METHODS AND COMPOSITIONS BASED ON SHIGA TOXIN TYPE 2 PROTEIN

Description

Background of the invention

[0001] In general, the invention relates to the field of treating and preventing Shiga toxin associated diseases.

[0002] In the United States, Shiga toxin (Stx)-producing Escherichia coli (STEC) account for about 110,000 infections per year. Enterohemorrhagic E. coli (EHEC), most notably the serotype 0157:H7, is a subset of STEC that is noted for producing Stx mediated disease. A possible complication from an infection with a Stx-producing organism is the hemolytic uremic syndrome (HUS), which is characterized by hemolytic anemia, thrombic thrombocytopenia, and renal failure. There is approximately a 5-10% fatality rate for those with HUS and survivors may have lasting kidney damage. Currently there are no FDA approved therapies or vaccines to combat or prevent illness from a Stx-mediated disease, but several promising options for the future include: a humanized monoclonal antibody that binds to and neutralizes Stx2 and a chimeric StxA2/StxB1 toxoid that elicits a neutralizing response and provides protection against a lethal challenge of Stx1 or Stx2 or Stx1 and Stx2.

[0003] There are essentially two main types of Stxs: Stx/Stx1 and Stx2. Stx is produced from Shigella dysenteriae type 1, while Stx1 and Stx2 are produced from Escherichia coli. Stx and Stx1 are virtually identical, with only one amino acid difference in the A subunit. The mature A and B subunits of Stx1 and Stx2 have 68 and 73% similarity, respectively. Despite the amino acid sequence differences, the crystal structures of Stx and Stx2 are remarkably similar (Figure 1). These toxins can be differentiated by polyclonal antisera: polyclonal antisera raised against Stx1 does not neutralize Stx2 and vice-versa. Variants of Stx1 and Stx2 exist and include Stx1c, Stx1d, Stx2c, Stx2d, Stx2d-activatable (Stx2-act.), Stx2e, and Stx2f.

[0004] Shiga toxins are complex holotoxins with an AB₅ structure. The active domain (A), contains an N-glycosidase that depurinates the 28S rRNA of the 60S ribosomal subunit, which stops protein synthesis and eventually leads to cell death. The A subunit is ~ 32 kDa and is proteolytically cleaved by trypsin or furin into a ~ 28 kDa A₁ subunit and a ~ 5 kDa A₂ peptide which are connected through a single disulphide bond. The A₁ subunit contains the active domain, and the A₂ peptide non-covalently tethers the active domain to the binding (B) domain. The (B) domain consists of five identical ~ 7.7 kDa monomers that form a pentamer through which the C-terminus of the A₂ peptide traverses. Each of the B subunit monomers has two cysteine residues that form a disulphide bond within each monomer. The B pentamer binds the eukaryotic receptor globotriaosyl ceramide (Gb₃) (or Gb₄ as is the case for Stx2e).

[0005] Despite the known results of exposure to these toxins, currently there is no known cure or vaccine for Stx-mediated diseases. The use of antibiotics may exacerbate the situation by increasing toxin release from bacteria. Thus, there is a need for a compound to prevent or to treat the complications of EHEC infection produced by Shiga toxin. Such a compound could be used to treat infected subjects and decrease the systemic effects of toxin on the CNS, blood, and kidneys. In addition, if the toxin could be neutralized, antibiotics could be safely given to kill the bacteria in the GI tract. Antibiotic treatment for STEC infection are contraindicated due to the potential for the antibiotic to increase toxin production by inducing the phage that carries the toxin gene. Such a compound could also be used to prevent complications of infection by treating exposed or high risk individuals before they acquire EHEC infection. Such individuals would include children in day care or the elderly in nursing homes, where a case of EHEC diarrhea has been identified. These individuals are at increased risk of developing EHEC infection, often with severe complications, and spread of EHEC in these environments is not unusual.

SUMMARY OF THE INVENTION

[0006] Monoclonal antibody 11E10 recognizes the A subunit of Stx2 and neutralizes its cytotoxicity. Despite the 68% amino acid (aa) sequence similarity between StxA1 and StxA2, the 11E10 monoclonal antibody does not bind to StxA1. We have discovered that the 11E10 epitope encompasses a discontinuous, or conformational, epitope that spans three regions on the StxA2 monomer. The three regions of dissimilarity, which includes aa 42-49 (SEQ ID NO: 1), 96-100 (SEQ ID NO: 2) and 244-259 (SEQ ID NO: 3), are found to be located near each other on the crystal

[0007] Accordingly, the invention features a polypeptide that includes at least the amino acid sequence set forth in SEQ ID NO: 1. Desirably, the polypeptide includes the amino acid sequences set forth in SEQ ID NOs: 1 and 2 or, more desirably, SEQ ID NOs: 1, 2, and 3. The sequences set forth in SEQ ID NOs: 1, 2, and 3 are inserted into a non-Stx2 protein scaffold substantially identical to Stx1 or a fragment thereof, e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical. In one embodiment, the protein scaffold is Stx1 bearing one or more conservative point mutations. The polypeptide of the invention includes an amino acid sequence substantially identical to the amino acid sequence set forth in SEQ ID NO: 8. In yet another embodiment, the polypeptide may include fragments of Stx2 that include SEQ ID NOs: 1, 2, or 3; SEQ ID NOs: 1 and 2; or SEQ ID NOs: 1, 2, and 3, e.g., amino acids 29-297, amino acids 1-158, or amino acids 29-128 of the Stx2 polypeptide sequence, wherein the fragment is not full length Stx2. In some embodiments, the fragment is inserted into a protein scaffold, e.g., Stx or Stx1.

[0008] The invention also features a polypeptide that includes an amino acid sequence substantially identical to a fragment of the amino acid sequence set forth in SEQ ID NO: 8. In one embodiment, the fragment includes a sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to amino acids 64-122 of SEQ ID NO: 8 and further includes at least the amino acid sequence set forth in SEQ ID NO: 1. Preferably, the fragment further comprises the amino acid sequence(s) set forth in SEQ ID NO: 2 or SEQ ID NOS: 2 and 3. The fragment may be, e.g., 20, 40, 59, 60, 150, 200, 219, 236, 250, 300, or 314 amino acids in length. In certain embodiments, the polypeptide is toxoided. All of the polypeptides recited above are encompassed within the term "polypeptides of the invention."

[0009] The invention also includes nucleic acid molecules, including where the nucleic acid is linked to an expression construct in a vector and where this vector is inserted into a host cell, encoding any of the polypeptides of the invention.

[0010] In a related aspect, the invention features a composition for stimulating an immune response against Stx2 using any one of the polypeptides of the invention.

[0011] Desirably, the polypeptide includes the sequences set forth in SEQ ID NOs: 1 and 2 or, more desirably, 1, 2, and 3. In any of these embodiments, the composition can further include an adjuvant. In certain embodiments, the composition does not stimulate an immune response against Stx1.

[0012] The invention also features the use of any of the polypeptides of the invention (e.g., a protein scaffold such as Stx1 into which the amino acids sequences set forth in at least one, two, or all three of SEQ ID NOs: 1, 2, or 3 are inserted). Such peptides may be useful for immunization against or treatment of any Shiga toxin associated disease including hemolytic uremia syndrome and diseases associated with E. coli and S. dysenteriae infection. The peptide has at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence set forth in SEQ ID NO: 8. In another aspect, the invention features a method of producing an anti-Stx2 antibody (e.g., monoclonal and polyclonal antibodies) or fragment thereof that specifically binds to the 11E10 epitope of Stx2. Such antibodies or fragments specifically bind to Stx2 and not to Stx1. This method includes the immunization of a mammal with a polypeptide that includes a fragment of Stx2 (i.e., not full length Stx2) that includes at least one, two, or three of the sequences set forth in SEQ ID NOs: 1, 2, and 3, where this polypeptide does not include full length Stx2. Preferably the method includes the use of a polypeptide containing at least the sequence set forth in SEQ ID NO: 1, more preferably the sequences set forth in SEQ ID NOs: 1 and 2, and even more preferably the sequences set forth in SEQ ID NOs: 1, 2, and 3. The peptide includes a protein scaffold, for example a protein substantially identical to Stx1, into which one or more of the amino acid sequences set forth in SEQ ID NOs: 1, 2, and 3 are inserted. The method may include immunization of the mammal with a polypeptide containing the 11E10 epitope, for example as described herein, where the polypeptide does not include full-length Stx2. In one embodiment, a mammal is immunized with a polypeptide containing an amino acid sequence substantially identical to the amino acid sequence set forth in SEQ ID NO: 8. Anti-Stx2 antibodies produced by the above methods can be screened using standard methods known in the art or described herein including, for example, the in vitro neutralization assay, to identify antibodies that specifically bind to Stx2 and not Stx1. The immunogenic polypeptide and methods of preparing this polypeptide, along with the nucleic acid molecule that encodes this polypeptide (including where this
nucleic acid is linked to an expression construct in a vector, and where this vector is inserted into a host cell), are also included as related aspects of the invention.

[0013] The invention also features anti-Stx2 antibodies or fragments thereof that specifically bind to the 11E10 epitope of Stx2, where the antibodies or fragments thereof specifically bind to Stx2 and not Stx1. Preferred antibodies of the invention bind to an epitope that includes at least one, two, or all three of the sequences set forth in SEQ ID NOs: 1, 2, and 3, including at least SEQ ID NO: 1, more desirably including at least SEQ ID NOs: 1 and 2, and most desirably containing SEQ ID NOs: 1, 2, and 3. The antibody epitope can be a conformational epitope where the amino acid sequences are in proximity based on the conformation of the protein scaffold, for example, as in the chimeric proteins described herein, where one or more of the Stx2 sequences set forth in SEQ ID NOs: 1, 2, and 3 are inserted into a protein scaffold substantially identical to Stx1. The antibodies can be IgG, IgM, IgE, IgD, IgA, Fab, Fv, monoclonal and polyclonal antibodies, or antibody fragments and can be developed by the methods described herein. The antibodies preferably bind Stx2 with a K_d of less than 100 nM, 50 nM, 10 nM, 1 nM, 100 pM, 10 pM, or 1 pM or less. In one example, the antibody of the invention inhibits binding of the 11E10 antibody to Stx2 or to a chimeric protein containing the 11E10 epitope, including an inhibition with a K_d value of between 100 nM and 1 pM. An antibody of the invention may inhibit Stx2 binding to the eukaryotic receptor globotriaosyl ceramide (Gb3). The anti-Stx2 antibodies of the invention specifically exclude any mouse, humanized, or chimeric forms of the following antibodies 11E10, TMA-15, VTM1.1, 5C12 (including 5C12 human monoclonal antibody and r5C12), 6G3, 5H8, 11F11, 11G10, 2E1, 10E10, IG3, 2F10, 3E9, 4H9, 5A4, 5F3, 5C11, 1A4, 1A5, BC5 BB12, DC1 EH5, EA5 BA3, ED5 DF3, GB6, BA4, and cαStx2 antibodies. The invention further includes a hybridoma cell line that produces any of the antibodies of the invention.

[0014] Yet another aspect of the invention features a method of detecting Stx2 in a biological sample (e.g., tissue, cell, cell extract, bodily fluid, and biopsy sample) using any of the anti-Stx2 antibodies of the invention. Detection methods of the invention include without limitation ELISA, RIA, Western blotting, immunoprecipitation, and flow cytometry. The invention includes the diagnosis of a Shiga toxin-associated disease based on the identification of Stx2 in a sample. The invention also features an immunological test kit for detecting a Shiga toxin-associated disease, the kit including an antibody of the invention and a means for detecting an interaction between the antibody and Stx2 present in the sample.

[0015] Yet another aspect of the invention features a method of treating a Shiga toxin associated disease using an antibody as provided herein or as produced by any of the foregoing methods. Examples of Shiga toxin associated diseases include hemolytic uremia syndrome (HUS) and diseases associated with E. coli and S. dysenteriae infection. These antibodies can be administered in combination with other therapies, including, but not limited to, antibodies that specifically bind other Shiga toxin associated proteins (e.g., Stxl).

[0016] By "11E10 epitope" is meant a sequence of amino acids which, either as a result of linear structure or three dimensional conformation, forms the binding site for the 11E10 antibody. This term may include any non-full length Stx2 protein that includes sequences identical to or substantially identical to one, two, or three of the sequences set forth in SEQ ID NOs: 1, 2, and 3 (e.g., SEQ ID NOs: 1 and 2 or SEQ ID NOs: 1, 2, and 3). In desired embodiments, the 11E10 epitope includes SEQ ID NOs: 1 and 2 or 1, 2 and 3. One example of a protein that includes an 11E10 epitope is a protein that includes an amino acid sequence substantially identical to the amino acid sequence set forth in SEQ ID NO: 8.

[0017] By the terms "antibody that specifically binds to the 11E10 epitope of Stx2" or "11E10 epitope-specific antibody" is meant an antibody that binds with a K_d value of between 100 nM-1 pM to a protein that includes the 11E10 epitope. Such antibodies are also characterized by little or no detectable binding to the Stx1 protein (e.g., having a K_d value of greater than 100 nM, 200 nM, 500 nM, 1 µM, 10 µM, 100 µM, 1 mM or greater for Stx1). Antibody affinities may be determined using any of the assays known in the art including, but not limited to, surface plasmon resonance based assay, enzyme-linked immunoabsorbent assay (ELISA), and competition assays (e.g. RIA's). Also, the antibody may be subjected to an in vitro neutralization assay as described herein. An antibody that binds specifically to the 11E10 epitope may neutralize the cytotoxic effect of Stx2 by at least 10%, 20%, 30%, 40%, 50%, 75%, or greater, using the assays described herein or known in the art. The term specifically excludes the following mouse, chimeric, humanized or human forms of the following anti-Stx2 antibodies: 11E10, TMA-15, VTM1.1, 5C12 (including 5C12 human monoclonal antibody and r5C12 (Akiyoshi and Tzipori (2005) Infect. Immun. 73:4054-4061), 6G3, 5H8, 11F11, 11G10, 2E1, 10E10 (Perera et al. (1988) J. Clin. Microbiol. 26:2127-2131), IG3, 2F10, 3E9, 4H9, 5A4, 5F3, 5C11, 1A4, 1A5 (Ma et al. (2008) Immunol. Lett. 121:110-115 (2008), BC5 BB12, DC1 EH5, EA5 BA3, ED5 DF3, GB6, BA4 (Downes et al. (1988) Infect. Immun. 56:1926-1933), cαStx2 antibodies, antibodies described in Smith et al. ((2006) Vaccine 24:4122-4129), antibodies described in Donohue-Rolfe et al. ((1999) Infect Immun. 67:3645-364), and antibodies described in Sheoran et al. ((2003) Infect Immun. 71:3125-3130).

[0018] By "inhibit binding" is meant to cause a decrease in one protein binding to another protein by at least 50%, preferably 60%, 70%, 80%, 90%, or more, as measured, for example, by Western blot as described herein or by ELISA or the Gb₃ receptor binding assays known in the art.

[0019] The term "antibody" is used in the broadest sense and includes monoclonal antibodies (including full length monoclonal antibodies), polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), or antibody fragments, provided such molecules possess a desired biological activity (e.g., neutralization of the Stx2 toxin as described herein).

