(19)
(11) EP 2 298 066 A9

(12) CORRECTED EUROPEAN PATENT APPLICATION
Note: Bibliography reflects the latest situation

(15) Correction information:
Corrected version no 1 (W1 A1)
Corrections, see
Drawings

(48) Corrigendum issued on:
26.10.2011 Bulletin 2011/43

(43) Date of publication:
23.03.2011 Bulletin 2011/12

(21) Application number: 10183322.6

(22) Date of filing: 05.07.2004
(51) International Patent Classification (IPC): 
A01H 1/02(2006.01)
A01H 5/00(2006.01)
C12N 15/11(2006.01)
A01H 1/06(2006.01)
A01H 5/10(2006.01)
C12Q 1/68(2006.01)
(84) Designated Contracting States:
AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PL PT RO SE SI SK TR

(30) Priority: 04.07.2003 EP 03291677
08.12.2003 EP 03293057

(62) Application number of the earlier application in accordance with Art. 76 EPC:
09175998.5 / 2179643
04744142.3 / 1641336

(71) Applicant: INSTITUT NATIONAL DE LA RECHERCHE AGRONOMIQUE
75007 Paris (FR)

(72) Inventors:
  • Primard-Brisset, Catherine
    78470 Saint Remy Les Chevreuse (FR)
  • Delourme, Régine
    35590 L'Hermitage (FR)
  • Poupard, Jean-Pierre
    78026 Versailles (FR)
  • Horvais, Raymonde
    35440 MontreuilL-sur-Ille (FR)
  • Budar, Françoise
    91470 Les Molieres (FR)
  • Pelletier, Georges
    91440 Bures Sur Yvette (FR)
  • Renard, Michel
    35650 Le Rheu (FR)

(74) Representative: Faivre Petit, Frédérique et al
Cabinet Regimbeau 20, rue de Chazelles
75847 Paris Cedex 17
75847 Paris Cedex 17 (FR)

 
Remarks:
This application was filed on 30-09-2010 as a divisional application to the application mentioned under INID code 62.
 


(54) Method of producing double low restorer lines of Brassica napus having a good agronomic value


(57) A method of producing double low restorer line of Brassica napus for Ogura cytoplasmic male sterility (cms) presenting radish introgression carrying the Rfo restorer gene deleted of the radish Pgi-2 allele and recombined with the Pgi-2 gene from Brassica oleracea, and having a good agronomic value characterized by female fertility, a good transmission rate of Rfo and a high vegetative vigour. A method of forming Brassica napus hybrid seeds and progeny thereof. The seeds of Brassica napus and use of the combined markers PGIol, PGIunt, PGIint, BolJon and CP418 for characterising.




Description


[0001] The invention relates to a method of producing a double low restorer lines of Brassica napus for Ogura cytoplasmic male sterility (cms) presenting a radish introgression carrying the Rfo restorer genes deleted of the radish Pgi-2 allele and recombined with the Pgi-2 gene from Brassica oleracea, and having a good agronomic value characterized by female fertility, a good transmission rate of Rfo and a high vegetative vigour. The invention relates also to a method of forming Brassica napus hybrid seed and progeny thereof and to the use of markers for selection.

[0002] Breeding restorer lines for the Ogu-INRA Cytoplasmic Male Sterility (cms) system in rapeseed (Brassica napus L.) has been a major objective during the past few years. Extensive backcross and pedigree breeding were necessary to improve their female fertility and to get double low restorer lines. The so-called « double low » varieties are those low in erucic acid in the oil and low in glucosinolates in the solid meal remaining after oil extraction. However some difficulties can still be encountered in breeding these lines (introgression rearrangements, possible linkage with negative traits) due to the large size of the radish introgression.

[0003] The inventors thus assigned themselves the objective of providing a new improved double low restorer line with a good agronomic value.

[0004] This objective is obtained by a new method of producing a recombined double low restorer line for the Ogu-INRA cms in rapeseed.

