Background of the invention
[0001] Classical swine fever (CSF) is a highly contagious and often fatal infectious disease
in domestic pigs and wild boar. Outbreaks in industrialized pig productions are controlled
by sanitary measures and large scale culling, and cause significant economic losses
(
Edwards, S., Fukusho, A., Lefevre, P.C., Lipowski, A., Pejsak, Z., Roehe, P., Westergaard,
J., 2000. Classical swine fever: the global situation. Vet. Microbiol. 73 (2-3), 103-119;
Fauquet C.M. et al. 2005. Virus Taxonomy, VIIIth Report of the International Committee
on Taxonomy of Viruses. Elsevier / Academic press, 2005;
Vandeputte, J. and Chappuis, G., 1999. Classical swine fever: the European experience
and a guide for infected areas. Rev. Sci. Tech. 18 (3), 638-647). Outbreaks of CSF have to be reported to the OIE (Office International des Epizooties)
and the disease is controlled within the European Union (EU) by a stamping-out policy
without prophylactic vaccination. Despite sustained eradication efforts, outbreaks
of CSF still occur regularly in European domestic pigs.
[0003] Pestiviruses are small, positive-sense, single-stranded RNA viruses with a genome
of about 12.3 kb (
Meyers, G. and Thiel, H.J., 1996. Molecular characterization of pestiviruses. Adv.
Virus Res. 47, 53-118). The genome comprises one open reading frame encoding a single polyprotein of 3.898
amino acids that is flanked by a 5'terminal and a 3'terminal untranslated region (UTR).
The polyprotein is co-and post-translationally processed by viral and cellular proteases
(
Meyers, G. and Thiel, H.J., 1996. Molecular characterization of pestiviruses. Adv.
Virus Res. 47, 53-118). It is cleaved into four structural proteins (C, ERNS, E1 and E2) and seven non-structural
proteins (Npro, p7, NS2, NS3, NS4A, NS4B, NS5A and NS5B) (
Tautz, N., Elbers, K., Stoll, D., Meyers, G., Thiel H.J., 1997. Serine protease of
pestiviruses: determination of cleavage sites. J. Virol. 71(7), 5415-22).
[0004] For effective control and prevention of virus spread during CSF outbreaks, the fast,
sensitive and reliable detection of CSFV is of particular importance. CSFV can be
detected by virus isolation, antigen ELISA, gel-based RT-PCR and real-time RT-PCR
protocols (
Aguero, M., Fernandez, J., Romero, L.J., Zamora, M.J., Sanchez, C., Belak, S., Arias,
M., Sanchez-Vizcaino, J.M., 2004. A highly sensitive and specific gel-based multiplex
RT-PCR assay for the simultaneous and differential diagnosis of African swine fever
and Classical swine fever in clinical samples. Vet. Res. 35 (5), 551-563;
Hergarten, G., Hurter, K.P., Hess, R.G., 2001. [Detection of infection with classical
swine fever virus in wild boar: a comparison of different laboratory diagnostic methods.].
Dtsch. Tierarztl. Wochenschr. 108 (2), 51-54).
[0005] Different real-time RT-PCR protocols are available and used in the diagnostics laboratories
(
Barlic-Maganja, D. and Grom, J., 2001. Highly sensitive one-tube RT-PCR and microplate
hybridisation assay for the detection and for the discrimination of classical swine
fever virus from other pestiviruses. J. Virol. Methods 95 (1-2), 101-110;
Hoffmann, B., Beer, M., Schelp, C., Schirrmeier, H., Depner, K., 2005. Validation
of a real-time RT-PCR assay for sensitive and specific detection of classical swine
fever. J. Virol. Methods 130 (1-2), 36-44;
Hoffmann, B., Depner, K., Schirrmeier, H., Beer, M., 2006. A universal heterologous
internal control system for duplex real-time RT-PCR assays used in a detection system
for pestiviruses. J. Virol. Methods 136 (1-2), 200-209;
Leifer, I., Depner, K., Blome, S., Le Potier, M.F., Le, D.M., Beer, M., Hoffmann,
B., 2009a. Differentiation of C-strain "Riems" or CP7_E2alf vaccinated animals from
animals infected by classical swine fever virus field strains using real-time RT-PCR.
J. Virol. Methods 158 (1-2), 114-122;
Zhao, J.J., Cheng, D., Li, N., Sun, Y., Shi, Z., Zhu, Q.H., Tu, C., Tong, G.Z., Qiu,
H.J., 2008. Evaluation of a multiplex real-time RT-PCR for quantitative and differential
detection of wild-type viruses and C-strain vaccine of Classical swine fever virus.
Vet. Microbiol. 126 (1-3), 1-10). All established protocols use the conserved 5' UTR as template for CSFV field strain
detection. Recently a C-strain specific protocol was described that uses the E
RNS genome region for specific detection of CSF C-strain "Riems" vaccine virus (
Leifer, I., Depner, K., Blome, S., Le Potier, M.F., Le, D.M., Beer, M., Hoffmann,
B., 2009a. Differentiation of C-strain "Riems" or CP7_E2alf vaccinated animals from
animals infected by classical swine fever virus field strains using real-time RT-PCR.
J. Virol. Methods 158 (1-2), 114-122). In situations with high throughput of positive sample material, amplicon contamination
from the real-time RT-PCR itself or from other RT-PCR applications targeting the same
genome region like sequence analysis can interfere with CSFV diagnostics. Thus, there
is a need for a further specific method for detection of CSFV. The new method has
to be compatible with the detection of reference genes, i.e. the detection of a reference
gene does interfere with the new detection method.
[0006] The inventors unexpectedly found that CSFV can be specifically detected by detection
of the NS5A region or parts thereof. Thus, the present invention provides a new method
for specific CSFV detection. Furthermore, the inventors were able to detect strains
of Classical Swine Fever Virus (CSFV) of which the NS5A region was unknown (SEQ ID
NO. 37 to 41). This unambiguously shows that the method according to the present invention
provides a method by which all CSFV strains can be detected while being very specific
for CSFV.
Description of the invention
[0007] The present invention relates on a method for determining the presence of a classical
swine fewer virus (CSFV) in a subject comprising the following step:
- detection of the NS5A region or parts thereof of at least one classical swine fewer
virus (CSFV) genome in a sample derived from said subject;
wherein the detection of the NS5A region or parts thereof of the at least one classical
swine fewer virus (CSFV) genome is attributed to the presence of a classical swine
fewer virus (CSFV) in said subject.
[0008] A "Sample" in the meaning of the invention can be all biological tissues and all
fluids such as lymph, urine, cerebral fluid, blood, saliva, serum, faeces, plasma,
cell culture supernatant. Tissues may be, e.g. organs tissue like spleen, kidney,
tonsil, lymp node, epithelium tissue, connective tissue such as bone or blood, muscle
tissue such as visceral or smooth muscle and skeletal muscle and, nervous tissue.
Tissue may also be selected from the group consisting of bone marrow, cartilage, skin,
mucosa and hair. The sample is collected from the patient or subject in which the
presence of CSFV shall be determined according to the invention. Where appropriate,
as for instance in the case of solid samples, the sample may need to be solubilised,
homogenized, or extracted with a solvent prior to use in the present invention in
order to obtain a liquid sample. A liquid sample hereby may be a solution or suspension.
Liquid samples may be subjected to one or more pre-treatments prior to use in the
present invention. Such pre-treatments include, but are not limited to dilution, filtration,
centrifugation, concentration, sedimentation, precipitation, dialysis. Pre-treatments
may also include the addition of chemical or biochemical substances to the solution,
such as acids, bases, buffers, salts, solvents, reactive dyes, detergents, emulsifiers,
chelators.
[0009] By NS5A region any the region of the genome of a classical swine fewer virus is meant
which shows at least 70% sequence identity to the region of nucleotides 8423 to 9913
of SEQ ID NO. 1, preferably at least 80% sequence identity, more preferably at least
90% sequence identity, even more preferably at least 95% sequence identity (including
but not limited to at least 96% sequence identity, at least 97% sequence identity,
at least 98% sequence identity, at least 99% sequence identity, at least 99.5% sequence
identity and 100% sequence identity). The determination of percent identity between
two sequences may accomplished by different methods and algorithms known by those
skilled in the art, e.g. by using the mathematical algorithm of
Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90: 58735877. Such an algorithm is incorporated into the BLASTN and BLAST programs of
Altschul et al. (1990) J. Mol. Biol. 215: 403-410. BLAST nucleotide searches are performed with the BLASTN program, score = 100, word
length = 12, to obtain nucleotide sequences showing a given sequence identity to the
region of genomes of classical swine fewer viruses (CSFV) recited herein. To obtain
gapped alignments for comparative purposes, Gapped BLAST is utilized as described
in
Altschul et al. (1997) Nucleic Acids Res. 25: 3389-3402. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective
programs are used.
