TECHNICAL FIELD
[0001] The present invention relates to a marker and reagent for detecting human IL-17-producing
helper T-cells (hereinafter also referred to as "Th17 cells") and a method for detecting
human Th17 cells.
BACKGROUND ART
[0002] Rheumatoid arthritis (hereinafter referred to as "RA") is the systemic inflammatory
autoimmune disease whose main clinical symptom is arthritis. The state of RA is diagnosed
by rational symptoms such as joint pain or by visual procedures such as the observations
on the extent of swelling or bone X-ray. However, no quantitative index has been established.
Thus, no quantitative method for continuously monitoring the treatment effects has
been established under the current state of the art.
[0003] The pathogenesis of RA has not been elucidated. It is considered that bacterial infections
and the like trigger an inflammation in joint tissues via complicated networks of
immunocytes and cytokines.
Helper T-cells play a central role in immune reactions. Immature helper T-cells (naive
T-cells) are differentiated into helper T-cells when an antigen is presented by antigen-presenting
cells. When specific cytokines are present at this time, naïve T-cells are differentiated
into four types of the cells, which are helper T-cells producing interferon (IFN)-γ
(Th1 cells), helper T-cells producing interleukin (IL)-4 (Th2 cells), helper T-cells
producing IL-17 (Th17 cells) and regulatory T-cells having immunosuppressive effects
(Treg cells).
[0004] It has been shown that among these helper T-cells, Th17 cells can be involved in
the onset of RA.
[0005] It has been suggested that IL-17 is deeply involved in the formation of pathological
conditions and in particular joint and bone deformities because the level of IL-17
is significantly higher in synovial fluid of RA patients than in that of the patients
of osteoarthritis and T-cells in synovial tissue from RA patients include IL-17 positive
cells (see Japanese Unexamined Patent Publication No.
2000-186040 (Patent Literature 1)). Japanese Unexamined Patent Publication No.
2000-186046 also discloses that IL-17 can be used as a diagnostic marker of RA.
[0006] Japanese Unexamined Patent Publication No.
2007-506100 (Patent Literature 2) discloses that the analysis of cytokines in peripheral blood
serum of RA patients revealed that the levels of IFN-γ, IL-1β, TNF-α, G-CSF, GM-CSF,
IL-6, IL-4, IL-10, IL-13, IL-5 and IL-7 were significantly high and the levels of
IL-2, CXCL8/IL-8, IL-12 and CCL2/MCP-1 were not high in RA patients.
[0007] According to the studies by
Ivanov et al. (Cell, 2006, 126, p.1121-1133: Non-Patent Literature 1),
Stumhofer et al. (Nature Immunology, 2006, vol.7, p.937-945: Non-Patent Literature 2), and
Wilson et al. (Nature Immunology, 2007, vol.8, p.950-957: Non-Patent Literature 3), the following facts have been shown about Th17 cells:
- a nuclear receptor called RORγt has an important role in the differentiation of Th17
cells;
- IL-6, IL-23 and TGF-β induce the differentiation of immature helper T-cells (naïve
T-cells) to Th17 cells;
- they express IL-17A, IL-17F, IL-6, IL-22, IL-26, TNF, IFN-γ and CCL20; and
- IL-23 receptor and IL-12 receptor β are located on the surface of Th17 cells.
Citation List
[0008]
Patent Literature 1: Japanese Unexamined Patent Publication No. 20001-86046
Patent Literature 2: Japanese Unexamined Patent Publication No. 2007-506100
Non-Patent Literature 1: Ivanov et al., "The Orphan Nuclear Receptor RORγt Directs the Differentiation Program
of Proinflammatory IL-17+T Helper Cells", Cell, 2006, 126, p.1121-1133
Non-Patent Literature 2: Stumhofer et al., "Interleukin 27 negatively regulates the development of interleukin
17-producing T helper cells during chronic inflammation of the central nervous system",
Nature Immunology, 2006, vo1.7, p.937-945
Non-Patent Literature 3: Wilson et al., "Development, cytokine profile and function of human interleukin 1.7-producing
helper T cells", Nature Immunology, 2007, vol.8, p.950-957
SUMMARY OF INVENTION
Technical Problem
[0009] In the above documents by Ivanov et al., Stumhofer et al. and Wilson et al., the
amount of IL-17 is measured by enzyme linked immunosorbent assay (ELISA) using antibodies
specific to IL--17.
The relations between Th17 cells and autoimmune diseases, preferably RA may be more
deeply understood by establishing a method which allows not only measurement of the
amount of IL-17 but also detection of Th17 cells per se.
[0010] The present inventors aimed to find molecular markers that allows specific detection
of human Th 17 cells.
Solution to Problem
[0011] The present inventors isolated Th17 cells from peripheral blood of a healthy adult
and identified the genes which are specifically expressed in the obtained Th17 cells,
thereby completing the present invention.
[0012] Thus, the present invention provides a polynucleotide marker for detecting human
Th 17 cells which is a polynucleotide having a nucleic acid sequence of at least one
gene selected from the group consisting of:
genes encoding membrane proteins consisting of: ADAM12 (ADAM metallopeptidase domain 12), ANKS1B (ankyrin repeat and sterile alpha motif domain containing 1B), ATP6V0A4 (ATPase, H+ transporting, lysosomal V0 subunit a4), ATP9A (ATPase, class II, type 9A), BVES (blood vessel epicardial substance), C5orf40 (chromosome 5 open reading frame 40), CDH4 (cadherin 4, type 1, R-cadherin (retinal)), DIO2 (deiodinase, iodothyronine, type II), DMD (dystrophin), GPR34 (G protein-coupled receptor 34), IRS2 (insulin receptor substrate 2), KCNE3 (potassium voltage-gated channel, Isk-related family, member 3), L1CAM (L1 cell adhesion molecule), MCAM (melanoma cell adhesion molecule), MFAP3L (microfibrillar-assaciated protein 3-like), MYO7A (myosin VIIA), PTPRM (protein tyrosine phosphatase, receptor type, M), SHROOM2 (shroom family member 2), SLC16A4 (solute carrier family 16, member 4 (monocarboxylic acid transporter 5)), SLCO2B1 (solute carrier organic anion transporter family, member 2B1), TANC2 (tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2), TJP1 (tight junction protein 1 (zona accludens 1)), TMEM163 (transmembrane protein 163), TNS3 (tensin 3), UPK1B (uroplakin 1B), WDFY3 (WD repeat and FYVE domain containing 3), DRD2 (dopamine receptor D2), GJC1 (gap junction protein, gamma 1, 45kDa), PGBD5 (LOC100134440) (piggyBac transposable element derived 5 (similar to PGBD5 protein)),
MS4A7 (membrane-spanning 4-domains, subfamily A, member 7), ODZ4 (odz, odd Oz/ten-m homolog 4), PHKA1 (phosphorylase kinase, alpha 1), RGS1 (regulator of G-protein signaling 1), SHB (Src homology 2 domain containing adaptor protein B), SLC44A3 (solute carrier family 44, member 3), SLC6A15 (solute carrier family 6 (neutral amino acid transporter), member 15), SYNGR3 (synaptogyrin 3), AKAP12 (A kinase (PRKA) anchor protein 12), C9orf125 (chromosome 9 open reading frame 125), DPY19L2 (dpy-19-like 2), HRH4 (histamine receptor H4), MUC20 (mucin 20, cell surface associated), POPDC3 (popeye domain containing 3), SORBS1 (sorbin and SH3 domain containing 1), TANC1 (tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1), THEM44 (transmembrane protein 44) and UNC13C (unc-13 homolog C);
[0013] genes encoding secretory proteins consisting of:
CXCL13 (chemokine (C-X-C motif) ligand 13),
PCOLCE2 (procollagen C-endopeptidase enhancer 2),
PNOC (prepronociceptin), SMPDL3A (sphingomyelin phosphodiesterase, acid-like 3A),
TGFBI (transforming growth factor, beta-induced),
C17orf99 (chromosome 17 open reading frame 99),
EBI3 (Epstein-Barr virus induced 3),
IL1A (interleukin 1, alpha) and
WNT3 (wingless-type MMTV integration site family, member 3);
[0014] genes encoding intracellular proteins consisting of:
BCAT1 (branched chain aminotransferase 1, cytosolic),
BHLHE22 (basic helix-loop-helix family, member e22),
C13orf18 (LOC728970) (chromosome 13 open reading frame 18 (hypothetical LOC728970)),
CA2 (carbonic anhydrase II),
CCDC3 (coiled-coil domain containing 3),
CDS1 (CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase)
1), CHN1 (chimerin (chimaerin) 1),
CLIC5 (LOC 100131610) (chloride intracellular channel 5 (similar to chloride intracellular
channel 5)),
CTSH (cathepsin H),
CYP7B1 (cytochrome P450, family 7, subfamily B, polypeptide 1),
DAPK2 (death-associated protein kinase 2),
DMRT1 (doublesex and mab-3 related transcription factor 1), DSE (dermatan sulfate epimerase),
FBXL17 (F-box and leucine-rich repeat protein 17),
FBXL21 (F-box and leucine-rich repeat protein 21),
FHOD3 (formin homology 2 domain containing 3),
H2AFY2 (H2A histone family, member Y2),
HLX (H2.0-like homeobox),
IRAK3 (irzterleukin-1 receptor-associated kinase 3),
MACC1 (metastasis associated in colon cancer 1), MAML3 (mastermind-like 3),
MYO10 (myosin X),
OTUB2 (OTU domain, ubiquitin aldehyde binding 2),
PAPSS2 (3'-phosphoadenosine 5'-phosphosulfate synthase 2),
PCBP3 (Poly (rC) binding protein 3 (PCBP3), transcript variant 2),
PDE4DIP (phosphodiesterase 4D interacting protein),
PLD1 (phospholipase D1, phosphatidylcholine-specific),
PPARG (peroxisome proliferator-activated receptor gamma),
PTPN13 (Protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated
phosphatase)),
RGS18 (regulator of G-protein signaling 18),
SIM1 (single-minded homolog 1),
SNAI2 (snail homolog 2),
SOX2 (SRY (sex determining region Y)-box 2),
SPIRE1 (spire homolog 1),
TBC1D12 (TBC1 domain family, member 12),
TGM5 (transglutaminase 5),
TMOD1 (tropomodulin 1),
TUBB6 (tubulin, beta 6),
DDIT4L (DNA-damage-inducible transcript 4-like),
DHRS9 (dehydrogenase/reductase (SDR family) member 9),
ERC2 (ELKS/RAB6-interacting/CAST family member 2),
FERMT2 (fermitin family homolog 2),
HHEX (hematopoietically expressed homeobox),
HS3ST1 (heparan sulfate (glucosamine) 3-O-sulfotransferase 1),
NR5A2 (nuclear receptor subfamily 5, group A, member 2),
PHLDA1 (pleckstrin homology-like domain, family A, member 1),
RBM20 (RNA binding motif protein 20),
NINL (ninein-like),
RTN2 (reticulon 2),
SH3RF2 (SH3 domain containing ring finger 2),
TSHZ2 (teashirt zinc finger homeobox 2),
EML1 (echinoderm microtubule associated protein like 1),
HIST1H2BC (histone cluster 1, H2bc),
MAP3K4 (mitogen-activated protein kinase kinase kinase 4),
PDK4 (pyruvate dehydrogenase kinase, isozyme 4),
RGS2 (regulator of G-protein signaling 2) and
RGS20 (regulator of G-protein signaling 20);
[0015] genes consisting of:
C1orf106 (chromosome 1 open reading frame 106),
C6orf145 (chromosome 6 open reading frame 145), LOC401097 (Similar to LOC 166075),
MAMLD1 (mastermind-like domain containing 1),
ZC3H12C (zinc finger CCCH-type containing 12C),
C12orf64 (chromosome 12 open reading frame 64),
C6orf168 (chromosome 6 open reading frame 168),
CAMSAP1L1 (calmodulin regulated spectrin-associated protein 1-pike 1) and
MAGED4 (MAGED4B) (melanoma antigen family D, 4, (melanoma antigen family D, 4B)); and
genes comprising at least one nucleic acid sequence selected from SEQ ID NOs:147 to
151, 157 to 162 and 167 to 174;
or a variant and fragment thereof.
[0016] The present invention also provides a protein marker for detecting human Th17 cells
which is a protein encoded by at least one of the above genes or a functionally equivalent
variant and fragment thereof.
[0017] The present invention further provides a method for detecting human Th17 cells comprising
detecting the presence of at least one polynucleotide marker for detecting human Th17
cells or at least one protein marker for detecting human Th17 cells in a sample containing
cells derived from human.
[0018] In addition, the present invention provides a reagent for detecting human Th17 cells
comprising at least one substance selected from a nucleic acid probe which specifically
hybridizes to the above polynucleotide marker; and a nucleic acid aptamer, antibody,
ligand or receptor which specifically binds to the above protein marker.
Advantageous Effect of Invention
[0019] Human Th17 cells can be specifically detected by detecting at least one polynucleotide
marker or protein marker for detecting human Th17 cells of the present invention.
It may also allow detection of the possibility that a patient has a disease in which
Th17 cells may be involved such as autoimmune diseases, e.g. RA.
BRIEF DESCRIPTION OF DRAWINGS
[0020]
Fig. 1 shows graphs of the expression levels of the genes which are known to be specifically
expressed in Th17 cells (IL23R, IL17A, IL17F, IL22, IL26 and RORC) in Th1, Th2, Treg
and Th17 cells;
Fig. 2 shows histograms of fluorescent intensity obtained by the analysis of MCAM
measurement samples;
Fig. 3 shows histograms of fluorescent intensity obtained by the analysis of PTPRM
measurement samples;
Fig. 4 shows histograms of fluorescent intensity obtained by the analysis of GPR34
measurement samples;
Fig. 5 shows histograms of fluorescent intensity obtained by the analysis of CCR6
measurement samples;
Fig. 6 shows histograms of fluorescent intensity obtained by the analysis of IL-17A
measurement samples;
Fig. 7 shows histograms of fluorescent intensity obtained by the analysis of IFN-γ
measurement samples;
Fig. 8 shows histograms of fluorescent intensity obtained by the analysis of IL-4
measurement samples; and
Fig. 9 shows histograms of fluorescent intensity obtained by the analysis of FOXP3
measurement samples.
DESCRIPTION OF EMBODIMENTS
[0021] The polynucleotide marker for detecting human Th17 cells of the present invention
is the polynucleotide having a nucleic acid sequence of at least one gene selected
from the group consisting of the above genes, or a variant and fragment thereof.
[0022] Preferably, the polynucleotide has a nucleic acid sequence of at least one gene selected
from the group consisting of:
genes encoding membrane proteins consisting of: ADAM12, ATP6V0A4, ATP9A, BVES, C5orf40, CDH4, DIO2, GPR34, L1CAM, MCAM, PTPRM, SHROOM2,
TMEM163, UPK1B, DRD2, PGBD5 (LOC100134440), ODZ4, SLC6A15, AKAP12, C9orf125, POPDC3 and UNC13C;
genes encoding secretory proteins consisting of: PCOLCE2, PNOC, TGFBI and IL1A; and
genes encoding intracellular proteins consisting of: BHLHE22, PPARG, SIM1 and SNAI2.
[0023] The present polynucleotide marker for detecting human Th17 cells is the polynucleotide,
variant or fragment thereof which has been found to be specifically present in Th
17 cells rather than in other helper T-cells derived from human peripheral blood (Th1,
Th2 and Treg cells).
Therefore, by detecting at least one of the above polynucleotide markers, Th17 cells
can be distinguished from Th1, Th2 and Treg cells and specifically identified, and
an index for activity of diseases
in vivo can be studied in which Th17 cells may be involved.
[0024] As used herein, the term "gene" has the same meaning as that is commonly recognized
in the art, and refers to a part of a genome which is transcribed into mRNA and translated
into a protein.
[0025] In the present specification, genes containing at least one nucleic acid sequence
selected from SEQ ID NOs: 147 to 151, 157 to 162 and 167 to 174 are the genes to be
transcribed into mRNAs containing at least one of these nucleic acid sequences or
a complementary sequence thereof. Thus, genes containing at least one nucleic acid
sequence selected from SEQ ID NOs: 147 to 151, 157 to 162 and 167 to 174 comprise
genes containing a nucleic acid sequence complementary to at least one nucleic acid
sequence selected from SEQ ID NOs: 147 to 151, 157 to 162 and 167 to 174.
[0026] As used herein, a membrane protein means a protein existing in a cell membrane and
being contained in a membrane fraction of cells. A secretory protein means a protein
synthesized in cells and secreted to the outside of the cell membrane. An intracellular
protein means a protein which is mainly present in cells.
[0027] As used herein, the phrase that a polynucleotide is "specifically expressed" in Th17
cells means that the expression level of the polynucleotide in Th17 cells is significantly
higher than the expression level of the polynucleotide in cells other than Th17 cells.
Specifically, it means that the expression level of the polynucleotide in Th17 cells
is about two times or more of the expression level of the polynucleotide in cells
other than Th17 cells. Preferably, the expression level of the polynucleotide in Th17
cells is about two times or more of the expression level of the polynucleotide in
helper T-cells other than Th17 cells (Th1, Th2 and Treg cells).
[0028] The nucleotide sequences of the present polynucleotide markers are already known.
They can be obtained from, for example, Unigene (a database provided by National Center
for Biotechnology Information (NCBI) of National Library of Medicine). Unigene codes
for the nucleic acid sequences of the present polynucleotide markers are specified
in Table 9.
[0029] As used herein, "variant" of a polynucleotide means a polynucleotide into which a
mutation has been introduced that does not alter the nature of the protein encoded
by the above gene. Such mutation includes a deletion, substitution or addition of
one or more nucleotides to the nucleic acid sequence of the above gene.
As used herein, "fragment" of a polynucleotide means a polynucleotide having a contiguous
part of the nucleic acid sequence of the above gene and having a length which allows
its specific hybridization with a nucleic acid probe for detecting human Th17 cells
described hereinafter.
[0030] The variant of the polynucleotide as the present polynucleotide marker for detecting
human Th17 cells has generally at least 80%, more preferably at least 85%, further
preferably at least 90% and particularly preferably at least 95% homology with the
nucleic acid sequence of the above gene.
As used herein, the homology of nucleic acid and amino acid sequences is calculated
in BLASTN, BLASTP, BLASTX or TBLASTN (e.g. available from http://www.ncbi.nlm.nih.gov)
with default settings.
[0031] The polynucleotide marker may be any of DNA or RNA, and may be the gene per se (DNA),
mRNA, cDNA or cRNA.
[0032] Human Th17 cells can also be detected by detecting at least one protein encoded by
the above gene. Thus, the present invention also provides the protein marker for detecting
human Th17 cells consisting of the protein encoded by at least one of the above genes
or a functionally equivalent variant and fragment thereof.
[0033] Preferably, the above protein is encoded by at least one gene selected from the group
consisting of:
genes encoding membrane proteins consisting of: ADAM12, ATP6VOA4, ATP9A, BVES, C5orf40, CDH4, DIO2, GPR34, L1 CAM, MCAM, PTPRM, SHROOM2,
TMEM163, UPK1B, DRD2, PGBD5 (LOC100134440), ODZ4, SLC6A15, AKAP12, C9orf125, POPDC3 and UNC13C;
genes encoding secretory proteins consisting of: PCOLCE2, PNOC, TGFBI and IL1A; and
genes encoding intracellular proteins consisting of: BHLHE22, PPARG, SIM1 and SNAI2.
