deletion, insertion, substitution, or addition of one or several
nucleotides, (2) a polynucleotide capable of hybridizing under stringent conditions
with a polynucleotide consisting of a sequence complementary to a nucleotide sequence
of SEQ ID NO: 2, or (3) a polynucleotide having a sequence identity of 70% or higher,
preferably 80% or higher, or more preferably 85% or higher, with a polynucleotide
consisting of a nucleotide sequence of SEQ ID NO: 2.
[0037] With technical common sense in the field, a person skilled in the art could easily
produce: a mutant polypeptide, in the amino-acid sequence of a particular polynucleotide
with a deletion, insertion, substitution, or addition of one or several amino acids;
a mutant polynucleotide capable of hybridizing under stringent conditions with a particular
polynucleotide; or a mutant polynucleotide having a sequence identity of 70% or higher
with a particular polynucleotide. Further, based on the descriptions in the present
specification and the technical common sense, a person skilled in the art could easily
confirm whether or not a polypeptide coded for by the mutant polynucleotide retains
the same activity as a polypeptide coded for by the original polynucleotide.
[0038] When used in the present specification, the term "stringent hybridization conditions"
means overnight incubation at 42°C in a hybridization solution (containing 50% formamide,
5 x SSC [150 mM of NaCl, 15 mM of trisodium citrate], 50 mM of sodium phosphate (with
a pH of 7.6), 5 x Denhardt's solution, 10% dextran sulfate, and 20 µg/ml of sheared
and denatured salmon sperm), followed by washing of a filter at approximately 65°C
in 0.1 × SSC.
[0040] The present invention thus far has been described by taking an adrenergic receptor
as an example of a GPCR constituting a protein complex according to the present invention.
However, a protein complex according to the present invention only needs to be a complex
of a GPCR and (1) a polypeptide consisting of an amino-acid sequence of SEQ ID NO:
1; (2) a polypeptide (i) consisting of an amino-acid sequence of SEQ ID NO: 1 with
a deletion, insertion, substitution, or addition of one or several amino acids, and
(ii) having activity to modify ligand affinity of a GPCR with which the polypeptide
has formed a complex; (3) a polypeptide encoded by a polynucleotide consisting of
a nucleotide sequence of SEQ ID NO: 2; (4) a polypeptide (i) encoded by a polynucleotide
consisting of a nucleotide sequence of SEQ ID NO: 2 with a deletion, insertion, substitution,
or addition of one or several nucleotides, and (ii) having activity to modify ligand
affinity of a GPCR with which the polypeptide has formed a complex; (5) a polypeptide
(i) encoded by a polynucleotide capable of hybridizing under stringent conditions
with a polynucleotide consisting of a sequence complementary to a nucleotide sequence
of SEQ ID NO: 2 and (ii) having activity to modify ligand affinity of a GPCR with
which the polypeptide has formed a complex; or (6) a polypeptide (i) coded for by
a polynucleotide having a sequence identity of 70% or higher with a polynucleotide
consisting of a nucleotide sequence of SEQ ID NO: 2 and (ii) having activity to modify
ligand affinity of a GPCR with which the polypeptide has formed a complex. That is,
the GPCR constituting the protein complex is not limited to an adrenergic receptor,
but may be dopamine receptors, muscarinic receptors, or endothelin receptors. Further,
a person skilled in the art could easily obtain, from a publicly-known database, information
on the sequence of a GPCR constituting the present invention, and therefore could
easily produce a desired protein complex, based on the descriptions in the present
specification and the technical common sense.
[2. Lipid Membrane Containing a Protein Complex]
[0041] The present invention also provides a method for producing a protein complex of a
GPCR and a particular polypeptide. The method according to the present invention for
producing a protein complex is characterized by including the step of causing a GPCR
and a particular polypeptide to coexist on a lipid membrane. That is, the present
invention provides a lipid membrane containing a protein complex and a method for
producing the same.
[0042] A lipid membrane according to the present invention is characterized by containing
such a protein complex as described above. The lipid membrane according to the present
invention may be a naturally-occurring lipid membrane, or may be an artificial lipid
membrane. In cases where the lipid membrane is a naturally-occurring lipid membrane,
the lipid membrane is intended to be a biological membrane. In cases where the lipid
membrane is an artificial lipid membrane, the lipid membrane is intended to be a lipid
planar membrane or liposome.
[0043] In one aspect of the present invention, a lipid membrane can be a biological membrane
of a transformant having introduced thereinto a polynucletoide encoding a polypeptide
constituting a protein complex according to the present invention. Such a transformant
can be obtained by introducing an expression vector containing the polynucleotide
into a living organism so that the polypeptide is expressed in the form of a biological
membrane. It should be noted that the living organism for use as the transformant
may be a prokaryotic organism or a eucaryotic organism.
