FIELD OF THE INVENTION
[0002] The present invention relates to methods, compositions, and kits for generating rRNA-depleted
samples and for isolating rRNA from samples. In particular, the present invention
provides compositions comprising affinity-tagged antisense rRNA molecules that exhibit
sequences complementary to substantially all of at least one full-length rRNA molecule
encoded by a rRNA gene (e.g., compositions comprising affinity-tagged antisense rRNA
molecules that exhibit sequences which, either alone or in combination, are complementary
to substantially all or the complete sequence of at least one rRNA molecule selected
from among 28S, 26S, 25S, 18S, 5.8S and 5S eukaryotic cytoplasmic rRNA molecules,
12S and 16S eukaryotic mitochondrial rRNA molecules, and 23S, 16S and 5S prokaryotic
rRNA molecules) and methods for using such compositions to generate rRNA-depleted
samples or to isolate rRNA from samples.
BACKGROUND OF THE INVENTION
[0003] Since rRNA comprises about 95% to about 98% of the RNA in a cell, its presence can
complicate various types of analyses of other RNA molecules of interest in a sample
(e.g., gene expression analyses by arrays or microarrays, next-generation sequencing
of tagged cDNA molecules made from one or more types of RNA molecules in samples (e.g.,
using the massively parallel digital sequencing methods referred to as "RNA-seq"),
etc.). The problems caused by rRNA are especially difficult for analyses of RNA molecules
of interest that are fragmented. For example, a considerable and continuing problem
in the art is to find better methods for removing degraded rRNA from formalin-fixed
paraffin-embedded (FFPE) tissue sections. If better methods were available to remove
degraded rRNA from samples (e.g., FFPE-derived samples), it is believed that the enormous
quantities of clinical specimens, for which medical outcomes of various diseases and
various treatments are recorded in the medical records, would provide extremely valuable
information related to identifying RNAs involved in the cause, maintenance, response,
diagnosis, or prognosis of many diseases, such as cancer. Still further, better methods
for removing rRNA, including degraded rRNA, from non-rRNA RNA molecules of interest
would greatly improve the applicability and success of methods that comprise deliberately
degrading the RNA as part of the particular method (such as the method of
Ingolia et al., Science 324: 218-23, 2009).
[0004] WO 03/054162 A2 discloses a method of removing rRNA using oligonucleotides, which comprise a poly(A)
tail, which can be captured by oligo(dT) magnetic beads.
[0005] WO 2007/019444 A2 discloses a method of removing rRNA using biotinylated oligonucleotides. The biotinylated
oligonucleotides used to remove the rRNA are shown to be about 20 nucleobases in length.
They comprise only one affinity-tag.
[0008] Stoffels et al I Environmental Microbiology (1999) 1(3), 259-271, disclose a method for rRNA probe-based cell fishing of bacteria. Bacterial target
cells are labelled by in situ hybridization with biotinylated polyribonucleotide probes.
The probes hybridize to a hypervariable region in domain III of the 23S rRNA molecules.
Cells labelled with the hybridized probes were separated from non-target cells using
paramagnetic streptavidin-coated particles in a magnetic field.
[0009] Bauman and Bentvelzen in Cytometry 9: 517-524 (1988) disclose a method of flow cytometric detection of rRNA in suspended cells by fluorescent
in situ hybridization. Single-stranded sense and antisense RNA probes labelled with
biotin-11-UTP transcribed from a 28S rRNA fragment were used to detect the rRNA.
SUMMARY OF THE INVENTION
[0010] The present invention provides methods, compositions, and kits as defined in the
claims for generating rRNA-depleted samples or for isolating rRNA from samples. In
particular, the present invention provides methods for generating compositions comprising
affinity-tagged antisense rRNA molecules, kits comprising such compositions, and methods
for using such compositions to generate rRNA-depleted samples or to isolate rRNA from
a sample (e.g., for further analysis and use).
[0011] In some embodiments, the present invention provides methods for generating a composition
comprising affinity-tagged antisense rRNA molecules that exhibit sequences which,
either alone or in combination, are complementary to the complete sequence of at least
one rRNA molecule selected from among 28S, 26S, 25S, 18S, 5.8S and 5S eukaryotic cytoplasmic
rRNA molecules, 12S and 16S eukaryotic mitochondrial rRNA molecules, and 23S, 16S
and 5S prokaryotic rRNA molecules, wherein the composition is for use in a method
for generating a rRNA-depleted sample or for isolating rRNA from a sample. In some
embodiments, the composition comprises affinity-tagged antisense rRNA molecules that
exhibit sequences which, either alone or in combination, are complementary to multiple
different rRNA molecule selected from among 28S, 26S, 25S, 18S, 5.8S and 5S eukaryotic
cytoplasmic rRNA molecules, 12S and 16S eukaryotic mitochondrial rRNA molecules, and
23S, 16S and 5S prokaryotic rRNA molecules from one or multiple cells or organisms.
In some embodiments, the present invention provides methods for using the composition
comprising the affinity-tagged antisense rRNA molecules for generating a rRNA-depleted
sample and/or for isolating rRNA from a sample.
[0012] In some embodiments, the present invention provides a composition comprising affinity-tagged
antisense rRNA molecules that, either alone or in combination, exhibit one or more
sequences that are complementary to substantially all of the sequence exhibited by
at least one full-length rRNA molecule selected from among 28S, 26S, 25S, 18S, 5.8S
and/or 5S eukaryotic cytoplasmic rRNA molecules, and 12S and 16S eukaryotic mitochondrial
rRNA molecules. In some embodiments, the present invention provides a composition
comprising affinity-tagged antisense rRNA molecules that, either alone or in combination,
exhibit one or more sequences that are complementary to substantially all of the sequence
exhibited by the at least one full-length rRNA molecule selected from among 23S, 16S
and 5S prokaryotic rRNA molecules. In particular embodiments, the at least one full-length
cytoplasmic rRNA molecule includes both the 28S rRNA and the 18S rRNA (or both the
25S rRNA and the 18S rRNA, or both the 26S rRNA and the 18S rRNA) from one or multiple
eukaryotic cells, tissues, organs, or organisms. In some embodiments, the at least
one full-length rRNA molecule includes both the 23S rRNA and the 16S rRNA from one
or multiple prokaryotic organisms. In some embodiments wherein the at least one full-length
rRNA molecule includes both the 28S rRNA and the 18S rRNA (or both the 25S rRNA and
the 18S rRNA, or both the 26S rRNA and the 18S rRNA) from one or multiple eukaryotic
cells, tissues, organs, or organisms, the affinity-tagged antisense rRNA molecules
also correspond to the 5.8S rRNA molecule and the 5S rRNA molecule from the one or
multiple eukaryotic cells, tissues, organs, or organisms. In some embodiments, the
affinity-tagged antisense rRNA molecules also correspond to at least one full-length
rRNA molecule that includes both the 12S and 16S eukaryotic mitochondrial rRNA molecules
from the one or multiple eukaryotic cells, tissues, organs, or organisms. In some
embodiments, the affinity-tagged antisense rRNA molecules also correspond to at least
one full-length rRNA molecule that includes both the 23S rRNA and the 16S rRNA from
one or multiple prokaryotic organisms, and in some embodiments, the affinity-tagged
antisense rRNA molecules also correspond to at least one full-length rRNA molecule
that includes the 5S rRNA molecules from the one or multiple prokaryotic organisms.
In further embodiments of any of the compositions comprising affinity-tagged antisense
rRNA molecules, the compositions are substantially free of non-rRNA RNA molecules
comprising the affinity tags. In further embodiments of any of the compositions comprising
affinity-tagged antisense rRNA molecules, the compositions further comprise a binding
matrix comprising affinity-tag-binding molecules.
[0013] In some embodiments wherein the composition comprising affinity-tagged antisense
rRNA molecules corresponds to all of at least one rRNA molecule selected from among
28S, 26S, 25S, and 18S eukaryotic cytoplasmic rRNA molecules, 12S and 16S eukaryotic
mitochondrial rRNA molecules, and prokaryotic 23S and 16S rRNA molecules, said affinity-tagged
antisense rRNA molecules are fragmented (e.g., by controlled nuclease fragmentation
or by controlled fragmentation using a divalent metal cation, such as Mg2+, and heat).
In some embodiments, the composition comprising fragmented affinity-tagged antisense
rRNA molecules comprises fragments ranging in size from about 3,500 nucleotides to
about 240 nucleotides.
[0014] In some embodiments, the present invention provides a method for generating a composition
comprising affinity-tagged antisense rRNA molecules comprising: a) generating double-stranded
DNA molecules comprising an RNA polymerase promoter that directs RNA synthesis of
antisense RNA corresponding to all of at least one rRNA molecule selected from among
25S, 26S, 28S, 18S, 5.8S, and 5S eukaryotic cytoplasmic rRNA molecules, 12S and 16S
eukaryotic mitochondrial rRNA molecules, and 23S, 16S, and 5S prokaryotic rRNA molecules;
and b) contacting the double-stranded DNA molecules comprising the RNA polymerase
promoter with an RNA polymerase and ribonucleoside-5'-triphosphates complementary
to all of the nucleobases, including at least one pair of ribonucleoside-5'-triphosphates
complementary to the same nucleobase, one of which pair comprises an affinity tag
and the other of which pair does not comprise an affinity tag, and incubating under
conditions wherein affinity-tagged antisense rRNA molecules are generated corresponding
to substantially all of the sequence of the at least one rRNA molecule.
[0015] With respect to such methods, work conduct during the development of embodiments
of the present invention determined that the concentration of the ribonucleoside-5'-
triphosphate molecules comprising the affinity tag relative to the concentration of
the ribonucleoside-5'- triphosphate molecules that lacked the affinity tag in the
at least one pair of ribonucleoside-5'-triphosphates complementary to the same nucleobase
was important for generating a composition comprising affinity-tagged antisense rRNA
molecules that could be used to remove >95% of the at least one rRNA molecules from
a sample, and that the relative concentration of the ribonucleoside-5'- triphosphate
molecules comprising the affinity tag needed to be higher than had been previously
used in the art. In some embodiments of the present method for generating a composition
comprising antisense rRNA molecules, at least about 35% of the ribonucleoside-5'-
triphosphate molecules comprising the at least one pair of ribonucleoside-5'- triphosphates
comprise an affinity tag and about 65% of the ribonucleoside-5'- triphosphate molecules
comprising the pair do not have an affinity tag. In some embodiments of this method,
at least about 40% of the ribonucleoside-5'- triphosphate molecules comprising the
at least one pair of ribonucleoside-5'- triphosphates have an affinity tag and about
60% of the ribonucleoside-5'- triphosphate molecules comprising the pair do not have
an affinity tag. In some embodiments of this method, at least about 50% of the ribonucleoside-5'-
triphosphate molecules comprising the at least one pair of ribonucleoside-5'-triphosphates
have an affinity tag and about 50% of the ribonucleoside-5'-triphosphate molecules
comprising the pair do not have an affinity tag. In some embodiments of this method,
at least about 60% of the ribonucleoside-5'-triphosphate molecules comprising the
at least one pair of ribonucleoside-5'-triphosphates have an affinity tag and about
40% of the ribonucleoside-5'-triphosphate molecules comprising the pair do not have
an affinity tag. In some embodiments of this method, wherein the at least one rRNA
molecule is selected from 5.8S and 5S eukaryotic cytoplasmic rRNA, and prokaryotic
5S rRNA, at least about 75% of the ribonucleoside-5'- triphosphate molecules comprising
the at least one pair of ribonucleoside-5'- triphosphates have an affinity tag and
25% of the ribonucleoside-5'- triphosphate molecules comprising the pair do not have
an affinity tag.
[0016] In some other embodiments, the present invention provides a method for generating
a composition comprising affinity-tagged antisense rRNA molecules comprising: a) generating
double-stranded DNA molecules comprising an RNA polymerase promoter that directs RNA
synthesis of antisense RNA corresponding to all of at least one rRNA molecule selected
from among 25S, 26S, 28S, 18S, 5.8S, and 5S eukaryotic cytoplasmic rRNA molecules,
12S and 16S eukaryotic mitochondrial rRNA molecules, and 23S, 16S, and 5S prokaryotic
rRNA molecules; b) contacting the double-stranded DNA molecules comprising the RNA
polymerase promoter with an RNA polymerase and ribonucleoside-5'-triphosphates complementary
to all of the nucleobases, including at least one ribonucleoside-5'-triphosphate that
comprises an affinity-tag-reactive moiety (e.g., an allylamino group on the 5 position
of uridine), and incubating under conditions wherein antisense rRNA molecules comprising
the affinity-tag-reactive moiety are generated, which antisense rRNA molecules correspond
to substantially all of the sequence of the at least one rRNA molecules; and c) contacting
the antisense rRNA molecules comprising the affinity-tag-reactive moiety with a quantity
of an affinity tag reagent (e.g., Biotin-X-X-NHS, EPICENTRE Biotechnologies, Madison,
WI) under conditions wherein the affinity tag reagent reacts with at least a portion
of the affinity-tag-reactive moieties in the antisense rRNA molecules comprising the
affinity-tag-reactive moiety and affinity-tagged antisense rRNA molecules are generated.
[0017] Work conducted during the development of embodiments of the present invention found
that the relative number of the affinity tags per given number of nucleobases in the
affinity-tagged antisense rRNA molecules is important for generating a composition
comprising affinity-tagged antisense rRNA molecules that can be used to remove >95%
of the at least one rRNA molecules from a sample, and that the number of the affinity
tags per given number of nucleobases in the affinity-tagged antisense rRNA molecules
generated using the method varies based on the amount of the affinity-tag-reactive
moieties present in the antisense rRNA molecules generated in step b), the properties
and concentration of the affinity tag reagent, the reaction conditions, and the reaction
time. Thus, in some embodiments of this method, 100% of the ribonucleoside-5'- triphosphate
molecules comprising one particular nucleobase have an affinity-tag-reactive moiety.
In some other embodiments of this method, the ribonucleoside-5'-triphosphates includes
at least one pair of ribonucleoside-5'-triphosphates complementary to the same nucleobase,
one of which pair comprises an affinity-tag-reactive moiety (e.g., UTP having an allylamino
reactive group on the 5 position of uridine or "AA-UTP") and the other of which pair
does not comprise an affinity tag. In some embodiments of this method, at least about
50% of the ribonucleoside-5'- triphosphate molecules comprising the at least one pair
of ribonucleoside-5'- triphosphates have an affinity-tag-reactive moiety and about
50% of the ribonucleoside-5'- triphosphate molecules comprising the pair do not have
an affinity-tag-reactive moiety. In some embodiments of this method, at least about
75% of the ribonucleoside-5'- triphosphate molecules comprising the at least one pair
of ribonucleoside-5'- triphosphates have an affinity-tag-reactive moiety and 25% of
the ribonucleoside-5'- triphosphate molecules comprising the pair do not have an affinity-tag-reactive
moiety. In some embodiments of this method, the affinity tag reagent is a biotinylation
reagent (e.g., Biotin-X-X-NHS) and the affinity tag comprises biotin. In some embodiments,
the biotin is joined via a spacer arm to the nucleobase (e.g., a spacer arm joined
to the allylamino group on the 5 position of uridine, e.g., from incorporation of
AA-UTP).
[0018] In further embodiments, the present invention provides a method for generating a
composition comprising antisense rRNA molecules comprising: a) generating double-stranded
DNA molecules comprising an RNA polymerase promoter that directs RNA synthesis of
antisense RNA corresponding to all of at least one rRNA molecule selected from among
25S, 26S, 28S, 18S, 5.8S, and 5S eukaryotic cytoplasmic rRNA molecules, 12S and 16S
eukaryotic mitochondrial rRNA molecules, and 23S, 16S, and 5S prokaryotic rRNA molecules;
and b) contacting the double-stranded DNA molecules comprising the RNA polymerase
promoter with an RNA polymerase and ribonucleoside-5'-triphosphates complementary
to all of the nucleobases, including at least one pair of ribonucleoside-5'-triphosphates
complementary to the same nucleobase, one of which pair comprises an affinity tag
and the other of which pair does not comprise an affinity tag, and incubating under
conditions wherein affinity-tagged antisense rRNA molecules are generated corresponding
to substantially all of the sequence of the at least one rRNA molecule, wherein the
affinity tags are present at a ratio of at least two affinity tags per hundred nucleobases
of the affinity-tagged antisense rRNA molecules (e.g., based on fluorescence quantification
of 200 ng of affinity-tagged antisense rRNA according to the instructions supplied
with the Fluorescence Biotin Quantitation Kit, Pierce Biotechnology, Rockford, IL;
Cat. #: Thermo 46610) after digestion of the affinity-tagged antisense rRNA with RNase
1 at 36°C for 45 min and heat inactivation of the enzyme according to the RNase 1
literature provided by the manufacturer, EPICENTRE Biotechnologies, Madison, WI).
In some other embodiments of this method, the affinity tags are present at a ratio
of at least about three to five affinity tags per hundred nucleobases of the affinity-tagged
antisense rRNA molecules (e.g., based on the fluorescence data obtained using the
Pierce Fluorescence Biotin Quantitation Kit). In some other embodiments of this method,
the affinity tags are present at a ratio of at least about four to six affinity tags
per hundred nucleobases of the affinity-tagged antisense rRNA molecules (e.g., based
on the fluorescence data obtained using the Pierce Fluorescence Biotin Quantitation
Kit). In some other embodiments of this method, the affinity tags are present at a
ratio of at least about six to eight affinity tags per hundred nucleobases of the
affinity-tagged antisense rRNA molecules (e.g., based on the fluorescence data obtained
using the Pierce Fluorescence Biotin Quantitation Kit). In some embodiments of this
method wherein the at least one rRNA molecule is selected from among 28S, 26S, 25S,
and 18S eukaryotic cytoplasmic rRNA molecules, 12S and 16S eukaryotic mitochondrial
rRNA molecules, and 23S and 16S prokaryotic rRNA molecules, at least about 35% to
about 50% of the ribonucleoside-5'-triphosphates comprising the at least one pair
of ribonucleoside-5'-triphosphates complementary to the same nucleobase comprise the
affinity tag (e.g., an affinity tag comprising biotin; e.g., biotin-16-UTP) and the
affinity tags are present in the affinity-tagged antisense rRNA molecules generated
at a ratio of at least about two to eight affinity tags per hundred nucleobases (e.g.,
based on the fluorescence data obtained using the Pierce Fluorescence Biotin Quantitation
Kit). In some embodiments of this method wherein the at least one rRNA molecule is
selected from among 5.8S and 5S eukaryotic rRNA molecules and 5S prokaryotic rRNA
molecules, at least about 60% to about 75% of the ribonucleoside-5'-triphosphates
comprising the at least one pair of ribonucleoside-5'-triphosphates complementary
to the same nucleobase comprise the affinity tag (e.g., an affinity tag comprising
biotin; e.g., biotin-16-UTP) and the affinity tags are present in the affinity-tagged
antisense rRNA molecules generated at a ratio of at least about two to eight affinity
tags per hundred nucleobases (e.g., based on the fluorescence data obtained using
the Pierce Fluorescence Biotin Quantitation Kit).
[0019] In further embodiments, the present invention provides a method for generating a
composition comprising antisense rRNA molecules comprising: a)
generating double-stranded DNA molecules comprising an RNA polymerase promoter that
directs RNA synthesis of antisense RNA corresponding to all of at least one rRNA molecule
selected from among 25S, 26S, 28S, 18S, 5.8S, and 5S eukaryotic cytoplasmic rRNA molecules,
12S and 16S eukaryotic mitochondrial rRNA molecules, and 23 S, 16S, and 5S prokaryotic
rRNA molecules; b) contacting the double-stranded DNA molecules comprising the RNA
polymerase promoter with an RNA polymerase and ribonucleoside-5'-triphosphates complementary
to all of the nucleobases, including at least one ribonucleoside-5'-triphosphate that
comprises an affinity-tag-reactive moiety (e.g., an allylamino group on the 5 position
of uridine), and incubating under conditions wherein antisense rRNA molecules comprising
the affinity-tag-reactive moiety are generated, which antisense rRNA molecules correspond
to substantially all of the sequence of the at least one rRNA molecules; and c) contacting
the antisense rRNA molecules comprising the affinity-tag-reactive moiety with a quantity
of an affinity tag reagent (e.g., Biotin-X-X-NHS, EPICENTRE Biotechnologies, Madison,
WI) under conditions wherein the affinity tag reagent reacts with the affinity-tag-reactive
moieties in the antisense rRNA molecules comprising the affinity-tag-reactive moiety
and affinity-tagged antisense rRNA molecules are generated, wherein the affinity tags
are present at a ratio of at least about two affinity tags per hundred nucleobases
of the affinity-tagged antisense rRNA molecules (e.g., based on fluorescence quantification
of RNase 1-digested affinity-tagged antisense rRNA molecules (200 nanograms) using
the Fluorescence Biotin Quantitation Kit from Pierce Biotechnology, Rockford, IL).
In some other embodiments of this method, the affinity tags are present at a ratio
of at least about three to five affinity tags per hundred nucleobases of the affinity-tagged
antisense rRNA molecules (e.g., based on the fluorescence data obtained using the
Pierce Fluorescence Biotin Quantitation Kit). In some other embodiments of this method,
the affinity tags are present at a ratio of at least about four to six affinity tags
per hundred nucleobases of the affinity-tagged antisense rRNA molecules (e.g., based
on the fluorescence data obtained using the Pierce Fluorescence Biotin Quantitation
Kit). In some other embodiments of this method, the affinity tags are present at a
ratio of at least about six to eight affinity tags per hundred nucleobases of the
affinity-tagged antisense rRNA molecules (e.g., based on the fluorescence data obtained
using the Pierce Fluorescence Biotin Quantitation Kit).
[0020] In some embodiments of any of the methods herein for generating affinity-tagged antisense
rRNA molecules, the affinity tag comprises biotin. In some embodiments, the biotin
is joined via a spacer arm to the 5 position of uridine. In some embodiments of any
of these methods, the RNA polymerase is selected from among T7 RNA polymerase, T3
RNA polymerase, and SP6 RNA polymerase. In some embodiments of any of these methods,
wherein the at least one rRNA molecule is selected from among eukaryotic cytoplasmic
25S, 26S, and 28S rRNA molecules, the RNA polymerase is SP6 RNA polymerase. In some
embodiments of any of these methods, wherein the at least one rRNA molecule is a prokaryotic
23S rRNA, the RNA polymerase is SP6 RNA polymerase.
[0021] In certain embodiments of any of the above methods for generating affinity-tagged
antisense rRNA molecules, the methods further comprise, after generating the antisense
rRNA molecules, contacting the double-stranded DNA molecules comprising the RNA polymerase
promoter with a DNase enzyme under conditions wherein the double-stranded DNA molecules
comprising the RNA polymerase promoter are digested.
[0022] In some embodiments of any of the methods for generating affinity-tagged antisense
rRNA molecules, step a) of the method (comprising "generating double-stranded DNA
molecules comprising an RNA polymerase promoter that directs RNA synthesis of antisense
RNA corresponding to all of at least one rRNA molecule selected from among 25S, 26S,
28S, 18S, 5.8S, and 5S eukaryotic cytoplasmic rRNA molecules, 12S and 16S eukaryotic
mitochondrial rRNA molecules, and 23S, 16S, and 5S prokaryotic rRNA molecules") comprises
either: i) incubating the at least one rRNA molecule with a DNA polymerase and at
least one primer pair under conditions wherein double-stranded DNA molecules that
comprise an RNA polymerase promoter that is capable of directing RNA synthesis of
antisense RNA corresponding to all of the at least one rRNA molecule are generated,
wherein each said at least one primer pair comprises a forward primer and a reverse
primer, wherein the reverse primer anneals to the at least one rRNA molecule and has
a 5' portion that exhibits the sequence of one strand of an RNA polymerase promoter
and the forward primer anneals to the DNA generated from the reverse primer; or: ii)
incubating the at least one rRNA molecule with a DNA polymerase and at least one primer
pair under conditions wherein double-stranded DNA molecules are generated, wherein
each said at least one primer pair comprises a forward primer and a reverse primer,
wherein the reverse primer primes DNA synthesis after annealing to the at least one
rRNA molecule and the forward primer primes DNA synthesis after annealing to the DNA
generated from DNA polymerase extension of the reverse primer, and then ligating said
double-stranded DNA molecules generated from each at least one primer pair into a
DNA vector that comprises an RNA polymerase promoter, wherein RNA polymerase promoter
is capable of directing synthesis of antisense RNA that is complementary to the at
least one rRNA molecule using said double-stranded DNA that is ligated into said DNA
vector as a template.
[0023] In some embodiments of any of the methods for generating affinity-tagged antisense
rRNA molecules, step a) of the method (comprising "generating double-stranded DNA
molecules comprising an RNA polymerase promoter that directs RNA synthesis of antisense
RNA corresponding to all of at least one rRNA molecule selected from among 25S, 26S,
28S, 18S, 5.8S, and 5S eukaryotic cytoplasmic rRNA molecules, 12S and 16S eukaryotic
mitochondrial rRNA molecules, and 23S, 16S, and 5S prokaryotic rRNA molecules") comprises
obtaining a genomic DNA fragment that encodes the at least one rRNA molecule and either:
i) contacting said genomic DNA fragment with a DNA polymerase and at least one primer
pair, wherein the first primer of each of said at least one primer pair has a 5' portion
that exhibits the sequence of one strand of an RNA polymerase promoter and a 3' portion
that is complementary to a portion of a first strand of the genomic DNA fragment and
the second primer of each of said at least one primer pair is complementary to a portion
of the second strand of the genomic DNA fragment, and incubating under conditions
wherein RNA polymerase promoter-containing double-stranded DNA copies of at least
a portion of the genomic DNA fragment are generated, wherein the RNA polymerase promoter
is capable of directing RNA synthesis of antisense RNA corresponding to all of the
at least one rRNA molecule; or: ii) ligating said genomic DNA fragment or a PCR amplification
product thereof into a DNA vector that comprises an RNA polymerase promoter to obtain
a genomic clone, wherein the RNA polymerase promoter in said genomic clone is capable
of directing synthesis of antisense RNA that is complementary to the at least one
rRNA molecule using said double-stranded DNA that is ligated into said DNA vector
as a template.
[0024] In some embodiments of the methods for generating affinity-tagged antisense rRNA
molecules and of the compositions generated using the method, the affinity-tagged
antisense rRNA molecules do not exhibit any rRNA internal transcribed spacer sequences.
In some other embodiments, the affinity-tagged antisense rRNA molecules exhibit internal
transcribed spacer sequences selected from among: i) a sequence exhibited by the ITS1
rRNA spacer region, which is located between a eukaryotic 18S rRNA gene and a eukaryotic
5.8S rRNA gene; ii) a sequence exhibited by the ITS2 rRNA spacer region, which is
located between a eukaryotic 5.8S rRNA gene and a eukaryotic 28S rRNA gene; iii) a
sequence exhibited by a prokaryotic 16S-23S ITS; and iv) a sequence exhibited by a
prokaryotic 23S-5S rRNA ITS.
