1. FIELD OF THE INVENTION
[0001] The present invention relates to recombinant methods of manufacturing and formulating
elastase proteins for use in treating and preventing diseases of biological conduits.
The present invention further relates to novel recombinant elastase proteins and pharmaceutical
compositions containing such proteins. Yet further, the present invention relates
to the use of pharmaceutical compositions comprising recombinant elastase proteins
for the treatment and prevention of diseases of biological conduits.
2. BACKGROUND OF THE INVENTION
[0002] Elastin is a protein capable of spontaneously recoiling after being stretched. Crosslinked
elastin is the major structural component of elastic fibers, which confers tissue
elasticity. A proteinase may be named an elastase if it possesses the ability to solubilize
mature, cross-linked elastin (
Bieth, JG "Elastases: catalytic and biological properties," at pp. 217-320 (Mecham
Edition, Regulation of Matrix Accumulation, New York, Academic Press, 1986). Several published patent applications (
WO 2001/21574;
WO 2004/073504; and
WO 2006/036804) indicate that elastase, alone and in combination with other agents, is beneficial
in the treatment of diseases of biological conduits, including biological conduits
which are experiencing, or susceptible to experiencing, obstruction and vasospasm.
For elastase therapy of human subjects, the use of a human elastase is desirable to
reduce the risk of immune reaction to a non-human elastase.
[0003] To this date, however, there is no known commercially viable means of producing biologically
active elastase in sufficiently pure form and in sufficient quantities for clinical
applications. Because elastases are powerful proteases that can hydrolyze numerous
proteins other than elastin, the proteolytic activity of elastase poses potential
obstacles for its recombinant production. For example, the activity of mature elastase
can damage the host cell which is expressing it, degrade itself, or degrade agents
used to assist in the production or characterization of the elastase.
[0004] Elastases are often expressed as preproproteins, containing a signal peptide, an
activation peptide, and a mature, active portion. Cleavage of the signal sequence
upon secretion yields a proprotein that can have little or no enzymatic activity,
and whose amino acid sequence contains the amino acid sequence of an activation peptide
and a mature protein. Generally, for recombinant expression, an inactive precursor
may be expressed instead of the mature active enzyme to circumvent damage to the cell
that expresses it. For example,
U.S. Patent No. 5,212,068 describes the cloning of human pancreatic elastase cDNAs (referred to therein as
elastase "IIA," "IIB," "IIIA" and "IIIB"). The various elastases were expressed as
full-length cDNAs, including the native signal sequences, in mammalian COS-1 cells.
In addition, engineered versions of the elastases, containing a
B. subtilis signal sequence and a β-galactosidase signal sequence, were also expressed in
B. subtilis and
E. coli, respectively.
U.S. Patent No. 5,212,068 also suggests expressing elastases in
S. cerevisiae. Generally, working examples of elastase expression in
U.S. Patent No. 5,212,068 show low activity of the recovered elastase or require an activation step involving
treatment with trypsin, to generate the active elastase. In addition, the elastases
were largely present in inclusion bodies when expressed in
E. coli, and only small portions of the expressed elastase were soluble and active. None
of the elastase preparations described in
U.S. Patent No. 5,212,068 was purified to pharmaceutical grade.
[0006] Thus, there is a need in the art for recombinant manufacturing methods that allow
the generation of therapeutic amounts of biologically active pharmaceutical grade
elastases, and preferably avoid a trypsin activation step that is costly for large-scale
preparation and can result in trypsin contamination of the final product. Administration
of an elastase containing trypsin to a patient could result in activation of the protease-activated
receptors 1 and 2, which may reduce some of the beneficial effects of elastase treatment.
[0007] Citation or identification of any reference in Section 2 or in any other section
of this application shall not be construed as an admission that such reference is
available as prior art to the present invention.
3. SUMMARY OF THE INVENTION
[0008] The present invention is defined in the claims. To the extent that the following
description may set out details relating to subject matter that is not covered by
the claims, such subject matter is provided for information only.
[0009] The present invention provides novel, efficient methods of making recombinant elastase
proteins and the use of the recombinant proteins in compositions,
e.g., pharmaceutical compositions, elastase formulations or unit dosages, for the treatment
and prevention of diseases of biological conduits.
[0010] The present invention is directed to auto-activated proelastase proteins, nucleic
acids encoding auto-activated proelastase proteins, host cells comprising said nucleic
acids, methods of making auto-activated proelastase proteins and the use of auto-activated
proelastase proteins in the manufacture of mature, biologically active elastase proteins,
for example for use in pharmaceutical formulations. The term "auto-activated" (or
"autoactivated is used herein interchangeably with the terms "auto-activating," "self
activating," and "self-activated" and is not intended to imply that an activation
step has taken place. The term "activation" is used herein interchangeably with the
term "conversion" and is not intended to imply that a protein resulting from "activation"
necessarily possesses enzymatic activity.
[0011] As used hereinbelow, and unless indicated otherwise, the term "elastase" generally
refers to mature elastase proteins with elastase activity as well as immature elastase
proteins, including immature proelastase proteins (also referred to herein as elastase
proproteins) and immature preproelastase proteins (also referred to herein as elastase
preproproteins).
[0012] Preferred elastases of the invention are type I pancreatic elastases,
e.g., human type I pancreatic elastase and porcine type I pancreatic elastase. Type I
pancreatic elastases are sometimes referred to herein as "elastase-1," "elastase I,"
"elastase type 1," "type 1 elastase" or "ELA-1." Human type I pancreatic elastase
is also referred to herein as hELA-1 or human ELA-1, and porcine type I pancreatic
elastase is also referred to herein as pELA-1 or porcine ELA-1.
[0013] A mature elastase protein of the invention typically has an amino acid sequence encoded
by a naturally occurring elastase gene or a variant of such sequence. Preferred sequence
variants, including variants containing amino acid substitutions, are described herein.
A proelastase protein is a largely inactive precursor of a mature elastase protein,
and a preproelastase protein further contains a signal sequence for protein secretion.
Pre and pro sequences of the elastase proteins of the invention are typically not
native to the elastase genes encoding the mature elastase proteins of the invention.
Thus, in a sense, the immature elastase proteins of the invention are "chimeric" proteins,
with their mature portions encoded by a naturally-occurring elastase gene and their
immature portions encoded by non-elastase gene sequences.
[0014] For ease of reference, elastase proteins of the invention and their core sequence
components are depicted in Figure 2. As shown in Figure 2, the amino acid residues
within the proelastase sequence that are N-terminal to the cleavage bond (
i.e., the bond that is cleaved to yield mature elastase protein) are designated herein
as PX,...P5, P4, P3, P2, and P1, where P1 is immediately N-terminal to the cleavage
bond, whereas amino acids residues located to the C-terminus to the cleavage bond
(and to the N-terminus) of the mature elastase protein are designated P1', P2', P3',...PX',
where P1' is immediately C-terminal to the cleavage bond and represents the N-terminal
amino acid residue of the mature protein.
Figure 2 also shows the following components:
- (1) SIGNAL SEQUENCE: A sequence that increases the proportion of expressed molecules
that are secreted from the cell. An exemplary sequence is amino acids 1-22 of SEQ
ID NOS:50 or 51.
- (2) PROPEPTIDE + SPACER: An optional, preferably a non-elastase, propeptide sequence
(such as yeast α-factor propropeptide) that can further optionally include one or
more spacer sequences (a yeast α-factor propeptide sequences and Kex2 and STE 13 spacer
sequences are depicted in Figure 1B). In a specific embodiment, the propeptide sequence
does not include a spacer.
- (3) ELASTASE PROPEPTIDE: Peptide that, when present on the N-terminal end of an elastase,
renders the molecule inactive or less active as compared to the corresponding mature
elastase protein. The elastase propeptide may be contiguous with the activation peptide
or may contain additional amino acids relative to the activation peptide. Exemplary
elastase propeptide sequences are amino acids 1-10 of SEQ ID NOS:64 and 69.
- (4) ACTIVATION PEPTIDE: Used interchangeably herein with "activation sequence," an
activation peptide is a component of, and can be contiguous with, the elastase propeptide.
As shown in Figure 2, the activation peptide contains amino acid residues P10 through
P1. An exemplary activation peptide consensus sequence is SEQ ID NO:80; other examples
of activation peptide sequences are are SEQ ID NOS: 23, 72 and 73.
- (5) RECOGNITION SEQUENCE: A recognition sequence is a component of the elastase propeptide.
As shown in Figure 2, the recognition sequence contains amino acid residues P3 through
P1. Exemplary recognition sequence consensus sequences are SEQ ID NOS:11-13 and 93,
and an exemplary recognition sequence is SEQ ID NO:20.
- (6) CLEAVAGE DOMAIN: A region in the proelastase protein that spans the cleavage bond.
As shown in Figure 2, the cleavage domain contains amino acid residues P5 through
P3'. Exemplary cleavage domain sequences are SEQ ID NOS:42, 43, 48, 49, 53, 53, 54
and 55.
- (7) CLEAVAGE SITE: Another region in the proelastase protein that also spans the cleavage
bond. As shown in Figure 2, the cleavage site contains amino acid residues P4 through
P4'. An exemplary cleavage site sequence is SEQ ID NO:27.
- (8) PREPROELASTASE PROTEIN: A protein that can comprise all of the component parts.
An exemplary preproelastase protein can comprise a peptides of SEQ ID NO:50, 51, 96,
or 97 followed by an operably linked protein of SEQ ID NO:64 or SEQ ID NO:69.
- (9) PROELASTASE PROTEIN: A protein that comprises mature elastase protein, an elastase
propeptide, and the optional propeptide and spacer sequences. Exemplary proelastase
sequences are SEQ ID NOS:64 and 69.
- (10) MATURE ELASTASE PROTEIN: A protein that when properly processed displays elastase
activity. Exemplary mature sequences are SEQ ID NO:1 (human) and SEQ ID NO:39 (porcine).
[0015] The elastase protein components can be considered modular building blocks of the
elastase proteins, proelastase proteins and preproelastase proteins. For example,
the present invention provides a proelastase protein comprising the sequence of an
elastase propeptide and a mature elastase protein. The elastase propeptide can contain
an activation peptide. The elastase propeptide can also contain an elastase recognition
sequence. The present invention also provides a proelastase protein comprising a cleavage
domain or cleavage site in the region spanning the junction between the elastase propeptide
and the mature elastase protein. The proelastase proteins may further comprise a signal
sequence for secretion. Such proteins are considered preproelastase proteins. The
preproelastase proteins may further comprise a yeast alpha factor propeptide and optionally
a spacer sequence between the signal sequence and the elastase propeptide. The elastase
proteins of the invention may also contain components in addition to the core modular
components illustrated in Figure 2. For example, an elastase protein can contain an
epitope tag or a histidine tag for purification. It should also be noted that the
elastase proteins of the invention need not contain all the components depicted in
Figure 2, but generally contain at least one of the components (including, by way
of example but not limitation, a mature elastase or a proelastase sequence) depicted
in Figure 2. Exemplary elastase proteins of the invention are set forth in embodiments
1-12, 28-39 and 68-69 in Section 8 below, including exemplary type I proelastase proteins
set forth in embodiments 13-27 in Section 8 below.
[0016] Nucleic acids encoding the elastase proteins of the invention, methods for producing
and purifying the proteins, recombinant cells and cell culture supernatants, compositions
comprising elastase proteins (e.g., pharmaceutical compositions, unit dosages, formulations),
the use of the proteins for therapeutic purposes and kits comprising the proteins,
formulations, pharmaceutical compositions and unit doses are encompassed herein. Nucleic
acids encoding the elastase proteins of the invention are exemplified in embodiments
40-67 in Section 8 below, including vectors (see, e.g., embodiments 70-72). Also exemplified
in Section 8 are recombinant cells (see, e.g., embodiments 73-84), cell supernatants
containing elastase proteins (see, e.g., embodiment 88). Methods for producing elastase
proteins are exemplified in embodiments 89-224, 261-276 and 347-373 in Section 8.
Methods for producing elastase formulations are exemplified in embodiments 225-260
in Section 8. Methods of producing pharmaceutical compositions are exemplified in
embodiments 374-385 in Section 8. Pharmaceutical compositions comprising elastase
proteins are exemplified in embodiments 277-313 and 386 in Section 8, and unit dosages
are exemplified in embodiments 415-420 in Section 8. Formulations of elastase proteins
are exemplified in embodiments 324-346 in Section 8. The use of the elastase proteins
for therapeutic purposes is exemplified in embodiments 387-414 in Section 8. Kits
comprising the proteins are exemplified in Section 8 by way of embodiments 421-424.
[0017] Various aspects of the invention with respect to pharmaceutical compositions and/or
proelastase proteins with SEQ ID NOS:64 and 69 are exemplified as embodiments 425-472
in Section 8 below; however, such embodiments are applicable to other elastase protein
sequences and compositions disclosed herein.
[0018] The production methods described herein often include an activation step, whereby
the activation peptide is removed from the proelastase sequence/separated from the
mature elastase sequence, thereby generating a mature elastase protein. The activation
steps described herein may be auto activation steps,
i.e., carried out by an elastase activity, or nonauto activation step,
i.e., non-elastase mediated,
e.g., carried out by trypsin.
[0019] In certain aspects, the present invention provides a nucleic acid molecule comprising
a nucleotide sequence which encodes an elastase protein (including but not limited
to a protein of any one of SEQ ID NOS: 6-9, 64-69, 88-91, or 98-103) comprising (i)
an elastase propeptide comprising an activation peptide sequence comprising an elastase
recognition sequence operably linked to (ii) the amino acid sequence of a protein
having elastase activity. The protein optionally further comprises a signal sequence,
such as a yeast α-factor signal peptide and exemplified by the amino acid sequence
of SEQ ID NO:34, operably linked to said elastase propeptide. The α-factor is sometimes
referred to herein as "alpha-factor" or "alpha mating factor" or "α-mating factor."
In certain specific embodiments, the protein comprises a non-elastase propeptide such
as yeast α-factor propeptide. In certain specific embodiments, the protein can comprise
one or more spacer sequences. Spacer sequences can include, but are not limited to,
Kex2 and STE13 protease cleavage sites. In a specific embodiment, a Kex2 spacer can
be used. In another embodiment, a Kex2 spacer can be operably linked to STE 13 spacers
as shown in Figure 1B. A signal peptide sequence and a non-elastase propeptide sequence
is exemplified by the amino acid sequences of SEQ IDS NO:51 or 97. A peptide containing
a signal peptide sequence, a non-elastase propeptide sequence,and a spacer sequence
is exemplified by the amino acid sequences of SEQ IDS NO:50 or 96.
[0020] In other specific embodiments, the signal sequence is a mammalian secretion signal
sequence, such as a porcine or human type I elastase (used interchangeably with a
type I pancreatic elastase) signal sequence.
[0021] Preferably, the elastase recognition sequence is a type I pancreatic elastase recognition
sequence.
[0022] In specific embodiments, the protein having type I elastase activity is a mature
human type I elastase, for example a protein of the amino acid sequence of SEQ ID
NO:1, 4, 5, 84, or 87.
[0023] The present invention also provides a nucleic acid molecule comprising a nucleotide
sequence which encodes a protein comprising (i) a signal sequence operable in
Pichia pastoris operably linked to (ii) an activation sequence (including but not limited to an amino
acid sequence of SEQ ID NOS: 23, 72, 73, or 80) comprising a protease recognition
sequence (including but not limited to an amino acid sequence of any of SEQ ID NOS:11-23
and 93 which in turn is operably linked to (iii) the amino acid sequence of a mature
human type I elastase. In a preferred embodiment, the protease recognition sequence
is a human type I elastase recognition sequence, most preferably an elastase recognition
sequence of SEQ ID NO:20.
[0024] Proelastase proteins (optionally comprising a signal sequence and thus representing
preproelastase proteins) and mature elastase proteins encoded by the nucleic acids
of the invention are also provided, as are compositions (
e.g., pharmaceutical compositions, formulations and unit dosages) comprising said mature
elastase proteins.
[0025] In a preferred embodiment, the proelastase protein or mature elastase protein does
not have an N-terminal methionine residue. In another embodiment, however, the proelastase
protein or mature elastase protein does have an N-terminal methionine residue.
Table 1 below summarizes the sequence identifiers used in the present specification.
Preferred proteins of the invention comprise or consist of any of SEQ ID NOS:1-32,
34, 37-73, 77, 78, 82-92, and 98-105 listed in Table 1 below, or are encoded in part
or entirely by the nucleotide sequences of SEQ ID NO:33 and SEQ ID NO:81.
Table 1: Summary of amino acid and nucleotide SEQ ID NOS.
| MOLECULE |
NUCLEOTIDE OR AMINO ACID |
SEQ ID NO |
| Mature human elastase I, including first "valine," with possible polymorphism at position
220 (V or L) (numbering refers to position in context of preproprotein) |
Amino Acid |
1 |
| Mature human elastase I, minus first "valine," with possible polymorphism at position
220 (V or L) (numbering refers to position in context of preproprotein) |
Amino Acid |
2 |
| Mature human elastase I, minus first two "valines," with possible polymorphism at
position 220 (V or L) (numbering refers to position in context of preproprotein) |
Amino Acid |
3 |
| Mature human elastase I, with first "valine" substituted by "alanine," with possible
polymorphism at position 220 (V or L) (numbering refers to position in context of
preproprotein) |
Amino Acid |
4 |
| Mature human elastase I (isotype 2), including first "valine" |
Amino Acid |
5 |
| Engineered elastase proprotein no. 1 (pPROT42 variant), with possible polymorphism
at position 220 (V or L) (numbering refers to position in context of preproprotein) |
Amino Acid |
6 |
| Engineered elastase proprotein no. 2, with possible polymorphism at position 220 (V
or L) (numbering refers to position in context of preproprotein) |
Amino Acid |
7 |
| Engineered elastase proprotein no. 3, with possible polymorphism at position 220 (V
or L) (numbering refers to position in context of preproprotein) |
Amino Acid |
8 |
| Engineered elastase proprotein no. 4, with possible polymorphism at position 220 (V
or L) (numbering refers to position in context of preproprotein) |
Amino Acid |
9 |
| Engineered elastase proprotein no. 5 (pPROT24 trypsin activated sequence), with possible
polymorphism at position 220 (V or L) (numbering refers to position in context of
preproprotein) |
Amino Acid |
10 |
| Consensus elastase recognition sequence 1 (Positions Xaa1=P3, Xaa2=P2, Xaa3=P1) |
Amino Acid |
11 |
| Consensus elastase recognition sequence 2 (Positions P3-P2-P1) |
Amino Acid |
12 |
| Consensus elastase recognition sequence 3 (Positions P3-P2-P1) |
Amino Acid |
13 |
| Elastase recognition sequence 1 (Positions P3-P2-P1) |
Amino Acid |
14 |
| Elastase recognition sequence 2 (Positions P3-P2-P1) |
Amino Acid |
15 |
| Elastase recognition sequence 3 (Positions P3-P2-P1) |
Amino Acid |
16 |
| Wild-type trypsin recognition sequence (pPROT24) (Positions P3-P2-P1) |
Amino Acid |
17 |
| Elastase recognition sequence 5 (Positions P3-P2-P1) |
Amino Acid |
18 |
| Elastase recognition sequence 6 (Positions P3-P2-P1) |
Amino Acid |
19 |
| Elastase recognition sequence 7 (Positions P3-P2-P1 of Variants 48 and 55) |
Amino Acid |
20 |
| Elastase recognition sequence 8 |
Amino Acid |
21 |
| Human elastase activation sequence 1 |
Amino Acid |
22 |
| Human elastase activation sequence 2 |
Amino Acid |
23 |
| pro-PROT-201 cleavage site |
Amino Acid |
24 |
| pPROT40 cleavage site |
Amino Acid |
25 |
| pPROT41 cleavage site |
Amino Acid |
26 |
| pPROT42 cleavage site |
Amino Acid |
27 |
| pPROT43 cleavage site |
Amino Acid |
28 |
| pPROT44 cleavage site |
Amino Acid |
29 |
| pPROT45 cleavage site |
Amino Acid |
30 |
| pPROT46 cleavage site |
Amino Acid |
31 |
| pPROT47 cleavage site |
Amino Acid |
32 |
| Coding region of a human elastase-1 (i.e., human type I pancreatic elastase) (NCBI
Accession No. NM 001971) |
Nucleotide |
33 |
| Yeast alpha factor signal peptide |
Amino Acid |
34 |
| 20F primer |
Nucleotide |
35 |
| 24R primer |
Nucleotide |
36 |
| pPROT42 P3 Cleavage Site Variant Elastase, with possible polymorphism at position
220 (V or L) (numbering refers to position in context of preproprotein) |
Amino Acid |
37 |
| pPROT42 P2 Cleavage Site Variant Elastase, with possible polymorphism at position
220 (V or L) (numbering refers to position in context of preproprotein) |
Amino Acid |
38 |
| Mature porcine pancreatic Elastase I (from GenBank Accession P00772.1) |
Amino Acid |
39 |
| Elastase Variant Propeptide Cleavage Domain 40 |
Amino Acid |
40 |
| Elastase Variant Propeptide Cleavage Domain 41 |
Amino Acid |
41 |
| Elastase Variant Propeptide Cleavage Domain 42 |
Amino Acid |
42 |
| Elastase Variant Propeptide Cleavage Domain 43 |
Amino Acid |
43 |
| Elastase Variant Propeptide Cleavage Domain 44 |
Amino Acid |
44 |
| Elastase Variant Propeptide Cleavage Domain 45 |
Amino Acid |
45 |
| Elastase Variant Propeptide Cleavage Domain 46 |
Amino Acid |
46 |
| Elastase Variant Propeptide Cleavage Domain 47 |
Amino Acid |
47 |
| Elastase Variant Propeptide Cleavage Domain 48 |
Amino Acid |
48 |
| Elastase Variant Propeptide Cleavage Domain 49 |
Amino Acid |
49 |
| Yeast alpha-mating factor signal peptide, propeptide, and spacer sequence 1 |
Amino Acid |
50 |
| Yeast alpha-mating factor signal peptide and propeptide sequence 2 |
Amino Acid |
51 |
| Elastase Variant Propeptide Cleavage Domain 52 |
Amino Acid |
52 |
| Elastase Variant Propeptide Cleavage Domain 53 |
Amino Acid |
53 |
| Elastase Variant Propeptide Cleavage Domain 54 |
Amino Acid |
54 |
| Elastase Variant Propeptide Cleavage Domain 55 |
Amino Acid |
55 |
| Elastase Variant Propeptide Cleavage Domain 56 |
Amino Acid |
56 |
| Elastase Variant Propeptide Cleavage Domain 57 |
Amino Acid |
57 |
| Elastase Variant Propeptide Cleavage Domain 58 |
Amino Acid |
58 |
| Elastase Variant Propeptide Cleavage Domain 59 |
Amino Acid |
59 |
| Elastase Variant Propeptide Cleavage Domain 60 |
Amino Acid |
60 |
| Elastase Variant Propeptide Cleavage Domain 61 |
Amino Acid |
61 |
| Elastase Variant Propeptide Cleavage Domain 62 |
Amino Acid |
62 |
| Elastase Variant Propeptide Cleavage Domain 63 |
Amino Acid |
63 |
| Elastase Proenzyme with variant Cleavage Domain 48, with possible polymorphism at
position 220 (V or L) (numbering refers to position in context of preproprotein) |
Amino Acid |
64 |
| Elastase Proenzyme with variant Cleavage Domain 49, with possible polymorphism at
position 220 (V or L) (numbering refers to position in context of preproprotein) |
Amino Acid |
65 |
| Elastase Proenzyme with variant Cleavage Domain 52, with possible polymorphism at
position 220 (V or L) (numbering refers to position in context of preproprotein) |
Amino Acid |
66 |
| Elastase Proenzyme with variant Cleavage Domain 53, with possible polymorphism at
position 220 (V or L) (numbering refers to position in context of preproprotein) |
Amino Acid |
67 |
| Elastase Proenzyme with variant Cleavage Domain 54, with possible polymorphism at
position 220 (V or L) (numbering refers to position in context of preproprotein) |
Amino Acid |
68 |
| Elastase Proenzyme with variant Cleavage Domain 55, with possible polymorphism at
position 220 (V or L) (numbering refers to position in context of preproprotein) |
Amino Acid |
69 |
| Wild Type Elastase +AlaArg Cleavage Variant, with possible polymorphism at position
220 (V or L) (numbering refers to position in context of preproprotein) |
Amino Acid |
70 |
| Wild Type Elastase +Arg Cleavage Variant, with possible polymorphism at position 220
(V or L) (numbering refers to position in context of preproprotein) |
Amino Acid |
71 |
| Variant 48 Human Elastase Activation peptide |
Amino Acid |
72 |
| Variant 55 Human Elastase Activation peptide |
Amino Acid |
73 |
| Human Elastase Cleavage Domain Consensus Sequence; corresponds to residues P5, P4,
P3, P2, P1, P'1, P'2, and P'3 of an elastase cleavage domain |
Amino Acid |
74 |
| PCR Mutagenesis Primer for pPROT3 construction |
Nucleic Acid |
75 |
| PCR Mutagenesis Primer or pPROT3 construction |
Nucleic Acid |
76 |
| Mature ELA1 C-terminal Variant of Talas et al., 2000, Invest Dermatol. 114(1):165-70. |
Amino Acid |
77 |
| Mature ELA-1 variants, with possible polymorphisms at positions 44 (W or R); 59 (M
or V); 220 (V or L); and 243 (Q or R) (numbering refers to position in context of
preproprotein) |
Amino Acid |
78 |
| Activation peptide variants (wild type, trypsin cleavable), with possible polymorphisms
at position 10 (Q or H) (numbering refers to position in context of preproprotein) |
Amino Acid |
79 |
| Activation peptide "consensus" sequence |
Amino Acid |
80 |
| Coding region of ELA-1.2A |
Amino Acid |
81 |
| Translation Product of ELA-1.2A |
Amino Acid |
82 |
| (Trypsin activated pPROT24 sequence) |
|
|
| Translation Product of ELA-1.2A |
Amino Acid |
83 |
| (trypsin activated pPROT24 sequence), with possible polymorphisms at positions 44
(W or R); 59 (M or V); 220 (V or L); and 243 (Q or R) (numbering refers to position
in context of preproprotein) |
|
|
| Mature human elastase I, including first "valine," with possible polymorphisms at
positions 44 (W or R); 59 (M or V); 220 (V or L); and 243 (Q or R) (numbering refers
to position in context of preproprotein) |
Amino Acid |
84 |
| mature human elastase I, minus first "valine," with possible polymorphisms at positions
44 (W or R); 59 (M or V); 220 |
Amino Acid |
85 |
| (V or L); and 243 (Q or R) (numbering refers to position in context of preproprotein) |
|
|
| Mature human elastase I, minus first two "valines," with possible polymorphisms at
positions 44 (W or R); 59 (M or V); 220 (V or L); and 243 (Q or R) (numbering refers
to position in context of preproprotein) |
Amino Acid |
86 |
| mature human elastase I, with first "valine" substituted by "alanine," with possible
polymorphisms at positions 44 (W or R); 59 (M or V); 220 (V or L); and 243 (Q or R)
(numbering refers to position in context of preproprotein) |
Amino Acid |
87 |
| Engineered elastase proprotein no. 1 (pPROT42 variant), with possible polymorphisms
at positions 10 (Q or H); 44 (W or R); 59 (M or V); 220 (V or L); and 243 (Q or R)
(numbering refers to position in context of preproprotein) |
Amino Acid |
88 |
| Engineered elastase proprotein no. 2, with possible polymorphisms at positions 10
(Q or H); 44 (W or R); 59 (M or V); 220 (V or L); and 243 (Q or R) (numbering refers
to position in context of preproprotein) |
Amino Acid |
89 |
| Engineered elastase proprotein no. 3, with possible polymorphisms at positions 10
(Q or H); 44 (W or R); 59 (M or V); 220 (V or L); and 243 (Q or R) (numbering refers
to position in context of preproprotein) |
Amino Acid |
90 |
| engineered elastase proprotein no. 4, with possible polymorphisms at positions 10
(Q or H); 44 (W or R); 59 (M or V); 220 (V or L); and 243 (Q or R) (numbering refers
to position in context of preproprotein) |
Amino Acid |
91 |
| engineered elastase proprotein no. 5 (pPROT24 trypsin activated sequence), with possible
polymorphisms at positions 10 (Q or H); 44 (W or R); 59 (M or V); 220 (V or L); and
243 (Q or R) (numbering refers to position in context of preproprotein) |
Amino Acid |
92 |
| Consensus elastase recognition sequence 4 (Positions P3-P2-P1) |
Amino Acid |
93 |
| pPROT42 P3 Cleavage Site Variant Elastase, with possible polymorphisms at positions
44 (W or R); 59 (M or V); 220 (V or L); and 243 (Q or R) (numbering refers to position
in context of preproprotein) |
Amino Acid |
94 |
| pPROT42 P2 Cleavage Site Variant Elastase, with possible polymorphisms at positions
44 (W or R); 59 (M or V); 220 (V or L); and 243 (Q or R) (numbering refers to position
in context of preproprotein) |
Amino Acid |
95 |
| Yeast alpha-mating factor signal peptide, propeptide, and spacer sequence 1 |
Amino Acid |
96 |
| Yeast alpha-mating factor signal peptide and propeptide sequence 2 |
Amino Acid |
97 |
| Elastase Proenzyme with variant Cleavage Domain 48 Generic to SEQ ID NO:64, with possible
polymorphisms at positions 10 (Q or H); 44 (W or R); 59 (M or V); 220 (V or L); and
243 (Q or R) (numbering refers to position in context of preproprotein) |
Amino Acid |
98 |
| Elastase Proenzyme with variant Cleavage Domain 49, with possible polymorphisms at
positions 10 (Q or H); 44 (W or R); 59 (M or V); 220 (V or L); and 243 (Q or R) (numbering
refers to position in context of preproprotein) |
Amino Acid |
99 |
| Elastase Proenzyme with variant Cleavage Domain 52, with possible polymorphisms at
positions 10 (Q or H); 44 (W or R); 59 (M or V); 220 (V or L); and 243 (Q or R) (numbering
refers to position in context of preproprotein) |
Amino Acid |
100 |
| Elastase Proenzyme with variant Cleavage Domain 53, with possible polymorphisms at
positions 10 (Q or H); 44 (W or R); 59 (M or V); 220 (V or L); and 243 (Q or R) (numbering
refers to position in context of preproprotein) |
Amino Acid |
101 |
| Elastase Proenzyme with variant Cleavage Domain 54, with possible polymorphisms at
positions 10 (Q or H); 44 (W or R); 59 (M or V); 220 (V or L); and 243 (Q or R) (numbering
refers to position in context of preproprotein) |
Amino Acid |
102 |
| Elastase Proenzyme with variant Cleavage Domain 55, with possible polymorphisms at
positions 10 (Q or H); 44 (W or R); 59 (M or V); 220 (V or L); and 243 (Q or R) (numbering
refers to position in context of preproprotein) |
Amino Acid |
103 |
| Wild Type Elastase +AlaArg Cleavage Variant, with possible polymorphisms at positions
44 (W or R); 59 (M or V); 220 (V or L); and 243 (Q or R) (numbering refers to position
in context of preproprotein) |
Amino Acid |
104 |
| Wild Type Elastase +Arg Cleavage Variant, with possible polymorphisms at positions
10 (Q or H); 44 (W or R); 59 (M or V); 220 (V or L); and 243 (Q or R) (numbering refers
to position in context of preproprotein) |
Amino Acid |
105 |
| Mature human elastase I cleavage variant lacking first four amino acids, with possible
polymorphisms at positions 10 (Q or H); 44 (W or R); 59 (M or V); 220 (V or L); and
243 (Q or R) (numbering refers to position in context of preproprotein) |
Amino Acid |
106 |
| Mature human elastase I cleavage variant lacking first six amino acids, with possible
polymorphisms at positions 44 (W or R); 59 (M or V); 220 (V or L); and 243 (Q or R)
(numbering refers to position in context of preproprotein) |
Amino Acid |
107 |
| Mature human elastase I cleavage variant lacking first nine amino acids, with possible
polymorphisms at positions 44 (W or R); 59 (M or V); 220 (V or L); and 243 (Q or R)
(numbering refers to position in context of preproprotein) |
Amino Acid |
108 |
| Nucleic acid sequence of Figure 1A |
Nucleic Acid |
109 |
| Amino acid sequence of Figure 1A |
Amino Acid |
110 |
| Nucleic acid sequence of Figure 1B |
Nucleic Acid |
111 |
| Amino acid sequence of Figure 1B |
Amino Acid |
112 |
| Nucleic acid sequence of Figure 13 |
Nucleic Acid |
113 |
| Amino acid sequence of Figure 14 |
Amino Acid |
114 |
| Cleavage domain sequence of trypsin-activated pPROT101-24-V |
Amino Acid |
115 |
| Cleavage domain sequence of auto-activated pPROT101-42-V |
Amino Acid |
116 |
| Cleavage domain sequence of auto-activated pPROT101-49-V |
Amino Acid |
117 |
| Cleavage domain sequence of auto-activated pPROT101-55L-V |
Amino Acid |
118 |
[0026] There are at least 5 confirmed polymorphisms in human type I elastase protein, at
positions 10 (Q or H); 44 (W or R); 59 (M or V); 220 (V or L); and 243 (Q or R). The
fulllength (preproelastase) protein is 258 amino acids in length. The first 8 amino
acids correspond to the signal or "pre" peptide sequence that is cleaved off to generate
an inactive proprotein, and a further "pro" peptide sequence (comprising or consisting
of 10 amino acids corresponding to an activation peptide) are cleaved to generate
the active, mature protein. Thus, the polymorphism at position 10 is present in the
proprotein but not in the mature protein.
[0027] Accordingly, in Table 2 below are presented all possible combinations of the 5 polymorphisms
of human type 1 elastase. The present invention provides preproelastase and proelastase
proteins (including but not limited to the variant preproelastase and proelastase
proteins described herein), such as the proteins exemplified in embodiments 1-39 and
68-69 or the proteins obtained or obtainable by the method of any one of embodiments
89-224, 261-276, and 347- 373 in Section 8, comprising the any of the combinations
of polymorphisms set forth in Table 2 below.
Table 2: Variants of human type I immature elastase (pre-pro) and pro elastase proteins. The
position numbering refers to the position in the context of the preproprotein of native
human type I elastase.
| Position |
10 |
44 |
59 |
220 |
243 |
| Embodiment |
Q or H |
W or R |
M or V |
V or L |
Q or R |
| 1. |
Q |
W |
M |
V |
Q |
| 2. |
Q |
W |
M |
V |
R |
| 3. |
Q |
W |
M |
L |
Q |
| 4. |
Q |
W |
V |
V |
Q |
| 5. |
Q |
R |
M |
V |
Q |
| 6. |
Q |
W |
M |
L |
R |
| 7. |
Q |
W |
V |
L |
Q |
| 8. |
Q |
R |
V |
V |
Q |
| 9. |
Q |
W |
V |
V |
R |
| 10. |
Q |
R |
M |
L |
Q |
| 11. |
Q |
R |
M |
V |
R |
| 12. |
Q |
R |
V |
L |
Q |
| 13. |
Q |
R |
V |
V |
R |
| 14. |
Q |
R |
M |
L |
R |
| 15. |
Q |
W |
V |
L |
R |
| 16. |
Q |
R |
V |
L |
R |
| 17. |
H |
W |
M |
V |
Q |
| 18. |
H |
W |
M |
V |
R |
| 19. |
H |
W |
M |
L |
Q |
| 20. |
H |
W |
V |
V |
Q |
| 21. |
H |
R |
M |
V |
Q |
| 22. |
H |
W |
M |
L |
R |
| 23. |
H |
W |
V |
L |
Q |
| 24. |
H |
R |
V |
V |
Q |
| 25. |
H |
W |
V |
V |
R |
| 26. |
H |
R |
M |
L |
Q |
| 27. |
H |
R |
M |
V |
R |
| 28. |
H |
R |
V |
L |
Q |
| 29. |
H |
R |
V |
V |
R |
| 30. |
H |
R |
M |
L |
R |
| 31. |
H |
W |
V |
L |
R |
| 32. |
H |
R |
V |
L |
R |
[0028] Moreover, in Table 3 below are presented all possible combinations of the 4 polymorphisms
of human type I elastase that may be present in a mature elastase protein. The present
invention provides mature elastase proteins (including but not limited to the variant
mature elastase proteins described herein), such as the mature elastase proteins obtained
or obtainable by the method of any one of embodiments 89-224, 261-276, and 347-373
in Section 8, comprising the any of the combinations of polymorphisms set forth in
Table 3 below.
