FIELD
[0001] The present disclosure relates to compounds capable of reducing adverse effects of
radiation exposure and/or increasing tumor ablation, as well as methods of using such
compounds to reduce or ameliorate or block one or more of the adverse effects of radiation
exposure or to increase tumor ablation.
BACKGROUND
[0002] Radiation has long been known to damage biological tissues and cells. Initial deposition
of energy in irradiated cells occurs in the form of ionized and excited atoms or molecules
distributed at random throughout the cells. The ionizations cause chemical changes
in the exposed area, producing highly unstable charged or "ionized" molecules. These
rapidly undergo chemical changes, producing free radicals that react with cellular
components and lead to permanent damage.
[0003] As an immediate consequence of radiation damage, cells can undergo apoptosis, dying
in interphase within a few hours of irradiation. Typical morphologic changes include
loss of normal nuclear structure and degradation of DNA. DNA damage is important in
triggering programmed cell death; membrane damage and signaling pathways are also
thought to be involved.
[0004] A sufficiently high dose of radiation will inhibit mitosis. The inhibition of cellular
proliferation is a primary mechanism by which radiation kills most cells. As radiation
kills cells by inhibiting their ability to divide, its effects in living organisms
occur primarily in tissues with high cell turnover or division rates, characterized
by high proliferative activity. These include tissues such as the bone marrow and
the mucosal lining of the stomach and small intestine. Another major target of radiation
injury is the vascular system. Normal tissues experiences progressive and unremitting
fibrosis, and occlusion of nutrient arteries and capillaries to soft tissues, following
therapeutic radiation treatment for cancer. The secondary morbidity of this includes
tissue necrosis and non-healing wounds.
[0005] The development of effective radioprotectant molecules is of great importance to
populations potentially subjected to accidental, intentional or military exposure
to radiation, including ionizing radiation.
[0006] In addition, the ability to prevent radiotherapy-induced toxicity without affecting
antitumor therapeutic efficacy has the potential to enhance the therapeutic benefit
for cancer patients without increasing their risk of serious adverse effects. Thus,
another benefit to be realized from developing new cytoprotective therapies is to
improve the therapeutic ratio by reducing the acute and chronic toxicities associated
with more intensive and more effective anticancer therapies.
SUMMARY
[0007] It has been surprisingly discovered that cell and tissue survival can be dramatically
increased following radiation exposure through inhibition of the interaction between
TSP-1 and CD47, and/or the function of one or both of these proteins. This effect
is demonstrated herein using antisense molecules, peptides, and antibodies, all of
which can now be used as radioprotectant agents. These agents find application in
minimizing, reducing and/or preventing tissue damage following intentional and accidental
radiation exposure, as well as increasing the therapeutic efficacy of radiation therapies
by protecting non-target tissue from incidental radiation damage. This effect is shown
to be specific to non-target tissue. Moreover, it has been surprisingly discovered
that inhibition of the TSP-1/CD47 interaction increases tumor ablation in a subject
undergoing radiotherapy.
[0008] The present invention is as defined in the claims.
[0009] The foregoing and other features and advantages will become more apparent from the
following detailed description of several embodiments, which proceeds with reference
to the accompanying figures.
BRIEF DESCRIPTION OF THE FIGURES
[0010]
Figure 1. TSP1 and CD47 limit survival of irradiated soft tissue. Age and sex matched C57BL/6 wild type, TSP1 and CD47 null mice received 25 Gy irradiation
to the right hind limb (Figure 1A). Tissue changes were assessed every week, and scores
are presented for two months (Figure 1B). Significance was determined using the independent
two-sample t-test. *P < 0.05 versus wild type. Representative H&E stained sections of muscle and skin are
shown from irradiated hind limbs harvested after two months (20x) (Figure 1C). Mitochondrial
viability of hind limb muscle biopsies was assessed at two months post-irradiation
by the reduction of a tetrazolium salt to water insoluble formazan through mitochondrial
oxidation as described (Figure 1D). Significance was determined using the independent
two-sample t-test. *P < 0.05 versus wild type non-radiated. Results were expressed as absorbance normalized
to dry tissue weight. Copy numbers in control and irradiated muscle tissue harvested
at two months were determined for two mitochondrial genes (NADH6 and 16s rRNA, mt-Rnr2) and two nuclear genes (the general transcription factor Gtf2ird1 and osteocalcin, Bglap2) by quantitative PCR (Figure 1E). For each sample, results were normalized to the
nuclear gene Pkd1.
Figure 2. TSP2 does not modulate radiation-induced tissue damage. Age and sex matched B6129sf1/J wild type and TSP2 null mice received 25 Gy to the
right hind limb. Tissue changes were assessed every week and scored over the next
2 months (Figure 2A). Mitochondrial viability of hind limb muscle biopsies was assessed
at 2 months by the reduction of a tetrazolium salt to water insoluble formazan through
mitochondrial oxidation as described (Figure 2B). Results were expressed as absorbance
normalized to dry tissue weight. These in vivo experiments demonstrate that the other subfamily member TSP2 does not limit radiation
tissue survival.
Figure 3. TSP1 null animals demonstrate hypertrophy of hind limbs following radiation. Age and sex matched C57BL/6 wild type and TSP1 null mice received 25 Gy irradiation
to the right hind limb. The cutaneous envelope of the medial hind limb was excised
exposing the femoral vein and artery. Representative images at 8 weeks post-radiation
are presented.
Figure 4. Limb flexibility is preserved in irradiated tissue in the absence of TSP1. Limb extension in age and sex matched C57BL/6 wild type, TSP1 and CD47 null mice
was measured as described eight weeks following 25 Gy to the right hind limb. Significance
was determined using the independent two-sample t-test. *P < 0.05 versus wild type non-irradiated.
Figure 5. TSP1 limits tissue vascular response following radiation. Age and sex matched wild type and TSP1-null mice received 25 Gy to the right hind
limb. Eight weeks later limb perfusion was assessed via BOLD MRI (Figure 5A). Images
were obtained for 30 minutes from T2* weighted gradient echo sequences. DEA/NO (100 nmol/g body weight) was administered
5 minutes after starting the scan. The percent change in integrated BOLD values as
a function of time is presented as mean ± SE of eight pairs of wild type and TSP1-null
mice respectively. Representative multislice multiecho, T2 maps, and BOLD images show normal and irradiated hind limbs of WT and TSP1-null animals
(Figure 5B). In all images, the left limb irradiated (XRT).
Figure 6. The absence of TSP1 preserves blood oxygenation responses to NO in irradiated hind
limbs. Positive (upper panels) and negative BOLD MRI signal curves (lower panels) are shown
following NO treatment for irradiated (open symbols) and normal hind limbs (closed
symbols) in age and sex matched wild type and TSP1-null eight weeks following 25 Gy
to the right hind limb.
Figure 7. TSP1 and CD47 modulate irradiated hind limb responses to vasoactive challenge. Age and sex matched C57B1/6 wild type, TSP1 and CD47 null mice received 25 Gy radiation
to the right hind limb. Eight weeks following irradiation, limb perfusion was assessed
by laser Doppler imaging following NO vasoactive challenge (1 µl/gram weight 100 mM
DEA/NO stock via rectal bolus). Animals were maintained at a core temperature of 35.5°
C and 1.5% isoflurane anesthesia (Figure 7A). Significance was determined using the
independent two-sample t-test. *P < 0.05 versus wild type. Cutaneous skin sections 1 x 2 cm in dimension were harvested
from age and sex matched mice, stained for H & E, and vessels counted (Figure 7B).
Figure 8. TSP1 and CD47 modulate irradiated hind limb responses to vasoactive challenge. Age and sex matched C57B1/6 wild type, TSP1 and CD47 null mice received 25 Gy radiation
to the right hind limb. Eight weeks following irradiation, limb perfusion was assessed
by laser Doppler imaging for 45 minutes following NO vasoactive challenge (1 µl/gram
weight 100 mM DEA/NO stock via rectal bolus). Animals were maintained at a core temperature
of 35.5° C and 1.5% isoflurane anesthesia (Figure 8A). Cutaneous skin sections 1 x
2 cm in dimension were harvested from age- and sex-matched mice, stained for H&E,
and vessels counted (Figure 8B).
Figure 9. Endogenous TSP1 and CD47 sensitize muscle and bone marrow to radiation-induced apoptosis. The presence of apoptosis within mouse hind limb tissue was examined by immunohistochemistry
using a peroxidase in situ apoptosis detection kit. Non-irradiated control hind limbs
(upper panels) and hind limbs irradiated for a total of 25 Gy from the indicated strains
were prepared for paraffin-embedded tissue sections 12 hours post-radiation, and were
examined for the presence of apoptotic nuclei. Apoptosis is inferred by intranuclear
staining of muscle and bone marrow cells. Images were acquired using a 20x objective.
Figure 10. TSP1 and CD47 limit vascular cell survival and proliferation following radiation. Primary vascular endothelial cells were harvested as previously described from wild
type, TSP1 null, and CD47 null mice and plated in growth medium on 96-well culture
plates (5 x 103 cells/200 µl per well), treated with the indicated doses of radiation, and cell viability
determined by MTT assay at 72 hours (Figure 10A). Significance was determined using
the independent two-sample t-test. *P < 0.05 versus wild type. Lungs were obtained from 12 week old wild type, TSP1 and
CD47 null mice and stained for H & E (Figure 10B) Images obtained at x100. Primary
vascular endothelial cells were harvested from wild type and TSP2 null mice and plated
in growth medium on 96-well culture plates (5 x 103 cells/200 µl per well), treated with the indicated doses of radiation and cell viability
determined by MTT assay following 72 hrs incubation (Figure 10C). Primary murine wild
type and TSP1 null vascular endothelial cells were seeded into 96 well plates at 5x104 cells/well density. After 24 hours cells were then either irradiated at 40 Gy or
left to incubate at 37 °C as a control. At the indicated time points post-irradiation,
proliferation was assessed by quantifying incorporation of bromodeoxyuridine (BrdU)
into new synthesized DNA using a BrdU Cell Proliferation Assay (Calbiochem, La Jolla,
CA) (Figure 10D). Significance was determined using the one-way ANOVA test. *P < 0.05 versus wild type. C57BL/6 wild type (Figure 10E) and TSP1 null (Figure 10F)
12-week old female mice were inoculated with B6F10 melanoma cells (2.5 x 106 cells/animal) to the right lateral thigh. On tumors reaching 200 mm3, half of each group underwent 10 Gy radiation to the tumor bearing limb. Tumor size
was measured bi-weekly. Animals were sacrificed if tumors exceeded 2 cm3. Results are from 16 animals, 8 of each strain.
Figure 11. Radioprotective activities of TSP1 and CD47 antibodies, a CD47 binding peptide from
TSP1, and a CD47 morpholino. HUVEC were plated on 96-well plates in standard growth medium. Cells were treated
with TSP1 (Figure 11A) or CD47 (Figure 11B) monoclonal antibodies (clone A6.1 or B6H12,
respectively) and received the indicated doses of radiation 24 hours after addition
of the antibodies. Cell (mitochondrial) viability was measured 48 hours post irradiation
using an MTT assay. Cells were treated using peptide 7N3 (Figure 11C) and control
peptide 604 (Figure 11D), subjected to the same experimental conditions, and assayed
via MTT. Knockdown of CD47 by pretreatment for 48 hours using a specific morpholino
granted protection against cell death after a radiation dose of 10 Gy when compared
to control groups (non-treated, mismatched morpholino, and endoporter vehicle control)
(Figure 11E; *p <0.05, #p < 0.01) using the MTT assay to determine HUVEC viability post radiation (40 Gy).
Cells treated with a CD36 morpholino (Figure 11F) under the same conditions demonstrated
no radioprotection. Experiments were repeated 3 times and results presented as the
mean ± SD.
Figure 12. Peptides 7N3 and C6d are radioprotective to HUVEC in culture. Human umbilical vein endothelial cells (HUVEC) grown in EGM medium in 96-well plates
were treated with graded doses of a peptide agent, as indicated. One hour later, cells
were exposed to a single dose of gamma radiation (0, 10, 20, 30, and 40 Gray) and
allowed to incubate 72 hours at 37 °C. Cell viability was determined with the CellTiter
96 AQueous One Solution Cell Proliferation Assay. A protective effect against increasing
doses of radiation can be seen with both 7N3 (Figure 12A) as well as C6d (Figure 12B)
peptides when compared to virtually no protection provided by the control peptide
604 (Figure 12C).
Figure 13. Peptide 7N3 is radioprotective to HAVSMC in culture. Human aortic vascular smooth muscle cells (HAVSMC) were also subjected to the CellTiter
96 Aqueous One Solution cell proliferation assay (Promega, Madison, WI). HAVSMC have
been shown to be more radioresistant therefore greater doses of radiation were used
in this assay. Again, the peptide 7N3 showed a profound radioprotective protective
effect even at very high doses of radiation.
Figure 14. TSP1 and CD47 antibodies or antisense suppression of CD47 maintain proliferation
of irradiated HUVEC. HUVEC were plated in 96-well plates in growth medium and treated with CD47 morpholino
(Figure 14A; *p < 0.05, #p <0.01) TSP1, or CD47 antibodies (Figure 14B; *p < 0.05, #p <0.01) and exposed to 10 Gy irradiation 48 hours later. Cell proliferation at the
indicated times post-radiation was determined by intracellular BrdU incorporation.
Experiments were repeated 3 times, and results presented as the mean ± SD.
Figure 15. HUVEC protected by radioprotective agents are both viable and proliferate at a better
rate than untreated cells in culture. Proliferation was assessed by quantifying incorporation of bromodeoxyuridine (BrdU)
into newly synthesized DNA using a BrdU Cell Proliferation Assay. HUVEC were seeded
into 96 well plates for 24 hours at 37° C, then treated with either antibody A6.1
or B6H12 or peptide 7N3. The treated cells were irradiated at 40 Gy 1 hour later.
Control and irradiated plates were assayed for BrdU uptake over 96 hours post-radiation.
The assay was performed according to the manufacturer's protocol, and the plates were
read at 420 nm.
Figure 16. CD47 suppression using an antisense morpholino minimizes tissue damage from radiation
injury. Age and sex matched C57BL/6 wild type mice underwent a one-time treatment of the
right hindlimb with either a murine specific CD47 morpholino oligonucleotide (10 µM
in 750 µl PBS) or 750 µl of PBS injected local-regionally to the muscle and soft tissues.
Forty-eight hours later animals received 25 Gy irradiation to the treated hindlimb,
and the animals were observed for a period of 8 weeks. At the end of 8 weeks, there
was a considerable amount of alopecia, dry desquamation and early signs of fibrotic
contractures within the irradiated hind limbs of mice receiving only PBS. In contrast,
the mice receiving treatment with CD47 morpholino showed little to no alopecia, ulceration,
or desquamation at the end of eight weeks (Figure 16A). The tissue necrosis grading
scores for 8 animals are presented as mean ± SD (Figure 16B) and show a similar trend
throughout the 8-week observation period.
Figure 17. Therapeutic suppression of CD47 prevents radiation-induced apoptosis in muscle and
bone marrow. The presence of apoptosis was detected by the TUNEL method as brown nuclear staining.
Non-irradiated control hindlimbs (upper panels) and hindlimbs irradiated for a total
of 25 Gy all from age and sex matched C57BL/6 wild type mice were prepared for paraffin-embedded
tissue sections 24 hours post-radiation and were examined for the presence of apoptotic
nuclei. Mice hindlimbs injected with the CD47 morpholino (bottom panels) 48 hours
prior to radiation were also prepared in the same manner 24 hours post-radiation.
Apoptosis is inferred by intranuclear staining of muscle and bone marrow cells. Images
were acquired using a 20x objective.
Figure 18. Targeting CD47 Protects Composite Tissue From Radiation-Induced Vascular Damage. Age matched male C57BL/6 mice received 25 Gy to both hind limbs. Forty-eight hours
prior to irradiation the right hind limb was treated by direct intra-muscular injection
with the CD47 morpholino (750 µl at 10 µM concentration). The opposite (control) limb
received nothing. Eight weeks post-radiation hind limb blood flow changes to a nitric
oxide (NO) challenge (DEA/NO 100 nmol/g body weight via rectal instillation) was assessed
via Laser Doppler imaging (Figure 18A). In other experiments, the opposite (control)
limb received injection of either missense oligonucleotide or sterile PBS with similar
results (not shown). Laser Doppler was performed under 1.5% isoflurane inhalation
anesthesia with animal core temperature held constant at 36.5° C. Results in the lower
panel represent the mean ± SD of 6 mice in each treatment group (Figure 18B).
Figure 19. CD47 suppression enhances re-growth delay in irradiated syngeneic B16 melanoma and
squamous cell carcinoma tumors but increases radioresistance of B16 cells in vitro. C57BL/6 mice were injected with 1x106 B16 mouse melanoma cells into their right hindlimbs. Five days later, the mice were
randomized into 4 groups (12 mice in each group) where they either received injections
of CD47 morpholino (10 µM) in sterile PBS, PBS, or no injection. The two groups receiving
injections were then subjected to radiation (10 Gy) to the effected hindlimb 48 hours
later. The other two groups served as controls and consisted of tumor alone or tumor
subjected to only the morpholino. Tumors were followed post-radiation for 30 days,
measuring their volume every 6 days (Figure 19A). Results are presented as the mean
± SD of 12 mice in each treatment group and are representative of 3 independent studies.
These same experimental treatment conditions were tested using another syngeneic tumor
cell line (SCC VII) in C3H mice and followed for 15 days where similar results were
found after injecting 1.5x105 cells (Figure 19B). Results are presented as the mean ± SD of 10 mice (C3H) in each
treatment group and are representative of 3 independent studies. B16 mouse melanoma
cells were plated on 96-well plates in standard growth medium. Cells were treated
with peptide 7N3 or CD47 morpholino and received a radiation dose of 10 Gy (Figure
19C; *p <0.05, #p < 0.01). Cell (mitochondrial) viability was measured 48 hours post radiation using
the MTT assay.
Figure 20. Systemic delivery of CD47 morpholino is as effective as local delivery for enhancing
tumor growth delay post-irradiation. Groups of 10 C3H mice were injected with SCC VII squamous cell carcinoma in the hindlimb
as in Figure 20. Mice were treated by local injection of PBS (closed circles) or CD47
morpholino (open circles) as above or by intraperitoneal injection of the morpholino
(triangles) 48 prior to irradiation of the hindlimb at Gy. Tumor growth was assessed
as above. Results are presented as the mean ± SD of 10 mice (C3H) in each treatment
group
Figure 21. Increased fibrotic response, viable immune reaction, and macrophage infiltration
is seen in tumors with suppressed CD47 expression. C57BL/6 mice were injected with 1x106 B16 mouse melanoma cells into their hind limbs. Treatment consisted of two groups
where the hind limbs were treated with either 150 µl of PBS or 150 µl of CD47 morpholino
(10 µM) 48 hours prior to radiation (10 Gy). The control group consisted of just tumor
without radiation. 24 hours post-radiation the mice were sacrificed, and their hindlimbs
were prepared in paraffin embedded tissue sections for analysis. The top panels represent
hind limbs and tumors in each group stained by standard H&E protocol (Figure 21A).
The middle panels demonstrate those cells undergoing apoptosis as detected by the
TIJNEL method. Positive (apoptotic) cells are indicated by brown nuclear staining
(Figure 21B). Specific staining for macrophage surface marker CD68 was performed using
a murine-specific antibody as seen in the bottom panels (Figure 21C). Dark staining
within the tumor indicates macrophage infiltration. Images were acquired using either
a 4x or 10x objective.
Figure 22. The radioprotective effect of CD47 suppression is independent of cGMP/NO signaling. HUVEC plated in 96 well plates were treated with the indicated doses of a slow releasing
NO donor DETA/NO (Figure 22A) or membrane permeable cGMP analog, 8-Bromo cGMP (Figure
22B). Cells were subjected to either high dose (40 Gy) radiation or no radiation.
Cell viability was measured by an MTT assay 48 hours post radiation. An NO inhibitor,
L-NAME (Figure 22C), was also incubated with HUVEC prior to radiation and cell viability
was again measured by MTT assay. HUVEC viability was also examined after co-incubation
of L-NAME and CD47 morpholino ± radiation.
SEQUENCE LISTING
[0011] The disclosed nucleic and amino acid sequences referenced herein are shown using
standard letter abbreviations for nucleotide bases, and three letter code for amino
acids, as defined in 37 C.F.R. 1.822. In the accompanying sequence listing:
SEQ ID NO: 1 is peptide C6d.
SEQ ID NO: 2 is peptide p7N3.
SEQ ID NO: 3 is peptide p604,
SEQ ID NO: 4 is a CD47 targeting morpholino.
SEQ ID NO: 5 is a CD47 control morpholino.
SEQ ID NOs: 6 and 7 are oligonucleotides used to amplify PKD1 polycystin 1 NT_039649.6 (nuclear).
SEQ ID NO: 8 and 9 are oligonucleotides used to amplify GTF2IRD1 General transcription factor, NT_039314 (nuclear).
SEQ ID NOs: 10 and 11 are oligonucleotides used to amplify Osteocalcin NM_001032298.2 (nuclear).
SEQ ID NOs: 12 and 13 are oligonucleotides used to amplify NADH6 NC_005089.1 (mitochondrial).
SEQ ID NOs: 14 and 15 are oligonucleotides used to amplify 6S rRNA NC_005089.1 (mitochondrial).
SEQ ID NO: 16 is a CD36 targeting morpholino.
DETAILED DESCRIPTION
I. Abbreviations
[0012]
- 3TSR
- type 1 repeats of TSP1
- 8-Br-cGMP
- 8-Bromo cyclic guanine monophosphate
- ANOVA
- analysis of variance
- BOLD MRI
- blood oxygen level dependent magnetic resonance imaging
- cGMP
- cyclic guanine monophosphate
- E3CaG1
- C-terminal regions of TSP1
- eNOS
- endothelial NO synthase
- FTSG
- full thickness skin graft
- Gy
- Gray
- HASMC
- human aortic smooth muscle cells (equivalent to HAVSMC)
- HAVSMC
- human aortic vascular smooth muscle cells
- HUVEC
- human umbilical vein endothelial cells
- I/R
- ischemia-reperfusion
- IR
- ionizing radiation
- L-NAME
- N-nitro-L-arginine methyl ester
- NO
- nitric oxide
- NoC1
- N-terminal domains of TSP1
- NOS
- nitric oxide synthase
- PAD
- peripheral artery disease
- PBS
- phosphate buffered saline
- PVD
- peripheral vascular disease
- SD
- standard deviation
- sGC
- soluble guanylyl cyclase
- TSP1
- thrombospondin-1
- VSMC
- vascular smooth muscle cells
II. Terms
[0013] Unless otherwise noted, technical terms are used according to conventional usage.
Definitions of common terms in molecular biology may be found in
Benjamin Lewin, Genes V, published by Oxford University Press, 1994 (ISBN 0-19-854287-9);
Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell
Science Ltd., 1994 (ISBN 0-632-02182-9); and
Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk
Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8).
[0014] In order to facilitate review of the various embodiments of the invention, the following
explanations of specific terms are provided:
[0015] Administration: Administration of an active compound or composition can be by any route known to
one of skill in the art. Administration can be local or systemic. Examples of local
administration include, but are not limited to, topical administration, subcutaneous
administration, intramuscular administration, intrathecal administration, intrapericardial
administration, intra-ocular administration, topical ophthalmic administration, or
administration to the nasal mucosa or lungs by inhalational administration. In addition,
local administration includes routes of administration typically used for systemic
administration, for example by directing intravascular administration to the arterial
supply for a particular organ. Thus, in particular embodiments, local administration
includes intra-arterial administration and intravenous administration when such administration
is targeted to the vasculature supplying a particular organ. Local administration
also includes the incorporation of active compounds and agents into implantable devices
or constructs, such as vascular stents or other reservoirs, which release the active
agents and compounds over extended time intervals for sustained treatment effects.
[0016] Systemic administration includes any route of administration designed to distribute
an active compound or composition widely throughout the body via the circulatory system.
Thus, systemic administration includes, but is not limited to intra-arterial and intravenous
administration. Systemic administration also includes, but is not limited to, topical
administration, subcutaneous administration, intramuscular administration, or administration
by inhalation, when such administration is directed at absorption and distribution
throughout the body by the circulatory system.
[0017] Altered expression: Expression of a biological molecule (for example, mRNA or protein) in a subject or
biological sample from a subject that deviates from expression if the same biological
molecule in a subject or biological sample from a subject having normal or unaltered
characteristics for the biological condition associated with the molecule. Normal
expression can be found in a control, a standard for a population, etc. Altered expression
of a biological molecule may be associated with a disease. The term associated with
includes an increased risk of developing the disease as well as the disease itself.
Expression may be altered in such a manner as to be increased or decreased. The directed
alteration in expression of mRNA or protein may be associated with therapeutic benefits.
[0018] Altered protein expression refers to expression of a protein that is in some manner
different from expression of the protein in a normal (wild type) situation. This includes
but is not necessarily limited to: (1) a mutation in the protein such that one or
more of the amino acid residues is different; (2) a short deletion or addition of
one or a few amino acid residues to the sequence of the protein; (3) a longer deletion
or addition of amino acid residues, such that an entire protein domain or sub-domain
is removed or added; (4) expression of an increased amount of the protein, compared
to a control or standard amount; (5) expression of an decreased amount of the protein,
compared to a control or standard amount; (6) alteration of the subcellular localization
or targeting of the protein; (7) alteration of the temporally regulated expression
of the protein (such that the protein is expressed when it normally would not be,
or alternatively is not expressed when it normally would be); and (8) alteration of
the localized (for example, organ or tissue specific) expression of the protein (such
that the protein is not expressed where it would normally be expressed or is expressed
where it normally would not be expressed), each compared to a control or standard.
[0019] Controls or standards appropriate for comparison to a sample, for the determination
of altered expression, include samples believed to express normally as well as laboratory
values, even though possibly arbitrarily set, keeping in mind that such values may
vary from laboratory to laboratory. Laboratory standards and values may be set based
on a known or determined population value and may be supplied in the format of a graph
or table that permits easy comparison of measured, experimentally determined values.
[0020] Analog, derivative or mimetic: An analog is a molecule that differs in chemical structure from a parent compound,
for example a homolog (differing by an increment in the chemical structure, such as
a difference in the length of an alkyl chain), a molecular fragment, a structure that
differs by one or more functional groups, a change in ionization. Structural analogs
are often found using quantitative structure activity relationships (QSAR), with techniques
such as those disclosed in
Remington (The Science and Practice of Pharmacology, 19th Edition (1995), chapter 28). A derivative is a biologically active molecule derived from the base
structure. A mimetic is a molecule that mimics the activity of another molecule, such
as a biologically active molecule. Biologically active molecules can include chemical
structures that mimic the biological activities of a compound. It is acknowledged
that these terms may overlap in some circumstances.
[0021] Animal: Living multi-cellular vertebrate organisms, a category that includes, for example,
mammals and birds. The term mammal includes both human and non-human mammals. Similarly,
the term subject includes both human and veterinary subjects, for example, humans,
non-human primates, dogs, cats, horses, and cows.
[0022] Angiogenesis: Biological process leading to the generation of new blood vessels through sprouting
or growth from pre-existing blood vessels. The process involves the migration and
proliferation of endothelial and vascular smooth muscle cells from preexisting vessels.
Angiogenesis occurs during pre-natal development, post-natal development, and in the
adult. In the adult, angiogenesis occurs during the normal cycle of the female reproductive
system, wound healing, and during pathological processes such as cancer (for a review
see
Battegay, J. Molec. Med. 73(7): 333-346, 1995).
[0023] Antagonist: A molecule or compound that tends to nullify the action of another, or in some instances
that blocks the ability of a given chemical to bind to its receptor or other interacting
molecule, preventing a biological response. Antagonists are not limited to a specific
type of compound, and may include in various embodiments peptides, antibodies and
fragments thereof, and other organic or inorganic compounds (for example, peptidomimetics
and small molecules).
[0024] Antibody: A protein (or protein complex) that includes one or more polypeptides substantially
encoded by immunoglobulin genes or fragments of immunoglobulin genes. The recognized
immunoglobulin genes include the kappa, lambda, alpha, gamma, delta, epsilon and mu
constant region genes, as well as the myriad immunoglobulin variable region genes.
Light chains are classified as either kappa or lambda. Heavy chains are classified
as gamma, mu, alpha, delta, or epsilon, which in turn define the immunoglobulin classes,
IgG, IgM, IgA, IgD and IgE, respectively.
[0025] The basic immunoglobulin (antibody) structural unit is generally a tetramer. Each
tetramer is composed of two identical pairs of polypeptide chains, each pair having
one light (about 25 kD) and one heavy chain (about 50-70 kD). The N-terminus of each
chain defines a variable region of about 100 to 110 or more amino acids primarily
responsible for antigen recognition. The terms variable light chain (V
L) and variable heavy chain (V
H) refer, respectively, to these light and heavy chains.
