FIELD
[0001] Methods of identifying, diagnosing, prognosing, and assessing risk of developing
lupus are disclosed, as well as methods of treating lupus. Also disclosed are methods
for identifying effective lupus therapeutic agents and predicting responsiveness to
lupus therapeutic agents.
BACKGROUND
[0002] Lupus is an autoimmune disease that is estimated to affect nearly 1 million Americans,
primarily women between the ages of 20-40. Lupus involves antibodies that attack connective
tissue. The principal form of lupus is a systemic one (systemic lupus erythematosus;
SLE). SLE is a chronic autoimmune disease with strong genetic as well as environmental
components (See,
e.g., Hochberg MC, Dubois' Lupus Erythematosus. 5th ed., Wallace DJ, Hahn BH, eds. Baltimore:
Williams and Wilkins (1997);
Wakeland EK, et al., Immunity 2001;15(3):397-408;
Nath SK, et al., Curr. Opin. Immunol. 2004;16(6):794-800;
D'Cruz et al., Lancet (2007), 369:587-596). Various additional forms of lupus are known, including, but not limited to, cutaneous
lupus erythematosus (CLE), lupus nephritis (LN), and neonatal lupus.
[0003] Untreated lupus can be fatal as it progresses from attack of skin and joints to internal
organs, including lung, heart, and kidneys (with renal disease being the primary concern),
thus making early and accurate diagnosis of and/or assessment of risk of developing
lupus particularly critical. Lupus mainly appears as a series of flare-ups, with intervening
periods of little or no disease manifestation. Kidney damage, measured by the amount
of proteinuria in the urine, is one of the most acute areas of damage associated with
pathogenicity in SLE, and accounts for at least 50% of the mortality and morbidity
of the disease.
[0004] Clinically, SLE is a heterogeneous disorder characterized by high-affinity autoantibodies
(autoAbs). AutoAbs play an important role in the pathogenesis of SLE, and the diverse
clinical manifestations of the disease are due to the deposition of antibody-containing
immune complexes in blood vessels leading to inflammation in the kidney, brain and
skin. AutoAbs also have direct pathogenic effects contributing to hemolytic anemia
and thrombocytopenia. SLE is associated with the production of antinuclear antibodies,
circulating immune complexes, and activation of the complement system. SLE has an
incidence of about 1 in 700 women between the ages of 20 and 60. SLE can affect any
organ system and can cause severe tissue damage. Numerous autoAbs of differing specificity
are present in SLE. SLE patients often produce autoAbs having anti-DNA, anti-Ro, and
anti-platelet specificity and that are capable of initiating clinical features of
the disease, such as glomerulonephritis, arthritis, serositis, complete heart block
in newborns, and hematologic abnormalities. These autoAbs are also possibly related
to central nervous system disturbances. Arbuckle
et al. described the development of autoAbs before the clinical onset of SLE (
Arbuckle et al. N. Engl. J. Med. 349(16): 1526-1533 (2003)). Definitive diagnosis of lupus, including SLE, is not easy, resulting in clinicians
resorting to a multi-factorial signs and symptoms-based classification approach (
Gill et al., American Family Physician 68(11): 2179-2186(2003)).
[0005] One of the most difficult challenges in clinical management of complex autoimmune
diseases such as lupus is the accurate and early identification of the disease in
a patient. Over the years, many linkage and candidate gene studies have been performed
to identify genetic factors contributing to SLE susceptibility. Haplotypes carrying
the HLA Class II alleles DRB1*0301 and DRB 1*1501 are clearly associated with disease
as well as the presence of antibodies to nuclear autoantigens.
See, e.g., Goldberg MA, et al., Arthritis Rheum. 19(2):129-32 (1976);
Graham RR, et al., Am J Hum Genet. 71(3):543-53 (2002); and
Graham RR, et al., Eur J Hum Genet. 15(8):823-30 (2007). More recently, variants of Interferon Regulatory Factor 5 (IRF5) and Signal Transducer
and Activator of Transcription 4 (STAT4) were discovered to be significant risk factors
for SLE.
See, e.g., Sigurdsson S, et al., Am J Hum Genet. 76(3):528-37 (2005);
Graham RR, et al., Nat Genet. 38(5):550-55 (2006);
Graham RR, et al., Proc Natl Acad Sci USA 104(16):6758-63 (2007); and
Remmers EF, et al., N Engl J Med. 357(10):977-86 (2007). The identification of IRF5 and STAT4 as SLE risk genes provides support for
the concept that, in certain instances, the type I interferon (IFN) pathway plays
an important role in SLE disease pathogenesis. Type I IFN is present in serum of SLE
cases, and production of IFN is linked to the presence of Ab and nucleic acid containing
immune complexes (reviewed in
Ronnblom et al., J Exp Med 194:F59 (2001); see also
Baechler EC, et al., Curr Opin Immunol. 16(6):801-07 (2004);
Banchereau J, et al., Immunity 25(3):383-92 (2006);
Miyagi et al., J Exp Med 204(10):2383-96 (2007)). The majority of SLE cases exhibit a prominent type I IFN gene expression 'signature'
in blood cells (
Baechler et al., Proc Natl Acad Sci USA 100:2610 (2003);
Bennett et al., J Exp Med 197:711 (2003)) and have elevated levels of IFN-inducible cytokines and chemokines in serum (
Bauer et al., PLoS Med 3:e491 (2006)). Immune complexes containing native DNA and RNA stimulate toll-like receptors (TLRs)
7 and 9 expressed by dendritic cells and B cells to produce type I interferon which
further stimulates immune complex formation (reviewed in (
Marshak-Rothstein et al., Annu Rev Immunol 25, 419 (2007)).
[0006] In addition, a number of studies have been performed to identify reliable biomarkers
for diagnostic and prognostic purposes. No clinically validated diagnostic markers,
however, e.g., biomarkers, have been identified that enable clinicians or others to
accurately define pathophysiological aspects of SLE, clinical activity, response to
therapy, prognosis, or risk of developing the disease, although a number of candidate
genes and alleles (variants) have been identified that are thought to contribute to
SLE susceptibility. For example, at least 13 common alleles that contribute risk for
SLE in individuals of European ancestry have been reported (
Kyogoku et al., Am J Hum Genet 75(3):504-7 (2004);
Sigurdsson et al., Am J Hum Genet 76(3):528-37 (2005);
Graham et al., Nat Genet 38(5):550-55 (2006);
Graham et al., Proc Natl Acad Sci U S A 104(16):6758-63 (2007);
Remmers et al., N Engl J Med 357(10):977-86 (2007);
Cunninghame Graham et al., Nat Genet 40(1):83-89 (2008);
Harley et al., Nat Genet 40(2):204-10 (2008);
Horn et al., N Engl J Med 358(9):900-9 (2008);
Kozyrev et al., Nat Genet 40(2):211-6 (2008);
Nath et al., Nat Genet 40(2): 152-4 (2008);
Sawalha et al., PLoS ONE 3(3):e1727 (2008)). The putative causal alleles are known for
HLA-DR3, HLA-DR2, FCGR2A, PTPN22, ITGAM and
BANK1 (
Kyogoku et al., Am J Hum Genet 75(3):504-7 (2004);
Kozyrev et al., Nat Genet 40(2):211-6 (2008);
Nath et al., Nat Genet 40(2): 152-4 (2008)), while the risk haplotypes for
IRF5, TNFSF4 and
BLK likely contribute to SLE by influencing mRNA and protein expression levels (
Sigurdsson et al., Am J Hum Genet 76(3):528-37 (2005);
Graham et al., Nat Genet 38(5):550-55 (2006);
Graham et al., Proc Natl Acad Sci U S A 104(16):6758-63 (2007);
Cunninghame Graham et al., Nat Genet 40(1):83-89 (2008);
Horn et al., N Engl J Med 358(9):900-9 (2008)). The causal alleles for
STAT4, KIAA1542, IRAK1, PXK and other genes, such as
BLK, have not been determined (
Remmers et al., N Engl J Med 357(10):977-86 (2007);
Harley et al., Nat Genet 40(2):204-10 (2008);
Horn et al., N Engl J Med 358(9):900-9 (2008);
Sawalha et al., PLoS ONE 3(3):e1727 (2008)). These and other genetic variations associated with lupus are also described in
Int'1 Pat. Appl. No.
PCT/US2008/064430 (Int'1 Pub. No.
WO 2008/144761). While the contribution of such genetic variation to various aspects of SLE risk
and disease that has been described to date has been important, more information about
the contribution of genetic variation to, for example, the significant clinical heterogeneity
of SLE remains to be determined.
[0007] WO-A-2008/144761 teaches that the risk of developing lupus and that lupus may be diagnosed by detecting
a BLK SNP. One of the SNPs mentioned is rs922483. Also some of the SNPs of Tables
4 and 6 of the present application are disclosed in the Tables of
WO-A-2008/144761.
[0010] It would therefore be highly advantageous to have additional molecular-based diagnostic
methods that can be used to objectively identify the presence of and/or classify the
disease in a patient, define pathophysiologic aspects of lupus, clinical activity,
response to therapy, prognosis, and/or risk of developing lupus. In addition, it would
be advantageous to have molecular-based diagnostic markers associated with various
clinical and/or pathophysiological and/or other biological indicators of disease.
Thus, there is a continuing need to identify new risk loci and polymorphisms associated
with lupus as well as other autoimmune disorders. Such associations would greatly
benefit the identification of the presence of lupus in patients or the determination
of susceptibility to develop the disease. Such associations would also benefit the
identification of pathophysiologic aspects of lupus, clinical activity, response to
therapy, or prognosis. In addition, statistically and biologically significant and
reproducible information regarding such associations could be utilized as an integral
component in efforts to identify specific subsets of patients who would be expected
to significantly benefit from treatment with a particular therapeutic agent, for example
where the therapeutic agent is or has been shown in clinical studies to be of therapeutic
benefit in such specific lupus patient subpopulation.
[0011] The invention described herein meets the above-described needs and provides other
benefits.
SUMMARY
[0012] The methods disclosed are based, at least in part, on the discovery of a set of novel
loci that are associated with SLE and that contribute disease risk (SLE risk loci).
In addition, a set of alleles associated with these SLE risk loci are disclosed. Also
included is the causal allele within the
BLK locus that is associated with biological effects that increase SLE risk. In addition,
risk loci associated with other autoimmune diseases and increased SLE risk are disclosed.
[0013] In one aspect, a method, as defined in claim 1, of identifying lupus in a subject
is provided, the method comprising detecting in a biological sample derived from the
subject the presence of a variation in a SLE risk locus, wherein the SLE risk locus
is
BLK, wherein the variation in the
BLK locus occurs at a nucleotide position corresponding to the position of a single nucleotide
polymorphism (SNP), wherein the SNP is rs922483 (SEQ ID NO: 13), wherein the variation
is thymine at chromosomal location 11389322 on human chromosome 8, and wherein the
subject is suspected of suffering from lupus. In one embodiment, the detecting comprises
carrying out a process selected from a primer extension assay; an allele-specific
primer extension assay; an allele-specific nucleotide incorporation assay; an allele-specific
oligonucleotide hybridization assay; a 5' nuclease assay; an assay employing molecular
beacons; and an oligonucleotide ligation assay.
[0014] Disclosed is a method of identifying lupus in a subject is provided, the method comprising
detecting in a biological sample derived from the subject the presence of a variation
in at least one SLE risk locus as set forth in Table 4, wherein the variation in the
at least one locus occurs at a nucleotide position corresponding to the position of
a SNP for the at least one locus as set forth in Table 4, and wherein the subject
is suspected of suffering from lupus. In certain parts of the disclosure a variation
is detected in at least two loci, or at least three loci, or at least four loci, or
at least five loci, or at least ten loci, or at least 13 loci, or at 26 loci. In one
part of the disclosure the at least one locus is selected from
TNIP1, PRDM1, JAZF1, UHRF1BP1, and
IL10. In one embodiment, the variation in the at least one locus comprises a SNP as set
forth in Table 4. In certain embodiments, the presence of a variation in at least
one SLE risk locus as set forth in Table 4, wherein the variation in the at least
one locus occurs at a nucleotide position corresponding to the position of a SNP for
the at least one locus as set forth in Table 4, is detected in combination with the
presence of a variation in the
BLK SLE risk locus, wherein the variation in the
BLK locus occurs at a nucleotide position corresponding to the position of a SNP, wherein
the SNP is rs922483 (SEQ ID NO: 13), wherein the variation is thymine at chromosomal
location 11389322 on human chromosome 8. In one embodiment, the detecting comprises
carrying out a process selected from a primer extension assay; an allele-specific
primer extension assay; an allele-specific nucleotide incorporation assay; an allele-specific
oligonucleotide hybridization assay; a 5' nuclease assay; an assay employing molecular
beacons; and an oligonucleotide ligation assay.
[0015] Disclosed is a method of identifying lupus in a subject is provided, the method comprising
detecting in a biological sample derived from the subject the presence of a variation
in at least one SLE risk locus as set forth in Table 6, wherein the variation in the
at least one locus occurs at a nucleotide position corresponding to the position of
a SNP for the at least one locus as set forth in Table 6, and wherein the subject
is suspected of suffering from lupus. In certain parts of the disclosure a variation
is detected in at least two loci, or at least three loci, or at least four loci, or
at five loci. In one part of the disclosure the at least one locus is selected from
IFIH1, CFB, CLEC16A, IL12B, and
SH2B3. In one part of the disclosure the variation in the at least one locus comprises a
SNP as set forth in Table 6. In certain embodiments, the presence of a variation in
at least one SLE risk locus as set forth in Table 6, wherein the variation in the
at least one locus occurs at a nucleotide position corresponding to the position of
a SNP for the at least one locus as set forth in Table 6, is detected in combination
with the presence of a variation in the
BLK SLE risk locus, wherein the variation in the
BLK locus occurs at a nucleotide position corresponding to the position of a SNP, wherein
the SNP is rs922483 (SEQ ID NO: 13), wherein the variation is thymine at chromosomal
location 11389322 on human chromosome 8. In one embodiment, the detecting comprises
carrying out a process selected from a primer extension assay; an allele-specific
primer extension assay; an allele-specific nucleotide incorporation assay; an allele-specific
oligonucleotide hybridization assay; a 5' nuclease assay; an assay employing molecular
beacons; and an oligonucleotide ligation assay.
[0016] Disclosed is a method of identifying lupus in a subject, the method comprising detecting
in a biological sample derived from the subject the presence of a variation in at
least one SLE risk locus as set forth in Table 4 and the presence of a variation in
at least one SLE risk locus as set forth in Table 6, wherein the variation in each
locus occurs at a nucleotide position corresponding to the position of a SNP for each
locus as set forth in Tables 4 and 6, respectively, and wherein the subject is suspected
of suffering from lupus. In certain parts of the disclosure, a variation is detected
in at least three loci, or at least four loci, or at least five loci, or at least
seven loci, or at least ten loci. In one part of the disclosure the at least one locus
as set forth in Table 4 is selected from
TNIP1, PRDM1, JAZF1, UHRF1BP1, and
IL10 and the at least one locus as set forth in Table 6 is selected from
IFIH1, CFB, CLEC16A, IL12B, and
SH2B3. In one part of the disclosure the variation in the at least one locus as set forth
in Table 4 and the variation in the at least one locus as set forth in Table 6 comprises
a SNP as set forth in Tables 4 and 6, respectively. In certain embodiments, the presence
of a variation in at least one SLE risk locus as set forth in Table 4, wherein the
variation in the at least one locus occurs at a nucleotide position corresponding
to the position of a SNP for the at least one locus as set forth in Table 4, and the
presence of a variation in at least one SLE risk locus as set forth in Table 6, wherein
the variation in the at least one locus occurs at a nucleotide position corresponding
to the position of a SNP for the at least one locus as set forth in Table 6, is detected
in combination with the presence of a variation in the
BLK SLE risk locus, wherein the variation in the
BLK locus occurs at a nucleotide position corresponding to the position of a SNP, wherein
the SNP is rs922483 (SEQ ID NO: 13), wherein the variation is thymine at chromosomal
location 11389322 on human chromosome 8. In one embodiment, the detecting comprises
carrying out a process selected from a primer extension assay; an allele-specific
primer extension assay; an allele-specific nucleotide incorporation assay; an allele-specific
oligonucleotide hybridization assay; a 5' nuclease assay; an assay employing molecular
beacons; and an oligonucleotide ligation assay.
[0017] In one part of the disclosure, a method for predicting responsiveness of a subject
with lupus to a lupus therapeutic agent is provided, the method comprising determining
whether the subject comprises a variation in a SLE risk locus, wherein the SLE risk
locus is
BLK, wherein the variation in the
BLK locus occurs at a nucleotide position corresponding to the position of a SNP, wherein
the SNP is rs922483 (SEQ ID NO: 13), wherein the variation is thymine at chromosomal
location 11389322 on human chromosome 82, wherein the presence of the variation in
the
BLK SLE risk locus indicates the responsiveness of the subject to the therapeutic agent.
[0018] In another part of the disclosure, a method for predicting responsiveness of a subject
with lupus to a lupus therapeutic agent is provided, the method comprising determining
whether the subject comprises a variation in at least one SLE risk locus as set forth
in Table 4, wherein the variation in the at least one locus occurs at a nucleotide
position corresponding to the position of a SNP for the at least one locus as set
forth in Table 4, wherein the presence of a variation in the at least one locus indicates
the responsiveness of the subject to the therapeutic agent. In certain parts of the
disclosure, the subject comprises a variation in at least two loci, or at least three
loci, or at least four loci, or at least five loci, or at least ten loci, or at least
13 loci, or at 26 loci. In one part of the disclosure, the at least one locus is selected
from
TNIP1, PRDM1, JAZF1, UHRF1BP1, and
IL10. In one part of the disclosure, the variation in the at least one locus comprises
a SNP as set forth in Table 4. In certain parts of the disclosure, the method comprises
determining whether the subject comprises a variation in at least one SLE risk locus
as set forth in Table 4, wherein the variation in the at least one locus occurs at
a nucleotide position corresponding to the position of a SNP for the at least one
locus as set forth in Table 4, in combination with a variation in the
BLK SLE risk locus, wherein the variation in the
BLK locus occurs at a nucleotide position corresponding to the position of a SNP, wherein
the SNP is rs922483 (SEQ ID NO: 13), wherein the variation is thymine at chromosomal
location 11389322 on human chromosome 8, wherein the presence of a variation in the
at least one locus as set forth in Table 4 and the presence of the variation in the
BLK locus indicates the responsiveness of the subject to the therapeutic agent.