[0025] In some embodiments, the present invention provides a composition comprising affinity-tagged
antisense rRNA molecules that are bound to a binding matrix comprising affinity-tag-binding
molecules, wherein the affinity-tagged antisense rRNA molecules, alone or in combination,
exhibit sequences corresponding to substantially all of at least one full-length rRNA
molecule selected from: 25S, 26S, 28S, 18S, 5.8S, and 5S eukaryotic cytoplasmic rRNA
molecules, 12S and 16S eukaryotic mitochondrial rRNA molecules, and 23S, 16S, and
5S prokaryotic rRNA molecules.
[0026] A composition comprising affinity-tagged antisense rRNA molecules that are bound
to a binding matrix comprising affinity-tag-binding molecules is generated by incubating
the composition comprising affinity-tagged antisense rRNA molecules with a binding
matrix comprising affinity-tag-binding molecules under binding conditions, wherein
the affinity tag binds to the affinity-tag-binding molecules that are attached to
the matrix or solid support (e.g., microparticles) to form a specific binding pair.
In some embodiments, this method further comprises the step of washing the composition
under conditions wherein affinity-tagged antisense rRNA molecules that are not specifically
bound to the binding matrix are removed, thereby generating a purified composition
comprising affinity-tagged antisense rRNA molecules that are bound to the binding
matrix.
[0027] In particular embodiments of this aspect of the invention, the composition comprising
affinity-tagged antisense rRNA molecules that are bound to a binding matrix can be
any composition of affinity-tagged antisense rRNA molecules described herein and can
be generated using any method for generating a composition comprising antisense rRNA
molecules described herein.
[0028] In one particular embodiment of this composition, the affinity-tagged antisense rRNA
molecules comprise biotin as the affinity tag, wherein the biotin is joined to at
least about two nucleobases per hundred nucleobases of the antisense rRNA molecules,
and the binding matrix comprises a microparticle to which an affinity-tag-binding
molecule comprising streptavidin or avidin is attached. In some other embodiments
of this composition, the affinity-tagged antisense rRNA molecules comprise biotin
as the affinity tag, wherein the biotin is joined to at least about two to four nucleobases
per hundred nucleobases of the antisense rRNA molecules, or to at least three to five
nucleobases per hundred nucleobases of the antisense rRNA molecules, or to at least
four to six nucleobases per hundred nucleobases of the antisense rRNA molecules, or
to at least six to eight nucleobases per hundred nucleobases of the antisense rRNA
molecules.
[0029] In some embodiments of the invention, any of the compositions comprising affinity-tagged
antisense rRNA molecules, including any of the compositions comprising affinity-tagged
antisense rRNA molecules that are bound to a binding matrix, is used in a method of
the invention for generating a rRNA-depleted sample or for isolating substantially
all of the RNA molecules that, either alone or in combination, exhibit the sequence
of at least one full-length rRNA molecule.
[0030] In some embodiments, the present invention provides methods for generating a rRNA-depleted
sample from an initial sample comprising: a) providing i) an initial sample comprising
RNA molecules, wherein the RNA molecules comprise rRNA molecules and at least one
non-rRNA RNA molecule of interest; ii) a composition comprising affinity-tagged antisense
rRNA molecules that, alone or in combination, exhibit sequences corresponding to substantially
all of at least one full-length rRNA molecule selected from: 25S, 26S, 28S, 18S, 5.8S,
and 5S eukaryotic cytoplasmic rRNA molecules, 12S and 16S eukaryotic mitochondrial
rRNA molecules, and 23S, 16S, and 5S prokaryotic rRNA molecules; and iii) a binding
matrix (e.g., microparticles) comprising affinity-tag-binding molecules; b) contacting
the initial sample with the composition under conditions such that at least some of
the affinity-tagged antisense rRNA molecules and at least some of the rRNA molecules
form double-stranded rRNA hybrids thereby generating a treated sample; c) contacting
the treated sample with the binding matrix under conditions such that at least a portion
of the double-stranded rRNA hybrids bind to the binding matrix and are removed from
the treated sample, thereby generating a rRNA-depleted sample, wherein the rRNA-depleted
sample is substantially free of rRNA sequences exhibited by the at least one rRNA
molecule and comprises substantially all of the at least one non-rRNA RNA molecule
of interest present in the initial sample (e.g., at least >90% ..., >95% ..., >98%
..., >99% ..., >99.8% ..., or >99.9% of the at least one non-rRNA RNA molecule of
interest present in the initial sample).
[0031] In certan embodiments, one or more steps are repeated and/or additional methods are
performed to generate the rRNA-depleted sample. In particular embodiments, the methods
are peformed with repeated rounds of subtraction in order to generate the rRNA-depleted
sample. In particular embodiments, at least a portion of the RNA molecules in the
initial sample are highly fragmented, and wherein the rRNA-depleted sample is at least
50% ... 60% ... 70% ... 80% ... 90.0% ... 95% ... 98% ... 99% ... or 100% free of
rRNA sequences exhibited by the at least one rRNA molecule.
[0032] In certain embodiments, the present invention provides methods for generating a rRNA-depleted
sample from an initial sample comprising: a) providing: i) an initial sample comprising
RNA molecules, wherein the RNA molecules comprise rRNA molecules and at least one
non-rRNA RNA molecule of interest; ii) a composition comprising affinity-tagged antisense
rRNA molecules that, alone or in combination, are complementary to substantially all
of the sequence exhibited by the at least one rRNA molecule selected from: 25S, 26S,
28S, 18S, 5.8S, and 5S eukaryotic cytoplasmic rRNA molecules, 12S and 16S eukaryotic
mitochondrial rRNA molecules, and 23S, 16S, and 5S prokaryotic rRNA molecules; and
iii) a binding matrix (e.g., microparticles) comprising affinity-tag-binding molecules;
b) contacting the initial sample with the composition under conditions such that at
least some of the affinity-tagged antisense rRNA molecules and at least some of the
rRNA molecules form double-stranded rRNA hybrids thereby generating a treated sample;
c) contacting the treated sample with the binding matrix under conditions such that
at least a portion of the double-stranded rRNA hybrids bind to the binding matrix
and are removed from the treated sample, thereby generating an rRNA-depleted sample,
wherein the rRNA-depleted sample comprises substantially all (e.g., >90%... , >95%
..., >98% ..., >99% ..., >99.8% ..., or >99.9%) of the at least one non-rRNA RNA molecule
of interest present in the initial sample and is substantially free (e.g., >95% ...
, >98% ..., >99% ..., >99.8% ..., or >99.9% free) of rRNA sequences exhibited by the
at least one rRNA molecule present in the initial sample.
[0033] In additional embodiments, the present invention provides methods for generating
a rRNA-depleted sample from an initial sample comprising: a) providing; i) an initial
sample comprising RNA molecules, wherein the RNA molecules comprise rRNA molecules
and at least one non-rRNA RNA molecules of interest; ii) a composition comprising
affinity-tagged antisense rRNA molecules complementary to substantially all of the
sequence exhibited by the at least one rRNA molecule selected from: 25S, 26S, 28S,
18S, 5.8S, and 5S eukaryotic cytoplasmic rRNA molecules, 12S and 16S eukaryotic mitochondrial
rRNA molecules, and 23S, 16S, and 5S prokaryotic rRNA molecules, wherein the affinity
tags are present on the antisense rRNA molecules at a ratio of at least about two
to at least four affinity-tags per hundred nucleobases of the antisense rRNA molecules;
and iii) a binding matrix comprising affinity-tag-binding molecules; b) contacting
the initial sample with the composition under conditions such that at least some of
the affinity-tagged antisense rRNA molecules and at least some of the rRNA molecules
form double-stranded rRNA hybrids thereby generating a treated sample; c) contacting
the treated sample with the binding matrix under conditions wherein at least a portion
of the double-stranded rRNA hybrids bind to the binding matrix and are removed from
the treated sample, thereby generating a rRNA-depleted sample, wherein the rRNA-depleted
sample comprises substantially all (e.g., >90%... , >95% ... , >98% ..., >99% ...,
>99.8% ..., or >99.9%) of the at least one non-rRNA RNA molecule of interest present
in the initial sample and is substantially free (e.g., >95% ... , >98% ..., >99% ...,
>99.8% ..., or >99.9% free) of molecules that, either alone or in combination, exhibit
the sequences within the at least one rRNA molecule present in the initial sample.
[0034] In certain embodiments, the present invention provides methods for generating a rRNA-depleted
sample from an initial sample comprising: a) providing; i) an initial sample comprising
RNA molecules, wherein the RNA molecules comprise rRNA molecules and at least one
non-rRNA RNA molecule of interest; ii) a composition comprising affinity-tagged antisense
rRNA molecules complementary to substantially all of the sequence exhibited by the
at least one rRNA molecule selected from: 25S, 26S, 28S, 18S, 5.8S, and 5S eukaryotic
cytoplasmic rRNA molecules, 12S and 16S eukaryotic mitochondrial rRNA molecules, and
23S, 16S, and 5S prokaryotic rRNA molecules; and iii) a binding matrix (e.g., microparticles)
comprising affinity-tag-binding molecules; b) contacting the initial sample with the
composition under conditions such that at least some of the affinity-tagged antisense
rRNA molecules and at least some of the rRNA molecules form double-stranded rRNA hybrids
thereby generating a treated sample; c) contacting the treated sample with the binding
matrix under conditions such that at least a portion of the double-stranded rRNA hybrids
bind to the binding matrix and are removed from the treated sample, thereby generating
a rRNA-depleted sample, wherein the rRNA-depleted sample comprises substantially all
(e.g., >90%... , >95% ... , >98% ..., >99% ..., >99.8% ..., or >99.9%) of the at least
one non-rRNA RNA molecule of interest present in the initial sample) and wherein,
the rRNA-depleted sample is either: i) ≥99.0% free (e.g., >99.0%, 99.1%, 99.2%, 99.3%,
99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.95%, or 99.99% free) of RNA molecules
that, either alone or in combination, exhibit a sequence within the at least one rRNA
molecule present in the initial sample, or ii) contains undetectable levels of the
at least one rRNA molecules from the initial sample as measured using agarose gel
electrophoresis and ethidium bromide staining.
[0035] In some embodiments, the present invention provides methods for generating a rRNA-depleted
sample from an initial sample comprising: a) providing i) an initial sample comprising
RNA molecules, wherein the RNA molecules comprise rRNA molecules and at least one
non-rRNA RNA molecule of interest; and ii) a composition comprising affinity-tagged
antisense rRNA molecules that are bound to a binding matrix (e.g., microparticles
comprising affinity-tag-binding molecules), wherein the affinity-tagged antisense
rRNA molecules, alone or in combination, exhibit sequences corresponding to substantially
all of at least one full-length rRNA molecule selected from: 25S, 26S, 28S, 18S, 5.8S,
and 5S eukaryotic cytoplasmic rRNA molecules, 12S and 16S eukaryotic mitochondrial
rRNA molecules, and 23S, 16S, and 5S prokaryotic rRNA molecules; b) contacting the
initial sample with the composition under conditions such that at least some of the
affinity-tagged antisense rRNA molecules in the composition and at least some of the
rRNA molecules form double-stranded rRNA hybrids that are bound to the binding matrix,
thereby generating a treated sample; and c) removing the binding matrix to which the
double-strand rRNA hybrids are bound, thereby generating a rRNA-depleted sample, wherein
the rRNA-depleted sample is: i) substantially free of rRNA sequences exhibited by
the at least one rRNA molecule and comprises substantially all of the at least one
non-rRNA RNA molecule of interest present in the initial sample (e.g., at least >90%
..., >95% ..., >98% ..., >99% ..., >99.8% ..., or >99.9% of the at least one non-rRNA
RNA molecule of interest present in the initial sample), and ii) either, substantially
free (e.g., >95% ... , >98% ..., >99% ..., >99.8% ..., or >99.9% free) of rRNA sequences
exhibited by the at least one rRNA molecule present in the initial sample, or, contains
undetectable levels of the at least one rRNA molecules from the initial sample as
measured using agarose gel electrophoresis and ethidium bromide staining. In particular
embodiments of this method of the invention, the composition comprising affinity-tagged
antisense rRNA molecules that are bound to a binding matrix is any composition of
affinity-tagged antisense rRNA molecules described herein and/or is generated using
any method for generating a composition comprising antisense rRNA molecules described
herein.
[0036] In particular embodiments of any of the methods for generating an rRNA-depleted sample,
the rRNA-depleted sample is 98.0% free of rRNA molecules that exhibit sequences within
the at least one rRNA molecule (e.g., 98.0% free, 98.5% free, 99.0% free, 99.5% free,
99.7% free, 99.9% free, 99.99% free, or 100% free). In other embodiments, the at least
one rRNA molecule includes both the 28S rRNA and the 18S rRNA, and wherein the rRNA-depleted
sample is 99.0% free (e.g., 99.5% free) of rRNA molecules that exhibit sequences within
the 28S rRNA gene and the 18S rRNA gene. In other embodiments, the rRNA-depleted sample
contains undetectable levels of rRNA molecules that exhibit sequences within the at
least one rRNA molecule (e.g., undetectable as measured using agarose gel electrophoresis
and ethidium bromide staining). In some embodiments of the method, the composition
comprising affinity-tagged antisense rRNA molecules does not exhibit any rRNA internal
transcribed spacer sequences. In some other embodiments of the method, the composition
comprising the antisense rRNA molecules exhibits internal transcribed spacer sequences
selected from among: i) a sequence exhibited by the ITS1 rRNA spacer region, which
is located between a eukaryotic 18S rRNA gene and a eukaryotic 5.8S rRNA gene; ii)
a sequence exhibited by the ITS2 rRNA spacer region, which is located between a eukaryotic
5.8S rRNA gene and a eukaryotic 28S rRNA gene; iii) a sequence exhibited by a prokaryotic
16S-23S ITS; and iv) a sequence exhibited by a prokaryotic 23S-5S rRNA ITS. In particular
embodiments of the methods for generating rRNA-depleted samples or for isolating rRNA
from a sample, step b) is performed using a composition comprising antisense rRNA
molecules that do not exhibit any rRNA internal transcribed spacer sequences, whereas,
in other embodiments, step b) is performed using a composition comprising affinity-tagged
antisense rRNA molecules that exhibit one or more of the internal transcribed spacer
sequences.
[0037] In some embodiments of any of the methods for generating a rRNA-depleted sample from
an initial sample wherein the initial sample comprises RNA molecules that comprise
rRNA molecules and at least one non-rRNA RNA molecule of interest, the RNA molecules
in the initial sample are fragmented (e.g., from an FFPE or other sample comprising
degraded RNA molecules, or from a sample wherein the RNA molecules are deliberated
degraded (e.g. by incubation in the presence of heat and Mg2+) prior to being provided
in the initial sample). In some embodiments of any of the methods of the invention
for generating a rRNA-depleted sample, the at least one non-rRNA RNA molecule of interest
comprises a multiplicity of non-rRNA molecules of interest. In some embodiments, the
at least one non-rRNA RNA molecule of interest comprises substantially all of the
non-rRNA RNA molecules present in the initial sample (e.g., including both the intact
and fragmented non-rRNA RNA molecules present in the initial sample). In some embodiments,
the at least one non-rRNA RNA molecule of interest comprises substantially all of
the eukaryotic mRNA molecules present in the initial sample. In some embodiments,
the at least one non-rRNA RNA molecule of interest comprises substantially all of
the non-rRNA RNA molecules comprising the transcriptome (minus the at least one rRNA
molecule) from one or multiple eukaryotic cells, tissues, organs, or organisms (e.g.,
for use in making sequencing templates or labeled target nucleic acid, e.g., for analysis
of the expression or relative expression of said at least one non-rRNA RNA molecule
of interest by digital expression analysis or microarray analysis, respectively).
In some embodiments, the at least one non-rRNA RNA molecule of interest comprises
the non-rRNA RNA molecules comprising a transcriptome (minus the at least one rRNA
molecule) of one or multiple eukaryotic cells, tissues, organs, or organisms (e.g.,
for use in making sequencing templates or labeled target nucleic acid, e.g., for analysis
of the expression or relative expression of all of said non-rRNA RNA molecules by
digital expression analysis or microarray analysis, respectively, e.g., for medical
or agricultural analysis). In some embodiments, the at least one non-rRNA RNA molecule
of interest comprises a subfraction of the non-rRNA RNA molecules comprising the transcriptome
(minus the at least one rRNA molecules) of one or multiple cells, tissues, organs,
or organisms (e.g., a subfraction selected from among mRNA molecules, miRNA molecules,
ncRNA molecules, piwiRNA, snRNA, etc.) (e.g., for use in making sequencing templates
or labeled target nucleic acid, e.g., for analysis of the expression or relative expression
of said subfraction of non-rRNA RNA molecules, e.g., by digital expression analysis
or microarray analysis, respectively, e.g., for medical or agricultural analysis).
In some embodiments, the at least one non-rRNA RNA molecule of interest comprises
substantially all of the non-rRNA RNA molecules comprising a transcriptome (minus
the at least one rRNA molecule) of one or multiple prokaryotic cells or of one or
multiple cells comprising both eukaryotic and prokaryotic cells. In some embodiments,
the at least one non-rRNA RNA molecule of interest comprises or consists of one or
multiple RNA molecules that exhibit specific nucleic acid sequences (e.g., wherein
the presence or absence or the quantity of said one or multiple RNA molecules that
exhibit the specific nucleic acid sequences is used to detect a pathogen or a medical
condition, e.g., for screening (e.g., for screening for the presence of a a pathogen
in water, on a surface, such as a hospital surface, etc.), or e.g., for diagnostic
or theranostic assay (e.g., for diagnosing or monitoring the quantity of a pathogen,
or the status of a disease or medical condition for deciding on a therapy or treatment).
[0038] In some embodiments of any of the methods of the invention for generating a rRNA-depleted
sample, the method further comprises using the rRNA-depleted sample or the at least
one non-rRNA RNA molecule of interest contained therein for further analysis or use.
In some embodiments, the method further comprises using the at least one non-rRNA
RNA molecule of interest as part of a method for generating templates for next-generation
DNA sequencing (e.g., for digital expression analysis or RNA-Seq, miRNA profiling,
etc.). In some embodiments of the method for generating a rRNA-depleted sample, the
method further comprises using the at least one non-rRNA RNA molecule of interest
as part of a method for generating labeled target nucleic acid molecules for hybridization
to probes of an array or microarray on a porous or non-porous surface (e.g., to probes
on an array or microarray, a dot blot, etc.). In some embodiments of the method for
generating a rRNA-depleted sample, the method further comprises using the rRNA-depleted
sample for performing a diagnostic or theranostic assay to detect for the presence
of the at least one non-rRNA RNA molecule of interest (e.g., wherein the presence
or quantity of said at least one non-rRNA RNA molecule of interest is indicative of
the presence or status of a health or disease state). In some embodiments of the method
for generating a rRNA-depleted sample, the method further comprises amplifying the
at least one non-rRNA RNA molecule of interest for further analysis or use. In some
embodiments of the method for generating a rRNA-depleted sample, the method further
comprises using the at least one non-rRNA RNA molecule of interest or an amplification
product thereof for transfection of a eukaryotic cell (e.g., an antigen-presenting
cell (APC), such as a dendritic cell, a macrophage, or an artificial APC for immunotherapeutic
use). In some embodiments, the at least one non-rRNA RNA molecule of interest or an
amplification product thereof is used for transfection of a human or animal cell from
the same individual from whom the at least one non-rRNA RNA molecule of interest was
obtained (e.g., to make a vaccine comprising the APC-transfected cell for immunotherapeutic
use to treat a disease, e.g., cancer, in a human or animal individual). In some embodiments,
the at least one non-rRNA RNA molecule of interest or an amplification product thereof
is used for transfection of a cell from a different human or animal than the cell
from whom the at least one non-rRNA RNA molecule of interest was obtained (e.g., to
make a vaccine comprising the APC-transfected cell for immunotherapeutic use to treat
a disease, e.g., cancer, in a human or animal individual). In certain embodiments,
the RNA vaccine is made using the at least one non-rRNA RNA of interest from a first
individual and the RNA vaccine is used to vaccinate a second individual. In some embodiments
of the method for generating a rRNA-depleted sample, the method further comprises
using the at least one non-rRNA RNA molecule of interest or an amplification product
thereof to manufacture an RNA vaccine for therapeutic use. In some embodiments of
the method, the at least one non-rRNA RNA molecule of interest or a sense RNA amplification
product thereof is used to manufacture an RNA vaccine that is used to directly inoculate
a patient for therapeutic use. In some embodiments, the RNA vaccine is made using
the at least one non-rRNA RNA of interest from a cell, tissue, or organ from first
individual and is the RNA vaccine is administered to said first individual as an immunotherapeutic
treatment. In some embodiments, the RNA vaccine is made using the at least one non-rRNA
RNA of interest from a first individual and the RNA vaccine is used to vaccinate a
second individual.
[0039] In still other embodiments, the invention provides methods for using the composition
comprising affinity-tagged antisense rRNA molecules for isolating substantially all
of the RNA molecules that, either alone or in combination, exhibit a sequence within
at least one full-length rRNA molecule selected from among 25 S, 26S, 28S, 18S, 5.8S,
and 5S eukaryotic cytoplasmic rRNA molecules, 12S and 16S eukaryotic mitochondrial
rRNA molecules, and 23S, 16S, and 5S prokaryotic rRNA molecules.
[0040] Thus, in some embodiments, the present invention provides methods for isolating substantially
all of the RNA molecules that, either alone or in combination, exhibit the sequence
within at least one full-length rRNA molecule, the method comprising: a) providing
i) an initial sample comprising RNA molecules, wherein the RNA molecules comprise
rRNA molecules and non-rRNA RNA molecules; ii) a composition comprising affinity-tagged
antisense rRNA molecules that exhibits sequences corresponding to substantially all
of at least one full-length rRNA molecule selected from: 25S, 26S, 28S, 18S, 5.8S,
and 5S eukaryotic cytoplasmic rRNA molecules, 12S and 16S eukaryotic mitochondrial
rRNA molecules, and 23S, 16S, and 5S prokaryotic rRNA molecules; and iii) a binding
matrix (e.g., microparticles) comprising affinity-tag-binding molecules; b) contacting
the initial sample with the composition under conditions such that at least some of
the affinity-tagged antisense rRNA molecules and at least some of the rRNA molecules
form double-stranded rRNA hybrids thereby generating a treated sample; c) contacting
the treated sample with the binding matrix under conditions such that at least a portion
of the double-stranded rRNA hybrids bind to the binding matrix; d) removing the binding
matrix to which are bound the double-stranded rRNA hybrids comprising the affinity-tagged
antisense rRNA molecules and the at least some of the rRNA molecules from the treated
sample; and e) incubating the binding matrix in a solution under conditions wherein
the at least some rRNA molecules from the treated sample are released into the solution,
thereby isolating substantially all of the RNA molecules that, either alone or in
combination, exhibit a sequence within at least one full-length rRNA molecule present
in the initial sample (e.g., at least >95% ..., >98% ..., >99% ..., >99.8% ..., or
>99.9% of the at least one full-length rRNA molecules present in the initial sample).
[0041] In some embodiments, the present invention provides methods for isolating substantially
all of the RNA molecules that, either alone or in combination, exhibit the sequence
within at least one full-length rRNA molecule, the method comprising: a) providing
i) an initial sample comprising RNA molecules, wherein the RNA molecules comprise
rRNA molecules and non-rRNA RNA molecules; ii) a composition comprising affinity-tagged
antisense rRNA molecules that exhibits sequences corresponding to substantially all
of at least one full-length rRNA molecule selected from: 25S, 26S, 28S, 18S, 5.8S,
and 5S eukaryotic cytoplasmic rRNA molecules, 12S and 16S eukaryotic mitochondrial
rRNA molecules, and 23S, 16S, and 5S prokaryotic rRNA molecules; and iii) a binding
matrix (e.g., microparticles) comprising affinity-tag-binding molecules; b) contacting
the initial sample with the composition under conditions such that at least some of
the affinity-tagged antisense rRNA molecules and at least some of the rRNA molecules
form double-stranded rRNA hybrids thereby generating a treated sample; c) contacting
the treated sample with the binding matrix under conditions such that at least a portion
of the double-stranded rRNA hybrids bind to the binding matrix; d) removing the binding
matrix to which are bound the double-stranded rRNA hybrids comprising the affinity-tagged
antisense rRNA molecules and the at least some of the rRNA molecules from the treated
sample; and e) incubating the binding matrix in a solution under conditions wherein
the at least some rRNA molecules from the treated sample are released into the solution,
thereby generating an isolated rRNA sample comprising substantially all of the RNA
molecules that, either alone or in combination, exhibit a sequence within at least
one full-length rRNA molecule present in the initial sample (e.g., at least >90% ...,
>95% ..., >98% ..., >99% ..., >99.8% ..., or >99.9% of the at least one full-length
rRNA molecule present in the initial sample) and wherein the isolated rRNA sample
is substantially free (e.g., at least >90% ..., >95% ... , >98% ..., >99% ..., >99.8%
..., or >99.9% free) of the non-rRNA RNA molecules present in the initial sample.
[0042] In some embodiments, the present invention provides methods for isolating substantially
all of the RNA molecules that, either alone or in combination, exhibit the sequence
within at least one full-length rRNA molecule, the method comprising: a) providing
i) an initial sample comprising RNA molecules, wherein the RNA molecules comprise
rRNA molecules and non-rRNA RNA molecules; ii) a composition comprising affinity-tagged
antisense rRNA molecules that exhibits sequences corresponding to substantially all
of at least one full-length rRNA molecule selected from: 25S, 26S, 28S, 18S, 5.8S,
and 5S eukaryotic cytoplasmic rRNA molecules, 12S and 16S eukaryotic mitochondrial
rRNA molecules, and 23S, 16S, and 5S prokaryotic rRNA molecules; and iii) a binding
matrix (e.g., microparticles) comprising affinity-tag-binding molecules; b) contacting
the initial sample with the composition under conditions such that at least some of
the affinity-tagged antisense rRNA molecules and at least some of the rRNA molecules
form double-stranded rRNA hybrids thereby generating a treated sample; c) contacting
the treated sample with the binding matrix under conditions such that at least a portion
of the double-stranded rRNA hybrids bind to the binding matrix; d) removing the binding
matrix to which are bound the double-stranded rRNA hybrids comprising the affinity-tagged
antisense rRNA molecules and the at least some of the rRNA molecules from the treated
sample; and e) incubating the binding matrix in a solution under conditions wherein
the at least some rRNA molecules from the treated sample are released into the solution,
thereby generating an isolated rRNA sample comprising substantially all of the RNA
molecules that, either alone or in combination, exhibit a sequence within at least
one full-length rRNA molecule present in the initial sample (e.g., at least >90% ...,
>95% ..., >98% ..., >99% ..., >99.8% ..., or >99.9% of the at least one full-length
rRNA molecule present in the initial sample) and wherein, either i) the isolated rRNA
sample is substantially free (e.g., at least >90% ..., >95% ... , >98% ..., >99% ...,
>99.8% ..., or >99.9% free) of the non-rRNA RNA molecules present in the initial sample,
or ii) contains undetectable levels of non-rRNA RNA from the initial sample as measured
using agarose gel electrophoresis and ethidium bromide staining.