[0044] In another aspect of the present invention, a lipid membrane can be a lipid bilayer
containing a polypeptide constituting a protein complex of the present invention.
The lipid bilayer is a membranous structure composed of two layers of polar lipid
(in particular, phospholipid). The lipid bilayer structure is stabilized as a two-dimensional
structure when it takes the form of a sphere, but can be a planar structure if its
end is isolated from a water molecule. When used in the present specification, the
term "liposome" means a spherical lipid bilayer that is made artificially, and the
term "lipid planar membrane" means a planar lipid bilayer that is made artificially.
In the field, an artificial lipid bilayer is used in in vitro measurement of the activity
of a membrane protein (e.g., a channel protein). In this way, a person skilled in
the art could easily produce a lipid planar membrane and cause the lipid planar membrane
to retain a protein (polypeptide) of interest. Further, liposome is a lipid artificial
membrane that is referred to also as "vesicle", and can be produced by beating up
a suspension of lipid (e.g., phospholipid) and then subjecting it to ultrasonication.
In the field, researches have been widely conducted with liposome as a cell membrane
model or as a means of drug delivery system (DDS). In this way, a person skilled in
the art could easily produce liposome and cause the liposome to retain a protein (polypeptide)
of interest.
[0045] In one embodiment, the present invention provides a lipid membrane containing an
α
1L-subtype of adrenergic receptor. As described above, the α
1L-subtype of adrenergic receptor is a protein complex of an α
1A-subtype molecule and a CRELD1α protein. The α
1A-subtype of adrenergic receptor and the CRELD1α are both membrane-bound proteins,
and, as described above, their interaction with each other is dissolved by homogenization
(membrane disruption). That is, their interaction with each other is expressed by
placing and retaining both of them on a lipid membrane.
[0046] In cases where the lipid membrane according to the present embodiment is a biological
membrane, a method according to the present embodiment for producing a lipid membrane
can also be a method for producing a transformant that expresses an α
1L-subtype of adrenergic receptor, and only needs to include the step of coexpressing
an α
1A-adrenergic receptor protein and a CRELD1α protein. Information on the sequence of
the α
1A-subtype of adrenergic receptor is provided as NCBI Accession No. U03866 or NM_000680
and, in the present specification, represented as SEQ ID NO: 3 (amino-acid sequence)
and SEQ ID NO: 4 (nucleotide sequence). That is, a method according to the present
embodiment for producing a protein complex only needs to include the step of transforming
a host with a vector containing a polynucleotide consisting of a nucleotide sequence
of SEQ ID NO: 2 and a vector containing a polynucleotide consisting of a nucleotide
sequence of SEQ ID NO: 4.
[0047] It is preferable that the vectors be each an expression vector having a polynucleotide
of interest operably linked therewith. When used in the present specification, the
term "operably linked" means that a polynucleotide encoding a peptide (or protein)
of interest is under control of a control region such as a promoter and is in such
a form that the peptide (or protein) can be expressed in a host. A procedure for establishing
a desired vector by "operably linking" a polynucleotide encoding a peptide of interest
with an expression vector is well known in the field. Further, a method for introducing
an expression vector into a host is well known, too, in the field. Therefore, a person
skilled in the art could easily generate a desired peptide in a host.
[0048] When used in the present specification, the term "transformant" means not only a
cell, tissue, or an organ, but also an individual living organism. Examples of a living
organism serving as an object of transformation include, but are not limited to, various
microorganisms, plants, and animals. It should be noted that a transformant according
to the present invention only needs to have introduced thereinto at least a polynucleotide
encoding a polypeptide constituting a protein complex according to the present invention
and express such polypeptides. That is, it should be noted that a transformant generated
by means other than an expression vector is encompassed, too, in the technical scope
of the present invention. Further, although it is preferable that a transformant according
to the present invention be stably expressing a polypeptide constituting a protein
complex according to the present invention, the polypeptide of interest may be transiently
expressed. It should be noted that use of a transformant coexistent with a protein
complex according to the present embodiment makes it possible to screen an agonist
for or antagonist against the complex by observing the behavior of a second messenger
in a host cell.
[0049] In cases where the lipid membrane according to the present embodiment is an artificial
membrane, the method according to the present embodiment for producing a lipid membrane
can also be a method for producing a lipid planer membrane or liposome containing
an α
1L-subtype of adrenergic receptor and, more specifically, only needs to include the
step of reconstituting an α
1A-adreneregic receptor protein and a CRELD1α protein on an artificial planer membrane.
With common sense in the field, a person skilled in the art could easily reconstitute
a membrane protein on an artificial lipid membrane. Use of an artificial lipid membrane
coexistent with a protein complex according to the present embodiment makes it possible
to measure the ligand affinity of the complex.