[0026] As used herein, the term antibody includes intact immunoglobulins as well as a number
of well-characterized fragments produced by digestion with various peptidases, or
genetically engineered artificial antibodies. Thus, for example, pepsin digests an
antibody below the disulfide linkages in the hinge region to produce F(ab)'
2, a dimer of Fab which itself is a light chain joined to V
H-C
H 1 by a disulfide bond. The F(ab)'
2 may be reduced under mild conditions to break the disulfide linkage in the hinge
region thereby converting the F(ab)'
2 dimer into an Fab' monomer. The Fab' monomer is essentially a Fab with part of the
hinge region (see,
Fundamental Immunology, W. E. Paul, ed., Raven Press, N.Y., 1993). While various antibody fragments are defined in terms of the digestion of an intact
antibody, it will be appreciated that Fab' fragments may be synthesized
de novo either chemically or by utilizing recombinant DNA methodology. Thus, the term antibody
as used herein also includes antibody fragments either produced by the modification
of whole antibodies or synthesized
de novo using recombinant DNA methodologies.
[0028] The terms bind specifically and specific binding refer to the ability of a specific
binding agent (such as, an antibody) to bind to a target molecular species in preference
to binding to other molecular species with which the specific binding agent and target
molecular species are admixed. A specific binding agent is said specifically to recognize
a target molecular species when it can bind specifically to that target.
[0029] A single-chain antibody (scFv) is a genetically engineered molecule containing the
V
H and V
L domains of one or more antibody(ies) linked by a suitable polypeptide linker as a
genetically fused single chain molecule (see, for example,
Bird et al., Science, 242:423-426, 1988;
Huston et al., Proc. Natl. Acad. Sci., 85:5879-5883, 1988). Diabodies are bivalent, bispecific antibodies in which V
H and V
L domains are expressed on a single polypeptide chain, but using a linker that is too
short to allow for pairing between the two domains on the same chain, thereby forcing
the domains to pair with complementary domains of another chain and creating two antigen
binding sites (see, for example,
Holliger et al., Proc. Natl. Acad. Sci., 90:6444-6448, 1993;
Poljak et al., Structure, 2:1121-1123, 1994). One or more CDRs may be incorporated into a molecule either covalently or noncovalently
to make the resultant molecule an immunoadhesin. An immunoadhesin may incorporate
the CDR(s) as part of a larger polypeptide chain, may covalently link the CDR(s) to
another polypeptide chain, or may incorporate the CDR(s) noncovalently. The CDRs permit
the immunoadhesin to specifically bind to a particular antigen of interest. A chimeric
antibody is an antibody that contains one or more regions from one antibody and one
or more regions from one or more other antibodies.
[0030] An antibody may have one or more binding sites. If there is more than one binding
site, the binding sites may be identical to one another or may be different. For instance,
a naturally-occurring immunoglobulin has two identical binding sites, a single-chain
antibody or Fab fragment has one binding site, while a bispecific or bifunctional
antibody has two different binding sites.
[0031] A neutralizing antibody or an inhibitory antibody is an antibody that inhibits at
least one activity of a target -- usually a polypeptide -- such as by blocking the
binding of the polypeptide to a ligand to which it normally binds, or by disrupting
or otherwise interfering with a protein-protein interaction of the polypeptide with
a second polypeptide. An activating antibody is an antibody that increases an activity
of a polypeptide. Antibodies may function as mimics of a target protein activity,
or as blockers of the target protein activity, with therapeutic effect derived therein.
[0032] Antigen: A compound, composition, or substance that can stimulate the production of antibodies
or a T-cell response in an animal, including compositions that are injected or absorbed
into an animal. An antigen reacts with the products of specific humoral or cellular
immunity, including those induced by heterologous immunogens.
[0033] Antisense, Sense, and Antigene: Double-stranded DNA (dsDNA) has two strands, a 5' -> 3' strand, referred to as the
plus strand, and a 3' -> 5' strand (the reverse compliment), referred to as the minus
strand. Because RNA polymerase adds nucleic acids in a 5' -> 3' direction, the minus
strand of the DNA serves as the template for the RNA during transcription. Thus, the
RNA formed will have a sequence complementary to the minus strand and identical to
the plus strand (except that U is substituted for T).
[0034] Antisense molecules are molecules that are specifically hybridizable or specifically
complementary to either RNA or plus strand DNA. Sense molecules are molecules that
are specifically hybridizable or specifically complementary to the minus strand of
DNA. Antigene molecules are either antisense or sense molecules complimentary to a
dsDNA target. In one embodiment, an antisense molecule specifically hybridizes to
a target mRNA and inhibits transcription of the target mRNA.
[0035] Aptamer: A single-stranded nucleic acid molecule (such as DNA or RNA) that assumes a specific,
sequence-dependent shape and binds to a target protein with high affinity and specificity.
Aptamers generally comprise fewer than 100 nucleotides, fewer than 75 nucleotides,
or fewer than 50 nucleotides. Mirror-image aptamer(s) (also called Spiegelmers™) are
high-affinity L-enantiomeric nucleic acids (for example, L-ribose or L-2'-deoxyribose
units) that display high resistance to enzymatic degradation compared with D-oligonucleotides
(such as aptamers). The target binding properties of mirror-image aptamers are designed
by an
in vitro-selection process starting from a random pool of oligonucleotides, as described for
example, in
Wlotzka et al., Proc. Natl. Acad. Sci. 99(13):8898-8902, 2002. Applying this method, high affinity mirror-image aptamers specific for a polypeptide
can be generated.
[0036] Binding affinity: A term that refers to the strength of binding of one molecule to another at a site
on the molecule. If a particular molecule will bind to or specifically associate with
another particular molecule, these two molecules are said to exhibit binding affinity
for each other. Binding affinity is related to the association constant and dissociation
constant for a pair of molecules, but it is not critical to the methods herein that
these constants be measured or determined. Rather, affinities as used herein to describe
interactions between molecules of the described methods are generally apparent affinities
(unless otherwise specified) observed in empirical studies, which can be used to compare
the relative strength with which one molecule (
e.g., an antibody or other specific binding partner) will bind two other molecules (
e.g., two versions or variants of a peptide). The concepts of binding affinity, association
constant, and dissociation constant are well known.
[0037] Binding domain: The molecular structure associated with that portion of a receptor that binds ligand.
More particularly, the binding domain may refer to a polypeptide, natural or synthetic,
or nucleic acid encoding such a polypeptide, the amino acid sequence of which represents
a specific region (binding domain) of a protein, which either alone or in combination
with other domains, exhibits binding characteristics. Neither the specific sequences
nor the specific boundaries of such domains are critical, so long as binding activity
is exhibited. Likewise, used in this context, binding characteristics necessarily
includes a range of affinities, avidities and specificities, and combinations thereof,
so long as binding activity is exhibited.
[0038] Binding partner: Any molecule or composition capable of recognizing and binding to a specific structural
aspect of another molecule or composition. Examples of such binding partners and corresponding
molecule or composition include antigen/antibody, hapten/antibody, lectin/carbohydrate,
apoprotein/cofactor and biotin/(strept)avidin.
[0039] cDNA (complementary DNA): A piece of DNA lacking internal, noncoding segments (introns) and transcriptional
regulatory sequences. cDNA can also contain untranslated regions (UTRs) that are responsible
for translational control in the corresponding RNA molecule. cDNA is synthesized in
the laboratory by reverse transcription from messenger RNA extracted from cells.
[0040] DNA (deoxyribonucleic acid): A long chain polymer that comprises the genetic material of most living organisms
(some viruses have genes comprising ribonucleic acid (RNA)). The repeating units in
DNA polymers are four different nucleotides, each of which comprises one of the four
bases, adenine, guanine, cytosine and thymine bound to a deoxyribose sugar to which
a phosphate group is attached. Triplets of nucleotides (referred to as codons) code
for each amino acid in a polypeptide. The term codon is also used for the corresponding
(and complementary) sequences of three nucleotides in the mRNA into which the DNA
sequence is transcribed.
[0041] Unless otherwise specified, any reference to a DNA molecule is intended to include
the reverse complement of that DNA molecule. Except where single-strandedness is required
by the text herein, DNA molecules, though written to depict only a single strand,
encompass both strands of a double-stranded DNA molecule. Thus, a reference to the
nucleic acid molecule that encodes a specific protein, or a fragment thereof, encompasses
both the sense strand and its reverse complement. Thus, for instance, it is appropriate
to generate probes or primers from the reverse complement sequence of the disclosed
nucleic acid molecules.
[0042] Deletion: The removal of a sequence of DNA (which may be as short as a single nucleotide),
the regions on either side being joined together.
[0043] Effective amount of a compound: A quantity of compound sufficient to achieve a desired effect in a subject being
treated. An effective amount of a compound can be administered in a single dose, or
in several doses, for example daily, during a course of treatment. However, the effective
amount of the compound will be dependent on the compound applied, the subject being
treated, the severity and type of the affliction, and the manner of administration
of the compound.
[0044] Encode: A polynucleotide is said to encode a polypeptide if, in its native state or when
manipulated by methods well known to those skilled in the art, it can be transcribed
and/or translated to produce the mRNA for and/or the polypeptide or a fragment thereof.
[0045] Epitope: An antigenic determinant. These are particular chemical groups or peptide sequences
on a molecule that are antigenic, for instance, that elicit a specific immune response.
An antibody binds a particular antigenic epitope, based on a 3-D structure of the
antibody and the matching or cognate epitope. Epitopes can be formed both from contiguous
amino acids or noncontiguous amino acids juxtaposed by tertiary folding of a protein.
Epitopes formed from contiguous amino acids are typically retained on exposure to
denaturing solvents whereas epitopes formed by tertiary folding are typically lost
on treatment with denaturing solvents. An epitope typically includes at least 3, and
more usually, at least 5, about 9, or 8 to 10 amino acids in a unique spatial conformation.
Methods of determining spatial conformation of epitopes include, for example, x-ray
crystallography and 2-dimensional nuclear magnetic resonance. See,
e.g., "Epitope Mapping Protocols" in Methods in Molecular Biology, Vol. 66, Glenn E. Morris,
Ed (1996). In one embodiment, an epitope binds an MHC molecule, such an HLA molecule
or a DR molecule. These molecules bind polypeptides having the correct anchor amino
acids separated by about eight to about ten amino acids, such as nine amino acids.
[0046] Functionally equivalent sequence variant: Sequence alterations that yield the same results as described herein. Such sequence
alterations can include, but are not limited to, deletions, base modifications, mutations,
labeling, and insertions.
[0047] Fusion protein: A protein comprising two amino acid sequences that are not found joined together
in nature.
[0048] Gene expression: The process by which the coded information of a nucleic acid transcriptional unit
(including, for example, genomic DNA or cDNA) is converted into an operational, non-operational,
or structural part of a cell, often including the synthesis of a protein. Gene expression
can be influenced by external signals; for instance, exposure of a subject to an agent
that inhibits gene expression. Expression of a gene also may be regulated anywhere
in the pathway from DNA to RNA to protein. Regulation of gene expression occurs, for
instance, through controls acting on transcription, translation, RNA transport and
processing, degradation of intermediary molecules such as mRNA, or through activation,
inactivation, compartmentalization or degradation of specific protein molecules after
they have been made, or by combinations thereof. Gene expression may be measured at
the RNA level or the protein level and by any method known in the art, including Northern
blot, RT-PCR, Western blot, or
in vitro, in situ, or
in vivo protein activity assay(s).
[0049] The expression of a nucleic acid may be modulated compared to a control state, such
as at a control time (for example, prior to administration of a substance or agent
that affects regulation of the nucleic acid under observation) or in a control cell
or subject, or as compared to another nucleic acid. Such modulation includes but is
not necessarily limited to overexpression, underexpression, or suppression of expression.
In addition, it is understood that modulation of nucleic acid expression may be associated
with, and in fact may result in, a modulation in the expression of an encoded protein
or even a protein that is not encoded by that nucleic acid.
[0050] Interfering with or inhibiting gene expression refers to the ability of an agent
to measurably reduce the expression of a target gene. Expression of a target gene
may be measured by any method known to those of skill in the art, including for example
measuring mRNA or protein levels. It is understood that interfering with or inhibiting
gene expression is relative, and does not require absolute suppression of the gene.
Thus, in certain embodiments, interfering with or inhibiting gene expression of a
target gene requires that, following application of an agent, the gene is expressed
at least 5% less than prior to application, at least 10% less, at least 15% less,
at least 20% less, at least 25% less, or even more reduced. Thus, in some particular
embodiments, application of an agent reduces expression of the target gene by about
30%, about 40%, about 50%, about 60%, or more. In specific examples, where the agent
is particularly effective, expression is reduced by 70%, 80%, 85%, 90%, 95%, or even
more. Gene expression is substantially eliminated when expression of the gene is reduced
by 90%, 95%, 98%, 99% or even 100%.
[0051] Heterologous: A type of sequence that is not normally (for example, in the wild-type sequence)
found adjacent to a second sequence. In one embodiment, the sequence is from a different
genetic source, such as a virus or other organism, than the second sequence.
[0052] Hybridization: Oligonucleotides and their analogs hybridize by hydrogen bonding, which includes
Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary
bases. Generally, nucleic acid consists of nitrogenous bases that are either pyrimidines
(cytosine (C), uracil (U), and thymine (T)) or purines (adenine (A) and guanine (G)).
These nitrogenous bases form hydrogen bonds between a pyrimidine and a purine, and
the bonding of the pyrimidine to the purine is referred to as base pairing. More specifically,
A will hydrogen bond to T or U, and G will bond to C. Complementary refers to the
base pairing that occurs between to distinct nucleic acid sequences or two distinct
regions of the same nucleic acid sequence.
[0053] Increasing tumor ablation: The increased killing of cancerous or tumor cells in a subject undergoing radiotherapy.
In some examples, increasing tumor ablation is evidenced by an increased delay in
tumor regrowth following exposure to radiation as part of radiotherapy in a subject.
Increasing tumor ablation encompasses, but is not restricted to, an enhanced anti-tumor
immune response resulting from the protection of immune cells from the deleterious
affects of radiotherapy by exposure of the immune cells to an agent that inhibits
the interaction between TSP1 and CD47.
[0054] Inhibiting protein activity: To decrease, limit, or block an action, function or expression of a protein. The
phrase inhibit protein activity is not intended to be an absolute term. Instead, the
phrase is intended to convey a wide-range of inhibitory effects that various agents
may have on the normal (for example, uninhibited or control) protein activity. Inhibition
of protein activity may, but need not, result in an increase in the level or activity
of an indicator of the protein's activity. By way of example, this can happen when
the protein of interest is acting as an inhibitor or suppressor of a downstream indicator.
Thus, protein activity may be inhibited when the level or activity of any direct or
indirect indicator of the protein's activity is changed (for example, increased or
decreased) by at least 10%, at least 20%, at least 30%, at least 50%, at least 80%,
at least 100% or at least 250% or more as compared to control measurements of the
same indicator.
[0055] Inhibition of protein activity may also be effected, for example, by inhibiting expression
of the gene encoding the protein or by decreasing the half-life of the mRNA encoding
the protein.
[0056] Inhibits (or inhibiting) interaction: An agent inhibits an interaction between two or more molecules when the presence
of the agent prevents one or more of the molecules from contacting, and thus interacting
with, the other. In one example, the agent may decrease the presence or availability
of one (or more) of the molecules. Thus, a CD47 antisense morpholino that suppresses
the expression of CD47 will decrease the amount of CD47 that is available to interact
with TSP1, and therefor inhibit interaction between CD47 and TSP1. Likewise, an agent
that enhances proteolysis of CD47 or TSP1, or enhance removal of CD47 from the cell
surface, will inhibit interaction between CD47 and TSP1.
[0057] In another example, the agent may physically blockade n interaction between the two
(or more) molecules. Thus, a CD47-reactive monoclonal antibody that prevents TSP1
from binding to CD47 is an agent that inhibits interaction between CD47 and TSP1.
[0058] Injectable composition: A pharmaceutically acceptable fluid composition comprising at least one active ingredient,
for example, a protein, peptide, or antibody. The active ingredient is usually dissolved
or suspended in a physiologically acceptable carrier, and the composition can additionally
comprise minor amounts of one or more non-toxic auxiliary substances, such as emulsifying
agents, preservatives, pH buffering agents and the like. Such injectable compositions
that are useful for use with the compositions of this disclosure are conventional;
appropriate formulations are well known in the art.
[0059] Isolated: An isolated biological component (such as a nucleic acid, peptide or protein) has
been substantially separated, produced apart from, or purified away from other biological
components in the cell of the organism in which the component naturally occurs, for
instance, other chromosomal and extrachromosomal DNA and RNA, and proteins. Nucleic
acids, peptides and proteins that have been isolated thus include nucleic acids and
proteins purified by standard purification methods. The term also embraces nucleic
acids, peptides and proteins prepared by recombinant expression in a host cell as
well as chemically synthesized nucleic acids. The terms isolated and purified do not
require absolute purity; rather, it is intended as a relative term. Thus, for example,
an isolated peptide preparation is one in which the peptide or protein is more enriched
than the peptide or protein is in its natural environment within a cell. Preferably,
a preparation is purified such that the protein or peptide represents at least 50%
of the total peptide or protein content of the preparation.
[0060] Label: A detectable compound or composition that is conjugated directly or indirectly to
another molecule to facilitate detection of that molecule. Specific, nonlimiting examples
of labels include fluorescent tags, enzymatic linkages, and radioactive isotopes.
[0061] Mammal: This term includes both human and non-human mammals. Similarly, the term subject
includes both human and veterinary subjects, for example, humans, non-human primates,
mice, rats, dogs, cats, horses, and cows.
[0062] Modulator: An agent that increases or decreases (modulates) the activity of a protein or other
bio-active compound, as measured by the change in an experimental biological parameter.
A modulator can be essentially any compound or mixture (for example, two or more proteins),
such as a NO donor, a polypeptide, a hormone, a nucleic acid, a sugar, a lipid and
the like.
[0063] Morpholino: A morpholino oligo is structurally different from natural nucleic acids, with morpholino
rings replacing the ribose or deoxyribose sugar moieties and non-ionic phosphorodiamidate
linkages replacing the anionic phosphates of DNA and RNA. Each morpholino ring suitably
positions one of the standard bases (A, G, C, T/U), so that a 25-base morpholino oligo
strongly and specifically binds to its complementary 25-base target site in a strand
of RNA via Watson-Crick pairing. Because the backbone of the morpholino oligo is not
recognized by cellular enzymes of signaling proteins, it is stable to nucleases and
does not trigger an innate immune response through the toll-like receptors. This avoids
loss of oligo, inflammation or interferon induction. Morpholinos can be delivered
by a number of techniques, including direct injection to tissues or via infusion pump
and intravenous bolus, topical application, or intraperitoneal injection.
[0064] Mutation: Any change of DNA sequence, for instance within a gene or chromosome. In some instances,
a mutation will alter a characteristic or trait (phenotype), but this is not always
the case. Types of mutations include base substitution point mutations (for example,
transitions or transversions), deletions, and insertions. Missense mutations are those
that introduce a different amino acid into the sequence of the encoded protein; nonsense
mutations are those that introduce a new stop codon. In the case of insertions or
deletions, mutations can be in-frame (not changing the frame of the overall sequence)
or frame shift mutations, which may result in the misreading of a large number of
codons (and often leads to abnormal termination of the encoded product due to the
presence of a stop codon in the alternative frame).
[0065] This term specifically encompasses variations that arise through somatic mutation,
for instance those that are found only in disease cells, but not constitutionally,
in a given individual. Examples of such somatically-acquired variations include the
point mutations that frequently result in altered function of various genes that are
involved in development of cancers. This term also encompasses DNA alterations that
are present constitutionally, that alter the function of the encoded protein in a
readily demonstrable manner, and that can be inherited by the children of an affected
individual. In this respect, the term overlaps with polymorphism, as defined below,
but generally refers to the subset of constitutional alterations that have arisen
within the past few generations in kindred and that are not widely disseminated in
a population group. In particular embodiments, the term is directed to those constitutional
alterations that have major impact on the health of affected individuals.
[0066] Nitric Oxide: A bioactive gas produced by a family of isoenzymes (
e.g., NOS) and that drives many pro-survival signals in mammalian cells through activation
of soluble guanylate cyclase (sGC). NO signaling is regulated at multiple points along
the canonical pathway including at the level of sGC and downstream at the cGMP-dependant
kinase by thrombospondin-1-CD47. Inhibitory signaling via TSP1-CD47 tempers both basal
sGC activity in tissues and cells and blocks sGC activation by NO. Nitric oxide is
an important prosurvival and proflow (that is, pro-blood-flow) molecule.
[0067] Nitric Oxide synthase: An enzyme that catalyzes conversion of l-arginine, NADPH and oxygen to citrulline,
nitric oxide and NADP+. Nitric oxide synthase catalyzes nitric oxide synthesis in
the inner lining cells of blood vessels, as well as in macrophages and nerve cells.
The generic nomenclature includes all three known isoforms of NOS designated in the
literature as eNOS, iNOS and nNOS and alternatively as NOS-I, NOS-II and NOS-III.
[0068] Nucleic acid molecule: A polymeric form of nucleotides, which may include both sense and anti-sense strands
of RNA, cDNA, genomic DNA, and synthetic forms and mixed polymers thereof. A nucleotide
refers to a ribonucleotide, deoxynucleotide or a modified form of either type of nucleotide.
A nucleic acid molecule as used herein is synonymous with nucleic acid and polynucleotide.
A nucleic acid molecule is usually at least 10 bases in length, unless otherwise specified.
The term includes single- and double-stranded forms. A polynucleotide may include
either or both naturally occurring and modified nucleotides linked together by naturally
occurring nucleotide linkages and/or non-naturally occurring chemical linkers.
[0069] Nucleic acid molecules may be modified chemically or biochemically or may contain
non-natural or derivatized nucleotide bases, as will be readily appreciated by those
of skill in the art. Such modifications include, for example, labels, methylation,
substitution of one or more of the naturally occurring nucleotides with an analog,
internucleotide modifications, such as uncharged linkages (for example, methyl phosphonates,
phosphotriesters, phosphoramidates, carbamates, etc.), charged linkages (for example,
phosphorothioates, phosphorodithioates, etc.), pendent moieties (for example, polypeptides),
intercalators (for example, acridine, psoralen, etc.), chelators, alkylators, and
modified linkages (for example, alpha anomeric nucleic acids, etc.). The term nucleic
acid molecule also includes any topological conformation, including single-stranded,
double-stranded, partially duplexed, triplexed, hairpinned, circular and padlocked
conformations. Also included are synthetic molecules that mimic polynucleotides in
their ability to bind to a designated sequence via hydrogen bonding and other chemical
interactions. Such molecules are known in the art and include, for example, those
in which peptide linkages substitute for phosphate linkages in the backbone of the
molecule.
[0070] Unless specified otherwise, the left hand end of a polynucleotide sequence written
in the sense orientation is the 5' end and the right hand end of the sequence is the
3' end. In addition, the left hand direction of a polynucleotide sequence written
in the sense orientation is referred to as the 5' direction, while the right hand
direction of the polynucleotide sequence is referred to as the 3' direction. Further,
unless otherwise indicated, each nucleotide sequence is set forth herein as a sequence
of deoxyribonucleotides. It is intended, however, that the given sequence be interpreted
as would be appropriate to the polynucleotide composition: for example, if the isolated
nucleic acid is composed of RNA, the given sequence intends ribonucleotides, with
uridine substituted for thymidine.
[0071] An anti-sense nucleic acid is a nucleic acid (such as, an RNA or DNA oligonucleotide)
that has a sequence complementary to a second nucleic acid molecule (for example,
an mRNA molecule). An anti-sense nucleic acid will specifically bind with high affinity
to the second nucleic acid sequence. If the second nucleic acid sequence is an mRNA
molecule, for example, the specific binding of an anti-sense nucleic acid to the mRNA
molecule can prevent or reduce translation of the mRNA into the encoded protein or
decrease the half life of the mRNA, and thereby inhibit the expression of the encoded
protein.
[0072] Oligonucleotide: A plurality of joined nucleotides joined by native phosphodiester bonds, between
about 6 and about 300 nucleotides in length. An oligonucleotide analog refers to moieties
that function similarly to oligonucleotides but have non-naturally occurring portions.
For example, oligonucleotide analogs can contain non-naturally occurring portions,
such as altered sugar moieties or inter-sugar linkages, such as a phosphorothioate
oligodeoxynucleotide. Functional analogs of naturally occurring polynucleotides can
bind to RNA or DNA, and include peptide nucleic acid (PNA) molecules and morpholinos.
[0073] Particular oligonucleotides and oligonucleotide analogs can include linear sequences
up to about 200 nucleotides in length, for example a sequence (such as DNA or RNA)
that is at least 6 bases, for example at least 8, 10, 15, 20, 25, 30, 35, 40, 45,
50, 100 or even 200 bases long, or from about 6 to about 50 bases, for example about
10-25 bases, such as 12, 15 or 20 bases.
[0074] Operably linked: A first nucleic acid sequence is operably linked with a second nucleic acid sequence
when the first nucleic acid sequence is placed in a functional relationship with the
second nucleic acid sequence. For instance, a promoter is operably linked to a coding
sequence if the promoter affects the transcription or expression of the coding sequence.
Generally, operably linked DNA sequences are contiguous and, where necessary to join
two protein-coding regions, in the same reading frame.
[0075] Open reading frame: A series of nucleotide triplets (codons) coding for amino acids without any internal
termination codons. These sequences are usually translatable into a peptide.
[0076] Ortholog: Two nucleic acid or amino acid sequences are orthologs of each other if they share
a common ancestral sequence and diverged when a species carrying that ancestral sequence
split into two species. Orthologous sequences are also homologous sequences.
[0077] Parenteral: Administered outside of the intestine, for example, not via the alimentary tract.
Generally, parenteral formulations are those that will be administered through any
possible mode except ingestion. This term especially refers to injections, whether
administered intravenously, intrathecally, intramuscularly, intraperitoneally, or
subcutaneously, and various surface applications including intranasal, intradermal,
and topical application, for instance.
[0078] Pharmaceutically acceptable carriers: The pharmaceutically acceptable carriers useful in this disclosure are conventional.
Remington's Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co., Easton,
PA, 15th Edition (1975), describes compositions and formulations suitable for pharmaceutical
delivery of the compounds herein disclosed.
[0079] In general, the nature of the carrier will depend on the particular mode of administration
being employed. For instance, parenteral formulations usually comprise injectable
fluids that include pharmaceutically and physiologically acceptable fluids such as
water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or
the like as a vehicle. For solid compositions (for example, powder, pill, tablet,
or capsule forms), conventional non-toxic solid carriers can include, for example,
pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate. In addition
to biologically-neutral carriers, pharmaceutical compositions to be administered can
contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying
agents, preservatives, and pH buffering agents and the like, for example sodium acetate
or sorbitan monolaurate.
[0080] Pharmaceutical agent: A chemical compound or composition capable of inducing a desired therapeutic or prophylactic
effect when properly administered to a subject or a cell. Incubating includes exposing
a target to an agent for a sufficient period of time for the agent to interact with
a cell. Contacting includes incubating an agent in solid or in liquid form with a
cell.
[0081] Polypeptide: A polymer in which the monomers are amino acid residues that are joined together
through amide bonds. When the amino acids are alpha-amino acids, either the L-optical
isomer or the D-optical isomer can be used, the L-isomers being preferred. The term
polypeptide or protein as used herein encompasses any amino acid sequence and includes
modified sequences such as glycoproteins. The term polypeptide is specifically intended
to cover naturally occurring proteins, as well as those that are recombinantly or
synthetically produced.
[0082] The term polypeptide fragment refers to a portion of a polypeptide that exhibits
at least one useful epitope. The phrase "functional fragment(s) of a polypeptide"
refers to all fragments of a polypeptide that retain an activity, or a measurable
portion of an activity, of the polypeptide from which the fragment is derived. Fragments,
for example, can vary in size from a polypeptide fragment as small as an epitope capable
of binding an antibody molecule to a large polypeptide capable of participating in
the characteristic induction or programming of phenotypic changes within a cell. An
epitope is a region of a polypeptide capable of binding an immunoglobulin generated
in response to contact with an antigen. Thus, smaller peptides containing the biological
activity of insulin, or conservative variants of the insulin, are thus included as
being of use.
[0083] Conservative amino acid substitution tables providing functionally similar amino
acids are well known to one of ordinary skill in the art. The following six groups
are examples of amino acids that are considered to be conservative substitutions for
one another:
- 1) Alanine (A), Serine (S), Threonine (T);
- 2) Aspartic acid (D), Glutamic acid (E);
- 3) Asparagine (N), Glutamine (Q);
- 4) Arginine (R), Lysine (K);
- 5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); and
- 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W).