[0019] In still another part of the disclosure, a method for predicting responsiveness of
a subject with lupus to a lupus therapeutic agent is provided, the method comprising
determining whether the subject comprises a variation in at least one SLE risk locus
as set forth in Table 6, wherein the variation in the at least one locus occurs at
a nucleotide position corresponding to the position of a SNP for the at least one
locus as set forth in Table 6, wherein the presence of a variation in the at least
one locus indicates the responsiveness of the subject to the therapeutic agent. In
certain parts of the disclosure, the subject comprises a variation in at least two
loci, or at least three loci, or at least four loci, or at five loci. In one part
of the disclosure, the at least one locus is selected from
IFIH1, CFB, CLEC16A, IL12B, and
SH2B3. In one part of the disclosure, the variation in the at least one locus comprises
a SNP as set forth in Table 6. In certain parts of the disclosure, the method comprises
determining whether the subject comprises a variation in at least SLE risk locus as
set forth in Table 6, wherein the variation in the at least one locus occurs at a
nucleotide position corresponding to the position of a SNP for the at least one locus
as set forth in Table 6, in combination with a variation in the
BLK SLE risk locus, wherein the variation in the
BLK locus occurs at a nucleotide position corresponding to the position of a SNP, wherein
the SNP is rs922483 (SEQ ID NO: 13), wherein the variation is thymine at chromosomal
location 11389322 on human chromosome 8, wherein the presence of a variation in the
at least one locus as set forth in Table 6 and the presence of the variation in the
BLK locus indicates the responsiveness of the subject to the therapeutic agent.
[0020] In a further part of the disclosure, a method for predicting responsiveness of a
subject with lupus to a lupus therapeutic agent is provided, the method comprising
determining whether the subject comprises a variation in at least one SLE risk locus
as set forth in Table 4, wherein the variation in the at least one locus occurs at
a nucleotide position corresponding to the position of a SNP for the at least one
locus as set forth in Table 4, and a variation in at least one SLE risk locus as set
forth in Table 6, wherein the variation in the at least one locus occurs at a nucleotide
position corresponding to the position of a SNP for the at least one locus as set
forth in Table 6, wherein the presence of a variation in the at least one locus as
set forth in Table 4 and the presence of a variation in the at least one locus as
set forth in Table 6 indicates the responsiveness of the subject to the therapeutic
agent. In certain parts of the disclosure, the subject comprises a variation in at
least three loci, or at least four loci, or at least five loci, or at least seven
loci, or at least ten loci. In one embodiment, the at least one locus as set forth
in Table 4 is selected from
TNIP1, PRDM1, JAZF1, UHRF1BP1, and
IL10 and the at least one locus as set forth in Table 6 is selected from
IFIH1, CFB, CLEC16A, IL12B, and
SH2B3. In one part of the disclosure, the variation in the at least one locus as set forth
in Table 4 and the at least one locus as set forth in Table 6 comprises a SNP as set
forth in Tables 4 and 6, respectively. In certain parts of the disclosure, the method
comprises determining whether the subject comprises a variation in at least one SLE
risk locus as set forth in Table 4, wherein the variation in the at least one locus
occurs at a nucleotide position corresponding to the position of a SNP for the at
least one locus as set forth in Table 4, and a variation in at least one SLE risk
locus as set forth in Table 6, wherein the variation in the at least one locus occurs
at a nucleotide position corresponding to the position of a SNP for the at least one
locus as set forth in Table 6, in combination with a variation in the
BLK SLE risk locus, wherein the variation in the
BLK locus occurs at a nucleotide position corresponding to the position of a SNP, wherein
the SNP is rs922483 (SEQ ID NO: 13), wherein the variation is thymine at chromosomal
location 11389322 on human chromosome 8, wherein the presence of a variation in the
at least one locus as set forth in Table 4 and the presence of a variation in the
at least one locus as set forth in Table 6 and the presence of the variation in the
BLK locus indicates the responsiveness of the subject to the therapeutic agent.
[0021] In yet another part of the disclosure, a method of diagnosing or prognosing lupus
in a subject is provided, the method comprising detecting in a biological sample derived
from the subject the presence of a variation in a SLE risk locus, wherein the SLE
risk locus is
BLK, wherein the variation in the
BLK locus occurs at a nucleotide position corresponding to the position of a SNP, wherein
the SNP is rs922483 (SEQ ID NO: 13), wherein the variation is thymine at chromosomal
location 11389322 on human chromosome 8, and the presence of the variation in the
BLK locus is a diagnosis or prognosis of lupus in the subject.
[0022] In yet a further part of the disclosure, a method of diagnosing or prognosing lupus
in a subject is provided, the method comprising detecting in a biological sample derived
from the subject the presence of a variation in at least one SLE risk locus as set
forth in Table 4, wherein: the biological sample is known to comprise, or suspected
of comprising, nucleic acid comprising a variation in at least one SLE risk locus
as set forth in Table 4; the variation in the at least one locus comprises, or is
located at a nucleotide position corresponding to, a SNP as set forth in Table 4;
and the presence of the variation in the at least one locus is a diagnosis or prognosis
of lupus in the subject. In certain parts of the disclosure, a variation is detected
in at least two loci, or at least three loci, or at least four loci, or at least five
loci, or at least ten loci, or at least 13 loci, or at 26 loci. In one part of the
disclosure, the at least one SLE risk locus is selected from
TNIP1, PRDM1, JAZF1, UHRF1BP1, and
IL10. In certain parts of the disclosure, the method comprises detecting the presence of
a variation in at least one SLE risk locus as set forth in Table 4 in combination
with the presence of a variation in the
BLK SLE risk locus, wherein: the biological sample is known to comprise, or suspected
of comprising, nucleic acid comprising a variation in at least one SLE risk locus
as set forth in Table 4 and a variation in the
BLK locus, the variation in the at least one locus as set forth in Table 4 comprises,
or is located at a nucleotide position corresponding to, a SNP as set forth in Table
4, and the variation in the
BLK locus occurs at a nucleotide position corresponding to the position of a SNP, wherein
the SNP is rs922483 (SEQ ID NO: 13), wherein the variation is thymine at chromosomal
location 11389322 on human chromosome 8, and the presence of the variation in the
at least one locus as set forth in Table 4 and the presence of the variation in the
BLK locus is a diagnosis or prognosis of lupus in the subject.
[0023] In a still further part of the disclosure, a method of diagnosing or prognosing lupus
in a subject is provided, the method comprising detecting in a biological sample derived
from the subject the presence of a variation in at least one SLE risk locus as set
forth in Table 6, wherein: the biological sample is known to comprise, or suspected
of comprising, nucleic acid comprising a variation in at least one SLE risk locus
as set forth in Table 6; the variation in the at least one locus comprises, or is
located at a nucleotide position corresponding to, a SNP as set forth in Table 6;
and the presence of the variation in the at least one locus is a diagnosis or prognosis
of lupus in the subject. In certain parts of the disclosure, a variation is detected
in at least two loci, or at least three loci, or at least four loci, or at five loci.
In one part of the disclosure the at least one SLE risk locus is selected from
IFIH1, CFB, CLEC16A, IL12B, and
SH2B3. In certain parts of the disclosure, the method comprises detecting the presence of
a variation in at least one SLE risk locus as set forth in Table 6 in combination
with the presence of a variation in the
BLK SLE risk locus, wherein: the biological sample is known to comprise, or suspected
of comprising, nucleic acid comprising a variation in at least one SLE risk locus
as set forth in Table 6 and a variation in the
BLK locus, the variation in the at least one locus as set forth in Table 6 comprises,
or is located at a nucleotide position corresponding to, a SNP as set forth in Table
6, and the variation in the
BLK locus occurs at a nucleotide position corresponding to the position of a SNP, wherein
the SNP is rs922483 (SEQ ID NO: 13), wherein the variation is thymine at chromosomal
location 11389322 on human chromosome 8, and the presence of the variation in the
at least one locus as set forth in Table 6 and the presence of the variation in the
BLK locus is a diagnosis or prognosis of lupus in the subject.
[0024] In yet another part of the disclosure, a method of diagnosing or prognosing lupus
in a subject is provided, the method comprising detecting in a biological sample derived
from the subject the presence of a variation in at least one SLE risk locus as set
forth in Table 4 and the presence of a variation in at least one SLE risk locus as
set forth in Table 6, wherein: the biological sample is known to comprise, or suspected
of comprising, nucleic acid comprising a variation in at least one SLE risk locus
as set forth in Table 4 and a variation in at least one SLE risk locus as set forth
in Table 6; the variation in the at least one locus comprises, or is located at a
nucleotide position corresponding to, a SNP as set forth in Tables 4 and 6, respectively;
and the presence of the variation in the at least one locus as set forth in Table
4 and the presence of the variation in the at least one locus as set forth in Table
6 is a diagnosis or prognosis of lupus in the subject. In certain parts of the disclosure,
a variation is detected in at least three loci, or at least four loci, or at least
five loci, or at least seven loci, or at least ten loci. In one part of the disclosure,
the at least one SLE risk locus as set forth in Table 4 is selected from
TNIP1, PRDM1, JAZF1, UHRF1BP1, and
IL10 and the at least one SLE risk locus as set forth in Table 6 is selected from
IFIH1, CFB, CLEC16A, IL12B, and
SH2B3. In certain parts of the disclosure, the method comprises detecting the presence of
a variation in at least one SLE risk locus as set forth in Table 4 and the presence
of a variation in at least one SLE risk locus as set forth in Table 6 in combination
with the presence of a variation in the
BLK SLE risk locus, wherein: the biological sample is known to comprise, or suspected
of comprising, nucleic acid comprising a variation in at least one SLE risk locus
as set forth in Table 4 and variation in at least SLE risk locus as set forth in Table
6 and a variation in the
BLK locus, the variation in the at least one locus as set forth in Table 4 comprises,
or is located at a nucleotide position corresponding to, a SNP as set forth in Table
4, and the variation in the at least one locus as set forth in Table 6 comprises,
or is located at a nucleotide position corresponding to, a SNP as set forth in Table
6, and the variation in the
BLK locus occurs at a nucleotide position corresponding to the position of a SNP, wherein
the SNP is rs922483 (SEQ ID NO: 13), wherein the variation is thymine at chromosomal
location 11389322 on human chromosome 8, and the presence of the variation in the
at least one locus as set forth in Table 4 and the presence of the variation in the
at least one locus as set forth in Table 6 and the presence of the variation in the
BLK locus is a diagnosis or prognosis of lupus in the subject.
[0025] In another part of the disclosure, a method of aiding in the diagnosis or prognosis
of lupus in a subject is provided, the method comprising detecting in a biological
sample derived from the subject the presence of a variation in a SLE risk locus, wherein
the SLE risk locus is
BLK, wherein the variation in the
BLK locus occurs at a nucleotide position corresponding to the position of a SNP, wherein
the SNP is rs922483 (SEQ ID NO: 13), wherein the variation is thymine at chromosomal
location 11389322 on human chromosome 8, and the presence of the variation in the
BLK locus is a diagnosis or prognosis of lupus in the subject.
[0026] In yet another part of the disclosure, a method of aiding in the diagnosis or prognosis
of lupus in a subject is provided, the method comprising detecting in a biological
sample derived from the subject the presence of a variation in at least one SLE risk
locus as set forth in Table 4, wherein: the biological sample is known to comprise,
or suspected of comprising, nucleic acid comprising a variation in at least one SLE
risk locus as set forth in Table 4; the variation in the at least one locus comprises,
or is located at a nucleotide position corresponding to, a SNP as set forth in Table
4; and the presence of the variation in the at least one locus is a diagnosis or prognosis
of lupus in the subject. In certain parts of the disclosure, a variation is detected
in at least two loci, or at least three loci, or at least four loci, or at least five
loci, or at least ten loci, or at least 13 loci, or at 26 loci. In one part of the
disclosure, the at least one SLE risk locus is selected from
TNIP1, PRDM1, JAZF1, UHRF1BP1, and
IL10. In certain parts of the disclosure, the method comprises detecting the presence of
a variation in at least one SLE risk locus as set forth in Table 4 in combination
with the presence of a variation in the
BLK SLE risk locus, wherein: the biological sample is known to comprise, or suspected
of comprising, nucleic acid comprising a variation in at least one SLE risk locus
as set forth in Table 4 and a variation in the
BLK locus, the variation in the at least one locus as set forth in Table 4 comprises,
or is located at a nucleotide position corresponding to, a SNP as set forth in Table
4, and the variation in the
BLK locus occurs at a nucleotide position corresponding to the position of a SNP, wherein
the SNP is rs922483 (SEQ ID NO: 13), wherein the variation is thymine at chromosomal
location 11389322 on human chromosome 8, and the presence of the variation in the
at least one locus as set forth in Table 4 and the presence of the variation in the
BLK locus is a diagnosis or prognosis of lupus in the subject.
[0027] In a still further part of the disclosure, a method of aiding in the diagnosis or
prognosis of lupus in a subject is provided, the method comprising detecting in a
biological sample derived from the subject the presence of a variation in at least
one SLE risk locus as set forth in Table 6, wherein: the biological sample is known
to comprise, or suspected of comprising, nucleic acid comprising a variation in at
least one SLE risk locus as set forth in Table 6; the variation in the at least one
locus comprises, or is located at a nucleotide position corresponding to, a SNP as
set forth in Table 6; and the presence of the variation in the at least one locus
is a diagnosis or prognosis of lupus in the subject. In certain parts of the disclosure,
a variation is detected in at least two loci, or at least three loci, or at least
four loci, or at five loci. In one part of the disclosure, the at least one SLE risk
locus is selected from
IFIH1, CFB, CLEC16A, IL12B, and
SH2B3. In certain parts of the disclosure, the method comprises detecting the presence of
a variation in at least one SLE risk locus as set forth in Table 6 in combination
with the presence of a variation in the
BLK SLE risk locus, wherein: the biological sample is known to comprise, or suspected
of comprising, nucleic acid comprising a variation in at least one SLE risk locus
as set forth in Table 6 and a variation in the
BLK locus, the variation in the at least one locus as set forth in Table 6 comprises,
or is located at a nucleotide position corresponding to, a SNP as set forth in Table
6, and the variation in the
BLK locus occurs at a nucleotide position corresponding to the position of a SNP, wherein
the SNP is rs922483 (SEQ ID NO: 13), wherein the variation is thymine at chromosomal
location 11389322 on human chromosome 8, and the presence of the variation in the
at least one locus as set forth in Table 6 and the presence of the variation in the
BLK locus is a diagnosis or prognosis of lupus in the subject.
[0028] In yet a further part of the disclosure, a method of aiding in the diagnosis or prognosis
of lupus in a subject is provided, the method comprising detecting in a biological
sample derived from the subject the presence of a variation in at least one SLE risk
locus as set forth in Table 4 and the presence of a variation in at least one SLE
risk locus as set forth in Table 6, wherein: the biological sample is known to comprise,
or suspected of comprising, nucleic acid comprising a variation in at least one SLE
risk locus as set forth in Table 4 and a variation in at least one SLE risk locus
as set forth in Table 6; the variation in the at least one locus comprises, or is
located at a nucleotide position corresponding to, a SNP as set forth in Tables 4
and 6, respectively; and the presence of the variation in the at least one locus as
set forth in Table 4 and the presence of the variation in the at least one locus as
set forth in Table 6 is a diagnosis or prognosis of lupus in the subject. In certain
parts of the disclosure, a variation is detected in at least three loci, or at least
four loci, or at least five loci, or at least seven loci, or at least ten loci. In
one part of the disclosure, the at least one SLE risk locus as set forth in Table
4 is selected from
TNIP1, PRDM1, JAZF1, UHRF1BP1, and
IL10 and the at least one SLE risk locus as set forth in Table 6 is selected from
IFIH1, CFB, CLEC16A, IL12B, and
SH2B3. In certain parts of the disclosure, the method comprises detecting the presence of
a variation in at least one SLE risk locus as set forth in Table 4 and the presence
of a variation in at least one SLE risk locus as set forth in Table 6 in combination
with the presence of a variation in the
BLK SLE risk locus, wherein: the biological sample is known to comprise, or suspected
of comprising, nucleic acid comprising a variation in at least one SLE risk locus
as set forth in Table 4 and variation in at least SLE risk locus as set forth in Table
6 and a variation in the
BLK locus, the variation in the at least one locus as set forth in Table 4 comprises,
or is located at a nucleotide position corresponding to, a SNP as set forth in Table
4, and the variation in the at least one locus as set forth in Table 6 comprises,
or is located at a nucleotide position corresponding to, a SNP as set forth in Table
6, and the variation in the
BLK locus occurs at a nucleotide position corresponding to the position of a SNP, wherein
the SNP is rs922483 (SEQ ID NO: 13), wherein the variation is thymine at chromosomal
location 11389322 on human chromosome 8, and the presence of the variation in the
at least one locus as set forth in Table 4 and the presence of the variation in the
at least one locus as set forth in Table 6 and the presence of the variation in the
BLK locus is a diagnosis or prognosis of lupus in the subject.
[0029] In one part of the disclosure, a method of treating a lupus condition in a subject
is provided, wherein a genetic variation is known to be present at a nucleotide position
corresponding to a SNP in a SLE risk locus, wherein the SNP is rs922483 (SEQ ID NO:
13) and the SLE risk locus is
BLK, wherein the variation is thymine at chromosomal location 11389322 on human chromosome
8, the method comprising administering to the subject a therapeutic agent effective
to treat the condition.
[0030] In another part of the disclosure, a method of treating a lupus condition in a subject
in whom a genetic variation is known to be present at a nucleotide position corresponding
to a SNP as set forth in Table 4 in at least one SLE risk locus as set forth in Table
4 is provided, the method comprising administering to the subject a therapeutic agent
effective to treat the condition. In one part of the disclosure, the at least one
SLE risk locus is selected from
TNIP1, PRDM1, JAZF1, UHRF1BP1, and
IL10.
[0031] In another part of the disclosure, a method of treating a lupus condition in a subject
in whom a genetic variation is known to be present at a nucleotide position corresponding
to a SNP as set forth in Table 6 in at least one SLE risk locus as set forth in Table
6 is provided, the method comprising administering to the subject a therapeutic agent
effective to treat the condition. In one part of the disclosure, the at least one
SLE risk locus is selected from
IFIH1, CFB, CLEC16A, IL12B, and
SH2B30.
[0032] In another part of the disclosure, a method of treating a subject having a lupus
condition is provided, the method comprising administering to the subject a therapeutic
agent effective to treat the condition in a subject who has a genetic variation at
a nucleotide position corresponding to a SNP in a SLE risk locus, wherein the SNP
is rs922483 (SEQ ID NO: 13) and the SLE risk locus is
BLK, wherein the variation is thymine at chromosomal location 11389322 on human chromosome
8.
[0033] In yet another part of the disclosure, a method of treating a subject having a lupus
condition is provided, the method comprising administering to the subject a therapeutic
agent effective to treat the condition in a subject who has a genetic variation at
a nucleotide position corresponding to a SNP as set forth in Table 4 in at least one
SLE risk locus as set forth in Table 4. In one part of the disclosure, the at least
one SLE risk locus is selected from
TNIP1, PRDM1, JAZF1, UHRF1BP1, and
IL10.
[0034] In still yet another part of the disclosure, a method of treating a subject having
a lupus condition is provided, the method comprising administering to the subject
a therapeutic agent effective to treat the condition in a subject who has a genetic
variation at a nucleotide position corresponding to a SNP as set forth in Table 6
in at least one SLE risk locus as set forth in Table 6. In one part of the disclosure,
the at least one SLE risk locus is selected from
IFIH1, CFB, CLEC16A, IL12B, and
SH2B3.
[0035] In yet another part of the disclosure, a method of treating a subject having a lupus
condition is provided, the method comprising administering to the subject a therapeutic
agent shown to be effective to treat said condition in at least one clinical study
wherein the agent was administered to at least five human subjects who each had a
genetic variation at a nucleotide position corresponding to a SNP in a SLE risk locus,
wherein the SNP is rs922483 (SEQ ID NO: 13) and the SLE risk locus is
BLK, wherein the variation is thymine at chromosomal location 11389322 on human chromosome
8.