[0010] In a further preferred embodiment the NS5A region of the genome of the at least one
classical swine fewer virus is the NS5A region of at least one of the genomes of the
classical swine fewer viruses (CSFV) strain selected from the group consisting of
the known strains AY072924 "Paderborn", EU490425 '"Thiverval" ,EU497410 "JL1(06)",
AY775178 "Shimen/HVRI", AY646427 "IL/94/TWN", AY805221 "C/HVRI", DQ127910 "SWH", X8793
"Alfort/187", J04358 "Alfort/Tueb", X96550 "CAP", AY578688 "RUCSFPLUM", AY578687 "BRESCIAX",
AY55439796 "TD", AY663656 "China", AY259122 "Riems", AF326963 "Eystrup" (SEQ ID NO.
1), AY382481 "China vacc.", AY568569 "CH/01/TWN", AY367767 "GXWZ02", AF531433 "HCLV",
AF407339 "strain 39", AF333000 "cF114", AF099102 "Russian vacc.", AF092448 "Shimen",
AF091507 "HCLV", AF091661 "Brescia", U90951 "Alfort A19", U45478 "Glentorf", U45477
"Riems", as well as the strains with newly identified and sequenced NS5A region CSFV
Koslov, CSFV Hennef, CSFV Borken, CSFV Roesrath, and CSFV Bergen.
[0011] In one embodiment of the invention the NS5A region is detected by detecting one or
more of the sequences selected from the group consisting of SEQ ID NOs 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 ,29, 30, 31, 32,
33, 34, 35, 36, 37, 38, 39, 40, and 41, or fragments thereof. In a further embodiment
said fragment comprises at least the sequence according to SEQ ID NO. 2.
[0012] Methods and means for the specific detection of sequences within a sample comprising
a mixture of nucleic acid is well known by those skilled in the art. Such method may
comprise sequencing methods (including Sanger method (
Sanger, F. et al. (1977): DNA sequencing with chain-terminating inhibitors. Proc.
Natl. Acad. Sciences US 74, 5463-5467), shot gun- and pyrosequencing (
Ronaghi, M (2001): Pyrosequencing sheds light on DNA sequencing. Genome Research 11,
3-11;
Bankier AT (2001) Shotgun DNA sequencing. Methods Mol. Biol. 167, 89-100, GS FLX Pyrosequencing (
Droege, M. Hill, B. (2008): The Genome Sequencer FLX System- longer reads, more applications,
straight forward bioinformatics and more complete data sets. J. Biotechnol. 136, 3-10) and other next-generation sequencing technologies like Illumina/Solexa, ABI/Solid
(
Morozova, O., Marra, M.A. (2008): Applications of next-generation sequencing technologies
in functional genomics. Genomics 92, 255-64),
in-situ hybridisation, Northern blot, polymerase chain reaction (PCR), quantitative PCR (qPCR),
real-time PCR, reverse transcriptase PCR (RT-PCR), real-time RT-PCR, Microarray analysis.
[0013] The detection of the NS5A region in one embodiment comprises the use of a nucleic
acid probe hybridizing to the NS5A region of at least one classical swine fewer virus
(CSFV) genome and/or to a nucleic acid complementary to the at least one NS5A region
of the at least one classical swine fewer virus (CSFV) genome.
[0014] "Nucleic acid", in accordance with the present invention, includes DNA, such as cDNA
or genomic DNA, and RNA. It is understood that the term "RNA" as used herein comprises
all forms of RNA including mRNA as well as genomic RNA (gRNA) of viruses. Preferably,
embodiments reciting "RNA" are directed to gRNA of the virus. In connection with DNA
the rules for nomenclature of the International Union of Pure and Applied Chemistry
(IUPAC) are used which are as follows: A is adenine, C is cytosine, G is guanine,
T is thymine, R is G or A , Y is T or C, K is G or T, M is A or C, S is G or C, W
is A or T, B is G or T or C (all but A), D is G or A or T (all but C), H is A or C
or T (all but G), V is G or C or A (all but T), N is A or G or C or T (any). These
symbols are also valid for RNA, although U replaces T (for uracil rather than thymine).
[0015] "Nucleic acid probe", in accordance with the present invention is an oligonucleotide,
nucleic acid or a fragment thereof that specifically hybridizes with a target sequence
in a nucleic acid molecule, e.g. gRNA of a CSFV or cDNA or amplification products
thereof. Thus, a nucleic acid probe according to the present invention is an oligonucleotide,
nucleic acid or a fragment thereof, which is substantially complementary to a specific
target sequence. A substantially complementary nucleic acid may have a sequence completely
complementary to the target sequence. However, also mismatches of one or more nucleotides
may be allowed, so long as the nucleic acid probe can specifically hybridize to the
target sequence(s) under stringent conditions. For example, the nucleic acid probe
of the present invention include oligonucleotides that have a sequence identity to
the target sequence of at least 70%, preferably at least 80%, more preferably at least
90%, even more preferably at least 95% sequence identity (including but not limited
to at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence
identity, at least 99% sequence identity, at least 99.5% sequence identity and 100%
sequence identity). It may also be desirable that a nucleic acid probe binds to a
variety of sequences which differ by one or more nucleotides. A way to encounter this
problem is the use of so called degenerated nucleic acid probes. Degenerated nucleic
acid probes are mixtures of oligonucleotides which differ in sequence at one or more
positions. The oligonucleotides of degenerated nucleic acid probes may differ in their
length or may all have the same length. In one embodiment of the present invention
the nucleic acid probe is a degenerated nucleic acid probe and hybridizes to NS5A
regions of essentially all classical swine fewer viruses (CSFV) genomes.
[0016] In one embodiment of the present invention nucleic acid probes (for CSFV as well
as for reference nucleic acids) have a length of 7 to 40 nucleotides, preferably 12
to 30 nucleotides, more preferably 15 to 20 nucleotides, even more preferably the
nucleic acid probe has a length of 16 nucleotides.
[0017] In a further embodiment the nucleic acid probe hybridizes to a nucleic acid having
at least 70% sequence identity to the sequence of nucleotides 8423 to 9913 according
to SEQ ID NO. 1, preferably at least 80% sequence identity, more preferably at least
90% sequence identity, even more preferably at least 95% sequence identity (including
but not limited to at least 96% sequence identity, at least 97% sequence identity,
at least 98% sequence identity, at least 99% sequence identity, at least 99.5% sequence
identity and 100% sequence identity).
[0018] In a preferred embodiment the nucleic acid probe hybridizes to a nucleic acid having
a sequence selected from the group consisting of SEQ ID NOs 8, 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 ,29, 30, 31, 32, 33, 34,
35, 36, 37, 38, 39, 40, and 41 (see Figure 2). In a further embodiment the nucleic
acid probe hybridizes to a nucleic acid having any of the sequences according to SEQ
ID NOs 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
28 ,29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, and 41.
[0019] In a further embodiment the nucleic acid probe hybridizes to a nucleic acid having
at least 70% sequence identity to the sequence of nucleotides 9400 to 9505 according
to SEQ ID NO. 1, preferably at least 80% sequence identity, more preferably at least
90% sequence identity, even more preferably at least 95% sequence identity (including
but not limited to at least 96% sequence identity, at least 97% sequence identity,
at least 98% sequence identity, at least 99% sequence identity, at least 99.5% sequence
identity and 100% sequence identity).
[0020] In a further embodiment the nucleic acid probe hybridizes to a nucleic acid having
at least 70% sequence identity to the sequence of nucleotides 9440 to 9469 according
to SEQ ID NO. 1, preferably at least 80% sequence identity, more preferably at least
90% sequence identity, even more preferably at least 95% sequence identity (including
but not limited to at least 96% sequence identity, at least 97% sequence identity,
at least 98% sequence identity, at least 99% sequence identity, at least 99.5% sequence
identity and 100% sequence identity).
[0021] In a further embodiment the nucleic acid probe hybridizes to a nucleic acid having
at least 70% sequence identity to the sequence of nucleotides 9447 to 9462 according
to SEQ ID NO. 1, preferably at least 80% sequence identity, more preferably at least
90% sequence identity, even more preferably at least 95% sequence identity (including
but not limited to at least 96% sequence identity, at least 97% sequence identity,
at least 98% sequence identity, at least 99% sequence identity, at least 99.5% sequence
identity and 100% sequence identity).
