<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE ep-patent-document PUBLIC "-//EPO//EP PATENT DOCUMENT 1.5//EN" "ep-patent-document-v1-5.dtd">
<ep-patent-document id="EP10179373B1" file="EP10179373NWB1.xml" lang="en" country="EP" doc-number="2366780" kind="B1" date-publ="20180613" status="n" dtd-version="ep-patent-document-v1-5">
<SDOBI lang="en"><B000><eptags><B001EP>ATBECHDEDKESFR..GRITLILUNLSEMCPTIE......FI....CY....................................................</B001EP><B005EP>J</B005EP><B007EP>BDM Ver 0.1.63 (23 May 2017) -  2100000/0</B007EP></eptags></B000><B100><B110>2366780</B110><B120><B121>EUROPEAN PATENT SPECIFICATION</B121></B120><B130>B1</B130><B140><date>20180613</date></B140><B190>EP</B190></B100><B200><B210>10179373.5</B210><B220><date>19991026</date></B220><B240><B241><date>20100924</date></B241><B242><date>20140903</date></B242></B240><B250>en</B250><B251EP>en</B251EP><B260>en</B260></B200><B300><B310>9823468</B310><B320><date>19981028</date></B320><B330><ctry>GB</ctry></B330></B300><B400><B405><date>20180613</date><bnum>201824</bnum></B405><B430><date>20110921</date><bnum>201138</bnum></B430><B450><date>20180613</date><bnum>201824</bnum></B450><B452EP><date>20180223</date></B452EP></B400><B500><B510EP><classification-ipcr sequence="1"><text>C12N   9/02        20060101AFI20110816BHEP        </text></classification-ipcr><classification-ipcr sequence="2"><text>A01H   4/00        20060101ALI20110816BHEP        </text></classification-ipcr></B510EP><B540><B541>de</B541><B542>MUTIERTE LUCIFERASE MIT VERBESSERTER THERMOSTABILITÄT</B542><B541>en</B541><B542>MUTANT LUCIFERASE HAVING INCREASED THERMOSTABILITY</B542><B541>fr</B541><B542>LUCIFERASE MUTÉE AYANT UNE THERMOSTABILITÉ AMÉLIORÉE</B542></B540><B560><B561><text>EP-A- 0 524 448</text></B561><B561><text>WO-A-01/31028</text></B561><B561><text>WO-A-95/25798</text></B561><B561><text>WO-A-98/46729</text></B561><B561><text>WO-A-99/14336</text></B561><B562><text>YE L ET AL: "Cloning and sequencing of a cDNA for firefly luciferase from Photuris pennsylvaniva", BIOCHIMICA ET BIOPHYSICA ACTA, AMSTERDAM, vol. 1339, 25 April 1997 (1997-04-25), pages 39-52, XP000909154, ISSN: 0006-3002</text></B562><B562><text>WHITE P J ET AL: "GENERATION AND CHARACTERISATION OF A THERMOSTABLE MUTANT OF LUCIFERASE FROM PHOTINUS PYRALIS", PROCEEDINGS OF THE INTERNATIONAL SYMPOSIUM ON BIOLUMINESCENCEAND CHEMILUMINESCENSE, XX, XX, 5 September 1994 (1994-09-05), pages 419-422, XP000889722,</text></B562><B562><text>WHITE ET AL: "improved thermostability of the north american firefly luciferase: saturation mutagenesis at position 354", BIOCHEMICAL JOURNAL, THE BIOCHEMICAL SOCIETY, LONDON, vol. 319, 1 January 1996 (1996-01-01), pages 343-350, XP002097112, ISSN: 0264-6021</text></B562><B562><text>KAJIYAMA NAOKI ET AL: "Thermostabilization of firefly luciferase by a single amino acid substitution at position 217", BIOCHEMISTRY, vol. 32, no. 50, 1993, pages 13795-13799, XP002521669, ISSN: 0006-2960</text></B562><B562><text>DEMENTIEVA E I ET AL: "PHYSICOCHEMICAL PROPERTIES OF RECOMBINANT LUCIOLA MINGRELICA LUCIFERASE AND ITS MUTANT FORMS", BIOCHEMISTRY, AMERICAN CHEMICAL SOCIETY, EASTON, PA.; US, vol. 1, no. 61, 1 January 1996 (1996-01-01), pages 115-119, XP002078631, ISSN: 0006-2960</text></B562><B562><text>TISI L C ET AL: "Development of a thermostable firefly luciferase", ANALYTICA CHIMICA ACTA, ELSEVIER, AMSTERDAM, NL, vol. 457, no. 1, 15 April 2002 (2002-04-15), pages 115-123, XP002424745, ISSN: 0003-2670</text></B562></B560></B500><B600><B620><parent><pdoc><dnum><anum>08013254.1</anum><pnum>2071023</pnum></dnum><date>20080723</date></pdoc><pdoc><dnum><anum>99950990.4</anum><pnum>1124944</pnum></dnum><date>19991026</date></pdoc></parent></B620></B600><B700><B720><B721><snm>Squirrell, David James</snm><adr><str>Building 224
Tetricus Science Park DSTL 
Porton Down</str><city>Salisbury, Wiltshire SP43 0JQ</city><ctry>GB</ctry></adr></B721><B721><snm>Murphy, Melanie Jane</snm><adr><str>Ministry of Defence CBDE
Porton Down</str><city>Salisbury, Wiltshire SP4 0JQ</city><ctry>GB</ctry></adr></B721><B721><snm>Leslie, Rachel Louise</snm><adr><str>DSTL 
Porton Down</str><city>Salisbury, Wiltshire SP4 0JQ</city><ctry>GB</ctry></adr></B721><B721><snm>Lowe, Christopher Robin</snm><adr><str>Institue Biotech University of Cambridge
Tennis Court Road</str><city>Cambridge, CB2 1QT</city><ctry>GB</ctry></adr></B721><B721><snm>White, Peter John</snm><adr><str>Detection Department Dstl 
Porton Down</str><city>Salisbury, Wiltshire SP4 0JQ</city><ctry>GB</ctry></adr></B721><B721><snm>Tisi, Laurence Carlo</snm><adr><str>23 King Edgar Close</str><city>Ely, CB6 1DP</city><ctry>GB</ctry></adr></B721><B721><snm>Murray, James Augustus Henry</snm><adr><str>7 Park Road
Penarth</str><city>Vale of Glamorgan, CF64 3BD</city><ctry>GB</ctry></adr></B721></B720><B730><B731><snm>Promega Corporation</snm><iid>101132662</iid><irf>144 053 a/fha</irf><adr><str>2800 Woods Hollow Road</str><city>Madison, WI 53711-5399</city><ctry>US</ctry></adr></B731></B730><B740><B741><snm>Hoffmann Eitle</snm><iid>100061036</iid><adr><str>Patent- und Rechtsanwälte PartmbB 
Arabellastraße 30</str><city>81925 München</city><ctry>DE</ctry></adr></B741></B740></B700><B800><B840><ctry>AT</ctry><ctry>BE</ctry><ctry>CH</ctry><ctry>CY</ctry><ctry>DE</ctry><ctry>DK</ctry><ctry>ES</ctry><ctry>FI</ctry><ctry>FR</ctry><ctry>GR</ctry><ctry>IE</ctry><ctry>IT</ctry><ctry>LI</ctry><ctry>LU</ctry><ctry>MC</ctry><ctry>NL</ctry><ctry>PT</ctry><ctry>SE</ctry></B840></B800></SDOBI>
<description id="desc" lang="en"><!-- EPO <DP n="1"> -->
<p id="p0001" num="0001">The present invention relates to novel proteins, in particular mutant luciferase enzymes having increased thermostability as compared to the corresponding wild type enzyme, to the use of these enzymes in assays and to test kits containing them.</p>
<p id="p0002" num="0002">Firefly luciferase catalyses the oxidation of luciferin in the presence of ATP, Mg<sup>2+</sup> and molecular oxygen with the resultant production of light. This reaction has a quantum yield of about 0.88. The light emitting property has led to its use in a wide variety of luminometric assays where ATP levels are being measured. Examples of such assays include those which are based upon the described in <patcit id="pcit0001" dnum="EP680515B"><text>EP-B-680515</text></patcit> and <patcit id="pcit0002" dnum="WO9602665A"><text>WO 96/02665</text></patcit>.</p>
<p id="p0003" num="0003">Luciferase is obtainable directly from the bodies of insects, in particular beetles such as fireflies or glow-worms. Particular species from which luciferases have been obtained include the Japanese GENJI or KEIKE fireflies, <i>Luciola cruciata</i> and <i>Luciola lateralis,</i> the East European firefly <i>Luciola mingrelica,</i> the North American firefly <i>Photinus pyralis</i> and the glow-worm <i>Lampyris noctiluca.</i> Other species from which luciferase can be obtained are listed in <nplcit id="ncit0001" npl-type="s"><text>Ye et al., Biochimica et Biophysica Acta, 1339 (1997) 39-52</text></nplcit>. Yet a further species is <i>Phrixothrix</i> (railroad-worms), as described by <nplcit id="ncit0002" npl-type="s"><text>Viviani et al., Biochemistry, 38, (1999) 8271-8279</text></nplcit>.</p>
<p id="p0004" num="0004">However, since many of the genes encoding these enzymes have been cloned and sequenced, they may also be produced using recombinant DNA technology. Recombinant DNA sequences encoding the enzymes are used to transform microorganisms such as <i>E. coli</i> which then express the desired enzyme product.</p>
<p id="p0005" num="0005">The heat stability of wild and recombinant type luciferases is such that they lose activity quite rapidly when exposed to temperatures in excess of about 30°C, particularly over 35°C. This instability causes problems when the enzyme is used or stored at high ambient temperature, or if the assay is effected<!-- EPO <DP n="2"> --> under high temperature reaction conditions, for example in order to increase reaction rate.</p>
<p id="p0006" num="0006">Mutant luciferases having increased thermostability are known from <patcit id="pcit0003" dnum="EP524448A"><text>EP-A-524448</text></patcit> and <patcit id="pcit0004" dnum="WO9525798A"><text>WO95/25798</text></patcit>. The first of these describes a mutant luciferase having a mutation at position 217 in the Japanese firefly luciferase, in particular by replacing a threonine residue with an isoleucine residue. The latter describes mutant luciferases having over 60% similarity to luciferase from <i>Photinus pyralis, Luciola mingrelica, Luciola cruciata</i> or <i>Luciola lateralis</i> but in which the amino acid residue corresponding to residue 354 of <i>Photinus pyralis</i> or 356 of the <i>Luciola</i> species is mutated such that it is other than glutamate.</p>
<p id="p0007" num="0007"><patcit id="pcit0005" dnum="WO9846729A2"><text>WO 98/46729 A2</text></patcit> discloses recombinant mutant luciferase enzymes having a mutation at the amino acid corresponding to residue 245 in <i>Photinus pyralis</i> luciferase with an increased Km for ATP.</p>
