ATBECHDEDKESFRGBGRITLILUNLSEMCPTIESILTLVFIRO..CY..TRBGCZEEHUPLSK....IS..MT..........................JDIM360 Ver 2.15 (14 Jul 2008) - 2100000/02336320EUROPEAN PATENT SPECIFICATIONB120120321EP10167455.42007072320100701enenen0629124120060731EP20120321201212201106222011252012032120121220111104C12P 19/34 20060101AFI20110930BHEP C07H 21/02 20060101ALI20110930BHEP C07H 21/04 20060101ALI20110930BHEP A61K 31/713 20060101ALI20110930BHEP C12N 15/113 20100101ALI20110930BHEP deSensibilisierung von Krebszellen für eine Therapie unter Verwendung von siNA-Zielgenen aus den Chromosomenregionen 1p und 19qenSensizitation of cancer cells to therapy using sina targeting genes from the 1p and 19q chromosomal regionsfrSensibilisation de cellules cancéreuses à une thérapie à l'aide de gènes ciblant siNA depuis les régions chromosomiques 1p et 19qWO-A2-03/070918WO-A2-2004/045497RAMAKANTH S ET AL: "Correlation between pulmonary cytochrome P450 transcripts and the organ-selective pneumotoxicity of 3-methylindole", 1 March 1994 (1994-03-01), TOXICOLOGY LETTERS, ELSEVIER BIOMEDICAL PRESS, AMSTERDAM, NL, PAGE(S) 77 - 85, XP023801704, ISSN: 0378-4274 [retrieved on 1994-03-01] * page 83, paragraph 2 *07825533.8206432820070723Berger François41 Chemin de la Coronnerie38240 MeylanFRPelletier, Laurent74 Lotissement le Champ de BourgF-38570 GoncelinFRIssartel, Jean-Paul9, rue du Fournet38120 St EgreveFRBoccard, Sandra45 Grande RueF-38700 La TroncheFRUNIVERSITE JOSEPH FOURIER (GRENOBLE 1)100245453EPD09UJFERC2Domaine Universitaire de St.Martin d'Hères, B.P. 53F-38041 Grenoble Cédex 09FRGrosset-Fournier, Chantal Catherineet al100026601Grosset-Fournier & Demachy 54, rue Saint-Lazare75009 ParisFRATBEBGCHCYCZDEDKEEESFIFRGBGRHUIEISITLILTLULVMCMTNLPLPTROSESISKTR20110622201125

The invention relates to the identification of genes involved in resistance of cancer cells to therapy, to short nucleic acid molecules which inhibit the expression of these genes by RNA interference and to their use as adjuvant in cancer therapy, to sensitize cancer cells to conventional anticancer agents.

Gliomas are the most prevalent primary brain tumours. Among them, astrocytomas are a notable source of preoccupation in oncology because their incidence continually increase in industrialized countries (Ohgaki, H. and Kleihues, P., acta Neuropathol., 2005, 109, 93-108) and, above all, their prognostic is pessimistic because they are refractory to even the most aggressive therapy. For example, median survival time in a patient with glioblastoma multi-form (GBM), the worst grade of astrocytoma, is between 6 to 15 months after diagnosis (Chinot, O. et Martin, P.M., Biologie des tumeurs cérébrales gliales, 1996, Montpellier, France). Standard treatment is surgery followed by radiotherapy and chemotherapy. Recently, a large phase III study demonstrated that temozolomide (Temodal®) therapy associated to radiotherapy provided a modest 3 months increase survival in glioblastoma (Stupp et al., N. Engl. J. Med., 2005, 352, 987-996).

Numerous works have addressed the chemoresistance as the principal cause of therapeutic fail (Harris, A.L., Int. J. Radial. Biol. Relat. Stud. Phys. Chem. Med., 1985, 48, 675-680).

Contrasting with astrocytomas, oligodendrogliomas have a dramatic chemosensitivity (Perry et al., Arch. Neural, 1999, 56, 434-436) resulting in a median survival of 10 years after medical management. Oligodendroglioma response to chemotherapy has been correlated with the loss of heterozygosity (LOH) on 1p and 19q chromosomal arms (Cairncross et al., J. Nail. Carter lnst., 1998, 90, 1473-1479) with a common chromosomic area including 1p32-36 and 19q13.2-4 (Smith et al., Oneogene, 1999, 18, 4144 -4152).

The major part of studies addressing the chemoresistance of astrocytomas concerned drug efflux mechanism. However, the data are scattered and conflicting (Ashmore et al., Anticancer drugs, 1999, 10, 861-872). Expression of MDR-1 P-glycoprotein (P-gp), a protein associated with MDR, was not preferentially detected in resistant gliomas (Demeule et al., Int. J. Cancer, 2001, 93, 62-66). Moreover, MDR-type drug resistance in glioma cell lines results of long-tenn culturing, and in vivo, only cerebral endothelium induces this mechanism (Bahr et al., Brain Pathol., 2003, 13, 482-494). Finally, MDR-related genes were not located in the common 1p/19q deletion.

The correlation between 1p/19q LOH and oligodendrogliomas chemosensitivity strongly suggests that the reduction of global expression of some genes in the common region of deletion could be responsible for the observed chemosensitivity.

An adjuvant treatment targeting these genes could increased the chemosensitivity of cancer cells.

The completion of human genome sequencing provides the opportunity to investigate potential candidates among the 1,700 genes located in the 1p/19q LOH region.

Some studies have focused the search on genes with potential oncogenic properties, which inactivation would lead to oligodendroglioma oncogenesis but no convincing results were obtained to date.

Numerous genes located in the 1p/19q chromosomal regions (LOH regions) could have potential impact on drug resistance, including those involved in drug efflux systems, metabolism, apoptosis, cell-cycle regulation and DNA-repair.

To date, the correlation between gene expression and drug resistance has been demonstrated for two genes of the Nucleotide Excision Repair (NER) system, extensively studies in cancer cells: the ERCC1 and ERCC2 genes. Furthermore, a functional involvement of these genes in drug resistance has been established for the ERCC1 gene only.

Chemotherapy drugs commonly employed, such as PCV regimen (procarbazine, lomustine or CCNU, and vincristine), cisplatin, fotemustine or temozolamide, are DNA-alkylating molecules. These drugs damage DNA leading cells to apoptosis, Cells can correct chemotherapy-induced alterations thanks to various DNA-repair mechanism (Li et al., Anticancer Res., 2000, 20, 645-652 ; Wu et al., Clin. Cancer Res., 2003, 9, 5874-5879) and thus overcome treatment. This phenomenom is responsible for chemoresistance (Bosken et al., J. Natl. Cancer Inst., 2002, 94, 1091-1099).

A major role of ERCC1 in reparation of DNA alterations related to alkylating chemotherapy has been reported (Chaney S.G. & Sancar A., J. Natl. Cancer Inst., 1996, 88, 1346-1360; Li et al., Anticancer Res., 2000, 20, 645-652). Suppression of ERCC1 expression in vitro by antisense or siRNA technology, leads to a decrease repair activity and an increased sensitivity of cultured cell lines to platinum-based anticancer agents (Selvakumaran et al., Cancer Res., 2003, 63, 1311-1316; Youn et al., Cancer Res., 2004, 64, 4849-4857; Chang et al., Biochem. Biophys. Res. Commun., 2005, 327, 225-233).