[0043] In some embodiments of the methods for isolating substantially all of the RNA molecules
that, either alone or in combination, exhibit the sequence within at least one full-length
rRNA molecule, the isolated rRNA sample is from an initial sample (e.g., comprising
a biological specimen, including a medical specimen, such as saliva, sputum, feces,
urine, or a cell, tissue, or organ sample, an environmental sample, a metagenomic
sample, or any other type of sample which may contain the RNA of interest), whether
the sample is unprepared or prepared (e.g., by fixation using a solution, e.g., formalin
or ethanol; mounting on a slide; or using other procedures known in the art), and
the isolated rRNA is analyzed to determine the genera, species or strains of origin,
thereby indicating what particular genera, species or strains were present in the
initial sample, and therefore, in the particular specimen or environment from which
the sample was collected. For example, in some embodiments, the method is used to
identify and study the organisms present in a human or animal or plant "microbiome",
e.g., for research, medical, or agricultural applications. In some embodiments, the
isolate rRNA sample is from an initial sample comprising a sample from a human, animal,
or plant specimen that is provided for medical diagnostic or theranostic testing or
analysis (e.g., to detect a pathogenic microorganism, such as a fungal or bacterial
pathogen, that is or may be related to or causative of a disease condition, e.g.,
a pathogenic bacterium that can be detected or diagnosed based on analysis of at least
one rRNA molecule, e.g., as described by
Chakravorty, S et al., J. Microbiol. Methods 69: 330-339,2007 and by
Millar, BC et al. in Current Issues Mol. Biol. 9: 21-40, 2007.) In some embodiments, the isolated rRNA sample is analyzed using any of the many
next-generation sequencing methods known in the art (e.g., after tagging the 3' end
or the 3' and 5' ends of the isolated rRNA molecules and reverse transcribing them
to make tagged or di-tagged linear ssDNA templates or circular ssDNA templates for
next-generation sequencing (e.g., using a Roche 454™, Illumina Solexa™, Life Technologies
SOLID™, Pacific Biosciences, Intelligent Biosystems, Helicos, Qiagen, or another next-generation
sequencing platform. In still other embodiments, the isolated rRNA sample is analyzed
by real-time PCR.
[0044] In some embodiments, the present invention provides methods for isolating substantially
all of the RNA molecules that, either alone or in combination, exhibit the sequence
within at least one full-length rRNA molecule, the method comprising: a) providing
i) an initial sample comprising RNA molecules, wherein the RNA molecules comprise
rRNA molecules and non-rRNA RNA molecules; and ii) a composition comprising affinity-tagged
antisense rRNA molecules that are bound to a binding matrix (e.g., microparticles
comprising affinity-tag-binding molecules), wherein the affinity-tagged antisense
rRNA molecules, alone or in combination, exhibit sequences corresponding to substantially
all of at least one full-length rRNA molecule selected from: 25S, 26S, 28S, 18S, 5.8S,
and 5S eukaryotic cytoplasmic rRNA molecules, 12S and 16S eukaryotic mitochondrial
rRNA molecules, and 23S, 16S, and 5S prokaryotic rRNA molecules; b) contacting the
initial sample with the composition under conditions such that at least some of the
affinity-tagged antisense rRNA molecules in the composition and at least some of the
rRNA molecules form double-stranded rRNA hybrids that are bound to the binding matrix,
thereby generating a treated sample; and c) removing the binding matrix to which the
double-strand rRNA hybrids are bound, thereby isolating substantially all of the RNA
molecules that, either alone or in combination, exhibit the sequence within at least
one full-length rRNA molecule. In some embodiments of this method, the method further
comprises the step of washing the binding matrix to which the double-stranded rRNA
hybrids are bound in order to remove non-specifically-bound non-rRNA RNA molecules
from the sample. In some embodiments, the treated sample is stored on the binding
matrix for future analysis or use. In some embodiments, the method further comprises
the step of incubating the binding matrix in a solution under conditions wherein the
at least some rRNA molecules from the treated sample are released into the solution,
thereby generating a solution of the isolated rRNA sample comprising substantially
all of the RNA molecules that, either alone or in combination, exhibit a sequence
within at least one full-length rRNA molecule present in the initial sample (e.g.,
at least >90% ..., >95% ..., >98% ..., >99% ..., >99.8% ..., or >99.9% of the RNA
molecules that, either alone or in combination, exhibit a sequence within at least
one full-length rRNA molecule present in the initial sample) and wherein, either i)
the isolated rRNA sample is substantially free (e.g., at least >90% ..., >95% ...,
>98% ..., >99% ..., >99.8% ..., or >99.9% free) of the non-rRNA RNA molecules present
in the initial sample, or ii) contains undetectable levels of non-rRNA RNA from the
initial sample as measured using agarose gel electrophoresis and ethidium bromide
staining. In some embodiments, the isolated rRNA sample is from an environmental or
metagenomic sample and the isolated rRNA is analyzed to determine the genera, species
or strains that were present in the sample, and therefore, the particular environment
from which the sample was collected. In some embodiments, the isolated rRNA sample
is analyzed (e.g., by next-generation sequencing, real-time reverse transcription
PCR, or another method, such as a method described elsewhere herein).
[0045] In some embodiments of any of the methods of the invention for generating a rRNA-depleted
sample or for isolating substantially all of the RNA molecules that, either alone
or in combination, exhibit the sequence of at least one full-length rRNA molecule,
the method uses any of the compositions comprising affinity-tagged antisense rRNA
molecules obtained using any of the methods described herein for generating affinity-tagged
antisense rRNA molecules.
[0046] In some embodiments of any of the methods for generating a rRNA-depleted sample or
for isolating substantially all of the rRNA that, either alone or in combination,
exhibits a sequence within at least one full-length rRNA molecule from an initial
sample, the composition comprising affinity-tagged antisense rRNA molecules that are
bound to a binding matrix comprises biotin as the affinity tag, wherein the biotin
is joined to at least about two to eight nucleobases per hundred nucleobases of the
antisense rRNA molecules, and the binding matrix comprises microparticles to which
streptavidin or avidin is attached as the affinity-tag-binding molecule. In some other
embodiments of this method, the affinity-tagged antisense rRNA molecules comprise
biotin as the affinity tag, wherein the biotin is joined to at least about two to
four nucleobases per hundred nucleobases of the antisense rRNA molecules, or to at
least about three to five nucleobases per hundred nucleobases of the antisense rRNA
molecules, or to at least about four to six nucleobases per hundred nucleobases of
the antisense rRNA molecules, or to at least about six to eight nucleobases per hundred
nucleobases of the antisense rRNA molecules.
[0047] In some embodiments of any of the methods of the invention for generating a rRNA-depleted
sample or for isolating substantially all of the rRNA that, either alone or in combination,
exhibits a sequence within at least one full-length rRNA molecule from an initial
sample, the initial sample contains degraded RNA and the method is used for generating
a rRNA-depleted sample for further analysis and use. For example, in some embodiments,
the initial sample is an FFPE sample that contains degraded RNA, and the method is
used for generating a rRNA-depleted sample that contains at least one non-rRNA RNA
molecule of interest, wherein the rRNA-depleted sample is used for analysis of expression
or relative expression of one or more RNA molecules, selected from among mRNA, miRNA,
ncRNA, piwiRNA, and RNA comprising the whole transcriptome (minus the rRNA) from one
or multiple cells, tissues, organs, or organisms, wherein the method of analysis is
selected from among microarray analysis (e.g., Affymetrix, NimbleGen Systems, Agilent
Systems), next-generation sequencing (or so-called "digital" analysis), including,
among others, next-gen RNA sequencing methods and techniques referred to by terms
such as "RNA-Seq," "digital mRNA profiling," "transcriptome profiling," and "ribosome
profiling"(e.g.,
Ingolia et al., Science 324: 218-223, 2009), screening analysis, and analysis using a diagnostic or theranostic assay, including
a diagnostic or theranostic assay comprising reverse-transcription qPCR, and a diagnostic
or theranostic assay comprising RNA amplification and/or detection of a sequencing
using a labeled probe.
[0048] In certain embodiments of any of the methods of the invention for using a composition
comprising affinity-tagged antisense rRNA molecules for generating a rRNA-depleted
sample or for isolating substantially all of the RNA molecules that, either alone
or in combination, exhibit the sequence of at least one full-length rRNA molecule,
the composition of affinity-tagged antisense rRNA molecules are generated from a first
species or organism, and used for generating a rRNA-depleted sample or for isolating
substantially all of the RNA molecules that, either alone or in combination, exhibit
a sequence within at least one full-length rRNA molecule from a second species or
organism different from the first species or organism (e.g., the first species or
organism is mouse or rat and the second species or organism is human). In some embodiments,
the affinity-tagged antisense rRNA molecules are generated from any at least one rRNA
molecule from the first species of organism wherein said affinity-tagged antisense
rRNA molecules hybridize with sequences exhibited within all of the at least one rRNA
molecules present in the initial sample from the second species or organism under
the conditions used in the method for generating a rRNA-depleted sample or for isolating
at least one rRNA molecule from the initial sample. In further embodiments, the first
species or organism is a non-human mammal (e.g., cat, dog, sheep, mouse, rat, monkey,
etc.) and the second species or organism is
homo sapiens. In particular embodiments, the first species or organism comprises non-
E.
coli bacteria, and the second species or organism is
E. coli. In some embodiments, the method for generating a rRNA-depleted sample or for isolating
substantially all of the RNA molecules that, either alone or in combination, exhibit
a sequence within at least one full-length rRNA molecule is performed using a metagenomic
or environmental sample containing multiple species or organisms. Thus, in some embodiments
wherein the composition comprising affinity-tagged antisense rRNA molecules corresponds
to at least one full-length prokaryotic rRNA molecule (e.g., generated from at least
one full-length rRNA molecule from
E. coli), the composition is used for generating a rRNA-depleted sample or for isolating substantially
all of the RNA molecules that, either alone or in combination, exhibit a sequence
within at least one full-length rRNA molecule comprising multiple rRNA molecules from
multiple species or organisms.
[0049] In some embodiments of any of the methods of the invention for generating a rRNA-depleted
sample or for isolating substantially all of the RNA molecules that, either alone
or in combination, exhibit the sequence of at least one full-length rRNA molecule,
instead of using the compositions comprising affinity-tagged antisense rRNA molecules,
the method uses compositions comprising affinity-tagged single-stranded DNA molecules
that, alone or in combination, are complementary to substantially all of the sequence
exhibited by the at least one full-length rRNA molecule selected from: 25S, 26S, 28S,
18S, 5.8S, and 5S eukaryotic cytoplasmic rRNA molecules, 12S and 16S eukaryotic mitochondrial
rRNA molecules, and 23S, 16S, and 5S prokaryotic rRNA molecules, wherein the affinity
tags are present at a ratio of at least about two to at least four affinity tags per
hundred nucleobases of the affinity-tagged single-stranded DNA molecules.
[0050] Word conducted during developments of the present invention found that the method
can be performed using samples wherein the initial sample comprises generally any
amount of total RNA molecules. In one embodiment, the amount of total RNA present
in the initial sample is between about 10 picograms and 50 nanograms. In another embodiment,
the amount of total RNA present in the initial sample is between about 50 nanograms
and one microgram. In still another embodiment, the amount of total RNA present in
the initial sample is between about one microgram and five micrograms. In some embodiments
of these methods, at least a portion of the RNA molecules in the initial sample are
highly fragmented (e.g., previously digested with an RNase enzyme or from older RNA
samples). In some embodiments of these methods, the RNA molecules in the initial sample
are from a paraffin-embedded sample (e.g., paraffin-embedded formalin-fixed sample).
In further embodiments of these methods, the affinity-tagged antisense RNA molecules
corresponds to the at least one rRNA molecules from the same species or organism (e.g.,
the affinity-tagged antisense RNA molecules correspond to the at least one rRNA molecule
from human cells or the affinity-tagged antisense RNA molecules correspond to the
at least one rRNA molecule from
E. coli cells). In certain embodiments of these methods wherein the affinity-tagged antisense
RNA molecules corresponds to the at least one rRNA molecule from human cells, the
at least one rRNA molecule is human 28S rRNA.
[0051] In some embodiments of any of the methods of the invention for generating a rRNA-depleted
sample or for isolating substantially all of the RNA molecules that, either alone
or in combination, exhibit the sequence of at least one full-length rRNA molecule,
the ratio of the affinity-tag-binding molecules to the affinity tags during the contacting
in step b) is at least 2 to 1 (e.g., 2:1, 3:1, 4:1, 5:1, ... or 10:1).
[0052] In certain embodiments of any of the methods of the invention for generating a rRNA-depleted
sample or for isolating substantially all of the RNA molecules that, either alone
or in combination, exhibit the sequence of at least one full-length rRNA molecule,
the initial sample comprising RNA molecules represents total RNA isolated from a cell
or tissue sample or from an environmental sample (e.g., from a cell line, a tissue
biopsy sample, a bodily fluid sample, a swab from a hospital surface, a water sample,
etc.). In some embodiments of these methods, the method further comprises providing
a control sample of RNA (e.g., comprising total RNA) from a cell or tissue sample,
and also performing the method using the control sample. In certain embodiments, the
control sample comprises total RNA from HeLa cells and/or from
E. coli cells.
[0053] In additional embodiments of any of the methods of the invention for generating a
rRNA-depleted sample or for isolating substantially all of the RNA molecules that,
either alone or in combination, exhibit the sequence of at least one full-length rRNA
molecule, the initial sample is substantially free of salts and/or organic liquids.
In other of these embodiments, the initial sample comprises RNase-free water and/or
TE buffer. In particular embodiments, the method further comprises treating the rRNA-depleted
sample or the isolated rRNA sample under conditions such that the RNA molecules present
in the sample are further purified (e.g., by further purification using ethanol, isopropanol
or ammonium acetate precipitation). In particular embodiments, the rRNA-depleted sample
or the isolated rRNA sample is used in methods for further analysis, such as for analysis
by next-gen sequencing, for preparing labeled target for microarray analysis, for
screening or diagnostic or theranostic analysis (e.g., using a plant, human, or animal,
screening, diagnostic or theranostic kit). In some embodiments, the nucleic acids
in the rRNA-depleted sample or the isolate rRNA sample is amplified prior to further
analysis. In other embodiments of these methods, the contacting in step b) is conducted
in the presence of an RNase inhibitor. In some embodiments, the compositions used
in the method further comprise RNase free water.
[0054] In further embodiments of any of the methods of the invention for generating a rRNA-depleted
sample or for isolating substantially all of the RNA molecules that, either alone
or in combination, exhibit the sequence of at least one full-length rRNA molecule,
the condition in step b) comprise incubating at a temperate of about 60-75 °C for
a first time period (e.g., 5-15 minutes) and incubating at about room temperature
for a second time period (e.g., 10-25 minutes). In some embodiments of these methods,
the conditions in step b) include the presence of hybridization buffer. In particular
embodiments of these methods, the conditions in step c) include at least occasional
mixing at room temperature and/or at 35-60 °C, or 25-70°C, or about 50°C. In further
embodiments of these methods, the binding matrix comprises a plurality of individual
particles (e.g., nanoparticle, magnetic particles, macroporous beads, etc.) In further
embodiments of these methods, the binding matrix comprises a binding column or a membrane.
In some embodiments of these methods, the affinity tags are selected from biotin,
avidin or streptavidin, digoxigenin, antibodies (or antibody fragments), and other
useful binding molecules. In certain embodiments of these methods, the affinity-tag-binding
molecules are selected from biotin, avidin or streptavidin, digoxigenin, antibodies
(or antibody fragments), and other useful binding molecules.
[0055] In some embodiments of the invention, one or more of the sequences in the at least
one rRNA molecules, or in one or more of the non-rRNA RNA molecules, or in one or
more other nucleic acid molecules present in the initial sample is amplified (e.g.,
using any appropriate method known in the art for RNA and/or DNA amplification, e.g.,
real-time PCR or reverse transcription-PCR, transcription-mediated amplification,
RNA amplification using a RiboMultiplier™ Kit, Epicentre Biotechnologies, Madison,
WI, strand-displacement amplification, LAMP, ICAN™, UCAN™ (TAKARA), rolling circle
amplification, etc.) either, prior to, or after generating the rRNA-depleted sample
or isolating the at least one rRNA molecule, respectively, using one of the methods
of the present invention for generating a rRNA-depleted sample or for isolating substantially
all of the RNA molecules that, either alone or in combination, exhibit the sequence
within at least one full-length rRNA molecule. In some of these embodiments, the sample
comprising the respective one or more amplified sequences of non-rRNA RNA molecules,
or rRNA molecules, and/or other nucleic acid molecules is used for further analysis.
[0056] In other embodiments, the present invention provides a composition comprising antisense
rRNA molecules corresponding to substantially all of at least one rRNA molecule selected
from: 25S, 26S, 28S, 18S, 5.8S, and 5S eukaryotic cytoplasmic rRNA molecules, 12S
and 16S eukaryotic mitochondrial rRNA molecules, and 23S, 16S, and 5S prokaryotic
rRNA molecules, wherein the antisense rRNA molecules comprise affinity-tags, wherein
the composition is substantially free of non-rRNA RNA molecules comprising the affinity
tags. In certain embodiments, the composition further comprises a binding matrix,
wherein the binding matrix comprises affinity-tag-binding molecules (e.g., microparticles).
In particular embodiments, the antisense rRNA molecules are bound to the binding matrix
via the affinity-tag - affinity tag binding molecule interaction.
[0057] In some embodiments, the present invention provides compositions comprising: a) a
composition comprising antisense rRNA molecules corresponding to substantially all
of at least one rRNA molecule selected from: 25S, 26S, 28S, 18S, 5.8S, and 5S eukaryotic
cytoplasmic rRNA molecules, 12S and 16S eukaryotic mitochondrial rRNA molecules, and
23S, 16S, and 5S prokaryotic rRNA molecules, wherein the antisense rRNA molecules
comprise affinity tags, and b) non-rRNA RNA molecules that are affinity-tag free.
In certain embodiments, the compositions further comprise a binding matrix comprising
affinity-tag-binding molecules.
[0058] In particular embodiments, the present invention provides compositions comprising
an rRNA-depleted sample comprising non-rRNA RNA molecules, wherein the composition
is substantially free of rRNA sequences exhibited by at least one rRNA molecule selected
from: 25S, 26S, 28S, 18S, 5.8S, and 5S eukaryotic cytoplasmic rRNA molecules, 12S
and 16S eukaryotic mitochondrial rRNA molecules, and 23S, 16S, and 5S prokaryotic
rRNA molecules.
[0059] In further embodiments, the present invention provides compositions comprising antisense
rRNA molecules corresponding to substantially all of at least one rRNA molecule selected
from: 25S, 26S, 28S, 18S, 5.8S, and 5S eukaryotic cytoplasmic rRNA molecules, 12S
and 16S eukaryotic mitochondrial rRNA molecules, and 23S, 16S, and 5S prokaryotic
rRNA molecules, wherein the antisense rRNA molecules comprise affinity-tags, and wherein
the composition is substantially free of non-rRNA RNA molecules comprising the affinity
tags.
[0060] In other embodiments, the present invention provides compositions comprising: a)
compositions comprising antisense rRNA molecules corresponding to substantially all
of at least one rRNA molecule selected from: 25S, 26S, 28S, 18S, 5.8S, and 5S eukaryotic
cytoplasmic rRNA molecules, 12S and 16S eukaryotic mitochondrial rRNA molecules, and
23S, 16S, and 5S prokaryotic rRNA molecules, wherein the antisense rRNA molecules
comprise affinity-tags, and b) non-rRNA RNA molecules that are affinity-tag free.
In further embodiments, the compositions further comprise a binding matrix comprising
affinity-tag-binding molecules.
[0061] In some embodiments, the present invention provides compositions comprising: an rRNA-depleted
sample comprising non-rRNA RNA molecules, wherein the composition is substantially
free of rRNA sequences exhibited by at least one rRNA molecule selected from among
25S, 26S, 28S, 18S, 5.8S, and 5S eukaryotic cytoplasmic rRNA molecules, 12S and 16S
eukaryotic mitochondrial rRNA molecules, and 23S, 16S, and 5S prokaryotic rRNA molecules.
In some particular embodiments, the compositions are substantially free of rRNA sequences
exhibited by two, three, or four rRNA molecules selected from among 25S, 26S, 28S,
18S, 5.8S, and 5S eukaryotic cytoplasmic rRNA molecules. In some particular embodiments,
the compositions are substantially free of rRNA sequences exhibited by both 12S and
16S eukaryotic mitochondrial rRNA molecules.
[0062] In certain embodiments, the present invention provides compositions comprising: a)
compositions comprising antisense rRNA molecules corresponding to substantially all
of at least one rRNA molecule selected from: 25S, 26S, 28S, 18S, 5.8S, and 5S eukaryotic
cytoplasmic rRNA molecules, 12S and 16S eukaryotic mitochondrial rRNA molecules, and
23S, 16S, and 5S prokaryotic rRNA molecules, wherein the antisense rRNA molecules
comprise affinity-tags, and wherein the antisense rRNA molecules are from a first
species or organism, and b) non-rRNA RNA molecules that are affinity-tag free, wherein
the non-rRNA RNA molecules are from a second species or organism different from the
first species or organism. In other embodiments, the compositions further comprise
a binding matrix comprising affinity-tag-binding molecules.
[0063] In some embodiments, the present invention provides compositions comprising: a) affinity-tagged
antisense rRNA molecules corresponding to substantially all of at least one rRNA molecule
selected from: 25S, 26S, 28S, 18S, 5.8S, and 5S eukaryotic cytoplasmic rRNA molecules,
12S and 16S eukaryotic mitochondrial rRNA molecules, and 23S, 16S, and 5S prokaryotic
rRNA molecules, wherein the affinity tags are present on the antisense rRNA molecules
at a ratio of at least about two to eight affinity tags per hundred nucleobases of
the antisense rRNA molecules, and b) non-rRNA RNA molecules that are affinity-tag
free. In some embodiments, composition comprises affinity-tagged antisense rRNA molecules
from a first species or organism and non-rRNA RNA molecules that are affinity-tag
free from a second species or organism. In certain embodiments, the compositions further
comprise a binding matrix comprising affinity-tag-binding molecules.
[0064] In additional embodiments, the present invention provides compositions comprising:
an rRNA-depleted sample comprising non-rRNA RNA molecules, wherein the composition
is at least about 99.0% free of rRNA sequences exhibited by at least one rRNA molecule
selected from: 25S, 26S, 28S, 18S, 5.8S, and 5S eukaryotic cytoplasmic rRNA molecules,
12S and 16S eukaryotic mitochondrial rRNA molecules, and 23S, 16S, and 5S prokaryotic
rRNA molecules.
[0065] The present invention provides kits or systems for performing any of the methods
of the invention, including any of the steps of said methods.
[0066] For example, in some further embodiments, the present invention provides kits and
systems comprising: a) a first component comprising a composition comprising antisense
rRNA molecules complementary to substantially all of the sequence exhibited by the
at least one rRNA molecule selected from: 25S, 26S, 28S, 18S, 5.8S, and 5S eukaryotic
cytoplasmic rRNA molecules, 12S and 16S eukaryotic mitochondrial rRNA molecules, and
23S, 16S, and 5S prokaryotic rRNA molecules, wherein the antisense rRNA molecules
comprise affinity-tags, and wherein the composition is substantially free of non-rRNA
RNA molecules comprising the affinity tags; and b) at least one second component selected
from the group consisting of: i) a binding matrix comprising affinity-tag-binding
molecules; ii) a control sample comprising total RNA from a cell or tissue sample;
iii) a solution comprising an RNase inhibitor; iv) a binding matrix wash solution
that is RNase-free; v) a volume of RNase- free water; vi) a hybridization buffer;
vii) a total RNA purification reagent; and viii) a binding matrix resuspension solution,
wherein said solution is RNase-free. In certain embodiments, the second component
is the binding matrix. In further embodiments, the second component is the control
sample. In some embodiments, the second component is the solution comprising an RNase
inhibitor.
[0067] In some embodiments, the present invention provides kits and systems comprising:
a) a first component comprising a composition comprising antisense rRNA molecules
complementary to substantially all of the sequence exhibited by the at least one rRNA
molecule selected from: 25S, 26S, 28S, 18S, 5.8S, and 5S eukaryotic cytoplasmic rRNA
molecules, 12S and 16S eukaryotic mitochondrial rRNA molecules, and 23S, 16S, and
5S prokaryotic rRNA molecules, wherein the antisense rRNA molecules comprise affinity-tags,
and wherein the composition is substantially free of non-rRNA RNA molecules comprising
the affinity tags; and b) at least one second component selected from the group consisting
of: i) a binding matrix comprising affinity-tag-binding molecules; ii) a control sample
comprising total RNA from a cell or tissue sample; iii) a solution comprising an RNase
inhibitor; iv) a binding matrix wash solution that is RNase-free; v) a volume of RNase-free
water; vi) a hybridization buffer; and vii) a total RNA purification reagent.
[0068] In additional embodiments, the present invention provides kits and systems comprising:
a) a first component comprising a composition comprising affinity-tagged antisense
rRNA molecules complementary to substantially all of the sequence exhibited by the
at least one rRNA molecule selected from: 25S, 26S, 28S, 18S, 5.8S, and 5S eukaryotic
cytoplasmic rRNA molecules, 12S and 16S eukaryotic mitochondrial rRNA molecules, and
23S, 16S, and 5S prokaryotic rRNA molecules, wherein the antisense rRNA molecules
comprise affinity tags, wherein the affinity tags are present on the antisense rRNA
molecules at a ratio of at least about two to eight affinity tags per hundred nucleobases
of the antisense rRNA molecules, and wherein the composition is substantially free
of non-rRNA RNA molecules comprising the affinity tags; and b) at least one second
component selected from the group consisting of: i) a binding matrix comprising affinity-tag-binding
molecules; ii) a control sample comprising total RNA from a cell or tissue sample;
iii) a solution comprising an RNase inhibitor; iv) a binding matrix wash solution
that is RNase-free; v) a volume of RNase-free water; vi) a hybridization buffer; and
vii) a total RNA purification reagent.