[0084] In some circumstances, variations in the cDNA sequence that result in amino acid
changes, whether conservative or not, are minimized in order to preserve the functional
and immunologic identity of the encoded protein. The immunologic identity of the protein
may be assessed by determining whether it is recognized by an antibody; a variant
that is recognized by such an antibody is immunologically conserved. Any cDNA sequence
variant will preferably introduce no more than twenty, and preferably fewer than ten
amino acid substitutions into the encoded polypeptide. Variant amino acid sequences
may, for example, be 80%, 90%, or even 95% or 98% identical to the native amino acid
sequence. Programs and algorithms for determining percentage identity can be found
at the NCBI website.
[0085] Preventing or treating: Preventing refers to inhibiting the full development of something (such as a disease,
condition, etc.), for example inhibiting the development of tissue damage after radiation
therapy or other exposure to energetic radiation. Treatment refers to a therapeutic
intervention that ameliorates a sign or symptom after it has begun to develop.
[0086] Purified: In a more pure form than is found in nature. The term purified does not require absolute
purity; rather, it is intended as a relative term. Thus, for example, a purified protein
preparation is one in which the protein referred to is more pure than the protein
in its natural environment within a cell.
[0087] The term substantially purified as used herein refers to a molecule (for example,
a nucleic acid, polypeptide, oligonucleotide, etc.) that is substantially free of
other proteins, lipids, carbohydrates, or other materials with which it is naturally
associated. In one embodiment, a substantially purified molecule is a polypeptide
that is at least 50% free of other proteins, lipids, carbohydrates, or other materials
with which it is naturally associated. In another embodiment, the polypeptide is at
least at least 80% free of other proteins, lipids, carbohydrates, or other materials
with which it is naturally associated. In yet other embodiments, the polypeptide is
at least 90% or at least 95% free of other proteins, lipids, carbohydrates, or other
materials with which it is naturally associated.
[0088] Radioprotectant/Radioprotection: A cytoprotective substance or composition that prevents or lessens effect(s) of radiation,
particularly on cells, biological tissues, organs, or organisms. The concept of the
therapeutic ratio (TR) is central to understanding the rationale for using radioprotectants/radioprotectors
(
Brizel, J. Clin. Oncol 25:4084-4089, 2007). The TR relates tumor control probabilities and normal tissue complication probabilities
to one another. An optimal radioprotector reduces the latter without significantly
compromising the former, and is itself only minimally toxic. Radioprotective agents
can be classified as protectants or mitigants: Protectors are administered before
exposure to radiation (
e.g., radiotherapy (RT) or accidental or unintentional exposure) and are designed to
prevent radiation-induced injury. Amifostine is the prototype protectant see,
e.g., Kouvaris
et al., 12:738-747, 2007. Mitigants are administered after exposure to radiation, but before
the phenotypic expression of injury and are intended to ameliorate injury. Palifermin
(Kepivance®, Keratinocyte growth factor, KGF; see,
e.g., Speilberger et al., J. Support Oncol. 2:73-74, 2004) can be considered as the prototype mitigant. Treatment is a strategy that is predominantly
palliative and supportive in nature.
[0089] Radioprotection allows cells and tissues to survive, and optimally heal and grow,
in spite of injury from radiation. Radiation inherently damages tissues. The degree
of secondary tissue death and necrosis determines the amount of morbidity and mortality.
Radioprotectants attempt reduce, minimize or block the ability of radiation injury
to drive cell death. Cell death and tissue damage can be measured by many art known
methods. Methods used
in vitro and
in vivo include biochemical assessment of cell death using functional apoptosis and necrosis
assays (
e.g., DNA fragmentation, caspase activation, PARP cleavage, annexin V exposure, cytochrome
C release, and so forth), morphological changes in cells and tissues, and nuclear
fragmentation and loss.
In vivo, tissue damage can be assessed by loss of perfusion, scarring, desquamation, alopecia,
organ perforation and adhesions, etc.
[0090] Radiation: Radiation, as the term is used in physics, is energy in the form of waves or moving
subatomic particles emitted by an atom or other body as it changes from a higher energy
state to a lower energy state. Common sources of radiation include radon gas, cosmic
rays from outer space, and medical x-rays. Radiation can be classified as ionizing
or non-ionizing radiation, depending on its effect on atomic matter. The most common
use of the word "radiation" refers to ionizing radiation. Ionizing radiation has sufficient
energy to ionize atoms or molecules, while non-ionizing radiation does not. Radioactive
material is a physical material that emits ionizing radiation. There are three common
types of radiation, alpha, beta and gamma radiation. They are all emitted from the
nucleus of an unstable atom. X-rays produced by diagnostic and metallurgical imaging
and security screening equipment are also ionizing radiation, as are neutrons produced
by nuclear power generation and nuclear weapons.
[0091] Sources of radiation exposure include, but are not limited to, radiotherapy, nuclear
warfare, nuclear reactor accidents, and improper handling of research or medical radioactive
materials.
[0092] Radiation Dosage: The rad is a unit of absorbed radiation dose defined in terms of the energy actually
deposited in the tissue. One rad is an absorbed dose of 0.01 joules of energy per
kilogram of tissue. The more recent SI unit is the gray (Gy), which is defined as
1 joule of deposited energy per kilogram of tissue. Thus, one gray is equal to 100
rad.
[0093] To accurately assess the risk of radiation, the absorbed dose energy in rad is multiplied
by the relative biological effectiveness (RBE) of the radiation to get the biological
dose equivalent in rems. Rem stands for "Röntgen Equivalent Man". In SI units, the
absorbed dose energy in grays is multiplied by the same RBE to get a biological dose
equivalent in sieverts (Sv). The sievert is equal to 100 rem.
[0094] The RBE is a "quality factor," often denoted by the letter Q, which assesses the
damage to tissue caused by a particular type and energy of radiation. For alpha particles,
Q may be as high as 20, so that one rad of alpha radiation is equivalent to 20 rem.
The Q of neutron radiation depends on its energy. However, for beta particles, x-rays,
and gamma rays, Q is taken as one, so that the rad and rem are equivalent for those
radiation sources, as are the gray and sievert.
[0095] Radiation Poisoning: Also called radiation sickness or acute radiation syndrome, radiation poisoning involves
damage to biological tissue due to excessive exposure to ionizing radiation. The term
is generally used to refer to acute problems caused by a large dosage of radiation
in a short period, though this also has occurred with long term exposure to low level
radiation. Many of the symptoms of radiation poisoning result from ionizing radiation
interference with cell division. Beneficially, this same interference enables treatment
of cancer cells; such cells are among the fastest-dividing in the body, and in certain
instances can be destroyed by a radiation dose that adjacent normal cells are likely
to survive.
[0096] Symptoms of radiation poisoning include: reduction of red and/or white blood cell
count, decreased immune function (with increased susceptibility to infection), nausea
and vomiting, fatigue, sterility, hair loss, tissue burns and necrosis, gastrointestinal
damage accompanied by internal bleeding, and so forth.
[0097] Radiation Therapy (Radiotherapy): The treatment of disease (
e.g., cancer or another hyperproliferative disease or condition) by exposure of a subject
or their tissue to a radioactive substance. Radiation therapy is the medical use of
ionizing radiation as part of cancer treatment to control malignant cells. Radiotherapy
may be used for curative or adjuvant cancer treatment. It is used as palliative treatment
where cure is not possible and the aim is for local disease control or symptomatic
relief.
[0098] Recombinant: A nucleic acid that has a sequence that is not naturally occurring or has a sequence
that is made by an artificial combination of two otherwise separated segments of sequence.
This artificial combination can be accomplished by chemical synthesis or, more commonly,
by the artificial manipulation of isolated segments of nucleic acids, for example,
by genetic engineering techniques.
[0099] Ribozyme: RNA molecules with enzyme-like properties, which can be designed to cleave specific
RNA sequences. Ribozymes are also known as RNA enzymes or catalytic RNAs.
[0100] RNA interference (RNA silencing; RNAi): A gene-silencing mechanism whereby specific double-stranded RNA (dsRNA) trigger the
degradation of homologous mRNA (also called target RNA). Double-stranded RNA is processed
into small interfering RNAs (siRNA), which serve as a guide for cleavage of the homologous
mRNA in the RNA-induced silencing complex (RISC). The remnants of the target RNA may
then also act as siRNA; thus resulting in a cascade effect.
[0101] Senescence: The biological process(es) of aging and showing the effects of increased age. In
one embodiment, a senescent cell does not divide and/or has a reduced capacity to
divide.
[0102] Sequence identity: The similarity between two nucleic acid sequences, or two amino acid sequences, is
expressed in terms of the similarity between the sequences, otherwise referred to
as sequence identity. Sequence identity is frequently measured in terms of percentage
identity (or similarity or homology); the higher the percentage, the more similar
the two sequences are.
[0103] Methods of alignment of sequences for comparison are well known in the art. Various
programs and alignment algorithms are described in:
Smith and Waterman (Adv. Appl. Math. 2: 482, 1981);
Needleman and Wunsch (J. Mol. Biol. 48: 443, 1970);
Pearson and Lipman (PNAS USA 85: 2444, 1988);
Higgins and Sharp (Gene, 73: 237-244, 1988);
Higgins and Sharp (CABIOS 5: 151-153, 1989);
Corpet et al. (Nuc. Acids Res. 16: 10881-10890, 1988);
Huang et al. (Comp. Appls Biosci. 8: 155-165, 1992); and
Pearson et al. (Meth. Mol. Biol. 24: 307-31, 1994).
Altschul et al. (nature Genet., 6: 119-129, 1994) presents a detailed consideration of sequence alignment methods and homology calculations.
[0104] The alignment tools ALIGN (
Myers and Miller, CABIOS 4:11-17, 1989) or LFASTA (Pearson and Lipman, 1988) may be used to perform sequence comparisons
(Internet Program © 1996, W. R. Pearson and the University of Virginia, fasta20u63
version 2.0u63, release date December 1996). ALIGN compares entire sequences against
one another, while LFASTA compares regions of local similarity. These alignment tools
and their respective tutorials are available on the Internet at the NCSA Website.
Alternatively, for comparisons of amino acid sequences of greater than about 30 amino
acids, the Blast 2 sequences function can be employed using the default BLOSUM62 matrix
set to default parameters, (gap existence cost of 11, and a per residue gap cost of
1). When aligning short peptides (fewer than around 30 amino acids), the alignment
should be performed using the Blast 2 sequences function, employing the PAM30 matrix
set to default parameters (open gap 9, extension gap 1 penalties). The BLAST sequence
comparison system is available, for instance, from the NCBI web site; see also
Altschul et al., J. Mol. Biol. 215:403-410, 1990;
Gish. & States, Nature Genet. 3:266-272, 1993;
Madden et al. Meth. Enzymol. 266:131-141, 1996;
Altschul et al., Nucleic Acids Res. 25:3389-3402, 1997; and
Zhang & Madden, Genome Res. 7:649-656, 1997.
[0105] Orthologs of proteins are typically characterized by possession of greater than 75%
sequence identity counted over the full-length alignment with the amino acid sequence
of specific protein using ALIGN set to default parameters. Proteins with even greater
similarity to a reference sequence will show increasing percentage identities when
assessed by this method, such as at least 80%, at least 85%, at least 90%, at least
92%, at least 95%, or at least 98% sequence identity. In addition, sequence identity
can be compared over the full length of particular domains of the disclosed peptides.
[0106] When significantly less than the entire sequence is being compared for sequence identity,
homologous sequences will typically possess at least 80% sequence identity over short
windows of 10-20 amino acids, and may possess sequence identities of at least 85%,
at least 90%, at least 95%, or at least 99% depending on their similarity to the reference
sequence. Sequence identity over such short windows can be determined using LFASTA;
methods are described at the NCSA Website. One of skill in the art will appreciate
that these sequence identity ranges are provided for guidance only; it is entirely
possible that strongly significant homologs could be obtained that fall outside of
the ranges provided.
[0108] Hybridization conditions resulting in particular degrees of stringency will vary
depending upon the nature of the hybridization method of choice and the composition
and length of the hybridizing nucleic acid sequences. Generally, the temperature of
hybridization and the ionic strength (especially the Na+ concentration) of the hybridization
buffer will determine the stringency of hybridization, though waste times also influence
stringency. Calculations regarding hybridization conditions required for attaining
particular degrees of stringency are discussed by
Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3,
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989, chapters 9 and
11. The following is an exemplary set of hybridization conditions:
Very High Stringency (detects sequences that share 90% identity)
[0109]
| Hybridization: |
5x SSC at 65°C for 16 hours |
| Wash twice: |
2x SSC at room temperature (RT) for 15 minutes each |
| Wash twice: |
0.5x SSC at 65°C for 20 minutes each |
High Stringency (detects sequences that share 80% identity or greater)
[0110]
| Hybridization: |
5x-6x SSC at 65°C-70°C for 16-20 hours |
| Wash twice: |
2x SSC at RT for 5-20 minutes each |
| Wash twice: |
1x SSC at 55°C-70°C for 30 minutes each |
Low Stringency (detects sequences that share greater than 50% identity)
[0111]
| Hybridization: |
6x SSC at RT to 55°C for 16-20 hours |
| Wash at least twice: |
2x-3x SSC at RT to 55°C for 20-30 minutes each. |
[0112] Nucleic acid sequences that do not show a high degree of identity may nevertheless
encode similar amino acid sequences, due to the degeneracy of the genetic code. It
is understood that changes in nucleic acid sequence can be made using this degeneracy
to produce multiple nucleic acid sequences that each encode substantially the same
protein.
[0113] Specifically hybridizable and specifically complementary are terms that indicate
a sufficient degree of complementarity such that stable and specific binding occurs
between the oligonucleotide (or its analog) and the DNA or RNA target. The oligonucleotide
or oligonucleotide analog need not be 100% complementary to its target sequence to
be specifically hybridizable. An oligonucleotide or analog is specifically hybridizable
when binding of the oligonucleotide or analog to the target DNA or RNA molecule interferes
with the normal function of the target DNA or RNA, and there is a sufficient degree
of complementarity to avoid non-specific binding of the oligonucleotide or analog
to non-target sequences under conditions where specific binding is desired, for example
under physiological conditions in the case of
in vivo assays or systems. Such binding is referred to as specific hybridization.
[0114] Small interfering RNAs: Synthetic or naturally-produced small double stranded RNAs (dsRNAs) that can induce
gene-specific inhibition of expression in invertebrate and vertebrate species are
provided. These RNAs are suitable for interference or inhibition of expression of
a target gene and comprise double stranded RNAs of about 15 to about 40 nucleotides
containing a 3' and/or 5' overhang on each strand having a length of 0- to about 5-nucleotides,
wherein the sequence of the double stranded RNAs is essentially identical to a portion
of a coding region of the target gene for which interference or inhibition of expression
is desired. The double stranded RNAs can be formed from complementary ssRNAs or from
a single stranded RNA that forms a hairpin or from expression from a DNA vector.
[0115] Small molecule inhibitor: A molecule, typically with a molecular weight less than 1000, or in some embodiments,
less than about 500 Daltons, wherein the molecule is capable of inhibiting, to some
measurable extent, an activity of some target molecule.
[0116] Subject: Living multi-cellular organisms, including vertebrate organisms, a category that
includes both human and non-human mammals.
[0117] Target sequence: A target sequence is a portion of ssDNA, dsDNA, or RNA that, upon hybridization to
a therapeutically effective oligonucleotide or oligonucleotide analog
(e.g., a morpholino), results in the inhibition of expression of the target. Either an antisense
or a sense molecule can be used to target a portion of dsDNA, as both will interfere
with the expression of that portion of the dsDNA. The antisense molecule can bind
to the plus strand, and the sense molecule can bind to the minus strand. Thus, target
sequences can be ssDNA, dsDNA, and RNA.
[0118] Test compound: A compound used in a test or screen, and which can be essentially any compound, such
as a small molecule, a chemotherapeutic, a polypeptide, a hormone, a nucleic acid,
a modified nucleic acid, a sugar, a lipid and the like. Test compounds are used, for
example, when screening for compounds that block the activity of TSP1 and/or CD47,
or for compounds that affect TSP1 binding to CD47, and alternatively that mimic the
activity of TSP1. Test compound may also function to suppress TSP1 and/or CD47 expression
and/or production.
[0119] Therapeutic: A generic term that includes both diagnosis and treatment.
[0120] Therapeutically effective amount: A quantity of compound sufficient to achieve a desired effect in a subject being
treated.
[0121] An effective amount of a compound may be administered in a single dose, or in several
doses, for example daily, during a course of treatment. However, the effective amount
will be dependent on the compound applied, the subject being treated, the severity
and type of the affliction, and the manner of administration of the compound. For
example, a therapeutically effective amount of an active ingredient can be measured
as the concentration (moles per liter or molar-M) of the active ingredient (such as
a small molecule, peptide, protein, or antibody) in blood (
in vivo) or a buffer (
in vitro) that produces an effect.
[0122] Therapeutically effective dosages of morpholino are generally in the range of 1-10
µM concentrations. By way of example, as used herein total delivered morpholino to
1 x 2 cm flaps or hind limbs was approximately 1 to 10 µg of morpholino oligonucleotide.
Antibodies to TSP1 or CD47 were therapeutically efficacious at 40 µg per flap diluted
to a concentration of approximately 0.4 µg/µl. Exact dosage amounts will vary by the
size and other characteristics of the subject being treated, the duration of the treatment,
the mode of administration, and so forth. For local treatment of tumors in mice, a
typical dose was 150 µl of 10 µM CD47 morpholino, and for systemic IP delivery a typical
volume of 450 µl of 10 µM was used. Doses for systemic administration of the morpholino
in other species can readily be determined using standard pharmacokinetic and/or pharmacodynamic
methods.
[0123] Under conditions sufficient for/to: A phrase that is used to describe any environment that permits the desired activity.
[0124] Unless otherwise explained, all technical and scientific terms used herein have the
same meaning as commonly understood by one of ordinary skill in the art to which this
invention belongs. The singular terms "a," "an," and "the" include plural referents
unless context clearly indicates otherwise. Similarly, the word "or" is intended to
include "and" unless the context clearly indicates otherwise. Hence "comprising A
or B" means including A, or B, or A and B. It is further to be understood that all
base sizes or amino acid sizes, and all molecular weight or molecular mass values,
given for nucleic acids or polypeptides are approximate, and are provided for description.
Although methods and materials similar or equivalent to those described herein can
be used in the practice or testing of the present invention, suitable methods and
materials are described below. In case of conflict, the present specification, including
explanations of terms, will control. In addition, the materials, methods, and examples
are illustrative only and not intended to be limiting.
III. Thrombospondin and CD47
[0125] Thrombospondin 1 (TSP1) is an extracellular secreted protein that is involved in
a myriad of cellular processes, including platelet aggregation, neurite outgrowth,
cell motility, cell survival, and cellular proliferation. Among TSP1's best-characterized
functions is inhibition of angiogenesis. Angiogenesis ameliorates the poor oxygenation
of damaged tissue that is a limiting factor for patient recovery in a variety of clinical
settings, including surgery, burn wound healing, organ transplantation and recovery,
amputation, peripheral vascular disease and myocardial infarction. Because it is desirable
to promote angiogenesis within these contexts, antagonizing TSP1's activity has been
a valuable research objective. Additionally, tumors require vascularization for growth.
Agents that mimic the ability of TSP1 to inhibit angiogenesis are therefore considered
possible therapies for cancer.
In vitro studies have shown the ability of such agents to block tumor driven angiogenesis.
In vivo results in animals have also been encouraging and have led to clinical trials in
people. See
Rusk et al., Clin Cancer Res 12:7456-7464, 2006;
Markovic et al., Am J Clin Oncol 30:303-309, 2007.
[0126] TSP1 contains three type 1 repeat structural domains and a carboxy-terminal domain
that were identified as the loci of the full-length protein's anti-angiogenic functionality
(
Lawler, Curr. Opin. Cell Biol. 12(5): 634-640, 2000). Overexpression of TSP1 has been observed in ischemic tissue, and is proposed to
regulate angiogenesis within ischemic tissue (
Favier et al., J Pathol. 207(3): 358-366, 2005), since TSP1 preferentially interferes with wound healing-associated angiogenesis
(
Streit et al., EMBO J. 19(13): 3272-3282, 2000) and limits revascularization in a model of hind limb ischemia similar to that employed
by the current inventors (
Kopp et al., J. Clin. Invest. 116(12): 3277-3291, 2006). Peptides derived from the type 1 repeats inhibit angiogenesis (
Shafiee et al., IOVS 41(8): 2378-2388, 2000;
Yee et al., Am J. Pathol. 165(2): 541-552, 2004;
Tolsma et al., J. Cell Biol. 122: 497-511, 1993;
Armstrong and Bornstein, Mat. Biol. 22(1): 63-71, 2003;
Guo et al., Cancer Res. 58(14): 3154-3162, 1998;
Guo et al., J. Peptide Res 50:210-221, 1997.). Additional TSP1 peptides
(e.g., 4N1 and 7N3 classes) have previously been described; see,
e.g., U.S. Patent Nos. 5,399,667;
5,627,265;
6,469,138;
5,357,041;
5,491,130;
5,770,563;
5,849,701;
6,051,549;
6,384,189;
6,458,767; and
7,129,052.
[0127] TSP1 acts through several cellular receptors, including CD36 and integrin-associated
protein (IAP)/CD47. It was originally thought that TSP1 exerted its anti-angiogenic
effects by acting through CD36 (
Quesada et al., Cell Death and Diff. 12: 649-658, 2005;
Jiménez et al., Nat Med. 6(1): 41-48, 2000;
de Fraipon et al., Trends Mol. Med. 7(9): 401-407, 2001). Some evidence had indicated that CD36 was not solely responsible for the action
of TSP1. For example, short peptides comprised of the TSP1 type 1 repeat can inhibit
FGF- and VEGF-induced migration of human endothelial cells that lack CD36 binding
(
Vogel et al., J. Cell. Biochem. 53:74-84, 1993;
Guo et al., J. Peptide Res 50:210-221, 1997;
Short et al., J Cell Biol. 168(4): 643-653, 2005). A sequence in the carboxy-terminal domain of TSP1 was hypothesized to mediate at
least part of the protein's anti-angiogenic effects through an interaction with CD47
(
Bornstein, J Clin. Inv. 107(8): 929-934, 2001) and was shown to have anti-angiogenic activity (
Kanda et al., Exp Cell Res. 252(2):262-72, 1999). In contrast with the results from TSP1-derived peptides, the use of oligonucleotides
to inhibit production of TSP1 suggested a contributory role of TSP1 in excisional
dermal wound healing (
DiPietro et al., Am J. Pathol. 148(6): 1851-1860, 1996).
[0128] CD47 is an atypical member of the immunoglobulin and the G protein-coupled receptor
superfamilies. It consists of an N-terminal extracellular IgV set domain, 5 transmembrane
segments and an alternatively spliced cytoplasmic tail (
Brown and Frazier, Trends Cell Biol. 11(3): 130-135, 2001). Although identified earlier as "integrin associated protein (IAP), CD47 was discovered
to be a receptor for the C-terminal domain of TSP1 in 1996 (
Gao et al., J. Biol. Chem. 271: 21-24, 1996). Two members of the signal inhibitory receptor protein family, SIRPα (also known
as BIT, SHPS-1 and p84) and SIRPyare cell-bound counter receptors for CD47 (
van Beek et al., J. Immunol. 175:7781-87, 2005). CD47 is expressed on many if not all normal cells, and signals in part through
coupling to G proteins of the Gi heterotrimeric class (
Frazier et al., J. Biol Chem. 274:8554-8560, 1999).
[0129] It was recently discovered that TSP1, via binding to CD47, potently limits physiologic
NO signaling in all vascular cell types including endothelial cells, VSMC and platelets.
TSP1-CD47 signaling also directly and acutely regulates tissue blood flow and arterial
tone by inhibiting NO-driven vasorelaxation, and exerts anti-vasorelaxive effects
on smooth muscle by antagonizing the ability of nitric oxide (NO) to stimulate cGMP
synthesis (
Isenberg et al., Proc Natl Acad Sci U S A. 102(37): 13141-13146, 2005;
Isenberg et al., Cardiovasc Res., 71(4):785-793, 2006;) ;
Isenberg et al., J Biol Chem 281:26069-26080, 2006,
Isenberg et al., Blood, 109(5):1945-1952, 2007). Though inhibition of NO signaling may be induced by TSP1 interacting with CD36,
this effect occurs at doses 100 to 1000 fold greater than the doses of TSP1 that drive
inhibition through CD47. Also TSP1 inhibition of NO signaling through CD36 can not
occur in the absence of CD47 at any dose, thus the physiologically relevant pathway
is via CD47. (
Isenberg et al., J Biol Chem. 281(36):26069-26080, 2006). See also International Patent Publication No.
WO 2008/060785.
[0130] The structure and function of CD47 has been explored using anti-CD47 antibodies and
peptide ligands of the receptor. Certain anti-CD47 and TSP1-derived CD47 ligands initiate
cell death in breast cancer cell lines (
Manna and Frazier, Cancer Res. 64: 1026-1036, 2004) and Jurkat T cells (
Manna and Frazier, J Immunol. 170(7): 3544-3553, 2003). These, and similar experiments, led to the hypothesis that CD47 is necessary for
FAS-mediated apoptosis of Jurkat T cells (
Manna et al., J Biol. Chem. 280(33): 29637-29644, 2005). Synthetic peptides derived from the full-length sequence of CD47 have been used
to probe its structure (
Rebres et al., J. Biol. Chem. 276(37): 34607-34616, 2001). Ligation of CD47 induces actin polymerization (
Rebres et al., J. Biol. Chem. 276(10): 7672-7680, 2001); and its ligation by peptides derived from the carboxy-terminus of TSP1 stimulates
the integrin-mediated adhesion of melanoma cells to specific substrates (
Barazi et al., J. Biol. Chem. 277(45): 42859-42866, 2002;
Gao et al., J. Cell Biol. 135(2): 533-544, 1996).
[0131] Different antibodies engaging CD47 can exert opposing stimulatory and inhibitory
effects on cells (
Li et al., J Immunol 166:2427-2436, 2001;
Waclavicek et al., J Immunol 159:5345-5354, 1997;
Pettersen et al., J Immunol 162:7031-7040, 1999;
Ticchioni et al., J Immunol 158:677-684, 1997). Likewise, a specific CD47 ligand can act as an agonist or an antagonist in different
contexts. For instance, CD47 ligation by a particular ligand may have different effects
in isolated cells than
in vivo. Therefore, some effects of CD47 antibodies that have been defined using isolated
cells do not extrapolate to
in vivo activities, and the function of a specific CD47 ligand
in vivo can not be predicted solely on the basis of
in vitro testing.
IV. Overview of Several Embodiments
[0132] Provided herein is a method of protecting animal tissue from damage caused by radiation
exposure, which method comprises contacting the tissue with a therapeutically effective
amount of an agent that inhibits interaction between thrombospondin-1 (TSP1) and CD47,
including an agent that does not necessarily blockade the physical interaction between
TSP1 and CD47, thereby protecting the tissue from radiation damage. In certain embodiments,
this method is employed as a method of protecting personnel exposed to a radioactive
substance or ionizing radiation, and the method comprises contacting tissue of the
personnel with the therapeutically effective amount of the agent.
[0133] It is contemplated in various examples that contacting in such is performed at least
one of before, during or after exposure to radiation. For instance, in some cases
the agent is administered within two weeks prior to exposure to radiation, during
radiation exposure, and/or within two weeks following radiation exposure. In other
cases, the agent is administered within 4 days prior to radiation exposure, during
radiation exposure, and/or within about 1 day following radiation exposure.
[0134] In examples of the described methods, the radiation comprises an acute or chronic
dose of ionizing or non-ionizing radiation. For instance, the ionizing radiation in
some instances results from nuclear fission or fusion or from radioisotopes. In other
instances, the ionizing radiation comprises X-rays. In other instances the ionizing
radiation comprises radionuclides.
[0135] Also provided are methods of protecting animal tissue from damage caused by radiation
exposure that are employed to enhance the therapeutic window for radiotherapy in a
subject, such methods comprising contacting tissue of the subject with the therapeutically
effective amount of the agent that inhibits interaction between TSP1 and CD47 prior
to the radiotherapy.
[0136] It is also contemplated that the methods described herein are useful where the radiation
exposure comprises diagnostic X-rays, radiation therapy, a CAT-scan, a mammogram,
a radionuclide scan, or an interventional radiological procedure under CT or fluoroscopy
guidance. In other embodiments, the radiation exposure comprises tissue-incorporated
radionuclides from ingestion of contaminated food or water, non-medical or unintentional
exposure to ionizing radiation from a nuclear weapon, non-medical or unintentional
exposure to a radioactive spill, and/or cosmic radiation, including space flight-associated
radiation exposure.