[0036] In still yet another part of the disclosure, a method of treating a subject having
a lupus condition is provided, the method comprising administering to the subject
a therapeutic agent shown to be effective to treat said condition in at least one
clinical study wherein the agent was administered to at least five human subjects
who each had a genetic variation at a nucleotide position corresponding to a SNP as
set forth in Table 4 in at least one SLE risk locus as set forth in Table 4. In one
part of the disclosure, the at least one SLE risk locus is selected from
TNIP1, PRDM1, JAZF1, UHRF1BP1, and
IL10.
[0037] In yet another part of the disclosure, a method of treating a subject having a lupus
condition is provided, the method comprising administering to the subject a therapeutic
agent shown to be effective to treat said condition in at least one clinical study
wherein the agent was administered to at least five human subjects who each had a
genetic variation at a nucleotide position corresponding to a SNP as set forth in
Table 6 in at least one SLE risk locus as set forth in Table 6. In one part of the
disclosure, the at least one SLE risk locus is selected from
IFIH1, CFB, CLEC16A, IL12B, and
SH2B3.
[0038] In another part of the disclosure, a method comprising manufacturing a lupus therapeutic
agent is provided, which includes packaging the agent with instructions to administer
the agent to a subject who has or is believed to have lupus and who has a genetic
variation at a position corresponding to a SNP in a SLE risk locus, wherein the SNP
is rs922483 (SEQ ID NO: 13) and the SLE risk locus is
BLK, wherein the variation is thymine at chromosomal location 11389322 on human chromosome
8.
[0039] In yet another part of the disclosure, a method comprising manufacturing a lupus
therapeutic agent is provided, which includes packaging the agent with instructions
to administer the agent to a subject who has or is believed to have lupus and who
has a genetic variation at a position corresponding to a SNP as set forth in Table
4 in at least one SLE risk locus as set forth in Table 4.
[0040] In yet a further part of the disclosure, a method comprising manufacturing a lupus
therapeutic agent is provided, which includes packaging the agent with instructions
to administer the agent to a subject who has or is believed to have lupus and who
has a genetic variation at a position corresponding to a SNP as set forth in Table
6 in at least one SLE risk locus as set forth in Table 6.
[0041] In one part of the disclosure, a method for selecting a patient suffering from lupus
for treatment with a lupus therapeutic agent is provided, the method comprising detecting
the presence of a genetic variation at a nucleotide position corresponding to a SNP
in a SLE risk locus, wherein the SNP is rs922483 (SEQ ID NO: 13) and the SLE risk
locus is
BLK, wherein the variation is thymine at chromosomal location 11389322 on human chromosome
8. In one part of the disclosure, the detecting comprises carrying out a process selected
from a primer extension assay; an allele-specific primer extension assay; an allele-specific
nucleotide incorporation assay; an allele-specific oligonucleotide hybridization assay;
a 5' nuclease assay; an assay employing molecular beacons; and an oligonucleotide
ligation assay.
[0042] In a further part of the disclosure, a method for selecting a patient suffering from
lupus for treatment with a lupus therapeutic agent is provided, the method comprising
detecting the presence of a genetic variation at a nucleotide position corresponding
to a SNP as set forth in Table 4 in at least one SLE risk locus as set forth in Table
4. In certain parts of the disclosure, a variation is detected in at least two loci,
or at least three loci, or at least four loci, or at least five loci, or at least
ten loci, or at least 13 loci, or at 26 loci. In one part of the disclosure, the at
least one SLE risk locus is selected from
TNIP1, PRDM1, JAZF1, UHRF1BP1, and
IL10. In one part of the disclosure, the variation at the least one locus comprises a SNP
as set forth Table 4. In one part of the disclosure, the detecting comprises carrying
out a process selected from a primer extension assay; an allele-specific primer extension
assay; an allele-specific nucleotide incorporation assay; an allele-specific oligonucleotide
hybridization assay; a 5' nuclease assay; an assay employing molecular beacons; and
an oligonucleotide ligation assay.
[0043] In a further part of the disclosure, a method for selecting a patient suffering from
lupus for treatment with a lupus therapeutic agent is provided, the method comprising
detecting the presence of a genetic variation at a nucleotide position corresponding
to a SNP as set forth in Table 6 in at least one SLE risk locus as set forth in Table
6. In certain parts of the disclosure, a variation is detected in at least two loci,
or at least three loci, or at least four loci, or at five loci. In one part of the
disclosure, the at least one SLE risk locus is selected from
IFIH1, CFB, CLEC16A, IL12B, and
SH2B3. In one part of the disclosure, the variation at the least one locus comprises a SNP
as set forth Table 6. In one part of the disclosure, the detecting comprises carrying
out a process selected from a primer extension assay; an allele-specific primer extension
assay; an allele-specific nucleotide incorporation assay; an allele-specific oligonucleotide
hybridization assay; a 5' nuclease assay; an assay employing molecular beacons; and
an oligonucleotide ligation assay.
[0044] In another part of the disclosure, a method of assessing whether a subject is at
risk of developing lupus is provided, the method comprising detecting in a biological
sample obtained from the subject, the presence of a genetic signature indicative of
risk of developing lupus, wherein said genetic signature comprises a set of at least
three SNPs, each SNP occurring in a SLE risk locus as set forth in Table 4 and/or
Table 6. In certain parts of the disclosure, the genetic signature comprises a set
of at least four SNPs, or at least five SNPs, or at least seven SNPs, or at least
ten SNPs. In one embodiment, the SLE risk loci are selected from
TNIP1, PRDM1, JAZF1, UHRF1BP1, IL10, IFIH1, CFB, CLEC16A, IL12B, and
SH2B3. In certain parts of the disclosure, the genetic signature further comprises a SNP
in a SLE risk locus, wherein the SNP is rs922483 (SEQ ID NO: 13) and the SLE risk
locus is
BLK, wherein the variation is thymine at chromosomal location 11389322 on human chromosome
8.
[0045] In a further part of the disclosure, a method of diagnosing lupus in a subject is
provided, the method comprising detecting in a biological sample obtained from said
subject, the presence of a genetic signature indicative of lupus, wherein said genetic
signature comprises a set of at least three SNPs, each SNP occurring in a SLE risk
locus as set forth in Table 4 and/or Table 6. In certain parts of the disclosure,
the genetic signature comprises a set of at least four SNPs, or at least five SNPs,
or at least seven SNPs, or at least ten SNPs, or at least 15 SNPs, or at least 20
SNPs, or at least 30 SNPs. In one embodiment, the SLE risk loci are selected from
TNIP1, PRDM1, JAZF1, UHRF1BP1, IL10, IFIH1, CFB, CLEC16A, IL12B, and
SH2B3. In certain parts of the disclosure, the genetic signature further comprises a SNP
in a SLE risk locus, wherein the SNP is rs922483 (SEQ ID NO: 13) and the SLE risk
locus is
BLK, wherein the variation is thymine at chromosomal location 11389322 on human chromosome
8.
BRIEF DESCRIPTION OF THE DRAWINGS
[0046]
Figure 1 shows an overview of the experimental design for the targeted replication
study of certain SNPs to identify additional SLE risk loci as described in Example
1.
Figure 2 shows novel genome-wide significant associations in SLE and the identification
of novel risk loci within TNIP1 (A), PRDM1 (B), JAZF1 (C), UHRF1BP1 (D), and IL10 (E) as described in Example 1. (F) A histogram of the P values of independent SNPs
in the case and control replication samples as described in Example 1; the expected
density of results under a null distribution is indicated by the dashed line.
Figure 3 shows the percentage of variants reaching candidate (P < 1 x 10-5) and confirmed (P < 5 x 10-8) status in the meta-analysis stratified by the P value in the original GWAS as described
in Example 1.
Figure 4 shows a linkage disequilibrium block (shown in r2) within the BLK promoter region as described in Example 2. Figure 4 discloses 'C>T-rs922483' as SEQ
ID NO: 13.
Figure 5 shows the results of luciferase reporter gene expression assays of the BLK promoter region having various haplotypes as described in Example 2. (A) SNP rs922483
C>T (SEQ ID NO: 13) in BJAB cells; (B) SNP rs922483 C>T (SEQ ID NO: 13) in Daudi cells;
(C) SNP rs1382568 A>C/G>C in BJAB cells; (D) SNP rs1382568 A>C/G>C in Daudi cells;
(E) SNP rs4840568 G>A in BJAB cells; (F) SNP rs4840568 G>A in Daudi cells; data shown
represent the mean +/- standard error of the mean in triplicate assays; grey bars
show the results for the haplotype indicated to the left of the graph; hatched bar:
risk haplotype 22-ACT; stippled bar: non-risk haplotype 22-GAC; *p<0.05, **p<0.01,
***p<0.001, ns=not significant (t-test). Figures 5A-F disclose '22 (GT) repeat' as
SEQ ID NO: 15. Figures 5C-F also disclose 'rs922483 C>T' as SEQ ID NO: 13.
Figure 6 shows the results of luciferase reporter gene expression assays of the BLK promoter region having either 18 (GT) repeats (SEQ ID NO: 14) or 22 (GT) repeats
(SEQ ID NO: 15) and the SNP rs1382568 A>C/G>C in Daudi cells as described in Example
2. Data shown represent the mean +/- standard error of the mean in duplicate assays;
ns=not significant (t-test). Figure 6 discloses '18 (GT) repeat' as SEQ ID NO: 14,
'22 (GT) repeat' as SEQ ID NO: 15, and 'rs922483 C>T' as SEQ ID NO: 13.
Figure 7 shows the sequence of the SNP, rs922483 (SEQ ID NO: 13), and the location
within the SNP of the causal allele for the BLK locus as described in Example 2. The location of the causal allele is shown by bold
brackets; the C/T variations are indicated in bold.
DETAILED DESCRIPTION
[0047] The practice of the present invention will employ, unless otherwise indicated, conventional
techniques of molecular biology (including recombinant techniques), microbiology,
cell biology, biochemistry, and immunology, which are within the skill of the art.
Such techniques are explained fully in the literature, such as, "
Molecular Cloning: A Laboratory Manual", second edition (Sambrook et al., 1989); "
Oligonucleotide Synthesis" (M. J. Gait, ed., 1984); "
Animal Cell Culture" (R. I. Freshney, ed., 1987); "
Methods in Enzymology" (Academic Press, Inc.); "
Current Protocols in Molecular Biology" (F. M. Ausubel et al., eds., 1987, and periodic updates); "
PCR: The Polymerase Chain Reaction", (Mullis et al., eds., 1994). In addition, primers, oligonucleotides and polynucleotides employed in the present
invention can be generated using standard techniques known in the art.
[0048] Unless defined otherwise, technical and scientific terms used herein have the same
meaning as commonly understood by one of ordinary skill in the art to which this invention
belongs. For example,
Singleton et al., Dictionary of Microbiology and Molecular Biology 2nd ed., J. Wiley
& Sons (New York, N.Y. 1994), and
March, Advanced Organic Chemistry Reactions, Mechanisms and Structure 4th ed., John
Wiley & Sons (New York, N.Y. 1992), provide one skilled in the art with a general guide to many of the terms used in
the present application.
DEFINITIONS
[0049] For purposes of interpreting this specification, the following definitions will apply
and whenever appropriate, terms used in the singular will also include the plural
and vice versa. As used in this specification and the appended claims, the singular
forms "a," "an" and "the" include plural referents unless the context clearly dictates
otherwise. Thus, for example, reference to "a protein" includes a plurality of proteins;
reference to "a cell" includes mixtures of cells, and the like. In the event that
any definition set forth below conflicts with any document incorporated herein by
reference, the definition set forth below shall control.
[0050] "Lupus" or "lupus condition", as used herein is an autoimmune disease or disorder
that in general involves antibodies that attack connective tissue. The principal form
of lupus is a systemic one, systemic lupus erythematosus (SLE), including cutaneous
SLE and subacute cutaneous SLE, as well as other types of lupus (including nephritis,
extrarenal, cerebritis, pediatric, non-renal, discoid, and alopecia).
[0051] The term "polynucleotide" or "nucleic acid," as used interchangeably herein, refers
to polymers of nucleotides of any length, and include DNA and RNA. The nucleotides
can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and/or
their analogs, or any substrate that can be incorporated into a polymer by DNA or
RNA polymerase. A polynucleotide may comprise modified nucleotides, such as methylated
nucleotides and their analogs. If present, modification to the nucleotide structure
may be imparted before or after assembly of the polymer. The sequence of nucleotides
may be interrupted by non-nucleotide components. A polynucleotide may be further modified
after polymerization, such as by conjugation with a labeling component. Other types
of modifications include, for example, "caps", substitution of one or more of the
naturally occurring nucleotides with an analog, internucleotide modifications such
as, for example, those with uncharged linkages (e.g., methyl phosphonates, phosphotriesters,
phosphoamidates, cabamates, etc.) and with charged linkages (e.g., phosphorothioates,
phosphorodithioates, etc.), those containing pendant moieties, such as, for example,
proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.
), those with intercalators (e.g., acridine, psoralen, etc.), those containing chelators
(e.g., metals, radioactive metals, boron, oxidative metals, etc.), those containing
alkylators, those with modified linkages (e.g., alpha anomeric nucleic acids, etc.),
as well as unmodified forms of the polynucleotide(s). Further, any of the hydroxyl
groups ordinarily present in the sugars may be replaced, for example, by phosphonate
groups, phosphate groups, protected by standard protecting groups, or activated to
prepare additional linkages to additional nucleotides, or may be conjugated to solid
supports. The 5' and 3' terminal OH can be phosphorylated or substituted with amines
or organic capping groups moieties of from 1 to 20 carbon atoms. Other hydroxyls may
also be derivatized to standard protecting groups. Polynucleotides can also contain
analogous forms of ribose or deoxyribose sugars that are generally known in the art,
including, for example, 2'-O-methyl-2'-O-allyl, 2'-fluoro- or 2'-azido-ribose, carbocyclic
sugar analogs, α- anomeric sugars, epimeric sugars such as arabinose, xyloses or lyxoses,
pyranose sugars, furanose sugars, sedoheptuloses, acyclic analogs and abasic nucleoside
analogs such as methyl riboside. One or more phosphodiester linkages may be replaced
by alternative linking groups. These alternative linking groups include, but are not
limited to, embodiments wherein phosphate is replaced by P(O)S("thioate"), P(S)S ("dithioate"),
"(O)NR 2 ("amidate"), P(O)R, P(O)OR', CO or CH 2 ("formacetal"), in which each R or
R' is independently H or substituted or unsubstituted alkyl (1-20 C) optionally containing
an ether (--O--) linkage, aryl, alkenyl, cycloalkyl, cycloalkenyl or araldyl. Not
all linkages in a polynucleotide need be identical. The preceding description applies
to all polynucleotides referred to herein, including RNA and DNA.
[0052] "Oligonucleotide," as used herein, refers to short, single stranded polynucleotides
that are at least about seven nucleotides in length and less than about 250 nucleotides
in length. Oligonucleotides may be synthetic. The terms "oligonucleotide" and "polynucleotide"
are not mutually exclusive. The description above for polynucleotides is equally and
fully applicable to oligonucleotides.
[0053] The term "primer" refers to a single stranded polynucleotide that is capable of hybridizing
to a nucleic acid and allowing the polymerization of a complementary nucleic acid,
generally by providing a free 3'-OH group.
[0054] The term "genetic variation" or "nucleotide variation" refers to a change in a nucleotide
sequence (e.g., an insertion, deletion, inversion, or substitution of one or more
nucleotides, such as a single nucleotide polymorphism (SNP)) relative to a reference
sequence (e.g., a commonly-found and/or wild-type sequence, and/or the sequence of
a major allele). The term also encompasses the corresponding change in the complement
of the nucleotide sequence, unless otherwise indicated. In one embodiment, a genetic
variation is a somatic polymorphism. In one embodiment, a genetic variation is a germline
polymorphism.
[0055] A "single nucleotide polymorphism", or "SNP", refers to a single base position in
DNA at which different alleles, or alternative nucleotides, exist in a population.
The SNP position is usually preceded by and followed by highly conserved sequences
of the allele (e.g., sequences that vary in less than 1/100 or 1/1000 members of the
populations). An individual may be homozygous or heterozygous for an allele at each
SNP position.
[0056] The term "amino acid variation" refers to a change in an amino acid sequence (e.g.,
an insertion, substitution, or deletion of one or more amino acids, such as an internal
deletion or an N- or C-terminal truncation) relative to a reference sequence.
[0057] The term "variation" refers to either a nucleotide variation or an amino acid variation.
[0058] The term "a genetic variation at a nucleotide position corresponding to a SNP," "a
nucleotide variation at a nucleotide position corresponding to a SNP," and grammatical
variants thereof refer to a nucleotide variation in a polynucleotide sequence at the
relative corresponding DNA position occupied by said SNP in the genome. The term also
encompasses the corresponding variation in the complement of the nucleotide sequence,
unless otherwise indicated.
[0059] The term "array" or "microarray" refers to an ordered arrangement of hybridizable
array elements, preferably polynucleotide probes (e.g., oligonucleotides), on a substrate.
The substrate can be a solid substrate, such as a glass slide, or a semi-solid substrate,
such as nitrocellulose membrane.
[0060] The term "amplification" refers to the process of producing one or more copies of
a reference nucleic acid sequence or its complement. Amplification may be linear or
exponential (e.g., PCR). A "copy" does not necessarily mean perfect sequence complementarity
or identity relative to the template sequence. For example, copies can include nucleotide
analogs such as deoxyinosine, intentional sequence alterations (such as sequence alterations
introduced through a primer comprising a sequence that is hybridizable, but not fully
complementary, to the template), and/or sequence errors that occur during amplification.
[0061] The term "allele-specific oligonucleotide" refers to an oligonucleotide that hybridizes
to a region of a target nucleic acid that comprises a nucleotide variation (generally
a substitution). "Allele-specific hybridization" means that, when an allele-specific
oligonucleotide is hybridized to its target nucleic acid, a nucleotide in the allele-specific
oligonucleotide specifically base pairs with the nucleotide variation. An allele-specific
oligonucleotide capable of allele-specific hybridization with respect to a particular
nucleotide variation is said to be "specific for" that variation.
[0062] The term "allele-specific primer" refers to an allele-specific oligonucleotide that
is a primer.
[0063] The term "primer extension assay" refers to an assay in which nucleotides are added
to a nucleic acid, resulting in a longer nucleic acid, or "extension product," that
is detected directly or indirectly. The nucleotides can be added to extend the 5'
or 3' end of the nucleic acid.
[0064] The term "allele-specific nucleotide incorporation assay" refers to a primer extension
assay in which a primer is (a) hybridized to target nucleic acid at a region that
is 3' or 5' of a nucleotide variation and (b) extended by a polymerase, thereby incorporating
into the extension product a nucleotide that is complementary to the nucleotide variation.
[0065] The term "allele-specific primer extension assay" refers to a primer extension assay
in which an allele-specific primer is hybridized to a target nucleic acid and extended.