[0022] In one embodiment of the present invention the nucleic acid probe has between 16
and 40 nucleotides and comprises the sequence according to SEQ ID NO. 2.
[0023] As outlined above it might be desirable that the classical swine fewer virus (CSFV)
is detected specifically. Thus in one embodiment of the present invention the nucleic
acid probe does not hybridize to a bovine viral diarrhoea virus (BVDV) and does not
hybridize to a border disease virus (BDV) under stringent conditions.
[0024] The hybridization of a nucleic acid probe to DNA or RNA from a sample is an indication
of the presence of the relevant DNA or RNA in the sample. Hybridization conditions
are known to those skilled in the art and can be found in
Current Protocols in Molecular Biology, John Wiley & Sons, N.Y., 6.3.1-6.3.6, 1991. In one embodiment of the present invention the nucleic acid probe does hybridize
to the NS5A region of at least one classical swine fewer virus (CSFV) but does not
to nucleic acids from BVDV and BDV or to nucleic acids complementary thereon under
stringent conditions. Stringent conditions are defined as equivalent to hybridization
in 6X sodium chloride/sodium citrate (SSC) at 45°C, followed by a wash in 0.2 X SSC,
0.1 % SDS at 65°C
[0025] In a preferred embodiment the nucleic acid probe does not hybridize to a bovine viral
diarrhoea virus (BVDV) and does not hybridize to a border disease virus (BDV). The
skilled artisan will recognize that it is desirable that the nucleic acid probe does
not hybridize to BVDV and BDV under stringent conditions. However, the skilled artisan
is aware of the fact that under certain circumstances unspecific hybridization of
nucleic acids may occur und non stringent conditions and/or due to high concentration
of "unspecific" target nucleic acids. Thus, the nucleic acid probe according to the
invention might hybridize unspecific to the nucleic acid of BVDV or BDV under unfavourable
conditions, e.g. high concentrations of nucleic acids of BVDV and/or BDV as they might
occur in e.g. under cell culture conditions. Nevertheless the nucleic acid probe according
to the invention does not hybridize to nucleic acids of BVDV or BDV under conditions
of the method according to the invention, i.e. with concentrations of nucleic acids
BVDV and/or BDV as they occur in samples of subjects or in concentrations of nucleic
acids of BVDV and/or BDV as they occur after amplification of the NS5A region of a
CSFV or fragments thereof with specific CSFV amplification primers according to the
present invention.
[0026] Further included are nucleic acid mimicking molecules known in the art such as synthetic
or semisynthetic derivatives of DNA or RNA and mixed polymers, both sense and antisense
strands. They may contain additional non-natural or derivatized nucleotide bases,
as will be readily appreciated by those skilled in the art. Such nucleic acid mimicking
molecules or nucleic acid derivatives according to the invention include peptide nucleic
acid, phosphorothioate nucleic acid, phosphoramidate nucleic acid, 2'-O-methoxyethyl
ribonucleic acid, morpholino nucleic acid, hexitol nucleic acid (HNA), 3'-minor groove
binder oligodeoxynucleotide conjugates (MGB-ODN) and locked nucleic acid (LNA) (see,
for example,
Braasch and Corey, Chemistry & Biology 8, 1-7 (2001); and
Kutyavin, Afonina, Mills et al., Nucleic Acid Research 28(2), 655-661 (2000)). LNA is an RNA derivative in which the ribose ring is constrained by a methylene
linkage between the 2'-oxygen and the 4'-carbon.
[0027] In one embodiment of the present invention the nucleic acid probe comprises at least
one modification to increase the stability of the probe-target hybrid. Such modifications
are known by those skilled in the art. In one embodiment of the present invention
the oligonucleotides of the nucleic acid probe comprise at least one modification
selected from the group consisting of locked nucleic acids (LNA), peptide nucleic
acid (PNA) and 3'-minor groove binder (MGB).
[0028] For the purposes of the present invention, a peptide nucleic acid (PNA) is a polyamide
type of DNA analogue with an amide backbone in place of the sugar-phosphate backbone
of DNA. As a consequence, certain components of DNA, such as phosphorus, phosphorus
oxides, or deoxyribose derivatives, are not present in PNAs. As disclosed by
Nielsen et al., Science 254:1497 (1991); and
Egholm et al., Nature 365:666 (1993), PNAs bind specifically and tightly to complementary DNA strands and are not degraded
by nucleases. Furthermore, they are stable under acidic conditions and resistant to
proteases (
Demidov et al. (1994), Biochem. Pharmacol., 48, 1310-1313). Their electrostatically neutral backbone increases the binding strength to complementary
DNA as compared to the stability of the corresponding DNA-DNA duplex (
Wittung et al. (1994), Nature 368, 561-563;
Ray and Norden (2000), Faseb J., 14, 1041-1060).
[0029] For the purposes of the present invention, Locked nucleic acid (LNA) nucleosides
are a class of nucleic acid analogues in which the ribose ring is "locked" by a methylene
bridge connecting the 2'-O atom and the 4'-C atom. LNA nucleosides contain the common
nucleobases (T, C, G, A, U and mC) and are able to form base pairs according to standard
Watson-Crick base pairing rules. When incorporated into a DNA oligonucleotide, LNA
therefore hybridize with a complementary nucleotide strand more rapid and increases
the stability of the resulting duplex. As a result the duplex melting temperature
(Tm) may increase by up to 8°C per LNA monomer substitution. (see e.g.
Peterson, M. and Wengel, J. (2003) LNA: a versatile tool for therapeutics and genomics.
Trends Biotechnol. 21, 74-81).
[0030] For purpose of the present invention a 3'-Minor groove binder probe is a nucleic
acid probe which is covalently linked to a minor groove binding conjugate at the 3'-end
of said nucleic acid probe. Minor groove binding conjugates are well known by those
skilled in the art (see e.g.
Kutyavin, Afonina, Mills et al., Nucleic Acid Research 28(2), 655-661 (2000)). They may be selected from e.g. DPI
3 and CDPI
3. Furthermore, it will be easily recognized by those skilled in the art that the minor
groove binding conjugates may be directly linked to the 3'-end of the nucleic acid
probe or may be indirectly linked to the 3'-end of the nucleic acid probe via a linker.
Such linkers are well known by the skilled artisan (see e.g.
Kutyavin, Afonina, Mills et al., Nucleic Acid Research 28(2), 655-661 (2000)). Examples of such linkers are aminopropyl or alkylamine linker. In one embodiment
the minor groove binding conjugate binds to the minor groove formed by the 3' terminal
5 to 6 bp of the nucleic acid probe/target nucleic acid probe duplex.
[0031] In fact, PNA, LNA or MGB-nucleic acid probes bind more strongly to DNA than DNA itself
does. Because of this, PNA/DNA, LNA/DNA and MGB-nucleic acid probes/DNA duplexes bind
under a wider range of stringency conditions than DNA/DNA duplexes, making it easier
to perform multiplex hybridization. Smaller probes can be used than with DNA due to
the strong binding. In addition, it is more likely that single base mismatches can
be determined with PNA/DNA, LNA/DNA and MGB-nucleic acid probes/DNA hybridization
because a single mismatch in a PNA/DNA, LNA/DNA and MGB-nucleic acid probes/DNA 15-mer
lowers the melting point (T
m) by 8°-20° C, vs. 4°-16° C for the DNA/DNA 15-mer duplex. Thereby the stability of
the probe-target hybrid is increased. This also improves discrimination between perfect
matches and mismatches. PNA, LNA and MGB-nucleic acid probes also permit the hybridisation
of DNA samples at low salt or no-salt conditions. As a consequence, the target DNA
has fewer secondary structures under hybridisation conditions and is more accessible
to probe molecules.
[0032] In one embodiment the nucleic acid probe comprises at least at least 4 modifications
to increase the stability of the probe-target hybrid, more preferably at least 5,
even more preferably 7.
[0033] In one embodiment the nucleic acid probe has the sequence of SEQ ID NO. 2. In a further
embodiment the nucleic acid probe has the sequence of SEQ ID NO. 2 and has 7 LNA.