Table 3: Variants of mature human type I elastase proteins. The position numbering refers
to the position in the context of the preproprotein of native human type I elastase.
| Position |
44 |
59 |
220 |
243 |
| Embodiment |
W or R |
M or V |
V or L |
Q or R |
| 1. |
W |
M |
V |
Q |
| 2. |
W |
M |
V |
R |
| 3. |
W |
M |
L |
Q |
| 4. |
W |
V |
V |
Q |
| 5. |
R |
M |
V |
Q |
| 6. |
W |
M |
L |
R |
| 7. |
W |
V |
L |
Q |
| 8. |
R |
V |
V |
Q |
| 9. |
W |
V |
V |
R |
| 10. |
R |
M |
L |
Q |
| 11. |
R |
M |
V |
R |
| 12. |
R |
V |
L |
Q |
| 13. |
R |
V |
V |
R |
| 14. |
R |
M |
L |
R |
| 15. |
W |
V |
L |
R |
| 16. |
R |
V |
L |
R |
[0029] The mature type I elastases of the invention can be purified, for example for use
in pharmaceutical compositions. In specific embodiments, the elastases are at least
70%, 80%, 90%, 95%, 98% or 99% pure.
[0030] The mature type I elastases of the invention preferably have a specific activity
of greater than 1, greater than 5, greater than 10, greater than 20, greater than
25, or greater than 30 U/mg of protein, as determined by measuring the rate of hydrolysis
of the small peptide substrate N-succinyl-Ala-Ala-Ala-pNitroanilide (SLAP), which
is catalyzed by the addition of elastase. One unit of activity is defined as the amount
of elastase that catalyzes the hydrolysis of 1 micromole of substrate per minute at
30°C and specific activity is defined as activity per mg of elastase protein (U/mg).
Preferably, a mature human type I elastase has a specific activity within a range
in which the lower limit is 1, 2, 3, 4, 5, 7, 10, 15 or 20 U/mg protein and in which
the upper limit is, independently, 5, 10, 15, 20, 25, 30, 35, 40 or 50 U/mg protein.
In exemplary embodiments, the specific activity is in the range of from 1 to 40 U/mg
of protein, from 1 to 5 U/mg of protein, from 2 to 10 U/mg of protein, from 4 to 15
U/mg of protein, from 5 to 30 U/mg of protein, from 10 to 20 U/mg of protein, from
20 to 40 U/mg of protein, or any range whose upper and lower limits are selected from
any of the foregoing values. A mature porcine type I elastase preferably has a specific
activity within a range in which the lower limit is 1, 2, 3, 4, 5, 7, 10, 15, 20,
30, 40, 50, 60, or 75 U/mg protein and in which the upper limit is, independently,
5, 10, 15, 20, 25, 30, 35, 40, 50, 60, 75, 90, 95 or 100 U/mg protein. In exemplary
embodiments, the specific activity of the porcine elastase is in the range of from
10 to 50 U/mg of protein, from 20 to 60 U/mg of protein, from 30 to 75 U/mg of protein,
from 30 to 40 U/mg of protein, from 20 to 35 U/mg of protein, from 50 to 95 U/mg of
protein, from 25 to 100 U/mg of protein, or any range whose upper and lower limits
are selected from any of the foregoing values.
[0031] Accordingly, certain aspects of the present invention relate to compositions, such
as pharmaceutical compositions, elastase formulations and unit dosages, such as those
exemplified in embodiments 277-314, 346, 386, and 415-420 or those obtained or obtainable
by the method of any one of embodiments 261-276 and 374-385 in Section 8 below.
[0032] In certain embodiments, the compositions of the invention comprise trypsin-activated
elastase proteins, e.g., trypsin activated proteins made by any of the methods disclosed
herein. In other embodiments, the compositions comprise autoactivated elastase proteins,
e.g., autoactivated elastase proteins made by any of the methods disclosed herein.
In certain aspects, a composition of the invention is characterized by at least one,
at least two, at least three, at least four, at least five, at least six or at least
seven of the following properties: (a)the composition is free of trypsin; (b) the
composition is substantially free of trypsin; (c) the composition is free of any protein
consisting of SEQ ID NOS:70 and 71; (d) the composition is substantially free of any
protein consisting of SEQ ID NOS:2 and 3; (e) the composition is free of bacterial
proteins; (f) the composition is substantially free of bacterial proteins; (g) the
composition is free of mammalian proteins other than said mature elastase protein;
(h) the composition is substantially free of mammalian proteins other than said mature
elastase protein; (i) the composition is free or substantially free of one, two, three
or all four proteins consisting of SEQ ID NO:85, 86, 94 and 95; (j) the composition
is free or substantially free of one, two, or all three proteins consisting of SEQ
ID NO:106, 107 and 108; (k) the composition contains pharmaceutically acceptable levels
of endotoxins (
e.g., 10 EU/mg elastase or less, or 5 EU/mg elastase or or less); (1) the mature elastase
protein in the composition is characterized by a specific activity of 1 to 40 U/mg
of protein or any other range of specific activity disclosed herein; (m) the trypsin
activity in said composition corresponds to less than 4 ng per 1 mg of mature elastase
protein or any other range of trypsin activity disclosed herien; (n) the composition
comprises polysorbate-80; (o) the composition comprises dextran; (p) the composition
comprises sodium ions, potassium ions, phosphate ions, chloride ions and polysorbate-80;
(q) the composition comprises sodium ions, potassium ions, phosphate ions, chloride
ions and dextran; (r) the composition comprises sodium ions, potassium ions, phosphate
ions, chloride ions, polysorbate-80, and dextran; (s) the mature elastase protein
in said composition dispays an amount of stability disclosed herein, e.g., maintains
60% to 100% of its specific activity after at least a week of storage at 4°C, after
at least a month of storage at 4°C, after at least two months of storage at 4°C, after
at least three months of storage at 4°C, or after at least month six months of storage
at 4°C; and (t) the composition comprises a unit dosage of 0.0033 mg to 200 mg of
said mature elastase protein, or any other unit dosage of mature elastase protein
disclosed herein.
[0033] In certain aspects, the composition is characterized by at least three characteristics,
at least four characteristics or five characteristics independently selected from
the following groups (i) through (v):
- (i) (a), (b) or (m)
- (ii) (e) or (f)
- (iii) (g) or (h)
- (iv) (k)
- (v) (1)
[0034] In specific embodiments, two of said at least three or at least said four characteristics
are selected from groups (i) and (iv) or (v). In other embodiments, three of at least
said four characteristics are selected from groups (i), (iv) and (v).
[0035] In specific embodiments, the present invention provides a composition, including
but not limited to a pharmaceutical composition, elastase formulation or unit dosage,
comprising (i) a therapeutically effective amount of human type I elastase that is
free of trypsin and (ii) a pharmaceutically acceptable carrier. Alternatively, the
present invention provides a composition comprising (i) a therapeutically effective
amount of human type I elastase that is substantially free of trypsin and (ii) a pharmaceutically
acceptable carrier. In specific embodiments, the human type I elastase and/or the
composition comprises less than 5 ng/ml of trypsin activity, less than 4 ng/ml of
trypsin activity, less than 3 ng/ml of trypsin activity, less than 2 ng/ml of trypsin
activity, or less than 1.56 ng/ml of trypsin activity. In the foregoing examples,
the ng/ml trypsin activity can be assayed in a liquid human type I elastase composition
or preparation containing 1 mg/ml human type I elastase protein. Thus, the trypsin
activities may also be described in terms of milligrams of elastase protein, for example,
less than 3 ng trypsin activity/mg elastase protein, less than 1.56 ng trypsin activity/mg
elastase protein, etc. The present invention further provides a composition comprising
(i) a therapeutically effective amount of human type I elastase and (ii) a pharmaceutically
acceptable carrier, wherein the composition comprises less than 5 ng of trypsin activity
per mg of elastase, less than 4 ng trypsin activity per mg of elastase, less than
3 ng of trypsin activity per mg of elastase, less than 2 ng of trypsin activity per
mg of elastase, or less than 1.56 ng of trypsin activity per mg of elastase.
[0036] The present invention further provides methods of improving the quality of mature
elastase proteins produced by trypsin activation methods (
e.g., the methods of embodiment 145 in Section 8 below), comprising purifying the mature
elastase protein on a Macro-Prep High S Resin column. It was found by the present
inventors that mature elastase proteins purified on a Macro-Prep High S Resin column
yields elastase compositions with trypsin activity levels corresponding 20-25 ng trypsin
activity/mg elastase protein, as compared to purification on a Poros (Poly (Styrene-Divinylbenzene))
column which yields elastase compositions with trypsin activity leavels corresponding
to approximately 1000 ng trypsin activity/mg elastase protein. The present invention
further provides elastase compositions comprising mature elastase proteins produced
by purifying trypsin-activated elastase proteins on a Macro-Prep High S Resin column.
The Macro-Prep High S Resin is available from Biorad (Hercules, CA), according to
whom a column of rigid methacrylate supports with little shrinkage and swelling. Other
similar cation exchange columns of the same class and/or with the same bead size (around
50 µm) may be used, such as other methacrylate columns, may suitably be used.
[0037] Other aspects of the present invention relate to compositions, including but not
limited to pharmaceutical compositions, elastase formulations or unit dosages, comprising
porcine type I pancreatic elastase. In specific embodiments, the present invention
provides a composition comprising (i) a therapeutically effective amount of porcine
type I pancreatic elastase that is free of trypsin and (ii) a pharmaceutically acceptable
carrier. Alternatively, the present invention provides a composition comprising (i)
a therapeutically effective amount of porcine type I pancreatic elastase that is substantially
free of trypsin and (ii) a pharmaceutically acceptable carrier. In specific embodiments,
the porcine type I pancreatic elastase and/or the composition comprises less than
100 ng/ml of trypsin activity, less than 75 ng/ml of trypsin activity, less than 50
ng/ml of trypsin activity, less than 25 ng/ml of trypsin activity, less than 15 ng/ml
of trypsin activity, less than 10 ng/ml of trypsin activity, less than 5 ng/ml of
trypsin activity, less than 4 ng/ml of trypsin activity, less than 3 ng/ml of trypsin
activity, less than 2 ng/ml of trypsin activity, or less than 1.56 ng/ml of trypsin
activity. In the foregoing examples, the ng/ml trypsin activity can be assayed in
a liquid porcine type I pancreatic elastase composition or preparation containing
1 mg/ml porcine type I pancreatic elastase. Thus, the trypsin activities may also
be described in terms of milligrams of elastase protein, for example, less than 25
ng trypsin activity/mg elastase protein, less than 5 ng trypsin activity/mg elastase
protein, etc. The present invention further provides a composition comprising (i)
a therapeutically effective amount of porcine type I elastase and (ii) a pharmaceutically
acceptable carrier, wherein the composition comprises than 100 ng of trypsin activity
per mg of elastase, less than 75 ng trypsin activity per mg of elastase, less than
50 ng of trypsin activity per mg of elastase, less than 25 ng of trypsin activity
per mg of elastase, less than 15 ng of trypsin activity per mg of elastase, less than
10 ng or trypsin activity per mg of elastase, less than 5 ng of trypsin activity per
mg of elastase, less than 4 ng trypsin activity per mg of elastase, less than 3 ng
of trypsin activity per mg of elastase, less than 2 ng of trypsin activity per mg
of elastase, or less than 1.56 ng of trypsin activity per mg of elastase.
[0038] In other embodiments, the present invention provides compositions of elastase proteins,
such as mature elastase proteins, including but not limited to pharmaceutical compositions,
elastase formulations or unit dosages, that are free of N-terminal variants corresponding
to one, two, three or all four of SEQ ID NOS: 70, 71, 104, 105. In certain embodiments,
the present invention provides a pharmaceutical composition comprising (i) a therapeutically
effective amount of mature human type I elastase (ii) a pharmaceutically acceptable
carrier, which pharmaceutical composition is free of any protein with SEQ ID NOS:70,
71, 104, 105.
[0039] In other embodiments, the present invention provides a composition, including but
not limited to a pharmaceutical composition, an elastase formulation or unit dosage,
comprising (i) a therapeutically effective amount of human type I elastase that is
free or substantially free of variant proteins containing specific additional amino
acids on the N-terminal end of the mature elastase protein (SEQ ID NOS: 37, 38, 70,
71, 94, 95, 104, 105) and (ii) a pharmaceutically acceptable carrier. In other embodiments,
the present invention provides a composition comprising (i) a therapeutically effective
amount of human type I elastase that is free or substantially free of variant proteins
lacking N-terminal amino acids of the mature elastase protein (SEQ ID NOS: 2, 3, 37,
38, 70, 71, 85, 86, 94, 95, 104, 105, 106, 107, 108) and (ii) a pharmaceutically acceptable
carrier. In specific embodiments, the human type I elastase and/or the composition
comprises less than 25% N-terminal variants, less than 20% N-terminal variants, less
than 15% N-terminal variants, less than 10% N-terminal variants, less than 5% N-terminal
variants, less than 4% N-terminal variants, less than 3% N-terminal variants, less
than 2% N-terminal variants, less than 1% N-terminal variants, less than 0.5% N-terminal
variants, 0% N-terminal variants, or comprises N-terminal variants in an amount ranging
between any two of the foregoing percentages (
e.g., 2%-25% N-terminal variants, 0.5%-10% N-terminal variants, 5%-15% N-terminal variants,
0%-2% N-terminal variants,
etc.). As used herein, the term "less than X% N-terminal variants" refers to the amount
of N-terminal variants as a percentage of total elastase protein.
[0040] In other embodiments, the present invention provides a composition, including but
not limited to a pharmaceutical composition, an elastase formulation or unit dosage,
comprising (i) a therapeutically effective amount of mature human type I elastase
(ii) a pharmaceutically acceptable carrier, which pharmaceutical composition is substantially
free of bacterial proteins and/or is substantially free of mammalian proteins other
than said mature human type I elastase. In specific embodiments, the human type I
elastase and/or the composition comprises less than 25% bacterial proteins and/or
mammalian proteins other than said mature human type I elastase, less than 20% bacterial
proteins and/or mammalian proteins other than said mature human type I elastase, less
than 15% bacterial proteins and/or mammalian proteins other than said mature human
type I elastase, less than 10% bacterial proteins and/or mammalian proteins other
than said mature human type I elastase, less than 5% bacterial proteins and/or mammalian
proteins other than said mature human type I elastase, less than 4% bacterial proteins
and/or mammalian proteins other than said mature human type I elastase, less than
3% bacterial proteins and/or mammalian proteins other than said mature human type
I elastase, less than 2% bacterial proteins and/or mammalian proteins other than said
mature human type I elastase, less than 1% bacterial proteins and/or mammalian proteins
other than said mature human type I elastase, less than 0.5% bacterial proteins and/or
mammalian proteins other than said mature human type I elastase, 0% bacterial proteins
and/or mammalian proteins other than said mature human type I elastase, or comprises
bacterial proteins and/or mammalian proteins other than said mature human type I elastase
in an amount ranging between any two of the foregoing percentages (
e.g., 2%-25% bacterial proteins and/or mammalian proteins other than said mature human
type I elastase, 0.5%-10% bacterial proteins and/or mammalian proteins other than
said mature human type I elastase, 5%-15% bacterial proteins and/or mammalian proteins
other than said mature human type I elastase, 0%-2% bacterial proteins and/or mammalian
proteins other than said mature human type I elastase,
etc.). As used herein, the term "less than X% bacterial proteins and/or mammalian proteins
other than said mature human type I elastase" refers to the amount of such proteins
as a percentage of total protein in an elastase preparation or in said composition.
In certain embodiments, the elastase represents at least 95%, at least 96%, at least
97%, at least 98%, at least 99%, at least 99.5% or at least 99.8% of the total protein
in such compositions or preparations.
[0041] Methods for the treatment and prevention of diseases of biological conduits, comprising
administration of compositions (e.g., pharmaceutical compositions, elastase formulations
or unit dosages) comprising a purified mature human type I elastase of the invention
to a patient in need thereof, are also disclosed herein.
[0042] Further provided are vectors comprising nucleic acids encoding any of the elastase
proteins of the invention ("nucleic acids of the invention"), host cells engineered
to express the nucleic acids of the invention. In specific embodiments, the vectors
further comprise a nucleotide sequence which regulates the expression of the elastase
protein. For example, the nucleotide sequence encoding the protein of the invention
can be operably linked to a methanol-inducible promoter. Other suitable promoters
are exemplified in Section 5.3 below.
[0043] In a specific embodiment, the present invention provides a vector comprising a nucleotide
sequence encoding an open reading frame, the open reading frame comprising a yeast
α-factor signal peptide or a type I elastase signal peptide (
e.g., porcine elastase signal peptide) operably linked to a human type I elastase proprotein
sequence. Optionally, the vector further comprises a methanol-inducible promoter operably
linked to the open reading frame.
[0044] Host cells comprising the nucleic acids and vectors of the invention are also provided.
In certain embodiments, the vector or nucleic acid is integrated into the host cell
genome; in other embodiments, the vector or nucleic acid is extrachromosomal. A preferred
host cell is a
Pichia pastoris cell. Other suitable host cells are exemplified in Section 5.3 below.
[0045] In a specific embodiment, the present invention provides a
Pichia pastoris host cell genetically engineered to encode an open reading frame comprising a yeast
α-factor signal peptide or a porcine elastase signal peptide operably linked to a
human type I elastase proenzyme sequence. Optionally, the open reading frame is under
the control of a methanol-inducible promoter.
[0046] The present invention further provides methods for producing an immature or mature
elastase protein of the invention comprising culturing a host cell engineered to express
a nucleic acid of the invention under conditions in which the proelastase protein
is produced. In certain embodiments, the mature elastase protein is also produced.
[0047] Preferred culture conditions for producing the proelastase and mature proteins of
the invention, particularly for the host cell
Pichia pastoris, include a period of growth at a low pH. Typically, the low pH is 2.0, 2.5, 3.0, 3.5,
4.0, 4.5, 5.0, 5.5, 6.0, or any range between any pair of the foregoing values. In
specific embodiments, the low pH is a pH ranging from 2.0 to 6.0, from 2.0 to 5.0,
from 3.0 to 6.0, from 3.0 to 5.0, from 4.0 to 6.0, or from 3.0 to 4.0. At the end
of the culture period, the pH of the culture can be raised, preferably to a pH of
7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0, 10.5, 11.0 or a pH ranging between any two of
the foregoing values for the purpose of separating or removing the activation sequence
from the mature elastase protein. In specific embodiments, the pH of the culture is
raised to a pH ranging from 7.5 to 10.0 or 8.0 to 9.0 and most preferably to a pH
of 8.0.
[0048] Where the expression of a proelastase protein of the invention is under the control
of a methanol-inducible promoter, conditions for producing an immature or mature elastase
protein of the invention may also comprise a period of methanol induction.
[0049] The elastase production methods of the invention may further comprise the step of
recovering the protein expressed by the host cell. In certain instances, the protein
recovered is a proelastase comprising the activation sequence. In other instances,
the protein recovered is a mature elastase lacking the activation sequence. Under
certain conditions, both proelastase and mature elastase proteins are recovered.
[0050] Preferably, particularly where it is desired to circumvent auto-activation of an
auto-activated proelastase, culture conditions for proelastase expression may comprise
a period of growth and induction at low pH. Typically, the low pH is 2.0, 2.5, 3.0,
3.5, 4.0, 4.5, 5.0, 5.5, or 6.0, or any range between any pair of the foregoing values.
In specific embodiments, the low pH is a pH ranging from 2.0 to 3.0, from 4.0 to 5.0,
from 5.0 to 6.0, or from 6.0 to 7.0. In particular embodiments, the pH ranges from
4.0 to 6.0 and is most preferably a pH of 5.5.
[0051] Preferably, particularly where it is desired to circumvent auto-activation of an
auto-activated proelastase, culture conditions for proelastase expression comprise
a period of growth and induction in sodium citrate, sodium succinate, or sodium acetate.
In specific embodiments, a concentration of 5-50 mM, 7.5-100 mM, 10-15 mM, 50-200
mM, 75-175 mM, 100-150 mM, 75-125 mM, or of any range whose upper and lower limits
are selected from any of the foregoing values (
e.g., 50-75 mM, 75-100 mM,
etc.) is used. In a preferred embodiment, the sodium citrate, sodium succinate, or sodium
acetate concentration is 90-110 mM and most preferably is 100 mM.
[0052] Additionally, particularly where it is desired to circumvent auto-activation of an
auto-activated proelastase or auto-degradation by mature elastase, culture conditions
for expression of an immature elastase protein may comprise a period of growth and
induction at the lower end of the temperature range suitable for the host cell in
question. For example, where the host cell is a
Pichia pastoris host cell, the preferred range is about 22-28°C. In a specific embodiment, the
Pichia pastoris host cell is cultured at 28°C.
[0053] Additionally, particularly where it is desired to circumvent protein degradation
by host cell proteases, culture conditions for expression of an immature elastase
protein may comprise a period of growth and induction at the lower end of the temperature
range suitable for the host cell in question. For example, where the host cell is
a
Pichia pastoris host cell, the preferred range is about 22-28°C. In a specific embodiment, the
Pichia pastoris host cell is cultured at 28°C.
[0054] The activation of an auto-activated proelastase protein of the invention may be initiated
by the addition of extrinsic elastase in a small (catalytic) amount. In certain embodiments,
a catalytic amount of extrinsic elastase represents less than 10%, less than 5%, less
than 2%, less than 1%, less than 0.5% or less than 0.1%, on either a molar or molecular
weight basis, of the elastase in the sample to which the catalytic elastase is added.
[0055] Alternatively or concurrently, the auto-activated proelastase may be subjected to
pH 7 - 11 (most preferably pH 8), upon which the auto-activated proelastase activation
peptide is removed without requiring trypsin and resulting in mature, active elastase.
In specific embodiments, Tris base is added to a concentration of 50-200 mM, 75-175
mM, 100-150 mM, 75-125 mM, or any range whose upper and lower limits are selected
from any of the foregoing values (
e.g., 50-75 mM, 75-100 mM,
etc.) during the activation step. In a preferred embodiment, Tris base is added to a concentration
90-110 mM, most preferably 100 mM. The pH of the Tris base is preferably 7-11; in
specific embodiments, the Tris base is at a pH of 7.0-11.0, 7-9, 7.5 to 9.5, 7.5 to
10, 8-10, 8-9, or any range whose upper and lower limits are selected from any of
the foregoing values. In a preferred embodiment, the Tris base is at a pH of 7.5-8.5,
most preferably 8.0.
[0056] Expression of an immature elastase sequence can in some instances yield a mixture
of proelastase proteins and mature elastase proteins, as well as N-terminal variant
elastase proteins. Thus, the present invention provides a composition comprising at
least two of (1) a proelastase protein, (2) a mature elastase protein, and (3) N-terminal
variant elastase proteins.
[0057] Once a mature elastase is produced, it can be lyophilized, for example for pharmaceutical
formulations. In an exemplary embodiment, the present invention provides methods of
isolating a lyophilized mature type I elastase comprising steps:
- (a) culturing a host cell, such as a Pichia pastoris host cell, engineered to express a nucleic acid molecule encoding a preproelastase
open reading frame under conditions in which the open reading frame is expressed,
wherein, in a specific embodiment, said open reading frame comprises nucleotide sequences
encoding, in a 5' to 3' direction (i) a signal peptide, e.g., a singal peptide operable in Pichia pastoris; (ii) an activation sequence comprising an elastase recognition sequence; and (iii)
the sequence of a mature type I elastase protein, thereby producing a proelastase
protein;
- (b) subjecting the proelastase protein to autoactivation conditions, thereby producing
a mature type I elastase, wherein the autoactivation conditions include, one or a
combination of the following:
- (i) changing the pH of a solution (which can be a cell culture supernatant) containing
the proelastase protein, e.g., to a pH of 6.5-11, preferably 8-9;
- (ii) purifying the proelastase protein, for example, by ion exchange chromatography,
and subjecting the solution extended conversion to remove N-terminal variants, thereby
producing mature human type I elastase;
- (iii) concentrating the proelastase protein (e.g., 2-fold, 3-fold, 5-fold, 8-fold, 10-fold, 12-fold, or a range in which the upper
and lower limits are independently selected from the foregoing levels of concentrations);
- (iv) subjecting the proelastase protein to increased temperature (e.g., 29°C, 30°C, 32°C, 35°C, 40°C, 45°C, or 40°C, or a range in which the upper and lower
limits are independently selected from the foregoing temperatures);
- (v) purifying the proelastase protein (e.g., using Macro-Prep High S Resin) from a cell culture supernatant and incubating a
solution comprising the purified proelastase protein at ambient temperatures (e.g., 22°C to 26°C) for a period of at least one day (e.g., one day, two days, three days, four days five days, or six days, a range of days
in which the upper and lower limits are independently selected from the foregoing
values) (this is influenced by the presence of citrate/acetate, concentration, temperature,
and pH in the solution, and can readily be determined by one of skill in the art).
- (c) optionally, purifying the mature human type I elastase, e.g., ion exchange chromatography step for polish chromatography; and
- (d) lyophilizing the mature type I elastase, thereby isolating a lyophilized mature
human type I elastase. The mature type I elastase is preferably a human type I elastase.
In certain aspects, the lyophilized mature type I elastase is preferably more than
95% pure; in specific embodiments, the lyophilized mature type I elastase is more
than 98% or more than 99% pure.
[0058] The mature elastase proteins of the invention can be formulated into pharmaceutical
compositions. Thus, in exemplary embodiments, the present invention provides a method
of generating a pharmaceutical composition comprising a mature human type I elastase,
said method comprising (i) isolating a lyophilized mature human type I elastase according
to the methods described above; and (ii) reconstituting the lyophilized mature human
type I elastase in a pharmaceutically acceptable carrier. The mature human type I
elastases of the invention preferably have a specific activity of greater than 1,
greater than 5, greater than 10, greater than 20, greater than 25, or greater than
30 U/mg of protein, as determined by measuring the rate of hydrolysis of the small
peptide substrate N-succinyl-Ala-Ala-Ala-pNitroanilide (SLAP), which is catalyzed
by the addition of elastase. One unit of activity is defined as the amount of elastase
that catalyzes the hydrolysis of 1 micromole of substrate per minute at 30°C and specific
activity is defined as activity per mg of elastase protein (U/mg). Preferably, a mature
human type I elastase of the invention has a specific activity within a range in which
the lower limit is 1, 2, 3, 4, 5, 7, 10, 15 or 20 U/mg protein and in which the upper
limit is, independently, 5, 10, 15, 20, 25, 30, 35, 40 or 50 U/mg protein. In exemplary
embodiments, the specific activity is in the range of 1-40 U/mg of protein, 1-5 U/mg
protein, 2-10 U/mg protein, 4-15 U/mg protein, 5-30 U/mg of protein, 10-20 U/mg of
protein, 20-40 U/mg of protein, or any range whose upper and lower limits are selected
from any of the foregoing values (
e.g., 1-10 U/mg, 5-40 U/mg,
etc.).
[0059] The pharmaceutical compositions of the invention are preferably stable. In specific
embodiments, a pharmaceutical composition (for example a pharmaceutical composition
prepared by lyophilization and reconstitution as described above) maintains at least
50%, more preferably at least 60%, and most preferably at least 70% of its specific
activity after a week of storage at 4°C. In specific embodiments, the pharmaceutical
composition maintains at least 75%, at least 80%, at least 85% or at least 95% of
its specific activity after reconstitution and a week of storage at 4°C.
[0060] This invention also provides proteins comprising a type I elastase proprotein amino
acid sequence containing an elastase cleavage domain sequence. Other cleavage domains
that can be used in this invention are any of the sequences described by the concensus
cleavage domain sequence (SEQ ID NO:74) Xaa
1 Xaa
2 Xaa
3 Xaa
4 Xaa
5 Xaa
6 Xaa
7 Xaa
8, where Xaa
1=P5, Xaa
2=P4, Xaa
3=P3, Xaa
4=P2, Xaa
5=P1, Xaa
6=P'1, Xaa
7=P'2, and Xaa
8=P'3, where:
- Xaa1 is glutamate, histidine, proline, glycine, asparagine, lysine, or alanine, or, optionally,
an analog thereof;
- Xaa2 is threonine, alanine, proline or histidine or, optionally, an analog thereof;
- Xaa3 is alanine, leucine, isoleucine, methionine, lysine, asparagine or valine, or, optionally,
an analog thereof, but is preferably not glycine or proline;
- Xaa4 is proline, alanine, leucine, isoleucine, glycine, valine, or threonine, or, optionally,
an analog thereof;
- Xaa5 is alanine, leucine, valine, isoleucine, or serine but not glycine, tyrosine, phenylalanine,
proline, arginine, glutamate, or lysine, or, optionally, an analog thereof;
- Xaa6 is alanine, leucine, valine, isoleucine or serine, or, optionally, an analog thereof;
- Xaa7 is glycine, alanine, or valine, or, optionally, an analog thereof; and
- Xaa8 is valine, threonine, phenylalanine, tyrosine, or tryptophan, or, optionally, an
analog thereof.
[0061] This invention also provides a method of isolating a mature human type I elastase
comprising: (a) culturing, under culturing conditions, a host cell comprising a nucleotide
sequence which encodes a proprotein comprising (i) an activation sequence comprising
a trypsin recognition sequence operably linked to (ii) the amino acid sequence of
a protein having elastase activity under said culturing conditions, wherein said culturing
conditions comprise a period of growth or induction at pH of 2 to 6; (b) recovering
the expressed proprotein; (c) contacting the recovered protein with a catalytic amount
of trypsin under pH conditions in which the trypsin is active; and (d) isolating mature
human type I elastase. In this method the mature human type I elastase may consist
essentially of SEQ ID NO: 1, 4, 5, 84, or 87. In certain embodiments, the conditions
may comprise (a) a period of growth or induction at pH of 4 to 6; (b) a period of
growth or induction at 22°C to 28°C; or (c) sodium citrate, sodium succinate, or sodium
acetate concentrations of about 50 mM to about 200 mM or a sodium citrate concentration
is 90 mM to about 110 mM in the culture media of said host cells.
[0062] It should be noted that the indefinite articles "a" and "an" and the definite article
"the" are used in the present application, as is common in patent applications, to
mean one or more unless the context clearly dictates otherwise. Further, the term
"or" is used in the present application, as is common in patent applications, to mean
the disjunctive "or" or the conjunctive "and: '
[0063] All publications mentioned in this specification are herein incorporated by reference.
Any discussion of documents, acts, materials, devices, articles or the like that has
been included in this specification is solely for the purpose of providing a context
for the present invention. It is not to be taken as an admission that any or all of
these matters form part of the prior art base or were common general knowledge in
the field relevant to the present invention as it existed anywhere before the priority
date of this application.
[0064] The features and advantages of the invention will become further apparent from the
following detailed description of embodiments thereof
4. BRIEF DESCRIPTION OF THE DRAWINGS
[0065] Figures 1A-1B:
Figure 1A shows the synthetic (
i.e., recombinant) human ELA-1.2A sequence. The recombinant human elastase-1 (
i.e., human type 1 pancreatic elastase) sequence contains a 750-base pair coding region.
Selected restriction enzyme sites are underlined. Base substitutions are in double
underlined, bolded text and the codons containing them are double underlined. Stop
codons are boxed. The propeptide sequence is italicized. The coding region results
in a 250-amino acid protein. After cleavage of the 10-amino acid propeptide, the resulting
nature enzyme is 240 amino acids.
Figure 1B shows the pPROT324 translational fusion region. The translational fusion between
the vector and the ELA-1 coding region is depicted. The PCR amplification of the ELA-1
sequence provided for the incorporation of the Kex2 and STE13 signal cleavage domains
to yield a secreted product with an expected N-terminus of the first amino acid (in
bold text) of the activation sequence (italicized).
[0066] Figure 2: A N-terminal to C-terminal schematic of the (overlapping) core components of the
elastase proteins of the invention, wherein the numbered components depict: (1) signal
sequence (vertical stripes); (2) optional propeptide/spacer sequence (bricks); (3)
elastase propeptide (diagonal stripes, unshaded and diamond pattern combined); (4)
activation peptide (unshaded and diamond pattern combined); (5) recognition sequence
(diamond pattern); (6) cleavage domain (unshaded, diamond pattern and the left portion
of the horizontal stripes); (7) cleavage site (unshaded, diamond pattern and the left
portion of the horizontal stripes); (8) preproelastase protein (entire scheme); (9)
proelastase protein (diagonal stripes, unshaded, diamond pattern and horizontal stripes
combined); and (10) mature elastase protein (horizontal stripes). The table shows
the amino acid designations of the region in the schematic spanned by the arrow. Not
drawn to scale. The nomenclature is for reference purposes only and is not intended
to connote a particular function, activity or mechanism.
[0067] Figure 3. Diagram of the pPROT24-V Vector. "α-factor secretion" refers to a cassette containing
the yeast α-factor signal peptide and propeptide, followed by a Kex2 site and STE13
repeats.
[0068] Figure 4: SDS-PAGE analysis of fractions from capture chromatography of a 201-24-266-VU culture
containing trypsin-activated pro-PRT-201. Lane numbers correspond to fraction numbers.
Fractions 6-18 primarily consist of glycosylated proenzyme (upper band) and non-glycosylated
proenzyme (lower band). Fractions 19-35 primarily consist of non-glycosylated proenzyme.
M = molecular weight markers. FT = column flow through.
[0069] Figures 5A-5F:
Figure 5A is an auto-activated proprotein data table. Propeptide sequences are listed in the
first column. SDS-PAGE of supernatants after 1, 2 and 3 days of induction (lanes 1,
2 and 3, respectively) are shown in the second column. Relative proprotein yields
based on SDS-PAGE are listed in the third column. Relative stabilities of the proprotein
over 3 days of induction based on SDS-PAGE are listed in the fourth column. Proproteins
with 42 and 48 propeptide sequences are ranked as having low stability because of
the presence of mature protein during induction (observed after 1, 2 and 3 days for
the 42 variant and after 2 and 3 days for the 48 variant). Relative conversion rates
of the proproteins as determined by time to achieve maximal SLAP reaction velocity
are listed in the fifth column. The estimated percentages of converted protein that
comprised N-terminal variants of the mature elastase protein are listed in the sixth
column.
Figures 5B-5F show conversion rate data for propeptide sequences 24, 42, 48, 49 and 55, respectively.
[0070] Figure 6. pPROT55M3-V cloning scheme. pPROT55M3-V was engineered by
in vitro ligation of two additional expression cassettes to the 4.3 kb pPROT55-V vector backbone,
giving a total of three tandem expression cassettes. The 2.3 kb expression cassette
fragment was released from pPROT55-V with a BgIII and BamHT restriction digest and
purified, followed by ligation of two copies of the expression cassette to pPROT55-V
linearized with BamHI.
[0071] Figure 7: Shaker flask optimization of clone 201-55M3-006-VU. The standard induction media,
BKME, was prepared and supplemented with sodium citrate to achieve final concentrations
of 0, 12.5, 25 and 50 mM sodium citrate, pH 5.5. The media was used to resuspend growth
phase cell pellets using a ratio of 1 g wet cell weight to 10 mL of induction media.
Cell suspensions or 25 mL each were placed in a 250 mL non-baffled flasks and incubated
at 22°C or 25°C for 3 days with shaking at 275 rpm. Methanol was added twice daily
to a final concentration of 0.5% by volume. Supernatant aliquots were taken during
the 3-day period and analyzed for protein expression by SDS-PAGE and Coomassie staining.
Panel A shows samples induced at 22°C and Panel B shows samples induced at 25°C. In
both panels, lanes 1-3 are Supernatants after 1, 2 and 3 days of induction, respectively,
containing 0% sodium citrate; lanes 4-6 are similar except with 12.5% sodium citrate;
lanes 7-9 are similar except with 25% sodium citrate; and lanes 10-12 are similar
except with 50 mM sodium citrate.
[0072] Figure 8. SDS-PAGE analysis of 201-55-001-VU and 201-55M3-003-VU fermentation supernatants.
Lanes 1, 2: 201-55-001-VU supernatant; lanes 3, 4: 201-55M3-003-VU supernatant; lane
5: empty; lane 6: molecular weight markers.
[0073] Figure 9. SDS-PAGE analysis of fractions from pPROT55M3-V proprotein capture chromatography.
A total of 30 microliters from each elution fraction was mixed with 10 microliters
4X Laemmli sample loading buffer supplemented with beta-mercaptoethanol. The proteins
were electrophoresed on an 8-16% linear gradient gel followed by Coomassie staining.
Two predominant forms of PRT-201 were observed: the proprotein (fractions 15-43) and
spontaneously converted mature PRT-201 (fractions 15-44). Lane numbers correspond
to fraction numbers. M, molecular weight marker. BC, before column (pre-load) sample.