[0066] The term "allele-specific oligonucleotide hybridization assay" refers to an assay
in which (a) an allele-specific oligonucleotide is hybridized to a target nucleic
acid and (b) hybridization is detected directly or indirectly.
[0067] The term "5' nuclease assay" refers to an assay in which hybridization of an allele-specific
oligonucleotide to a target nucleic acid allows for nucleolytic cleavage of the hybridized
probe, resulting in a detectable signal.
[0068] The term "assay employing molecular beacons" refers to an assay in which hybridization
of an allele-specific oligonucleotide to a target nucleic acid results in a level
of detectable signal that is higher than the level of detectable signal emitted by
the free oligonucleotide.
[0069] The term "oligonucleotide ligation assay" refers to an assay in which an allele-specific
oligonucleotide and a second oligonucleotide are hybridized adjacent to one another
on a target nucleic acid and ligated together (either directly or indirectly through
intervening nucleotides), and the ligation product is detected directly or indirectly.
[0070] The term "target sequence," "target nucleic acid," or "target nucleic acid sequence"
refers generally to a polynucleotide sequence of interest in which a nucleotide variation
is suspected or known to reside, including copies of such target nucleic acid generated
by amplification.
[0071] The term "detection" includes any means of detecting, including direct and indirect
detection.
[0072] The term "SLE risk locus" and "confirmed SLE risk locus" refer to the loci indicated
in Table 4 and Table 6 and the
BLK locus.
[0073] The term "SLE risk allele" and "confirmed SLE risk allele" refer to a variation occurring
in a SLE risk locus. Such variations include, but are not limited to, single nucleotide
polymorphisms, insertions, and deletions. Certain exemplary SLE risk alleles are indicated
in Table 4 and in Table 6.
[0074] As used herein, a subject "at risk" of developing lupus may or may not have detectable
disease or symptoms of disease, and may or may not have displayed detectable disease
or symptoms of disease prior to the treatment methods described herein. "At risk"
denotes that a subject has one or more risk factors, which are measurable parameters
that correlate with development of lupus, as described herein and known in the art.
A subject having one or more of these risk factors has a higher probability of developing
lupus than a subject without one or more of these risk factor(s).
[0075] The term "diagnosis" is used herein to refer to the identification or classification
of a molecular or pathological state, disease or condition. For example, "diagnosis"
may refer to identification of a particular type of lupus condition, e.g., SLE. "Diagnosis"
may also refer to the classification of a particular sub-type of lupus, e.g., by tissue/organ
involvement (e.g., lupus nephritis), by molecular features (e.g., a patient subpopulation
characterized by genetic variation(s) in a particular gene or nucleic acid region.)
[0076] The term "aiding diagnosis" is used herein to refer to methods that assist in making
a clinical determination regarding the presence, or nature, of a particular type of
symptom or condition of lupus. For example, a method of aiding diagnosis of lupus
can comprise measuring the presence of absence of one or more SLE risk loci or SLE
risk alleles in a biological sample from an individual.
[0077] The term "prognosis" is used herein to refer to the prediction of the likelihood
of autoimmune disorder-attributable disease symptoms, including, for example, recurrence,
flaring, and drug resistance, of an autoimmune disease such as lupus. The term "prediction"
is used herein to refer to the likelihood that a patient will respond either favorably
or unfavorably to a drug or set of drugs.
[0078] As used herein, "treatment" refers to clinical intervention in an attempt to alter
the natural course of the individual or cell being treated, and can be performed before
or during the course of clinical pathology. Desirable effects of treatment include
preventing the occurrence or recurrence of a disease or a condition or symptom thereof,
alleviating a condition or symptom of the disease, diminishing any direct or indirect
pathological consequences of the disease, decreasing the rate of disease progression,
ameliorating or palliating the disease state, and achieving remission or improved
prognosis. Disclosed is that methods and compositions are useful in attempts to delay
development of a disease or disorder.
[0079] An "effective amount" refers to an amount effective, at dosages and for periods of
time necessary, to achieve the desired therapeutic or prophylactic result. A "therapeutically
effective amount" of a therapeutic agent may vary according to factors such as the
disease state, age, sex, and weight of the individual, and the ability of the antibody
to elicit a desired response in the individual. A therapeutically effective amount
is also one in which any toxic or detrimental effects of the therapeutic agent are
outweighed by the therapeutically beneficial effects. A "prophylactically effective
amount" refers to an amount effective, at dosages and for periods of time necessary,
to achieve the desired prophylactic result. Typically but not necessarily, since a
prophylactic dose is used in subjects prior to or at an earlier stage of disease,
the prophylactically effective amount will be less than the therapeutically effective
amount.
[0080] An "individual," "subject" or "patient" is a vertebrate. In certain embodiments,
the vertebrate is a mammal. Mammals include, but are not limited to, primates (including
human and non-human primates) and rodents (e.g., mice and rats). In certain embodiments,
a mammal is a human.
[0081] A "patient subpopulation," and grammatical variations thereof, as used herein, refers
to a patient subset characterized as having one or more distinctive measurable and/or
identifiable characteristics that distinguishes the patient subset from others in
the broader disease category to which it belongs. Such characteristics include disease
subcategories (e.g., SLE, lupus nephritis), gender, lifestyle, health history, organs/tissues
involved, treatment history, etc.
[0082] A "control subject" refers to a healthy subject who has not been diagnosed as having
lupus or a lupus condition and who does not suffer from any sign or symptom associated
with lupus or a lupus condition.
[0083] The term "sample", as used herein, refers to a composition that is obtained or derived
from a subject of interest that contains a cellular and/or other molecular entity
that is to be characterized and/or identified, for example based on physical, biochemical,
chemical and/or physiological characteristics. For example, the phrase "disease sample"
and variations thereof refers to any sample obtained from a subject of interest that
would be expected or is known to contain the cellular and/or molecular entity that
is to be characterized.
[0084] By "tissue or cell sample" is meant a collection of similar cells obtained from a
tissue of a subject or patient. The source of the tissue or cell sample may be solid
tissue as from a fresh, frozen and/or preserved organ or tissue sample or biopsy or
aspirate; blood or any blood constituents; bodily fluids such as cerebral spinal fluid,
amniotic fluid, peritoneal fluid, or interstitial fluid; cells from any time in gestation
or development of the subject. The tissue sample may also be primary or cultured cells
or cell lines. Optionally, the tissue or cell sample is obtained from a disease tissue/organ.
The tissue sample may contain compounds which are not naturally intermixed with the
tissue in nature such as preservatives, anticoagulants, buffers, fixatives, nutrients,
antibiotics, or the like. A "reference sample", "reference cell", "reference tissue",
"control sample", "control cell", or "control tissue", as used herein, refers to a
sample, cell or tissue obtained from a source known, or believed, not to be afflicted
with the disease or condition which a method or composition is being used to identify.
In one part of the disclosure, a reference sample, reference cell, reference tissue,
control sample, control cell, or control tissue is obtained from a healthy part of
the body of the same subject or patient in whom a disease or condition is being identified
using a composition or method. In one part of the disclosure, a reference sample,
reference cell, reference tissue, control sample, control cell, or control tissue
is obtained from a healthy part of the body of an individual who is not the subject
or patient in whom a disease or condition is being identified using a composition
or method.
[0085] For the purposes herein a "section" of a tissue sample is meant a single part or
piece of a tissue sample,
e.g. a thin slice of tissue or cells cut from a tissue sample. It is understood that multiple
sections of tissue samples may be taken and subjected to analysis. provided that it
is understood that the present disclosure comprises a method whereby the same section
of tissue sample is analyzed at both morphological and molecular levels, or is analyzed
with respect to both protein and nucleic acid.
[0086] By "correlate" or "correlating" is meant comparing, in any way, the performance and/or
results of a first analysis or protocol with the performance and/or results of a second
analysis or protocol. For example, one may use the results of a first analysis or
protocol in carrying out a second protocols and/or one may use the results of a first
analysis or protocol to determine whether a second analysis or protocol should be
performed. With respect to the gene expression analysis or protocol, one may use the
results of the gene expression analysis or protocol to determine whether a specific
therapeutic regimen should be performed.
[0087] The word "label" when used herein refers to a compound or composition which is conjugated
or fused directly or indirectly to a reagent such as a nucleic acid probe or an antibody
and facilitates detection of the reagent to which it is conjugated or fused. The label
may itself be detectable (
e.g., radioisotope labels or fluorescent labels) or, in the case of an enzymatic label,
may catalyze chemical alteration of a substrate compound or composition which is detectable.
[0088] A "medicament" is an active drug to treat a disease, disorder, and/or condition.
In one part of the disclosure, the disease, disorder, and/or condition is lupus or
its symptoms or side effects.
[0089] The term "increased resistance" to a particular therapeutic agent or treatment option,
when used in accordance with the disclosure, means decreased response to a standard
dose of the drug or to a standard treatment protocol.
[0090] The term "decreased sensitivity" to a particular therapeutic agent or treatment option,
when used in accordance with the disclosure, means decreased response to a standard
dose of the agent or to a standard treatment protocol, where decreased response can
be compensated for (at least partially) by increasing the dose of agent, or the intensity
of treatment.
[0091] "Patient response" can be assessed using any endpoint indicating a benefit to the
patient, including, without limitation, (1) inhibition, to some extent, of disease
progression, including slowing down and complete arrest; (2) reduction in the number
of disease episodes and/or symptoms; (3) reduction in lesional size; (4) inhibition
(i.e., reduction, slowing down or complete stopping) of disease cell infiltration
into adjacent peripheral organs and/or tissues; (5) inhibition (i.e. reduction, slowing
down or complete stopping) of disease spread; (6) decrease of auto-immune response,
which may, but does not have to, result in the regression or ablation of the disease
lesion; (7) relief, to some extent, of one or more symptoms associated with the disorder;
(8) increase in the length of disease-free presentation following treatment; and/or
(9) decreased mortality at a given point of time following treatment.
[0092] A "lupus therapeutic agent", a "therapeutic agent effective to treat lupus", and
grammatical variations thereof, as used herein, refer to an agent that when provided
in an effective amount is known, clinically shown, or expected by clinicians to provide
a therapeutic benefit in a subject who has lupus. In one part of the disclosure, the
phrase includes any agent that is marketed by a manufacturer, or otherwise used by
licensed clinicians, as a clinically-accepted agent that when provided in an effective
amount would be expected to provide a therapeutic effect in a subject who has lupus.
In one part of the disclosure, a lupus therapeutic agent comprises a non-steroidal
anti-inflammatory drug (NSAID), which includes acetylsalicylic acid (e.g., aspirin),
ibuprofen (Motrin), naproxen (Naprosyn), indomethacin (Indocin), nabumetone (Relafen),
tolmetin (Tolectin), and any other agents that comprise a therapeutically equivalent
active ingredient(s) and formulation thereof. In one part of the disclosure, a lupus
therapeutic agent comprises acetaminophen (e.g., Tylenol), corticosteroids, or anti-malarials3
(e.g., chloroquine, hydroxychloroquine). In one part of the disclosure, a lupus therapeutic
agent comprises an immunomodulating drug (e.g., azathioprine, cyclophosphamide, methotrexate,
cyclosporine). In one part of the disclosure, a lupus therapeutic agent is an anti-B
cell agent (e.g., anti-CD20 (e.g., rituximab), anti-CD22), an anti-cytokine agent
(e.g., anti-tumor necrosis factor α, anti-interleukin-1-receptor (e.g., anakinra),
anti-interleukin 10, anti-interleukin 6 receptor, anti-interferon alpha, anti-B-lymphocyte
stimulator), an inhibitor of costimulation (e.g., anti-CD154, CTLA4-Ig (e.g., abatacept)),
a modulator of B-cell anergy (e.g., LJP 394 (e.g., abetimus)). In one part of the
disclosure, a lupus therapeutic agent comprises hormonal treatment (
e.g., DHEA), and anti-hormonal therapy (
e.g., the anti-prolactin agent bromocriptine). In one part of the disclosure, a lupus
therapeutic agent is an agent that provides immunoadsorption, is an anti-complement
factor (e.g., anti-C5a), T cell vaccination, cell transfection with T-cell receptor
zeta chain, or peptide therapies (e.g., edratide targeting anti-DNA idiotypes).
[0093] A therapeutic agent that has "marketing approval", or that has been "approved as
a therapeutic agent", or grammatical variations thereof of these phrases, as used
herein, refer to an agent (e.g., in the form of a drug formulation, medicament) that
is approved, licensed, registered or authorized by a relevant governmental entity
(e.g., federal, state or local regulatory agency, department, bureau) to be sold by
and/or through and/or on behalf of a commercial entity (e.g., a for-profit entity)
for the treatment of a particular disorder (e.g., lupus) or a patient subpopulation
(e.g., patients with lupus nephritis, patients of a particular ethnicity, gender,
lifestyle, disease risk profile, etc.). A relevant governmental entity includes, for
example, the Food and Drug Administration (FDA), European Medicines Evaluation Agency
(EMEA), and equivalents thereof.
[0094] "Antibodies" (Abs) and "immunoglobulins" (Igs) refer to glycoproteins having similar
structural characteristics. While antibodies exhibit binding specificity to a specific
antigen, immunoglobulins include both antibodies and other antibody-like molecules
which generally lack antigen specificity. Polypeptides of the latter kind are, for
example, produced at low levels by the lymph system and at increased levels by myelomas.
[0095] The terms "antibody" and "immunoglobulin" are used interchangeably in the broadest
sense and include monoclonal antibodies (
e.g., full length or intact monoclonal antibodies), polyclonal antibodies, monovalent
antibodies, multivalent antibodies, multispecific antibodies (e.g., bispecific antibodies
so long as they exhibit the desired biological activity) and may also include certain
antibody fragments (as described in greater detail herein). An antibody can be chimeric,
human, humanized and/or affinity matured.
[0096] The terms "full length antibody," "intact antibody" and "whole antibody" are used
herein interchangeably to refer to an antibody in its substantially intact form, not
antibody fragments as defined below. The terms particularly refer to an antibody with
heavy chains that contain the Fc region.
[0097] "Antibody fragments" comprise a portion of an intact antibody, preferably comprising
the antigen binding region thereof. Examples of antibody fragments include Fab, Fab',
F(ab')
2, and Fv fragments; diabodies; linear antibodies; single-chain antibody molecules;
and multispecific antibodies formed from antibody fragments.
[0098] Papain digestion of antibodies produces two identical antigen-binding fragments,
called "Fab" fragments, each with a single antigen-binding site, and a residual "Fc"
fragment, whose name reflects its ability to crystallize readily. Pepsin treatment
yields an F(ab')
2 fragment that has two antigen-combining sites and is still capable of cross-linking
antigen.
[0099] "Fv" is a minimum antibody fragment which contains a complete antigen-binding site.
Disclosed is that a two-chain Fv species consists of a dimer of one heavy- and one
light-chain variable domain in tight, non-covalent association. Collectively, the
six CDRs of an Fv confer antigen-binding specificity to the antibody. However, even
a single variable domain (or half of an Fv comprising only three CDRs specific for
an antigen) has the ability to recognize and bind antigen, although at a lower affinity
than the entire binding site.
[0100] The Fab fragment contains the heavy- and light-chain variable domains and also contains
the constant domain of the light chain and the first constant domain (CH1) of the
heavy chain. Fab' fragments differ from Fab fragments by the addition of a few residues
at the carboxy terminus of the heavy chain CH1 domain including one or more cysteines
from the antibody hinge region. Fab'-SH is the designation herein for Fab' in which
the cysteine residue(s) of the constant domains bear a free thiol group. F(ab')
2 antibody fragments originally were produced as pairs of Fab' fragments which have
hinge cysteines between them. Other chemical couplings of antibody fragments are also
known.
[0101] The term "monoclonal antibody" as used herein refers to an antibody obtained from
a population of substantially homogeneous antibodies, i.e., the individual antibodies
comprising the population are identical except for possible mutations, e.g., naturally
occurring mutations, that may be present in minor amounts. Thus, the modifier "monoclonal"
indicates the character of the antibody as not being a mixture of discrete antibodies.
In certain parts of the disclosure, such a monoclonal antibody typically includes
an antibody comprising a polypeptide sequence that binds a target, wherein the target-binding
polypeptide sequence was obtained by a process that includes the selection of a single
target binding polypeptide sequence from a plurality of polypeptide sequences. For
example, the selection process can be the selection of a unique clone from a plurality
of clones, such as a pool of hybridoma clones, phage clones, or recombinant DNA clones.
It should be understood that a selected target binding sequence can be further altered,
for example, to improve affinity for the target, to humanize the target binding sequence,
to improve its production in cell culture, to reduce its immunogenicity
in vivo, to create a multispecific antibody, etc., and that an antibody comprising the altered
target binding sequence is also a monoclonal antibody. In contrast to polyclonal antibody
preparations which typically include different antibodies directed against different
determinants (epitopes), each monoclonal antibody of a monoclonal antibody preparation
is directed against a single determinant on an antigen. In addition to their specificity,
monoclonal antibody preparations are advantageous in that they are typically uncontaminated
by other immunoglobulins.
[0102] The modifier "monoclonal" indicates the character of the antibody as being obtained
from a substantially homogeneous population of antibodies, and is not to be construed
as requiring production of the antibody by any particular method. For example, the
monoclonal antibodies to be used may be made by a variety of techniques, including,
for example, the hybridoma method (e.g.,
Kohler et al., Nature, 256: 495 (1975);
Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press,
2nd ed. 1988);
Hammerling et al., in: Monoclonal Antibodies and T-Cell Hybridomas 563-681 (Elsevier,
N.Y., 1981)), recombinant DNA methods (see, e.g.,
U.S. Patent No. 4,816,567), phage display technologies (see, e.g.,
Clackson et al., Nature, 352: 624-628 (1991);
Marks et al., J. Mol. Biol. 222: 581-597 (1992);
Sidhu et al., J. Mol. Biol. 338(2): 299-310 (2004);
Lee et al., J. Mol. Biol. 340(5): 1073-1093 (2004);
Fellouse, Proc. Natl. Acad. Sci. USA 101(34): 12467-12472 (2004); and
Lee et al., J. Immunol. Methods 284(1-2): 119-132(2004), and technologies for producing human or human-like antibodies in animals that have
parts or all of the human immunoglobulin loci or genes encoding human immunoglobulin
sequences (see, e.g.,
WO98/24893;
WO96/34096;
WO96/33735;
WO91/10741;
Jakobovits et al., Proc. Natl. Acad. Sci. USA 90: 2551 (1993);
Jakobovits et al., Nature 362: 255-258 (1993);
Bruggemann et al., Year in Immunol. 7:33 (1993);
U.S. Patent Nos. 5,545,807;
5,545,806;
5,569,825;
5,625,126;
5,633,425;
5,661,016;
Marks et al., Bio.Technology 10: 779-783 (1992);
Lonberg et al., Nature 368: 856-859 (1994);
Morrison, Nature 368: 812-813 (1994);
Fishwild et al., Nature Biotechnol. 14: 845-851 (1996);
Neuberger, Nature Biotechnol. 14: 826 (1996) and
Lonberg and Huszar, Intern. Rev. Immunol. 13: 65-93 (1995).