[0034] More preferably, the above protein is a membrane protein encoded by at least one
gene selected from the group consisting of
GPR34, MCAM, and
PTPRM.
[0035] The amino acid sequence of such protein marker can be obtained based on the nucleic
acid sequence of the polynucleotide marker obtained from Unigene and the like. It
can also be obtained from databases provided by NCBI and the like. NCBI code numbers
for the amino acid sequences of the present protein markers for detecting human Th17
cells are specified in Table 9.
[0036] The protein marker for detecting human Th17 cells is the protein encoded by the above
gene, a functionally equivalent variant or fragment thereof.
As used herein, "functionally equivalent variant" of a protein means a protein into
which a mutation has been introduced that does not alter functions of the protein.
Such mutation includes a deletion, substitution or addition of one or more amino acids
to the known amino acid sequence of the protein.
As used herein, "fragment" of a protein means a protein having a contiguous amino
acid sequence of the protein encoded by the above gene or a functionally equivalent
variant thereof and being able to specifically bind to a nucleic acid aptamer, antibody,
ligand or receptor for detecting human Th17 cells described hereinafter.
[0037] The functionally equivalent variant of the protein corresponding to the present protein
marker for detecting human Th17 cells has generally at least 80%, preferably at least
85%, more preferably at least about 90% and particularly preferably at least 95% homology
with the known amino acid sequence of the protein encoded by the above gene.
[0038] A molecule that can specifically hybridize to the present polynucleotide marker can
be used for detection of the marker, making it useful as a probe for detecting human
Th17 cells. The probe may be a nucleic acid probe such as DNA or RNA, or a peptide
probe that can specifically hybridize to the polynucleotide marker. The probe for
detecting human Th17 cells is preferably a nucleic acid probe, particularly a DNA
probe for detecting the polynucleotide marker.
[0039] As used herein, the phrase "can specifically hybridize" means that it can hybridize
to a target nucleic acid molecule (the polynucleotide marker) under a stringent condition.
As used herein, "stringent condition" means a condition under which the probe for
detecting human Th 17 cells can hybridize to the target polynucleotide marker with
a detectably higher extent than it does to a polynucleotide other than the target
polynucleotide marker (e.g. more than at least two times of the background).
The stringent condition generally depends on the sequences and varies depending on
various circumstances. Generally, the stringent condition is selected so that it is
about 5°C lower than a thermal melting point of the specific sequence under a certain
ionic strength and pH. This Tm is a temperature at which 50% of the complementary
probe hybridizes to the target sequence in equilibrium (under a certain ionic strength,
pH and nucleic acid composition).
[0040] Such condition may be those which are used in conventional hybridization techniques
between polynucleotides such as PCR, microarray or Southern blotting.
Specifically, it may be a condition of pH 7.0 to 9.0, a salt concentration of lower
than about 1.5M Na-ion, more specifically about 0.01 to 1.0 M Na-ion concentration
(or other salt) and a temperature of at least about 30°C. More specifically, the stringent
condition in microarray technique includes the hybridization at 37°C in 50% formamide,
1M NaCl and 1% SDS and washing at 60 to 65°C in 0.1 x SSC.
The stringent condition in PCR technique includes a condition of pH 7 to 9, 0.01 to
0.1 M Tris-HCl, 0.05 to 0.15 M potassium ion concentration (or other salt) and at
least about 55°C.
[0041] The sequence of the nucleic acid probe for detecting human Th17 cells can be appropriately
selected by a person skilled in the art based on the common technical knowledge in
the art and the sequence of the polynucleotide marker so that it can specifically
hybridize to the polynucleotide marker.
The nucleic acid probe for detecting human Th17 cells can be designed by using, for
example, a commonly available primer designing software (e.g. Primer3 (available from
http://frodo.wi.mit.edu./cgi-bin/primer3/primer3.cgi) or DNASIS Pro (Hitachi Software
Engineering Co., Ltd.)).
[0042] The nucleic acid probe for detecting human Th17 cells can be prepared according to
polynucleotide synthesis methods which are well-known in the art.
[0043] The nucleic acid probe for detecting human Th 17 cells may be labeled with a labeling
substance normally used in the art. The labeled nucleic acid probe allows an easy
detection of the polynucleotide marker for detecting human Th17 cells, namely of human
Th17 cells.
The labeling substance may be a labeling substance generally used in the art including
radioisotopes such as
32P, fluorescent substances such as fluorescein, enzymes such as alkaline phosphatase
and horseradish peroxidase, and biotin.
[0044] Human Th17 cells can be specifically detected by using one or more nucleic acid probes
for detecting human Th17 cells. For example, a DNA chip or microarray for detecting
the polynucleotide marker for detecting human Th17 cells can be obtained by immobilizing
one or more probes on a substrate according to a method well-known in the art.
The nucleic acid probe for detecting human. Th17 cells may include a set of two or
more primers for amplifying the polynucleotide marker by nucleic acid amplification
methods such as PCR technique, for example.
[0045] A molecule that can specifically bind to the present protein marker can be used for
the detection of the marker, making it useful in the detection of human Th17 cells.
Such molecule may be a nucleic acid aptamer such as DNA or RNA, an antibody, a ligand
or a receptor that can specifically bind to the present protein marker, and preferably
an antibody.
When the protein marker for detecting human Th17 cells is an enzyme, it can be detected
by applying a substrate for the enzyme to develop color or emit light or fluorescent.
[0046] The antibody for detecting human Th17 cells can be prepared by the following well-known
procedure, for example. A DNA molecule encoding a protein having an amino acid sequence
of the present protein marker is prepared based on the nucleic acid sequence of the
present polynucleotide marker or the amino acid sequence of the present protein marker,
and is introduced into an appropriate expression vector. The obtained expression vector
is introduced into an appropriate host cells, and the obtained transformed cells are
cultured to obtain a desired protein. The obtained protein is purified and used as
an immunogen optionally with an adjuvant to immunize an appropriate mammal such as
rat or mouse. Spleen cells of the immunized animals are screened for antibody producing
cells that produce an antibody directed to the target immunogen. The selected antibody
producing cells are fused with myeloma cells to obtain hybridomas. These hybridomas
are screened for antibody producing hybridomas that produce an antibody having specific
binding property to the protein encoded by the gene. The desired antibody can be obtained
by culturing the obtained antibody producing hybridomas.
[0047] The nucleic acid aptamer that can be used for detecting human Th17 cells can be prepared
by the following well-known procedure, for example. A nucleic acid library including
random nucleic acid sequences is prepared according to the known technique, and an
aptamer that specifically binds to the target protein (the protein marker) can be
selected by the systematic evolution of ligands by exponential enrichment method (SELEX
method) or the like.
[0048] The molecule which can specifically bind to the protein marker for detecting human
Th17 cells may be labeled with a labeling substance normally used in the art. The
labeled antibody for detecting human Th17 cells allows an easy detection of the protein
marker for detecting human Th17 cells, namely of human Th 17 cells.
The labeling substance may be a labeling substance generally used in the art including
radioisotopes such as
32P, fluorescent substances such as fluorescein, enzymes such as alkaline phosphatase
and horseradish peroxidase, and biotin.
[0049] A method for detecting human Th17 cells by detecting the presence of at least one
polynucleotide or protein marker for detecting human Th17 cells in a sample containing
cells derived from human is also within the scope of the present invention.
In the method, it is preferred that two or more polynucleotide markers or protein
markers for detecting human Th17 cells are detected in order to improve the detection
sensitivity.
[0050] In the present method, the sample containing cells derived from human includes a
biological sample obtained from human or a sample containing cultured human cells.
The biological sample includes blood, tissue, synovial fluid, cerebrospinal fluid,
pleural fluid, ascitic fluid and the like.
[0051] An embodiment of the method for detecting the presence of the polynucleotide marker
for detecting human Th17 cells is described.
Nucleic acid (DNA or RNA) is extracted from a sample containing cells derived from
human by a well-known method in the art such as the one using a phenolic extraction
and ethanol precipitation or a commercial DNA extraction kit.
Then, the presence of the polynucleotide marker in the obtained nucleic acid sample
is detected, preferably using the nucleic acid probe for detecting human Th17 cells.
When the presence of the polynucleotide marker is detected by nucleic acid amplification
method such as PCR, RT-PCR, real-time PCR, LAMP (Loop-mediated isothermal amplification)
and the like, the nucleic acid probe for detecting human Th 17 cells is preferably
a primer set for amplifying the polynucleotide marker by a nucleic acid amplification
method.
The presence of the polynucleotide marker for detecting human Th17 cells may also
be detected by well-known methods in the art, for example hybridization methods such
as Southern hybridization, Northern hybridization, fluorescence
in situ hybridization (FISH), or DNA chip or microarray. Such methods are carried out under
the stringent condition, and the hybridization of the nucleic acid probe for detecting
human Th17 cells is detected by detecting the labeling substance and the like to detect
the presence of the polynucleotide marker.
[0052] An embodiment of the method for detecting the presence of the protein marker for
detecting human Th17 cells is described.
When the target protein marker is an intracellular protein, proteins are extracted
from a sample containing cells derived from human by using well-known methods in the
art. The extraction of proteins from a sample can be accomplished by known methods
such as disruption of the cells by ultrasonic, lysis of the cells with a cell lysis
solution. The protein marker in the obtained protein extract can be detected by using
the molecule which specifically binds to the protein marker. Specifically, the protein
marker for detecting human Th17 cells can be detected by well-known methods in the
art such as ELISA or Western blotting. The molecule which specifically binds to the
protein marker in the detection is preferably the above nucleic acid aptamer, antibody,
ligand or receptor, and more preferably the antibody for detecting human Th17 cells.
[0053] When the target protein marker is a secretory protein, the protein marker secreted
in the sample containing the cells can be detected by using the molecule which specifically
binds to the protein marker.
Alternatively, the cells (lymphocytes) are recovered from the sample containing the
cells from human and the obtained cells are stimulated with anti-CD3 antibody, anti-CD28
antibody, concanavalin A, phytohemagglutinin (PHA), phorbol myristate acetate (PMA),
ionomycin or the like. Then, the secreted protein marker can be detected by using
the molecule which specifically binds to the protein marker.
Specifically, the protein marker can be detected by well-known methods in the art
such as ELISA or Western blotting. The molecule which specifically binds to the protein
marker in the detection is preferably the above nucleic acid aptamer, antibody, ligand
or receptor, and more preferably the antibody for detecting human Th 17 cells.
[0054] When the target protein marker is a protein located on the cell surface, the protein
marker located on the cell surface in the sample containing the cells derived from
human can be detected by using the molecule which specifically binds to the protein
marker.
Alternatively, a membrane fraction of the cells is obtained from the sample containing
the cells derived from human and the protein marker in the membrane fraction can be
detected by using the molecule which specifically binds to the protein marker. Specifically,
the protein marker can be detected by well-known methods in the art such as ELISA,
Western blotting or a method based on flow cytometry (FCM). The molecule which specifically
binds to the protein marker in the detection is preferably the above nucleic acid
aptamer, antibody, ligand or receptor, and more preferably the antibody for detecting
human Th17 cells.
[0055] For example, the protein marker for detecting human Th 17 cells can be detected by
FCM as follows.
First, the sample containing the cells derived from human is brought into contact
with the antibody for detecting human Th17 cells labeled with an appropriate labeling
substance. Human Th17 cells, when exist, bind to the labeled antibody on their surfaces.
Then, the sample containing the cells bound to the labeling substance can be applied
to a flow cytometer to detect human Th17 cells. Human Th17 cells that have bound to
the labeling substance can optionally be classified and fractionated by using a cell
sorter.
Such method of FCM is well-known to a person skilled in the art and he can appropriately
select the reaction conditions.
[0056] The present invention also provides a reagent for detecting human Th 17 cells which
can be used in the present method for detecting human Th17 cells
The reagent comprises at least one substance selected from a nucleic acid probe which
specifically hybridizes to the polynucleotide marker for detecting human Th17 cells,
and a nucleic acid aptamer, antibody, ligand and receptor which specifically binds
to the protein marker for detecting human Th17 cells.
Examples
[0057] The present invention is now described in detail by way of Examples, which do not
limit the present invention.
Example 1: Analysis of highly expressed genes in cultured Th17 cells derived from
human peripheral blood
1. Isolation of Th1, Th2, Treg and Th17 cells from human peripheral blood
(1) Isolation of Th1, Th2 and Th17 cells from human peripheral blood
[0058] Buffy coat obtained from peripheral blood of a healthy adult was overlaid on Ficoll-paque
plus solution (GE Healthcare Bioscience) and centrifuged to obtain a monocyte fraction.
Crude CD4 positive cells were purified from the fraction by using magnetic beads bound
to anti-CD4 antibody (Miltenyi Biotec).
The obtained CD4 positive cells were stained with the fluorescence labeled antibodies
shown in Table 1 and then Th1, Th2 and Th17 cells were separated by a cell sorter
(FACS Aria: Becton Dickinson). The separation was carried out with the gating shown
in Table 2.
[0059]
[Table 1]
| Antigen |
Fluorescence labeling substance |
Clone |
Manufacturer |
| CD4 |
APC-Cy7 |
RPA-T4 |
BD Biosciences |
| OD25 |
PE-Cy7 |
BC96 |
eBioscience |
| CXCR3 |
Alexa Fluor™ 488 |
1C6/CXCR3 |
BD Biosciences |
| CCR4 |
APC |
FAB1567A |
R&D systems |
| CCR6 |
PE |
11A9 |
BD Biosciences |
[0060]
[Table 2]
| Cell |
Gating |
| Tn1 |
CD4high CD25low-negative CXCR3+ CCR6- CCR4- |
| Th2 |
CD4high CD25low-negative CXCR3- CCR6- CCR4+ |
| Th17 |
CD4high CD25low-negative CXCR3- CCR6+ CCR4+ |
(2) Isolation of Treg cells from human peripheral blood
[0062] CD4 positive cells obtained in the same manner as the above (1) were stained with
the fluorescence labeled antibodies shown in Table 3, and CD4high CD25high CD127internal-negative
cells were purified as Treg cells by using the above cell sorter.
[0063]
[Table 3]
| Antigen |
Fluorescence labeling substance |
Clone |
Manufacturer |
| CD4 |
FITC |
OKT4 |
eBioscience |
| CD25 |
PE-Cy7 |
BC96 |
eBioscience |
| CD45RO |
PE |
UCHL1 |
BioLegend |
| CD127 |
Alexa Fluor™ 647 |
HIL-7R-M21 |
BD Biosciences |
2. Cell culture
(1) Th1, Th2 and Th17 cell cultures
[0065] Th1, Th2 and The cells derived from adult peripheral blood obtained in the above
step 1. (1) were respectively plated in a 96-well plate at the density of 1..5 x 10
5 cells/0.3 ml/well. The medium used was Yssel medium (IMDM, 1% human serum of AB-type,
0.25% BSA, 1.8 mg/l 2-aminomethanol, 40 mg/l transferrin, 5 mg/l insulin, 2 mg/l linoleic
acid, 2 mg/l oleic acid, 2 mg/l palmitic acid, 1% penicillin/ streptomycin).
For activation and proliferation of the above cells, magnetic beads coated with anti-CD2/3/28
antibody (Miltenyi Biotec) (hereinafter also referred to as "antibody beads") were
added at 0.75 x 10
5 per well. After addition of cytokines and neutralizing antibody(s) suitable for differentiation
culture of respective Th1, Th2 and Th 17 cells, cells were incubated in an incubator
at 37°C with 5% CO
2. Cytokines and neutralizing antibodies used are shown in Table 4.
[0066]
[Table 4]
| Cell |
Cytokine |
Neutralizing antibody (Clone) |
| Th1 |
IL-12, IL-2 |
Anti-IL-4 antibody (MP4-25D2) |
| Th2 |
IL-4, IL-2 |
Anti-IFN-γ antibody (R4-6A2) |
| Th17 |
TGF-β-1, IL-6, IL-23,
IL-21, IL-1β, TNFα IL-2 |
Anti-IL-4 antibody (MP4-25D2),
Anti-IFN-γ antibody (R4-6A2) |
[0067] The concentrations of the above cytokines were 50 ng/ml for IL-6 and 10 ng/ml for
other than IL-6.
The concentrations of antibodies were 10 µg/ml for anti-IFNM-γ antibody and 2.5 µg/ml
for anti-IL-4 antibody. The cytokines and neutralizing antibodies were obtained from
R&D systems and eBioscience, respectively.
After three days from the start of culture, cells were diluted three-fold with the
medium containing the above cytokines and antibody(s) and cultured for further seven
days (10 days in total).
After ten days from the start of culture, the obtained Th1, Th2 and Th17 cells were
respectively divided into two equal parts, and one was washed with Yssel medium and
PBS before centrifugation to collect cells, which were stored at -80°C until the subsequent
RNA extraction step. These cells were designated as Th1, Th2 and Th17 cells "without
activation stimulation". The other half was added with the antibody beads and cultured
for three more hours to re-activate the cells. The cells were collected by centrifugation
and similarly stored at -80°C. These cells were designated as Th1, Th2 and Th17 cells
"with activation stimulation".
(2) Treg cell culture
[0068] Treg cells obtained in the above step 1. (2) were cultured in the same manner in
Yssel medium as the above step 2. (1) and activated with the antibody beads. To the
medium were added cytokines IL-2 and TGF-β1 (R&D systems), and neutralizing antibodies
anti-IFN-γ antibody, anti-IL-4 antibody (eBioscience) and anti-IL-6 antibody (BD Bioscience).
These cytokines and neutralizing antibodies were used at the concentrations of 10
ng/ml and 5 µg/ml, respectively.
After three days from the start of culture, cells were added with the cytokines and
neutralizing antibodies at the same amounts as those at the start of the culture.
After culturing for three more days, cells were divided into two equal parts, one
half was not added with the antibody beads used for activation and the other half
was added with the antibody beads before culturing further three hours, thereby obtaining
Treg cells "without activation stimulation" and Treg cells "with activation stimulation",
respectively. The cells were then collected by centrifugation and stored at -80°C
until the subsequent RNA extraction step.
3. Extraction of total RNA
[0069] The cells obtained as the above step 2. were subjected to extraction of total RNAs
using RNeasy Plus Mini kit and RNeasy micro kit (QIAGEN).
The specific procedures were according to the attached instructions of the kits.
4. Expression analysis by microarray
[0070] Total RNA (10 to 100 ng) extracted from the cells as the above step 3. were reverse-transcribed
to cDNAs with Two-Cycle Target Labeling and Control Reagents (Affymetrix), and further
transcribed to biotinylated-cRNAs. The amplified biotinylated-cRNAs (20 µg) were fragmented.
The specific procedures were according to the attached instruction of the kit.
The biotinylated-cRNAs derived from the cells as obtained above (15 µg) were applied
to GeneChip Human Genome U-133 Plus 2.0 Array (Affymetrix) as samples, transferred
to GeneChip Hybridization Oven 640 (Affymetrix) and hybridized under the conditions
of 45°C and 60 rpm for 16 hours.