ERCC2 (XPD) expression has been correlated with resistance to alkylating compounds in numerous cell lines (Chen et al., Ai Zheng, 2002, 21, 233-239; Xu et al., Anticancer drugs, 2002, 13, 511-519), comprising glioma cell lines (Chen et al., Neurosurgery, 1998, 42, 1112-1119) and it has been reported that its overexpression increased DNA repair in glioma cell lines (Chen et al., Chin. Med. J., 2003, 116, 1171-1174). However, a functional involvement of ERCC2 in drug resistance has not been established.

RNAi interference is the process where the introduction of double stranded RNA into a cell inhibits gene expression in a sequence dependent fashion (reviewed in Shuey et al., Drug Discovery Today, 2002, 7, 1040-1046). RNA has been observed in a number of organisms such as mammalian, Drosophila, nematodes, fungi and plants and is believed to be involved in anti-viral defense, modulation of transposon-activity and regulation of gene expression. RNAi is usually described as a post-transcriptional gene-silencing mechanism in which dsRNA triggers degradation of homologous messenger RNA in the cytoplasm. Target recognition is highly sequence specific since one or two base pair mismatches between the siRNA and the target gene will greatly reduce silencing effect. The mediators of RNA interference are 21-and 23-nucleotide small interfering RNAs (siRNA). In a second step, siRNAs bind to a ribonuclease complex called RNA-induccd silencing complex (RISC) that guides the small siRNA to its homologous mRNA target. Consequently, RISC cuts the RNA approximately in the middle of the region paired with the antisens siRNA, after which the mRNA is further degraded. Therefore, the use of exogenous siRNA holds great promise as a new tool for mammalian functional genomics and may also have future applications as gene-specific therapeutics.

Using siRNA technology, the inventors have established that four other genes involved in DNA repair (MUTYH, PNKP, POLD1, and RUVBL2) and two genes encoding P450 cytochrom isoforms (CYP2A6 and CYP4BI) are also involved in astrocytomas chemoresistance. In addition, the inventors have established, for the first time that ERCC2 is functionally involved in drug resistance.

MUTYH which belongs to the Base Excision Repair (BER) system is known to repair 8-oxo-7,8-dihydro2'deoxyguanosine (8-oxodG) caused by oxidation. MUTYH mutations and variants were associated with development of multiple colorectal adenomas and cancers (Chow et al., Lancet Oncol., 2004, 5, 600-606). PNKP, also belonging to the BER system, was shown to be involved in repairing DNA strand breaks caused by reactive oxygen species, ionizing radiations or alkylating agents (Whitehouse et al., Celt, 2001, 104, 107-117; Chappell et al., EMBO J., 2002, 21, 2827-2832). It has been related to susceptibility to genotoxic agents but not to chemoresistance (Rasouli-Nia et al., P.N.A.S., 2004, 101, 6905-6910). POLD1 is known to be involved in NER and NMR (Nucleotide Mismatch Repair) systems, while RUVBL2 is known to be involved in homologous recombination; these proteins have neither been related to chemosensitivity.

The cytochrome P450 isoforms CYP2A6 and CYP4B1 are known as activators of carcinogenic aromatic amines, and represent possible risk factors for tobacco-related and bladder cancers in human (Kamataki et al., Biochem. Res. Comm., 2005, Sep 19; Imaoka et al., Biochem. Res. Comm. 2000, 277, 776-780): they have neither been related to chemosensitivity.

The inventors have engineered siRNA which efficently inhibit the targeted genes expression and significantly sensitize astrocytoma cells to chemotherapy.

These siRNAs are useful as adjuvant in cancer therapy, to sensitize cancer cells to chemotherapy and radiotherapy.

Therefore, the invention relates to a double-stranded short interfering nucleic acid (siNA) molecule comprising a sense and an antisense region, wherein the sense region comprises a nucleotide sequence that is selected from the group consisting of: the sequences SEQ ID NO: 64 and 70 and the sequences having at least 70 % identity, preferably at least 80 % identity, more preferably at least 90 % identity with said sequences, and the antisense region comprises a nucleotide sequence that is complementary to the sense region.

The siNA molecules according to the invention target two genes CYP2A6 and CYP4B1) of the chromosomic regions 1p32-36 and 19q13.2-4 (loss of heterozygosity regions or LOH region) which are all involved in resistance of cancer cells to chemotherapy and/or radiotherapy. The siNA molecules according to the invention are able to down regulate the expression of the CYP2A6 or CYP4B1 genes (target genes) by RNA interference and thereby increase the sensitivity of cancer cells to conventional anticancer agents. Thus the siNA molecules according to the present invention potentiate the cytotoxic effect of chemotherapy/radiotherapy on cancer cells.

The resistance of cancer cells to an anticancer agent may be evaluated by a resistance index (RI) corresponding to the proportion of a cell population that survived to treatment with said anticancer agent. It is calculated as follows: cell number with anticancer agent treatment / cell number in control condition.

The sensibilization effect mediated by the siNA according to the present invention, may be evaluated by the siNA-induced drug sensibilization index (DS) which corresponds to the cell population (%) that survived to a simple treatment with an anticancer agent but died in response to the same treatment with an siNA transfection. It is calculated as follows (RI control siNA - RI target siNA) / RI control siNA x 100; the target siNA is directed to the resistance gene and the control siNA is directed to a geene which is not involved in resistance to anticancer therapy.

Both indexed may be determined by any assay that measures cell viability, which is well-known in the art, such as for example a MTT assay.

Confirmation that the sensitization effect is mediated by inhibition of the target gene expression may be assayed by any RNA or protein analysis technique, which is well-known in the art (Northern-blot, Westem-blot, quantitative RT-PCR).

The siNA molecules according to the invention are defined by reference to the human CYP246 or CYP4B1 gene sequences (Table I); the target sequence corresponds to the portion of the RNA which is complimentary to the antisense region of the siNA molecule. <b><u>Table I</u>: Genes targeted with the siNA</b> Target gene GenBank accession number Target sequence positions CYP2A6 NM_000762 SEQ ID NO: 64 591-609 CYP4B1 NM_000779 SEQ ID NO: 70 645-663

The invention encompasses the synthetic, semi-synthetic or recombinant siNAs which inhibit the expression of a target gene from any organism. Given the positions of the targets in the human mRNAs, one skilled in the art will easily find the corresponding positions in the homologous sequences of other organisms (eukaryotes, for example mammals) which arc accessible in the databases such as the NCBI database (http://www.ncbi.nlm.nih.gov/). Such homologous sequences can be identified as is known in the art, for example using sequence alignment. In addition, the siNA molecules of the invention may inhibit the expression of target gene variants, for example polymorphic variants resulting from haplotype polymorphism.

siNA molecules can be designed to target such homologous sequences, for example using perfectly complementary sequence or by incorporating non-canonical base pairs, for example mismatches and/or wobble base pairs, including flipped mismatches, single hydrogen bond mismatches, trans-type mismatches, triple base interactions and quadruple base interactions, that can provide additional target sequences. For example, the siNA molecule can be designed to target a sequence that is unique to a specific target gene RNA sequence (a single allele or single nucleotide polymorphism (SNP)) due to the high degree of specificity that the siNA molecule requires, to mediate RNA activity. Alternatively, when mismatches are identified, non-canonical base-pairs (for example, mismatches and/or wobble bases) can be used to generate siNA molecules that target more than one sequence. In a non-limiling example, non-canonical base-pairs such as uu and cc base pairs are used to generate siNA molecules that are capable of targeting homologous target gene sequences. In this approach, a single siNA can be used to inhibit expression of more than one gene instead of using more than one siNA molecule to target the different genes.