[0103] The monoclonal antibodies herein specifically include "chimeric" antibodies in which
a portion of the heavy and/or light chain is identical with or homologous to corresponding
sequences in antibodies derived from a particular species or belonging to a particular
antibody class or subclass, while the remainder of the chain(s) is identical with
or homologous to corresponding sequences in antibodies derived from another species
or belonging to another antibody class or subclass, as well as fragments of such antibodies,
so long as they exhibit the desired biological activity (
U.S. Patent No. 4,816,567; and
Morrison et al., Proc. Natl. Acad. Sci. USA 81:6855-9855 (1984)).
[0104] "Humanized" forms of non-human (
e.g., murine) antibodies are chimeric antibodies that contain minimal sequence derived
from non-human immunoglobulin. Disclosed is that a humanized antibody is a human immunoglobulin
(recipient antibody) in which residues from a hypervariable region of the recipient
are replaced by residues from a hypervariable region of a non-human species (donor
antibody) such as mouse, rat, rabbit, or nonhuman primate having the desired specificity,
affinity, and/or capacity. In some instances, framework region (FR) residues of the
human immunoglobulin are replaced by corresponding non-human residues. Furthermore,
humanized antibodies may comprise residues that are not found in the recipient antibody
or in the donor antibody. These modifications may be made to further refine antibody
performance. In general, a humanized antibody will comprise substantially all of at
least one, and typically two, variable domains, in which all or substantially all
of the hypervariable loops correspond to those of a non-human immunoglobulin, and
all or substantially all of the FRs are those of a human immunoglobulin sequence.
The humanized antibody optionally will also comprise at least a portion of an immunoglobulin
constant region (Fc), typically that of a human immunoglobulin. For further details,
see
Jones et al., Nature 321:522-525 (1986);
Riechmann et al., Nature 332:323-329 (1988); and
Presta, Curr. Op. Struct. Biol. 2:593-596 (1992). See also the following review articles and references cited therein:
Vaswani and Hamilton, Ann. Allergy, Asthma & Immunol. 1:105-115 (1998);
Harris, Biochem. Soc. Transactions 23:1035-1038 (1995);
Hurle and Gross, Curr. Op. Biotech. 5:428-433 (1994).
[0105] A "human antibody" is one which comprises an amino acid sequence corresponding to
that of an antibody produced by a human and/or has been made using any of the techniques
for making human antibodies as disclosed herein. Such techniques include screening
human-derived combinatorial libraries, such as phage display libraries (see, e.g.,
Marks et al., J. Mol. Biol., 222: 581-597 (1991) and
Hoogenboom et al., Nucl. Acids Res., 19: 4133-4137 (1991)); using human myeloma and mouse-human heteromyeloma cell lines for the production
of human monoclonal antibodies (see, e.g.,
Kozbor J. Immunol., 133: 3001 (1984);
Brodeur et al., Monoclonal Antibody Production Techniques and Applications, pp. 55-93
(Marcel Dekker, Inc., New York, 1987); and
Boerner et al., J. Immunol., 147: 86 (1991)); and generating monoclonal antibodies in transgenic animals (e.g., mice) that are
capable of producing a full repertoire of human antibodies in the absence of endogenous
immunoglobulin production (see, e.g.,
Jakobovits et al., Proc. Natl. Acad. Sci USA, 90: 2551 (1993);
Jakobovits et al., Nature, 362: 255 (1993);
Bruggermann et al., Year in Immunol., 7: 33 (1993)). This definition of a human antibody specifically excludes a humanized antibody
comprising antigen-binding residues from a non-human animal.
[0107] A "blocking antibody" or an "antagonist antibody" is one which inhibits or reduces
a biological activity of the antigen it binds. Certain blocking antibodies or antagonist
antibodies partially or completely inhibit the biological activity of the antigen.
[0108] A "small molecule" or "small organic molecule" is defined herein as an organic molecule
having a molecular weight below about 500 Daltons.
[0109] The word "label" when used herein refers to a detectable compound or composition.
The label may be detectable by itself (e.g., radioisotope labels or fluorescent labels)
or, in the case of an enzymatic label, may catalyze chemical alteration of a substrate
compound or composition which results in a detectable product. Radionuclides that
can serve as detectable labels include, for example, I-131, 1-123, 1-125, Y-90, Re-188,
Re-186, At-211, Cu-67, Bi-212, and Pd-109.
[0110] An "isolated" biological molecule, such as a nucleic acid, polypeptide, or antibody,
is one which has been identified and separated and/or recovered from at least one
component of its natural environment.
[0111] Reference to "about" a value or parameter herein includes (and describes) are directed
to that value or parameter per se. For example, description referring to "about X"
includes description of "X."
GENERAL TECHNIQUES
[0112] Nucleotide variations associated with lupus are provided herein. These variations
provide biomarkers for lupus, and/or predispose or contribute to development, persistence
and/or progression of lupus.
[0113] In certain parts of the disclosure, the methods relate to prognosis, i.e., the prediction
of the likelihood of autoimmune disorder-attributable disease symptoms, including,
for example, recurrence, flaring, and drug resistance, of an autoimmune disease such
as lupus. In one part of the disclosure, the prediction relates to the extent of those
responses. In one part of the disclosure, the prediction relates to whether and/or
the probability that a patient will survive or improve following treatment, for example
treatment with a particular therapeutic agent, and for a certain period of time without
disease recurrence. The predictive methods can be used clinically to make treatment
decisions by choosing the most appropriate treatment modalities for any particular
patient. The predictive methods are valuable tools in predicting if a patient is likely
to respond favorably to a treatment regimen, such as a given therapeutic regimen,
including for example, administration of a given therapeutic agent or combination,
surgical intervention, steroid treatment, etc., or whether long-term survival of the
patient, following a therapeutic regimen is likely. Diagnosis of SLE may be according
to current American College of Rheumatology (ACR) criteria. Active disease may be
defined by one British Isles Lupus Activity Group's (BILAG) "A" criteria or two BILAG
"B" criteria. Some signs, symptoms, or other indicators used to diagnose SLE adapted
from:
Tan et al. "The Revised Criteria for the Classification of SLE" Arth Rheum 25 (1982) may be malar rash such as rash over the cheeks, discoid rash, or red raised patches,
photosensitivity such as reaction to sunlight, resulting in the development of or
increase in skin rash, oral ulcers such as ulcers in the nose or mouth, usually painless,
arthritis, such as non-erosive arthritis involving two or more peripheral joints (arthritis
in which the bones around the joints do not become destroyed), serositis, pleuritis
or pericarditis, renal disorder such as excessive protein in the urine (greater than
0.5 gm/day or 3+ on test sticks) and/or cellular casts (abnormal elements derived
from the urine and/or white cells and/or kidney tubule cells), neurologic signs, symptoms,
or other indicators, seizures (convulsions), and/or psychosis in the absence of drugs
or metabolic disturbances that are known to cause such effects, and hematologic signs,
symptoms, or other indicators such as hemolytic anemia or leukopenia (white bloodcount
below 4,000 cells per cubic millimeter) or lymphopenia (less than 1,500 lymphocytes
per cubic millimeter) or thrombocytopenia (less than 100,000 platelets per cubic millimeter).
The leukopenia and lymphopenia generally must be detected on two or more occasions.
The thrombocytopenia generally must be detected in the absence of drugs known to induce
it. The disclosure is not limited to these signs, symptoms, or other indicators of
lupus.
Detection of Genetic Variations
[0114] Nucleic acid, according to any of the above methods, may be genomic DNA; RNA transcribed
from genomic DNA; or cDNA generated from RNA. Nucleic acid may be derived from a vertebrate,
e.g., a mammal. A nucleic acid is said to be "derived from" a particular source if
it is obtained directly from that source or if it is a copy of a nucleic acid found
in that source.
[0115] Nucleic acid includes copies of the nucleic acid, e.g., copies that result from amplification.
Amplification may be desirable in certain instances, e.g., in order to obtain a desired
amount of material for detecting variations. The amplicons may then be subjected to
a variation detection method, such as those described below, to determine whether
a variation is present in the amplicon.
[0116] Variations may be detected by certain methods known to those skilled in the art.
Such methods include, but are not limited to, DNA sequencing; primer extension assays,
including allele-specific nucleotide incorporation assays and allele-specific primer
extension assays (e.g., allele-specific PCR, allele-specific ligation chain reaction
(LCR), and gap-LCR); allele-specific oligonucleotide hybridization assays (e.g., oligonucleotide
ligation assays); cleavage protection assays in which protection from cleavage agents
is used to detect mismatched bases in nucleic acid duplexes; analysis of MutS protein
binding; electrophoretic analysis comparing the mobility of variant and wild type
nucleic acid molecules; denaturing-gradient gel electrophoresis (DGGE, as in, e.g.,
Myers et al. (1985) Nature 313:495); analysis of RNase cleavage at mismatched base pairs; analysis of chemical or enzymatic
cleavage of heteroduplex DNA; mass spectrometry (e.g., MALDI-TOF); genetic bit analysis
(GBA); 5' nuclease assays (e.g., TaqMan®); and assays employing molecular beacons.
Certain of these methods are discussed in further detail below.
[0117] Detection of variations in target nucleic acids may be accomplished by molecular
cloning and sequencing of the target nucleic acids using techniques well known in
the art. Alternatively, amplification techniques such as the polymerase chain reaction
(PCR) can be used to amplify target nucleic acid sequences directly from a genomic
DNA preparation from tumor tissue. The nucleic acid sequence of the amplified sequences
can then be determined and variations identified therefrom. Amplification techniques
are well known in the art, e.g., polymerase chain reaction is described in
Saiki et al., Science 239:487, 1988;
U.S. Pat. Nos. 4,683,203 and
4,683,195.
[0118] The ligase chain reaction, which is known in the art, can also be used to amplify
target nucleic acid sequences. See, e.g.,
Wu et al., Genomics 4:560-569 (1989). In addition, a technique known as allele-specific PCR can also be used to detect
variations (e.g., substitutions). See, e.g.,
Ruano and Kidd (1989) Nucleic Acids Research 17:8392;
McClay et al. (2002) Analytical Biochem. 301:200-206. In certain embodiments of this technique, an allele-specific primer is used wherein
the 3' terminal nucleotide of the primer is complementary to (i.e., capable of specifically
base-pairing with) a particular variation in the target nucleic acid. If the particular
variation is not present, an amplification product is not observed. Amplification
Refractory Mutation System (ARMS) can also be used to detect variations (e.g., substitutions).
ARMS is described, e.g., in European Patent Application Publication No.
0332435, and in
Newton et al., Nucleic Acids Research, 17:7, 1989.
[0119] Other methods useful for detecting variations (e.g., substitutions) include, but
are not limited to, (1) allele-specific nucleotide incorporation assays, such as single
base extension assays (see, e.g.,
Chen et al. (2000) Genome Res. 10:549-557;
Fan et al. (2000) Genome Res. 10:853-860;
Pastinen et al. (1997) Genome Res. 7:606-614; and
Ye et al. (2001) Hum. Mut. 17:305-316); (2) allele-specific primer extension assays (see, e.g.,
Ye et al. (2001) Hum. Mut. 17:305-316; and
Shen et al. Genetic Engineering News, vol. 23, Mar. 15, 2003), including allele-specific PCR; (3) 5'nuclease assays (see, e.g.,
De La Vega et al. (2002) BioTechniques 32:S48-S54 (describing the TaqMan® assay);
Ranade et al. (2001) Genome Res. 11:1262-1268; and
Shi (2001) Clin. Chem. 47:164-172); (4) assays employing molecular beacons (see, e.g.,
Tyagi et al. (1998) Nature Biotech. 16:49-53; and
Mhlanga et al. (2001) Methods 25:463-71); and (5) oligonucleotide ligation assays (see, e.g.,
Grossman et al. (1994) Nuc. Acids Res. 22:4527-4534; patent application Publication No.
US 2003/0119004 A1;
PCT International Publication No. WO 01/92579 A2; and
U.S. Pat. No. 6,027,889).
[0120] Variations may also be detected by mismatch detection methods. Mismatches are hybridized
nucleic acid duplexes which are not 100% complementary. The lack of total complementarity
may be due to deletions, insertions, inversions, or substitutions. One example of
a mismatch detection method is the Mismatch Repair Detection (MRD) assay described,
e.g., in
Faham et al., Proc. Natl Acad. Sci. USA 102:14717-14722 (2005) and
Faham et al., Hum. Mol. Genet. 10:1657-1664 (2001). Another example of a mismatch cleavage technique is the RNase protection method,
which is described in detail in
Winter et al., Proc. Natl. Acad. Sci. USA, 82:7575, 1985, and
Myers et al., Science 230:1242, 1985. For example, a method may involve the use of a labeled riboprobe which is complementary
to the human wild-type target nucleic acid. The riboprobe and target nucleic acid
derived from the tissue sample are annealed (hybridized) together and subsequently
digested with the enzyme RNase A which is able to detect some mismatches in a duplex
RNA structure. If a mismatch is detected by RNase A, it cleaves at the site of the
mismatch. Thus, when the annealed RNA preparation is separated on an electrophoretic
gel matrix, if a mismatch has been detected and cleaved by RNase A, an RNA product
will be seen which is smaller than the full-length duplex RNA for the riboprobe and
the mRNA or DNA. The riboprobe need not be the full length of the target nucleic acid,
but can a portion of the target nucleic acid, provided it encompasses the position
suspected of having a variation.
[0121] In a similar manner, DNA probes can be used to detect mismatches, for example through
enzymatic or chemical cleavage. See, e.g.,
Cotton et al., Proc. Natl. Acad. Sci. USA, 85:4397, 1988; and
Shenk et al., Proc. Natl. Acad. Sci. USA, 72:989, 1975. Alternatively, mismatches can be detected by shifts in the electrophoretic mobility
of mismatched duplexes relative to matched duplexes. See, e.g.,
Cariello, Human Genetics, 42:726, 1988. With either riboprobes or DNA probes, the target nucleic acid suspected of comprising
a variation may be amplified before hybridization. Changes in target nucleic acid
can also be detected using Southern hybridization, especially if the changes are gross
rearrangements, such as deletions and insertions.
[0122] Restriction fragment length polymorphism (RFLP) probes for the target nucleic acid
or surrounding marker genes can be used to detect variations, e.g., insertions or
deletions. Insertions and deletions can also be detected by cloning, sequencing and
amplification of a target nucleic acid. Single stranded conformation polymorphism
(SSCP) analysis can also be used to detect base change variants of an allele. See,
e.g.
Orita et al., Proc. Natl. Acad. Sci. USA 86:2766-2770, 1989, and
Genomics, 5:874-879, 1989.
[0123] A microarray is a multiplex technology that typically uses an arrayed series of thousands
of nucleic acid probes to hybridize with, e.g, a cDNA or cRNA sample under high-stringency
conditions. Probe-target hybridization is typically detected and quantified by detection
of fluorophore-, silver-, or chemiluminescence-labeled targets to determine relative
abundance of nucleic acid sequences in the target. In typical microarrays, the probes
are attached to a solid surface by a covalent bond to a chemical matrix (via epoxy-silane,
amino-silane, lysine, polyacrylamide or others). The solid surface is for example,
glass, a silicon chip, or microscopic beads. Various microarrays are commercially
available, including those manufactured, for example, by Affymetrix, Inc. and Illumina,
Inc.
[0124] A biological sample may be obtained using certain methods known to those skilled
in the art. Biological samples may be obtained from vertebrate animals, and in particular,
mammals. Tissue biopsy is often used to obtain a representative piece of tumor tissue.
Alternatively, tumor cells can be obtained indirectly in the form of tissues or fluids
that are known or thought to contain the tumor cells of interest. For instance, samples
of lung cancer lesions may be obtained by resection, bronchoscopy, fine needle aspiration,
bronchial brushings, or from sputum, pleural fluid or blood. Variations in target
nucleic acids (or encoded polypeptides) may be detected from a tumor sample or from
other body samples such as urine, sputum or serum. (Cancer cells are sloughed off
from tumors and appear in such body samples.) By screening such body samples, a simple
early diagnosis can be achieved for diseases such as cancer. In addition, the progress
of therapy can be monitored more easily by testing such body samples for variations
in target nucleic acids (or encoded polypeptides). Additionally, methods for enriching
a tissue preparation for tumor cells are known in the art. For example, the tissue
may be isolated from paraffin or cryostat sections. Cancer cells may also be separated
from normal cells by flow cytometry or laser capture microdissection.
[0125] Subsequent to the determination that a subject, or the tissue or cell sample comprises
a genetic variation disclosed herein, it is contemplated that an effective amount
of an appropriate lupus therapeutic agent may be administered to the subject to treat
the lupus condition in the subject. Diagnosis in mammals of the various pathological
conditions described herein can be made by the skilled practitioner. Diagnostic techniques
are available in the art which allow, e.g., for the diagnosis or detection of lupus
in a mammal.
[0126] A lupus therapeutic agent can be administered in accordance with known methods, such
as intravenous administration as a bolus or by continuous infusion over a period of
time, by intramuscular, intraperitoneal, intracerobrospinal, subcutaneous, intra-articular,
intrasynovial, intrathecal, oral, topical, or inhalation routes. Optionally, administration
may be performed through mini-pump infusion using various commercially available devices.
[0127] Effective dosages and schedules for administering lupus therapeutic agents may be
determined empirically, and making such determinations is within the skill in the
art. Single or multiple dosages may be employed. For example, an effective dosage
or amount of interferon inhibitor used alone may range from about 1 mg/kg to about
100
mg/
kg of body weight or more per day. Interspecies scaling of dosages can be performed
in a manner known in the art, e.g., as disclosed in
Mordenti et al., Pharmaceut. Res., 8:1351 (1991).
[0128] When
in vivo administration of a lupus therapeutic agent is employed, normal dosage amounts may
vary from about 10 ng/kg to up to 100 mg/kg of mammal body weight or more per day,
preferably about 1 µg/kg/day to 10 mg/kg/day, depending upon the route of administration.
Guidance as to particular dosages and methods of delivery is provided in the literature;
see, for example,
U.S. Pat. Nos. 4,657,760;
5,206,344; or
5,225,212. It is anticipated that different formulations will be effective for different treatment
compounds and different disorders, that administration targeting one organ or tissue,
for example, may necessitate delivery in a manner different from that to another organ
or tissue.
[0129] It is contemplated that yet additional therapies may be employed in the methods.
The one or more other therapies may include but are not limited to, administration
of steroids and other standard of care regimens for the disorder in question. It is
contemplated that such other therapies may be employed as an agent separate from,
e.g., a targeted lupus therapeutic agent.
Kits
[0130] For use in the applications described or suggested above, kits or articles of manufacture
are also provided. Such kits may comprise a carrier means being compartmentalized
to receive in close confinement one or more container means such as vials, tubes,
and the like, each of the container means comprising one of the separate elements
to be used in the method. For example, one of the container means may comprise a probe
that is or can be detectably labeled. Such probe may be a polynucleotide specific
for a polynucleotide comprising a SLE risk locus. Where the kit utilizes nucleic acid
hybridization to detect the target nucleic acid, the kit may also have containers
containing nucleotide(s) for amplification of the target nucleic acid sequence and/or
a container comprising a reporter means, such as a biotin-binding protein, such as
avidin or streptavidin, bound to a reporter molecule, such as an enzymatic, fluorescent,
or radioisotope label.