<p id="p0008" num="0008"><patcit id="pcit0006" dnum="WO9914336A2"><text>WO 99/14336 A2</text></patcit> relates to thermostable luciferases and methods of production thereof. In particular, a mutant <i>Photuris pennsylvanica</i> luciferase enzyme is disclosed having a mutation at residue 36 to from serine to proline.</p>
<p id="p0009" num="0009">White et al. disclose the generation of a thermostable mutant of <i>Photinus pyralis</i> luciferase by random chemical mutagenesis using hydroxylamine, and characterization of the mutant luciferase ("<nplcit id="ncit0003" npl-type="s"><text>Generation and characterisation of a thermostable mutant of luciferase from Photinus pyralis", Proceedings of the International Symposium on Bioluminescence and Chemiluminescense, 1994-09-05, p. 419-222</text></nplcit>).</p>
<p id="p0010" num="0010">Further luciferase mutants having amino acid substitutions at position 354 in <i>P. pyralis</i> luciferase are disclosed in <nplcit id="ncit0004" npl-type="s"><text>White et al., Biochem. J., 1996, 319, 343-350</text></nplcit>.</p>
<p id="p0011" num="0011"><nplcit id="ncit0005" npl-type="s"><text>Kajiyama and Nakano, Biochemistry 1993, 32, 13795-13799</text></nplcit> describe mutant <i>Luciola cruciata</i> luciferase enzymes having an amino acid substitution at position 217. Substitution with isoleucin resulted in a luciferase superior in thermal and pH stability and having an increased specific activity compared to the wild-type.</p>
<p id="p0012" num="0012">The applicants have found yet further mutants which can bring about increased thermostability and which may complement the mutations already known in the art.</p>
<p id="p0013" num="0013">The present invention provides a recombinant luciferase having luciferase activity and an amino acid sequence which differs from wild-type luciferase from <i>Photinus pyralis, Luciola mingrelica, Luciola cruciata, Luciola lateralis, Pyrophorus plagiophthalamus, Lampyris noctiluca, or Photuris pennsylvanica,</i> in that in the sequence of the recombinant luciferase, the amino acid residue corresponding to residue 105 in <i>Photinus pyralis</i> wild-type luciferase, to residue 106 in <i>Luciola mingrelica</i> wild-type luciferase, to residue 107 in <i>Luciola cruciata</i> or <i>Luciola lateralis</i> wild-type luciferases, or to residue 108 in <i>Luciola lateralis</i> wild-type luciferase is mutated as compared to the corresponding amino acid which appears in the corresponding wild-type luciferase sequence, such that the recombinant luciferase has increased thermostability as compared to the corresponding wild-type luciferase.</p>
<p id="p0014" num="0014">Further aspects of the invention are defined in the claims.</p>
<p id="p0015" num="0015">Disclosed is a protein having luciferase activity and at least 60% similarity to luciferase from <i>Photinus pyralis, Luciola mingrelica, Luciola cruciata</i> or <i>Luciola lateralis, Hotaria paroula, Pyrophorus plagiophthalamus Lampyris noctiluca, Pyrocoelia nayako, Photinus pennsylanvanica</i> or Phrixothrix, wherein in the sequence of the enzyme, at least one of
<ol id="ol0001" compact="compact" ol-style="">
<li>(a) the amino acid residue corresponding to residue 214 in <i>Photinus pyralis</i> luciferase or to residue 216 of <i>Luciola mingrelica, Luciola cruciata</i> or <i>Luciola lateralis</i> luciferase;</li>
<li>(b) the amino acid residue corresponding to residue 232 in <i>Photinus pyralis</i> luciferase or to residue 234 of <i>Luciola mingrelica, Luciola cruciata</i> or <i>Luciola lateralis</i> luciferase;</li>
<li>(c) the amino acid residue corresponding to residue 295 in <i>Photinus pyralis</i> luciferase or to residue 297 of <i>Luciola mingrelica, Luciola cruciata</i> or <i>Luciola lateralis</i> luciferase;</li>
<li>(d) the amino acid residue corresponding to amino acid 14 of the <i>Photinus pyralis</i> luciferase or to residue 16 of <i>Luciola<!-- EPO <DP n="3"> --><!-- EPO <DP n="4"> --><!-- EPO <DP n="5"> --> mingrelica,</i> &amp; residue 17 of <i>Luciola cruciata</i> or <i>Luciola lateralis;</i></li>
<li>(e) the amino acid residue corresponding to amino acid 35 of the <i>Photinus pyralis</i> luciferase or to residue 37 of <i>Luciola mingrelica</i> 38 of <i>Luciola cruciata</i> or <i>Luciola lateralis;</i></li>
<li>(f) the amino acid residue corresponding to amino acid residue 105 of the <i>Photinus pyralis</i> luciferase or to residue 106 of <i>Luciola mingrelica,</i> 107 of <i>Luciola cruciata</i> or <i>Luciola lateralis</i> or 108 of <i>Luciola lateralis</i> gene;</li>
<li>(g) the amino acid residue corresponding to amino acid residue 234 of the <i>Photinus pyralis</i> luciferase or to residue 236 of <i>Luciola mingrelica, Luciola cruciata</i> or <i>Luciola lateralis;</i></li>
<li>(h) the amino acid residue corresponding to amino acid residue 420 of the <i>Photinus pyralis</i> luciferase or to residue 422 of <i>Luciola mingrelica, Luciola cruciata</i> or <i>Luciola lateralis;</i></li>
<li>(i) the amino acid residue corresponding to amino acid residue 310 of the <i>Photinus pyralis</i> luciferase or to residue 312 of <i>Luciola mingrelica, Luciola cruciata or Luciola lateralis;</i> is different to the amino acid which appears in the corresponding wild type sequence and wherein the luciferase enzyme possesses has increased thermostability as compared to an enzyme having the amino acid of the corresponding wild-type luciferase of a particular species at this position.</li>
</ol></p>
<p id="p0016" num="0016">Preferably, the protein has luciferase activity and at least 60% similarity to luciferase from <i>Photinus pyralis, Luciola mingrelica, Luciola cruciata</i> or <i>Luciola lateralis, Hotaria paroula, Pyrophorus plagiophthalamus Lampyris noctiluca, Pyrocoelia nayako,</i> or <i>Photinus pennsylanvanica.</i></p>
<p id="p0017" num="0017">In particular, the protein is a recombinant protein which has luciferase activity and substantially the sequence of a wild-type luciferase, for example of Photinus <i>pyralis, Luciola mingrelica, Luciola cruciata</i> or <i>Luciola lateralis, Hotaria paroula, Pyrophorus plagiophthalamus (Green-Luc GR), Pyrophorus plagiophthalamus (Yellow-Green Luc YG), Pyrophorus plagiophthalamus (Yellow-Luc YE), Pyrophorus plagiophthalamus (Orange-Luc OR), Lampyris noctiluca, Pyrocelia nayako Photinus<!-- EPO <DP n="6"> --> pennsylanvanica LY, Photinus pennsylanvanica KW, Photinus pennsylanvanica J19</i>, or <i>Phrixothrix green (Pv<sub>GR</sub>) or red (Ph<sub>RE</sub>)</i> but which may include one or more, for example up to 100 amino acid residues, preferably no more than 50 amino acids and more preferably no more than 30 amino acids, which have been engineered to be different to that of the wild type enzyme.</p>
<p id="p0018" num="0018">In particular, bioluminescent enzymes from species that can use the substrate D-luciferin (4,5-dihydro-2-[6-hydroxy-2-benzothiazolyl]-4-thiazole carboxylic acid) to produce light emission may form the basis of the mutant enzymes of the invention.<!-- EPO <DP n="7"> --></p>
<p id="p0019" num="0019">The particular substituted amino acids in any case which give rise to enhanced thermostability can be determined by routine methods as illustrated hereinafter. In each case, different substitutions may result in enhanced thermostability. Substitution may be effected by site-directed mutagenesis of DNA encoding native or suitable mutant proteins as would be understood by the skilled person. The invention in this case is associated with the identification of the positions which are associated with thermostability.</p>
<p id="p0020" num="0020">In general however, it may be desirable to consider substituting an amino acid of different properties to the wild type amino acid. Thus hydrophilic amino acid residues may, in some cases be preferably substituted with hydrophobic amino acid residues and vice versa. Similarly, acidic amino acid residues may be substituted with basic residues.</p>
<p id="p0021" num="0021">For instance, the protein may comprise a protein having luciferase activity and at least 60% similarity to luciferase from <i>Photinus pyralis, Luciola mingrelica, Luciola cruciata</i> or <i>Luciola lateralis</i> enzyme wherein in the sequence of the enzyme, at least one of
<ol id="ol0002" compact="compact" ol-style="">
<li>(a) the amino acid residue corresponding to residue 214 in Photinus <i>pyralis</i> luciferase and to residue 216 of <i>Luciola mingrelica, Luciola cruciata</i> or <i>Luciola lateralis</i> luciferase is mutated and is other than threonine in the case of <i>Photinus pyralis</i> luciferase; or</li>
<li>(b) the amino acid residue corresponding to residue 232 in <i>Photinus pyralis</i> luciferase and to residue 234 of <i>Luciola mingrelica, Luciola cruciata</i> or <i>Luciola lateralis</i> luciferase is<!-- EPO <DP n="8"> --> mutated and is other than isoleucine in the case of <i>Photinus pyralis</i> luciferase; or</li>
<li>(c) amino acid residue corresponding to residue 295 in <i>Photinus pyralis</i> luciferase and to residue 297 of <i>Luciola mingrelica, Luciola cruciata</i> or <i>Luciola lateralis</i> luciferase is mutated and is for example, other than phenylalanine in the case of <i>Photinus pyralis</i> luciferase;</li>
</ol>
and the luciferase enzyme has increased thermostability as compared to the wild-type luciferase.</p>