In a further embodiment the nucleic acid probe comprises at least 4 modifications
to increase the stability of the probe-target hybrid, wherein said modifications are
at four positions selected from the group consisting of positions 2, 4, 7, 9, 11,
13 and 15 of SEQ ID NO. 2. In a yet further embodiment the nucleic acid probe comprises
at least 5 modifications to increase the stability of the probe-target hybrid, wherein
said modifications are at five positions selected from the group consisting of positions
2, 4, 7, 9, 11, 13 and 15 of SEQ ID NO. 2. In a more preferred the nucleic acid has
the sequence according to SEQ ID NO. 2 and has LNAs at position 2, 4, 7, 9, 11, 13
and 15.
[0034] In some cases, the concentration of classical swine fewer virus (CSFV) present in
a subject may be below detectable levels. In such case it is desirable to amplify
the genome of at least one classical swine fewer virus (CSFV) or fragments thereof.
Thus, in one embodiment of the present invention prior to the detection of the NS5A
region of the at least one classical swine fewer virus (CSFV) genome said genome of
the at least one classical swine fewer virus (CSFV) or parts thereof is amplified.
The skilled artisan will unambiguously recognize that the region which has to be detected
must be part of the amplified part of the at least one classical swine fewer virus
(CSFV) genome, i.e. the region to which the nucleic acid probe specifically hybridizes
has to be part of the amplified region.
[0035] Nucleic-acid amplification can be accomplished by any of the various nucleic-acid
amplification methods known in the art, including but not limited to the polymerase
chain reaction (PCR), ligase chain reaction (LCR) (such as in
Landegren, et al., "A Ligase-Mediated Gene Detection Technique," Science 241:1077-1080,
1988, or, in
Wiedmann, et al., "Ligase Chain Reaction (LCR)--Overview and Applications," PCR Methods
and Applications (Cold Spring Harbor Laboratory Press, Cold Spring Harbor Laboratory,
NY, 1994) pp. S51-S64.)), transcription-based amplification system (TAS), nucleic acid sequence based amplification
(NASBA), rolling circle amplification (RCA), transcription-mediated amplification
(TMA), self-sustaining sequence replication (3SR), isothermal amplification (such
as in
Walker, et al., "Strand displacement amplification--an isothermal, in vitro DNA amplification
technique," Nucleic Acids Res. 20(7):1691-6 (1992)) and Qβ amplification. Polymerase chain reaction amplification is preferred.
[0036] In one embodiment of the present invention the NS5A region of the genome of at least
one classical swine fever virus (CSFV) or fragments thereof is amplified prior to
detection.
[0037] In one embodiment of the amplification product at least comprises a sequence which
has a sequence identity of at least 70% to the region of nucleotides 9447 to 9462
according to SEQ ID NO. 1, preferably the region has a sequence identity of more than
80%, more preferably more than 90%, even more preferably more than 95% (including
but not limited to more than 96%, more than 97%, more than 98%, more than 99%, more
than 99.5% and 100% sequence identity). In a preferred embodiment the amplified region
at least comprises the sequence according to SEQ ID NO. 2.
[0038] In a preferred embodiment the amplification product has at least 70% sequence identity
to the nucleotides 8423 to 9913 according to SEQ ID NO. 1, preferably said region
has at least 80% sequence identity to the nucleotides 9400 to 9505 according to SEQ
ID NO. 1, more preferably at least 90% sequence identity, even more preferably at
least 95% sequence identity (including but not limited to at least 96% sequence identity,
at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence
identity, at least 99.5% sequence identity and 100% sequence identity).
[0039] In a further embodiment the amplification product has a sequence identity of at least
70% nucleotides 9388 to 9507 according to SEQ ID NO. 1, preferably at least 80% sequence
identity to the nucleotides 9400 to 9505 according to SEQ ID NO. 1, more preferably
at least 90% sequence identity, even more preferably at least 95% sequence identity
(including but not limited to at least 96% sequence identity, at least 97% sequence
identity, at least 98% sequence identity, at least 99% sequence identity, at least
99.5% sequence identity and 100% sequence identity).
[0040] In a further preferred embodiment the amplification product has a sequence identity
of at least 70% to the nucleotides 9400 to 9505 according to SEQ ID NO. 1, preferably
said region has at least 80% sequence identity to the nucleotides 9400 to 9505 according
to SEQ ID NO. 1, more preferably at least 90% sequence identity, even more preferably
at least 95% sequence identity (including but not limited to at least 96% sequence
identity, at least 97% sequence identity, at least 98% sequence identity, at least
99% sequence identity, at least 99.5% sequence identity and 100% sequence identity).
[0041] In a further preferred embodiment at least one of the regions of the regions selected
from the group of sequences consisting of SEQ ID NO.s 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 ,29, 30, 31, 32, 33, 34, 35, 36,
37, 38, 39, 40, and 41 is amplified prior to detection. In a further embodiment at
least one amplified region comprises at least one sequence selected from group of
sequences of nucleotides 13 to 118 of any one of the sequences according to SEQ ID
NOs 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
28 ,29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40, or nucleotides 1 to 107of SEQ
ID 41.
[0042] In one embodiment the amplification product has a length of 20 to 1500 nucleotides,
preferably 40 to 1000 nucleotides, more preferably 50 to 500 nucleotides, even more
preferably 80 to 150 nucleotides, most preferred the amplification product has a length
of 90 to 120 nucleotides.
[0043] The person skilled in the art knows how to design and manufacture primers suited
for the amplification as outlined above, i.e. oligonucleotide primers. Oligonucleotide
primers may be prepared using any suitable method, such as, for example, the phosphotriester
and phosphodiester methods or automated embodiments thereof. In one such automated
embodiment diethylophosphoramidites are used as starting materials and may be synthesized
as described by
Beaucage et al., Tetrahedron Letters, 22:1859-1862 (1981). One method for synthesizing oligonucleotides on a modified solid support is described
in
U.S. Pat. No. 4,458,006. It is also possible to use a primer which has been isolated from a biological source
(such as a restriction endonuclease digest).
[0044] In a further embodiment the at least one CSFV amplification primer is suited for
amplifying a region of a classical swine fewer virus genome (CSFV), wherein the amplification
product has a sequence identity of at least 70% to any one of the sequences selected
from the group consisting of nucleotides 8423 to 9913 according to SEQ ID NO. 1, nucleotides
9388 to 9507 according to SEQ ID NO. 1, nucleotides 9400 to 9505 according to SEQ
ID NO. 1, and nucleotides 9447 to 9462 according to SEQ ID NO. 1. Preferably said
nucleic acid has a sequence identity of at least 80% sequence identity to any one
of the sequences selected from the group consisting of nucleotides 8423 to 9913 according
to SEQ ID NO. 1, nucleotides 9388 to 9507 according to SEQ ID NO. 1, nucleotides 9400
to 9505 according to SEQ ID NO. 1, and nucleotides 9447 to 9462 according to SEQ ID
NO. 1, more preferably at least 90% sequence identity, even more preferably at least
95% sequence identity (including but not limited to at least 96%, at least 97%, at
least 98%, at least 99%, at least 99.5% and 100% sequence identity).
[0045] Preferred amplification primers have a length of from about 15-100, more preferably
about 20-50, most preferably about 20-40 bases. He is also aware of the possibility
to design degenerated primer in order to allow hybridization of the primer to a variety
of sequences differing in sequence at one or more positions. The skilled artisan easily
recognizes that any primers that are suited for the amplification of fragments of
the genome of a classical swine fewer virus (CSFV) as outlined above can be used in
the method according to the present invention.
[0046] In a preferred embodiment the primers for amplification (CSFV amplification primer)
comprise a 3'end consisting of at least the last 6 nucleotides according to the sequence
of SEQ ID NO. 3 or SEQ ID NO. 4, respectively, preferably of at least the last 8 nucleotides,
more preferably of at least the last 10 nucleotides. In further preferred embodiment
the 3'ends of the at least two CSFV amplification primer consist of the sequence according
to the sequence of SEQ ID NO. 3 or SEQ ID NO. 4, respectively. In yet another preferred
embodiment the at least two CSFV amplification primer have the sequence according
to SEQ ID NO. 3 or SEQ ID NO. 4, respectively. However, in one non limiting embodiment
of the present invention amplification is performed using amplification primers having
the sequence of SEQ ID NO. 3 and SEQ ID NO. 4.
[0047] In some cases it might be necessary to not only determine the presence of a classical
swine fewer virus (CSFV) but also verify the isolation of the nucleic acid from the
sample or to determine the relative amount classical swine fewer virus (CSFV) in a
subject or a sample of a subject, respectively. For routine diagnostic the integration
of controls verifying the RNA isolation step as well as the RT-PCR are of utmost importance.