[0005] A first object of the present invention relates to a method of producing double low restorer lines of Brassica napus for Ogura cms presenting radis introgression carrying the Rfo restorer gene deleted of the radish Pgi-2 allele and recombined with the Pgi-2 gene from Brassica oleracea, and having a good agronomic value characterised by female fertility, a good transmission rate of Rfo and a high vegetative vigour, said method including the step of:
  1. a) crossing double low cms lines of spring Brassica napus comprising a deleted radish insertion with the double low line of spring Drakkar for forming heterozygous restored plants of Brassica napus,
  2. b) irradiating before meiosis the heterozygous restored plants obtained in step a) with gamma ray irradiation,
  3. c) crossing pollen from flowers obtained in step b) with the cms double low spring Wesroona line,
  4. d) testing the progeny for vigour, female fertility and transmission rate of the cms gene,
  5. e) selecting progeny lines.


[0006] According to one advantageous form of embodiment of the method of the present invention, the irradiation dose in step b) is 65 Gray during 6 mn.

[0007] According to one advantageous form of embodiment of the method according to the present invention, the double low cms line of spring Brassica napus of step a) is R211.

[0008] R211 is an INRA spring restorer line.

[0009] Drakkar is a French spring registered variety.

[0010] Wesroona is an Australian spring registered variety.

[0011] According to one advantageous form of embodiment of the method according to the present invention, the testing in step d) is performed with the combination of five markers selected from PGlol, PGIUNT, PGlint, BolJon and CP418.

[0012] Another object of the present invention relates to double low restorer lines of Brassica napus for Ogura cms presenting a Rfo insertion deleted of the radish Pgi-2 allele and recombined with the Pgi-2 gene from Brassica oleracea, and having a good agronomic value characterised by female fertility, a good transmission rate of Rfo and a high vegetative vigour.

[0013] According to one advantageous form of embodiment, the double low restorer lines present a unique combination of five markers selected from PGIol, PGIUNT, PGIint, Boron and CP418.

[0014] Another object of the present invention relates to Brassica napus hybrid plants and progeny thereof obtained though the steps of
  1. a) providing a restorer line produced according to the previous disclosed method of the invention and bred to be homozygous,
  2. b) using said restorer line in a hybrid production field as the pollinator,
  3. c) using cms sterile plants in a hybrid production field as the hybrid seed producing plant, and
  4. d) harvesting the hybrid seed from the male sterile plant.


[0015] Another object of the present invention relates to seeds of Brassica plant obtained from the methods according to the present invention.

[0016] Still another object of the invention relates to seeds of Brassica napus deposited in NCIMB Limited, 23 St Machar Drive, Aberdeen, Scotland, AB24 3RY, UK, on July 4, 2003, under the reference number NCIMB41183.

[0017] Another object of the present invention relates to the use of at least four markers PGIol, PGIint, BolJon and CP418, or any portion of them comprising at least one polymorphic site, for characterising recombined restorer lines of Brassica napus for Ogura cms presenting a Rfo insertion deleted of the radish Pgi-2 allele and recombined with the Pgi-2 gene from Brassica oleracea, and having a good agronomic value characterised by female fertility, a good transmission rate of Rfo and a high vegetative vigour.

[0018] In a preferred embodiment, the combination is of five markers PGIol, PGIUNT, PGIint, BolJon and CP418.

[0019] In the present invention, the expression "any portion of them comprising at least one polymorphic site" means any part of the sequence showing at least a difference between the B. oleracea type sequence and B. rapa type sequence.

[0020] Such markers are represented in the following figures and sequence listing for the R2000 line, a double low restorer lines of Brassica napus for cms according to the present invention.