After completion of the hybridization, the microarray was washed and fluorescence-labeled
in GeneChip Fluidic Station 450 (Affymetrix), and scanned in GeneChip Scanner 3000
7G (Affymetrix) to obtain fluorescent intensity data.
5. Selection of genes specifically expressed in human Th 17 Cells
[0071] The fluorescent data obtained in the above step 4. was standardized with the expression
analysis software GeneSpring Ver.10 (Agilent Technologies) based on MASS algorithm.
Relative fluorescent intensities of the genes from Th17 cells were compared with those
from Th1, Th2 and Treg cells.
The genes whose relative fluorescent intensities in Th17 cells were three or more
times higher than any of those of Th1, Th2 and Treg cells and which were significantly
expressed (which showed "p value < 0.05" after ANOVA test between four groups of relative
fluorescent intensities in Th1, Th2, Treg and Th17 cells) were identified as the genes
which were specifically expressed in Th17 cells.
[0072] The number of samples used in the above selection step is shown in Table 5.
[0073]
[Table 5]
| |
Th1 |
Th2 |
Th17 |
Treg |
| w/ activation stimulation |
5 |
5 |
5 |
4 |
| w/o activation stimulation |
5 |
5 |
5 |
3 |
[0074] The genes specifically expressed in Th17 cells "without activation stimulation" and
"with activation stimulation" are shown in Tables 6 and 7, respectively.
[0075]
[Table 6-1]
| Without activation stimulation |
| Location of encoded protein |
Gene symbol |
Entrez Gene ID |
Protein ID |
Transcript ID |
UniGene ID |
Probe Set ID |
Expression ratio |
| Th17/Th1 |
Th17/Th2 |
Th17/Treg |
| |
ADAM12 |
8038 |
NP_003465, |
NM_003474, |
Hs.594537 |
202952_s_at |
21.8 |
80.1 |
3.2 |
| |
NP_067673 |
NM_021641 |
| |
ANKS1B |
56899 |
NP_064525, |
NM_020140, |
Hs.506458 |
227439_at |
6.9 |
11.7 |
4.3 |
| |
NP_690001, |
NM_152788, |
240292_x_at |
7.8 |
10.3 |
4.6 |
| |
NP_858056 |
NM_181670 |
|
|
|
|
| |
ATP6V0A4 |
50617 |
NP_065683, |
NM_020632, |
Hs.98967 |
220197_at |
22.8 |
244.1 |
153.8 |
| |
NP_570855, |
NM_130840, |
| |
NP_570856 |
NM_130841 |
| |
ATP9A |
10079 |
NP_006036 |
NM_006045 |
Hs.714307 |
212062_at |
5.7 |
53.5 |
44.3 |
| |
BVES |
11149 |
NP_009004, |
NM_007073, |
Hs.221660 |
228783_at |
3.0 |
6.5 |
16.2 |
| |
NP_671488 |
MM_147147 |
| |
C5orf40 |
408263 |
NP_001001343 |
NM_001001343 |
Hs.437066 |
1554801_at |
9.4 |
12.8 |
3.1 |
| |
CDH4 |
1002 |
NP_001785 |
NM_001794 |
Hs.473231 |
206866_at |
19.2 |
16.0 |
7.6 |
| |
|
|
NP_000784, |
NM_000793, |
|
|
|
|
|
| |
DIO2 |
1734 |
NP_001007024 |
NM_001007023 |
Hs.202354 |
203700_s_at |
9.2 |
3,4 |
17.1 |
| |
|
|
NP_054644 |
NM_013989 |
|
|
|
|
|
| Membrane |
|
|
NP_000100, |
NM_000109, |
|
|
|
|
|
| |
|
|
NP-003997, |
NM_004006, |
|
|
|
|
|
| |
|
|
NP_003998, |
NM_004007, |
|
|
|
|
|
| |
|
|
NP_004000, |
NM_004009, |
|
|
|
|
|
| |
|
|
NP_004001, |
NM_004010, |
|
|
|
|
|
| |
|
|
NP_004002, |
NM_004011, |
|
|
|
|
|
| |
|
|
NP_004003, |
NM_004012, |
|
|
|
|
|
| |
|
|
NP_004004, |
NM-004013, |
|
|
|
|
|
| |
DMD |
1756 |
NP_004005, |
NM_004014. |
Hs.495912 |
203881_s_at |
10.3 |
3.2 |
10.0 |
| |
|
|
NP_004006, |
NM_004015, |
|
|
|
|
|
| |
|
|
NP_004007, |
NM_004016, |
|
|
|
|
|
| |
|
|
NP_004008, |
NM_004017, |
|
|
|
|
|
| |
|
|
NP_004009, |
NM_004018, |
|
|
|
|
|
| |
|
|
NP_004010, |
NM_004019, |
|
|
|
|
|
| |
|
|
NP_004011, |
NM_004020, |
|
|
|
|
|
| |
|
|
NP_004012, |
NM_004021, |
|
|
|
|
|
| |
|
|
NP_004013, |
NM_004022, |
|
|
|
|
|
| |
|
|
NP_004014, |
NM_004023, |
|
|
|
|
|
[0076]
[Table 6-2]
| Without activation stimulation |
| Location of encoded protein |
Gene symbol |
Entrez Gene ID |
Protein ID |
Transcript ID |
UniGene ID |
Probe Set ID |
Expression ratio |
| Th17/Th1 |
Th17/Th2 |
Th17/Treg |
| |
DRD2 |
1813 |
NP_000786, |
NM_000795, |
Hs.73893 |
216938_x_at |
5.3 |
5.6 |
5.4 |
| |
NP_057658 |
NM_016574 |
| |
GJC1 |
10052 |
NP_001073852, |
NM_001080383, |
Hs.532593 |
228776_at |
7.0 |
10.7 |
4.9 |
| |
NP_005488 |
NM_005497 |
243502_at |
3.8 |
10.5 |
8.3 |
| |
GPR34 |
2857 |
NP_001091048, |
NM_001097579, |
Hs.496989 |
223620_at |
4.2 |
7.9 |
7.0 |
| |
NP_005291 |
NM_005300 |
| |
IL23R |
149233 |
NP_653302 |
NM_144701 |
Hs.677426 |
1552912_a_at |
8.2 |
15.3 |
4.1 |
| |
IRS2 |
8660 |
NP_003740 |
NM_003749 |
Hs.442344 |
209184_s_at |
3.5 |
4.0 |
3.3 |
| |
209185_s_at |
6.0 |
5.9 |
4.3 |
| |
KCNE3 |
10008 |
NP_005463 |
NM_005472 |
Hs.523899 |
227647_at |
9.8 |
8.3 |
5.9 |
| |
L1CAM |
3897 |
NP_000416, |
NM_00425, |
Hs.522818 |
204584_at |
8.5 |
9.4 |
5.1 |
| |
NP_076493 |
NM_024003 |
| |
PGBD5, |
79605, |
NP_078830, |
NM_024554, |
Hs.520463 |
219225_at |
9.9 |
17.3 |
11.3 |
| |
LOC100134440 |
100134440 |
XP_001716155 |
XM_001716103 |
| |
MCAM |
4162 |
NP_006491 |
NM_006500 |
Hs.599039 |
210869_s_at |
9.5 |
18.0 |
5.6 |
| |
MFAP3L |
9848 |
NP_001009554, |
NM_001009554, |
Hs.593942 |
205442_at |
11.5 |
29.9 |
7.1 |
| |
NP_067679 |
NM_021647 |
| Membrane |
MS4A7 |
58475 |
NP_067024, |
NM_021201, |
Hs.530735 |
223343_at |
16.6 |
11.7 |
3.2 |
| |
NP_996821, |
NM_206938, |
| |
NP_996822, |
NM_206939, |
| |
NP_996823 |
NM_206940, |
| |
MYO7A |
4647 |
NP_000251, |
NM_000260, |
Hs.370421 |
208189_s_at |
19.4 |
22.9 |
6.5 |
| |
NP_001120651, |
NM_001127179, |
| |
NP_001120652 |
NM_001127180 |
| |
ODZ4 |
26011 |
NP_001092286 |
NM_001098816 |
Hs.213087 |
213273_at |
9.8 |
13.1 |
7.0 |
| |
PHKA1 |
5255 |
NP_001116142, |
NM_001122670, |
Hs.201379 |
229876_at |
4.2 |
3.7 |
15.8 |
| |
NP_002628 |
NM_002637 |
| |
PTPRM |
5707 |
NP_001098714, |
MN_001105244, |
Hs.49774 |
1555579_s_at |
3.6 |
76.0 |
3.7 |
| |
NP_002836 |
NM_002845 |
| |
RGS1 |
5996 |
NP_002913 |
NM_002922 |
Hs.75256 |
202988_s_at |
3.3 |
3.6 |
3.9 |
| |
SHB |
6461 |
NP_003019 |
NM_003028 |
Hs.521482 |
1557458_s_at |
14.9 |
27.8 |
7.4 |
| |
SHROOM2 |
357 |
NP_001640 |
NM_001649 |
Hs.567236 |
204967_at |
3.4 |
3.4 |
3.4 |
| |
SLC16A4 |
9122 |
NP_004687 |
NM_004696 |
Hs351306 |
205234_at |
66.3 |
20.4 |
3.4 |
| |
SLC44A3 |
126969 |
NP_001107578, |
NM_001114106, |
Hs.483423 |
228221_at |
3.1 |
9.3 |
3.5 |
| |
NP_689582 |
NM_152369 |
[0077]
[Table 6-3]
| Without activation stimulation |
| Location of encoded protein |
Gene symbol |
Entrez Gene ID |
Protein ID |
Transcript ID |
UniGene ID |
Probe Set ID |
Expression ratio |
| Th17/Th1 |
Th17/Th2 |
Th17/Treg |
| |
SLC6A15 |
55117 |
NP_060527, |
NM_018057, |
Hs.44424 |
206376_at |
10.7 |
11.9 |
15.2 |
| |
NP_877499 |
NM_182767 |
| |
SLCO2B1 |
11309 |
P_009187 |
NM_007256 |
Hs.7884 |
203473_at |
9.7 |
6.0 |
6.8 |
| |
SYNGR3 |
9143 |
NP_004200 |
NM_004209 |
Hs.435277 |
205691_at |
4.7 |
7.9 |
5.5 |
| |
TANC2 |
26115 |
NP_079461 |
NM_025185 |
Hs.410889 |
208425_s_at |
4.7 |
9.0 |
7.3 |
| |
224952_at |
6.1 |
5.8 |
7.5 |
| |
TJP1 |
7082 |
NP_003248, |
NM_003257, |
Hs.716406 |
202011_at |
15.3 |
19.2 |
4.3 |
| Membrane |
NP_783297 |
NM_175610 |
| |
TMEM163 |
81615 |
NP_112185 |
NM_030923 |
Hs.369471 |
1552626_a_at |
16.1 |
32.5 |
16.4 |
| |
223503_at |
28.8 |
47.9 |
29.7 |
| |
TNS3 |
64759 |
NP_073585 |
NM_022748 |
Hs.520814 |
217853_at |
7.6 |
158.8 |
4.5 |
| |
UPK1B |
7348 |
NP_008883 |
NM_006952 |
Hs.271580 |
210065_s_at |
5.8 |
7.5 |
4.6 |
| |
WDFY3 |
23001 |
NP_055806, |
NM_014991, |
Hs.480116 |
212598_at |
14.2 |
18.4 |
45.6 |
| |
NP_848698, |
NM_178583, |
212602_at |
18.7 |
56.1 |
29.3 |
| |
NP_848700 |
NM_178585 |
212606_at |
23.0 |
82.7 |
71.7 |
| |
C17orf99 |
100141515 |
NP_001156547 |
NM_001163075 |
Hs.633034 |
236981_at |
29.1 |
10.9 |
4.1 |
| |
CXCL 13 |
10563 |
NP_006410 |
NM_006419 |
Hs.100431 |
205242_at |
57.7 |
20.1 |
4.6 |
| |
EBI3 |
10148 |
NP_005746 |
NM_005755 |
Hs.501452 |
219424_at |
3.6 |
43.8 |
3.7 |
| |
IL17A |
3605 |
NP_002181 |
NM_002190 |
Hs.41724 |
216876_s_at |
340.3 |
618.9 |
21.8 |
| |
IL17F |
112744 |
NP_443104 |
NM_052872 |
Hs.272295 |
234408_at |
559.0 |
778.4 |
525.7 |
| |
IL1A |
3552 |
NP_000566 |
NM_000575 |
Hs.1722 |
210118_s_at |
38.1 |
13.8 |
6.5 |
| Extracellular / secreted |
IL22 |
50616 |
NP_065386 |
NM_020525 |
Hs.287369 |
222974_at |
7.5 |
26.0 |
13.6 |
| IL26 |
55801 |
NP_060872 |
NM_018402 |
Hs.272350 |
221111_at |
11.6 |
13.5 |
53.7 |
| |
IL9 |
3578 |
NP_000581 |
NM_000590 |
Hs.960 |
208193_at |
103.8 |
193.5 |
24.1 |
| |
PCOLCE2 |
26577 |
NP_037495 |
NM_013363 |
Hs.8944 |
219295_s_at |
10.6 |
16.8 |
25.3. |
| |
PNOC |
5368 |
NP_006219 |
NM_006228 |
Hs.88218 |
205901_at |
36.8 |
27.3 |
69.3 |
| |
SMPDL3A |
10924 |
NP_006705 |
NM_006714 |
Hs.486357 |
213624_at |
4.0 |
3.8 |
7.9 |
| |
TGFB1 |
7045 |
NP_000349 |
NM_000358 |
Hs.369397 |
201506_at |
54.7 |
476.7 |
33.8 |
| |
WNT3 |
7473 |
NP_110380 |
NM_030753 |
Hs.445884 |
229103_at |
6.6 |
5.9 |
6.2 |
| Intracellular |
BCAT1 |
586 |
NP_005495 |
NM_005504 |
Hs.438993 |
24390_s_at |
3.1 |
4.1 |
18.9 |
| 214452_at |
3.5 |
6.4 |
24.8 |
| 225285-at |
3.0 |
3.5 |
31.5 |
| 226517_ at |
3.1 |
3.5 |
38.3 |
| BHLHE22 |
27319 |
NP_689627 |
NM_152414 |
Hs.591870 |
228636_at |
18.9 |
24.7 |
40.5 |
[0078]
[Table 6-4]
| Without activation stimulation |
| Location of encoded protein |
Gene symbol |
Entrez Gene ID |
Protein ID |
Transcript ID |
UniGene ID |
Probe Set ID |
Expression ratio |
| Th17/Th1 |
Th17/Th2 |
Th17/Treg |
| |
C13orf18, |
80183, |
NP_079389, |
NM_025113, |
Hs.98117 |
44790_s_at |
3.2 |
11.2 |
32.0 |
| |
XP_001132115, |
XM_001132115, |
| |
LOC728970 |
728970 |
XP_001133896, |
XM_001133896, |
| |
XP_001720207 |
XM_001720155 |
| |
CA2 |
760 |
NP_000058 |
NM_000067 |
Hs.155097 |
209301_at |
6.3 |
452.7 |
103.6 |
| |
CCDC3 |
83643 |
NP_113643 |
NM_031455 |
Hs.498720 |
223316_at |
16.3 |
106.1 |
42.1 |
| |
CDS1 |
1040 |
NP_001254 |
NM_001263 |
Hs.654899 |
205709_s_at |
13.9 |
26.7 |
3.8 |
| |
CHN1 |
1123 |
NP_001020372, |
NM_001025201 |
Hs.654534 |
212624_s_at |
6.9 |
12.3 |
6.4 |
| |
NP_001813 |
NM_001822 |
| |
CLIC5, |
53405, |
NP_001107558, |
NM001114086, |
Hs.485489 |
213317_at |
6.7 |
53.5 |
13.3 |
| |
NP_058625, |
NM_016929, |
217628_at |
3.1 |
9.1 |
4.2 |
| |
|
|
XP_001723610 |
XM_001723558 |
243917_at |
13.9 |
56.8 |
16.7 |
| |
LOC100131610 |
100131610 |
|
|
219866_at |
7.1 |
28.2 |
17.8 |
| |
CTSH |
1512 |
NP_004381, |
NM_004390, |
Hs.148641 |
202295_s_at |
4.7 |
10.4 |
5.6 |
| |
NP_683880 |
NM_148979 |
| |
CYP7B1 |
9420 |
NP_004811 |
NM_004820 |
Hs,667720 |
207386_at |
12.3 |
10.2 |
4.1 |
| |
DAPK2 |
23604 |
MP_055141 |
NM_014326 |
Hs.237886 |
206324_s_at |
7.3 |
9.9 |
8.3 |
| Intracellular |
215184_at |
6.3 |
11.0 |
7.1 |
| |
DDIT4L |
115265 |
NP_660287 |
NM_145244 |
Hs.480378 |
228057_at |
3.1 |
5.2 |
106.8 |
| |
DHRS9 |
10170 |
NP_001135742. |
NM_001142270, |
Hs.179608 |
219799_s_at |
8.3 |
14.6 |
11.9 |
| |
NP_001135743, |
NM_001142271, |
223952_x_at |
5.3 |
7.8 |
7.7 |
| |
NP_005762, |
NM_005771, |
224009_x_at |
6.3 |
7.9 |
7.0 |
| |
NP_954674 |
NM_199204 |
|
|
|
|
| |
DMRT1 |
1761 |
NP_068770 |
NM_021951 |
Hs.98586 |
220493_at |
3.6 |
16.6 |
6.4 |
| |
DSE |
29940 |
NP_001074445, |
NM_001080976. |
Hs.486292 |
218854_at |
13.9 |
41.8 |
26.2 |
| |
NP_037484 |
NM_013352 |
| |
ERC2 |
26059 |
NP_056391 |
NM_015576 |
Hs.476389 |
213938_at |
3.5 |
6.1 |
6.1 |
| |
FBXL17 |
64839 |
NP_073735 |
NM_022824 |
Hs.657225 |
227203_at |
8.9 |
7.7 |
4.7 |
| |
FBXL21 |
26223 |
NP_038291 |
NM_012159 |
Hs.591275 |
1555412_at |
22.9 |
29.2 |
13.0 |
| |
FERMT2 |
10979 |
NP_00128471, |
NM_001134999, |
Hs.509343 |
209210_s_at |
3.1 |
9.5 |
|
| |
NP_001128472, |
NM_001135000, |
5.8 |
| |
NP_006823 |
NM_006832 |
|
| |
FHOD3 |
80206 |
NP_079411 |
mm_025135 |
Hs.436636 |
218980_at |
7.2 |
10.3 |
7.8 |
| |
H2AFY2 |
55508 |
NP_061119 |
NM_018649 |
Hs.499953 |
218445_at |
5.2 |
6.5 |
6.4 |
[0079]
[Table 6-5]
| Without activation stimulation |
| Location of encoded protein |
Gene symbol |
Entrez Gene ID |
Protein ID |
Transcript ID |
UniGene ID |
Probe Set ID |
Expression ratio |
| Th17/Th1 |
Th17/Th2 |
Th17/Treg |
| |
HHEX |
3087 |
NP_002720 |
NM_002729 |
Hs.118651 |
204689_at |
3.6 |
5.9 |
6.4 |
| |
HLX |
3142 |
NP_068777 |
NM_021958 |
Hs.74870 |
214438_at |
4.1 |
8.4 |
26.3 |
| |
HS3ST1 |
9957 |
NP_005105 |
NM_905114 |
Hs.507348 |
205466_s_at |
21.2 |
6.0 |
3.2 |
| |
IRAK3 |
11213 |
NP_001135995, |
NM_001142523, |
Hs.369265 |
213817_at |
14.5 |
16.5 |
6.0 |
| |
NP_009130 |
NM_007199 |
220034_at |
5.5 |
10.3 |