Definitions

In one embodiment, the invention features an siNA molecule wherein each strand comprises or consists of 15 to about 30 (e.g. about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides, and each strand comprises at least 15 to about 30 (e.g. about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides) nucleotides that are complementary to the nucleotides of the other strand. For example, the siNA molecule of the invention comprises or consists of a 19 to 21nucleotide duplex (19 to 21 base pairs).

In another embodiment, the invention features an siNA molecule wherein the sense region comprises or consists of a nucleotide sequence having any of SEQ ID NO: 64 and 70 and the antisense region comprises or consists of a nucleotide sequence having any of SEQ ID NO: 101 to 102, respectively. These siNA target the human genes (Table II). <b><u>Table II:</u> siNA targeting the human genes</b> Target gene siNA sense strand identification number siNA antisense strand Identification number sequence CYP2A6 SEQ ID NO: 64 SEQ ID NO: 101 5'-ugacaggaacucuuugucc-3' CYP4B1 SEQ ID NO: 70 SEQ ID NO: 102 5'-aucgcugacugcaagguag-3'

In another embodiment of the invention, the siNA molecule comprises overhanging nucleotide(s) at one or both end(s), preferably, 1 to about 3 (e.g. about 1, 2, or 3) overhanging nucleotides. The overhanging uleotides which are advantageously at the 3' end of each strand, are preferably, 2'-deoxynucleotide(s), preferably 2'deoxypyrimidine(s), such as a 2'-deoxythymidine(s). For example, the siNA molecule of the invention is a 19 to 21-nucleotide duplex with 3'-terminal a overhang(s).

In another embodiment of the invention, the siNA molecule comprises blunt end(s), where both ends are blunt, or alternatively, where one of the ends is blunt.

In another embodiment of the invention, the siNA molecule is assembled from two separate oligonucleotide fragments or strands, wherein one fragment (sense strand) comprises the sense region and the second fragment (antisense strand) comprises the antisense region of the siNA molecule.

In another embodiment, the invention features an siNA molecule wherein the sense region is connected to the antisense region via a linker molecule, such as a nucleotide or non-nucleotide linker. A nucleotide linker can be a linger of at least 2 nucleotides in length, for example about 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length. Examples of such siNA molecules include small hairpin nucleic acid (shNA) molecules.

A non-nucleotide linker comprises abasic nucleotides, aptamers, polyether, polyamine, polyamide, peptide, carbohydrate, lipid, polyhydrocarbon, or other polymeric compounds.

In another embodiment of the invention SiNA molecule comprises mismatches, bulges, loops or wobble base pairs to modulate the activity of the siNA molecule to mediate RNA interference.

In another embodiment of the invention, the siNA molecule comprises or consists of ribonucleotide(s) (2*-OH nucleotides).

In addition, the siNA molecule may include one or more modification which increase resistance to nuclease degradation in vivo and/or improve cellular uptake. The siNA may include nucleotides which are modified at the sugar, phosphate, and/or base moiety, and/or modifications of the 5' or 3' end(s), or the internucleotidic linkage.

In another embodiment of the invention, the siNA molecule comprises one or more modified pyrimidine and/or purine nucleotides, preferably on each strand of the double-stranded siNA. More preferably, said modified nucleotides are selected from the group consisting of: 2'-O-methylnucleotides, 2'-O-methoxyethylnucleotides, deoxynucleotides, such as 2'-deoxynucleotides and 2',deoxy-2'-fluoronucleotides, universal base nucleotides, acyclic nucleotides and 5-C-methyl nucleotides, An siNA molecule of the invention can generally comprise about 5 % to about 100 % modified nucleotides (e.g., about 5 %, 10 %, 15 %, 20 %, 25 %, 30 %, 35 %, 40 %, 45 %, 50%, 55 %, 60 %, 65 %, 70 %, 75 %, 80 %, 85 %, 90 %, 95 % or 100 % modified nucleotides). The actual percentage of modified nucleotides present in a given siNA molecule will depend on the total number of nucleotides present in the siNA molecule. The percent modification can be based upon the total number of nucleotides present in the sense strand, antisense strand or both the sense and the antisense strands.

In another embodiment, the invention features an siNA molecule wherein the strand comprising the sense region (sense strand) includes a terminal cap moiety at the 5'-end, the 3'-end, or both the 5' and 3'ends of the strand, preferably a deoxy abasic moiety or glyceryl moiety.

In another embodiment, the invention features an siNA molecule wherein the strand comprising said antisense region (antisense strand) includes a phosphate group at the 5'-end.

In another embodiment of the invention, the siNA molecule comprises at least one modified internucleotidic linkage, such as a phosphorothioate linkage.

The siNA molecules according to the invention may be produced by chemical synthesis by using well-known oligonucleotides synthesis methods which make use of common nucleic acid protecting and coupling groups, such as dimethoxytrityl at the 5'-end and phosphoramidites, at the 3' end. The nucleic acid molecules of the present invention can be modified to enhance stability by modification with nuclease resistant groups, for example 2'-amino, 2'-C-allyl, 2'-fluoro, 2'-O-methyl, 2'-H (for a review see Usman and Cedergen, TIBS, 1992, 17, 34 and Usman et al., Nucleic Acids Symp. Ser., 1994, 31, 163). Examples of such modified oligonucleotides include with no limitation: 2' F-CTP, 2' F-UTP, 2' NH2-CTP, 2' NH2-UTP, 2' N3-CTP, 2-thio CTP, 2-thio UTP, 4-thio UTP, 5-indo CTP, 5-iodo UTP, 5-bromo UTP, 2-chloro ATP, adenosine 5'-(1-thiotriphosphate), cytidine 5'-(1-thiotriphosphate), guanosine-5'-(1-thiotriphosphate), oridine-5'-(1-thiotriphosphate), pseudo-UTP, 5-(3-aminoallyl)-UTP and 5-(3-aminoallyl)-dUTP. siNA contructs can be purified by gel electrophoresis using general methods or can be purified by high pressure liquid chromatography (HPLC) and re-suspended in water.

The chemically-synthesized siNA molecule according to The invention may be assembled from two distinct oligonucleotides which are synthesized separately. Alternatively, both strands of the siNA molecule may be synthesized in tandem using a cleavable linker, for example a succinyl-based linker.

Alternatively, the siNA molecules of the invention may he expressed (in vitro or in vivo) from transcription units inserted into DNA or RNA vectors known to those skilled in the art and commercially available.

The invention relates also to a transcription unit comprising: a transcription initiation region, a transcription tennination region, and a nucleic acid sequence encoding at least one siNA molecule according to the present invention, wherein said nucleic acid sequence is operably linked to said initiation region in a manner that allows expression and/or delivery of the siNA molecule.

The nucleic acid sequence may encode one or both strands of the siNA molecule, or a single self-complementary strand that self-hybridizes into an siNA duplex.

The transcription initiation region may be from a promoter for a eukaryotic DNA polymerase I, II or III (pol I, II or III). Transcripts from pol II or pol III promoters are expressed at high levels in all cells. Alternatively, prokaryotic RNA polymerase promoters may be used, providing that prokaryotic RNA polymerase enzyme is expressed in the appropriate cells. transcription units derived from genes encoding U6 small nuclear transfer RNA and adenovirus VA RNA are useful in generating high concentrations of desired siNA in cells.