<p id="p0022" num="0022">The sequences of all the various luciferases show that they are highly conserved having a significant degree of similarity between them. This means that corresponding regions among the enzyme sequences are readily determinable by examination of the sequences to detect the most similar regions, although if necessary commercially available software (e.g. "Bestfit" from the <nplcit id="ncit0006" npl-type="b"><text>University of Wisconsin Genetics Computer Group; see Devereux et al (1984) Nucleic Acid Research 12: 387-395</text></nplcit>) can be used in order to determine corresponding regions or particular amino acids between the various sequences. Alternatively or additionally, corresponding acids can be determined by reference to <nplcit id="ncit0007" npl-type="s"><text>L. Ye et al., Biochim. Biophys Acta 1339 (1997) 39-52</text></nplcit>. The numbering system used in this reference forms the basis of the numbering system used in the present application.</p>
<p id="p0023" num="0023">With respect to the possible change of the amino acid residue corresponding to residue 214 in <i>Photinus pyralis</i> luciferase, the polar amino acid threonine is suitably replaced with a non polar amino acid such as alanine, glycine, valine, lecine, isoleucine, proline, phenylalanine, methionine, tryptophan or cysteine. A particularly preferred substitution for the threonine residue corresponding to residue 214 in <i>Photinus pyralis</i> is alanine. A more preferred substitution is cysteine. However, different polar residues such as asparagine at this position may also enhance the thermostability of the corresponding enzyme having threonine at this position.<!-- EPO <DP n="9"> --></p>
<p id="p0024" num="0024">Other amino acids which appear at this position in wild-type luciferase enzymes include glycine (<i>Luciola mingrelica, Hotaria paroula</i>), asparagine (<i>Pyrophorus plagiophthalamus, GR, YC, YE and OR, Luciola cruciata, Luciola lateralis, Lampyris noctiluca, Pyrocelia nayako Photinus pennsylanvanica LY, KW</i>, <i>J19</i>) and serine (position 211 in <i>Phrixothrix</i> luciferase). These may advantageously be substituted with non-polar or different non-polar side chains such as alanine and cysteine.</p>
<p id="p0025" num="0025">As regards the possible change of the amino acid residue corresponding to residue 232 in <i>Photinus pyralis</i> luciferase, the nonpolar amino acid isoleucine is suitably replaced with a different non polar amino acid such as alanine, glycine, valine, leucine, proline, phenylalanine, methionine, tryptophan or cysteine. Other amino acids appearing at this position in wild type sequences include serine and asparagine (as well as valine or alanine at corresponding position 229 in Phritothix green and red respectively). Suitably, these polar residues are substituted by non-polar residues such as those outlined above. A particularly preferred substitution for the residue corresponding to residue 232 in <i>Photinus pyralis</i> luciferase and to residue 234 of <i>Luciola mingrelica, Luciola cruciata</i> or <i>Luciola lateralis</i> luciferase is alanine, where this represents a change of amino acid over the wild-type sequence.</p>
<p id="p0026" num="0026">Changes of the amino acid residue corresponding to residue 295 in <i>Photinus pyralis</i> luciferase and to residue 297 of <i>Luciola mingrelica, Luciola cruciata</i> or <i>Luciola lateralis</i> luciferase, may also affect the thermostability of the protein. (This corresponds to position 292 in <i>Phrixothix</i> luciferase.) In general, the amino acid at this position is a non-polar amino acid phenylalanine or leucine. These are suitably changed for different non-polar amino acids. For example, in <i>Photinus pyralis,</i> the non-polar amino acid phenylalanine is suitably replaced with a different non polar amino acid, such as alanine, leucine, glycine, valine, isoleucine, proline, methionine, tryptophan or cysteine. A particularly preferred<!-- EPO <DP n="10"> --> substitution for the phenylalanine residue corresponding to residue 214 in <i>Photinus pyralis</i> luciferase is leucine.</p>
<p id="p0027" num="0027">Mutation at the amino acid residue corresponding to amino acid 14 of the <i>Photinus pyralis</i> luciferase or to amino acid 16 in Luciola luciferase, (13 in <i>Phrixothrix</i> luciferase) is also possible. This amino acid residue (which is usually phenylalanine, but may also be leucine, serine, arginine or in some instances tyrosine) is suitably changed to a different amino acid, in particular to a different nonpolar amino acid such as alanine, valine, leucine, isoleucine, proline, methionine or tryptophan, preferably alanine.</p>
<p id="p0028" num="0028">Mutation at the amino acid residue corresponding to amino acid 35 of the <i>Photinus pyralis</i> luciferase or to amino acid residue 37 in Luciola mingrelica luciferase (corresponding to amino acid 38 in other <i>Luciola</i> spp. And in <i>Phrixothrix</i>) may also be effective. This amino acid varies amongst wild type enzymes, which may include leucine (<i>Photinus pyralis</i>) but also lysine, histidine, glycine, alanine, glutamine and aspartic acid at this position. Suitably the amino residue at this position is substituted with a non-polar amino acid residue or a different non-polar amino acid<br/>
such as alanine, valine, phenylalanine, isoleucine, proline, methionine or tryptophan. A preferred amino acid at this position is alanine, where this is different to the wild-type enzyme.<br/>
Also disclosed are other aspects, wherein mutations<br/>
at the amino acid corresponding to position 14 of the <i>Photinus pyralis</i> sequence and/or mutation at the amino acid residue corresponding to amino acid 35 of the <i>Photinus pyralis</i> luciferase are not the only mutation in the enzyme. They are suitably accompanied by others of the mutations defined above, in particular those at positions corresponding to positions 214, 395 or 232 of <i>Photinus pyralis</i> luciferase.<!-- EPO <DP n="11"> --></p>
<p id="p0029" num="0029">Changes of the amino acid residue corresponding to residue 105 in <i>Photinus pyralis</i> luciferase and to residue 106 of <i>Luciola mingrelica, Luciola cruciata</i> or <i>Luciola lateralis</i> luciferase, (102 in <i>Phrixothrix)</i> may also affect the thermostability of the protein. In general, the amino acid at this position is a non-polar amino acid alanine or glycine, or serine in <i>Phrixothrix.</i> These are suitably changed for different non-polar amino acids. For example, in <i>Photinus pyralis,</i> the non-polar amino acid alanine is suitably replaced with a different non polar amino acid, such as phenylalanine, leucine, glycine, valine, isoleucine, proline, methionine or tryptophan. A particularly preferred substitution for the alanine residue corresponding to residue 105 in <i>Photinus pyralis</i> luciferase is valine.</p>
<p id="p0030" num="0030">Changes of the amino acid residue corresponding to residue 234 in <i>Photinus pyralis</i> luciferase and to residue 236 of <i>Luciola mingrelaca, Luciola cruciata</i> or <i>Luciola lateralis</i> luciferase (231 in <i>Phrixothrix),</i> may also affect the thermostability of the protein. In general, the amino acid at this position is aspartic acid or glycine and in some cases, glutamine or threonine. These are suitably changed for non-polar or different non-polar amino acids as appropriate. For example, in <i>Photinus pyralis,</i> the amino acid residue is aspartic acid is suitably replaced with a non polar amino acid, such as alanine, leucine, glycine, valine, isoleucine, proline, methionine or tryptophan. A particularly preferred substitution for the phenylalanine residue corresponding to residue 234 in <i>Photinus pyralis</i> luciferase is glycine. Where a non-polar amino acid residue such as glycine is present at this position (for example in <i>Luciola</i> luciferase), this may be substituted with a different non-polar amino acid.</p>
<p id="p0031" num="0031">Changes of the amino acid residue corresponding to residue 420 in <i>Photinus pyralis</i> luciferase and to residue 422 of <i>Luciola mingrelica, Luciola cruciata</i> or <i>Luciola lateralis</i> luciferase (417 in <i>Phrixothrix</i> green and 418 in <i>Phrixothrix</i> red), may also affect the thermostability of the protein. In general, the<!-- EPO <DP n="12"> --> amino acid at this position is an uncharged polar amino acid serine or threonine or glycine. These are suitably changed for different uncharged polar amino acids. For example, in <i>Photinus pyralis,</i> the serine may be replaced with asparagine, glutamine, threonine or tyrosine, and in particular threonine.</p>
<p id="p0032" num="0032">Changes of the amino acid residue corresponding to residue 310 in <i>Photinus pyralis</i> luciferase and to residue 312 of <i>Luciola mingrelica, Luciola cruciata</i> or <i>Luciola lateralis</i> luciferase, may also affect the thermostability of the protein. The amino acid residue at this position varies amongst the known luciferase proteins, being histidine in <i>Photinus pyralis, Pyrocelia nayako, Lampyris noctiluca</i> and some forms of Photinus <i>pennsylanvanica</i> luciferase, threonine in <i>Luciola mingrelica, Hotaria paroula</i> and <i>Phrixothix</i> (where it is amino acid 307) luciferase, valine in <i>Luciola cruciata</i> and <i>Luciola lateralis,</i> and asparagine in some <i>Pyrophorus plagiophthalamus</i> luciferase. Thus, in general, the amino acid at this position is hydrophilic amino acid which may be changed for a different amino acid residue which increases thermostability of the enzyme. A particularly preferred substitution for the histidine residue corresponding to residue 310 in <i>Photinus pyralis</i> luciferase is arginine.</p>
<p id="p0033" num="0033">Other mutations may also be present in the enzyme. For example,<br/>
the protein also has the amino acid at position corresponding to amino acid 354 of the <i>Photinus pyralis</i> luciferase (356 in Luciola luciferase and 351 in <i>Phrixothrix)</i> changed from glutamate, in particular to an amino acid other than glycine, proline or aspartic acid. Suitably, the amino acid at this position is tryptophan, valine, leucine, isoleucine are asparagine, but most preferably is lysine or arginine. This mutation is described in <patcit id="pcit0007" dnum="WO9525798A"><text>WO 95/25798</text></patcit>.</p>
<p id="p0034" num="0034">Alternatively, the protein also has the amino acid at the position corresponding to amino acid 217<!-- EPO <DP n="13"> --> in Luciola luciferase (215 in <i>Photinus pyralis</i>) changed to a hydrophobic amino acid in particular to isoleucine, leucine or valine as described in <patcit id="pcit0008" dnum="EP052448A"><text>EP-A-052448</text></patcit>.</p>
<p id="p0035" num="0035">The proteins may contain further mutations in the sequence provided the luciferase activity of the protein is not unduly compromised. The mutations suitably enhance the properties of the enzyme or better suit it for the intended purpose in some way. This may mean that they result in enhanced thermostability and/or colour shift properties, and/or the K<sub>m</sub> for ATP of the enzymes. Examples of mutations which give rise to colour shifts are described in <patcit id="pcit0009" dnum="WO9518853A"><text>WO95/18853</text></patcit>. Mutations which affect K<sub>m</sub> values are described for example in <patcit id="pcit0010" dnum="WO9622376A"><text>WO 96/22376</text></patcit> and International Patent Application No. <patcit id="pcit0011" dnum="GB9801026W" dnum-type="L"><text>PCT/GB98/01026</text></patcit>.</p>
<p id="p0036" num="0036">Proteins of the disclosure suitably have more than one such mutation, and preferably all three of the mutations described above.</p>
<p id="p0037" num="0037">Proteins of the disclosure include both wild-type and recombinant luciferase enzymes. They have at least 60% similarity to the sequences of <i>Photinus pyralis, Luciola mingrelica, Luciola cruciata</i> or <i>Luciola lateralis</i> or other luciferase enzymes as discussed above in the sense that at least 60% of the amino acids present in the wild-type enzymes are present in the proteins of the disclosure. Such proteins can have a greater degree of similarity, in particular at least 70%, more preferably at least 80% and most preferably at least 90% to the wild-type enzymes listed above. Similar proteins of this type include allelic variants, proteins from other insect species as well as recombinantly produced enzymes.</p>
<p id="p0038" num="0038">They may be identified for example, in that they are encoded by nucleic acids which hybridise with sequences which encode wild-type enzymes under stringent hybridisation conditions, preferably high stringency conditions. Such conditions would be well understood by the person skilled in the art, and are<!-- EPO <DP n="14"> --> exemplified for example in <nplcit id="ncit0008" npl-type="b"><text>Sambrook et al. (1989) Molecular Cloning, Cold Spring Harbor Laboratory Press</text></nplcit>). In general terms, low stringency conditions can be defined as 3 x SCC at about ambient temperature to about 65°C, and high stringency conditions as 0.1 x SSC at about 65°C. SSC is the name of a buffer of 0.15M NaCl, 0.015M trisodium citrate. 3 x SSC is three times as strong as SSC and so on.</p>
<p id="p0039" num="0039">In particular, the similarity of a particular sequence to the sequences of the invention may be assessed using the multiple alignment method described by Lipman and Pearson, (<nplcit id="ncit0009" npl-type="s"><text>Lipman, D.J. &amp; Pearson, W.R. (1985) Rapid and Sensitive Protein Similarity Searches, Science, vol 227, pp1435-1441</text></nplcit>). The "optimised" percentage score should be calculated with the following parameters for the Lipman-Pearson algorithm:ktup =1, gap penalty =4 and gap penalty length =12. The sequence for which similarity is to be assessed should be used as the "test sequence" which means that the base sequence for the comparison, such as the sequence of <i>Photinus pyralis</i> or any of the other sequences listed above,as recorded in Ye et <i>al., supra.,</i> or in the case of <i>Phrixotrix,</i> as described in <nplcit id="ncit0010" npl-type="s"><text>Biochemistry, 1999, 38, 8271-8279</text></nplcit>, should be entered first into the algorithm. Generally, <i>Photinus pyralis</i> will be used as the reference sequence.</p>
<p id="p0040" num="0040">Particular examples of proteins of the disclosure are wild-type luciferase sequence with the mutations as outlined above. The proteins have at least one and preferably more than one such mutation.</p>
<p id="p0041" num="0041">The invention further provides nucleic acids which encode the luciferases as claimed. Suitably, the nucleic acids are based upon wild-type sequences which are well known in the art. Suitable mutation to effect the desired mutation in the amino acid sequence would be readily apparent, based upon a knowledge of the genetic code.<!-- EPO <DP n="15"> --></p>
<p id="p0042" num="0042">The nucleic acids of the invention are suitably incorporated into an expression vector such as a plasmid under the control of control elements such as promoters, enhancers, terminators etc. These vectors can then be used to transform a host cell, for example a prokaryotic or eukaryotic cell such as a plant or animal cell, but in particular a prokaryotic cell such as <i>E. coli</i> so that the cell expresses the desired luciferase enzyme. Culture of the thus transformed cells using conditions which are well known in the art will result in the production of the luciferase enzyme which can then be separated from the culture medium. Where the cells are plant or animal cells, plants or animals may be propagated from said cells. The protein may then be extracted from the plants, or in the case of transgenic animals, the proteins may be recovered from milk. Vectors, transformed cells, transgenic plants and animals and methods of producing enzyme by culturing these cells all form further aspects of the invention.</p>
<p id="p0043" num="0043">The <i>Photinus pyralis</i> T214A mutant luciferase was created by random mutagenesis as described hereinafter. It was found that the T214A single point mutation has greater thermostability than wild type luciferase.</p>
<p id="p0044" num="0044">Two new triple mutant luciferases: E354K/T214A/A215L and E354K/T214A/I232A were also prepared and these also have exhibited greater thermostability.</p>
<p id="p0045" num="0045">Particular examples of mutant enzymes of <i>Photinus pyralis</i> include the following:
<ul id="ul0001" list-style="none" compact="compact">
<li>I232A/E354K</li>
<li>T214A/I232A/E354K</li>
<li>A215L/I232A/E354K</li>
<li>T214A/I232A/E354K/A215L</li>
<li>I232A/E354K/T214A/F295L</li>
<li>I232A/E354K/T214A F295L/F74A/L35A</li>
<li>I232A/E354K/T214A/F295L/F14A/L35A/A215L</li>
<li>A105V</li>
<li>T214A<!-- EPO <DP n="16"> --></li>
<li>T214C</li>
<li>T214N</li>
<li>T295L</li>
<li>I232A</li>
<li>F14A</li>
<li>L35A</li>
<li>D234G</li>
<li>S420T</li>
<li>H310R</li>
</ul>
or equivalents of any of these when derived from the luciferases of other species.</p>
<p id="p0046" num="0046">The mutations for the creation of the triple mutant were introduced to the luciferase gene on plasmid pET23 by site-directed mutagenesis, (PCR). The oligonucleotides added to the PCR reaction in order to effect the relevant mutations are given in the Examples below.</p>
<p id="p0047" num="0047">It has been reported previously that the effect of point mutations at the 354 and 215 positions are additive. Disclosed is the possibility of combining three or more such mutations to provide still greater thermostability.</p>
<p id="p0048" num="0048">Thermostable luciferase of the invention will advantageously be employed in any bioluminescent assay which utilises the luciferase/luciferin reaction as a signalling means. There are many such assays known in the literature. The proteins may therefore be included in kits prepared with a view to performing such assays, optionally with luciferin and any other reagents required to perform the particular assay.</p>
<p id="p0049" num="0049">The invention will now be particularly described by way of example with reference to the accompanying diagrammatic drawings in which:
<ul id="ul0002" list-style="none">
<li><figref idref="f0001 f0002">Figure 1</figref> illustrates the plasmids used in the production of mutants in accordance with the invention;<!-- EPO <DP n="17"> --></li>
<li><figref idref="f0003">Figure 2</figref> shows the results of heat inactivation studies on luciferases including luciferases of the disclosure;</li>
<li><figref idref="f0004 f0005 f0006 f0007">Figure 3</figref> shows the results of thermostability experiments on various luciferase mutants;</li>
<li><figref idref="f0003">Figure 4</figref> shows the results of thermostability experiments on other luciferase mutants; and</li>
<li><figref idref="f0008">Figure 5</figref> shows oligonucleotides used in the preparation of mutant enzymes of the disclosure.</li>
</ul></p>
<heading id="h0001"><u>Example 1</u></heading>
<heading id="h0002"><u>Identification of Thermostable Mutant Luciferase</u></heading>
<p id="p0050" num="0050">The error-prone PCR was based on the protocol devised by <nplcit id="ncit0011" npl-type="s"><text>Fromant et al., Analytical Biochemistry, 224, 347-353 (1995</text></nplcit>).</p>
<p id="p0051" num="0051">The dNTP mix in this reaction was:
<ul id="ul0003" list-style="none" compact="compact">
<li>35mM dTTP</li>
<li>12.5mM dGTP</li>
<li>22.5mM dCTP</li>
<li>14mM dATP</li>
</ul></p>
<p id="p0052" num="0052">The PCR conditions were:
<ul id="ul0004" list-style="none" compact="compact">
<li>0.5 µl (50ng) plasmid pPW601a J54*</li>
<li>5.0 µl 10x KCl reaction buffer</li>
<li>1 µl each of W56 and W57<sup>+</sup> (60 pmoles of each primer) 1 µl Biotaq ™ polymerase (5U)</li>
<li>2 µl dNTPs (see above)</li>
<li>1.76 µl MgCl<sub>2</sub> (50 mM stock)</li>
<li>1 µl mNCl<sub>2</sub> (25mM stock) [final concentration in reaction = 3.26mM] 36.7 µl dH<sub>2</sub>O
<ul id="ul0005" list-style="none">
<li>*Plasmid pPW601aJ54 is a mutated version of pPW601a (<patcit id="pcit0012" dnum="WO9525798A"><text>WO 95/25798</text></patcit>) where an NdeI site has been created within the 3<!-- EPO <DP n="18"> --> bases prior to the ATG start codon. This allows for easy cloning from pPW601a into the pET23 vector.</li>
<li>+Primer sequences:
<ul id="ul0006" list-style="none" compact="compact">
<li>W56:</li>
<li>5' - AAACAGGGACCCATATGGAAGACGC - 3'</li>
<li>W57:</li>
<li>5' - AATTAACTCGAGGAATTTCGTCATCGCTGAATACAG - 3')</li>
</ul></li>
</ul></li>
</ul></p>
<p id="p0053" num="0053">Cycling parameters were:
<ul id="ul0007" list-style="none" compact="compact">
<li>94°C-5 min<br/>
Then 12 x cycles of:
<ul id="ul0008" list-style="none">
<li>94°C-30s</li>
<li>55°C-30s</li>
<li>72°C--5min</li>
</ul></li>
<li>72°C-10 min</li>
</ul></p>
<p id="p0054" num="0054">The PCR products were purified from the reaction mix using a Clontech Advantage ™ PCR-pure kit. An aliquot of the purified products was then digested with the restriction enzymes NdeI and XhoI. The digested PCR products were then "cleaned up" with the Advantage kit and ligated into the vector pET23a which had been digested with the same enzymes.</p>
<p id="p0055" num="0055">Ligation conditions:
<ul id="ul0009" list-style="none" compact="compact">
<li>4µl pET23a (56ng)</li>
<li>5µl PCR products (200ng)</li>
<li>3µl 5x Gibco BRL ligase reaction buffer</li>
<li>1µl Gibco BRL ligase (10U)</li>
<li>2µl dH<sub>2</sub>0</li>
</ul></p>
<p id="p0056" num="0056">The ligation was carried out overnight at 16°C.<!-- EPO <DP n="19"> --></p>
<p id="p0057" num="0057">The ligated DNAs were then purified using the Advantage™ kit and then electroporated into electrocompetent <i>E. coli</i> HB101 cells (1mm cuvettes, 1.8 Kv).</p>
<p id="p0058" num="0058">Eleven electroporations were performed and the cells were then added to 40 ml of TY broth containing 50µg/ml ampicillin. The cells were then grown overnight at 37°C. The entire 50ml of culture grown overnight was used to purify plasmid DNA. This is the library.</p>
<heading id="h0003"><u>Screening the library</u></heading>
<p id="p0059" num="0059">An aliquot of the plasmid library was used to electroporate <i>E</i>. <i>coli</i> BL21 DE3 cells. These cells were then plated onto LB agar containing 50µg/ml ampicillin and grown overnight at 37°C.</p>
<p id="p0060" num="0060">The next day, colonies were picked and patched onto nylon filters on LB agar + amp plates and growth continued overnight at 37°C. The next day, filters were overlaid with a solution of luciferin - 500µM in 100mM sodium citrate pH5.0. The patches were then viewed in a darkroom. One colony/patch was picked from 200 for further analysis.</p>
<heading id="h0004"><u>Characterisation of the thermostable mutant</u></heading>
<p id="p0061" num="0061">The <i>E. coli</i> clone harbouring the mutant plasmid was isolated. Plasmid DNA was prepared for ABI sequencing. The entire open reading frame encoding luciferase was sequenced using 4 different oligonucleotide primers. Sequencing revealed a single point mutation at nt 640 (A → G). Giving a codon change of ACT (T) to GCT (A) at amino acid position 214.</p>
<heading id="h0005"><u>Example 2</u></heading>
<heading id="h0006"><u>Preparation of Triple Mutant Enzyme</u></heading>
<p id="p0062" num="0062">A mutagenic oligonucleotide was then used to create this same mutation in pMOD1 (A215L/E354K) to create a triple mutant pMOD2 (A215L/E354K/T214A). This mutation also creates a unique SacI/SstI site in pMOD1.<!-- EPO <DP n="20"> --></p>
<heading id="h0007"><u>Example 3</u></heading>
<heading id="h0008"><u>Preparation of further triple mutant enzyme</u></heading>
<p id="p0063" num="0063">The following primers were used to create the triple mutant T214A/I232A/E354K using a standard PCR reaction and with the pET23 plasmid with the T214A mutation as template:
<tables id="tabl0001" num="0001">
<table frame="none">
<tgroup cols="2" colsep="0" rowsep="0">
<colspec colnum="1" colname="col1" colwidth="61mm"/>
<colspec colnum="2" colname="col2" colwidth="31mm"/>
<tbody>
<row>
<entry>CTGATTACACCCAAGGGGGATG</entry>
<entry>E354K-sense</entry></row>
<row>
<entry>CATCCCCCTTGGGTGTAATCAG</entry>
<entry>E354K-antisense</entry></row>
<row>
<entry/>
<entry/></row>
<row>
<entry>GCAATCAAATCGCTCCGGATACTGC</entry>
<entry>I232A-sense</entry></row>
<row>
<entry>GCAGTATCCGGAGCGATTTGATTGC</entry>
<entry>I232A-antisense.</entry></row></tbody></tgroup>
</table>
</tables></p>
<heading id="h0009"><u>Example 4</u></heading>
<heading id="h0010"><u>Identification of thermostable 295 mutant</u></heading>
<p id="p0064" num="0064">The F295 mutant was created using the error-prone PCR method described by <nplcit id="ncit0012" npl-type="s"><text>Fromant et al., Analytical Biochemistry, vol 224, 347-353 (1995</text></nplcit>). The PCR conditions used were as follows:
<ul id="ul0010" list-style="none" compact="compact">
<li>0.5 µl (50 ng) plasmid pET23</li>
<li>5.0 µl 10x KCI reaction buffer</li>
<li>1 µl primer 1 - 60 pmoles of each primer</li>
<li>1 µl primer 2</li>
<li>1 µl Biotaq™ polymerase (5U)</li>
<li>2 µl dNTPs, in mixture 35 mM dTTP, 12.5 mM dGTP, 22.5 mM dCTP, 14 mM dATP</li>
<li>1.76 µl MgCl<sub>2</sub> (50 mM stock)</li>
<li>1 µl MnCl<sub>2</sub> (25 mM stock) [final concentration in reaction = 3.26 mM]</li>
<li>36.7 µl dH<sub>2</sub>O<br/>
Primer 1 = 5' - AAACAGGGACCCATATGGAAGACGC - 3'<br/>
Primer 2 = 5' - AATTAACTCGAGGAATTTCGTCATCGCTGAATACAG - 3'</li>
</ul></p>
<p id="p0065" num="0065">The cycling parameters were:
<ul id="ul0011" list-style="none" compact="compact">
<li>94°C for 5 min</li>
<li>15 cycles of: 30 s @ 94°C
<ul id="ul0012" list-style="none" compact="compact">
<li>30 s @ 55°C</li>
<li>5 min @ 72°C</li>
</ul></li>
<li>then 10 min at 72°C</li>
</ul><!-- EPO <DP n="21"> --></p>
<p id="p0066" num="0066">The PCR products were purified from the reaction mix using a Clontech Advantage™ PCR-Pure kit. An aliquot of the purified products was then digested with the restriction enzymes Ndel and Xhol. The digested PCR products were then "cleaned up" with the Advantage™ kit and ligated into the vector pET23a, which had been digested with the same enzymes.</p>
<p id="p0067" num="0067">The ligation conditions were as follows:
<ul id="ul0013" list-style="none" compact="compact">
<li>56 ng pET23a</li>
<li>200 ng PCR products</li>
<li>3 µl 5x Gibco BRL ligase reaction buffer</li>
<li>1µl Gibco BRL ligase (10U)</li>
<li>volume made up to 10 µl with dH<sub>2</sub>O</li>
</ul></p>
<p id="p0068" num="0068">The ligation was carried out overnight at 16°C.</p>
<p id="p0069" num="0069">The ligated DNAs were then purified using the Advantage™ kit and then electroporated into electrocompetent <i>Escherichia coli</i> DH5α cells (1mm cuvettes, 1.8kV). 1ml of SOC broth was added to each electroporation and the cells allowed to recover and express antibiotic resistance genes encoded by the plasmid. Aliquots of the library were inoculated onto LB agar containing 50 µg/ml ampicillin and the bacteria were grown overnight at 37°C. Nylon filter discs were then overlaid onto the agar plates and the colonies transferred to fresh plates. The original plates were left at room temperature for the colonies to re-grow. The plates with the nylon filters were incubated at 42°C for 2 h before plates were sprayed with 500µM luciferin in 100mM citrate buffer pH5.0 and viewed in a darkroom.</p>
<p id="p0070" num="0070">Three thermostable colonies were selected on the basis that they still glowed after 2 h at 42°C. Plasmid DNA was isolated from these clones and sequenced, and this revealed the F295L mutation in each case.<!-- EPO <DP n="22"> --></p>
<heading id="h0011"><u>Example 5</u></heading>
<p id="p0071" num="0071">Other mutants of the invention were produced by PCR using appropriate combinations of the oligonucleotides listed above as well as the following:
<tables id="tabl0002" num="0002">
<table frame="none">
<tgroup cols="2" colsep="0" rowsep="0">
<colspec colnum="1" colname="col1" colwidth="78mm"/>
<colspec colnum="2" colname="col2" colwidth="28mm"/>
<tbody>
<row>
<entry>GAAAGGCCCGGCACCAGCCTATCCTCTAGAGG</entry>
<entry>F14A-sense</entry></row>
<row>
<entry>CCTCTAGCGGATAGGCTGGTGCCGGGCCTTTC</entry>
<entry>F14A-antisense</entry></row>
<row>
<entry/>
<entry/></row>
<row>
<entry>GAGATACGCCGCGGTTCCTGG</entry>
<entry>L35A-sense</entry></row>
<row>
<entry>CCAGGAACCGCGGCGTATCTC</entry>
<entry>L35A-antisense</entry></row></tbody></tgroup>
</table>
</tables></p>
<heading id="h0012"><u>Example 6</u></heading>
<heading id="h0013"><u>Purification of luciferase and heat inactivation studies.</u></heading>
<p id="p0072" num="0072">Cells expressing the recombinant mutant luciferases were cultured, disrupted and extracted as described in <patcit id="pcit0013" dnum="WO9525798A"><text>WO 95/25798 to yield </text></patcit>cell free extracts of luciferase.</p>
<p id="p0073" num="0073">Eppendorf tubes containing the cell free extracts were incubated generally at 40°C unless otherwise stated. Purified preparations of wild type luciferases (for comparative purposes were incubated in thermostability buffer comprising 50mM potassium phosphate buffer pH7.8 containing 10% saturated ammonium sulphate, 1mM dithiothreitol and 0.2% bovine serum albumin (BSA). At set times a tube was removed and cooled in an ice/water bath prior to assay with remaining assayed activity being calculated as a percentage of the initial activity or relative bioluminesce.</p>
<p id="p0074" num="0074">The results are illustrated in <figref idref="f0003">Figures 2</figref> and <figref idref="f0004 f0005 f0006 f0007">3</figref> hereinafter. It can be seen from <figref idref="f0003">Figure 2</figref> that luciferase mutants of the disclosure have improved thermostability compared with the previously known mutants.</p>
<p id="p0075" num="0075">The dramatic increase in stability over wild-type luciferase (RWT) is clear from <figref idref="f0004 f0005 f0006 f0007">Figure 3</figref>.<!-- EPO <DP n="23"> --></p>
<heading id="h0014"><u>Example 7</u></heading>
<heading id="h0015"><u>Investigations into the activity of 214 mutants</u></heading>
<p id="p0076" num="0076">A library of 214 mutants was prepared using site-directed mutagenesis using cassette oligos (<figref idref="f0008">Figure 5</figref>) and thermostable mutants selected and tested as described in Example 1. Three particularly thermostable mutants were characterised by sequencing as described in Example 1 as T214A, T214C and T214N.</p>
<p id="p0077" num="0077">O/N cultures of E. coli XL1-Blue harbouring plasmids encoding T214, T214A, T214C and T214N were lysed using the Promega lysis buffer. 50µl of liquid extracts were then heat inactivated at 37°C and 40°C over various time points. Aliquots 10µl of heated extract were then tested in the Promega live assay buffer (100µl).</p>
<p id="p0078" num="0078">The results are shown in the following Tables
<tables id="tabl0003" num="0003">
<table frame="all">
<tgroup cols="6">
<colspec colnum="1" colname="col1" colwidth="17mm"/>
<colspec colnum="2" colname="col2" colwidth="16mm"/>
<colspec colnum="3" colname="col3" colwidth="15mm"/>
<colspec colnum="4" colname="col4" colwidth="15mm"/>
<colspec colnum="5" colname="col5" colwidth="15mm"/>
<colspec colnum="6" colname="col6" colwidth="15mm"/>
<thead>
<row>
<entry valign="top"/>
<entry valign="top">0</entry>
<entry valign="top">4 min</entry>
<entry valign="top">8 min</entry>
<entry valign="top">22 min</entry>
<entry valign="top">(37°C)</entry></row></thead>
<tbody>
<row>
<entry>rwt T214</entry>
<entry>11074</entry>
<entry>5561</entry>
<entry>2555</entry>
<entry>343</entry>
<entry>RLU</entry></row>
<row>
<entry>T214C</entry>
<entry>106449</entry>
<entry>92471</entry>
<entry>90515</entry>
<entry>78816</entry>
<entry>RLU</entry></row>
<row>
<entry>T214A</entry>
<entry>63829</entry>
<entry>52017</entry>
<entry>45864</entry>
<entry>35889</entry>
<entry>RLU</entry></row>
<row>
<entry>T214N</entry>
<entry>60679</entry>
<entry>49144</entry>
<entry>41736</entry>
<entry>29488</entry>
<entry>RLU</entry></row></tbody></tgroup>
</table>
</tables>
<tables id="tabl0004" num="0004">
<table frame="all">
<tgroup cols="5">
<colspec colnum="1" colname="col1" colwidth="17mm"/>
<colspec colnum="2" colname="col2" colwidth="11mm"/>
<colspec colnum="3" colname="col3" colwidth="14mm"/>
<colspec colnum="4" colname="col4" colwidth="14mm"/>
<colspec colnum="5" colname="col5" colwidth="14mm"/>
<thead>
<row>
<entry valign="top"/>
<entry valign="top"/>
<entry namest="col3" nameend="col5" align="center" valign="top">% remaining activity 37°C</entry></row></thead>
<tbody>
<row>
<entry>rwt T214</entry>
<entry>100</entry>
<entry>50.2</entry>
<entry>23.1</entry>
<entry>3.1</entry></row>
<row>
<entry>T214C</entry>
<entry>100</entry>
<entry>86.9</entry>
<entry>85.0</entry>
<entry>74.0</entry></row>
<row>
<entry>T214A</entry>
<entry>100</entry>
<entry>81.5</entry>
<entry>71.8</entry>
<entry>56.2</entry></row>
<row>
<entry>T214N</entry>
<entry>100</entry>
<entry>81.0</entry>
<entry>68.8</entry>
<entry>48.6</entry></row></tbody></tgroup>
</table>
</tables></p>
<p id="p0079" num="0079">The experiment was repeated at 40°C with the 3 mutants
<tables id="tabl0005" num="0005">
<table frame="all">
<tgroup cols="6">
<colspec colnum="1" colname="col1" colwidth="15mm"/>
<colspec colnum="2" colname="col2" colwidth="16mm"/>
<colspec colnum="3" colname="col3" colwidth="15mm"/>
<colspec colnum="4" colname="col4" colwidth="15mm"/>
<colspec colnum="5" colname="col5" colwidth="15mm"/>
<colspec colnum="6" colname="col6" colwidth="12mm"/>
<thead>
<row>
<entry valign="top"/>
<entry valign="top">0</entry>
<entry valign="top">4 min</entry>
<entry valign="top">8 min</entry>
<entry valign="top">16 min</entry>
<entry valign="top"/></row></thead>
<tbody>
<row>
<entry>T214C</entry>
<entry>104830</entry>
<entry>79365</entry>
<entry>72088</entry>
<entry>56863</entry>
<entry>RLU</entry></row>
<row>
<entry>T214A</entry>
<entry>64187</entry>
<entry>43521</entry>
<entry>28691</entry>
<entry>14547</entry>
<entry>RLU</entry></row>
<row>
<entry>T214N</entry>
<entry>60938</entry>
<entry>38359</entry>
<entry>25100</entry>
<entry>12835</entry>
<entry>RLU</entry></row></tbody></tgroup>
</table>
</tables><!-- EPO <DP n="24"> -->
<tables id="tabl0006" num="0006">
<table frame="all">
<tgroup cols="5">
<colspec colnum="1" colname="col1" colwidth="15mm"/>
<colspec colnum="2" colname="col2" colwidth="11mm"/>
<colspec colnum="3" colname="col3" colwidth="14mm"/>
<colspec colnum="4" colname="col4" colwidth="14mm"/>
<colspec colnum="5" colname="col5" colwidth="15mm"/>
<thead>
<row>
<entry valign="top"/>
<entry valign="top"/>
<entry namest="col3" nameend="col5" align="center" valign="top">% remaining activity 40°C</entry></row>
<row>
<entry valign="top"/>
<entry valign="top">0</entry>
<entry valign="top">4 min</entry>
<entry valign="top">8 min</entry>
<entry valign="top">16 min</entry></row></thead>
<tbody>
<row>
<entry>T214C</entry>
<entry>100</entry>
<entry>73.7</entry>
<entry>68.8</entry>
<entry>54.2</entry></row>
<row>
<entry>T214A</entry>
<entry>100</entry>
<entry>67.8</entry>
<entry>44.7</entry>
<entry>22.7</entry></row>
<row>
<entry>T214N</entry>
<entry>100</entry>
<entry>63.0</entry>
<entry>41.2</entry>
<entry>21.1</entry></row></tbody></tgroup>
</table>
</tables></p>
<p id="p0080" num="0080">These results indicate that T214C is significantly more thermostable than either r-wt or T214A or N. This change in properties is unexpected as it is usually expected that the more cysteine residues that are present, the worse the thermostability.</p>
<heading id="h0016"><u>Example 8</u></heading>
<heading id="h0017"><u>Investigation of other point mutations</u></heading>
<p id="p0081" num="0081">A series of other <i>Photinus</i> pyralis mutants with single point mutations were prepared using random error-prone PCR (<figref idref="f0008">Figure 5</figref>). Following, screening and sequencing of the mutants generated, the sequencing was checked using site-directed mutagenesis followed by further sequencing. These were D234G, A105V and F295L. The thermostability of these mutants as well as recombinant wild-type Photinus pyralis luciferase was tested. Protein samples in Promega lysis buffer were incubated at 37°C for 10 minutes and their activity assayed after 2, 5 and 10 minutes. The results, showing that each mutation produced enhanced thermostability over wild type, is shown in <figref idref="f0003">Figure 4</figref>.</p>
</description>
<claims id="claims01" lang="en"><!-- EPO <DP n="25"> -->
<claim id="c-en-01-0001" num="0001">