[0021] According to one advantageous form of embodiment, the present invention relates to:
  • The marker PGIol which is amplified using the primers: PGIol U and PGIol L
    (PGIol U: 5'TCATTTGATTGTTGCGCCTG3';
    PGIol L: 5'TGTACATCAGACCCGGTAGAAAA3')
  • The marker PGIint which is amplified using the primers: PGIint U and PGIint L
    (PGIint U: 5'CAGCACTAATCTTGCGGTATG3';
    PGIint L: 5'CAATAACCCTAAAAGCACCTG3')
  • The marker PGIUNT which is amplified using the primers: PGIol U and PGIint L:

    (PGIol U: 5'TCATTTGATTGTTGCGCCTG3';

    PGIint L: 5'CAATAACCCTAAAAGCACCTG3')

  • The marker BolJon which is amplified using the primers: BolJon U and BolJon L:

    (BolJon U: 5'GATCCGATTCTTCTCCTGTTG3';

    BolJon L: 5'GCCTACTCCTCAAATCACTCT3')

  • The marker CP418 which is amplified using the primers: SG129 U and pCP418 L:
    (SG129 U: cf. Giancola et al., 2003 Theor Appl. Genet. (in press)
    pCP418 L: 5'AATTTCTCCATCACAAGGACC3')


[0022] Another object of the present invention relates to the PGlol, PGIUNT, PGIint, BolJon and CP418 markers whose sequences follow:

PGlol R2000 marker:



[0023] 


PGIUNT R2000 marker:



[0024] 


PGIint R2000 marker:



[0025] 




BolJon R2000 marker:



[0026] 


CP418L R2000 marker:



[0027] 



[0028] In the annexed drawing that follows, the following abbreviations are used:
Dra
Drakkar
Rel-15-1, E38, R15
R2000
Hete, Hel, R211.Drakkar
heterozygous R211 *Drakkar
Darm
Darmor
Bol:
Brassica oleracea
Bra, B.rap:
Brassica rapa
GCPA18-A19, Wes, Aust:
Wesroona
Sam, SamlPGIolSunt5
Samourai
RRH1, ba2c
RRH1
rav, N.WR
Hybrid Brassica napus*wild Radish
  • Figure 1 illustrates Gamma ray Iradiation and F2 production.
  • Figure 2 illustrates seed set on 'R211' and 'R2000'.
  • Figure 3 illustrates the number of seeds per pod of different lines.
  • Figure 4 illustrates PGIol primer localisation on the segment of PGI sequence from Data Base. In that figure:

    PGIol: - primer PGIol U (named in SGAP: BnPGIch 1 U)

    • primer PGIol L (named in SGAP: Bn PGIch 1 L)

    PGIint: - primer PGIint U

    • primer PGIint L (is out side the sequence).

  • Figure 5 illustrates electrophoresis gel of PGI-2 gene (PGIol), PCR marker and SG34, a PCR marker close to Rfo.
  • Figure 6 illustrates Pgi-2 segment of DNA amplified by PCR with PGIol primers.
  • Figure 7 illustrates digestion of the PCR product PGIol by Mse1.


[0029] In that figure:
Sam and Darm has a 75bp band.
Drak, R211.Dk and R2000 showed a 70pb one (Acrylamide 15%).
8 was similar to Samourai (75bp); mix with Drakkar (70pb) it allowed the visualisation of the two bands.
  • Figure 8 illustrates electrophoresis agarose gel of PGIUNT marker.


[0030] In that figure:

PGIUNT band (about 980bp) is present in B. oleracea, B. rapa cv Asko, maintainer and restored lines except in 'R211'.



[0031] There is no amplification in radish and Arabidopsis.

[0032] In various Brassica genotypes only one band was amplified. Size band are similar but sequences are different. - Figure 9 illustrates electrophoresis gel of PGIint PCR marker.

[0033] In that figure PGIint of radish line 7 is of about 950bp. This band is the same as in the restored RRH1 and R113. It is not found in R211. It is not either in R2000. However the PGIint band is of a similar size of about 870bp in the various Brassica species, but sequences are different.
  • Figure 10 illustrates electrophoresis agarose gel of BolJon PCR marker.
  • Figure 11 illustrates electrophoresis agarose gel of CP418 marker.