[0074] Figure 10: HIC-HPLC analysis of purified proprotein conversion. Purified pro-PRT-201-55M3-003-VU
was subjected to conversion at 26°C. The graph shows relative amounts of mature (full-length)
PRT-201 and N-terminal variants produced during the conversion.
[0075] Figure 11: HIC-HPLC analysis of proprotein conversion in fermentation supernatant effected by
tangential flow filtration. Clarified 201-55M3-003-VU fermentation supernatant was
subjected to tangential flow filtration with 100 mM Tris, pH 8.0, using constant volume
diafiltration at ambient temperature with regenerated cellulose membranes. The graph
shows relative amounts of proprotein, mature (full-length) PRT-201 and N-terminal
variants present at various time points during the conversion.
[0076] Figures 12. SDS-PAGE analysis of fractions from pPROT55M3-V conversion capture chromatography.
A total of 30 microliters from each elution fraction was mixed with 10 microliters
4X Laemmli sample loading buffer supplemented with beta-mercaptoethanol. The proteins
were electrophoresed on an 8-16% linear gradient gel followed by Coomassie staining.
Two predominant forms of PRT-201 were observed: the glycosylated mature form (fractions
35-70), and the non-glycosylated mature form (fractions 75-160). Lane numbers correspond
to fraction numbers. M, molecular weight marker. BC, before column (pre-load) sample.
[0077] Figure 13: Concentration dependence of pro conversion. Purified pro-PRT-201 from the 201-55M3-003-VU
clone (pro-PRT-201-55M3-003-VU) was subjected to conversion at concentrations of 0.2,
1.0, 1.6, and 1.8 mg/mL. Conversion reactions were monitored by HIC-HPLC in real-time
until the proprotein was ≤ 1% of the total protein. The graph shows the relative amounts
of mature (full-length) PRT-201 (unshaded bars) and N-terminal variants (diagonal
filled bars) produced during the conversions.
[0078] Figure 14. DNA sequence of synthetic (
i.
e., recombinant) porcine pancreatic elastase type 1. The recombinant sequence contains
a 750 base pair coding region. SacII and XbaI restriction sites as underlined were
incorporated to facilitate cloning. Stop codons are boxed. The pro-peptide sequence
is in bold-face type.
[0079] Figure 15. Amino acid sequence of synthetic (
i.
e., recombinant) porcine type I pancreatic elastase. The pro-peptide region is in bold-face
type while the trypsin cleavage site is boxed. After cleavage of the 10 amino acid
pro-peptide, the resulting mature enzyme is 240 amino acids.
[0080] Figure 16. Cloning scheme of porcine type I pancreatic elastase into PV-1 vector. After synthesis
of the porcine type I pancreatic elastase proprotein coding region, it was cloned
in the Blue Heron pUC vector. In addition to amplifying the coding sequence of porcine
type I pancreatic elastase, PCR was used to incorporate XhoI and SacII restriction
sites for cloning into the PV-1 vector. The PCR product was digested, gel-purified
and ligated with PV-1 vector digested with XhoI and SacII, thus resulting in a pPROT101-24-V
expression vector encoding trypsin-activated porcine type I pancreatic elastase proprotein.
[0081] Figure 17. Expression analysis of auto-activated pPROT101-42-V and trypsin-activated pPROT101-24-V
clones during methanol induction by SDS-PAGE. Shaker flask supernatants after 1 day
of induction were analyzed on an 8-16% gradient gel followed by staining with Coomassie
staining. Lanes I-10 contain supernatants from ten different clones transformed with
pPROT101-42-V. Lanes 11-12 contain supernatants from two different clones transformed
with pPROT101-24-V. M, molecular weight markers.
[0082] Figure 18. Expression analysis of auto-activated pPROT101-49-V and pPROT101-55L-V clones during
methanol induction by SDS-PAGE. Shaker flask supernatants after 1 and 2 days of induction
were analyzed on an 8-16% gradient gel followed by Coomassie staining. Lanes 1-2 contain
supernatants from a pPROT101-49-V clone after 1 and 2 days of induction, respectively.
Lanes 3-4 contain supernatants from a pPROT101-55L-V clone after 1 and 2 days of induction,
respectively. M, molecular weight markers.
[0083] Figure 19. Time course activation of pPROT101-49-V and pPROT101-55L-V proteins by small-scale
conversion assay as determined by SLAP elastase activity. Error bars represent ±SD
of the mean (n=4).
[0084] Figure 20. SDS-PAGE analysis of pPROT101-49-V and pPROT101-55L-V supernatants before and after
small-scale conversion assay. Prior to electrophoresis, the samples were mixed with
citric acid, the reducing agent TCEP, and LDS sample buffer (Invitrogen, CA). The
samples were heated at 70°C for 10 minutes. Lanes 1-2: pPROT101-49-V pre- and post-convenion
assay supernatant, respectively; lanes 3-4: pPROT101-55L-V pre- and post-conversion
assay supernatant, respectively. M, molecular weight markers.
[0085] Figure 21. TrypZean standard curve.
[0086] Figure 22. A side, partially sectioned view of one embodiment of the medical device described
in Section 5.9.
[0087] Figure 23. A view similar to Figure 22 that illustrates the movement of the actuators of the
medical device.
[0088] Figure 24. An end section view in the plane of line 2-2 in Figure 22.
[0089] Figure 25. An end section view in the plane of line 3-3 in Figure 22.
[0090] Figure 26. A diagram of the fluid path of the medical device of Figure 22, extending from the
Luer hubs through the fluid delivery conduits to the reservoir and then to the tissue
penetrators.
[0091] Figure 27. A side, partially sectioned view of a second embodiment of the medical device of
the present invention showing the actuators in their constrained configurations.
[0092] Figure 28. A view similar to Figure 27, but showing the actuators in their unconstrained configurations.
[0093] Figure 29. An end perspective view of the assembly along the line 3'-3' of Figure 27.
[0094] Figure 30. An end perspective view of the assembly along the line 4'-4' of Figure 29 showing
the tissue penetrators.
[0095] Figure 31. A side view showing the detail of the proximal end of the device, shown to the right
in Figures 27 and 28.
[0096] Figure 32. A partial view of the exterior of the medical device of Figure 22 in its constrained
position.
5. DETAILED DESCRIPTION OF THE INVENTION
[0097] The present invention is directed to methods for recombinant expression and production
of mature, biologically active elastase proteins. The present invention provides novel,
efficient methods of making recombinant elastase proteins by culturing host cells,
including the preferred host cell,
Pichia pastoris, comprising nucleic acids encoding proelastase proteins and preproelastase proteins.
The use of the recombinant proteins to manufacture pharmaceutical compositions for
the treatment and prevention of diseases of biological conduits (including arteries
or veins) is also provided.
[0098] In certain aspects, the present invention is directed to recombinant auto-activated
proelastase proteins and related nucleic acids, host cells, and methods of manufacture.
Such auto-activated proelastase proteins are engineered to contain an elastase recognition
site immediately N-terminal to the first residue of the mature elastase protein. Under
specified culture conditions, such as those described in Section 6 below, it is possible
to reduce auto-activation until activation is desired. It is also possible to reduce
auto-activation until the proelastase is removed from the cell culture.
[0099] The present invention provides efficient expression and purification processes for
producing pharmaceutical grade elastase proteins. The present invention also provides
methods for treating or preventing diseases of biological conduits using the elastase
proteins of the invention.
[0100] The description in Section 5 herein is applicable to the embodiments of Section 8.
Thus, for example, a reference to an elastase protein of the invention includes, but
is not limited to, a reference to an elastase protein according to any one of embodiments
1-39 and 68-69, or an elastase protein obtained or obtainable by the method of any
one of embodiments 89-224, 261 to 276, and 347 to 373. Likewise, a reference to a
nucleic acid of the invention refers,
inter alia, to a nucleic acid according to any one of embodiments 40-67; reference to a vector
refers,
inter alia, a reference to a vector according to any one of embodiments 70-72; reference to a
cell refers,
inter alia, to a cell according to any one of embodiments 73-87, reference to a cell culture
supernatant refers,
inter alia, to a cell culture supernatant according to embodiment 88; reference to compositions,
such as pharmaceutical compositions, elastase formulations and unit dosages, includes,
for example, those exemplified in embodiments 277-314, 346, 386, and 415-420 or those
obtained or obtainable by the method of any one of embodiments 261-276 and 374-385;
and references to therapeutic methods also includes a reference to therapeutic methods
according to any one of embodiments 387-414; and reference to a kit includes a reference
to,
inter alia, a reference to a kit of embodiments 421-425 of Section 8.
5.1 ELASTASE PROTEINS
[0101] The present invention is directed to,
inter alia, methods for recombinant expression and production of mature, biologically active
elastase proteins. The elastase proteins are generally expressed as preproproteins,
containing, among other sequences, a signal peptide, an activation peptide, and a
mature portion with biological activity. Suitable mature elastase protein sequences
are described in Section 5.1.1 below. Suitable activation peptide sequences are described
in Section 5.1.2 below. Suitable signal sequences are described in Section 5.1.3 below.
[0102] Accordingly, in certain aspects, the elastase proteins of the invention are preproelastase
proteins. Removal of the signal sequence from the preproprotein upon secretion generally
yields an inactive proprotein containing an activation peptide and a mature protein.
The phrases "activation sequence" and "activation peptide" are used interchangeably
herein. Thus, in other aspects, the elastase proteins of the invention are proelastase
proteins comprising an activation peptide that is operably linked to a mature elastase
protein. In an exemplary embodiment, an activation peptide or sequence of a wildtype
human type I pancreatic elastase comprises the first 10 N-terminal amino acids of
the human type I elastase proprotein (SEQ ID NO:22). In certain embodiments, the activation
peptide is a peptide of SEQ ID NO:80. Activation peptides or sequences useful in the
practice of this invention also include, but are not limited to, SEQ ID NO: 23, 72
and 73. Still other activation sequences useful in the practice of this invention
can be obtained from the N-terminal residues 1-10 of SEQ ID NO:64-69 and 98-103.
[0103] Removal of the activation peptide from the proelastase sequence generates a mature
elastase protein. The step by which the activation peptide is removed from the proelastase
sequence/separated from the mature elastase sequence to generate a mature elastase
protein is referred to herein as an activation step. Thus, in yet other aspects, the
elastase proteins of the invention are mature elastase proteins.
[0104] Amino acid residues comprising the C-terminus (i.e., carboxy terminus) of the activation
peptide and the N-terminus (i.e., amino terminus) of the mature protein that surround
the cleavage bond are depicted in Figure 2 and also identified herein as follows.
First, residues located at the C-terminus of the activation peptide are designated
PX,...P5, P4, P3, P2, and P1, where P1 is the C-terminal residue of the activation
peptide. Residues located at the N-terminus of the mature protein are designated P1',
P2', P3',...PX', where P1' is the N-terminal amino acid residue of the mature protein.
The scissile bond that is cleaved by proteolysis (referred to as the "cleavage bond"
in Figure 2) is the peptide bond between the P1 residue of the activation peptide
and P1' residue of the mature protein.
[0105] The region spanning 4 amino acids of the C-terminus of the activation peptide (residues
P4 to P1) through to the first 4 amino acids of the N-terminus of the mature protein
(residues P1' to P4') is referred to herein as the "cleavage site."
[0106] The region spanning approximately 5 amino acids of the C-terminus of the activation
peptide
(i.e., residues P5 to P1) through to approximately the first 3 amino acids of the N-terminus
of the mature protein (
i.e., residues P1' to P3') is referred to herein as the "cleavage domain." Examples of
cleavage domains that can be used in the context of this invention include, but are
not limited to, SEQ ID NOS: 42, 43, 48, 49, 52, 53, 54 or 55. Other cleavage domains
that can be used in this invention are any of the sequences described by the consensus
cleavage domain sequence Xaa
1 Xaa
2 Xaa
3 Xaa
4 Xaa
5 Xaa
6 Xaa
7 Xaa
8, where Xaa
1=P5, Xaa
2=P4, Xaa
3=P3, Xaa
4=P2, Xaa
5=P1, Xaa
6=P1', Xaa
7=P2', and Xaa
8=P3', where:
- Xaa1 is glutamate, histidine, proline, glycine, asparagine, lysine, or alanine, or, optionally,
an analog thereof;
- Xaa2 is threonine, alanine, proline or histidine or, optionally, an analog thereof;
- Xaa3 is alanine, leucine, isoleucine, methionine, lysine, asparagine or valine, or, optionally,
an analog thereof, but is preferably not glycine or proline;
- Xaa4 is proline, alanine, leucine, isoleucine, glycine, valine, or threonine, or, optionally,
an analog thereof;
- Xaa5 is alanine, leucine, valine, isoleucine, or serine but not glycine, tyrosine, phenylalanine,
proline, arginine, glutamate, or lysine, or, optionally, an analog thereof;
- Xaa6 is alanine, leucine, valine, isoleucine or serine, or, optionally, an analog thereof;
- Xaa7 is glycine, alanine, or valine, or, optionally, an analog thereof; and
- Xaa8 is valine, threonine, phenylalanine, tyrosine, or tryptophan, or, optionally, an
analog thereof.
[0107] The three amino acid region spanning residues P3, P2, and P1 of the activation peptide
is referred to herein as an "elastase recognition site". Examples of recognition sites
that can be used in the context of this invention include, but are not limited to,
SEQ ID NOS: 14-16, and 18-21. Other recognition sites contemplated by this invention
include any recognition site described by the consensus recognition sites of SEQ ID
NO: 11, 12, 13, or 93. The SEQ ID NO:11 consensus elastase recognition sequence 1
is represented by the peptide sequence Xaa
1 Xaa
2 Xaa
3, wherein Xaa
1=P3, Xaa
2=P2, Xaa
3=P1, wherein:
- Xaa1 is alanine, leucine, isoleucine, methionine, lysine, asparagine or valine, or, optionally,
an analog thereof but is preferably not glycine or proline;
- Xaa2 is proline, alanine, leucine, isoleucine, glycine, valine, or threonine, or, optionally,
an analog thereof;
- Xaa3 is alanine, leucine, valine, isoleucine, or serine, or, optionally, an analog thereof,
but is preferably not glycine, tyrosine, phenylalanine, proline, arginine, glutamate,
or lysine.
[0108] The SEQ ID NO:12 consensus elastase recognition sequence 2 is represented by the
sequence Xaa
1 Pro Xaa
2, wherein:
- Xaa1 is alanine, leucine, isoleucine, methionine, lysine, or valine, or, optionally, an
analog thereof, but is preferably not glycine or proline;
- Pro is proline, or, optionally, an analog thereof;
- Xaa2 is alanine, leucine, valine, isoleucine, or serine, or, optionally, an analog thereof,
but is preferably not glycine, tyrosine, phenylalanine, proline, arginine, glutamate,
or lysine.
[0109] The SEQ ID NO:13 consensus elastase recognition sequence 3 is represented by the
peptide sequence Xaa
1 Xaa
2 Xaa
3, wherein Xaa
1=P3, Xaa
2=P2, Xaa
3=P1, wherein Xaa
1 is asparagine or alanine, or, optionally, an analog thereof; wherein Xaa
2 is proline or alanine, or, optionally, an analog thereof, and wherein Xaa
3 is alanine, leucine, or valine, or, optionally, an analog thereof.
[0110] The SEQ ID NO:93 consensus elastase recognition sequence 4 is represented by the
sequence Xaa
1 Pro Xaa
2, wherein:
- Xaa1 is alanine, leucine, isoleucine, methionine, lysine, asparagine or valine, or, optionally,
an analog thereof, but is preferably not glycine or proline;
- Pro is proline, or, optionally, an analog thereof;
- Xaa2 is alanine, leucine, valine, isoleucine, or serine, or, optionally, an analog thereof,
but is preferably not glycine, tyrosine, phenylalanine, proline, arginine, glutamate,
or lysine.
[0111] Reference to a sequence as a "cleavage sequence," "cleavage domain," "activation
sequence," "elastase recognition sequence,"
etc., is solely for ease of reference and is not intended to imply any function of the
sequence or mechanism by which the sequence is recognized or processed.
[0112] The proteins of the invention are generally composed of amino acids and may in addition
include one or more (e.g., up to 2, 3, 4, 5, 6, 7, 8, 9, 10, 12 or 15) amino acid
analogs. Generally, as used herein, an amino acid refers to a naturally-occurring
L stereoisomer. An amino acid analog refers to a D-stereoisomer, a chemically modified
amino acid, or other unnatural amino acid. For example, unnatural amino acids include,
but are not limited to azetidinecarboxylic acid, 2-aminoadipic acid, 3-aminoadipic
acid, β-alanine, aminopropionic acid, 2-aminobutyric acid, 4-aminobutyric acid, 6-aminocaproic
acid, 2-aminoheptanoic acid, 2-aminoisobutyric acid, 3-aminoisbutyric acid, 2-aminopimelic
acid, tertiary-butylglycine, 2,4-diaminoisobutyric acid, desmosine, 2,2'-diaminopimelic
acid, 2,3-diaminopropionic acid, N-ethylglycine, N-ethylasparagine, homoproline, hydroxylysine,
allohydroxylysine, 3-hydroxyproline, 4-hydroxyproline, isodesmosine, allo-isoleucine,
N-methylalanine, N-methylglycine, N-methylisoleucine, N-methylpentylglycine, N-methylvaline,
naphthalanine, norvaline, norleucine, ornithine, pentylglycine, pipecolic acid and
thioproline. A chemically modified amino acid includes an amino acid that is chemically
blocked, reversibly or irreversibly, and/or modified at one or more of its side groups,
α-carbon atoms, terminal amino group, or terminal carboxylic acid group. A chemical
modification includes adding chemical moieties, creating new bonds, and removing chemical
moieties. Examples of chemically modified amino acids include, for example, methionine
sulfoxide, methionine sulfone, S-(carboxymethyl)-cysteine, S-(carboxymethyl)-cysteine
sulfoxide and S-(carboxymethyl)-cysteine sulfone. Modifications at amino acid side
groups include acylation of lysine ε-amino groups, N-alkylation of arginine, histidine,
or lysine, alkylation of glutamic or aspartic carboxylic acid groups, and deamidation
of glutamine or asparagine. Modifications of the terminal amino include the des-amino,
N-lower alkyl, N-di-lower alkyl, and N-acyl modifications. Modifications of the terminal
carboxy group include the amide, lower alkyl amide, dialkyl amide, and lower alkyl
ester modifications. A lower alkyl is a C
1-C
4 alkyl. Furthermore, one or more side groups, or terminal groups, may be protected
by protective groups known to the ordinarily-skilled protein chemist. The α-carbon
of an amino acid may be mono- or di-methylated.
[0113] The proteins of the invention may be modified or derivatized, such as modified by
phosphorylation or glycosylation, or derivatized by conjugation, for example to a
lipid or another protein (e.g., for targeting or stabilization), or the like.
[0114] The present invention often relates to an "isolated" or "purified" elastase protein.
An isolated elastase protein is one that is removed from its cellular milieu. A purified
elastase protein is substantially free of cellular material or other contaminating
proteins from the cell or tissue source from which the elastase protein is derived,
or substantially free of chemical precursors or other chemicals when chemically synthesized.
The language "substantially free of cellular material" includes preparations of elastase
protein in which the protein is separated from cellular components of the cells from
which it is recombinantly produced. Thus, elastase protein that is substantially free
of cellular material includes preparations of elastase protein having less than about
30%, 20%, 10%, or 5% (by dry weight) of heterologous protein (also referred to herein
as a "contaminating protein"). When the elastase protein is produced by a process
in which it is secreted into culture medium, it is also preferably substantially free
of the culture medium, i.e., culture medium represents less than about 20%, 10%, or
5% of the volume of the elastase protein preparation.
[0115] In certain embodiments, an isolated or purified elastase is additionally free or
substantially free of cellular DNA. In specific embodiments, host cell genomic DNA
is present in an amount of less than 10 picogram, less than 5 picograms, less than
3 picograms, less than 2 picograms, or less than 1 picogram of DNA per milligram of
elastase protein in a preparation of isolated or purified elastase protein, or in
a composition comprising isolated or purified elastase protein. In one embodiment,
the host cell DNA is
Pichia pastoris DNA.
[0116] Useful elastase protein sequences are provided in Table 1. In a specific embodiment,
the invention provides a proelastase protein (including but not limited to a protein
of any one of SEQ ID NOS:6-9, 64-69, 88-91 and 98-103) comprising (i) an activation
sequence comprising an elastase recognition sequence operably linked to (ii) the amino
acid sequence of a protein having type I elastase activity. Several polymorphisms
of human type I elastase are known. Any combination of polymorphisms is contemplated
in the proelastase protein sequences of the present invention, including but not limited
to the combinations of polymorphisms set forth in Table 2. The protein optionally
further comprises a signal sequence operably linked to said activation sequence. In
certain specific embodiments, the signal sequence is operable in
Pichia pastoris, such as a yeast α-factor signal peptide, exemplified by the amino acid sequence of
SEQ ID NO:34. Alternative signal peptide containing sequences are exemplified in SEQ
ID NOS:50 and 96 (containing a signal peptide, a non-elastase propeptide and a spacer
sequence) and SEQ ID NOS:51 and 97 (containing the signal peptide and a non-elastase
propeptide). In other specific embodiments, the signal sequence is a mammalian secretion
signal sequence, such as a porcine elastase signal sequence. Preferably, the elastase
recognition sequence is a type I elastase recognition sequence, most preferably a
human type I elastase recognition sequence.
[0117] The present invention further encompasses variants of the elastase proteins of the
invention. Variants may contain amino acid substitutions at one or more predicted
non-essential amino acid residues. Preferably, a variant includes no more than 15,
no more than 12, no more than 10, no more than 9, no more than 8, no more than 7,
no more than 6, no more than 5, no more than 4, no more than 3, no more than 2 or
no more than 1 conservative amino acid substitution relative to a naturally occurring
mature elastase and/or no more than 5, no more than 4, no more than 3, or no more
than 2 non-conservative amino acid substitutions, or no more than 1 non-conservative
amino acid substitution, relative to a naturally occurring mature elastase.
[0118] In a specific embodiments, the variant has no more than 10 or more preferably no
more than five conservative amino acid substitutions relative to a mature elastase,
a proelastase or a preproelastase of the invention, such as with respect to a mature
elastase of SEQ ID NO: or SEQ ID NO:84 or a proelastase protein of SEQ ID NO:6-9,
64-69, 88-91, and 98-103. The amino acid sequences of SEQ ID NOS:1 and 84 contain
one or more positions corresponding to potential polymorphisms in the mature elastase
sequence, at positions 44 (W or R); 59 (M or V); 220 (V or L); and 243 (Q or R) (positions
refer to preproprotein). The invention thus encompasses mature elastase proteins with
any combination of the four polymorphisms identified in SEQ ID NO: 84. Each of such
combinations is outlined in Table 3 above. The sequence of SEQ ID NOS:88-91 and 98-103
further contain a potential polymorphism in the propeptide sequence, at position 10
(Q or H). The invention thus encompasses preproelastase and proelastase sequences
containing any combination of the five polymorphisms identified in SEQ ID NOS:88-91
and 98-103. Each of such combinations is outlined in Table 2 above.
[0119] A "conservative amino acid substitution" is one in which the amino acid residue is
replaced with an amino acid residue having a similar side chain. Families of amino
acid residues having similar side chains have been defined in the art. These families
include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic
side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g.,
glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side
chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine,
tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic
side chains (e.g., tyrosine, phenylalanine, tryptophan).
[0120] The variant elastase proteins of the invention may include amino acid substitutions
with amino acid analogs as well as amino acids, as described herein.
[0121] In specific embodiments, the protein of the invention comprises or consists essentially
of a variant of a mature human type I elastase, e.g., a variant which is at least
about 75%, 85%, 90%, 93%, 95%, 96%, 97%, 98% or 99% identical to the elastase proproteins
or mature elastase proteins listed in Table 1, such as, but not limited to, the elastase
proproteins of SEQ ID NOS: 6-9, 64-69, 88-91, and 98-103, and retain elastase activity
when expressed to produce a mature elastase protein of SEQ ID NO: 1, 4, 5, 84 or 87.
[0122] To determine the percent identity of two amino acid sequences or of two nucleic acids,
the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced
in the sequence of a first amino acid or nucleic acid sequence for optimal alignment
with a second amino or nucleic acid sequence). The amino acid residues or nucleotides
at corresponding amino acid positions or nucleotide positions are then compared. When
a position in the first sequence is occupied by the same amino acid residue or nucleotide
as the corresponding position in the second sequence, then the molecules are identical
at that position. The percent identity between the two sequences is a function of
the number of identical positions shared by the sequences (% identity = (# of identical
positions/total # of overlapping positions) x 100). In one embodiment, the two sequences
are the same length. In other embodiments, the two sequences differ in length by no
more than 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9% or 10% of the length of the longer of
the two sequences.
[0123] The determination of percent identity between two sequences can be accomplished using
a mathematical algorithm. A preferred, non-limiting example of a mathematical algorithm
utilized for the comparison of two sequences is the algorithm of
Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264-2268, modified as in
Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5877. Such an algorithm is incorporated into the NBLAST and XBLAST programs of
Altschul, et al. (1990) J. Mol. Biol. 215:403-410. BLAST nucleotide searches can be performed with the NBLAST program, score = 100,
wordlength = 12 to obtain nucleotide sequences homologous to nucleic acid molecules
of the invention. BLAST protein searches can be performed with the XBLAST program,
score = 50, wordlength = 3 to obtain amino acid sequences homologous to protein molecules
of the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST
can be utilized as described in
Altschul et al. (1997) Nucleic Acids Res. 25:3389-3402. Alternatively, PSI-Blast can be used to perform an iterated search which detects
distant relationships between molecules
(Id.). When utilizing BLAST, Gapped BLAST, and PSI-Blast programs, the default parameters
of the respective programs (e.g., XBLAST and NBLAST) can be used.
See http://www.ncbi.nlm.nih.gov.
[0124] Another preferred, non-limiting example of a mathematical algorithm utilized for
the comparison of sequences is the algorithm of
Myers and Miller, CABIOS (1989). Such an algorithm is incorporated into the ALIGN program (version 2.0) which is
part of the CGC sequence alignment software package. When utilizing the ALIGN program
for comparing amino acid sequences, a PAM120 weight residue table, a gap length penalty
of 12, and a gap penalty of 4 can be used. Additional algorithms for sequence analysis
are known in the art and include ADVANCE and ADAM as described in
Torellis and Robotti, 1994, Comput. Appl. Biosci. 10:3-5; and FASTA described in
Pearson and Lipman, 1988, Proc. Natl. Acad Sci. 85:2444-8. Within FASTA, ktup is a control option that sets the sensitivity and speed of the
search. If ktup=2, similar regions in the two sequences being compared are found by
looking at pairs of aligned residues; if ktup=1, single aligned amino acids are examined.
ktup can be set to 2 or 1 for protein sequences, or from 1 to 6 for DNA sequences.
The default if ktup is not specified is 2 for proteins and 6 for DNA. For a further
description of FASTA parameters, see http://bioweb.pasteur.fr/docs/man/man/fasta.1.htm1#sect2,
the contents of which are incorporated herein by reference.
[0125] The percent identity between two sequences can be determined using techniques similar
to those described above, with or without allowing gaps. In calculating percent identity,
typically exact matches are counted.
[0126] The elastase proteins of the invention can exhibit post-translational modifications,
including, but not limited to glycosylations (e.g., N-linked or O-linked glycosylations),
myristylations, palmitylations, acetylations and phosphorylations (e.g., serine/threonine
or tyrosine). In one embodiment, the elastase proteins of the invention exhibit reduced
levels of O-linked glycosylation and/or N-linked glycosylation relative to endogenously
expressed elastase proteins. In another embodiment, the elastase proteins of the invention
do not exhibit O-linked glycosylation or N-linked glycosylation.
5.1.1. THE MATURE ELASTASE SEQUENCE
[0127] The mature elastase sequences of the present invention are preferably mammalian elastase
sequences, most preferably human elastase sequences. In other embodiments, the mature
mammalian elastase sequences are from other mammals such as mouse, rat, pig, cow,
or horse.
[0128] In the methods and compositions of the invention, the mature elastase sequence employed
is preferably that of a type I pancreatic elastase, which preferentially cleaves hydrophobic
protein sequences, preferable on the carboxy side of small hydrophobic residues such
as alanine. Examples of type I pancreatic elastases include the human elastase I enzyme
(NCBI Accession Number NP_001962) that is expressed in skin and the porcine pancreatic
elastase I enzyme (NCBI Accession Number CAA27670) that is expressed in the pancreas.
SEQ ID NO: and SEQ ID NO: 84 are examples of mature human type I elastase sequences.
[0129] Alternatively, a type II elastase that can cleave hydrophobic protein sequences,
preferably on the carboxy side of medium to large hydrophobic amino acid residues,
may be used. Examples of type II elastases include the human elastase IIA enzyme (NCBI
Accession Number NP254275) and the porcine elastase II enzyme (NCBI Accession Number
A26823) that are both expressed in the pancreas.
[0130] Variants of a mature elastase protein of the invention are also encompassed. Variants
include proteins comprising amino acid sequences sufficiently identical to or derived
from the amino acid sequence of the mature elastase protein of the invention and exhibit
elastase biological activity. A biologically active portion of a mature elastase protein
of the invention can be a protein which is, for example, at least 150, 160, 175, 180,
185, 190, 200, 210, 220, 230, 231, 232, 233, 234, 235, 236, 237, 238, or 239 amino
acids in length. Moreover, other biologically active portions, in which other regions
of the protein are deleted, can be prepared by recombinant techniques and evaluated
for one or more of the functional activities of the native form of a mature elastase
protein of the invention.
[0131] In addition, mature elastase proteins comprising any combination of the four human
type I elastase polymorphisms are represented by SEQ ID NO:84. Possible combinations
are set forth in Table 3 above.
5.1.2. PROELASTASE ACTIVATION SEQUENCES
[0132] The elastase activation sequence is any sequence whose removal from a proelastase
protein results in a biologically active mature elastase protein.
[0133] Activation sequences generally contain protease recognition sites adjacent to where
proproteins are cleaved to produce mature, biologically active proteins. An activation
sequence may be engineered to add a protease or elastase recognition site, or it may
be engineered to replace an existing protease recognition site with another protease
recognition site. Activation peptides or sequences useful in the practice of this
invention include, but are not limited to, SEQ ID NO: 23, 72 and 73. Still other activation
sequences useful in the practice of this invention can be obtained from the N-terminal
residues 1-10 of SEQ ID NO:64-68. In preferred aspects, the proelastase activation
sequence is engineered to contain a recognition sequence for a type I or type II elastase.
Most preferably, the elastase recognition sequence is recognized by the mature elastase
to which it is operably linked. Thus, in embodiments directed to a type II elastase,
the recognition sequence is most preferably a type II elastase recognition sequence.
Conversely, in embodiments directed to a type I elastase, the recognition sequence
is most preferably a type I elastase recognition sequence. In a preferred embodiment,
the recognition sequence is a human type I elastase recognition sequence. Exemplary
type I recognition sequences include the amino acid sequence of SEQ ID NOS: 14-16,
and 18-21. Other recognition sites contemplated by this invention include any recognition
site described by the consensus recognition sites of SEQ ID NO: 11, 12, or 13.
5.1.3. SIGNAL SEQUENCES
[0134] The proelastase proteins of the invention may further contain a signal sequence which
increases the secretion of proelastase protein into the culture medium of the host
cell in which it is expressed.
[0135] The native signal sequence of the elastase protein may be used, particularly for
expression in a mammalian host cell. In other embodiments, the native signal sequence
of an elastase protein of the invention can be removed and replaced with a signal
sequence from another protein, such as the porcine type I elastase signal sequence,
the human type I elastase signal sequence, or the yeast α-factor signal sequence.
In certain specific embodiments, the yeast α-factor signal peptide can further comprise
(1) a yeast α-factor propeptide or (2) a yeast α-factor propeptide and spacer sequence,
each respectively exemplified by the amino acid sequence of SEQ ID NOS:50 and 96 or
SEQ ID NOS:51 and 97. Alternatively, the gp67 secretory sequence of the baculovirus
envelope protein can be used as a heterologous signal sequence (
Current Protocols in Molecular Biology (Ausubel et al., eds., John Wiley & Sons, 1992)). Other examples of eukaryotic heterologous signal sequences include the secretory
sequences of melittin and human placental alkaline phosphatase (Stratagene; La Jolla,
California). In yet another example, useful prokaryotic heterologous signal sequences
include the phoA secretory signal (Sambrook
et al., supra) and the protein A secretory signal (Pharmacia Biotech; Piscataway, New Jersey).
5.2 ELASTASE NUCLEIC ACIDS
[0136] One aspect of the invention pertains to recombinant nucleic acid molecules that encode
a recombinant elastase protein of the invention. As used herein, the term "nucleic
acid molecule" is intended to include DNA molecules (
e.
g., cDNA or genomic DNA) and RNA molecules (
e.
g., mRNA) and analogs of the DNA or RNA generated using nucleotide analogs. The nucleic
acid molecule can be single-stranded or double-stranded, but preferably is double-stranded
DNA.
[0137] The present invention is directed to nucleic acids encoding the elastase proteins
of the invention. Thus, in certain embodiments, the present invention provides a nucleic
acid molecule comprising a nucleotide sequence which encodes a proelastase protein
(including but not limited to a protein of any one of SEQ ID NOS:6-9, 64-69, 88-91,
or 98-103) comprising (i) an activation sequence comprising an elastase recognition
sequence operably linked to (ii) the amino acid sequence of a protein having type
I elastase activity. In other embodiments, the present invention also provides a nucleic
acid molecule comprising a nucleotide sequence which encodes a protein comprising
(i) a signal sequence operable in
Pichia pastoris operably linked to (ii) an activation sequence (including but not limited to an amino
acid sequence of SEQ ID NOS: 23, 72, or 73) comprising a protease recognition sequence
which in turn is operably linked to (iii) the amino acid sequence of a mature human
type I elastase.
[0138] A nucleic acid of the invention may be purified. A "purified" nucleic acid molecule,
such as a cDNA molecule, can be substantially free of other cellular material, or
culture medium when produced by recombinant techniques, or substantially free of chemical
precursors or other chemicals when chemically synthesized.
[0139] In instances wherein the nucleic acid molecule is a cDNA or RNA,
e.
g., mRNA, molecule, such molecules can include a poly A "tail," or, alternatively,
can lack such a 3' tail.
[0140] A nucleic acid molecule of the invention can be amplified using cDNA, mRNA or genomic
DNA as a template and appropriate oligonucleotide primers according to standard PCR
amplification techniques. The nucleic acid so amplified can be cloned into an appropriate
vector and characterized by DNA sequence analysis. Furthermore, oligonucleotides corresponding
to all or a portion of a nucleic acid molecule of the invention can be prepared by
standard synthetic techniques,
e.
g., using an automated DNA synthesizer.
5.3 RECOMBINANT EXPRESSION VECTORS AND HOST CELLS
[0141] Further provided are vectors comprising any of the nucleic acids of the invention
or host cells engineered to express the nucleic acids of the invention. In specific
embodiments, the vectors comprise a nucleotide sequence which regulates the expression
of the protein encoded by the nucleic acid of the invention. For example, the nucleotide
sequence encoding the protein of the invention can be operably linked to a methanol-inducible
promoter.
[0142] Host cells comprising the nucleic acids and vectors of the invention are also provided.
In certain embodiments, the vector or nucleic acid is integrated into the host cell
genome; in other embodiments, the vector or nucleic acid is extrachromosomal. A preferred
host cell is a
Pichia pastoris cell.
[0143] As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting
another nucleic acid to which it has been linked. One type of vector is a "plasmid,"
which refers to a circular double-stranded DNA loop into which additional DNA segments
can be ligated. Another type of vector is a viral vector, wherein additional DNA segments
can be ligated into the viral genome. Certain vectors are capable of autonomous replication
in a host cell into which they are introduced (
e.
g., bacterial vectors having a bacterial origin of replication and episomal mammalian
vectors). Other vectors (
e.
g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon
introduction into the host cell, and thereby are replicated along with the host genome.
Moreover, certain vectors, expression vectors, are capable of directing the expression
of coding sequences to which they are operably linked. In general, expression vectors
of utility in recombinant DNA techniques are often in the form of plasmids (vectors).