3.4 |
| |
MACC1 |
346389 |
NP_877439 |
NM_182762 |
Hs.558388 |
1566766_a_at |
5.9 |
15.7 |
3.5 |
| |
MAML3 |
55634 |
NP_061187 |
NM_018717 |
Hs.586165 |
242794_at |
5.4 |
5.7 |
4.1 |
| |
MYO10 |
4651 |
NP_036466 |
NM_012334 |
Hs.481720 |
201976_s_at |
39.5 |
17.2 |
7.1 |
| |
NR5A2 |
2494 |
NP_003813, |
NM_003822, |
Hs.33446 |
2018343_s_at |
5.5 |
17.9 |
39.5 |
| |
NP_995582 |
NM_205860 |
| |
OTUB2 |
78990 |
NP_075601 |
NM_03112 |
Hs.278815 |
219369_s_at |
3.4 |
3.7 |
6.3 |
| |
222878_s_at |
3.2 |
3.2 |
6.6 |
| |
PAPSS2 |
9060 |
NP_001015880, |
NM_001015880, |
Hs.524491 |
203058_s_at |
4.4 |
5.1 |
19.5 |
| |
NP_004661 |
NM_004670 |
203060_s_at |
6.6 |
17.0 |
14.3 |
| |
PCBP3 |
54039 |
NP_001123613, |
NM_001130141, |
Hs.474049 |
230486_at |
4.1 |
3.6 |
4.8 |
| |
NP_065389 |
NM_020528 |
| Intracellular |
PDE4DIP |
9659 |
NP_001002810, |
NM_001002810, |
Hs.654651 |
205872_x_at |
4.3 |
33.4 |
3.3 |
| |
NP_001002811, |
NM_001002811, |
Hs.613082 |
209700_x_at |
4.1 |
10.9 |
9.5 |
| |
NP_001002812, |
NM_001002812, |
|
|
|
|
|
| |
NP_0055459, |
NM_014644, |
|
|
|
|
|
| |
NP_071754 |
NM_022359 |
|
|
|
|
|
| |
PHLDA1 |
22822 |
MP_031376 |
NM_007350 |
Hs.602085 |
217999_s_at |
3.6 |
5.0 |
10.3 |
| |
225842_at |
3.3 |
3.2 |
8.0 |
| |
PLD1 |
5337 |
NP_001123553, |
NM_001130081, |
Hs.382865 |
177_at |
3.5 |
3.4 |
10.3 |
| |
NP_002653 |
NM_002662 |
215723_s_at |
3.9 |
3.4 |
11.4 |
| |
|
|
226836_at |
5.7 |
3.6 |
13.1 |
| |
PPARG |
5468 |
NP_005028, |
NM_005037, |
Hs.162646 |
208510_s_at |
7.9 |
134.5 |
16.5 |
| |
NP_056953. |
NM_015869, |
| |
NP_619725, |
NM_138711, |
| |
NP_619726 |
NM_138712 |
| |
PTPN13 |
5783 |
NP_006255, |
NM_006264, |
Hs.436142 |
243792_x_at |
3.5 |
4.2 |
7.9 |
| |
NP_542414, |
NM_080683, |
| |
NP_542415, |
NM_080684, |
| |
NP_542416 |
NM_080685 |
[0080]
[Table 6-6]
| Without activation stimulation |
| Location of encoded protein |
Gene symbol |
Entrez Gene ID |
Protein ID |
Transcript ID |
UniGene ID |
Probe Set ID |
Expression ratio |
| Th17/Th1 |
Th17/Th2 |
Th17/Treg |
| |
RBM20 |
282996 |
NP_001127835, |
NM_001134363, |
Hs.715766 |
238763_at |
8.0 |
3.5 |
3.0 |
| |
XP_001716171, |
XM_001716119, |
| |
XP_291671, |
XM_291671, |
| |
XP_944430 |
XM_939337 |
| |
RGS18 |
64407 |
NP_570138 |
NM_130782 |
Hs.440890 |
223809_at |
3.3 |
6.9 |
8.8 |
| |
RORC |
6097 |
NP_001001523, |
NM_001001523, |
Hs256022 |
228806_at |
14.0 |
170.6 |
7.7 |
| |
NP_005051 |
NM_005060 |
| |
NINL |
22981 |
NP_079452 |
NM_025176 |
Hs.696157 |
207705_s_at |
4.7 |
4.7 |
3.1 |
| |
RTN2 |
6253 |
NP_005610, |
NM_005619, |
Hs.47517 |
34408_at |
3.7 |
4.6 |
4.5 |
| |
NP_996783, |
NM_206900, |
| |
NP_996784 |
NM_206901 |
| |
SH3RF2 |
153769 |
NP_689763 |
NM_152550 |
Hs.443728 |
243582_at |
5.8 |
4.1 |
18.5 |
| |
S1M1 |
6492 |
NP_005059 |
NM_005068 |
Hs.520293 |
1556300_s_at |
8.8 |
4.8 |
69.0 |
| Intracellular |
|
206876_at |
8.7 |
4.8 |
37.5 |
| |
SNA12 |
6591 |
NP_003059 |
NM_003068 |
Hs.360174 |
213139_at |
24.6 |
22.5 |
13.8 |
| |
SOX2 |
6657 |
NP_003097 |
NM_003106 |
Hs.518438 |
228038_at |
9.6 |
8.3 |
3.4 |
| |
SPIRE1 |
56907 |
NP_001122098 |
NM_001128626, |
Hs.515283 |
1554807_a_at |
4.7 |
6.1 |
3.8 |
| |
NP_001122099, |
NM_001128627, |
224935_at |
8.0 |
9.0 |
4.7 |
| |
NP_064533 |
NM_020148 |
225018_at |
6.6 |
9.2 |
6.3 |
| |
IBC1D12 |
23232 |
NP_056003 |
NM_015188 |
Hs.500598 |
221858_at |
7.7 |
5.8 |
5.5 |
| |
TGM5 |
9333 |
NP_004236, |
NM_004245, |
Hs.129719 |
207911_s_at |
3.6 |
6.6 |
5.1 |
| |
NP_963925 |
NM_201631 |
| |
TMOD1 |
7111 |
NP_003266 |
NM_003275 |
Hs.494595 |
203661_s_at |
7.0 |
14.7 |
5.1 |
| |
203662_s_at |
7.8 |
14.5 |
4.5 |
| |
TSHZ2 |
128553 |
NP_775756 |
NM_173485 |
Hs.649877 |
220213_at |
3.6 |
12.4 |
3.8 |
| |
Hs.271605 |
243940_at |
3.1 |
10.6 |
4.1 |
| |
TUBB6 |
84617 |
NP_115914 |
NM_032525 |
Hs.193491 |
209191_at |
4.1 |
12.7 |
4.7 |
| Unknown |
C1orf106 |
55765 |
NP_001136041, |
NM_001142569, |
Hs.518997 |
219010_at |
78.5 |
111.8 |
3.3 |
| NP_060735 |
NM_018265 |
| C6orf145 |
221749 |
NP_899229 |
NM_183373 |
Hs.484500 |
212923_s_at |
10.4 |
3.8 |
5.2 |
| LOC401097 |
401097 |
XP_001717155, |
XM_001717103, |
Hs.710781 |
236738_at |
6.8 |
3.3 |
24.9 |
| XP_001718614, |
XM_001718562, |
| XP_001718795 |
XM_001718743 |
| MAMLD1 |
10046 |
NP_005482 |
NM_005491 |
Hs.20136 |
205088_at |
6.6 |
8.3 |
34.1 |
[0081]
[Table 6-7]
| Without activation stimulation |
| Location of encoded protein |
Gene symbol |
Entrez Gzne ID |
Protein ID |
Transcript ID |
UniGene ID |
Probe Set ID |
Expression ratio |
| Th17/Th1 |
Th17/Th2 |
Th17/Treg |
| |
ZC3H12C |
85463 |
NP_203748 |
NM_033390 |
Hs.376289 |
231899_at |
3.0 |
4.1 |
18.7 |
| |
--- |
--- |
--- |
AA579799, |
Hs.663788 |
215768_at - |
4.1 |
8.1 |
8.7 |
| |
AA947186, |
| |
AL049337, |
| |
AW665328 |
| |
--- |
--- |
--- |
AK093229 |
Hs.586723 |
222900_at |
5.9 |
3.0 |
4.5 |
| |
--- |
--- |
--- |
AK0055628, |
Hs.594351 |
226777_at |
21.6 |
39.7 |
3.6 |
| |
UC001ijj 1 |
| |
--- |
--- |
--- |
AK129763, |
Hs.157726 |
227452_at |
4.6 |
4.2 |
4.5 |
| |
CR595568, |
| |
uc002jiy1, |
| |
uc002jiz 1 |
| |
|
|
|
AA416573, |
|
|
|
|
|
| |
|
|
|
AA628762, |
|
|
|
|
|
| Unknown |
|
|
|
D53835, |
|
|
|
|
|
| |
|
|
|
D53836, |
|
|
|
|
|
| |
|
|
|
H24473, |
|
|
|
|
|
| |
|
|
|
R37871, |
|
|
|
|
|
| |
--- |
--- |
--- |
R40232, |
Hs.654918 |
229951_x_at |
4.7 |
15.0 |
7.1 |
| |
|
|
|
T10348, |
|
|
|
|
|
| |
|
|
|
T23451, |
|
|
|
|
|
| |
|
|
|
W56351, |
|
|
|
|
|
| |
|
|
|
W51867, |
|
|
|
|
|
| |
|
|
|
Z28733 |
|
|
|
|
|
| |
--- |
--- |
--- |
AI766299 |
--- |
236338_at |
4.3 |
4.4 |
3.3 |
| |
|
|
|
AI262017, |
|
|
|
|
|
| |
|
|
|
AI280978, |
|
|
|
|
|
| |
--- |
--- |
--- |
AI284950, |
Hs.666775 |
237923_at |
6.9 |
5.3 |
4.0 |
| |
|
|
|
AI733224, |
|
|
|
|
|
| |
|
|
|
AI733801 |
|
|
|
|
|
[0082]
[Table 6-8]
| Without activation stimulation |
| Location of encoded protein |
Gene symbol |
Entrez Gene ID |
Protein ID |
Transcript ID |
UniGene ID |
Probe Set ID |
Expression ratio |
| Th17/Th1 |
Th17/Th2 |
Th17/Treg |
| |
|
|
|
AA687415, |
|
|
|
|
|
| |
|
|
|
AA96901, |
|
|
|
|
|
| |
|
|
|
AI291640, |
|
|
|
|
|
| |
|
|
|
AI446064, |
|
|
|
|
|
| |
|
|
|
AI634557, |
|
|
|
|
|
| |
|
|
|
AI6944948, |
|
|
|
|
|
| |
|
|
|
AI701854, |
|
|
|
|
|
| |
|
|
|
AI983938, |
|
|
|
|
|
| |
|
|
|
AV745212, |
|
|
|
|
|
| |
--- |
--- |
--- |
AV745909, |
Hs.434948 |
238009_at |
4.0 |
19.0 |
27.6 |
| |
|
|
|
AV746001, |
|
|
|
|
|
| |
|
|
|
AW008696, |
|
|
|
|
|
| |
|
|
|
AW511701, |
|
|
|
|
|
| |
|
|
|
AW974416, |
|
|
|
|
|
| Unknown |
|
|
|
BG149302, |
|
|
|
|
|
| |
|
|
|
BG150103, |
|
|
|
|
|
| |
|
|
|
N66771, |
|
|
|
|
|
| |
|
|
|
R66991 |
|
|
|
|
|
| |
|
|
|
AI148241, |
|
|
|
|
|
| |
|
|
|
AI735444, |
|
|
|
|
|
| |
--- |
--- |
--- |
BE645654, |
Hs.59083 |
238151_at |
50.6 |
21.1 |
24.4 |
| |
|
|
|
BF510855, |
|
|
|
|
|
| |
|
|
|
BF511636 |
|
|
|
|
|
| |
--- |
--- |
--- |
AK094629 |
Hs.594896 |
238623_at |
4.9 |
4.8 |
3.4 |
| |
|
|
|
AI682088, |
|
|
|
|
|
| |
|
|
|
AI951058, |
|
|
|
|
|
| |
|
|
|
F06296, |
|
|
|
|
|
| |
--- |
--- |
--- |
F13164, |
Hs.606172 |
241726_at |
5.4 |
5.7 |
9.5 |
| |
|
|
|
T77624, |
|
|
|
|
|
| |
|
|
|
Z44722 |
|
|
|
|
|
[0083]
[Table 7-1]
| With activation stimulation |
| Location of encoded protein |
Gene symbol |
Entrez Gene ID |
Protein ID |
Transcript ID |
UniGene ID |
Probe Set ID |
Expression ratio |
| Th17/Th1 |
Th17/Th2 |
Th17/Treg |
| |
ADAM12 |
8038 |
NP_003465, |
NM_003474, |
Hs.594537 |
202952_s_at |
19.5 |
71.0 |
3.5 |
| |
NP_067673 |
NM_021641 |
| |
AKAP12 |
9590 |
NP_665091, |
NM_005100, |
Hs.371240 |
210517_s_at |
9.8 |
4.5 |
12.8 |
| |
NP_653080 |
NM_144497 |
227529_s_at |
8.9 |
5.7 |
45.5 |
| |
ANKS1B |
56899 |
NP_064525, |
NM_020140, |
Hs_556458 |
227439_at |
5.7 |
10.5 |
15.1 |
| |
NP_690001, |
NM_152788, |
227440_at |
3.6 |
12.0 |
6.3 |
| |
NP_858056 |
NM_181670 |
240292_x_at |
5.1 |
9.9 |
8.6 |
| |
ATP6V0A4 |
50617 |
NP_065683, |
NM_020632, |
Hs.98967 |
220197_at |
9.0 |
96.4 |
64.8 |
| |
NP_570855, |
NM_130840, |
| Membrane |
NP_570856 |
NM_130841 |
| |
ATP9A |
10079 |
NP_006036 |
NM_006045 |
Hs.714307 |
212062_at |
7.5 |
55.4 |
46.4 |
| |
BVES |
11149 |
NP_009004, |
NM_007073, |
Hs.221660 |
228783_at |
3.4 |
5.9 |
9.8 |
| |
NP_671488 |
NM_147147 |
| |
G5orf40 |
408363 |
NP_004014343 |
NM_001001343 |
Hs.437066 |
1554801_at |
17.2 |
21.0 |
5.4 |
| |
C9orf125 |
84302 |
NP_115718 |
NM_032342 |
Hs.655738 |
224458_at |
7.5 |
5.2 |
8.2 |
| |
CDH4 |
1002 |
NP_001785 |
NM_001794 |
Hs.473231 |
2068666_at |
7.4 |
13.7 |
11.6 |
| |
DIO2 |
1734 |
NP_000784, |
NM_000793, |
Hs.202354 |
203699_s_at |
57 |
8.0 |
15.4 |
| |
NP_D01007024, |
NM_001007023, |
203700_s_at |
13.2 |
13.6 |
14.1 |
| |
NP_054644 |
NM_013989 |
231240_at |
9.6 |
5.3 |
6.3 |
[0084]
[Table7-2]
| With activation stimulation |
| Location of encoded protein |
Gene symbol |
Entrez Gene ID |
Protein ID |
Transcript ID |
UniGene ID |
Probe Set ID |
Expression ratio |
| Th17/Th1 |
Th17/Th2 |
Th17/Treg |
| |
|
|
NP_000100, |
NM_000109, |
|
|
|
|
|
| |
|
|
NP_003997, |
NM_004006, |
|
|
|
|
|
| |
|
|
NP_003998, |
NM_004007, |
|
|
|
|
|
| |
|
|
NP_004000, |
NM_004009, |
|
|
|
|
|
| |
|
|
NP_004001, |
NM_004010, |
|
|
|
|
|
| |
|
|
NP_004002, |
NM_004011, |
|
|
|
|
|
| |
|
|
NP_004003, |
NM_004012, |
|
|
|
|
|
| |
|
|
NP_004004, |
NM_00Q4013, |
|
|
|
|
|
| |
DMD |
1756 |
NP_004005, |
NM_004014, |
Hs.495912 |
203881_s_at |
9.7 |
3.1 |
10.4 |
| |
NP_004006, |
NM_004015, |
| |
|
|
NP_004007, |
NM_004016, |
|
|
|
|
|
| |
|
|
NP_004008, |
NM_004017, |
|
|
|
|
|
| |
|
|
NP_004009, |
NM_004018, |
|
|
|
|
|
| |
|
|
NP_004010, |
NM_004019, |
|
|
|
|
|
| |
|
|
NP_004011, |
NM_004020, |
|
|
|
|
|
| |
|
|
NP_004012, |
MM_004021, |
|
|
|
|
|
| |
|
|
NP_004013, |
NM_004022, |
|
|
|
|
|
| Membrane |
|
|
NP_004014 |
NM_004023 |
|
|
|
|
|
| |
DPY19L2 |
283417 |
NP_776173 |
NM_173812 |
Hs.533644 |
230158_at |
12.5 |
13.0 |
3.4 |
| |
GPR34 |
2857 |
NP_001091048, |
NM_001097579 |
Hs.495989 |
223620_at |
7.2 |
12.6 |
22.1 |
| |
HRH4 |
59340 |
NP_001137300, |
NM_001143828, |
Hs.287388 |
221170_at |
45.8 |
3.0 |
45.6 |
| |
NP_067637 |
NM_021624 |
| |
IL23R |
149233 |
NP_653302 |
NM_144701 |
Hs.677426 |
1561853_a_at |
15.1 |
7.8 |
6.2 |
| |
IRS2 |
8600 |
NP_003740 |
NM_003749 |
Hs.442344 |
209185_s_at |
3.3 |
6.4 |
5.1 |
| |
KCNE3 |
10008 |
NP_005463 |
NM_005472 |
Hs.523899 |
227647_at |
14.9 |
5.0 |
3.7 |
| |
L1CAM |
3897 |
NP_000416, |
NM_000425, |
Hs.522818 |
204584_at |
10.3 |
6.6 |
5.9 |
| |
NP_076493 |
NM_024003 |
| |
MCAM |
4162 |
NP_006491 |
NM_006500 |
Hs.599039 |
210869_s_at |
12.8 |
24.4 |
4.3 |
| |
MFAP3L |
9848 |
NP_001009554, |
NM_001009554, |
Hs.593942 |
205442_at |
25.8 |
22.6 |
10.5 |
| |
NP_067679 |
NM_021647 |
210492_at |
3.5 |
4.7 |
6.7 |
| |
MUC20 |
200958 |
NP_001091986, |
NM_001098516, |
Hs.308992 |
231941_s_at |
8.3 |
3.4 |
7.2 |
| |
NP_689886, |
NM_152673, |
| |
XP_001726746 |
XM_001726694 |
| |
MYO7A |
4647 |
NP_000251, |
NM_000260, |
Hs.370421 |
208189_s_at |
13.7 |
13.0 |
6.8 |
| |
NP_001120651, |
NM_001127179, |
211103_at |
7.5 |
15.1 |
5.1 |
| |
NP_001120652 |
NM_001127180 |
|
|
|
|
[0085]
[Table 7-3]
| With activation stimulation |
| Location of encoded protein |
Gene symbol |
Entrez Gene ID |
Protein ID |
Transcript ID |
UniGene ID |
Probe Set ID |
Expression ratio |
| Th17/Th1 |
Th17/Th2 |
Th17/Treg |
| |
POPDC3 |
64208 |
NP_071756 |
NM_022361, |
Hs.458336 |
219926_at |
4.5 |
12.9 |
12.8 |
| |
NR_024539 |
| |
PTPRM |
5797 |
NP_001098714, |
NM_001105244, |
Hs.49774 |
1555579_s_at |
4.1 |
66.0 |
4.1 |
| |
NP_002836 |
NM_002845 |
| |
SHROOM2 |
357 |
NP_001640 |
NM_001649 |
Hs.567236 |
204967 at |
11.5 |
3.5 |
5.9 |
| |
SLC16A4 |
9122 |
NP_004687 |
NM 004696 |
Hs.351306 |
205234 at |
29.8 |
16.6 |
6.8 |
| |
SLCO2B1 |
11309 |
NP_009187 |
NM_007256 |
Hs.7884 |
203473 at |
11.0 |
5.9 |
5.9 |
| |
SORBS1 |
10580 |
NP_001030126, |
NM_001034954, |
Hs.713556 |
218087_s_at |
37.9 |
4.7 |
12.8 |
| |
NP_001030127, |
NM_001034955, |
| |
NP_001030128, |
NM_001034956, |
| |
NP_001030129, |
NM_001034957, |
|
|
|
|
| |
NP_006425, |
NM_006434, |
222513_s_at |
14.4 |
3.6 |
8.2 |
| |
NP_056200, |
NM_015385, |
|
|
|
|
| Membrane |
NP_079267 |
NM_024991 |
|
|
|
|
| |
TANC1 |
85461 |
NP_203752 |
NM_033394 |
Hs.61590 |
225308_s_at |
8.1 |
17.7 |