[0034] In that figure, the CP418 band (of about 670bp) is specific to the B. oleracea genome. It is present in B. ol, B. napus (Samourai, Drakkar, Pactol and the herterozygous R211 *Dk). It is absent from the restored rapeseed (RRH, R113 and R211). It is present in the homozygous R2000.
  • Figure 12 illustrates summary markers table.
  • Figures 13(a), 13(b) illustrate PGIol marker sequence alignment between Arabidopsis, Radish, B. rapa, B. oleracea and R2000.
  • Figures 14(a), 14(b), 14(c), 14(d) illustrate the PGlint-UNT marker sequence alignment between Arabidopsis, Radish, B. rapa, B. oleracea and R2000.
  • Figures 15(a), 15(b), 15(c) illustrate the CP418L marker sequence alignment between Arabidopsis, Radish, B. rapa, B. oleracea and R2000.
  • Figures 16 and 16bis illustrate Arabidopsis, Radish and B. rapa BolJon markers. There are aligned with DB sequences of Arabidopsis (AC007190end-AC01 1000beginning), the B. oleracea EMBH959102 end and EMBH448336 beginning and representative consensus sequences of the SG129markers band 1 and 2 in B. napus (in Drakkar and Samourai respectively).


[0035] From the point 836bp, AC07190-AC11000 and GCPATpBOJ sequences are no longer closely homologous to the Brassica sequences.

[0036] The radish and B. rapa (GCPconsen RsRf BOJ and BR) sequences are still closely homologous to the B. napus one, from 858bp point to the 900bp and 981 points respectively.

[0037] In radish, only partial homology is found on the Brassica sequence further down.

[0038] In B. rapa species cv Asko, the left of its BolJon sequence can be aligned again, after a 78bp deletion, with those of B. oleracea and B. rapa in B. napus from the 1057bp point to the BolJon L primer.
  • Figures 17 and 17bis illustrate the localisation of Pgi-2 primers on the Arabidopsis th MJB21.12 sequence.
  • Figure 18 illustrates the BolJon primers localisation on the mipsAtl62850 gene and overlapping area of AC007190 and ACO11000 Arabidopsis th clones. Alignment with the Arabidopsis BolJon PCR product (740bp) is presented.


[0039] It should be understood, however, that the examples are given solely by way of illustration of the object of the invention, of which they in no way constitute a limitation.

Example I: Method of producing a double low restorer line of Brassica napus for Ogura cms presenting a radish introgression, carrying the Rfo restorer gene deleted of the radish Pgi-2 allele and recombined with the Pgi-2 gene from Brassica oleracea, and having a good agronomic value characterised by female fertility, a good transmission rate of Rfo and a high vegetative vigour.


Materials and methods:



[0040] Genotypes: The `R211' line with a deleted radish insertion was crossed to the spring low glucosinolates (GLS) rapeseed 'Drakkar' to produce a F1 progeny ('R211 *Dk'). The spring low GLS cms line 'Wesroona' (australian origin) was used for following crosses. Were used as control in molecular analyses: Winter restored lines derived from 'Samourai' carrying the complete (`RRHl') or incomplete (`R113') introgression as well as European radish line7, Asiatic restored radish D81, hybrid Brasica napus* wild radish, Brassica oleracea, and B. rapa cv Asko, Arabidopsis thaliana.

[0041] Gamma ray irradiation: Whole flowering plants were treated with gamma rays from a Co60 source in a controlled area. Subletal dose fo 65 Gray was applied before meioses.

[0042] Testcrosses and F2 production: Irradiated plants were transferred in an insectproof greenhouse after removing flower buds larger than 2 mm. The irradiated F1 progeny was used to handpollinate the cms 'Wesroona' line. The restored derived F1' plants were allowed to produce F2 families harvested individually and precisely sown in a field assay along with non irradiated controls (Fig. 1).

[0043] Phenotypic selection: Three visual criteria were scored (on a 1 to 5 scale) over 2 years in field assays, on 1200 F2 offsprings plus 44 controls (82 330 quoted plants): 1-Vegetative vigour,
2- Normality of the ratio of fertile /sterile plants in the F2 segregation, and 3- Female fertility (pod development and seed set).