[3. Use of a Lipid Membrane]
[0050] A person skilled in the art would easily understand that the above-described method
for producing a lipid membrane can be both a method for producing a protein complex
and a method for modifying the ligand affinity of a GPCR. That is, the present invention
provides a method for modifying the affinity of a GPCR for its ligands.
[0051] Further, use of the lipid membrane according to the present invention makes it possible
to screen an agonist for or antagonist against a GPCR having modified ligand affinity.
That is, the present invention provides a method for screening agonists for or antagonists
against a GPCR having modified ligand affinity.
[0052] The screening method according to the present invention is characterized by including
the steps of generating such a protein complex as described above on a lipid membrane;
and incubating the protein complex together with a candidate factor. When used in
the present specification, "incubating" means causing a plurality of substances to
coexist and putting them in such a state that they make sufficient contact with each
other.
[0053] In a preferred embodiment, the screening method according to the present invention
includes the step of incubating, together with a candidate factor, a transformant
containing a GPCR of interest (e.g., a cell having α
1L-subtype of adrenergic receptor expressed therein). The screening method according
to the present embodiment makes it possible to screen agonists for or antagonists
against a GPCR of interest (e.g., an α
1L-subtype of adrenergic receptor) by measuring the fluctuation of a second messenger
in a cell (e.g., the amount of cAMP in cases where the G protein is Gs protein or
Gi protein or the concentrations of inosine triphosphate and Ca
2+ in cases where the G protein is Gq protein).
[0054] The agonists for α
1L-subtype of adrenergic receptor can be used as a drug for urinary incontinence, a
mydriatic drug, a drug for glaucoma, and a drug for central stimulation. The antagonists
against α
1L-subtype of adrenergic receptor can be used as a drug for urinary disturbance, a drug
for Raynaud's disease, a drug for microcirculatory failure, an antihypertensive drug,
a central depressant, a drug for improvement of renal blood flow, and a diuretic drug.
Further, since β
1L-subtype of adrenergic receptor is known to be associated with heart disease and dopamine
D2 receptor and muscarinic receptor are known to be associated with central nervous
system disease, agonists or antagonists thereto are useful, too.
[4. Knockdown Cell and Use Thereof]
[0055] The present invention also provides a transformant in which a polypeptide that forms
a protein complex with a GPCR has been knocked down and a method for producing the
same. A method according to the present invention for producing a transformant is
characterized by including the step of inhibiting expression of an endogenous polypeptide.
[0056] For example, the CRELD1α protein, which is a polypeptide that forms a complex with
a GPCR, is expressed in various cells. Therefore, a transformant in which expression
of an endogenous CRELD1α protein has been inhibited is very useful as a control cell
that is used in analyzing the function of the protein complex or screening a target
compound (e.g., an agonist or antagonist). The knockdown cell, described in this section,
may be used alone, but is preferably used in combination with the above-described
protein complex or the above-described lipid membrane containing the protein complex.
It should be noted that the GPCR expressed in the object cell may be endogenous or
exogenous.
[0057] In one aspect, the present invention can include the step of inhibiting expression
of an endogenous CRELD1α protein in a cell in which a GPCR has been expressed. This
makes it possible to modify the ligand affinity of the GPCR expressed in the cell.
That is, the method according to the present invention for producing a transformant
can be both a method for producing a transformant expressing a GPCR having modified
ligand affinity and a method for modifying the affinity of a GPCR for its ligand.
In one embodiment, the present invention can include the step of inhibiting expression
of an endogenous CRELD1α protein in a cell expressing an α
1L-subtype of adrenergic receptor. This makes it possible to modify a cell indicative
of a phenotype of α
1L-subtype to be a cell indicative of a phenotype of α
1A-subtype.
[0058] It is preferable that an RNAi method be used as a technique for inhibiting expression
of an endogenous CRELD1α protein. The RNAi method is a technique well known in the
field; for example, expression of an endogenous CRELD1α protein can be successfully
inhibited by introducing, into a cell of interest, an oligonucleotide consisting of
a nucleotide sequence of SEQ ID NO: 5. In the case of use of a vector for introducing,
into a cell of interest, an oligonucleotide consisting of a nucleotide sequence of
SEQ ID NO: 5, it is preferable that an oligonucleotide consisting of a nucleotide
sequence of SEQ ID NO: 6 be used as an antisense, without implying any limitation.
[0059] The present invention further provides a method, characterized by using the above-described
transformant, for screening an agonist for or antagonist against a GPCR having modified
ligand affinity.
[0060] The present invention is not limited to the description of the embodiments above,
but may be altered by a skilled person within the scope of the claims. An embodiment
based on a proper combination of technical means disclosed in different embodiments
is encompassed in the technical scope of the present invention.
[0061] All the academic and patent literatures cited herein are incorporated by references
to the present specification.