[0069] In some embodiments of a kit or system, the affinity-tags are present in the composition
of affinity-tagged antisense rRNA molecules at a ratio of at least about two to about
eight affinity tags per every 100 nucleobases of the antisense rRNA molecules (e.g.,
at least 2:100, 3:100, 4:100, 5:100, 6:100, 7:100, or 8:100). In certain embodiments,
the affinity tag is associated with only one nucleobase of the antisense rRNA molecules.
In some of these embodiments, the affinity-tags are associated with only one type
of nucleobase selected from: adenine (A), cytosine (C), guanine (G) and uracil (U).
[0070] In other embodiments of a kit or system, the compositions comprising affinity-tagged
antisense rRNA molecules correspond to at least 95.0% of all of the at least one rRNA
sequence (e.g., 95.0% ... 95.5% ... 96.0% ... 96.5% ... 97.0% ... 97.5% ... 98% ...
98.5% ... 99.0% ... 99.5% ... 99.9 ... or 100% of the at least one rRNA molecule (e.g.,
wherein the compositions comprise antisense rRNA molecules that exhibit, alone or
in combination, sequences corresponding to all of the full-length rRNA sequence for
a particular rRNA molecule).
BRIEF DESCRIPTION OF THE DRAWINGS
[0071] The foregoing summary and description is better understood when read in conjunction
with the accompanying drawings which are included by way of example and not by way
of limitation.
Figure 1A shows an ethidium bromide stained agarose gel containing the following PCR
amplicons: Lane M - DNA molecular weight ladder; Lane 1 - 300 ng of PCR amplicon for
human 18S rRNA; Lane 2 - 300 ng of PCR amplicon for human 5.8S rRNA; Lane 3 - 300
ng of PCR amplicon for human 5S rRNA; Lane 4 - 300 ng of PCR amplicon for E. coli 23S rRNA 5' segment; Lane 5 - 300 ng of PCR amplicon for E. coli 23S rRNA 3' segment; Lane 6 - 300 ng of PCR amplicon for E. coli 16S rRNA; and Lane 7 - 300 ng of PCR amplicon for E. coli 5SS rRNA
Figure 1B shows an ethidium bromide stained agarose gel containing the following antisense
sequences: Lane M - DNA molecular weight ladder; Lane 1-300 ng of human antisense
18S rRNA; Lane 2 - 300 ng of human antisense 5.8S rRNA; Lane 3 - 300 ng of human antisense
5S rRNA; Lane 4 - 300 ng of E. coli antisense 23S rRNA 5' segment; Lane 5 - 300 ng of E. coli antisense 23S rRNA 3' segment; Lane 6 - 300 ng of E. coli antisense 16S rRNA; and Lane 7 - 300 ng of E. coli antisense 5S rRNA.
Figure 1C shows an ethidium bromide stained agarose gel containing the following lanes:
Lane M - DNA molecular weight ladder; Lane 1 - 300 ng of T7-based 28S biotinylated
antisense rRNA; and Lane 2 - 300 ng of SP6-based 28S biotinylated antisense rRNA.
Figure 2A shows the following: Lane M - DNA molecular weight ladder; Lane 1 - Biotinylated
antisense rRNA following purification with microspheres directly on column; Lane 2
- Biotinylated antisense rRNA following purification from supernatant after removal
of microspheres; and Lane 3 - Biotinylated antisense rRNA control.
Figure 2B shows the following: Lane M - DNA molecular weight ladder; Lane 1 - Biotinylated
antisense rRNA control; Lane 2 - Biotinylated antisense rRNA following purification
after 20 µl of microspheres; Lane 3 - Biotinylated antisense rRNA following purification
after 2x 20 µl of microspheres; and Lane 4-Biotinylated antisense rRNA following purification
after 40 µl of microspheres
Figure 3A shows the following: Lane M - DNA molecular weight ladder; Lane 1 -10% biotinylated
antisense rRNA minus microspheres; Lane 2 - 10% biotinylated antisense rRNA plus 20
µl microspheres; Lane 3 - 10% biotinylated antisense rRNA plus 40 µl microspheres;
Lane 4 - 20% biotinylated antisense rRNA minus microspheres; Lane 5 - 20% biotinylated
antisense rRNA plus 20 µl microspheres; and Lane 6 - 20% biotinylated antisense rRNA
plus 40 µl microspheres.
Figure 3B shows the following: Lane M - DNA molecular weight ladder; Lane 1 - 35%
biotinylated antisense rRNA minus streptavidin microspheres; Lane 2-35% biotinylated
antisense rRNA plus streptavidin microspheres; Lane 3 - 50% biotinylated antisense
rRNA minus streptavidin microspheres; Lane 4 - 50% biotinylated antisense rRNA plus
streptavidin microspheres; Lane 5 - 60% biotinylated antisense rRNA minus streptavidin
microspheres; and Lane 6 - 60% biotinylated antisense rRNA plus streptavidin microspheres.
Figure 3C shows the following: Lane M - DNA molecular weight ladder; Lane 1 - PCR
of 35% biotinylated antisense rRNA minus streptavidin microspheres; Lane 2 - PCR of
35% biotinylated antisense rRNA plus streptavidin microspheres; Lane 3 - PCR of 50%
biotinylated antisense rRNA minus streptavidin microspheres; Lane 4 - PCR of 50% biotinylated
antisense rRNA plus streptavidin microspheres; Lane 5 - PCR of 60% biotinylated antisense
rRNA minus streptavidin microspheres; and Lane 6 - PCR of 60% biotinylated antisense
rRNA plus streptavidin microspheres. Panel 1 shows 5'-23S rRNA primers. Panel 2 shows
3'-23S rRNA primers. Panel 3 shows 5'-16S rRNA primers. Panel 4 shows 3'-16S rRNA
primers.
Figure 4 shows the following: Lane M - DNA molecular weight ladder; Lane 1 - L. plantarum total RNA plus E. coli biotinylated antisense rRNA mixture subtraction; and Lane 2 - L. plantarum total RNA minus E. coli biotinylated antisense rRNA mixture subtraction.
Figure 5, panels A-D, showing the following: Lane M - DNA molecular weight ladder;
Lanes 1, 2 - PCR result for 50 ng input E. coli total RNA plus subtraction; Lanes 3,4 - PCR result for 100 ng input E. coli total RNA plus subtraction; Lanes 5, 6 - PCR result for 500 ng input E. coli total RNA plus subtraction; Lanes 7,8 - PCR result for 1000 ng input E. coli total RNA plus subtraction; Lanes 9,10 - PCR result for 2500 ng input E. coli total RNA plus subtraction; Lanes 11,12 - PCR result for 5000 ng input E. coli total RNA plus subtraction; Lanes 13,14 - PCR result for 500 ng input E. coli total RNA minus subtraction; and Lane 15 - PCR result for no template control reaction.
Panel 5A shows 5'-23S rRNA RT-PCR. Panel 5B shows 5'-16S rRNA RT-PCR. Panel 5C shows
5S rRNA RT-PCR. Panel 5D shows ompA mRNA RT-PCR.
Figure 6A shows the following: Lane M - DNA molecular weight ladder; Lane 1 - 300
ng intact E. coli total RNA; and Lane 2 - 300 ng fragmented E. coli total RNA.
Figure 6B shows the following: Lane M - DNA molecular weight ladder; Lane 1 - Intact
E. coli total RNA minus subtraction; Lane 2 - Intact E. coli total RNA plus subtraction; Lane 3 - Fragmented E. coli total RNA minus subtraction; and Lane 4 - Fragmented E. coli total RNA plus subtraction. Panel 1 shows an ethidium bromide stained agarose gel.
Panel 2 shows ompA mRNA Northern blot. Panel 3 shows 23S rRNA Northern blot. Panel 4 shows 16S rRNA
Northern blot. Panel 5 shows 5S rRNA Northern blot.
Figure 6C shows the following: Lane M - DNA molecular weight ladder; Lane 1 - Intact
E. coli total RNA minus subtraction; Lane 2 - Intact E. coli total RNA plus subtraction; Lane 3 - Fragmented E. coli total RNA minus subtraction; and Lane 4 - Fragmented E. coli total RNA plus subtraction. Panel 1 shows ompA RT-PCR. Panel 2 shows 23S rRNA 5'
RT-PCR. Panel 3 shows 16S rRNA 5' RT-PCR. Panel 4 shows 5S rRNA RT-PCR.
Figure 7A shows the following: Lane M - DNA molecular weight ladder; Lane 1 - biotinylated
antisense 28S rRNA; Lane 2 - biotinylated antisense 18S rRNA; Lane 3 - Human total
RNA; Lane 4 - Human total RNA plus biotinylated antisense 28S rRNA; Lane 5 - Human
total RNA plus biotinylated antisense 18S rRNA; Lane 6 - Mouse total RNA; Lane 7 -
Mouse total RNA plus biotinylated antisense 28S rRNA; Lane 8 - Mouse total RNA plus
biotinylated antisense 18S rRNA; Lane 9 - Rat total RNA; Lane 10 - Rat total RNA plus
biotinylated antisense 28S rRNA; and Lane 11 - Rat total RNA plus biotinylated antisense
18S rRNA.
Figure 7B shows the following: Lane M - DNA molecular weight ladder; Lane 1 - Human
total RNA (HeLa) minus subtraction; Lane 2 - Human total RNA (HeLa) plus subtraction;
Lane 3 - Mouse total RNA (3T3) minus subtraction; Lane 4 - Mouse total RNA (3T3) minus
subtraction; Lane 5 - Rat total RNA (NRK) minus subtraction; and Lane 6 - Rat total
RNA (NRK) plus subtraction.
Figure 8 shows the following: Lane M - DNA molecular weight ladder; Lane 1 - PCR result
for 100 ng input human total RNA plus subtraction; Lane 2 - PCR result for 500 ng
input human total RNA plus subtraction; Lane 3 - PCR result for 5.0 µg input human
total RNA plus subtraction; Lane 4 - PCR result for 500 ng input human total RNA minus
subtraction; and Lane 5 - PCR result for no template control reaction. Panel A shows
5'28S rRNA RT-PCR. Panel B shows 3' 28S rRNA RT-PCR. Panel C shows 5' 18S rRNA RT-PCR.
Panel D shows 3' 18S rRNA RT-PCR. Panel E shows 5.8S rRNA RT-PCR. Panel F shows 5S
rRNA RT-PCR. Panel G shows 5' GAPDH mRNA RT-PCR.
Figure 9A shows the following: Lane M - DNA molecular weight ladder; Lane 1 - Intact
Hela total RNA minus subtraction; Lane 2 - Intact HeLa total RNA plus subtraction;
Lane 3 - Fragmented (1 minute) Hela total RNA minus subtraction; Lane 4 - Fragmented
(1 minute) Hela total RNA plus subtraction; Lane 5-Fragmented (2 minute) Hela total
RNA minus subtraction; Lane 6 - Fragmented (2 minute) Hela total RNA plus subtraction;
Lane 7 - Fragmented (3 minute) Hela total RNA minus subtraction; and Lane 8 - Fragmented
(3 minute) Hela total RNA plus subtraction.
Figure 9B shows the following: Lane 1 - PCR result for intact HeLa total RNA minus
subtraction; Lane 2 - PCR result for intact HeLa total RNA plus subtraction; Lane
3 - PCR result for fragmented (1 minute) HeLa total RNA minus subtraction; Lane 4
- PCR result for fragmented (1 minute) HeLa total RNA plus subtraction; Lane 5 - PCR
result for fragmented (2 minute) HeLa total RNA minus subtraction; Lane 6 - PCR result
for fragmented (2 minute) HeLa total RNA plus subtraction; Lane 7 - PCR result for
fragmented (3 minute) HeLa total RNA minus subtraction; Lane 8 - PCR result for fragmented
(3 minute) HeLa total RNA plus subtraction; and Lane 9 - PCR result for no template
control reaction. Panel 1 shows 5' 28S rRNA. Panel 2 shows 5' 18S rRNA. Panel 3 shows
5.8S rRNA. Panel 4 shows 5S rRNA. Panel 5 shows 5' GAPDH mRNA
Figure 10A shows the following: Lane M - DNA molecular weight ladder; Lane 1 - Intact
E. coli total RNA minus subtraction; Lane 2 - Intact E. coli total RNA plus subtraction; Lane 3 - Fragmented E. coli total RNA minus subtraction; and Lane 4 - Fragmented E. coli total RNA plus subtraction. Panel 1 shows ompA mRNA. Panel 2 shows 23S rRNA. Panel
3 shows 16S rRNA. Panel 4 shows 5S rRNA.
Figure 10B shows the following: Lane M - DNA molecular weight ladder; Lane 1 - PCR
result for intact E. coli total RNA minus subtraction; Lane 2 - PCR result for intact E. coli total RNA plus subtraction; Lane 3 - PCR result for fragmented E. coli total RNA minus subtraction; and Lane 4 - PCR result for fragmented E. coli total RNA plus subtraction. Panel 1 shows ompA mRNA. Panel 2 shows 23S rRNA. Panel
3 shows 16S rRNA. Panel 4 shows 5S rRNA.
Figure 11A shows the following: Lane M - DNA molecular weight ladder; Lane 1 - Intact
HeLa total RNA minus subtraction; Lane 2 - Intact HeLa total RNA plus subtraction;
Lane 3 - Fragmented HeLa total RNA minus subtraction; and Lane 4 - Fragmented HeLa
total RNA plus subtraction. Panel 1 shows results of an exemplary method of the present
invention. Panel 2 shows the results of the OLIGOTEX method.
Figure 11B shows the following: Lane M - DNA molecular weight ladder; Lane 1 - PCR
results for intact HeLa total RNA minus subtraction; Lane 2 - PCR results for intact
HeLa total RNA plus subtraction; Lane 3 - PCR results for fragmented HeLa total RNA
minus subtraction; and Lane 4 - PCR results for fragmented HeLa total RNA plus subtraction.
Panel 1 shows 5'- 28S rRNA. Panel 2 shows 3'- 28S rRNA. Panel 3 shows 5'- 18S rRNA.
Panel 4 shows 3'- 18S rRNA. Panel 5 shows 5.8S rRNA. Panel 6 shows 5S rRNA.
Figure 11C shows the following: Lane M - DNA molecular weight ladder; Lane 1 - PCR
results for intact HeLa total RNA minus subtraction; Lane 2 - PCR results for intact
HeLa total RNA plus subtraction; Lane 3 - PCR results for fragmented HeLa total RNA
minus subtraction; and Lane 4 - PCR results for fragmented HeLa total RNA plus subtraction.
Panel 1 shows 5'- GAPDH. Panel 2 shows 3'- GAPDH. Panel 3 shows 5'- PGK1. Panel 4
shows 3' - PGK1.
Figure 11D shows the following: Lane M - DNA molecular weight ladder; Lane 1 - PCR
results for intact HeLa total RNA minus subtraction; Lane 2 - PCR results for intact
HeLa total RNA plus subtraction; Lane 3 - PCR results for fragmented HeLa total RNA
minus subtraction; and Lane 4 - PCR results for fragmented HeLa total RNA plus subtraction.
Panel 1 shows Poly A- RNA #1. Panel 2 shows Poly A- RNA #3. Panel 3 shows Poly A-
RNA #15. Panel 4 shows Bimorphic RNA #5.
Figure 12A shows the following: Lane M - DNA molecular weight ladder; Lane 1 - Intact
HeLa total RNA minus subtraction; Lane 2 - Intact HeLa total RNA plus subtraction;
Lane 3 - Fragmented HeLa total RNA minus subtraction; and Lane 4 - Fragmented HeLa
total RNA plus subtraction.
Figure 12B shows Lane M - DNA molecular weight ladder; Lane 1 - PCR results for intact
HeLa total RNA minus subtraction; Lane 2 - PCR results for intact HeLa total RNA plus
subtraction; Lane 3 - PCR results for fragmented HeLa total RNA minus subtraction;
and Lane 4 - PCR results for fragmented HeLa total RNA plus subtraction; Panel 1 -
5'- 28S rRNA; Panel 2 - 3'- 28S rRNA; Panel 3 - 5'- 18S rRNA; Panel 4 - 3'- 18S rRNA;
Panel 5 - 5.8S rRNA; and Panel 6 - 5S rRNA.
Figure 12C shows Lane M - DNA molecular weight ladder; Lane 1 - PCR results for intact
HeLa total RNA minus subtraction; Lane 2 - PCR results for intact HeLa total RNA plus
subtraction; Lane 3 - PCR results for fragmented HeLa total RNA minus subtraction;
Lane 4 - PCR results for fragmented HeLa total RNA plus subtraction; Panel 1 - 5'-
GAPDH; and Panel 2 - 3'- GAPDH.
DEFINITIONS
[0072] It is to be understood that the terminology used herein is for the purpose of describing
particular embodiments only, and is not intended to be limiting. Further, unless defined
otherwise, all technical and scientific terms used herein have the same meaning as
commonly understood by one of ordinary skill in the art to which this invention pertains.
In describing and claiming the present invention, the following terminology and grammatical
variants will be used in accordance with the definitions set forth below.
[0073] When the terms "for example", "e.g.", "such as", "include", "including" or variations
thereof are used herein, these terms will not be deemed to be terms of limitation,
and will be interpreted to mean "but not limited to" or "without limitation."
[0074] As used herein, a "composition comprising affinity-tagged antisense rRNA molecules"
means "a composition comprising RNA molecules that, either alone or in combination,
exhibit one or more sequences that are complementary to substantially all of the sequence
exhibited by the at least one full-length rRNA molecule, wherein at least a portion
of the nucleotides in said RNA molecules are joined to an affinity tag."
[0075] As used herein, the phrase "a composition comprising antisense rRNA molecules corresponding
to substantially all of at least one rRNA molecule" or "a composition comprising antisense
rRNA molecules corresponding to substantially all of" (or "all of the sequence exhibited
by") "at least one rRNA molecule" or "a composition comprising antisense rRNA molecules
that, alone or in combination, are complementary to substantially all" (or "all of
the sequence") "of at least one full-length rRNA molecule" refers to a composition
comprising affinity-tagged antisense rRNA molecules that exhibit, that will specifically
hybridize with or anneal with or complex with, at least 95% of the RNA molecules or
fragments of RNA molecules that exhibit a sequence of a particular full-length rRNA
molecule. Preferably, the antisense rRNA molecules in the composition will specifically
hybridize with at least 95% of the molecules of a particular rRNA molecule or fragments
thereof in a sample, such that, when affinity-tagged, said antisense rRNA molecules
can be used with a binding matrix to remove at least about 95% of the RNA molecules
or fragments of RNA molecules that exhibit a sequence of said particular rRNA molecule
from the sample. It is not necessary that the antisense nucleic acid sequences exhibited
in the composition share 95% sequence identity with the complement of a particular
rRNA molecule, but instead, it is only necessary that the antisense nucleic acid sequences
are able to specifically hybridize, anneal or complex with at least 95% of the RNA
molecules or fragments of RNA molecules that exhibit a sequence of said particular
rRNA molecule. The antisense nucleic acid sequences in the composition do not need
to be present in a single nucleic acid strand (although they may be), but instead,
the composition comprising antisense rRNA molecule can consist of antisense rRNA fragments
that will collectively hybridize with at least 95% of the RNA molecules or fragments
of RNA molecules that exhibit a sequence of a particular rRNA molecule. In certain
embodiments, the antisense nucleic acid sequences will specifically hybridize with
at least 95% ... 96% ... 97% ... 98% ... 98.5% ... 99.0% ... 99.3% ... 99.5% ... 99.8%,
99.0% ...99.5% ... 99.9 ... or 100% of the RNA molecules or fragments of RNA molecules
that exhibit the sequence of a particular rRNA molecule.
[0076] A used herein, the phrase "an rRNA-depleted sample that comprises substantially all
of said at least one non-rRNA RNA molecule of interest present in said initial sample,"
refers to a purified sample that originally contained rRNA molecules and a first amount
of the at least one non-rRNA RNA molecule of interest and that has been purified by
removing a certain amount of rRNA molecules, while retaining at least 90% of said
first amount of said at least one non-rRNA RNA molecule of interest. In certain embodiments,
at least 91% ... 93% ... 96% ... 97% ... 98% ... 98.5% ... 99.0% ... 99.3% ... 99.5%
... 99.8% ..., or 99.9% of said first amount of said at least one non-rRNA RNA molecule
of interest is present in the rRNA-depleted sample. Those with knowledge in the art
will know or easily find methods for assaying for the first amount of the at least
one non-rRNA RNA molecule of interest in the initial sample and assaying for the amount
of the at least one non-rRNA RNA molecule of interest remaining in the rRNA-depleted
sample, and using said information to calculate the percentage of said first amount
of said at least one non-rRNA RNA molecule of interest that is present in the rRNA-depleted
sample. For example, in one embodiment, the percentage of the at least one non-rRNA
RNA molecule of interest remaining in the rRNA-depleted sample is determined based
on the amounts of the at least one non-rRNA RNA molecule of interest in the initial
sample and in the rRNA-depleted sample as determined using reverse transcription real-time
PCR (also called "RT-qPCR").
[0077] A used herein, the phrase "an isolated rRNA sample that is substantially free of
the non-rRNA RNA molecules present in the initial sample" refers to a purified sample
that initially contained non-rRNA RNA molecules and a first amount of the at least
one rRNA molecule and that has been purified by removing a certain amount of the non-rRNA
RNA molecules, while retaining at least 90% of said first amount of said at least
one rRNA molecule. In certain embodiments, at least >90% ..., >95% ..., >98% ...,
>99% ..., >99.8% ..., or >99.9% of said first amount of said at least one rRNA molecule
is present in the isolated rRNA sample. In certain embodiments, at least >90% ...,
>95% ..., >98% ..., >99% ..., >99.8% ..., or >99.9% of the non-rRNA RNA molecules
that were present in the initial sample are not present in the isolated rRNA sample
(e.g., wherein the amounts of the at least one rRNA molecule and/or of the non-rRNA
molecules are determined using RT-qPCR as described above).
[0078] As used herein, the phrase "substantially free of RNA molecules that exhibit sequences
of the at least one rRNA molecule" refers to a purified sample wherein 5% or less
of all the molecules present in the initial sample that exhibited a nucleic acid sequence
from said at least one rRNA molecule are still present in the rRNA-depleted sample.
In certain embodiments, 5% ... 4% ... 3% ... 2% ... 1.5% ... 1.0% ... 0.5% ... or
0.1% or less of all the molecules present in the initial sample that exhibited a nucleic
acid sequence from a particular rRNA molecule are still present in the purified sample.
Those with knowledge in the art will know or easily find methods for assaying for
the amounts of RNA molecules that exhibit sequences of the at least one rRNA molecule
that are present in the initial sample and in the rRNA-depleted sample. For example,
in one embodiment, the percentage of RNA molecules that exhibit sequences of the at
least one rRNA molecules is determined based on the amounts of the RNA molecules that
exhibit sequences of the at least one rRNA molecule in the initial sample and in the
rRNA-depleted sample as determined using reverse transcription real-time PCR (also
called "RT-qPCR").
[0079] As used herein, the phrase "substantially free of non-rRNA RNA molecules comprising
affinity tags," refers to a composition wherein 2% or less of all the affinity- tagged
nucleic acid sequences present are non-rRNA RNA molecules having affinity tags. In
certain embodiments, 2% ... 1.5% ... 1.0% ... 0.5% ... 0.1% or less of all the affinity-tagged
nucleic acid molecules present are non-rRNA RNA molecules having affinity tags.
[0080] As used herein, the terms "an rRNA-depleted sample" or "a sample that is substantially
free of rRNA molecules" is sometimes referred to herein as "a rRNA subtracted sample"
or "a subtracted sample," and the "methods for generating rRNA-depleted samples" or
the "methods for isolating rRNA from samples" are sometimes referred to herein as
"methods for rRNA subtraction" or, more simply, as "rRNA subtraction." The term "rRNA
subtraction" herein shall mean and refer to "a method for generating a rRNA-depleted
sample or a method for isolating rRNA from a sample." Similarly, when a form of the
verb "to subtract" is used herein, it shall mean "a method or the process of performing
a method for generating a rRNA-depleted samples or for isolating rRNA from a sample"
and the term "subtracted" herein shall mean or refer to the rRNA-depleted state of
the sample after performing the method or process.
[0081] As used herein, the phrase "binding matrix" refers to any type of substrate, whether
porous or non-porous, that will bind affinity-tagged nucleic acid molecules such that
affinity-tagged nucleic acid molecules, and the sequences they are hybridized to,
can can be preferentially removed from a sample. Affinity-tag-binding molecules are
associated with the binding matrix to allow the binding matrix to bind affinity-tagged
nucleic acid molecules. Examples of such binding matrices include, but are not limited
to, nylon membranes or particles, silica membranes or particles, cellulose acetate
membranes or particles, membranes or particles composed of silica and Fe
2O
3, and other similar membranes, fibers, coated plates, solid supports, and particles.
[0082] As used herein, a "specific binding pair" refers to two molecules that have affinity
for and "bind" to each other under certain conditions, referred to as "binding conditions."
Biotin and streptavidin or avidin are examples of a "specific binding pair" or "affinity
binding molecules," but the invention is not limited to use of this particular specific
binding pair. In many embodiments of the present invention, one member of a particular
specific binding pair is referred to as the "affinity tag molecule" or the "affinity
tag" and the other as the "affinity-tag-binding molecule" or the "affinity tag binding
molecule." For example, but without limitation, in some embodiments, biotin is referred
to as the affinity tag or affinity tag molecule, and a streptavidin or avidin molecule,
whether it is free, attached to a surface, attached to another molecule, or labeled
with a detectable molecule such as a dye, is referred to as the affinity-tag-binding
molecule. In other embodiments, streptavidin is the affinity tag and biotin is the
affinity-tag-binding molecule, since streptavidin and biotin function together as
a specific binding pair or as affinity binding molecules. A wide variety of other
specific binding pairs or affinity binding molecules, including both affinity tag
molecules and affinity-tag-binding molecules, are known in the art (e.g., see
U.S. Pat. No. 6,562,575), which can be used in the present invention. For example, an antigen (which itself
may be an antibody) and an antibody, including a monoclonal antibody, that binds the
antigen is a specific binding pair. Also, an antibody and an antibody binding protein,
such as
Staphylococcus aureus Protein A, can be employed as a specific binding pair. Other examples of specific
binding pairs include, but are not limited to, a carbohydrate moiety which is bound
specifically by a lectin and the lectin; a hormone and a receptor for the hormone;
and an enzyme and an inhibitor of the enzyme. Usually, molecules that comprise a specific
binding pair interact with each other through non-covalent bonds such as hydrogen-bonding,
hydrophobic interactions (including stacking of aromatic molecules), van der Waals
forces, and salt bridges. Without being bound by theory, it is believed in the art
that these kinds of non-covalent bonds result in binding, in part due to complementary
shapes or structures of the molecules involved in the binding pair. The term "binding"
according to the invention refers to the interaction between an affinity binding molecules
or specific binding pairs (e.g., between biotin as an affinity tag molecule and streptavidin
as an affinity-tag-binding molecule) as a result of non-covalent bonds, such as, but
not limited to, hydrogen bonds, hydrophobic interactions, van der Waals bonds, and
ionic bonds. Based on the definition for "binding," and the wide variety of affinity
binding molecules or specific binding pairs, it is clear that "binding conditions"
vary for different specific binding pairs. Those skilled in the art can easily determine
conditions whereby, in a sample, binding occurs between the affinity binding molecules.