[0020] As used herein, "purified" or "isolated" refers to a protein that has been identified and separated and/or recovered from a component of its natural environment. Contaminant components of its natural environment are materials that would typically interfere with diagnostic or therapeutic uses for the protein, and may include enzymes, hormones, and other proteinaceous or non-proteinaceous solutes.

[0021] By "toxoided" is meant altered, for example, by mutation, conjugation, or cross-linking, in a manner to diminish cytotoxicity while maintaining antigenicity.

[0022] Toxoided versions of Stx2 include formaldehyde-and gluteraldehyde-treated Stx2 and Stx2 with a Y77S mutation. Other non-limiting examples of toxoided Stx proteins are Stx2 bearing Y77S and E167Q mutations (Wen et al. (2006) Vaccine 24: 1142-1148), Stx2 bearing a E167D and 6 histidine tag (Robinson et al. (2006) Proc. Natl. Acad. Sci. U. S. A 103:9667-9672), StxA2/StxB1 toxoid bearing Y77S, E167Q, and R170L mutations (Smith et al, Vaccine 24:4122-4129 (2006)). Other examples are described in Gordon et al. ((1992) Inflect. Immunol. 60(2):485-490).

[0023] By "non-full length Stx2" is meant a protein that contains fewer than 90%, 85%, 80%, 75%, 70%, 65%, 60%, or fewer amino acids of the full length Stx2 polypeptide. Examples of non-full length Stx2 include but are not limited to the amino acid sequences set forth in SEQ ID NOs: 4-8. Other examples include polypeptides that include or consist of amino acids 29-297, 1-158, or 29-128 of Stx2, including, for example the chimeric polypeptides provided in Figure 1A. The A subunit for wild-type Stx1, Stx2 or the chimeric toxins described within this application all have a 22 amino acid leader sequence that is removed, thus generating the mature A subunit protein.

[0024] For the purposes of this specification, the term "full-length Stx2" and the amino acid numbering of Stx2 fragments refer to the full-length mature StxA2 subunit. This mature A subunit is later asymmetrically cleaved by trypsin or furin into an A1 fragment (N-terminal ~ 248 amino acids) and a A2 peptide (C-terminal ~ 50 aa's). The A subunit, either native or chimeric in form, is usually present in the context of the holotoxin; however, expressed alone (e.g., without the B subunit), an A subunit or fragment thereof could elicit an immune response against the 11E10 epitope.

[0025] As used herein, the term "protein scaffold" or "scaffold" refers to a protein structure that has inserted into it one or more amino acid sequences of a heterologous protein, e.g., an Stx2 amino acid sequence set forth in SEQ ID NOs: 1, 2, or 3. The three-dimensional structure of a protein scaffold is known, and the fragments of the heterologous protein are inserted at strategic locations, e.g., at surface-exposed loops or at regions of structural homology between the protein scaffold and the heterologous protein. The insertion of a fragment of Stx2 may be accompanied by selective deletion of certain sequences of the protein scaffold, e.g., a sequence having structural homology to the sequence that will be inserted. In this scaffold and the heterologous protein. The insertion of a fragment of Stx2 may be accompanied by selective deletion of certain sequences of the protein scaffold, e.g., a sequence having structural homology to the sequence that will be inserted. In this instance, the non-deleted sequences of the protein scaffold may be used for determining percent sequence identity to another protein, e.g., Stx1. Exemplary proteins that have been used as protein scaffolds are Stx or Stx1 (described herein), green fluorescent protein (Abedi et al. (1998) Nucleic Acids Res. 26:623-630), and cytotoxic T-lymphocyte-associated antigen 4 (CTLA-4) (Hufton et al. (2000) FEBS lett. 475:225-231). Protein scaffolds specifically exclude a protein tag, e.g., FLAG epitope or glutathione-S-transferase, to the end of which a heterologous protein sequence is fused.

[0026] By "substantially identical" is meant a nucleic acid or amino acid sequence that, when optimally aligned, for example using the methods described below, share at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with a second nucleic acid or amino acid sequence, e.g., a Stx2, Stx1, or a chimeric protein such as the one set forth in SEQ ID NO: 8. "Substantial identity" may be used to refer to various types and lengths of sequence, such as full-length sequence, epitopes or immunogenic peptides, functional domains, coding and/or regulatory sequences, exons, introns, promoters, and genomic sequences. Percent identity between two polypeptides or nucleic acid sequences is determined in various ways that are within the skill in the art, for instance, using publicly available computer software such as Smith Waterman Alignment (Smith, T. F. and M. S. Waterman (1981) J. Mol. Biol. 147:195-7); "Best Fit" (Smith and Waterman (1981) Advances in Applied Mathematics, 482-489) as incorporated into GeneMatcher PIus^TM(Schwarz and Dayhof (1979) Atlas of Protein Sequence and Structure, Dayhoff, M.O., Ed pp 353-358); BLAST program (Basic Local Alignment Search Tool (Altschul, S. F., W. Gish, et al. (1990) J. Mol. Biol. 215: 403-10), BLAST-2, BLAST-P, BLAST-N, BLAST-X, WU-BLAST-2, ALIGN, ALIGN-2, CLUSTAL, or Megalign (DNASTAR) software. In addition, those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the length of the sequences being compared. In general, for proteins, the length of comparison sequences can be at least 5 amino acids, preferably 10, 25, 50, 100, 150, 200, 300, or 315 amino acids or more up to the entire length of the protein. For nucleic acids, the length of comparison sequences can generally be at least 15, 75, 150, 300, 450, 600, 900, or 945 nucleotides or more up to the entire length of the nucleic acid molecule. It is understood that for the purposes of determining sequence identity when comparing a DNA sequence to an RNA sequence, a thymine nucleotide is equivalent to a uracil nucleotide. In one embodiment, the sequence identity of a protein, for example, the mature A subunit of a Shiga toxin protein, can be measured over the length of a fragment of SEQ ID NO: 8, e.g., from amino acids 64 to 122 or 64 to 282 of SEQ ID NO: 8. For amino acid sequences, conservative substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid, asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine.

[0027] By "fragment" is meant a portion of a polypeptide or nucleic acid molecule that contains less than 100% of the entire length of the reference nucleic acid molecule or polypeptide, preferably, at least 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%. A fragment may contain, e.g., 10, 15, 75, 150, 300, 450, 600, 900, or 945 or more nucleotides or 4, 5, 10, 25, 50, 100, 150, 200, 300, 315 amino acids or more. Fragments of Shiga toxin type 1 or Shiga toxin type 2 protein can include any portion that is less than the full-length protein, for example, a fragment of 4, 5, 8, 10, 25, 50, 100, 150, 200, 300, 315, or more amino acids in length. In one example, a fragment includes amino acids 64 to 122 or 64 to 282 of SEQ ID NO: 8.

[0028] By "Shiga toxin associated disease" is meant any disease resulting from a pathogen expressing a Shiga toxin. The term "Shiga toxin associated disease" is meant to include hemolytic uremia syndrome, shigellosis, and diseases resulting from Shiga toxin-producing Escherichia coli and S. dysenteriae infection.

BRIEF DESCRIPTION OF DRAWINGS

[0029] 

Figure 1A illustrates initial hybrid Stx1/Stx2 A subunits. Stx1 is presented in black, Stx2 is depicted in white. The names of the chimeric toxins are shown to the left of the respective chimeric proteins, and the regions of Stx2 are listed beneath the chimeric A subunits.

Figure 1B shows Western blot analyses of Stx1, Stx2 and the initial chimeric toxins probed with rabbit anti-Stx1 and anti-Stx2 polyclonal (top panel) or monoclonal 11E10 (bottom panel). Lanes 1 and 2 contain 25 ng of purified Stx1 or Stx2 respectively. Lanes 3 to 8 contain the following chimeric toxins: lane 3, Stx1(2A_29-2970); lane 4, Stx1(2A_1-158); lane 5, Stx1(2A_29-128); lane 6, Stx1(2A_29-76); lane 7, Stx1(2A_42-76); lane 8, Stx1(2A_42-49).

Figure 1C shows the percent neutralization of the initial chimeric toxins with the 11E10 monoclonal antibody. The neutralization data were normalized such that the % neutralization of full-length Stx2 was set to 100% (actual % neutralization = 65%) and the neutralization levels for the rest of the toxins are given as a percent of the normalized full-length Stx2 neutralization. The error bars represent the standard error of the normalized values.

Figure 2A shows amino acid alignment of StxA1 and StxA2 in the three regions that comprise the 11E10 monoclonal antibody epitope. The black and gray amino acids depict conserved and non-conserved amino acids, respectively; the dots represent identical residues. The three regions of the 11E10 monoclonal antibody epitope are as follows: region A (StxA2 residues 42-49), region B (StxA2 residues 96-100); region C (StxA2 residues 244-259). The numbering of the amino acids shown in the alignments is in respect to the StxA1 mature protein. StxA1 has an extra amino acid at position 185; this addition causes region C the epitope in StxA2 to be one number different than the corresponding region of Stx1.

Figure 2B shows a ribbon diagram of the Stx2 crystal structure that shows the Stx2 A₁ and B subunits in light grey, except for three regions of the 11E10 monoclonal antibody epitope. Regions A (green), B (blue), and C (cyan) are labeled with black, gray, and white arrows, respectively. The A₂ peptide is depicted in black, and the active site (red) is marked with an asterisk.

Figure 2C shows a spacefill representation of the Stx2 crystal structure. Regions A, B, and C are indicated with arrows.

Figure 3A illustrates second generation chimeric toxins that contain chimeric A subunits. Stx1 is presented in black, while Stx2 is depicted in white. The names of the chimeric toxins are shown to the left of the respective chimeric proteins and the regions of Stx2 are listed beneath the chimeric A subunits. Region A, B, and C refer to amino acids 42-49 (SEQ ID NO: 1), 96-100 (SEQ ID NO: 2), 244-259 (SEQ ID NO: 3), respectively of StxA2.

Figure 3B depicts Western blot analyses of Stx1, Stx2, and the five second generation chimeric toxins probed with rabbit anti-Stx1 (top panel) or the 11E10 monoclonal antibody (bottom panel). Lane 1 contains 25 ng of purified Stx2. Lanes 2 to 6 contain the following chimeric toxins: lane 2, Stx1 +A; lane 3, Stx1 +AB; lane 4, Stx1 +AC; lane 5, Stx1 +BC; lane 6, Stx1 +ABC.

Figure 3C shows neutralization of the second generation hybrid toxins by the 11E10 monoclonal antibody. The level of Stx2 neutralization was normalized to100% as in Fig. 1C. The error bars represent the standard error of the normalized values.

Figure 4A shows Western blot analyses of Stx2 and Stx2 variants with the 11E10 monoclonal antibody. Lane 1 contains 25 ng of purified Stx2. Lanes 2 to 5 contain the following toxins: lane 2, Stx2c; lane 3, Stx2d; lane 4, Stx2d_act; lane 5, Stx2e. The Western blots were probed with either rabbit anti-Stx2 polyclonal antibodies (top panel) or the monoclonal antibody 11E10 (bottom panel).

Figure 4B depicts the percent neutralization by 11E10 of the Stx2 variants. The level of Stx2 neutralization was normalized to 100% as in Fig. 1C. The error bars represent the standard error of the normalized values.

Figure 5 depicts protein synthesis inhibition measured by translation of luciferase mRNA in rabbit reticulocyte lysate. A 0.2 ng aliquot of purified Stx2 was mixed with 0, 0.2, or 2 ng 11E10 and added to reticulocyte lysates. Protein synthesis inhibition was indicated by a reduction of translation of luciferase mRNA and was measured by bioluminescence after addition of the toxin-treated lysate to luciferin substrate. A 2 ng sample of the isotype-matched irrelevant antibody 13C4 was mixed with 2 ng Stx2 as a negative control. Error bars represent the 95% confidence interval calculated from the standard error of the means ratio. Probability values derived from a two-tailed Student's t-Test indicates a significant difference in bioluminescence signal between samples with and without antibody (p < 0.005).

Figures 6A-6J shows that monoclonal antibody 11E10 alters the overall cellular distribution of Stx2 in Vero cells. Stx2 was mixed with PBS (A, H-J) or 11E10 (B, C and E-G) and then added to Vero cells for 6h. As a control, 11E10 was added to Vero cells in the absence of Stx2 (D). The toxin was detected with polyclonal antibodies against Stx2 followed by secondary antibody conjugated with AlexaFluor 488 (A and B), while 11E10 was detected with anti-mouse IgG conjugated with AlexaFluor 488 (C and D). Stx2 colocalization with the early endosome marker EEA1 was assessed by double labeling of intoxicated cells. Stx2 distribution in the presence (Panel E) and absence (Panel H) of antibody 11E10 was visualized with anti-Stx2 monoclonal 11F11 and green fluorescent secondary antibody. The distribution of endosome marker EEA1 was visualized with goat anti-EEA1 and red fluorescent secondary antibodies (Panels F and I). These staining patterns were superimposed (Panels G and J), and colocalization of toxin with endosomes was indicated by a yellow-orange coloration, indicated by arrows.

Figures 7A-7D show the amino acid sequence of Stx2 Region A (SEQ ID NO: 1) (Fig. 7A), Stx2 Region B (SEQ ID NO: 2) (Fig. 7B), Stx2 Region C (SEQ ID NO: 3) (Fig. 7C), and Stx2e Region B (SEQ ID NO: 19) (Fig. 7D).

Figure 8A shows the amino acid sequence of the Stx1+A chimera (SEQ ID NO: 4). The processed leader sequence is underlined, and the Stx2 A region is boldly underlined. The unprocessed protein is 315 amino acids in length; the mature protein is 293 amino acids in length.

Figure 8B shows the amino acid sequence of the Stx1+AB chimera (SEQ ID NO: 5). The processed leader sequence is underlined, and the Stx2 A and B regions are boldly underlined. The unprocessed protein is 315 amino acids in length; the mature protein is 293 amino acids in length.

Figure 8C shows the amino acid sequence of the Stx1+AC chimera (SEQ ID NO: 6). The processed leader sequence is underlined, and the Stx2 A and C regions are boldly underlined. The unprocessed protein is 315 amino acids in length; the mature protein is 293 amino acids in length.

Figure 8D shows the amino acid sequence of the Stx1+BC chimera (SEQ ID NO: 7). The processed leader sequence is underlined, and the Stx2 B and C regions are boldly underlined. The unprocessed protein is 315 amino acids in length; the mature protein is 293 amino acids in length.

Figure 8E shows the amino acid sequence of the Stx1+ABC chimera (SEQ ID NO: 8). The processed leader sequence is underlined, and the Stx2 A, B, and C regions are boldly underlined. The unprocessed protein is 315 amino acids in length; the mature protein is 293 amino acids in length.

Figure 9A shows the DNA sequence of the Stx1 operon (SEQ ID NO: 9) beginning at the StxA1 start codon and ending at the StxB1 stop codon.

Figure 9B shows the DNA sequence of StxA1 (SEQ ID NO: 10) beginning at the StxA1 start codon and ending at the StxA1 stop codon.

Figure 9C shows the DNA sequence of StxB1 (SEQ ID NO: 11) beginning at the StxB1 start codon and ending at the StxB1 stop codon.

Figure 10A shows the amino acid sequence of StxA1 (SEQ ID NO: 12). The processed leader sequence is underlined. The unprocessed protein is 315 amino acids in length; the mature protein is 293 amino acids in length.