Example
[1. Structures]
[0062] A human α
1A-adrenergic receptor gene (ADRA1A) was cloned from a human prostate library with a
PCR technique. The cloned gene had a whole length of 1465 bp, and had an ORF sequence
perfectly matching that of the human alpha-1A gene (NCBI Accession No. U03866 or NM_000680),
which has conventionally been reported. Further, sequences preceding and following
the ORF sequence matched those reported in Hirasawa et al. (1993).
[0063] A CRELD1α gene was cloned from a human prostate cDNA library. As a result of sequence
determination, the cloned gene matched that reported in Rupp et al. (2002) (NCBI Accession
No. NM_015513).
[0064] Next, the coding region of the ADRA1A gene was subcloned into the EcoRI restriction
enzyme site of the multicloning site A of the pIRES (Clonetech, Catalog No. PT3266-5).
Further, the coding region of the CRELD1α was subcloned into the XbaI restriction
enzyme site of the multicloning site B of the pIRES. For the purpose of subcloning,
each of the genes had a restriction enzyme adapter added to each end.
[2. Production of a Transformant]
[0065] The vector was amplified/purified in a conventional method, and then transfected
into CHO-K1 cells, which are cells of Chinese Hamster ovarian origin, with Lipofectamine
2000 (Invitrogen Corporation) according to the manufacturer's protocol. Two days after
the transfection, 1200 µg/ml of the antibiotic Geneticin (G418) were added to the
DMEM culture medium. Cells into which the vector had not been transfected, i.e., cells
subjected to the same operation with Lipofectamine 2000 and the like expect that the
vector had not been added, were completely annihilated at a G418 concentration of
1000 µg/ml. The G418-resistant cells were diluted, suspended, and injected dividedly
into a 96-well plate so that an average of 0.5 cells was put in per well, and a single
colony was chosen. This operation was repeated three times, whereby a stable clone
(α
1L cells) having coexpressed the ADRA1A gene and the CREDL1α gene was produced. Further,
as control groups, the cells (α
1A cells) having stably expressed only the ADRA1A gene and the cells (CREDL1α cells)
having stably expressed only the CREDL1α gene were produced.
[3. Binding Experiment]
[0066] The drugs used in the binding experiment and their proper chemical names are as follows:
silodosin, prazosin, tamsulosin, RS-17053 (N-[2-(2-cyclopropylmethoxyphenoxy)ethyl]-5-chloro-α,α-dimethyl-1H-indole-3-ethanamine
hydrochloride), BMY 7378 (8-[2-[4-(2-methoxyphenyl)-1-piperazinyl]ethyl]8-azaspiro[4,5]decane7,9-dione
dihydrochloride).
[0067] The stable clone was studied by a pharmacological binding method with [
3H]-silodosin, which is a radioligand. An experiment was conducted using a whole-cell
binding method. That is, cells were scattered two to three days before the experiment
so that they are semi-confluent, washed twice with ice-cold PBS, and then scraped
by a scraper. The cells thus collected were suspended again in a Krebs-HEPES solution,
and then incubated at 4°C for four hours together with [
3H]-silodosin and another drug as needed. Thereafter, the cells were filtered/washed
by a Whatmann GC/F filter pretreated with polyethylene imine, and the radioactivity
was measured by a liquid scintillation counter. The nonspecific binding was evaluated
as binding in the presence of 30 µM phenotolamine.
[A] Saturation Binding Experiment according to the Whole-cell Method
[0068] The binding of [
3H]-silodosin of various concentrations (30 to 1000 pM) to the α
1L cells was examined (Fig. 1). Fig. 1 shows a saturation binding curve obtained by
the whole-cell method. The specific binding of [
3H]-silodosin to the α
1L cells exhibited a maximum binding amount (Bmax) of 134 fmol/mg protein and a Kd value
of 843 pM (pK
D = 9.1).
[B] Competitive Binding Experiment
[0069] Silodosin is known to bind selectively to the α
1A-and α
1L-subtypes with a high affinity. The term "high affinity" here means a Kd value of
1 nM or less. In order to identify the pharmacologic properties of receptors expressed
in the α
1L cells, a competitive binding experiments with prazosin at 300 pM [
3H]-silodosin binding sites were conducted using the whole-cell binding experiment
method. The α
1A cells were used as control cell line. [
3H]-silodosin is known as a selective antagonist of α
1A- and α
1L-subtypes both.