[0044] Advanced selfed generations of the selected families were obtained either in field or greenhouse and produced homozygous lines (F4) for further analysis.

[0045] Isozyme analysis was performed as in Delourme R. and Eber F. 1992. Theor Appl Genet 85: 222-228, marker development from Fourmann M. et al. 2002. Theor Appl. Genet. 105:1196-1206. PCR products are validated by sequencing. Alignments were made using Blast Ncbi and Uk Crop Net Brassica DB and the Multialin software INRA Toulouse.

Method:



[0046] We choose one low GLS spring homozygous restorer line, 'R211', already exhibiting deletions in the introgression (Delourme R. and Eber F. 1992. Theor Appl Genet 85: 222-228. Delourme R. et al. 1998. Theor Appl Genet 97: 129-134. Delourme R. et al. 1999. 10th Int. Rapeseed Congress, Canberra). Several molecular markers are missing on either side of Rfo, such as spATCHIA (Fourmann M. et al. 2002. Theor Appl. Genet. 105:1196-1206), spSG91 (Giancola S. et al. 2003 Theor Appl. Genet. (in press)). 'R211' lost the isozyme expression of the Pgi-2 allele of the radish gene but also the one of Pgi-2 allele of B. oleracea genome (1,2). Moreover, the homozygous 'R211' shows linked negative traits such as low vigour and very poor seed set. We hypothesised that these plant lack a rapeseed chromosomal segment. The fertile ratio in F2 progenies derived from this material is lower than expected (64% instead of 75%). We initiated the program from this 'R211' line and tried to force recombination between the Rfo carrying introgression from this deleted line and the rapeseed homologous chromosome from a double low B. napus line.

[0047] Ionising irradiation is known to induce chromosomal rearrangements by double strand breaks followed by aberrant rejoining of the ends. Gamma-ray irradiation was used on a heterozygous F1 derived from the 'R211' line to induce chromosome breaks, just before meiosis, aiming at a recombination of the deleted radish introgression in the rapeseed genome.

Results:



[0048] Very few families were at the best score for the three criteria out of 1200 F2 families tested.

[0049] Only one, 'R2000', proved to produce a normal ratio of fertile plants per selfed progeny with a stable recovery of good agronomic traits such as a good female fertility, with a normal seed set compared to 'R211' (Figs. 2 and 3). This family was obtained from a 6 mn irradiation treatment at a dose flow of 65 Gray per hour.

[0050] Glucosinolate analysis confirmed its low content.

[0051] In figure 2 (Seed set on 'R211' and 'R2000') R2000 showed normal inflorescences, with a normal looking architecture.

[0052] In figure 3 (Number of seeds per pod), we observe:
  • on the best 'R2000' F4 families in self pollination (Selfings) and in testcrosses,
  • on 'Pactol' cms line on rapeseed and 'R211' controls.

Example II: Selection of markers in the Pgi-2 gene



[0053] PGI isoenzyme analysis: 'R2000' progeny expressed the rapeseed Pgi-2 allele from B. oleracea genome, originally lost in 'R211'.

[0054] Three PCR markers were defined to characterise the R2000 family compared to the known restorer rapeseed RRH1 and R113.
  1. 1) PGIol marker was developed from the BrassicaDB sequences to be specific to the Brassica genome. There is no amplification in radish nor in Arabidopsis th., but only in Brassica, with one 248 bp band.
  2. 2) PGIint marker amplified a longer part of the Pgi-2 gene, allowing clear distinction between the various tested species Brassica, Raphanus and Arabidopsis. The species B. rapa and B. oleracea were not distinguished by the band size on agarose gel, but by their PGINT band sequence.
  3. 3) PGIUnt marker, a combination of the PGI ol U and PGI int L primers. This marker had the specificity of the PGIol marker but amplifying a longer part as for PGIint one.

II.1 PGIol marker



[0055] With the PGIol primers, the 'R211' parental line showed no amplification, while the spring tested lines showed a 248bp band. Its DNA sequence is homologous to the PGI-2 sequences from the Crop Net UK DB in Brassica species and from previous work in our group (named SGAP sequences) (Localisation of the primers SG PGI chou, Fig. 4).