The invention concerns also an expression vector comprising a nucleic acid encoding at least one siNA molecule of the instant invention. The expression vector may encode one or both strands of the siNA molecule, or a single self-complementary strand that self hybridizes into an siNA duplex. The nucleic acid encoding the siNA molecule of the instant invention is preferably inserted in a transcription unit as defined above.

Large numbers of DNA or RNA vectors suitable for siNA molecule expression are known to those of skill in the art and commercially available. The recombinant vectors can be DNA plasmids or viral vectors. SiNA expressing viral vectors can be constructed based on, but not limited to, adeno-associated virus, retrovirus, adenovirus or alphavirus. The recombinant vectors capable of expressing the siNA molecules can be delivered in vivo, and persist in target cells, Alternatively, viral vectors can be used to provide transient expression of siNA molecules.

The invention concerns also eukaryotic or prokaryotic cells which are modified by a vector as defined above.

The invention concerns also a pharmaceutical composition comprising at least an siNA molecule or an expression vector, as defined above, in an acceptable carrier, such as stabilizer, buffer and the like.

A pharmaceutical composition or formulation refers to a form suitable for administration, e.g., systemic or local administration, into a cell or subject, including for example a human. Suitable forms, in part, depend upon the use or the route of entry, for example oral, inhalation, or by injection. These compositions or formulations are prepared according to any method known in the art for the manufacture of pharmaceutical compositions.

In one embodiment, the invention features a composition wherein the siNA molecule or vector is associated to a compound that allows the delivery of the siNA/vector into cancer celld, The compound may be a membrane peptide, transporter, lipid, hydrophobic moiety, cationic polymer, PEI. Examples of membrane peptides include those able to cross the blood-brain barrier, such as with no limitation the Pep:Trans™ (http://www.syntem.com/english/techpeptrans.html). Preferably, the siNA and the compound are formulated in microspheres, nanoparticules or liposomes. Furthermore, the siNA molecule or vector may be associated with a compound that allows a specific targeting of the tumor, such as a ligand of a cell-surface antigen or receptor, for example a peptide or an antibody specific for said antigen/receptor (e.g., PS100, PDGFR, erb-B2).

In another embodiment, the invention features a composition comprising a combination of at least two different siNA molecules.

In another embodiment, the invention features a composition wherein the siNA molecule or vector is associated with at least one anticancer drug.

The invention also concerns an siNA molecule or a vector as defined above, as a medicament.

The invention concerns also the use of an siNA molecule or a vector as defined above, for the manufacture of a medicament for treating cancer.

The cancer may be or any type. Preferably, the cancer is a solid tumor, for example brain tumors such as astrocytomas, glioblastomas, oligodendrogliomas or mixed tumors.

In one embodiment of said use, the siNA molecule or vector is associated with an anticancer drug.

The invention concerns also a product containing at least one siNA molecule or vector as defined above, and an anticancer drug, as a combined preparation for simultaneous, separate or sequential use in anticancer therapy.

The anticancer drugs which are used in combination with the siNA molecule or the vector according to the invention are those commonly used in chemotherapy, and include cytotoxic agents, such as alkylating agents and antimetabolites.

Preferred anticancer drugs are alkylating agents, such as: cisplatin (cis-diaminedicloroplannum, CDDP or DDP), temozolomide, fotemustine, procarbazine, lomustine and vincristine.

In addition, the siNA molecule according to the invention may be used in combination with other conventional anticancer therapies including radiotherapy, immunotherapy and surgery.

A pharmaceutically effective dose is that dose required to prevent, inhibit the occurrence or treat (alleviate a symptom to some extent, preferably all the symptoms) of a disease or state. The pharmaceutically effective dose of the siNA depends upon the type of cancer, the composition used, the route of administration, the type of mammal being treated, the physical characteristics of the specific mammal under consideration, concurrent medication, and other factors, that those skilled in the medical arts will recognize. Generally, an amount between 0.1 mg/kg and 100 mg/kg body weight/day of active ingredients is administered.

The siNA of the invention may be administered by a single or multiple route(s) chosen from: local (intratumoral, for example, intracerebral (irtrathecal, intraventricular)), parenteral (percutaneous, subcutaneous, intravenous, intramuscular, intraperitoneal), oral, sub-lingual, or inhalation.

When the siNA molecule or vector is used in combination with chemotherapy or radiotherapy, it is preferably administered immediately prior to the anticancer agent or several hours (2 to 48 hours) before.

In addition to the preceding features, the invention further comprises other features which will emerge from the description which follows, which refers to examples illustrating the siNA molecules and their uses according to the invention, as well as to the appended drawings in which:

Example 1: siRNA directed to 1p/19q DNA repair genes are able to sensitize cancer cells to chemotherapy 1) Material and Methods a) Cell culture

U87, U373, U138, CCF and LN229 cells deriving from human astrocytoma were purchased from American Type Culture Collection (ATCC). GHD cell line derived from a human astrocytoma biopsy, was checked by fluorescence in situ hybridization, chromosome 7 polysomy, chromosome 10 monosomy and immuno-histo-chemistry. Cells were maintained in DMEM (CAMBREX BIOSCIENCES), 10 % FCS (v/v; ABCYS), and incubated in a humidified atmosphere with 5% CO2, at 37 °C.

b) Inhibition of gene expression with siRNA

Three to five siRNA pairs were designed for each candidate gene and prepared into duplex form (EUROGENTEC). siRNAs targeting the Green Fluorescent Protein (GFP) and the ERCC1 protein were used as control siRNAs. 24 hours after cell seeding (96 well plates), siRNA (150 nM) were transfected with Oligofectamine™ (Invitrogen), according to the manufacturer's instructions. Each condition (siRNA) was tested in 3 independent experiments, each time in hexaplicate.

c) Cell survival and chemoresistance

Cells were seeded in 96 well plates, transfected with siRNA after 24 h and treated with cisplatine (CDDP, MERCK, 5 µM final concentration) or termolomide (TMZ, SCHERING-PLOUGH, 1 µM final concentration) after 48 h. Cell survival was determined 96 hours post-treatment, by measuring mitochondrial succinate dehydrogenase activity, with 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT, SIGMA) added to a final concentration of 0.5 mg/ml into culture medium. Cultule medium was discarded after 4 h of incubation with MTT and formazon crystals were dissolved in DMSO/ethanol (50/50, v/v). Optical density was read at 540 nm. Chemoresistance was related to an index (CI) corresponding to the proportion of a cell population that survived to chemotherapy. It was calculated as follows: cell number (OD) with chemotherapy / cell number (OD) in control condition. The benefit of siRNA transfection was represented by the siRNA-induced drug sensibilization index (DS) which corresponds to the cell population (%) that survived to a simple chemotherapy treatment but died in response to the same treatment with a siRNA transfection. It was calculated as follows: (CI siRNA GFP- CI siRNA x) / CI siRNA GFP x 100. Significant differences between series were tested by ANOVA with Statview (SAS institute). Differences were considered significant when p < 0.05 (*) and very significant when p < 0.01 (**).

d) Q-RT PCR

RNAs were extracted on silica column (Nucleospin™, MACHEREY-NAGEL). RNAs were reverse transcribed using the M-MLV reverse transcriptase RNase H minus enzyme (Promega) and oligodT as a primer, at 40°C during 1.5 hours. After reverse transcription, cDNAs were purified (Mini Elute, PCR Purification Kit™, QIAGEN) and assayed by quantitative PCR using the HotStar Reaction mix (ROCHE). using a pair of primers specific for the candidate gene and the reference gene ERCCI (Table III). Measurements were carried out on a Light Cycler thermo-cycler (ROCHE). <b><u>Table III:</u> qRT-PCR primers sequences</b> Gene Primer Sequence (5'-3') SEQ ID NO: Annealing temperature (°C) Product size (bp) Cyclophyline A Forvard ttcatctgcactgecaagac 1 61.8 158 Reverse togagttgtcacagtcagc 2 ERCC1 Forward ggcgacgtsattccogacta 3 61.8 121 Reverse agttcttccecaggctctgc 4 ERCC2 Forward cggaactstgggaacctccl 5 64.0 200 Reverse tacttelccagggcgacact 6 MUTYH Forward glcclgacgtggaggagtgt 7 64.0 200 Reverse cctctgcaccagcwaattt 8 PNKP Ferward tcgaaagatgacggactcct 9 64.0 20G Reverse tttattgtggaggggagctg 10

Measures were performed twire from each cell sample, and results were expressed as the mean of at least three independent samples (originating from independent in vitro experiments).

2) Results a) Identification of DNA repair genes potentially involved in chemoresistance of astrocytoma cells

Genes potentially responsible for chemoresistance of astrocytoma, were screened from the chromosomic area commonly considered as correlated with oligodendroglioma chemosensitivity (1p36-1p32 and 19q13.2-19q13.4; Smith et al., Oncogene, 1999, 18, 4144-4152). Gene sequences were retrieved from data bases on the web (http://www.nebi.nebi.nlm.nih.gov/PubMed/ ; http://www.ensembl.org ; http://www.egal.ienet.uk/DNA Repair Genes.html; Supplement to the paper by Wood et al., Mutant. Res., 2005, 577, 275-283) and published data (Harris, A.L., Int J Radiat Biol Relat Stud Phys Chem Med, 1985, 48, 675-90 ; Christmann et al., Toxicology, 2003, 193, 3-34 ; Wood et al., Mutat. Res., 2005, 577, 275-283). Eight genes belonging to different repair systems were selected (Table IV). <b><u>Table IV:</u> List of DNA repair-associated genes located on 1p/19q LOH regions</b> DNA repair genes DNA repair system Accession number Localization LIG1 NER NM_000234 19q13.2-3 ERCC2 (XPD) NER NM_000400 19q13.3 POLDI NER and MMR** NM_002691 19q13.3 RUVBL2 Homologous Recombination NM_006666 19q13.3 PNKP BER** NM_007254 19q13.3-4 RAD 54L Homologous Recombination NM_003579 1p32 MUTYH BER NM_012222 1p34.3 MAD2L2 (REV7) DNA polymerase NM_006341 1p36 * NER: Nucleotide Excision Repair
** NMR: Nucleotide Mismatch repair
*** BER: Base excision repair

b) In vitro chemosensitivity assay

An in vitro assay for the siRNAs high-throughput screening, was developed to find out which genes (Table IV) are implicated in glioma chemoresistance mechanisms. The cell number after chemotherapy and siRNA transfection was measured to have a global chemosensitization evaluation, defined as a significant increased cell death compared with the effect of the drug alone. In a first series of experiments, the following conditions et the assay were established: (I) drug and siRNA treatment protocols, (ii) specific temporal sequence of cell seeding and drug treatment, (iii) siRNA transaction, (iii) cell viability measurement. CDDP was chosen because it is an alkylating agent harboring a very reproducible activity in vitro. Most, if not all, cell damages occurred during the first hour of drug treatment since one and 24 hour(s) incubations were equally efficient. Moreover, it was established that the mRNA amount was the lowest 24 and 48 hours after siRNA transfection. Altogether, these data suggested that siRNAs had to be added prior to the drug.

c) Screening of DNA-repair genes involved in chemoresistance of astrocytoma cells

The screening was performed in three steps. First siRNAs targeting candidate genes were screened on one cell line and results were confirmed at statistic level in further experiments. The study was then extended to six astrocytoma-derived cell lines and the siRNAs were validated at molecular level. Finally, the study was extended to a second chemotherapy agent.

The eight DNA-repair genes located in the 1p/19q (Table IV) were screened with live different siRNAs by gene, on the GHD cell line. The siRNAs sequences are presented in Table V. One siRNA specific for GFP and one siRNA specific for ERCCI were used as controls. <b><u>Table V</u>: SiRNAs sequences</b> Gene siRNA sequence*(1) (2) SEQ ID NO: ERCC2 5'-ggacgucgaugggaaaugc-3' 11 5'-agacggugcucaggaucaa-3' 12 5'-ucaucaucgagcccuuuga-3' 13 5'-ggaacaagcugcucuuuau-3' 14 5'-ugacuuucuuaccuucgau-3' 15 LIG1 5'-agacgcucagcagcuucuu-3' 16 5'-gaagauagacaucaucaaa-3' 17 5'-agacagcagagcccagaaa-3' 18 5-gcagacguucugcgagguu-3' 19 5'-gcagauccagccauuccaa-3' 20 MAD2L2 5'-gaagaaugauguggagaa-3' 21 5'-gacucgcuguugucucaug-3' 22 5'-cucgcaacaugcagaagau-3' 23 5'-gaagauccaggucaucaag-3' 24 5'-uggagcaggauguccacaug-3' 25 MUTYH 5'-gaagcaugcuaagaacaac-3' 26 5'-ugggaugauugcugagugu-3' 27 5'-gcacccuuguuucccagca-3' 28 5'-gguuguccacaccuucucu-3' 29 5'-gcugacauaucaaguauau-3' 30 PNKP 5'-cacacuguauuuggucaau-3' 31 5'-agagacccgcacaccagaa-3' 32 5'-gaaucuuguacccagagau-3' 33 5'-aguccaccuuucucaagaa-3' 34 5'-caaccgguuucgagagaug-3' 35 POLD1 5'-ggagauggaggcagaacac-3' 36 5'-guuggagauugaccauuau-3 37 5'-ucaccgguuacaacaucca-3' 38 5'-cuuagacuccaccagcugc-3' 39 5'-auucagaugggauaccucc-3' 40 RAD54L 5'-ccagcauugugaauagaug-3' 41 5'-ucaccucgcuaaagaagcu-3' 42 5'-ggagcuguuuauccuggau-3' 43 5'-ugaucugcuugaguauuuc-3' 44 5'-gcagugagacccagaucca-3' 45 RUVBL2 5'-aucuucucccuggagauga-3' 46 5'-acugacccucaagaccaca-3' 47 5'-acgcaaggguacagaagug-3' 48 GFP 5'-gacguaaacggccacaaguuc-3' 49 ERCC1 5'-ggagcuggcuaagaugugu-3' 50 (1) siRNA sequences are defined by the sequence of the sense strand. The antisense strand is perfectly complementary to the sense strand. SiRNAs responsible for a significant sensitization effect arc in bold.
(2) Said sequences comprise a 3'-terminal tt overhang.

Cell viability was measured in absence and in presence of CDDP. SiRNAs were selected on the basis of two criteria: the absence of basal toxicity and their efficiency to improve chemotherapy treatment. Toxic siRNAs inducing more than 35 % cell death after transfection (without CDDP) were discarded. In contrast, those increasing cell death were retained. An siRNA increased chemosensitivity when its chemoresistance index (CI) was lower than GFP siRNA CI, ie lower than 0.5. In figure 1, the white square corresponds to siRNA with low toxicity and with chemo-sensitization properties. Eight siRNAs out of 38 matched with these criteria, corresponding to 5 genes: ERCC2, MUTYH, PNKP, FOLD1, and RUVBL2 (figure 1). Only one sequence of MUTYH, PNKP, RUVBL2 and POLD1 (SEQ ID NO: 30, 31, 38 and 46) siRNAs increased chemosensitivity while 4 (SEQ ID NO: 11, 13, 14 and 15) out of 5 sequences targeting ERCC2 fulfilled these conditions.

The most efficient siRNA for each of these genes was transfected in 6 different glioma derived cell lines treated with CDDP or temozolomide (TMZ). CIs for each siRNA were compared with control CI (siRNA GFP). The results confirmed that three siRNAs targeting ERCC2, MUTYH and PNKP, respectively, had a significant chemo-sensitization effect on astrocytoma cells (figure 2). The three siRNAs were equally efficient (up to 17%) on 3 (ERCC2) or 2 (MUTYH and PNKP) cell lines (figure 2). When combined by 2 or 3, siRNAs did not show any greater efficiency. By comparison, inhibition of ERCC1 was more potent to sensitize cells to CDDP (up to 24.9 %) and its effect was the most widespread since 4 out of the 6 cell lines were sensitized.

The previously observed effects were validated at molecular level: a significant mRNA content decrease was confirmed by qRT-PCR for all siRNAs (Table VI). <b><u>Table VI</u>: Validation of siRNA -induced mRNA content down-regulation</b> Cell line mRNA inhibition
% P
ANOVA GHD ERCC2 61.6 0.011 MUTYH 71.0 0.004 FNKP 83.8 0.005 ERCC1 58.6 0.019 U373 ERCC2 95.7 0.003 MUTYH 72.9 0.007 PNKP 44.2 0.013 ERCC1 77.4 0.018

When a particular siRNA was transfected, the quantities in mRNA corresponding to all the other non targetted genes were unchanged, confirming the target specificity of the selected siRNA. There was no obvious link between the efficiency of siRNA to decrease mRNA amounts (nor with final mRNA content) and functional impact on cell viability (Figure 2). This is reinforced by the observation that ERCC1 mRNA amount actually decreased (by 65 %) in U87 cells which were yet not chemosensitized.

d) Study for a link between DNA-repair genes expression and siRNA-induced chemotherapy

Expression of the 4 DNA-repair genes was studied by qRT-PCR in the 6 cell lines, with (induced level) or without cisplatin (basal level) to analyse the hypothesis that differences in expression could account for differences in siRNA responses. For each individual mRNA, the relative gene expression levels were roughly similar in all cell lines in absence of drug (Table VII). <b><u>Table VII</u> : DNA repair gene expression</b> Cell line ERCC1 Basal Induced Qty* sem Qty sem %** GHD 33 13 35 15 104 LN229 33 13 78 30 233 U138 40 17 97 36 242 U373 11 5 1 2 6 110 U87 25 10 25 10 39 CCF 8 4 12 6 148 Cell line ERCC2 Basal Induced Qty* sem Qty sem %** GHD 10 3 17 5 163 LN229 4 1 11 1 268 U138 21 4 66 15 312 U373 14 1 17 4 122 U87 5 1 5 1 96 CCF 2 1 3 1 196 Cell line MUTYH Basal Induced Qty* sem Qty sem %** GHD 108 19 114 14 105 LN229 137 52 439 44 320 U138 185 43 469 157 254 U373 49 33 135 41 278 U87 91 28 191 37 110 CCF 45 20 117 40 257 Cell line PNKP Basal Induced Qty* sem Qty sem %** GHD 94 28 83 23 88 LN229 137 35 283 70 206 U138 550 116 1198 171 218 U373 115 31 149 4 130 U87 224 50 196 63 88 CCF 76 20 130 29 171 quantity in zeptomol (1021mol) in a 25 ng total RNA extract
** percentage of basal level

MUTYH and PNKP mRNAs were the most abundant and ERCC2 was generally the less one. Expression of the four genes was reinforced up to three times in response to chemotherapy, in at least two cell lines (Table VII). No gene was up-regulated in all cell lines, the four genes were up-regulated in two cell lines (LN229 and U138) and none in one other (U87). Thus, there was no common induction profile conserved among all cell lines. Finally, no correlation was found between chemosensitization by a siRNA (DS) and basal or CDDP-induced expression of corresponding gene or even global expression of the 4 genes. e) Transposition of chemo-sensitization by siRNAs from CDDP to temozolomide.

Since temozolomide is becoming the chemotherapy gold standard for gliomas, the study was extended to this drug. ERCC1 siRNAs were more efficient for sensitizing astrocytoma-derived cell lines to this second drug. However, down-regulating MUTYH, PNKP or ERCC2 improved very significantly drug effects in U373 cells (figure 2).

Example 2: siRNA directed to 1p/19q genes involved in drug metabolism are able to sensitize cancer cells to chemotherapy 1) Material and Methods

The experimental procedures are described in example 1.

2) Results a) Identification of genes potentially involved in chemoresistance of astrocytoma cells

Genes potentially responsible for chemoresistance of astrocytoma, were screened from the chromosomic area considered as commonly correlated with oligodendroglioma chemosensitivity, as described in example 1. Nine genes involved in drug metabolism (detoxification, cellular efflux, apoptosis) were selected (Table VIII).

b) Screening of DNA-repair genes involved in chemoresistance of astrocytoma cells

The eight genes located in the 1p/19q (Table VIII) were screened with five different siRNAs by gene, on two different cell-lines, U373 and GHD. The siRNAs sequences are presented in Table IX. A siRNA specific for GFP was used as control. <b><u>Table IX:</u> SiRNAs sequences*</b> Gene siRNA sequence position SEQ ID NO: CYP2B6 ccaccauccuccagaacuu 1359 51 ggaaaucaaugcuuacauu 724 52 acaggugauuggcccacau 994 53 ugacccacacuacuuugaa 1198 54 acacgcucucgcucuucuu 879 55 ccagggagaggaguuuagu 326 91 gaagcauugaggagcgaau 475 92 CYP2F1 ccacacauaaccugcucuu 928 56 gcauaagcacagccaucuu 64 57 ucaaugacaacuuccaaau 661 58 acacggaguucuacuugaa 857 59 ccaccgucaugcagaacuu 1370 60 CYP2A6 ugaccacguugaaccucuu 887 61 ccaaguuucgggauuucuu 1142 62 gcaccagcaucguuguaga 1020 63 ggacaaagaguuccuguca 591 64 gcaagccugucaccuuugu 1175 65 CYP4B1 ugagccugacuaugccaaa 297 66 ugaugugcugaagcccuau 453 67 ggagucuacucgcuucuau 253 68 gcacgaucauucuucucau 3228 69 cuaccuugcagucagcgau 645 70 FRAP1 agaacucgcugauccaaau 1230 71 ccagcagcauaagcaggaa 5287 72 caagcgacaucccaugaaa 7670 73 gcaggcugcucuccauggu 969 74 ggcucaugcugggacccaa 1010 75 MGC13170 ggagcuguccauacgccac 1159 76 ggagaagguggauaagugg 1068 77 ccaggcucaugcugggacc 1007 78 gugcagccucagaagaaga 674 103 gaagaagaaauucucuuuc 453 104 MLP cgagggcacugcucaggaa 597 79 gaagaaauucucuuucaag 456 80 aaagcaauggagacuuauc 293 81 cgacuucguucuaauauau 1089 82 ucaacuuccuucagaauuu 1694 83 MSH4 guagacgacuucguucuaa 1084 84 agagcuuacuaugguuccu 1380 85 agaagguauuggcauuugu 2345 86 gcugacuccugaggaagaa 407 87 ccaagacccuggaagaa 301 105 RPS8 ccacaagaagcggaaguau 86 88 agaguuggaguucaaucuu 602 89 agagaaagcccuaccacaa 73 90 *siRNA sequences are defined by the sequence of the sense strand.
The antisense strand is perfectly complementary to the sense strand.
SiRNAs responsible for a significant sensitization effect are highlighted in bold.