Figure 10B shows the amino acid sequence of StxB1 (SEQ ID NO: 13). The processed leader sequence is underlined. The unprocessed protein is 89 amino acids in length; the mature protein is 69 amino acids in length.

Figure 11A shows the DNA sequence of the Stx2 operon (SEQ ID NO: 14) beginning at the StxA2 start codon and ending at the StxB2 stop codon.

Figure 11B shows the DNA sequence of StxA2 (SEQ ID NO: 15) beginning at the StxA2 start codon and ending at the StxA2 stop codon.

Figure 11C shows the DNA sequence of StxB2 (SEQ ID NO: 16) beginning at the StxB2 start codon and ending at the StxB2 stop codon.

Figure 12A shows the amino acid sequence of StxA2 (SEQ ID NO: 17). The processed leader sequence is underlined. The unprocessed protein is 319 amino acids in length; the mature protein is 297 amino acids in length.

Figure 12B shows the amino acid sequence of StxB2 (SEQ ID NO: 18). The processed leader sequence is underlined. The unprocessed protein is 89 amino acids in length; the mature protein is 70 amino acids in length.

DETAILED DESCRIPTION OF THE INVENTION

[0030] In general, the invention features compositions and methods related to discovery of the 11E10 epitope of the Stx2 protein. We have found that the 11E10 epitope includes at least one, two, or three of the sequences set forth in SEQ ID NOs: 1, 2, and 3. The compositions and methods of the invention may be useful for the detection, treatment, or prevention of Shiga toxin-associated diseases. For example, a subject having, or at risk of developing, a Shiga toxin associated disease (e.g., hemolytic uremia syndrome and diseases associated with E. coli and S. dysenteriae infection) can be treated with a peptide containing the 11E10 epitope or with antibodies that specifically bind to the 11E10 epitope of the Stx2 protein.

I. INDICATIONS

[0031] Shiga toxin associated diseases include those resulting from infection with Shiga toxin producing S. dysenteriae or Enterohemorrhagic E. coli (EHEC), most notably the serotype O157:H7 These infections often result in hemolytic uremic syndrome (HUS), which is characterized by hemolytic anemia, thrombotic thrombocytopenia, and renal failure.

[0032] The compounds and methods of the invention are useful for treating subjects having, or at risk of developing a Shiga toxin associated disease. Such subjects would include children in day care or the elderly in nursing homes. In one example, the subject is in a day care or in a nursing home where a case of EHEC diarrhea has been detected. In this example, the subject may or may not have developed the disease. The methods and compositions of the invention may be used to treat the infection in the individual infected with EHEC, to detect other infected individuals, and to prevent the spread of EHEC in the day care or nursing home.

II. ANTIBODIES

[0033] The invention includes the production of antibodies which specifically bind to the 11E10 epitope of the Shiga toxin type 2 (Stx2) protein and the antibodies themselves. Desirably, such an antibody does not detectably bind to Stx1. The unique ability of antibodies to recognize and specifically bind to target proteins provides approaches for both diagnosing and treating diseases related to Shiga toxin-producing Escherichia coli (STEC). The invention provides for the production of antibodies, including, but not limited to, polyclonal and monoclonal antibodies, anti-idiotypic antibodies, murine and other mammalian antibodies, antibody fragments, bispecific antibodies, antibody dimers or tetramers, single chain antibodies (e.g., scFv's and antigen-binding antibody fragments such as Fabs, diabodies, and Fab' fragments), recombinant binding regions based on antibody binding regions, chimeric antibodies, primatized antibodies, humanized and fully human antibodies, domain deleted antibodies, and antibodies labeled with a detectable marker, or coupled with a toxin or radionuclide. Such antibodies are produced by conventional methods known in the art. In one aspect, the invention includes the preparation of monoclonal antibodies or antibody fragments that specifically bind to the 11E10 epitope of Stx2 where the preparation includes the use of a polypeptide which contains at least one, two, or three sequences selected from the sequences set forth in SEQ ID NOs: 1, 2, or 3. One example is the protein set forth in of SEQ ID NO: 8.

Polyclonal Antibodies

[0034] Polyclonal antibodies can be prepared by immunizing rabbits or other animals by injecting antigen followed by subsequent boosts at appropriate intervals. The animals are bled and the sera are assayed against purified protein usually by ELISA.

[0035] Polyclonal antibodies that specifically bind to the 11E10 epitope can be raised in animals by multiple subcutaneous (sc) or intraperitoneal (ip) injections of the antigen and an adjuvant. It may be useful to conjugate the peptide containing the 11E10 epitope to a protein that is immunogenic in the species to be immunized (e.g., keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin, or soybean trypsin inhibitor) using a bifunctional or derivatizing agent (e.g., maleimidobenzoyl sulfosuccinimide ester (conjugation through cysteine residues), N-hydroxysuccinimide (through lysine residues), glutaraldehyde, or succinic anhydride).

[0036] For example, animals can be immunized against the 11E10 epitope, immunogenic conjugates, or derivatives by combining 1 µg to 1 mg of the peptide or conjugate (for rabbits or mice, respectively) with 3 volumes of Freund's complete adjuvant and injecting the solution intradermally at multiple sites. One month later the animals are boosted with 1/5 to 1/10 the original amount of peptide or conjugate in Freund's complete adjuvant by subcutaneous injection at multiple sites. Seven to 14 days later the animals are bled and the serum is assayed for antibody titer to the antigen or a fragment thereof. Animals are boosted until the titer plateaus. Preferably, the animal is boosted with the conjugate of the same polypeptide, but conjugated to a different protein and/or through a different cross-linking reagent. Conjugates also can be made in recombinant cell culture as protein fusions. Also, aggregating agents such as alum are suitably used to enhance the immune response.

[0037] Chimeric, humanized, or fully human polyclonals may be produced in animals transgenic for human immunoglobulin genes, or by isolating two or more Stx2 reactive B-lymphocytes from a subject for starting material.

[0038] Polyclonals may also be purified and selected for (such as through affinity for a conformationally constrained antigen peptide), iteratively if necessary, to provide a monoclonal antibody. Alternatively or additionally, cloning out the nucleic acid encoding a single antibody from a lymphocyte may be employed.

Monoclonal Antibodies

[0039] In another embodiment of the invention, monoclonal antibodies are obtained from a population of substantially homogeneous antibodies (i.e., the individual antibodies including the population are identical except for possible naturally occurring mutations that may be present in minor amounts). Thus, the term monoclonal indicates the character of the antibody as not being a mixture of discrete antibodies.

[0040] Monoclonal antibodies can be prepared by methods known in the art, such as the hybridoma method of Kohler and Milstein by fusing splenocytes from immunized mice with continuously replicating tumor cells such as myeloma or lymphoma cells. (Kohler and Milstein (1975) Nature 256: 495 - 497; Gulfre and Milstein (1981) Methods in Enzymology: Immunochemical Techniques 73: 1 - 46, Langone and Banatis eds., Academic Press). The hybridoma cells are then cloned by limiting dilution methods and supernates assayed for antibody production by ELISA, RIA, or bioassay. In another embodiment, monoclonals may be made by recombinant DNA methods.

[0041] For preparation of monoclonal antibodies (Mabs) that specifically bind the 11E10 epitope, any technique that provides for the production of antibody molecules by continuous cell lines in culture may be used. For example, the hybridoma technique originally developed by Kohler and Milstein ((1975) supra, as well as in Kohler and Milstein (1976) Eur J lmmunol. 6: 511 - 519; Kohler et al. (1976) Eur J Immunol. 6: 292 -295; Hammerling et al. (1981) in: Monoclonal Antibodies and T-Cell Hybridomas, Elsevier, N.Y., pp. 563 - 681), and the trioma technique, the human B-cell hybridoma technique (Kozbor et al. (1983) Immunol Today 4: 72 - 79), and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al. (1985) in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77 - 96). Such antibodies may be of any immunoglobulin class including IgG, IgM, IgE, IgA, IgD and any subclass thereof. The hybridoma producing the Mabs in the invention may be cultivated in vitro or in vivo. In an additional embodiment of the invention, monoclonal antibodies can be produced in germ-free animals utilizing technology known in the art.

[0042] In general, a mouse or other appropriate host animal, such as a hamster, is immunized with the a polypeptide that includes the 11E10 epitope to induce lymphocytes that produce or are capable of producing antibodies that can specifically bind to the antigen or fragment thereof used for immunization. Alternatively, lymphocytes are immunized in vitro.

[0043] The splenocytes of the immunized host animal (e.g., a mouse) are extracted and fused with a suitable cell line, e.g., a myeloma cell line, using a suitable fusing agent, such as polyethylene glycol, to form a hybridoma cell (Goding (1986) Monoclonal Antibodies: Principles and Practice, pp. 59 - 103, Academic Press). Any suitable myeloma cell line may be employed in accordance with the present invention; however, preferred myeloma cells are those that fuse efficiently, support stable high-level production of antibody by the selected antibody-producing cells, and are sensitive to a medium such as HAT medium. Among these, preferred myeloma cell lines are murine myeloma lines, such as those derived from MOPC-21 and MPC-11 mouse tumors available from the Salk Institute Cell Distribution Center, San Diego, Calif. USA, and SP-2 cells available from the American Type Culture Collection, Rockville, Md. USA.

[0044] The hybridoma cells thus prepared may be seeded and grown in a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused, parental myeloma cells. The hybridoma cells obtained through such a selection and/or culture medium in which the hybridoma cells are being maintained can then be assayed to identify production of monoclonal antibodies that specifically bind the 11E10 epitope. Preferably, the binding specificity of monoclonal antibodies produced by hybridoma cells is determined by immunoprecipitation or by an in vitro binding assay, such as radioimmunoassay (RIA) or enzyme-linked immunoabsorbent assay (ELISA) or using a Biacore instrument. The binding affinity of the monoclonal antibody can, for example, be determined by the Scatchard analysis of Munson and Rodbard ((1980) Anal Biochem. 107: 220-239).

[0045] After hybridoma cells are identified that produce antibodies of the desired specificity, affinity, and/or activity, the clones may be subcloned by limiting dilution procedures and grown by standard methods (Goding, supra). In addition, the hybridoma cells may be grown in vivo as ascites tumors in an animal. The monoclonal antibodies secreted by the subclones are suitably separated from the culture medium, ascites fluid, or serum by conventional immunoglobulin purification procedures such as, for example, protein A-Sepharose, hydroxyapatite chromatography, gel electrophoresis, dialysis, or affinity chromatography.

[0046] DNA encoding the monoclonal antibodies of the invention is readily isolated and sequenced using conventional procedures (e.g., using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies). The hybridoma cells of the invention serve as a preferred source of such DNA. Once isolated, the DNA may be placed into expression vectors, which are then transfected into host cells such as E. coli cells, COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin protein, to obtain the synthesis of monoclonal antibodies in the recombinant host cells (see e.g., Skerra et al. (1993) Curr Opin Immunol. 5: 256 - 262 and Pluckthun (1992) Immunol Rev. 130: 151 - 188).

[0047] The DNA also may be modified, for example, by substituting all or part of the coding sequence for human heavy- and light-chain constant domains in place of the homologous murine sequences (Morrison et al. (1984) Proc Natl Acad Sci. U.S.A. 81: 6851 - 6855), or by covalently joining to the immunoglobulin coding sequence all or part of the coding sequence for a non-immunoglobulin polypeptide. In that manner, chimeric or hybrid antibodies are prepared that have the binding specificity of an anti-11E10 epitope monoclonal antibody. Typically such non-immunoglobulin polypeptides are substituted for the constant domains of an antibody of the invention, or they are substituted for the variable domains of one antigen-combining site of an antibody of the invention to create a chimeric bivalent antibody including one antigen-combining site having specificity for the 11E10 epitope according to the invention and another antigen-combining site having specificity for a different antigen.

Modified Antibodies

[0048] Modified antibodies of the invention include, but are not limited to, chimeric monoclonal antibodies (for example, human-mouse chimeras), human monoclonal antibodies, and humanized monoclonal antibodies. A chimeric antibody is a molecule in which different portions are derived from different animal species, such as those having a human immunoglobulin constant region and a variable region derived from a murine mAb (see, e.g., U.S. Patent Nos. 4,816,567 and 4,816,397). Humanized forms of non-human (e.g., murine) antibodies are chimeric immunoglobulins, immunoglobulin chains, or fragments thereof (such as Fv, Fab, Fab', F(ab')₂ or other antigen-binding subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobulin, such as one or more complementarity determining regions (CDRs) from the non-human species and a framework region from a human immunoglobulin molecule (see, e.g., U.S. Patent No. 5,585,089).

[0049] Humanized antibodies include human immunoglobulins (recipient antibody) in which residues from a complementary-determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity, and capacity. In some instances, Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues. Humanized antibodies may also include residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences. In general, the humanized antibody will include substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin, and all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence. The humanized antibody optimally also will include at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin.

[0050] Chimeric and humanized monoclonal antibodies can be produced by recombinant DNA techniques known in the art, for example using methods described in WO 87/02671; EP 184,187; EP 171,496; EP 173,494; WO 86/01533; US 4,816,567; EP 125,023; Better et al. (1988) Science 240: 1041 - 1043; Liu et al. ((1987) Proc Natl Acad Sci. U.S.A. 84: 3439 - 3443); Liu et al. ((1987) J Immunol. 139: 3521 - 3526); Sun et al. ((1987) Proc Natl Acad Sci. U.S.A. 84: 214 - 218); Nishimura et al. ((1987) Cancer Res. 47: 999 - 1005); Wood et al. ((1985) Nature 314: 446 - 449); Shaw et al. ((1988) JNatl Cancer Inst. 80: 1553 - 1559); Morrison ((1985) Science 229: 1202 - 1207); Oi et al. ((1986) Biotechniques. 4: 214); US 5,225,539; Jones et al. ((1986) Nature 321: 552 - 525); Verhoeyan et al. ((1988) Science 239: 1534); and Beidler et al. ((1988) J lmmunol. 141: 4053 - 4060). See below for a further discussion of humanized antibodies and methods related thereto.

[0051] Another highly efficient means for generating recombinant antibodies is disclosed by Newman ((1992) Biotechnology. 10: 1455 - 1460). See also U.S. Patent Nos. 5,756,096; 5,750,105; 5,693,780; 5,681,722; and 5,658,570.

[0052] Methods for humanizing non-human antibodies are well known in the art. Humanization may be essentially performed following the method of Winter and coworkers as described above (including Jones et al.0 ((1986) Nature 321: 522 - 525); Riechmann et al. ((1988) Nature 332: 323 - 327); Verhoeyen et al. ((1988) Science 239: 1534 - 1536), by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody. Accordingly, such humanized antibodies are chimeric antibodies (see U.S. Patent Nos. 4,816,567 and 6,331,415). In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.

[0053] The choice of human variable domains, both light and heavy, to be used in making the humanized antibodies is very important to reduce antigenicity. According to the so-called best-fit method, the sequence of the variable domain of a rodent antibody is screened against the entire library of known human variable-domain sequences. The human sequence which is closest to that of the rodent is then accepted as the human framework (FR) for the humanized antibody (Sims et al. (1993) J Immunol. 151: 2296 - 2308; Chothia and Lesk (1987) J Mol Biol. 196: 901 - 917). Another method uses a particular framework derived from the consensus sequence of all human antibodies of a particular subgroup of light or heavy chains. The same framework may be used for several different humanized antibodies (Carter et al. (1992) Proc Natl Acad Sci. U.S.A. 89: 4285 - 4289; Presta et al. (1993) J Immunol. 151: 2623 - 2632).