[0070] As shown by the competitive curve in (a) of Fig. 2, most (88% or higher) of receptors
in the α
1L cells exhibit low sensitivity to prazosin (pK
i = 7.6). Further, the receptors are similarly low in sensitivity to RS-17053, and
have high sensitivity to tamsulosin. Further, the receptors in the α
1L cells exhibit only low sensitivity to BMY 7378 (Table 2). On the other hand, the
sensitivities (pK
i values) of the α
1A cells, which were used as a control group, to prazosin (Fig. 2), tamsulosin, and
RS-17053 are as high as 9.5, 9.9, and 8.8, respectively, which correspond to the α
1A properties hitherto reported (Table 2).
[Table 2]
| Pharmacologic Properties of α1L-adrenergic Receptors in Two Cell Lines and Human Prostate |
| Drug |
α1L Cells |
α1A Cells |
Human Prostate |
| [3H]-silodosin (pKD) |
9.1 |
9.7 |
9.5 |
| Prazosin |
7.6 |
9.5 |
8.3 |
| Tamsulosin |
9.3 |
9.9 |
10.0 |
| RS-17053 |
< 6.0 |
8.8 |
6.6 |
| BMY 7378 |
< 6.0 |
6.5 |
5.9 |
[0071] In this table, the inhibition constants (K
i) of competitive drugs at [
3H]-silodosin binding sites in the α
1L cells, the α
1A cells, and the human prostate tissue segments are shown as -logK
i (pK
i). However, the value of [
3H]-silodosin exhibits a pK
D value (dissociation equilibrium constant) calculated from the saturation binding
curve. The value is an average of three to four examples.
[0072] Further, (b) of Fig. 2 shows results obtained by examining sensitivity to prazosin
in the homogenates of α
1L cells and the homogenates of α
1A cells. In the homogenates, the α
1L cells exhibited as high sensitivity to prazosin as the α
1A cells. This fact coincides well with the results that the α
1L receptors in prostate and brain disappeared upon tissue homogenization and that the
pharmacological profile was converted to α
1A phenotype.
[0073] Binding affinities for various drugs of α
1-adrenergic receptors in α
1L and α
1A cells and human prostate are summarized in Table 2. The α
1L cells, in which the ADRA1A gene and the CRELD1α gene were coexpressed, differ in
receptor properties from α
1A receptors, and coincides well in pharmacologic properties with α
1L receptors reported in human prostates and the like. Therefore, unlike the α
1A cells, the α
1L cells are considered as a cell line having expressed α
1L receptors predominantly.
[4. Intracellular Ca2+ Measurement Experiment]
[0074] Furthermore, in order to completely get rid of the influence of CRELD1α, which might
have been endogenously expressed in the α
1A cells, the RNAi method was used to produce cells in which CREED1α expression had
been knocked down (such cells being hereinafter referred to as "KD cells". In order
to inhibit gene expression with the RNAi method, a vector was produced by inserting
an oligonucleotide (sense sequence;
GATCCAGGCGACTTAGTGTTCACCTTCAAGAGAGGTGAACA CTAAGTCGCCTTTA: SEQ ID NO: 5, antisense
sequence; AGCTTAAAGGCGACTTAGTGTTCACCTCTCTTGAAGGTGAAC ACTAAGTCGCCTG: SEQ ID NO: 6)
containing a coding region of mRNA of chinese hamster CRELD1α into a commercially-available
pSilencer™ 4.1-CMV hygro (Ambion, Inc.) according to the instruction manual therefor,
and then transfected into the α
1A cells in the same procedure as described above. The Ca
2+ response to noradrenaline in the KD cells was examined according to a fluorescent
photometric method with Fura-2, which is a fluorescent dye. The pEC
50 value of the Ca
2+ response to noradrenaline in the KD cells was 7.9. On the other hand, when the cells
were treated in advance with prazosin 10
-8 M for two minutes, the dose-response curve of Ca
2+ response to noradrenaline shifted rightward, and the pK
B value of prazosin was calculated to be 9.3. This shows that the Ca
2+ response to noradrenaline in the KD cells coincides with the properties of the α
1A-subtype.
[0075] Thus, when the expression of endogenous CRELD1α in a CHO cell having a gene of α
1A-subtype expressed therein was inhibited by the RNAi method, α
1A receptor properties were perfectly exhibited. It should be noted that there have
been some experiments where the receptor functions, such as Ca
2+ response, of a
1A-subtype were examined by using CHO cells in which a gene of the receptor had been
expressed. However, there has not necessarily been an agreement in the receptor properties
obtained as a result of those experiments.
[0076] Use of the present invention makes it possible to clarify a GPCR whose entity has
been unknown and thereby provide treatment for any disease associated with the receptor,
and also makes it possible to modify the ligand affinity of a GPCR.
[0077] The embodiments and concrete examples of implementation discussed in the foregoing
detailed explanation serve solely to illustrate the technical details of the present
invention, which should not be narrowly interpreted within the limits of such embodiments
and concrete examples, but rather may be applied in many variations within the spirit
of the present invention, provided such variations do not exceed the scope of the
patent claims set forth below.