[0056] It was ortholog of the clone MJB21-12, on the chromosome V, (34543bp) in Arabidopsis (NCBI DB).

[0057] PGIol plus SG34 to set an Homozygocity test:

[0058] The combined use of two sets of primers in a mix PCR, PGIol marking the Pgi-2 gene absent in the homozygote restored plant and SG34 (from S. Giancola et al., Giancola S. et al., 2003 Theor Appl. Genet. (in press)), a very close marker to the Rfo gene, was set up to discriminate homozygous from heterozygous plant among the fertile plants segregating in F2 progenies derived from 'R211'. In place of using SG34, it is possible to use any other marker close to or in the Rfo gene.

[0059] Only one family R2000 showed no difference between homozygote and heterozygote offsprings:

The Pgi-2 gene is present in the R2000 homozygote, which is not the case for the parental homozygous R211.



[0060] In figure 5 (PGIol and SG34 PCR markers):

The homozygous 'R2000' family has recovered the PGIol band.



[0061] DNA sequence of the band confirmed the homology with the known Arabidopsis and Brassica Pgi-2 sequence. Control genotypes (Drakkar, Pactol, and, Samourai, Darmor) had the same pattern on the gel. Sequence of this common band allowed to confirm their high homology as they were quasi similar except one base substitution.

[0062] The homozygous 'R2000' family has recovered the PGIol band of the Brassica oleracea type. It was distinct from the known restorer of the Samourai group.

[0063] This amplified part of the Pgi-2 is very conserved and hardly any differences were shown among the various genotypes. A longer part of Pgi-2 gene was investigated.

II.2 PGIUNT and PGIint markers



[0064] Electrophoresis Patterns of PCR products:

PGIUNT marker: A second reverse primer, PGIint L, was designed further down the Pgi-2 sequence, to amplify as well conserved and as variable regions of the gene. When used with the PGIol U primer, it amplifies a 980bp band only in Brassica genomes. R211 didn't show any band. The homozygous 'R2000' showed the PGIUNT band as in the Drakkar parent.



[0065] In figure 8 (PGIUNT marker):

PGIint marker amplified a segment of PGIUNT. The upper primer PGIint allows the amplification in all tested species, allowing a clear distinction between Arabidopsis, Radish and Brassica. B. rapa and B. oleracea were not distinguished by the band size on agarose gel, but by their PGIint sequence. All tested restored genotypes, but the 'R211' line, exhibited the European radish band and one Brassica band, homologous to the B. rapa one.



[0066] The homozygous 'R2000' didn't show the radish PGIint band, as in the deleted `R211' parental line, but showed one Brassica band, homologous to the B. oleracea one.

[0067] Electrophoresis of PGIint marker is represented in figure 9.

[0068] Sequence analysis:

Comparison of the PGI sequences from the data bases.



[0069] A PGI segment of about 490bp is known.

[0070] Sequences of a segment of about 490bp from different genotypes (B. oleracea, B. rapa, B. napus) have been studied in our laboratory group and some sequences were given to Brassica Crop Net DB: EMAF25875 to 25788 by M. Fouramnn (4) These sequences are very conserved.

[0071] Comparison of the B. rapa et B. oleracea species PGI sequences (figures 13 and 14):

Comparison between PGI sequences we have obtained from the tested genotypes of B. oleracea and B. rapa species, showed that they were distinct by 21 base substitutions. Theses substitutions allowed to distinguish PGIint sequences from the other tested genotypes of rapeseed, homologous to either B. rapa cv Asko (RRH1 and R113) or B. oleracea (Drakkar, R211*DK but also R2000).


Example III: Selection of marker in a region close to Rfo



[0072] Markers surrounding the Rfo gene in the radish insertion were determined in order to facilitate the Rfo gene cloning (Desloires S. et al., 2003 EMBO reports 4, 6:588-594). One of these, the SG129 PCR marker was located very close to Rfo (Giancola S. et al., 2003 Theor Appl. Genet. (in press)): it co-amplified distinct bands in B. oleracea and B. rapa genomes of B. napus, but the radish band was very difficult to see on an agarose gel.