4.9 |
| |
TANC2 |
26115 |
NP_079461 |
NM_025185 |
Hs.410889 |
224952_at |
5.3 |
4.9 |
6.4 |
| |
TJP1 |
7082 |
NP_003248, |
NM_003257, |
Hs.716406 |
202011_at |
11.5 |
11.7 |
5.6 |
| |
NP_783297 |
NM_175610 |
| |
TMEM183 |
81615 |
NP_112185 |
NM_030923 |
Hs.369471 |
1552626_a_at |
10.8 |
12.6 |
13.9 |
| |
223503_at |
18.5 |
23.9 |
21.7 |
| |
TMEM44 |
93109 |
NP_001011655, |
NM_001011655, |
Hs.478729 |
228054_at |
7.4 |
5.2 |
3.3 |
| |
NP_612408 |
NM_138399 |
| |
TNS3 |
64759 |
NP_073585 |
NM_022748 |
Hs.520814 |
217853_at |
7.8 |
27.1 |
6.4 |
| |
UNC13C |
440279 |
NP_001074003 |
NM_001080534 |
Hs.657273 |
1556095_at |
7.3 |
6.1 |
3.8 |
| |
UPK1B |
7348 |
NP_008883 |
NM_006952 |
Hs.271580 |
210065_s_at |
5.3 |
9.6 |
10.3 |
| |
WDFY3 |
23001 |
NP_055806, |
NM_014991, |
Hs.480116 |
212598_at |
10.7 |
16.1 |
19.6 |
| |
NP_648698, |
NM_178583, |
212602_at |
8.5 |
19.4 |
9.8 |
| |
NP_848700 |
NM_178585 |
212606_at |
22.6 |
62.2 |
20.5 |
| Extracellular/ secreted |
CXCL13 |
10563 |
NP_006410 |
NM_006419 |
Hs.100431 |
205242_at |
47.5 |
40.4 |
4.8 |
| IL17A |
3605 |
NP_002181 |
NM_002190 |
Hs.41724 |
208402_at |
16.5 |
11.1 |
3.2 |
| 216876_s_at |
404.7 |
50.0 |
7.6 |
| IL17F |
112744 |
NP_443104 |
NM_052872 |
Hs.272295 |
234408_at |
464.4 |
421.4 |
77.1 |
| IL22 |
50616 |
NP_065386 |
NM_020525 |
Hs.287369 |
221165_s_at |
4.7 |
4.6 |
4.3 |
| 222974_at |
4.3 |
5.5 |
9.8 |
| IL26 |
55801 |
NP_060872 |
NM_018402 |
Hs.272350 |
221111_at |
10.2 |
22.5 |
67.8 |
| IL9 |
3578 |
NP_000581 |
NM_000590 |
Hs.960 |
250193_at |
729.7 |
174.0 |
35.8 |
[0086]
[Table 7-4]
| With activation stimulation |
| Location of encoded protein |
Cene symbol |
Entrez Gene ID |
Protein ID |
Transcript ID |
UniGene ID |
Probe Set ID |
Expression ratio |
| Th17/Th1 |
Th17/Th2 |
Th17/Treg |
| Extracellular/ secreted |
PCOLCE2 |
26577 |
NP_037495 |
NM_013363 |
Hs.8944 |
219295_s_at |
10.8 |
19.3 |
6.2 |
| PNOC |
5368 |
NP_006219 |
NM 006228 |
Hs.88218 |
205901_at |
39.4 |
11.4 |
24.3 |
| SMPDL3A |
10924 |
NP 006705 |
NM_006714 |
Hs.486357 |
213624_at |
3.4 |
3.3 |
3.5 |
| TGFBI |
7045 |
NP_000349 |
NM_000353 |
Hs.369397 |
201506 at |
55.9 |
318.3 |
32.0 |
| |
BCAT1 |
586 |
NP_005495 |
NM_005504 |
Hs.438993 |
214452 at |
3.1 |
5.8 |
28.9 |
| |
BHLHE22 |
27319 |
NP_689627 |
MM_152414 |
Hs.591870 |
228636_at |
11.6 |
14.2 |
18.7 |
| |
C13orf18, |
80183, |
NP_079389, |
NM_025113, |
|
|
|
|
|
| |
XP_001132115, |
XM_001132115, |
Hs.98117 |
44790_s_at |
3.2 |
18.8 |
12.4 |
| |
LOC728970 |
728970 |
XP_001133896, |
XM_001133896, |
| |
XP_001720707 |
XM_001720155 |
|
|
|
|
|
| |
CA2 |
760 |
NP_000058 |
NM_000067 |
Hs.155097 |
209301_at |
5.2 |
61.3 |
167.6 |
| |
CCDC3 |
83643 |
NP_113643 |
NM_031455 |
Hs.498720 |
223316_at |
11.2 |
52.3 |
43.4 |
| |
CDS1 |
1040 |
NP_001254 |
NM_001263 |
Hs.654899 |
205709_s_at |
7.3 |
9.5 |
4.2 |
| |
226185_at |
4.2 |
7.8 |
3.3 |
| |
CHN1 |
1123 |
NP_001020372, |
NM_001025201, |
Hs.654534 |
212624_s_at |
11.5 |
21.3 |
9.1 |
| |
NP_001813 |
NM_001822 |
| |
CLIC5, |
53405, |
NP_001107558, |
NM_001114086, |
Hs.485489 |
213317_at |
7.1 |
22.1 |
9.6 |
| |
NP_058625, |
NM_016929, |
217628_at |
3.1 |
4.2 |
4.6 |
| |
LOC100131610 |
100131610 |
XP_01723610 |
XM_001723558 |
243917_at |
10.8 |
17.2 |
11.7 |
| Intracellular |
|
|
219866_at |
6.2 |
10.6 |
12.2 |
| |
CTSH |
1512 |
NP_004381, |
NM_004390, |
Hs.148641 |
202295_s_at |
4.6 |
12.1 |
6.9 |
| |
NP_683880 |
NM_148979 |
| |
CYP7B1 |
9420 |
NP_004811 |
NM_004820 |
Hs.667720 |
207386_at |
16.4 |
11.8 |
5.3 |
| |
DAPK2 |
23604 |
NP_055141 |
NM_014326 |
Hs.237886 |
206324_s at |
4.4 |
4.7 |
3.9 |
| |
DMRT1 |
1761 |
NP_068770 |
NM 021951 |
Hs.98586 |
220493_at |
5.2 |
18.4 |
3.9 |
| |
DSE |
29940 |
NP_001074445, |
NM_001080976 |
Hs.486292 |
218854_at |
15.0 |
51.2 |
22.3 |
| |
NP_037484 |
NM_013352 |
| |
EML1 |
2009 |
NP_001008707, |
NM_001008707, |
Hs.12451 |
204796_at |
10.1 |
8.9 |
5.8 |
| |
NP_004425 |
NM_004434 |
204797_s_at |
3.1 |
3.1 |
3.2 |
| |
FBXL17 |
64839 |
NP_073735 |
NM_022824 |
Hs.657226 |
227203_at |
12.6 |
11.8 |
4.5 |
| |
FBXL21 |
26223 |
NP_036291 |
NM_012159 |
Hs.591275 |
1555412_at |
26.5 |
35.3 |
22.3 |
| |
FHOD3 |
80206 |
NP_079411 |
NM_025135 |
Hs.436636 |
218980 at |
7.0 |
9.9 |
6.7 |
| |
H2AFY2 |
55506 |
NP_061119 |
NM_018649 |
Hs,499953 |
218445_at |
3.9 |
8.2 |
4.7 |
| |
HIST1H2BC |
8347 |
NP_003517 |
NM_003526 |
Hs.658713 |
236193_at |
3.8 |
4.4 |
3.3 |
| |
HLX |
3142 |
NP_068777 |
NM_021958 |
Hs.74870 |
214438 at |
3.3 |
5.2 |
39.3 |
[0087]
[Table 7-5]
| With activation stimulation |
| Location of encoded protein |
Gene symbol |
Entrez Gene ID |
Protein ID |
Transcript ID |
UniGene ID |
Probe Set |
Expression ratio |
| ID |
Th17/Th1 |
Th17/Th2 |
Th17/Treg |
| |
IRAK3 |
11213 |
NP_001135995, |
NM_001142523, |
Hs 369265 |
213817_at |
9.4 |
18.8 |
6.5 |
| |
NP_009130 |
NM_007199 |
| |
MACC1 |
346389 |
NP_877439 |
NM_182762 |
Hs.598388 |
1566764_at |
5,6 |
12.8 |
3.5 |
| |
1566766_a_at |
9.2 |
17.3 |
4.7 |
| |
MAML3 |
55534 |
NP_061187 |
NM_018717 |
Hs.586165 |
242794_at |
6.4 |
5.7 |
4.6 |
| |
MAP3K4 |
4216 |
NP_005913, |
NM_005922, |
Hs.390428 |
204089_at |
3.3 |
3.3 |
3.4 |
| |
NP_006715 |
NM_006724 |
216199_s_at |
3.2 |
3.6 |
3.4 |
| |
MYO10 |
4651 |
NP_036466 |
NM_012334 |
Hs.481720 |
1554026_a_at |
9.1 |
11.7 |
7.1 |
| |
201976_s_at |
45.4 |
19.1 |
15.0 |
| |
216222_s_at |
3.0 |
6.2 |
6.7 |
| |
OTUB2 |
78990 |
NP_075601 |
NM_023112 |
Hs.278815 |
219369_s_at |
3.1 |
3.4 |
3.8 |
| |
222878_s_at |
4.2 |
7.2 |
4.8 |
| |
PAPSS2 |
9060 |
NP_001015880, |
NM_001015880, |
Hs.524491 |
203058_s_at |
5.5 |
11.0 |
11.1 |
| |
NP_004661 |
NM_004670 |
203060_s_at |
6.3 |
47.2 |
17.3 |
| |
PCBP3 |
54039 |
NP_001123613, |
NM_001130141, |
Hs.474049 |
230488_at |
4.5 |
3.1 |
5.0 |
| |
NP_065389 |
NM_020528 |
| Intracellular |
PDE4DIP |
9659 |
NP_001002810, |
NM_001002810, |
Hs.654651 |
205872_x_at |
5.2 |
33.6 |
4.3 |
| |
NP_001002811, |
NM_001002811, |
Hs.613082 |
209700_x_at |
4.9 |
29.1 |
8.3 |
| |
NP_001002812, |
NM_001002812, |
|
|
|
|
|
| |
NP_055459, |
NM_014644, |
|
|
|
|
|
| |
NP_071754 |
NM_022359 |
|
|
|
|
|
| |
PDK4 |
5166 |
NP_002603 |
NM_002612 |
Hs.8364 |
225207_at |
5.3 |
3.0 |
4.1 |
| |
PLD1 |
5337 |
NP_001123553, |
NM_001130081, |
Hs.382865 |
226536_at |
3.7 |
3.2 |
8.2 |
| |
NP_002653 |
NM_002662 |
Hs.382865 |
| |
PPARG |
5468 |
NP_005028, |
NM_005037, |
Hs.162646 |
208510_s_at |
8.0 |
22.8 |
14.1 |
| |
NP_056953, |
NM_015869, |
| |
NP_619725, |
NM_138711, |
| |
NP_619726 |
NM_138712 |
| |
PTPN13 |
5783 |
NP_006255, |
NM_006264, |
Hs.436142 |
204201_s_at |
3.1 |
4.5 |
19.7 |
| |
NP_542414, |
NM_080683, |
243792_x_at |
7.9 |
5.5 |
11.7 |
| |
NP_542415, |
NM_080684, |
|
|
|
|
| |
NP_542416 |
NM_080685 |
|
|
|
|
| |
RGS18 |
64407 |
MP_570138 |
NM_130782 |
Hs.440890 |
223809_at |
4.1 |
4.9 |
3.4 |
| |
RGS2 |
5997 |
NP_002914 |
NM_002923 |
Hs.78944 |
202388_at |
3.3 |
3.5 |
8.1 |
[0088]
[Table 7-6]
| With activation stimulation |
| Location of encoded protein |
Gene symbol |
Entrez Gene ID |
Protein ID |
Transcript ID |
UniGene ID |
Probe Set ID |
Expression ratio |
| Th17/Th1 |
Th17/Th2 |
Th17/Treg |
| |
RGS20 |
8601 |
NP_003693, |
NM_003702, |
Hs.368733 |
210138_at |
6.4 |
4.9 |
9.7 |
| |
NP_733466 |
NM_170587 |
| |
RORC |
6057 |
NP_001001523, |
NM_001001523, |
Hs.256022 |
228806_at |
150.1 |
51.2 |
5.7 |
| |
NP_005051 |
NM_005060 |
| |
SIM1 |
6492 |
NP_005059 |
NM_005068 |
Hs.520293 |
1556300_s_at |
14.5 |
5.8 |
99.6 |
| |
206876_at |
10.9 |
5.2 |
26.9 |
| |
SNAI2 |
6591 |
NP_003059 |
NM_003068 |
Hs.360174 |
213139_at |
8.2 |
15.0 |
6.8 |
| |
SOX2 |
6657 |
NP_003097 |
NM_003106 |
Hs.518438 |
228038_at |
14.4 |
14.4 |
16.4 |
| Intracellular |
SPIRE1 |
56907 |
NP_001122098, |
NM_001128626, |
Hs.515283 |
1554807_a_at |
6.0 |
3.3 |
4.4 |
| |
NP_001122099, |
NM_001128627, |
224995_a_at |
7.2 |
5.2 |
5.9 |
| |
NP_064533 |
NM_020148 |
225018_at |
5.5 |
5.4 |
7.8 |
| |
TBC1D12 |
23232 |
NP_066003 |
NM_015188 |
Hs.500598 |
221858_at |
4.2 |
3.2 |
3.1 |
| |
TGM5 |
9333 |
NP_004236, |
NM_004245, |
Hs.120719 |
207911_s_at |
5.1 |
7.7 |
6.5 |
| |
NP_963925 |
NM_201631 |
| |
TMOD1 |
7111 |
NP_003266 |
NM_003275 |
Hs.494595 |
203661_s_at |
6.2 |
10.7 |
4.0 |
| |
203662_s_at |
6.2 |
9.6 |
3.7 |
| |
TUBB6 |
84617 |
NP_115914 |
NM 032525 |
Hs.193491 |
209191_at |
3.5 |
11.2 |
6.4 |
| |
C12orf64 |
283310 |
NP_775862 |
NM_173591 |
Hs.355145 |
1553746_a_at |
4.2 |
5.3 |
10.8 |
| |
C6orf168 |
84553 |
NP_115900 |
NM_032511 |
Hs.573245 |
232067_at |
3.3 |
5.8 |
37.1 |
| |
CAMSAP1L1 |
23271 |
NP_982284 |
NM_203459 |
Hs.23585 |
217196_s_at |
22.5 |
10.1 |
3.7 |
| |
MAGED4, |
728239, |
NP_001092270, |
NM_001098800, |
|
|
|
|
|
| |
NP_110428, |
NM_030801, |
Hs.511729 |
223313_s_at |
16.3 |
8.6 |
3.5 |
| |
MAGED4B |
81557 |
NP_803879, |
NM_177535, |
| Unknown |
NP_803881 |
NM_177537 |
|
|
|
|
|
| |
--- |
--- |
--- |
AK093612 |
Hs.663643 |
1556602_at |
4.1 |
5.9 |
6.3 |
| |
--- |
--- |
--- |
BC010059 |
Hs.637648 |
1562957_at |
6.6 |
3.6 |
4.6 |
| |
--- |
--- |
--- |
AK055628, |
Hs.594351 |
226777_at |
30.4 |
42.8 |
3.4 |
| |
uc001ljj |
| |
--- |
--- |
--- |
GENSOAN |
--- |
227985_at |
13.4 |
19.2 |
3.6 |
| |
00000030683 |
[0089]
[Table 7-7]
| With activation stimulation |
| Location of encoded protein |
Gene symbol |
Entrez Gene ID |
Protein ID |
Transcript ID |
UniGene ID |
Probe Set ID |
Expression ratio |
| Th17/Th1 |
Th17/Th2 |
Th17/Treg |
| |
|
|
|
AA416573, |
|
|
|
|
|
| |
|
|
|
AA628762, |
|
|
|
|
|
| |
|
|
|
D53835, |
|
|
|
|
|
| |
|
|
|
D53836, |
|
|
|
|
|
| |
|
|
|
H24473, |
|
|
|
|
|
| |
--- |
--- |
--- |
R37871, |
Hs.654918 |
229951_x_at |
4,2 |
13.5 |
4.9 |
| |
|
|
|
R40232, |
|
|
|
|
|
| |
|
|
|
T10348, |
|
|
|
|
|
| |
|
|
|
T23451, |
|
|
|
|
|
| |
|
|
|
W56351, |
|
|
|
|
|
| |
|
|
|
W57867, |
|
|
|
|
|
| Unknown |
|
|
|
Z28733 |
|
|
|
|
|
| |
--- |
--- |
--- |
AK027107 |
Hs.655798 |
232331_at |
3.5 |
3.5 |
9.0 |
| |
|
|
|
AI269134, |
|
|
|
|
|
| |
|
|
|
AI312873, 2873, |
|
|
|
|
|
| |
|
|
|
AI671475, |
|
|
|
|
|
| |
|
|
|
AV656012, |
|
|
|
|
|
| |
--- |
--- |
--- |
AW162011, |
Hs.657330 |
235436_at |
73.9 |
22.0 |
3.3 |
| |
|
|
|
BG151392, |
|
|
|
|
|
| |
|
|
|
H691527, |
|
|
|
|
|
| |
|
|
|
N43169, |
|
|
|
|
|
| |
|
|
|
Z36958 |
|
|
|
|
|
[0090]
[Table 7-8]
| With activation stimulation |
| Location of encoded protein |
Gene symbol Gene symbol |
Entrez |
Protein |
Transcript |
UniGene |
Probe Set |
Expression ratio |
| Cene ID |
ID |
ID |
ID |
ID |
Th17/Th1 |
Th17/Th2 |
Th17/Treg |
| |
|
|
|
AA687415, |
|
|
|
|
|
| |
|
|
|
AA96901, |
|
|
|
|
|
| |
|
|
|
AI291640, |
|
|
|
|
|
| |
|
|
|
AI446004, |
|
|
|
|
|
| |
|
|
|
AI634557, |
|
|
|
|
|
| |
|
|
|
AI694948, |
|
|
|
|
|
| |
|
|
|
AI701854, |
|
|
|
|
|
| |
|
|
|
AI983938, |
|
|
|
|
|
| |
|
|
|
|
|
|
|
|
|
| |
--- |
--- |
--- |
AV745212, |
Hs.434948 |
238009_at |
4.6 |
15.9 |
15.0 |
| |
|
|
|
AV745909, AV746001, |
|
|
|
|
|
| |
|
|
|
AW008696, |
|
|
|
|
|
| |
|
|
|
AW511701, |
|
|
|
|
|
| |
|
|
|
AW974416, |
|
|
|
|
|
| |
|
|
|
BG149302, |
|
|
|
|
|
| Unknown |
|
|
|
BG150103, |
|
|
|
|
|
| |
|
|
|
N66771, |
|
|
|
|
|
| |
|
|
|
R66991 |
|
|
|
|
|
| |
|
|
|
AI148241, |
|
|
|
|
|
| |
|
|
|
AI735444, |
|
|
|
|
|
| |
--- |
--- |
--- |
BE645654. |
Hs.659083 |
238151_at |
37.6 |
48.1 |
29.9 |
| |
|
|
|
BF510855, |
|
|
|
|
|
| |
|
|
|
BF511636 |
|
|
|
|
|
| |
--- |
--- |
--- |
AK094629 |
Hs.694896 |
238623_at |
7.0 |
5.6 |
6.8 |
| |
|
|
|
AI435469, |
|
|
|
|
|
| |
|
|
|
BF111679, |
|
|
|
|
|
| |
--- |
--- |
--- |
BF112253, |
Hs.656932 |
241022_at |
6,1 |
10.7 |
12,4 |
| |
|
|
|
R37814 |
|
|
|
|
|
| |
|
|
|
AA846423, |
|
|
|
|
|
| |
--- |
--- |
--- |
AI022103, |
Hs.665895 |
243922_at |
16.7 |
12.8 |
6.0 |
| |
|
|
|
BF061333 |
|
|
|
|
|
[0091]
[Table 7-9]
| With activation stimulation |
| Location of encoded protein |
Gene symbol |
Entrez Gene ID |
Protein ID |
Transcript ID |
UniGene ID |
Probe Set lD |
Expression ratio |
| Th17/Th1 |
Th17/Th2 |
Th17/Treg |
| Unknown |
|
|
|
AA648972, |
|
|
|
|
|
| |
|
|
AA879467, |
|
|
|
|
|
| --- |
--- |
--- |
A1802768 |
Hs.602350 |
244247_at |
3.9 |
3.4 |
5.3 |
| |
|
|
AW974600 |
|
|
|
|
|
[0092] Among the above genes, those shown in Table 8 have been known for their specific
expression in Th17 cells.
[0093]
[Table 8]
| SEQ ID NO: |
Gene symbol (Gene title) |
Entrez Gene ID |
Protein ID |
Transcript ID |
UniGene ID |
Probe Set ID |
Expression ratio |
| Th17/Th1 |
Th17/Th2 |
Th17/Treg |
| 175 |
IL23R(interlevkin 23 receptor) |
149233 |
NP_653302 |
NM_144701 |
Hs.677426 |
1552912_a_at |
7.6 |
11.7 |
4,5 |
| 176 |
IL17A(interleukin 17A) |
3605 |
NP_002181 |
NM_002190 |
Hs.41724 |
216876_s_at |
397.5 |
473.0 |
29.3 |
| 177 |
IL17F(interleukin 17F) |
112744 |
NP_443104 |
NM_052872 |
Hs.272295 |
234408_at |
611.6 |
951.0 |
383.6 |
| 178 |
IL22(interleukin 22) |
50616 |
NP_065386 |
NM_020525 |
Hs.287369 |
222974_at |
6.4 |
29.9 |
10.6 |
| 179 |
IL28(interleukin 26) |
55801 |
NP_060872 |
NM_018402 |
Hs.272350 |
221111_at |
10.1 |
13.0 |
39.4 |
| 180 |
RORC (RAR-relatad orphan receptor C) |
6097 |
NP_001001523, |
NM_001001523, |
Hs.256022 |
228806_at |
13.8 |
17.49 |
7.6 |
| NP_005051 |
NM_005060 |
[0094] Expression levels of those known genes in Th1, Th2, Treg and Th17 cells obtained
in the above step 2. were analyzed with microarray as described above. It was found
that those genes were expressed 4 to 950 times higher in Th17 cells than in Th1, Th2
and Treg cells. These results are shown in Fig. 1. These results indicated that the
above cells are suitable for investigation of markers for detecting Th17 cells.
[0095] The present inventors have identified novel polynucleotide markers for detecting
Th17 cells by excluding the genes shown in Table 8 from those obtained as above. These
novel polynucleotide markers are shown in Table 9.
In this table, "Condition" means with or without activation stimulation of cells.
The genes designated as "Common" in the column of "Condition" are the genes specifically
expressed in both Th17 cells with stimulation and without stimulation. The genes designated
as "With stimulation" and "Without stimulation" are the genes specifically expressed
either in Th17 cells with stimulation or without stimulation, respectively.
[0096]

[0097]

[0098]

[0099]

[0100]

[0101]

[0102]

[0103]

[0104]

[0105]

[0106] It is believed that detection of the polynucleotide markers shown in Table 9 by well-known
methods in the art such as PCR or detection of proteins encoded by these polynucleotide
markers by well-known methods in the art such as ELISA or flow cytometry allows specific
detection of human Th 17 cells.
Example 2: Expression analysis of protein markers for detecting human Th17 cells
1. Preparation of measurement samples
(1) Preparation of MCAM measurement samples
[0107] To Th17 cells "without activation stimulation" (5 x 10
6 cells/ml) prepared in Example 1 under the paragraph "2. Cell culture" was added a
phycoerythrin (PE)-labeled anti-MCAM antibody (BioLegend) to a final concentration
of 1.25 µg/ml and reaction was carried out at 4°C for 20 minutes.
[0108] After the reaction, Th17cells were washed by adding phosphate buffered saline (PBS)
containing 0.5% BSA and centrifuging to collect the cells. The washed Th17 cells were
suspended in PBS containing 0.5 µg/ml 7-amino-actinomycin D (7-AAD) and 0.5% BSA to
prepare a MCAM measurement sample of Th17 cells (5 x 10
6 cells/ml).
[0109] MCAM measurement samples of Th1 cells (5 x 10
6 cells/ml), of Th2 cells (5 x 10
6 cells/ml) and of Treg cells (5 x 10
6 cells/ml) were prepared in the similar manner as above except that Th1, Th2 and Treg
cells "without activation stimulation", respectively, were used instead of Th17 cells
"without activation stimulation".
[0110] A negative control sample (5 x 10
6 cells/ml) was prepared by adding a PE-labeled mouse IgG2a isotype control (BioLegend)
to a final concentration of 1.0 µg/ml instead of the PE-labeled MCAM antibody and
reacting at 4°C for 20 minutes.
(2) Preparation of PTPRM measurement samples
[0111] To Th17 cells "without activation stimulation" (5 x 10
6 cells/ml) prepared in Example 1 under the paragraph "2. Cell culture" was added an
anti-PTPRM antibody (Abcam) to a final concentration of 2.0 µg/ml and reaction was
carried out at 4°C for 20 minutes.
[0112] After the reaction, Th17 cells were added with PBS containing 0.5% BSA and centrifuged
to collect the cells. The collected Th17 cells were suspended in PBS containing 0.5%
BSA. The suspension was added with a PE-labeled anti-mouse IgG antibody (BioLegend)
to a final concentration of 1.0 µg/ml and reaction was carried out at 4°C for 20 minutes.
[0113] After reaction with the PE-labeled anti-mouse IgG antibody, T17 cells were washed
by adding PBS containing 0.5% BSA and centrifuging to collect the cells. The washed
Th17 cells were suspended in PBS containing 0.5 µg/ml 7-ammo-actinomycin D (7-AAD)
and 0.5% BSA to prepare a PTPRM measurement sample of Th17 cells (5 x 10
6 cells/ml).
[0114] PTPRM measurement samples of Th1 cells (5 x 10
6 cells/ml), of Th2 cells (5 x 10
6 cells/ml) and of Treg cells (5 x 10
6 cells/ml) were prepared in the similar manner as above except that Th 1, Th2 and
Treg cells "without activation stimulation", respectively, were used instead of Th17
cells "without activation stimulation".
[0115] A negative control sample (5 x 10
6 cells/ml) was prepared by adding a mouse IgG2a isotype control (BioLegend) to a final
concentration of 1.0 µg/ml instead of the anti-PTPRM antibody and reacting at 4°C
for 20 minutes.
(3) Preparation of CCR6 measurement samples
[0116] CCR6 measurement samples of Th17 cells (5 x 10
6 cells/ml), of Th1 cells (5 x 10
6 cells/ml), of Th2 cells (5 x 10
6 cells/ml) and of Treg cells (5 x 10
6 cells/ml) were prepared in the similar manner as the above paragraph "(1) Preparation
of MCAM measurement samples" except that a PE-labeled anti-CCR6 antibody (BD Bioscience)
was used at a final concentration of 1.0 µg/ml instead of the PE-labeled anti-MCAM
antibody.
[0117] A negative control sample (5 x 10
6 cells/ml) was prepared by adding a PE-labeled mouse IgG1 isotype control (BioLegend)
to a final concentration of 1.0 µg/ml instead of the PE-labeled anti-CCR6 antibody
and reacting at 4°C for 20 minutes.
(4) Preparation of FOXP3 measurement samples
[0118] Th17 cells "without activation stimulation" (5 x 10
6 cells/ml) prepared in Example 1 under the paragraph "2. Cell culture" were fixed
and permeability of the cell membranes was increased using FOXP3 staining buffer set
(eBioscience) before addition of a PE-labeled anti-FOXP3 antibody (BioLegend) to a
final concentration of 3.125 µg/ml and reaction at 4°C for 20 minutes.
[0119] After the reaction, Th17 cells were washed by adding phosphate buffered saline (PBS)
containing 0.5% BSA and centrifuging to collect the cells. The washed Th17 cells were
suspended in PBS containing 0.5% BSA to prepare a FOXP3 measurement sample of Th17
cells (5 x 10
6 cells/ml).
[0120] FOXP3 measurement samples of Th1 cells (5 x 10
6 cells/ml), of Th2 cells (5 x 10
6 cells/ml) and of Treg cells (5 x 10
6 cells/ml) were prepared in the similar manner as above except that Th1, Th2 and Treg
cells "without activation stimulation", respectively, were used instead of Th17 cells
"without activation stimulation".
[0121] A negative control sample (5 x 10
6 cells/ml) was prepared by adding a PE-labeled mouse IgG1 isotype control (BioLegend)
to a final concentration of 1.0 µg/ml instead of the PE-labeled FOXP3 antibody and
reacting at 4°C for 20 minutes.
(5) Preparation of GRP34 measurement samples
[0122] Th17 cells "without activation stimulation" prepared in Example 1 under the paragraph
"2. Cell culture" were prepared in 5% FBS/RPMI at 2.5 x 10
5 cells/ml. Phorbol myristate acetate at a final concentration of 50 ng/ml and ionomycin
at a final concentration of 1 µM were added and incubated at 37°C for 4 hours to stimulate
Th17 cells. Then, brefeldin A was added to a final concentration of 10 µg/ml and incubated
at 37°C for 2 hours.
[0123] After cultivation, Th17 cells were washed twice by adding phosphate buffered saline
(PBS) containing 0.5% BSA and centrifuging to collect the cells. The washed Th17 cells
were added with 2% paraformaldehyde to fix the cells. After fixing the cells, a saponin
buffer (0.5% saponin, 0.5% bovine serum albumin (BSA), 1 mM sodium azide (in PBS))
was added to accelerate cell membrane permeability of Th 17 cells.
[0124] The sample after saponin treatment was added with an anti-GPR34 antibody (Lifespan
Biosciences) to a final concentration of 25.0 µg/ml and reaction was carried out at
4°C for 20 minutes. After the reaction, the saponin buffer was added and Th17 cells
were collected by centrifugation. The collected Th17 cells were suspended in the saponin
buffer. The suspension was added with a PE-labeled anti-mouse IgG antibody (BioLegend)
to a final concentration of 1.0 µg/ml and reaction was carried out at 4°C for 20 minutes.
[0125] After the reaction with the PE-labeled anti-mouse IgG antibody, Th17 cells were washed
twice by adding the saponin buffer and centrifuging to collect the cells. The washed
Th17 cells were suspended in PBS containing 0.5% BSA to prepare a GRP34 measurement
sample of Th17 cells (2.5 x 10
5 cells/ml).
[0126] GRP34 measurement samples of Th1 cells, of Th2 cells and of Treg cells were prepared
in the similar manner as above except that Th1, Th2 and Treg cells "without activation
stimulation", respectively, were used instead of Th17 cells "without activation stimulation".
[0127] A negative control sample (2.5 x 10
6 cells/ml) was prepared by adding a mouse IgG2a isotype control (BioLegend) to a final
concentration of 1.0 µg/ml instead of the anti-GPR34 antibody and reacting at 4°C
for 20 minutes.
(6) Preparation of IL-I7A measurement samples
[0128] Th17 cells "without activation stimulation" prepared in Example 1 under the paragraph
"2. Cell culture" were prepared in 5% FBS/RPMI at 2.5 x 10
5 cells/ml. Phorbol myristate acetate at a final concentration of 50 ng/ml and ionomycin
at a final concentration of 1 µM were added and incubated at 37°C for 4 hours to stimulate
Th17 cells. Then, brefeldin A was added to a final concentration of 10 µg/ml and incubated
at 37°C for 2 hours.
[0129] After cultivation, Th17 cells were washed by adding phosphate buffered saline (PBS)
containing 0.5% BSA and centrifuging to collect the cells. The washed Th17 cells were
added with 2% paraformaldehyde to fix the cells. After fixing the cells, a saponin
buffer (0.5% saponin, 0.5% bovine serum albumin (BSA), 1 mM sodium azide (in PBS))
was added to accelerate cell membrane permeability of Th17 cells.
[0130] The sample after saponin treatment was added with a PerCP-Cy5.5-labeled anti-IL-17A
antibody (eBioscience) to a final concentration of 0.15 µg/ml and reaction was carried
out at 4°C for 20 minutes.
[0131] After the reaction, Th17 cells were washed by adding the saponin buffer and centrifuging
to collect cells. The washed Th17 cells were suspended in PBS containing 0.5% BSA
to prepare a IL-17A measurement sample of Th17 cells (2.5 x 10
5 cells/ml).
A negative control sample (2.5 x 10
6 cells/ml) was prepared by adding a PerCP-Cy5.5-labeled mouse lgG1 isotype control
(eBioscience) to a final concentration of 1.0 µg/ml instead of the PerCP-Cy5.5-labeled
anti-IL-17A antibody.
(7) Preparation of IFN-γ measurement samples
[0132] IFN-γ measurement samples of Th17cells (2.5 x 10
5 cells/ml), of Th1 cells (2.5 x 10
5 cells/ml), of Th2 cells (2.5 x 10
5 cells/ml) and of Treg cells (2.5 x 10
5 cells/ml) were prepared in the similar manner as the above paragraph "(6) Preparation
of IL-17A measurement samples" except that an Alexa488-labeld anti-IFN- γ antibody
(BioLegend) was used at a final concentration of 1.0 µg/ml instead of the PerCP-Cy5.5-labeled
anti-IL-17A antibody.
[0133] A negative control sample (2.5 x 10
6 cells/ml) was prepared by adding an Alex488-labeled mouse IgG1 isotype control (BioLegend)
to a final concentration of 1.0 µg/ml instead of the Alexa488-labeled anti-IFN-γ antibody
and reacting at 4°C for 20 minutes.
(8) Preparation of IL-4 measurement samples
[0134] IL-4 measurement samples of Th17 cells (2.5 x 10
5 cells/tml), of Th1 cells (2.5 x 10
5 cells/ml), of Th2 cells (2.5 x 10
5 cells/ml) and of Treg cells (2.5 x 10
5 cells/ml) were prepared in the similar manner as the above paragraph "(6) Preparation
af IL-17A measurement samples" except that an APC-labeled anti-IL-4 antibody (eBioscience)
was used at a final concentration of 0.2 µg/ml instead of the PerCP-Cy5.5-labeled
anti-IL-17A antibody.
[0135] A negative control sample (2.5 x 10
6 cells/ml) was prepared by adding an APC-labeled rat IgG1 isotype control (BioLegend)
to a final concentration of 1.0 µg/ml instead of the APC-labeled anti-IL-4 antibody
and reacting at 4°C for 20 minutes.
2. Expression analysis of protein markers in measurement samples using flow cytometer
[0136] The prepared measurement samples were analyzed by FACSCanto II (BD Bioscienct) and
FACS DIVA software (BD Bioscience). Histograms (particle size distribution) of fluorescent
intensities obtained by the analysis are shown in Figs. 2 to 9, which correspond respectively
to the histograms obtained from MCAM measurement samples, PTPRM measurement samples,
GPR34 measurement samples, CCR6 measurement samples, IL-17A measurement samples, IFS-γ
measurement samples, IL-4 measurement samples, and FOXP3 measurement samples. In Figs.
2 to 9, the vertical axis of the histograms shows the number of cells and the horizontal
axis shows the fluorescent intensity. The numbers at the upper right of the histograms
correspond to the ratio (%) of positive cells for the marker gene relative to the
number of total cells in the respective measurement samples. The cells were determined
as positive or negative based on the maximal fluorescent intensity in the negative
control. Namely, the cells having higher fluorescent intensity than the maximal fluorescent
intensity of the negative control were determined as positive, while the cells having
a fluorescent intensity equal to or lower than the maximal fluorescent intensity of
the negative control were determined as negative. The ratio of positive cells was
calculated as the ratio of the number of positive cells relative to the number of
total cells.
[0137] CCR6 and IL-17A are known markers for Th17 cells. Figs. 5 and 6 show that the expression
levels of CCR6 and IL-17A proteins are high in Th17 cells. IFN-γ is a known marker
for Th1 cells. Fig. 7 shows that the expression level of IFN-γ protein is high in
Th1 cells. IL-4 is a known marker for Th2 cells. Fig. 8 shows that the expression
level of IL-4 protein is high in Th2 cells. FOXP3 is a known marker for Treg cells.
Fig. 9 shows that the expression level of FOXP3 protein is high in Treg cells. Thus,
it is indicated that these measurement samples are suitable for expression analysis
of protein markers.
[0138] Figs. 2 to 4 show that the expression levels of MCAM, PTPRM and GPR34 proteins are
high in Th17 cells. It is also found that the ratios of positive cells in the MCAM
measurement sample, PTPRM measurement sample and GPR34 measurement sample of Th17
cells were equal to or higher than the ratios of positive cells in the CCR6 measurement
sample and IL-17A measurement sample. This reveals that the proteins encoded by the
genes MCAM, PTPRM and GPR34 which were identified in Example 1 as the polynucleotide
markers for detecting Th17 cells can also be used as protein markers for detecting
Th17 cells.
Example 3: Expression analysis of polynucleotide markers for detecting Th17 cells
by real-time PCR
1. Preparation of cDNA
(1) Preparation of cDNA from cells "without activation stimulation"
[0139] Total RNA (0.1 µg) of Th17 cells "without activation stimulation" extracted in Example
1 under the paragraph "3. Extraction of total RNA" was reverse-transcribed with a
poly dT primer (Hokkaido System Science Co., Ltd.), random primers (Hokkaido System
Science Co., Ltd.) and Superscript III reverse transcriptase (Invitrogen Corporation)
to obtain cDNA of Th17 cells "without activation stimulation". Reverse transcription
was carried out according to the attached instructions.
[0140] cDNAs of Th1 cells "without activation stimulation", of Th2 cells "without activation
stimulation" and of Treg cells "without activation stimulation" were prepared in the
similar manner as above except that total RNAs (001 µg) of Th1 cells, Th2 cells and
Treg cells "without activation stimulation" were used instead of total RNA (0.1 µg)
of Th17 cells "without stimulation".
[0141] The number of samples of the cells "without activation stimulation" used for preparation
of cDNA is shown in Table 10.
[0142]
[Table 10]
| |
Th1 cells |
Th2 cells |
Th17 cells |
Treg cells |
| w/o activation stimulation |
5 |
5 |
5 |
4 |
(2) Preparation of cDNA from cells "with activation stimulation"
[0143] Th17 cells "without activation stimulation" prepared in Example 1 under the paragraph
"2. Cell culture" were prepared in 5% FBS/RPMI at 2.5 x 10
5 cells/ml. Th17 cells were stimulated by incubating the cells at 37°C for 3 hours
with T cell activation/expansion kit (Miltenyi Biotic). These The17 cells "with activation
stimulation" were subjected to extraction of total RNA in the same manner as Example
1, "3. Extraction of total RNA". The extracted total RNA (0.1 µg) of Th17 cells "with
activation stimulation" was reverse-transcribed with a poly dT primer (Hokkaido System
Science Co., Ltd.), random primers (Hokkaido System Science Co., Ltd.) and Superscript
III reverse transcriptase (Invitrogen Corporation) to obtain cDNA of Th17 cells "with
activation stimulation". Reverse transcription was carried out according to the attached
instructions.
[0144] cDNAs of Th1 cells "with activation stimulation", of Th2 cells "with activation stimulation"
and of Treg cells "with activation stimulation" were prepared in the similar manner
as above except that total RNA (0.1 µg) of Th1 cells, Th2 cells and Treg cells "with
activation stimulation" were used instead of total RNA (0.1 µg) of Th17 cells "with
activation stimulation".
[0145] The number of samples of the cells "with activation stimulation" used for preparation
of cDNA is shown in Table 11.
[0146]
[Table 11]
| |
Th1 cells |
Th2 cells |
Th17 cells |
Treg cells |
| w/ activation stimulation |
5 |
5 |
5 |
3 |
2. Design of primer sets
[0147] The following primer sets were designed with Primer3 software.
(1) Primer sets for detecting The17 cells
[0148] Primer sets were designed for the genes
ADAM12, ATP6V0A4, ATP9A, BVES, C5orf40, CDH4, DI02, L1CAM, MCAM, SHROOM2, TMEM163,
UPK1B, DRD2, PGBD5 (LOC100134440),
ODZ4, SLC6A15, AKAP12, C9or125, POPDC3, UNC13C, PCOLCE2, PNOC, TGFBI, IL1A, BHLHE22,
PPARG, SIM1 and
SNAI2, which were detected in Example 1 as the polynucleotide markers for detecting Th17
cells.
(2) Primer sets for known markers for Th17cells
[0149] Primer sets were designed for known gene markers for The17 cells,
CCR6, RORC and
IL-17A.
(3) Primer sets for known markers for Th1 cells
[0150] Primer sets were designed for known gene markers for Th1 cells,
T8X21 and IFN-γ.
(4) Primer sets for known markers for Th2 cells
[0151] Primer sets were designed for known gene markers for Th2 cells,
GATA3 and
IL-4.
(5) Primer sets for known markers for Treg cells
[0152] Primer sets were designed for a known gene marker for Treg cells,
FOXP3.
(6) Primer sets for internal controls
[0153] Primer sets were designed for internal control genes,
Gapdh, ACTB, B2M and
UBC.
[0154] Designed primer sets are shown in Table 12.
[0155]
[Table 12]
| Gene symbol |
Forward primer |
SEQ ID NO: |
Reverse primer |
SEQ ID NO: |
| ADAM12 |
TCTCCCTCGCTCGAAATTACA |
181 |
CAGAATATGCCCGTACATGTCCAT |
182 |
| ATP6V0A4 |
TCCHGAACATTTGGCTTC |
183 |
TCCATGTGCCGTTTCTGAAC |
184 |
| ATP9A |
AGAGGAGCAGTATCAGACTTTGAA |
185 |
AGCGGTCGTGCACAGTCA |
186 |
| BVES |
CGGCTTGCACCAGTTTCTTC |
187 |
GCTCCTTCTTCTATCGGTITCATC |
188 |
| C5orf40 |
TCGGAGGGCAGAGCTCTAAC |
189 |
CCTCQATGTTCATCCCGATT |
190 |
| CDH4 |
GATCAGCCCCACTGTCGAAA |
191 |
GATGGATCCCCACTGATCATG |
192 |
| OIO2 |
CATGATGCTAAGAGTCCTCGGTAA |
193 |
TTCTGCAACTGAGAGAAGATATG |
194 |
| L1CAM |
CAAGGAGGGGCCAGTGCAA |
195 |
GAAGCCCCACCCTTCTCTTC |
196 |
| MCAM |
CGGCATCCCTGTCAACAGTAA |
197 |
GGTACCC6TTCCTCCCTACAC |
198 |
| SHROOM2 |
TGCATGTTAATGGTGAGTGAATCC |
199 |
TTGATCCAACAAATGCCCTAATAC |
200 |
| TMEM163 |
GGTCAAACTCCTCATCGACATG |
201 |
GCCCTTCACTCAAACATCTCGTA |
202 |
| UPK1B |
CCAGTGGAAAAACAATGGAGTCA |
203 |
ACAGCAATTGTCGTGGAGCAT |
204 |
| DRD2 |
CTGCTCATGGCTGTCATCGT |
205 |
CGGGACACAGCCATGCA |
206 |
| PGBD5 |
AGAGTTTGAGAAGCAAQGGATTTACT |
207 |
GGCCGGTGGAGTCACTGTT |
208 |
| ODZ4 |
GCCGACAGACTTAGCCATCA |
209 |
TCCCGGCGACTTGC |
210 |
| SLC6A15 |
TGCCAGCACCTATTACTGGTACA |
211 |
AGTTTAAGCCGCCACTTTCAGAA |
212 |
| AKAP12 |
TCCA7AGCTGGGTCTGG7GTAGA |
213 |
TTCTTGATTGAGACCCAGGATTC |
214 |
| C9orf125 |
GAGAGGCTCCAGCACTACTCA |
215 |
CTACACCAACCCATTCCAGGAT |
216 |
| POPDC3 |
TTCAGTTCCTQGATTCTCCTGAGT |
217 |
CAGTGAGGGTTACCTGAAAAATGC |
218 |
| UNC13C |
TCAGGGACCAACCACCAAGA |
219 |
CAGGACACGTGTGTAGGCAGTTT |
220 |
| PCOLCE2 |
CCACCACATTCCCTGTAACGA |
221 |
TCCGTCTACACTTTTGTTGACACA |
222 |
| PNOC |
CTCAGTCTCTTCTCCAGTGTGTTCA |
223 |
GAGCTTCTCCTGGCATGTG |
224 |
| TGFB1 |
GGGCGGCAAAAAACTGAGA |
225 |
CCGCGATGCAGCTGTTCT |
226 |
| IL1A |
CAATTGTATGTGACTGCCCAAGA |
227 |
TGGGTATCTCAGGCATCTCCTT |
228 |
| BHLHE22 |
TGCTCCCCACCCCCTTTA |
229 |
CTGCTTTGTTTGCTCTGCAAGT |
230 |
| PPARG |
CCTGAGCCACTGCCAACATT |
231 |
AGGTGTCAGATTTTCCCTCAGAAT |
232 |
| SIM1 |
CATGCCTCACATCGCTTCAG |
233 |
CCACACTATCTTCATCCCAATGAC |
234 |
| SNA12 |
CTTGCCCTCACTGCAACAGA |
235 |
TCTGCAGATGAGCCCTCAGA |
236 |
| TBX2T |
GATGCGCAGGAAGTTTCA |
237 |
GACGCCCCCTTGTTGTTTG |
238 |
| GATA3 |
GCGGGCTCTATCACAAAATGA |
239 |
GCCTTCGCTTGGGCTTAAT |
240 |
| FOXP3 |
CACCTGGCTGGGAAAATGG |
241 |
GGAGCCCTTGTCGGATGAT |
242 |
| CCR6 |
GGCAGTTCTCCAGGCTATTTGT |
243 |
GGAGGCCAAAGACACAGATCA |
244 |
| RORC |
GCAAGGCTGAGTCATGAGAACA |
245 |
GCGGAAGAAGCCGTTGCA |
246 |
| IFNG |
CCAACGCAAAGCAATACATGA |
247 |
CGAAACAGCATCTGACTCCTTTT |
248 |
| IL4 |
TGGGTCTCACCTCCCAACTG |
249 |
GCGGGCACATGCTAGCA |
250 |
| IL17A |
CCCAAAAGGTCCTCAGATTACTACA |
251 |
CATTGCGGTGGAGATTCCA |
252 |
| GAPDH |
ACCCACTCCTCCACCTTTGA |
253 |
TTGCTGTAGCGAAATTCGTTGT |
254 |
| ACTB |
CAGCAGATGTGGATCAGCAAG |
255 |
GCATTTGCGGTGGACGAT |
256 |
| B2M |
TGCTGTGTCCATGTTTGATGTATCT |
257 |
TCTCTGCTCCCCACCTCTAAGT |
258 |
| UBC |
GTCGCAGCCGGGATTTG |
259 |
GCATTGTCAAGTGACGATCACA |
260 |
3. Expression analysis of gene markers by real-time PCR
(1) Real-time PCR using cDNAs of cells "without activation stimulation" as templates
[0156] cDNAs of Th17 cells "without activation stimulation" obtained from 5 samples in the
above " 1. Preparation of cDNA" were respectively used as a template. The primer sets
used were the primer sets for
ADAM12, ATP6V0A4, ATP9A, BITES, C5orf40, CDH4, DIO2 L1CAM, MCAM, SHROOM2, TMEM163,
UPK1B, DRD2, PGBD5, ODZ4, SLC6A15, AKAP12, C9orf125, POPDC3, UNC13C, PCOLCE2, PNOC,
TGFBI, IL1A, BHLHE22, PPARG, SIMI , SNA12, TBX21, GATA3, FOXP3, CCR6, RORC, GAPDH,
ACTB, B2M and
UBC, which were designed as described in "2. Design of primer sets". Real-time PCR was
carried out with the template, primer sets and Power SYBR Green PCR Master Mix (Applied
Biosystems) in 7300 Real Time PCR System (Applied Biosystems) and Ct value of each
gene was measured. PCR was carried out at 50°C for 2 minutes, 4°C for 10 minutes followed
by 45 cycles of 95°C for15 seconds and 60°C for 1 minute and two cycles of 95°C for
15 seconds and 60°C for 1 minute. Ct value was measured by automatic calculation on
7300 Fast SDS software (Applied Biosystems).
[0157] Real-time PCR was also carried out in the similar manner as above except that cDNAs
of Th1 cells "without activation stimulation" obtained from 5 samples, cDNAs of Th2
cells "without activation stimulation" obtained from 5 samples and cDNAs of Treg cells
"without activation stimulation" obtained from 4 samples were used as a template instead
of cDNAs of Th17 cells "without activation stimulation", and Ct values for the genes
were measured.
(2) Real-time PCR using cDNAs of cells "with activation stimulation" as templates
[0158] cDNAs of Th17 cells "with activation stimulation" obtained from 5 samples in the
above "1. Preparation of cDNA" were used as a template. The primer sets used were
the primer sets for
AKAP12, C9orf125, POPDC3, UNC13C, PCOLCE2, PNOC, TGFBI, IFNG, IL4, IL17A, GAPDH, ACTB,
B2M and
UBC, which were designed as described in "2. Design of primer sets". Real-time PCR was
carried out with the template, primer sets and Power SYBR Green PCR Master Mix (Applied
Biosystems) in 7300 Real Time PCR System (Applied Biosystems) and Ct value of each
gene was measured. PCR was carried out at 50°C for 2 minutes, 95°C for 10 minutes
followed by 45 cycles of 95°C for 15 seconds and 60°C for 1 minute and two cycles
of 95°C for 15 seconds and 60°C for 1 minute. Ct value was measured by automatic calculation
on 7300 Fast SDS software (Applied Biosystems).
[0159] Real-time PCR was also carried out in the similar manner as above except that cDNAs
of Th1 cells "with activation stimulation" obtained from 5 samples, cDNAs of Th2 cells
"with activation simulation" obtained from 5 samples and cDNAs of Treg cells "with
activation stimulation" obtained from 3 samples were used as a template instead of
cDNAs of Th17 cells "with activation stimulation", and Ct values for the genes were
measured.
(3) Analysis of expression level
[0160] Based on the Ct values obtained from real-time PCR, expression levels of the gene
markers were calculated according to the formula (I):

wherein: y = (Ct value of a gene) - (((Ct value of
Gapdh gene) + (Ct value of
ACTB gene) + (Ct value of
B2M gene) + (Ct value of
UBC gene))/4)
[0161] The expression level of each gene marker in Th17 cells "without activation stimulation"
was obtained as an average of the expression levels of the gene marker in question
obtained from five cDNAs used as templates. The expression level of each gene marker
in Th17 cells "with activation stimulation" was also obtained as an average of the
expression levels of the gene marker in question obtained from five cDNAs used as
templates.
[0162] Similarly, the expression level of each gene marker in Th1 cells or Th2 cells "without
activation stimulation" or "with activation stimulation" was obtained as an average
of the expression levels of the gene marker in question obtained from five cDNAs used
as templates. The expression level of each gene marker in Treg cells "without activation
expression" was obtained as an average of the expression levels of the gene marker
in question obtained from four cDNAs used as templates. The expression level of each
gene marker in Treg cells "with activation stimulation" was obtained as an average
of the expression levels of the gene marker in question obtained from three cDNAs
used as templates.