Industrial Applicability
[0078] It is now clear that α
1L-AR is a functional receptor and a main target for therapeutic drugs in lower urinary
tract system. Thus, the present α
1L-AR expression cells, developed by the inventors, should be considered to be extremely
useful in drug development for urinary disturbance in patients with benign prostatic
hyperplasia and for urinary incontinence. Further, the α
1L-AR expression cells are considered to be extremely useful as a method for screening
therapeutic drugs for any disease associated with α
1L-AR.

1. A protein complex of a GPCR and a polypeptide, the polypeptide being:
(1) a polypeptide consisting of an amino-acid sequence of SEQ ID NO: 1;
(2) a polypeptide (i) consisting of an amino-acid sequence of SEQ ID NO: 1 with a
deletion, insertion, substitution, or addition of one or several amino acids, and
(ii) having activity to modify ligand affinity of a GPCR with which the polypeptide
has formed a complex;
(3) a polypeptide encoded by a polynucleotide consisting of a nucleotide sequence
of SEQ ID NO: 2;
(4) a polypeptide (i) encoded by a polynucleotide consisting of a nucleotide sequence
of SEQ ID NO: 2 with a deletion, insertion, substitution, or addition of one or several
nucleotides, and (ii) having activity to modify ligand affinity of a GPCR with which
the polypeptide has formed a complex;
(5) a polypeptide (i) encoded by a polynucleotide capable of hybridizing under stringent
conditions with a polynucleotide consisting of a sequence complementary to a nucleotide
sequence of SEQ ID NO: 2 and (ii) having activity to modify ligand affinity of a GPCR
with which the polypeptide has formed a complex; or
(6) a polypeptide (i) coded for by a polynucleotide having a sequence identity of
70% or higher with a polynucleotide consisting of a nucleotide sequence of SEQ ID
NO: 2 and (ii) having activity to modify ligand affinity of a GPCR with which the
polypeptide has formed a complex.
2. The protein complex as set forth in claim 1, wherein the GPCR is an adrenergic receptor,
a dopamine receptor, a muscarinic receptor, or an endothelin receptor.
3. The protein complex as set forth in claim 2, wherein the adrenergic receptor is α1-receptor or a β1-receptor.
4. The protein complex as set forth in claim 3, wherein the α1-receptor is an α1A-receptor.
5. The protein complex as set forth in claim 2, wherein the dopamine receptor is a D2
receptor.
6. A lipid membrane containing a protein complex as set forth in claim 1.
7. A method for producing a lipid membrane as set forth in claim 6, comprising the step
of causing a GPCR and a polypeptide to coexist on a lipid membrane,
the polypeptide being:
(1) a polypeptide consisting of an amino-acid sequence of SEQ ID NO: 1;
(2) a polypeptide (i) consisting of an amino-acid sequence of SEQ ID NO: 1 with a
deletion, insertion, substitution, or addition of one or several amino acids, and
(ii) having activity to modify ligand affinity of a GPCR with which the polypeptide
has formed a complex;
(3) a polypeptide encoded by a polynucleotide consisting of a nucleotide sequence
of SEQ ID NO: 2;
(4) a polypeptide (i) encoded by a polynucleotide consisting of a nucleotide sequence
of SEQ ID NO: 2 with a deletion, insertion, substitution, or addition of one or several
nucleotides, and (ii) having activity to modify ligand affinity of a GPCR with which
the polypeptide has formed a complex;
(5) a polypeptide (i) encoded by a polynucleotide capable of hybridizing under stringent
conditions with a polynucleotide consisting of a sequence complementary to a nucleotide
sequence of SEQ ID NO: 2 and (ii) having activity to modify ligand affinity of a GPCR
with which the polypeptide has formed a complex; or
(6) a polypeptide (i) coded for by a polynucleotide having a sequence identity of
70% or higher with a polynucleotide consisting of a nucleotide sequence of SEQ ID
NO: 2 and (ii) having activity to modify ligand affinity of a GPCR with which the
polypeptide has formed a complex.