[0137] Also provided herein are methods of increasing tumor ablation in a subject undergoing
radiotherapy comprising contacting tissue of the subject with a therapeutically effective
amount of an agent that inhibits the interaction of TSP1 and CD47 prior to the radiotherapy,
thereby increasing tumor ablation.
[0138] In various embodiments, the agent is administered orally, subcutaneously, intramuscularly,
intravenously, intraperitoneally, transdermally, intranasally, or rectally.
[0139] The agent that inhibits the interaction of TSP1 and CD47 will comprise, in various
embodiments, an oligonucleotide comprising at least about 15 contiguous bases and
that hybridizes to the mRNA of CD47 under high stringency conditions; an oligonucleotide
comprising at least about 15 contiguous bases and that hybridizes to the mRNA of TSP1
under high stringency conditions; an isolated or recombinant TSP1 or CD47 soluble
fragment; an antibody that specifically binds TSP1; an antibody that specifically
binds CD47; or a mixture of two or more thereof. For instance, the agent that inhibits
the interaction of TSP1 and CD47 in some examples is selected from the group consisting
of peptide 7N3 (SEQ ID NO: 2) and peptide C6d (SEQ ID NO: 1).
[0140] Optionally, an agent as used in the provided methods may be modified by addition
of a detectable label, glycosylation, β-hydroxylation, alkylation, reduction, calcium
depletion, calcium supplementation, conjugation, and addition of a group or moiety
to improve stability and/or bioavailability of the peptide (in embodiments where the
agent is a peptide).
[0141] In specific examples, the agent is an oligonucleotide comprising at least about 15
contiguous bases and that hybridizes to the mRNA of CD47 under high stringency conditions.
Such oligonucleotides will, in some embodiments, be a morpholino, for instance a morpholino
that comprises the sequence shown in SEQ ID NO: 4.
[0142] In another specific example, the agent is an antibody (
e.g., a humanized antibody) that specifically binds to CD47 or a fragment thereof, or
an antibody that specifically binds to TSP1 or a fragment thereof. Specific examples
of such agents that bind TSP1 include the monoclonal antibody A6.1, the monoclonal
antibody C6.7, an antibody that competes with A6.1 or C6.7 for binding, a binding
fragment of any one of these, or a humanized version of any one of these. Examples
of such agents that bind to CD47 include antibodies MIAP301, OX101, and B6H12, an
antibody that competes with MIAP301, OX101, and B6H12 for binding, a binding fragment
of any one of these, or a humanized version of any one of these.
V. Radioprotectants Targeting Thrombospondin-1 and CD47
[0143] Described herein is the discovery that cell and tissue survival can be dramatically
increased following radiation exposure through inhibition of the interaction between
TSP-1 and CD47 and also through the suppression of CD47 itself. This effect is shown
using antisense molecules, peptides, and antibodies, which can now be used as radioprotectant
agents. These agents find application in minimizing, reducing and/or preventing tissue
damage following intentional and accidental radiation exposure, as well as increasing
the therapeutic efficacy of radiation therapies by protecting non-target tissue from
incidental radiation damage. These agents also find application in increasing tumor
ablation in a patient undergoing radiotherapy.
[0144] Also provided are pharmaceutical compositions for the treatment of a subject suffering
from, or believed to be suffering from, radiation injury, the pharmaceutical composition
comprising: a pharmacologically effective amount of radioprotective agent, or a functional
analogue thereof, or pharmaceutical composition as identified herein, together with
a pharmaceutically acceptable diluent. The disclosure further provides method of treating
or preventing radiation injury in a subject in need thereof or in potential need thereof,
the method comprising: administering to the subject a pharmaceutical composition comprising:
at least one radioprotectant agent that interferes with or blocks the interaction
between TSP1 and CD47, and a pharmaceutically acceptable excipient, in particular
wherein the radiation injury comprises irradiation injury.
[0145] The invention is as defined in the claims.
VI. Therapeutic Uses
[0146] The increased use of radionuclides in diagnostic and therapeutic nuclear medicine,
as well as the presence of man-made and naturally occurring radioactivity in the environment,
emphasizes the need for radioprotective agents for protection of cells, tissues and
organisms before, during, and after exposure to radiation. The radioprotective agents
described herein enable survival of living organisms in otherwise lethal radiation
exposure conditions, and provide reduction of cellular and tissue damage from exposure
to non-lethal levels of radiation.
[0147] The potential utility of radioprotective agents in protecting against exposure to
environmental radiation, as well as in cancer radiation therapy, has long been recognized.
These newly identified radioprotective agents described herein, administered prior
to, during, and/or after exposure to radiation, would eliminate or reduce the severity
of deleterious cellular effects caused by exposure to environmental ionizing radiation
such as resulting from a nuclear explosion, a spill of radioactive material, close
proximity to radioactive material and the like. The agents also provide dramatic protection
of normal tissue exposed to therapeutic radiation used for cancer therapy.
[0148] The present invention provides methods which protect cells and living organisms from
deleterious cellular effects by preventing or eliminating these effects or by reducing
their severity. According to the present invention, living organisms to be protected
can be exposed with an agent that blocks or inhibits the interaction between TSP1
and CD47 prior to, after, or during exposure of the cell to radiation. The cells may
be directly treated by the radioprotective agent, such as by applying a solution of
a radioprotective agent of the disclosure to the cell or by administering a radioprotective
agent as described to a mammal. The compounds of the present invention thus can provide
a protective effect in the cell and living organisms which eliminates or reduces the
severity of the detrimental cellular effects which would otherwise be caused by the
exposure.
[0149] It will be recognized that any and all tissue, skin or hair follicles can be treated
or protected topically in accordance with the present invention.
Radioprotectants to prevent or treat radiation damage
[0150] Radioprotective agents of the present disclosure can be used to minimize or prevent
the damage from solar radiation exposure experienced by astronauts, pilots, other
flight personnel and frequent fliers. The radioprotective agents can also be utilized
in protecting from accidental radiation exposure from nuclear power facilities, other
radiation generating facilities including those for food irradiation, or as a result
of detonation of an atomic bomb of other device that releases radiation or radioisotopes.
Also, they can be used to confer protection to those personnel involved with clean
up of such radiation accidents or disposal facilities. The radioprotective agents
of the present invention are also of use in reducing the toxic effects of inhaled
or ingested radionuclides and in reducing toxicity from radiation produced by electronic
devices of non-ionizing nature of radiation: such as cellular telephones, and microwaves.
[0151] Rapidly growing interventional radiologic procedures such as dilatation of stenosed
vessels, recanalization or vascular angioanastomoses would also benefit from the use
of radioprotectors.
[0152] Additionally, therapy and diagnostic tests utilizing radiation are withheld from
pregnant women, women who may be pregnant, and women capable of becoming pregnant
to avoid harming the fetus in utero. This can often preclude necessary treatment or
diagnosis for these women. Accordingly, radioprotective agents that are non-toxic
and highly effective can be administered to such women so as to confer protection
on the women and any possible fetus above and beyond any conventional mechanical radiation
shielding device. This can also provide a level of safety to those women nursing their
infants.
Radioprotectants to enhance radiotherapy
[0153] In addition, the radioprotective agents described herein are believed to provide
a selective protection of normal cells, and not of cancer cells, during cancer radiation
therapy. For example, these agents, administered to a cancer patient prior to or during
radiation therapy, will provide protection to normal, non-cancer cells while allowing
the radiation treatment to destroy cancerous cells. Therefore, the radioprotective
agents would provide a selective protective effect on the normal cells as compared
to tumor cells and would eliminate or reduce the severity of deleterious or other
detrimental side effects of radiation therapy on normal cells and tissues.
[0154] Radioprotective agents thus are useful in eliminating or reducing the severity of
deleterious cellular effects in normal cells caused by cancer radiation therapy and
diagnostic tests utilizing radiation.
[0155] For example, the treatment of malignant tumors through the use of radiation is often
limited due to damage to non-tumor cells. Damage to the non-tumor cells can compromise
the effectiveness of the radiation therapy. The dominant consideration in establishing
radiation doses for cancer radiotherapy is the assessment of tolerance of the most
radiosensitive normal tissue or organ in the treatment field. This assessment, together
with the expected radiation dose required to eradicate a tumor determines the feasibility
of the treatment strategy, and whether a cure or palliation is to be attempted. Often,
the maximum tolerable doses are insufficient to eradicate the tumor. Thus, the use
of a radioprotective agent such as those provided herein would greatly increase the
tolerable dose, and therefore the prospects for eradication of tumors and treatment
of the cancer.
[0156] More particularly, provided herein are methods of protecting non-cancer, or normal,
cells of a mammal from deleterious cellular effects caused by exposure of the mammal
to ionizing radiation. The radioprotective agents described herein provide protection
of normal cells during intentional exposure to radiation, such as during radiation
therapy or diagnostic procedures such as x-rays and CAT scans. The cancer cells, if
protected at all are believed to be protected to a lesser extent than normal cells.
Despite a moderate protection
in vitro, the cancer cells are rendered more sensitive to radiation
in vivo, resulting in greater tumor ablation by radiotherapy. Thus, the inventors provide
methods whereby the deleterious cellular effects on non-cancer cells caused by exposure
of the mammal to radiation are eliminated or reduced in severity or in extent
[0157] A further aspect of the radioprotective effect on normal cells is the preserved viability
of macrophages and other immune cells that infiltrate and attack cancerous cells.
As described herein, the TSP1/CD47 inhibition as part of radiotherapy significantly
increases tumor ablation in a subject undergoing radiotherapy. Thus, not only do the
described radioprotective agents allow for greater dosages of radiation in radiotherapy,
but they enhance the innate ability of host anti-tumor immunity to attack cancerous
cells.
VII. Combination Therapies
[0158] The immediate damage caused by radiation is mediated by formation of highly reactive
free radicals inside the cell such as hydroxyl, peroxide, and carbonate radicals.
These rapidly react with sensitive macromolecules such as DNA to cause permanent cell
damage and eventual cell death. Chemical radioprotectants limit this immediate damage
by directly neutralizing reactive radicals. The radioprotectants embodied in the subject
disclosure are not directed to this immediate chemical damage but permit the cell
to repair the immediate damage without triggering a suicide response. Therefore, combinations
of the present embodiments with chemical protectants, such as thiols, that act by
directly scavenging free radicals would be useful. Such combination would be particularly
useful in cases where advance warning of radiation exposure is possible, but may have
less advantage post-exposure, where chemical radioprotectants are less effective.
VIII. Production of Antibodies
[0159] In some embodiments, the radioprotective agent is an antibody or antigenic fragment
thereof. Representative examples are antibody A6.1 (available from Genetex, Imgenex
and Santa Cruz Biotechnology),antibody B6H12 (cell line HB-9771, ATCC; available form
Abcam, Cambridge MA), and antibodies MIAP301 and OX101 (available from Santa Cruz
Biotechnology). Also contemplated are antibodies that block or inhibit the interaction
of TSP1 and CD47, which in addition have radioprotective activity.
[0160] Optimally, antibodies raised against a target protein (such as TSP1 or CD47) would
specifically detect that peptide/protein, and optimally would inhibit the interaction
between TSP1 and CD47. In some embodiments, CD47 antibodies that do not inhibit TSP1
binding may be active if they inhibit a TSP1-induced signal through CD47. Antibodies
that specifically detect a target protein would recognize and bind that protein (and
peptides derived therefrom) and would not substantially recognize or bind to other
proteins or peptides found in a biological sample. The determination that an antibody
specifically detects its target protein is made by any one of a number of standard
immunoassay methods; for instance, the Western blotting technique (
Sambrook et al., In Molecular Cloning: A Laboratory Manual, CSHL, New York, 1989).
[0161] To determine by Western blotting that a given antibody preparation (such as one produced
in a mouse or rabbit) specifically detects the target peptide, the peptide of interest
is synthesized and transferred to a membrane (for example, nitrocellulose) by Western
blotting, and the test antibody preparation is incubated with the membrane. After
washing the membrane to remove non-specifically bound antibodies, the presence of
specifically bound antibodies is detected by the use of an anti-mouse or anti-rabbit
antibody conjugated to an enzyme such as alkaline phosphatase.
[0162] Application of an alkaline phosphatase substrate 5-bromo-4-chloro-3-indolyl phosphate/nitro
blue tetrazolium results in the production of a dense blue compound by immunolocalized
alkaline phosphatase. Antibodies that specifically detect the target peptide will,
by this technique, be shown to bind to the target peptide band (which will be localized
at a given position on the gel determined by its molecular weight). Non-specific binding
of the antibody to other proteins may occur and may be detectable as a weak signal
on the Western blot. The non-specific nature of this binding will be recognized by
one skilled in the art by the weak signal obtained on the Western blot relative to
the strong primary signal arising from the specific antibody-target peptide binding.
[0163] In addition, ELISA protocols could be used to identify therapeutic antibodies that
inhibit interaction between TSP1 and CD47.
[0164] The determination that an antibody inhibits the association between TSP1 and CD47,
or the ability of TSP1 or CD47 to provide radioprotection or minimize complications
from tissue exposure to radiation, may be made, for example, using any one of the
assays described herein that measure interaction or activity of one (or both) of these
proteins. In addition, assays (including those described herein) that measure the
radioprotectant effect of the antibodies can be employed.
[0165] For instance, the determination that an antibody inhibits TSP1 binding to purified
or recombinant CD47 can be made by comparing the binding activity alone with the binding
activity in the presence of the antibody using a solid phase ligand binding assay.
An antibody that inhibits the activity of TSP1 to signal through CD47 on cells will
reduce the activity of a cGMP-dependent reporter in a suitable transfected cell assay
by a certain amount, for example, by 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even
by 100%.
A. Monoclonal Antibody Production by Hybridoma Fusion
[0166] Monoclonal antibody to epitopes of a target peptide
(e.g., from TSP1 or CD47) can be prepared from murine hybridomas according to the classical
method of
Kohler and Milstein (nature 256:495-497, 1975) or derivative methods thereof. Briefly, a mouse is repetitively inoculated with
a few micrograms of the selected protein over a period of a few weeks. The mouse is
then sacrificed, and the antibody-producing cells of the spleen are isolated. The
spleen cells are fused by means of polyethylene glycol with mouse myeloma cells, and
the excess un-fused cells destroyed by growth of the system on selective media comprising
aminopterin (HAT media). The successfully fused cells are diluted and aliquots of
the dilution placed in wells of a microtiter plate where growth of the culture is
continued. Antibody-producing clones are identified by detection of antibody in the
supernatant fluid of the wells by immunoassay procedures, such as ELISA, as originally
described by
Engvall (Enzymol. 70:419, 1980), and derivative methods thereof. Selected positive clones can be expanded and their
monoclonal antibody product harvested for use. Detailed procedures for monoclonal
antibody production are described in
Harlow and Lane (Antibodies, A Laboratory Manual, CSHL, New York, 1988).
B. Polyclonal Antibody Production by Immunization
[0167] Polyclonal antiserum containing antibodies to heterogeneous epitopes of a single
protein can be prepared by immunizing suitable animals with the expressed protein,
which can be unmodified or modified to enhance immunogenicity. Effective polyclonal
antibody production is affected by many factors related both to the antigen and the
host species. For example, small molecules tend to be less immunogenic than others
and may require the use of carriers and adjuvant. Also, host animals vary in response
to site of inoculations and dose, with either inadequate or excessive doses of antigen
resulting in low titer antisera. Small doses (ng level) of antigen administered at
multiple intradermal sites appear to be most reliable. An effective immunization protocol
for rabbits can be found in
Vaitukaitis et al. (J. Clin. Endocrinol. Metab. 33:988-991, 1971).
[0168] Booster injections can be given at regular intervals, and antiserum harvested when
antibody titer thereof, as determined semi-quantitatively, for example, by double
immunodiffusion in agar against known concentrations of the antigen, begins to fall.
See, for example,
Ouchterlony et al. (In Handbook of Experimental Immunology, Wier, D. (ed.) chapter
19. Blackwell, 1973). Plateau concentration of antibody is usually in the range of about 0.1 to 0.2 mg/ml
of serum (about 12 µM). Affinity of the antisera for the antigen is determined by
preparing competitive binding curves, as described, for example, by
Fisher (Manual of Clinical Immunology, Ch. 42, 1980).
C. Antibodies Raised against Synthetic Peptides
[0169] A third approach to raising antibodies against a target peptide is to use synthetic
peptides synthesized on a commercially available peptide synthesizer based upon the
amino acid sequence of the native protein (
e.g., TSP1 or CD47).
[0170] By way of example only, polyclonal antibodies to a CD47 or TSP1 peptide can be generated
through well-known techniques by injecting rabbits or other animals (
e.g., mice, guinea pigs, goats, pigs, primates) with chemically synthesized peptide.
D. Antibodies Raised by Injection of a Pepticle-Encoding Sequence
[0171] Antibodies may be raised against a target peptide by subcutaneous injection of a
DNA vector that expresses that peptide into laboratory animals, such as mice. Delivery
of the recombinant vector into the animals may be achieved using a handheld form of
the Biolistic system (
Sanford et al., Particulate Sci. Techno. 5:27-37, 1987) as described by
Tang et al. (Nature 356:152-154, 1992). Expression vectors suitable for this purpose may include those that express the
desired peptide-encoding sequence under the transcriptional control of either the
human β-actin promoter or the cytomegalovirus (CMV) promoter.
E. Humanized Antibodies
[0172] Also contemplated are humanized antibodies, for instance humanized equivalents of
murine or other non-human monoclonal antibodies. A "humanized" immunoglobulin is an
immunoglobulin including a human framework region and one or more CDRs from a non-human
(for example a mouse, rat, or synthetic) immunoglobulin. The non-human immunoglobulin
providing the CDRs is termed a "donor," and the human immunoglobulin providing the
framework is termed an "acceptor." In one embodiment, all the CDRs are from the donor
immunoglobulin in a humanized immunoglobulin. Constant regions need not be present,
but if they are, they must be substantially identical to human immunoglobulin constant
regions, such as at least about 85-90%, such as about 95% or more identical. Hence,
all parts of a humanized immunoglobulin, except possibly the CDRs, are substantially
identical to corresponding parts of natural human immunoglobulin sequences. A "humanized
antibody" is an antibody comprising a humanized light chain and a humanized heavy
chain immunoglobulin. A humanized antibody binds to the same antigen as the donor
antibody that provides the CDRs. The acceptor framework of a humanized immunoglobulin
or antibody may have a limited number of substitutions by amino acids taken from the
donor framework. Humanized or other monoclonal antibodies can have additional conservative
amino acid substitutions which have substantially no effect on antigen binding or
other immunoglobulin functions. Humanized immunoglobulins can be constructed by means
of genetic engineering (see for example,
U.S. Patent No. 5,585,089).
[0173] The use of antibody components derived from humanized monoclonal antibodies obviates
potential problems associated with the immunogenicity of the constant regions of the
donor antibody. Techniques for producing humanized monoclonal antibodies are described,
for example, by
Jones et al., Nature 321:522, 1986;
Riechmann et al., Nature 332:323, 1988;
Verhoeyen et al., Science 239:1534, 1988;
Carter et al., Proc. Natl. Acad. Sci. U.S.A. 89:4285, 1992;
Sandhu, Crit. Rev. Biotech. 12:437, 1992; and
Singer et al., J. Immunol. 150:2844, 1993. The antibody may be of any isotype, but in several embodiments the antibody is an
IgM or an IgG, including but not limited to, IgG
1, IgG
2, IgG
3 and IgG
4.
[0174] Humanized monoclonal antibodies can be produced by transferring donor complementarity
determining regions (CDRs) from heavy and light variable chains of the donor mouse
(or other animal) immunoglobulin. The production of chimeric antibodies, which include
a framework region from one antibody and the CDRs from a different antibody, is well
known in the art. For example, humanized antibodies can be routinely produced. The
antibody or antibody fragment can be a humanized immunoglobulin having complementarity
determining regions (CDRs) from a donor monoclonal antibody that binds a cell surface
antigen of pancreatic cells (such as endocrine, exocrine or ductal cells) and immunoglobulin
and heavy and light chain variable region frameworks from human acceptor immunoglobulin
heavy and light chain frameworks. Generally, the humanized immunoglobulin specifically
binds to the cell surface antigen (or cells expressing the antigen) with an affinity
constant of at least 10
7 M
-1, such as at least 10
8 M
-1 at least 5 X 10
8 M
-1 or at least 10
9 M
-1.
[0175] In one embodiment, the sequence of the humanized immunoglobulin heavy chain variable
region framework can be at least about 65% identical to the sequence of the donor
immunoglobulin heavy chain variable region framework. Thus, the sequence of the humanized
immunoglobulin heavy chain variable region framework can be at least about 75%, at
least about 85%, at least about 95%, or at least about 99% identical to the sequence
of the donor murine immunoglobulin heavy chain variable region framework. Human framework
regions, and mutations that can be made in a humanized antibody framework regions,
are known in the art (see, for example, in
U.S. Patent No. 5,585,089). One of skill in the art can readily select a human framework region of use.
[0176] Also contemplated are fully human antibodies. Mice have been generated that express
only human immunoglobulin genes, instead of mouse genes. These mice are immunized
with the target antigen, such as TSP1 or CD47, and resultant antibodies that are raised
are selected for the activity desired. In the current instance, it is contemplated
that this technique can be used to generate antibodies (including monoclonal antibodies)
useful for blocking TSP-CD47 interactions. These procedures are substantially similar
to those used to select a mouse antihuman Ab, but result in a fully human antibody
since the mouse only has human Ig genes.
IX. Peptides and Peptide Variants
A. Representative Methods of Production
[0178] By way of example, suitably N-alpha-protected (and side-chain protected if reactive
side-chains are present) amino acid analogs or peptides are activated and coupled
to suitably carboxyl-protected amino acid or peptide derivatives, either in solution
or on a solid support. Protection of the alpha-amino functions generally takes place
by urethane functions such as the acid-labile tertiary-butyloxycarbonyl group ("Boc"),
benzyloxycarbonyl ("Z") group and substituted analogs or the base-labile 9-fluoremyl-methyloxycarbonyl
("Fmoc") group. The Z group can also be removed by catalytic hydrogenation. Other
suitable protecting groups include the Nps, Bmv, Bpoc, Aloc, MSC, etc. A good overview
of amino-protecting groups is given in
The Peptides: Analysis, Synthesis, Biology, Vol. 3, Gross and Meienhofer, eds. (Academic
Press, New York, 1981). Protection of carboxyl groups can take place by ester formation, for example, base-labile
esters like methyl or ethyl, acid labile esters like tert. butyl or, substituted benzyl
esters or hydrogenolytically. Protection of side-chain functions like those of lysine
and glutamic or aspartic acid can take place using the aforementioned groups. Protection
of thiol, and although not always required, of guanidino, alcohol and imidazole groups,
can take place using a variety of reagents such as those described in
The Peptides, Analysis, Synthesis, Biology, Vol. 3, Gross and Meienhofer, eds. (Academic
Press, New York, 1981), or in
van Nispen (Pure and Applied Chemistry, 59(3), 331-344, 1987). Activation of the carboxyl group of the suitably protected amino acids or peptides
can take place by the azide, mixed anhydride, active ester, or carbodiimide method
especially with the addition of catalytic- and racemization-suppressing compounds
like 1-N--N-hydroxybenzotriazole, N-hydroxysuccinimide, 3-hydroxy-4-oxo-3,4-dihydro-1,2,3,-benzotriazine,
N-hydroxy-5 norbornene-2,3-dicar-boxyimide. Also the anhydrides of phosphorus-based
acids can be used. See,
e.g., The Peptides, Analysis, Synthesis, Biology, Vol. 3, Gross and Meienhofer, eds. (Academic
Press, New York, 1981); and
van Nispen (Pure and Applied Chemistry, 59(3), 331-344, 1987).
[0179] It is also possible to prepare the peptides by the solid phase method of Merrifield.
Different solid supports and different strategies are known (
e.g.,
Barany and Merrifield in The Peptides: Analysis, Synthesis, Biology, Vol. 2, Gross
and Meienhofer, eds. (Acad. Press, New York, 1980);
Kneib-Cordonier and Mullen, Int. J. Peptide Protein Res., 30, 705-739, 1987; and
Fields & Noble, Int. J. Peptide Protein Res., 35, 161-214, 1990). The synthesis of compounds in which a peptide bond is replaced by an isostere can,
in general, be performed using the previously described protecting groups and activation
procedures.
[0180] Removal of the protecting groups and, in the case of solid phase peptide synthesis,
the cleavage from the solid support, can take place in different ways, depending on
the nature of those protecting groups and the type of linker to the solid support.
Usually, deprotection takes place under acidic conditions and in the presence of scavengers,
using well known methods.
[0182] Peptides according to the subject disclosure can also be made according to recombinant
DNA methods, by expressing a recombinant polynucleotide sequence that codes for the
oligopeptide(s) in question in a suitable host cell, usually a microbial cell. Generally,
the process involves introducing into a cloning vehicle (
e.g., a plasmid, phage DNA, or other DNA sequence able to replicate in a host cell) a DNA
sequence coding for the particular oligopeptide or oligopeptides, introducing the
cloning vehicle into a suitable eukaryotic or prokaryotic host cell, and culturing
the host cell thus transformed. When a eukaryotic host cell is used, the compound
may optionally include a glycoprotein portion.
[0183] Polynucleotides encoding the peptides disclosed herein are also provided. These polynucleotides
include DNA, cDNA and RNA sequences that encode the peptide of interest. Silent mutations
in the coding sequence result from the degeneracy (
i.e., redundancy) of the genetic code, whereby more than one codon can encode the same
amino acid residue. Thus, for example, leucine can be encoded by CTT, CTC, CTA, CTG,
TTA, or TTG; serine can be encoded by TCT, TCC, TCA, TCG, AGT, or AGC; asparagine
can be encoded by AAT or AAC; aspartic acid can be encoded by GAT or GAC; cysteine
can be encoded by TGT or TGC; alanine can be encoded by GCT, GCC, GCA, or GCG; glutamine
can be encoded by CAA or CAG; tyrosine can be encoded by TAT or TAC; and isoleucine
can be encoded by ATT, ATC, or ATA. Tables showing the standard genetic code can be
found in various sources (
e.g., Stryer, Biochemistry, 3rd Edition, W.H. 5 Freeman and Co., NY 1988).
[0184] A nucleic acid encoding a peptide can be cloned or amplified by
in vitro methods, such as the polymerase chain reaction (PCR), the ligase chain reaction (LCR),
the transcription-based amplification system (TAS), the self-sustained sequence replication
system (3SR) and the Qβ replicase amplification system (QB). For example, a polynucleotide
encoding the peptide (or a longer polypeptide, such as an expression fusion polypeptide,
containing the peptide) can be isolated by polymerase chain reaction of cDNA using
primers based on the DNA sequence of the molecule. A wide variety of cloning and
in vitro amplification methodologies are well known to persons skilled in the art. PCR methods
are described in, for example,
U.S. Patent No. 4,683,195;
Mullis et al., Cold Spring Harbor Symp. Quant. Biol. 51:263, 1987; and
Erlich, ed., PCR Technology (Stockton Press, NY, 1989). Polynucleotides also can be isolated by screening genomic or cDNA libraries with
probes selected from the sequences of the desired polynucleotide under stringent hybridization
conditions.
[0185] The polynucleotides encoding a peptide (
e.g., a peptide from or derived from TSP1 or CD47) include a recombinant DNA which is incorporated
into a vector into an autonomously replicating plasmid or virus or into the genomic
DNA of a prokaryote or eukaryote, or which exists as a separate molecule (such as
a cDNA) independent of other sequences. The nucleotides of the invention can be ribonucleotides,
deoxyribonucleotides, or modified forms of either nucleotide. The term includes single-stranded
and double-stranded forms of DNA.
[0186] In one embodiment, vectors are used for expression in yeast such as
S. cerevisiae or
Kluyveromyces lactis. Several promoters are known to be of use in yeast expression systems such as the
constitutive promoters plasma membrane H
+-ATPase (
PMA1), glyceraldehyde-3-phosphate dehydrogenase (
GPD), phosphoglycerate kinase-1 (
PGK1), alcohol dehydrogenase-1 (
ADH1), and pleiotropic drug-resistant pump (
PDR5)
. In addition, many inducible promoters are of use, such as
GAL1-10 (induced by galactose),
PHO5 (induced by low extracellular inorganic phosphate), and tandem heat shock
HSE elements (induced by temperature elevation to 37°C). Promoters that direct variable
expression in response to a titratable inducer include the methionine-responsive
MET3 and
MET25 promoters and copper-dependent
CUP1 promoters. Any of these promoters may be cloned into multicopy (2µ) or single copy
(
CEN) plasmids to give an additional level of control in expression level. The plasmids
can include nutritional markers (such as
URA3, ADE3, HIS1, and others) for selection in yeast and antibiotic resistance (
AMP) for propagation in bacteria. Plasmids for expression on
K. lactis are known, such as pKLAC1. Thus, in one example, after amplification in bacteria,
plasmids can be introduced into the corresponding yeast auxotrophs by methods similar
to bacterial transformation.