[0144] The recombinant expression vectors of the invention comprise nucleotide sequence
encoding a mature elastase, a proelastase or a preproelastase of the invention in
a form suitable for expression in a host cell. This means that the recombinant expression
vectors include one or more regulatory sequences, selected on the basis of the host
cells to be used for expression, which is operably linked to the nucleic acid sequence
to be expressed. Within a recombinant expression vector, "operably linked" is intended
to mean that the nucleotide sequence of interest is linked to the regulatory sequence(s)
in a manner which allows for expression of the nucleotide sequence (
e.
g., in an
in vitro transcription/translation system or in a host cell when the vector is introduced
into the host cell). The term "regulatory sequence" is intended to include promoters,
enhancers and other expression control elements (
e.
g., polyadenylation signals). Such regulatory sequences are described, for example,
in
Goeddel, Gene Expression Technology: Methods in Enzymology 185 (Academic Press, San
Diego, CA, 1990). Regulatory sequences include those which direct constitutive expression of a nucleotide
sequence in many types of host cells and those which direct expression of the nucleotide
sequence only in certain host cells (
e.
g., tissue-specific regulatory sequences). It will be appreciated by those skilled
in the art that the design of the expression vector can depend on such factors as
the choice of the host cell to be transformed, the level of expression of elastase
protein desired,
etc. The expression vectors of the invention can be introduced into host cells to thereby
produce elastase proteins encoded by nucleic acids as described herein.
[0145] The recombinant expression vectors of the invention can be designed for expression
of an elastase protein of the invention in prokaryotic (
e.g., E. coli) or eukaryotic cells (
e.
g., insect cells (using baculovirus expression vectors), yeast cells or mammalian cells).
Suitable host cells are discussed further in Goeddel,
supra. Alternatively, the recombinant expression vector can be transcribed and translated
in vitro, for example using T7 promoter regulatory sequences and T7 polymerase.
[0146] Expression of proteins in prokaryotes is most often carried out in
E.
coli with vectors containing constitutive or inducible promoters directing the expression
of either fusion or non-fusion proteins. Fusion vectors add a number of amino acids
to a protein encoded therein, usually to the amino terminus of the recombinant protein.
Such fusion vectors typically serve three purposes: 1) to increase expression of the
recombinant elastase protein; 2) to increase the solubility of the recombinant elastase
protein; and 3) to aid in the purification of the recombinant elastase protein by
acting as a ligand in affmity purification. Often, in fusion expression vectors, a
proteolytic cleavage domain is introduced at the junction of the fusion moiety and
the recombinant protein to enable separation of the recombinant protein from the fusion
moiety subsequent to purification of the fusion protein. Thus, the fusion moiety and
proteolytic cleavage domain together can act as an activation sequence, including
a protease recognition site, for recombinant expression of an elastase protein. Enzymes
capable of activating such fusion proteins, and their cognate recognition sequences,
include Factor Xa, thrombin and enterokinase. Typical fusion expression vectors include
pGEX (Pharmacia Biotech Inc.;
Smith and Johnson, 1988, Gene 67:31-40), pMAL (New England Biolabs, Beverly, MA) and pRIT5 (Pharmacia, Piscataway, NJ) which
fuse glutathione S-transferase (GST), maltose E binding protein, or protein A, respectively,
to the target recombinant protein.
[0149] In another embodiment, the expression vector is a yeast expression vector. Examples
of vectors for expression in yeast
S.
cerevisiae or
P. pastors include pYepSec1 (
Baldari et al., 1987, EMBO J. 6:229-234), pMFa (
Kurjan and Herskowitz, 1982, Cell 30:933-943), pJRY88 (
Schultz et al., 1987, Gene 54:113-123), pYES2 (Invitrogen Corporation, San Diego, CA), and pPicZ (Invitrogen Corp, San
Diego, CA). For expression in yeast, a methanol-inducible promoter is preferably used.
Alteration of the nucleic acid sequence of the nucleic acid to be inserted into an
expression vector so that the individual codons for each amino acid are those preferentially
utilized in
P. pastoris is also contemplated herein. More specifically, the codons of SEQ ID NO:33 or SEQ
ID NO:81 can be substituted for codons that are preferentially utilized in
P. pastoris.
[0150] Alternatively, the expression vector is a baculovirus expression vector. Baculovirus
vectors available for expression of proteins in cultured insect cells (
e.
g., Sf 9 cells) include the pAc series (
Smith et al., 1983, Mol. Cell Biol. 3:2156-2165) and the pVL series (
Lucklow and Summers, 1989, Virology 170:31-39). Another strategy is to alter the nucleic acid sequence of the nucleic acid to be
inserted into an expression vector so that the individual codons for each amino acid
are those preferentially utilized in insect cells.
[0151] In yet another embodiment, an elastase protein is expressed in mammalian cells using
a mammalian expression vector. Examples of mammalian expression vectors include pCDM8
(
Seed, 1987, Nature 329(6142):840-2) and pMT2PC (
Kaufman et al., 1987, EMBO J. 6:187-195). When used in mammalian cells, the expression vector's control functions are often
provided by viral regulatory elements. For example, commonly used promoters are derived
from polyoma, Adenovirus 2, cytomegalovirus and Simian Virus 40. For other suitable
expression systems for both prokaryotic and eukaryotic cells see chapters 16 and 17
of Sambrook
et al.,
supra.
[0152] In another embodiment, the recombinant mammalian expression vector is capable of
directing expression of the nucleic acid preferentially in a particular cell type
(e.g., tissue-specific regulatory elements are used to express the nucleic acid).
Tissue-specific regulatory elements are known in the art. Non-limiting examples of
suitable tissue-specific promoters include the albumin promoter (liver-specific;
Pinkert et al., 1987, Genes Dev. 1:268-277), lymphoid-specific promoters (
Calame and Eaton, 1988, Adv. Immunol. 43:235-275), in particular promoters of T cell receptors (
Winoto and Baltimore, 1989, EMBO J. 8:729-733) and immunoglobulins (
Banerji et al., 1983, Cell 33:729-740;
Queen and Baltimore, 1983, Cell 33:741-748), neuron-specific promoters (e.g., the neurofilament promoter;
Byrne and Ruddle, 1989, Proc. Natl. Acad. Sci. USA 86:5473-5477), pancreas-specific promoters (
Edlund et al., 1985, Science 230:912-916), and mammary gland-specific promoters (
e.
g., milk whey promoter;
U.S. Patent No. 4,873,316 and European Application Publication No.
EP264166). Developmentally-regulated promoters are also encompassed, for example the mouse
hox promoters (
Kessel and Gruss, 1990, Science 249:374-379) and the beta-fetoprotein promoter (
Campes and Tilghman, 1989, Genes Dev. 3:537-546).
[0153] In certain aspects of the invention, expression of a protein of the invention may
be increased by increasing the dosage of the corresponding gene, for example by the
use of a high copy expression vector or gene amplification. Gene amplification can
be achieved in dihydrofolate reductase- (
"dhfr-") deficient CHO cells by cotransfection of the gene of interest with the
dhfr gene and exposure to selective medium with stepwise increasing concentrations of
methotrexate. See,
e.
g.,
Ausubel et al., Current Protocols in Molecular Biology Unit 16.14, (John Wiley &
Sons, New York, 1996). An alternative method for increasing gene copy number is to multimerize an expression
cassette (e.g., promoter with coding sequence) encoding the elastase protein of interest
in a vector prior to introducing the vector into the host cell. Methods and vectors
for achieving expression cassette multimerization are known in yeast and mammalian
host cell systems (see,
e.
g.,
Monaco, Methods in Biotechnology 8:Animal Cell Biotechnology, at pp. 39-348 (Humana
press, 1999);
Vassileva et al., 2001, Protein Expression and Purification 21:71-80;
Mansur et al., 2005, Biotechnology Letter 27(5):339-45. In addition, kits for multi-copy gene expression are commercially available. For
example, a multi-copy
Pichia expression kit can be obtained from Invitrogen (Carlsbad, California). The multimerization
of an expression cassette is exemplified in Example 6,
infra.
[0154] Accordingly, other aspects of the invention pertain to host cells into which a recombinant
expression vector of the invention has been introduced. The terms "host cell" and
"recombinant host cell" are used interchangeably herein. It is understood that such
terms refer not only to the particular subject cell but to the progeny or potential
progeny of such a cell. Because certain modifications may occur in succeeding generations
due to either mutation or environmental influences, such progeny may not, in fact,
be identical to the parent cell, but are still included within the scope of the term
as used herein.
[0155] A host cell can be any prokaryotic (
e.
g.,
E. coli) or eukaryotic cell (e.g., insect cells, yeast or mammalian cells).
[0156] Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional
transformation or transfection techniques. As used herein, the terms "transformation"
and "transfection" are intended to refer to a variety of art-recognized techniques
for introducing foreign nucleic acid into a host cell, including calcium phosphate
or calcium chloride co-precipitation, DEAE-dextran-mediated transfection, lipofection,
or electroporation. Suitable methods for transforming or transfecting host cells can
be found in Sambrook
et al. (supra), and other laboratory manuals.
[0157] For stable transfection of mammalian cells, it is known that, depending upon the
expression vector and transfection technique used, only a small fraction of cells
may integrate the foreign DNA into their genome. In order to identify and select these
integrants, a coding sequence for a selectable marker (
e.
g., for resistance to antibiotics) is generally introduced into the host cells along
with the open reading frame of interest. Preferred selectable markers include those
which confer resistance to drugs, such as G418, hygromycin, zeocin and methotrexate.
Cells stably transfected with the introduced nucleic acid can be identified by drug
selection (
e.
g., cells that have incorporated the selectable marker coding sequence will survive,
while the other cells die).
[0158] In another embodiment, the expression characteristics of an endogenous elastase coding
seqence within a cell, cell line or microorganism may be modified by inserting a DNA
regulatory element heterologous to the elastase coding sequence into the genome of
a cell, stable cell line or cloned microorganism such that the inserted regulatory
element is operatively linked with the endogenous gene
[0159] A heterologous sequence, containing a regulatory element, may be inserted into a
stable cell line or cloned microorganism, such that it is operatively linked with
and activates expression of an endogenous elastase gene, using techniques, such as
targeted homologous recombination, which are well known to those of skill in the art,
and described
e.
g., in Chappel,
U.S. Patent No. 5,272,071;
PCT publication No. WO 91/06667, published May 16, 1991. The heterologous sequence may further include the signal peptides, cleavage sequences
and/or activation sequences of the present invention.
5.4 METHODS OF MANUFACTURING MATURE ELASTASE PROTEINS
[0160] A host cell of the invention, such as a prokaryotic or eukaryotic host cell in culture,
can be used to produce an elastase protein of the invention. Accordingly, the invention
further provides methods for producing an elastase protein of the invention using
the host cells of the invention. In one embodiment, the method comprises culturing
the host cell of invention (into which a recombinant expression vector encoding an
elastase protein of the invention has been introduced) in a suitable medium such that
the elastase protein is produced. In another embodiment, the method further comprises
isolating the elastase protein from the medium or the host cell.
[0161] The present invention further provides methods for producing immature elastase proteins
of the invention comprising culturing a host cell engineered to express a nucleic
acid of the invention under conditions in which the proelastase protein is produced.
In certain embodiments, the preproelastase protein is also produced. The present invention
further provides methods for producing mature elastase proteins of the invention comprising
culturing a host cell engineered to express a nucleic acid of the invention under
conditions in which a proelastase protein is produced and subjecting the proelastase
protein to activation conditions such that the mature elastase protein is produced.
[0162] Preferred culture conditions for producing the immature and mature proteins of the
invention, particularly for the host cell
Pichia pastoris, include a period of growth at a low pH. In specific embodiments, the low pH is a
pH of 2-6, a pH of 2-5, a pH of 3-6, a pH of 3-5, a pH of 4-6, a pH of 3-4 or any
range whose upper and lower limits are selected from any of the foregoing values.
At the end of the culture period, the pH of the culture can be raised, preferably
to a pH of 7-11, most preferably to a pH of 8.
[0163] Where the expression of a proelastase protein of the invention is under the control
of a methanol-inducible promoter, conditions for producing an immature or mature elastase
protein of the invention may also comprise a period of methanol induction.
[0164] The elastase production methods of the invention may further comprise the step of
recovering the protein expressed by the host cell. In certain instances, the protein
recovered is a proelastase, containing the activation sequence. In other instances,
the protein recovered is a mature elastase lacking the activation sequence. Under
certain conditions, both proelastase and mature elastase proteins are produced. In
other instances, the preproelastase is produced.
[0165] Preferably, particularly where it is desired to circumvent auto-activation of an
auto-activated proelastase, culture conditions for proelastase expression comprise
a period of growth in sodium citrate, sodium succinate, or sodium acetate. In specific
embodiments, a concentration of about 5-50 mM, 7.5-100 Mm, 10-150 mM, 50-200 mM, 75-175
mM, 100-150 mM, 75-125 mM, or of any range whose upper and lower limits are selected
from any of the foregoing values is used. In a preferred embodiment, the sodium citrate,
sodium succinate, or sodium acetate concentration is 90-110 mM, most preferably 100
mM.
[0166] Additionally, particularly where it is desired to circumvent protein degradation,
culture conditions for proelastase expression comprise a period of growth and induction
at the lower end of the temperature range suitable for the host cell in question.
For example, where the host cell is a
Pichia pastoris host cell, the preferred range is about 22-28°C. In specific embodiments, the
Pichia pastoris host cell is cultured at a temperature of about 28°C. The growth and induction need
not be performed at the same temperature; for example, in an embodiment where
Pichia pastoris is utilized as a host cell, growth can be performed at 28°C while induction can be
performed at 22°C.
[0167] The activation of an auto-activated proelastase protein of the invention may be initiated
by the addition of extrinsic elastase in a small (catalytic) amount. Alternatively
or concurrently, the activation of an auto-activated proelastase protein of the invention
may be initiated by raising the pH of the solution containing the auto-activated proelastase
protein. The pH is preferably 7-11; in specific embodiments, the solution is at a
pH of 7-10, 7-9, 8-10, 8-9, or any range whose upper and lower limits are selected
from any of the foregoing values. In a preferred embodiment, the pH of the solution
7-9, most preferably 8.
[0168] In specific embodiments, the auto-activated proelastase may be subjected to Tris
base, during the activation step. In specific embodiments, Tris base is added to a
concentration of 5-50 mM, 7.5-100 Mm, 10-150 mM, 50-200 mM, 75-175 mM, 100-150 mM,
75-125 mM, or of any range whose upper and lower limits are selected from any of the
foregoing values. In a preferred embodiment, Tris base is added to a concentration
90-110 mM, most preferably 100 mM. The pH of the Tris base is preferably 7-11; in
specific embodiments, the Tris base is at a pH of 7-10, 7-9, 8-10, 8-9, or any range
whose upper and lower limits are selected from any of the foregoing values. In a preferred
embodiment, the Tris base is at a pH of 7-9, most preferably 8.
[0169] In certain aspects of the invention, the temperature for elastase autoactivation
is ambient temperature, e.g., a temperature ranging from 22°C to 26°C. In certain
embodiments, the elastase activation step is preferably performed with the proelastase
at a low initial concentration, e.g., 0.1-0.3 mg/ml, for optimal accuracy of the cleavage
reaction and minimal formation of N-terminal variants.
[0170] In certain embodiments of the invention, addition of catalytic amounts of elastase
is not required to convert the auto-activated proelastase to mature elastase, as the
proelastase can undergo autoproteolysis. In certain embodiments, the rate of autoproteolysis
is concentration independent. Without seeking to be limited by theory, it is believed
that concentration independent autoproteolysis of certain auto-activated proelastase
proteins is mediated via an intramolecular process where the proelastase molecule
cleaves itself via an intramolecular reaction. However, in other embodiments, activation
of the auto-activated proelastase is concentration dependent. Without seeking to be
limited by theory, it is believed that concentration dependent autoproteolysis of
certain auto-activated proelastase proteins is mediated via an intermolecular reaction
where proelastase is cleaved by another proelastase and/or by a mature elastase. In
still other embodiments, certain auto-activated elastase proproteins display a combination
of concentration dependent and concentration independent activation. In those instances
where auto-activation is concentration dependent, the proprotein can be maintained
in a more dilute form to reduce activation if desired. Activation of elastase proproteins
comprising the elastase propeptide cleavage domain of SEQ ID NO:55 that include but
are not limited to the proprotein of SEQ ID NO:69 can be controlled by maintaining
such proproteins in a dilute form.
[0171] It is also recognized that certain undesirable N-terminal sequence variants of mature
elastase can accumulate in the course of producing mature elastase proteins of this
invention. More specifically, proelastase proteins containing the SEQ ID NO:42 elastase
propeptide cleavage domain that include the proprotein of SEQ ID NO:6 can yield N-terminal
sequence variants where cleavage has occurred at the peptide bond that is C-terminal
to any of the residues at positions P3 or P2. However, the occurrence of such undesirable
N-terminal variants can be reduced by placing certain amino acids in certain locations
in the activation sequence. For example, when a proline in present in the P2 position,
the production of N-terminal variants with one or two additional N-terminal amino
acids is reduced or eliminated. Also, elimination of the need for trypsin for activation
reduces or eliminates the production of the variant that lacks nine N-terminal residues.
Additionally, the occurrence of undesirable N-terminal variants can be reduced or
eliminated by conducting the activation reaction under certain conditions.
[0172] More specifically, in certain embodiments activation conditions include an "extended
conversion" step during which N-terminal variants produced during the initial portion
of the conversion reaction are subsequently selectively degraded. The relative amounts
of protein species during "extended conversion" can be monitored in real-time by HIC-HPLC.
The selective degradation of undesired N-terminal variants increases the proportion
of full-length, mature PRT-201 in the conversion reaction and reduces the proportion
of N-terminal variants. For proelastase proteins containing the SEQ ID NO:55 elastase
propeptide cleavage domain, the extended conversion step is performed for 4 to 8 hours,
and preferably about 6 hr. For other proelastase proteins, the extended conversion
step may be increased or decreased, depending on the proportion of N-terminal variants
relative to mature (full length) elastase immediately after all of the proelastase
has been converted. When the conversion occurs in complex media, such as fermentation
broth, the period of extended conversion may be increased due to competition at the
active site of mature elastase by other proteins and peptides in solution. Alternatively,
a mixture of mature elastase and N-terminal variant elastase can be recovered from
the complex media prior to the extended conversion step, thereby reducing the active
site competitition and the time required to remove the N-terminal variant species.
[0173] As mentioned above, during a conversion reaction for pro-PRT-201-55M3-003-VU, there
is a side-reaction that leads to the production of N-terminal variants. In the specific
case of pro-PRT-201-55M3-003-VU, these N-terminal variants are missing the first two
valines and have little or no elastase activity. For other mutant pro-proteins there
are additional N-terminal variants produced, some with additions and others with different
deletions. An N-terminal removal step has been developed which reduces the N-terminal
variants to a range of 0-2%. The development of this removal step evolved from a variety
of experiments and observations. As mentioned previously, during optimization of conversion
condition experiments with pro-PRT-201-42 it was observed that longer conversion reactions
often led to a very low percentage of N-terminal variants. It was subsequently determined
that the longer conversion reactions allowed mature PRT-201 to selectively degrade
N-terminal variants. The discovery of PRT-201's ability to selectively degrade N-terminal
variants under certain conditions had a tremendous benefit by helping to produce a
more purified PRT-201 product with less N-terminal variants. This N-terminal variant
removal step was implemented into a large scale production process by establishing
conditions that would allow the pro-PRT-201 to convert to mature PRT-201 and then
allow the PRT-201 to degrade the N-terminal variants.
[0174] A representative example of such a step is shown in Figure 10 as it was monitored
in real-time by HIC-HPLC. At approximately 50 minutes, the 100% pro-PRT-201-SSM3 had
completely converted to approximately 86% mature PRT-201 and 14% N-terminal variants.
The conversion reaction was extended which allowed mature PRT-201 to selectively degrade
the N-terminal variants resulting in a decrease of variants from 14% to 2%. With longer
incubations, the N-terminal variants can be selectively degraded to an undetectable
level. When the N-terminal variant level is sufficiently low, the activity of PRT-201
is suppressed with sodium citrate and adjustment of the reaction pH to 5.0.
[0175] Once purified mature elastase has been obtained, the active enzyme can be brought
into a solution at which the elastase protein is relatively inactive and placed into
a buffer for further column chromatography, e.g., cation exchange chromatography,
purification steps. In general, the elastase protein can be placed in sodium citrate
at a concentration of about 5 to 25 mM and a pH of about 2 to 5. In a specific embodiment,
the elastase is placed in 20 mM sodium citrate, pH 5. The eluted fractions are then
optionally analyzed by one, more than one, or all of the following methods: (1) spectrophotometry
at A280 to determine concentration, (2) SDS-PAGE to assess purity, (3) activity assay,
e.g., SLAP assay, to assess elastase specific activity, and (4) HIC-HPLC to detect
mature elastase and N-terminal variants, and fractions with suitable characteristics
(e.g., acceptable specific activity, acceptably low levels (preferably absence) of
detectable glycoforms, and acceptably low levels (preferably absence) of detectable
N-terminal variants) are pooled.
[0176] Once purified mature elastase has been obtained, the active enzyme can be brought
into a suitable solution for lyophilization. In general, the elastase protein can
be placed into a buffer of 1 X phosphate buffered saline ("PBS") (137 mM sodium chloride,
10 mM sodium phosphate, 2.7 mM potassium phosphate pH 7.4) prior to lyophilization.
In certain embodiments, the elastase protein can be placed into a buffer of 0.1 X
PBS (13.7 mM sodium chloride, 1.0 mM sodium phosphate, 0.27 mM potassium phosphate
pH 7.4) prior to lyophilization.
[0177] Expression of a proelastase sequence can in some instances yield a mixture of proelastase
and mature elastase proteins. Thus, the present invention provides a composition comprising
both a proelastase protein and a mature elastase protein.
5.5 PHARMACEUTICAL COMPOSITIONS
[0178] The mature elastase proteins of the invention can be incorporated into pharmaceutical
compositions suitable for administration. Such compositions typically comprise the
elastase protein and pharmaceutically inert ingredients, for example a pharmaceutically
acceptable carrier. As used herein the language "pharmaceutically acceptable carrier"
is intended to include any and all solvents, dispersion media, coatings, antibacterial
and antifungal agents, isotonic and absorption delaying agents, and the like, compatible
with pharmaceutical administration. Also contemplated as pharmaceutically inert ingredients
are conventional excipients, vehicles, fillers, binders, disintegrants, solvents,
solubilizing agents, and coloring agents. The use of such media and agents for pharmaceutically
active substances is well known in the art. Except insofar as any conventional media
or agent is incompatible with a mature elastase protein, use thereof in the compositions
is contemplated. Supplementary active compounds can also be incorporated into the
compositions.
[0179] Accordingly, certain aspects of the present invention relate to pharmaceutical compositions.
In specific embodiments, the present invention provides a composition comprising (i)
a therapeutically effective amount of a mature human type I elastase and (ii) a pharmaceutically
acceptable carrier. The mature human type I elastase that can be used in the composition
include but are not limited to the proteins of SEQ ID NO: 1, 4, 5, 84, 87. The mature
human type I elastase may contain any of the combinations of polymorphisms set forth
in Table 3 above.
[0180] In other embodiments, the present invention provides a pharmaceutical composition
comprising (i) a therapeutically effective amount of mature human type I elastase
(ii) a pharmaceutically acceptable carrier, which pharmaceutical composition is free
of trypsin, or fragments of trypsin. In other embodiments, the pharmaceutical composition
is substantially free of trypsin or fragments of trypsin. As used herein, the phrase
"free of trypsin" refers to a composition in which trypsin is not used in any portion
of the production process. As used herein, the phrase "substantially free of trypsin"
refers to a composition wherein trypsin is present at a final percent (i.e., weight
trypsin/total composition weight) of no more than about 0.0025% or more preferably,
less than about 0.001 % on a weight/weight basis. As used herein, the phrase "free
of" trypsin refers to a composition in which the variant is undetectable, e.g., by
means of an enzymatic assay or ELISA.
[0181] In certain aspects, a composition of the invention has less trypsin activity than
the equivalent of 3 ng/ml of trypsin as measured by a BENZ assay, preferably less
trypsin activity than the equivalent of 2.5 ng/ml of trypsin as measured by a BENZ
assay, and even more preferably less trypsin activity than the equivalent of 2 ng/ml
of trypsin as measured by a BENZ assay. In a specific embodiment, the present invention
provides a composition comprising a therapeutically effective amount of elastase protein
in which the trypsin activity is the equivalent of less than 1.6 ng/ml of trypsin
as measured by a BENZ assay. Examples of elastase compositions with less trypsin activity
than the equivalent of 1.6 ng/ml of trypsin as measured by a BENZ assay are provided
in Example 8 below. In certain embodiments, the ng/ml trypsin activity can be assayed
in a liquid human type I elastase composition or preparation containing 1 mg/ml human
type I elastase protein. Thus, the trypsin activities may also be described in terms
of milligrams of elastase protein, for example, less than 3 ng trypsin activity/mg
elastase protein, less than 1.56 ng trypsin activity/mg elastase protein, etc.
[0182] The present invention further provides pharmaceutical compositions that are either
free or substantially free of undesirable N-terminal variants of mature elastase.
Undesirable N-terminal variants include, but are not limited to, variants produced
by cleavage at the peptide bond that is C-terminal to any of the residues at the P5,
P4, P3, P2, P'1, P'2, P'3, P'4, P'6, and/or P'9 positions. Certain undesirable N-terminal
variants are produced by trypsin activation; others are produced by autoactivation
of proelastase sequences that do not contained optimized activation sequences.
[0183] In certain embodiments, the pharmaceutical composition is free or substantially free
of one, more than one or all N-terminal variants of mature elastase that include but
are not limited to SEQ ID NOS: 2, 3, 37, 38, 70, 71, 85, 86, 94, 95, 104, 105, 106,
107, 108. In certain embodiments, the present invention provides a pharmaceutical
composition comprising (i) a therapeutically effective amount of mature human type
I elastase (ii) a pharmaceutically acceptable carrier, which pharmaceutical composition
is free or substantially free of any protein with SEQ ID NOS: 2, 3, 37, 38, 70, 71,
85, 86, 94, 95, 104, 105, 106, 107, or 108. In other embodiments, the pharmaceutical
composition is substantially free ofN-terminal variants of mature elastase that include
but are not limited to SEQ ID NOS: 2, 3, 37, 38, 70, 71, 85, 86, 94, 95, 104, 105,
106, 107, or 108. As used herein, the phrase "free of" a particular variant refers
to a composition in which the variant is undetectable, e.g., by means of cation exchange
HPLC assay, hydrophobic interaction HPLC assay, or mass spectrometry combined with
liquid chromatography. As used herein, the phrase "substantially free" refers to a
composition wherein the N-terminal variant is present at a final percent (
i.
e. weight N-terminal variant/total composition weight) of at least less than about
0.5%. In certain preferred embodiments, the composition that is substantially free
of N-terminal variant is a composition where the concentration ofN-terminal variant
is less than about 0.1 % or less than about 0.01 % or, more preferably, even less
than about 0.001 % on a weight/weight basis. In certain aspects, the presence of N-terminal
variants is detected by means of cation exchange HPLC assay, hydrophobic interaction
HPLC assay, or mass spectrometry combined with liquid chromatography.
[0184] In certain specific embodiments, a pharmaceutical composition that is free ofN-terminal
variants of SEQ ID NO:70, 71, 104 and 105 is produced by activation of a proelastase
which does not contain an arginine in the P1 postion and/or an alanine in the P2 position.
[0185] In other embodiments, the present invention provides a pharmaceutical composition
comprising (i) a therapeutically effective amount of mature human type I elastase
(ii) a pharmaceutically acceptable carrier, which pharmaceutical composition is substantially
free of bacterial proteins and/or is substantially free of mammalian proteins other
than said mature human type I elastase. As used herein, the phrase "substantially
free of mammalian proteins" or "substantially free of bacterial proteins" refers to
a composition wherein such proteins are present at a final percent (
i.
e. weight mammalian proteins (other than elastase and, optionally, a carrier protein
such as albumin) or bacterial proteins/total composition weight) of at least less
than about 0.5%. In certain preferred embodiments, the composition that is substantially
free of such proteins is a composition where the concentration of the undesirable
protein is less than about 0.1% or less than about 0.01%, or, more preferably, even
less than about 0.001 % on a weight/weight basis.
[0186] In certain aspects, a pharmaceutical composition that is "free of mammalian proteins"
(other than elastase) contains elastase that is produced from a recombinant cell line
that is not a mammalian cell and where no protein with a mammalian sequence or substantially
a mammalian sequence is present in any portion of the production process. In certain
aspects, a pharmaceutical composition that is "free of bacterial proteins" contains
elastase that is produced from a recombinant cell line that is not a bacterial cell
and where no protein with a bacterial sequence or substantially a bacterial sequence
is present in any portion of the production process.
[0187] The mature human type I elastases (including variants) of the invention are most
preferably purified for use in pharmaceutical compositions. In specific embodiments,
the elastases are at least 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% pure. In other
specific embodiments, the elastases are up to 98%, 98.5%, 99%, 99.2%, 99.5% or 99.8%
pure.
[0188] For formulating into pharmaceutical compositions, the mature human type I elastases
of the invention preferably have a specific activity of greater than greater than
1, greater than 5, greater than 10, greater than 20, greater than 25, or greater than
30 U/mg of protein, as determined by measuring the rate of hydrolysis of the small
peptide substrate N-succinyl-Ala-Ala-Ala-pNitroanilide (SLAP), which is catalyzed
by the addition of elastase. One unit of activity is defined as the amount of elastase
that catalyzes the hydrolysis of 1 micromole of substrate per minute at 30°C and specific
activity is defined as activity per mg of elastase protein (U/mg). Preferably, a pharmaceutical
composition comprises a mature human type I elastase which has a specific activity
within a range in which the lower limit is 1, 2, 3, 4, 5, 7, 10, 15 or 20 U/mg protein
and in which the upper limit is, independently, 5, 10, 15, 20, 25, 30, 35, 40 or 50
U/mg protein. In exemplary embodiments, the specific activity is in the range of 1-40
U/mg of protein, 1-5 U/mg protein, 2-10 U/mg protein, 4-15 U/mg protein, 5-30 U/mg
of protein, 10-20 U/mg of protein, 20-40 U/mg of protein, or any range whose upper
and lower limits are selected from any of the foregoing values.
[0189] The pharmaceutical compositions of the invention are preferably stable. In specific
embodiments, a pharmaceutical composition (for example a pharmaceutical composition
prepared by lyophilization above) maintains at least 50%, more preferably at least
60%, and most preferably at least 70% of its specific activity after a week, more
preferably after a month, yet more preferably after 3 months, and most preferably
after 6 months of storage at 4°C. In specific embodiments, the pharmaceutical composition
maintains at least 75%, at least 80%, at least 85%, at least 90% or at least 95% of
its specific activity after a week, more preferably after a month, yet more preferably
after 3 months, and most preferably after 6 months of storage at 4°C.
[0190] A pharmaceutical composition of the invention is formulated to be compatible with
its intended route of administration. Methods for administering elastases to treat
or prevent diseases of biological conduits are described in
WO 2001/21574;
WO 2004/073504; and
WO 2006/036804. The most preferred route of administration is parenteral, for example direct administration
to the vessel wall, including local administration to the external adventitial surface
of surgically exposed vessels and local administration to the vessel wall using a
drug delivery catheter. Solutions or suspensions used for parenteral administration
can include the following components: a sterile diluent such as water for injection,
saline solution, phosphate buffered saline solution, sugars such as sucrose or dextrans,
fixed oils, polyethylene glycols, glycerine, propylene glycol, polysorbate-80 (also
known as tween-80), or other synthetic solvents; antibacterial agents such as methyl
parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents
such as ethylenediaminetetraacetic acid; buffers such as phosphates and agents for
the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted
with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral
preparation can be enclosed in ampules, disposable syringes or single or multiple
dose vials made of glass or plastic. The parenteral preparation can also be enclosed
in a drug delivery catheter. In all cases, the composition must be sterile.
[0191] In specific embodiments, a pharmaceutical composition of the invention is a liquid
formulation comprising one or more of the following excipients: dextrose (e.g., 2-10%
w/v); lactose (
e.
g., 2-10% w/v); mannitol (
e.
g., 2-10% w/v); sucrose (
e.
g., 2-10% w/v); trehalose
(e.g., 2-10% w/v); ascorbic acid
(e.g., 2-10 mM); calcium chloride (
e.
g., 4-20 mM); dextran-70
(e.g., 2-10% w/v); poloxamer 188
(e.g., 0.2-1% w/v); polysorbate-80 (e.g., 0.001-5% w/v, more preferably 0.1-5%); glycerin
(e.g., 0.2-5% w/v); arginine (e.g., 2-10% w/v); glycine
(e.g., 2-10% w/v); dextran-44 (e.g., 2-10% w/v); and dextran-18 (e.g., 2-10% w/v). In certain
embodiments, the concentration, singly or in the aggregate, of dextrose, lactose,
mannitol, sucrose, trehalose, dextran-70, glycerin, arginine, glycine, dextran-44
or dextran-18 is within a range in which the lower limit is 2.5, 4, 5, or 7% w/v and
in which the upper limit is, independently, 4, 5, 6, 8, or 10% w/v.
[0192] A liquid formulation can be made by adding water to a dry formulation containing
a mature elastase protein, one or more buffer reagents and/or one or more excipients.
The dry formulation can be made by lyophilizing a solution comprising mature elastase
protein, one or more buffer reagents, and/or one or more excipients.
[0193] A liquid formulation can be made, for example, by reconstituting lyophilized elastase
proteins of the invention with sterilized water or a buffer solution. Examples of
a buffer solution include sterile solutions of saline or phosphate-buffered saline.
In a specific embodiment, after reconstitution of a dry formulation comprising mature
elastase protein to the desired protein concentration, the solution contains approximately
137 mM sodium chloride, 2.7 mM potassium phosphate, 10 mM sodium phosphate (a phosphate
buffered saline concentration that is considered 1X) and the pH of the solution is
approximately 7.4. In certain aspects, the dry formulation comprising mature elastase
protein also contains sodium, chloride, and phosphate ions in amounts such that only
water is needed for reconstitution.
[0194] A liquid formulation can be also be made, for example, by reconstituting lyophilized
elastase proteins with a buffer solution containing one or more excipients. Examples
of excipients include polysorbate-80 and dextran. In a specific embodiment, after
reconstitution of a dry formulation comprising mature elastase protein to the desired
protein concentration, the resulting solution contains approximately 137 mM sodium
chloride, 2.7 mM potassium phosphate, 10 mM sodium phosphate, 0.01% polysorbate-80,
and the pH of the solution is approximately 7.4. The one or more excipients can be
mixed with the mature elastase protein before lyophilization or after lyophilization
but before reconstitution. Thus, in certain aspects, the dry formulation comprising
mature elastase protein also contains excipients such as polysorbate-80 or dextran.
[0195] In certain aspects, the present invention provides a liquid formulation comprising:
0.001-50 mg/ml of mature elastase protein in a solution of 137 mM sodium chloride,
2.7 mM potassium phosphate, 10 mM sodium phosphate and comprising 5-10%, more preferably
6-9%, of an excipient selected from dextrose, lactose, mannitol, sucrose, trehalose,
dextran-70, glycerin, arginine, glycine, dextran-44 or dextran-18.
[0196] In a specific embodiment, the present invention provides a liquid formulation comprising:
0.001-50 mg/ml of mature elastase protein in a solution of 137 mM sodium chloride,
2.7 mM potassium phosphate, 10 mM sodium phosphate with a pH of 7.4.
[0197] In another specific embodiment, the present invention provides a liquid formulation
comprising: 0.001-50 mg/ml of mature elastase protein in a solution of 137 mM sodium
chloride, 2.7 mM potassium phosphate, 10 mM sodium phosphate and comprising 0.01%
polysorbate-80, with a pH of 7.4.
[0198] In another specific embodiment, the present invention provides a liquid formulation
comprising: 0.001-50 mg/ml of mature elastase protein in a solution of 137 mM sodium
chloride, 2.7 mM potassium phosphate, 10 mM sodium phosphate and comprising 0.01 %
polysorbate-80 and 8% dextran-18, with a pH of 7.4.
[0199] In another specific embodiment, the present invention provides a liquid formulation
comprising: 0.001-50 mg/ml of mature elastase protein in a solution of 137 mM sodium
chloride, 2.7 mM potassium phosphate, 10 mM sodium phosphate and comprising 8% dextran-18,
with a pH of 7.4.
[0200] The liquid formulations of the invention preferably contain a final concentration
of mature elastase proteins within a range in which the lower limit is 0.1, 0.5, 1,
2.5, 5, 10, 15 or 20 mg/ml and in which the upper limit is, independently, 0.5, 1,
2.5, 5, 10, 25, 50, 100, 250, 500, 1000, or 1500 mg/ml.