In particular, those skilled in the art can easily determine conditions whereby binding
between affinity binding molecules that would be considered in the art to be "specific
binding" can be made to occur. As understood in the art, such specificity is usually
due to the higher affinity between the affinity binding molecules than for other substances
and components (e.g., vessel walls, solid supports) in a sample. In certain cases,
the specificity might also involve, or might be due to, a significantly more rapid
association of affinity binding molecules than with other substances and components
in a sample.
[0083] In some embodiments of the invention, an "affinity tag reagent" or and "affinity
tag having a reactive moiety" is used, by which we mean herein, a molecule that comprises
both an affinity tag and a reactive chemical group or moiety that is capable of reacting
with one or more atoms or groups of the molecule with which it reacts to form one
or more covalent chemical bonds between the molecule comprising the affinity tag and
the molecule with which it reacts. By way of example, but without limitation, in some
embodiments, the affinity tag reagent is an acylating reagent (e.g., an N-hydroxysuccinimidyl
ester), wherein the affinity tag is chemically joined to an atom in the molecule with
which it reacts via an acyl linkage. In other embodiments, the affinity tag reagent
is an alkylating reagent, group, wherein the affinity tag is chemically joined to
an atom in the molecule with which it reacts via an alkyl linkage. In other embodiments,
the affinity tag reagent reacts via an electrocyclic type of chemical reaction, such
as a 1,3-dipolar cycloaddition (e.g., cycloaddition of an alkyne with an azide). Thus,
the term "reactive" moiety with respect to, for example, an "affinity tag reagent"
or "affinity tag having a reactive moiety" is used to refer to a moiety or group that
is involved in or responsible for the chemical reaction whereby a molecule comprising
the affinity tag reacts chemically to form a covalent chemical bond with one or more
atoms in the molecule with which it reacts, rather than to the binding that results
between affinity binding molecules due to non-covalent forces and bonds.
[0084] When we refer to attaching the "affinity-tag-binding molecule" or the "affinity tag
binding molecule," such as streptavidin or avidin, directly to the surface or solid
support, it usually, but not always means that the affinity-tag-binding molecule is
covalently attached to the surface by means of a chemical linker that is joined to
the surface and to the affinity-tag-binding molecule. When we refer to attaching the
"affinity-tag-binding molecule" or the "affinity tag binding molecule," such as streptavidin
or avidin, indirectly to the surface, it is meant that the affinity-tag-binding molecule
is bound to another molecule with which it has affinity (e.g., an anti-streptavidin
antibody) that is in turn bound to the surface. In some embodiments, the affinity-tag-binding
molecule, such as streptavidin or avidin, is not attached to a surface, but is bound
by another molecule, such as an antibody or Protein A, and the biotinylated modified-nucleotide-capped
RNA is recovered by precipitation or by binding to a second antibody or other molecule
using methods and compositions known in the art.
[0085] As used herein, the term "about" means encompassing plus or minus 25%. For example,
"about 200 nucleotides" refers to a range encompassing between 150 and 250 nucleotides.
[0086] As used herein, the term "hybridization" or "hybridize" is used in reference to the
pairing of complementary nucleic acids. Hybridization and the strength of hybridization
(
i.e., the strength of the association between the nucleic acids) is influenced by such
factors as the degree of complementary between the nucleic acids, stringency of the
conditions involved, the melting temperature (T
m) of the formed hybrid, and the G:C ratio within the nucleic acids. A single molecule
that contains pairing of complementary nucleic acids within its structure is said
to be "self-hybridized." An extensive guide to nucleic hybridization may be found
in
Tijssen, Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization
with Nucleic Acid Probes, part I, chapter 2, "Overview of principles of hybridization
and the strategy of nucleic acid probe assays," Elsevier (1993).
DETAILED DESCRIPTION
[0087] The present invention provides methods, compositions, and kits as defined in the
claims for generating rRNA-depleted samples and for isolating rRNA from samples. In
particular, the present invention provides compositions comprising affinity-tagged
antisense rRNA molecules corresponding to substantially all of the sequence of at
least one rRNA molecule (e.g., a eukaryotic 28S, 26S, 25S, 18S, 5.8S, and/or 5S rRNA
and/or a prokaryotic 23S, 16S, and/or 5S rRNA) and methods of using such compositions
to generate rRNA-depleted samples.
[0088] Ribosomal RNA constitutes a majority mass of the RNA content of a cell and thus,
presents a tremendous background contamination burden when studying the less abundant
and, often, more relevant transcripts. Methods to reduce rRNA are available but are
severely limiting since, for example, they require only "high quality intact RNA"
samples for good rRNA removal. Fragments of rRNA in the sample without the complementary
consensus sequences will not be removed using the methods in the art and, thus, still
contribute to significant rRNA contamination of the sample, which limits the efficacy
of downstream transcript analysis and significantly increases cost burden from unnecessary
use of consumables and manpower. Furthermore, even in the best case wherein the RNA
in the sample comprises so-called "intact total RNA," the sample can still comprise
a population of fragmented rRNA, which still gives rise to a rRNA background using
the methods in the art. Still further, the methods in the art do not remove sufficient
quantities of all of the sequence exhibited by the rRNA molecules, so the rRNA background
is high when the sample is used for modem analysis methods, such as for generating
tagged sequencing templates from RNA for use in next-generation sequencing (e.g.,
for so-called "digital" gene expression methods). For example, it has been reported
that more than half of the sequence reads can be for rRNA sequences, even after one
or more rounds of rRNA removal using commercial methods known in the art (e.g., using
RiboMinus™, Life Technologies, Carlsbad, CA). Another requirement of these existing
methods is the need for a relatively large sample size, which is frequently prohibitive.
Often, total RNA extracted from especially long-term stored cell/tissue samples is
invariably very fragmented and limited in quantity. Thus, a method to simultaneously
remove both fragmented and intact rRNA and to do so from a small sample size is needed.
[0089] The present invention addresses this need as it provides, for example, methods for
the efficient removal of either completely fragmented or variably fragmented rRNA
molecules, leaving the non-rRNA RNA transcripts generally unperturbed. Furthermore,
the method operates independently of any "unique feature" of the non-ribosomal RNA
transcripts such as, a poly(A) tail as in the case of eukaryotic mRNA and thus, presents
no selection bias in the recovery of all non-ribosomal RNA transcripts. In certain
embodiments to achieve these objectives, one or more affinity-tagged antisense rRNA
representing substantially all of the full-length sequence of each rRNA in whole or
in part (e.g., eukaryotic 28S, 26S, 25S, 18S, 5.8S and/or 5Ss and/or prokaryotic 23
S, 16S and 5S) are synthesized and hybridized to their respective complementary rRNA
sequences in the test sample, and the hybrids as well as any residual unhybridized
affinity-tagged antisense rRNA molecules are then physically removed using affinity-tag-binding
molecules (e.g., linked to a binding matrix), leaving the non-rRNA RNA transcripts
unperturbed. Since substantially the entire (or the entire) sequence of at least one,
and preferably each rRNA, is represented in the composition comprising affinity-tagged
antisense rRNA molecules, any size fragments of the native rRNA contained in the samples
are also able to form hybrids under the same hybridization conditions and are efficiently
removed along with any intact rRNA sequences that may also be present.
[0090] In particular embodiments, in order to achieve efficient rRNA removal, a molar excess
of the affinity-tagged antisense rRNA molecules is used in the hybridization reaction,
which drives the hybrid formation process to completion. Excess affinity-tagged antisense
rRNA molecules may also be removed since these molecules themselves may contribute
to various types of background in different downstream methods or analyses. To accomplish
this, the affinity-tagged antisense rRNA molecules preferably contain an optimal amount
of affinity-tag molecules, and an appropriate amount of the binding matrix comprising
the affinity-tag-binding molecules is used for removal of both rRNA-hybridized and
unhybridized affinity-tagged antisense rRNA molecules. As described in the Examples,
conditions were developed that allow the methods to be performed using samples comprising
a broader dynamic range of total RNA than existing methods, including using samples
comprising sub-microgram quantities of total RNA.
Exemplary rRNA Sequences and Primers
[0091] The present invention includes compositions comprising affinity-tagged antisense
rRNA molecules corresponding to substantially all of at least one rRNA molecule. The
present invention is not limited to compositions comprising antisense rRNA molecules
that exhibit sequences that are exactly complementary to particular rRNA molecules
in the sample, but instead includes compositions comprising antisense rRNA molecules
that hybridize with or anneal to or complex with any rRNA molecules in the sample,
whether or not said rRNA molecules are from the same organism.
Exemplary Embodiment
[0092] Described below is an exemplary embodiment that may be used to generate rRNA-depleted
samples using affinity-tag-binding molecule linked microspheres (herein after "binding
microspheres" or "microspheres"). This embodiment is not meant to limit the present
invention and instead is simply an exemplary embodiment.
[0093] Wash the binding microspheres and suspend in solution (20 mM Tris-HCl pH 7.5, 1 M
NaCl, 1 mM EDTA and 0.0005% RNase-Free Triton-X100). Allow the binding microspheres
to reach room temperature. Vigorously vortex the microspheres for 20 seconds to produce
a homogeneous suspension. For each reaction, pipette 25 ul of the resuspended microspheres
into a microsphere wash tube. Centrifuge the dispensed microspheres at 10,000 rpm
in a bench top microcentrifuge for 3 minutes. Carefully pipette off and discard the
supernatant, without disturbing the microsphere pellet. Wash the microspheres by adding
1 volume of wash solution (20 mM Tris-HCl pH 7.5, 1 M NaCl and 1 mM EDTA) equal to
the original volume of microspheres (e.g., add 25 µl of wash solution for every 25
µl of microspheres) to the tube. Resuspend the microspheres by vigorous vortex mixing.
Centrifuge the tube at 10,000 rpm for 3 minutes in a bench top microcentrifuge. Carefully
pipette off and discard the supernatant, without disturbing the microsphere pellet.
Repeat the wash, resuspension, centrifuge, and pipetting steps.
[0094] Resuspend the microspheres in 1 volume resuspension solution. For example, add 25
µl of resuspension solution for every 25 µl of microspheres that were originally used.
Resuspend the microspheres by vigorous vortex mixing to produce a homogeneous suspension.
Add 0.25 µl of ScriptGuard™ RNase Inhibitor (EPICENTRE, Madison, WI) to the tube for
every 25 µl of resuspended microspheres and store them at room temperature.
[0095] For a sample containing, for example, 50 ng - 1 ug to total RNA (e.g., human, mouse,
or rat), in a 0.2-ml thin-walled microcentrifuge tube, combine: 10X reaction buffer
(0.5M Tris-HCl pH7.5 and 1 M NaCl), a total RNA sample, a rRNA removal solution (1.2
pmoles each of affinity-tagged antisense rRNA molecules corresponding to 28S, 18S,
5.8S and 5S human rRNA molecules), and RNase-free water. Gently mix the reaction(s)
and incubate at 68°C for 10 minutes. Remove the reaction tube(s) to room temperature
and incubate for at least 15 minutes.
[0096] Resuspend the washed microspheres from above by pipetting up and down. For each sample,
pipette 25 µl of the microspheres to a new RNase-free 1.5-ml microcentrifuge tube.
Add the room temperature total RNA sample to the appropriate tube containing the microspheres.
Mix each thoroughly by pipetting the tube contents up and down. Incubate each tube
at room temperature for 15 minutes with occasional (every 3 - 4 minutes) mixing by
gentle vortex (low setting) for 5 seconds. Place the tube at 37°C for 5 minutes. Immediately
centrifuge the tube at 14,000 rpm in a microcentrifuge for 5 minutes at room temperature.
Carefully pipette off each supernatant, which contains the rRNA-depleted sample, to
an RNase-free 1.5-ml microcentrifuge tube. If there are microspheres still visible
in the sample, and ethanol precipitation is desired to be used, repeat the above procedure.
The rRNA-depleted sample can, for example, be purified by ethanol precipitation or
column method.
[0097] For ethanol precipitation, adjust the volume of each sample to 180 µl using RNase-free
water. Add 18 µl of 3M Sodium Acetate to each tube. Add 2 µl of Glycogen (10 mg/ml)
to each tube and mix by gentle vortex. Add 3 volumes (600 µl) of ice cold 100% ethanol
to each tube and mix thoroughly by gentle vortex. Place the tubes at -20°C for at
least 1 hour. Centrifuge the tubes at >10,000 x g in a microcentrifuge for 30 minutes.
Carefully remove and discard the supernatant. Wash the pellet with ice cold 70% ethanol
and centrifuge at > 10,000 x g for 5 minutes. Carefully remove and discard the supernatant.
Repeat the ethanol and centrifuge step. Centrifuge briefly to collect any residual
supernatant. Carefully remove and discard the supernatant and allow the pellet to
air dry at room temperature for 5 minutes. Dissolve the pellet in the desired volume
of RNase-free water or buffer.
[0098] For column purification, the RNA Clean & Concentrator™-5 Column (Zymo Research; Catalog
Numbers R1015, R1016) can be used to used to purify the rRNA-depleted RNA sample.
If using the RNA Clean & Concentrator-5 Column, follow the manufacturer's procedure
entitled
"To recover total RNA including small RNAs". The eluted RNA can be used immediately of stored at -70°C to -80°C.
Sequencing Technologies
[0099] Purified RNA samples generated in accordance with the present invention can be sequenced
using any type of suitable sequencing technology. The present invention is not limited
by the the type of sequencing method employed. Exemplary sequencing methods are described
below.
[0100] Illustrative non-limiting examples of nucleic acid sequencing techniques include,
but are not limited to, chain terminator (Sanger) sequencing and dye terminator sequencing.
Chain terminator sequencing uses sequence-specific termination of a DNA synthesis
reaction using modified nucleotide substrates. Extension is initiated at a specific
site on the template DNA by using a short radioactive, or other labeled, oligonucleotide
primer complementary to the template at that region. The oligonucleotide primer is
extended using a DNA polymerase, standard four deoxynucleotide bases, and a low concentration
of one chain terminating nucleotide, most commonly a di-deoxynucleotide. This reaction
is repeated in four separate tubes with each of the bases taking turns as the di-deoxynucleotide.
Limited incorporation of the chain terminating nucleotide by the DNA polymerase results
in a series of related DNA fragments that are terminated only at positions where that
particular di-deoxynucleotide is used. For each reaction tube, the fragments are size-separated
by electrophoresis in a slab polyacrylamide gel or a capillary tube filled with a
viscous polymer. The sequence is determined by reading which lane produces a visualized
mark from the labeled primer as you scan from the top of the gel to the bottom.
[0101] Dye terminator sequencing alternatively labels the terminators. Complete sequencing
can be performed in a single reaction by labeling each of the di-deoxynucleotide chain-terminators
with a separate fluorescent dye, which fluoresces at a different wavelength.
[0102] A set of methods referred to as "next-generation sequencing" techniques have emerged
as alternatives to Sanger and dye-terminator sequencing methods (
Voelkerding et al., Clinical Chem., 55: 641-658, 2009;
MacLean et al., Nature Rev. Microbiol., 7: 287-296). Most current methods describe the use of next-generation sequencing technology
for de novo sequencing of whole genomes to determine the primary nucleic acid sequence
of an organism. In addition, targeted re-sequencing (deep sequencing) allows for sensitive
mutation detection within a population of wild-type sequence. Some examples include
recent work describing the identification of HIV drug-resistant variants as well as
EGFR mutations for determining response to anti-TK therapeutic drugs. Recent publications
describing the use of bar code primer sequences permit the simultaneous sequencing
of multiple samples during a typical sequencing run including, for example:
Margulies, M. et al. "Genome Sequencing in Microfabricated High-Density Picolitre
Reactors", Nature, 437, 376-80 (2005);
Mikkelsen, T. et al. "Genome-Wide Maps of Chromatin State in Pluripotent and Lineage-Committed
Cells", Nature, 448, 553-60 (2007);
McLaughlin, S. et al. "Whole-Genome Resequencing with Short Reads: Accurate Mutation
Discovery with Mate Pairs and Quality Values", ASHG Annual Meeting (2007);
Shendure J. et al. "Accurate Multiplex Polony Sequencing of an Evolved Bacterial Genome",
Science, 309, 1728-32 (2005);
Harris, T. et al. "Single-Molecule DNA Sequencing of a Viral Genome", Science, 320,
106-9 (2008);
Simen, B. et al. "Prevalence of Low Abundance Drug Resistant Variants by Ultra Deep
Sequencing in Chronically HIV-infected Antiretroviral (ARV) Naive Patients and the
Impact on Virologie Outcomes", 16th International HIV Drug Resistance Workshop, Barbados
(2007);
Thomas, R. et al. "Sensitive Mutation Detection in Heterogeneous Cancer Specimens
by Massively Parallel Picoliter Reactor Sequencing", Nature Med., 12, 852-855 (2006);
Mitsuya, Y. et al. "Minority Human Immunodeficiency Virus Type 1 Variants in Antiretroviral-Naive
Persons with Reverse Transcriptase Codon 215 Revertant Mutations", J. Vir., 82, 10747-10755
(2008);
Binladen, J. et al. "The Use of Coded PCR Primers Enables High-Throughput Sequencing
of Multiple Homolog Amplification Products by 454 Parallel Sequencing", PLoS ONE,
2, e197 (2007); and
Hoffmann, C. et al. "DNA Bar Coding and Pyrosequencing to Identify Rare HIV Drug
Resistance Mutations", Nuc. Acids Res., 35, e91 (2007).
[0103] Compared to traditional Sanger sequencing, next-gen sequencing technology produces
large amounts of sequencing data points. A typical run can easily generate tens to
hundreds of megabases per run, with a potential daily output reaching into the gigabase
range. This translates to several orders of magnitude greater than a standard 96-well
plate, which can generate several hundred data points in a typical multiplex run.
Target amplicons that differ by as little as one nucleotide can easily be distinguished,
even when multiple targets from related species or organisms are present. This greatly
enhances the ability to do accurate genotyping. Next-gen sequence alignment software
programs used to produce consensus sequences can easily identify novel point mutations,
which could result in new strains with associated drug resistance. The use of primer
bar coding also allows multiplexing of different patient samples within a single sequencing
run.
[0104] Next-generation sequencing (NGS) methods share the common feature of massively parallel,
high-throughput strategies, with the goal of lower costs in comparison to older sequencing
methods. NGS methods can be broadly divided into those that require template amplification
and those that do not. Amplification-requiring methods include pyrosequencing commercialized
by Roche as the 454 technology platforms (e.g., GS 20 and GS FLX), the Solexa platform
commercialized by Illumina, and the Supported Oligonucleotide Ligation and Detection
(SOLiD) platform commercialized by Applied Biosystems. Non-amplification approaches,
also known as single-molecule sequencing, are exemplified by the HeliScope platform
commercialized by Helicos BioSciences, and emerging platforms commercialized by VisiGen
and Pacific Biosciences, respectively.
[0105] In pyrosequencing (
Voelkerding et al., Clinical Chem., 55: 641-658, 2009;
MacLean et al., Nature Rev. Microbiol., 7: 287-296;
U.S. Pat. No. 6,210,891;
U.S. Pat. No. 6,258,568), template DNA is fragmented, end-repaired, ligated to adaptors, and clonally amplified
in-situ by capturing single template molecules with beads bearing oligonucleotides
complementary to the adaptors. Each bead bearing a single template type is compartmentalized
into a water-in-oil microvesicle, and the template is clonally amplified using a technique
referred to as emulsion PCR. The emulsion is disrupted after amplification and beads
are deposited into individual wells of a picotitre plate functioning as a flow cell
during the sequencing reactions. Ordered, iterative introduction of each of the four
dNTP reagents occurs in the flow cell in the presence of sequencing enzymes and luminescent
reporter such as luciferase. In the event that an appropriate dNTP is added to the
3' end of the sequencing primer, the resulting production of ATP causes a burst of
luminescence within the well, which is recorded using a CCD camera. It is possible
to achieve read lengths greater than or equal to 400 bases, and 1 x 10
6 sequence reads can be achieved, resulting in up to 500 million base pairs (Mb) of
sequence.
[0106] In the Solexa/Illumina platform (
Voelkerding et al., Clinical Chem., 55: 641-658, 2009;
MacLean et al., Nature Rev. Microbiol., 7: 287-296;
U.S. Pat. No. 6,833,246;
U.S. Pat. No. 7,115,400;
U.S. Pat. No. 6,969,488), sequencing data are produced in the form of shorter-length reads. In this method,
single-stranded fragmented DNA is end-repaired to generate 5'-phosphorylated blunt
ends, followed by Klenow-mediated addition of a single A base to the 3' end of the
fragments. A-addition facilitates addition of T-overhang adaptor oligonucleotides,
which are subsequently used to capture the template-adaptor molecules on the surface
of a flow cell that is studded with oligonucleotide anchors. The anchor is used as
a PCR primer, but because of the length of the template and its proximity to other
nearby anchor oligonucleotides, extension by PCR results in the "arching over" of
the molecule to hybridize with an adjacent anchor oligonucleotide to form a bridge
structure on the surface of the flow cell. These loops of DNA are denatured and cleaved.
Forward strands are then sequenced with reversible dye terminators. The sequence of
incorporated nucleotides is determined by detection of post-incorporation fluorescence,
with each fluor and block removed prior to the next cycle of dNTP addition. Sequence
read length ranges from 36 nucleotides to over 50 nucleotides, with overall output
exceeding 1 billion nucleotide pairs per analytical run.
[0107] Sequencing nucleic acid molecules using SOLiD technology (
Voelkerding et al., Clinical Chem., 55: 641-658, 2009;
MacLean et al., Nature Rev. Microbiol., 7: 287-296;
U.S. Pat. No. 5,912,148;
U.S. Pat. No. 6,130,073) also involves fragmentation of the template, ligation to oligonucleotide adaptors,
attachment to beads, and clonal amplification by emulsion PCR. Following this, beads
bearing template are immobilized on a derivatized surface of a glass flow-cell, and
a primer complementary to the adaptor oligonucleotide is annealed. However, rather
than utilizing this primer for 3' extension, it is instead used to provide a 5' phosphate
group for ligation to interrogation probes containing two probe-specific bases followed
by 6 degenerate bases and one of four fluorescent labels. In the SOLiD system, interrogation
probes have 16 possible combinations of the two bases at the 3' end of each probe,
and one of four fiuors at the 5' end. Fluor color and thus identity of each probe
corresponds to specified color-space coding schemes. Multiple rounds (usually 7) of
probe annealing, ligation, and fluor detection are followed by denaturation, and then
a second round of sequencing using a primer that is offset by one base relative to
the initial primer. In this manner, the template sequence can be computationally reconstructed,
and template bases are interrogated twice, resulting in increased accuracy. Sequence
read length averages 35 nucleotides, and overall output exceeds 4 billion bases per
sequencing run.
[0108] In certain embodiments, nanopore sequencing in employed (see, e.g.,
Astier et al., J Am Chem Soc. 2006 Feb 8;128(5):1705-10). The theory behind nanopore sequencing has to do with what occurs when the nanopore
is immersed in a conducting fluid and a potential (voltage) is applied across it:
under these conditions a slight electric current due to conduction of ions through
the nanopore can be observed, and the amount of current is exceedingly sensitive to
the size of the nanopore. If DNA molecules pass (or part of the DNA molecule passes)
through the nanopore, this can create a change in the magnitude of the current through
the nanopore, thereby allowing the sequences of the DNA molecule to be determined.
[0109] HeliScope by Helicos BioSciences (
Voelkerding et al., Clinical Chem., 55: 641-658, 2009;
MacLean et al., Nature Rev. Microbiol., 7: 287-296;
U.S. Pat. No. 7,169,560;
U.S. Pat. No. 7,282,337;
U.S. Pat. No. 7,482,120;
U.S. Pat. No. 7,501,245;
U.S. Pat. No. 6,818,395;
U.S. Pat. No. 6,911,345;
U.S. Pat. No. 7,501,245) is the first commercialized single-molecule sequencing platform. This method does
not require clonal amplification. Template DNA is fragmented and polyadenylated at
the 3' end, with the final adenosine bearing a fluorescent label. Denatured polyadenylated
template fragments are ligated to poly(dT) oligonucleotides on the surface of a flow
cell. Initial physical locations of captured template molecules are recorded by a
CCD camera, and then label is cleaved and washed away. Sequencing is achieved by addition
of polymerase and serial addition of fluorescently-labeled dNTP reagents. Incorporation
events result in fluor signal corresponding to the dNTP, and signal is captured by
a CCD camera before each round of dNTP addition. Sequence read length ranges from
25-50 nucleotides, with overall output exceeding 1 billion nucleotide pairs per analytical
run. Other emerging single molecule sequencing methods real-time sequencing by synthesis
using a VisiGen platform (
Voelkerding et al., Clinical Chem., 55: 641-658, 2009;
U.S. Pat. No. 7,329,492;
U.S. Pat. App. Ser. No. 11/671956;
U.S. Pat. App. Ser. No. 11/781166) in which immobilized, primed DNA template is subjected to strand extension using
a fluorescently-modified polymerase and florescent acceptor molecules, resulting in
detectible fluorescence resonance energy transfer (FRET) upon nucleotide addition.