[0187] The peptides can be expressed in a variety of yeast strains. For example, seven pleiotropic
drug-resistant transporters,
YOR1,
SNQ2, PDR5, YCF1,
PDR10, PDR11, and
PDR15, together with their activating transcription factors,
PDR1 and
PDR3, have been simultaneously deleted in yeast host cells, rendering the resultant strain
sensitive to drugs. Yeast strains with altered lipid composition of the plasma membrane,
such as the
erg6 mutant defective in ergosterol biosynthesis, can also be utilized. Proteins that
are highly sensitive to proteolysis can be expressed in a yeast lacking the master
vacuolar endopeptidase Pep4, which controls the activation of other vacuolar hydrolases.
Heterologous expression in strains carrying temperature-sensitive (ts) alleles of
genes can be employed if the corresponding null mutant is inviable.
[0188] Viral vectors can also be prepared encoding the peptides disclosed herein. Myriad
viral vectors have been constructed and are known to those of skill in the art, including
but not limited to polyoma, SV40 (
Madzak et al., J. Gen. Virol. 73:153311536, 1992), adenovirus (
Berkner, Cur. Top. Microbiol. Immunol., 158:39-36, 1992;
Berliner et al., BioTechniques, 6:616-629, 1988;
Gorziglia et al., J. Virol. 66:4407-4412, 1992;
Quantin et al., Proc. Nad. Acad. Sci. USA 89:2581-2584, 1992;
Rosenfeld et al., Cell, 68:143-155, 1992;
Wilkinson et al., Nucl. Acids Res. 20:2233-2239, 1992;
Stratford-Perricaudet et al., Hum. Gene Ther., 1:241-256,), vaccinia virus (
Mackett et al., Biotechnology, 24:495-499, 1992), adeno-associated virus (
Muzyczka, Curr. Top. Microbiol. Immunol. 158:91-123, 1992;
On et al., 1990, Gene, 89:279-282), herpes viruses including HSV and EBV (
Margolskee, Curr. Top. Microbiol. Immunol., 158:67-90, 1992;
Johnson et al., J. Virol. 66:2952-2965, 1992;
Fink et al., Hum. Gene Ther. 3:11-19, 1992;
Breakfield et al., Mol. Neurobiol., 1:337-371, 1987;
Fresse et al., Biochem. Pharmacol. 40:2189-2199, 1990), Sindbis viruses (
Herweijer et al., Human Gene Therapy 6:1161-1167, 1995;
U.S. Pat. No. 5,091,309), alphaviruses (
Schlesinger, Trends Biotechnol. 11:18-22, 1993;
Frolov et al., Proc. Natl. Acad. Sci. USA 93:11371-11377, 1996) and retroviruses of avian (
Brandyopadhyay et al., Mol. Cell Biol. 4:749-754, 1984;
Petropouplos et al., J. Virol. 66:3391-3397, 1992), murine (
Miller, Curr. Top. Microbiol. Immunol., 158:1-24, 1992;
Miller et al., 1985, Mol. Cell Biol., 5:431-437;
Sorge et al., Mol. Cell Biol. 4:1730-1737, 1984;
Mann et al., J. Virol. 54:401-407, 1985), and human origin (
Page et al., J. Virol. 64:5370-5276, 1990;
Buchschalcher et al., J. Virol. 66:2731-2739, 1992). Baculovirus (Autographa californica multinuclear polyhedrosis virus; AcMNPV) vectors
are also known in the art, and may be obtained from commercial sources (such as PharMingen,
San Diego, CA; Protein Sciences Corp., Meriden, CT; Stratagene, La Jolla, CA).
B. Peptide Sequence Variants
[0189] Radioprotectant characteristics of the peptides disclosed herein (for instance, the
7N3 peptide) lie not in their precise and entire amino acid sequence, but rather in
the three-dimensional structure inherent in the amino acid sequences encoded by the
DNA sequences. It is possible to recreate the binding characteristics of any of these
peptides, for instance the binding characteristics of any one of the specific peptides
described herein, by recreating the three-dimensional structure, without necessarily
recreating the exact amino acid sequence. Production of variations is enabled particularly
in view of the guidance provided for the tolerance of variations at various positions
within the core peptide. Such modifications and variations can be achieved for instance
by designing a nucleic acid sequence that encodes for the three-dimensional structure,
but which differs, for instance by reason of the redundancy of the genetic code or
the substitution of one or more specific amino acids. Similarly, the DNA sequence
may also be varied, while still producing a functional peptide.
[0190] Variant therapeutic peptides include peptides that differ in amino acid sequence
from the disclosed sequence, but that share structurally significant sequence homology
with any of the provided peptides. Such variants may be produced by manipulating the
nucleotide sequence of the encoding sequence, using standard procedures, including
site-directed mutagenesis or PCR. The simplest modifications involve the substitution
of one or more amino acids for amino acids having similar biochemical properties.
These so-called conservative substitutions are likely to have minimal impact on the
activity of the resultant peptide, especially when made outside of the binding site
of the peptide. One of ordinary skill in the art will be able to predict or empirically
determine (particularly in view of the provided teachings) amino acids that may be
substituted for an original amino acid in a peptide.
[0191] More substantial changes in peptide structure may be obtained by selecting amino
acid substitutions that are less conservative than those listed in the above table.
Such changes include changing residues that differ more significantly in their effect
on maintaining polypeptide backbone structure (for example, sheet or helical conformation)
near the substitution, charge or hydrophobicity of the molecule at the target site,
or bulk of a specific side chain. The following substitutions are generally expected
to produce the greatest changes in protein properties: (a) a hydrophilic residue (for
example, seryl or threonyl) is substituted for (or by) a hydrophobic residue (for
example, leucyl, isoleucyl, phenylalanyl, valyl or alanyl); (b) a cysteine or proline
is substituted for (or by) any other residue; (c) a residue having an electropositive
side chain (for example, lysyl, arginyl, or histadyl) is substituted for (or by) an
electronegative residue (for example, glutamyl or aspartyl); or (d) a residue having
a bulky side chain (for example, phenylalanine) is substituted for (or by) one lacking
a side chain (for example, glycine).
[0192] Variant peptide-encoding sequences may be produced by standard DNA mutagenesis techniques,
for example, M13 primer mutagenesis. Details of these techniques are provided in
Sambrook (In Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York,
1989), Ch. 15. By the use of such techniques, variants may be created which differ in minor ways
from the disclosed radioprotectant peptides. DNA molecules and nucleotide sequences
which are derivatives of those specifically disclosed herein and that differ from
those disclosed by the deletion, addition, or substitution of nucleotides while still
encoding a radioprotectant peptide, are comprehended by this disclosure. In their
most simple form, such variants may differ from the disclosed sequences by alteration
of the coding region to fit the codon usage bias of the particular organism into which
the molecule is to be introduced.
[0193] Alternatively, the coding region may be altered by taking advantage of the degeneracy
of the genetic code to alter the coding sequence such that, while the nucleotide sequence
is substantially altered, it nevertheless encodes a peptide having an amino acid sequence
substantially similar to the disclosed peptide sequences. For example, one nucleotide
codon triplet GCT encodes alanine. Because of the degeneracy of the genetic code,
three other nucleotide codon triplets - (GCG, GCC and GCA) - also code for alanine.
Thus, a nucleotide sequence containing GCT for alanine could be changed at the same
position to any of the three alternative codons without affecting the amino acid composition
or characteristics of the encoded peptide. Based upon the degeneracy of the genetic
code, variant DNA molecules may be derived from the cDNA and gene sequences disclosed
herein using standard DNA mutagenesis techniques as described above, or by synthesis
of DNA sequences. Thus, this disclosure also encompasses nucleic acid sequences which
encode the subject peptides, but which vary from the disclosed nucleic acid sequences
by virtue of the degeneracy of the genetic code.
[0194] An analogue can also be provided by systematically improving at least one desired
property of an amino acid sequence. This can, for instance, be done by an Ala-scan
and/or replacement net mapping method. With such methods, myriad different variant
peptides are produced based on an original amino acid sequence; each variant peptide
contains a substitution of at least one amino acid residue compared to the starting
peptide. The amino acid residue may either be replaced by alanine (Ala-scan) or by
any other amino acid residue (replacement net mapping). This way, many positional
variants of the original amino acid sequence are synthesized. Every positional variant
is screened for a specific activity, such as the activity of reducing cell or tissue
damage to radiation exposure as described herein, or increased stability in a biological
setting. The generated data are used to design improved peptide derivatives of a certain
amino acid sequence.
C. Peptide Modifications
[0195] The present disclosure includes biologically active molecules that mimic the action
of the inhibitor/blockade peptides of the present disclosure. The peptides of the
disclosure include synthetic embodiments of naturally-occurring peptides described
herein, as well as analogues (non-peptide organic molecules), derivatives (chemically
functionalized protein molecules obtained starting with the disclosed peptide sequences)
and variants (homologs) of these peptides that specifically bind TSP1 or CD47, or
that block the interaction there between. Each peptide of the disclosure is comprised
of a sequence of amino acids, which may be either L- and/or D- amino acids, naturally
occurring and otherwise.
[0196] Thus, a variant peptide can also be generated by substitution of an L-amino acid
residue with a D-amino acid residue. This substitution, leading to a peptide that
does not naturally occur in nature, can improve a property of an amino acid sequence.
It is, for example, useful to provide a peptide sequence of known activity of all
D-amino acids in retro inversion format, thereby allowing for retained activity and
increased half-life values. By generating many positional variants of an original
amino acid sequence and screening for a specific activity, improved peptide derivatives
comprising D-amino acids can be designed with further improved characteristics. It
has been shown in the art that peptides that are protected by D-amino acids at either
one or both termini were found to be more stable than those consisting of L-amino
acids only. Other types of modifications include those known in the art of peptide
drug development to have beneficial effects for use of the peptide in a pharmaceutical
composition. These effects may include improved efficacy, altered pharmacokinetics,
increasing stability resulting in a longer shelf-life and less stringent cold chain
handling requirements. Thus, in one embodiment, an anti-radiation peptide comprises
a sequence of amino acids joined together in a chain by peptide bonds between their
amino and carboxylate groups, wherein at least one amino acid is a D-amino acid.
[0197] Also, peptides or analogues can be circularized, for example, by providing them with
(terminal) cysteines; dimerized or multimerized, for example, by linkage to lysine
or cysteine or other compounds with side-chains that allow linkage or multimerization;
brought in tandem- or repeat-configuration; conjugated or otherwise linked to carriers
known in the art, if only by a labile link that allows dissociation. Synthetic versions
of the oligopeptides described herein, and functional analogues or breakdown products,
are herein provided to be used in methods of the treatment and/or prevention of radiation
injury or damage.
[0198] Peptides may be modified by a variety of chemical techniques to produce derivatives
having essentially the same activity as the unmodified peptides, and optionally having
other desirable properties. For example, carboxylic acid groups of the peptides, whether
carboxyl-terminal or side chain, may be provided in the form of a salt of a pharmaceutically-acceptable
cation or esterified to form a C
1-C
16 ester, or converted to an amide of formula NR
1R
2 wherein R
1 and R
2 are each independently H or C
1-C
16 alkyl, or combined to form a heterocyclic ring, such as a 5- or 6- membered ring.
Amino groups of the peptides, whether amino-terminal or side chain, may be in the
form of a pharmaceutically-acceptable acid addition salt, such as the HCl, HBr, acetic,
benzoic, toluene sulfonic, maleic, tartaric and other organic salts, or may be modified
to C
1-C
16 alkyl or dialkyl amino or further converted to an amide.
[0199] Hydroxyl groups of the peptide side chains may be converted to C
1-C
16 alkoxy or to a C
1-C
16 ester using well-recognized techniques. Phenyl and phenolic rings of the peptide
side chains may be substituted with one or more halogen atoms, such as fluorine, chlorine,
bromine or iodine, or with C
1-C
16 alkyl, C
1-C
16 alkoxy, carboxylic acids and esters thereof, or amides of such carboxylic acids.
Methylene groups of the peptide side chains can be extended to homologous C
2-C
4 alkylenes. Thiols can be protected with any one of a number of well-recognized protecting
groups, such as acetamide groups. Those skilled in the art will also recognize methods
for introducing cyclic structures into the peptides of this disclosure to select and
provide conformational constraints to the structure that result in enhanced stability.
[0200] Peptidomimetic and organomimetic embodiments are also within the scope of the present
disclosure, whereby the three-dimensional arrangement of the chemical constituents
of such peptido- and organomimetics mimic the three-dimensional arrangement of the
peptide backbone and component amino acid side chains in the described inhibitor peptides,
resulting in such peptido- and organomimetics of the peptides of this disclosure having
measurable or enhanced angiogenic or anti-angiogenic activity. For computer modeling
applications, a pharmacophore is an idealized, three-dimensional definition of the
structural requirements for biological activity. Peptido- and organomimetics can be
designed to fit each pharmacophore with current computer modeling software (using
computer assisted drug design or CADD). See
Walters, Computer-Assisted Modeling of Drugs, in Klegerman & Groves, eds., 1993, Pharmaceutical
Biotechnology, Interpharm Press: Buffalo Grove, IL, pp. 165-174 and
Principles of Pharmacology Munson (ed.) 1995, Ch. 102, for descriptions of techniques used in CADD. Also included within the scope of the
disclosure are mimetics prepared using such techniques that produce radioprotective
peptides.
D. Additional Peptides
[0201] Additional peptides useful for blocking the interaction of TSP1 with CD47 are described
in International Patent Publication No.
WO 2008/060785. The radioprotectant characteristics of these and other peptides can be characterized
using assays that measure their ability to reduce or prevent tissue or cellular damage
after radiation exposure. Representative example methods are provided herein, including
for instance in the Examples. Other methods will be apparent to those of ordinary
skill in the art.
X. Pharmaceutical Compositions
[0202] The therapeutic compounds described herein may be formulated in a variety of ways
depending on the location and type of disease to be treated or prevented in the subject.
Pharmaceutical compositions are thus provided for both local use at or near an affected
area and for systemic use (in which the agent is administered in a manner that is
widely disseminated via the cardiovascular system). This disclosure includes within
its scope pharmaceutical compositions including at least one peptide (for example,
peptide C6d HIGWKDFTAYRWRLS (SEQ ID NO: 1) or peptide p7N3 FIRVVMYEGKK (SEQ ID NO:
2)) or another inhibitor of TSP1 or CD47 action or interaction (
e.g., Ab A6.1 or Ab B6H12, or a CD47-directed morpholino such as CGTCACAGGCAGGACCCACTGCCCA
(SEQ ID NO: 4)), formulated for use in human or veterinary medicine. While the peptides
and inhibitors typically will be used to treat human subjects, they may also be used
to treat similar or identical diseases in other vertebrates, such other primates,
dogs, cats, horses, and cows.
[0203] Pharmaceutical compositions that include at least one peptide or other inhibitor
or therapeutic compound as described herein as an active ingredient, or that include
both a therapeutic peptide or inhibitor/blockade agent and an additional agent as
active ingredients, or that include both a radioprotective peptide or inhibitor and
an additional therapeutic agent, may be formulated with an appropriate solid or liquid
carrier, depending upon the particular mode of administration chosen. Additional active
ingredients include, for example, nitric oxide donors, nitrovasodilators, activators
of the enzyme soluble guanylylcyclase, or cGMP phosphodiesterase inhibitors. Pharmaceutical
compositions may include additional cytoprotective or radioprotectve agents known
to the art (for example as described in
Tofilon, Chem Rev. 109:2974-88, 2009).
[0205] The dosage form of the pharmaceutical composition will be determined by the mode
of administration chosen. For instance, in addition to injectable fluids, inhalational,
topical, opthalmic, peritoneal, and oral formulations can be employed. Inhalational
preparations can include aerosols, particulates, and the like. In general, the goal
for particle size for inhalation is about 1µm or less in order that the pharmaceutical
reach the alveolar region of the lung for absorption. Oral formulations may be liquid
(for example, syrups, solutions, or suspensions), or solid (for example, powders,
pills, tablets, or capsules). For solid compositions, conventional non-toxic solid
carriers can include pharmaceutical grades of mannitol, lactose, starch, or magnesium
stearate. Actual methods of preparing such dosage forms are known, or will be apparent,
to those of ordinary skill in the art.
[0206] The compositions or pharmaceutical compositions can be administered by any route,
including parenteral administration, for example, intravenous, intramuscular, intraperitoneal,
intrasternal, or intra-articular injection or infusion, or by sublingual, oral, topical,
intra-nasal, ophthalmic, or transmucosal administration, or by pulmonary inhalation.
When the active compounds are provided as parenteral compositions, for example, for
injection or infusion, they are generally suspended in an aqueous carrier, for example,
in an isotonic buffer solution at a pH of about 3.0 to about 8.0, preferably at a
pH of about 3.5 to about 7.4, 3.5 to 6.0, or 3.5 to about 5.0. Useful buffers include
sodium citrate-citric acid and sodium phosphate-phosphoric acid, and sodium acetate/acetic
acid buffers. A form of repository or depot slow release preparation may be used so
that therapeutically effective amounts of the preparation are delivered into the bloodstream
over many hours or days following transdermal injection or delivery.
[0207] Active compounds (
e.g., peptides, proteins, oligos, and so forth) are also suitably administered by sustained-release
systems. Suitable examples of sustained-release formulations include suitable polymeric
materials (such as, for example, semi-permeable polymer matrices in the form of shaped
articles, for example, films, or mirocapsules), suitable hydrophobic materials (for
example as an emulsion in an acceptable oil) or ion exchange resins, and sparingly
soluble derivatives (such as, for example, a sparingly soluble salt). Sustained-release
compounds may be administered by intravascular, intravenous, intra-arterial, intramuscular,
subcutaneous, intra-pericardial, or intra-coronary injection. Administration can also
be oral, rectal, parenteral, intracisternal, intravaginal, intraperitoneal, topical
(as by powders, ointments, gels, drops or transdermal patch), buccal, or as an oral
or nasal spray.
[0208] Preparations for administration can be suitably formulated to give controlled release
of the therapeutic agent(s) (
e.g., peptides, antibodies, oligonucleotides or other compounds that block CD47 and/or
TSP1 activity or interaction). For example, the pharmaceutical compositions may be
in the form of particles comprising a biodegradable polymer and/or a polysaccharide
jellifying and/or bioadhesive polymer, an amphiphilic polymer, an agent modifying
the interface properties of the particles and a pharmacologically active substance.
These compositions exhibit certain biocompatibility features that allow a controlled
release of the active substance. See, for example,
U.S. Patent No. 5,700,486.
[0209] In some embodiments, therapeutic agent(s) are delivered by way of a pump (see
Sefton, CRC Crit. Ref. Biomed. Eng. 14:201, 1987;
Buchwald et al., Surgery 88:507, 1980;
Saudek et al., N. Engl. J. Med. 321:574, 1989) or by continuous subcutaneous infusions, for example, using a mini-pump. An intravenous
bag solution may also be employed. The key factor in selecting an appropriate dose
is the result obtained, as measured by increases or decreases in radioprotection,
or by other criteria for measuring control or prevention of disease, as are deemed
appropriate by the practitioner. Other controlled release systems are discussed in
the review by
Langer (Science 249:1527-1533, 1990).
[0210] In another aspect of the disclosure, therapeutic agent(s) are delivered by way of
an implanted pump, described, for example, in
U.S. Patent No. 6,436,091;
U.S. Patent No. 5,939,380; and
U.S. Patent No. 5,993,414. Implantable drug infusion devices are used to provide subjects with a constant and
long term dosage or infusion of a drug or any other therapeutic agent. Essentially,
such device may be categorized as either active or passive.
[0211] Active drug or programmable infusion devices feature a pump or a metering system
to deliver the drug into the patient's system. An example of such an active drug infusion
device currently available is the Medtronic SynchroMed™ programmable pump. Such pumps
typically include a drug reservoir, a peristaltic pump to pump the drug out from the
reservoir, and a catheter port to transport the pumped out drug from the reservoir
via the pump to a patient's anatomy. Such devices also typically include a battery
to power the pump, as well as an electronic module to control the flow rate of the
pump. The Medtronic SynchroMed™ pump further includes an antenna to permit the remote
programming of the pump.
[0212] Passive drug infusion devices, in contrast, do not feature a pump, but rather rely
upon a pressurized drug reservoir to deliver the drug. Thus, such devices tend to
be both smaller as well as cheaper as compared to active devices. An example of such
a device includes the Medtronic IsoMed™. This device delivers the drug into the patient
through the force provided by a pressurized reservoir applied across a flow control
unit.
[0213] The implanted pump can be completely implanted under the skin of a subject, thereby
negating the need for a percutaneous catheter. These implanted pumps can provide the
patient with therapeutic agent(s) at a constant or a programmed delivery rate. Constant
rate or programmable rate pumps are based on either phase-change or peristaltic technology.
When a constant, unchanging delivery rate is required, a constant-rate pump is well
suited for long-term implanted drug delivery. If changes to the infusion rate are
expected, a programmable pump may be used in place of the constant rate pump system.
Osmotic pumps may be much smaller than other constant rate or programmable pumps,
because their infusion rate can be very low. An example of such a pump is described
listed in
U.S. Patent No. 5,728,396.
[0214] The therapeutic agents may also be delivered passively and in sustained fashion as
part of and incorporated into implantable devices, such as vascular stents which can
be placed directly into diseased blood vessels through several standard approaches,
including direct surgical insertion or percutaneoulsy with angiographic control.
[0215] For oral administration, the pharmaceutical compositions can take the form of, for
example, tablets or capsules prepared by conventional means with pharmaceutically
acceptable excipients such as binding agents (for example, pregelatinised maize starch,
polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers (for example, lactose,
microcrystalline cellulose or calcium hydrogen phosphate); lubricants (for example,
magnesium stearate, talc or silica); disintegrants (for example, potato starch or
sodium starch glycolate); or wetting agents (for example, sodium lauryl sulphate).
The tablets can be coated by methods well known in the art. Liquid preparations for
oral administration can take the form of, for example, solutions, syrups or suspensions,
or they can be presented as a dry product for constitution with water or other suitable
vehicle before use. Such liquid preparations can be prepared by conventional means
with pharmaceutically acceptable additives such as suspending agents (for example,
sorbitol syrup, cellulose derivatives or hydrogenated edible fats); emulsifying agents
(for example, lecithin or acacia); non-aqueous vehicles (for example, almond oil,
oily esters, ethyl alcohol or fractionated vegetable oils); and preservatives (for
example, methyl or propyl-p-hydroxybenzoates or sorbic acid). The preparations can
also contain buffer salts, flavoring, coloring, and sweetening agents as appropriate.
[0216] For administration by inhalation, the compounds for use according to the present
disclosure are conveniently delivered in the form of an aerosol spray presentation
from pressurized packs or a nebulizer, with the use of a suitable propellant, for
example, dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane,
carbon dioxide or other suitable gas. In the case of a pressurized aerosol, the dosage
unit can be determined by providing a valve to deliver a metered amount. Capsules
and cartridges for use in an inhaler or insufflator can be formulated containing a
powder mix of the compound and a suitable powder base such as lactose or starch.
[0217] For topical administration, the compounds can be, for example, mixed with a liquid
delivery agent for administration locally. The agents used therapeutically (such as
peptides, antibodies and morpholinos) are readily soluble or suspendable in water
and saline, and as such these would be useful for delivery since water or saline do
not cause adverse biological tissue effects. This allows sufficiently high doses to
be administered locally or systemically, without secondary toxicity from the delivery
vehicle.
[0218] Pharmaceutical compositions that comprise at least one therapeutic agent as described
herein as an active ingredient will normally be formulated with an appropriate solid
or liquid carrier, depending upon the particular mode of administration chosen. The
pharmaceutically acceptable carriers and excipients useful in this disclosure are
conventional. For instance, parenteral formulations usually comprise injectable fluids
that are pharmaceutically and physiologically acceptable fluid vehicles such as water,
physiological saline, other balanced salt solutions, aqueous dextrose, glycerol or
the like. Excipients that can be included are, for instance, proteins, such as human
serum albumin or plasma preparations. If desired, the pharmaceutical composition to
be administered may also contain minor amounts of non-toxic auxiliary substances,
such as wetting or emulsifying agents, preservatives, and pH buffering agents and
the like, for example sodium acetate or sorbitan monolaurate. Actual methods of preparing
such dosage forms are known, or will be apparent, to those skilled in the art.
[0219] For example, for parenteral administration, therapeutic agent(s) can be formulated
generally by mixing them at the desired degree of purity, in a unit dosage injectable
form (solution, suspension, or emulsion), with a pharmaceutically acceptable carrier,
for instance, one that is non-toxic to recipients at the dosages and concentrations
employed and is compatible with other ingredients of the formulation. A pharmaceutically
acceptable carrier is a non-toxic solid, semisolid or liquid filler, diluent, encapsulating
material or formulation auxiliary of any type.
[0220] Generally, the formulations are prepared by contacting the therapeutic agent(s) each
uniformly and intimately with liquid carriers or finely divided solid carriers or
both. Then, if necessary, the product is shaped into the desired formulation. Optionally,
the carrier is a parenteral carrier, and in some embodiments it is a solution that
is isotonic with the blood of the recipient. Examples of such carrier vehicles include
water, saline, Ringer's solution, and dextrose solution. Non-aqueous vehicles such
as fixed oils and ethyl oleate are also useful herein, as well as liposomes.
[0221] The pharmaceutical compositions that comprise at least one therapeutic agent, in
some embodiments, will be formulated in unit dosage form, suitable for individual
administration of precise dosages. The amount of active compound(s) administered will
be dependent on the subject being treated, the severity of the affliction, and the
manner of administration, and is best left to the judgment of the prescribing clinician.
Within these bounds, the formulation to be administered will contain a quantity of
the active component(s) in amounts effective to achieve the desired effect in the
subject being treated.
[0222] The therapeutically effective amount of therapeutic agent, such as a peptide, antibody,
or oligonucleotide (
e.g., morpholino or other antisense molecule) will be dependent on the peptide or inhibitor
utilized, the subject being treated, the severity and type of the affliction, and
the manner of administration. The exact dose is readily determined by one of skill
in the art based on the potency of the specific compound, the age, weight, sex and
physiological condition of the subject.
[0223] The peptides/proteins of the present disclosure (for example, CD47 or TSP1 peptides,
or a peptide that inhibits or alters binding between TSP1 and CD47, including a peptide
from an antibody or an artificial antibody with this functional characteristic, or
a peptide or protein that inhibits the expression or activity of either of these proteins)
also can be administered as naked DNA encoding the peptide. To simplify the manipulation
and handling of the nucleic acid encoding the peptide, the nucleic acid is generally
inserted into a cassette, where it is operably linked to a promoter. Preferably, the
promoter is capable of driving expression of the protein in cells of the desired target
tissue. The selection of appropriate promoters can readily be accomplished. Preferably,
the promoter is a high expression promoter, for example the 763-base-pair cytomegalovirus
(CMV) promoter, the Rous sarcoma virus (RSV) promoter (
Davis et al., Hum. Gene. Ther. 4:151-159, 1993), or the MMT promoter.
[0224] Other elements that enhance expression also can be included, such as an enhancer
or a system that results in high levels of expression, such as a tat gene or tar element.
This cassette is inserted into a vector, for example, a plasmid vector such as pUC118,
pBR322, or other known plasmid vector, that includes, for example, an
E. coli origin of replication. See,
Sambrook, et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory
Press (1989). The plasmid vector may also include a selectable marker such as the ß-lactamase
gene for ampicillin resistance, provided that the marker polypeptide does not adversely
affect the metabolism of the organism being treated. The cassette also can be bound
to a nucleic acid binding moiety in a synthetic delivery system, such as the system
disclosed in
PCT publication WO 95/22618.
[0225] Optionally, the DNA may be used with a microdelivery vehicle such as cationic liposomes
and adenoviral vectors. (For a review of the procedures for liposome preparation,
targeting and delivery of contents, see
Mannino and Gould-Fogerite, BioTechniques, 6:682, 1988);
Feigner and Holm, Bethesda Res. Lab. Focus, 11(2):21, 1989); and
Maurer, Bethesda Res. Lab. Focus, 11(2):25, 1989). Replication-defective recombinant adenoviral vectors can be produced in accordance
with known techniques. (See
Quantin, et al., Proc. Natl. Acad. Sci. USA, 89:2581-2584, 1992;
Stratford-Perricadet, et al., J. Clin. Invest., 90:626-630,1992; and
Rosenfeld, et al., Cell, 68:143-155, 1992).
[0226] The effective dose of the nucleic acid will be a function of the particular expressed
protein, the target tissue, the subject, and his or her clinical condition. Effective
amounts of DNA are between about 1 and 4000 µg, or about 1000 and 2000 µg, or between
about 2000 and 4000 µg. In certain situations, it is desirable to use nucleic acids
encoding two or more different proteins in order to optimize the therapeutic outcome.
For example, DNA encoding a therapeutic peptide, such as a CD47 or TSP1 peptide (for
example, peptide C6d HIGWKDFTAYRWRLS (SEQ ID NO: 1) or peptide p7N3 FIRVVMYEGKK (SEQ
ID NO: 2)) can be used. Alternatively, DNA encoding a CD47 or TSP1 peptide can be
combined with other genes or their encoded gene products to enhance the activity of
targeted cells.
[0227] In order to facilitate injection, the nucleic acid is formulated with a pharmaceutically
acceptable carrier. Examples of suitable carriers include, but are not limited to,
saline, albumin, dextrose and sterile water. The nucleic acid is injected into the
ischemic tissue using standard injection techniques by use of, for example, a hypodermic
needle, for example a hypodermic needle size between No. 29 and No. 16. The nucleic
acid also may be injected by an externally applied local injection apparatus, such
as that used to inject antigens for allergy testing; or a transcutaneous patch capable
of delivery to subcutaneous muscle. The nucleic acid is injected at one site, or at
multiple sites throughout the ischemic tissue.
[0228] Once injected, the nucleic acid capable of expressing the desired radioprotective
protein is taken up and expressed by the cells of the tissue. Because the vectors
containing the nucleic acid of interest are not normally incorporated into the genome
of the cells, expression of the protein of interest takes place for only a limited
time. Typically, the radioprotectant protein is only expressed at therapeutic levels
for about two days to several weeks, preferably for about one to two weeks. Reinjection
of the DNA can be utilized to provide additional periods of expression of the radioprotectant
protein. If desired, use of a retrovirus vector to incorporate the heterologous DNA
into the genome of the cells will increase the length of time during which the therapeutic
polypeptide is expressed, from several weeks to indefinitely.
[0229] Also contemplated is application of the provided radioprotectant agents via an autoinjector.
Thus, another embodiment is the pharmaceutical composition comprising a described
radioprotectant agent which is contained in an autoinjector. An autoinjector is a
medical device designed to deliver a single dose of a particular (typically life-saving)
drug, sometimes also described as a pre-filled syringe for self-injection or for injection
by non-medical personnel.
[0230] By design, autoinjectors are easy to use and are intended for self-administration
by patients or administration by laymen to patients. The site of injection typically
is into the thigh or the buttocks, wherein the treatment comprises subcutaneous or
intramuscular injection with the peptide or other agent provided herein. Because autoinjectors
may be designed to automatically and reliably deliver a desired dose of medicament,
they facilitate quick, convenient, and accurate delivery of therapeutic compounds.
Autoinjectors are well suited for use by subjects who must self-administer therapeutic
substances or by healthcare workers who must inject multiple subjects over a relatively
short period of time, for instance, in an emergency situation. Moreover, autoinjectors
incorporating a needled injection mechanism may be designed so that the needle is
hidden from view before, during, and even after an injection operation, thereby reducing
or eliminating any anxiety associated with the act of penetrating a visible needle
into the subject's tissue. Though their precise specifications vary widely, needled
autoinjectors generally include a body or housing, a needled syringe or similar device,
and one or more drive mechanisms for inserting a needle into the tissue of the subject
and delivering a desired dose of liquid medicament through the inserted needle. The
drive mechanisms included in state of the art needled autoinjectors generally include
a source of energy capable of powering the drive mechanism. This energy source may
be, for example, mechanical (
e.g., spring-loaded), pneumatic, electromechanical, or chemical, as described in
U.S. Patent Nos. 6,149,626,
6,099,504,
5,957,897,
5,695,472,
5,665,071,
5,567,160,
5,527,287,
5,354,286,
5,300,030,
5,102,393,
5,092,843,
4,894,054,
4,678,461, and
3,797,489. International Publications numbered
WO 01/17593,
WO 98/00188,
WO 95/29720,
WO 95/31235, and
WO 94/13342 also describe various injectors including different drive mechanisms. Many autoinjectors
are (optionally spring-loaded) syringes. An autoinjector of the present invention,
in particular, the body or housing thereof that is in direct contact with the radioprotective
agent, is preferably made of a material that has a minimal affinity for that agent
(
e.g., minimal affinity to a peptide or nucleic acid molecule). This can reduce unwanted
adhesion or sticking of agent to the autoinjector. One example material that exhibits
reduced affinity for peptides is polypropylene, for instance essentially pure polypropylene.
[0231] Examples of autoinjectors include Epipen® and Twinject®, which are often prescribed
to persons who are at risk for anaphylaxis. Another example of an autoinjector is
the Rebiject® for interferon beta used to treat Multiple Sclerosis. Autoinjectors
are also used in the military to protect personnel from chemical warfare agents. In
the United States military, an autoinjector is part of every Biological or Chemical
Weapons Response kit. It is issued to every soldier in the event they may face biological
or chemical weapons. An autoinjector herein not only comprises these types of injection
devices that usually are spring-driven, whereby the skin penetration and/or the injection
of the drug takes place automatically, but also comprises pre-filled syringes, autoinjector
cartridges and the like.
[0232] The disclosure therefore provides such an autoinjector useful for the treatment of
(ir)radiation injury irrespective of whether the radiation is emitted by radioactive
substances (radioisotopes), such as uranium, radon, and plutonium, or is produced
by man-made sources, such as x-ray and radiation therapy machines. Also provided are
autoinjectors comprising a pharmaceutical composition consisting of radioprotective
agent (such as a peptide or antibody, or morpholino or other nucleic acid molecule,
as described herein) and a suitable excipient.
[0233] Suitable excipients, for example, are composed of water, propylene glycol, ethyl
alcohol, sodium benzoate and benzoic acid as buffers, and benzyl alcohol as preservative;
or of mannitol, human serum albumin, sodium acetate, acetic acid, sodium hydroxide,
and water for injections. Other exemplary compositions for parenteral administration
via an autoinjector include injectable solutions or suspensions that may contain,
for example, suitable non-toxic, parenterally acceptable diluents or solvents, such
as mannitol, 1,3-butanediol, water, Ringer's solution, an isotonic sodium chloride
solution, or other suitable dispersing or wetting and suspending agents, including
synthetic mono- or diglycerides, and fatty acids, including oleic acid.
[0234] In one embodiment, an autoinjector comprises as an active ingredient at least one
radioprotective agent described herein, such as a radioprotective peptide (or functional
analog thereof) that is capable of reducing adverse effects of radiation in a subject
when administered after the subject has been exposed to radiation. Preferably, the
peptide can confer at least a partial protection against radiation damage if administered
at least 30 minutes, more preferably at least one hour, most preferably at least several
hours or even several days (such as, three or more days) post-irradiation. This type
of autoinjector is also referred to as an "emergency-autoinjector," reflecting its
applicability in unexpected emergency situations.
[0235] In one embodiment, the autoinjector contains a sterile solution packaged within a
syringe-like device that delivers its entire 1 ml to 5 ml contents automatically upon
activation. Each milliliter contains 100 mg, or in some embodiments 200 mg, radioprotective
agent (
e.g., peptide) with an excipient, such as an excipient comprising propylene glycol, ethyl
alcohol, sodium benzoate and benzoic acid as buffers, and benzyl alcohol as preservative.
[0236] The therapeutic agents can also be administered directly as part of a surgical or
other medical procedure, or at the bedside by a treating physician. Drug quality product
(
e.g., peptide, antibody or morpholino) can be diluted for instance in sterile saline and
given by injection using sterile 1 cc syringes and small bore needles (25 gauge and
less) to a subject in need of radioprotection. Alternatively, a wound bed can be irrigated
for instance with a saline or other therapeutically effective solution containing
a known concentration (dosage) of drug or compound, or a combination thereof. Precise
control and localization of therapeutic effects can thus be obtained.
[0237] Controlled release parenteral formulations can be made as implants, oily injections,
or as particulate systems. For a broad overview of protein delivery systems, see
Banga, Therapeutic Peptides and Proteins: Formulation, Processing, and Delivery Systems,
Technomic Publishing Company, Inc., Lancaster, PA, 1995. Particulate systems include microspheres, microparticles, microcapsules, nanocapsules,
nanospheres, and nanoparticles. Microcapsules contain the therapeutic peptide as a
central core. In microspheres, the therapeutic agent is dispersed throughout the particle.
Particles, microspheres, and microcapsules smaller than about 1 µm are generally referred
to as nanoparticles, nanospheres, and nanocapsules, respectively. Capillaries have
a diameter of approximately 5 µm so that only nanoparticles are administered intravenously.
Microparticles are typically around 100 µm in diameter and are administered subcutaneously
or intramuscularly (see
Kreuter, Colloidal Drug Delivery Systems, J. Kreuter, ed., Marcel Dekker, Inc., New
York, NY, pp. 219-342, 1994;
Tice & Tabibi, Treatise on Controlled Drug Delivery, A. Kydonieus, ed., Marcel Dekker,
Inc. New York, NY, pp. 315-339, 1992).
[0238] Also contemplated is the use of nanoparticles as delivery agents, which can be targeted
to specific cells, tissues or organ for instance by incorporation on their surface
ligands of receptors specific in their expression to the targeted cells, tissues or
organs, The targeting entity can be the same or different than the therapeutically
active agent carried by the nanoparticle. Further, distribution of nanoparticles to
certain tissues spaces (
e.g. the blood versus the central nervous system protected by the blood-brain barrier)
can be determined by altering the size of the nanoparticles thereby allowing or preventing
their transit of such barriers between tissue compartments.
[0239] Polymers can be used for ion-controlled release. Various degradable and nondegradable
polymeric matrices for use in controlled drug delivery are known in the art (
Langer, Accounts Chem. Res. 26:537, 1993). For example, the block copolymer, polaxamer 407 exists as a viscous yet mobile
liquid at low temperatures but forms a semisolid gel at body temperature. It has shown
to be an effective vehicle for formulation and sustained delivery of recombinant interleukin-2
and urease (
Johnston et al., Pharm. Res. 9:425, 1992;
Pec, J. Parent. Sci. Tech. 44(2):58, 1990). Alternatively, hydroxyapatite has been used as a microcarrier for controlled release
of proteins (
Ijntema et al., Int. J. Pharm. 112:215, 1994). In yet another aspect, liposomes are used for controlled release as well as drug
targeting of lipid-capsulated compounds (
Betageri et al., Liposome Drug Delivery Systems, Technomic Publishing Co., Inc., Lancaster,
PA, 1993). Numerous additional systems for controlled delivery of therapeutic proteins are
known (
e.g.,
U.S. Patent No. 5,055,303;
U.S. Patent No. 5,188,837;
U.S. Patent No. 4,235,871;
U.S. Patent No. 4,501,728;
U.S. Patent No. 4,837,028;
U.S. Patent No. 4,957,735; and
U.S. Patent No. 5,019,369;
U.S. Patent No. 5,055,303;
U.S. Patent No. 5,514,670;
U.S. Patent No. 5,413,797;
U.S. Patent No. 5,268,164;
U.S. Patent No. 5,004,697;
U.S. Patent No. 4,902,505;
U.S. Patent No. 5,506,206;
U.S. Patent No. 5,271,961;
U.S. Patent No. 5,254,342; and
U.S. Patent No. 5,534,496).
[0240] The specific form of the agents and their manner of administration depends in part
upon the particular tissue to be treated. The compounds or pharmaceutical compositions
containing them can be applied, for example, as a mouthwash to coat the oral mucosal
tissue, as a spray or syringe to coat the mucosal tissues of the nose and/or throat,
or as a cream or paste, an enema, or other forms of topical administration known to
one of skill in the art, as appropriate.
[0241] The amount of agent to be delivered, as well as the dosing schedule necessary to
provide the desired radio/chemo protective effects, will be influenced by the bioavailability
of the specific compound selected (and/or an active metabolite thereof), the type
and extent of radiation exposure or radiation dosage schedule, and other factors that
will be apparent to those of skill in the art.
[0242] Alternatively, the compound may be administered in a gel, lotion, ointment or other
suitable form which is applied to the tissue up to about 90 minutes before irradiation
or treatment and remains on the tissue during and optionally after the treatment.
[0243] The same dosage and concentrations can be used when the radioprotective agent is
administered after irradiation and/or radiotherapeutic treatment. The three administrations
(before, during and after radiotherapy treatment) may be used alone, or in any combination
of two or all three administrations, as needed.
XI. Suppression of Protein Expression
[0244] In some embodiments, it is desirable to reduce or suppress TSP1 or CD47 protein expression,
for example in various experimental conditions or in the treatment or amelioration
of radiation exposure, such as exemplified herein.
[0245] Although the mechanism by which antisense RNA molecules interfere with gene expression
has not been fully elucidated, it is believed that antisense RNA molecules (or fragments
thereof) bind to the endogenous mRNA molecules and thereby inhibit translation of
the endogenous mRNA or result in its degradation. A reduction of protein expression
in a cell may be obtained by introducing into cells an antisense construct based on
the TSP1 (or CD47) encoding sequence, including the human (or other mammalian)
TSP1 cDNA or CD47 cDNA or gene sequence or flanking regions thereof. For antisense suppression,
a nucleotide sequence from a TSP1-encoding sequence, for example all or a portion
of the
TSP1 cDNA or gene, is arranged in reverse orientation relative to the promoter sequence
in the transformation vector. One of ordinary skill in the art will understand how
other aspects of the vector may be chosen.
[0246] The introduced sequence need not be the full length of the cDNA or gene, or reverse
complement thereof, and need not be exactly homologous to the equivalent sequence
found in the cell type to be transformed. Generally, however, where the introduced
sequence is of shorter length, a higher degree of homology to the native target sequence
will be needed for effective antisense suppression. The introduced antisense sequence
in the vector may be at least 20 nucleotides in length, and improved antisense suppression
will typically be observed as the length of the antisense sequence increases. The
length of the antisense sequence in the vector advantageously may be greater than
about 30 nucleotides, or greater than about 100 nucleotides. For suppression of the
TSP1 gene itself, transcription of an antisense construct results in the production of
RNA molecules that are the reverse complement of mRNA molecules transcribed from the
endogenous
TSP1 gene in the cell.
[0247] Suppression of endogenous TSP1 or CD47 expression can also be achieved using ribozymes.
Ribozymes are synthetic molecules that possess highly specific endoribonuclease activity.
The production and use of ribozymes are disclosed in
U.S. Patent No. 4,987,071 and
U.S. Patent No. 5,543,508. The inclusion of ribozyme sequences within antisense RNAs may be used to confer
RNA cleaving activity on the antisense RNA, such that endogenous mRNA molecules that
bind to the antisense RNA are cleaved, which in turn leads to an enhanced antisense
inhibition of endogenous gene expression.
[0248] Suppression can also be achieved using RNA interference, using known and previously
disclosed methods. Several models have been put forward to explain RNAi, in particular
the mechanisms by which the cleavage derived small dsRNAs or siRNAs interact with
the target mRNA and thus facilitate its degradation (
Hamilton et al., Science 286, 950, 1999;
Zamore et al., Cell 101, 25, 2000;
Hammond et al., Nature 404, 293, 2000;
Yang et al., Curr. Biol. 10, 1191, 2000;
Elbashir et al., Genes Dev. 15, 188, 2001;
Bass Cell 101, 235, 2000). It has been proposed that the cleavage derived small dsRNAs or siRNAs act as a
guide for the enzymatic complex required for the sequence specific cleavage of the
target mRNA. Evidence for this includes cleavage of the target mRNA at regular intervals
of ∼21-23 nts in the region corresponding to the input dsRNA (
Zamore et al., Cell 101, 25, 2000), with the exact cleavage sites corresponding to the middle of sequences covered
by individual 21- or 22 nt small dsRNAS or siRNAs (
Elbashir et al., Genes Dev. 15, 188, 2001). Although mammals and lower organisms appear to share dsRNA-triggered responses
that involve a related intermediate (small dsRNAs), it is likely that there will be
differences as well as similarities in the underlying mechanism. dsRNAs can be formed
from RNA oligomers produced synthetically (for technical details see material from
the companies Xeragon and Dharmacon, both available on the internet). Small dsRNAs
and siRNAs can also be manufactured using standard methods of
in vitro RNA production. In addition, the Silencer™ siRNA Construction kit (and components
thereof) available from Ambion (Catalog # 1620; Austin, TX), which employs a T7 promoter
and other well known genetic engineering techniques to produce dsRNAs. Double stranded
RNA triggers could also be expressed from DNA based vector systems.
[0249] Inhibition also can be accomplished using morpholino oligonucleotides, for instance
as described herein. The herein described discoveries and therapeutics find immediate
application through implanted devices in the management and treatment, for instance,
accidental or intentional radiation exposure. The morpholino can be delivered systemically
as herein described. Morpholinos targeting CD47 or TSP1 can also be incorporated into
(or onto) an implanted device for sustained local release directly to enhance radioprotection.
The therapeutic agents (
e.g., morpholino, antibody, peptide) could be then targeted specifically to area(s) of
maximum benefit throughout the body including for instance a site that is to undergo
(or which has undergone or is undergoing) radiation therapy. In more general applications,
various implantable scaffolds or synthetics can serve the same means by allowing for
controlled and extended release of the therapeutic agent. With regard to accidental
radiation exposure particularly (but not exclusively), the therapeutics can be incorporated
directly into wound dressing and gels and applied directly to a wound surface. In
localizing the therapeutic to the area needed, potential negative side effects derived
from non-specific roles of TSP1 and CD47 can be limited and/or controlled.
[0250] The radioprotective nucleic acids and nucleic acid analogs that are used to suppress
endogenous TSP1 or CD47 expression may be modified chemically or biochemically or
may contain non-natural or derivatized nucleotide bases, as will be readily appreciated
by those of skill in the art. Such modifications include, for example, labels, methylation,
substitution of one or more of the naturally occurring nucleotides with an analog,
internucleotide modifications, such as uncharged linkages (for example, methyl phosphonates,
phosphotriesters, phosphoramidates, carbamates, etc.), charged linkages (for example,
phosphorothioates, phosphorodithioates, etc.), pendent moieties (for example, polypeptides),
intercalators (for example, acridine, psoralen, etc.), chelators, alkylators, and
modified linkages (for example, alpha anomeric nucleic acids, etc.). The term nucleic
acid molecule also includes any topological conformation, including single-stranded,
double-stranded, partially duplexed, triplexed, hairpinned, circular and padlocked
conformations. Also included are synthetic molecules that mimic polynucleotides in
their ability to bind to a designated sequence via hydrogen bonding and other chemical
interactions. Such molecules are known in the art and include, for example, those
in which peptide linkages substitute for phosphate linkages in the backbone of the
molecule.
[0251] Additionally, although particular exemplary sequences are disclosed herein for use
as radioprotectant agents, one of skill in the art will appreciate that the present
methods also encompass sequence alterations of the disclosed agents that yield the
same results as described herein. Such sequence alterations can include, but are not
limited to, deletions, base modifications, mutations, labeling, and insertions.
[0252] Suppression of protein expression may also be achieved through agents that enhance
proteolysis of CD47 or TSP1 (
Allen et al., Endocrinology 150:1321-1329, 2009). In other particular examples, the suppression of CD47 expression involves an agent
that enhances the removal of CD47 from the cell surface or decreases the transcription,
mRNA processing, or translation of CD47. Similar embodiments are envisioned, regarding
suppression of TSP1.
XII. Screening for Additional Agents that Affect TSP1/CD47 Activity and/or Interaction
[0253] In various embodiments, it may be useful to treat a subject expected to be exposed
to radiation, or suspected of being so exposed, with an agent that inhibits a TSP1
or CD47 activity or interaction. Examples of such methods are described herein, along
with example compounds and compositions useful in such methods. However, equivalents
of the specifically described compounds are also useful in these methods. Thus, here
described are methods for identifying agents with TSP1 or CD47 inhibitory activity,
methods of identifying agents that interfere with an interaction between a TSP1 polypeptide
and a CD47 polypeptide, and so forth.
[0254] Compounds which may be screened in accordance with this disclosure include, but are
not limited to peptides, antibodies and fragments thereof, and other organic or inorganic
compounds (for example, peptidomimetics, small molecules) that inhibit TSP1 and/or
CD47 activity as described herein, or interfere (directly or indirectly) with an interaction
between TSP1 and CD47. Such compounds may include, but are not limited to, peptides
such as, for example, soluble peptides, including but not limited to members of random
peptide libraries; (see, for example,
Lam et al., Nature, 354:82-84, 1991;
Houghten et al., Nature, 354:84-86, 1991), and combinatorial chemistry-derived molecular library made of D- and/or L-configuration
amino acids, phosphopeptides (including, but not limited to, members of random or
partially degenerate, directed phosphopeptide libraries; see, for example,
Songyang et al., Cell, 72:767-778, 1993), antibodies (including, but not limited to, polyclonal, monoclonal, humanized, anti-idiotypic,
chimeric or single chain antibodies, and Fab, F(ab')
2 and Fab expression library fragments, and epitope-binding fragments thereof), and
small organic or inorganic molecules.
[0255] Computer modeling and searching technologies permit identification of compounds,
or the improvement of already identified compounds that can modulate expression or
activity of TSP1 or CD47. Examples of molecular modeling systems are the CHARMM (Chemistry
at HARvard Molecular Mechanics) and QUANTA programs (Polygen Corporation, Waltham,
Mass.). CHARMM performs the energy minimization and molecular dynamics functions.
QUANTA performs the construction, graphic modeling and analysis of molecular structure.
QUANTA allows interactive construction, modification, visualization, and analysis
of the behavior of molecules with each other.
[0256] A number of articles review computer modeling of drugs interactive with specific-proteins,
such as
Rotivinen et al., Acta Pharmaceutical Fennica 97:159-166, 1988;
Ripka, New Scientist 54-57, 1988;
McKinaly and Rossmann, Annu Rev Pharmacol Toxicol 29:111-122, 1989;
Perry and Davies, OSAR: Quantitative Structure-Activity Relationships in Drug Design
pp. 189-193, 1989, (
Alan R. Liss, Inc.); Lewis and Dean, Proc R Soc Lond 236:125-140 and 141-162, 1989; and, with respect to a model receptor for nucleic acid components,
Askew et al., J Am Chem Soc 111:1082-1090, 1989. Other computer programs that screen and graphically depict chemicals are available
from companies such as BioDesign, Inc. (Pasadena, Calif.), Allelix, Inc. (Mississauga,
Ontario, Canada), and Hypercube, Inc. (Cambridge, Ontario). Although these are primarily
designed for application to drugs specific to particular proteins, they can be adapted
to design of drugs specific to regions of DNA or RNA, once that region is identified.
[0257] One could also screen libraries of known compounds, including natural products or
synthetic chemicals, and biologically active materials, including proteins, for compounds
which are inhibitors or activators. Agents identified by the assays described herein
may be selected for further study if, for example, they show a statistically different
result from a control. Example statistical analysis is provided in the examples. A
statistically significant result is then considered to be one in which p < 0.05, in
certain embodiments.
[0258] Disclosed herein are methods of identifying agents with potential for inhibition
of TSP1 or CD47, and particularly the activity of either of these proteins in influencing
tissue survival to radiation exposure. Any agent capable of inhibiting (to a measurable
degree) at least one biological activity of TSP1 or CD47 is contemplated. In some
embodiments, a TSP1 (or CD47) inhibitory agent interferes with an interaction between
TSP1 and CD47.
[0259] Compounds identified may be useful, for example, in modulating an activity of TSP1
or CD47, or increasing or decreasing a binding affinity between TSP1 and CD47, thereby
providing radioprotection and/or reducing adverse effects, particularly in soft tissues,
of radiation exposure.
[0260] The following examples are provided to illustrate certain particular features and/or
embodiments. These examples should not be construed to limit the invention to the
particular features or embodiments described.
EXAMPLES
Example 1: Thrombospondin-1 and CD47 Limit Cell and Tissue Survival of Radiation Injury
[0261] Thrombospondin-1 is a potent antagonist of NO/cGMP signaling in ischemic soft tissues.
This example demonstrates that soft tissues in thrombospondin-1 null mice are remarkably
resistant to radiation injury. Twelve hours after 25 Gy hind limb irradiation, thrombospondin-1
null mice show significantly less cell death in muscle and bone marrow. Two months
following irradiation, skin and muscle units in the null mice show minimal histological
evidence of radiation injury and near full retention of mitochondrial function. Tissue
perfusion and acute vascular responses to NO are also preserved in irradiated thrombospondin-1
null hind limbs. The role of thrombospondin-1 in radiosensitization is specific in
that thrombospondin-2 null mice were not protected. However, mice lacking the thrombospondin-1
receptor CD47 showed similar radioresistance as thrombospondin-1 null mice. Thrombospondin-1-
and CD47-dependent radiosensitization is cell autonomous because vascular cells isolated
from the respective null mice showed dramatically increased survival and improved
proliferative capacity following irradiation
in vitro.
Introduction
[0262] Radiation remains a primary mode of cancer therapy, with one half of newly diagnosed
cancer patients receiving some form of radiation therapy. Free radicals generated
by ionizing radiation acutely damage cellular DNA and other cellular macromolecules,
eliciting stress responses that ultimately lead to cell death (
Chapman, Int J Radiant Biol 79:71-81, 2003). Because DNA damage compromises the ability of cells to undergo mitosis, the tissues
most sensitive to effects of radiation are generally those undergoing rapid proliferation.
Several mechanisms contribute to radiation-induced cell death, including mitotic death,
apoptosis, and cell cycle arrest. The mechanism and extent of cell death depend on
cell type, cell environment, and the radiation dose. Bystander effects of the direct
radiation damage can cause can lead to additional cell death through either direct
cell contact or release of intracellular mediators (
Prise et al., Lancet Oncol 6:520-528, 2005). Ultimately, radiation damage results in death of both cancer and normal cells.
Therefore, limiting toxicity to adjacent normal tissues restricts the therapeutic
dosage of radiation that can be delivered to a given tumor.
[0263] In addition to using 3-dimensional conformal radiation therapy to maximize radiation
delivery to tumor versus adjacent healthy tissues (
Purdy, Front Radiat Ther Oncol 40:18-39, 2007), a second approach to improve the therapeutic window for radiotherapy involves use
of chemical radiosensitizers or radioprotectants. General chemical radiosensitizers
or pathway-specific sensitizers (such as histone deacetylase inhibitors or inhibitors
of Ras signaling) have been used to increase the radio sensitivity of tumors (
Poggi et al., Curr Probl Cancer 25:334-411, 2001;
Karagiannis et al., Oncogene 25:3885-3893, 2006;
McKenna et al., Oncogene 22:5866-5875, 2003). Conversely, amifostine and nitroxides such as Tempol have demonstrated radioprotective
activities for adjacent tissues (
Poggi et al., Curr Probl Cancer 25:334-411, 2001;
Cotrim et al., Clin Cancer Res 13:4928-4933, 2007).
[0264] Tissues may also produce endogenous radioprotectants in response to radiation injury.
Nitric oxide (NO) is a primary regulator of mammalian physiology. Radiation increases
NO production in vascular cells, and NO can protect cells and tissues from radiation
damage by stimulating soluble guanylate cyclase (sGC) production of cGMP to promote
cell survival pathways and by several cGMP-independent effector pathways (
Freeman et al., Gut 53:214-221, 2004;
Leach J et al., J Biol Chem 277:15400-15406, 2002;
Zhong et al., Life Sci 74:3055-3063, 2004). Consistent with these studies, pretreatment of mice with exogenous NO prolongs
their survival following a lethal dose of whole body irradiation (
Liebmann et al., Cancer Res 54:3365-3368, 1994). However, studies using iNOS inducers and NOS inhibitors indicate that elevated
NO production can also contribute to radiation injury (
Ohta et al., Biol Pharm Bull 30:1102-1107, 2007). Furthermore,
NOS2 gene transfer into tumors increased their radiosensitivity (
Cook et al., Cancer Res 64:8015-8021, 2004), and
NOS1 null mice show increased radioresistance in bone marrow (
Epperly et al., Exp Hematol 235:137-145, 2007). These apparently conflicting observations could be rationalized if the effects
of NO on radiation injury are biphasic and the radioprotective activity of NO occurs
at low doses, which typically involve cGMP signaling.
[0265] It was recently reported that the matricellular protein, thrombospondin-1 (TSP1)
blocks NO-stimulated activation of sGC (
Isenberg et al., Proc Natl Acad Sci USA 102:13141-13146, 2005;
Isenberg et al., Cardiovasc Res 71:785-793, 2006) and that this process requires engagement of the cell surface receptor CD47 (
Isenberg et al., J Biol Chem 281:26069-26080, 2006). Targeting TSP1 or CD47 enhances ischemic tissue survival and blood flow (
Isenberg et al., Arterioscler Thromb Vasc Biol 27:2582-2588, 2007;
Isenberg et al., Blood 109:1945-1952, 2007;
Isenberg et al., Circ Res 100:712-720, 2007). CD47 engagement may also induce apoptosis of some cell types independent of NO
(
Manna et al., J Biol Chem 280:29637-29644, 2005;
Bras et al., Mol Cell Biol 27:7073-7088, 2007). In view of these studies, we hypothesized that inhibition of NO signaling by TSP1
might limit the radioprotective activity of NO. We tested this hypothesis using TSP1
and CD47 null mice and demonstrate here that the absence of these proteins significantly
improves tissue survival of radiation. Furthermore, we demonstrate that the radiosensitizing
activity of TSP1 signaling via CD47 is cell autonomous.
Materials and Methods
[0266] Animals: Wild type, TSP1 null, and CD47 null mice in C57BL/6 background were housed in a pathogen
free environment and had ad libitum access to standard rat chow and water. TSP2 null
male mice 12 weeks of age and matched wild type B6129sf1/J control animals were obtained
from Jackson Labs (Bar Harbor, ME). Care and handling of animals was in compliance
with standards established by the Animal Use and Care Committee of the National Cancer
Institute.
[0267] Reagents and cells: Primary murine vascular endothelial cells were harvested from wild type, TSP1, CD47
and TSP2 null mice and cultured as previously described in endothelial growth media
(Lonza, Switzerland) (
Isenberg et al., Proc Natl Acad Sci U S A 102:13141-13146, 2005). Murine B16F10 melanoma cells were kindly provided by Dr. Lyuba Varticovski (NCI)
and grown in RPMI with 10% FCS (Gibco, Grand Island, NY).
[0268] Irradiation of mice: Age and sex matched wild type, TSP1, CD47 and TSP2 null mice underwent local irradiation
to the right hind limb as previously described (
Flanders et al., Am J Pathol 160:1057-1068, 2002). Briefly animals (without anesthetics) were placed in customized Lucite jigs that
allow for immobilization and selective irradiation of the leg. A single radiation
dose of 25 Gy was delivered by a Therapax DXT300 X-ray irradiator (Pantak, Inc., East
Haven, CT) using 2.0-mm Al filtration (300 kVp) at a dose rate of 2.53 Gy/min. Care
was taken to avoid irradiation of other body parts by using lead shields specifically
designed as a part of the jigs. After irradiation, the animals were placed in cages
as indicated above and observed daily for 8 weeks at which time animals were euthanized
and tissues fixed in formalin 10% for further analysis.
[0269] In other experiments, mice receiving 25 Gy to the hind limb were euthanized 12 hours
later and hind limbs fixed in 10% formalin. Unstained tissue sections were prepared
on charged slides from paraffin embedded hind limbs for in situ analysis of apoptosis
as described.
[0270] Radiation growth delay assay: C57BL/6 wild type and TSP1 null 12 week old female mice were inoculated with syngeneic
B6F10 melanoma cells (2.5 x 10
6 cells/animal) to the right lateral thigh. When tumor volume reached 200 mm
3 half of each group underwent 10 Gy irradiation to the tumor-bearing limb. Tumor size
was measured with calipers bi-weekly by the same investigator. Tumor volume was calculated
by the formula: volume =
W2 x
L/
2, where
W = shortest diameter and
L = longest diameter. Animals were sacrificed if tumors exceeded 2 cm
3 or at 26 days. Results are from 16 animals, 8 of each strain.
[0271] Irradiation of cells: Primary murine lung derived endothelial cells were plated in standard growth medium
in 96- or 6-well culture plates (Nunc) and allowed to adhere. Irradiation was done
on a Precision X-Ray X-Rad 320 (East Haven, CT) operating at 300 kV/10 mA with a 2
mm aluminum filter. The dose rate at 50 cm from the x-ray source was 242 cGy/minute,
as determined by multiple thermoluminescent dosimeter readings.
[0272] Skin reaction: Skin reaction following hind limb irradiation was quantified every week following
treatment for 8 weeks using a previously described grading system (
Flanders et al., Am J Pathol 163:2247-2257, 2003). The grading system consisted of 5 categories: normal, hair loss, erythema, dry
desquamation and moist desquamation/ulceration.
[0273] Leg contraction assay: Measurement of hind limb extension was performed as previously described with modification
(
Flanders et al., Am J Pathol 160: 1057-1068, 2002). Animals were placed under light general anesthesia with 1% isoflurane via nose
cone, and the pelvis was immobilized against a post fixed to the examination table.
The treated and untreated limbs were then placed individually under a defined degree
of tension and the distance of extension measured.
[0274] Blood oxygen level dependent (BOLD) MRI imaging: MRI images were acquired using a Bruker Biospin 4.7 T scanner and isoflurane anesthesia.
Muscle tissue scanned was at rest, so alterations in oxygenation reflected changes
in perfusion rather than in oxygen consumption. MR measurements were started after
the mouse's body temperature reached 37 °C. Prior to the experiments, gradient echo
based T
1 sequence was used to determine the target slice location. A series of T
2* weighted gradient echo BOLD image data sets at transverse to the midpoint of the
femur were repeatedly acquired for 30 min to monitor temporal changes in blood oxygenation
and blood flow. Diethylamine-NONOate (DEA/NO, 100 nmol/g body weight) was injected
with saline via the rectal cannula 5.0 min after starting the scan. Imaging parameters
used were: TR = 450 ms, Flip angle = 45, Nex = 1, slice thickness = 2 mm, matrix size
= 64 x 64, total imaging time for the series was 29 min.
[0275] Laser Doppler analysis: Hind limb flow was measured using laser Doppler imaging (MoorLD1-2λ, Moor Instruments,
Devon, England). Briefly, animals were placed in a supine position on a heating pad,
and anesthesia was provided by 1% inhalation isoflurane in a 50:50 mixture of oxygen
to room air. Core temperature was monitored by rectal probe and was further controlled
with a heat lamp. The hair of the ventral surface of the anterior abdominal wall or
respective hind limb was clipped and depiliated with Nare™ and a region of interest
(ROI) marked. After equilibration to the experimental set-up baseline, hind limb blood
flow was measured. The following instrument settings were used: override distance
21 cm; scan time 4 msec/pixel. Results are expressed as the change percent control
from baseline of the ROI.
[0276] Mitochondrial DNA analysis: Primer sequences were derived using FastPCR (accessible on the World Wide Web at
primerdigital.com/index.php?page=35) and were chosen to amplify approximately 100
bp regions of unique genomic and mitochondrial genes using quantitative PCR. DNA was
quantified by measuring fluorescent intensity using Taq polymerase amplification in
a SYBR green reaction mixture (Thermo Fisher Scientific) with an MJ Research Opticon
I instrument (Biorad, Herecules, CA). Data were processed using the Opticon I software
supplied with the instrument. Melting curve analysis was performed for each sample
to insure a single product was produced in each reaction. The cycling parameters consisted
of an initial denaturation at 95 °C for 15 min, followed by 40 cycles of denaturation
at 94 °C and annealing at 60 °C for 20 sec each with extension for 30 sec at 72 °C,
ending with a final extension at 72 °C for 10 min. Melting temperatures were determined
in 0.2 °C steps from 60 to 95 °C with a dwell time of 8 sec. Gene copy number was
assessed using 2-fold dilutions of genomic DNA samples from mouse muscle tissue samples.
Samples were normalized using
PKD1 as an internal control standard. The gene identification numbers are listed followed
by the coordinates of the first gene primer.
PKD1 polycystin 1 NT_039649.6 (nuclear), 0917160
ACCGACTCAACCAGGCCACAG (SEQ ID NO: 6),
GGAGGTCCATTGTGCCCATGG (SEQ ID NO: 7);
GTF2IRD1 General transcription factor, NT_039314 (nuclear), 4559250
AGGGACCGCCTCCACAAGCTG (SEQ ID NO: 8),
TCTCCGTGCAGGAACTGGCTG (SEQ ID NO: 9);
Osteocalcin NM_001032298.2 (nuclear), 255 ACCCTGCTTGTGACG (SEQ ID NO: 10), GCTTTAGGGCAGCACAGGTCC
(SEQ ID NO: 11);
NADH6 NC_005089.1 (mitochondrial), 13587 CCGCAAACAAAGATCACCCAG (SEQ ID NO: 12), GTTGGAGTTATGTTGGAAGGAGG
(SEQ ID NO: 13); and
6S rRNA NC_005089.1 (mitochondrial) 1432, GCTTGGTGATAGCTGGTTACC (SEQ ID NO: 14), TCCGTTCCAGAAGAGCTGTCC
(SEQ ID NO: 15).
[0277] Cell survival assay: Wild type, TSP1 null and CD47 null or TSP2 null and wild type B6129sf1/J lung derived
endothelial cells were resuspended in EGM medium and seeded into 96-well plates (Nunc,
Denmark) at a density of 5x10
3 cells/200 µl per well and incubated for 24 hours at 37° C. Cells were then exposed
to a single dose of gamma radiation (0, 10, 20, 30, and 40 Gray) and allowed to incubate
another 72 hours at 37 °C. Cell viability was determined with the CellTiter 96 AQueous
One Solution Cell Proliferation Assay (Promega, Madison, WI, USA) as per the manufacture's
instructions and absorbance at 490 nm determined using an MR580 Microelisa Auto Reader
(Dynatech, Alexandria, VA).
[0278] Cell proliferation assay: Proliferation was assessed by quantifying incorporation of bromodeoxyuridine (BrdU)
into newly synthesized DNA using a BrdU Cell Proliferation Assay (Calbiochem, La Jolla,
CA). Primary murine wild type, TSP1, TSP2, and CD47 null lung endothelial cells were
seeded into 96 well plates at 5x10
4 cells/well density. After 24 hours incubation at 37 °C treatment groups were irradiated
at 40 Gy. Control and irradiated plates were assayed for BrdU uptake over 24 hours
starting at 48 to 168 hours post-radiation. The assay was performed according to the
manufacturer's protocol, and the plates were read at 420 nm.
[0279] Mitochondrial viability assay: Mitochondrial viability of hind limb muscle biopsies was assessed by the reduction
of a tetrazolium salt to water insoluble formazan through mitochondrial oxidation
as described (
Isenberg et al., Blood 109:1945-1952, 2007). Results were expressed as absorbance normalized to dry tissue weight.
[0280] Tissue apoptosis: The ApopTag
in situ detection kit (Chemicon, Millipore, MA) was employed following the manufacturer's
recommendations In brief, sections undergo deparaffinization, rehydration and washing,
followed by treatment with 20 µg/ml of proteinase K for 15 minutes at room temperature
and repeat washing. Endogenous peroxidase activity was quenched with 3% H
2O
2 in PBS for 5 minutes. The 3'-hydroxy DNA strand breaks were enzymatically labeled
with digoxygenin nucleotide via TdT and incubated for 1 hour at 37°C, and the reaction
terminated with a stop buffer. Sections were then incubated with anti-digoxygenin
peroxidase for 30 minutes at room temperature, washed, stained with 3-3' diaminobenzidine
substrate, counterstained with methyl green and mounted. Positive and negative control
slides provided with the kit are used in each assay to insure consistency.
[0281] Histology: Tissue units were excised, fixed in 10% buffered formaldehyde, paraffin embedded,
and sectioned at a thickness of 5 µm. Sections were then stained with hematoxylin
and eosin (H&E). Review of each slide was performed by an independent pathologist
blinded to the origin of each tissue slide.
[0282] Immunohistochemistry: Paraffin embedded hind limbs were sectioned at a thickness of 5 µm and applied to
charged glass slides and processed for immunohistology. Tissue sections were deparaffinized
with xylene and rehydrated in alcohol. Slides were then heat inactivated in 10 mmol/L
sodium citrate (pH 6.0) in a microwave for 5 minutes. Cooled slides were rinsed with
PBS and then incubated with 3% H
2O
2 for 30 minutes at room temperature. Sections were then blocked with 5% normal goat
serum in PBS for 30 minutes at room temperature followed by 12 hour incubation in
a humidified chamber at 37 °C with a monoclonal CD31 antibody (clone JC70A, DakoCytomation,
Denmark) at a 1:40 dilution. Slides were washed and then incubated with secondary
antibody, washed and incubated in pre-diluted Streptavidin-HRP conjugate (BD PharMingen).
Color was developed by DAB substrate kit (BD PharMingen).
[0283] Statistics: All experiments were replicated at least three times. Results are presented as the
mean ± SD with analysis of significance done by the Student's
t test or one-way ANOVA with Tukey post hoc test where indicated using Origin software
(version 7, OriginLabs Corp., Northhampton, MA), with significance taken at
p values < 0.05.
Results
TSP1 and CD47 null mice show tissue preservation following radiation injury.
[0284] Previous studies identified a role for TSP1 in inducing developmental hair loss during
the catagen phase (
Yano K et al., J Invest Dermatol 120:14-19, 2003). Extending this observation to radiation alopecia, we observed less hair loss 8
weeks post-treatment on the irradiated hind limbs of TSP1 null mice compared to age
and sex matched wild type mice (Figure 1A). An even more dramatic preservation of
hair viability was observed for the hind limbs of irradiated CD47 null mice. Moreover,
irradiated skin on the-treated null mice showed minimal to no skin ulceration or wet
desquamation (Figure 1A). When scored using the grading system of Flanders (
Flanders et al., Am J Pathol 160:1057-1068, 2002;
Flanders et al., Am J Pathol 163:2247-2257, 2003), wild type animals demonstrated both accelerated skin changes and more substantial
final changes in skin phenotype compared to null animals (Figure 1B). Histologically,
hair follicles and skin architecture were better preserved 8 weeks post-irradiation
in TSP1 nulls and essentially normal in the CD47 nulls (Figure 1C).
[0285] Remarkably, tissue preservation in the irradiated null mice also extended to the
underlying skeletal muscle. H&E stained sections of irradiated wild type muscle showed
significant loss of muscle fibers and nuclei, but these were largely intact in irradiated
tissue sections from TSP1 and CD47 null animals (Figure 1C). Mitochondrial viability
in irradiated muscle tissue was assessed by tetrazolium salt reduction (Figure 1D).
In contrast to the expected loss of mitochondrial viability in irradiated wild type
muscle, mitochondrial viability assessed 8 weeks post irradiation was significantly
greater in muscle biopsies from irradiated hind limbs in both TSP1 and CD47 null mice,
with no significant difference between the irradiated and control limbs in these mice
(Figure 1D).
[0286] This preservation of mitochondrial function in the TSP1 null mice occurred despite
the expected substantial loss in copy number for two mitochondrial genes (
NADH6 and
16S mtRNA) compared to that for two nuclear genes in the irradiated tissue as expected due
to the relatively inefficient DNA repair processes in mitochondria (
Prithivirajsingh et al., FEBS Lett 571:227-232, 2004). Selective loss of the mitochondrial genes was similar in the TSP1 nulls (Figure
1E), indicating that TSP1 has no effect on the level of immediate DNA damage caused
by radiation or on the subsequent level of mitochondrial DNA repair.
Thrombospondin-2 is not a radiosensitizer
[0287] In contrast to the TSP1 null mice, TSP2 null mice in a B6129sf1/J background demonstrated
significant hair loss and skin damage following radiation at the gross tissue level.
Recovery from irradiation did not differ between the TSP2 null and wild type mice
in the same background over the 8 week period studied (Figure 2A). Mitochondrial viability
in irradiated muscle tissue was assessed by tetrazolium salt reduction and demonstrated
a comparable decrease in viability between wild type and TSP2 null muscle samples
(Figure 2). H&E stained sections from irradiated wild type and TSP2 null hind limbs
showed comparable levels of muscle fiber and nuclei loss, and no tendency towards
vascular remodeling was found in TSP2 null irradiated hind limbs.
TSP1 and CD47 null mice demonstrate enhanced leg extension following radiation injury.
[0288] In addition to demonstrating significant resistance to cutaneous injury following
radiation, irradiated hind limbs of TSP1 and CD47 null animals did not show any atrophy
at 8 weeks. Rather, there was a tendency towards hypertrophy of the limb soft tissues
and vascular elements as compared to irradiated limbs in wild type animals and control
non-irradiated limbs (Figure 3). TSP2 null hind limbs did not show hypertrophy. Limb
flexibility, quantified as the maximum degree of limb lengthening, was preserved in
TSP1 and CD47 null hind limbs 8 weeks after 25 Gy of radiation (Figure 4). In contrast,
wild type limbs demonstrated the expected loss of extension.
TSP1 and CD47 limit radiation-induced alterations in vascular response.
[0289] Two months after 25 Gy irradiation of the right hind limb, blood flow responses in
both hind limbs were assessed using BOLD MRI following challenge with a rapidly releasing
NO donor (1 µl/g animal weight of 100 mM DEA/NO, Figure 5A). The irradiated hind limbs
in wild type animals demonstrated an exaggerated overall increase in blood flow compared
to the untreated hind limb. In contrast, the blood flow responses integrated over
the irradiated and untreated hind limbs were essentially identical for the first 15
minutes in TSP1 null animals, demonstrating protection from the effects of radiation
injury on vascular responsiveness. Multislice multiecho (MSME) and T2 weighted images
confirmed significant tissue changes and injury in wild type irradiated hind limbs
(Figure 5B). These changes were markedly less in irradiated TSP1 null limbs.
[0290] Analysis of areas in the hind limbs exhibiting positive and negative BOLD signals
further emphasized the preservation of normal vascular responses in irradiated TSP1
null hind limbs (Figure 6A, 6B). Areas with both positive and negative BOLD signals
in irradiated limbs showed more exaggerated responses to NO than corresponding areas
in control limbs of wild type mice. The corresponding areas in irradiated TSP1 null
hind limbs resembled those of the untreated limb, confirming the preservation of normal
vascular responsiveness despite radiation injury.
[0291] We further examined global vascular perfusion in irradiated hind limbs using laser
Doppler imaging (Figure 7). Two months following irradiation, perfusion responses
were assessed over 45 minutes following administration of DEA/NO (1 µl/gram body weight
of a 100 mM stock solution, Figure 8A). Blood flow in the irradiated limb increased
modestly in the irradiated limb of wild type mice, but significantly greater increases
in response to vasoactive challenge were found in TSP1 and CD47 null mice.
[0292] Tissue blood flow is dependent directly upon vascular density and increased vascularity
could afford a protective advantage following tissue injury. Localized differences
in organ vascularity have been reported between wild type and TSP1 or TSP2 null mice.
Enhanced dermal vascularity was noted in TSP1 null pups compared to wild type (
Crawford et al., Cell 93:1159-1170, 1998). However, similar aged pups showed no difference in retinal vascularity until stressed
by hyperoxia-induced ischemia (
Wang et al., Dev Dyn 228:630-642, 2003). In dermal wound healing, wild type and TSP1 null tissue sections demonstrated comparable
vascularity (
Bornstein et al., Int. J. Biochem. Cell Biol. 36:1115-1125, 2004), in contrast to TSP2 null tissue sections which showed enhanced vessel density.
Furthermore, in contrast analysis of several visceral organs in wild type and TSP1
null mice failed to demonstrate significant vascular differences (
Lawler et al., J. Clin Invest. 101:982-992, 1998). Quantification of vascular elements in cutaneous units from age and sex matched
C57 BL/6 wild type, TSP1 and CD47 null and B6129sfJ and TSP2 null mice failed to document
any significant difference in vessel count (Figure 8B). Similarly, immunohistochemical
analysis of CD31
+ vessels in paraffin-embedded hind limb demonstrated no significant differences between
wild type, TSP1 null, and CD47 null mice.
Irradiated hind limbs in null mice experience minimal apoptosis.
[0293] To assess the effects of TSP1 and CD47 on radiation-induced apoptosis
in vivo, in situ staining of limb sections to detect DNA fragmentation was performed on age and sex
matched wild type and null mice that received 25 Gy to the hind limb. Consistent with
previous studies (
Mazur et al., Cell Biol Toxicol 19:13-27, 2003), time course experiments in wild type animals demonstrated maximal tissue staining
at 12 hours. In contrast, immunohistology of TSP1 and CD47 null limbs post-radiation
demonstrated minimal to no evidence of apoptosis either in the skeletal musculature
or the bone marrow (Figure 9).
Endogenous TSP1 and CD47 regulate radiation-induced death of vascular cells in vitro.
[0294] Improved hind limb survival in TSP1 and CD47 null mice could result from an intrinsic
resistance of cells in the null tissue to irradiation or from a diminished inflammatory
response in the nulls that permits better repair of the radiation injury. To differentiate
these two hypotheses, we assessed the intrinsic radiation sensitivity of primary vascular
cells cultured from each strain. Several studies have reported that vascular endothelial
cells are highly radiosensitive and so may limit hind limb survival of irradiation
(
Rodemann & Blaese, Semin Radiat Oncol 17:81-88, 2002).
[0295] Primary endothelial cells from lungs of wild type, TSP1, and CD47 null mice were
irradiated, and mitochondrial viability was determined by MTT assay 72 hours following
injury. Wild type cells demonstrated radiation dose-dependent cell death that resembled
that of human cells (Figure 10A). In contrast, doses up to 40 Gy failed to induce
significant cell death in TSP1 and CD47 null cells.
[0296] Chronic pulmonary inflammation has been reported in TSP1 null mice (
Lawler et al., J Clin Invest 101:982-992, 1998) and the resulting inflammatory mediators could potentially alter the radiation sensitivity
of endothelial cells harvested from this organ. However, the 12 week old sex matched
mice used in the present study demonstrated no evidence of lung inflammation in any
strain based on histologic analysis of H&E sections (Figure 10B). Radioprotection
in primary cells was specific for loss of TSP1 in that primary TSP2 null endothelial
cells were not protected after irradiation (Figure 10C).
TSP1 limits endothelial cell proliferation post-irradiation.
[0297] Although the above results show that ablation of TSP1 or CD47 permits cell survival
following 40 Gy (ir)radiation, it was not clear that these cells maintain the ability
to proliferate. To assess this, we examined cellular incorporation of bromodeoxyuridine
(BrdU) into DNA. Consistent with their limited proliferative capacity in tissue culture,
untreated wild type murine lung endothelial cells showed diminished BrdU uptake with
time, and 40 Gy irradiation further diminished their DNA synthesis. As previously
published, TSP1 null cells have an enhanced proliferative capacity (
Isenberg et al., Proc Natl Acad Sci U S A 102:13141-13146, 2005), but irradiation of these cells did not significantly decrease DNA synthesis over
the 7 day time period studied (Figure 10D). Therefore, in addition to promoting survival,
the absence of TSP1 permits continued growth of irradiated vascular cells.
Absence of endogenous TSP1 does not limit tumor response to radiation.
[0298] Expression of TSP1 by tumor cells is known to limit tumor angiogenesis and growth
(Weinstat-
Saslow et al., Cancer Res. 54:6504-6511, 1994), but not acute blood flow (
Isenberg et al., Neoplasia 10:886-896, 2008. Conversely, host TSP1 expression can limit B16 tumor growth by inhibiting angiogenesis
(
Lawler et al., Am. J. Pathol 159:1949-1956, 2001). Because pretreatment with exogenous TSP1 enhanced the response of a human melanoma
xenograft to radiation (
Rofstad et al., Cancer Res. 63:4055-5061, 2003), we examined whether endogenous host TSP1 could similarly serve as a radiosensitizer.
Syngenic B16F10 melanoma cells were implanted into the hind limbs of age and sex matched
wild type and TSP1 null mice. B16 melanoma cells express very low levels of TSP1 mRNA,
and TSP1 protein was reported to be below detectable levels (
Culp et al., Mol Cancer Res. 5:1225-1231, 2007). When the tumors obtained a volume of 200 mm
3, half of the mice of each strain received 10 Gy radiation to the tumor bearing hind
limb. Tumors in both wild type (Figure 10E) and TSP1 null (Figure 10F) animals demonstrated
a significant growth delay following radiation. The delay was somewhat longer in the
null, suggesting that therapies to protect normal tissue by blocking TSP1/CD47 signaling
would not impair radiotherapy of the tumor. As demonstrated in Example 4, the increased
growth delay in null, radioprotected animals is predictive of the growth delay observed
in animals treated with a CD47 targeting morpholino prior to irradiation.
Discussion
[0299] Off target damage to non-cancerous tissues and vital organs remains one of the primary
limitations for applying radiation therapy to treat cancer. One effort to enhance
the therapeutic potential for radiotherapy while minimizing its complications has
centered upon developing radioprotectants. We herein identify TSP1 and CD47 as limiting
components of a cell-autonomous signaling pathway that controls tissue survival following
high dose irradiation. The therapeutic potential of this pathway are substantial.
Targeting this pathway may enhance the therapeutic window for radiotherapy of cancer
by radioprotection of healthy tissue. Agents that block this radiosensitization pathway
could also be valuable to limit the toxic effects of accidental radiation exposure.
[0300] Radiation-induced tissue damage and vascular dysregulation was evident in irradiated
wild type and TSP2 null hind limbs, but minimal in irradiated TSP1 null and CD47 null
hind limbs. Enhanced cell survival and proliferation correlated with tissue preservation
at the gross and microscopic levels in both TSP1 and CD47 null animals, an advantage
also not realized in irradiated TSP2 null mice. Tissue preservation translated into
improved functional status 8 weeks post-irradiation. Functional benefits to the irradiated
tissue beds included decreased hair loss, cutaneous desquamation and ulceration, tissue
contracture, and ischemia. These long term benefits appear to result from an acute
survival advantage of the null genotypes, because both tissue and bone marrow apoptosis
were drastically reduced in the null mice within one day following the radiation injury.
In the absence of TSP1/CD47 signaling, vascular cells cultured from the respective
null mice showed enhanced cell survival and proliferative capacity following radiation
injury, demonstrating that this acute radioprotection of vascular cells is cell-autonomous.
[0301] Damage to DNA is an immediate and universal effect of radiation. As expected, endogenous
TSP1 does not prevent this immediate damage as assessed by similar loss of mitochondrial
DNA in wild type and null irradiated tissue. DNA damage in turn initiates both cell
repair pathways and cell death via p53-dependent and p53-independent mechanisms. Because
TSP1 signaling via CD47 is known to induce caspase-independent type III cell death
in leukocytes (
Bras et al., Mol Cell Biol 27:7073-7088, 2007), the absence of TSP1 or CD47 may prevent radiation-induced cell death through a
similar mechanism. This combined with enhancement of pro-survival NO/cGMP signaling
could account for the cell-autonomous radioprotection of the null vascular cells.
[0302] The protection from radiation-induced damage
in vivo, however, probably involves additional functions of TSP1 and CD47. CD47 is required
for leukocyte recruitment (
Lindberg et al., Science 274:795-798, 1996), and TSP1 is also known to stimulate T cell migration (
Li et al., J Cell Biol 157:509-519, 2002). Therefore, TSP1 and CD47 null mice also may benefit from decreased leukocyte recruitment
during the acute response to radiation injury. Moreover, as suggested in Example 5,
radioprotection conferred by blocking the TSP1/CD47 interaction is largely independent
of NO/cGMP signaling.
[0303] Endothelial cells are exquisitely sensitive to radiation induced cell death through
the induction of several mediators of apoptosis (
Rodemann & Blaese, Semin Radiat Oncol 17:81-88, 2002). Within 24 hours of irradiation, damaged capillaries demonstrate leukocyte attachment,
endothelial cell swelling, thrombosis with complete loss of capillary networks, and
secondary ischemia. Even vessels that remain patent undergo long term thickening of
the basement membrane and soft tissue scarring. This late effect is driven by activation
of fibroblasts by radiation through the terminal differentiation of progenitor cells
into post-mitotic fibrocytes and elevated production of collagen by the same (
Rodemann & Blaese, Semin Radiat Oncol 17:81-88, 2002;
Brush et al., Semin Radiat Oncol 17:121-130, 2007). These processes depend on TGFβ, and TSP1 is a mediator of latent TGFβ activation
(
Murphy-Ullrich & Poczatek, Cytokine Growth Factor Rev 11:59-69, 2000) and TGFβ-dependent fibrosis (
Belmadani et al., Am J Pathol 171:777-789, 2007). Deletion of
Smad3 in mice is protective for radiation-induced fibrosis by blocking TGFβ signaling (
Flanders et al., Am J Pathol 160:1057-1068, 2002). Thus, TSP1 null mice may be partially protected from the long term fibrotic response
to radiation, but this does not explain the immediate protection of the TSP1 null,
and we would not expect CD47 null mice to share this TGFβ-dependent benefit.
[0304] Although TSP1 and CD47 null endothelial cells and mice show a dramatic resistance
to radiation, TSP2 null cells and mice showed no significant protection against radiation-induced
cell death or tissue damage. This was surprising because TSP1 and TSP2 share a number
of cellular receptors, and both are potent angiogenesis inhibitors. TSP2 was inferred
to interact with CD47 based on conservation of a CD47-binding peptide sequence identified
in TSP1 and a shared immune phenotype of TSP1 and TSP2 null mice (
Gao et al., J Biol Chem 271:21-24, 1996;
Lamy et al., J Immunol 178:5930-5939, 2007). However, uncertainties concerning structural basis for TSP1-CD47 interaction raise
questions about whether TSP2 also interacts with this receptor (
Carlson et al., Cell Mol Life Sci 65:672-686, 2008). Lack of radioprotection in the TSP2 null could arise either from lack of TSP2 binding
to CD47 or lack of significant TSP2 expression at an appropriate time following radiation
injury.
[0305] Deletion of several other genes in transgenic mice has been associated with increased
(
Nos1, Smad3, Chk2, p53) or decreased (
cKit, p53) radioresistance of bone marrow or intestinal crypt cells to whole body irradiation
or to irradiation of cells
in vitro (
Epperly et al., Exp Hematol 235:137-145, 2007;
Komarova et al., Oncogene 23:3265-3271, 2004;
Epperly et al., Radiat Res 165:671-677, 2006;
Takai et al., Embo J 21:5195-5205, 2002). However, less attention has been given to identifying genes that modulate the radiosensitivity
of skin and other soft tissues that can be dose-limiting for radiotherapy of tumors
and complicate post-irradiation reconstructive surgery.
[0306] Thbs1 or
CD47 deletion dramatically improves hind limb resistance to high dose irradiation and
vascular cell survival of irradiation
in vitro. This suggests that strategies to prevent TSP1/CD47 interaction or to suppress expression
of either protein can enhance the radioresistance of soft tissues. Our studies in
TSP1 null mice suggest that tumors in these mice retain their sensitivity to radiation.
Therefore, TSP1/CD47 antagonists may have selective radioprotective activity for normal
tissues.
Example 2: In vitro Characterization of Radioprotectant Agents
[0307] This example describes a series of experiments characterizing the radioprotective
activities of agents that inhibit the interaction of thrombospondin-1 (TSP1) and CD47,
using
in vitro, cell-based assays.
Methods
[0308] Unless otherwise noted, methods are as described above.
[0309] Reagents and cells. Human umbilical vein endothelial cells (HUVEC) were cultured in endothelial basal
medium supplemented with the manufacturer's additives and 2% fetal calf serum (FCS)
in 5% CO
2 at 37° C (Lonza, Switzerland). A CD47 targeting morpholino oligonucleotide (SEQ ID
NO: 4) and mismatched control morpholino SEQ ID NO: 5, and a CD36 targeting morpholino
(SEQ ID NO: 16) and a 4 base mismatched control were purchased from GeneTools, LLC
(Philomath, Oregon). The CD47 targeting morpholino blocks translation of both murine
and human CD47 mRNAs. Mouse monoclonal antibodies recognizing human CD47 (B6H12) and
murine or human TSPI (A6.1) were purchased from Abcam (Cambridge, MA). The TSP1-derived
CD47 binding peptide FIRVVMYEGKK (7N3) (SEQ ID NO: 2) was synthesized by Peptides
International (Louisville, KY). A control peptide FIRGGMYEGKK (604) SEQ ID NO: 3)
was synthesized by the late Dr. Henry Krutzsch (NCI, NIH) (
Barazi et al., J. Biol Chem 277:42859-42866, 2002).
[0310] Cell Viability Assay. HUVEC were plated at a density of 5000 cells/well in 96 well plates (Nunc), and were
treated 24 hours later with either the indicated doses of a CD47 antibody (B6H12),
a TSP1 antibody (A6.1), the CD47-binding peptide 7N3, or control peptide 604. One
hour later the cells were exposed to a single dose of gamma radiation (0, 10, 20,
30, and 40 Gy) and allowed to incubate another 72 hours at 37°C. Experiments done
with B16F10 melanoma cells in Example 4 were done in a similar manner treating either
1 hour prior to a single dose of radiation (10 Gy) with peptide 7N3 or 48 hours prior
with CD47 morpholino. Cell viability was determined using the CellTiter 96 Aqueous
One Solution cell proliferation assay (Promega, Madison, WI) as per the manufacturer's
instructions and absorbance at 490 nm was determined using an MR580 Microelisa AutoReader
(Dynatech, Alexandria, VA). The same assay was performed on HUVEC using either the
CD47 or CD36 morpholino, but 48 hours were allowed to pass prior to radiation (0 or
40 Gy) to allow for suppression of the target proteins. Similarly, control experiments
were performed using the nitric oxide synthase (NOS) inhibitor L-NAME, a membrane
permeable cGMP analogue, 8-Bromo cGMP, or the NO donor DETA/NO.
Results
Radioprotection of human endothelial cells by targeting TSP1 or CD47.
[0311] As disclosed above, hind limbs of TSP1 and CD47 null animals are resistant to tissue
damage from high dose radiation. Vascular cells in culture from the null mice are
also profoundly radioresistant, demonstrating that this effect is cell autonomous.
Thus, it was investigated whether therapeutic targeting of TSP1 or CD47 could confer
protection from ionizing radiation (IR) using human vascular cells that express both
TSP1 and CD47. HUVEC treated with an antibody to TSP1 (clone A6.1) or its receptor
CD47 (clone B6H12) provided dramatic protection in HUVEC, with treated cells displaying
preservation of mitochondrial function at up to 40 Gy (Figure 11A, B). A CD47 binding
peptide (7N3) was less efficacious (Figure 11C) but at higher radiation doses still
enhanced cell survival post-irradiation relative to the control peptide 604 (Figure
11 D). Previous reports had shown that suppression of CD47 alone in cells and tissues
is sufficient to enhance physiologic NO signaling and confer tissue protection to
ischemia (
Isenberg et al., Ann Surg 247:180-190, 2008). Similarly, an antisense CD47 morpholino rendered HUVEC resistant to radiation-driven
cell death when compared to untreated, missense and endoporter controls (Figure 11E,
P < 0.05). This radioprotective effect is specific to TSP1 since HUVEC that were treated
with an antisense morpholino specific for the TSP1 receptor CD36 showed a decrease
in cellular viability similar to that of untreated cells and cells treated with the
corresponding mismatched control morpholino (Figure 11F).
Peptides 7N3 and C6d convey radioprotection to HUVEC in culture
[0312] In an additional experiment to test the effect of radioprotective peptides, human
umbilical vein endothelial cells (HUVEC) grown in EGM medium in 96-well plates were
treated with graded doses of a peptide agent, as indicated. One hour later, cells
were exposed to a single dose of gamma radiation (0, 10, 20, 30, and 40 Gray) and
allowed to incubate 72 hours at 37 °C. Cell viability was determined with the CellTiter
96 AQueous One Solution Cell Proliferation Assay. A protective effect against increasing
doses of radiation can be seen with both 7N3 (Figure 12A) as well as C6d (Figure 12B)
peptides when compared to virtually no protection provided by the control peptide
604 (Figure 12C).
Peptide 7N3 is radioprotective to HAVSMC in culture
[0313] Human aortic smooth muscle cells (HAVSMC) were also subjected to the same cell viability
assay as above. HAVSMC have been shown to be more radioresistant therefore greater
doses of radiation were used in this assay. Again, the peptide 7N3 showed a profound
radioprotective protective effect even at very high doses of radiation (Figure 13).
TSP1/CD47 Inhibition maintains proliferative capacity in irradiated endothelial cells
[0314] Tissue health requires the ability to repair and replace damaged structures through
cell proliferation. Proliferative capacities are typically lost in normal tissues
following radiation injury. We therefore determined whether therapeutic targeting
of TSP1/CD47 preserved the proliferative capabilities of human vascular cells. DNA
synthesis in untreated cells progressively decreased over 1 week following irradiation
(Figure 14A). Pretreatment using a CD47 morpholino, but not with vehicle or a mismatched
control morpholino, maintained proliferation in cells exposed to 10 Gy of radiation
over the same time period (Figure 14A,
P < 0.05). However, this is not seen after treatment with a CD36 morpholino, demonstrating
that this effect is CD47-specific. Enhanced DNA synthesis was also seen under the
same conditions using antibodies against either TSPI or CD47 (Figure 14B,
P < 0.05).
[0315] Proliferative capacities were also determined in endothelial cells exposed to high
doses of radiation of 40 Gy. HUVEC were seeded into 96 well plates for 24 hours at
37° C, then treated with either antibody A6.1 or B6H12 or peptide 7N3. The treated
cells were irradiated at 40 Gy 1 hour later. Control and irradiated plates were assayed
for BrdU uptake over 96 hours post-radiation. The assay was performed according to
the manufacturer's protocol, and the plates were read at 420 nm.
[0316] Consistent with their limited viability post-radiation in tissue culture, untreated
HUVEC showed diminished BrdU uptake with time, and 40 Gy irradiation further diminished
their DNA synthesis (Figure 15). In contrast, TSP1-CD47 targeting therapies conferred
enhanced proliferative capacity to primary vascular cells post-radiation (Figure 15).
These results show that not only are the treated cells viable but proliferating at
a better rate than untreated cells. Taken together, the results of the cellular proliferation
assays were consistent with the observations described in Example 1 that primary murine
TSP1 and CD47-null vascular cells maintain their proliferative capacity even after
high doses of irradiation (40 Gy).
Example 3: In vivo Characterization of Radioprotectant Agents
[0317] This example describes characterization of the radioprotective
in vivo activities of agents that inhibit the interaction of thrombospondin-1 (TSP1) and
CD47. These results demonstrate that temporary suppression of CD47 expression can
protect normal tissues from damage by IR. This protection is observed in skin, muscle,
and bone marrow of irradiated mouse hindlimbs. Tissue radioprotection following CD47
suppression is at least partially a cell-autonomous response based on the increased
radioresistance of TSP1 null and CD47 null vascular cells
in vitro (
see Example 1) and the ability of CD47 antisense suppression, blocking peptides, and
antibodies to induce similar radioresistance in wild type vascular cells
in vitro (
see Example 2).
Methods
[0318] Unless otherwise noted, methods are as described above.
[0319] Animals: Wild type C57BL/6 or C3H mice were housed and fed as described above.
[0320] Irradiation of mice: Age and sex matched wild type mice underwent local irradiation to the right hindlimb
as described in Example 1. Forty-eight hours prior to irradiation, animals received
the CD47 morpholino (SEQ ID NO: 4), a control morpholino (SEQ ID NO: 5) (both at 10
µM in 750µl PBS via intramuscular injection), vehicle, or no treatment to the hind
limb. Under 1% isoflurane inhalation anesthesia, the animals were placed in customized
Lucite jigs that allow for immobilization and selective irradiation of the right hindlimb.
A single radiation dose of 25 Gy was delivered by a Therapax® DXT300 X-ray irradiator
(Pantak, Inc., East Haven, CT) using 2.0-mm Al filtration (300 kVp) at a dose rate
of 2.53 Gy/min. Care was taken to avoid irradiation of other body parts by using lead
shields specifically designed as a part of the jigs. After irradiation, the animals
were placed in cages as indicated above and observed weekly. Skin reaction after hind
limb irradiation was quantified every week after treatment for 8 weeks using a previously
described grading system (
Flanders et al., Am J. Pathol 163:2247-2257, 2003). Briefly, tissue necrosis grading system consists of 5 categories: normal, hair
loss, erythema, dry desquamation, and moist desquamation/ulceration.
[0321] Laser Doppler Analysis: Hind limb blood flow was measured using laser Doppler imaging as described above.
Animals received 25 Gy to right and left hind limbs. The right limb also received
500 µl of sterile PBS + 10 µM CD47 morpholino via intramuscular injection 48 hours
prior to radiation. Analysis of hind limb blood flow to vasoactive challenge was performed
8 weeks after treatment and radiation. Studies were performed under 1.5% isoflurane
inhalation anesthesia and a core temperature of 36.5° C. The parameters of the scan
area; 1.6 x 2.5 cm, scan speed; 4 ms per pixel, scan time; 1 minute 54 sec, override
distance; 20 cm. After obtaining baseline analysis of limb blood flow, an NO challenge
(10 µM DEA/NO, 100 nmol/g bodyweight) was administered via intra-rectal installation
and flow analysis repeated.
[0322] Immunohistochemical Evaluation: Staining for the macrophage marker CD68 was done as previously described (
Manso et al., Cancer Res 68:7090-7099, 2008) utilizing a rat anti-mouse CD68 antibody (AbD Serotec, Raleigh, NC). H&E staining
of tissue hind limbs was prepared by American HistoLabs, Gaithersburg, MD.
Results
Tissue protection from radiation injury by anti-sense CD47 suppression
[0323] Age and sex matched C57BL/6 wild type mice underwent a one-time treatment of the
right hindlimb with the CD47 antisense morpholino oligonucleotide (10 µM in 750 µl
PBS), a mismatched control morpholino, or vehicle (PBS) injected local-regionally
to the muscle and soft tissues. Forty-eight hours later the animals received 25 Gy
irradiation to the treated hindlimb and were observed for 8 weeks. At the end of 8
weeks, significant alopecia, dry and wet desquamation, and tissue ulceration with
fibrous contracture of radiated hindlimbs was noted in mice pre-treated with the control
morpholino or vehicle. In contrast, mice receiving the CD47 targeting morpholino showed
minimal to no alopecia, ulceration, and desquamation at the end of 8 weeks (Figure
16A and B). These hindlimbs also showed minimal contracture due to fibrosis and remained
flexible and supple.
Decreased apoptosis in irradiated bone marrow and skeletal muscle through CD47 suppression
[0324] Immunohistological analysis of programmed cell death via TUNEL labeling of irradiated
hindlimbs from treated and control hindlimbs demonstrated minimum cell death (apoptosis)
in the skeletal muscle of limbs that received the CD47 morpholino (Figure 17). Although
bone marrow cells are among the most sensitive to radiation-induced death, tissue
protection extended to the bone marrow compartment. Routine H&E results of treated
hindlimb skeletal muscle were comparable to results obtained in hindlimbs from CD47
null mice (
see Example 1) with muscle cell survival and hypertrophy (results not shown). Control
irradiated hindlimbs showed significant apoptosis in bone marrow and skeletal muscle
cells.
Targeting CD47 blocks radiation-induced vasculopathy
[0325] The vasculature, and in particular vascular endothelial cells, are very sensitive
to radiation (
Mouthon et al., Radiat Res 160:593-599, 2003;
Milliat et al., Am J. Pathol 169:1484-1495, 2006;
Garcia et al., Science 300:1155-1159, 2003). Following injury, vascular networks undergo a progressive fibrous obliteration,
resulting in a loss of perfusion, ischemia, and tissue necrosis. Irradiated hindlimbs
treated with the CD47 suppressing morpholino showed enhanced vascular perfusion in
response to a DEA/NO challenge on laser Doppler 8 weeks post-injury (Figure 18). In
contrast, control irradiated hindlimbs demonstrated a substantial perfusion defect.
Example 4: TSP/CD47 Targeting is not Radioprotective for Cancer Cells in vitro and Increases Tumor Ablation in vivo
[0326] This example describes the effects of TSP/CD47 targeting on an
in vitro cancer cell line. Also described is the observation that tumor ablation is increased
following CD47 knockdown in a subject undergoing radiotherapy. Although suppression
of CD47 also confers a modest radioprotection to B16 melanoma cells
in vitro, such radioprotection does not occur for B16 tumors
in vivo. Rather, as described herein, suppression of CD47 dramatically enhances ablation of
B16 melanoma and squamous cell carcinoma cells in tumor-bearing mice.
Methods
[0327] Unless otherwise noted, methods are as described above.
[0328] Tumor Establishment and Irradiation. C57 B16 mice were injected in the right hindlimb with 1x10
6 B16F10 melanoma cells, and tumors were allowed to establish for 1 week. After tumor
incorporation, the hind limbs were treated with either the CD47 morpholino or sterile
phosphate buffered saline (PBS). Forty-eight hours later, all mice were subjected
to right hind limb irradiation (10 Gy). The mice were observed and tumor size determined
twice a week by the same individual until lesion size necessitated animal euthanasia.
[0329] In other experiments, C3H mice were injected in the right hindlimb with either 1.5x10
5 SCC VII cells, and tumors were allowed to establish for 1 week. After tumor incorporation,
the hindlimbs were treated with either the CD47 morpholino in sterile phosphate buffered
saline (PBS) or an equal volume of PBS or the mice were treated intraperitoneally
with the CD47 morpholino. Forty-eight hours later, all mice were subjected to right
hind limb irradiation (10 Gy). The mice were observed and tumor size determined two
to three times a week by the same individual until lesion size necessitated animal
euthanasia.
[0330] Irradiation of cells. HUVEC and B16 mouse melanoma cells were plated in standard growth medium in 96- or
6-well culture plates (Nunc) and allowed to adhere. Irradiation was done on a Precision
X-Ray X-Rad 320 (East Haven, CT) operating at 300 kV/10 mA with a 2 mm aluminum filter.
The dose rate at 50 cm from the x-ray source was 242 cGy/minute, as determined by
multiple thermo luminescent dosimeter readings.
[0331] Tissue Apoptosis: The ApopTag
in situ detection kit (Chemicon, Millipore, MA) was used as described in Example 1. Additionally,
animals were injected with 1x10
6 B16 melanoma cells and treated with either CD47 morpholino or sterile PBS as previously
described. Mice were sacrificed 24 hours post irradiation (10 Gy), and hind limbs
were embedded in paraffin blocks. Tissue sections incorporating the entire hind limb
were examined for apoptosis employing 3'-hydroxy DNA strand breaks enzymatically labeled
with digoxygenin nucleotide via TdT. Positive and negative control slides provided
with the kit are used in each assay to ensure consistency.
Radiation and CD47 suppression increase tumour oblation in a syngeneic murine melanoma
[0332] A major concern with any radioprotection strategy is that it will likewise enhance
radio-resistance in tumors. As discussed above, syngeneic tumors implanted in TSP1
null mice demonstrated no loss in radiosensitivity in these tumors, but this does
not address whether suppressing CD47 in the tumor would be radioprotective. Therefore,
we implanted syngeneic B16F10 melanoma tumors into the thighs of C57BL/6 mice, treated
them with the CD47 targeting morpholino or vehicle, and followed tumor growth rates
after therapeutic irradiation (10 Gy). As expected, vehicle control and tumor only
groups demonstrated rapid tumor growth, with animals succumbing within 3-4 weeks (Figure
19A). Treatment with the morpholino in the absence of irradiation only slightly delayed
tumor growth. In contrast, treatment of tumor-bearing limbs with the CD47 morpholino
followed by irradiation dramatically increased tumor ablation thereby delaying tumor
re-growth (Figure 19A). Concurrent with an enhanced tumor response to radiation, the
normal tissue areas of these limbs demonstrated minimal alopecia and no other morphologic
or histologic evidence of tissue injury.
[0333] To determine whether this enhanced tumor response to IR was unique to the B16 melanoma
or the C57BL/6 background, we conducted another study in C3H mice implanted into the
hindlimb with a mouse squamous cell carcinoma (SCC VII). The same treatment and radiation
schedules were used, and similar dramatic tumor growth delays relative to irradiation
alone were seen in those mice treated with the CD47 morpholino (Figure 19B).
[0334] Analysis of isolated B16F10 melanoma cells exposed to irradiation (10 Gy) revealed
a mild radioprotective effect for cell viability
in vitro after treatment with either peptide 7N3 or CD47 morpholino when compared to untreated
cells (Figure 19C, *
p <0.05, #
p < 0.01). These data demonstrate some cell autonomous effect of CD47 suppression on
radio-resistance of this tumor cell line, but this cannot explain the dramatically
increased tumor ablation as evidenced by the tumor growth delay effect seen
in vivo. Therefore, other mechanisms were investigated by which CD47 suppression could increase
the sensitivity of B16 tumors to radiation
in vivo.
Systemic suppression of CD47 enhances tumor growth delay following irradiation.
[0335] For many tumors, local administration of radioprotectants is not feasible. Therefore,
we determined whether systemic administration of the C47 morpholino was as effective
as local administration. C3H mice were implanted with SCC VII cells, and after the
tumors were established the mice were treated either locally or intraperitoneally
with CD47 morpholino 48 hours prior to therapeutic irradiation. IP administration
resulted in an equivalent delay in tumor growth (Figure 20), indicating that the morpholino
has adequate biodistribution for systemic use.
Increased fibrosis, inflammatory response, and macrophages infiltration in tumors
where CD47 is suppressed
[0336] Tumor cells are often infiltrated with inflammatory cells such as lymphocytes, neutrophils,
macrophages, and mast cells. Depending on their differentiation state, tumor-infiltrating
macrophages can either limit or support tumor growth (
Mantovani et al., Eur J Immunol 37:14-16, 2007;
Pollard, J.W., Nat Rev Cancer 4:71-78, 2004;
Nakakubo et al., Br J Cancer 89:1736-1742, 2003). Killing of tumor cells by M1 differentiated macrophages involves phagocytosis,
which is inhibited when the target cells express CD47 (
Matozaki et al., Trends Cell Biol 19:72-80, 2009;
Okazawa et al., J Immunol 174:2004-2011, 2005), suggesting that suppression of CD47 on either the tumor or infiltrating cells could
affect tumor regrowth. H&E staining of tumors from irradiated hind limbs treated with
the CD47 morpholino revealed greater fibrosis and necrotic response within the tumor
parenchyma post radiation compared to irradiated tumors without treatment (Figure
21A). As expected, tumors in irradiated untreated hind limbs had increased numbers
of inflammatory cells undergoing apoptosis (Figure 21B). In contrast, tumors treated
with the CD47 morpholino prior to irradiation showed minimal numbers of apoptotic
cells associated with the tumor. Concurrently, tissue staining for the macrophage
marker CD68 showed positive staining in the periphery of only those tumors subjected
to CD47 suppression (Figure 21C). Therefore, the increased regrowth delay in irradiated
tumor-bearing limbs treated with the CD47 morpholino is associated with increased
macrophage recruitment and/or survival, which may result in enhanced innate immune
clearance of these irradiated tumors.
Example 5: Radioprotection by TSP1/CD47 Targeting is Largely NO-Independent
[0337] This example describes the characterization of the mechanism by which TSP1/CD47 targeting
confers radioprotection.
[0338] Administration of the NO donor DETA/NO has been associated with increased survival
in irradiated hamster fibroblasts (
Wink et al., Proc Natl Acad Sci USA 90:9813-9817, 1993). TSP1, via CD47, is known to limit physiologic NO signaling in vascular cells and
tissues of several mammalian species including mice and pigs (
Isenberg et al., Proc Natl Acad Sci USA 102:13141-13146, 2005;
Isenberg et al., Ann Surg 247:860-868, 2008;
Isenberg et al., Blood 109:1945-1952, 2007), suggesting that the radioprotection obtained by suppressing CD47 expression results
from enhanced NO signaling. However, treatment using a slow releasing exogenous NO
donor (Figure 22A) or a cell permeable cGMP analog (Figure 22B) did not confer a significant
survival advantage to irradiated HUVEC. Conversely, non-selective inhibition of endogenous
NO production by NO synthases using L-NAME did not significantly increase cell death
post-irradiation (Figure 22C) and did not prevent treatment with the CD47 morpholino
from enhancing cell survival (Figure 22C). Therefore, the radioprotection afforded
by TSP1/CD47 targeting occurs in a largely NO-independent manner.
| |
Input Set : |
|
| |
|
|
| |
|
|
| |
Output Set : |
|
| |
|
|
| |
|
|
| |
Started: |
2009-08-05 22:25:52.199 |
| |
Finished: |
2009-08-05 22:25:53.643 |
| |
Elapsed: |
0 hr(s) 0 min(s) 1 sec(s) 444 ms |
| |
Total Warnings: |
16 |
| |
Total Errors: |
0 |
| |
No. of SeqIDs Defined: |
16 |
| |
Actual SeqID Count: |
16 |
| |
|
|
| Error code |
Error Description |
|
| |
|
|
| w 213 |
Artificial or Unknown found in <213> in SED ID (1) |
| w 213 |
Artificial or Unknown found in <213> in SED ID (2) |
| w 213 |
Artificial or Unknown found in <213> in SED ID (3) |
| w 213 |
Artificial or Unknown found in <213> in SED ID (4) |
| w 213 |
Artificial or Unknown found in <213> in SED ID (5) |
| w 213 |
Artificial or Unknown found in <213> in SED ID (6) |
| w 213 |
Artificial or Unknown found in <213> in SED ID (7) |
| w 213 |
Artificial or Unknown found in <213> in SED ID (8) |
| w 213 |
Artificial or Unknown found in <213> in SED ID (9) |
| w 213 |
Artificial or Unknown found in <213> in SED ID (10) |
| w 213 |
Artificial or Unknown found in <213> in SED ID (11) |
| w 213 |
Artificial or Unknown found in <213> in SED ID (12) |
| w 213 |
Artificial or Unknown found in <213> in SED ID (13) |
| w 213 |
Artificial or Unknown found in <213> in SED ID (14) |
| w 213 |
Artificial or Unknown found in <213> in SED ID (15) |
| w 213 |
Artificial or Unknown found in <213> in SED ID (16) |
SEQUENCE LISTING
[0339]
<110> THE GOVERNMENT OF THE UNITED STATES OF AMERICA AS REPRESENTED BY THE SECRETARY
OF THE DEPARTMENT OF HEALTH AND HUMAN SERVICES Isenberg, Jeffrey S. Roberts, David
D. Maxhimer, Justin
<120> Radioprotectants Targeting Thrombospondin-1 and CD47
<130> 4239-81055-02
<140> PCTUS0952902
<141> 2009-08-05
<150> 61/086,991
<151> 2008-08-07
<160> 16
<170> PatentIn version 3.5
<210> 1
<211> 15
<212> PRT
<213> Artificial sequence
<220>
<223> Synthetic Peptide
<400> 1

<210> 2
<211> 11
<212> PRT
<213> Artificial sequence
<220>
<223> Synthetic Peptide
<400> 2

<210> 3
<211> 11
<212> PRT
<213> Artificial sequence
<220>
<223> Synthetic Peptide
<400> 3

<210> 4
<211> 25
<212> DNA
<213> Artificial sequence
<220>
<223> Synthetic oliogonucleotide
<400> 4
cgtcacaggc aggacccact gccca 25
<210> 5
<211> 25
<212> DNA
<213> Artificial sequence
<220>
<223> Synthetic Oliogonucleotide
<400> 5
cgtgacagcc acgaccgact gcgca 25
<210> 6
<211> 21
<212> DNA
<213> Artificial sequence
<220>
<223> Synthetic Oliogonucleotide
<400> 6
accgactcaa ccaggccaca g 21
<210> 7
<211> 21
<212> DNA
<213> Artificial sequence
<220>
<223> Synthetic Oliogonucleotide
<400> 7
ggaggtccat tgtgcccatg g 21
<210> 8
<211> 21
<212> DNA
<213> Artificial sequence
<220>
<223> Synthetic Oliogonucleotide
<400> 8
agggaccgcc tccacaagct g 21
<210> 9
<211> 21
<212> DNA
<213> Artificial sequence
<220>
<223> Synthetic Oliogonucleotide
<400> 9
tctccgtgca ggaactggct g 21
<210> 10
<211> 15
<212> DNA
<213> Artificial sequence
<220>
<223> Synthetic Oliogonucleotide
<400> 10
accctgcttg tgacg 15
<210> 11
<211> 21
<212> DNA
<213> Artificial sequence
<220>
<223> Synthetic Oliogonucleotide
<400> 11
gctttagggc agcacaggtc c 21
<210> 12
<211> 21
<212> DNA
<213> Artificial sequence
<220>
<223> Synthetic Oliogonucleotide
<400> 12
ccgcaaacaa agatcaccca g 21
<210> 13
<211> 23
<212> DNA
<213> Artificial sequence
<220>
<223> Synthetic Oliogonucleotide
<400> 13
gttggagtta tgttggaagg agg 23
<210> 14
<211> 21
<212> DNA
<213> Artificial sequence
<220>
<223> Synthetic Oliogonucleotide
<400> 14
gcttggtgat agctggttac c 21
<210> 15
<211> 21
<212> DNA
<213> Artificial sequence
<220>
<223> Synthetic Oliogonucleotide
<400> 15
tccgttccag aagagctgtc c 21
<210> 16
<211> 25
<212> DNA
<213> Artificial sequence
<220>
<223> Synthetic Oliogonucleotide
<400> 16
atgggctgtg accggaactg tgggc 25