In 2005, a multiplex real-time RT-PCR assay with a heterologous internal control was
described (
Hoffmann, B., Depner, K., Schirrmeier, H., Beer, M., 2006. A universal heterologous
internal control system for duplex real-time RT-PCR assays used in a detection system
for pestiviruses. J. Virol. Methods 136 (1-2), 200-209). However, for analysing the status of the sample the amplification of nucleic acids
from internal controls, e.g. house-keeping genes is preferred. Therefore, reference
nucleic acids are included in a preferred embodiment of the present invention. Such
a reference nucleic acid may be added externally or nucleic acids contained in the
sample of the subject may serve as a reference nucleic acid. In latter case nucleic
acids of so called housekeeping genes are preferred as they are most likely are abundant
throughout all samples and are expressed substantially constant and are, therefore,
well suited as reference nucleic acids. As the genome of classical swine fewer viruses
(CSFV) consists of RNA, reference nucleic acids preferably consist of RNA, e.g. mRNA
of said housekeeping genes. Nevertheless, the reference nucleic acid may also consist
of DNA or any other nucleic acid as outlined above. In a further embodiment the reference
nucleic acid consists of RNA and is reverse transcribed to cDNA. In a preferred embodiment
the reference nucleic acid is an mRNA of one or more genes selected from the group
consisting of β-actin, Glyceraldehyd-3-phosphate dehydrogenase (GAPDH), 18S rRNA,
ß 2 microglobulin. In a further preferred embodiment of the present invention said
reference nucleic acid is the mRNA of β-actin (SEQ ID NO. 42).
[0048] Reference nucleic acid probes and/or reference amplification primers might be necessary
for the detection of the reference nucleic acid. The skilled artisan knows how to
design suited primers and/or probes. Different regions of the reference nucleic acid
may serve for the detection and the respective reference amplification primers and/or
reference nucleic acid probes can be designed by those skilled in the art. In a preferred
embodiment the mRNA of β-actin is determined by using the reference amplification
primers, said reference amplification primers comprising 3'-ends consisting of at
least the last 6 nucleotides of the sequence according to SEQ ID NO. 5 and SEQ ID
NO. 6, respectively. In preferred embodiment the reference amplification primers have
3'-ends consisting of the sequences according to SEQ ID NO. 5 and SEQ ID NO. 6, respectively.
In one embodiment the reference nucleic acid probe comprises the sequence according
to SEQ ID NO. 7 and is between 5 and 40 nucleotides in length. In a preferred embodiment
the reference nucleic acid probe has the sequence according to SEQ ID NO. 7.
[0049] In a further embodiment the nucleic acid probe and/or one or more CSFV amplification
primer and/or reference nucleic acid probes and/or reference amplification primers
may by labelled with fluorescent dyes. In the context of the present invention, fluorescent
dyes may for example be FAM (5-or 6-carboxyfluorescein), VIC, NED, fluorescein, fluorescein
isothiocyanate (FITC), IRD-700/800, cyanine dyes, also as CY3, CY5, CY3.5, CY5.5,
Cy7, xanthen, 6-carboxy-2',4',7',4,7-hexachlorofluorescein (HEX), TET, 6-carboxy-4',5'-dichloro-2',7'-dimethodyfluorescein
(JOE), N,N,N',N'-Tetramethyl-6-carboxyrhodamine (TAMRA), 6-carboxy-X-rhodamine (ROX),
5-Carboxyrhodamine-6G (R6G5), 6-carboxyrhodamine-6G (RG6), Rhodamine, Rhodamine Green,
Rhodamine Red, Rhodamine 110, BODIPY dyes, such as BODIPY TMR, Oregon Green, coumarines
such as Umbelliferone, benzimides, such as Hoechst 33258; phenanthridines, such as
Texas Red, Yakima Yellow, Alexa Fluor, PET, ethidium bromide, acridinium dyes, carbazol
dyes, phenoxazine dyes, porphyrine dyes, polymethin dyes, and the like.
[0050] Different methods for the amplification and/or detection of nucleic acids are known
to those skilled in the art. Any method may be applied by which nucleic acids may
be detected specifically, i.e. detection of specific sequences within said nucleic
acid. In a preferred embodiment of the present invention the detection and/or amplification
of the NS5A region and/or the reference nucleic acid is performed by one or more of
the methods selected from a group consisting of sequencing (including Sanger method,
shot-gun sequencing and pyro sequencing
in-situ hybridisation, Northern blot, polymerase chain reaction (PCR), quantitative PCR (qPCR),
real-time PCR, reverse transcriptase PCR (RT-PCR), real-time RT-PCR, Microarray analysis.
[0051] The real-time PCR is a method to simultaneously amplify and quantify nucleic acids
using a polymerases chain reaction (PCR). Real-time reverse transcription PCR (RT-PCR)
is a real-time PCR method further comprising a reverse transcription of RNA into DNA,
e.g. mRNA into cDNA. In qPCR methods, the amplified nucleic acid is quantified as
it accumulates. Typically, fluorescent dyes that intercalate with double-stranded
DNA (e.g. ethidiumbromide or SYBR® Green I) or labelled nucleic acid probes ("reporter
probes") that fluoresce when hybridized with a complementary nucleic acid (e.g. the
accumulating DNA) are used for detection and/or quantification in PCR based methods.
Particularly, fluorogenic primers, hybridization probes (e.g. LightCycler probes (Roche)),
hydrolysis probes (e.g. TaqMan probes (Roche)), or hairpin probes, such as molecular
beacons, Scorpion primers (DxS), Sunrise primers (Oncor), LUX primers (Invitrogen),
Amplifluor primers (Intergen) or the like can be used as reporter probes. In accordance
with the present invention, fluorogenic primers or probes may for example be primers
or probes to which fluorescence dyes have been attached, e.g. covalently attached.
Such fluorescence dyes may for example be FAM (5-or 6-carboxyfluorescein), VIC, NED,
Fluorescein, FITC, IRD-700/800, CY3, CY5, CY3.5, CY5.5, HEX, TET, TAMRA, JOE, ROX,
BODIPY TMR, Oregon Green, Rhodamine Green, Rhodamine Red, Texas Red, Yakima Yellow,
Alexa Fluor, PET Biosearch Blue™, Marina Blue®, Bothell Blue®, CAL Fluor® Gold, CAL
Fluor® Red 610, Quasar™ 670, LightCycler Red640®, Quasar™ 705, LightCycler Red705®
and the like. Particular reporter probes may additionally comprise fluorescence quenchers.
[0052] In particular embodiments of the invention the polymerase used for PCR based methods
is a polymerase from a thermophile organism or a thermostable polymerase or is selected
from the group consisting of
Thermus thermophilus (Tth) DNA polymerase,
Thermus acquaticus (Taq) DNA polymerase,
Thermotoga maritima (Tma) DNA polymerase,
Thermococcus litoralis (Tli) DNA polymerases,
Pyrococcus furiosus (Pfu) DNA polymerase,
Pyrococcus woesei (Pwo) DNA polymerase,
Pyrococcus kodakaraensis KOD DNA polymerase,
Thermus filiformis (Tfi) DNA polymerase,
Sulfolobus solfataricus Dpo4 DNA polymerase,
Thermus pacificus (Tpac) DNA polymerase,
Thermus eggertssonii (Teg) DNA polymerase,
Thermus brockianus (Tbr) and
Thermus flavus (Tfl) DNA polymerase.
[0053] The host for the classical swine fewer virus (CSFV) are swine. However, it might
be necessary to determine the presence of the virus in any other species, e.g. humans
which come into contact with swines. Thus, in one embodiment the subject according
to the present invention is a mammal, e.g. a human, cattle, cat, dog, horse, or swine.
In a preferred embodiment the subject is a swine.
[0054] The present invention further relates to a kit for determining the presence of a
classical swine fewer virus (CSFV) in a subject comprising:
- a nucleic acid probe which is capable of hybridising to the NS5A region of a classical
swine fewer virus (CSFV) or parts thereof and/or to a nucleic acid complementary to
the NS5A region of classical swine fewer virus (CSFV) or parts thereof and/or at least
one primer for sequencing of the NS5A region of the at least one classical swine fewer
virus (CSFV) or parts thereof.
[0055] The kit may optionally further comprises at least one primer for the amplification
of the genome of a classical swine fewer virus (CSFV amplification primer). In a preferred
embodiment the kit comprises at least one CSFV amplification primer for the amplification
of the genome of a CSFV or parts thereof. The kit additionally and optionally may
comprise reference nucleic acid probes and reference amplification primers according
to the present invention
[0056] The nucleic acid probe, CSFV amplification primer, reference nucleic acid probes
and reference amplification primers of the kit have the same embodiments and features
as outlined herein above.