[0073] The target SG129 sequence was ortholog of a clone (AC011OOO, at the locus F16P17) in Arabidopsis thaliana. This clone overlapped an Arabidopsis adjacent contig clone (AC07190).

[0074] From the Brassica Crop Net DB, we found one B. oleracea clone, (EMBH448336, 764bp) blasting with the beginning of the A011000, and a second B. oleracea clone (EMBH53971), distant from about 300bp on the Arabidopsis map, that blasted with the end of AC07190.

[0075] We designed a new PCR marker, BolJon, between the two B. oleracea clones. We verified that it allowed amplification of a specific PCR bands in the different genotypes compared here.

[0076] In figures 16 (electrophoresis gel of BolJon PCR products):
  • In Arabidopsis, a BolJon 815bp band was amplified, homologue to the overlapping segment of the contigs.
  • In Brassiceae diploid species, BolJon marker showed distinct bands: one of 950bp in B. oleracea and one of 870bp in B. rapa. It showed that the two B. oleracea clones (EMBH53971 and EMBH448336) are in sequence continuity in Brassica genome as it is for the ortholog sequences in Arabidopsis.
  • In B. napus, these two bands are co-amplified in the maintainer lines, Samourai or Drakkar.
  • In radish line7, one BolJon band was amplified of about 630 bp long. The band of the restored radish cmsRd81 was slightly smaller.
  • In all the restored rapeseed lines, one of the BolJon bands was of the same size as the radish line7. BolJon is a marker of the radish introgression.
  • The homozygous restored rapeseed lines, 'RRHl', 'R113' and also 'R211', only showed the B. rapa band and the 630bp radish band bp suggesting the B. oleracea ortholog of the target gene is absent or has been modified when the radish segment of chromosome was inserted into the rapeseed B. oleracea constitutive genome.


[0077] 'R2000' homozygote plants showed radish PCR BolJon, plus the two Brassica BolJon bands, again having recovered the B. oleracea one, lost in 'R211' and other restorer lines.

[0078] We designed a primer, pCP418L, specific of the B. oleracea genome in the tested species. With the SG129U primer it amplified only one PCR band (670bp) in the B.oleracea species (Figs. 17).

[0079] There was no amplification in B.rapa, in radish, nor in Arabidopsis, but there was a clear CP418 band in B. napus maintainer lines. Its sequence was strictly homologous to the EMBH448336 sequence. This marker was in a very conserved DNA sequence allowing no polymorphism between genotypes except by presence / absence.

[0080] In RRH1, R113 and in R211 there was no CP418 band, indicating as previously that the B.oleracea ortholog of the target gene is absent or has been modified following the radish insertion.

[0081] 'R2000' homozygote plants showed CP418 band, again having recovered the specific B. oleracea one.

[0082] In the present invention, a new recombined low GLS restorer line has been selected with a good female fertility. The poor value of line 'R211' allowed selection in the field for a rare recombination event and characterisation the `R2000' family.

[0083] The homozygous 'R2000' presents a unique combination of the PGIol, PGIUNT, PGIint and BolJon markers when compared with the rapeseed restorer analysed yet:

PGIinT marker showed that the homozygous restored rapeseed lines, RRH1 and R113 presented the European radish band plus one Brassica band, homologous to B. rapa genome. 'R2000' shows no radish band, lost as in its parental deleted line R211, but showed one Brassica band homologous to B. oleracea. The ortholog PGIint sequence in its B. rapa genome is not amplified with this marker in R211 and Drakkar genetic background.



[0084] PGIol marker and PGIUNT marker sequences in restored lines RRH1 and R113 were homologous to the B. rapa cv Asko one. In 'R2000', PGIUNT sequence is homologous to B. oleracea. The ortholog PGIUnt sequence in its B. rapa genome is not amplified with this marker in R211 and Drakkar genetic background.