Another real-time single molecule sequencing system developed by Pacific Biosciences
(
Voelkerding et al., Clinical Chem., 55: 641-658, 2009;
MacLean et al., Nature Rev. Microbiol., 7: 287-296;
U.S. Pat. No. 7,170,050;
U.S. Pat. No. 7,302,146;
U.S. Pat. No. 7,313,308;
U.S. Pat. No. 7,476,503) utilizes reaction wells 50-100 nm in diameter and encompassing a reaction volume
of approximately 20 zeptoliters (10 x 10
-21 L). Sequencing reactions are performed using immobilized template, modified phi29
DNA polymerase, and high local concentrations of fluorescently labeled dNTPs. High
local concentrations and continuous reaction conditions allow incorporation events
to be captured in real time by fluor signal detection using laser excitation, an optical
waveguide, and a CCD camera.
binding matrix solid supports
[0110] The binding matrix employed in the present invention may be any surface or solid
support to which the affinity-tag-binding molecule can be attached and which does
not exhibit substantial non-specific binding of the affinity-tagged antisense rRNA
molecules. The present invention is not limited to any one solid support. In some
embodiments, polystyrene plates containing either 96 or 384 wells are employed. In
some embodiments, streptavidin (SA) coated 96-well or 384-well microtiter plates (Boehringer
Mannheim Biochemicals, Indianapolis, IN) are used as solid supports. In some embodiments,
particles or beads are employed. The particles can be made of any suitable material,
including, but not limited to, latex. In some embodiments, minicolumns are employed.
The columns may contain affinity-tag-binding molecules. In other embodiments, a BEADARRAY
(Illumina, San Diego, CA) is employed. A variety of other solid supports are contemplated
including, but not limited to, glass microscope slides, glass wafers, gold, silicon,
microchips, and other plastic, metal, ceramic, or biological surfaces.
EXAMPLES
[0111] It is understood that the examples and embodiments described herein are for illustrative
purposes only and are not intended to limit the scope of the claimed invention.
Example 1
Synthesis of biotinylated antisense rRNA molecules representing the full-length sequences
of ribosomal RNA (rRNA) molecules of eukaryotes and prokaryotes
[0112] In order to synthesize antisense rRNA corresponding to the complete sequence of each
rRNA molecule, PCR templates were made containing a phage promoter sequence in all
but one case as follows.
Human 18S, 5.8S and 5S rRNA PCR templates for in vitro synthesis of antisense rRNA
[0113] PCR amplicons representing the full-length 18S (Accession# NR_003286), 5.8S (Accession#
U13369 REGION: 6623-6779) and 5S (Accession # NR_023363) rRNA sequences were synthesized.
Each 100-µl PCR reaction comprised 20 pmoles of a forward primer, 20 pmoles of a reverse
primer containing T7 RNA polymerase phage promoter sequence (shown in italics) and
5 ng random primed first-strand cDNA made from Universal Human Reference total RNA
(Stratagene) under FailSafe PCR reaction conditions optimized as described by the
manufacturer (EPICENTRE Biotechnologies). The PCR amplification reactions were performed
for 25 cycles to 30 cycles depending on the primer pair and the PCR amplicons corresponding
to the full-length 18S, 5.8S and 5S rRNA sequences and PCR products were purified
using the Qiaquick PCR purification kit as recommended by the manufacturer (Qiagen).
The following is a list of the respective forward and reverse primers used:
18S rRNA
[0114]
forward primer (SEQ ID NO: 1: 5'-CCTACCTACCTGGTTGATCC) and

5.8S rRNA
[0115]
forward primer (SEQ ID NO: 3: 5'-CGACTCTTAGCGGTGGATCACTC) and

5S rRNA
[0116]
forward primer (SEQ ID NO: 5: 5'-GTCTACGGCCATACCACCCTGAA) and

Escherichia coli 23S, 16S and 5S rRNA PCR templates for in vitro synthesis of antisense rRNA
[0117] PCR amplicons representing the full-length 23S (Accession# EG30077), 16S (Accession#
EG30084) and 5S (Accession # EG30070) rRNA sequences were synthesized. Each 100 µl
PCR reaction comprised 20 pmoles of a forward primer, 20 pmoles of a reverse primer
containing T7 RNA polymerase phage promoter sequence (shown in italics) and 5 ng random
primed first-strand cDNA made from
E. coli K-12 total RNA under FailSafe PCR reaction conditions optimized as described by the
manufacturer (EPICENTRE Biotechnologies). The PCR amplification reactions were performed
for 25 cycles to 30 cycles depending on the primer pair and the PCR amplicons corresponding
to the full-length 23S, 16S and 5S rRNA sequences and PCR products were purified using
the Qiaquick PCR purification kit as recommended by the manufacturer (Qiagen). The
following is a list of the respective forward and reverse primers used:
23S rRNA
[0118] In order to efficiently amplify the complete 23S rRNA sequence, two pairs of primers
were used whereby, the full-length 23S rRNA sequence was divided into approximately
two equal segments. The 5' 23S rRNA segment comprised forward primer (SEQ ID NO: 7:
5'-AAGCGACTAAGCGTACACGGTGGA) and reverse primer (SEQ ID NO: 8: 5'-
AATTCTAATACGACTCACTATAGGGAGATTCCTGGAAGCAGG GCATTTGTTG) and the 3' 23S rRNA segment comprised forward primer (SEQ ID NO: 9: 5'-CAACAAATGCCCTGCTTCCAGGAA)
and reverse primer (SEQ ID NO: 10: 5'-
AATTCTAATACGACTCACTATAGGGAGACACGGTTCATTAGTACCGGTTAGCT ).
16S rRNA
[0119]
forward primer (SEQ ID NO: 11: 5'-AGAGTTTGATCCTGGCTCAG) and
reverse primer (SEQ ID NO: 12: 5'-AATTCTAATACGACTCACTATAGGGAGAGGAG GTGATCCAACCGCAGGTT).
5S rRNA
[0120]
forward primer (SEQ ID NO: 13: 5'-TGCCTGGCGGCAGTAGCGCGGT) and
reverse primer (SEQ ID NO: 14: 5'-AATTCTAATACGACTCACTATAGGGAGATGC CTGGCAGTTCCCTACTCTC).
[0121] Each PCR amplicon (300 ng) representing the respective human or
E. coli rRNA sequence was analyzed by ethidium bromide stained agarose gel electrophoresis
as shown in Figure 1A.
Human 28S ribosomal RNA clone
In vitro synthesis of biotinylated antisense rRNA molecules from the respective PCR templates
for human 18S, 5.8S and 5S and E. coli 23S, 16S and 5S rRNA sequences
[0123] Either an AmpliScribe™ T7 High Yield Transcription Kit or an AmpliScribe™ T7-FLASH
Transcription Kit (EPICENTRE, Madison, WI) was used for
in vitro transcription (IVT) reactions comprising 500 ng to 1000 ng of the respective templates
(human 18S, 5.8S and 5S_and
E. coli 23S, 16S and 5S) were performed as described by the manufacturer (EPICENTRE Biotechnologies)
with the following modification - the uridine triphosphate (UTP) was replaced with
mixtures of biotin-16-UTP and UTP comprising 10%, 20%, 35%, 50% or 60% biotin-16-UTP.
The IVT reactions were incubated at 37°C for 4 to 6 hours and the DNA template used
in each reaction was then digested with DNase I as recommended by the manufacturer.
Each biotinylated antisense rRNA was subsequently purified using illustra RNAspin
Mini columns as recommended by the manufacturer (GE Healthcare) and eluted in RNase-free
water. Each purified antisense rRNA was treated with Baseline-Zero™ DNase I as recommended
by the manufacturer (EPICENTRE Biotechnologies) to remove all traces of the DNA template
used for transcription. The biotinylated antisense rRNA was again purified using illustra
RNAspin Mini columns, eluted in RNase-free water and the RNA concentration determined
by measuring the absorbance at 260 nm with a spectrophotometer. (Note: subsequent
experiments showed that best results for generating rRNA-depleted samples with respect
to 5.8S and 5S eukaryotic rRNA or 5S prokaryotic rRNA were obtained using at least
about 75% biotin-16-UTP in the
in vitro transcription reaction.)
[0124] Each purified antisense RNA (300 ng), representing the entire human or
E. coli rRNA sequence, as analyzed by ethidium bromide stained agarose gel electrophoresis,
is shown in Figure 1B.
In vitro synthesis of biotinylated antisense rRNA from the plasmid templates for human 28S
rRNA sequence
[0125] Initially, 1 µg of the linearized T7-28S rRNA plasmid clone was used in an AmpliScribe™
T7 High Yield Transcription Kit for
in vitro transcription (IVT) as described by the manufacturer (EPICENTRE Biotechnologies)
with the following modification - a 1:1 mixture of bio-UTP:UTP instead of 100% UTP.
Incubation was performed at 37°C for 4 hours and the DNA template then removed by
digesting with DNase I as recommended by the manufacturer (EPICENTRE Biotechnologies).
An aliquot (300 ng) of the purified transcription reaction product was analyzed by
gel electrophoresis. It was evident from the results (Figure 1C, Lane 1) that very
little, if any of the expected full-length antisense 28S rRNA was produced in the
IVT reaction. Instead, RNA molecules ranging in size from low to high molecular weights
were observed. Thus, it appeared that the T7 RNA polymerase was unable to efficiently
transcribe the 28S DNA template.
[0126] Next, 1 µg of the linearized SP6-28S rRNA plasmid clone was tested in a standard
AmpliScribe™ SP6 High Yield Transcription Kit for
in vitro transcription (IVT) as described by the manufacturer (EPICENTRE Biotechnologies)
using a similar 1:1 mixture of bio-UTP and UTP. Incubation was performed at 37°C for
4 hours and the DNA template then removed by digesting with DNase I as recommended
by the manufacturer (EPICENTRE Biotechnologies). The biotinylated antisense rRNA produced
was subsequently purified using illustra RNAspin Mini columns as recommended by the
manufacturer (GE Healthcare) and eluted in RNase-free water. Thereafter, the purified
antisense 28S rRNA was treated with Baseline-Zero™ DNase I as recommended by the manufacturer
(EPICENTRE Biotechnologies) to remove all traces of the DNA template used for transcription.
The biotinylated antisense rRNA was again purified using illustra RNAspin Mini columns,
eluted in RNase-free water and the RNA concentration determined by measuring the absorbance
at 260 nm with a spectrophotometer. An aliquot (300 ng) of the transcription reaction
was analyzed by gel electrophoresis and it was evident from the results that the expected
antisense 28S rRNA was produced in the SP6-IVT reaction (Figure 1C, Lane 2).
Example 2
Removal of biotinylated antisense rRNA and resulting ds-rRNA hybrids formed using
E. coli total RNA using streptavidin-coated microspheres
[0127] E. coli rRNA was used as the model to test the amount of ProActive® Streptavidin Coated Microspheres
(Bangs Laboratories) needed to remove a fixed quantity biotinylated antisense rRNA
from solution. The streptavidin-coated microspheres were washed and resuspended in
the bind/wash buffer as recommended by the manufacturer (Bangs Laboratories).
E. coli biotinylated antisense rRNA materials synthesized using 35% biotin-UTP as described
in Example 1 were used to prepare a mixture comprising one microgram each of the 23S
rRNA 5' segment, the 23S rRNA 3' segment and the full-length 16S rRNA in a 4-µl volume
of RNase-free water. Each 4-µl biotinylated antisense rRNA mixture would represent
at least a >2-fold molar excess when mixed with one microgram of native
E. coli total RNA, which concentration was selected to drive the hybridization of the sense
and antisense rRNA to completion or near completion when mixed together.
[0128] The amount of streptavidin-coated microspheres required to efficiently remove the
added biotinylated antisense rRNA added to a hybridization reaction was determined.
Three 4-µl aliquots of the
E. coli biotinylated antisense rRNA mixture were prepared in 0.2 ml microcentrifuge tubes
to a final reaction volume of 20 µl comprising 1x hybridization buffer (50 mM Tris-HCl,
pH7.5 and 100 mM NaCl). The reactions were incubated at 68°C for 5 minutes and then
at room temperature for 15 minutes. Reactions #1 and #2 were each then added to a
fresh 1.5-ml microcentrifuge tube containing 20 µl of the washed and resuspended streptavidin-coated
microspheres. Control reaction #3 was added to a fresh 1.5-ml microcentrifuge tube
with only 20 µl bind/wash buffer. All reactions were further incubated at room temperature
for 15 minutes with occasional gentle mixing (3-4 minutes) in order to allow formation
of the biotin-streptavidin complex. The biotinylated antisense rRNA remaining in solution
following capture by the microspheres was then purified using RNA Clean-up Kit™ -5
columns as recommended by the manufacturer (ZYMO Research). Reactions #1 and #3 were
added directly in the ZYMO RNA Clean-up procedure whereas, reaction #2 was first spun
at 12,000 rpm for 5 minutes using a benchtop centrifuge to pellet the microspheres
and the supernatant removed and then added to the ZYMO RNA Clean-up procedure. Each
RNA sample was eluted in 10 µl RNase-free water and a 5-µl aliquot analyzed by ethidium
bromide stained agarose gel electrophoresis as shown in Figure 2A.
[0129] Figure 2A, lanes 1 and 2 show the residual biotinylated antisense rRNA following
binding to the streptavidin coated microspheres compared to the control (Lane 3).
The amount of antisense RNA remaining was more pronounced in Lane 2 where the microspheres
were removed prior to the ZYMO RNA clean-up procedure. While unclear, it is possible
that adding the hybridization reaction mixture with the microspheres directly to the
RNA purification column reduced the binding capacity of the column resulting in a
further loss of the biotinylated antisense RNA. Nevertheless, it was evident from
this experiment that 20 µl of the streptavidin coated microspheres was insufficient
to remove the entire amount of biotinylated antisense rRNA used.
[0130] Thus, an additional 20 µl of washed microspheres was tested to determine if it would
be sufficient to remove the 4 µl of biotinylated antisense rRNA. Four reactions, each
comprising 4 µl of the
E. coli biotinylated antisense rRNA were prepared in 1 x hybridization buffer to a final
volume of 20 µl. The reactions were incubated at 68°C for 5 minutes and then at room
temperature for 15 minutes. Each of reactions #2 and #3 was added to a fresh 1.5-ml
microcentrifuge tube containing 20 µl of the washed and resuspended streptavidin-coated
microspheres. Reaction #4 was added to a fresh 1.5-ml microcentrifuge tube containing
40 µl of the washed and resuspended streptavidin-coated microspheres. Control reaction
#1 was added to a fresh 1.5-ml microcentrifuge tube with only bind/wash buffer. The
reactions were further incubated at room temperature for 15 minutes with occasional
gentle mixing (3-4 minutes) in order to allow formation of the biotin-streptavidin
complex. The reactions were spun at 12,000 rpm for 5 minutes using a benchtop centrifuge
to pellet the microspheres and each supernatant transferred to a fresh 1.5-ml microcentrifuge
tubes. To the supernatant of reaction #3, an additional 20 µl of the washed streptavidin-coated
microspheres was added and again incubated at room temperature with occasional gentle
mixing (3-4 minutes). Reaction #3 was centrifuged at 12,000 rpm for 5 minutes once
more and the supernatant transferred to a fresh 1.5-ml microcentrifuge tube. The biotinylated
antisense RNA contained in each of the four reactions was purified using the ZYMO
RNA Clean-up procedure and eluted in 10 µl RNase-free water. The entire eluate for
each was analyzed by ethidium bromide stained agarose gel electrophoresis as shown
in Figure 2B.
[0131] Figure 2B, lane 2 again shows that biotinylated antisense rRNA is not completely
removed when only 20 µl of microspheres is used. However, when either 20 µl of microspheres
followed by a second 20 µl of microspheres or 40 µl of microspheres was used, there
appears to be complete removal of the added biotinylated antisense rRNA (Lane 3 and
Lane 4, respectively). Thus, the one treatment with 40 µl of microspheres was generally
preferred since it required fewer steps.
[0132] Next, the amount of microspheres used as described in Figure 2B was tested to determine
if it was also sufficient to efficiently remove the double-stranded ribosomal RNA
(ds-rRNA) hybrids formed after annealing the biotinylated antisense rRNA and the native
rRNA contained in total RNA. Firstly, in order to demonstrate the formation of the
ds-rRNA hybrid, 500 ng
of E. coli total RNA was mixed with 4 µl of the
E. coli biotinylated antisense rRNA in a reaction comprising 1x hybridization buffer in a
final volume of 20 µl. The reaction was incubated at 68°C for 5 minutes and then at
room temperature for 15 minutes, purified using the ZYMO RNA Clean-up procedure and
eluted in 10 µl RNase-free water. A 5-µl aliquot was analyzed by ethidium bromide
stained agarose gel electrophoresis along with equivalent amounts of the individual
E. coli total RNA and biotinylated antisense rRNA as shown in Figure 2C. Figure 2C, lane
3 shows the efficient formation of the ds-rRNA hybrids compared to the individual
sense and antisense RNA samples (Lanes 1 and 2, respectively).
[0133] Next, the removal of the ds-rRNA hybrids was tested using the quantities of washed
microspheres described in Figure 2B. Three reactions (#1, #2 and #3), each comprising
500 ng
of E. coli total RNA and 4 µl of the
E. coli biotinylated antisense rRNA in 1x hybridization buffer in a final volume of 20 µl
were prepared, along with two control reactions - one containing only the
E. coli biotinylated antisense rRNA (#4) and the other, only the
E. coli total RNA (#5). The reactions were incubated at 68°C for 5 minutes and then at room
temperature for 15 minutes. Reactions #1 and #3 were each added to a fresh 1.5-ml
microcentrifuge tube containing 20 µl of the washed and resuspended streptavidin-coated
microspheres. Reactions #2 and #4 were each added to a fresh 1.5-ml microcentrifuge
tube containing 40 µl of the washed and resuspended streptavidin-coated microspheres.
Control reaction #5 was added to a fresh 1.5-ml microcentrifuge tube containing only
bind/wash buffer. The reactions were further incubated at room temperature for 15
minutes with occasional gentle mixing (3-4 minutes) in order to allow formation of
the biotin-streptavidin complex. The reactions were spun at 12,000 rpm for 5 minutes
using a benchtop centrifuge to pellet the microspheres and each supernatant transferred
to a fresh 1.5-ml microcentrifuge tubes. To the supernatant of reaction #3, an additional
20 µl of the washed streptavidin-coated microspheres was added and incubated at room
temperature with occasional gentle mixing (3-4 minutes). Reaction #3 was again centrifuged
at 12,000 rpm for 5 minutes and the supernatant transferred to a fresh 1.5-ml microcentrifuge
tube. The RNA contained in each of the five reactions was purified using the ZYMO
RNA Clean-up procedure and eluted in 10 µl RNase-free water. A 5-µl aliquot of each
was analyzed by ethidium bromide stained agarose gel electrophoresis as shown in Figure
2D. In addition, 250 ng of untreated
E. coli total RNA was run as a control.
[0134] Figure 2D, Lane 1 shows the residual ds-rRNA when only 20 µl of microspheres was
used. However, with either 2x 20 µl (Lane 2) or 1x 40 µl of microspheres (Lane 3),
the ds-rRNA hybrids were no longer visible indicating that the biotinylated antisense
rRNA was capable of annealing to its complementary sense rRNA sequences and facilitate
their removal by the streptavidin microspheres. The quantity
of E. coli total RNA did not appear to be affected by the addition of 40 µl of microspheres
(Lane 5) when compared to a similar amount of untreated
E. coli total RNA (Lane 6). Thus, it was evident that 40 µl of microspheres was sufficient
to remove either the added biotinylated antisense rRNA or the resulting ds-rRNA hybrids
formed after hybridization of the biotinylated antisense rRNA to the rRNA.
Example 3
Effect of using different levels of biotin-UTP for synthesis of biotinylated antisense
rRNA and its removal with the Streptavidin Coated Microspheres
[0135] The experiments described in Example 2 above used biotinylated antisense rRNA synthesized
using a UTP:biotin-UTP mixture comprising 35% biotin-UTP. For the amount of antisense
rRNA used in the hybridization reaction, 40 µl of the strepavidin microspheres was
needed for its efficient removal. Thus, it was thought that antisense rRNA made with
lesser amounts of biotin-UTP should require less streptavidin microspheres for its
quantitative removal, which would result in an overall reduction in the cost associated
with the amount of both the biotin-UTP and microspheres required. Biotinylated antisense
16S and 23S rRNA were prepared using either 10% or 20% biotin-UTP solutions as described
above in Example 1 and standard 4-µl mixtures of the respective biotinylated antisense
rRNA were then made. The percentage of biotin-UTP used in the
in vitro transcription reaction for its synthesis is used to refer to the biotinylated antisense
rRNA product; for example, if the percentage of biotin-UTP used in the
in vitro transcription reaction is 10%, with the remaining 90% being UTP, the product is referred
to herein as 10% biotinylated antisense rRNA, even though the percentage of biotin-UTP
nucleotides incorporated into the product may be less than 10% compared to the UTP
nucleotides incorporated into the product.
[0136] Two sets of three reactions each comprising 4 µl of either the 10% (reaction #1,
#2 and #3) or 20% (reactions #4, #5 and #6) biotinylated antisense rRNA mixture were
prepared in a final volume of 20 µl in 1x hybridization buffer. The reactions were
incubated at 68°C for 5 minutes and then at room temperature for 15 minutes. Reactions
# 2 and #5 were each transferred to a fresh 1.5-ml microcentrifuge tube containing
20 µl of washed streptavidin microspheres and reactions # 3 and #6 were each transferred
to a fresh 1.5-ml microcentrifuge tube containing 40 µl of washed streptavidin microspheres.
Reactions #1 and #4 were each transferred to a fresh 1.5-ml microcentrifuge tubes
containing 40 µl of bind/wash buffer. The reactions were further incubated at room
temperature for 15 minutes with occasional gentle mixing (3-4 minutes) in order to
allow formation of the biotin-streptavidin complex. The reactions were spun at 12,000
rpm for 5 minutes on a benchtop centrifuge and the supernatant transferred to fresh
1.5-ml microcentrifuge tubes. Any biotinylated antisense rRNA remaining in the supernatants
were purified using the ZYMO RNA Clean-up procedure and eluted in 10 µl RNase-free
water. The entire amount of each purified sample was analyzed by ethidium bromide
stained agarose gel electrophoresis as shown in Figure 3A.
[0137] Figure 3A, Lanes 1 and 4 show the 10% and 20% biotinylated antisense rRNA not treated
with microspheres, respectively. Lanes 2 and 3 show the 10% biotinylated antisense
rRNA treated with 20 µl and 40 µl of microspheres, respectively. Lanes 5 and 6 show
the 20% biotinylated antisense rRNA treated with 20 µl and 40 µl of microspheres,
respectively. Clearly, there was a significant amount of both the 10% and 20% biotinylated
antisense rRNA remaining independent of either 20 µl or 40 µl of microspheres used
(Lanes 2, 3, 5 and 6). Nevertheless, the 20% condition (Lanes 5 and 6) was clearly
better than the 10% condition (Lanes 2 and 3). Thus, it appeared that using these
lower levels of biotin-UTP were used to synthesize the biotinylated rRNA, at least
some of the antisense rRNA product synthesized may not contain sufficient biotin molecules
to facilitate its removal by the streptavidin microspheres.
[0138] Thus, the question arose as to whether the 35% biotin-UTP used in Example 2 was the
optimal concentration to ensure that all antisense rRNA synthesized contained sufficient
biotin molecules for its subsequent removal by the streptavidin beads. To answer this
question, the following experiment tested biotinylated antisense rRNAs made as described
in Example 1 using either 50% or 60% biotin-UTP solutions. The standard 4-µl mixture
of the respective biotinylated antisense 16S and 23S rRNA synthesized using the 50%
and 60% levels of biotin-UTP was then made. The standard 4 µl-mixture of the 35% biotinylated
antisense rRNA included as a control.
[0139] Three sets of two reactions, each comprising 4 µl of the 35% (reactions #1 and #2)
or 50% (reactions #3 and #4) or 60% (reactions #5 and #6) biotinylated antisense rRNA
mixture were prepared in a final volume of 20 µl in 1x hybridization buffer. The reactions
were incubated at 68°C for 5 minutes and then at room temperature for 15 minutes.
Reactions # 2, #4 and #6 were each transferred to a fresh 1.5-ml microcentrifuge tube
containing 40 µl of washed streptavidin microspheres and reactions # 1, #3 and #5
were each transferred to a fresh 1.5-ml microcentrifuge tube containing 40 µl of bind/wash
buffer. All reactions were further incubated at room temperature for 15 minutes with
occasional gentle mixing (3-4 minutes) in order to allow formation of the biotin-streptavidin
complex. The reactions were spun at 12,000 rpm for 5 minutes on a benchtop centrifuge
and the supernatant transferred to fresh 1.5-ml microcentrifuge tubes. Any biotinylated
antisense rRNA remaining in the supernatants were purified using the ZYMO RNA Clean-up
procedure and eluted in 13.5 µl RNase-free water. Fifty percent of each purified sample
was analyzed by ethidium bromide-stained agarose gel electrophoresis as shown in Figure
3B.
[0140] Figure 3B, Lanes 1, 3 and 5 show the biotinylated antisense rRNA remaining in the
absence of any microspheres for the 35%, 50% and 60% biotin-UTP samples, respectively.
With the addition of 40 µl of streptavidin microspheres, there was no biotinylated
antisense rRNA visibly remaining in any of the corresponding reactions (Lanes 2, 4
and 6). It was not possible to observe any differences in the performance of the 35%,
50% and 60% biotinylated antisense rRNA samples following treatment with 40 µl of
the streptavidin microspheres by agarose gel analysis.
[0141] In order to further determine if there was a difference between the use of the 35%,
50% and 60% biotinylated antisense rRNA, the remaining half of each reaction was converted
to first-strand cDNA in a standard reverse transcriptase reaction containing random
hexamers and purified using the Qiaquick PCR purification kit as recommended by the
manufacturer (Qiagen). A 5-µl aliquot of each was then used in separate PCR amplification
reactions containing primers specific to the terminal 5' and 3' regions of 23S (SEQ
ID NO: 15: 5'-GACGTGCTAATCTGCGATAAGC, SEQ ID NO: 16: 5'- ATGGATTCAGTTAATGATAGTGTGTCG,
SEQ ID NO: 17: 5'- CTGAAAGCATCTAAGCACGAAACTTGC and SEQ ID NO: 18: 5'-CCTATCAACGTCGTCGTCTTCAAC)
and 16S (SEQ ID NO: 19: 5'-GCCTAACACATGCAAGTCGAAC, SEQ ID NO: 20: 5'-AGCTACCGTTTCCAGTAGTTATCC,
SEQ ID NO: 21: 5'-CGGAATCGCTAGTAATCGTGGAT and SEQ ID NO: 22: 5'-TCCCGAAGGTTAAGCTACCTACTT)
rRNAs for 20 PCR cycles. PCR amplification is notably more sensitive than ethidium
bromide agarose gel analysis and should therefore better demonstrate any differences
between the removal efficiencies of the 35%, 50% and 60% biotinylated antisense rRNA
by the microspheres. The results are shown in Figure 3C.
[0142] Figure 3C, Lanes 1, 3 and 5 show the expected PCR amplicons for the 5' 23S rRNA (Panel
1), 3' 23S rRNA (Panel 2), 5' 16S rRNA (Panel 3) and 3' 16S rRNA (Panel 4) with the
35%, 50% and 60% biotinylated antisense rRNA mixtures, respectively. Lanes 2, 4 and
6 show the corresponding PCR reaction products following the use of the streptavidin
microspheres. As seen in Lane 2 (Panels 2 and 4), residual carryover of 35% biotinylated
antisense rRNA resulted in still some specific PCR-amplified products that were not
observed with the 50% and 60% biotinylated antisense rRNA materials. Both the 50%
and 60% biotinylated antisense rRNA materials behaved similarly and thus, the 50%
condition was selected.
Example 4
Removal of the 23S and 16S rRNA from another prokaryotic species (Lactobacillus plantarum) using the E. coli biotinylated antisense 23S and 16S rRNA mixture
[0143] In order to test if the
E. coli biotinylated antisense rRNA mixture would be capable of removing the 23S and 16S
rRNA sequences exhibited by a relatively diverse prokaryotic species, total RNA from
Lactobacillus plantarum, which shares approximately 80% homology with
E. coli 16S and 23S rRNA was used. In one reaction, 500 ng of
L. plantarum total RNA was mixed with 4 µl of the
E. coli biotinylated antisense rRNA mixture described in Example 2 above in 1x hybridization
buffer in a final volume of 20 µl. A second reaction to serve as a control contained
everything as the first reaction minus the
E. coli biotinylated antisense rRNA mixture. The reactions were incubated at 68°C for 10
minutes and then at room temperature for 15 minutes. Each reaction was then added
to a fresh 1.5-ml microcentrifuge tube containing 50 µl of washed and resuspended
streptavidin-coated microspheres. The reactions were further incubated at room temperature
for 15 minutes with occasional gentle mixing (3-4 minutes) in order to allow for formation
of the biotin-streptavidin complex. The reactions were then spun at 12,000 rpm for
5 minutes using a benchtop centrifuge to pellet the microspheres, the supernatant
removed and the RNA purified using the ZYMO RNA Clean-up procedure. Each RNA sample
was eluted in 13.5 µl RNase-free water and 50% of each analyzed by ethidium bromide
stained agarose gel electrophoresis as shown Figure 4.
[0144] Figure 4, Lane 1 compared to Lane 2 shows that both the 16S and 23S rRNA bands for
L. plantarum were no longer visible following subtraction with the
E. coli biotinylated antisense rRNA mixture indicating that they were efficiently subtracted
as well even though the rRNA sequences were only 80% homologous.
Example 5
Removal of 23S, 16S and 5S rRNA from a range of inputs of E. coli total RNA using the E. coli biotinylated antisense rRNA mixture
[0145] An
E. coli biotinylated antisense rRNA mixture was prepared, now containing 23S, 16S and 5S
antisense rRNA, and the following reactions for generating rRNA-depleted samples and
control reactions were set up as shown in Table 1, and were performed in duplicate
in a final volume of 20 µl in 1x hybridization buffer:
Table 1:
| Reaction # |
E. coli total RNA Inputs |
E. coli biotinylated antisense rRNA mixture (23S, 16S, 5S) |
Streptavidin coated microspheres |
| 1,2 |
50 ng |
2 µl |
25 µl |
| 3,4 |
100 ng |
2 µl |
25 µl |
| 5,6 |
500 ng |
4 µl |
50 µl |
| 7,8 |
1000 ng |
4 µl |
50 µl |
| 9,10 |
2500 ng |
8 µl |
100 µl |
| 11,12 |
5000 ng |
10 µl |
125 µl |
| 13,14 |
500 ng |
- |
50 µl |
The reactions were incubated at 68°C for 10 minutes and then at room temperature for
15 minutes. Each reaction was then added to a fresh 1.5-ml microcentrifuge tube containing
the appropriate quantity of washed and resuspended streptavidin-coated microspheres.
The reactions were further incubated at room temperature for 15 minutes with occasional
gentle mixing (3-4 minutes) in order to allow for formation of the biotin-streptavidin
complex. The reactions were then spun at 12,000 rpm for 5 minutes using a benchtop
centrifuge to pellet the microspheres and the supernatant removed and the RNA purified
using the ZYMO RNA Clean-up procedure. Each RNA sample was eluted in 13.5 µl RNase-free
water. The entire RNA sample for each was then converted to first-strand cDNA in a
standard reverse transcriptase reaction containing random hexamers and purified using
the Qiaquick PCR purification kit as recommended by the manufacturer (Qiagen). A 5-µl
aliquot of each first-strand cDNA sample was used in separate PCR amplification reactions
containing primers specific to the terminal 5' regions of 23S (SEQ ID NO: 15 and SEQ
ID NO: 16) and 16S rRNA (SEQ ID NO: 19 and SEQ ID NO: 20), the complete 5S rRNA (SEQ
ID NO: 13 and SEQ ID NO: 23: 5'-TGCCTGGCAGTTCCCTACTCTC) and the
ompA mRNA (SEQ ID NO: 24: 5'-ACCAGGTTAACCCGTATGTTGGCT and SEQ ID NO: 25: 5'-ACCGATGTTGTTGGTCCACTGGTA)
for 20 cycles. A control reaction minus template was also performed for each primer
pair. A 5-µl aliquot of each PCR reaction was analyzed by ethidium bromide stained
agarose gel electrophoresis as shown in Figure 5.
[0146] Figure 5, Lanes 1-12 show excellent reduction in the amount of 23 S (Panel A), 16S
(Panel B) and 5S (Panel C) rRNA sequences contained in the different inputs of
E. coli total RNA in duplicate. Whereas, the
ompA mRNA (Panel D) transcripts was still clearly detected in all samples and appeared
to be unperturbed compared to the corresponding non-subtracted samples (Lanes 7 and
8 versus Lane 13 and 14). Clearly, this method for rRNA subtraction appears to be
applicable across a broad range of total RNA inputs with at least a 100-fold dynamic
range in this example.
Example 6
Subtraction of fragmented E. coli 23S, 16S and 5S rRNA sequences using the E. coli biotinylated antisense rRNA mixture
[0147] Ten micrograms
of E. coli total RNA was fragmented in 1x fragmentation buffer (Ambion) at 65°C for 3 minutes.
The fragmented RNA was purified using the ZYMO RNA Clean-up procedure, eluted in 20µl
RNase-free water and the concentration determined by measuring the absorbance at 260
nm with a spectrophotometer. A 300 ng aliquot of the fragmented RNA compared to the
intact RNA was analyzed by ethidium bromide stained agarose gel electrophoresis as
shown in Figure 6A.
[0148] Figure 6A, Lane 1 shows the intact
E. coli total RNA and Lane 2 shows the corresponding fragmented total RNA. The intact 23S
and 16S rRNA bands were no longer visible in the fragmented sample contained in Lane
2.
[0149] Next, ribosomal RNA subtraction was applied to a 2.5 µg sample of the fragmented
E. coli total RNA sample comparing it to a similar amount of intact
E.
coli total RNA. The following four reactions were assembled - reactions #1 and #2 contained
2.5 µg of intact
E. coli total RNA each and reactions #3 and #4 contained 2.5 µg of the fragmented
E. coli total RNA each. Next, to each of reactions #2 and #4, 8 µl of the
E. coli biotinylated antisense rRNA mixture was added and the final reaction volume adjusted
to 40 µl in 1x hybridization buffer. The reactions were incubated at 68°C for 10 minutes
and then at room temperature for 15 minutes. Each reaction was transferred to a fresh
1.5-ml microcentrifuge tube containing 50 µl of washed streptavidin microspheres.
The reactions were further incubated at room temperature for 15 minutes with occasional
gentle mixing (3-4 minutes) in order to allow for formation of the biotin-streptavidin
complex. The reactions were spun at 12,000 rpm for 5 minutes on a benchtop centrifuge
and each supernatant transferred to a fresh 1.5-ml microcentrifuge tube. The RNA contained
in the supernatants were purified using the ZYMO RNA Clean-up procedure and eluted
in 13.5 µl RNase-free water. Fifty percent of each purified sample was analyzed by
ethidium bromide stained agarose gel electrophoresis and Northern blot analysis as
shown in Figure 6B.
[0150] Figure 6B, Panel 1 (Lanes 2 and 4) show the RNA remaining following rRNA subtraction.
In the case of the intact total RNA, it is clearly evident that the 23S and 16S rRNA
bands are removed (Lane 2
versus Lane 1). Whereas, for the fragmented total RNA, there is an overall reduction in
the amount of RNA following subtraction as would be expected if the fragments of rRNA
were also subtracted (Lanes 4
versus Lane 3). The Northern blot analysis for
ompA mRNA (Panel 2) and 23S (Panel 3), 16S (Panel 4) and 5S (Panel 5) rRNA clearly show
similar and excellent subtraction of the different rRNA sequences in both the intact
total RNA (Panel 3, 4, and 5 - Lane 2) and fragmented total RNA (Panel 3, 4, and 5
- Lane 4) compared to the respective non-subtracted samples (Panel 3, 4, and 5 - Lane
1 and 3). At the same time, the amount of
ompA mRNA sequence appears to be unperturbed by the subtraction process for both the
intact total RNA (Panel 2 - Lane 2
versus Lane 1) and the fragmented total RNA (Panel 2 - Lane 4
versus Lane 3).
[0151] In addition, the remaining 50% of each purified RNA sample was converted to first-strand
cDNA in a standard reverse transcriptase reaction containing random hexamers and purified
using the Qiaquick PCR purification kit as recommended by the manufacturer (Qiagen).
A 5-µl aliquot of each was then used in separate PCR amplification reactions containing
primers specific to the terminal 5' regions of 23S (SEQ ID NO: 15 and SEQ ID NO: 16)
and 16S rRNA (SEQ ID NO: 19 and SEQ ID NO: 20), the complete 5S rRNA (SEQ ID NO: 13
and SEQ ID NO: 23) and the
ompA mRNA (SEQ ID NO: 24 and SEQ ID NO: 25) for 20 cycles. A 5-µl aliquot of each PCR
reaction was analyzed by ethidium bromide stained agarose gel electrophoresis as shown
in Figure 6C.
[0152] Figure 6C shows that by RT-PCR analysis, there was excellent subtraction of 23S (Panel
2), 16S (Panel 3) and 5S rRNA (Panel 4) for both the intact (Lane 2
versus Lane 1) and the fragmented (Lane 4
versus Lane 3) E. coli total RNA. Whereas, the
ompA mRNA was equally preserved in both cases before and after subtraction (Panel 1).
Example 7
Specific hybridization of human, mouse and rat 28S and 18S rRNA to human biotinylated
antisense 28S and 18S rRNA, and their removal with streptavidin microspheres
[0153] Intact total RNA (500 ng) samples for human (reactions #4 and #5), mouse (reactions
#7 and #8) and rat (reactions #10 and #11) were mixed with either 2.1 µg of biotinylated
antisense 28S rRNA or 1.0 µg of biotinylated antisense 18S rRNA in 1x hybridization
buffer in a final volume of 20 µl. Corresponding intact total RNA samples (reactions
#3, #6 and #9) and biotinylated antisense rRNA alone (#1 and #2) were included as
controls. All reactions were incubated at 68°C for 10 minutes followed by room temperature
for 15 minutes. The RNA contained in each sample was then purified using the ZYMO
RNA Clean-up procedure and eluted in 13.5 µl RNase-free water. The entire sample for
each was analyzed by ethidium bromide stained agarose gel electrophoresis as shown
in Figure 7A.
[0154] Figure 7A, Lanes 1 and 2 show the individual biotinylated antisense 23S and 18S rRNA,
respectively. Lanes 3, 6 and 9 show the individual intact total RNA corresponding
to human, mouse and rat, respectively. Lanes 4, 7 and 10 show the human, mouse and
rat total RNA samples, respectively following hybridization to the biotinylated antisense
28S rRNA. Clearly, the 28S rRNA band in the different total RNA samples have hybridized
to its complementary antisense rRNA since it now migrates with a high molecular weight
higher whereas, the 18S rRNA remained unperturbed. When the different total RNA samples
were then hybridized to the biotinylated antisense 18S rRNA, clearly the 18S rRNA
band now migrated with a higher molecular weight (Lane 5, 8 and 11) and now, the 28S
band was unperturbed. It's evident from these results that each biotinylated antisense
rRNA was hybridizing specifically to its complementary target and equally well for
human, mouse and rat that share at least 99% sequence homology.
[0155] Next, a biotinylated antisense rRNA mixture for human comprising approximately 1.2
pmoles each of 28S and 18S antisense rRNA in a final volume of 4 µl of RNase-free
water was prepared using the
in vitro synthesized RNA made as described in Example 1. Intact total RNA (2.5 µg) from human
(HeLa), mouse (3T3) and rat (NRK) were each mixed with 8 µl of the biotinylated antisense
rRNA solution in 1x hybridization buffer in a final volume of 40 µl. A control reaction
containing only 2.5 µg of the corresponding intact total RNA was also included. The
reactions were incubated at 68°C for 10 minutes followed by room temperature for 15
minutes. Each reaction was transferred to a fresh 1.5-ml microcentrifuge tube containing
100 µl of washed streptavidin microspheres, respectively. The reactions were further
incubated at room temperature for 15 minutes with occasional gentle mixing (3-4 minutes)
in order to allow formation of the biotin-streptavidin complex and then 37°C for 5
minutes. The reactions were spun at 14,000 rpm for 5 minutes on a benchtop centrifuge
and each supernatant transferred to a fresh 1.5-ml microcentrifuge tube. The RNA contained
in the supernatants were purified using the ZYMO RNA Clean-up procedure and eluted
in 13.5 µl RNase-free water. Fifty percent of each purified RNA sample was analyzed
by ethidium bromide stained agarose gel electrophoresis as shown in Figure 7B.
[0156] Figure 7B, Lanes 1, 3 and 5 show the individual total RNA without any 28S and 18S
rRNA subtraction, whereas, Lanes 2, 4, and 6 show the corresponding RNA remaining
following 28S and 18S rRNA subtraction. It is clear from these results that a majority
of the 28S and 18S rRNA bands were removed following the subtraction procedure as
described.
Example 8
Subtraction of 28S, 18S, 5.8S and 5S rRNA from varying amounts of intact human total
RNA using a human biotinylated antisense rRNA mixture
[0157] A biotinylated antisense rRNA mixture for human comprising approximately 1.2 pmoles
each of 28S, 18S, 5.8S and 5S antisense rRNA in a final volume of 4 µl of RNase-free
water was prepared using the
in vitro synthesized RNA made as described in Example 1. Ribosomal RNA subtraction reactions
comprising 100 ng (reaction #1), 500 ng (reaction #2) and 5.0 µg (reaction #3) of
intact HeLa total RNA with 2 µl, 4 µl and 8 µl of the biotinylated human antisense
rRNA mixture, respectively were prepared in 1x hybridization buffer in a final volume
of 20 µl. A control reaction (reaction #4) with only 500 ng of the intact HeLa total
RNA was also included. The reactions were incubated at 68°C for 10 minutes followed
by room temperature for 15 minutes. Each reaction was transferred to a fresh 1.5-ml
microcentrifuge tube containing 25 µl, 50 µl, 125 µl and 50 µl of washed streptavidin
microspheres, respectively. The reactions were further incubated at room temperature
for 15 minutes with occasional gentle mixing (3-4 minutes) in order to allow formation
of the biotin-streptavidin complex and then 37°C for 5 minutes. The reactions were
spun at 14,000 rpm for 5 minutes on a benchtop centrifuge and each supernatant transferred
to a fresh 1.5-ml microcentrifuge tube. The RNA contained in the supernatants were
purified using the ZYMO RNA Clean-up procedure and eluted in 13.5 µl RNase-free water.
Next, each purified RNA sample was converted to first-strand cDNA in a standard reverse
transcriptase reaction containing random hexamers and purified using the Qiaquick
PCR purification kit as recommended by the manufacturer (Qiagen). A 5-µl aliquot of
each was then used in separate PCR amplification reactions containing primers specific
to the terminal 5' and 3' regions of 28S (SEQ ID NO: 26: 5'-CTCAGTAACGGCGAGTGAAC,
SEQ ID NO: 27: 5'-GCCTCGATCAGAAGGACTTG, SEQ ID NO: 28: 5'- TACCACAGGGA TAACTGGCT and
SEQ ID NO: 29: 5'- TAGGAAGAGCCGACATCGAA) and 18S rRNA (SEQ ID NO: 30: 5'- CCTACCTGGTTGATCCTGCC,
SEQ ID NO: 31: 5'-CCAAGTAGGAGAGGAGCGAG, SEQ. ID. No. 32: 5'- CCCAGTAAGTGC GGGTCATA
and SEQ ID NO: 33: 5'- TCACTAAACCATCCAATCGGTAGTA) the complete 5.8S rRNA (SEQ ID NO:
3 and SEQ ID NO: 34: 5'-GATCCTTCCGCAGGT TCACCTAC), the complete 5S rRNA (SEQ ID NO:
5 and SEQ ID NO: 35: 5'-AAGCCTACAGCACCCGGTATTC) and 5' GAPDH mRNA (SEQ ID NO: 36:
5'-TCGACAGTCAGCCGCATCTTCTTT and SEQ ID NO: 37: 5'-ACCAAATCCGTTG ACTCCGACCTT) for 20
cycles. A control reaction for each primer pair minus template was included. A 5-µl
aliquot of each PCR reaction was analyzed by ethidium bromide stained agarose gel
electrophoresis shown in Figure 8.
[0158] Figure 8, Lanes 1, 2 and 3 show the RT-PCR results for 28S rRNA (Panel A), 18S rRNA
(Panel B), 5.8S rRNA (Panel C), 5S rRNA (Panel D) and GAPDH mRNA (Panel E) for the
100 ng, 500 ng and 5.0 µg inputs of total RNA subtracted with the biotinylated human
antisense rRNA mixture, respectively. Lane 4 shows the PCR for the 500 ng non-subtracted
total RNA input. It is evident from the results that there is excellent subtraction
over a broad range of total RNA inputs for the different ribosomal RNA sequences using
the biotinylated antisense rRNA mixture (Lanes 1, 2 and 3
versus Lane 4).
Example 9
Subtraction of human rRNA sequences exhibited by various levels of fragmented human
total RNA
[0159] HeLa intact total RNA was fragmented in 1x fragmentation buffer (Ambion) for 1, 2
and 3 minutes. The RNA samples were purified using the ZYMO RNA Clean-up procedure,
eluted RNase-free water and the concentration determined at an absorbance of 260 nm
using a spectrophotometer.
[0160] Duplicate reactions comprising either 2.5 µg of the intact (reactions # and #2) or
fragmented (reactions #3, #4, #5, #6, #7 and #8) total RNA samples were prepared in
1x hybridization buffer. To one of each duplicate reaction (#2, #4, #6 and #8), 8
µl of the biotinylated human antisense rRNA mixture was added and the final volume
for each reaction adjusted to 40 µl. The reactions were incubated at 68°C for 10 minutes
followed by room temperature for 15 minutes. Each reaction was transferred to a fresh
1.5-ml microcentrifuge tube containing 100 µl of washed streptavidin microspheres.
The reactions were further incubated at room temperature for 15 minutes with occasional
gentle mixing (3-4 minutes) in order to allow formation of the biotin-streptavidin
complex and then 37°C for 5 minutes. The reactions were spun at 14,000 rpm for 5 minutes
on a benchtop centrifuge and each supernatant transferred to a fresh 1.5-ml microcentrifuge
tube. The RNA contained in the supernatants were purified using the ZYMO RNA Clean-up
procedure and eluted in 13.5 µl RNase-free water. Fifty percent of each purified RNA
sample was analyzed by ethidium bromide stained gel electrophoresis as shown in Figure
9A.
[0161] Figure 9A, Lanes 4, 6 and 8, containing the fragmented total RNA and biotinylated
antisense rRNA show a significant reduction in the amount of RNA as a result of subtraction
compared to the respective controls (Lanes 3, 5 and 7). In Lane 2 compared to Lane
1 with the intact total RNA, the full-length rRNA bands were no longer visible.
[0162] Next, the remaining 50% of each purified RNA sample was converted to first-strand
cDNA in a standard reverse transcriptase reaction containing random hexamers and purified
using the Qiaquick PCR purification kit as recommended by the manufacturer (Qiagen).
A 5-µl aliquot of each was then used in separate PCR amplification reactions containing
primers specific to the terminal 5' regions of 28S (SEQ ID NO: 26 and SEQ ID NO: 27)
and 18S rRNA (SEQ ID NO: 30 and SEQ ID NO: 31), the complete 5.8S rRNA (SEQ ID NO:
3 and SEQ ID NO: 34), the complete 5S rRNA (SEQ ID NO: 5 and SEQ ID NO: 35) and 5'
GAPDH mRNA (SEQ ID NO: 36 and SEQ ID NO: 37) for 20 cycles. A control reaction minus
template was also performed for each primer pair. A 5-µl aliquot of each PCR reaction
was analyzed by ethidium bromide stained agarose gel electrophoresis shown in Figure
9B.
[0163] Figure 9B, Lanes 2, 4, 6 and 8 show the PCR results for 28S rRNA (Panel 1), 18S rRNA
(Panel 2), 5.8S rRNA (Panel 3), 5S rRNA (Panel 4) and GAPDH mRNA (Panel 5) for the
intact, and fragmented (1, 2 and 3 minutes) total RNA, respectively following subtraction.
The corresponding non-subtracted control reactions are shown in Lanes 1, 3, 5 and
7. It is evident from the results that there is excellent subtraction over a broad
range of fragmented total RNA inputs similar to the intact total RNA for the different
ribosomal RNA sequences using the biotinylated antisense rRNA mixture.
Example 10
Comparison of E. coli rRNA subtraction using the method of the present invention and the MICROBExpress™
method
[0164] A kit that uses conserved rRNA (23S and 16S) oligonucleotide sequences to subtract
the corresponding rRNA from inputs of 2 µg - 10 µg from prokaryotic total RNA was
purchased from Ambion for comparison to the exemplary methods in these Examples. An
15 µg aliquot of the intact control
E. coli total RNA supplied in the MICROBExpress™ kit was first fragmented in 1x fragmentation
buffer (Ambion) at 65°C for 2 minutes, purified using the ZYMO RNA Clean-up procedure,
eluted RNase-free water and the concentration determined at an absorbance of 260 nm
using a spectrophotometer. An equal aliquot (2.5 µg) of either the intact or fragmented
E.
coli total RNA was then used in subtraction reactions following either the exemplary method
described in Example 9 ("Exemplary Method") for the appropriate RNA samples or the
MICROBExpress™ method exactly as described by the manufacturer (Ambion). Control reactions
representing no rRNA subtraction were included for both methods. Each RNA sample was
then purified by EtOH precipitation as described for the MICROBExpress™ procedure
and resuspended in 12 µl RNase-free water. Fifty percent of each purified RNA sample
was analyzed by ethidium bromide stained agarose gel electrophoresis and Northern
blot as shown in Figure 10A.
[0165] Figure 10A, Lanes 1, 2 and 3, 4 show the relative rRNA subtraction from intact and
fragmented total RNA using the Exemplary Method and the MICROBExpress™ method for
23S rRNA (Panel 2), 16S rRNA (Panel 3) and 5S rRNA (Panel 4). Clearly, for both the
intact and fragmented total RNA samples, the different rRNA sequences were subtracted
significantly better using the Exemplary Method invention (Exemplary Method - Lanes
2 and 4) compared to the MICROBExpress method (MICROBExpress™ Panel - Lanes 2 and
4). It appears that even the control intact RNA supplied with the MICROBExpress™ contain
a level of fragmented rRNA sequences that were clearly not removed by the MicrobExpress
method (MICROBExpress™ Panel - Lane 2) but were clearly removed using the Exemplary
Method described herein (Exemplary Method, Panel - Lane 2). In addition, Panel 1 shows
that the
ompA mRNA sequence remain unperturbed before and after subtraction for both methods.
[0166] Next, the remaining 50% of each purified RNA sample was converted to first-strand
cDNA in a standard reverse transcriptase reaction containing random hexamers and purified
using the Qiaquick PCR purification kit as recommended by the manufacturer (Qiagen).
A 5-µl aliquot of each was then used in separate PCR amplification reactions containing
primers specific to the terminal 5' region of 23S (SEQ ID NO: 15 and SEQ ID NO: 16)
and 16S rRNA (SEQ ID NO: 19 and SEQ ID NO: 20) the complete 5S rRNA (SEQ ID NO: 13
and SEQ ID NO: 23) and
ompA mRNA (SEQ ID NO: 24 and SEQ ID NO: 25) for 20 cycles. A 5-µl aliquot of each PCR
reaction was analyzed by ethidium bromide stained agarose gel electrophoresis shown
in Figure 10B.
[0167] Figure 10B, Lanes 2 and 4 show the PCR results for 23S rRNA (Panel 2), 16S rRNA (Panel
3), 5S rRNA (Panel 4) and
ompA mRNA (Panel 1) for the intact and fragmented
E. coli total RNA, respectively following subtraction using the Exemplar Method and the MICROBExpress™
method. The corresponding non-subtracted control reactions are shown in Lanes 1 and
3. It is evident from the results that there is excellent subtraction of the different
rRNA sequences exhibited by both the intact and fragmented total RNA samples using
the Exemplary Method (Exemplary Method Panel) compared to the MICROBExpress™ method
(MicroExpress Panel). In both cases though, the
ompA mRNA was similarly maintained.
Example 11
Comparison of Human rRNA subtraction using an Exemplary Method vs. the OLIGOTEX poly
A+ mRNA purification method
[0168] A kit that uses oligonucleotide dT to isolate mRNA from eukaryotic total RNA was
purchased from Qiagen for comparison to the Exemplary Method described in Example
9 above. When fragmented RNA was used, the RNA was first fragmented in 1x fragmentation
buffer (Ambion) at 65°C for 2 minutes. The intact or fragmented RNA was purified using
the ZYMO RNA Clean-up procedure, eluted RNase-free water and the concentration determined
at an absorbance of 260 nm using a spectrophotometer. An equal aliquot (2.5 µg) of
either the intact or fragmented E.
coli total RNA was then used in rRNA subtraction reactions using the Exemplary Method
for the appropriate RNA samples or the Oligotex poly A+ mRNA purification method exactly
as described by the manufacturer (Qiagen). Control reactions representing no rRNA
subtraction were included for both methods. Each RNA sample was then purified by ethanol
precipitation and resuspended in 12 µl RNase-free water. Fifty percent of each purified
RNA sample was analyzed by ethidium bromide stained agarose gel electrophoresis as
shown in Figure 11A.
[0169] Figure 11A, Lanes 1, 2 and 3, 4 show the relative rRNA removal for intact and fragmented
total RNA using the Exemplary Method and the OLIGOTEX poly A+ mRNA purification method.