<claim-text>A recombinant luciferase having luciferase activity and an amino acid sequence which differs from wild-type luciferase from <i>Photinus pyralis, Luciola mingrelica, Luciola cruciata, Luciola lateralis, Pyrophorus plagiophthalamus, Lampyris noctiluca, or Photuris pennsylvanica,</i> in that in the sequence of the recombinant luciferase, the amino acid residue corresponding to residue 105 in <i>Photinus pyralis</i> wild-type luciferase, to residue 106 in <i>Luciola mingrelica</i> wild-type luciferase, to residue 107 in <i>Luciola cruciata</i> or <i>Luciola lateralis</i> wild-type luciferases, or to residue 108 in <i>Luciola lateralis</i> wild-type luciferase is mutated as compared to the corresponding amino acid which appears in the corresponding wild-type luciferase sequence, such that the recombinant luciferase has increased thermostability as compared to the corresponding wild-type luciferase.</claim-text></claim>
<claim id="c-en-01-0002" num="0002">
<claim-text>The recombinant luciferase according to claim 1 wherein the recombinant luciferase is a mutated form of <i>Photinus pyralis, Luciola mingrelica, Luciola cruciata</i> or <i>Luciola lateralis</i> luciferase.</claim-text></claim>
<claim id="c-en-01-0003" num="0003">
<claim-text>The recombinant luciferase according to claim 1 or claim 2 wherein the recombinant luciferase is a mutated form of <i>Photinus pyralis</i> luciferase.</claim-text></claim>
<claim id="c-en-01-0004" num="0004">
<claim-text>The recombinant luciferase according to any one of claims 1-3 wherein the amino acid residue corresponding to residue 105 in <i>Photinus pyralis</i> luciferase has been mutated to phenylalanine, leucine, glycine, isoleucine, proline, methionine or tryptophan.</claim-text></claim>
<claim id="c-en-01-0005" num="0005">
<claim-text>A nucleic acid which encodes a recombinant luciferase according to any one of the preceding claims.</claim-text></claim>
<claim id="c-en-01-0006" num="0006">
<claim-text>A vector comprising a nucleic acid according to claim 5.</claim-text></claim>
<claim id="c-en-01-0007" num="0007">
<claim-text>A cell transformed with a vector according to claim 6.</claim-text></claim>
<claim id="c-en-01-0008" num="0008">
<claim-text>The cell according to claim 7 which is a prokaryotic cell.</claim-text></claim>
<claim id="c-en-01-0009" num="0009">
<claim-text>The cell according to claim 7 which is a plant cell.<!-- EPO <DP n="26"> --></claim-text></claim>
<claim id="c-en-01-0010" num="0010">
<claim-text>A plant comprising cells according to claim 9.</claim-text></claim>
<claim id="c-en-01-0011" num="0011">
<claim-text>A method of producing a recombinant luciferase according to any one of claims 1 to 4, which method comprises culture of a cell according to claim 7 or growth of a plant according to claim 10.</claim-text></claim>
<claim id="c-en-01-0012" num="0012">
<claim-text>The use of a recombinant luciferase according to any one of claims 1 to 4 in a bioluminescent assay.</claim-text></claim>
<claim id="c-en-01-0013" num="0013">
<claim-text>A kit comprising a recombinant luciferase according to any one of claims 1 to 4.</claim-text></claim>
<claim id="c-en-01-0014" num="0014">
<claim-text>The kit according to claim 13, further comprising luciferin.</claim-text></claim>
</claims>
<claims id="claims02" lang="de"><!-- EPO <DP n="27"> -->
<claim id="c-de-01-0001" num="0001">
<claim-text>Rekombinante Luciferase mit Luciferaseaktivität und einer Aminosäuresequenz, die sich von der Wildtyp-Luciferase von <i>Photinus pyralis, Luciola mingrelica, Luciola cruciata, Luciola lateralis, Pyrophorus plagiophthalamus, Lampyris noctiluca</i> oder <i>Photuris pennsylvanica</i> darin unterscheidet, dass in der Sequenz der rekombinanten Luciferase der Aminosäurerest, der dem Rest 105 in der <i>Photinus pyralis</i>-Wildtyp-Luciferase, dem Rest 106 in der <i>Luciola mingrelica</i>-Wildtyp-Luciferase, dem Rest 107 in den <i>Luciola cruciata-</i> oder <i>Luciola lateralis</i>-Wildtyp-Luciferasen, oder dem Rest 108 in der <i>Luciola lateralis</i>-Wildtyp-Luciferase entspricht, verglichen mit der entsprechenden Aminosäure, die in der entsprechenden Wildtyp-Luciferasesequenz vorkommt, mutiert ist, so dass die rekombinante Luciferase eine erhöhte Thermostabilität verglichen mit der entsprechenden Wildtyp-Luciferase hat.</claim-text></claim>
<claim id="c-de-01-0002" num="0002">
<claim-text>Rekombinante Luciferase gemäß Anspruch 1, wobei die rekombinante Luciferase eine mutierte Form der <i>Photinus pyralis-, Luciola mingrelica-, Luciola cruciata-</i> oder <i>Luciola lateralis-</i>Luciferase ist.</claim-text></claim>
<claim id="c-de-01-0003" num="0003">
<claim-text>Rekombinante Luciferase gemäß Anspruch 1 oder Anspruch 2, wobei die rekombinante Luciferase eine mutierte Form der <i>Photinus pyralis-</i>Luciferase ist.</claim-text></claim>
<claim id="c-de-01-0004" num="0004">
<claim-text>Rekombinante Luciferase gemäß irgendeinem der Ansprüche 1-3, wobei der Aminosäurerest, der dem Rest 105 in der <i>Photinus pyralis</i>-Luciferase entspricht, in Phenylalanin, Leucin, Glycin, Isoleucin, Prolin, Methionin oder Tryptophan mutiert worden ist.<!-- EPO <DP n="28"> --></claim-text></claim>
<claim id="c-de-01-0005" num="0005">
<claim-text>Nukleinsäure, die eine rekombinante Luciferase gemäß irgendeinem der vorherigen Ansprüche kodiert.</claim-text></claim>
<claim id="c-de-01-0006" num="0006">
<claim-text>Vektor, der eine Nukleinsäure gemäß Anspruch 5 umfasst.</claim-text></claim>
<claim id="c-de-01-0007" num="0007">
<claim-text>Zelle, die mit einem Vektor gemäß Anspruch 6 transformiert ist.</claim-text></claim>
<claim id="c-de-01-0008" num="0008">
<claim-text>Zelle gemäß Anspruch 7, die eine prokaryotische Zelle ist.</claim-text></claim>
<claim id="c-de-01-0009" num="0009">
<claim-text>Zelle gemäß Anspruch 7, die eine Pflanzenzelle ist.</claim-text></claim>
<claim id="c-de-01-0010" num="0010">
<claim-text>Pflanze, die Zellen gemäß Anspruch 9 umfasst.</claim-text></claim>
<claim id="c-de-01-0011" num="0011">
<claim-text>Verfahren zur Herstellung einer rekombinanten Luciferase gemäß irgendeinem der Ansprüche 1 bis 4, wobei das Verfahren das Kultivieren einer Zelle gemäß Anspruch 7 oder das Anwachsen einer Pflanze gemäß Anspruch 10 umfasst.</claim-text></claim>
<claim id="c-de-01-0012" num="0012">
<claim-text>Verwendung einer rekombinanten Luciferase gemäß irgendeinem der Ansprüche 1 bis 4 in einem Biolumineszenz-Assay.</claim-text></claim>
<claim id="c-de-01-0013" num="0013">
<claim-text>Kit, das eine rekombinante Luciferase gemäß irgendeinem der Ansprüche 1 bis 4 umfasst.</claim-text></claim>
<claim id="c-de-01-0014" num="0014">
<claim-text>Kit gemäß Anspruch 13, das weiter Luciferin umfasst.</claim-text></claim>
</claims>
<claims id="claims03" lang="fr"><!-- EPO <DP n="29"> -->
<claim id="c-fr-01-0001" num="0001">
<claim-text>Luciférase recombinante ayant une activité de luciférase et une séquence d'acides aminés qui diffère de la luciférase sauvage de types <i>Photinus pyralis, Luciola mingrelica, Luciola cruciata, Luciola lateralis, Pyrophorus plagiophthalamus, Lampyris noctiluca,</i> ou <i>Photuris pennsylanvanica</i> en ce que, dans la séquence de la luciférase recombinante, le résidu d'acide aminé correspondant au résidu 105 dans la luciférase sauvage <i>Photinus pyralis,</i> au résidu 106 dans la luciférase sauvage <i>Luciola mingrelica,</i> au résidu 107 dans les luciférases sauvages <i>Luciola cruciata</i> ou <i>Luciola lateralis,</i> ou au résidu 108 dans la luciférase sauvage <i>Luciola lateralis,</i> est muté en comparaison de l'acide aminé correspondant qui apparaît dans la séquence de luciférase sauvage correspondante, de sorte que la luciférase recombinante présente une thermo-stabilité accrue par rapport à la luciférase sauvage correspondante.</claim-text></claim>
<claim id="c-fr-01-0002" num="0002">
<claim-text>Luciférase recombinante selon la revendication 1, dans laquelle la luciférase recombinante est une forme mutée de la luciférase de types <i>Photinus pyralis, Luciola mingrelica, Luciola cruciata</i> ou <i>Luciola lateralis.</i></claim-text></claim>
<claim id="c-fr-01-0003" num="0003">
<claim-text>Luciférase recombinante selon la revendication 1 ou 2, dans laquelle la luciférase recombinante est une forme mutée de la luciférase de type <i>Photinus pyralis.</i></claim-text></claim>
<claim id="c-fr-01-0004" num="0004">
<claim-text>Luciférase recombinante selon l'une quelconque des revendications 1 à 3, dans laquelle le résidu d'acide aminé correspondant au résidu 105 dans la luciférase de type <i>Photinus pyralis</i> a été muté en phénylalanine, leucine, glycine, isoleucine, proline, méthionine ou tryptophane.</claim-text></claim>
<claim id="c-fr-01-0005" num="0005">
<claim-text>Acide nucléique qui code pour une luciférase recombinante selon l'une quelconque des revendications précédentes.</claim-text></claim>
<claim id="c-fr-01-0006" num="0006">
<claim-text>Vecteur comprenant un acide nucléique selon la revendication 5.</claim-text></claim>
<claim id="c-fr-01-0007" num="0007">
<claim-text>Cellule transformée par un vecteur selon la revendication 6.<!-- EPO <DP n="30"> --></claim-text></claim>
<claim id="c-fr-01-0008" num="0008">
<claim-text>Cellule selon la revendication 7, qui est une cellule procaryote.</claim-text></claim>
<claim id="c-fr-01-0009" num="0009">
<claim-text>Cellule selon la revendication 7, qui est une cellule végétale.</claim-text></claim>