[0057] In one embodiment the kit is a kit for performing real-time RT-PCR. Thus, in this
embodiment the kit according to the present invention further comprises reagents for
conducting real-time RT-PCR. Such reagents include buffers, dNTPs, and enzymes (such
as polymerases) for performing real-time RT-PCR. The skilled artisan is aware of reagents
needed for performing real-time RT-PCR.
[0058] The term "polymerase" refers to an enzyme that synthesizes nucleic acid strands (e.g.,
RNA or DNA) from ribonucleoside triphosphates or deoxynucleoside triphosphates.
[0059] A variety of polypeptides having polymerase activity are useful in accordance with
the present invention. Included among these polypeptides are enzymes such as nucleic
acid polymerases (including DNA polymerases and RNA polymerases). Such polymerases
include, but are not limited to,
Thermus thermophilus (Tth) DNA polymerase,
Thermus aquaticus (Taq) DNA polymerase,
Thermotoga neopolitana (Tne) DNA polymerase,
Thermotoga maritima (Tma) DNA polymerase,
Thermococcus litoralis (Tli or VENT™.) DNA polymerase,
Pyrococcus furiosus (Pfu) DNA polymerase, DEEPVENT™ DNA polymerase,
Pyrococcus woosii (Pwo) DNA polymerase,
Pyrococcus sp KDD2 (KOD) DNA polymerase,
Bacillus sterothermophilus (Bst) DNA polymerase,
Bacillus caldophilus (Bca) DNA polymerase,
Sulfolobus acidocaldarius (Sac) DNA polymerase,
Thermus eggertssonii (Teg),
Thermoplasma acidophilum (Tac) DNA polymerase,
Thermus flavus (Tfl/Tub) DNA polymerase,
Thermus ruber (Tru) DNA polymerase,
Thermus brockianus (DYNAZYME) DNA polymerase,
Methanobacterium thermoautotraphicum (Mth) DNA polymerase, mycobacterium DNA polymerase (Mtb, Mlep), and mutants, variants
and derivatives thereof. RNA polymerases such as T3, T5 and SP6 and mutants, variants
and derivatives thereof may also be used in accordance with the invention.
[0060] The nucleic acid polymerases used in the present invention may be mesophilic or thermophilic,
and are preferably thermophilic. Preferred mesophilic DNA polymerases include T7 DNA
polymerases, T5 DNA polymerase, Klenow fragment DNA polymerase, DNA polymerase III
and the like. Preferred thermostable DNA polymerases that may be used in the methods
and kits of the invention include Teg, Taq, Tne, Tma, Pfu, Tfl, Tth, Stoffel fragment,
VENT™ and DEEPVENT™ DNA polymerases, and mutants, variants and derivatives thereof
(
U.S. Pat. No. 5,436,149;
U.S. Pat. No. 4,889,818;
U.S. Pat. No. 4,965,188;
U.S. Pat. No. 5,079,352;
U.S. Pat. No. 5,614,365;
U.S. Pat. No. 5,374,553;
U.S. Pat. No. 5,270,179;
U.S. Pat. No. 5,047,342;
U.S. Pat. No. 5,512,462;
WO 92/06188;
WO 92/06200;
WO 96/10640;
Barnes, W. M., Gene 112:29-35 (1992);
Lawyer, F. C., et al., PCR Meth. Appl. 2:275-287 (1993);
Flaman, J.-M, et al., Nucl. Acids Res. 22(15):3259-3260 (1994)). Examples of DNA polymerase substantially lacking in 3' exonuclease activity include,
but are not limited to, Taq, Tne
exo-, Tma
exo-, Pfu
exo-, Pwo
exo- and Tth DNA polymerases, and mutants, variants and derivatives thereof.
[0061] Polypeptides having reverse transcriptase activity for use in the invention include
any polypeptide having reverse transcriptase activity. Such enzymes include, but are
not limited to, retroviral reverse transcriptase, retrotransposon reverse transcriptase,
hepatitis B reverse transcriptase, cauliflower mosaic virus reverse transcriptase,
bacterial reverse transcriptase, Tth DNA polymerase, Taq DNA polymerase (
Saiki, R. K., et al., Science 239:487-491 (1988);
U.S. Pat. Nos. 4,889,818 and
4,965,188), Tne DNA polymerase (
WO 96/10640), Tma DNA polymerase (
U.S. Pat. No. 5,374,553) and mutants, variants or derivatives thereof (see, e.g., copending
U.S. patent application Ser. Nos. 08/706,702 and
08/706,706, of A. John Hughes and Deb K. Chattedee, both filed Sep. 9, 1996, which are incorporated by reference herein in their entireties). Preferred enzymes
for use in the invention include those that are reduced or substantially reduced in
RNase H activity. By an enzyme "substantially reduced in RNase H activity" is meant
that the enzyme has less than about 20%, more preferably less than about 15%, 10%
or 5%, and most preferably less than about 2%, of the RNase H activity of the corresponding
wildtype or RNase H
+ enzyme such as wildtype Moloney Murine Leukemia Virus (M-MLV), Avian Myeloblastosis
Virus (AMV) or Rous Sarcoma Virus (RSV) reverse transcriptases. The RNase H activity
of any enzyme may be determined by a variety of assays, such as those described, for
example, in
U.S. Pat. No. 5,244,797, in
Kotewicz, M. L., et al., Nucl. Acids Res. 16:265 (1988) and in
Gerard, G. F., et al., FOCUS 14(5):91 (1992), the disclosures of all of which are fully incorporated herein by reference. Particularly
preferred such polypeptides for use in the invention include, but are not limited
to, M-MLV H reverse transcriptase, RSV H
- reverse transcriptase, AMV H
- reverse transcriptase, RAV (Rous-associated virus) H
- reverse transcriptase, MAV (myeloblastosis-associated virus) H- reverse transcriptase
and HIV H
- reverse transcriptase. It will be understood by one of ordinary skill, however, that
any enzyme capable of producing a DNA molecule from a ribonucleic acid molecule (i.e.,
having reverse transcriptase activity) that is substantially reduced in RNase H activity
may be equivalently used in the compositions, methods and kits of the invention.
[0062] DNA and RNA polymerases for use in the invention may be obtained commercially, for
example from QIAGEN (Hilden, Germany), Life Technologies, Inc. (Rockville, Md.), New
England BioLabs (Beverly, Mass.) or ROCHE Biochemicals. Polypeptides having reverse
transcriptase activity for use in the invention may be obtained commercially, for
example from QIAGEN (Hilden, Germany), Life Technologies, Inc. (Rockville, Md.), Pharmacia
(Piscataway, N.J.), Sigma (Saint Louis, Mo.) or ROCHE (Penzberg, Germany). Alternatively,
polypeptides having reverse transcriptase activity may be isolated from their natural
viral or bacterial sources according to standard procedures for isolating and purifying
natural proteins that are well-known to one of ordinary skill in the art (see, e.g.,
Houts, G. E., et al., J. Virol. 29:517 (1979)). In addition, the polypeptides having reverse transcriptase activity may be prepared
by recombinant DNA techniques that are familiar to one of ordinary skill in the art
(see, e.g.,
Kotewicz, M. L., et al., Nucl. Acids Res. 16:265 (1988);
Soltis, D. A., and Skalka, A. M., Proc. Natl. Acad. Sci. USA 85:3372-3376 (1988)).
[0063] As used herein, the term "dNTP" refers to desoxyribonucleoside triphosphates. Non-limiting
examples of such dNTPs are dATP, dGTP, dCTP, dTTP, dUTP, which may also be present
in the form of labelled derivatives, for instance comprising a fluorescence label,
a radioactive label, a biotin label. dNTPs with modified nucleotide bases are also
encompassed, wherein the nucleotide bases are for example hypoxanthine, xanthine,
7-methylguanine, inosine, xanthinosine, 7-methylguanosine, 5,6-dihydrouracil, 5-methylcytosine,
pseudouridine, dihydrouridine, 5-methylcytidine. Furthermore, ddNTPS of the above-described
molecules are encompassed in the present invention.
[0064] The kit according to the present invention in one embodiment includes a positive
control nucleic acid suited to prove the efficiency of the CSFV amplification primers
and nucleic acid probes. In one embodiment said positive control nucleic acid comprises
a first primer binding sequence, a second primer binding sequence and a probe binding
sequence, wherein the first and the second primer binding sequence are selected and
oriented so that the sequence located in-between can be amplified by the at least
two CSFV amplification primers; wherein the probe binding sequence comprises a part
of the NS5A region of a classical swine fewer virus (CSFV) to which said nucleic acid
probe hybridizes; and wherein the probe binding sequence is located in-between the
first and second primer binding sequence comprises. In a preferred embodiment of the
present invention the positive control nucleic acid is RNA or DNA.