[0131] Kits will typically comprise the container described above and one or more other
containers comprising materials desirable from a commercial and user standpoint, including
buffers, diluents, filters, needles, syringes, and package inserts with instructions
for use. A label may be present on the container to indicate that the composition
is used for a specific therapy or non-therapeutic application, and may also indicate
directions for either
in vivo or
in vitro use, such as those described above.
[0132] Other optional components in the kit include one or more buffers (
e.g., block buffer, wash buffer, substrate buffer, etc), other reagents such as substrate
(
e.g., chromogen) which is chemically altered by an enzymatic label, epitope retrieval
solution, control samples (positive and/or negative controls), control slide(s) etc.
An additional component is an enzyme, for example, including but not limited to, a
nuclease, a ligase, or a polymerase.
Methods of Marketing
[0133] Disclosed are methods for marketing a lupus therapeutic agent or a pharmaceutically
acceptable composition thereof comprising promoting to, instructing, and/or specifying
to a target audience, the use of the agent or pharmaceutical composition thereof for
treating a patient or patient population with lupus from which a sample has been obtained
showing the presence of a genetic variation as disclosed herein.
[0134] Marketing is generally paid communication through a non-personal medium in which
the sponsor is identified and the message is controlled. Marketing for purposes herein
includes publicity, public relations, product placement, sponsorship, underwriting,
and sales promotion. This term also includes sponsored informational public notices
appearing in any of the print communications media designed to appeal to a mass audience
to persuade, inform, promote, motivate, or otherwise modify behavior toward a favorable
pattern of purchasing, supporting, or approving the method.
[0135] The marketing of diagnostic methods may be accomplished by any means. Examples of
marketing media used to deliver these messages include television, radio, movies,
magazines, newspapers, the internet, and billboards, including commercials, which
are messages appearing in the broadcast media.
[0136] The type of marketing used will depend on many factors, for example, on the nature
of the target audience to be reached, e.g., hospitals, insurance companies, clinics,
doctors, nurses, and patients, as well as cost considerations and the relevant jurisdictional
laws and regulations governing marketing of medicaments and diagnostics. The marketing
may be individualized or customized based on user characterizations defined by service
interaction and/or other data such as user demographics and geographical location.
[0137] The following are examples of the methods and compositions of the disclosure. It
is understood that various other methods may be practiced, given the general description
provided above.
EXAMPLES
[0138] Throughout the Examples, references to certain publications are denoted by numbers,
which have complete bibliography information at the end of the Examples section.
Example 1
Identification of Novel Risk Loci for SLE
Methods and Subjects
Subjects
[0139] The selection and genotyping of SLE cases, the samples used in the genome-wide association
scan (GWAS) as well as controls from the New York Health Project (NYHP) collection
(
Mitchell et al., J Urban Health 81(2):301-10 (2004)), were described previously (
Hom et al., N Engl J Med 358(9):900-9 (2008)). As detailed below, the SLE cases consisted of three case series: a) 338 cases
from the Autoimmune Biomarkers Collaborative Network (ABCoN) (
Bauer et al., PLoS medicine 3(12):e491 (2006)), an NIH/NIAMS-funded repository, and 141 cases from the Multiple Autoimmune Disease
Genetics Consortium (MADGC) (
Criswell et al., Am J Hum Genet 76(4):561-71 (2005)); b) 613 cases from the University of California San Francisco (UCSF) Lupus Genetics
Project (
Seligman et al., Arthritis Rheum 44(3):618-25 (2001);
Remmers et al., N Engl J Med 357(10):977-86 (2007)); and c) 335 cases from the University of Pittsburgh Medical Center (UPMC) (
Demirci et al., Ann Hum Genet 71(Pt 3):308-11 (2007)) and 8 cases from The Feinstein Institute for Medical Research. The controls were
1861 samples from the NYHP collection, 1722 samples from the publicly available iControlDB
database (available at Illumina Inc.), and 4564 samples from the publicly available
National Cancer Institute Cancer Genetic Markers of Susceptibility (CGEMS) project
(available at the URL: cgems(dot)cancer(dot)gov).
GENOMEWIDE DATA SET OF 1310 SLE CASES AND 7859 CONTROLS
[0141] Sample and SNP filtering was conducted using analytical modules within the software
programs PLINK and EIGENSTRAT as described below (
see also Purcell et al., Am J Hum Genet 81(3):559-75 (2007);
Price et al., Nat Genet 38(8):904-09 (2006)). The genomewide SNP data were used in this study to facilitate close matching of
cases and controls, and to provide genotypes at the confirmed and suspected SLE loci.
Table 1. Number of samples analyzed in genome-wide and replication study organized
by site.
| |
Case |
Control |
| |
Collection |
N |
Collection |
N |
| Discovery samples |
|
|
|
|
| GWASa |
|
1310 |
|
7859 |
| Replication samples |
|
|
|
|
| USb |
PROFILE |
415 |
NYHP |
776 |
| |
UMN |
366 |
ALZ |
2215 |
| |
UCSF |
284 |
|
|
| |
UPMC |
52 |
|
|
| |
JHU |
12 |
|
|
| |
Total |
1129 |
|
2991 |
| Swedenc |
Umeå |
244 |
Umeå |
- |
| |
Uppsala |
145 |
Uppsala |
132 |
| |
Stockholm |
270 |
Stockholmd |
1112 |
| |
Lund |
155 |
Lund |
94 |
| |
Total |
834 |
Total |
1338 |
| Total |
|
3273 |
|
12188 |
| a Samples from the genome-wide association scan described (Hom, G. et al., N Engl J Med 358:900-9 (2008)). b Independent SLE cases from a U.S. cohort drawn from the PROFILE SLE consortium, University
of California- San Francisco (UCSF) (Thorburn, C.M. et al., Genes Immun 8:279-87 (2007)), University of Pittsburgh Medical Center (UPMC), University of Minnesota (UMN),
and Johns Hopkins University (JHU). U.S. controls from the New York Health Project
(Gregersen et al.) and Alzhiemers cases and controls from the University of Pittsburgh
and the NCRAD. c SLE cases and controls from Stockholm, Karolinska, Solna, Uppsala, Lund and Umeå,
Sweden. d 823 of the controls from Stockholm were genotyped using the Illumina 317K SNP array.
SNPs in these samples were imputed and analyzed as described in Methods. |
Custom SNP Array
[0142] A custom array was designed with 10,848 SNPs that passed the quality control measures
described below. The complete array had 12,864 SNPs but 2016 SNPs failed the quality
control measures leaving 10,848 SNPs that were advanced into the analysis. The custom
array consisted of 3,188 SNPs selected based on a nominal P < 0.05 in a SLE genome-wide
association scan, 505 SNPs from 25 previously reported SLE risk loci, 42 SNPs selected
after a literature search for confirmed risk alleles from other autoimmune diseases
and 7,113 SNPs used for ascertaining and controlling for population substructure.
The latter group included SNPs that have been used to define continental population
differences (
Kosoy, R. et al., Hum. Mutat. 30:69-78 (2009)) and SNPs enriched for European population substructure (
Tian, C. et al., PLoS Genet 4, e4 (2008)). The custom array was manufactured by Illumina, Inc. using their iSelect Custom
BeadChip and the rs identification numbers we provided for the SNPs that passed the
quality control filters described below.
Quality Control and Imputation
[0143] For the U.S. data, a total of 1,464 U.S. cases and 3,078 U.S. controls were genotyped
on the custom Illumina chip described above, also referred to herein as the custom
12K chip. We used stringent quality control (QC) criteria to ensure that high quality
data was included in the final analysis. Specifically, we a) excluded 116 individuals
who had > 5% missing data and b) excluded 279 individuals based on cryptic relatedness
and duplicate samples based on Identical by State (IBS) status (PI Hat > 0.15). We
included only SNPs with a) < 5 % missing data, b) Hardy-Weinberg Equilibrium (HWE)
p-value > 1x10
-6, c) Minor Allele Frequency (MAF) > 0.01 % and d) SNPs with p-value > 1 x 10
-5 in a test for differential missingness between cases and controls. SNPs were also
examined for batch effects. After applying the above filters, a final set of 1,144
cases and 3,003 controls and 11,024 SNPs were available for analysis. All QC tests
were performed using PLINK (
Purcell et al., Am J Hum Genet 81(3):559-75 (2007)).
[0144] For the Swedish data, a set of 888 cases and 527 controls genotyped on the custom
12K chip were available for analysis. A separate set of 1,115 Swedish controls genotyped
on the Illumina, Inc. 317K Human HapMap SNP bead array (also referred to herein as
the 317K array) was also incorporated into the analysis. We followed the following
steps to combine the two data sets. First, an overlapping data set of 6,789 SNPs between
the 12K and 317K data was created. We used this data set to examine the Swedish replication
cohort for cryptic relatedness and duplicate samples. As a result, 313 samples were
excluded (PI Hat> 0.15). After quality control checks, we forwarded for analysis 863
cases and 523 controls genotyped on the custom 12K chip and 831 controls genotyped
on the 317K Illumina chip. Second, we imputed (see below) the 831 Swedish controls
genotyped with the 317K array to create a larger set of overlapping SNPs. Of the remaining
SNPs, we captured 4,605 SNPs by imputation. A final set of 11,394 overlapping SNPs
was forwarded to analysis. We filtered the SNPs in this data set using the same thresholds
as described above. The remaining 1,250 SNPs not captured by the imputation were analyzed
only in the original set of Swedish samples genotyped on the 12K chip.
[0145] The 831 Swedish controls genotyped with the 317K array were imputed using MACH (a
Markov Chain based haplotyping software program available at the URL sph(dot)umich(dot)edu(slash)csg(slash)abecasis(slash)MACH)
using Phase II HapMap CEU samples as a reference. Phase II HapMap CEU refers to samples
from the Human Haplotype Project known as Utah residents with ancestry from northern
and western Europe (CEU) from the "Phase II" data release. (
See also Li et al. Am J Hum Genet S79 at 2290 (2006)). Before imputation, we applied stringent quality control checks on the 317K SNPs.
A subset of 293,242 markers passing the following criteria (1) MAF > 1%, (2) missing
rate < 5% and (3) HWE p-value >1x10
-6 were included in the imputation. After the imputation, SNPs with low imputation quality,
i.e. R-squared_Hat (RSQR_HAT) < 0.40 reported by MACH, were discarded. An overlapping
set of 11,394 markers was available for analysis. To take into account the uncertainty
in imputation, probabilistic scores rather than genotype calls were used in the analysis.
[0146] For imputation of genome-wide association study samples, genotype data used in the
meta-analysis was from 1310 SLE cases genotyped with the Illumina 550K genome-wide
SNP platform (
see Hom, G. et al., N Engl J Med 358:900-9 (2008)). The selection and genotyping of the SLE case samples was described previously
(
Hom, G. et al., N Engl J Med 358:900-9 (2008)). In addition to the 3,583 controls previously described (
Hom, G. et al., N Engl J Med 358:900-9 (2008)), 4,564 control samples from the publicly available Cancer Genetics Markers of Susceptibility
(CGEMS) project were included after obtaining approval (available at the URL: cgems(dot)cancer(dot)gov).
The entire sample of 7,859 controls was examined using the data quality control filters
as previously described (
Hom, G. et al., N Engl J Med 358:900-9 (2008)). We next used IMPUTE version 1 (available at the URL www(dot)stats(dot)ox(dot)ac(dot)
(dot)uk(slash)∼marchini(slash)software(slash)gwas(slash)impute(dot)html) to infer
genotypes using HapMap Phase II CEU samples as a reference (
Marchini, J. et al., Nat. Genet. 39:906-913 (2007)). We used SNPTEST (available at the URL www(dot)stats(dot)ox(dot)ac(dot)uk(slash)∼marchini(slash)software(slash)gwas(slash)snptes_v
1(dot)1(dot)4(dot)html) to generate association statistics (
Marchini, J. et al., Nat. Genet. 39:906-913 (2007)). Specifically, association statistics were generated using an additive model (-Frequentist
1 option in SNPTEST), adjusted for the uncertainty of the imputed genotype (-proper
option in SNPTEST). The rank ordered list of association statistics was used to select
regions for replication as described.
Population Stratification in Replication Samples
[0147] For each replication cohort, we used ancestry informative markers to correct for
possible population stratification. A subset of 5,486 uncorrelated ancestry informative
markers that passed stringent quality control criteria were used to infer the top
ten principal components of genetic variation using the software EIGENSTRAT (
Price et al., Nat Genet 38(8):904-09 (2006)). Outliers were removed from each sample set (defined as σ > 6). Specifically, we
removed 27 genetic outliers from the US cohort and 45 outliers from the Swedish cohort
respectively. Some degree of population stratification along the first two eigenvectors
was observed in both the US and Swedish replication collections. To correct for the
case-control stratification, we used one of the following strategies: (1) we applied
the correction of the Cochran-Armitage test statistic incorporated in EIGENSTRAT to
the US replication data set and to Swedish data set wherever genotype data was available;
(2) we used principal components as covariates in a logistic regression model in the
analysis of the imputed Swedish data.
Association Analysis
[0148] For the U.S. data, some inflation in the test statistics was observed after performing
an uncorrected 1-degree of freedom allelic test for association (PLINK [
Purcell, S. et al. Am J Hum Genet 81:559-75 (2007)]). To correct for population stratification in the U.S. sample, principal component
analysis (EIGENSTRAT) using 5,486 uncorrelated ancestry informative markers was conducted.
First, we removed genetic outliers (defined as σ > 6). Second, Cochran-Armitage trend
chi-square test statistics were calculated for each genotyped SNP in 1,129 cases and
2,991 controls, followed by adjustment of the test statistic value of each SNP in
EIGENSTRAT using the first four eigenvectors. Two-tailed p-values based on the test-statistic
for each SNP was calculated. After correction for population stratification, the λ
gc in the U.S. samples was 1.05.
[0149] For the Swedish data, we examined the Swedish cohort for hidden population stratification
using 5,486 ancestry informative markers genotyped in the 12K samples as well as in
additional Illumina 317K controls. After removal of genetic outliers, we had 834 cases
and 515 controls genotyped on the custom 12K chip and 823 controls genotyped on the
Illumina 317K chip. We used the correction of the test statistic implemented in EIGENSTRAT
on the overlapping set of 6789 SNPs between the two Illumina arrays. To correct for
stratification in the set of 4605 SNPs genotyped in the 12K samples and imputed in
the Illumina 317K samples, we used the first four eigenvectors determined above as
covariates in a logistic regression model implemented in SNPTEST because EIGENSTRAT
was not intended for use with imputed genotype data. A small set of 1250 markers not
captured by imputation in the Illumina 317K SNPs was analyzed only in the 834 cases
and 515 controls genotyped on the custom 12K chip. After correction for population
stratification the λ
gc in the Swedish samples was 1.10.
Meta-Analysis
[0150] We used a weighted z-score method to conduct the meta-analysis. To combine results
across different cohorts, alleles were oriented to the forward strand of the National
Center for Biotechnology Information (NCBI) 36 reference sequence of the human genome
to avoid ambiguity associated with C/G and A/T SNPs. The NCBI reference sequence of
the human genome is available at the URL www(dot)ncbi(dot)nlm(dot)nih(dot)gov.
See also Pruitt et al., Nucl. Acids Res. 35 (database issue):D61-D65 (2007). P values for each cohort were converted to z-scores taking into account direction
of effect relative to an arbitrary reference allele. A weighted sum of z-scores was
calculated by weighing each z-score by the square root of the sample size for each
cohort and then dividing the sum by the square root of the total sample size. The
combined z-score for the Swedish and U.S. replication cohorts were converted to one-tailed
p values. The meta-analysis z-score was converted to a two-tailed p value and evidence
for association was evaluated. We considered SNPs passing a threshold of 5 x 10
-8 overwhelmingly associated with SLE. Loci with combined p-value less than 1 x 10
-5 that did not pass genome-wide significance were considered strong candidates. The
meta-analysis method was carried out using the freely available METAL software package
(available at the URL www(dot)sph(dot)umich(dot)edu(slash)csg(slash)abecasis(slash)Metal).
To calculate pooled odds ratios, we used the Cochran-Mantel-Haenszel (CMH) method
as implemented by the METAL software. Odds ratios were calculated relative to the
risk allele for each SNP. Also, a weighted average allele frequency in controls was
calculated relative to the risk allele of each SNP.
Percent Variance Explained
[0151] For SNPs previously associated with SLE and SNPs with a meta p-value less than 1
x 10
-5 in our replication study, we calculated the percentage of variance explained. We
used a liability threshold model which assumes that SLE has an underlying liability
score which is normally distributed with mean 0 and variance one. We assumed prevalence
of 0.1 % of SLE in the general population. To calculate threshold for each genotype,
we used allele frequencies in controls and an effect size corresponding to the odds
ratio (OR) from our analysis.
Interaction Analysis
[0152] To look for epistatic effects between the top signals, we compiled a list of all
SNPs in Tables 2, 4, and 6 and carried out an interaction analysis in each replication
cohort using the epistasis option implemented in PLINK. To achieve greater statistical
power, we performed a case-only analysis. After correcting for the number of tests,
none of the SNP-SNP interactions were found significant at the p < 0.05 level.
Conditional Analysis
[0153] In each genomic region showing strong association with SLE, we selected the SNP showing
the strongest signal. We used PLINK to condition on this SNP and looked for other
SNPs showing strong association with SLE.
A Large-Scale Replication Study Identifies TNIP1, PRDM1, JAZF1, UHRFIBP1, and IL10 as Novel Risk Loci for Systemic Lupus Erythematosus
[0154] Recent genome-wide association (GWA) and candidate gene studies have identified at
least 15 common risk alleles that achieve genome-wide significance (P < 5 x 10
-8). These include genes important for adaptive immunity and the production of autoantibodies
(HLA class II alleles,
BLK, PTPN22, and
BANK1) and genes with roles in innate immunity and interferon signaling (
ITGAM,
TNFAIP3,
STAT4, and
IRF5) (
Cunninghame Graham, D.S. et al., Nat. Genet. 40:83-89 (2008);
Graham, R.R. et al., Nat. Genet. 40(9): 1059-61 (2008);
Graham, R.R., et al., J Intern Med 265:680-88 (2009);
Harley, J.B. et al., Nat. Genet. 40:204-10 (2008);
Hom, G. et al., N Engl J Med 358:900-9 (2008);
Kozyrev, S.V. et al., Nat. Genet. 40:211-6 (2008);
Sawalha, A.H. et al., PLoS ONE 3:e1727 (2008);
Sigurdsson, S. et al., Am J Hum Genet 76:528-37 (2005)). To identify additional risk loci we performed a targeted replication study of
SNPs from 2,466 loci that showed a nominal P value < 0.05 in a recent GWAS7 scan of
1310 cases and 7859 controls. We also genotyped SNPs from 25 previously reported SLE
risk loci, 42 SNPs from 35 loci implicated in other autoimmune diseases, and over
7,000 ancestry informative markers. An overview of the experimental design is shown
in Figure 1. The SNPs described above were incorporated into an Illumina custom SNP
array. The array was genotyped in independent cases and controls from the U.S. and
Sweden. Eight hundred twenty-three of the Swedish controls were genotyped using the
Illumina 310K SNP array and variants were analyzed as described in the Methods above.
[0155] Specifically, as described above, we designed a custom SNP array consisting of >
12,000 variants and genotyped two independent SLE case and control populations from
the United States (1,129 SLE cases and 2,991 controls) and Sweden (834 SLE cases and
1,338 controls). Included among the U.S. controls were 2,215 Alzheimer's disease case/control
samples, which were felt to be acceptable as controls since the genetic basis of SLE
and Alzheimer's are expected to be independent. We next applied data quality filters
to remove poor performing samples and SNPs, population outliers and duplicate/related
individuals (see Methods above). Following these quality control measures, a final
set of 10,848 SNPs was examined as indicated in Figure 1. Association statistics for
3,735 variants were calculated and corrected for population stratification using 7,113
ancestry informative markers (see Methods above).
[0156] We first examined 25 variants (from 23 loci) that were previously reported to be
associated with SLE (see Table 2). We found further evidence of association for 21
of the variants (P < 0.05), including 9 loci that reached genome-wide significance
(P < 5 x 10
-8) in the current combined data set. Among the genome-wide significant results were
HLA Class II
DR3 (
DRB1 *
0301),
IRF5, TNFAIP3, BLK, STAT4, ITGAM, PTPN22, PHRF1 (
KIAA1542)
, and
TNFSF4 (OX40L). The analysis provided additional evidence for variants from 9 loci where a single
previous study reported genome-wide levels of significance: HLA*DR2,
TNFAIP3 (rs6920220),
BANK1, ATG5, PTTG1, PXK, FCGR2A, UBE2L3, and
IRAK1/
MECP2).
[0157] An earlier candidate gene study identified
MECP2 (
Sawalha, A.H. et al., PLoS ONE 3:e1727 (2008)) as a potential risk allele for SLE. However, in the current dataset, SNPs near
IRAK1, a gene critical for toll-like receptor 7 and 9 signaling and located within the identified
region of linkage disequilibrium surrounding
MECP2, showed the strongest evidence of association. Similar findings were recently reported
(
Jacob, C.O. et al., Proc. Natl. Acad. Sci. USA (2009)), and further work will be needed to determine the causal allele in the
IRAK1/
MECP2 locus. We found additional evidence of association for 3 loci -
TYK2, ICA1 and
NMNAT2 - that had previously shown significant but not genome-wide level evidence for association.
(
Harley, J.B. et al., Nat. Genet. 40:204-10 (2008);
Sigurdsson, S. et al., Am J Hum Genet 76:528-37 (2005)). For four previously implicated variants -
LYN, SCUBE1, TLR5 and
LY9 - no evidence of association was observed in the combined dataset.
[0158] To identify novel SLE risk loci, we examined a total of 3,188 SNPs from 2,446 distinct
loci that showed evidence of association to SLE in our genome-wide dataset (
Hom, G. et al., N Engl J Med 358, 900-9 (2008)), which comprised 502,033 SNPs genotyped in 1,310 SLE cases and an expanded set
of 7,859 controls. Using this dataset, we imputed > 2.1 M variants using Phase II
HapMap CEU samples as a reference (see Methods above), and generated a rank-ordered
list of association statistics. Variants with P < 0.05 were selected for possible
inclusion on the custom replication array. For efficient genotyping, we identified
groups of correlated variants (r
2>0.2), followed by selection of at least two SNPs from each group where the lowest
P value was < 0.001. For the remaining groups, the SNP with the lowest P value in
the group was included. In the replication samples, we calculated the association
statistics (see Methods) and observed a significant enrichment of the replication
results relative to the expected null distribution. Excluding the previously reported
SLE risk alleles, there were 134 loci with a P < 0.05 (expected 64, P = 2 x 10
-15) and 12 loci with a P < 0.001 (expected 1, P = 1 x 10
-9), suggesting the presence of true positives.
[0159] Each of Figures 2A-2E show the association results from the genome-wide association
scan plotted on the y axis versus genomic position on the x axis within a 500 kb region
surrounding the loci defined by
TNIP1 (Fig. 2A),
PRDM1 (Fig. 2B),
JAZF1 (Fig. 2C),
UHRF1BP1 (Fig. 2D), and
IL-10 (Fig. 2E). The meta-analysis P value for the most associated marker is indicated
by a red square in each of Figs. 2A-2E. For each of Figs. 2A-2E, P values from the
genome scan are colored to indicate LD to the genome-wide associated variant: red
signifies r
2> 0.8, yellow r
2> 0.5, green r
2 > 0.2, and grey r
2< 0.2. Along the bottom of each of Figs. 2A-2E, the recombination rate from the CEU
HapMap (light blue line) and the known human genes (blue) are shown. In Fig. 2B (
PRDM1), a previously reported and independent SLE risk locus at the nearby ATG5 gene is
indicated (rs2245214). Fig. 2F shows a histogram of the P values of 1256 independent
SNPs (r
2 < 0.1 to any other SNP in the array) in the 1,963 case and 4,329 control replication
samples. Under a null distribution, the expected density of results is indicated by
the dashed line in Fig. 2F. As indicated in Fig. 2F, a significant enrichment of results
less than P < 0.05 was observed.
[0160] Accordingly, the replication study identified 5 novel SLE risk loci with a combined
P value that exceeded the genome-wide threshold for significance (P < 5 x 10
-8):
TNIP1, PRDM1, JAZF1,
UHRF1BP1, and
IL10. Detailed statistical associations for these and other loci are shown below in Table
4.
[0161] A variant, rs7708392, on 5q33.1 that resides within an intron of TNF-Alpha Induced
Protein 3 (TNFAIP3)-Interacting Protein 1 (
TNIP1) was significantly associated with SLE in all three cohorts and had a combined P
= 3.8 x 10
-13 (Figure 2A). Variants near
TNIP1 were recently found to contribute to risk of psoriasis (
Nair, R.P. et al., Nat Genet 41:199-204 (2009)), however the SLE and psoriasis variants are separated by 21 Kb and appear to be
distinct genetic signals (r
2 = 0.001). TNIP1 and TNFAIP3 are interacting proteins (
Heyninck, K., et al., FEBS Lett 536:135-40 (2003)), however, the precise role of TNIP1 in regulating TNFAIP3 is unknown. The association
of multiple distinct variants near TNFAIP3 with SLE (
Graham, R.R. et al., Nat. Genet. 40(9): 1059-61 (2008),
Musone, S.L. et al., Nat. Genet. 40(9):1062-64 (2008)), rheumatoid arthritis (
Plenge, R.M. et al., Nat Genet 39:1477-82 (2007)), psoriasis (
Nair, R.P. et al., Nat Genet 41:199-204 (2009)) and type I diabetes (
Fung, E.Y. et al., Genes Immun 10:188-91 (2009)) suggests this pathway has an important role in the regulation of autoimmunity.
[0162] A second confirmed risk variant (rs6568431, P = 7.12 x 10
-10) was identified in an intergenic region between PR Domain containing 1, with ZNF
domain (
PRDM1, also known as
BLIMP1) and APG5 autophagy 5-like (
ATG5). The signal at rs6568431 appears to be distinct from the previously reported SLE
risk allele within
ATG5, rs2245214 (
Harley, J.B. et al., Nat Genet 40:204-10 (2008)) (see Table 4), as rs6568431 has an r
2 < 0.1 with rs2245214, and rs2245214 remains significantly associated with SLE (P
< 1 x 10
-5) after conditional logistic regression incorporating rs6568431 (Figure 2B).
[0163] The promoter region of Juxtaposed with Another Zinc Finger gene 1 (
JAZF1) is a third new confirmed SLE locus (rs849142, P=1.54 x 10
-9) (Figure 2C). Of interest, this same variant was previously linked to risk of type-2
diabetes (
Zeggini, E. et al., Nat Genet 40:638-45 (2008)) and differences in height (
Johansson, A. et al., Hum Mol Genet 18:373-80 (2009)). A separate prostate cancer allele near
JAZF1, rs10486567, (
Thomas, G. et al., Nat Genet 40:310-5 (2008)) showed no evidence for association in the current study.
[0164] A fourth novel risk locus in SLE is defined by a non-synonymous allele (R454Q) of
ICBP90 binding protein 1 (
UHRFBP1, rs11755393, P = 2.22 x 10
-8) (Figure 2D). This allele is a non-conservative amino acid change in a putative binding
partner of UHRF1, a transcription and methylation factor linked to multiple pathways
(
Arita, K., et al., Nature 455:818-21 (2008)). The
UHRFBP1 risk allele is in a region of extended linkage disequilibrium which encompasses multiple
genes, including small nuclear ribonucleoprotein polypeptide C (
SNPRC), part of a RNA processing complex often targeted by SLE autoantibodies.
[0165] The fifth novel SLE locus identified is interleukin-10 (
IL10; rs3024505, P = 3.95 x 10
-8) (Figure 2E). IL10 is an important immunoregulatory cytokine that functions to downregulate
immune responses (
Diveu, C., et al., Curr Opin Immunol 20:663-8 (2008)), and variation in IL10 has inconsistently been reported to be associated with SLE
(
Nath, S.K., et al., Hum Genet 118:225-34 (2005)). The variant associated with SLE is identical to the SNP recently identified as
contributing risk to ulcerative colitis (
Franke, A. et al., Nat Genet 40:1319-23 (2008)) and type 1 diabetes (
Barrett, J.C. et al., Nature Genetics 41:703 - 707 (2009)), suggesting the possibility of shared pathophysiology in the IL10 pathway across
these disorders.
[0166] Using a significance threshold of P < 1 x10
-5 in the combined replication sample, we identified 21 additional SLE candidate risk
loci (Table 4). Less than one locus (0.01) with a P < 1 x 10
-5 was expected under a null distribution for the meta-analysis (P = 8 x 10
-77), suggesting that several of these loci are likely to be true positive loci. Interesting
candidate genes in this list include: a) interferon regulatory factor 8 (
IRF8), which was implicated in a previous GWAS (
Graham, R.R. et al., Nat. Genet. 40(9):1059-61 (2008)) and whose family members
IRF5 and
IRF7 are within confirmed SLE risk loci; b) TAO kinase 3 (
TAOK3), a missense allele (rs428073, N47S) of a kinase expressed in lymphocytes; c) lysosomal
trafficking regulator (
LYST), mutations of which cause the Chediak-Higashi syndrome in humans, a complex disorder
characterized by a lymphoproliferative disorder; and d) interleukin 12 receptor, beta
2 (
IL12RB2), a locus which includes
IL23R and
SERPBP1, but appears distinct from the
IL23R variants reported in the autoimmune diseases inflammatory bowel disease, psoriasis
and ankylosing spondylitis (
Duerr, R.H. et al., Science 314:1461-3 (2006)).
[0167] A remarkable feature of recent GWA studies is the large number of overlapping loci
shared between different complex diseases (
Zhernakova, A., et al., Nat Rev Genet 10:43-55 (2009)). We tested 42 variants from 35 loci that were previously reported as autoimmune
disease risk alleles for association with SLE (Tables 6 and 7). No single locus had
an unadjusted P value < 5 x 10
-8, however, we found an enrichment of associated alleles. From the 35 loci tested (42
total variants), there were five alleles with an unadjusted P < 0.0004 (less than
one result expected by chance, P = 4.4 x 10
-12), and with a P < 0.05 after a Bonferroni correction for the 35 pre-specified loci.
For each of the five variants, the SLE associated allele matches the previously reported
allele and has the same direction of effect (Table 6). We observed a highly significant
association of a missense allele of
IFIH1 (rs1990760, P = 3.3 x 10
-7) that has previously been linked to type I diabetes and Grave's disease (
Smyth, D.J. et al., Nat Genet 38:617-9 (2006);
Sutherland, A. et al., J Clin Endocrinol Metab 92:3338-41 (2007)). We also observed an association with a missense allele (R32Q) of complement factor
B (CFB, rs641153) that resides in the HLA class IIIregion and is a validated risk
allele for age-related macular degeneration (
Gold, B. et al., Nat Genet 38:458-62 (2006)). The SLE risk allele is not in significant linkage disequilibrium (LD) with other
HLA region variants linked to SLE (DR2/DR3) and remained significant after conditional
logistic regression analyses that incorporated DR2 and DR3. The HLA is a complex genetic
region, but it is striking that the allele of SNP rs641153 has a protective effect
nearly identical to the reported AMD risk allele (
Gold, B. et al., Nat Genet 38:458-62 (2006)). Further study of the five candidate disease alleles is indicated.
[0168] In addition, Table 7 provides detailed summary statistics for the 42 variants identified
in other autoimmune diseases. Of interest, variants from
CTLA4,
IL23R,
NOD2 and
CD40 that are significant risk factors in other autoimmune diseases appear to show no
evidence of association to SLE.
[0169] Using 26 SLE risk alleles (21 previously reported loci in Table 2, plus the 5 novel
SLE loci described above), several additional analyses were performed. Pair-wise interaction
analysis with the confirmed loci was conducted and, consistent with previous literature
from SLE (
Harley, J.B. et al., Nat Genet 40:204-10 (2008)) and other complex diseases (
Barrett, J.C. et al., Nat Genet 40:955-62 (2008)), no evidence for non-additive interactions was observed. Using conditional logistic
regression analyses, we found no evidence for multiple independent alleles contributing
to risk at any of the individual risk loci. We next estimated the percent of variance
explained by each of the confirmed SLE risk alleles, using the methods described by
Barrett et al. (
Barrett, J.C. et al., Nat Genet 40:955-62 (2008)).
HLA-DR3,
IRF5 and
STAT4 were each estimated to account for >1% of the genetic variance, while the remaining
loci each accounted for less than 1% of the variance. Together, the 26 SLE risk loci
explain an estimated 8% of the total genetic susceptibility to SLE.
[0170] Targeted replication of GWAS results is an efficient study design to confirm additional
risk loci (
Hirschhorn, J.N. et al., Nat Rev Genet 6:95-108 (2005)). There is little available data, however, as to the probability of replicating
results that fall short of accepted P value criteria for genome-wide significance.
In the current study, all variants with a P < 0.05 from the original GWAS studies
were included for replication. As shown in Figure 3, the lower the P value in the
GWAS study, the higher the probability of reaching candidate or confirmed status in
the replication meta-analysis. Of interest, no candidate or confirmed results were
obtained in the current study from the group of variants with a GWAS P between 0.05
and 0.01, despite accounting for ∼50% of all variants tested in the replication. These
results may be useful in guiding future targeted study designs, although certainly
the size of the original GWAS population, the replication sample size, the disease
architecture, and the effect size of the candidate variants also need to be carefully
considered in planning replication efforts.
[0171] These data provide further evidence that common variation in genes important for
function of the adaptive and innate arms of the immune system are important in establishing
risk for developing SLE. While each of the identified alleles accounts for only a
fraction of the overall genetic risk, these and other ongoing studies are providing
new insight into the pathogenesis of lupus and are suggesting new targets and pathways
for drug discovery and development.
Table 2. Replication results of previously reported SLE risk loci
| SNP |
Chr |
Critical Region |
P Values |
Locus |
Risk Allele |
Risk Allele Frequency |
OR (95% C.I) |
| GWAS |
US |
Sweden |
Combined |
| Variants with a P < 5 x 10-8 in the current dataset |
| rs3135394a |
6p21.32 |
32.027-32.874 |
7.8 x 10-22 |
1.8 x 10-21 |
8.3 x 10-21 |
2.0 x 10-60 |
HLA-DR3b |
G |
0.10 |
1.98 (1.84-2.14) |
| rs7574865a |
2q32.2 |
191.609-191.681 |
3.0 x 10-19 |
6.4 x 10-16 |
2.7 x 10-12 |
1.4 x 10-41 |
STAT4 |
T |
0.23 |
1.57 (1.49-1.69) |
| rs2070197a |
7q32.1 |
128.276-128.476 |
n.a. |
1.4 x 10-16 |
4.1 x 10-9 |
5.8 x 10-24 |
IRF5 |
C |
0.11 |
1.88 (1.78-1.95) |
| rs11860650a |
16p11.2 |
31.195-31.277 |
5.3 x 10-11 |
1.8 x 10-5 |
9.2 x 10-8 |
1.9 x 10-21 |
ITGAM |
T |
0.13 |
1.43 (1.32-1.54) |
| rs2736340 |
8p23.1 |
11.331-11.488 |
5.5 x 10-8 |
4.6 x 10-9 |
0.0028 |
7.9 x 10-17 |
BLK |
T |
0.25 |
1.35 (1.27-1.43) |
| rs5029937a |
6q23.3 |
138.174-138.284 |
1.0 x 10-4 |
2.4 x 10-7 |
3.1 x 10-5 |
5.3 x 10-13 |
TNFAIP3 |
T |
0.03 |
1.71 (1.51-1.95) |
| rs2476601 |
1 p13.2 |
113.963-114.251 |
3.3 x 10-5 |
4.5 x 10-5 |
1.5 x 10-5 |
3.4 x 10-12 |
PTPN22 |
A |
0.10 |
1.35 (1.24-1.47) |
| rs4963128 |
11 p15.5 |
0.485-0.664 |
0.0021 |
1.5 x 10-5 |
8.7 x 10-4 |
4.9 x 10-9 |
PHRF1 |
C |
0.67 |
1.20 (1.13-1.27) |
| rs2205960 |
1 q25.1 |
171.454-171.523 |
9.5 x 10-6 |
0.030 |
6.7 x 10-4 |
6.3 x 10-9 |
TNFSF4 |
T |
0.23 |
1.22 (1.15-1.30) |
| Variants with a previous report of P < 5 x 10-8 |
| rs9271366a |
6p21.32 |
32.446-32.695 |
0.0079 |
7.4 x 10-4 |
8.3 x 10-5 |
1.4 x 10-7 |
HLA-DR2c |
G |
0.16 |
1.26 (1.18-1.36) |
| rs6920220a |
6q23.3 |
138.000-138.048 |
9.9 x 10-4 |
5.2 x 10-4 |
0.049 |
4.0 x 10-7 |
TNFAIP3 |
A |
0.21 |
1.17 (1.10-1.25) |
| rs2269368 |
Xq28 |
152.743-152.943 |
2.5 x 10-5 |
n.a. |
0.0049 |
7.5 x 10-7 |
IRAK1/MECP2 |
T |
0.14 |
1.11 (1.01-1.22) |
| rs2431099 |
5q33.3 |
159.813-159.821 |
1.5 x 10-5 |
0.16 |
0.047 |
1.6 x 10-6 |
PTTG1 |
G |
0.52 |
1.15 (1.09-1.22) |
| rs5754217 |
22q11.2 |
20.240-20.315 |
0.0060 |
8.4 x 10-4 |
0.018 |
2.3 x 10-6 |
UBE2L3 |
T |
0.19 |
1.20 (1.13-1.27) |
| rs2245214a |
6q21 |
106.749-106.876 |
0.032 |
4.3 x 10-6 |
0.35 |
1.2 x 10-5 |
ATG5 |
G |
0.37 |
1.15 (1.09-1.21) |
| rs10516487 |
4q24 |
102.930-103.134 |
0.097 |
0.091 |
0.0015 |
8.3 x 10-4 |
BANK1 |
G |
0.70 |
1.11 (1.04-1.18) |
| rs2176082a |
3p14.3 |
58.214-58.443 |
0.010 |
0.012 |
0.0031 |
1.2 x 10-5 |
PXK |
A |
0.28 |
1.17 (1.10-1.25) |
| rs1801274 |
1q23.3 |
159.724-159.746 |
4.1 x 10-4 |
n.a. |
n.a. |
4.1 x10-4 |
FCGR2A |
G |
0.50 |
1.16 (1.09-1.20) |
| Variants with a previous report of > 5 x 10-8 |
| rs280519a |
19p13.2 |
10.387-10.430 |
7.1 x 10-4 |
n.a. |
0.036 |
7.4 x 10-5 |
TYK2 |
A |
0.48 |
1.13 (1.06-1.21) |
| rs10156091 |
7p21.3 |
8.134-8.154 |
0.095 |
0.0031 |
8.7 x 10-4 |
6.5 x 10-4 |
ICA1 |
T |
0.10 |
1.16 (1.06-1.27) |
| rs2022013 |
1q25.3 |
181.538-181.670 |
0.26 |
2.05 x 10-5 |
2.8 x 10-4 |
0.0015 |
NMNAT2 |
T |
0.60 |
1.09 (1.03-1.16) |
| rs7829816 |
8q12.1 |
56.985-57.025 |
0.49 |
0.76 |
0.19 |
0.17 |
LYN |
A |
0.79 |
1.05 (0.96-1.17) |
| rs2071725 |
22q13.2 |
41.908-41.970 |
0.63 |
0.34 |
0.29 |
0.30 |
SCUBE1 |
G |
0.86 |
1.09 (0.98-1.20) |
| rs5744168a |
1q41 |
n.a. |
n.a. |
1.00 |
0.40 |
0.67 |
TLR5 |
G |
0.94 |
1.02 (0.94-1.12) |
| rs509749 |
1q23.3 |
158.993-159.067 |
0.64 |
0.94 |
0.93 |
0.76 |
LY9 |
G |
0.96 |
1.01 (0.91-1.12) |
| Critical Region here is defined as the minimal region containing variants with r2> 0.4 in the HapMap CEU population and is reported in HG18 coordinates (Mb). P values
calculated from indicated case/control population (GWAS: 1310 case and 7859 control,
U.S.: 1129 case and 2991 control, Sweden 834 case and 1338 control, Combined: 3273
case and 12,188 control samples), and Combined P value calculated as described in
methods. Risk Allele is reported relative to + reference strand. Risk Allele Frequency
is the frequency in control chromosomes. Odds ratio is the combined odds ratio as
described in Methods above. a Indicates markers that were imputed, as described in Methods, in the GWAS samples
and directly genotyped in the replication samples. b rs3135394 has an r2 = 0.87 to the HLA*DR3 (DRB1*0301) allele. c rs9271366 has an r2 = 0.97 to the HLA*DR2 (DRB1*1501) allele. See Table 3 for expanded summary statistics.