8. A transformant expressing a protein complex as set forth in claim 1.
9. A method for producing a transformant as set forth in claim 8, comprising the step
of coexpressing a GPCR and a polypeptide in a cell,
the polypeptide being:
(1) a polypeptide consisting of an amino-acid sequence of SEQ ID NO: 1;
(2) a polypeptide (i) consisting of an amino-acid sequence of SEQ ID NO: 1 with a
deletion, insertion, substitution, or addition of one or several amino acids, and
(ii) having activity to modify ligand affinity of a G-protein-coupled receptor with
which the polypeptide has formed a complex;
(3) a polypeptide encoded by a polynucleotide consisting of a nucleotide sequence
of SEQ ID NO: 2;
(4) a polypeptide (i) encoded by a polynucleotide consisting of a nucleotide sequence
of SEQ ID NO: 2 with a deletion, insertion, substitution, or addition of one or several
nucleotides, and (ii) having activity to modify ligand affinity of a GPCR with which
the polypeptide has formed a complex;
(5) a polypeptide (i) encoded by a polynucleotide capable of hybridizing under stringent
conditions with a polynucleotide consisting of a sequence complementary to a nucleotide
sequence of SEQ ID NO: 2 and (ii) having activity to modify ligand affinity of a GPCR
with which the polypeptide has formed a complex; or
(6) a polypeptide (i) coded for by a polynucleotide having a sequence identity of
70% or higher with a polynucleotide consisting of a nucleotide sequence of SEQ ID
NO: 2 and (ii) having activity to modify ligand affinity of a GPCR with which the
polypeptide has formed a complex.
10. A method for modifying ligand affinity of a GPCR, comprising the step of causing the
GPCR and a polypeptide to coexist on a lipid membrane,
the polypeptide being:
(1) a polypeptide consisting of an amino-acid sequence of SEQ ID NO: 1;
(2) a polypeptide (i) consisting of an amino-acid sequence of SEQ ID NO: 1 with a
deletion, insertion, substitution, or addition of one or several amino acids, and
(ii) having activity to modify ligand affinity of a GPCR with which the polypeptide
has formed a complex;
(3) a polypeptide encoded by a polynucleotide consisting of a nucleotide sequence
of SEQ ID NO: 2;
(4) a polypeptide (i) encoded by a polynucleotide consisting of a nucleotide sequence
of SEQ ID NO: 2 with a deletion, insertion, substitution, or addition of one or several
nucleotides, and (ii) having activity to modify ligand affinity of a GPCR with which
the polypeptide has formed a complex;
(5) a polypeptide (i) encoded by a polynucleotide capable of hybridizing under stringent
conditions with a polynucleotide consisting of a sequence complementary to a nucleotide
sequence of SEQ ID NO: 2 and (ii) having activity to modify ligand affinity of a GPCR
with which the polypeptide has formed a complex; or
(6) a polypeptide (i) coded for by a polynucleotide having a sequence identity of
70% or higher with a polynucleotide consisting of a nucleotide sequence of SEQ ID
NO: 2 and (ii) having activity to modify ligand affinity of a GPCR with which the
polypeptide has formed a complex.
11. A method for screening an agonist for or antagonist against a GPCR having modified
ligand affinity, comprising the steps of:
generating a protein complex by causing a GPCR and a polypeptide to coexist on a lipid
membrane; and
incubating the protein complex together with a candidate factor,
the polypeptide being:
(1) a polypeptide consisting of an amino-acid sequence of SEQ ID NO: 1;
(2) a polypeptide (i) consisting of an amino-acid sequence of SEQ ID NO: 1 with a
deletion, insertion, substitution, or addition of one or several amino acids, and
(ii) having activity to modify ligand affinity of a GPCR with which the polypeptide
has formed a complex;
(3) a polypeptide encoded by a polynucleotide consisting of a nucleotide sequence
of SEQ ID NO: 2;
(4) a polypeptide (i) encoded by a polynucleotide consisting of a nucleotide sequence
of SEQ ID NO: 2 with a deletion, insertion, substitution, or addition of one or several
nucleotides, and (ii) having activity to modify ligand affinity of a GPCR with which
the polypeptide has formed a complex;
(5) a polypeptide (i) encoded by a polynucleotide capable of hybridizing under stringent
conditions with a polynucleotide consisting of a sequence complementary to a nucleotide
sequence of SEQ ID NO: 2 and (ii) having activity to modify ligand affinity of a GPCR
with which the polypeptide has formed a complex; or
(6) a polypeptide (i) coded for by a polynucleotide having a sequence identity of
70% or higher with a polynucleotide consisting of a nucleotide sequence of SEQ ID
NO: 2 and (ii) having activity to modify ligand affinity of a GPCR with which the
polypeptide has formed a complex.
12. The method as set forth in claim 11, further comprising the step of measuring an intracellular
Ca2+ concentration or the step of measuring metabolism of intracellular inositol phosphate.
13. A method for producing a transformant expressing a G-protein-coupled receptor having
modified ligand affinity, comprising the step of inhibiting expression of a polypeptide
in a cell in which a GPCR has been expressed,
the polypeptide being:
(1) a polypeptide consisting of an amino-acid sequence of SEQ ID NO: 1;
(2) a polypeptide (i) consisting of an amino-acid sequence of SEQ ID NO: 1 with a
deletion, insertion, substitution, or addition of one or several amino acids, and
(ii) having activity to modify ligand affinity of a GPCR with which the polypeptide
has formed a complex;
(3) a polypeptide encoded by a polynucleotide consisting of a nucleotide sequence
of SEQ ID NO: 2;
(4) a polypeptide (i) encoded by a polynucleotide consisting of a nucleotide sequence
of SEQ ID NO: 2 with a deletion, insertion, substitution, or addition of one or several
nucleotides, and (ii) having activity to modify ligand affinity of a GPCR with which
the polypeptide has formed a complex;
(5) a polypeptide (i) encoded by a polynucleotide capable of hybridizing under stringent
conditions with a polynucleotide consisting of a sequence complementary to a nucleotide
sequence of SEQ ID NO: 2 and (ii) having activity to modify ligand affinity of a GPCR
with which the polypeptide has formed a complex; or
(6) a polypeptide (i) coded for by a polynucleotide having a sequence identity of
70% or higher with a polynucleotide consisting of a nucleotide sequence of SEQ ID
NO: 2 and (ii) having activity to modify ligand affinity of a GPCR with which the
polypeptide has formed a complex.
14. The method as set forth in claim 13, the polypeptide is an endogenous protein.
15. The method as set forth in claim 13, wherein the step of inhibiting the expression
of the polypeptide is performed according to an RNAi method.
16. The method as set forth in claim 15, wherein the RNAi method is performed by inserting
an oligonucleotide consisting of a nucleotide sequence of SEQ ID NO: 5.
17. The method as set forth in claim 13, wherein the cell is a transformant expressing
an exogenous GPCR.
18. A method for modifying ligand affinity of a GPCR, comprising the step of inhibiting
expression of a polypeptide in a cell in which the GPCR has been expressed,
the polypeptide being:
(1) a polypeptide consisting of an amino-acid sequence of SEQ ID NO: 1;
(2) a polypeptide (i) consisting of an amino-acid sequence of SEQ ID NO: 1 with a
deletion, insertion, substitution, or addition of one or several amino acids, and
(ii) having activity to modify ligand affinity of a GPCR with which the polypeptide
has formed a complex;
(3) a polypeptide encoded by a polynucleotide consisting of a nucleotide sequence
of SEQ ID NO: 2;
(4) a polypeptide (i) encoded by a polynucleotide consisting of a nucleotide sequence
of SEQ ID NO: 2 with a deletion, insertion, substitution, or addition of one or several
nucleotides, and (ii) having activity to modify ligand affinity of a GPCR with which
the polypeptide has formed a complex;
(5) a polypeptide (i) encoded by a polynucleotide capable of hybridizing under stringent
conditions with a polynucleotide consisting of a sequence complementary to a nucleotide
sequence of SEQ ID NO: 2 and (ii) having activity to modify ligand affinity of a GPCR
with which the polypeptide has formed a complex; or
(6) a polypeptide (i) coded for by a polynucleotide having a sequence identity of
70% or higher with a polynucleotide consisting of a nucleotide sequence of SEQ ID
NO: 2 and (ii) having activity to modify ligand affinity of a GPCR with which the
polypeptide has formed a complex.
19. A method for screening an agonist for or antagonist against a GPCR having modified
ligand affinity, comprising the steps of:
inhibiting expression of a polypeptide in a cell in which a GPCR has been expressed;
and
incubating the cell together with a candidate factor, the polypeptide being:
(1) a polypeptide consisting of an amino-acid sequence of SEQ ID NO: 1;
(2) a polypeptide (i) consisting of an amino-acid sequence of SEQ ID NO: 1 with a
deletion, insertion, substitution, or addition of one or several amino acids, and
(ii) having activity to modify ligand affinity of a GPCR with which the polypeptide
has formed a complex;
(3) a polypeptide encoded by a polynucleotide consisting of a nucleotide sequence
of SEQ ID NO: 2;
(4) a polypeptide (i) encoded by a polynucleotide consisting of a nucleotide sequence
of SEQ ID NO: 2 with a deletion, insertion, substitution, or addition of one or several
nucleotides, and (ii) having activity to modify ligand affinity of a GPCR with which
the polypeptide has formed a complex;
(5) a polypeptide (i) encoded by a polynucleotide capable of hybridizing under stringent
conditions with a polynucleotide consisting of a sequence complementary to a nucleotide
sequence of SEQ ID NO: 2 and (ii) having activity to modify ligand affinity of a GPCR
with which the polypeptide has formed a complex; or
(6) a polypeptide (i) coded for by a polynucleotide having a sequence identity of
70% or higher with a polynucleotide consisting of a nucleotide sequence of SEQ ID
NO: 2 and (ii) having activity to modify ligand affinity of a GPCR with which the
polypeptide has formed a complex.
20. The method as set forth in claim 19, further comprising the step of measuring an
intracellular Ca2+ concentration or the step of measuring metabolism of intracellular inositol phosphate.