<claim id="c-fr-01-0010" num="0010">
<claim-text>Plante comprenant des cellules selon la revendication 9.</claim-text></claim>
<claim id="c-fr-01-0011" num="0011">
<claim-text>Procédé de production d'une luciférase recombinante selon l'une quelconque des revendications 1 à 4, ledit procédé comprenant la culture d'une cellule selon la revendication 7 ou la croissance d'une plante selon la revendication 10.</claim-text></claim>
<claim id="c-fr-01-0012" num="0012">
<claim-text>Utilisation d'une luciférase recombinante selon l'une quelconque des revendications 1 à 4 dans un dosage bioluminescent.</claim-text></claim>
<claim id="c-fr-01-0013" num="0013">
<claim-text>Kit comprenant une luciférase recombinante selon l'une quelconque des revendications 1 à 4.</claim-text></claim>
<claim id="c-fr-01-0014" num="0014">
<claim-text>Kit selon la revendication 13, comprenant en outre de la luciférine.</claim-text></claim>
</claims>
<drawings id="draw" lang="en"><!-- EPO <DP n="31"> -->
<figure id="f0001" num="1"><img id="if0001" file="imgf0001.tif" wi="110" he="209" img-content="drawing" img-format="tif"/></figure><!-- EPO <DP n="32"> -->
<figure id="f0002" num="1"><img id="if0002" file="imgf0002.tif" wi="135" he="214" img-content="drawing" img-format="tif"/></figure><!-- EPO <DP n="33"> -->
<figure id="f0003" num="2,4"><img id="if0003" file="imgf0003.tif" wi="120" he="214" img-content="drawing" img-format="tif"/></figure><!-- EPO <DP n="34"> -->
<figure id="f0004" num="3a,3b"><img id="if0004" file="imgf0004.tif" wi="114" he="206" img-content="drawing" img-format="tif"/></figure><!-- EPO <DP n="35"> -->
<figure id="f0005" num="3c,3d"><img id="if0005" file="imgf0005.tif" wi="109" he="219" img-content="drawing" img-format="tif"/></figure><!-- EPO <DP n="36"> -->
<figure id="f0006" num="3e,3f"><img id="if0006" file="imgf0006.tif" wi="102" he="207" img-content="drawing" img-format="tif"/></figure><!-- EPO <DP n="37"> -->
<figure id="f0007" num="3g,3h"><img id="if0007" file="imgf0007.tif" wi="110" he="209" img-content="drawing" img-format="tif"/></figure><!-- EPO <DP n="38"> -->
<figure id="f0008" num="5"><img id="if0008" file="imgf0008.tif" wi="145" he="174" img-content="drawing" img-format="tif"/></figure>
</drawings>
<ep-reference-list id="ref-list">
<heading id="ref-h0001"><b>REFERENCES CITED IN THE DESCRIPTION</b></heading>
<p id="ref-p0001" num=""><i>This list of references cited by the applicant is for the reader's convenience only. It does not form part of the European patent document. Even though great care has been taken in compiling the references, errors or omissions cannot be excluded and the EPO disclaims all liability in this regard.</i></p>
<heading id="ref-h0002"><b>Patent documents cited in the description</b></heading>
<p id="ref-p0002" num="">
<ul id="ref-ul0001" list-style="bullet">
<li><patcit id="ref-pcit0001" dnum="EP680515B"><document-id><country>EP</country><doc-number>680515</doc-number><kind>B</kind></document-id></patcit><crossref idref="pcit0001">[0002]</crossref></li>
<li><patcit id="ref-pcit0002" dnum="WO9602665A"><document-id><country>WO</country><doc-number>9602665</doc-number><kind>A</kind></document-id></patcit><crossref idref="pcit0002">[0002]</crossref></li>
<li><patcit id="ref-pcit0003" dnum="EP524448A"><document-id><country>EP</country><doc-number>524448</doc-number><kind>A</kind></document-id></patcit><crossref idref="pcit0003">[0006]</crossref></li>
<li><patcit id="ref-pcit0004" dnum="WO9525798A"><document-id><country>WO</country><doc-number>9525798</doc-number><kind>A</kind></document-id></patcit><crossref idref="pcit0004">[0006]</crossref><crossref idref="pcit0007">[0033]</crossref><crossref idref="pcit0012">[0052]</crossref><crossref idref="pcit0013">[0072]</crossref></li>
<li><patcit id="ref-pcit0005" dnum="WO9846729A2"><document-id><country>WO</country><doc-number>9846729</doc-number><kind>A2</kind></document-id></patcit><crossref idref="pcit0005">[0007]</crossref></li>
<li><patcit id="ref-pcit0006" dnum="WO9914336A2"><document-id><country>WO</country><doc-number>9914336</doc-number><kind>A2</kind></document-id></patcit><crossref idref="pcit0006">[0008]</crossref></li>
<li><patcit id="ref-pcit0007" dnum="EP052448A"><document-id><country>EP</country><doc-number>052448</doc-number><kind>A</kind></document-id></patcit><crossref idref="pcit0008">[0034]</crossref></li>
<li><patcit id="ref-pcit0008" dnum="WO9518853A"><document-id><country>WO</country><doc-number>9518853</doc-number><kind>A</kind></document-id></patcit><crossref idref="pcit0009">[0035]</crossref></li>
<li><patcit id="ref-pcit0009" dnum="WO9622376A"><document-id><country>WO</country><doc-number>9622376</doc-number><kind>A</kind></document-id></patcit><crossref idref="pcit0010">[0035]</crossref></li>
<li><patcit id="ref-pcit0010" dnum="GB9801026W" dnum-type="L"><document-id><country>GB</country><doc-number>9801026</doc-number><kind>W</kind></document-id></patcit><crossref idref="pcit0011">[0035]</crossref></li>
</ul></p>
<heading id="ref-h0003"><b>Non-patent literature cited in the description</b></heading>
<p id="ref-p0003" num="">
<ul id="ref-ul0002" list-style="bullet">
<li><nplcit id="ref-ncit0001" npl-type="s"><article><author><name>YE et al.</name></author><atl/><serial><sertitle>Biochimica et Biophysica Acta</sertitle><pubdate><sdate>19970000</sdate><edate/></pubdate><vid>1339</vid></serial><location><pp><ppf>39</ppf><ppl>52</ppl></pp></location></article></nplcit><crossref idref="ncit0001">[0003]</crossref></li>
<li><nplcit id="ref-ncit0002" npl-type="s"><article><author><name>VIVIANI et al.</name></author><atl/><serial><sertitle>Biochemistry</sertitle><pubdate><sdate>19990000</sdate><edate/></pubdate><vid>38</vid></serial><location><pp><ppf>8271</ppf><ppl>8279</ppl></pp></location></article></nplcit><crossref idref="ncit0002">[0003]</crossref></li>
<li><nplcit id="ref-ncit0003" npl-type="s"><article><atl>Generation and characterisation of a thermostable mutant of luciferase from Photinus pyralis</atl><serial><sertitle>Proceedings of the International Symposium on Bioluminescence and Chemiluminescense</sertitle><pubdate><sdate>19940905</sdate><edate/></pubdate></serial><location><pp><ppf>419</ppf><ppl>222</ppl></pp></location></article></nplcit><crossref idref="ncit0003">[0009]</crossref></li>
<li><nplcit id="ref-ncit0004" npl-type="s"><article><author><name>WHITE et al.</name></author><atl/><serial><sertitle>Biochem. J.</sertitle><pubdate><sdate>19960000</sdate><edate/></pubdate><vid>319</vid></serial><location><pp><ppf>343</ppf><ppl>350</ppl></pp></location></article></nplcit><crossref idref="ncit0004">[0010]</crossref></li>
<li><nplcit id="ref-ncit0005" npl-type="s"><article><author><name>KAJIYAMA</name></author><author><name>NAKANO</name></author><atl/><serial><sertitle>Biochemistry</sertitle><pubdate><sdate>19930000</sdate><edate/></pubdate><vid>32</vid></serial><location><pp><ppf>13795</ppf><ppl>13799</ppl></pp></location></article></nplcit><crossref idref="ncit0005">[0011]</crossref></li>
<li><nplcit id="ref-ncit0006" npl-type="b"><article><atl/><book><author><name>DEVEREUX et al.</name></author><book-title>Nucleic Acid Research</book-title><imprint><name>University of Wisconsin Genetics Computer Group</name><pubdate>19840000</pubdate></imprint><vid>12</vid><location><pp><ppf>387</ppf><ppl>395</ppl></pp></location></book></article></nplcit><crossref idref="ncit0006">[0022]</crossref></li>
<li><nplcit id="ref-ncit0007" npl-type="s"><article><author><name>L. YE et al.</name></author><atl/><serial><sertitle>Biochim. Biophys Acta</sertitle><pubdate><sdate>19970000</sdate><edate/></pubdate><vid>1339</vid></serial><location><pp><ppf>39</ppf><ppl>52</ppl></pp></location></article></nplcit><crossref idref="ncit0007">[0022]</crossref></li>
<li><nplcit id="ref-ncit0008" npl-type="b"><article><atl/><book><author><name>SAMBROOK et al.</name></author><book-title>Molecular Cloning</book-title><imprint><name>Cold Spring Harbor Laboratory Press</name><pubdate>19890000</pubdate></imprint></book></article></nplcit><crossref idref="ncit0008">[0038]</crossref></li>
<li><nplcit id="ref-ncit0009" npl-type="s"><article><author><name>LIPMAN, D.J.</name></author><author><name>PEARSON, W.R.</name></author><atl>Rapid and Sensitive Protein Similarity Searches</atl><serial><sertitle>Science</sertitle><pubdate><sdate>19850000</sdate><edate/></pubdate><vid>227</vid></serial><location><pp><ppf>1435</ppf><ppl>1441</ppl></pp></location></article></nplcit><crossref idref="ncit0009">[0039]</crossref></li>
<li><nplcit id="ref-ncit0010" npl-type="s"><article><atl/><serial><sertitle>Biochemistry</sertitle><pubdate><sdate>19990000</sdate><edate/></pubdate><vid>38</vid></serial><location><pp><ppf>8271</ppf><ppl>8279</ppl></pp></location></article></nplcit><crossref idref="ncit0010">[0039]</crossref></li>
<li><nplcit id="ref-ncit0011" npl-type="s"><article><author><name>FROMANT et al.</name></author><atl/><serial><sertitle>Analytical Biochemistry</sertitle><pubdate><sdate>19950000</sdate><edate/></pubdate><vid>224</vid></serial><location><pp><ppf>347</ppf><ppl>353</ppl></pp></location></article></nplcit><crossref idref="ncit0011">[0050]</crossref><crossref idref="ncit0012">[0064]</crossref></li>
</ul></p>
</ep-reference-list>
</ep-patent-document>