[0201] In certain aspects, the present invention provides a liquid formulation comprising:
0.0001-500 mg/ml (more preferably 1-100 mg/ml, and yet more preferably 0.5-20 mg/ml)
of mature elastase protein in a solution of 0.5X PBS-1.5X PBS (more preferably 1X
PBS), the solution comprising 5-10% (more preferably 6-9%) of an excipient selected
from dextrose, lactose, mannitol, sucrose, trehalose, dextran-70, glycerin, arginine,
glycine, dextran-44 or dextran-18 and having a pH of 6.5 - 8.5. In a specific embodiment,
the liquid formulation comprises 0.5 mg/ml mature elastase protein and 8% dextran-18
8 in 1X PBS, pH 7.4. In a specific embodiment, the liquid formulation comprises 5
mg/ml mature elastase protein and 8% dextran-18 in 1X PBS, pH 7.4.
[0202] A liquid formulation of the invention preferably has an osmolality within a range
in which the lower limit is 100, 125, 150, 175, 200, 250 or 275 mOsm/kg and in which
the upper limit is, independently, 500, 450, 400, 350, 325, 300, 275 or 250 mOsm/kg.
In specifc embodiments, the osmolarity of a liquid formulation of the invention preferably
has an osmolality of approximately 125 to 500 mOsm/kg, more preferably of approximately
275 to 325 mOsm/kg, for example as measured by the freezing point depression method.
[0203] It is especially advantageous to formulate parenteral compositions, such as compositions
that can be made into the liquid formulations of the invention, in dosage unit form
for ease of administration and uniformity of dosage. Dosage unit form as used herein
refers to physically discrete units suited as unitary dosages for the subject to be
treated; each unit containing a predetermined quantity of mature elastase protein
calculated to produce the desired therapeutic effect in association with the required
pharmaceutical carrier.
[0204] As defined herein, a therapeutically effective amount of mature elastase protein
(i.e., an effective dosage) ranges from about 0.0033 mg - 200 mg. For vessels with
smaller diameter and thinner walls, such as those in a radiocephalic arteriovenous
fistula, smaller doses (such as of 0.0033 mg - 2.0 mg) are preferable. For vessels
with a larger diameter and thicker walls such as femoral arteries, larger doses (such
as 2.05 - 100 mg) are preferable.
[0205] In certain embodiments, the pharmaceutical compositions can be included in a container,
pack, dispenser, or catheter. In still other embodiments, the pharmaceutical compositions
can be included in a container, pack, dispenser, or catheter together with instructions
for administration. Instructions for administration can be included in printed form
either within or upon a container, pack, dispenser, or catheter. Alternatively, instructions
for administration can be included either within or upon a container, pack, dispenser,
or catheter in the form of a reference to another printed or internet accessible document
that provides the instructions.
[0206] In certain embodiments, the pharmaceutical compositions can be included in a container,
pack, or dispenser. In still other embodiments, the pharmaceutical compositions can
be included in a container, pack, or dispenser together with instructions for administration.
Instructions for administration can be included in printed form either within or upon
a container, pack, or dispenser. Alternatively, instructions for administration can
be included either within or upon a container, pack, or dispenser in the form of a
reference to another printed or internet accessable document that provides the instructions.
[0207] The invention includes methods for preparing pharmaceutical compositions. Once a
mature elastase is produced according to the invention, it can be lyophilized and
stored until it is reconstituted into a pharmaceutical formulation suitable for administration.
In an exemplary embodiment, the present invention provides a method of isolating a
lyophilized mature human type I elastase comprising: (a) culturing a host cell, such
as a
Pichia pastoris host cell, engineered to express a nucleic acid molecule encoding a preproelastase
open reading frame under conditions in which the open reading frame is expressed,
wherein said open reading frame comprises nucleotide sequences encoding, in a 5' to
3' direction (i) a signal peptide operable in
Pichia pastoris; (ii) an activation sequence comprising an elastase recognition sequence; and (iii)
the sequence of a mature type I elastase protein, thereby producing a proelastase
protein; (b) subjecting the proelastase protein to autoactivation conditions, thereby
producing a mature type I elastase, wherein the autoactivation conditions include,
for example: (i) changing the pH of a solution containing the proelastase protein,
e.
g., to a pH of 6.5-11, preferably 8-9; or (ii) purifying the proelastase protein, for
example, by ion exchange chromatography, and subjecting the solution extended conversion
to remove N-terminal variants, thereby producing mature human type I elastase; (c)
optionally, purifying the mature human type I elastase,
e.
g., ion exchange chromatography step for polish chromatography; and (d) lyophilizing
the mature type I elastase, thereby isolating a lyophilized mature human type I elastase.
The mature type I elastase is preferably a human type I elastase. In certain aspects,
the lyophilized mature type I elastase is preferably more than 95% pure; in specific
embodiments, the lyophilized mature type I elastase is more than 98% or more than
99% pure.
[0208] The mature elastase proteins of the invention can be formulated into pharmaceutical
compositions. Thus, in an exemplary embodiments, the present invention provides a
method of generating a pharmaceutical composition comprising a mature human type I
elastase, said method comprising (i) isolating a lyophilized mature human type I elastase
according to the methods described above (
e.g., in Section 5.4); and (ii) reconstituting the lyophilized mature human type I
elastase in a pharmaceutically acceptable carrier.
5.6 EFFECTIVE DOSE
[0209] The present invention generally provides the benefit of parenteral, preferably local,
administration of recombinant elastase proteins, alone or in combination with other
agents, for treating or preventing disease in biological conduits.
[0210] In certain embodiments, as an alternative to parenteral administration, oral administration
of agents for treating or preventing disease in biological conduits may be used.
[0211] Toxicity and therapeutic efficacy of the elastase proteins utilized in the practice
of the methods of the invention can be determined by standard pharmaceutical procedures
in cell cultures or experimental animals, e.g., for determining the LD50 (the dose
lethal to 50% of the population) and the ED50 (the dose therapeutically effective
in 50% of the population). The dose ratio between toxic and therapeutic effects is
the therapeutic index and it can be expressed as the ratio LD50/ED50. Such information
can be used to more accurately determine useful doses in humans.
5.7 METHODS OF ADMINISTRATION
[0212] The invention relates to pharmaceutical compositions comprising novel elastase proteins
and methods of use thereof for preventing or treating disease in biological conduits.
Such pharmaceutical compositions can be formulated in a conventional manner as described
in Section 5.5 above.
[0213] The elastase compositions of the present invention can be administered to the desired
segment of the biological conduit being treated by a device known to one of skill
in the art to be acceptable for delivery of solutions to the wall of an artery or
vein,
e.
g., a syringe, a drug delivery catheter, a drug delivery needle, an implanted drug
delivery polymer, such as a sheet or microsphere preparation, an implantable catheter,
or a polymer-coated vascular stent, preferably a self-expanding stent.
[0214] In certain embodiments, the administration to the desired segment may be guided by
direct visualization, ultrasound, CT, fluoroscopic guidance, MRI or endoscopic guidance.
[0215] In certain aspects of the present invention, administration of an elastase to a biological
conduit comprises applying a liquid formulation of elastase directly to the external
adventitial surface of a surgically exposed artery or vein. In specific aspects of
this invention, the administration is performed with a syringe.
[0216] In certain aspects of the present invention, administration of an elastase to a biological
conduit comprises localizing a delivery apparatus in close proximity to the segment
of the biological conduit to be treated. In some embodiments, during delivery of the
elastase protein by a delivery apparatus, a portion of the delivery apparatus can
be inserted into the wall of the biological conduit. In some embodiments, the lumen
of the biological conduit can be pressurized while the elastase protein is delivered
to the pressurized segment of the biological conduit. In some embodiments, the lumen
of the biological conduit is pressurized by mechanical action. In some embodiments,
the lumen of the biological conduit is pressurized with a balloon catheter. In some
embodiments, pressure is applied to the inner wall of the biological conduit by a
self-expanding member which is part of a catheter or device. In some embodiments,
the elastase protein is administered and the pressurizing is performed by the same
device. In some embodiments, the biological conduit is surgically exposed and the
elastase protein is delivered into the lumen or is applied to the external surface
of the biological conduit
in vivo. In embodiments involving luminal delivery, blood flow through the vessel may be stopped
with a clamp or to allow the elastase to contact the vessel wall for longer time periods
and to prevent inhibition of the elastase by serum. In some embodiments, the biological
conduit is surgically removed and the elastase is delivered to the luminal surface
and/or to the external surface of the conduit
in vitro. The treated conduit may then, in certain embodiments, be returned to the body.
[0217] In other aspects of the present invention, administration of an elastase to a biological
conduit entails the use of a polymer formulation that is placed as a stent within
the vessel to be treated, a clamp or strip applied to the external surface of the
biological conduit, or a wrap on or around the vessel to be treated, or other device
in, around or near the vessel to be treated.
[0218] In yet other aspects of the present invention, an elastase is percutaneously injected
into a tissue region for purpose of dilating arteries and/or vein within that region,
including collateral arteries. In other aspects, an elastase is percutaneously injected
directly into the wall of an artery or vein or into the surrounding tissues for the
purpose of dilating a specific segment of vessel. In embodiments aimed at treatment
of heart vessels, an elastase protein can be either percutaneously delivered to the
pericardial space or directly applied to surgically exposed coronary vessels.
[0219] Medical devices that can be used to administer the elastase proteins of the invention
to blood vessels are described in Section 5.9 below.
5.8 KITS
[0220] The present invention provides kits for practicing the methods of the present invention.
A "therapeutic" kit of the invention comprises in one or more containers one or more
of the agents described herein as useful for treating or preventing disease in biological
conduits, optionally together with any agents that facilitate their delivery. An alternative
kit of the invention, the "manufacturing" kit, comprises in one or more containers
one or more of the agents described herein as useful for making recombinant elastase
proteins.
[0221] The therapeutic kit of the invention may optionally comprise additional components
useful for performing the methods of the invention. By way of example, the therapeutic
kit may comprise pharmaceutical carriers useful for formulating the agents of the
invention. The therapeutic kit may also comprise a device or a component of a device
for performing the therapeutic methods of the invention, for example a syringe or
needle. The inclusion of devices such as an intramural or perivascular injection catheters
or intraluminal injection catheters in the therapeutic kits is also contemplated.
In certain embodiments, the agents of the invention can be provided in unit dose form.
In addition or in the alternative, the kits of the invention may provide an instructional
material which describes performance of one or more methods of the invention, or a
notice in the form prescribed by a governmental agency regulating the manufacture,
use or sale of pharmaceuticals or biological products, which notice reflects approval
by the agency of manufacture, use or sale for human administration. Instructional
materials can be included in printed form either within or upon one or more containers
of the kit. Alternatively, instructional materials can be included either within or
upon one or more containers of the kit in the form of a reference to another printed
or internet accessable document that provides the instructional materials.
[0222] In specific embodiments, a kit of the invention comprises a medical device as described
in Section 5.9 below.
[0223] The manufacturing kit of the invention may optionally comprise additional components
useful for performing the methods of the invention.
5.9 MEDICAL DEVICES USEFUL FOR ADMINISTRATION OF ELASTASE PROTEINS
[0224] Provided herein are medical devices that can be used to administer the elastase proteins
of the present invention to a biological conduit, such as an artery or vein. Such
devices are described below and in provisional application no.
61/025,084, filed January 31, 2008, provisional application no.
61/025,463, filed February 1, 2008, and provisional application no.
61/075,710, filed June 25, 2008, each of which is incorporated by reference herein in its entirety. The elastase
proteins of the present invention can also be administered to biological conduits
via conventional catheters.
[0225] In one embodiment, a medical device useful for administration of elastase proteins
has a central longitudinal axis, and comprises one or more actuators, wherein the
one or more actuators can exist in a constrained configuration in which a length of
said one or more actuators is oriented substantially parallel to the longitudinal
axis of said medical device and an unconstrained configuration in which at least a
portion of the length of said one or more actuators is oriented substantially non-parallel
to the device's central longitudinal axis. After the device is positioned at a target
site adjacent to the wall of a biological conduit, one or more actuators (and if desired,
all of the actuators) may be released from a constrained configuration and permitted
to adopt an unconstrained configuration, thereby making contact with the wall of the
biological conduit. The one or more actuators may be of any shape, and in preferred
embodiments, the movement of the one or more actuators from the constrained configuration
to the unconstrained configuration occurs upon release of a constraining force by
the device operator but without the input by the operator of any deforming forces
to the device or the target tissue.
[0226] In a first specific embodiment, shown in Figure 22, the device is a fluid delivery
catheter 10 comprising one or more actuators that are formed as a pair of elongate
splines 12, 14, the intermediate regions of which are movable between a constrained
configuration which is oriented substantially parallel to the central longitudinal
axis 15 of the catheter assembly and an unconstrained configuration in which at least
a portion of the pair of splines is oriented substantially non-parallel to said central
longitudinal axis (see the left L and right R portions of the spline lengths in Figure
23). The one or more splines 12, 14 may be constructed as elongate bands or wires
that each have opposite proximal and distal ends. In a preferred embodiment, the splines
have flat, opposing interior surfaces 24, 26, and flat opposite facing exterior surfaces
28, 30. In this embodiment, the splines 12, 14 can translate between constrained positions
and unconstrained positions, as shown respectively in Figures 22 and 23. In one embodiment,
the pair of splines is positioned back-to-back in their constrained configurations
as shown in Figure 22.
[0227] The catheter 10 further comprises one or more tissue penetrators 16, 18 secured to
one or more surfaces of the one or more splines 12, 14, a central catheter component
20 having an elongate length, and an exterior catheter component 22 that can shield
the tissue penetrator or penetrators during catheter movement within the biological
conduit.
[0228] The tissue penetrators 16, 18 may be constructed of any suitable material. Preferred
examples of such materials include, but are not limited to, nickel, aluminum, steel
and alloys thereof. In a specific embodiment, the tissue penetrators are constructed
of nitinol.
[0229] The central catheter component 20 and the exterior catheter component 22 may be constructed
of materials typically employed in constructing catheters. Examples of such materials
include, but are not limited to, silicone, polyurethane, nylon, Dacron, and PEBAX
™.
[0230] The actuators are preferably constructed of a flexible, resilient material. In a
preferred embodiment, the flexible, resilient material is capable of being constrained
upon the application of a constraining force,
e.
g., when the actuators are in the constrained configuration, and adopts its original
unconstrained shape when the constraining force is removed,
e.
g., when the actuators are in the unconstrained configuration. Any such flexible, resilient
material can be used, including but not limited to surgical steel, aluminum, polypropylene,
olefinic materials, polyurethane and other synthetic rubber or plastic materials.
The one or more actuators are most preferably constructed of a shape memory material.
Examples of such shape memory materials include, but are not limited to, copper-zinc-aluminum-nickel
alloys, copper-aluminum-nickel alloys, and nickel-titanium (NiTi) alloys. In a preferred
embodiment, the shape memory material is nitinol. In a preferred embodiment, when
the pair of splines assumes the unconstrained configuration, the shape memory properties
of the material from which each spline is formed cause the splines, without the application
of any external deforming force, to bow radially away from each other in a single
plane as shown in Figure 23.
[0231] One or more of the splines (and preferably each of the splines) has a flexible fluid
delivery conduit 32, 34 that extends along the length of the spline, or within the
spline, as shown in Figure 24. As the splines 12, 14 move from their straight, constrained
configurations to their bowed, unconstrained configurations, the fluid delivery conduits
32, 34 also move from straight configurations to bowed configurations. In one embodiment,
the fluid delivery conduits 32, 34 are separate tubular conduits that are secured
along the lengths of the pair of splines 12, 14. In another embodiment, the fluid
delivery conduits are conduits formed into or within the material of the splines.
[0232] One or more of the splines (and preferably each of the splines 12,14) is also formed
with a zipper rail 36, 38 that extends along a length of the spline (Figure 24). The
zipper rails 36, 38 are formed of either the same material as the splines 12, 14,
or a material that flexes with the splines 12, 14.
[0233] One or more of the tissue penetrators 16, 18 is secured to the exterior surfaces
28, 30 of the pair of splines 12, 14 (Figure 24). The tissue penetrators 16, 18 are
connected to and communicate with the fluid delivery conduits 32, 34 that extend along
the lengths of the splines 12, 14. The tissue penetrators 16, 18 are positioned to
project substantially perpendicular from the exterior surfaces 28, 30 of the splines
12, 14. The tissue penetrators 16, 18 have hollow interior bores that communicate
with the fluid delivery conduits 32, 34 of the splines. The distal ends of the tissue
penetrators have fluid delivery ports that communicate with the interior bores of
the tissue penetrators.
[0234] The device permits delivery of fluids into or through one or more distinct layers
of a wall of a biological conduit, for example a vascular wall. The vascular wall
comprises numerous structures and layers, including the endothelial layer and basement
membrane layer (collectively the intimal layer), the internal elastic lamina, the
medial layer, and the adventitial layer. These layers are arranged such that the endothelium
is exposed to the lumen of the vessel and the basement membrane, the internal elastic
lamina, the media, and the adventitia are each successively layered over the endothelium,
as described in
U.S. Pat. App. Publication No. 2006/0189941A1. With the medical devices of the present invention, the depth to which the tissue
penetrators 16, 18 can penetrate is determined by the length of each tissue penetrator
16, 18. For example, if the target layer is the adventitial layer, tissue penetrators
16, 18 having a defmed length sufficient for penetration to the depth of the adventitial
layer upon deployment of the device are used. Likewise, if the target layer is the
medial layer, tissue penetrators 16, 18 having a defined length sufficient for penetration
to the depth of the medial layer upon deployment of the device are used.
[0235] In specific embodiments, the length of tissue penetrators 16, 18 may range from about
0.3 mm to about 5 mm for vascular applications, or up to about 20 mm or even 30 mm
for applications involving other biological spaces or conduits, for example in colonic
applications. Tissue penetrators 16, 18 preferably have a diameter of about 0.2 mm
(33 gauge) to about 3.4 mm (10 gauge), more preferably 0.2 mm to 1.3 mm (about 33
to 21 gauge). The distal tips of the tissue penetrators may have a standard bevel,
a short bevel, or a true short bevel. In an alternative embodiment, the tissue penetrators
attached to any one spline are not of identical lengths, but may be configured such
that their distal ends align so as to be equidistant from the wall of the biological
conduit when the medical device is in the unconstrained position, e.g., during use.
[0236] The central catheter component 20 has an elongate length with opposite proximal and
distal ends, shown to the left and right respectively in Figure 22. In one embodiment,
the central catheter component 20 has a cylindrical exterior surface that extends
along its elongate length. The proximal ends of the splines 12, 14 are attached e.g.,
soldered or glued, to the distal end of the central catheter component 20, while the
distal ends of the splines 12, 14 are attached, e.g., soldered or glued, to a catheter
guide tip 40. The tip 40 has a smooth exterior surface that is designed to move easily
in the biological conduit. A guide wire bore 48 extends through the length of the
central catheter 20 and tip 40. The guide wire bore is dimensioned to receive a guide
wire in sliding engagement through the bore.
[0237] A pair of fluid delivery lumens 44, 46 extends through the interior of the central
catheter component 20 for the entire length of the catheter component (Figure 25).
At the distal end of the central catheter component 20 the pair of fluid delivery
lumens 44, 46 communicates with the pair of fluid delivery conduits 32, 34 that extend
along the lengths of the splines 12, 14 to the tissue penetrators 16, 18. A guide
wire bore 48 also extends through the interior of the central catheter component 20
from the proximal end to the distal end of the central catheter component (Figure
25). The proximal end of the central catheter component 20 is provided with a pair
of Luer hubs 50, 52 (Figure 22). In one embodiment, each Luer hub 50, 52 communicates
with one of the fluid delivery lumens 44, 46 extending through the length of the central
catheter. Each Luer hub 50, 52 is designed to be connected with a fluid delivery source
to communicate a fluid through each Luer hub 50, 52, then through each fluid delivery
lumen 44, 46 extending through the central catheter component 20, then through each
fluid delivery conduit 32, 34 extending along the lengths of the pair of splines 12,
14, and then through the tissue penetrators 16, 18 secured to each of the pair of
splines. In another embodiment, each Luer hub 50, 52 independently communicates with
both of the fluid delivery lumens 44, 46 extending through the length of the central
catheter component. In this configuration, a first fluid can be delivered through
a first Luer hub to both tissue penetrators 16, 18 and a second fluid can be delivered
through a second Luer hub to both tissue penetrators 16, 18. Delivery of fluid to
both tissue penetrators from each Luer hub can be achieved by an independent conduit
extending from each Luer hub to a distal common reservoir 61 as shown in Figure 32.
This reservoir communicates with both tissue penetrators 16, 18. Alternatively, in
another embodiment, the medical device of the instant invention comprises only a single
Luer hub connected to a single fluid delivery lumen extending through the central
catheter, which then is attached to a distal common reservoir, permitting the delivery
of a single fluid to both tissue penetrators 16, 18.
[0238] The exterior catheter component 22 has a tubular configuration that surrounds the
pair of splines 12, 14 and a majority of the central catheter 20 (Figure 22). The
catheter component 22 has an elongate length that extends between opposite proximal
and distal ends of the catheter component shown to the left and right, respectively
in Figure 22. The catheter component distal end is dimensioned to engage in a secure
engagement with the guide tip 40, where the exterior surface of the tip 40 merges
with the exterior surface of the catheter component 22 when the catheter component
distal end is engaged with the tip. The tubular configuration of the catheter component
22 is dimensioned so that an interior surface of the catheter component 22 is spaced
outwardly of the plurality of tissue penetrators 16, 18 on the pair of splines 12,
14 in the constrained positions of the pair of splines. The proximal end of the central
catheter 20 extends beyond the proximal end of the catheter component 22 when the
catheter component distal end engages with the catheter guide tip 40.
[0239] A mechanical connection 54 is provided between the exterior catheter component 22
proximal end and the central catheter component 20 proximal end that enables the exterior
catheter component to be moved rearwardly along the lengths of the pair of splines
12, 14 and the central catheter component 20 causing the exterior catheter component
22 distal end to separate from the guide tip 40 and pass over the pair of splines
12, 14, and forwardly over the length of the central catheter component 20 and over
the lengths of the pair of splines 12, 14 to engage the exterior catheter component
22 distal end with the tip 40 (Figure 22). The mechanical connection 54 could be provided
by a handle or button that manually slides the exterior catheter component 22 over
the central catheter component 20. The connection 54 could also be provided by a thumbwheel
or trigger mechanism. In addition, the connection 54 could be provided with an audible
or tactile indicator (such as clicking) of the incremental movement of the exterior
catheter component 22 relative to the central catheter component 20.
[0240] In one embodiment, the exterior catheter component 22 is provided with a single zipper
track 56 that extends along the entire length of one side of the exterior catheter
component 22 on the interior surface of the exterior catheter component (Figure 24).
The zipper track 56 in the interior of the exterior catheter component 22 engages
in a sliding engagement with the zipper rails 36, 38 at one side of each of the splines
12, 14. Advancing the exterior catheter component 22 forwardly along the lengths of
the central catheter component 20 and the pair of splines 12, 14 toward the guide
tip 40 of the catheter assembly causes the zipper track 56 of the exterior catheter
component to slide along the rails 36, 38 of the pair of splines 12, 14. This moves
the pair of splines 12, 14 from their bowed, unconstrained configuration shown in
Figure 23 toward their back-to-back, constrained configuration shown in Figure 22.
The engagement of the spline rails 36, 38 in the zipper track 56 of the exterior catheter
component 22 holds the pair of splines 12, 14 in their back-to-back relative positions
shown in Figure 22. With the exterior catheter component 22 pushed forward over the
central catheter component 20 and the pair of splines 12, 14 to where the distal end
of the exterior catheter component 22 engages with the guide tip 40, the tissue penetrators
16, 18 are covered and the catheter assembly of the present invention can be safely
moved forward or backward in a biological conduit. The exterior catheter component
22 covers the tissue penetrators 16, 18 projecting from the pair of splines 12, 14
and the engagement of the exterior catheter component 22 with the distal guide tip
40 provides the catheter assembly with a smooth exterior surface that facilitates
the insertion of the catheter assembly into and through a biological conduit such
as a blood vessel. In another embodiment, the exterior catheter component 22 is provided
with two zipper tracks at 180 degrees from each other that extend along the entire
length of the exterior catheter component 22 on the interior surface and the splines
have rails on both sides.
[0241] A guide wire 58 is used with the catheter assembly (Figure 22). The guide wire 58
extends through the central catheter component guide wire bore 48, along the splines
12, 14, and through the guide tip outlet 42. In certain embodiments, the guide wire
58 has a solid core,
e.
g., stainless steel or superelastic nitinol. The guide wire may be constructed of radiopaque
material, either in its entirety or at its distal portions (e.g., the most distal
1 mm to 25 mm or the most distal 3 mm to 10 mm). The guide wire 58 may optionally
be coated with a medically inert coating such as TEFLON®.
[0242] In use of this device, the guide wire 58 is positioned in the biological conduit
by methods well known in the art. The guide wire 58 extends from the biological conduit,
through the guide wire outlet 42 in the tip 40 of the assembly, through the exterior
shielding catheter 22 past the tissue penetrators 16, 18, and through the guide wire
bore 48 of the central catheter 20. In other embodiments, the catheter assembly is
a rapid-exchange catheter assembly, wherein the guide wire lumen is present in the
distal end of the guide tip 40 of the catheter, but does not extend throughout the
entire length of the medical device.
[0243] After positioning of the guide wire, the device is advanced into the biological conduit
along the previously positioned guide wire 58. One or more radiopaque markers may
optionally be provided on the device to monitor the position of the device in the
biological conduit. Any material that prevents passage of electromagnetic radiation
is considered radiopaque and could be used. Preferred radiopaque materials include,
but are not limited to, platinum, gold, or silver. The radiopaque material can be
coated on the surface of all or a part of the tip 40, on all or part of the splines
12, 14 or other actuators, on the guide wire 58, or on some combination of the foregoing
strucutres. Alternatively, a ring of radiopaque material can be attached to the tip
40. The device may optionally be provided with onboard imaging, such as intravascular
ultrasound or optical coherence tomography. The tip of the device may optionally be
provided with optics that are used to determine the position of the device or characteristics
of the surrounding biological conduit.
[0244] When the device is at its desired position in the biological conduit, the operator
uses mechanical connection 54 to retract the exterior catheter component 22 rearwardly
away from the guide tip 40. In a preferred embodiment, as the exterior catheter component
22 is withdrawn from over the tissue penetrators 16, 18, the zipper track 56 of the
exterior catheter component 22 is withdrawn over the rails 36, 38 of the pair of splines
12, 14. This movement releases the pair of splines 12, 14 from their constrained,
back-to-back configuration shown in Figure 22, and allows the shape memory material
of the splines 12, 14 to adopt their unconstrained, bowed configurations shown in
Figure 23. As the splines 12, 14 move to their unconstrained, bowed configurations,
the splines come into contact with the inner surface of the wall(s) of the biological
conduit and the tissue penetrators 16, 18 on the exterior surfaces 28, 30 of the splines
12, 14 are pressed into the interior surface of the biological conduit at the position
of the device.
[0245] After the tissue penetrators 16, 18 have entered the desired layer of the wall of
a biological conduit, a fluid can be delivered through the fluid delivery lumens 44,
46 in the central catheter component 20, through the fluid delivery conduits 32, 34
on the pair of splines 12, 14, and through the tissue penetrators 16, 18. When the
delivery of the fluid is complete, the operator uses the mechanical connection 54
to move the exterior catheter component 22 (which may also be referred to as a shielding
component) forward over the central catheter component 20 and over the pair of splines
12, 14 toward the guide tip 40. As the exterior catheter component 22 moves forward
over the pair of splines 12, 14, the zipper track 56 on the interior of the exterior
catheter component 22 passes over the rails 36, 38 on the pair of splines 12, 14,
causing the splines 12, 14 to move from their unconstrained, bowed configuration back
to their constrained configuration. When the exterior catheter component 22 has been
entirely advanced over the pair splines 12, 14 and again engages with the guide tip
40, the zipper track 56 in the exterior catheter component 22 holds the splines 12,
14 in their constrained configuration. The device then can be repositioned for release
at another location in the biological conduit or another biological conduit, or withdrawn
from the body.
[0246] The shape and length of the splines 12, 14 are selected such that various embodiments
of the device can be used in biological spaces or conduits of various sizes or diameters.
In certain embodiments, the splines may be flat or rounded. Flat splines preferably
have a width ranging from about 0.2 mm to about 20 mm, a height ranging from about
0.2 mm to about 5 mm, and a length ranging from about 10 mm to about 200 mm, depending
on the particular application. Rounded splines preferably have a diameter ranging
from about 0.2 mm to about 20 mm and a length ranging from about 10 mm to about 200
mm, depending on the particular application. In specific embodiments, flat splines
are 3.5 mm to 5 mm, 5 mm to 10 mm, 10 mm to 15 mm, 15 mm to 20 mm in width, or any
range therewithin (
e.
g., 3.5 mm to 10 mm); 3.5 mm to 5 mm, 5 mm to 10 mm. 10 mm to 15 mm, 15 mm to 20 mm
in height, or any range therewithin (
e.
g., 3.5 mm to 10 mm); and 10 mm to 20 mm, 20 mm to 40 mm, 40 mm to 80 mm, 80 mm to
120 mm, 120 mm to 150 mm or 150 to 200 mm in length, or any range therewithin (
e.
g., 10 mm to 40 mm), or any permutation of the foregoing (
e.
g., a width of 5 mm to 10 mm, a height or 3.5 to 5 mm, and a length of 20 to 40 mm).
In other embodiments, rounded splines are 3.5 mm to 5 mm, 5 mm to 10 mm, 10 mm to
15 mm, 15 mm to 20 mm in diameter, or any range therewithin (
e.
g., 3.5 mm to 10 mm) and 10 mm to 20 mm, 20 mm to 40 mm, 40 mm to 80 mm, 80 mm to 120
mm, 120 mm to 150 mm or 150 to 200 mm in length, or any range therewithin (
e.
g., 10 mm to 40 mm), or any permutation of the foregoing (
e.
g., a diameter of 5 mm to 10 mm and a length of 20 to 40 mm).
[0247] In a second specific embodiment, shown in Figure 27, the device of the present invention
is a fluid delivery catheter 110 comprising a central catheter component 112 having
an elongate length with a longitudinal axis 113, one or more (and preferably two)
flexible, resilient actuators that, in this specific embodiment, are formed as tissue
penetrator presentation tubes 114, 116 that extend from the distal portion of the
central catheter component 112. At least a portion of the tissue presentation tubes
114, 116 are movable between a constrained configuration which is oriented substantially
parallel to the central longitudinal axis 113 of the catheter assembly and an unconstrained
configuration which is oriented substantially non-parallel to the central longitudinal
axis 113 of the catheter.
[0248] The catheter further comprises one or more (and preferably two) flexible, elongate
tissue penetrators 118, 120 that extend through the two tissue penetrator presentation
tubes 114, 116, and an exterior deployment tube 122 that extends over portions of
the lengths of the central catheter component 112, the tissue penetrator presentation
tubes 114, 116, and the middle rail 132.
[0249] The central catheter component 112 and the exterior deployment tube 122 may be constructed
of any materials suitable for constructing catheters. Examples of such materials include,
but are not limited to, silicone, polyurethane, nylon, Dacron, and PEBAX
™.
[0250] The tissue penetrators 118, 120 connect to respective hubs 166, 168 (Figure 31).
One or more of the pair of tissue penetrators 118, 120 preferably has a diameter of
about 0.2 mm (33 gauge) to about 3.4 mm (10 gauge), more preferably 0.8 mm to 1.3
mm (about 18 to 21 gauge). One or more of the pair of tissue penetrators may have
a standard bevel, a short bevel or a true short bevel. The pair of tissue penetrators
118, 120 are preferably constructed of materials that allow the tissue penetrators
to flex along their lengths. Examples of such materials include, but are not limited
to, nickel, aluminum, steel and alloys thereof. In a specific embodiment, the tissue
penetrators are constructed of nitinol. The full length of the tissue penetrators
118, 120 can be constructed of a single material, or the distal ends (
e.
g., the distal 1 mm to the distal 20 mm), including the tips 156, 158, of the tissue
penetrators 118, 120 may be constructed of one material and connected to the respective
hubs 166, 168 via a tubing constructed of a different material,
e.
g., plastic.
[0251] One or more of the pair of tissue penetrator presentation tubes 114, 116 is preferably
constructed of a flexible, resilient material. Such flexible, resilient material can
be deformed,
e.
g., when the tissue penetrator presentation tubes 114, 116 are in the straight, constrained
configuration of Figure 27, but returns to its original shape when the deformation
force is removed,
e.
g., when the tissue penetrator presentation tubes 114, 116 are in the curved, unconstrained
configuration shown in Figure 28. Any such flexible, resilient material can be used,
including but not limited to surgical steel, aluminum, polypropylene, olefmic materials,
polyurethane and other synthetic rubber or plastic materials. The pair of tissue penetrator
presentation tubes 114, 116 is most preferably constructed of a shape memory material.
Examples of such shape memory materials include, but are not limited to, copper-zinc-aluminum-nickel
alloys, copper-aluminum-nickel alloys, and nickel-titanium (NiTi) alloys. In a preferred
embodiment, the shape memory material is nitinol.
[0252] The central catheter component 112 has a flexible elongate length with opposite proximal
124 and distal 126 ends (Figure 27). The distal end 126 of the central catheter component
is formed as a guide tip that has an exterior shape configuration that will guide
the distal end 126 through a biological conduit. A guide wire bore 128 within middle
rail 132 extends through the center of the central catheter 112 from the proximal
end 124 to the distal end 126. The guide wire bore 128 receives a flexible, elongate
guide wire 130 for sliding movement of the bore 128 over the wire (Figure 29). The
guide wire 130 is used to guide the catheter assembly through a biological conduit.
In certain embodiments, the guide wire 130 has a solid core,
e.
g., stainless steel or superelastic nitinol. The guide wire may optionally be constructed
of radiopaque material, either in its entirety or at its distal portions (
e.
g., the most distal 1 mm to 25 mm or the most distal 1 mm to 3 mm). The guide wire
130 may optionally be coated with a medically inert coating such as TEFLON@. In other
embodiments, the catheter assembly is a rapid-exchange catheter assembly wherein a
guide wire is positioned on the distal end of the guide tip 126 and extends therefrom.
[0253] A narrow middle rail 132 surrounding the guide wire bore 128 extends from the guide
tip of the catheter distal end 126 toward the catheter proximal end 124. The middle
rail 132 connects the guide tip 126 to a base portion 138 of the central catheter
component.
[0254] The central catheter component base portion 138 has a cylindrical exterior surface
that extends along the entire length of the base portion. The base portion 138 extends
along a majority of the overall length of the central catheter component 112. As shown
in Figure 29, the guide wire bore 128 extends through the center of the central catheter
component base portion 138. In addition, a pair of tissue penetrator lumens 140, 142
also extend through the length of the central catheter component base portion 138
alongside the guide wire bore 128. At the proximal end 124 of the central catheter
component, a pair of ports 144, 146 communicate the pair of lumens 140, 142 with the
exterior of the central catheter component 112 (Figure 27).
[0255] In an alternative embodiment, the medical device of Figure 27 also may comprise a
single flexible, resilient actuator that is formed as a tissue penetrator presentation
tube, a single flexible, elongate tissue penetrator that extends through the tissue
penetrator presentation tube and connects to a hub, and an exterior deployment tube
that extends over portions of the lengths of the central catheter component, the tissue
penetrator presentation tube, and the middle rail.
[0256] The pair of first and second tissue penetrator presentation tubes 114, 116 project
from the catheter central component base portion 138 toward the catheter distal end
126. Each of the tissue penetrator presentation tubes is formed as a narrow, elongate
tube having a proximal end that is secured to the central catheter component base
portion 138, and an opposite distal end 148, 150. Each of the first and second tissue
penetrator presentation tubes 114, 116 has an interior bore 152, 154 that communicates
with the respective first tissue penetrator lumen 140 and second tissue penetrator
lumen 142 in the central catheter component base portion 138.
[0257] As shown in Figures 29 and 30, the exterior configurations of the tissue penetrator
presentation tubes 114, 116 are matched to the middle rail 132 so that the lengths
of the tissue penetrator presentation tubes 114, 116 may be positioned side-by-side
on opposite sides of the middle rail 132. The tissue penetrator tube distal ends 148,
150 can be formed as guide tip surfaces that also facilitate the passage of the catheter
through a vascular system. The tissue penetrator tube distal ends 148, 150 are preferably
larger in diameter than the tissue penetrator presentation tubes 114, 116. In a specific
embodiment, the tissue penetrator tube distal tips 148, 150 are rounded and bulbous
tips. Such tips are atraumatic and the tubes will not inadvertently puncture the wall
of a biological conduit. The tips 148, 150 are exposed and do not extend outwardly
beyond the diameter of the guide tip 126.