Clearly, for both the intact and fragmented total RNA samples, the different rRNA
sequences were visibly removed using the Exemplary Method (Panel 1 - Lanes 2 and 4)
and the OLIGOTEX method (Panel 2 - Lanes 2 and 4) compared to the respective controls
(Panel 1 - Lanes 1 and 3 and Panel 2 - Lanes 1 and 3). In addition, it appears that
there was very little mRNA visibly remaining following the OLIGOTEX method and all
of the types of small RNA molecules (tRNA, miRNA etc.) appear to have been eliminated
as well (Panel 2 - Lanes 2 and 4).
[0170] Next, the remaining 50% of each purified RNA sample was converted to first-strand
cDNA in a standard reverse transcriptase reaction containing random hexamers and purified
using the Qiaquick PCR purification kit as recommended by the manufacturer (Qiagen).
A 5-µl aliquot of each was then used in separate PCR amplification reactions containing
primers specific to the terminal 5' and 3' regions of 28S (SEQ ID NO: 26, SEQ ID NO:
27, SEQ ID NO: 28 and SEQ ID NO: 29) and 18S rRNA (SEQ SEQ ID NO: 30, SEQ ID NO: 31,
SEQ ID NO: 32 and SEQ ID NO: 33), the complete 5.8S rRNA (SEQ ID NO: 3 and SEQ ID
NO: 34) and the complete 5S rRNA (SEQ ID NO: 5 and SEQ ID NO: 35) for 20 cycles. A
5-µl aliquot of each PCR reaction was analyzed by ethidium bromide stained agarose
gel electrophoresis shown in Figure 11B.
[0171] Figure 11B, Lanes 2 and 4 show the PCR results for 28S rRNA (Panels 1 and 2), 18S
rRNA (Panel 3 and 4), 5.8S rRNA (Panel 5) and 5S rRNA (Panel 6) for the intact and
fragmented HeLa total RNA, respectively following rRNA subtraction using the Exemplary
Method and the OLIGOTEX method. The corresponding non-subtracted control reactions
are shown in Lanes 1 and 3. It is evident from the results that there is overall excellent
subtraction of the different rRNA sequences exhibited by both the intact and fragmented
total RNA samples using using the Exemplary Method (Exemplary Method Panel) and to
the OLIGOTEX method (OLIGOTEX Panel). In fact, the Exemplary Method appears to be
somewhat better than the OLIGOTEX method for both the 28S and 18S rRNA sequences (Panels
1-4) whereas, for the 5.8S and 5S rRNA sequences, the OLIGOTEX method appears to be
slightly better (Panel E and F, respectively).
[0172] In addition, PCR primers specific for the terminal 5' and 3' regions of GAPDH (SEQ
ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38: 5'-CACAAGAGGAAGAGAGAGA CCCTCA and SEQ ID
NO: 39: 5'-TTGATGGTACATGACAAGGTGCGG) and PGK1 (SEQ ID NO: 40: 5'-GAATCACCGACCTCTCTCCC,
SEQ. ID. No. 41: 5'-CGACTCTCATAACGACCCGC, SEQ ID NO: 42: 5'-CCAGAGGTGACCACTTTCAA and
SEQ ID NO: 43: 5'-ATGTGGAACAGAGCCTTCCTC) mRNA were used in PCR (GAPDH: 22 cycles and
PGK1: 26 cycles) with the random primed cDNA templates and a 5-µl aliquot of each
PCR reaction was analyzed by ethidium bromide stained agarose gel electrophoresis
as shown in Figure 11C. It is clearly evident from the PCR results that there is a
reduction in the amount of mRNA for both GAPDH (Panels 1 and 2) and PGK 1 (Panels
3 and 4) in the OLIGOTEX method for both intact and fragmented total RNA (OLIGOTEX
Panel, Lanes 2 and 4, respectively) compared to the non-rRNA- subtracted samples (OLIGOTEX
Panel, Lanes 1 and 3, respectively), using the Exemplary Method (Exemplary Method
Panel, Lanes 2 and 4). Furthermore, the Exemplary Method did not show any significant
loss in the same mRNA sequences for both intact and fragmented total RNA (Exemplary
Method Panel, Lanes 2 and 4, respectively) compared to the non-rRNA subtracted samples
(Exemplary Method Panel, Lanes 1 and 3, respectively). In addition, the 5' regions
of both GAPDH (Panel 1, Lane 4) and PGK1 (Panel 3, Lane 4) for the fragmented total
RNA sample were lost with the OLIGOTEX method (OLigotex Panel) since the poly A tail
was no longer present but not so for the Exemplary Method (Exemplary Method Panel,
Lane 4 (Panel 1 and 3), respectively). Overall, these results demonstrate a clear
benefit of the Exemplary Method compared to the OLIGOTEX method.
[0173] Next, PCR primers specific for Poly A- and bimorphic transcripts (SEQ ID NO:
44: 5'-CACGTTTTCTCAGCTGCTTG and SEQ ID NO: 45: 5'-TTCACCTTTTCATC CAAGGC for transcript
#1, SEQ ID NO: 46: 5'-GTGTGGTGGTGTGTGCCTAT and SEQ ID NO: 47: 5'-GAGACATGGTCTTGCTCCGT
for transcript #3, SEQ ID NO: 48: 5'-TAGCTCAGTGGTAGAGCGCA and SEQ ID NO: 49: 5'-GATTTGCTCAGCA
GCACGTA for transcript #15 and SEQ ID NO: 50: 5'-CACTTGGGGACACTTTCCAG and SEQ ID NO:
51: 5'-TCAGGGAAAATGAGCCAATC for bimorphic transcript #5 (
Poly A- Transcripts Expressed in HeLa Cells Qingfa Wu et. al. (July 2008). PLoS One
(www followed by "plosone.org/article/info:doi/10.1371/journal.pone.0002803")) were used in PCR with the random primed cDNA templates (36, 22, 28 and 38 cycles,
respectively) and a 5-µl aliquot of each PCR reaction was analyzed by ethidium bromide
stained agarose gel electrophoresis as shown in Figure 11D. It is clearly evident
from the PCR results that the poly A- and biomorphic transcripts were no longer present
following the OLIGOTEX mRNA purification method for both intact and fragmented total
RNA (OLIGOTEX Panel, Lanes 2 and 4, respectively) whereas, these sequences were maintained
following rRNA subtraction using the Exemplary Method for both intact and fragmented
total RNA (Exemplary Method PANEL, Lane 2 and 4, respectively). These results point
to another clear benefit of the rRNA subtraction methods described in this application
for maintaining a broader spectrum of transcripts allowing for better representation
of the cellular content.
Example 12
Comparison of human rRNA subtraction using an Exemplary Method of the present invention
vs. the RiboMinus™ Eukaryote Kit for RNA-Seq
[0174] A kit (RiboMinus™ Eukaryote Kit for RNA-Seq) that uses two conserved oligonucleotide
sequences for each of 28S, 18S, 5.8S and 5S rRNA to subtract the corresponding rRNA
from inputs of 2 µg - 10 µg from eukaryotic total RNA was purchased from InVitrogen
(Burlington, ON) for comparison to an examplary method of the present invention. When
fragmented total RNA was used, the initial total RNA was first fragmented in 1x fragmentation
buffer (Ambion, Austin, TX) at 65°C for 2 minutes. The intact or fragmented total
RNA was purified using the ZYMO RNA Clean-up procedure, eluted RNase-free water and
the concentration determined at an absorbance of 260 nm using a spectrophotometer.
An equal aliquot (2.5 µg) of either the intact or fragmented HeLa total RNA was then
used in rRNA subtraction reactions using the Exemplary Method for the appropriate
RNA samples or the RiboMinus™ Eukaryote Kit for RNA-Seq method exactly as described
by the manufacturer (InVitrogen). Control reactions representing no rRNA subtraction
were included for both methods. Each RNA sample was then purified by ethanol precipitation
and resuspended in 12 µl RNase-free water. Fifty percent of each purified RNA sample
was analyzed by ethidium bromide stained agarose gel electrophoresis as shown in Figure
12A.
[0175] Figure 12A, Lanes 1, 2 and 3, 4 show the relative rRNA removal for intact and fragmented
total RNA using the Exemplary Method and the RiboMinus™ Eukaryote Kit for RNA-Seq
method. Clearly, for both the intact and fragmented total RNA samples, the different
rRNA sequences were visibly removed using the Exemplary Method (Exemplary method -
Lanes 2 and 4) whereas for the RiboMinus™ Eukaryote Kit for RNA-Seq method, only the
intact total RNA showed reduction of the rRNA sequences (RiboMinus™ method - Lanes
2) compared to the respective non-rRNA-subtracted samples (Exemplary method - Lanes
1 and 3 and RiboMinus™ method-Lane 1). There appeared to be only minimal reduction
of the rRNA-subtracted fragmented total RNA sample using the RiboMinus™ Eukaryote
Kit for RNA-Seq as judged by the ethidium bromide stained intensity (RiboMinus™ method
- Lane 4) compared to the non-rRNA- subtracted sample (RiboMinus™ method - Lane 3)
likely due to the fact that those ribosomal fragments that are not represented by
the consensus oligonucleotide sequences in the kit would therefore not be removed.
[0176] Next, the remaining 50% of each purified RNA sample was converted to first-strand
cDNA in a standard reverse transcriptase reaction containing random hexamers and purified
using the Qiaquick PCR purification kit as recommended by the manufacturer (Qiagen).
A 5-µl aliquot of each was then used in separate PCR amplification reactions containing
primers specific to the terminal 5' and 3' regions of 28S (SEQ ID NO: 26, SEQ ID NO:
27, SEQ ID NO: 28 and SEQ ID NO: 29) and 18S rRNA (SEQ SEQ ID NO: 30, SEQ ID NO: 31,
SEQ ID NO: 32 and SEQ ID NO: 33), the complete 5.8S rRNA (SEQ ID NO: 3 and SEQ ID
NO: 34) and the complete 5S rRNA (SEQ ID NO: 5 and SEQ ID NO: 35) for 20 cycles. A
5-µl aliquot of each PCR reaction was analyzed by ethidium bromide stained agarose
gel electrophoresis shown in Figure 12B.
[0177] Figure 12B, Lanes 2 and 4 show the PCR results for 28S rRNA (Panels 1 and 2), 18S
rRNA (Panel 3 and 4), 5.8S rRNA (Panel 5) and 5S rRNA (Panel 6) for the intact and
fragmented HeLa total RNA, respectively following rRNA subtraction using the Exemplary
Method and the RiboMinus™ Eukaryote Kit for RNA-Seq method. The corresponding non-rRNA-subtracted
control reactions are shown in Lanes 1 and 3. It is evident from the results that
there is overall excellent subtraction of the 28S rRNA (Panels 1 and 2) and 18S rRNA
(Panel 3 and 4) sequences contained in both the intact and fragmented total RNA samples
using the Exemplary Method (Exemplary Method Panel) but not the RiboMinus™ Eukaryote
Kit for RNA-Seq method (RiboMinus™ Panel). However, both methods showed similar removal
of the 5.8S (Panel 5) and 5S rRNA sequences (Panel 6).
[0178] In addition, PCR primers specific for the terminal 5' and 3' regions of GAPDH (SEQ
ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38: 5'-CACAAGAGGAAGAGAGAGA CCCTCA and SEQ ID
NO: 39: 5'-TTGATGGTACATGACAAGGTGCGG) mRNA was used in PCR (GAPDH: 24 cycles) with
the random primed cDNA templates and a 5-µl aliquot of each PCR reaction was analyzed
by ethidium bromide stained agarose gel electrophoresis as shown in Figure 12C. It
is clearly evident from the PCR results that there is no obvious reduction in the
amount of mRNA for GAPDH (Panels 1 and 2) for both methods with either the intact
or fragmented HeLa total RNA (Lanes 2 and 4) compared to the non-rRNA- subtracted
samples (Lanes 1 and 3), respectively. Overall, these results demonstrate a clear
benefit of the Exemplary Method in the removal of 18S and 28S rRNA sequences independent
of the state (intact or fragmented) of the total RNA sample compared to the RiboMinus™
Eukaryote Kit for RNA-Seq method. In fact, even for the intact total RNA sample, the
Exemplary method appeared to be more efficient at removal of 18S and 28S rRNA sequences
likely due, at least in part, to the fact that there is invariably some degree of
fragmented rRNA in even a most intact total RNA sample that would not be removed by
the RiboMinus™ method. In fact, the RiboMinus™ Eukaryote Kit for RNA-Seq method clearly
states that this method requires use of only high-quality total RNA samples.
[0179] Next, the random primed cDNA samples were analyzed by QPCR as follows: The cDNA samples
were diluted to anywhere from 2-fold to 10-fold depending on the starting amount.
Then, 1 µl of each dilution was added to a 25 µl qPCR reaction comprising 1x FS PreMix
E (GREEN), 12.5 pmole of forward and reverse PCR primers and 1 unit of FS Enzyme Mix.
The cycling conditions were 98°C for 2 minutes, followed by 40-45 cycles of 98°C for
5 seconds, 60°C for 15 seconds and 72°C for 30 seconds using the Bio-Rad iCycler (Bio-Rad,
Hercules, CA). The following QPCR primer pairs were used for 18S (SEQ. ID. No. 30:
SEQ. ID. No. 31, SEQ. ID. No. 52: 5'-CTTAGAGGGACAAGTGGCG, SEQ. ID. No. 53: 5'-GTAGGGTAGGCACACGCTGA,
SEQ. ID. No. 54: 5'-GAAACTTAAAGGAATTGACGGAAG, SEQ. ID. No. 55: 5'-GAATCGAGAAAGAGCTATCAATC,
SEQ. ID. No. 56: 5'-CGATTGGATGGTTTAGTGAGG and SEQ. ID. No. 57: 5'-CCTTGTTACGACTTTTACTTCCTCTAG),
28S (SEQ. ID. No. 58: 5'-GCCGAAACGATCTCAACCTA, SEQ. ID. No. 59: 5'-CGCCAGTTCTGCTTACCAAA,
SEQ. ID. No. 60: 5'-CGGACCAAGGAGTCTAACA, SEQ. ID. No. 61: 5'-CAGGCATAGTTCACCATCTTTCG,
SEQ. ID. No. 62: 5'-GGAGAGGGTGTAAATCTCGC, SEQ. ID. No. 63: 5'-GCCGACTTCCCTTACCTACA,
SEQ. ID. No. 64: 5'-GTGTCAGAAAAGTTACCACAGG, SEQ. ID. No. 65: 5'-GGCGAATTCTGCTTCACAATGATAG,
SEQ. ID. No. 66: 5'-GGGAGTAACTATGACTCTCTTAAGGT, SEQ. ID. No. 67: 5'-TTGGCTGTGGTTTCGCTGGAT,
SEQ. ID. No. 68:5'-GTGAACAGCAGTTGAACATGG and SEQ. ID. No. 69:5'-CTTCACAAAGAAAAGAGAACTCTCCC),
5.8S (SEQ. ID. No. 70: 5'-CGACTCTTAGCGGTGGATCA and SEQ. ID. No. 71: 5'-AAGCGACGCTCAGACAG)
and 5S (SEQ. ID. NO. 5 and SEQ. ID. No. 72: 5'-AAAGCCTACAGCACCCGGTATTC) rRNA sequences.
[0180] The QPCR results are shown in Table 2 below:
TABLE 2
| QPCR Primer Sets |
Percentage Ribosomal RNA Reduction |
| Exemplary Method |
RiboMinus™ Method |
| Intact Hela total RNA (2.5 µg) |
Fragmented Hela total RNA (2.5 µg) |
Intact Hela total RNA (2.5 µg) |
Fragmented Hela total RNA (2.5 µg) |
| 18S.5' (nt 100 - nt 247) |
> 99.9% |
> 99.9% |
93.30% |
50% |
| 18S.3' (nt 1544 - nt 1663) |
> 99.9% |
> 99.9% |
97.10% |
81.10% |
| 18S.F3/R3 (nt 1288 - nt 1417) |
> 99.9% |
> 99.9% |
96.40% |
34% |
| 18S.F4/R4 (nt 1818 - nt 1937) |
> 99.9% |
> 99.9% |
97.40% |
88.30% |
| 28S 3.5K (nt 1748 - nt 1867) |
> 99.9% |
> 99.9% |
85.60% |
0% |
| 28S #2 (nt 1324 - nt 1530) |
> 99.9% |
99.60% |
92.80% |
90.50% |
| 28S.F5/R5 (nt 4341 - nt 4456) |
> 99.9% |
> 99.9% |
93.80% |
78.20% |
| 28S.5'#2 (nt 2740 - nt 2843) |
> 99.9% |
> 99.9% |
92.80% |
29.30% |
| 28S.F3/R3 (nt 2401 - nt 2630) |
> 99.9% |
> 99.9% |
83.50% |
0% |
| 28S.F4/R4 (nt 3732 - nt 3851) |
> 99.9% |
> 99.9% |
82.30% |
0% |
| 5.8S (nt 1 - nt 157) |
> 99.9% |
> 99.9% |
99.40% |
99.60% |
| 5S (nt 1 - nt 121) |
96.80% |
97.80% |
91.80% |
88.90% |
[0181] Clearly, from the results in Table 2, the exemplary method was significantly more
efficient at removal of all ribosomal RNA sequences independent of the primer sets
used for both 28S and 18S rRNA sequences with either intact or fragmented total RNA.
Whereas, for the RiboMinus™ method with the fragmented RNA, there was little or no
ribosomal subtraction depending on the location of the different primer sets for both
28S and 18S rRNA sequences.
Example 13
Significant reduction of rRNA background and improvement in uniquely mappable reads using rRNA removal method disclosed
herein compared to the RiboMinus™ method
[0182] Intact and partially fragmented Universal Human Reference RNA (UHRR) (2 x 2.5 µg
each) were treated with either the method as described in Example 9 above or the RiboMinus™
Eukaryote Kit for RNA-Seq rRNA removal kit. The respective rRNA-depleted samples were
pooled and, for each, Illumina RNA-Seq libraries were prepared in triplicate using
rRNA-depleted RNA from the equivalent of 1 µg total RNA. Replicates of the respective
RNA-Seq libraries were pooled and sequencing was performed using Illumina® GAIIx next
generation sequencer with 36-nt reads. The data were analyzed using Illumina's Pipeline
Eland_rna Module and CASAVA Software as well as the TopHat Software for mapping splice
junctions (see http:// followed by "tophat.cbcb.umd.edu/index.html"). The mapping
results showed that rRNA background was significantly reduced by the methods described
in Example 9 compared to the RiboMinus™ method (see Table 3 below). In addition, the
uniquely mappable sequences not including rRNA sequences were significantly increased
(Table 3) in the sample treated with the methods as described in Example 9 compared
to the RiboMinus™. Furthermore, for the fragmented samples, the Example 9 methods
considerably outperformed the competitive kit, both in terms of reducing rRNA background
and improving the uniquely mappable sequences (Table 3).
TABLE 3
| Total RNA Sample |
rRNA Removal Method |
% rRNA Background |
% Uniquely Mappable Sequences |
| Intact UHRR |
Example 9 |
1.4% |
58.1% |
| Intact UHRR |
RiboMInus™ |
18.4% |
51.4% |
| Fragmented UHRR |
Example 9 |
2.1% |
59.6% |
| Fragmented UHRR |
RiboMInus™ |
63.3% |
24.6% |
Table 3 show that the rRNA removal methods described in Example 9 significantly reduces
rRNA background and improves RNA-Seq results. Intact and partially fragmented Universal
Human Reference RNA (UHRR) was treated with either the method from Example 9 or the
commercial kit (RiboMinus™ method). The rRNA-depleted RNAs were then used to prepare
RNA-Seq libraries that were sequenced on an Illumina® GAIIx sequencer.
Example 14
Prophetic Example for Plant rRNA Removal
[0183] Plants generally comprises rRNA sequences corresponding to chloroplast, mitochondrial
and of nuclear origins. For chloroplast origin, the rRNA comprise 23S, 16S, 5S and
4.5S sequences (e.g. Arabidopsis thaliana; Accession # AP000423.1); for mitochondrial
origin, the rRNA comprise 18S and 5S sequences (e.g., Arabidopsis thaliana; Accession
# Y08501.2) and for nuclear origin, the rRNA comprise 25/26S, 17/18S and 5.8S sequences
(e.g. Arabidopsis thaliana; AC006837.16). PCR templates corresponding to each of the
plant rRNA sequence could be synthesized (in full or in part), as well as the respective
biotinylated rRNA sequences as described in Example 1 for
E. coli.
[0184] The respective biotinylated antisense could then be mixed either in a single ratio
or several different ratios in order to efficiently remove all rRNA sequences from
the different plant tissues (e.g. leaf, root, stem etc.) where it is known that the
representation of the different rRNA are present in varying amounts, especially dependent
on the chloroplast content. It is contemplated that the various plant rRNA sequences
will be effectively removed similar to that described for human and
E. coli rRNA sequences as in Examples 5-12 herein.
[0185] Various modifications of the invention, in addition to those described herein, will
be apparent to those skilled in the art from the foregoing description. Such modifications
are also intended to fall within the scope of the appended claims.
SEQUENCE LISTING
[0186]
<110> Epicentre Technologies Corporation Sooknanan, Roy R.
<120> Methods, Compositions, and Kits for Generating rRNA-Depleted Samples or Isolating
rRNA from Samples
<130> EPICE-30968/WO-1/ORD
<150> US 61/234,044
<151> 2009-08-14
<160> 72
<170> PatentIn version 3.5
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 1
cctacctacc tggttgatcc 20
<210> 2
<211> 51
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 2
aattctaata cgactcacta tagggagaga tccttccgca ggttcaccta c 51
<210> 3
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 3
cgactcttag cggtggatca ctc 23
<210> 4
<211> 51
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 4
aattctaata cgactcacta tagggagaga tccttccgca ggttcaccta c 51
<210> 5
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 5
gtctacggcc ataccaccct gaa 23
<210> 6
<211> 50
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 6
aattctaata cgactcacta tagggagaaa gcctacagca cccggtattc 50
<210> 7
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 7
aagcgactaa gcgtacacgg tgga 24
<210> 8
<211> 52
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 8
aattctaata cgactcacta tagggagatt cctggaagca gggcatttgt tg 52
<210> 9
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 9
caacaaatgc cctgcttcca ggaa 24
<210> 10
<211> 53
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 10
aattctaata cgactcacta tagggagaca cggttcatta gtaccggtta get 53
<210> 11
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 11
agagtttgat cctggctcag 20
<210> 12
<211> 50
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 12
aattctaata cgactcacta tagggagagg aggtgatcca accgcaggtt 50
<210> 13
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 13
tgcctggcgg cagtagcgcg gt 22
<210> 14
<211> 50
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 14
aattctaata cgactcacta tagggagatg cctggcagtt ccctactctc 50
<210> 15
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 15
gacgtgctaa tctgcgataa gc 22
<210> 16
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 16
atggattcag ttaatgatag tgtgtcg 27
<210> 17
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 17
ctgaaagcat ctaagcacga aacttgc 27
<210> 18
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 18
cctatcaacg tcgtcgtctt caac 24
<210> 19
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 19
gcctaacaca tgcaagtcga ac 22 I
<210> 20
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 20
agctaccgtt tccagtagtt atcc 24
<210> 21
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 21
cggaatcgct agtaatcgtg gat 23
<210> 22
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 22
tcccgaaggt taagctacct actt 24
<210> 23
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 23
tgcctggcag ttccctactc tc 22
<210> 24
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 24
accaggttaa cccgtatgtt ggct 24
<210> 25
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 25
accgatgttg ttggtccact ggta 24
<210> 26
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 26
ctcagtaacg gcgagtgaac 20
<210> 27
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 27
gcctcgatca gaaggacttg 20
<210> 28
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 28
taccacaggg ataactggct 20
<210> 29
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 29
taggaagagc cgacatcgaa 20
<210> 30
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 30
cctacctggt tgatcctgcc 20
<210> 31
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 31
ccaagtagga gaggagcgag 20
<210> 32
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 32
cccagtaagt gcgggtcata 20
<210> 33
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 33
tcactaaacc atccaatcgg tagta 25
<210> 34
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 34
gatccttccg caggttcacc tac 23
<210> 35
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 35
aagcctacag cacccggtat tc 22
<210> 36
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 36
tcgacagtca gccgcatctt cttt 24
<210> 37
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 37
accaaatccg ttgactccga cctt 24
<210> 38
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 38
cacaagagga agagagagac cctca 25
<210> 39
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 39
ttgatggtac atgacaaggt gcgg 24
<210> 40
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 40
gaatcaccga cctctctccc 20
<210> 41
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 41
cgactctcat aacgacccgc 20
<210> 42
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 42
ccagaggtga ccactttcaa 20
<210> 43
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 43
atgtggaaca gagccttcct c 21
<210> 44
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 44
cacgttttct cagctgcttg 20
<210> 45
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 45
ttcacctttt catccaaggc 20
<210> 46
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 46
gtgtggtggt gtgtgcctat 20
<210> 47
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 47
gagacatggt cttgctccgt 20
<210> 48
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 48
tagctcagtg gtagagcgca 20
<210> 49
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 49
gatttgctca gcagcacgta 20
<210> 50
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 50
cacttgggga cactttccag 20
<210> 51
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 51
tcagggaaaa tgagccaatc 20
<210> 52
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 52
cttagaggga caagtggcg 19
<210> 53
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 53
gtagggtagg cacacgctga 20
<210> 54
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 54
gaaacttaaa ggaattgacg gaag 24
<210> 55
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 55
gaatcgagaa agagctatca atc 23
<210> 56
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 56
cgattggatg gtttagtgag g 21
<210> 57
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 57
ccttgttacg acttttactt cctctag 27
<210> 58
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 58
gccgaaacga tctcaaccta 20
<210> 59
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 59
cgccagttct gcttaccaaa 20
<210> 60
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 60
cggaccaagg agtctaaca 19
<210> 61
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 61
caggcatagt tcaccatctt tcg 23
<210> 62
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 62
ggagagggtg taaatctcgc 20
<210> 63
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 63
gccgacttcc cttacctaca 20
<210> 64
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 64
gtgtcagaaa agttaccaca gg 22
<210> 65
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 65
ggcgaattct gcttcacaat gatag 25
<210> 66
<211> 26
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 66
gggagtaact atgactctct taaggt 26
<210> 67
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 67
ttggctgtgg tttcgctgga t 21
<210> 68
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 68
gtgaacagca gttgaacatg g 21
<210> 69
<211> 26
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 69
cttcacaaag aaaagagaac tctccc 26
<210> 70
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 70
cgactcttag cggtggatca 20
<210> 71
<211> 17
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 71
aagcgacgct cagacag 17
<210> 72
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic
<400> 72
aaagcctaca gcacccggta ttc 23