[0054] It is also desired that antibodies be humanized with retention of high affinity for the antigen (i.e., the 11E10 epitope of Stx2) and other favorable biological properties. To achieve this goal, humanized antibodies are prepared through an analysis of the parental sequences and various conceptual humanized products using three-dimensional models of the parental and humanized sequences. Three-dimensional immunoglobulin models are commonly available and are familiar to those skilled in the art. Computer programs are available which illustrate and display probable three-dimensional conformational structures of selected candidate immunoglobulin sequences. Inspection of these displays permits analysis of the likely role of the residues in the functioning of the candidate immunoglobulin sequence, i.e., the analysis of residues that influence the ability of the candidate immunoglobulin to bind its antigen. In this way, FR residues may be selected and combined from the consensus and import sequences so that the desired antibody characteristic, such as increased affinity for the target antigen(s), is achieved. In general, the CDR residues are directly and most substantially involved in influencing antigen binding.

[0055] Completely human antibodies are useful for therapeutic treatment of human subjects. Such antibodies may be produced, for example, using transgenic mice which are incapable of expressing endogenous immunoglobulin heavy and light chain genes, but which can express human heavy and light chain genes. The transgenic mice may be immunized in the normal fashion with a selected antigen, e.g., a polypeptide that includes the 11E10 epitope. For examples, see PCT Publication Nos. WO 94/02602, WO 00/76310; U.S. Patent Nos. 5,545,806; 5,545,807; 5,569,825; 6,150,584; 6,512,097; and 6,657,103; Jakobovits et al. ((1993) Proc Natl Acad Sci. U.S.A. 90: 2551); Jakobovits et al. ((1993) Nature 362: 255 -258); Bruggemann et al. ((1993) Year in Immunol. 7: 33 - 40); Mendez et al. ((1997) Nat Gene. 15: 146 - 156), and Green and Jakobovits ((1998) JExp Med. 188: 483 - 495).

[0056] Human monoclonal antibodies can also be made by the hybridoma method. Human myeloma and mouse-human heteromyeloma cell lines for the production of human monoclonal antibodies have been described, for example, by Kozbor ((1984) J Immunol. 133: 3001 - 3005); Brodeur et al. ((1987) Monoclonal Antibody Production Techniques and Applications, pp. 51 - 63, Marcel Dekker, Inc., New York); and Boerner et al. ((1991) J Immunol. 147: 86 - 95).

[0057] Completely human antibodies which recognize a selected epitope can also be generated using a technique referred to as guided selection. In this approach, a selected non-human monoclonal antibody, e.g. a mouse antibody, is used to guide the selection of a completely human antibody recognizing the same epitope (Jespers et al. (1994) Biotechnology. 12: 899 - 903).

[0058] Examples of techniques which can be used to produce single-chain Fvs and antibodies include those described in U.S. Patent Nos. 4,946,778 and 5,258, 498; Huston et al. ((1991) Meth Enzymol. 203: 46 - 88); Shu et al. ((1993) Proc Natl Acad Sci. U.S.A. 90: 7995 - 7999); and Skerra et al. ((1988) Science 240: 1038 - 1040).

[0059] Alternatively, phage display technology (McCafferty et al. (1990) Nature 348: 552 - 553) can be used to produce human antibodies and antibody fragments in vitro, from immunoglobulin variable (V) domain gene repertoires from non-immunized donors. Phage display can be performed in a variety of formats. See, for example, Johnson and Chiswell ((1993) Curr Opin Struct Biol. 3: 564 - 571). Several sources of V-gene segments can be used for phage display. Clackson et al. ((1991) Nature 352: 624 - 628) isolated a diverse array of anti-oxazolone antibodies from a small random combinatorial library of V genes derived from the spleens of immunized mice. A repertoire of V genes from non-immunized human donors can be constructed and antibodies to a diverse array of antigens (including self-antigens) can be isolated essentially following the techniques described by Marks et al. ((1991) J Mo/ Biol. 222: 581 - 597), or Griffith et al. ((1993) EMBO J. 12: 725 - 734).

[0060] The invention provides functionally-active fragments, derivatives or analogues of the immunoglobulin molecules which specifically bind to a protein that includes the 11E10 epitope. Functionally-active in this context means that the fragment, derivative, or analogue is able to induce anti-anti-idiotype antibodies (i.e. tertiary antibodies) that recognize the same antigen that is recognized by the antibody from which the fragment, derivative or analogue is derived. Specifically, in a preferred embodiment, the antigenicity of the idiotype of the immunoglobulin molecule may be enhanced by deletion of framework and CDR sequences that are C-terminal to the CDR sequence that specifically recognizes the antigen. To determine which CDR sequences bind the antigen, synthetic peptides containing the CDR sequences can be used in binding assays with the antigen by any binding assay method known in the art.

[0061] The present invention provides antibody fragments such as, but not limited to, F(ab')₂, F(ab)₂, Fab', Fab, and scFvs. Antibody fragments which recognize specific epitopes may be generated by known techniques, e.g., by pepsin or papain-mediated cleavage.

[0062] The invention also provides heavy chain and light chain dimers of the antibodies of the invention, or any minimal fragment thereof such as Fvs or single chain antibodies (SCAs) (e.g., as described in U.S. Patent No. 4,946,778; Bird ((1988) Science 242: 423 - 42); Huston et al. ((1988) Proc Natl Acad Sci. U.S.A. 85: 5879 - 5883); and Ward et al. ((1989) Nature 334: 544 - 54), or any other molecule with the same specificity as the antibody of the invention. Single chain antibodies are formed by linking the heavy and light chain fragments of the Fv region via an amino acid bridge, resulting in a single chain polypeptide. Techniques for the assembly of functional Fv fragments in E. coli may be used (Skerra et al. (1988) Science 242: 1038 - 1041).

[0063] Alternatively, a clone encoding at least the Fab portion of the antibody may be obtained by screening Fab expression libraries (e.g., as described in Huse et al. ((1989) Science 246: 1275 - 1281)) for clones of Fab fragments that bind the specific antigen or by screening antibody libraries (see, e.g., Clackson et al. ((1991) Nature 352: 624 - 628) and Hanes and Pluckthun ((1997) Proc Natl Acad Sci. U.S.A. 94: 4937 - 4942)).

[0064] In other embodiments, the invention provides fusion proteins of the immunoglobulins of the invention, or functionally active fragments thereof. In one example, the immunoglobulin is fused via a covalent bond (e.g., a peptide bond), at either the N-terminus or the C-terminus to an amino acid sequence of another protein (or portion thereof, preferably at least an 10, 20 or 50 amino acid portion of the protein) that is not the immunoglobulin. Preferably the immunoglobulin, or fragment thereof, is covalently linked to the other protein at the N-terminus of the constant domain. As stated above, such fusion proteins may facilitate purification, increase half-life in vivo, and enhance the delivery of an antigen across an epithelial barrier to the immune system.

[0065] In another embodiment, the invention provides for the compositions and use of pooled antibodies, antibody fragments, and the other antibody variants described herein.

Therapeutic Administration

[0066] The invention also features the administration of antibodies developed using the methods above (e.g., antibodies which specifically bind the 11E10 epitope of Stx2) to subjects having, or at risk of developing a Shiga toxin associated disease.

[0067] The antibodies of the invention will be formulated, dosed, and administered in a fashion consistent with good medical practice. Factors for consideration in this context include the particular disorder being treated, the particular subject being treated, the clinical condition of the individual subject, the cause of the disorder, the site of delivery of the agent, the method of administration, the scheduling of administration, and other factors known to medical practitioners. The therapeutically effective amount of antibody that specifically binds to the 11E10 epitope of Stx2 to be administered will be governed by such considerations, and is the minimum amount necessary to prevent, ameliorate, treat, or stabilize, a Shiga toxin associated disease, or symptoms associated therewith. The antibody specific for the 11E10 epitope need not be, but is optionally formulated with one or more agents currently used to prevent or treat Shiga toxin associated diseases (e.g., antibodies specific for Stx1, including13C4, or humanized or chimeric derivatives thereof). The effective amount of such other agents depends on the amount of antibody specific for the 11E10 epitope of Stx2 present in the formulation, the type of disorder or treatment, and other factors discussed above.

[0068] The antibody is administered by any suitable means, including parenteral, subcutaneous, intraperitoneal, intrapulmonary, and intranasal. Parenteral infusions include intramuscular, intravenous, intraarterial, intraperitoneal, or subcutaneous administration. In addition, the antibody is suitably administered by pulse infusion, particularly with declining doses of the antibody. Preferably the dosing is given by injections, most preferably intravenous or subcutaneous injections, depending in part on whether the administration is brief or chronic.

III. VACCINES

[0069] The invention features compositions for stimulating an immune response against the Stx2 protein.

[0070] Individuals having or at risk of developing a Shiga toxin associated disease can be treated by administration of a composition (e.g., a vaccine) containing the 11E10 epitope of the invention, where the polypeptide does not include full-length Stx2 polypeptide or the processed StxA2 subunit, preferably in an immunogenically effective amount. The composition can be administered prophylacticly and/or therapeutically.

[0071] Different types of vaccines can be developed according to standard procedures known in the art. For example, a vaccine may be a peptide-based (see, for example, Smith et al. ((2006) Vaccine 24:4122-4129)), nucleic acid-based (e.g., see Bentacor et al., "DNA vaccine encoding the enterohemorragic Escherichia coli 1 (EHEC) Shiga-like toxin 2 (Stx2) A2 and B subunits confers protective immunity to Stx challenge in the murine model" Clin. Vaccine Immunol. (e-publication ahead of print, PMID 19176691)), bacterial- or viral-based vaccines. A vaccine formulation containing a polypeptide or nucleic acid that encodes the polypeptide that includes the 11E10 epitope may contain a variety of other components, including stabilizers. The vaccine can also include or be co-administered with, one or more suitable adjuvants. The ratio of adjuvant to the polypeptide that includes the 11E10 epitope in the vaccine may be determined by standard methods by one skilled in the art.

[0072] In another embodiment, peptide vaccines may utilize peptides including the 11E10 epitope or functional derivatives thereof as a prophylactic or therapeutic vaccine in a number of ways, including: 1) as monomers or multimers of the same sequence, 2) combined contiguously or non-contiguously with additional sequences that may facilitate aggregation, promote presentation or processing of the epitope (e.g., class I/II targeting sequences) and/or an additional antibody, T helper or CTL epitopes to increase the immunogenicity of the 11E10 epitope, 3) chemically modified or conjugated to agents that would increase the immunogenicity or delivery of the vaccine (e.g., fatty acid or acyl chains, KLH, tetanus toxoid, or cholera toxin), 4) any combination of the above, 5) any of the above in combination with adjuvants, including but not limited to inorganic gels such as aluminium hydroxide, and water-in-oil emulsions such as incomplete Freund's adjuvant, aluminum salts, saponins or triterpenes, MPL, cholera toxin, ISCOM'S®, PROVAX®, DETOX®, SAF, Freund's adjuvant, Alum®, Saponin®, among others, and particularly those described in U.S. Patent Nos. 5,709,860; 5,695,770; and 5,585,103; and/or in combination with delivery vehicles, including but not limited to liposomes, VPLs or virus-like particles, microemulsions, attenuated or killed bacterial and viral vectors, and degradable microspheres (see e.g., Kersten and Hirschberg ((2004) Expert Rev of Vaccines. 3: 453 - 462); Sheikh et al. ((2000) Curr Opin Mol Ther. 2: 37-54)), and 6) administered by any route or as a means to load cells with antigen ex vivo.

[0073] Dosages of a polypeptide that includes an 11E10 epitope, where the polypeptide is not full length Stx2, administered to the individual as either a prophylactic therapy or therapy against a Shiga toxin associated disease can be determined by one skilled in the art. Generally, dosages will contain between about 10 µg to 1,000 mg, preferably between about 10 mg and 500 mg, more preferably between about 30 mg and 120 mg, more preferably between about 40 mg and 70 mg, most preferably about 60 mg of the polypeptide that includes the 11E10 epitope.

[0074] At least one dose of the polypeptide that includes the 11E10 epitope will be administered to the subject, preferably at least two doses, more preferably four doses, with up to six or more total doses administered. It may be desirable to administer booster doses of the polypeptide that includes the 11E10 epitope at one or two week intervals after the last immunization, generally one booster dose containing less than or the same amount of the 11E10 epitope as the initial dose administered. In one example, the immunization regimen will be administered in four doses at one week intervals. Since a polypeptide or a nucleic acid may be broken down in the stomach, the immunization is preferably administered parenterally (e.g., subcutaneous, intramuscular, intravenous, or intradermal injection). The progress of immunized subjects may be followed by general medical evaluation, screening for infection by serology and/or gastroscopic examination.

IV. EXAMPLES

Example 1

[0075] Monoclonal antibody 11E10 recognizes the A₁ subunit of Stx2. The binding of 11E10 to Stx2 neutralizes both the cytotoxic and lethal activities of Stx2, but the monoclonal antibody does not bind to or neutralize Stx1 despite the 55% identity and 68% similarity in the amino acids of the mature A subunits. In this study, we sought to identify the segment(s) on Stx2 that constitutes the 11E10 epitope and to determine how recognition of that region by 11E10 leads to inactivation of the toxin. Toward those objectives, we generated a set of chimeric Stxl/Stx2 molecules and then evaluated the capacity of 11E10 to recognize those hybrid toxins by Western blot analyses and to neutralize them in Vero cell cytotoxicity assays. We also compared the amino acid sequences and crystal structures of Stx1 and Stx2 for stretches of dissimilarity that might predict a binding epitope on Stx2 for 11E10. Through these assessments, we concluded that the 11E10 epitope is comprised of three noncontiguous regions surrounding the Stx2 active site. To ask how 11E10 neutralizes Stx2, we examined the capacity of 11E10/Stx2 complexes to target ribosomes. We found that the binding of 11E10 to Stx2 prevented the toxin from inhibiting protein synthesis in an in vitro assay but also altered the overall cellular distribution of Stx2 in Vero cells. We propose that the binding of the 11E10 monoclonal antibody to Stx2 neutralizes at least some if not all of the effects of the toxin and may do so by preventing the toxin from reaching or inactivating the ribosomes.

[0076] We have investigated passive immunization strategies to neutralize the Stxs associated with STEC infections (Dowling et al. (2005) Antimicrob. AgentsChemother. 49:1808-1812, Edwards et al. (1998) In J. B. Kaper and A. D. O'Brien (ed.), Escherichia coli O157:H7 and other Shiga toxin-producing E. coli strains. ASM Press, Washington, DC., Kimura et al. (2002) Hybrid. Hybridomics. strains. ASM Press, Washington, DC., Kimura et al. (2002) Hybrid. Hybridomics. 21:161-168, Ma et al. (2008) Immunol. Lett. 121:110-115, Mukherjee et al. (2002) Inflect. Immun. 70:612-619, Mukherjee et al. (2002) Infect. Immun. 70:5896-5899.). Our passive immunization strategy is based on murine monoclonal antibodies developed in this laboratory that specifically bind to and neutralize Stx/Stx1 or Stx2 (Strockbine et al. (1985) Infect. Immun. 50:695-700, Perera et al. (1988) J Clin. Microbiol. 26:2127-2131). The monoclonal antibody 11E10 was generated by immunization of BALB/c mice with Stx2 toxoided by treatment with formaldehyde ( Perera et al., supra). By Western blot analysis, the 11E10 monoclonal antibody specifically recognizes the A₁ fragment of Stx2 and neutralizes Stx2 for Vero cells and mice but does not bind to or neutralize Stx/Stx1 (Edwards et al., supra;, Perera et al. supra). The murine 11E10 monoclonal antibody was modified to contain a human constant region to reduce the potential for an antibody recipient to generate an anti-mouse antibody response. This human/mouse chimeric antibody, called cαStx2, successfully underwent Phase I clinical testing (Dowling et al., supra). In this report, we define the epitope on the A subunit of Stx2 recognized by the murine 11E10 monoclonal antibody (and, therefore, also by cαStx2) on the A subunit of Stx2, and present evidence that the monoclonal antibody blocks the enzymatic action of the toxin in vitro and also alters toxin trafficking in Vero cells.

Materials and Methods

Bacterial strains, plasmids, purified Stx1 and Stx2, and monoclonal antibodies 11E10 and 13C4.

[0077] Bacteria were grown in Luria-Bertani (LB) broth or on LB agar (Becton Dickinson and Company, Sparks, MD) supplemented with 100 µg/ml of ampicillin as needed for selection of recombinant plasmids. Bacterial strains and plasmids used in this study are listed in Table 1. Stx1 and Stx2 were purified by affinity chromatography as described previously (Melton-Celsa and O'Brien (2000) p. 385-406. In Handbook of Experimental Pharmacology, vol. 145. Springer-Verlag, Berlin) and the monoclonal antibodies 11E10, 11F11 (specific for Stx2 (Perera et al.,supra), and 13C4 (specific for Stx1 (Strockbine et al. (1985) Infect. Immun. 50:695-700)] were produced in this laboratory and deposited with BEI Resources (Manassas, VA).

Table 1. Bacterial strains and plasmids used in this study.

Strain or plasmid	Relevant characteristics	Source or reference
E. coli strains
Dh5α	F-_80 dlacZ_M15 (lacZYA-argF)Ul69 endA1 recAlhsdR17(rK-mK +) deoR thi-1 phoA supE44 -gyrA96 relA1	Gibco BRL
XL10 Gold	Tetr Δ(mcrA)183 Δ(mcrCB-hsdSMR-mrr)173 endAl supE44 thi-1 recA1 gyrA96 relAl lac Hte [F' proAB lacIqZΔM15 Tn10 (Tetr) Amy Camr]	Stratagene
B121 (DE3)	F-ompT hsdSB (rBmb-) gal dcm (DE3)	Novagen
EH250	E .coli Ount:H12 isolate; Stx2d producer	Pierard et al. (1998) J Clin Microbiol 36: 3317-3322
Cloning Vectors
pBluescript II KS	E. coli cloning vector (Ampr)	Stratagene
pTRCHIS2c	E. coli expression vector (ampr	Invitrogen
Recombinant plasmids
pCKS120	pBR328 toxin clone of stx2c	Lindgren et al. (1994) Infect. Immun. 62: 623-631
pJES101	pKS (-) toxin clone of stx2e	Samuel et al. (1990) Infect. Immun. 58: 611-618
pSQ543	pSK (-) toxin clone of stx2dact	Lindgren et al. (1994) Infect. Immun. 62: 623-631
pMJS1	pBluescript II KS (-) toxin clone of stx1	Smith et al. (2006) Vaccine 24: 4122-4129
pMJS2	pBluescript II KS (-) toxin clone of stx2	Smith et al. (2006) Vaccine 24: 4122-4129
pMJS9	pBluescript II KS (-) toxin clone, chimeric stxA1-stxA2 gene (StxA2 = amino acids 29-297 + StxB2)	This study
pMJS10	pBluescript II KS (-) toxin clone, chimeric stxA1-stxA2 gene (StxA2 = amino acids 1-158)	This study
pMJS11	pTrcHis2 C toxin clone, chimeric stxA1-stxA2 gene (StxA2 = amino acids 1-158)	This study
pMJS 13	pBluescript II KS (-) toxin clone, chimeric stxA1-stxA2 gene (StxA2 = amino acids 29-128)	This study
pMJS15	pBluescript II KS (-) toxin clone, chimeric stxA1-stxA2 gene (StxA2 = aa 29-76)	This study
pMJS16	pBluescript II KS (-) toxin clone, chimeric stxA1-stxA2 gene (StxA2 = amino acids 42-76)	This study
pMJS28	pBluescript II KS (-) toxin clone, chimeric stxA1-stxA2 gene (StxA2 = amino acids 42-49)	This study
pMJS49	pTrcHis2 C toxin clone of stx1	This study
pMJS49A	pTrcHis2 C toxin clone, chimeric stxA1-stxA2 gene (StxA2 = amino acids 42-49)	This study
pMJS49AB	pTrcHis2 C toxin clone, chimeric stxA1-stxA2 gene (StxA2 = amino acids 42-49, 96-100)	This study
pMJS49AC	pTrcHis2 C toxin clone, chimeric stxA1-stxA2 gene (StxA2 = amino acids 42-49, 244-259)	This study
pMJS49BC	pTrcHis2 C toxin clone, chimeric stxA1-stxA2 gene (StxA2 = amino acids 96-100, 244-259)	This study
pMJS49ABC	pTrcHis2 C toxin clone, chimeric stxA1-stxA2 gene (StxA2 = amino acids 42-49, 96-100, 244-259)	This study
pMJS50	pTrcHis2 C toxin clone of stx2	Robinson et al. (2006) PNAS 103: 9667-9672
pMJS52	pTrcHis2 C toxin clone of stx2c	This study
pMJS59	pTrcHis2 C toxin clone of stx2d	This study
pMJS49ABC*	pMJS49ABC with Y77S mutation	This study

Construction of chimeric toxin plasmids.

[0078] Six chimeric toxin genes that contained portions of both stxA₁ and stxA₂ were generated by PCR with the splicing by overlap extension (SOE) protocol (Higuchi (1989) p. 61-70. In H. A. Erlich (ed.), PCR technology. Stockton Press, New York), and the PCR products were ligated into pBluescript II KS (-) (Stratagene, La Jolla, CA). The chimeric toxin genes contained the native promoters and Shine-Dalgarno sequences, and the levels of toxin expression from five of the clones were sufficient under those conditions. To increase the level of expression of the A subunit from one clone (pMJS11), the toxin operon was amplified by PCR a second time and an optimized Shine-Dalgarno sequence [TAAGGAGGACAGCTATG (the optimized Shine-Dalgarno sequence is underlined and the translational start site for StxA2 is bolded) SEQ ID NO: 20] was added upstream of stxA₂. This latter PCR product was ligated into the pTrcHis2 C expression vector (Invitrogen, Carlsbad, CA) that has an isopropyl-β-D-thiogalactopyranoside (IPTG)-inducible promoter. All primers used in this study are listed in Table 2. The DNA sequence of each construct created for this study was confirmed prior to use.

Table 2. Synthetic oligonucleotide primers used in this study

Primer	Sequence (5'-3')a'b	Purpose/ region of homology
MJS1		stx1 upstream primer, used to generate pMJS9, pMJS13, pMJS15, pMJS16 and pMJS28
MJS2		stx1 downstream primer, used to generate pMJS10, pMJS11, pMJS13, pMJS15, pMJS16 and pMJS28
MJS5		stx2 upstream primer, used to generate pMJS10
MJS6		Stx2 downstream primer, used to generate pMJS9
2A29F	GAACATATATCTCAGGGGACCAC (SEQ ID NO: 25)	Used with 1A28R to generate pMJS9, pMJS13 and pMJS15
1A28R		Used with 2A29F to generate pMJS9, pMJS13 and pMJS15
1A159F	TTACGGTTTGTTACTGTGACAGCTGAAGC (SEQ ID NO: 27)	Used with 2A158R to generate pMJS10 and pMJS11
2A158R		Used with 1A159F to generate pMJS10 and pMJS11
1A129F	CAGATAAATCGCCATTCGTTGA (SEQ ID NO: 29)	Used with 2A128R to generate pMJS13
2A128R		Used with 1A129F to generate pMJS13
2A42F		Used with 1A41R to generate pMJS16
1A41R		Used with 2A42F to generate pMJS16
1A77F	TATGTGACAGGATTTGTTAACAGGAC (SEQ ID NO: 33)	Used with 2A76R to generate pMJS15
2A76R		Used with 1A77F to generate pMJS15
1A51		stxA1 upstream primer #1 with optimized Shine-Dalgarno sequence, used to generate pMJS49
1A52		stxA1 upstream primer #2 with optimized Shine-Dalgarno sequence, used to generate pMJS49
1BC1	GGTGGTGGTGACGAAAAATAACTTCGCTGAATCC (SEQ ID NO: 37)	stxB1 His-tagged downstream primer #1, used to generate pMJS49
1BC2	CAGTGGTGGTGGTGGTGGTGACGAAAAATAAC (SEQ ID NO: 38)	stxB1 His-tagged downstream primer #2, used to generate pMJS49
BC3	GATCGAATTCTCAGTGGTGGTGGTGGTGGTG (SEQ ID NO: 39)	stxB1 His-tagged downstream primer #3, used to generate pMJS49 and pMJS52
MSAF		Used with MSAR to generate pMJS28, pMJS49A, pMJS49AB, pMJS49AC and pMJS49ABC
MSAR		Used with MSAF to generate pMJS28, pMJS49A, PMJS49AB, pMJS49AC and pMJS49ABC
96100F		Used with 96100R to generate pMJS49AB, pMJS49BC and pMJS49ABC
96100R		Used with 96100F to generate pMJS49AB, pMJS49BC and pMJS49ABC
JCT1F		C region primer #1, used with JCT1R to generate pMJS49AC, pMJS49BC and
		pMJS49ABC
JCT1R	TTCTGGTTGACTCTCTTCATTCAC (SEQ ID NO: 45)	C region primer #1, used with JCT1F to generate pMJS49AC, pMJS49BC and pMJS49ABC
JCT2F		C region primer #2, used with JCT2R to generate pMJS49AC, pMJS49BC and pMJS49ABC
JCT2R	ATGATGACAATTCAGTATTAATGCC (SEQ ID NO: 47)	C region primer #2, used with JCT2F to generate pMJS49AC, pMJS49BC and pMJS49ABC
2A51		stxA2 upstream primer # 1 with optimized Shine-Dalgarno sequence, used to generate pMJS11 and pMJS52
2A52	GATCGGATCCTAAGGAGGACAGCTATGAAGTGTA (SEQ ID NO: 49)	stxA2 upstream primer #2 with optimized Shine-Dalgarno sequence, used to generate pMJS11 and pMJS52
C12B	GGTGGTGGTGGTCATTATTAAACTGCACTTC (SEQ ID NO: 50)	stxB2 His-tagged downstream primer #1, used to generate pMJS52
C22B	CAGTGGTGGTGGTGGTGGTGGTCATTATTAAA (SEQ ID NO: 51)	stxB2 His-tagged downstream primer #2, used to generate pMJS52
2dF	GATCGGATCCCTGGTATCGTATTACTTCAGCC (SEQ ID NO: 52)	Used with 2dR to generate pMJS59
2dR	GATCGAATTCCTGCACACTACGAAACCAGC (SEQ ID NO: 53)	Used with 2dF to generate pMJS59
1Y77SF	TCAGTGACAGGATTTGTTAACAGGAC (SEQ ID NO: 54)	Used with 1Y77SR to generate pMJS49ABC*
1Y77SR		Used with 1Y77SF to generate pMJS49ABC*

a Restriction enzyme sites are underlined. b Mutagenic codon sites are in bold.

[0079] Five additional His-tagged chimeric toxins were generated from an stx₁ clone that contained six histidine codons immediately downstream of the B gene (Fig. 2A). The toxins produced by these chimeras contain one, two, or three regions from the Stx2 A subunit (hereafter referred to as regions A, B, and C) that comprise the putative 11E10 monoclonal antibody epitope in place of the comparable sequence in Stx1. Regions A, B, and C refer to amino acids 42-49 (SEQ ID NO: 1), 96-100 (SEQ ID NO: 2), and 244-259 (SEQ ID NO: 3), respectively, of the Stx2 A subunit. The five chimeric toxins made were named: Stx1 +A (containing the chimeric Stx2 A sequence set forth in SEQ ID NO: 4), Stx1 +AB (containing the chimeric Stx2 A sequence set forth in SEQ ID NO: 5), Stx1 +AC (containing the chimeric Stx2 A sequence set forth in SEQ ID NO: 6), Stx1 +BC (containing the chimeric Stx2 A sequence set forth in SEQ ID NO: 7), or Stx1 +ABC (containing the chimeric Stx2 A sequence set forth in SEQ ID NO: 8).

Generation and purification of partially toxoided Stx1 +ABC.

[0080] The Stx1 +ABC toxin was partially toxoided by changing the tyrosine residue at position 77 of the A subunit to a serine residue by the SOE protocol. The Y77S mutation decreased the 50% cytotoxic dose (CD₅₀) for Vero cells from 10⁶ to 10² CD₅₀s per ml of induced culture. This 4-log reduction in cytotoxicity after the Y77S mutation was introduced is similar to that which has been previously reported for the Y77S mutation in Stx1 (Deresiewicz et al. (1992) Biochemistry 31:3272-3280).

[0081] The Stx1 +ABC toxoid was purified with a nickel affinity column as previously described (Smith et al. (2006) Infect. Immun. 74:6992-6998). The concentration of the toxoid was determined by bicinchoninic acid assay (Pierce, Rockford, IL). A silver-stain of a sodium dodecyl sulfate-polyacrylamide gel revealed that the A and B subunits of the chimeric toxoid were the two major bands present, although other minor bands were observed (data not shown).

Construction of Stx2c and Stx2d variant clones.

[0082] A clone that expressed His-tagged Stx2c was created by PCR as previously described for Stx2 (Robinson et al. (2006) Proc. Natl. Acad. Sci. U. S. A 103:9667-9672). The stx_2d clone was generated by PCR from E. coli EH250 with primers 2DF and 2DR (Pierard et al. (1998) J. Clin. Microbiol. 36:3317-3322). The PCR product was ligated into the expression vector pTrcHis2 C. That stx_2c and stx_2d were amplified correctly was confirmed by sequence analyses.