[0163] Expression levels of the gene markers are shown in Tables 13 and 14. Table 13 shows
expression levels of gene markers in Th1, Th2, Treg and Th17 cells "without activation
stimulation" and Table 14 shows expression levels of gene markers in Th1, Th2, Treg
and Th17 cells "with activation stimulation"
[0164] Expression levels of gene markers in the cells "without activation stimulation"
[Table 13]
| Location of encoded protein |
Gene symbol |
Expression level |
| Th1 |
Th2 |
Treg |
Th17 |
| |
ADAM12 |
9.955 |
0.55 |
22.08 |
193.83 |
| |
ATP6VOA4 |
35.21 |
2.55 |
7.17 |
625.03 |
| |
ATP9A |
125,11 |
9.08 |
41.42 |
407.43 |
| |
BVES |
23.85 |
3.58 |
6.84 |
77.99 |
| |
C5orf40 |
0.74 |
0.00 |
33.36 |
107.84 |
| |
CDH4 |
4.93 |
7.47 |
29.44 |
143.90 |
| |
DI02 |
0,46 |
1.25 |
0.91 |
10.40 |
| |
L1CAM |
41,95 |
45.03 |
72.77 |
220.54 |
| |
MCAM |
62.69 |
18.93 |
159.46 |
500.64 |
| Membrane |
SHROOM2 |
0.22 |
0.46 |
0.90 |
11.44 |
| |
TMEM163 |
13.77 |
8.78 |
24.25 |
248.56 |
| |
UPK1B |
2.94 |
0.12 |
0.55 |
22.59 |
| |
DRD2 |
51.14 |
49.86 |
58.21 |
884.06 |
| |
PGBD5 |
10.30 |
11.96 |
19.04 |
157.52 |
| |
ODZ4 |
1.14 |
0.44 |
0.39 |
41.82 |
| |
SLG6A15 |
0.50 |
3.46 |
2.65 |
27.71 |
| |
AKAPM |
29.57 |
30,67 |
46.71 |
110.16 |
| |
C9orf125 |
1.31 |
0.50 |
3.43 |
39.73 |
| |
POPDC3 |
0.23 |
0.00 |
0.52 |
10.19 |
| |
UNC13C |
0.08 |
0.08 |
0.27 |
12.10 |
| Extracellular/ secreted |
PCOLCE2 |
0.60 |
0.00 |
2.59 |
15.64 |
| PNOC secreted |
8.01 |
25.75 |
5 43 |
335.81 |
| TGFBI |
58.45 |
31,18 |
253.89 |
1427.38 |
| IL1A |
13.47 |
47.92 |
128.89 |
502.06 |
| Intracellular |
BHLHE22 |
32.48 |
13.80 |
29.69 |
247.81 |
| PPARG |
120.16 |
16.40 |
92.84 |
456.67 |
| SIM1 |
143.63 |
229.38 |
40.78 |
837.78 |
| SNA12 |
0.15 |
0.03 |
4.20 |
69.35 |
| Known markers |
TBX21 |
4851.97 |
21.94 |
5113.23 |
26.92 |
| GATA3 |
1820.22 |
5684.93 |
4811.71 |
1353.37 |
| FOXP3 |
471.34 |
250.11 |
21799.93 |
334.68 |
| OCR6 |
102.73 |
42.69 |
939.98 |
401.01 |
| RORC |
96.77 |
3.75 |
328.38 |
788.05 |
[0165] Expression levels of gene markers in the cells "with activation stimulation
[Table 14]
| Location of encoded protein |
Gene symbol |
Expression level |
| Th1 |
Th2 |
Treg |
Th17 |
| Membrane |
AKAP12 |
34.55 |
59.13 |
46.36 |
201.43 |
| C9orf125 |
0.51 |
0.00 |
1.92 |
35.77 |
| POPDC3 |
7.28 |
2.60 |
3.42 |
28.09 |
| UNC13C |
0.04 |
0.36 |
1.76 |
11.11 |
| Extracellular/ secreted |
PGOLCE2 |
1.01 |
0.36 |
2.04 |
20.82 |
| PNOC |
10.33 |
28.87 |
0.63 |
289.07 |
| TGFBI |
39.99 |
6.24 |
86.85 |
861.02 |
| Known markers |
IFNG |
191944.46 |
393.70 |
1593.07 |
1118.25 |
| IL4 |
4011.14 |
8401.51 |
329.94 |
108.98 |
| IL17A |
84.43 |
458,57 |
1600.38 |
34052.24 |
[0167]
[Table 15]
| Location of encoded protein |
Gene symbol |
Expression ratio |
| Th17/Th1 |
Th17/Th2 |
Th17/Treg |
| |
ADAM12 |
19.49 |
352.65 |
8.78 |
| |
ATP6V0A4 |
17.75 |
245.31 |
87.13 |
| |
ATP9A |
3.26 |
44.86 |
9.84 |
| |
BVES |
3.27 |
21.80 |
11.41 |
| |
C5orf40 |
144.92 |
∞ |
3.23 |
| |
CDH4 |
29.17 |
19.26 |
4.89 |
| |
DIO2 |
22.83 |
8.34 |
11.42 |
| |
L1CAM |
5.26 |
4.90 |
3.03 |
| |
MCAM |
7.99 |
26.44 |
3.14 |
| Membrane |
SHROOM2 |
53.13 |
24.85 |
12.71 |
| |
TMEM163 |
18.13 |
28.42 |
10.29 |
| |
UPK1B |
7.69 |
191.37 |
41.23 |
| |
DRD2 |
17.29 |
17.73 |
15.19 |
| |
PGBD5 |
15.30 |
13.17 |
8.27 |
| |
ODZ4 |
36.59 |
94.68 |
106.41 |
| |
SLC6A15 |
55.24 |
8.01 |
10.47 |
| |
AKAP12 |
3.72 |
3.59 |
2.36 |
| |
C9orf125 |
30.34 |
79.90 |
11.59 |
| |
POPDC3 |
44.01 |
∞ |
19.75 |
| |
UNC13C |
152.73 |
157.50 |
44.10 |
| EXtracellular/ secreted |
PCOLCE2 |
25.86 |
4097-03 |
6.04 |
| PNOC |
41.93 |
13.04 |
61.86 |
| TGFBI |
24.42 |
45.77 |
5.62 |
| IL1A |
37.28 |
10.48 |
3.90 |
| Intracellular |
BHLHE22 |
7.63 |
17.96 |
8.35 |
| PPARG |
3.80 |
27.85 |
4.92 |
| SIM1 |
5.83 |
3.65 |
20.54 |
| SNAI2 |
466.76 |
2536.65 |
16.52 |
| Known markers |
TBX21 |
0.01 |
1.23 |
0.05 |
| GATA3 |
0.74 |
0.24 |
0.28 |
| FOXP3 |
0.71 |
1.34 |
0.02 |
| CCR6 |
3.90 |
9.39 |
0.43 |
| RORG |
8.14 |
210.37 |
2.40 |
[0168]
[Table 16]
| Location of encoded protein |
Gene symbol |
Expression ratio |
| Th17/Th1 |
Th17/Th2 |
Th17/Treg |
| Membrane |
AKAP12 |
5.83 |
3.41 |
4.99 |
| C9orf125 |
69.61 |
∞ |
18.59 |
| POPDC3 |
3.86 |
10.79 |
8.20 |
| UNC13C |
266.35 |
31.25 |
6.30 |
| Extracellular/ secreted |
PCOLCE2 |
20.54 |
58.21 |
10.22 |
| PNOG |
27.99 |
10.01 |
456.13 |
| TGFSI |
21.53 |
138.01 |
9.91 |
| Known markers |
IFN-γ |
0.01 |
2.84 |
0.70 |
| IL-4 |
0.03 |
0.01 |
0.33 |
| IL-17A |
403.31 |
74.26 |
21.28 |
[0169] Table 15 shows that the expression levels of ADAM 12, ATP6VOA4, ATP9A, BVES, C5orf40,
CDH4, DIO2, L1CAM, MCAM, SHROOM2, TMEM163, UPK1B, DRD2, PGBD5, ODZ4, SLC6A15, AKAP12,
C9orf125, POPDC3, UNC13C, PCOLCE2, PNOC, TGFBI, IL1A, BHLHE22, PPARG, SIM1 and SNAI2
in Th17 cells "without activation stimulation" are two or more times higher than that
in Th1, Th2 and Treg cells "without activation stimulation".
Table 16 shows that the expression levels of AKAP12, C9orf125, POPDC3, UNC13C, PCOLCE2,
PNOC and TGFBI in Th17 cells "with activation stimulation" are two or more times higher
than that in Th1, Th2 and Treg cells "with activation stimulation".
Thus, it is demonstrated that these genes are useful as polynucleotide markers for
detecting Th17 cells.
[0170] Example 4: Expression analysis of polynucleotide markers in healthy subjects and
patients with rheumatoid arthritis 1. Isolation of CD4 positive cells from peripheral
blood of healthy subjects and patients with rheumatoid arthritis
Peripheral blood from healthy adults (healthy subjects) and patients with rheumatoid
arthritis was collected in blood collecting tubes NP-HE0557 (NIPRO) and peripheral
blood CD4 positive cells were isolated with magnetic beads bound to anti-CD4 antibody
(Miltenyi Biotec). Isolation of CD4 positive cells using anti-CD4 antibody beads was
carried out according to the attached instruction.
2. Preparation of cDNA from peripheral blood CD4 positive cells
[0171] Total RNA was extracted from the isolated peripheral blood CD4 positive cells in
the same manner as Example 1, "3. Extraction of total RNA". The extracted total RNA
(0.1 µg) of peripheral blood CD4 positive cells were reverse-transcribed with a poly
dT primer (Hokkaido System Science Co., Ltd.), random primers (Hokkaido System Science
Co., Ltd.) and Superscript III reverse transcriptase (Invitrogen Corporation) to obtain
cDNA of peripheral blood CD4 positive cells. Reverse transcription was carried out
according to the attached instructions.
[0172] The number of samples of peripheral blood CD4 positive cells used for preparation
of cDNA is shown in Table 17.
[0173]
[Table 17]
| |
Healthy subject |
Patient with rheumatoid arthritis |
| w/o activation stimulation |
9 |
9 |
3. Expression analysis of gene markers by real-time PCR
(1) Real-time PCR using cDNAs of peripheral blood CD4 positive cells as templates
[0174] cDNAs of peripheral blood CD4 positive cells obtained from nine healthy subjects
and nine patients with rheumatoid arthritis as prepared in the above "2. Preparation
of cDNA from peripheral blood CD4 positive cells" were used as templates. The primer
sets used were the primer sets for ATP6VOA4, BVES, C5orf40, UPK1B, DRD2, PCOLCE2,
PNOC, TGFBI, BHLHE22, SIM1, CCR6, RORC, GAPDH, ACTB, B2M, and UBC, which were designed
as described in "2. Design of primer sets". Real-time PCR was carried out with the
template, primer sets and Power SYBR Green PCR Master Mix (Applied Biosystems) in
7300 Real Time PCR System (Applied Biosystems) and Ct value of each gene was measured.
PCR was carried out at 50°C for 2 minutes, 95°C for 10 minutes followed by 45 cycles
of 95°C for 15 seconds and 60°C for 1 minute and two cycles of 95°C for 15 seconds
and 60°C for 1 minute. Ct value was measured by automatic calculation on 7300 Fast
SDS software (Applied Biosystems).
(2) Analysis of expression level
[0175] Expression levels of the gene markers were calculated according to the above formula
(I). The expression level of each gene marker in peripheral blood CD4 positive cells
of the patients with rheumatoid arthritis was obtained as an average of the expression
levels of the gene marker in question obtained from nine cDNAs used as templates.
Similarly, the expression level of each gene marker in peripheral blood CD4 positive
cells of the healthy subjects was obtained as an average of the expression levels
of the gene marker in question obtained from nine cDNAs used as templates.
[0176] Expression levels of the gene markers in peripheral blood CD4 positive cells from
healthy subjects and patients with rheumatoid arthritis and expression ratios of the
gene markers between peripheral blood CD4 positive cells of healthy subjects and patients
with rheumatoid arthritis are shown in Table 18. In Table 18, "RA" denotes patients
with rheumatoid arthritis and "HC" denotes healthy subjects. The values shown in the
column RA group/HC group were calculated as follows:

[0177]
[Table 18]
| Location of encoded protein |
Gene symbol |
Expression level |
Expression ratio |
| HC group |
RA group |
RA group/HC group |
| Membrane |
ATP6V0A4 |
6.44 |
52.16 |
8.10 |
| BVES |
0.08 |
32.79 |
403.57 |
| C5orf40 |
0.04 |
21.60 |
496.29 |
| UPK1B |
0.31 |
39.65 |
126.98 |
| DRD2 |
59.42 |
243.55 |
4.10 |
| Extracellular/ secreted |
PCOLOF2 |
0.07 |
4.94 |
70.29 |
| PNOC |
18.89 |
73.38 |
3.88 |
| TGFBI |
1651.40 |
5413.26 |
3.28 |
| Intracellular |
BHLHE22 |
3.15 |
27.75 |
8.81 |
| SIM1 |
4.75 |
20.73 |
4.36 |
| Known markers |
CCR6 |
3136.22 |
4316,17 |
1.38 |
| RORC |
528.64 |
421.20 |
0.80 |
[0178] Table 18 shows that the expression levels of ATP6V0A4, BVES, C5orf40, UPK1B, DRD2,
PCOLCE2, PNOC, TGFBI, BHLHE22 and SIM1 in the RA group were three or more times higher
than that in the HC group. This indicates that these genes are useful as polynucleotide
markers for screening of patients with rheumatoid arthritis.
Example 5: Analysis of expression ratios of polynucleotide markers in cultured Th17
and Th22 cells derived from human peripheral blood
1. Isolation of Th17 and Th22 cells from human peripheral blood
[0179] Buffy coat obtained from peripheral blood of a healthy adult was overlaid on Ficoll-paque
plus solution (GE Healthcare Bioscience) and centrifuged to obtain a monocyte fraction.
Crude CD4 positive cells were purified from the fraction by using magnetic beads bound
to anti-CD4 antibody (Miltenyi Biotec).
The obtained CD4 positive cells were stained with the fluorescence labeled antibodies
shown in Table 19 and then Th17 and Th22 cells were separated by a cell sorter (FACS
Aria: Becton Dickinson). The separation was carried out with the gating shown in Table
20.
[0180]
[Table 19]
| Antigen |
Fluorescent labeling substance |
Clone |
Manufacturer |
| CD4 |
APC-Cy7 |
RPA-T4 |
BD Biosciences |
| CD25 |
PE-Cy7 |
BC96 |
eBioscience |
| CXCR3 |
Alexa Fluor™ 488 |
106/CXCR3 |
BD Biosciences |
| CCR4 |
APC |
FAB1567A |
R&D systems |
| CCR6 |
PE |
11A9 |
BD Biosciences |
| CD45RA |
APC |
HI100 |
BioLegend |
| CCR10 |
PE |
6588-5 |
BioLegend |
[0181]
[Table 20]
| |
Call Gating |
| Th17 |
CD4high CD25low-negative CXCR3- CCR6+ CCR4+ |
| Th22 |
CD4high CD25low-negative CD45RA- CXCR3- CCR10+ |
2. Th17 and Th22 cell cultures
[0183] Th17 and Th22 cells derived from adult peripheral blood obtained in the above step
1. were respectively plated in a 96-well plate at the density of 1.5 x 10
5 cells/0.3 ml/well. The medium used was Yssel medium (IMDM, 1% human serum of AB-type,
0.25% BSA, 1.8 mg/l 2-aminomethanol, 40 mg/l transferrin, 5 mg/l insulin, 2 mg/l linoleic
acid, 2 mg/l oleic acid, 2 mg/l palmitic acid, 1% penicillin/streptomycin).
For activation and proliferation of the above cells, magnetic beads coated with anti-CD2/3/28
antibody (Miltenyi Biotec) (hereinafter also referred to as "antibody beads") were
added at 0.75 x 10
5 per well. After addition of cytokines and neutralizing antibodies suitable for differentiation
culture of respective Th17 and Th22 cells, cells were incubated in an incubator at
37°C with 5% CO
2. Cytokines and neutralizing antibodies used are shown in Table 21.
[0184]
[Table 21]
| Cell |
Cytokine |
Neutralizing antibody (clone) |
| Th17 |
TGF-β1, IL-6, IL-23, |
Anti-IL-4 antibody (MP4-25D2) |
| IL-21, IL-1β, TNFα, IL-2 |
Anti-IFN-γ antibody (R4-6A2) |
| Th22 |
|
Anti-IL-4 antibody (MP4-25D2), |
| IL-6, TNFα, IL-2 |
Anti-IFN-γ antibody (R4-6A2), |
| |
Anti-TGF β antibody (9016) |
[0185] The concentrations of the above cytokines were 50 ng/ml for IL-6 and 10 ng/ml for
other than IL-6. The concentrations of antibodies were 10 µg/ml for anti-IFN-γ antibody,
2.5 µg/ml for anti-IL-4 antibody and 2.5 µg/ml for anti-TGF-β antibody.
[0186] The cytokines and neutralizing antibodies were obtained from R&D systems and eBioscience,
respectively.
[0187] After three days from the start of culture, cells were diluted three-fold with the
medium containing the above cytokines and antibodies and cultured for further seven
days (10 days in total).
[0188] After ten days from the start of culture, the obtained Th 17 and Th22 cells were
respectively divided into two equal parts, and one was washed with Yssel medium and
PBS before centrifugation to collect cells, which were stored at -80°C until the subsequent
RNA extraction step. These cells were designated as Th17 and Th22 cells "without activation
stimulation". The other half was added with the antibody beads and cultured for three
more hours to re-activate the cells. The cells were collected by centrifugation and
similarly stored at -80°C. These cells were designated as Th17 and Th22 cells "with
activation stimulation".
3. Extraction of total RNA
[0189] The cells obtained as the above step 2. were subjected to extraction of total RNAs
using RNeasy Plus Mini kit and RNeasy micro kit (QIAGEN). The specific procedures
were according to the attached instructions of the kits.
4. Expression analysis by microarray
[0190] Total RNAs (10 to 100 ng) extracted from the cells as the above step 3. were reverse-transcribed
to cDNAs with Two-Cycle Target Labeling and Control Reagents (Affymetrix), and further
transcribed to biotinylated-cRNAs. The amplified biotinylated-cRNAs (20 µg) were fragmented.
The specific procedures were according to the attached instructions of the kit.
[0191] The biotinylated-cRNAs derived from the cells as obtained above (15 µg) were applied
to GeneChip Human Genome U-133 Plus 2.0 Array (Affymetrix) as samples, transferred
to GeneChip Hybridization Oven 640 (Affymetrix) and hybridized under the conditions
of 45°C and 60 rpm for 16 hours.
[0192] After completion of the hybridization, the microarray was washed and fluorescence-labeled
in GeneChip Fluidic Station 450 (Affymetrix), and scanned in GeneChip Scanner 3000
7G (Affymetrix) to obtain fluorescent intensity data.
[0193] The fluorescent data obtained were standardized with the expression analysis software
GeneSpring Ver.11 (Agilent Technologies) based on MASS algorithm to obtain relative
fluorescent intensities of the genes in the cells. The relative fluorescent intensities
correspond to the expression levels of the genes in these cells.
[0194] Tables 22 and 23 show the results of the relative fluorescent intensities of the
genes corresponding to the polynucleotide markers in Th17 cells obtained in Example
1 compared to those in Th22 cells. Table 22 shows expression ratios of the polynucleotide
markers in Th17 and Th22 cells "without activation stimulation" and Table 23 shows
expression ratios of the polynucleotide markers in Th17 and Th22 cells "with activation
stimulation". In the tables, values in the column "Th17/Th22" correspond to the values
obtained by dividing the relative fluorescent intensity of a gene corresponding to
a polynucleotide marker in Th17 cells by that in Th22 cells.
[0195]
[Table 22]
| Location of encoded protein |
Gene symbol |
Expression ratio |
| Th22/Th17 |
| |
ADAM12 |
11.1 |
| |
ATP6V0A4 |
521.3 |
| |
ATP9A |
33.9 |
| |
BVES |
3.5 |
| |
C5orf40 |
7.7 |
| |
CDH4 |
12.5 |
| |
DI02 |
10,6 |
| |
MCAM |
10.5 |
| |
SHROOM2 |
5.2 |
| Membrane |
TMEM163 |
5.6 |
| |
3.8 |
| |
UPK1B |
9.2 |
| |
DRD2 |
5.8 |
| |
LOC100134440, PGBD5 |
14.5 |
| |
ODZ4 |
8.2 |
| |
SLC6A15 |
12.2 |
| |
AKAP12 |
17.2 |
| |
36.1 |
| |
C9orf125 |
3.3 |
| Extracellular/ secreted |
PCOLCE2 |
9.0 |
| PNOC |
38.5 |
| TGFBI |
182.0 |
| IL1A |
17.7 |
| Intracellular |
BHLHE22 |
108.3 |
| PPARG |
13.6 |
| SIM1 |
4.6 |
| 5,0 |
| SNAI2 |
8.2 |
| Membrane |
PTPRM |
36.3 |
[0196]
[Table 23]
| Location of encoded protein |
Gene symbol |
Expression ratio |
| Th17/Th22 |
| Membrane |
AKAP12 |
12.8 |
| 22.9 |
| C9orf125 |
6.8 |
| POPDC3 |
5.4 |
| Extracellular/ secreted |
PCOLCE2 |
11.9 |
| PNOC |
8.5 |
| TGFB1 |
367,4 |
| Membrane |
GPR34 |
28.2 |
[0197] Tables 22 and 23 clearly indicate that the polynucleotide markers in Th17 cells obtained
in Example 1 are expressed three or more times higher in Th17 cells than in Th22 cells.
Thus, it is demonstrated that the polynucleotide markers shown in Tables 22 and 23
are useful for detection of Th17 cells.
SEQUENCE LISTING