[0258] Each of the tissue penetrator tubes 114, 116 is preferably constructed of a shape
memory material, such as nitinol. The tubes 114, 116 are formed with curved, unconstrained
configurations shown in Figure 28. The tubes 114, 116 move to the curved, unconstrained
configurations shown in Figure 28 when no constraining force is applied against the
tubes. In order for the presentation tubes 114, 116 to lie in straight, constrained
configurations along the middle rail 132, a constraining force must be applied to
the tubes to keep them in their straight, constrained positions shown in Figure 27.
As each of the tubes 114, 116 moves from its straight, constrained configuration shown
in Figure 28 to its curved, unconstrained configuration shown in Figure 28, the tissue
penetrator bores 152, 154 extending through the tubes also move from straight configurations
to curved configurations.
[0259] The pair of tissue penetrators 118, 120, from their distal tips to the hubs 166,
168, have lengths that are slightly longer than the combined lengths of the tissue
penetrator lumens 140, 142 extending through the central catheter base portion 138
and the tissue penetrator bores 152, 154 extending through the tissue penetrator presentation
tubes 114, 116. The tips 156, 158 of the tissue penetrators 118, 120 are positioned
adjacent to the distal ends 148, 150 of the tissue penetrator presentation tubes 114,
116 and are positioned inside of the bores 152, 154 of the tubes in the constrained
configuration of Figure 27. The opposite, proximal ends of the tissue penetrators
118, 120 project out through the side ports 144, 146 of the central catheter 112.
The pair of tissue penetrators 118, 120 are dimensioned to easily slide through the
tissue penetrator lumens 140, 142 of the central catheter component 112 and the tissue
penetrator bores 152, 154 of the tissue penetrator presentation tubes 114, 116. The
side ports 144, 146 of the central catheter component 112 are preferably at 20° to
90° angles to the central catheter proximal end 124, most preferably at 30° to 60°
angles to the central catheter proximal end 124.
[0260] A pair of manual operator movement to linear movement controllers 162, 164 can be
connected to the proximal ends of the tissue penetrators 118, 120 and can be secured
to the central catheter ports 144, 146 (Figure 31). The controllers 162, 164 can be
constructed to convert operator movement into controlled linear movement of the tissue
penetrators 118, 120 through the central catheter tissue penetrator lumens 140, 142
and through the tissue penetrator presentation tube bores 152, 154. In one embodiment,
there are rotating controllers 162, 164 that can be manually moved in one direction,
such that the tissue penetrator injection tips 156, 158 at the tissue penetrator distal
ends can be adjustably positioned to extend a desired length out from the tissue penetrator
tube bores 152, 154 at the tissue penetrator tube distal ends 148, 150. By rotating
the controllers in the opposite direction, the tissue penetrators 118, 120 can be
retracted back into the tissue penetrator tube bores 152, 154. Each of the operator
movement to linear movement controllers 162, 164 can be provided with a hub 166, 168
that communicates with the interior bore extending through the tissue penetrators
118, 120 and can be used to connect a syringe or tubing containing a solution of a
diagnostic or therapeutic agent.
[0261] The exterior deployment tube 122 has a tubular length that surrounds the central
catheter 112, the tissue penetrator presentation tubes 114, 116, and the middle rail
132. The deployment tube 122 can be mounted on the central catheter component 112
and the pair of tissue penetrator presentation tubes 114, 116 for sliding movement
to a forward position of the deployment tube 122 where an open distal end 172 of the
deployment tube is positioned adjacent the distal ends 148, 150 of the tissue penetrator
presentation tubes 114, 116 as shown in Figure 27, and a rearward position of the
deployment tube 122 where the tube distal end 172 is positioned adjacent to the connection
of the tissue penetrator presentation tubes 114, 116 with the central catheter component
112 as shown in Figure 28. The opposite proximal end 174 of the deployment tube 122
can be provided with a mechanical connection 176 to the central catheter 112. The
mechanical connection 176 enables the deployment tube 122 to be moved between its
forward and rearward positions relative to the central catheter. 112 and the tissue
penetrator presentation tubes 114, 116 (Figures 27 and 28). Such a connection could
be provided by a thumbwheel, a sliding connection, a trigger or push button or some
other connection that is manually operable to cause the deployment tube 122 to move
relative to the central catheter 112 and the presentation tubes 114, 116. When the
deployment tube 122 is moved to its forward position shown in Figure 27, the tube
distal end 172 passes over the lengths of the tissue penetrator presentation tubes
114, 116 and moves the presentation tubes to their constrained positions extending
along the opposite sides of the central catheter middle rail 132. When the deployment
tube 122 is moved to its rearward position shown in Figure 28, the distal end 172
of the deployment tube is retracted from over the length of the tissue penetrator
presentation tubes 114, 116 and gradually allows the presentation tubes 114, 116 to
release their constrained energy and move to their curved, unconstrained configurations
shown in Figure 28.
[0262] In use of the catheter 110, the deployment tube 122 is in the forward position shown
in Figure 27. The guide wire 130 is positioned in a biological conduit (such as an
artery or vein) in a known manner. The catheter is then advanced into the biological
conduit over the guide wire. The guide wire 130 extends from the biological conduit,
and enters the central catheter component distal end 126 through the guide wire lumen
128. The wire 130 passes through the length of the central catheter 112 and emerges
at the proximal end of the central catheter component adjacent to the catheter ports
144, 146, where the guide wire 130 can be manually manipulated.
[0263] The catheter 110 can be advanced through the biological conduit and can be guided
by the guide wire 130. Radiopaque markers may optionally be provided on the assembly
to monitor the position of the assembly in the biological conduit. Any material that
prevents passage of electromagnetic radiation is considered radiopaque and may be
used. Useful radiopaque materials include, but are not limited to, platinum, gold,
or silver. The radiopaque material can be coated on the surface of all or a part of
the tip 126, on all or part of the presentation tubes 114, 116, on all or part of
the tissue penetrators 118, 120, on the guide wire 130, or on any combination of the
foregoing structures. Alternatively, a ring of radiopaque material can be attached
to the tip 126. The assembly may optionally be provided with onboard imaging, such
as intravascular ultrasound or optical coherence tomography. The tip of the assembly
may optionally be provided with optics that are useful for determining the position
of the assembly or the characteristics of the surrounding biological conduit. When
the assembly is at a desired position, the exterior deployment tube 122 can be moved
from its forward position shown in Figure 27 toward its rearward position shown in
Figure 28 by manual manipulation of the mechanical connection 176.
[0264] As the deployment tube 122 is withdrawn from over the pair of tissue penetrator presentation
tubes 114, 116, the constrained energy of the tissue penetrator presentation tubes
114, 116 is released and the tubes move toward their unconstrained, curved configurations
shown in Figure 28. This movement positions the tissue penetrator bores 152, 154 at
the tissue penetrator tube distal ends 148, 150 against the interior surfaces of the
biological conduit into which the assembly 110 has been inserted.
[0265] The operator movement to linear movement controllers 162, 164 then can be manually
operated to extend the tissue penetrator distal ends 156, 158 from the tissue penetrator
bores 152, 154 at the tissue penetrator presentation tube distal ends 148, 150. A
gauge may be provided on each of the operator movement to linear movement controllers
162, 164 that provides a visual indication of the extent of the projection of the
tissue penetrator tips 156, 158 from the tissue penetrator tube ends 148, 150 as the
controllers 162, 164 are rotated. The controllers also could provide an audible sound
or tactile feel such as clicking to indicate incremental distance steps of the tissue
penetrator movements. This deploys the tissue penetrator tips 156, 158 a desired distance
into the walls of the biological conduit.
[0266] In a third specific embodiment, a medical device of the instant invention is a fluid
delivery catheter comprising one or more tissue penetrators constructed of a flexible,
resilient material. In certain aspects, the medical device of the present invention
has a central longitudinal axis, and comprises one or more tissue penetrators, wherein
the one or more tissue penetrators can exist in a constrained configuration in which
a length of said one or more tissue penetrators is oriented substantially parallel
to the longitudinal axis of said medical device and an unconstrained configuration
in which at least a portion of the length of said one or more tissue penetrators is
oriented substantially non-parallel to the device's central longitudinal axis. After
the device is positioned at a target site adjacent to the wall of a biological conduit,
one or more tissue penetrators (and if desired, all of the tissue penetrators) may
be released from a constrained configuration and permitted to adopt an unconstrained
configuration, thereby making contact with the wall of the biological conduit. The
one or more tissue penetrators may be of any shape, and in preferred embodiments,
the movement of the one or more tissue penetrators from the constrained configuration
to the unconstrained configuration occurs upon release of a constraining force by
the device operator but without the input by the operator of any deforming forces
to the device or the target tissue.
[0267] In a preferred embodiment, tissue penetrators are constructed of flexible, resilient
material that is capable of being constrained upon the application of a constraining
force, e.g., when the tissue penetrators are in the constrained configuration, and
adopts its original unconstrained shape when the constraining force is removed,
e.g., when the tissue penetrators are in the unconstrained configuration. Any such flexible,
resilient material can be used, including but not limited to surgical steel, aluminum,
polypropylene, olefinic materials, polyurethane and other synthetic rubber or plastic
materials. The one or more tissue penetrators are most preferably constructed of a
shape memory material. Examples of such shape memory materials include, but are not
limited to, copper-zinc-aluminum-nickel alloys, copper-aluminum-nickel alloys, and
nickel-titanium (NiTi) alloys. In a preferred embodiment, the shape memory material
is nitinol. In a preferred embodiment, when the tissue penetrators assume the unconstrained
configuration, the shape memory properties of the material from which each tissue
penetrator is formed cause the tissue penetrators, without the application of any
external deforming force, to move from a position substantially parallel to the longitudinal
axis of the medical device to a position substantially perpendicular to the longitudinal
axis of the medical device.
[0268] In a preferred embodiment, the tissue penetrators are maintained in the constrained
configuration by an exterior catheter component having a tubular configuration that
surrounds the tissue penetrators. A mechanical connection is provided between the
exterior catheter component and the central catheter component to which the tissue
penetrators are attached. The mechanical connection enables the exterior catheter
component to be moved rearwardly along the length of the central catheter component,
thereby uncovering the constrained one or more tissue penetrators and permitting the
one or more tissue penetrators to assume an unconstrained configuration wherein they
make contact with the target delivery site. One of ordinary skill in the art would
appreciate that this specific embodiment may be readily adapted to incorporate radiopaque
markers to facilitate positioning of the device or rapid-exchange features to facilitate
the use of the device.
[0269] The medical device of the present invention, in its various embodiments, permits
delivery of fluids into distinct layers of a vascular wall. The vascular wall consists
of numerous structures and layers, structures and layers, including the endothelial
layer and the basement membrane layer (collectively the intimal layer), the internal
elastic lamina, the medial layer, and the adventitial layer. These layers are arranged
such that the endothelium is exposed to the lumen of the vessel and the basement membrane,
the intima, the internal elastic lamina, the media, and the adventitia are each successively
layered over the endothelium as described in
U.S. Pat. App. Publication No. 2006/0189941A1. With the medical devices of the present invention, the depth to which the tissue
penetrator tips 156, 158 can penetrate into the target tissue can be controlled by
rotating the controllers 162, 164. For example, if the target layer is the adventitial
layer, the constrained energy of the tubes 114, 116 is released, the tubes adopt their
unconstrained, curved configurations shown in Figure 28, and the tissue penetrator
tips 156, 158 are advanced with the controllers to a length sufficient for penetration
to the depth of the adventitial layer. Likewise, if the target layer is the medial
layer, the constrained energy of the tubes 114, 116 is released, the tubes adopt their
unconstrained, curved configurations shown in Figure 28, and the tissue penetrator
tips 156, 158 are advanced with the controllers to a length sufficient for penetration
to the depth of the medial layer.
[0270] With the tissue penetrators embedded in the desired layer of the wall of the biological
conduit, a fluid can then be delivered through the tissue penetrators 118, 120. When
the delivery of the fluid is complete, the controllers 162, 164 can be operated to
withdraw the tissue penetrator tips 156, 158 back into the interior bores 152, 154
of the tissue penetrator presentation tubes 114, 116. The deployment tube 122 can
then be moved to its forward position where the deployment tube distal end 172 moves
the tissue penetrator presentation tubes 114, 116 back to their constrained positions
shown in Figure 27. When the deployment tube 122 has been moved to its full forward
position shown in Figure 27, the assembly can then be repositioned or withdrawn from
the body.
[0271] The medical device of the instant invention also permits delivery of fluids to plaque
deposits on the inside of the wall of the biological conduit or within the wall of
the biological conduit.
[0272] The medical device of the instant invention also permits delivery of fluids to extracellular
spaces or tissues located outside of the outer wall of the biological conduit (e.g.,
to the exterior surface of a blood vessel or to muscle positioned against the outer
surface of vessel such as myocardium).
[0273] One advantageous feature of the devices of the present invention is that the actuators,
by virtue of their design, make contact with less than the complete circumference
of the inner wall of a biological conduit following their deployment therein. In preferred
embodiments, the actuators make contact with less than 100% of the circumference of
the inner wall of a biological conduit in which they are deployed. More preferably,
the actuators make contact with less than 75%, 50% or 25% of the circumference of
the inner wall of a biological conduit in which they are deployed. Most preferably,
the actuators make contact with less than 10%, 5%, 2.5%, 1%, 0.5% or 0.1 % of the
circumference of the inner wall of a biological conduit in which they are deployed.
[0274] The devices can be used to deliver fluids comprising a variety of therapeutic and/or
diagnostic agents to a wall of a biological conduit. Therapeutic agents include, but
are not limited to proteins, chemicals, small molecules, cells and nucleic acids.
A therapeutic agent delivered by the device may either comprise a microparticle or
a nanoparticle, be complexed with a microparticle or a nanoparticle, or be bound to
a microparticle or a nanoparticle. Protein agents include elastases, antiproliferative
agents, and agents that inhibit vasospasm. The use of the devices for delivery of
an elastase is specifically contemplated. Several published patent applications (
WO 2001/21574;
WO 2004/073504; and
WO 2006/036804) teach that elastase, alone and in combination with other agents, is beneficial in
the treatment of diseases of biological conduits, including obstruction of biological
conduits and vasospasm. Diagnostic agents include, but are not limited to, contrast,
microparticles, nanoparticles or other imaging agents.
[0275] A variety of distinct fluid delivery methods can be practiced with the device. In
certain applications, distinct fluids can be delivered through each tissue penetrator
of the device either simultaneously or sequentially. In other applications, the same
fluid can be delivered through both tissue penetrators either simultaneously or sequentially.
Embodiments and/or methods where a first fluid is delivered through both tissue penetrators
followed by delivery of a second fluid through both tissue penetrators are also contemplated.
[0276] Methods of using the devices to deliver fluids into or through a wall of a biological
conduit are also specifically contemplated. These methods comprise the steps of introducing
the device into the biological conduit, advancing the device to a target site within
the conduit, releasing the actuators from their constrained positions, optionally
advancing the tissue penetrators through lumens in the actuators to penetrate to a
desired depth into the wall of a biological conduit, delivering at least one fluid
into or through the wall, optionally returning the tissue penetrators back into the
lumens of the actuators, retracting the actuators to their constrained position, repositioning
the device in the same or a different conduit for the delivery of additional fluid
if so desired, and removing the device from the conduit.
6. EXAMPLES
[0277] This section describes methods of production of recombinant type I elastase for clinical
use, for example as an agent to enlarge the diameter of blood vessels and thereby
the lumen of blood vessels. Human type I pancreatic elastase displays 89% amino acid
identity across the entire length of the porcine type I pancreatic elastase, with
complete conservation of the "catalytic triad" and substrate specificity determining
residues. Porcine type I elastase is initially synthesized as an enzymatically inactive
proenzyme that is activated by trypsin to yield the mature enzyme that contains four
internal disulfide bonds and no glycosylation (see
Shotton, 1970, Methods Enzymol 19:113-140, Elastase; and
Hartley and Shotton, 1971, Biochem. J. 124(2): 289-299, Pancreatic Elastase.
The Enzymes 3:323-373 and references therein).
[0278] The examples below demonstrate the development of efficient and scalable recombinant
porcine and human type I elastase expression and purification schemes suitable for
cGMP manufacture of these enzymes for non-clinical and clinical studies, and commercial
pharmaceutical use. The mature porcine elastase has been given the name PRT-102. The
mature human type I elastase has been given the name PRT-201.
6.1 TERMINOLOGY AND ABBREVIATIONS
[0279] As used herein, the terms PRT-101, PRT-102, PRT-201 and pro-PRT-201 shall mean the
following:
PRT-101: porcine pancreatic elastase. Unless otherwise indicated, the porcine pancreatic
elastase employed in the examples is highly purified porcine pancreatic elastase purchased
from Elastin Products Company, Inc, Owensville, MO, catalog # EC134.
PRT-102: mature recombinant type I porcine pancreatic elastase. It should be noted
that vectors with the designation "pPROT101-XXX" encode PRT-102.
PRT-201: mature recombinant type I human pancreatic elastase.
pro-PRT-201: proenzyme form of recombinant human type I pancreatic elastase containing
a propeptide sequence.
[0280] The following abbreviations are used in Section 6 of the application:
- BKGY:
- buffered glycerol-complex medium
- BKME:
- buffered methanol-complex medium
- CHO:
- Chinese hamster ovary
- E. coli:
- Escherichia coli
- ELA-1:
- type I pancreatic elastase
- HEK :
- human embryonic kidney
- hELA-1 :
- human ELA-1
- HIC :
- hydrophobic interaction chromatography
- MBP :
- maltose binding protein
- pELA-1 :
- porcine ELA-1
- P. pastoris:
- Pichia pastoris
- PCR:
- polymerase chain reaction
- PMSF :
- phenylmethylsulphonyl fluoride
- RP:
- reversed phase
- S. cerevisiae:
- Saccharomyces cerevisiae
- SDS-PAGE:
- sodium dodecyl sulfate-polyacrylamide gel electrophoresis
- SEC:
- size exclusion chromatography
- USP:
- United States Pharmacopeia
- YPDS:
- yeast extract peptone dextrose sorbitol medium
6.2 EXAMPLE 1: ELASTASE DNA SYNTHESIS
[0281] The human elastase-1 coding sequence was obtained from
U.S. Patent No. 5,162,205 (Takiguichi et al., 1992). Several sequence changes were made to facilitate cloning into expression vectors
(Figure 1A). The base changes fell within the degeneracy of the genetic code so that
no amino acid residues were changed. A second stop codon was added immediately after
the native stop codon to minimize potential ribosome read through.
[0282] The modified coding sequence was synthesized by Blue Heron Biotechnology (Bothell,
WA) using a non-PCR "long oligo" technique under license from Amgen (Thousand Oaks,
CA). The recombinant DNA, named ELA-1.2A (SEQ ID NO:81), was cloned into the vector
Blue Heron pUC, a derivative of pUC119, and the resulting plasmid was named pPROT1.
pPROT1 was sequenced on both strands to confirm the correct sequence. High quality
sequencing data with extensive overlap on both strands permitted unambiguous base
assignments across the entire sequence, which was covered by a minimum of four sequencing
reactions with at least one reaction for each strand.
6.3 EXAMPLE 2: EXPRESSION OF PRT-201 IN E. COLI
[0283] A variety of expression strategies were attempted in an effort to obtain soluble
and enzymatically active human elastase in
E. coli.
[0284] One set of E.
coli expression vectors comprised in frame fusions of human type I pancreatic elastase
(ELA-1) to the carboxy terminus of a Maltose Binding Protein (MBP) that was in turn
fused to an N-terminal secretory peptide. Both the human ELA-1 mature and proenzyme
coding sequences were cloned as in-frame C-terminal fusions to the MBP coding sequence
of plasmid pMAL-p2G (New England Biolabs, Inc., Beverly, MA) to yield either pPROT3
(mature ELA-1) or pPROT5 (ELA-1 proenzyme). Construction ofpPROT3 was effected by
first obtaining by PCR mutagenesis a 6.6 kb mature human ELA-1 encoding fragment with
a SnaBI site at the N-terminal valine codon of mature human ELA-1 and a HindIII site
located 3' to the mature ELA-1 termination codons. This PCR mutagenesis used a pPROT1
template comprising the ELA-1.2A coding sequence (SEQ ID NO:81) and two oligonucleotide
primers (5' ATC TAC GTA GTC GGA GGG ACT GAG GCC, SEQ ID NO:75; and 5' gtc gac aag
ctt atc agt tgg agg cga t, SEQ ID NO:76). The resultant 6.6 kb PCR fragment was isolated,
digested with SnaBI and HindIII, and subsequently cloned into the XmaI/HindIII digested
pMAL-p2G vector to yield pPROT3. Construction of pPROT3 was effected by cloning the
ScaI/HindIII fragment from PPROT1 and ligating into the pMAL p2G vector that had been
digested with SnaBI and HindIII. The resultant fusion operably links the N-terminus
of the human ELA-1 proenzyme coding region to the C-terminus of the MBP of pMAL-p2G
in pPROT5. The trypsin cleavage domain of the human ELA-1 proprotein is preserved
in pPROT5.
[0285] E. coli strain TB 1 was transformed with pPROT3 and pPROT5 and subsequently induced with
IPTG to determine if either the fusion protein or enzymatically active human ELA-1
could be produced. In the case of pPROT3, all of the MBP-ELA-1 fusion protein produced
was insoluble. No soluble or enzymatically active MBP-ELA-1 fusion protein was detected
in the periplasmic material obtained by osmotic shock of induced pPROT3-containing
E. coli. In the case of pPROT5, low levels of soluble recombinant MBP-proELA-1 protein could
be detected in the periplasmic material obtained by osmotic shock of induced pPROT5-containing
E. coli through use of SDS-PAGE and Coomassie stain or by use of anti-MBP antibodies on a
Western blot (New England Biolabs, Inc., Beverly, MA). The soluble recombinant MBP-proELA-1
protein could be digested with trypsin to yield both MBP and mature human ELA-1. Mature
human ELA-1 obtained from inductions of pPROT5 was subsequently assayed for elastase
activity with SLAP peptide substrate. Elastase activity was observed in pPROT5 periplasmic
extracts. This elastase enzymatic activity was dependent on trypsin activation (
i.e., no activity was observed in absence of trypsin and amount of activity is increased
by increasing the time period of trypsin activation). Moreover, the elastase activity
was dependent on pPROT5 in as much as no activity was observed in pMAL-p2G vector
control extracts treated in parallel with trypsin. Finally, the pPROT5 elastase activity
was inhibited by PMSF (a known serine protease inhibitor).
[0286] The recombinant MBP-proELA-1 fusion protein was subsequently purified and cleaved
with trypsin to obtain an enzymatically active pPROT5-derived mature human ELA-1.
The fusion protein was first purified on amylose affinity chromatography followed
by elution with maltose. The purified MBP-proELA-1 was then treated with immobilized
trypsin. Following the trypsin activation step, the cleaved MBP-proELA-1 was purified
by cationic SP Sepharose chromatography. However, subsequent experiments with affinity
purified pPROT5-derived mature human ELA-1 indicated that only very limited amounts
of soluble and enzymatically active elastase could be obtained from
E. coli containing pPROT5. Moreover, the specific activity of the affmity purified, pPROT5-derived
mature human ELA-1 was very low, ranging from 0.27 to 0.38 U/mg (U = micromole of
SLAP substrate hydrolyzed per min).
[0287] An alternative strategy of obtaining soluble and enzymatically active ELA-1 in
E. coli was also pursued. In brief, the pPROT8 vector that encodes a protein fusion comprising
the first 8 amino acid residues of the
E. coli lacZ alpha subunit plus 5 amino acids of poly linker encoded residues followed by
the human ELA-1 N-terminal proenzyme was constructed. This vector was constructed
by ligating a BamHI/NcoI fragment containing the human ELA-1 coding sequence from
pPROT1 (
i.e., a vector containing the ELA-1.2A sequence; SEQ ID NO: 81) into pBlueHeron pUC (Blue
Heron Biotechnology, Bothell, WA, USA) that was digested with BamHI/NcoI.
[0288] E. coli strain EC100 (EPICENTRE Biotechnologies, Madison, WI) was transformed with pPROT8
and subsequently induced with IPTG to determine if either the fusion protein or enzymatically
active human ELA-1 could be produced. In the case of EC100 transformed cells, all
of the pPROT8 derived LacZ-proELA-1 fusion protein produced was insoluble (
i.e., found in inclusion bodies). An
E. coli strain containing mutations in the
trxB and
gor genes (the Origami™ strain, Takara Mirus Bio, Inc., Madison, WI) was subsequently
transformed with pPROT8 as
E. coli strains with mutations in these coding sequences are known to promote recovery of
soluble and enzymatically active recombinant proteins. Although some soluble pPROT8
derived LacZ-proELA-1 fusion protein in the
trxB /
gor E.coli strain was recovered upon induction with IPTG, it could not be converted to enzymatically
active human ELA-1 with trypsin.
6.4 EXAMPLE 3: EXPRESSION OF PRT-201 IN MAMMALIAN CELL LINES
[0289] Several expression strategies were attempted in an effort to obtain soluble and enzymatically
active human type I pancreatic elastase (ELA-1) in mammalian cell lines. The high
copy mammalian expression vector pcDNA3.1 (Invitrogen) containing the CMV promoter
was used as a backbone for two human ELA-1 elastase expression vectors, pPROT30 and
pPROT31. To construct pPROT30, the human ELA-1 proenzyme sequence was amplified by
PCR and fused to a porcine pancreatic elastase signal sequence incorporated in the
forward PCR primer. Using restriction sites incorporated into the PCR primers, the
PCR product was digested and ligated using the corresponding restriction sites in
the pcDNA3.1 vector. pPROT31 was constructed in a similar fashion, except that the
human ELA-1 mature coding sequence was used instead of the proenzyme coding sequence
in an attempt at direct expression of the mature enzyme.
E. coli was transformed with the ligation reactions and clones were selected for miniprep
screening. One clone for each expression vector was selected based on expected restriction
digest patterns for the correct insert. Plasmid DNA was prepared for each clone and
the expression vector coding sequences were confirmed by DNA sequencing.
[0290] The mammalian cell lines CHO, COS, HEK293 and HEK293T were transiently transfected
separately with pPROT30 and pPROT31. After several days, cell culture supernatants
were harvested and analyzed for human ELA-1 proprotein (pPROT30) or mature protein
(pPROT31) expression by Western blot. An anti-porcine pancreatic elastase polyclonal
antibody cross-reacted with a band of the expected molecular weight for the human
ELA-1 proprotein in pPROT30 supernatants and for the mature human ELA-1 protein in
pPROT31 supernatants.
[0291] The pPROT30 and pPROT31 supernatants were analyzed for elastase activity by SLAP
assay. For pPROT30, the supernatants were first treated with trypsin to convert the
proenzyme to mature PRT-201. No elastase activity was detected in any of the supernatants
for either vector using the SLAP assay.
6.5 EXAMPLE 4: EXPRESSION OF TRYPSIN-ACTIVATED PRT-201 IN P. PASTORIS
[0292] The vector for
P. pastoris secreted expression, PV-1, was synthesized by Blue Heron and used to first clone
the wild-type human ELA-1 coding sequence. The PV-1 vector was designed for simple
cloning, selection and high-level expression of the recombinant protein. The vector
contains the Zeocin™ resistance gene for direct selection of multi-copy integrants.
Fusion of the N-terminus of the elastase propeptide to a yeast α-mating type sequence
comprising the yeast secretion signal, propeptide and spacer sequences as shown in
Figure 1B permits secretion of the expressed protein in the culture media. The secreted
elastase proprotein can be easily separated from the cell pellet, a substantial first
step towards purification. Additionally, the proenzyme form of human ELA-1 containing
the trypsin cleavage site was selected for expression to avoid directly expressing
the mature, activated enzyme which may lead to protein misfolding or toxicity to the
cells expressing the recombinant enzyme.
[0293] Cloning of the expression construct pPROT24-V to direct the expression of ELA-1 I
proenzyme was accomplished as follows. The human ELA-1 coding region (SEQ ID NO:81)
was amplified from Blue Heron pUC ELA-1 by PCR (Expand High Fidelity PCR System, Roche,
Indianapolis, IN). The 20F forward primer incorporated an XhoI site (5'-ggctcgagaaaagagaggctgaagctactcaggaccttccggaaaccaatgcccgg-3;
SEQ ID NO:35). The 24R primer incorporated a SacII site (5'-gggccgcggcttatcagttggaggcgatgacat-3';
SEQ ID NO:36). The resulting PCR product was gel-purified and cloned into pCR2.1-TOPO
(Invitrogen). The ELA-1 coding sequence was isolated using XhoI and SacII, gel-purified,
and cloned into PV-1 vector at those sites to yield pPROT24-V (Figure 3).
[0294] The pPROT24-V ligated product was amplified in
E. coli strain TOP10. The cell mixture was plated on low salt LB plates supplemented with
25 microgram/mL Zeocin. DNA plasmid was prepared (Qiagen, Valencia, CA) and the human
ELA-1 insert was identified by restriction digestion. The pPROT24 coding sequence
was verified by sequencing both strands of purified maxiprep DNA with multiple overlapping
reactions. High quality sequencing data allowed unambiguous base assignments and confirmed
the correct coding sequence. Glycerol stocks of pPROT24-V/TOP 10 were made and stored
at - 80°C.
[0295] The wild-type NRRL Y-11430
P. pastoris strain obtained from the United States Department of Agriculture (USDA, Peoria, IL,
USA) was used for transformation. Plasmid DNA from pPROT24-V was linearized with SacI
and complete digestion was confirmed by running a small aliquot of the reaction on
an agarose gel. Electroporation was used to transform
P. pastoris with pPROT24-V plasmid DNA. Cell mixtures were plated onto YPDS plates containing
100 microgram/mL Zeocin. After three days, colonies began to form and were selected
over several more days for re-streaking on fresh plates.
[0296] In general, drug-resistant transformants were screened for expression in a 1 L baffled
flask. A single colony was used to inoculate 200 mL of BKGY medium. The composition
of the BKGY solution was the following: 10 g/L glycerol, 13.4 g/L yeast nitrogen base
with ammonium sulfate and without amino acids (Invitrogen), 20 g/L soy peptone, 10
g/L yeast extract, 0.4 mg/L biotin in 0.1 M potassium-phosphate buffer (pH 5.0). The
culture was grown for two days at 28°C with shaking at 275 rpm. The cultures were
pelleted by centrifugation at 650xg for 10 min at room temperature. The cell pellets
were resuspended with BKME induction media, pH 5.0, by resuspending the pellets at
a ratio of 1 g wet cells to 5 mL induction media. A 50 mL cell suspension was placed
in a 500 mL non-baffled flask to obtain a 1:10 ratio of cell suspension to flask volume.
The cells were incubated at 22°C with shaking at 275 rpm for 1-3 days. Methanol in
the induction media was replenished to a final concentration of 0.5% twice daily over
the course of induction.
[0297] To screen for expression, 1 mL aliquots were taken, transferred to 1.5 mL microfuge
tubes and centrifuged for 5 min at 20,000 x g in a microcentrifuge. Supernatants were
transferred to fresh tubes and stored at -80°C. For SDS-PAGE analysis, supernatant
aliquots were thawed and mixed with 4X Laemmli buffer supplemented to 5% volume with
the reducing agent beta-mercaptoethanol. Samples were boiled for 5 min, gently centrifuged,
and loaded onto an 8-16% gradient Tris-HCl pre-cast gel in a Criterion electrophoresis
system (Bio-Rad). After electrophoresis, the gel was stained with Coomassie and analyzed
for human ELA-1 proenzyme expression. Clone 201-24-266-VU was selected as a highyield
clone for further evaluation. A development cell bank consisting of 201-24-266-VU
glycerol stocks was prepared and stored at -80°C.
[0298] For scale-up production of human ELA-1 proenzyme using clone 201-24-266-VU, multiple
production runs were performed that generally followed the methods described below.
Where applicable, run-to-run variations in the methods are noted.
[0299] For cell culture, a series of 2 L baffled shaker flasks (typically ranging from 20
to 40 flasks) containing 500 mL BKGY growth medium were inoculated with 250 microliters
of thawed 201-24-266-VU glycerol stock. Cultures were grown at 28°C for 2 days in
a shaking incubator at 250 - 300 rpm. After 2 days, the cells were pelleted by centrifugation
and the supernatant was discarded. The cells were resuspended in BKME induction media,
pH 5.0, at a ratio of 1 g of weight cells to 5 mL media. A volume of 200-400 mL cell
suspension was placed in 2 L non-baffled flasks and cultured for 3 days in a shaking
incubator (250-300 rpm) at 22°C. Methanol in the media was replenished to 0.5% volume
twice daily during the course of induction. At the end of induction, the shake flask
cultures were centrifuged to pellet the cells. The supernatant was removed and immediately
filtered at room temperature through a 0.22 um polyethersufone membrane using 1 L
vacuum filtration units to remove any remaining cell debris. The filtrate was stored
at 2-8°C for up to 1.5 months. Based on HIC-HPLC analysis, the yield of human ELA-1
proenzyme from clone pro-PRT-201-24-266-VU in the clarified supernatant was typically
200 to 250 mg/L.
[0300] Capture of pro-PRT-201-24-266-VU from the supernatant was effected as follows. First,
supernatant from multiple rounds of shaker flask cultures (typically 4 to 10 rounds)
was combined (typically 8 to 25 L total), diluted 8-fold with water and adjusted to
pH 5.0 with 1 M HCl. The diluted supernatant was then loaded onto an equilibrated
2 L bed volume Macro-Prep High S ionic exchange capture column at 2-8°C at a rate
of 100 mL/min (linear flow rate 76 cm/hr). The chromatography program comprised the
following steps: 1. Wash column with 10 L (5 column volumes [CVs]) of Buffer A (20
mM sodium citrate, pH 5.0.) at 100 mL/min (76 cm/hr); 2. Wash column with 4 L (2 CVs)
of a mixture of 90% Buffer A and 10% Buffer B (500 mM sodium chloride; 20 mM sodium
citrate, pH 5.0) for a final buffer composition of 50 mM sodium chloride; 20 mM sodium
citrate, pH 5.0 at 100 mL/min (76 cm/hr); 3. Wash column with 6 L (3 CVs) of a mixture
of 80% Buffer A and 20% Buffer B for a final buffer composition of 100 mM sodium chloride;
20 mM sodium citrate, pH 5.0 at 100 ml/min (76 cm/hr); 4. Wash column with 6 L (3
CVs) of a linear gradient, starting from 75% Buffer A and 25% Buffer B to 68% Buffer
A and 32% Buffer B, at 100 ml/min (153 cm/hr); 5. Elute with a linear gradient of
30 L (15 CVs) starting from 68% Buffer A and 32% Buffer B to 0% Buffer A and 100%
Buffer B, at 100 ml/min (76 cm/hr). The eluate was collected in fractions of 500 -
1000 mL each.
[0301] Typically, two predominant protein species were observed by SDS-PAGE followed by
Coomassie staining: the glycosylated human ELA-1 proenzyme and the non-glycosylated
human ELA-1 proenzyme, as determined by subsequent LC/MS analysis, typically eluting
at about 320 mM sodium chloride, shown in Figure 4. In some production runs a protein
slightly smaller than the human ELA-1 proenzyme was observed as a minor species. Subsequent
LC/MS analysis of these fractions showed that most of the protein was not fulllength
proenzyme but instead was lacking several amino acids at the N-terminus. These N-terminal
variants were purified and subjected to elastase activity analysis, which revealed
that they had lower elastase activity than full length PRT-201. N-terminal variants
could arise from the human ELA-1 proenzyme exhibiting a low level of elastase activity
during cell culture and capture chromatography operations and either cleaving itself
through an intramolecular reaction or cleaving another human ELA-1 proenzyme molecule
through an intermolecular reaction. Suboptimal cleavage conditions during these operations
could lead to a high level of inaccurate cleavage of the proenzyme (sometimes referred
to as spontaneous or uncontrolled conversion) resulting in mostly N-terminal variants,
rather than intact, full length PRT-201.
[0302] After inspection of SDS-PAGE results, a subset of fractions was pooled to obtain
purified non-glycosylated pro-PRT-201 for further processing. Fractions containing
glycosylated proenzyme or full-length PRT-201 and/or N-terminal variants (which co-migrate
on SDS-PAGE) were typically excluded from the pooling. The pooled pro-PRT-201 was
typically stored in a 5 L plastic beaker at 2-8°C for several hours to overnight prior
to conversion from proenzyme to mature enzyme.