[0065] In a further preferred embodiment the positive control nucleic acid contained in
the kit according to the present invention comprises a transcription initiation sequence.
In context of the present invention a "transcription initiation sequence" is a sequence
which promotes the (reverse)-transcription from RNA to DNA or DNA to RNA by an enzyme,
respectively. In one embodiment of the present invention the positive control nucleic
acid contained in the kit according to the present invention consists of DNA and is
transcribed to RNA. The transcribed RNA is then used as a positive control in the
real-time RT-PCR reaction. Thus, in a preferred embodiment the positive control nucleic
acid contained in the kit according to the present invention consists of DNA and comprises
a transcription initiation sequence promoting the transcription from DNA to RNA. Transcription
initiation sequences are well known by those skilled in the art. Gene promoters are
examples of such transcription initiation sequences. Gene promoters contain specific
DNA sequences and/or response elements which provide a binding site for RNA polymerase
and/or transcription factors that recruit RNA polymerase. In a preferred embodiment
the transcription initiation sequence is selected from the group consisting of T7
promoter, T3 promoter and SP6 promoter. The transcription initiation sequence is positioned
and arranged within the positive control nucleic acid in a way so after transcription
or reverse transcription with an enzyme a transcribed or reveres transcribed positive
control nucleic acid may be obtained which comprises said first primer binding sequence,
said second primer binding sequence and said probe binding sequence, wherein the first
and the second primer binding sequence are selected and oriented so that the sequence
located in-between can be amplified by the at least two CSFV amplification primers;
wherein the probe binding sequence comprises a part of the NS5A region of a classical
swine fewer virus (CSFV) to which said nucleic acid probe hybridizes; and wherein
the probe binding sequence is located in-between the first and second sequence comprises
the probe binding sequence.
[0066] In a preferred embodiment of the present invention the positive control nucleic acid
comprises the sequence of SEQ ID NO. 43. In a further embodiment the positive control
nucleic acid has the sequence of SEQ ID NO. 43
[0067] The present invention further relates to an isolated nucleic acid comprising a 3'end
consisting of at least the last 6 nucleotides according to the sequence of SEQ ID
NO. 3 or SEQ ID NO. 4, respectively, preferably of at least the last 8 nucleotides,
more preferably of at least the last 10 nucleotides. In further preferred embodiment
the 3'ends of the nucleic acid consist of the sequence according to the sequence of
SEQ ID NO. 3 or SEQ ID NO. 4.
[0068] The present invention also relates to an isolated nucleic acid of 16 to 40 nucleotides
in lengths, wherein the nucleic acid comprises the sequence according to SEQ ID NO.
2. In a preferred embodiment the nucleic acid has the sequence according to SEQ ID
NO. 2. In a preferred embodiment the isolated nucleic acid has the embodiments of
the nucleic acid probe for the detection of CSFV as outlined herein above.
[0069] The present invention further relates to a nucleic acid comprising the sequence according
to SEQ ID NO. 43. Preferably the nucleic acid has the sequence according to SEQ ID
NO. 43.
Examples
Samples
[0071] BDV, BVDV and CSFV strains were obtained from the respective German national reference
laboratories. CSFV strains were cultured using porcine kidney cells (PK15), BVDV and
BDV were propagated on bovine kidney cells (MDBK) or sheep thymus cells (SFT), respectively,
according to the standard protocols (Collection of Cell Lines in Veterinary Medicine,
Friedrich-Loeffler-Institut [FLI], Insel Rims, Germany). Recent positive and negative
samples from wild boar in CSFV-positive regions in Western Germany submitted by state
veterinary services were tested. The EPIZONE reference RNA panel developed at the
FLI incorporates a representative collection of CSFV RNA samples of the most relevant
genotypes as well as members of related pestiviruses (BDV, BVDV, and atypical pestiviruses).
The panel currently comprises 31 different pestiviral RNA samples extracted from cell
culture supernatants at a concentration of around 1,000 genome copies per µl. This
panel was used to analyze the CSFV-specificity of the NS5A system.
Development of a new NS5A standard
[0072] For determination of sensitivity, a new RNA standard was generated. A 140bp-long
oligonucleotide (oLPC-CSF-NS5A) containing a T7 promoter and the primer and probe
binding sequence of the NS5A specific real-time RT-PCR protocol connected with short
spacer sequences served as template for in-vitro transcription of positive-sense single-strand
RNA (Table 1). The in-vitro transcribed RNA product was treated with DNase and purified
using the RNeasy® Mini Kit (Qiagen GmbH, Hilden, Germany). The concentration of RNA
was determined, and a ten-fold dilution series was established.
oLPC-CSF-NS5A:
[0073] 
Partial sequencing of CSFV genomes
[0074] For sequencing, the viral RNA was amplified in a RT-PCR with the Super Script® III
One-Step RT-PCR with Platinum® Taq Kit (Invitrogen, Carlsbad, CA, USA). DNA fragments
were isolated from agarose gels with the QIAquick® Gel Extraction Kit (Qiagen). Sequencing
was performed with the BigDye® Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems,
Foster City, CA, USA). Nucleotide sequences were read using the ABI 3130 Genetic Analyzer
(Applied Biosystems) and for analysis the Genetic Computer Group software version
11.0 (Accelrys Inc., San Diego, CA, USA) was used.
Real-time RT-PCR design
[0075] Different regions of the CSFV genome (E
RNS, NS2, NS3, NS5A and the 3'UTR) were tested for primer and probe selection (Figure
1). In order to obtain more sequence information to optimize sensitivity and specificity
of the NS5A real-time RT-PCR system, the corresponding region of various CSF viruses
of different genotypes was sequenced. These data together with the sequences in the
NCBI database were used for designing new primers and probes. A number of primer combinations
with different starting points, wobble bases or additional flap sequences as well
as different probes (sense-, antisense- and locked nucleic acid [LNA] probes) were
tested. The following primer combination turned out as optimal and is therefore a
preferred embodiment of the present invention: CSF-9403.1-F-flap (forward primer containing
an additional flap sequence and three wobble bases) and 9501R (reverse primer with
seven wobble bases). The size of the amplified fragment with these primers is 98 bp.
For detection, a FAM-labeled LNA probe with three wobble and seven LNA nucleotides
is used (SEQ ID NO. 2; see Table 2 and Figure 2).
[0076] For the one-step real-time RT-PCR protocol the AgPath-ID™ One-Step RT-PCR Kit (Applied
Biosystems) was used.
[0077] The 25 µl total reaction volume for the duplex real-time RT-PCR consists of: 12.5
µl 2x RT-PCR buffer, 2.5 µl RNase-free water, 1 µl 25x RT-PCR Enzyme mix, 2 µl β-actin
mix 3-HEX (for detection of reference nucleic acid β-actin mRNA)) and 2 µl NS5A mix-FAM.
[0078] The CSFV-specific NS5A mix-FAM contains 12.5 pmol/µl forward primer, 10 pmol/µl reverse
primer and 4 pmol/µl FAM-labeled probe. The mix for the internal control (β-actin
mix 3) contains 2.5 pmol/µl each of forward and reverse primer and 1.25 pmol/µl HEX-labeled
probe. Five µl of template RNA were added to 20 µl of master mix.
[0079] For the real-time RT-PCR the following thermal profile was used: 10 minutes at 45
°C (reverse transcription) and 10 minutes at 95°C (RT inactivation/polymerase activation)
followed by 42 cycles of DNA amplification, each consisting of 15 seconds denaturation
at 95 °C, 30 seconds annealing (with end-point fluorescence data collection) at 57
°C and 35 seconds elongation at 72 °C. To compare sensitivity and specificity both
a CSFV-specific and a "panpesti" real-time RT-PCR system were used (Hoffmann et al.,
2005; Hoffmann et al., 2006). Real-time RT-PCR was carried out using an Mx3005P cycler
(Stratagene, La Jolla, CA, USA).