Western blot analyses

[0083] Purified Stx1, Stx2, or sonic lysates of bacteria that expressed chimeric Stx1/Stx2 toxins were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and then examined by Western blot as previously described (Smith et al., supra ). The concentrations of the A subunits in sonic lysates that contained Stx1, Stx2, or the chimeric toxins were estimated as follows. First, the specific dilutions of rabbit anti-Stx1 and anti-Stx2 rabbit polyclonal antibodies that detected the purified A subunits from Stx1 or Stx2, respectively, to relatively equivalent levels were determined through the use of NIH Image J software, http://rsb.info.nih.gov/nih-image. Second, the chimera-containing sonic lysates were separated by SDS-PAGE, the resulting gels were then transferred to nitrocellulose, and those blots then probed with a mixture of rabbit anti-Stx1 and anti-Stx2 rabbit polyclonal antibodies diluted as determined above. Third, the bands that corresponded to the chimeric A subunits in each lane were quantified with the NIH Image J program to determine the toxin concentration in each lysate sample. Fourth, two additional polyacrylamide gels were loaded with purified Stx1, Stx2 or samples of the chimera-containing lysates normalized to contain equivalent concentrations (as determined from step 3). The toxin preparations were then subjected to SDS-PAGE followed by Western blot analysis with a mixture of rabbit anti-Stx1 and rabbit anti-Stx2 polyclonal antibodies (Figure 1B top panel) (blot 1) or 11E10 monoclonal antibody (Figure 1B bottom panel)(blot 2). The secondary antibodies used in these Westerns were goat anti-rabbit Immunoglobulin G (IgG) conjugated to Horseradish peroxidase [(HRP) Bio-Rad, Hercules, CA] at a dilution of 1:15,000 for blot 1 (Figure 1B top panel) and goat anti-mouse IgG conjugated to HRP (Bio-RAD, Hercules, CA) at a dilution of 1:3,000 for blot 2 (Figure 1B bottom panel). The bound secondary antibodies were detected by chemiluminescence with the ECL-Plus Western blotting detection kit (Amersham Bioscience, Little Chalfont, Buckinghamshire, England).

[0084] Western blots were also performed on sonic lysates of clones that expressed Stx2, Stx2c, Stx2d, Stx2d_act or Stx2e. First, the concentration of the A subunits from these toxin samples was determined as described above, except that only rabbit anti-Stx2 polyclonal antibodies was used as a probe. Then two additional polyacrylamide gels were loaded with equivalent quantities of the normalized samples, and Western blots were conducted with either rabbit anti-Stx2 polyclonal antibodies or the 11E10 monoclonal antibody as the primary antibodies. The secondary antibodies and method of detection were the same as described above.

In vitro neutralization assays on Vero cells.

[0085] In vitro neutralization assays of sonic lysates from bacteria that contained Stx1, Stx2, the chimeric Stx1/Stx2 toxins, Stx2c, Stx2d, Stx2d_act, or Stx2e were carried out with 11E10 on Vero cells (ATCC, Manassas, VA) as described previously (Marques et al. (1986) J lnfect. Dis. 154:338-341; Smith et al., supra). In brief, equal volumes of samples that contained toxin (one to three CD₅₀s) in Eagle's Minimal Essential Medium (EMEM) and purified 11E10 monoclonal antibody (0.5 mg/ml) in EMEM were mixed together and incubated for 2 h at 37°C and 5% CO₂. The toxin-antibody mixture was then overlaid onto subconfluent Vero cells in 96-well plates and incubated for 48 h. The Vero cells were then fixed, stained, and the optical density at 600 nm (OD₆₀₀) was determined. These neutralization experiments were done at least twice in duplicate. The capacity of the 11 E10 monoclonal antibody to neutralize the cytotoxic effect of the toxin in the sonic lysates was determined by comparing the cell viability in wells in which toxin alone or toxin and antibody were added. The percent neutralization of the toxins by the antibody was calculated by the following formula. Percent neutralization: [(Average OD₆₀₀ of toxin + Antibody wells - Average OD₆₀₀ of toxin only wells)/(Average OD₆₀₀ of cells only wells - Average OD₆₀₀ toxin only wells)] x 100. The 11E10 monoclonal antibody neutralized Stx2 to about 65% of wild-type activity. To make it easier to compare the percent neutralization levels of the toxin derivatives by the 11E10 monoclonal antibody, the data were normalized such that the amount of neutralization of Stx2 by 11E10 was set to 100%, and the neutralization levels of the other toxins were calculated relative to that of Stx2.

Immunization and challenge of mice

[0086] Preimmune sera were collected from CD-1 male mice that weighed 14-16 g (Charles River Laboratories, Boston, MA). These serum samples were used in enzyme-linked immunosorbent assays (ELISA) to determine if the mice had pre-existing titers to Stx1 or Stx2. None of the mice showed an immune response to either toxin at the start of the study. The mice were then divided into two groups: a sham-inoculated group (hereafter called negative-control group) and a group that was immunized with the chimeric toxoid. Mice in the negative control group were immunized intrapcritoneally with a mixture of PBS and TiterMax, a water-in-oil-adjuvant (TiterMax, USA Inc., Norcross, GA). The second group of mice was immunized intraperitoneally with 1 ug of toxoid mixed with TiterMax. The mice were boosted at 3-week intervals for a total of four boosts. Two weeks after the last boost, five negative-control mice and five toxoid-immunized mice were challenged intraperitoneally with 10 times the 50% lethal dose (LD₅₀) of Stx1 (1,250 ng), and 29 negative control mice and 34 toxoid-immunized mice were challenged with 5 LD₅₀s of Stx2 (5 ng).

In vitro protein synthesis inhibition assays.

[0087] Rabbit reticulocyte lysate, firefly luciferase mRNA, and luciferin substrate were purchased from Promega Corporation (Madison, WI). Stx2 (4 ng/µl) was combined with an equal volume of antibody (at 4 or 40 ng/µl), and 1 µl of the toxin/antibody mixture was combined with 9 µl reticulocyte lysate. The mixture was incubated at 30° C to allow toxin to inactivate ribosomes in the lysate. After 1 hour, an aliquot of luciferase mRNA and amino acids that had been heated to 70° C for 2 min was added, and the solution was incubated for an additional 90 min to allow the in vitro protein synthesis to proceed. All assays were done in triplicate. Luciferase activity was measured by adding 1 µl of the lysate mixture to 20 µl of luciferin substrate in clear 96 well plates (Fisher Scientific, Pittsburgh, PA). Bioluminescent light emission was detected with a Kodak Image Station 440CF in a 10 min exposure. Luminescent signal was analyzed by summation of total signal intensity within a circular area that corresponded to a single well.

Localization of 11E10 in intoxicated cells

[0088] Vero cells were seeded in 8 well tissue culture slides (Thermo Fisher Scientific, Rochester, NY) at a concentration of 1 X 10⁵ cells/ml and allowed to adhere for 24 hrs at 37°C in an atmosphere of 5% CO₂. Stx2 (0.2 ml of 10 ng/ml) was mixed with 10 ng of purified 11E10 monoclonal antibody or with PBS as a negative control. The antibody/toxin or PBS/toxin solutions were incubated with Vero cells for 6 h, and then the cells were fixed with buffered formalin (Formalde-Fresh, Fisher Scientific, Pittsburgh, PA) and permeabilized with 0.001% Triton-X100 (Pierce, Rockford, IL) in PBS. All immunostaining procedures were done in PBS with 3% bovine serum albumin (BSA, Sigma, St. Louis MO). The presence of monoclonal antibody 11E10 within the cells was detected with Alexa-Fluor 488 labeled donkey anti-mouse IgG (Invitrogen, Carlsbad, CA). Total Stx2 within the intoxicated cells was labeled with rabbit anti-Stx2 polyclonal antibodies, and Alexa-Fluor 488-conjugated donkey anti-rabbit IgG was used as the secondary antibody (Invitrogen, Carlsbad, CA). Stx2 and endosome double labeling was accomplished with anti-Stx2 monoclonal antibody 11F11 (Perera et al., supra), BEI Resources, Manassas, VA) and anti-EEA1 (C-15) goat polyclonal antibodies (Santa Cruz Biotechnology, Santa Cruz, CA), respectively, and Alexa-Fluor labeled secondary antibodies. After incubation with the appropriate primary and secondary antibodies, the cells were fixed with formalin for 20 min at 37° C, and the slides were mounted with SlowFade medium (Invitrogen, Carlsbad, CA). Images at 40x magnification of the bound fluorophore-labeled secondary antibodies were obtained via an Olympus microscope with reflected light fluorescence attachment and a Spot CCD digital camera (Diagnostic Instrument Products, Sterling Heights, MI). Fluorescence images were processed and overlaid with Adobe Photoshop (Adobe Systems, San Jose, CA).

Results

Interaction of initial chimeric toxins with monoclonal antibody 11E10.

[0089] To determine the portion of Stx2 that interacts with the 11E10 monoclonal antibody, we constructed an initial set of six chimeric toxin operons that contained different regions of the stxA₂ gene inserted in place of the corresponding region of stxA₁ (Fig. 1A). Western blots of purified Stx1, Stx2, or lysates from E. coli DH5α that express one of the six different chimeric Stx1/Stx2 toxins were probed with the 11E10 monoclonal antibody. The antibody reacted strongly with Stx2 and the chimeric toxins that contained the amino acids from the following regions of the Stx2 A subunit: 29-297, 1-158, and 29-128 (Fig. 1B). The chimeric toxin with the minimal portion of Stx2 that was still recognized by 11E10, albeit weakly, contained just eight amino acids from StxA2, region 42-49.

[0090] Next, the capacity of the 11E10 monoclonal antibody to neutralize the toxicity of bacterial lysates that contained Stx1, Stx2, or one of the six initial chimeric toxins for Vero cells was examined. As expected, the 11E10 monoclonal antibody neutralized Stx2 but did not neutralize Stx1 (Fig. 1C). However, the hybrid toxins with region 1-158 or 29-297 from StxA2 were about 85% neutralized by 11E10 compared to Stx2, a result that suggested that important components of the 11E10 epitope lie between residues 29-158 of Stx2. In contrast, the chimeric toxin with amino acids 29-128 from Stx2 was recognized strongly in the immunoblot but was only neutralized to about 32% of the level of Stx2. Together these findings suggest that the 11E10 neutralizing epitope encompasses a larger number of amino acids than are required for binding of 11E10 to Stx1(2A_29-128) in a Western blot and, therefore, that a portion of the neutralizing epitope is missing from this hybrid. The other three chimeric toxins that were weakly detected by the 11E10 monoclonal antibody in the Western blot analysis were not appreciably neutralized by 11E10 (less than 15%) when compared to the normalized level of Stx2 neutralization. Taken together, these results indicate that one or more key components of the 11E10 neutralizing epitope on Stx2 exist outside of amino acids 29-76.

Analyses of differences between the Stx1 and Stx2 A subunit amino acid sequences and crystal structures.

[0091] The Western blot and neutralization analyses of the first set of chimeric toxins indicated that the 11E10 epitope required at least amino acids 42-49 of the Stx2 A subunit (SEQ ID NO: 1) for toxin detection but also revealed that additional amino acids were needed for full recognition and toxin neutralization. Therefore, the amino acid sequences of the mature A subunits from Stx1 and Stx2 were aligned to identify additional unique stretches of amino acids that might be involved in recognition and neutralization of Stx2 by 11E10. Next, the crystal structures of Stx (Fraser et al. (1994), supra) and Stx2 (Fraser et al. (2004), supra) (Protein Data Bank accession numbers 1RQ4 and 1R4P, respectively) were compared using the Deep View/Swiss-PDB viewer to assess the location of regions of sequence differences between the toxins in the three dimensional structures and the proximity of such regions to each other. As established earlier, the eight amino acids that span residues 42-49 in the Stx2 A subunit form part of the 11E10 binding site and are hereafter referred to as region A or SEQ ID NO: 1 (Fig. 2A; Region A underscored amino acids). When the eight amino acids from region A were viewed in the context of the Stx2 crystal structure, they appeared to form a major bend in the toxin structure (as indicated in green and by a black arrow in Fig. 2B and also as indicated in Fig. 2C) and, in addition, were found on the outside face of Stx2, near the active site cleft around amino acid 167.

[0092] A second dissimilar area between the A subunits of Stx1 and Stx2 was identified when the amino acid sequences and the crystal structures of these two toxins were compared, a segment we called region B or SEQ ID NO: 2 (see Fig. 2A; Region B underscored amino acids). Region B spans five residues in the A subunit of Stx2 (₉₆THISV₁₀₀) (SEQ ID NO: 2) and four out of the five amino acids in this region differ between Stx1 and Stx2 (Fig. 2A). Although region B is approximately 50 amino acids away from region A, this portion of amino acids extends toward region A in the Stx2 crystal structure (region B is indicated in blue and by a gray arrow in Fig. 2B). The close proximity of region A to region B in a three-dimensional structure is even more apparent in a space-filling model (Fig. 2C).

[0093] The third dissimilar area between the A subunits of Stx1 and Stx2, which we named region C or SEQ ID NO: 3, overlaps the furin cleavage site around residue 246 of Stx2 (see Fig. 2A; Region C underscored amino acids). Region C was identified not only because of amino acid sequence differences between Stx1 and Stx2 in that location, but also because comparison of the crystal structures of Stx and Stx2 indicated that region C (as indicated in cyan and by a white arrow in Fig. 2C) was in spatial proximity to regions A and B. From our analyses of the Stx and Stx2 crystal structures we concluded that regions A, B, and C cluster on the same face of Stx2 relatively near the catalytic active site (as best seen in Fig. 2C).

Interaction of the second generation chimeric toxins with monoclonal antibody 11E10.

[0094] To determine whether regions B and C were part of the 11E10 epitope, we produced a second set of chimeric toxins that contained various combinations of regions A, B, or C from Stx2 in place of the corresponding regions on Stx1 (Fig. 3A). Next, Western blots of Stx1, Stx2 or the chimeric toxins were probed with 11E10 (Fig. 3B, bottom panel). The 11E10 monoclonal antibody detected all of the toxins that contained region A (Stx2, Stx1 +A, Stx1 +AB, Stx1 +AC, and Stx1 +ABC) (Fig 3B, bottom panel). The toxins missing region A were not detected by the 11E10 monoclonal antibody (Stx1 and Stx1 +BC), a finding that confirms that region A is an essential component of the 11E10 epitope. However, the two chimeric toxins that incorporated regions A and B (Stx1 +AB or Stx1 +ABC) appeared to be more strongly detected by the 11E10 monoclonal antibody than chimeric toxins that included region A alone or A combined with region C (Fig. 3B, bottom panel). Collectively, these results indicate that both regions A and B are important for full 11E10 recognition of the toxin.

[0095] We next assayed sonic lysates of each of the five second generation chimeric toxins (Fig. 3A) for in vitro neutralization by the 11E10 monoclonal antibody. The antibody neutralized the chimeric toxin that contained regions A, B, and C (Stx1 +ABC) to approximately 65% of the level of Stx2 neutralization. In contrast, the chimeric toxins that contained only regions A and B (Stx1 +AB) or A and C (Stx1 +AC) were neutralized to about half the neutralization level of the Stx1 +ABC chimera, (Fig. 3C). No appreciable neutralization by 11E10 was observed against the Stx1 +A or Stx1 +BC chimeric toxins (approximately 6.9 and 4.3% respectively). Since more extensive (> 50%) neutralization of the chimeric toxins required regions A, B, and C from Stx2, we concluded that all three regions (A, B, and C) are necessary for > 50% neutralization by 11E10.

Western blot and in vitro neutralization assay results with Stx2 and Stx2 variants and the 11E10 monoclonal antibody.