[0303] Conversion of pro-PRT-201 to mature PRT-201 by immobilized trypsin was effected as
follows. The pooled pro-PRT-201 fractions were dialyzed in 20 mM sodium phosphate,
pH 5.0, overnight at 2-8°C. This step provides for the removal of citrate, which inhibits
trypsin. Following dialysis, the pro-PRT-201 was passed over a column of recombinant
trypsin (TrypZean) immobilized to agarose beads pre-equilibrated with 20 mM sodium
phosphate, pH 5.0. Typically, the contact time between pro-PRT-201 and the immobilized
TrypZean was between 3.5 to 5 min. The resulting post-conversion material was analyzed
by SDS-PAGE to confirm conversion and subsequently loaded onto a Macro-Prep High S
polish column. The column was washed sequentially with 5 CVs of 20 mM sodium citrate,
pH 5.0; 2 CVs of 20 mM sodium citrate, 50 mM sodium chloride, pH 5.0; and 3 CVs of
20 mM sodium citrate, 100 mM sodium chloride, pH 5.0. The column was further washed
with a linear gradient from 125 mM sodium chloride to 160 mM sodium chloride in 20
mM sodium citrate, pH 5.0. PRT-201 was eluted in a linear gradient from 165 mM to
500 mM sodium chloride in 20 mM sodium citrate, pH 5.0 and collected in fractions.
Fractions were analyzed for protein by SDS-PAGE followed by Coomassie staining and
for elastase activity by SLAP assay. Typically, fractions having a specific activity
of 90% or greater than that of the fraction with the highest specific activity were
pooled. In subsequent LC/MS analysis, lateeluting fractions having lower specific
activity were found to be enriched in PRT-201 N-terminal variants.
[0304] Pooled fractions with high specific activity were diafiltered into formulation buffer
composed of 0.1X PBS (13.7 mM sodium chloride, 1 mM sodium phosphate, 0.27 mM potassium
phosphate) at pH 5.0. After concentration of PRT-201 to 1 mg/mL, the pH was adjusted
to 7.4. The solution was then aliquoted into glass serum vials with an elastomer stopper,
and lyophilized. Lyophilization was typically performed with a primary drying cycle
at -30 to -50°C and a secondary drying cycle at -15°C. After lyophilization, the vials
were stoppered under vacuum and crimped with an aluminum seal. The vials were then
typically stored at 2-8°C or -80°C.
[0305] To evaluate the stability of lyophilized PRT-201 in vials, two lots that were manufactured
into sterile GMP drug product have been placed on a stability program. The stability
program consists of storage of the drug product at -15°C and periodic removal of a
subset of vials for testing by the following stability-indicating analytical methods
(specifications are in parentheses): appearance of lyophilized material (white to
off-white powder), appearance after reconstitution (clear, colorless solution free
of particles), specific activity by SLAP assay (25-45 U/mg), purity by RP-HPLC (total
purity: not less than 93%; individual impurity: not more than 2%), purity by reduced
SDS-PAGE (not less than 93%), purity by non-reduced SDS-PAGE (not less than 93%),
particulate matter injections (conforms to USP), aggregates by SEC-HPLC (not more
than 3%), content per vial (4.5 - 5.5 mg), pH (6.5-8.5), moisture (does not exceed
5%) and sterility (conforms to USP). To date, both lots have met the indicated specifications
at all time points tested (lot C0807117 through 12 months and lot C1007132 through
9 months). These results indicate that PRT-201 is stable for at least 12 months when
stored lyophilized in vials at -15°C.
[0306] The use of sodium citrate, pH 5.0, during both capture chromatography of pro-PRT-201
and polish chromatography of converted PRT-201 was based on data showing that sodium
citrate inhibited elastase activity of purified PRT-201 and therefore might also inhibit
elastase activity of pro-PRT-201 and PRT-201 during processing operations. Such inhibition
could minimize the spontaneous conversion of pro-PRT-201 to N-terminal variants and
minimize auto-degradation of PRT-201. In an experiment where SLAP assay buffer contained
115 mM sodium citrate, pH 5.0, the specific activity of PRT-201 was inhibited by 91%.
[0307] Occasionally, eluted material from the pro-PRT-201 capture column was not subjected
to conversion by trypsin as described above but instead used to obtain preparations
enriched in various protein species. For example, pools of fractions containing primarily
glycosylated pro-PRT-201, non-glycosylated pro-PRT-201 or proteins arising from spontaneous
conversion were made from the capture column eluate. Typically, these fraction pools
were diafiltered into 10 mM sodium phosphate, pH 5.0, lyophilized, and stored at -
80°C.
[0308] A study was performed to determine the effect of pH and temperature on the stability
of purified pro-PRT-201 over time. Lyophilized pro-PRT-201 was reconstituted in 10
mM sodium phosphate at pHs ranging from 3.0 to 8.4, followed by incubation at 4°C
or 25°C for 7 days. After 7 days, the pro-PRT-201 samples under conditions of pH 4.0
- 8.0 and 25°C showed an enrichment in mature PRT-201 that increased with increasing
pH as shown by SDS-PAGE and Coomassie staining. Under the conditons of pH 8.4 and
25°C, complete conversion of pro-PRT-201 to mature PRT-201 was observed. The samples
at 4°C, from pH 4.0 to 8.4 showed little to no conversion. At pH 3.0, no conversion
was observed at either 4°C and 25°C. It has been reported in the literature (
Hartley and Shotton, 1971, Pancreatic Elastase. Enzymes 3:323-373) that porcine pancreatic elastase is irreversibly inactived after prolonged storage
at pHs lower than 3.0. Thus, based these results of this study and to avoid irreversibly
inactivating PRT-201, useful conditions to minimize conversion of purified pro-PRT-201
are storage at 4°C between pH 3.0 - 4.0.
6.6 EXAMPLE 5: EXPRESSION OF AUTO-ACTIVATED PRT-201 IN P. PASTORIS
[0309] To obtain a variant proenzyme capable of auto-activation, thereby eliminating the
need for trypsin activation, a variety of elastase cleavage domain variant vectors
were constructed and analyzed in small-scale culture and conversion experiments. The
variant vectors were created by site-directed PCR mutagenesis of the pPROT24-V vector
and subsequent derivative vectors. Site-directed mutagenesis was performed using Pfu
Turbo DNA polymerase (Stratagene). The
E.coli XL10-Gold strain was transformed with the resulting plasmids. The transformed cell
mixtures were plated on low salt LB plates supplemented with 25 microgram/mL Zeocin.
Drug-resistant clones were picked and plasmid DNA was prepared (Qiagen, Valencia,
CA). Clones were confirmed for the expected codon changes by sequencing both strands
of plasmid DNA in the propeptide region with multiple overlapping reactions.
P. pastoris was transformed with the variant vectors and clones were selected as described in
the preceding Example.
[0310] A summary of the elastase cleavage domain variants that were created is provided
in Table 4 below:

[0311] For Table 4 above, the first column listing of the "Pro-Peptide Sequence Name" corresponds
to the SEQ ID NO for the indicated elastase cleavage domain. Thus, 24 corresponds
to the wild-type trypsin cleavage domain of SEQ ID NO:24. Numbers 40-49, 52-63 correspond
respectively to the variant elastase cleavage domains of SEQ ID NOS: 40-49, and 52-63.
[0312] To culture the variant clones, shaker flask culture conditions developed for the
trypsin-activated 201-24-266-VU clone described in the preceding Example were generally
followed. Several methods of converting the variant proproteins secreted into the
shaker flask supernatant to mature PRT-201 were tested. The first conversion strategy
consisted of chromatographically purifying the variant proenzyme first, followed by
controlled cleavage in a specific conversion buffer. Because the amino acid changes
in the variant proproteins resulted in only small changes in the theoretical isoelectric
points compared to the wild-type proenzyme, cation exchange chromatography was carried
out generally as described in the preceding Example. Supernatants from the variant
clone cultures were prepared for chromatography either by dilution with water generally
as described in the preceding Example or by concentration followed by diafiltration
of the supernatant using tangential flow filtration into the column loading buffer.
After chromatographic purification, eluted fractions were analyzed by SDS-PAGE followed
by Coomassie staining. Gel analysis demonstrated greater amounts of converted mature
protein to proprotein in the fractions compared to the starting supernatant, indicating
that a considerable amount of spontaneous proprotein conversion had occurred. Upon
subsequent purification, the spontaneously converted protein was determined by LC/MS
to consist of mainly N-terminal variants which were shown to have little or no elastase
activity in the SLAP assay.
[0313] The second conversion strategy consisted of converting the variant proprotein prior
to purifying from the culture supernatant, followed by chromatographic purification
of the mature enzyme. This conversion strategy was first tested in a small-scale assay
and subsequently scaled up to accommodate larger conversion volumes. For small-scale
conversion, clarified supernatant from variant clone cultures was typically concentrated
5-fold by centrifugation at 2-8°C in an ultracentrifugal filter device. After concentration,
the retentate was diluted 5-fold with Tris buffer to a final concentration of 100
mM of Tris-HCl typically in a pH range of 8.0 to 9.0. Samples were incubated at room
temperature on a rocking platform. Elastase activity was monitored by SLAP assay typically
until the activity reaction velocity reached a plateau. In some cases, the reaction
velocity increased so slowly that SLAP monitoring was halted before a plateau was
achieved. Converted samples were analyzed for protein species (
e.g., proprotein and PRT-201 / N-terminal variants) by SDS-PAGE. To scale up this conversion
strategy, supernatant containing variant proprotein was concentrated 10-fold using
tangential flow filtration followed by diafiltration with 100 mM Tris-HCl ranging
in pH from 6.0 to 9.0. The progress of the conversion reaction was monitored over
time by HIC-HPLC analysis in which proprotein, PRT-201, and N-terminal variant species
were quantified. When the pH of the diafiltration buffer was between 8.0 and 9.0 there
were generally higher rates of conversion.
[0314] The elastase proproteins listed in Table 5 were expressed in
P. pastoris as described and tested for their capacity to undergo auto-conversion in small-scale
conversion assays as described in the second conversion strategy above. The results
of those studies are summarized in Table 5 below:
Table 5: Results of expression of elastase proproteins in
P. pastoris.
| Pro-Peptide Sequence Name |
Shaker Flask Yield |
Shaker Flask Stability |
Conversion Rate |
% N-Terminal Variants |
Trypsin Used in Processing |
| 24 |
High |
High |
Fast |
20% |
Yes |
| 40 |
None |
Not Applicable |
Not Applicable |
Not Applicable |
No |
| 41 |
Intermediate |
High |
Slow |
Not Tested |
No |
| 42 |
Low |
Low |
Intermediate |
25% |
No |
| 43 |
Intermediate |
High |
Slow |
Not Tested |
No |
| 44 |
Intermediate-High |
High |
No Conversion Detected |
Not Applicable |
No |
| 45 |
Intermediate |
High |
No Conversion Detected |
Not Applicable |
No |
| 46 |
Intermediate |
High |
No Conversion Detected |
Not Applicable |
No |
| 47 |
Intermediate |
High |
No Conversion Detected |
Not Applicable |
No |
| 48 |
Intermediate |
Low |
Fast |
15% |
No |
| 49 |
High |
Hish |
Slow |
35% |
No |
| 52 |
Intermediate |
Low |
Fast |
Not Tested |
No |
| 53 |
Intermediate |
Intermediate |
Fast |
25% |
No |
| 54 |
Intennediate |
Low |
Fast |
Not Tested |
No |
| 55 |
Intermediate - High |
Intermediate |
Fast |
15% |
No |
| 56 |
Low |
Low |
Not Tested |
Not Tested |
No |
| 57 |
Low |
Low |
Not Tested |
Not Tested |
No |
| 58 |
Intermediate - Hip |
Intermediate |
Slow |
Not Tested |
No |
| 59 |
Intermediate - High |
Intermediate |
Slow |
Not Tested |
No |
| 60 |
Intermediate - High |
High |
Slow |
Not Tested |
No |
| 61 |
None |
Not Applicable |
Not Applicable |
Not Applicable |
No |
| 62 |
High |
High |
No Conversion Detected |
Not Applicable |
No |
| 63 |
None |
Not Applicable |
Not Applicable |
Not Applicable |
No |
[0315] In Table 5 above, the first column listing of the "Pro-Peptide Sequence Name" corresponds
to the SEQ ID NO for the indicated elastase cleavage domain. Thus, 24 corresponds
to the wild-type trypsin activated elastase cleavage domain of SEQ ID NO:24. Numbers
40-49, and 52-63 correspond respectively to the variant elastase cleavage domains
of SEQ ID NOS: 40-49, and 52-63. The column labeled "Shaker Flask Yield" corresponds
to the amount of the corresponding proprotein in the culture supernatant over 3 days
of induction as determined by SDS-PAGE analysis. The column labeled "Shaker Flask
Stability" corresponds to the stability of the corresponding proprotein in the supernatant
of the shaker flask culture media over 3 days of induction as determined by the amount
of PRT-201 / N-terminal variants seen on SDS-PAGE analysis. The column labeled "Conversion
Rate" corresponds to the relative rate of conversion of proprotein to PRT-201, as
indicated by the time to achieve maximal SLAP reaction velocity (Fast: less than 60
minutes; Intermediate: 60 to 120 minutes; and Slow: greater than 120 minutes). Conversion
time courses of the variant proproteins were determined using the small-scale conversion
assay described above and compared to the conversion time course of the 24 proprotein
determined by activation using immobilized trypsin. The column labeled "% N-Terminal
Variants" refers to the percentage of converted protein that comprised N-terminal
variants of the mature elastase protein (i.e. variants comprising cleavage at the
bond C-terminal to any site other than P1). To illustrate the relative ranking systems
used in in Table 5, examples of SDS-PAGE, conversion rate and N-terminal variant analyses
for a subset of auto-activated variants are shown in Figure 5.
[0316] Analysis of the various variants revealed that elastase proproteins comprising either
the SEQ ID NO:48 or SEQ ID NO:55 variant elastase cleavage domain provided auto-activated
elastases with superior qualities including intermediate to high shaker flask yields
and low percentages of variants upon conversion. Further analysis of elastase proproteins
comprising either the SEQ ID NO:48 and SEQ ID NO:55 variant elastase cleavage domain
revealed that auto-activation of the corresponding proproteins (i.e. the elastase
proenzymes of SEQ ID NO:64 and SEQ ID NO:69, respectively) produced just one class
of N-terminal variant with a cleavage at the peptide bond C-terminal to the P'2 residue.
Further analysis of elastase proproteins revealed that the proprotein comprising SEQ
ID NO:55 variant elastase cleavage domain was more stablethan the proprotein comprising
the SEQ ID NO:48 variant elastase cleavage domain.
[0317] Initial experiments to optimize conditions for controlled cleavage of purified pro-PRT-201
were performed using the proprotein with the 42 pro-peptide sequence (SEQ ID NO:6).
This purified proprotein was subjected to conversion in a matrix of conditions including
pH (7.7 to 8.9), buffer composition (0.4 to 10 mM sodium citrate), protein concentration
(0.14 to 0.23 mg/mL), and reaction time (5 to 24 hours). At the end of the conversion
period, the reactions were quenched by adding formic acid to reduce the pH to 3.0.
The relative amounts of protein species in each reaction were determined by mass spectrometry.
Based on these results, the conversion conditions that resulted in the lowest percentage
of N-terminal variants included a pH of 8.3, a buffer composition of 100 mM Tris and
less than 1 mM sodium citrate, a protein concentration of 0.2 mg/mL, and a reaction
time of 5 to 24 hours. In this study, only the reaction end points were analyzed.
Thus real-time data on conversion quality was not obtained, and the final result may
have reflected both the initial production of N-terminal variants and a substantial
amount of time for those variants to have been degraded. Subsequently, an HIC-HPLC
assay was developed to enable real-time monitoring of the conversion reaction. Further
conversion optimization studies, including those using real-time HIC-HPLC monitoring,
are described in Example 6.
6.7 EXAMPLE 6: EXPRESSION OF AUTO-ACTIVATED PRT-201 IN P. PASTORISUSING A MULTICOPY VARIANT VECTOR
[0318] Multicopy integration of recombinant genes in
P. pastoris has been utlized to increase expression of the desired protein (see, e.g.,
Sreekrishna et al., 1989, Biochemistry 28:4117-4125;
Clare et al., 1991, Bio/Technology 9:455-460;
Romanos et al., 1991, Vaccine 9:901-906). However, in certain instances, expression levels obtained from single copy vector
integrants was efficient and was not improved by the multicopy vector integrants (
Cregg et al., 1987, Bio/Technology 5:479-485). Spontaneous multicopy plasmid integration events occur
in vivo at a low frequency in
P. pastoris. To obtain genomic integration of multiple copies of a gene and possibly increase
the protein expression, an
in vitro ligation method can be used to produce tandem inserts of the gene in an expression
vector, followed by
P. pastoris transformation.
[0319] To obtain a multicopy integrant of the pPROT55-V variant, an
in vitro ligation method was used to construct a vector containing multiple copies of the
pPROT55-V that was subsequently used for
P. pastoris transformation. To make the multicopy vector, the pPROT55-V vector was digested with
BglII and BamHI to release the 2.3 kb expression cassette encoding the pro-PRT-201
gene, the
AOX1 promoter, and the
AOX1 transcription termination sequence. The expression cassette was then ligated with
a preparation of the pPROT55-V vector that had been linearized with BamHI and treated
with calf intestinal alkaline phosphatase (New England Biolabs, MA, USA) to prevent
self-ligating. The ligation mixture was incubated overnight at 16°C. The
E. coli TOP 10 strain (Invitrogen, CA, USA) was transformed with the ligation reaction. The
transformation mix was plated out on low salt LB in the presence of 25 microgram/mL
of Zeocin. Drug-resistant transformants were picked and plasmid DNA was prepared.
[0320] To determine the number of expression cassettes in the resulting clones, plasmid
DNA was digested with BglII and BamHI and analyzed by agarose gel electrophoresis
with a DNA size standard marker. A clone containing a single defined insert band with
the size consistent with three 2.3 kb expression cassettes was identified and named
pPROT55M3-V. Restriction enzyme mapping was used to confirm the orientation of a linear
head-to-tail multimer formation for the pPROT55M3-V vector. Figure 6 depicts the pPROT55M3-V
cloning scheme.
[0321] The wild-type
P. pastoris strain NRRL Y-11430 was used for transformation, which was carried out as described
in Example 4 except that the pPROT55M3-V vector was linearized with BglII instead
of SacI prior to transformation. Drug-resistant transformants were cultured and screened
for expression of the pPROT55M3 proprotein as described in Example 4.
[0322] Optimization of shaker flask culture conditions was performed to minimize spontaneous
cleavage during induction. Shaker flask optimization focused on two variables, induction
temperature and induction media composition. First, it was found that performing induction
at 22°C compared to 25°C resulted in a higher ratio of proenzyme to mature enzyme
in the culture supernatant for all media compositions tested. Second, addition of
sodium citrate to increase the buffering strength of the induction media resulted
in the absence of spontaneously converted mature enzyme in the culture supernatant
across all sodium citrate concentrations tested (12.5 to 50 mM). The effects of these
variables on proprotein expression yield and stability in shaker flask supernatant
over time are illustrated in Figure 7.
[0323] The high-expressing three-copy clone 201-55M3-003-VU was selected for scale-up fermentation
analysis using fermentation procedures established for the 201-55-001-VU clone described
as follows. Fermentation of the 201-55-001-VU clone was effected by thawing one cell
bank vial and using it to inoculate a shaker flask containing 500 ml of BKGY growth
medium at pH 5.7. The seed culture was grown for 24 hours with shaking at 28°C until
the wet cell weight was approximately 40 g/L. The fermentor containing BKGY growth
medium at pH 5.7 was sterilized in the autoclave. After the media was cooled to 28°C,
supplements including yeast nitrogen base and biotin were added. The fermentor was
inoculated at a ratio of 1:33 of seed culture to BKGY growth medium.
[0324] The fermentation procedure started with a fed-batch of glycerol and glycerol feed
at pH 5.7 at 28°C. The pH was controlled by 10% phosphoric acid and 30% ammonium sulfate
solutions. The culture was agitated from 300-1000 rpm with aeration to control the
dissolved oxygen at 40%. After the initial glycerol batch was depleted and dissolved
oxygen spiked, indicating the depletion of glycerol from the system, additional 50%
glycerol was fed at 131 g/h until the wet cell weight reached preferably between 200g/L
to 300g/L. After the wet cell weight reached 200g/L-300 g/L, the induction was immediately
initiated with a methanol bolus of 0.025 mL per gram of wet biomass. After depletion
of the methanol bolus and the rise of dissolved oxygen, induction was continued by
the addition of limiting amounts of methanol with a constant feed rate of 0.0034 g
methanol/g wet cell weight/hr. At the start of constant methanol feed, the pH of the
fermentation broth was changed from 5.7 to 5.5 and the temperature was changed from
28°C to 22°C. The fermentation was harvested after 70 hours of induction.
[0325] To determine the relative yields of single and 3-copy clones, clone 201-55-001-VU,
containing one genomic integrant of the single copy pPROT55-V vector, was fermented
in parallel with clone 201-55M3-003-VU, containing one genomic integrant of the 3-copy
pPROT55M3-V vector. The fermentations were carried out as described above except that
the pH of the culture was maintained at 5.7 throughout induction. The harvested supernatants
from 201-55-001-VU and 201-55M3-003-VU fermentations were analyzed by gradient SDS-PAGE
followed by Colloidal Blue staining (Figure 8), which showed that higher proprotein
expression was obtained from the multicopy 201-55M3-003-VU clone compared to the single
copy 201-55-001-VU clone. SDS-PAGE results were confirmed with HIC-HPLC analysis of
proprotein concentration in the fermentation supernatants, demonstrating that the
201-55M3-003-VU clone produced approximately 600 mg/L of the secreted proprotein while
the 201-55-001-VU clone produced approximately 400 mg/L. Thus, the multicopy 201-55M3-003-VU
clone containing three expression cassettes produced approximately 50% more proprotein
compared to single copy 201-55-001-VU clone containing a single expression cassette.
[0326] Two conversion strategies were tested using the 201-55M3-003-VU supernatant produced
from the fermentation. These strategies generally follow the strategies described
for other proprotein variants in Example 5, except that they were performed on a larger
scale. In the first strategy, the proprotein was captured from the supernatant by
cation exchange chromatography, followed by conversion to the mature protein and polish
chromatography. In the second strategy, the proprotein was converted to the mature
protein prior to purification, followed by capture using cation exchange chromatography,
extended conversion to remove the N-terminal variants, and further polish chromatography.
Both strategies also included an extended incubation step in a buffer at pH 8.0 after
conversion to effect the selective degradation of N-terminal variants.
[0327] Using the first strategy, capture of the proprotein followed by conversion and PRT-201
polish purification were effected as follows. The 201-55M3-003-VU supernatant was
harvested from the fermentation culture and frozen at -80°C. Approximately 7 L of
frozen clarified supernatant (3.5 L from the 201-55M3-003-VU fermentation described
above and 3.5 L from 201-55M3-003-VU shaker flask cultures prepared generally as described
in Examples 4 and 5) was thawed and diluted 8-fold with deionized water and 1 M sodium
citrate, pH 4.3, at 2-8°C to obtain a final concentration of 25 mM sodium citrate.
The pH of the solution was adjusted to 4.7. The solution was loaded onto a 2.3 L bed
Macroprep High S cation exchange column at 76 cm/hr at 2-8°C. The column was washed
with 5 CVs of 25 mM sodium citrate, pH 4.7, followed by 5 CVs of 160 mM sodium chloride,
25 mM sodium citrate, pH 4.7. The proprotein was eluted with 15 CVs of a linear gradient
starting from 160 mM sodium chloride to 500 mM sodium chloride in 25 mM sodium citrate,
pH 4.7, at 87 ml/min (67 cm/hr). The eluate was collected in fractions. Fractions
were analyzed by SDS-PAGE for protein content (Figure 9). A small amount of spontaneously
converted protein was observed by SDS-PAGE. Fractions containing the proprotein were
pooled for further processing. The pooled material was subjected to HIC-HPLC analysis,
which showed that it consisted of 92% proprotein and 8% mature PRT-201.
[0328] To initiate conversion, the pooled material was buffer exchanged using tangential
flow filtration into 100 mM sodium chloride, 20 mM Tris, pH 4.0, using constant volume
diafiltration at 10-12°C. Tangential flow filtration was performed with regenerated
cellulose membranes, a transmembrane pressure of 15 psi, a crossflow rate of 20 L/min
and a flux of 800 mL/min. Three diavolumes of the buffer at 2-8°C was added at the
same rate as the flux. Subsequently, three additional volumes of buffer at ambient
temperature were added at the same rate as the flux to raise the temperature of the
conversion solution to the target of 26°C. Tangential flow filtration was used to
concentrate the conversion solution to the target of 1.5 mg/mL using the conditions
of 15 psi transmembrane pressure, 1.2 L/min crossflow rate, and 76 ml/min flux. However,
after approximately 2 minutes of starting the concentration procedure, unexpected
precipitation was observed and the concentration process was halted. The protein concentration
of the conversion solution was determined to be 1.1 mg/mL by UV absorbance at 280
nm in a volume of 570 mL. To minimize further precipitation, the conversion solution
was diluted to 1 mg/mL with 100 mM sodium chloride, 20 mM Tris, pH 4.0, and filtered
through a 0.22 micron membrane. Sixteen mL of 3 M Tris, pH 9.0 was added to the conversion
solution. The conversion solution was placed in a water bath at 26°C. The conversion
reaction was monitored by HIC-HPLC analysis. After 30 minutes, HIC-HPLC showed that
the majority of the proprotein had been converted to PRT-201 and some N-terminal variants
(Figure 10). After 1 hour, the conversion reaction consisted of 0% proprotein, 86%
full-length PRT-201 and 14% N-terminal variants. The conversion material was incubated
further for 4 more hours, at which time HIC-HPLC analysis showed that the conversion
material consisted of 98% full-length PRT-201 and 2% N-terminal variants.
[0329] The conversion material was diluted 4-fold with deionized water and 1 M sodium citrate,
pH 4.3, to a final concentration of 25 mM sodium citrate. The pH of the solution was
adjusted to 5.0 in preparation for loading onto the polish column. The solution was
loaded onto a 600 mL bed Macroprep High S cation exchange column at 27 mL/min (83
cm/hr). The column was washed with 5 CVs of 20 mM sodium citrate, pH 5.0 followed
by 5 CVs of 160 mM sodium chloride, 20 mM sodium citrate, pH 5.0. PRT-201 was eluted
with 15 CVs of a linear gradient starting from 160 mM to 500 mM sodium chloride in
25 mM sodium citrate, pH 5.0, at 87 mL/min (67 cm/hr). The eluate was collected in
fractions. Fractions were analyzed by SDS-PAGE for protein content and by SLAP assay
for specific activity. Fractions containing PRT-201 with a specific activity of ≥30
U/mg were pooled. The pooled PRT-201 fractions were diafiltered by tangential flow
filtration into formula3tion buffer (0.1X PBS, pH 5.0). The pH of diafiltered PRT-201
was adjusted to pH 7.4 and the protein concentration was adjusted to 1 mg/mL by tangential
flow filtration. Vials were filled and lyophilized as described for PRT-201 produced
from the 201-24-266-VU clone in Example 4.
[0330] Using the second strategy, proprotein conversion followed by purification of PRT-201
was effected as follows. Approximately 7 L of the frozen clarified supernatant from
the 201-55M3-003-VU fermentation described above was thawed and the conversion reaction
was initiated by tangential flow filtration with a conversion buffer containing 100
mM Tris, pH 8.0, using constant volume diafiltration at ambient temperature with regenerated
cellulose membranes. Two diavolumes of 100 mM Tris-HCl, pH 8.0 were sufficient to
change the pH of the retentate from pH 5.0 to 8.0 and effect conversion. An experiment
was also performed by directly adjusting the pH of the clarified supernatant to 8.0
by adding a Tris base to a final concentration of 100 mM and adjusting the pH to 8.0
with 1 N sodium hydroxide. This resulted in the formation of precipitates and a cloudy
supernatant, possibly due to precipitation of broth components, which was undesirable.
The preferred method of conversion using tangential flow filtration did not result
in precipitation.
[0331] The conversion reaction was monitored by real-time HIC-HPLC analysis. After initiation
of conversion, pro-PRT-201 converted to mature PRT-201 slowly over the first two hours,
followed by an acceleration of conversion (Figure 11). At 4.5 hours, the conversion
reaction consisted of approximately 4% pro-PRT-201, 75% mature PRT-201 and 21% N-terminal
variants. At 6.5 hours, the conversion reaction consisted of approximately 1 % pro-PRT-201,
83% mature PRT-201 and 16% N-terminal variants. The reduction in N-terminal variants
from 21 % to 16% from 4.5 hrs to 6.5 hrs may be due to degradation of N-terminal variants
by full length, active PRT-201, but this was not complete and not as rapid as the
reduction in N-terminal variants seen during conversion of purified pro-PRT 201. In
this second strategy, extending the conversion reaction may not entirely remove the
N-terminal variants due to the competing proteins in the supernatant that compete
for the active site of elastase. To improve the conversion reaction, the postconversion
material was captured and subsequently diafiltered into an appropriate buffer to initiate
extended conversion at pH 8.0 for selective degradation of N-terminal variants as
described below.
[0332] Capture of PRT-201 from the conversion material was effected as follows. The conversion
material was buffer exchanged into 20 mM sodium citrate, pH 5.0 and loaded onto a
Macro-Prep High S cation-exchange chromatography column. The column was washed with
5 CVs of 20 mM sodium citrate, pH 5.0 followed by 5 CVs of 20 mM sodium citrate, 160
mM sodium chloride, pH 5.0. PRT-201 was eluted with a linear gradient from 160 mM
to 500 mM sodium chloride in 20 mM sodium citrate, pH 5.0. The fractions were analyzed
by SDS-PAGE for protein content, HIC-HPLC for N-terminal variants, UV absorbance at
280 nm for protein concentraton, and SLAP assay for elastase activity. Two predominant
proteins bands were detected by SDS-PAGE, corresponding to PRT-201 and PRT-201 glycoforms,
as shown in Figure 12. Fractions that contained PRT-201 glycoforms as determined by
SDS-PAGE or N-terminal variants as determined by HIC-HPLC were excluded from pooling.
Fractions that exhibited relatively low specific activity (less than 30 U/mg) as determined
by SLAP assay were also excluded from pooling. The remaining fractions containing
PRT-201 were pooled for further processing. HIC-HPLC analysis of the pooled fractions
revealed that this material consisted of approximately 98% full-length PRT-201 and
1-2% N-terminal variants. The pooled material was stored at 2-8°C for 12-16 hrs.
[0333] Given the prior observation that N-terminal variants appeared to decrease over a
prolonged conversion period as described above, the pooled PRT-201 material was subjected
to an extended incubation step at pH 8.0. The extended incubation was performed by
diafiltration and tangential flow filtration with 100 mM Tris, 300 mM sodium chloride,
pH 8.0 for 2.5 hours at ambient temperature. After 2.5 hours, the conversion material
consisted of 100% mature PRT-201 as shown by HIC-HPLC analysis. The conversion material
was subjected to diafiltration and tangential flow filtration into 20 mM sodium citrate,
pH 5.0 to suppress elastase activity and prepare for column chromatography. The diafiltered
PRT-201 material was stored for approximately 64 hours at 2-8°C.
[0334] Polish chromatographic purification of PRT-201 was effected as follows. The diafiltered
PRT-201 material was loaded onto a Macro-Prep High S cation exchange column and washed
with 5 CVs of Buffer C (20 mM sodium citrate, pH 5.0) followed by 5 CVs of 160 mM
sodium chloride, 20 mM sodium citrate, pH 5.0. Elution of PRT-201 was performed with
a linear gradient of 15 CVs starting from 68% Buffer C and 32% Buffer D (160 mM sodium
chloride, 25 mM sodium citrate, pH 5.0) to 0% Buffer C and 100% Buffer D (500 mM sodium
chloride, 25 mM sodium citrate, pH 5.0), at 50 ml/min (153 cm/hr). The eluate was
collected in fractions. PRT-201 eluted as a symmetrical peak at 37 mS/cm (330 mM sodium
chloride). Fractions were analyzed by SDS-PAGE analysis for protein content, UV absorbance
at 280 nm for protein concentration and SLAP assay for specific activity. Fractions
containing PRT-201 that had a specific activity of 30.1-38.8 U/mg were pooled. The
pooled PRT-201 fractions were diafiltered by tangential flow filtration into formulation
buffer (0.1X PBS, pH 5.0). The pH of diafiltered PRT-201 was adjusted to pH 7.4 and
the protein concentration was adjusted to 1 mg/mL by tangential flow filtration. Vials
were filled and lyophilized as described for PRT-201 produced from the 201-24-266-VU
clone in Example 4.
[0335] The conditions for the conversion procedures described above were chosen based on
conversion optimization studies that examined protein concentration, temperature,
buffer composition, diavolume and pH variables. In the first study, the effect of
proprotein concentration on the production of N-terminal variants during conversion
was analyzed. Purified pro-PRT-201 from the 201-55M3-003-VU clone (pro-PRT-201-55M3-003-VU)
at a starting concentration of 0.2 mg/mL in 20 mM sodium phosphate, pH 5.0 was aliquotted
and concentrated to 1.0, 1.6, and 1.8 mg/mL using centrifugal concentrating devices
as determined by UV absorbance at 280 nm. Conversion of the proprotein was effected
by adding Tris and sodium chloride to 100 mM each of the four concentration samples,
adjusting the pH from 5.0 to 8.0, and incubating the samples at ambient temperature.
The conversion reaction was monitored by HIC-HPLC in real-time until the proprotein
was ≤ 1% of the total protein (Figure 13). At this endpoint, the 0.2 mg/mL sample
consisted of approximately 8% N-terminal variants, whereas the 1.0 mg/mL, 1.6 and
2.0 mg/mL samples consisted of approximately 14%, 19% and 29% N-terminal variants,
respectively. The remainder of the protein in each sample consisted of full-length
PRT-201. These results demonstrate that increasing concentrations of pro-PRT-201-55-003-VU
during conversion leads to the formation of more N-terminal variants and less full-length
PRT-201. Other studies have suggested that pro-PRT-201-55M3-003-VU conversion occurs
through both intramolecular and intermolecular reactions. Thus, for this variant proprotein,
it is likely that intramolecular reactions, which are favored in more dilute proprotein
solutions, give rise to more accurate conversion whereas intermolecular reactions,
favored in more concentrated proprotein solutions, result in less accurate conversion,
i.e., the formation of a higher percentage of the N-terminal variants relative to
full-length PRT-201.
[0336] In the second study, the effect of temperature on the production of N-terminal variants
during conversion was analyzed. Purified pro-PRT-201 from the 201-55M3-VU clone (named
pro-PRT-201-55M3-003-VU) was produced at a concentration of 1.6 mg/mL was subjected
to conversion as described above at either 15°C or 26°C. The conversion reactions
were monitored in real-time by HIC-HPLC and allowed to progress until the proprotein
comprised <1% of total protein. The time required to reach this reduction in proprotein
was approximately 30 minutes at 26°C and approximately 90 minutes at 15°C. At these
times, a similar percentage of N-terminal variants (about 20% of total protein) for
both temperatures was observed. Thus, the higher temperature of 26°C resulted in a
more rapid conversion reaction compared to the lower temperature of 15°C while producing
an essentially identical reaction product profile.
[0337] The third study examined the effect of buffer composition on proprotein solubility
during the conversion reaction. Purified pro-PRT-201 (pro-PRT-201-55M3-003-VU) at
a concentration of 1.0 mg/mL was subjected to conversion under the conditions listed
in Table 6. The conversion reactions were performed at ambient temperature except
for one (buffer composition of 20 mM Tris-HCl, 100 mM sodium chloride, pH 4.0) that
was performed at 2 to 8°C. Conversion reactions were inspected visually for precipitation.
As noted in Table 6, buffer compositions that did not result in precipitation included
100 mM Tris-HCl, pH 8.0; 100 mM Tris-HCl, 100 mM sodium chloride, pH 5.0; and 100
mM Tris-HCl, 300 mM sodium chloride, pH 8.0. Buffer compositions with lower concentrations
of Tris or without sodium chloride at lower pH (
i.e., pH 5.0) exhibited precipitation.