Table 2: Primers and probes used in the CSFV-specific NS5A real-time RT-PCR system with β-actin
mix 3 internal control. Locked nucleic acids (LNA) in probe sequences are marked by
bold italics. The synthetic oligonucleotide used for generation of a NS5A RNA standard
is listed as well.
| Primer name |
Primer sequence |
Additional informations |
| CSF-9403.1-F-flap (forward primer) |
 |
|
| CSF-9501R (reverse primer) |
CTTYACATTCTTHRCRGTYTTYACYCT |
NS5A specific system |
| 9448-LNA-FAM |
TGATAYTRGGGTCYGA |
|
| |
|
|
| CSF 100F (forward) |
ATGCCCAYAGTAGGACTAGCA |
|
| CSF 192R (reverse) |
CTACTGACGACTGTCCTGTAC |
Published by Hoffmann et al. 2005 |
| CSF 1-FAM |
TGGCGAGCTCCCTGGGTGGTCTAAGT |
|
| |
|
|
| ß-actin 3F (forward) |
BTCCTTCCTGGGCATGGA |
|
| ß-actin 3R (reverse) |
GRGGSGCGATGATCTTGAT |
Published by Moniwa et al. 2007 |
| ß-actin 3-HEX |
TCCATCATGAAGTGYGACGTSGACATCCG |
|
| Bold letters refer to LNA-Nucleotides |
Results of NS5A duplex real-time RT-PCR with internal control system
[0080] In order to test the CSFV-specificity of the new assay, the EPIZONE reference RNA
panel was used, containing 13 CSFV RNA samples, and 17 BDV or BVDV RNA samples of
all representative genotypes. Unlike the prior art CSF 1 system, all CSF viruses were
clearly positive using the NS5A system (Table 3). All non-CSFV pestivirus RNAs did
not deliver detectable amplification products with the NS5A system showing the specificity
of the method according to the present invention. Furthermore, the NS5A system showed
an improved sensitivity compared to the prior art system.
[0081] Current German field samples from recent CSFV outbreaks in wild boar were also tested
with the new NS5A assay confirming in all cases the previously determined sample status
(Hoffmann et al., 2005a) (data not shown). In addition, since recent CSF outbreaks
in Germany and Europe were mostly associated with the CSFV genotype 2.3, RNA of 20
recent European CSFV isolates of that genotype were extracted and tested with the
method according to the present invention (NS5A system). All samples scored clearly
positive. Subsequently, these RNAs were also 1000-fold diluted and tested in the NS5A
system and the prior art CSF 1 system, showing a reduction in Cq-value of about ten
(Table 4).
[0082] In order to further test the sensitivity of the NS5A system, a RNA standard and two
10-fold dilutions series containing CSFV RNA of a) genotype 2.3 and b) genotype 1.1
were analyzed. In both dilution series, six steps scored positive with the NS5A assay,
and the Cq-values were within 16 and 33 (genotype 1.1), respectively 20 and 38 (genotype
2.3). The in comparison tested prior art CSF1 system detected six steps of a C-strain
"Riems" dilution series and five steps of the CSF 2.3 dilution series (data not shown).
In both dilution series the NS5A assay was more sensitive than the CSF 1 system published
by Hoffmann et al., 2005.
[0083] Furthermore, a dilution series of a new RNA standard, generated by
in vitro transcription of a synthetic oligonucleotide was tested. Here, nine dilution steps
from 108 to 100 copies were detected in the NS5A real-time RT-PCR (Figures 3a and
3b).
[0084] For routine diagnostics, the NS5A system was finally tested in a duplex real-time
RT-PCR protocol with an internal control system using β-actin (mix 3). No remarkable
influence concerning sensitivity or specificity in the duplex assays compared with
a NS5A single assay was observed.
Table 3: Real-time RT-PCR results in the NS5A and CSF1 systems for CSFV samples of the EPIZONE
reference RNA panel. Cq-values of undiluted and 100-fold diluted sample RNAs are shown.
| CSFV sample |
NS5A system |
CSF1 system |
| |
Undiluted |
diluted 1:100 |
Undiluted |
diluted 1:100 |
| C strain |
25.9 |
33.4 |
28.3 |
38.0 |
| Eystrup91 |
29.4 |
38.8 |
27.7 |
38.6 |
| Alfort187 |
29.5 |
37.7 |
27.3 |
37.4 |
| Koslov1128 |
28.7 |
36.0 |
27.2 |
Negative |
| Brescia |
27.6 |
36.3 |
30.5 |
36.9 |
| Schweiz II |
29-8 |
38.9 |
28.4 |
38.7 |
| Pader |
28 |
36.6 |
27.2 |
Negative |
| Bergen |
29.4 |
36.2 |
28 |
41.1 |
| D4886/82/Ro |
28.1 |
36.6 |
28.1 |
39.6 |
| Uelzen |
27.5 |
37.8 |
28.8 |
36.8 |
| Spante |
27 |
34.7 |
27.8 |
37.2 |
| Congenital Tremor |
25.6 |
33.2 |
30.4 |
35.5 |
| Kanagawa |
28.1 |
36.1 |
27.4 |
36.7 |
Table 4: Twenty different European CSFV RNA samples of genotype 2.3 were tested with the
new CSFV specific NS5A real-time RT-PCR system and compared to the CSF 1 system. RNA
samples were obtained by RNA extraction from cell culture supernatant with QIAamp®
Viral RNA Mini Kit and diluted 1000-folk in RSB50 buffer. Cq-values are average values
of samples tested in duplicate.
| CSFV Genotype 2.3 sample |
NS5A system |
CSF 1 system |
| |
Sample original |
Sample 1:1000 diluted |
Sample original |
Sample 1:1000 diluted |
| CSF 1027 |
17.8 |
27.8 |
18.3 |
28.0 |
| CSF 1024 |
17.8 |
27.9 |
18.8 |
29.1 |
| CSF 0867 |
18.6 |
28.4 |
19.6 |
29.7 |
| CSF 0866 |
25.1 |
34.9 |
23.5 |
33.8 |
| CSF 0864 |
20.3 |
29.6 |
19.1 |
29.1 |
| CSF 1015 |
18.3 |
28.1 |
17.9 |
27-9 |
| CSF 0852 |
18.9 |
28.4 |
17.9 |
27.8 |
| CSF 0854 |
18.5 |
28.1 |
19.1 |
29.2 |
| CSF 0848 |
31.3 |
40.3 |
29.9 |
37.9/negative |
| CSF 0847 |
20.9 |
30.8 |
20.6 |
30.6 |
| CSF 0840 |
23.6 |
33.8 |
23.0 |
33.2 |
| CSF 0838 |
26.7 |
36.8 |
27.0 |
38.1 |
| CSF 0822 |
18.6 |
28.3 |
19.4 |
29.4 |
| CSF 0821 |
18.1 |
27.8 |
19.5 |
29.9 |
| CSF 0817 |
18.8 |
28.6 |
20.6 |
30.9 |
| CSF 0807 |
22.2 |
32.2 |
20.2 |
30.4 |
| CSF 0804 |
20.1 |
30.1 |
19.8 |
30.0 |
| CSF 0085 |
18.7 |
28.7 |
20.1 |
30.9 |
| CSF 0737 |
18.6 |
28.7 |
19.9 |
30.6 |
| CSF 0727 |
20.2 |
30.1 |
21.6 |
31.4 |
Table 5: Real-time RT-PCR results in the NS5A according to the present invention and the Pan-Pesti
systems for Non-CSFV Pestivirus strains of the EPIZONE reference RNA panel. Cq-values
are shown.
| Pestivirus genotype |
Pestivirus strain |
NS5A system |
Pan-Pesti system Hoffmann et al. 2006 |
| BDV |
Moredun |
neg |
34,16 |
| BDV |
Rudolph |
neg |
29,09 |
| BDV |
Gifhorn |
neg |
32,01 |
| BDV |
Isard |
neg |
32,01 |
| BVDV-1 |
NADL |
neg |
32,24 |
| BVDV-1 |
Paplitz |
neg |
29,19 |
| BVDV-1 |
PI809 |
neg |
30,55 |
| BVDV-1 |
NC3807-1251/1 |
neg |
30,5 |
| BVDV-1 |
Egbert |
neg |
34,64 |
| BVDV-1 |
B0806-17 |
neg |
30,14 |
| BVDV-1 |
B0807-3 |
neg |
29,7 |
| BVDV-1 |
NC3807-8757 |
neg |
31,08 |
| BVDV-2 |
8644 |
neg |
32,8 |
| BVDV-2 |
Bure |
neg |
35,04 |
| BVDV-2 |
Walter |
neg |
31,78 |
| BVDV-2 |
PO1600 |
neg |
30,34 |
| Pestivirus |
Hobi |
neg |
33,57 |
| Pestivirus |
Giraffe H138 |
neg |
36,19 |
Figure legends: