Genetic test for genetic disposition of haemophilia B in Rhodesian Ridgeback

Abstract

 The invention relates to a genetic test for genetic disposition of haemophilia B in Rhodesian Ridgeback by genotyping the canine factor IX gene for a specific point mutation (G to A on position 752) leading to a G244E mutation in the canine factor IX gene.

Description

[0001] The invention relates to a genetic test for genetic disposition of haemophilia B in Rhodesian Ridgeback by genotyping the canine factor IX gene.

Introduction

[0002] Haemophilia B is a condition affecting the blood clotting process by lack of biologically active coagulation factor IX. Factor IX is a 56 kDa plasma glycoprotein that is required for activation of Factor X in the coagulation cascade. Canine haemophilia B represents a naturally occurring hereditary coagulopathy with a range in severity of clinical signs and coagulant activity in different breed variants. It has been reported in many breeds. In Rhodesian Ridgebacks, a severe form of haemophilia B with pronounced clinical signs was first described in Lutze et al. (2000). Currently it is the clinically most important canine haemophilia form in Germany.

[0003] Different mutations in the gene encoding factor IX have been identified in different dog breeds, including Labrador, Lhasa Apso, Pit Bull Terrier, and Airedale Terrier resulting in clinical symptoms typical for haemophilia B (Evans et al., 1989; Mauser et al., 1996; Brooks et al., 1997; Gu et al., 1999; Table 11). To the author's knowledge, the genetic background of haemophilia B in Rhodesian Ridgebacks is unknown. Therefore the aim of this study was to investigate whether a genetic defect could be identified as underlying cause of haemophilia B in Rhodesian Ridgeback dogs. A genetic test would help to diagnose diseased dogs and identify genetically affected and carrier dogs.

[0004] It is the object of the present invention to provide a genetic test for the analysis of a genotype of a dog, preferably a Rhodesian Ridgeback in respect of haemophilia B.

[0005] This aim is achieved by the inventions as claimed in the independent claims. Advantageous embodiments are described in the dependent claims.

[0006] The problem is solved by providing a Canine factor IX gene according to Seq-ID No. 1 having a point mutation, wherein nucleotide 752 is A instead of G.

[0007] It has been found that a single point mutation in the canine factor IX leads to a very strong reduction in the activity of the factor and could be assigned to haemophilia B in the dog, preferably the Rhodesian Ridgebacks.

[0008] In Seq-ID No. 1 the nucleotide in position 752 is mutated from G to A. This mutation results in a glycine (GGA) to glutamic acid (GAA) exchange in position 244 in the catalytic domain of the haemophilic factor IX (Seq-ID No. 3; wild type Seq-ID No. 2).

[0009] The invention therefore relates to a genetic test for identification of at least one point mutation in Seq-ID No. 1 of the genome of the dog, wherein at least one point mutation leads to an amino acid exchange in position 244 of canine factor IX.

[0010] In a preferred embodiment the point mutation is a point mutation in nucleotide 752 of Seq-ID No. 1, more preferably the point mutation is a point mutation in which nucleotide 752 is A instead of G.

[0011] The analysis may also be used to detect further mutations in sequence Seq-ID No. 1, for example mutations which are not related to haemophilia B.

[0012] In an embodiment of the invention the analysis of a genotype of a dog in respect of haemophilia B comprises the identification of a point mutation in Seq-ID No. 1 of the genome of the dog, wherein one point mutation is a point mutation in which nucleotide 752 is A instead of G.

[0013] By this test it is possible to identify the genotype of the Rhodesian Ridgeback in respect of haemophilia B, and especially if the dog is a heterozygous carrier of the mutation.

[0014] The procedures to detect a point mutation in a genome are known to the person skilled in the art. Possible methods are sequencing the region of the genome, where the mutation is localised, with specific primers and then comparing the sequence with the wild type sequence. The sequencing may be done directly with the genomic DNA or by amplification of the selected region and then sequencing the amplified sequence. Other possible methods comprise ligase chain reaction (LCR), restriction fragment length polymorphism (RFLP), mass spectroscopy (MALDI-TOF), SSCP, DGGE, pyrosequencing, dHPLC, allele-specific hybridization, molecular beacons, microarrays, Flap endonuclease (FEN), real-time PCR, allele specific PCR, Taqman assay.

[0015] For example PCR may be used for the amplification of the region of the point mutation, the region of Seq-ID No. 1, which contains at least one of the point mutation in Seq-ID No. 1 of the genome of the dog, wherein nucleotide 752 is A instead of G.

[0016] In a preferred embodiment the dog is a Rhodesian Ridgeback.

[0017] Another embodiment of the invention is a process for the determination of the genetic disposition for haemophilia B of a dog by the use of the canine factor IX gene of the dog according to Seq-ID No. 1 having at least one point mutation in Seq-ID No. 1 of the genome of the dog, wherein at least one point mutation leads to an amino acid exchange in position 244 of canine factor IX.

[0018] In a preferred embodiment the point mutation is a point mutation on nucleotide 752, more preferably this nucleotide is A instead of G.

[0019] In a preferred embodiment the dog is a Rhodesian Ridgeback.

[0020] Another embodiment of the invention this process may be used for the selection of a Rhodesian Ridgeback for breeding.

[0021] Even if no multiple back-referenced claims are drawn, all reasonable combinations of the features in the claims shall be disclosed.

Table 1

Literature survey of mutations on canine factor IX gene in dogs with haemophilia;

Table 2

Results of sequence analysis of the canine factor IX DNA and TaqMan genotyping assay for a G-A missense mutation in exon 7 in Rhodesian Ridgebacks dogs with different status of haemophilia B (Signalement, pedigree: Confirmed carrier, mother of Nos. 4 and 5; Clinical signs: Severe bleeding after minor surgeries; Sequence analysis: n= Normal c=carrier a=affected) and injuries, occasional spontaneous bleeding (+/-)) ;

Fig. 1

Amino acid sequence alignment of protease domain of canine factor IX (CFIX) with humane factor IX (HFIX), bovine trypsin (TRYP), porcine elastase (ELAS), bovine chymotrypsin (CHYM) and porcine kallikrein (KALL);

Fig. 2

Factor IX domain composition: detected features according to ProSite and SMART. Key domains of factor IX include N-terminal gamma-carboxyglutamate (GLA, see grey arrow) containing domain (hexagon), the calcium binding EGF domain (pentagon, disulfide bonds indicated in grey) and trypsin-like serine protease domain (ellipse, C-terminal). The three active sites residues (H258, D306 and S402) of this domain are shown as small diamonds as well as the disulfide bonds (grey rectangular lines). A detailed list of the features of this domain and positions is shown in Table 3;

Fig. 3

Figure 3A: Protein mutated inside view: disulfide (spheres), active site and mutates amino acid (ribbon); Comparison of structure of mutated canine factor IX and wild type factor IX. Illustration of the affected residues of factor IX from the inside; Figure 3A is wild type; Figure 3B is mutated protein. Spherical shape: disulfide bridge; ribbon shape: mutated amino acid. The view includes the active site; Figure 3C shows an Overlay of Figures 3A and 3B (dark gray regions: Figure 3A; light grey: Figure 3B); Note how change of residue 244 leads to a change in overall protein geometry. Especially the disulfide bridge is affected.

Fig. 4

Model of the affected residues of the factor IX molecules from the outside; Figure 4A shows the mutated protein; Figure 4B the wild type; Spherical shape: disulfide bridge; ribbon shape: mutated amino acid; dark surface around the white circle: active site; clearly visible are the disulfide bridges and the active sites. It is clearly visible, that the mutated amino acid causes a shift in the spatial structure in the disulfide bridge and thus also in the active site (white circle; dark grey). It also causes a shift in the periphery of structures (lower right corner, white rectangle) with the effect, that an additional bond is forming a loop. Both can also be seen in the overlay of figure 4A and figure 4B shown in figure 4C (dark gray: figure 4A; light gray figure 4B).

DETAILED DESCRIPTION OF THE INVENTION

Materials and methods

Study design

[0022] The study included six phenotypically affected male dogs, four suspected carriers, and 12 healthy dogs. From all dogs with known or suspected haemophilia B status, factor IX activity was measured to verify the status for haemophilia B. From all these dogs, DNA was isolated from EDTA blood, and the coding region of canine factor IX was amplified and sequenced. The obtained DNA sequence was compared with the wild type canine factor IX DNA (Gene Bank Accession Number: NM_001003323). In addition, a TaqMan genotyping assay specific for the detected mutation, was performed in all these dogs. In order to prove the functional relevance of the detected mutation, amino acid alignment studies as well as protein structure modelling analyses were conducted. To investigate, if the mutation is just a single nucleotide polymorphism (SNP) unrelated to haemophilia B, additional TaqMan genotyping assays specific for the mutation were performed in DNA samples of 30 Rhodesian Ridgebacks with undefined haemophilia B status and samples of three other dog breeds (Doberman Pinscher: n = 20; German Wire haired Pointer: n = 20; Labrador: n = 25).

Animals and sample material

[0023] Rhodesian Ridgebacks with known status of haemophilia B were presented as patients or for haemophilia diagnosis to the Small Animal Clinic, University of Veterinary Medicine Hannover. The six phenotypically affected male Rhodesian Ridgebacks had all a known bleeding history and substantially reduced factor IX activities of approximately 1% (Table 2). Clinical signs mainly included severe bleeding after minor surgeries and injuries and occasional spontaneous bleeding. Among the four bitches with suspected carrier status due to moderately reduced factor IX activity (48-69%), one was confirmed by affected littermates. Twelve healthy Rhodesian Ridgeback dogs had a factor IX activity within the reference range and no hint for an excessive bleeding within their history.

Blood sample collection

[0024] Citrated blood for factor IX activity measurements was obtained from a cephalic or saphenous vein using sterile disposable needles (1.1 λ 30 mm) and only slight pressure was used to raise the vein. Citrated blood was collected into plastic tubes containing one part (1 mL) 0.11 mol/L sodium citrate solution for nine parts (9 mL) of blood and immediately mixed by careful rocking. Platelet poor citrated plasma for factor IX measurements was gained by centrifugation twice for 10 min at 2000 g. The final supernatant was then collected and stored in aliquots at -70 °C. In addition, 5 mL of EDTA blood were collected for genetic tests.

Factor IX activity measurements

[0025] Coagulation factor IX activities were automatically measured using a routine coagulometric test, which was optimised for canine sample material and is based on commercial human deficient plasma (Mischke, 2001). Measurements were performed in an AMAX Destiny coagulation analyser (Trinity Biotech). A mixture of 20 µL of diluted citrated plasma (1:40 diluted with imidazole buffer, Siemens Healthcare Diagnostics), 20 µL of factor IX deficient plasma (Siemens Healthcare Diagnostics), and 20 µL activating reagent (PTT reagent^®, Diagnostica Stago) was incubated, and exactly after 3 min 20 µL 25 mmol/L CaCl₂ solution (Diagnostica Stago) were added as starting reagent. A calibration curve was prepared with different dilutions of a canine pooled plasma corresponding to 200% (1:20), 150% (1:26.7), 125% (1:32), 100% (1:40), 75% (1:53.3), 50% (1:80), 25% (1:160), 10% (1:400), 5% (1:800), and 1% (1:4000) which were used instead of the diluted sample. Canine pooled plasma was prepared by mixing identical citrated plasma aliquots from 100 clinically healthy dogs with unremarkable haematological and biochemical profile and its factor IX activity was defined as 100%. All results are mean values of measurements in duplicate. The reference range for this test is 75-140%.

DNA isolation and amplification

[0026] Genomic DNA was extracted from 200 µL EDTA whole blood using a commercially available kit Biosprint 15 DNA Blood Kit (Qiagen) following manufacturers' instructions. The canine factor IX cDNA sequence was utilised to search the dog genome database at NCBI and the eight exons of the canine factor IX gene were determined. Nine pairs of oligonucleotide primers (sequences and PCR conditions are shown in Table 4) were used to amplify the coding region and the exon-intron boundaries of the canine factor IX gene using genomic DNA of the dogs. Target sequences were amplified in 50 µL reaction mixtures under standard reaction conditions containing approximately 50 ng genomic DNA and 0.2 µmol/L of each primer.

DNA sequencing

[0027] PCR products were purified prior to sequencing using Min Elute PCR Purification Kit (Qiagen). Sequencing was done by cycle sequencing using DyeDeoxy Terminators (Applied Biosystems) in an automated sequencer ABI 3130 Genetic Analyzer (Applied Biosystems). Sequence comparison was performed between different groups of Rhodesian Ridgebacks with defined haemophilia B status using BLAD ClustalW alignment.

Rapid screening of the missense mutation

[0028] TaqMan genotyping assay specific for the mutation was designed using File Builder Software Version 3.1 (Applied Biosystems). The region flanking the SNP was amplified in the presence of two allele-specific fluorescent probes. One probe labelled with VIC dye, detected the wild type allele sequence and one probe labelled with FAM dye detected the mutant allele sequence. PCR amplification and allelic discrimination was performed using Rotor-Gene 6000 (Corbett).

Amino acid sequence alignment and domain analysis

[0029] Alignment of the primary structure of the protease domain of canine factor IX with those of human factor IX, bovine trypsin, bovine chymotrypsin, porcine elastase and porcine kallikrein was based on sequence identity and structural topological equivalence and used the programme Clustal (Larkin et al., 2007). Domain analysis applied SMART (Letunic et al., 2009) and ProSite (Sigrist et al., 2009), detailed methods have been described previously (Gaudermann et al., 2006).

Structural protein modelling

[0030] Structural protein modelling applied CPHmodels (Lund et al., 2002) to generate a structure model and used PyMol (DeLano, 2002) for graphical analysis.

Results

Identification and rapid screening of the missense mutation

[0031] Comparison of the entire coding region of the canine factor IX DNA sequence and of the exon-intron junctions from six haemophilic dogs with severe factor IX deficiency (Nos. 1-6) with the wild type canine factor IX DNA revealed a G-A missense mutation at nucleotide 752 in exon 7 of the haemophilic factor IX gene. This mutation results in a glycine (GGA) to glutamic acid (GAA) exchange in the catalytic domain of the haemophilic factor IX. All affected dogs were hemizygous for the detected mutation in exon 7 (Table 2). Four dogs (Nos. 7-10), which were suspected or proven carriers, were found to be heterozygous for the G-A mutation and none of the healthy Rhodesian Ridgebacks was affected by the mutation. No further alterations in the sequences between affected dogs and the healthy control group could be observed. In all cases of Rhodesian Ridgebacks with defined haemophilia B status, the result of TaqMan genotyping assay confirmed the haemophilia B status and thereby the results of the sequencing analysis. Analyses with TaqMan genotyping assay did not reveal the presence of the G-A missense mutation in exon 7 of canine factor IX DNA in 30 further Rhodesian Ridgebacks with undefined haemophilia B status and 65 animals of three other dog breeds.

Amino acid sequence alignment and domain analysis

[0032] The catalytic domain of trypsin-like serine proteases is highly conserved throughout evolution. Amino acid sequence alignment of the members of this family of proteases demonstrates that certain amino acids are homologous between mammals. Fig. 1 shows the amino acid sequence alignment of the heavy chain of canine factor IX with the corresponding region of several other serine proteases (human factor IX, bovine trypsin, porcine elastase, bovine chymotrypsin, porcine kallikrein). Fig. 1 demonstrates that the mutation in canine factor IX affects one of the highly conserved amino acids, substituting a negatively charged residue (glutamic acid) for an amino acid that is uncharged and has no side chain (glycine). Domain analysis shows, that mutation of amino acid 244 from G to E is located in the trypsin domain of factor IX (Fig. 2). It also is directly next to a disulfide bridge (residues 243 and 259).

Structural protein modelling

[0033] Structure analysis shows that a change in conformation is most likely occurring within the inner part of the protein located close to the active centre due to the fact that the mutation to glutamic acid leads to a long side chain that needs more space and disturbs the structure even more due to its charge (Figs. 3 and 4). The mutation of residue 244 leads to a change in the structure of the pocket-shaped active site of the trypsin domain. The structural proximity is evident: The mutation lies directly adjacent to a disulfide bridge stabilizing the active site and causes, due to the changed structure of the mutated amino acid, a change in the geometry of the disulfide bridge and thus also in the active site.

Discussion

[0034] The results of the present study reveal with sufficient certainty that the detected G-A missense mutation in exon 7 is the responsible mutation for severe haemophilia B in Rhodesian Ridgebacks. The presence of the mutation was confirmed by two different techniques in 22 dogs with defined haemophilia B status. In addition, a cohort of samples from different breeds did not show the observed mutation. The latter results suggest strongly that the detected mutation cannot be a common and non-important mutation.

[0035] Amino acid sequence alignment and protein structural modelling analysis demonstrates that in haemophilic Rhodesian Ridgebacks a non-conserved amino acid substitution caused by the mutation leads to a major change in structure and activity: Based on the structure analysis of the protein created by protein modelling, the detected mutation most likely results in an activity reduction of factor IX, well in accordance with the low residual factor IX activity assessed in the functional coagulometric test of approximately 1% and the correspondent severe clinical signs. This further supports the hypothesis that the detected mutation is responsible for the haemophilia B in Rhodesian Ridgebacks. In addition, a similar change in the canine DNA resulted in a similar clinical condition (Evans et al., 1989; Table 1).

[0036] Factor IX activities measured in the haemophilic dogs were lower than in the previous report on one haemophilic Rhodesian Ridgeback (4%) (Lutze et al., 2000). Based on clinical criteria applied to humans, the residual factor IX activity corresponds to a severe (<1%) or moderately severe (1-5%) haemophilia severity degree (Rizza, 1977) and, in general, dogs seem to have a more severe clinic at a defined degree of factor activity reduction due to their discrepant behaviour (Mischke et al., 1996; Lutze et al., 2000). In addition, the major structure abnormality of the factor IX molecule is well in accordance with the fact that a heterologous antibody against the human factor IX, which cross-reacted with the normal canine factor IX molecule, showed reduced affinity to bind at the respective domain in the defect factor IX molecule in affected Rhodesian Ridgebacks (Lutze et al., 2000). In the cited study, the haemophilic Rhodesian Ridgeback dog (factor IX activity: 4%) had an antigen concentration of 25% and a carrier (factor IX activity: 56%) an antigen concentration of 53% of a canine pool plasma. The fact that an ELISA with a heterologous antibody was used in this study may have enhanced this phenomenon.

[0037] Without a known genetic background, diagnosis of female carriers of a defect is difficult. Apart from analyses on littermates it is mainly based on factor measurements. The present study demonstrates that factor IX activity in carriers confirmed by genetic analyses (maximum value 69%) can nearly reach the lower limit of the reference range (75%). It is therefore likely that under less optimal conditions (e.g., sample shipment to the laboratory, less optimally calibrated test), carrier detection based on factor IX activity measurements is unreliable. The developed TaqMan genotyping assay specific for the detected mutation is therefore a valuable tool for reliable detection of carriers, which is essential for effective breeding hygiene programmes. Unless the fact, that none of the 30 unselected Rhodesian Ridgebacks was tested positive for the mutation, investigation of larger numbers of dogs of this breed seems valuable to define the actual prevalence of the disease.

Conclusions

[0038] A G-A missense mutation in exon 7 of the canine factor IX gene was identified as the likely mutation responsible for severe haemophilia B in Rhodesian Ridgebacks. This mutation results in a glycine (GGA) to glutamic acid (GAA) exchange in the catalytic domain of the haemophilic factor IX.

[0039] While the present inventions have been described and illustrated in conjunction with a number of specific embodiments, those skilled in the art will appreciate that variations and modifications may be made without departing from the principles of the inventions as herein illustrated, as described and claimed. The present inventions may be embodied in other specific forms without departing from their spirit or essential characteristics. The described embodiments are considered in all respects to be illustrative and not restrictive. The scope of the inventions are, therefore, indicated by the appended claims, rather than by the foregoing description. All changes which come within the meaning and range of equivalence of the claims are to be embraced within their scope.

References Cited

[0040] 

Brooks, M.B., Gu, W., Ray, K., 1997. Complete deletion of the factor IX gene and inhibition of factor IX activity in a Labrador retriever with hemophilia B. Journal of American Veterinary Medical Association 211, 1418-1421.

DeLano, W.L., 2002. The PyMOL Molecular Graphics System. DeLano Scientific, Palo 277 Alto, CA, USA.

Evans, J.P., Brinkhous, K.M., Brayer, G.D., Reisner, H.M., High, K.A., 1989. Canine hemophilia B resulting from a point mutation with unusual consequences. Proceedings of the National Academy of Sciences USA 86, 10095-10099.

Gaudermann, P., Vogl, I., Zientz, E., Silva, F.J., Moya, A., Gross, R., Dandekar, T., 2006. Analysis of and function predictions for previously conserved hypothetical or putative proteins in Blochmannia floridanus. BMC Microbiology 6, 1-10.

Gu, W., Brooks, M., Catalfamo, J., Ray, J., Ray, K., 1999. Two distinct mutations cause severe hemophilia B in two related canine pedigrees. Thrombosis Haemostasis 82, 1270-1275.

Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R., McGettigan, P.A., McWilliam, H., Valentin, F., Wallace, I.M., Wilm, A., Lopez, R., Thompson, J.D., Gibson, T.J., Higgins, D.G., 2007. Clustal W and Clustal X version 2.0. Bioinformatics 23, 2947-2948.

Letunic, I., Doerks, T., Bork, P., 2009. SMART 6: recent updates and new developments. Nucleic Acids Research 37, D229-D232.

Lund, O., Nielsen, M., Lundegaard, C., Worning, P., 2002. CPHmodels 2.0: X3M a computer program to extract 3D models. In: CASP5: Proceedings of the 5th Meeting on the Critical Assessment of Techniques for Protein Structure Prediction. 1-5 December 2002, Asilomar, California, USA, Abstract A102.

Lutze, G., Kutschmann, K., Lutze Jr., G., Lichtenfeld, W., 2000. Diagnostic aspects of haemophilia B in dogs. Tierärztliche Praxis 28, 369-373 (in German).

Mauser, A.E., Whitlark, J., Whitney, K.M., Lothrop, C.D., 1996. A deletion mutation causes hemophilia B in Lhasa Apso dogs. Blood 88, 3451-3455.

Mischke, R., 2001. Optimization of coagulometric tests that incorporate human plasma for determination of coagulation factor activities in canine plasma. American Journal of Veterinary Research 62, 625-629.

Mischke, R., Rivera Ramirez, P.A., Deniz, A., Hänies, R., Otto, K., 1996. Haemophilia A in the dog: symptoms, blood coagulation analysis and therapy. Berliner und Münchener Tierärztliche Wochenschrift 109, 279-287.

Rizza, C.R., 1977. Clinical management of haemophilia. British Medical Bulletin 33, 225-230.

Sigrist, C.J., Cerutti, L., de Castro, E., Langendijk-Genevaux, P.S., Bulliard, V., Bairoch, A., Hulo, N., 2009. PROSITE, a protein domain database for functional characterization and annotation. Nucleic Acids Research (Epub).

Table 1

Breed	Mutation in canine factor IX gene	References
Mixed-breed, originally Cairn terner and Beagle (Chapel till Colony	G → A transition at nucleotide 1477 in the region encoding the catalytic domain (substitution of glutamic acid for glycine)	Evans et al. (1989)
Lhasa Apso	Deletion including nucleotides 772-776 and a C → T transition as nucleotide 777	Mauser et al. (1996)
Labrador	Complete deletion of factor IX gene	Brooks et al. (1997)
Pit Bull Terrier	Large deletion mutation spanning the entire 5' region of the factor IX gene extending to exon 6	Gu et al (1999)
Airedale Terner	5 kb insertion in exon 8. which with exon 7 encodes the factor IX catalytic region	Gu et al. (1999)

Table 2

Dog No	Internal number	Signalement, pedigree	Clinical signs	factor IX activity	Sequence analysis	TaqMan
1	P 1519	Male. 3 months	-	1	a	a
2	P 1551	Male, 2 years 5 months	-	<1	a	a
3	P 1554	Male, 1 year 2 months	-	3	a	a
4	P 1615	Male, 6 months (brother of No 4 son of No 10)	-	1	a	a
5	P 1621	Male, 6 month (brother of No 4, son of No. 10)	-	I	a	a
8	P 1867	Male, 2 years, 8 months	-	1	a	a
7	N 983	Female, 2 years. 2 months	-	48	c	c
8	P 1520	Female, 2 years, 7 months		62	c	c
9	P 1552	Female, 5 months	-	69	c	c
10	P 1616	Female, 3 years, 2 months		65	c	c
11	N 909	Female, 1 year 7 months	-	84	n	n
12	N 910	Female, 1 year, 6 months	-	92	n	n
13	N 988	Male, 3 years, 4 months		104	n	n
14	N989	Male, 5 years 1 month	-	100	n	11
15	156834	Male, 7 years, 11 months		154	n	n
16	156854	Female, 2 months	-	109	n	n
17	P 1519	Female, 4 months		77	n	n
18	105960	Male 2 years 2 months		127	n	n
19	Txxx	Male cash, 2 years, 6 months	-	110	n	n
20	P 1943	Male, 1 year 1 month		87	n	n
21	158120	Male castr 1 year, 9 months	-	98	n	n
22	148756	Male, 7 years 4 months		150	n	n

1 Confirmed carrier, mother of Nos. 4 and 5. b Severe bleeding after minor surgeries and injuries, occasional spontaneous bleeding n = Normal, c = carrier, a = affected.

Table 3

ProSite predicted features for trypsin domain:
DISULFID 243 259 By similarity [condition: C-x*-C]
ACT SITE 258 Charge relay system (By similarity) [condition: H] [group: 1]
ACT SITE 306 Charge relay system (By similarity) [condition: D] [group: 1]
DISULFID 373 387 By similarity [condition: C-x*-C]
DISULFID 398 426 By similarity [condition: C-x*-C]
ACT_SITE 402 Charge relay system (By similarity) [condition: S] [group: 1]
Absent feature: DISULFID 342 408 By similarity [condition not true: C-x*-C]

Table 4

Primer	Seq-ID No.	Sequence (5' → 3')	Binding	Annealing Temperature
cFIXg-for-1	4	TGTGTCACTTCCGGCTTCAG	Intron 1	58°C
cFIXg-rev-1	5	TCTACAGCTAGAAGACAAGCATAC	Intron 2
cFIXg-for-2	6	GATAAATTGGCTTTGGGATTACTTGG	Intron 2	58°C
cFIXg-rev-2	7	GTACTTTGCATCTGAAGAACATTACG	Intron 3
cFIXg-for-3	8	GCAGTTTTGAAGAAGCACGGG	Exon 2	58°C
cFIXg-rev-3	9	ACACAGAGAAAAGATACCTAATTCTCA	Intron 4
cFIXg-for-4	10	AAGACAGGGGCATCCCATAATC	Intron 4	58°C
cFIXg-rev-4	11	CTTCCATTAAGTGTTCCTTACCAC	Intron 5
cFIXg-for-5	12	CTCCCAAGCCTCTTTCCATG	Intron 5	58°C
cFIXg-rev-5	13	CAAACAGGGTTTATGAAAGTATGTGAAC	Intron 6
cfix-g-6-for	14	CCGCTTGCCAATGAAAAATA	Intron 6	58°C
cfix-g-6-rev	15	CTCTGGGCTCCAGTTTTGAC	Intron 7
cFIXg-for-7	16	ACACCCCTGCCTATCAACAG	Intron 7	58°C
cFIXg-rev-7	17	GCTCCTCTAGCATTAGCCC	Intron 8
cFIXg-for-8	18	CCTTGGCAAATACGTTTATGTGTAAG	Intron 8	58°C
cFIXg-rev-8	19	TCATGGAAGCCAGCACAGAAC	Exon 8
cfix-g-9-for	20	TTCCTCAAATTTGGGTCTGG	Exon 8	58°C
cfix-g-9-rev	21	CCTAAACGTGTCAACCTTGGA	Exon 8

Claims

1. Canine factor IX gene according to Seq-ID No. 1 having a point mutation, wherein nucleotide 752 is A instead of G.

2. Analysis of a genotype of a dog in respect of haemophilia B by a genetic test for identification of at least one point mutation in Seq-ID No. 1 of the genome of the dog, wherein at least one point mutation leads to an amino acid exchange in position 244 of canine factor IX.

3. Analysis according to claim 2, wherein one point mutation is a point mutation in nucleotide 752.

4. Analysis according to claim 3, wherein the point mutation in nucleotide 752 is a point mutation, where nucleotide 752 is A instead of G.

5. Analysis according to claim 2 or 3, wherein PCR is used for amplification of a region of Seq-ID No. 1, which contains the point mutation of nucleotide 752.

6. Analysis according to one of the claims 2 to 5, wherein the dog is a Rhodesian Ridgeback.

7. Process for the determination of the genetic disposition for haemophilia B of a dog, characterized by the use of the canine factor IX gene of the dog according to Seq-ID No. 1 having at least one point mutation in Seq-ID No. 1 of the genome of the dog, wherein at least one point mutation leads to an amino acid exchange in position 244 of canine factor IX.

8. Process according to claim 7, wherein one point mutation is a point mutation, wherein nucleotide 752 is A instead of G.

9. Process according to claims 7 or 8 for the selection of a Rhodesian Ridgeback for breeding.

Drawing