[0096] To determine which of the Stx2 variants could be recognized and/or neutralized by 11E10, Stx1, Stx2, or the Stx2 variants (Stx2c, Stx2d, Stx2d_act and Stx2e) were analyzed by Western blot. Stx2 and all of the Stx2 variants were recognized by 11E10, although Stx2e was detected to a much lesser extent (Fig. 4A, bottom panel). This weak detection of Stx2e by 11E10 in the Western blot format is consistent with our previous report that 11E10 was unable to detect Stx2e-producing strains by colony blot (Perera et al., supra). Stx2e has two conservative amino acid differences in region B as compared to Stx2 (AHISL (SEQ ID NO: 19) rather than THISV (SEQ ID NO: 2)). There are also several amino acid sequence differences immediately adjacent to region A (not shown). We conjecture that these differences may be responsible for the reduced recognition of Stx2e by 11E10 on Western blot.

[0097] When the neutralization capacity of monoclonal antibody 11E10 for the Stx2 variant toxins was evaluated, we found that 11E10 neutralized all the Stx2 variant toxins to greater than or equal to 60% of the level of neutralization of Stx2 (Fig. 4B). We were surprised at the level of neutralization observed by 11E10 of Stx2e because of the limited recognition of Stx2e by 11E10 in the Western blot format (Fig. 4A, bottom panel). However, the neutralization of Stx2e by 11E10 in this study agrees with our previous result that showed that 11E10 partially neutralizes Stx2e (Perera et al., supra).

Immune and protective response of the Stx1 +ABC toxoid in mice.

[0098] We next sought to ascertain whether a toxoided derivative of the Stx1 +ABC hybrid molecule could elicit a serum-neutralizing or protective response to Stx2 in mice. Groups of mice were immunized with the chimeric toxoid or PBS as a control. Serum from five toxoid-immunized mice and five PBS-immunized mice were then evaluated for an anti-Stx1 neutralizing response. None of the sera from the PBS-immunized mice contained Stx1- neutralizing activity. As expected from previous studies, all five toxoid-immunized mice had neutralizing antibodies directed against Stx1 (Smith et al. (2006) Vaccine 24:4122-4129, Wen et al., supra ). The mean anti-Stx1 neutralization titer for the serum from these five mice was 4.0 ± 0.9 logs above background. Eleven of the sera from the remaining 34 toxoid-immunized mice had some neutralizing response to Stx2, while none of the sera from the 29 PBS-immunized mice exhibited any anti-Stx2 response (data not shown).

[0099] Two weeks after the final boost, five negative-control mice and five toxoid-immunized mice were challenged intraperitoneally with 10 LD₅₀s of Stx1. All of the negative-control mice died while all of the toxoid-immunized mice survived the lethal challenge (Table 3), as predicted from the results of a previous study (Smith et al., supra, Wen et al., supra). In addition, the survival of the toxoid-immunized mice that were challenged with Stx1 directly correlated to the in vitro neutralizing titers from those mice.

Table 3. Protection of immunized mice against a lethal challenge with Stx1 or Stx2.

Group	Mice immunized with:	Mice challenged with 10LD50ab of:	Number of surviving mice/ total number of mice (percent survival)
A	PBS	Stx1	0/5
B	Stx1 +ABC toxoid	Stx1	5/5
C	PBS	Stx2	6/29 (20.7 %)
D	Stx1 +ABC toxoid	Stx2	12/34 (35.3 %)c

a The LD50 was previously determined to be 125 and 1 ng/mouse for Stx1 and Stx2 respectively. b The average weight of the mice when they were challenged was 47.1 g. c Fisher's exact test was used to compare the proportions that survived in groups C and D and the p value was 0.2667.

[0100] Because low Stx2 neutralizing antibody titers were observed in the toxoid-immunized group, we chose to challenge the rest of the mice with only 5 LD₅₀s of Stx2. Six out of 29 negative-control mice (20.7 %) survived the challenge with Stx2, while 12 out of 34 toxoid-immunized mice (35.3 %) survived (Table 3), a finding that, while not statistically significant, suggests that the chimeric toxoid may have provided some protection from Stx2.

In vitro protein synthesis inhibition assay.

[0101] Our finding that the 11E10 epitope appeared to consist of surface loops around the Stx2 active site cleft led us to hypothesize that 11E10 might neutralize Stx2 by blocking the capacity of the toxin to inhibit protein synthesis. Therefore, we assessed whether the 11E10 monoclonal antibody could neutralize the ribosome-inactivating effects of Stx2 in a rabbit reticulocyte protein synthesis assay to which luciferase mRNA was added. A concentration of toxin was chosen that decreased the signal from the luciferase reporter protein by approximately 60% as compared to the signal measured when no toxin was added (Fig. 5). Addition of 11E10 to the assay allowed protein synthesis to occur in the rabbit reticulocyte lysate even when the Stx2 was present, whereas the isotype-matched irrelevant antibody did not (Fig. 5).

Monoclonal antibody 11E10 alters the overall distribution of Stx2 in Vero cells

[0102] Although we found that monoclonal antibody 11E10 prevented the inhibition of protein synthesis by Stx2 in the in vitro protein synthesis assay, we further hypothesized that 11E10 may prevent Stx2 from reaching ribosomes in the cytoplasm of intoxicated Vero cells. We therefore sought to determine if monoclonal antibody 11E10 alters Stx2 localization in target cells. (We previously found that 11E10-bound Stx2 could bind to Vero cells and that 11E10 could attach to Stx2 bound to Vero cells (data not shown)). Stx2 was mixed with 11E10 or PBS and the antibody/toxin or PBS/toxin mixture was incubated with Vero cells. The distribution of Stx2 in the target cells was then visualized with rabbit polyclonal antibodies anti-Stx2 and a fluorophore-labeled anti-rabbit IgG secondary antibody (Fig. 6). Stx2 appeared to be distributed throughout the cytoplasm in the absence of 11E10 (Fig. 6A) but seemed to remain concentrated in largely perinuclear bodies in the presence of 11E10 (Fig. 6B). When the cells incubated with the toxin/11E10 mixture were stained with anti-mouse IgG, 11E10 was observed in the same perinuclear punctate structures as Stx2 (Fig. 6C). The 11E10 monoclonal antibody was unable to enter cells in the absence of toxin (Fig. 6D). The localization of 11E10-bound Stx2 within punctate bodies around the nucleus suggested that the antibody-toxin complex entered the cell but did not traffic into the cytoplasm. We therefore asked if Stx2 or 11E10-bound Stx2 was localized in early endosomes by immunostaining the intoxicated cells with the early endosome marker monoclonal antibody EEA-1. We found that much of the Stx2 in cells intoxicated with 11E10-bound Stx2 colocalized with the early endosome marker (Fig 6E-G), as shown by a yellow-orange color when the staining patterns were overlapped. In contrast, when Vero cells were incubated with Stx2 alone, the toxin was found throughout the cytoplasm and only a small amount colocalized with the early endosome marker (Fig 6H-J).

Discussion

[0103] Our results demonstrate that the 11E10 monoclonal antibody epitope is conformational and include three non-linear regions in the Stx2 A subunit that appear close to the active site of the toxin in the crystal structure (see Fig. 2C). Our strategy to identify the 11E10 epitope involved the generation of chimeric Stx1/Stx2 toxins and was based on the assumption that placing Stx2 sequences onto the Stx1 backbone would maintain the 3-dimensional tertiary structure of the antibody epitope and allow recognition by the 11E10 monoclonal antibody. We found that the minimal region of on-going laboratory evaluation of the humanized version of 11E10, cαStx2, on which Phase I safety testing has been completed (Dowling et al., supra).

[0104] We attempted to protect mice from Stx2 challenge by immunization with the toxoided chimeric Stx1 molecule that contained just the 29 amino acids from Stx2 that comprise the 11E10 epitope. We found that although the immunized mice raised a protective response to Stx1, only a few of the mice generated Stx2-neutralizing antibodies, and these were of low titer. The response to Stx2 may have been improved with additional boosts of the chimeric toxoid.

[0105] We found that 11E10 blocked the enzymatic activity of Stx2 in vitro, a fact that we predicted based on the close proximity of the 11E10 epitope to the toxin active site. We further observed that 11E10 altered the overall distribution of the toxin inside the cell, a finding that is similar to the data on Stx2 neutralization by a different StxA2 monoclonal antibody, 5C12, as reported by Krautz-Peterson et al. ((2008) Infect. Immun. 76:1931-1939). These investigators concluded that when monoclonal antibody 5C12 binds StxA2 it alters the intracellular trafficking pattern of the toxin (Krautz-Peterson et al, supra). Our data indicate that once the 11E10/Stx2 complex binds to and enters the host cell, the antibody may prevent toxin trafficking to the target ribosomes in the cytosol. However, since we demonstrated that 11E10 prevented the enzymatic function of the toxin in vitro, we predict that should the A subunit of Stx2 complexed with 11E10 reach its enzymatic target in the cytosol, the toxin would be unable to kill the cell.

SEQUENCE LISTING

[0106] 

<110> The Henry M. Jackson Foundation For The Advancement of Military Medicine, Inc.

<120> METHODS AND COMPOSITIONS BASED ON SHIGA TOXIN TYPE 2 PROTEIN

<130> 50111/117WO3

<160> 55

<170> PatentIn version 3.5

<210> 1
<211> 8
<212> PRT
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 1

<210> 2
<211> 5
<212> PRT
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 2

<210> 3
<211> 16
<212> PRT
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 3

<210> 4
<211> 315
<212> PRT
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 4

<210> 5
<211> 315
<212> PRT
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 5

<210> 6
<211> 315
<212> PRT
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 6

<210> 7
<211> 315
<212> PRT
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 7

<210> 8
<211> 315
<212> PRT
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 8

<210> 9
<211> 1227
<212> DNA
<213> Escherichia coli

<400> 9

<210> 10
<211> 948
<212> DNA
<213> Escherichia coli

<400> 10

<210> 11
<211> 270
<212> DNA
<213> Escherichia coli

<400> 11

<210> 12
<211> 315
<212> PRT
<213> Escherichia coli

<400> 12

<210> 13
<211> 89
<212> PRT
<213> Escherichia coli

<400> 13

<210> 14
<211> 1241
<212> DNA
<213> Escherichia coli

<400> 14

<210> 15
<211> 960
<212> DNA
<213> Escherichia coli

<400> 15

<210> 16
<211> 270
<212> DNA
<213> Escherichia coli

<400> 16

<210> 17
<211> 319
<212> PRT
<213> Escherichia coli

<400> 17

<210> 18
<211> 89
<212> PRT
<213> Escherichia coli

<400> 18

<210> 19
<211> 5
<212> PRT
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 19

<210> 20
<211> 17
<212> DNA
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 20
taaggaggac agctatg   17

<210> 21
<211> 36
<212> DNA
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 21
gatcggatcc ccctgtaacg aagtttgcgt aacagc   36

<210> 22
<211> 39
<212> DNA
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 22
gatcgaattc tcgcttacga tcatcaaaga gatcatacc   39

<210> 23
<211> 38
<212> DNA
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 23
gatcggatcc agcaagggcc accatatcac ataccgcc   38

<210> 24
<211> 38
<212> DNA
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 24
caggggaatt caccatgcga aattttttta acaaatgc   38

<210> 25
<211> 23
<212> DNA
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 25
gaacatatat ctcaggggac cac   23

<210> 26
<211> 47
<212> DNA
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 26
gtggtcccct gagatatatg ttctaatgga gtacctattg cagagcg   47

<210> 27
<211> 29
<212> DNA
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 27
ttacggtttg ttactgtgac agctgaagc   29

<210> 28
<211> 53
<212> DNA
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 28
gcttcagctg tcacagtaac aaaccgtaaa actgctctgg atgcatctct ggt    53

<210> 29
<211> 22
<212> DNA
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 29
cagataaatc gccattcgtt ga   22

<210> 30
<211> 43
<212> DNA
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 30
tcaacgaatg gcgatttatc tgcattccgg aacgttccag cgc   43

<210> 31
<211> 50
<212> DNA
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 31
ggtacgtctt tactgatgat taaccacacc ccaccgggca gttattttgc   50

<210> 32
<211> 50
<212> DNA
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 32
gcaaaataac tgcccggtgg ggtgtggtta atcatcagta aagacgtacc   50

<210> 33
<211> 26
<212> DNA
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 33
tatgtgacag gatttgttaa caggac   26

<210> 34
<211> 60
<212> DNA
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 34
gtcctgttaa caaatcctgt cacatataaa ttattttgct caataatcag acgaagatgg   60

<210> 35
<211> 39
<212> DNA
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 35
aggaggacag ctatgaaaat aattattttt agagtgcta   39

<210> 36
<211> 36
<212> DNA
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 36
gatcggatcc taaggaggac agctatgaaa ataatt   36

<210> 37
<211> 34
<212> DNA
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 37
ggtggtggtg acgaaaaata acttcgctga atcc   34

<210> 38
<211> 32
<212> DNA
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 38
cagtggtggt ggtggtggtg acgaaaaata ac   32

<210> 39
<211> 31
<212> DNA
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 39
gatcgaattc tcagtggtgg tggtggtggt g   31

<210> 40
<211> 45
<212> DNA
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 40
aaccacaccc caccgggcag ttattttgca gttgatgtca gaggg   45

<210> 41
<211> 45
<212> DNA
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 41
ataactgccc ggtggggtgt ggttaatcat cagtaaagac gtacc   45

<210> 42
<211> 44
<212> DNA
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 42
acacatatat cagtgccagg tacaacagcg gttacattgt   ctgg 44

<210> 43
<211> 46
<212> DNA
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 43
acctggcact gatatatgtg taaaatcagc aaagcgataa aaaaca   46

<210> 44
<211> 47
<212> DNA
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 44
gtgaatgaag agagtcaacc agaatgtccg gcagatggaa gagtccg   47

<210> 45
<211> 24
<212> DNA
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 45
ttctggttga ctctcttcat tcac   24

<210> 46
<211> 46
<212> DNA
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 46
ggcattaata ctgaattgtc atcatcaggg ggcgcgttct gttcgc   46

<210> 47
<211> 25
<212> DNA
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 47
atgatgacaa ttcagtatta atgcc   25

<210> 48
<211> 38
<212> DNA
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 48
aggaggacag ctatgaagtg tatattattt aaatgggt   38

<210> 49
<211> 34
<212> DNA
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 49
gatcggatcc taaggaggac agctatgaag tgta   34

<210> 50
<211> 31
<212> DNA
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 50
ggtggtggtg gtcattatta aactgcactt c   31

<210> 51
<211> 32
<212> DNA
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 51
cagtggtggt ggtggtggtg gtcattatta aa   32

<210> 52
<211> 32
<212> DNA
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 52
gatcggatcc ctggtatcgt attacttcag cc   32

<210> 53
<211> 30
<212> DNA
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 53
gatcgaattc ctgcacacta cgaaaccagc   30

<210> 54
<211> 26
<212> DNA
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 54
tcagtgacag gatttgttaa caggac   26

<210> 55
<211> 53
<212> DNA
<213> Artificial Sequence

<220>
<223> Synthetic Construct

<400> 55
gtcctgttaa caaatcctgt cactgataaa ttatttcgtt caacaataag ccg    53

Claims

1. A purified polypeptide comprising:

(i) SEQ ID NO: 1;

(ii) SEQ ID NOs: 1 and 2; or

(iii) SEQ ID NOs: 1, 2, and 3;

and a non-Stx2 protein scaffold, wherein said SEQ ID NO: 1, SEQ ID NOs: 1 and 2, or SEQ ID NOs: 1, 2, and 3 are inserted into said non-Stx2 protein scaffold and wherein said polypeptide has the antigenicity of Stx2 and wherein said polypeptide comprises an amino acid sequence having at least 95% sequence identity to the amino acid sequence set forth in SEQ ID NO:8.