To select siRNAs specifically including a chemosensitive effect, those inducing a basal toxic effect were eliminated (more than 35 % cell death after transfection). A positive chemosensitive effect was considered for siRNAs inducing a cytotoxic effect compared to siRNA GFP/CDDP condition. 2 siRNAs out of 45, matched with these criteria, corresponding to 2 genes: CYP2A6 and CYP4B1 (Table IX).

The most efficient siRNA for each of these genes was transfected in 6 different glioma derived cell lines treated with CDDP or temozolomide (TMZ). CIs for each siRNA were compared with control CI (siRNA GFP). The results confirmed that two siRNAs (SEQ ID NO: 64 and 70) targeting CYP2A6 and CYP4B1, respectively, had a significant chemosensitization effect on astrocytoma cells (figure 3).

SEQUENCE LISTING

A double-stranded short interfering nucleic acid molecule comprising a sense and an antisense region, wherein the sense region comprises a nucleotide sequence that is selected from the group consisting of: the sequences SEQ ID NO: 64 and 70, and the sequences having at least 70% identity, preferably at least 80 % identity, more preferably at least 90 % identity with said sequences, and the antisense region comprises a nucleotide sequence that is complementary to the sense region. The double-stranded short interfering nucleic acid molecule according to claim 1, wherein each strand comprises 15 to about 30 nucleotides, and each strand comprises at least 15 to about 30 nucleotides that are complementary to the nucleotides of the other strand, preferably said double-stranded short interfering nucleic acid molecule comprises a 19 to 21 -nucleotide duplex. The double-stranded short interfering nucleic acid molecule according to claim 1 or 2 ,wherein the sense region comprises a nucleotide sequence having any of SEQ ID NO: 64 and 70, and the antisense region comprises a nucleotide sequence having any of SEQ ID NO: 101 and 102 ,respectively, preferably said double-stranded short interfering nucleic acid molecule comprises - 1 to about 3 overhanging nucleotides at the 3' end of each strand, or - blunt end(s). The double-stranded short interfering nucleic acid molecule according to anyone of claims 1 to 3, which is assembled from two separate oligonucleotide fragments, wherein one fragment comprises the sense region and the second fragment comprises the antisense region of the short interfering nucleic acid molecule, preferably the sense region is connected to the antisense region via a linker molecule, more preferably, in particular said double-stranded short interfering nucleic acid molecule comprises ribonucleotides or comprises one or more modified pyrimidine and/or purine nucleotides The double-stranded short interfering nucleic acid molecule according to anyone of claims 1 to 4, wherein the strand comprising the sense region includes a terminal cap moiety at the 5'and/or 3' -end(s). The double-stranded short interfering nucleic acid molecule according to anyone of claims 1 to 5, wherein the strand comprising said antisense region includes a phosphate group at the 5 '-end. The double-stranded short interfering nucleic acid molecule according to anyone of claims 1 to 5, which comprises at least one modified internucleotidic linkage. A transcription unit comprising: a transcription initiation region, a transcription termination region, and a nucleic acid sequence encoding at least one short interfering nucleic acid molecule according to anyone of claims 1 to 4 and 6, wherein said nucleic acid sequence is operably linked to said initiation region in a manner that allows expression and/or delivery of the short interfering nucleic acid molecule. An expression vector comprising a transcription unit according to claim 8. A cell which is modified by a vector according to claim 9. A pharmaceutical composition comprising at least a short interfering nucleic acid molecule according to anyone of claims 1 to 7 or an expression vector according to claim 9 in an acceptable carrier, particularly in association with at least one anticancer drug The composition according to claim 11, which comprises a combination of at least two different short interfering nucleic acid molecules, particularly in association with at least one anticancer drug. Use of the short interfering nucleic acid molecule according to anyone of claims 1 to 7 or the vector according to claim 9, for the manufacture of a medicament for treating cancer. A product containing at least a short interfering nucleic acid molecule according to anyone of claims 1 to 7 or a vector according to claim 9, and an anticancer drug, as a combined preparation for simultaneous, separate or sequential use in anticancer therapy. The product according to claim 14, wherein said siNA molecule or vector is for use in anticancer therapy prior to the anticancer drug. Kleines doppelsträngiges interferierendes Nukleinsäuremolekül, welches eine Sense- und eine Antisense-Region umfasst, wobei die Sense-Region eine Nukleotidsequenz umfasst, die aus der Gruppe bestehend aus den Sequenzen SEQ ID NR. 64 und 70 ausgewählt ist, und wobei die Sequenzen mindestens 70 % Identität, vorzugsweise mindestens 80 % Identität, bevorzugter mindestens 90 % Identität mit diesen Sequenzen aufweisen, und die Antisense-Region umfasst eine Nukleotidsequenz, die komplementär zu der Sense-Region ist. Kleines doppelsträngiges interferierendes Nukleinsäuremolekül nach Anspruch 1, wobei jeder Strang 15 bis etwa 30 Nukleotide umfasst, und jeder Strang umfasst mindestens 15 bis etwa 30 Nukleotide, die komplementär zu den Nukleotiden des anderen Stranges sind, vorzugsweise welches kleines doppelsträngiges interferierendes Nukleinsäuremolekül einen 19- bis 21-Nukleotidduplex umfasst. Kleines doppelsträngiges interferierendes Nukleinsäuremolekül nach einem der Ansprüche 1 bis-3, wobei die Sense-Region eine Nukleotidsequenz umfasst, die eine der SEQ ID NR. 64 und 70 aufweist, und wobei die Antisense-Region eine Nukleotidsequenz umfasst, die eine der SEQ ID NR. 101 und 102 aufweist, wobei das kleine doppelsträngige interferierende Nukleinsäuremolekül vorzugsweise umfasst: • 1 bis etwa 3 überhängende Nukleotide am 3'-Ende jedes Strangs, oder • ein glattes Ende (glatte Enden). Kleines doppelsträngiges interferierendes Nukleinsäuremolekül nach einem der Ansprüche 1 bis-3, das aus zwei Oligonukleotidfragmenten zusammegefügt wird, wobei ein Fragment die Sense-Region umfasst und das die zweite Fragment die Antisense-Region das kleinen Nukleinsäuremoleküls umfasst, wobei die Sense-Region mit der Antisense-Region bevorzugt durch ein Bindungsmolekül verknüpft ist, wobei, stärker bevorzugt, das kleine doppelsträngige interferierende Nukleinsäuremolekül insbesondere Ribonukleotide, ein oder mehrere modifizierte Pyrimidin- und/oder Purinnukleotide umfasst. Kleines doppelsträngiges interferierendes Nukleinsäuremolekül nach einem der Ansprüche 1 bis 4, wobei der Strang, welcher die Sense-Region umfasst, eine Endkappengruppe am/an