[0085] BolJon marker showed that the homozygous restored rapeseed lines, including 'R211' presented the European radish band plus only the B. rapa one. 'R2000' shows the two bands of 'R211' plus the recovered B. oleracea BolJon band.

[0086] CP418 marker showed that 'R2000' recovered this conserved B. oleracea segment.

[0087] Our hypothesis is that a recombination event took place in the pollen mother cell which gave rise to 'R2000' plants. The deleted radish introgression was then integrated to the normal homologous chromosome segment, carrying the B. oleracea type Pgi-2 gene and BolJon target sequence, characterised by these markers, probably from the Drakkar '00' genome present in the irradiated heterozygous 'R211*DK'.

[0088] The pattern observed for BolJon suggests that the recombination event resulted in a particular duplicated region, one from radish and one B. oleracea, in the 'R2000' family.








Claims

1. Combination of five markers selected from PGIol, PGIUNT, PGIint, BolJon, and CP418, wherein the PGIol marker has the sequence of SEQ ID NO: 1, the PGIUNT marker has the sequence of SEQ ID NO: 2, the PGIint marker has the sequence of SEQ ID NO: 3, the BolJon marker has the sequence of SEQ ID NO: 4, and the CP418 marker has the sequence of SEQ ID NO: 5.
 
2. Use of the combination of five marker of claim 1 for characterising recombined double low restorer lines of Brassica napus for Ogura cms presenting a radish introgression carrying the male fertility Rfo restorer gene deleted of the radish isozyme Pgi-2 allele and recombined with the Pgi-2 gene from Brassica oleracea, and having a good agronomic value of female fertility, a good transmission rate of Rfo and a high vegetative vigour.
 
3. The use of claim 2, wherein the recombined double low restorer lines progeny of Brassica napus for Ogura cms presenting a radish introgression carrying the male fertility Rfo restorer gene deleted of the radish isozyme Pgi-2 allele and recombined with the Pgi-2 gene from Brassica oleracea, and having a good agronomic value of female fertility, a good transmission rate of Rfo and a high vegetative vigour, is obtained by a method comprising the steps of:

a) crossing double low cms lines of spring Brassica napus comprising a deleted radish insertion with the double low line of spring Drakkar for forming heterozygous restored plants of Brassica napus,

b) irradiating before meiosis the heterozygous restored plants obtained in step a) with gamma ray irradiation,

c) crossing pollen from flowers obtained in step b) with the cms double low spring Wesroona line,

d) testing the progeny for vigour, female fertility and transmission rate of the cms gene,and

e) selecting the progeny.


 
4. The use of claim 3, wherein step d) comprises amplifying the said five markers of claim 1.
 
5. The use of claim 4, wherein step e) comprises the selecting the progeny wherein a 248 bp band corresponding to PGIol is amplified in step d).
 
6. The use of claim 4, wherein step e) comprises the selecting the progeny wherein a 866 bp band corresponding to PGIint is amplified in step d).
 
7. The use of claim 4, wherein step e) comprises the selecting the progeny wherein a 979 bp band corresponding to PGIUNT is amplified in step d).
 
8. The use of claim 4, wherein step e) comprises the selecting the progeny wherein a 957 bp band corresponding to BolJon is amplified in step d).
 
9. The use of claim 4, wherein step e) comprises the selecting the progeny wherein a 672 bp band corresponding to CP418 is amplified in step d).
 
10. The use of any of claims 4 to 9, wherein step e) comprises the selecting the progeny wherein a 248 bp band corresponding to PGIol and a 866 bp band corresponding to PGIint and a 979 bp band corresponding to PGIUNT and a 957 bp band corresponding to BolJon and a 672 bp band corresponding to CP418 are amplified in step d).
 




Drawing












































































Search report



















Cited references

REFERENCES CITED IN THE DESCRIPTION



This list of references cited by the applicant is for the reader's convenience only. It does not form part of the European patent document. Even though great care has been taken in compiling the references, errors or omissions cannot be excluded and the EPO disclaims all liability in this regard.

Non-patent literature cited in the description