2. The purified polypeptide of claim 1, wherein said scaffold comprises a protein substantially identical to Stx1, or a fragment thereof.

3. The purified polypeptide of claim 1 or 2, wherein said polypeptide comprises a fragment including SEQ.ID.NO:1 and having at least 80% sequence identity to amino acids 64-122 of SEQ ID NO: 8.

4. The purified polypeptide of any one of claims 1 to 3, wherein said polypeptide is toxoided.

5. An isolated nucleic acid molecule encoding any one of the polypeptides of claims 1 to 4.

6. A vector capable of expressing a polypeptide, said vector comprising the nucleic acid molecule of claim 5.

7. A host cell containing the vector of claim 6.

8. Use of a polypeptide according to any one of claims 1 to 4 in the manufacture of an
anti-Stx2 antibody that specifically binds to the 11E10 epitope of Shiga toxin type 2 (Stx2) protein, said method comprising the steps of:

- immunizing a mammal with a polypeptide according to any one of 1 to 4, wherein said immunizing optionally further comprises using an adjuvant;

- purifying said anti-Stx2 antibody that specifically binds to the 11E10 epitope of Stx2 protein from a tissue of said mammal or from a hybridoma made using said tissue; and optionally

- screening said antibody against Stx2 and Stx1 in an in vitro neutralization assay, wherein an antibody that neutralizes at least 50 % of the cytotoxic effect of Stx2 is an anti-Stx2 antibody that specifically binds to the 11E10 epitope of Stx2 protein.

9. An anti-Stx2 antibody, or fragment thereof, that specifically binds to the 11E10 epitope of Shiga toxin type 2 (Stx2) protein comprising any one of the polypeptides of claims 1 to 4, wherein said antibody inhibits binding of an 11E10 antibody (ATCC 1907), chimeric 11E10 antibody, or humanized 11E10 antibody to said Stx2 protein, wherein said antibody is not an 11E10 antibody, a chimeric 11E10 antibody, or a humanized 11E10 antibody, wherein said 11E10 epitope is a conformational epitope.

10. The antibody, or fragment thereof, of claim 9, wherein said antibody inhibits binding between Stx2 and an 11E10 antibody, wherein said 11E10 antibody has a Kd of 0.50 nM or lower, or wherein said antibody blocks the enzymatic activity of Stx2 or alters the intracellular distribution of Stx2.

11. A hybridoma cell line that produces an antibody according to any one of claims 9 to 10.

12. An in vitro method of detecting Stx2 in a biological sample, wherein said biological sample is from a tissue, cell, cell extract, bodily fluid, or a biopsy, said method comprising the steps of:

- contacting said biological sample with the antibody, or fragment thereof, according to any one of claims 9 to 10, under conditions allowing for complex formation between said antibody and Stx2; and

- detecting said complex.

13. A in vitro method of diagnosing a Shiga toxin associated disease in subject, said method comprising the steps of:

- contacting a biological sample with an antibody according to any one of claims 9 to 10, under conditions allowing for complex formation between said antibody and Stx2; and

- detecting said complex;

wherein the presence of Stx2 in said sample diagnoses the subject with a Shiga toxin associated disease.

14. A polypeptide according to any one of claims 1 to 4 or an antibody according to any one of claims 9 to 10, for use as a medicament.

15. A polypeptide according to any one of claims 1 to 4 or an antibody according to any one of claims 9 to 10 for use in treating or preventing a Shiga toxin associated disease in a subject.

16. The polypeptide or antibody according to the use in claim 15, wherein said Shiga toxin associated disease is hemolytic uremic syndrome or a disease associated with E. coli or S. dysenteriae infection.

Ansprüche

1. Gereinigtes Polypeptid, umfassend:

(i) SEQ ID NO: 1;

(ii) SEQ ID NO: 1 und 2; oder

(iii) SEQ ID NO: 1, 2 und 3;

und ein Nicht-Stx2-Proteingerüst, wobei die SEQ ID NO: 1, SEQ ID NO: 1 und 2 oder SEQ ID NO: 1, 2 und 2 in das Nicht-Stx2-Proteingerüst insertiert sind, und wobei das Polypeptid die Antigenität von Stx2 aufweist, und wobei das Polypeptid eine Aminosäuresequenz mit einer zumindest 95%igen Sequenzidentität mit der Aminosäuresequenz aufweist, die in SEQ ID NO: 8 angeführt ist.

2. Gereinigtes Polypeptid nach Anspruch 1, wobei das Gerüst ein Protein, das mit Stx1 im Wesentlichen identisch ist, oder ein Fragment davon umfasst.

3. Gereinigtes Polypeptid nach Anspruch 1 oder 2, wobei das Polypeptid ein Fragment umfasst, das SEQ ID NO: 1 beinhaltet und eine zumindest 80%ige Sequenzidentität mit den Aminosäuren 64-122 von SEQ ID NO: 8 aufweist.

4. Gereinigtes Polypeptid nach einem der Ansprüche 1 bis 3, wobei das Polypeptid toxoid ist.

5. Isoliertes Nukleinsäuremolekül, das für ein beliebiges der Polypeptide nach einem der Ansprüche 1 bis 4 codiert.

6. Vektor, der in der Lage ist, ein Polypeptid zu exprimieren, wobei der Vektor das Nukleinsäuremolekül von Anspruch 5 umfasst.

7. Wirtszelle, die den Vektor nach Anspruch 6 enthält.

8. Verwendung eines Polypeptids nach einem der Ansprüche 1 bis 4 bei der Herstellung eines Anti-Stx2-Antikörpers, der spezifisch an das 11E10-Epitop des Shiga-Toxin-Typ-2-(Stx2)-Proteins bindet, wobei das Verfahren die Schritte umfasst.

- Immunisieren eines Säugers mit einem Polypeptid nach einem der Ansprüche 1 bis 4, wobei das Immunisieren optional des Weiteren das Verwenden eines Adjuvans umfasst;

- Reinigen des Anti-Stx2-Antikörpers, der spezifisch an das 11E10-Epitop des Stx2-Proteins bindet, aus einem Gewebe des Säugers oder aus einem Hybridom, das unter Verwendung des Gewebes hergestellt wurde; und optional

- Screenen des Antikörpers gegen Stx2 und Stx1 in einem In-vitro-Neutralisierungsassay, wobei ein Antikörper, der zumindest 50 % der cytotoxischen Wirkung von Stx2 neutralisiert, ein Anti-Stx2-Antikörper ist, der spezifisch an das 11E10-Epitop des Stx2-Proteins bindet.

9. Anti-Stx2-Antikörper oder Fragment davon, der bzw. das spezifisch an das 11E10-Epitop des Shiga-Toxin-Typ-2-(Stx2)-Proteins bindet, umfassend ein beliebiges der Polypeptide nach einem der Ansprüche 1 bis 4, wobei der Antikörper die Bindung eines 11E10-Antikörpers (ATCC 1907), chimären 11E10-Antikörpers oder humanisierten 11E10-Antikörpers an das Stx2-Protein hemmt, wobei der Antikörper kein 11E10-Antikörper, chimärer 11E10-Antikörper oder humanisierter 11E10-Antikörper ist, wobei das 11E10-Epitop ein Konformationsepitop ist.

10. Antikörper oder Fragment davon nach Anspruch 9, wobei der Antikörper die Bindung zwischen Stx2 und einem 11E10-Antikörper hemmt, wobei der 11E10-Antikörper eine Kd von 0,50 nM oder weniger aufweist, oder wobei der Antikörper die enzymatische Aktivität von Stx2 blockiert oder die intrazelluläre Verteilung von Stx2 verändert.

11. Hybridomzelllinie, die einen Antikörper nach einem der Ansprüche 9 bis 10 erzeugt.

12. In-vitro-Verfahren zum Nachweisen von Stx2 in einer biologischen Probe, wobei die biologische Probe aus einem Gewebe, einer Zelle, einem Zellextrakt, einer Körperflüssigkeit oder einer Biopsie stammt, wobei das Verfahren die Schritte umfasst:

- Inkontaktbringen der biologischen Probe mit dem Antikörper oder einem Fragment davon nach einem der Ansprüche 9 bis 10 unter Bedingungen, die eine Komplexbildung zwischen dem Antikörper und Stx2 ermöglichen; und

- Nachweisen des Komplexes.

13. In-vitro-Verfahren zum Diagnostizieren einer mit Shiga-Toxin assoziierten Krankheit bei einem Individuum, wobei das Verfahren die Schritte umfasst:

- Inkontaktbringen einer biologischen Probe mit einem Antikörper nach einem der Ansprüche 9 bis 10 unter Bedingungen, die eine Komplexbildung zwischen dem Antikörper und Stx2 ermöglichen; und

- Nachweisen des Komplexes;

wobei das Vorhandensein von Stx2 in der Probe eine mit Shiga-Toxin assoziierte Krankheit beim Individuum diagnostiziert.

14. Polypeptid nach einem der Ansprüche 1 bis 4 oder Antikörper nach einem der Ansprüche 9 bis 10 zur Verwendung als Medikament.

15. Polypeptid nach einem der Ansprüche 1 bis 4 oder Antikörper nach einem der Ansprüche 9 bis 10 zur Verwendung bei der Behandlung oder Prävention einer mit Shiga-Toxin assoziierten Krankheit bei einem Individuum.

16. Polypeptid oder Antikörper zur Verwendung nach Anspruch 15, wobei die mit Shiga-Toxin assoziierte Krankheit hämolytisches urämisches Syndrom oder eine mit einer E.-coli- oder S.-Dysenteriae-Infektion assoziierte Krankheit ist.

Revendications

1. Un polypeptide purifié comprenant:

(i) SEQ ID NO: 1;

(ii) SEQ ID NOs: 1 et 2; ou

(iii) SEQ ID NOs: 1, 2, et 3;

et un échafaudage protéique non-Stx2, dans lequel lesdites SEQ ID NO: 1, SEQ ID NOs: 1 et 2, ou SEQ ID NOs: 1, 2, et 3 sont insérées dans ledit échafaudage protéique non-Stx2 et dans lequel ledit polypeptide a le caractère antigénique de Stx2 et dans lequel ledit polypeptide comprend une séquence en acides aminés ayant au moins 95% d'identité de séquence par rapport à la séquence en acides aminés définie à la SEQ ID NO: 8.

2. Le polypeptide purifié de la revendication 1, dans lequel, ledit échafaudage comprend une protéine substantiellement identique à Stx1, ou un fragment de celle-ci.

3. Le polypeptide purifié de la revendication 1 ou 2, dans lequel ledit polypeptide comprend un fragment incluant SEQ ID NO: 1 et ayant au moins 80% d'identité de séquence par rapport aux acides aminés 64-122 de la SEQ ID NO: 8.

4. Le polypeptide purifié d'une quelconque des revendications 1 à 3, dans lequel ledit polypeptide toxoïdé.

5. Une molécule isolée d'acides nucléique encodant un quelconque des polypeptides des revendications 1 à 4.

6. Un vecteur capable d'exprimer un polypeptide, ledit vecteur comprenant la molécule d'acides nucléique de la revendication 5.

7. Une cellule hôte contenant le vecteur de la revendication 6.

8. Utilisation d'un polypeptide selon une quelconque des revendications 1 à 4 pour la fabrication d'un anticorps anti-Stx2 qui se lie spécifiquement à l'épitope 11E10 de la protéine de toxine de Shiga de type 2 (Stx2), ladite méthode comprenant les étapes de :

- on immunise un mammifère avec le polypeptide selon une quelconque des revendications précédentes 1 à 4, où ladite immunisation, de manière optionnelle, comprend en outre un adjuvant ;

- on purifie ledit anticorps anti-Stx2 qui se lie spécifiquement à l'épitope 11E10 de la protéine Stx2 à partir d'un tissu dudit mammifère ou à partir d'un hybridome réalisé en utilisant ledit tissu ; et en option

- on analyse ledit anticorps contre Stx2 et Stx1 dans un test de neutralisation in vitro, dans lequel un anticorps qui neutralise au moins 50% de l'effet cytotoxique de Stx2 est un anticorps anti-Stx2 qui se lie spécifiquement à l'épitope 11E10 de la protéine Stx2.

9. Un anticorps anti-Stx2, ou un fragment de celui-ci, qui se lie spécifiquement à l'épitope 11E10 de la protéine de la toxine de Shiga de type 2 (Stx2) comprenant un quelconque des polypeptides des revendications 1 à 4, dans lequel ledit anticorps inhibe la liaison d'un anticorps 11E10 (ATCC 1907), un anticorps 11E10 chimérique, ou un anticorps 11E10 humanisé contre ladite protéine Stx2, dans lequel ledit anticorps n'est pas un anticorps 11E10, un anticorps 11E10 chimérique, ou un anticorps 11E10 humanisé, dans lequel ledit épitope 11E10 est un épitope conformationel.

10. L'anticorps ou un fragment de celui-ci, de la revendication 9, dans lequel ledit anticorps inhibe la liaison entre Stx2 et un anticorps 11E10, dans lequel ledit anticorps 11E10 a un Kd de 0,50 nM ou inférieur, ou dans lequel ledit anticorps bloque l'activité enzymatique de Stx2 ou altère la distribution intracellulaire de Stx2.

11. Une lignée cellulaire d'hybridome qui produit un anticorps selon une quelconque des revendications 9 à 10.

12. Une méthode in vitro pour la detection de Stx2 dans un échantillon biologique, dans laquelle ledit échantillon biologique est un tissue, une cellule, un extrait cellulaire, un fluide corporel, ou une biopsie, ladite méthode comprenant les étapes de:

- on met au contact ledit échantillon biologique avec l'anticorps, ou un fragment de celui-ci, selon une quelconque des revendications 9 ou 10, dans des conditions permettant la formation d'un complexe entre ledit anticorps et Stx2 ; et

- on détecte ledit complexe.

13. Une méthode in vitro de diagnostic de la maladie associée à la toxine de Shiga chez un sujet, ladite méthode comprenant les étapes de:

- on met en contact un échantillon biologique avec un anticorps selon une quelconque des revendications 9 à 10, dans des conditions permettant la formation d'un complexe entre ledit anticorps et Stx2 ; et

- on détecte ledit complexe ;

dans laquelle la présence de Stx2 dans ledit échantillon remet pour le sujet un diagnostic de la maladie associée à la toxine de Shiga.

14. Un polypeptide selon une quelconque des revendications 1 à 4 ou un anticorps selon une quelconque des revendications 9 à 10, pour utilisation en tant que médicament.

15. Un polypeptide selon une quelconque des revendications 1 à 4 ou un anticorps selon une quelconque des revendications 9 à 10, pour utilisation dans le traitement ou la prévention chez un sujet de la maladie associée à la toxine de Shiga.

16. Le polypeptide ou anticorps selon l'utilisation de la revendication 15, sans lequel ladite maladie associée à la toxine de Shiga est le syndrome d'urémie hémolytique ou une maladie associée avec une infection d'E. coli ou de S. dysenteriae.

Drawing