Table 6: Effect of buffer composition on precipitation during conversion.
| Buffer Composition |
Temperature |
Precipitation Observed |
Soluble (No Precipitation Observed) |
| 1 mM Tris-HCl, pH 5.0 |
Ambient |
+ |
|
| 25 mM Tris-HCl, pH 5.0 |
Ambient |
+ |
|
| 100 mM Tris-HCl, pH 5.0 |
Ambient |
+ |
|
| 100 mM Tris-HCl, pH 8.0 |
Ambient |
|
+ |
| 20 mM Tris-HCl, 100 mM sodium chloride, pH 4.0 |
2-8°C |
+ |
|
| 100 mM Tris-HCl, 100 mM sodium chloride, pH 5.0 |
Ambient |
|
+ |
| 100 mM Tris-HCl, 300 mM sodium chloride, pH 8.0 |
Ambient |
|
+ |
[0338] In the fourth study, the effect of tangential flow filtration diavolume number on
precipitation during conversion of supernatant containing proprotein (pro-PRT-201-55M3-003-VU)
was analyzed. The solution used for buffer exchange was 100 mM Tris-HCI, 100 mM sodium
chloride, pH 8.0. Additionally, a direct pH adjustment of the supernatant from pH
5.0 to 8.0 without tangential flow filtration was tested. As noted in Table 7, direct
pH adjustment of the supernatant resulted in a large amount of precipitation. With
1 diavolume of exchange, some precipitation was observed. No precipitation was observed
when 2 to 5 diavolumes were used.
Table 7: Effect of diavolume number on precipitation during buffer exchange.
| Diavolumes |
Precipitation Observed |
| 0 |
Major precipitation |
| 1 |
Minor precipitation |
| 2 |
No precipitation |
| 3 |
No precipitation |
| 5 |
No precipitation |
[0339] In the fifth study, the effect of pH on elastase activity of mature PRT-201 was analyzed.
This study was designed to identify a useful pH range for conversion that would not
result in an irreversible loss of elastase activity of the mature PRT-201 conversion
product. Solutions of 1 mg/mL PRT-201 in 20 mM Tris-HCl, 20 mM potassium phosphate
were prepared from pH 1 to 14. Solutions were kept at ambient temperature for 0.5,
2, 24 and 48 hours. At the indicated time points, the solutions were tested for elastase
activity in the SLAP assay. Elastase activity was largely stable from pH 3 to 8 at
all time points. At pHs less than 3 and greater 8, elastase activity was reduced at
all time points, with a correlation between longer time points and lower elastase
activity. These results indicated that a conversion reaction performed outside a pH
range of 3 to 8 could negatively impact elastase activity of the PRT-201 conversion
product.
6.8 EXAMPLE 7: PRODUCTION OF AUTO-ACTIVATED RECOMBINANT PORCINE TYPE I PANCREATIC ELASTASE
[0340] A vector encoding auto-activated porcine ELA-1 proenzyme was expressed
P. pastoris. The resulting auto-activated porcine ELA-1 was compared to a porcine ELA-1 protein
expressed as a trypsin-activated wild-type proprotein.
[0341] To construct the trypsin-activated porcine ELA-1 vector, the porcine ELA-1 coding
region was synthesized by Blue Heron Biotechnology (Bothell, WA) using a non-PCR "long
oligo" technique under license from Amgen (Thousand Oaks, CA). The recombinant gene
was cloned into the Blue Heron pUC vector, a derivative of pUC119. The porcine ELA-1
gene was sequenced on both strands to confirm the correct sequence. SacII and Xbal
restriction sites were incorporated as potential cloning sites flanking the porcine
ELA-1 gene as shown in Figure 14. A second stop codon was also added immediately after
the native stop codon to minimize potential ribosome read through. Figure 15 shows
the nature identical amino acid sequence of porcine ELA-1 proenzyme, which contains
the trypsin-activated site.
[0342] The coding region of porcine ELA-1 was amplified by PCR using a pair of oligonucleotides
containing XhoI and SacII restriction sites to facilitate cloning. The PCR product
was digested with Xhol and SacII and purified by agarose gel electrophoresis. The
porcine ELA-1 fragment was cloned into the PV-1 vector at XhoI and SacII restriction
sites. The
E. coli TOP 10 strain was transformed with the ligation mixture. The cell mixture was plated
on low salt LB plates supplemented with 25 mg/mL Zeocin. Drug-resistant clones were
picked and plasmid DNA was prepared (Qiagen, CA). Based on restriction analysis, a
clone containing the porcine ELA-1 gene insert was identified and the vector was named
pPROT101-24-V. The coding sequence of this vector was confirmed by DNA sequencing.
The cloning scheme for pPROT101-24-V is depicted in Figure 16.
[0343] Using the trypsin-activated pPROT101-24-V vector, three different auto-activated
clones were engineered by changing the trypsin cleavage site in the pro-peptide region
of porcine ELA-1 to elastase cleavage sites. Site-directed mutagenesis was performed
generally as described in Example 4 using synthetic oligonucleotide primers containing
the desired mutations as described in Table 8. All the mutations in the pro-peptide
region were confirmed by double-stranded DNA sequencing.

[0344] The wild-type NRRL Y-11430
P. pastoris strain was transformed and drug-resistant transformants were cultured and screened
for expression of the porcine ELA-1 proproteins as described in Example 3. Based on
analysis by SDS-PAGE and Coomassie staining (see Figure 17 and Figure 18), the wild-type
trypsin-activated pPROT101-24-V clones had the highest levels of expression compared
to the auto-activated clones. Of the auto-activated clones, the pPROT101-49-V clones
had the highest level of expression, followed by the pPROT101-55L-V clones and then
the pPROT101-49-V clones. Auto-activated pPROT101-42-V and pPROT101-55L-V proproteins
exhibited substantial spontaneous conversion during induction, while the trypsin-activated
pPROT101-24-V and auto-activated pPROT101-49-V proproteins showed greater stability
in the induction media.
[0345] Studies of the elastase activity of PRT-102 produced by trypsin activation of proelastase
protein expressed from pPROT101-24-V showed higher specific activity than PRT-201
as shown in Table 9 below:
Table 9: Elastase activity of three different samples of mature porcine type I pancreatic
elastase (trypsin activated) as compared to mature human type I pancreatic elastase.
| Sample Name |
PRT-201 |
PRT-102 |
PRT-102 |
PRT-102 |
| Activity as measured by SLAP (U/mg protein) (Replicates) |
34.6 |
91.8 |
99.4 |
100.7 |
| 32.9 |
88.3 |
91.3 |
88.6 |
| |
|
|
|
|
| Average of Replicates |
33.6 |
88.5 |
93.5 |
92.9 |
| Standard Deviation |
0.9 |
3.2 |
5.2 |
6.7 |
[0346] A small-scale conversion experiment was used to determine if pPROT101-55L-V and pPROT101-49-V
proproteins could be converted to mature enzymes exhibiting elastase activity. pPROT101-55L-V
and pPROT101-49-V shaker flask supernatants were concentrated 10-fold with an centrifugal
filter unit and diluted 5-fold with 100 mM Tris-HCl, pH 9.0. The conversion was allowed
to proceed at room temperature and elastase activity was monitored over time by SLAP
assay. The average change in absorbance per minute was determined from each time point
and reported as non-normalized reaction velocity (Figure 19). Conversion of both pPROT101-49-V
and pPROT101-55L-V supernatants resulted in an increase in elastase activity. The
final time point samples from each clone were analyzed by SDS-PAGE followed by Coomassie
staining and compared to pre-conversion samples (Figure 20). The SDS-PAGE results
confirmed that nearly all of the pPROT101-49-V proprotein was converted to mature
protein by the end of the conversion assay. The SDS-PAGE results also showed that
nearly all of the pPROT101-55L-V had been spontaneously converted to mature protein
prior to the conversion assay.
[0347] Purified preparations of pPROT101-24-V and pPROT101-49-V proproteins and mature enzymes
were submitted to Danforth Plant Science Center, MO for intact molecular weight analysis.
The proproteins were purified by cation exchange chromatography (Macroprep High S,
Bio-Rad). For mature enzyme analysis, the proproteins from both clones were first
treated to produce mature enzymes and then purified by cation exchange chromatography.
The trypsin-activated proprotein was treated with trypsin while the auto-activated
proprotein was converted in the presence of 100 mM Tris-HCl, pH 9.0, followed by cation
exchange chromatography. The major peaks obtained from mass spectrometry analysis
are listed in Table 10.
Table 10: Expected and observed molecular weights for porcine ELA-1 proteins.
| Protein |
Expected MW |
Observed MW |
| Trypsin-activated pPROT101-24-V proprotein |
27068 |
27064 |
| Trypsin-activated pPROT101-24-V mature enzyme |
25908 |
25898 |
| Auto-activated pPROT101-49-V proprotein |
27049 |
27047 |
| Auto-activated pPROT101-49-V mature enzyme |
25908 |
25910 |
[0348] SDS-PAGE, elastase activity and mass spectrometry results demonstrated that auto-activated
forms of type I porcine pancreatic elastase can be produced by engineering the propeptide
sequence to replace the trypsin cleavage site with an elastase cleavage site. The
expression levels of these auto-activated forms of type I porcine pancreatic elastase
are lower than the wild-type trypsin-activated form. Of the autoactivated clones tested,
those with the pPROT101-49-V pro-peptide sequence showed the highest level of expression
and the least spontaneous conversion. Conversion of the pPROT101-49-V and pPROT101-55L-V
clones resulted in the production of mature proteins with substantial elastase activity.
Mass spectrometry analysis revealed that the molecular weights of pPROT101-49-V proprotein
and mature porcine type I corresponded to the expected masses.
6.9 EXAMPLE 8: TRYPSIN ACTIVITY ANALYSIS OF MATURE RECOMBINANT HUMAN ELASTASE-1 BY BENZ
COLORIMETRIC PEPTIDE SUBSTRATE ASSAY
[0349] A colorimetric hydrolysis assay using the small peptide substrate N-benzoyl-Phe-Val-Arg-pNitroanilide
(BENZ) was performed to determine if purified mature elastase protein produced by
the auto-activated clone 201-55M3-003-VU possesses trypsin activity. Three vials of
lyophilized PRT-201 purified from clone 201-55M3-003-VU were retrieved from - 80°C
storage and reconstituted with water to obtain 1 mg/mL PRT-201 in 0.1 X PBS, pH 7.4.
Protein concentrations were confirmed by measuring UV absorbance at 280 nm. A TrypZean
stock solution (10 mg/mL) was used to generate a standard curve for trypsin activity.
A previously tested trypsin-activated PRT-201 sample was included as a positive control.
In addition, some experimental and control samples were spiked with TrypZean to determine
trypsin activity recovery in the presence of PRT-201. A subset of the spiked and unspiked
samples was treated with soybean trypsin inhibitor (SBTI) to determine the ability
of SBTI to inhibit any intrinsic or spiked trypsin activity. TrypZean standards were
also treated with SBTI to confirm the effectiveness of the inhibitor. See Table 11
below for a summary of the samples included in this study.
Table 11: TrypZean dilutions for the standard curve were prepared using the assay buffer (0.1
M Tris, pH 8.3). The standard curve for TrypZean solutions is shown in Figure 21.
| Description |
No addition |
Plus TrypZean spike (to 100 ng/mL) |
Plus SBTI (to 10 ug/mL) |
Plus TrypZean spike and SBTI |
| PRT-201 from clone 55M3 Vial #1 |
√ |
√ |
√ |
√ |
| PRT-201 from clone 55M3 Vial #2 |
√ |
√ |
√ |
√ |
| PRT-201 from clone 55M3 Vial #3 |
√ |
√ |
√ |
√ |
| PRT-201 from trypsin activated clone |
√ |
√ |
√ |
√ |
| Buffer only (0.1 M Tris, pH 8.3) |
√ |
Not done |
√ |
Not done |
| TrypZean standard, 1.56 ng/mL |
√ |
Not done |
√ |
Not done |
| TrypZean standard, 3.13 ng/mL |
√ |
Not done |
√ |
Not done |
| TrypZean standard, 6.25 ng/mL |
√ |
Not done |
√ |
Not done |
| TrypZean standard, 12.5 ng/mL |
√ |
Not done |
√ |
Not done |
| Tr5ypZean standard, 25 ng/mL |
√ |
Not done |
√ |
Not done |
| TrypZean standard, 50 ng/mL |
√ |
Not done |
√ |
Not done |
| TrypZean standard, 100 ng/mL |
√ |
Not done |
√ |
Not done |
[0350] The substrate solution was prepared (0.4 mg/mL N-benzoyl-Phe-Val-Arg-pNitroanilide
Lot 7733 in 0.1 M Tris, pH 8.3) and prewarmed to 30°C in a water bath. In triplicate,
100 microliters of each sample was pipetted into a 96-well microplate. Using a multichannel
pipettor, 200 microliters of substrate solution was pipetted into each well and the
microplate was immediately placed into a microplate reader preheated to 30°C. The
microplate reader recorded the absorbance at 405 nm for each well once per minute
for 60 minutes.
[0351] The PRT-201 samples were also tested for elastase activity in the SLAP assay. The
SLAP substrate solution was prepared (4.5 mg/mL SLAP in 0.1 M Tris, pH 8.3) and prewarmed
to 30°C in a water bath. The 1 mg/mL PRT-201 samples were diluted 20X with water to
0.05 mg/mL. In triplicate, 10 microliters of each sample dilution was pipetted into
a 96-well microplate. Using a multichannel pipettor, 300 microliters of SLAP substrate
solution was pipetted into each well and the microplate was immediately placed into
a microplate reader preheated to 30°C. The microplate reader recorded the absorbance
at 405 nm for each well once per minute for 5 minutes.
[0352] The results of the BENZ and SLAP activity assays are respectively presented in Tables
12 and 13 below.
Table 12. Mean trypsin activity, reported as TrypZean concentration equivalent (ng/mL). [a]
Coefficient of regression < 0.8.
| Description |
No addition |
Plus TrypZean spike (to 100 ng/mL) |
Plus SBTI (to 10 ug/mL) |
Plus TrypZean spike and SBTI |
| PRT-201 from clone 55M3 Vial #1 |
<1.56 [a] |
118.7 |
<1.56 [a] |
<1.56 [a] |
| PRT-201 from clone 55M3 Vial #2 |
<1.56 [a] |
122.4 |
<1.56 [a] |
<1.56 [a] |
| PRT-201 from clone 55M3 Vial #3 |
<1.56 [a] |
122.8 |
<1.56 [a] |
<1.56 [a] |
| PRT-201 from trypsin activated clone |
8.7 |
130.0 |
<1.56 [a] |
<1.56 [a] |
| Buffer only (0.1 M Tris, pH 8.3) |
1.3 |
Not done |
<1.56 [a] |
Not done |
| TrypZean standard, 1.56 ng/mL |
2.7 |
Not done |
<1.56 [a] |
Not done |
| TrypZean standard, 3.13 ng/mL |
3.7 |
Not done |
<1.56 [a] |
Not done |
| TrypZean standard, 6.25 ng/mL |
6.5 |
Not done |
<1.56 [a] |
Not done |
| TrvpZean standard, 12.5 ng/mL |
11.2 |
Not done |
<1.56 [a] |
Not done |
| Tr5vpZean standard, 25 ng/ml |
23.5 |
Not done |
<1.56 [a] |
Not done |
| TrvpZean standard, 50 ng/mL |
49.4 |
Not done |
<1.56 [a] |
Not done |
| TrypZean standard, 100 ng/mL |
102.4 |
Not done |
<1.56 [a] |
Not done |
Table 13. Mean SLAP activity, reported as U/mg
| Description |
No addition |
| PRT-201 from clone 55M3 Vial #1 |
34.9 |
| PRT-201 from clone 55M3 Vial #2 |
36.6 |
| PRT-201 from clone 55M3 Vial #3 |
35.7 |
| PRT-201 from trypsin activated clone |
32.1 |
[0353] The level of trypsin activity of PRT-201 from clone 201-55M3-003-VU was below the
range of the standard curve in the trypsin activity assay (<1.56 ng/mL). Additionally,
the coefficients of regression for the triplicate hydrolysis reactions were poor (<0.8),
further supporting the absence of trypsin activity in this auto-activated mature elastase
protein. In contrast, the level of trypsin activity of the control trypsin-activate
sample was determined to be 8.7 ng/mL.
7. SEQUENCE LISTING
[0354]
| SEQ ID NO. |
Description |
Type of sequence |
Sequence |
| 1 |
Mature human elastase I, including first "valine" |
Amino acid, single letter format, wherein: |
 |
| |
X = V or L |
| 2 |
Mature human elastase I, minus first "valine" |
Amino acid, single letter format, wherein: |
 |
| |
X = V or L |
| 3 |
Mature human elastase I, minus first two "valines" |
Amino acid, single letter format, wherein: |
 |
| |
X = V or L |
| 4 |
Mature human elastase I, with first "valine" substituted by "alanine" |
Amino acid, single letter format, wherein: |
 |
| |
X = V or L |
| 5 |
Mature human elastase I (isotype 2), including first "valine" |
Amino acid, single letter format |
 |
| 6 |
Engineered elastase proprotein no. 1 (pPROT42 variant) |
Amino acid, single letter format, wherein X = V or L |
 |
| 7 |
Engineered elastase proprotein no. 2 |
Amino acid, single letter format, wherein: |
 |
| |
X = V or L |
| 8 |
Engineered elastase proprotein no. 3 |
Amino acid, single letter format, wherein: |
 |
| |
X = V or L |
| 9 |
Engineered elastase proprotein no. 4 |
Amino acid, single letter format, wherein: |
 |
| |
X = V or L |
| 10 |
Wild-type elastase proprotein no. 5 (produced from pPROT24 trypsin activated sequence) |
Amino acid, single letter format, wherein: |
 |
| |
X = V or L |
| 11 |
Consensus elastase recognition sequence 1 (Positions Xaa1=P3, Xaa2=P2, Xaa3=P1) |
Amino acid, three letter format |
Xaa1 Xaa2 Xaa3 |
| |
Xaa1= alanine, leucine, isoleucine, methionine, lysine, asparagine or valine |
| |
Xaa2 = proline, alanine, leucine, isoleucine, glycine, valine, or threonine |
| |
Xaa3 = alanine, leucine, valine, isoleucine, or serine |
| 12 |
Consensus elastase recognition sequence 2 (Positions P3-P2-P1) |
Amino acid, three letter format |
Xaa1 Pro Xaa2 |
| |
|
Xaa1 = alanine, leucine, isoleucine, methionine, lysine, or valine |
| |
|
Xaa2 = alanine, leucine, valine, isoleucine, or serine |
| 13 |
Consensus elastase recognition sequence 3 (Positions P3-P2-P1) |
Amino acid, three letter format |
Xaa1 Xaa2 Xaa3 |
| |
Xaa1= asparagine or alanine |
| |
Xaa2 = proline or alanine |
| |
Xaa3 = alanine or leucine or valine |
| 14 |
Elastase recognition sequence 1 (Positions P3-P2-P1) |
Amino acid, three letter format |
Ala Ala Ala |
| 15 |
Elastase recognition sequence 2 (Positions P3-P2-P1) |
Amino acid, three letter format |
Asn Ala Ala |
| 16 |
Elastase recognition sequence 3 (Positions P3-P2-P1) |
Amino acid, three letter format |
Asn Ala Pro |
| 17 |
Wild-type trypsin recognition sequence (pPROT24) (Positions P3-P2-P1) |
Amino acid, three letter format |
Asn Ala Arg |
| 18 |
Elastase recognition sequence 5 (Positions P3-P2-P1) |
Amino acid, three letter format |
Ala Pro Ala |
| 19 |
Elastase recognition sequence 6 (Positions P3-P2-P1) |
Amino acid, three letter format |
Ala Ala Pro |
| 20 |
Elastase recognition sequence 7 (Positions P3-P2-P1 of Variants 48 and 55) |
Amino acid, three letter format |
Asn Pro Ala |
| 21 |
Elastase recognition sequence 8 |
Amino acid, three letter format |
Leu Pro Ala |
| 22 |
Human elastase activation sequence 1 (Wild-type) |
Amino acid, three letter format |
Thr Gln Asp Leu Pro Glu Thr Asn Ala Arg |
| 23 |
Human elastase activation sequence 2 |
Amino acid, three letter format |
Thr Gln Asp Leu Pro Glu Thr Asn Ala Ala |
| 24 |
pro-PROT-201 cleavage site |
Amino acid, three letter format |
Thr Asn Ala Arg Val Val Gly Gly |
| 25 |
pPROT40 cleavage site |
Amino acid, three letter format |
Thr Ala Ala Ala Val Val Gly Gly |
| 26 |
pPROT41 cleavage site |
Amino acid, three letter format |
Thr Asn Ala Ala Ala Val Gly Gly |
| 27 |
pPROT42 cleavage site |
Amino acid, three letter format |
Thr Asn Ala Ala Val Val Gly Gly |
| 28 |
pPROT43 cleavage site |
Amino acid, three letter format |
Thr Asn Ala Pro Val Val Gly Gly |
| 29 |
pPROT44 cleavage site |
Amino acid, three letter format |
Thr Gly Ala Gly Ile Val Gly Gly |
| 30 |
pPROT45 cleavage site |
Amino acid, three letter format |
Thr Val Pro Gly Val Val Gly Gly |
| 31 |
pPROT46 cleavage site |
Amino acid, three letter format |
Thr Ala Pro Gly Val Val Gly Gly |
| 32 |
pPROT47 cleavage site |
Amino acid, three letter format |
Thr Asn Pro Gly Val Val Gly Gly |
| 33 |
Coding region of a human elastase-1 (NCBI Accession No. N_001971) |
Nucleotide |
 |
| 34 |
Yeast alpha factor signal peptide |
Amino acid, three letter format |
 |
| 35 |
20F primer |
Nucleotide |
 |
| 36 |
24R primer |
Nucleotide |
gggccgcggcttatcagttggaggcgatgacat |
| 37 |
pPROT42 P3 cleavage site variant elastase |
Amino acid, single letter format, wherein: |
 |
| |
X - V or L |
| 38 |
pPROT42 P2 cleavage site variant elastase |
Amino acid, single letter format, wherein: |
 |
| |
X = V or L |
| 39 |
Mature porcine pancreatic elastase I (from GenBank Accession P00772.1) |
Amino acid, single letter format |
 |
| 40 |
Elastase variant propeptide cleavage domain 40 |
Amino acid, three letter format |
Glu Thr Ala Ala Ala Val Val Gly |
| 41 |
Elastase variant propeptide cleavage domain 41 |
Amino acid, three letter format |
Glu Thr Asn Ala Ala Ala Val Gly |
| 42 |
Elastase variant propeptide cleavage domain 42 |
Amino acid, three letter format |
Glu Thr Asn Ala Ala Val Val Gly |
| 43 |
Elastase variant propeptide cleavage domain 43 |
Amino acid, three letter format |
Glu Thr Asn Ala Pro Val Val Gly |
| 44 |
Elastase variant propeptide cleavage domain 44 |
Amino acid, three letter format |
Glu Thr Gly Ala Gly Ile Val Gly |
| 45 |
Elastase varia nt propeptide cleavage domain 45 |
Amino acid, three letter format |
Glu Thr Val Pro Gly Val Val Gly |
| 46 |
Elastase variant propeptide cleavage domain 46 |
Amino acid, three letter format |
Glu Thr Ala Pro Gly Val Val Gly |
| 47 |
Elastase variant propeptide cleavage domain 47 |
Amino acid, three letter format |
Glu Thr Asn Pro Gly Val Val Gly |
| 48 |
Elastase variant propeptide cleavage domain 48 |
Amino acid, three letter format |
Glu Thr Asn Pro Ala Val Val Gly |
| 49 |
Elastase variant propeptide cleavage domain 49 |
Amino acid, three letter format |
Glu Thr Asn His Ala Val Val Gly |
| 50 |
Yeast alphamating factor signal peptide, propeptide, and spacer sequence 1 |
Amino acid, three letter format |
 |
| 51 |
Yeast alphamating factor signal peptide and propeptide sequence 2 |
Amino acid, three letter format |
 |
| 52 |
Elastase variant propeptide cleavage domain 52 |
Amino acid, three letter format |
Glu Thr Lys Pro Ala Val Val Gly |
| 53 |
Elastase variant propeptide cleavage domain 53 |
Amino acid, three letter format |
Glu Thr His Pro Ala Val Val Gly |
| 54 |
Elastase variant propeptide cleavage domain 54 |
Amino acid, three letter format |
Glu His Asn Pro Ala Val Val Gly |
| 55 |
Elastase variant propeptide cleavage domain 55 |
Amino acid, three letter format |
His Thr Asn Pro Ala Val Val Gly |
| 56 |
Elastase variant propeptide cleavage domain 56 |
Amino acid, three letter format |
Pro Thr His Pro Ala Val Val Gly |
| 57 |
Elastase variant propeptide cleavage domain 57 |
Amino acid, three letter format |
Pro Thr Asn Pro Ala Val Val Gly |
| 58 |
Elastase variant propeptide cleavage domain 58 |
Amino acid, three letter format |
His Thr His Pro Ala Val Val Gly |
| 59 |
Elastase variant propeptide cleavage domain 59 |
Amino acid, three letter format |
Glu Thr Phe Pro Ala Val Val Gly |
| 60 |
Elastase variant propeptide cleavage domain 60 |
Amino acid, three letter format |
His Thr Phe Pro Ala Val Val Gly |
| 61 |
Elastase variant propeptide cleavage domain 61 |
Amino acid, three letter format |
Gly Thr Phe Pro Ala Val Val Gly |
| 62 |
Elastase variant propeptide cleavage domain 62 |
Amino acid, three letter format |
His Thr Gly Pro Ala Val Val Gly |
| 63 |
Elastase variant propeptide cleavage domain 63 |
Amino acid, three letter format |
His Thr Lys Pro Ala Val Val Gly |
| 64 |
Elastase proenzyme with variant cleavage domain 48 |
Amino acid, single letter format, wherein: |
 |
| |
X = V or L |
| 65 |
Elastase proenzyme with variant cleavage domain 49 |
Amino acid, single letter format, wherein: |
 |
| |
X = V or L |
| 66 |
Elastase proenzyme with variant cleavage domain 52 |
Amino acid, single letter format, wherein: |
 |
| |
X = V or L |
| 67 |
Elastase proenzyme with variant cleavage domain 53 |
Amino acid, single letter format, wherein: |
 |
| |
X = V or L |
| 68 |
Elastase proenzyme with variant cleavage domain 54 |
Amino acid, single letter format, wherein: |
 |
| |
X = V or L |
| 69 |
Elastase proenzyme with variant cleavage domain 55 |
Amino acid, single letter format, wherein: |
 |
| |
X = V or L |
| 70 |
Wild-type elastase +AlaArg cleavage variant |
Amino acid, single letter format, wherein: |
 |
| |
X = V or L |
| 71 |
Wild-type elastase +Arg cleavage variant |
Amino acid, single letter format, wherein: |
 |
| |
X = V or L |
| 72 |
Variant 48 human elastase activation peptide |
Amino acid, three letter format |
Thr Gln Asp Leu Pro Glu Thr Asn Pro Ala |
| 73 |
Variant 55 human elastase activation peptide |
Amino acid, three letter format |
Thr Gln Asp Leu Pro His Thr Asn Pro Ala |
| 74 |
Human elastase cleavage domain consensus sequence; corresponds to residues P5, P4,
P3, P2, P1, P'1, P'2, and P'3 of an elastase cleavage domain |
Amino acid, three letter format |
Xaa1 Xaa2 Xaa3 Xaa4 Xaa5 Xaa6 Xaa7 Xaa8 |
| |
|
Xaa1 = glutamate, histidine, proline, glycine, asparagine, lysine, or alanine |
| |
|
Xaa2 = threonine, alanine, proline or histidine |
| |
|
Xaa3 = alanine, leucine, isoleucine, methionine, lysine, asparagine or valine |
| |
|
Xaa4 = proline, alanine, leucine, isoleucine, glycine, valine, or threonine |
| |
|
Xaa5 = alanine, leucine, valine, isoleucine, or serine |
| |
|
Xaa6 = alanine, leucine, valine, isoleucine or serine |
| |
|
Xaa7 = glycine, alanine, or valine |
| |
|
Xaa8 = valine, threonine, phenylalanine, tyrosine, or tryptophan |
| 75 |
PCR mutagenesis primer |
Nucleic Acid |
ATC TAC GTA GTC GGA GGG ACT GAG GCC |
| 76 |
PCR mutagenesis primer |
Nucleic Acid |
gtc gac aag ctt atc agt tgg agg cga t |
| 77 |
Mature ELA1 C-terminal variant of Talas et al. |
Protein, single letter format |
 |
| 78 |
Mature ELA1 variants |
Protein, single letter format, wherein: |
 |
| |
B = W or R |
| |
J = M or V |
| |
X = V or L |
| |
Z = Q or R |
| 79 |
Activation peptide variants (wild-type, trypsin cleavable) |
Protein, single letter format, wherein |
TUDLPETNAR |
| |
U = Q or H |
|
| 80 |
Activation peptide variant consensus |
Protein, three letter format |
Thr Xaa1 Asp Leu Pro Xaa2 Xaa3 Xaa4 Xaa5 Xaa6 |
| |
Xaa1 = glutamine or histidine |
| |
Xaa2 = glutamate, histidine, proline, glycine, asparagine, lysine, or alanine |
| |
Xaa3 = threonine, alanine, proline or histidine |
| |
Xaa4 = alanine, leucine, isoleucine, methionine, lysine, asparagine or valine |
| |
Xaa5= proline, alanine, leucine, isoleucine, glycine, valine, or threonine |
| |
Xaa6 = alanine, leucine, valine, isoleucine, or serine |
| 81 |
Coding region of ELA-1.2A |
Nucleotide |
 |
| 82 |
Translation product of ELA-1.2A |
Protein, single letter format |
 |
| |
(trypsin activated pPROT24 sequence) |
|
| 83 |
Variants of translation product of ELA-1.2A |
Protein, single letter format, wherein: |
 |
| |
U = Q or H |
| |
B = W or R |
| |
(trypsin activated pPROT24 sequence) |
J = M or V |
| |
X = V or L |
| |
Z = Q or R |
| 84 |
Mature human elastase I, including first "valine" |
Amino acid, single letter format, wherein: |
 |
| |
B = W or R |
| |
J = M or V |
| |
X = V or L |
| |
Z = Q or R |
| 85 |
Mature human elastase I, minus first "valine" |
Amino acid, single letter format, wherein: |
 |
| |
B = W or R |
| |
J = M or V |
| |
X = V or L |
| |
Z = Q or R |
| 86 |
Mature human elastase I, minus first two "valines" |
Amino acid, single letter format, wherein: |
 |
| |
B = W or R |
| |
J = M or V |
| |
X = V or L |
| |
Z = Q or R |
| 87 |
Mature human elastase I, with first "valine" substituted by "alanine" |
Amino acid, single letter format, wherein: |
 |
| |
B = W or R |
| |
J = M or V |
| |
X = V or L |
| |
Z = Q or R |
| 88 |
Engineered elastase proprotein no. 1 (pPROT42 variant) |
Amino acid, single letter format, wherein: |
 |
| |
U = Q or H |
| |
B = W or R |
| |
J = M or V |
| |
X = V or L |
| |
Z = Q or R |
| 89 |
Engineered elastase proprotein no. 2 |
Amino acid, single letter format, wherein: |
 |
| |
U = Q or H |
| |
B = W or R |
| |
J = M or V |
| |
X = V or L |
| |
Z = Q or R |
| 90 |
Engineered elastase proprotein no. 3 |
Amino acid, single letter format, wherein: |
 |
| |
U = Q or H |
| |
B = W or R |
| |
J = M or V |
| |
X = V or L |
| |
Z = Q or R |
| 91 |
Engineered elastase proprotein no. 4 |
Amino acid, single letter format, wherein: |
 |
| |
U = Q or H |
| |
B = W or R |
| |
J = M or V |
| |
X = V or L |
| |
Z = Q or R |
| 92 |
Engineered elastase proprotein no. 5 (pPROT24 trypsin activated sequence) |
Amino acid, single letter format, wherein: |
 |
| |
U = Q or H |
| |
B = W or R |
| |
J = M or V |
| |
X = V or L |
| |
Z = Q or R |
| 93 |
Consensus elastase recognition sequence 2 (Positions P3-P2-P1) |
Amino acid, three letter |
Xaa1 Pro Xaa2 |
| |
format |
Xaa1 = alanine, leucine, isoleucine, methionine, lysine, asparagine or valine |
| |
|
Xaa2 = alanine, leucine, valine, isoleucine, or serine |
| 94 |
pPROT42 P3 cleavage site variant elastase |
Amino acid, single letter format, wherein: |
 |
| |
B = W or R |
| |
J = M or V |
| |
X = V or L |
| |
Z = Q or R |
| 95 |
pPROT42 P2 cleavage site variant elastase |
Amino acid, single letter format, wherein: |
 |
| |
B = W or R |
| |
J = M or V |
| |
X = V or L |
| |
Z = Q or R |
| 96 |
Yeast alphamating factor signal peptide, propeptide, and spacer sequence |
Amino acid, three letter format |
 |
| 97 |
Yeast alphamating factor signal peptide and propeptide sequence |
Amino acid, three letter format |
 |
| 98 |
Elastase proenzyme with variant cleavage domain 48 |
Amino acid, single letter format, wherein: |
 |
| |
U = Q or H |
| |
B = W or R |
| |
J = M or V |
| |
X = V or L |
| |
Z = Q or R |
| 99 |
Elastase proenzyme with variant cleavage domain 49 |
Amino acid, single letter format, wherein: |
 |
| |
U = Q or H |
| |
B = W or R |
| |
J = M or V |
| |
X = V or L |
| |
Z = Q or R |
| 100 |
Elastase proenzyme with variant cleavage domain 52 |
Amino acid, single letter format, wherein: |
 |
| |
U = Q or H |
| |
B = W or R |
| |
J = M or V |
| |
X = V or L |
| |
Z = Q or R |
| 101 |
Elastase proenzyme with variant cleavage domain 53 |
Amino acid, single letter format, wherein: |
 |
| |
U = Q or H |
| |
B = W or R |
| |
J = M or V |
| |
X = V or L |
| |
Z = Q or R |
| 102 |
Elastase proenzyme with variant cleavage domain 54 |
Amino acid, single letter format, wherein: |
 |
| |
U = Q or H |
| |
B = W or R |
| |
J = M or V |
| |
X = V or L |
| |
Z = Q or R |
| 103 |
Elastase proenzyme with variant cleavage domain 55 |
Amino acid, single letter format, wherein: |
 |
| |
U = Q or H |
| |
B = W or R |
| |
J = M or V |
| |
X = V or L |
| |
Z = Q or R |
| 104 |
Wild-type elastase +AlaArg cleavage variant |
Amino acid, single letter format, wherein: |
 |
| |
B = W or R |
| |
J = M or V |
| |
X = V or L |
| |
Z = Q or R |
| 105 |
Wild-type elastase +Arg cleavage variant |
Amino acid, single letter format, wherein: |
 |
| |
B = W or R |
| |
J = M or V |
| |
X = V or L |
| |
Z = Q or R |
| 106 |
Mature human elastase I, minus N terminal "VVGG" sequence |
Amino acid, single letter format, wherein: |
 |
| |
B = W or R |
| |
J = M or V |
| |
X = V or L |
| |
Z = Q or R |
| 107 |
Mature human elastase I, minus N terminal "VVGGTE" sequence |
Amino acid, single letter format, wherein: |
 |
| |
B = W or R |
| |
J = M or V |
| |
X = V or L |
| |
Z = Q or R |
| 108 |
Mature human elastase I, minus N terminal "VVGGTEA GR" sequence |
Amino acid, single letter format, wherein: |
 |
| |
B = W or R |
| |
J = M or V |
| |
X = V or L |
| |
Z = Q or R |
| 109 |
Figure 1A sequence |
Nucleic Acid |
 |
| 110 |
Figure 1A sequence |
Amino Acid, single letter format |
 |
| 111 |
Figure 1B sequence |
Nucleic Acid |
 |
| 112 |
Figure 1B sequence |
Amino Acid, three letter format |
 |
| 113 |
Figure 13 sequence |
Nucleic Acid |
 |
| 114 |
Figure 14 sequence |
Amino Acid, single letter format |
 |
| 115 |
Cleavage domain sequence of trypsinactivated pPROT101-24-V |
Amino Acid, three letter format |
Phe Pro Glu Thr Asn Ala Arg Val Val Gly |
| 116 |
Cleavage domain sequence of auto-activated pPROT101-42-V |
Amino Acid |
Phe Pro Glu Thr Asn Ala Ala Val Val Gly |
| 117 |
Cleavage domain sequence of auto-activated pPROT101-49-V |
Amino Acid |
Leu Pro His Thr Asn Pro Ala Val Val Gly |
| 118 |
Cleavage domain sequence of auto-activated pPROT101-55L-V |
Amino Acid |
Phe Pro Glu Thr Asn His Ala Val Val Gly |