den 5'- und/oder 3'-Ende(n) beinhaltet. Kleines doppelsträngiges interferierendes Nukleinsäuremolekül nach einem der Ansprüche 1 bis 5, wobei der Strang, welcher die Antisense-Region umfasst, eine Phosphatgruppe am 5'-Ende beinhaltet. Kleines doppelsträngiges interferierendes Nukleinsäuremolekül nach einem der Ansprüche 1 bis 6, welches mindestens eine modifizierte internukleotidische Bindung umfasst. Transkriptionseinheit, welche Folgendes umfasst: eine Transkriptionsinitiierungsregion, eine Transkriptionsterminationsregion und eine Nukleinsäuresequenz, welche mindestens ein kleines interferierendes Nukleinsäuremolekül nach einem der Ansprüche 1 bis 4 und 6 codiert, wobei die Nukleinsäuresequenz wirkungsmäßig in einer Art und Weise mit der Initiierungsregion verbunden ist, welche die Expression und/oder Bereitstellung eines kleinen interferierenden Nukleinsäuremolekül gestattet. Expressionsvektor, welcher eine Transkriptionseinheit nach Anspruch 8 umfasst. Zelle, die durch einen Vektor nach Anspruch 9 modifiziert ist. Pharmazeutische Zusammensetzung, welche mindestens ein kleines interferierendes nach einem der Ansprüche 1 bis 7 oder einen Expressionsvektor nach Anspruch 9 in einer akzeptablen Trägersubstanz umfasst, die besonders mit mindestens einem Antikrebsmedikament in Zusammenhang stehen. Zusammensetzung nach Anspruch 11, welche eine Kombination aus mindestens zwei unterschiedlichen kleinen interferierenden Nukleinsäuremolekülen umfasst, die besonders mit mindestens einem Antikrebsmedikament in Zusammenhang stehen. Verwendung des kleinen interferierenden Nukleinsäuremoleküls nach einem der Ansprüche 1 bis 7 oder des Vektors nach Anspruch 9 für die Herstellung eines Medikamentes zur Behandlung von Krebs. Produkt, welches mindestens ein kleines interferierendes Nukleinsäuremolekül nach einem der Ansprüche 1 bis 7 oder einen Vektor nach Anspruch 9 enthält, und ein Antikrebsmedikament, als ein kombiniertes Präparat für die gleichzeitige, separate oder sequentielle Verwendung bei der Antikrebstherapie. Produkt nach Anspruch 14, wobei das siNA-Molekül oder der Vektor vor dem Antikrebsmedikament bei der Antikrebstherapie zum Einsatz kommt. Petite molécule d'acide nucléique interférant double brin comprenant une région sens et une région anti-sens, où la région sens comprend une séquence de nucléotides qui est choisie dans le groupe consistant en: les séquences SEQ ID NO: 64 et 70, et les séquences ayant au moins 70% d'identité, préférentiellement au moins 80% d'identité, plus préférentiellement au moins 90% d'identité avec lesdites séquences, et la région anti-sens comprend une séquence de nucléotides qui est complémentaire de la région sens. Petite molécule d'acide nucléique interférant double brin selon la revendication 1, où chaque brin comprend de 15 à environ 30 nucléotides, et chaque brin comprend au moins 15 à environ 30 nucléotides qui sont complémentaires des nucléotides de l'autre brin, préférentiellement ladite petite molécule d'acide nucléique interférant double brin comprend un duplex de 19 à 21 nucléotides. Petite molécule d'acide nucléique interférant double brin selon l'une quelconque des revendications 1 à 3, où la région sens comprend une séquence de nucléotide ayant l'une quelconque des SEQ ID NO: 64 et 70, et la région anti-sens comprend une séquence de nucléotide ayant l'une quelconque des SEQ ID NO: 101 et 102, respectivement, préférentiellement ladite petite molécule d'acide nucléique interférant double brin comprend : • de 1 à environ 3 nucléotides dépassant à l'extrémité 3' de chaque brin, ou • une(des) extrémité(s) franche(s) Petite molécule d'acide nucléique interférant double brin selon l'une quelconque des revendications 1 à 3, qui est assemblée à partir de deux fragments d'oligonucléotides, où un fragment comprend la région sens et le second fragment comprend la région anti-sens de la petite molécule d'acide nucléique, préférentiellement la région sens est connectée à la région anti-sens par une molécule de liaison, plus préférentiellement, en particulier, ladite petite molécule d'acide nucléique interférant double brin comprend des ribonucléotides un ou plusieurs nucléotides pyrimidiques et/ou puriques modifiés. Petite molécule d'acide nucléique interférant double brin selon l'une quelconque des revendications 1 à 4, où le brin comprenant la région sens comprend une coiffe terminale à l'extremité 5' et/ou 3'. Petite molécule d'acide nucléique interférant double brin selon l'une quelconque des revendications 1 à 5, où le brin comprenant ladite région anti-sens inclut un groupement phosphate à l'extrémité 5'. Petite molécule d'acide nucléique interférant double brin selon l'une quelconque des revendications 1 à 5, qui comprend au moins une liaison intemucléotidique modifiée. Unité de transcription comprenant : une région d'initiation de la transcription, une région de terminaison de la transcription, et une séquence d'acides nucléique codant au moins une petite molécule d'acide nucléique interférant selon l'une quelconque des revendications 1 à 4 et 6, où ladite séquence d'acide nucléique est opérationnellement liée à ladite région d'initiation d'une manière à permettre l'expression et/ou la libération d'une petite molécule d'acide nucléique interférant. Vecteur d'expression comprenant une unité de transcription selon la revendication 8. Cellule qui est modifiée par un vecteur selon la revendication 9. Composition pharmaceutique comprenant au moins une petite molécule d'acide nucléique interférant selon l'une quelconque des revendications 1 à 7 ou un vecteur selon la revendication 9, dans un véhicule acceptable, en particulier en association avec au moins un anti-cancéreux. Composition selon la revendication 11, qui comprend une combinaison d'au moins deux petites molécules d'acide nucléique interférent différentes, en particulier en association avec au moins un anti-cancéreux. Petite molécule d'acide nucléique interférant double brin selon l'une quelconque des revendications 1 à 7 ou un vecteur selon la revendication 9 pour la préparation d'un médicament pour le traitement du cancer. Produit contenant au moins une petite molécule d'acide nucléique interférant selon l'une quelconque des revendications 1 à 7 ou vecteur selon la revendication 9, et un anticancéreux, en tant que préparation combinée pour une utilisation simultanée, séparée ou séquentielle dans le cadre d'une thérapie anticancéreuse. Produit selon la revendication 14, où ladite molécule pANi ou vecteur est utilisée dans le cadre d'une thérapie anticancéreuse avant l'anticancéreux.
REFERENCES CITED IN THE DESCRIPTION

This list of references cited by the applicant is for the reader's convenience only. It does not form part of the European patent document. Even though great care has been taken in compiling the references, errors or omissions cannot be excluded and the EPO disclaims all liability in this regard.

Patent documents cited in the description

Non-patent literature cited in the description