N.A. = Not available; due to failure to pass QC measures (TYK2, FCGR2A, and IRAK1/MECP2), or the specific variant was not present in the genome-wide array (TLR5 and IRF5). However, rs2070197 (IRF5 region) is in strong linkage disequilibrium (LD) with rs10488631, which had a P =
2 x 10-11 in the genome scan. |
Table 3. Allele frequencies in replication study of previously reported SLE risk loci.
| SNP |
Chr |
Critical Region |
Locus |
A1/A2 |
GWAS |
US |
Sweden |
| Allele Frequency |
Allele Frequency |
Allele Frequency |
| OR |
Controls |
Cases |
OR |
Controls |
Cases |
OR |
Controls |
Cases |
| rs3135394 |
6p21.32 |
32.027-32.874 |
HLA-DR3 |
G/A |
1.89 |
0.102 |
0.166 |
2.33 |
0.090 |
0.188 |
2.27 |
0.135 |
0.239 |
| rs7574865 |
2q32.2 |
191.609-191.681 |
STAT4 |
T/G |
1.57 |
0.233 |
0.314 |
1.54 |
0.217 |
0.300 |
2.03 |
0.208 |
0.347 |
| rs2070197 |
7q32.1 |
128.276-128.476 |
IRF5 |
C/T |
n.a. |
n.a. |
n.a. |
1.82 |
0.105 |
0.176 |
2.08 |
0.125 |
0.226 |
| rs11860650 |
16p11.2 |
31.195-31.277 |
ITGAM |
T/C |
1.50 |
0.130 |
0.177 |
1.27 |
0.142 |
0.175 |
1.64 |
0.112 |
0.178 |
| rs2736340 |
8p23.1 |
11.331-11.488 |
BLK |
T/C |
1.31 |
0.246 |
0.299 |
1.47 |
0.236 |
0.313 |
1.25 |
0.262 |
0.307 |
| rs5029937 |
6q23.3 |
138.174-138.284 |
TNFAIP3 |
T/G |
1.57 |
0.034 |
0.051 |
1.84 |
0.033 |
0.059 |
1.88 |
0.034 |
0.065 |
| rs2476601 |
1p13.2 |
113.963-114.251 |
PTPN22 |
A/G |
1.35 |
0.098 |
0.116 |
1.48 |
0.083 |
0.119 |
1.47 |
0.120 |
0.167 |
| rs2245214 |
6q21 |
106.749-106.876 |
ATG5 |
G/C |
1.10 |
0.370 |
0.393 |
1.31 |
0.353 |
0.416 |
1.05 |
0.407 |
0.420 |
| rs4963128 |
11 p15.5 |
0.485-0.664 |
PHRF1 |
C/T |
1.16 |
0.673 |
0.698 |
1.28 |
0.660 |
0.712 |
1.27 |
0.685 |
0.734 |
| rs2205960 |
1q25.1 |
171.454-171.523 |
TNFSF4 |
T/G |
1.25 |
0.230 |
0.269 |
1.18 |
0.225 |
0.255 |
1.28 |
0.233 |
0.280 |
| rs9271366 |
6p21.32 |
32.446-32.695 |
HLA-DR2 |
G/A |
1.16 |
0.172 |
0.192 |
1.41 |
0.142 |
0.188 |
1.39 |
0.157 |
0.204 |
| rs6920220 |
6q23.3 |
138.000-138.048 |
TNFAIP3 |
A/G |
1.19 |
0.206 |
0.234 |
1.28 |
0.190 |
0.231 |
1.16 |
0.232 |
0.257 |
| rs2269368 |
Xq28 |
152.743-152.943 |
IRAK1/MECP2 |
T/C |
1.29 |
0.141 |
0.175 |
n.a. |
n.a. |
n.a. |
n.a. |
n.a. |
n.a. |
| rs2431099 |
5q33.3 |
159.813-159.821 |
PTTG1 |
G/A |
1.20 |
0.522 |
0.568 |
1.09 |
0.515 |
0.536 |
1.14 |
0.541 |
0.578 |
| rs5754217 |
22q11.2 |
20.240-20.315 |
UBE2L3 |
T/G |
1.16 |
0.188 |
0.213 |
1.23 |
0.191 |
0.225 |
1.22 |
0.231 |
0.268 |
| rs2176082 |
3p14.3 |
58.214-58.443 |
PXK |
A/G |
1.13 |
0.284 |
0.309 |
1.21 |
0.274 |
0.314 |
1.22 |
0.308 |
0.351 |
| rs280519 |
19p13.2 |
10.387-10.430 |
TYK2 |
A/G |
1.16 |
0.477 |
0.507 |
n.a. |
n.a. |
n.a. |
1.15 |
0.476 |
0.511 |
| rs1801274 |
1q23.3 |
159.724-159.746 |
FCGR2A |
G/A |
1.16 |
0.500 |
0.537 |
n.a. |
n.a |
n.a |
n.a. |
n.a. |
n.a. |
| rs10156091 |
7p21.3 |
8.134-8.154 |
ICA1 |
T/C |
1.12 |
0.098 |
0.104 |
1.26 |
0.105 |
0.129 |
1.19 |
0.095 |
0.110 |
| rs10516487 |
4q24 |
102.930-103.134 |
BANK1 |
G/A |
1.08 |
0.694 |
0.712 |
1.10 |
0.698 |
0.716 |
1.20 |
0.722 |
0.758 |
| rs2022013 |
1q25.3 |
181.538-181.670 |
NMNAT2 |
T/C |
1.05 |
0.599 |
0.609 |
1.22 |
0.580 |
0.627 |
1.04 |
0.618 |
0.627 |
| rs7829816 |
8q12.1 |
56.985-57.025 |
LYN |
A/G |
1.04 |
0.786 |
0.795 |
1.03 |
0.783 |
0.789 |
1.07 |
0.817 |
0.827 |
| rs2071725 |
22g13.2 |
41.908-41.970 |
SCUBE1 |
G/A |
1.03 |
0.859 |
0.870 |
1.12 |
0.859 |
0.873 |
1.01 |
0.887 |
0.889 |
| rs5744168 |
1 |
n.a. |
TLR5 |
G/A |
n.a. |
n.a. |
n.a. |
0.93 |
0.947 |
0.943 |
1.19 |
0.920 |
0.932 |
| rs509749 |
1q23.3 |
158.993-159.067 |
LY9 |
G/A |
1.02 |
0.425 |
0.428 |
1.00 |
0.429 |
0.430 |
0.99 |
0.453 |
0.451 |
| Critical Region here is defined as the minimal region containing variants with r2> 0.4 in the HapMap CEU population and is reported in HG18 coordinates. Allele frequencies
calculated from indicated case/control population (GWAS: 1310 case and 7859 control,
US: 1129 case and 2991 control, Sweden 834 case and 1338 control, Combined: 3273 case
and 12188 control samples). Alleles are reported relative to + reference strand, and
all data refers to Allele 1 (A1). The odds ratio (OR) for each population is listed. |
Table 4. Novel SLE risk loci in the combined dataset.
| |
|
|
|
P values |
|
Risk Allele |
| SNP |
SEQ ID NOS |
Chr. |
Critical Region |
GWAS |
US |
Sweden |
Combined |
Locus |
Risk Allele |
Frequency |
OR (95% C.I.) |
| Genome-wide significant loci |
| rs7708392a |
16 & 17 |
5 |
150.419-150.441 |
4.5 x 10-7 |
7.7 x 10-4 |
1.2 x 10-5 |
3.8 x 10-13 |
TNIP1 |
C |
0.24 |
1.27 (1.10-1.35) |
| rs6568431 |
18 & 19 |
6 |
106.675-106.705 |
6.1 x 16-6 |
0.0016 |
0.0050 |
7.1 x 10-10 |
PRDM1 |
A |
0.38 |
1.20 (1.14-1.27) |
| rs849142a |
20 & 21 |
7 |
28.108-28.223 |
4.5 x 10-7 |
0.10 |
5.4 x 10-4 |
1.5 x 10-9 |
JAZF1 |
T |
0.49 |
1.19 (1.13-1.26) |
| rs11755393a |
22 & 23 |
6 |
34.658-35.090 |
0.0014 |
3.7 x 10-4 |
5.1 x 10-4 |
2.2 x 10-8 |
UHRF1BP1 |
G |
0.35 |
1.17 (1.10-1.24) |
| rs3024505 |
24 & 25 |
1 |
205.007-205.016 |
2.6 x 10-6 |
0.062 |
1.8 x 10-4 |
40 x 10-8 |
IL10 |
A |
0.16 |
1.19 (1.11-1.28) |
| Loci with combined P value < 1 x 10-6 |
| rs10911363a |
26 & 27 |
1 |
181.672-181.816 |
20 x 10-4 |
1.5 x 10-5 |
0.52 |
9.5 x 10-8 |
NCF2 |
T |
0.27 |
1.19 (1.12-1.26) |
| rs12444486a |
28 & 29 |
16 |
84.548-84.576 |
3.5 x 10-5 |
0.021 |
0.026 |
1.9 x 10-7 |
IRF8 |
T |
0.50 |
1.16 (1.10-1.23) |
| rs11013210a |
30 & 31 |
10 |
23.181-23.337 |
1.6 x 10-5 |
0.013 |
0.12 |
20 x 10-7 |
ARMC3 |
T |
0.21 |
1.18 (1.11-1.26) |
| rs1874791a |
32 & 33 |
1 |
67.563-67.687 |
3.1 x 10-5 |
0.012 |
0.11 |
3.4 x 10-7 |
IL12RB2 |
A |
0.18 |
1.18 (1.10-1.26) |
| rs9782955 |
34 & 35 |
1 |
233.893-234.107 |
6.4 x 10-6 |
0.057 |
0.12 |
4.6 x 10-7 |
LYST |
C |
0.74 |
1.18 (1.11-1.26) |
| rs7683537a |
36 & 37 |
4 |
185.805-185.914 |
1.6 x 10-4 |
0.11 |
0.0013 |
7.6 x 10-7 |
MLF1IP |
T |
0.82 |
1.23 (1.14-1.33) |
| rs428073 |
38 & 39 |
12 |
117.706-117.315 |
1.7 x 10-5 |
0.22 |
0.0079 |
7.7 x 10-7 |
TAOK3 |
T |
0.69 |
1.18 (1.11-1.26) |
| rs497273a |
40 & 41 |
12 |
119.610-119.891 |
5.0 x 10-5 |
0.068 |
0.021 |
8.2 x 10-7 |
SPPL3 |
G |
0.65 |
1.14 1.08-1.21 |
| Loci with combined P value < 1 x 10-5 |
| rs1861525 |
42 & 43 |
7 |
25.097-25.183 |
8.5 x 10-5 |
0.16 |
0.0027 |
1.9 x 10-6 |
CYCS |
G |
0.05 |
1.27 (1.12-1.45) |
| rs921916 |
44 & 45 |
7 |
50.193-50.205 |
4.8 x 10-4 |
0.027 |
0.014 |
20 x 10-6 |
IKZF1 |
C |
0.18 |
1.15 (1.07-1.23) |
| rs7333671 |
46 & 47 |
13 |
73.177-73.198 |
22 x 10-4 |
0.14 |
0.0027 |
2.2 x 10-6 |
KLF12 |
G |
0.08 |
1.22 (1.11-1.34) |
| rs12992463 |
48 & 49 |
2 |
22.312-22.464 |
2.1 x 10-5 |
0.23 |
0.023 |
2.6 x 10-6 |
|
A |
0.50 |
1.12 (1.06-1.19) |
| rs12620999 |
50 & 51 |
2 |
237.616-237.770 |
1.6 x 10-5 |
0.040 |
0.45 |
3.1 x 10-6 |
COPS8 |
C |
0.19 |
1.13 (1.06-1.21) |
| rs503425a |
52 & 53 |
11 |
118.079-118.198 |
0.0012 |
3.3 x 10-4 |
0.43 |
33 x 10-6 |
DDX6 |
C |
0.20 |
1.16 (1.08-1.24) |
| rs10742326a |
54 & 55 |
11 |
34.733-34.809 |
1.4 x 10-4 |
0.017 |
0.21 |
3.6 x 10-6 |
APIP |
G |
0.59 |
1.14 (1.08-1.21) |
| rs4766921a |
56 & 57 |
12 |
117.835-117.883 |
4.6 x 10-5 |
n.a. |
0.036 |
4.6 x 10-6 |
KIAA1853 |
G |
0.67 |
1.18 (1.09-1.27) |
| rs11951576a |
58 & 59 |
5 |
6.741-6.866 |
2.5 x 10-5 |
0.42 |
0.014 |
46 x 10-6 |
POLS/SRD5A |
C |
0.69 |
1.14 (1.08-1.22) |
| rs6438700 |
60 & 61 |
3 |
123.355-123.454 |
7.4 x 10-5 |
0.23 |
0.020 |
5.5 x 16-6 |
CD86 |
C |
0.82 |
1.18 (1.09-1.27) |
| rs6486730a |
62 & 63 |
12 |
127.830-127.840 |
8.2 x 10-5 |
0.16 |
0.049 |
69 x 10-6 |
SLC15A4 |
G |
0.41 |
1.13 (1.07-1.19) |
| rs4748857a |
64 & 65 |
10 |
23.529-23.654 |
2.2 x 10-4 |
0.68 |
1.3 x 10-4 |
6.9 x 10-6 |
C10orf67 |
C |
0.73 |
1.16 (1.09-1.24) |
| rs3914167a |
66 & 67 |
5 |
39.426-39.454 |
1.8 x 10-4 |
0.24 |
0.0081 |
7.6 x 16-6 |
DAB2/C9 |
G |
0.27 |
1.15 (1.09-1.23) |
| Samples, critical region, P values, risk alleles, and odds ratios are as defined in
the Table 2 legend.a Indicates markers that were imputed, as described in Methods above, from the GWAS
samples and directly genotyped in the replication samples. See Table 5 for expanded
summary statistics. |
Table 5. Additional summary statistics for significant SLE risk loci in the combined
dataset.
| SNP |
Chr |
Critical Region |
Locus |
A1/A2 |
GWAS |
US |
Sweden |
| Allele Frequency |
Allele Frequency |
Allele Frequency |
| OR |
Controls |
Cases |
OR |
Controls |
Cases |
OR |
Controls |
Cases |
| rs7708392 |
5 |
150.419-150.441 |
TNIP1 |
C/G |
1.28 |
0.232 |
0.279 |
1.19 |
0.267 |
0.302 |
1.37 |
0.256 |
0.324 |
| rs6568431 |
6 |
106.675-106.705 |
PRDM1 |
A/C |
1.22 |
0.380 |
0.424 |
1.22 |
0.370 |
0.418 |
1.18 |
0.412 |
0.451 |
| rs849142 |
7 |
28.108-28.223 |
JAZF1 |
T/C |
1.23 |
0.490 |
0.542 |
1.11 |
0.491 |
0.516 |
1.25 |
0.499 |
0.552 |
| rs11755393 |
6 |
34.658-35.090 |
UHRF1BP1 |
G/A |
1.15 |
0.354 |
0.386 |
1.15 |
0.347 |
0.380 |
1.27 |
0.326 |
0.376 |
| rs3024505 |
1 |
205.007-205.016 |
IL10 |
A/G |
1.28 |
0.166 |
0.196 |
1.14 |
0.152 |
0.169 |
1.21 |
0.150 |
0.176 |
| |
|
|
|
|
|
|
|
|
|
|
|
|
|
| rs10911363 |
1 |
181.672-181.816 |
NCF2 |
T/G |
1.21 |
0.274 |
0.307 |
1.27 |
0.273 |
0.323 |
1.05 |
0.275 |
0.293 |
| rs12444486 |
16 |
84.548-84.576 |
IRF8 |
T/C |
1.19 |
0.507 |
0.550 |
1.11 |
0.501 |
0.528 |
1.15 |
0.482 |
0.526 |
| rs11013210 |
10 |
23.181-23.337 |
ARMC3 |
T/C |
1.27 |
0.199 |
0.234 |
1.17 |
0.229 |
0.257 |
1.13 |
0.225 |
0.243 |
| rs1874791 |
1 |
67.563-67.687 |
IL12RB2 |
A/G |
1.25 |
0.188 |
0.225 |
1.09 |
0.188 |
0.202 |
1.15 |
0.146 |
0.163 |
| rs9782955 |
1 |
233.893-234.107 |
LYST |
C/T |
1.25 |
0.737 |
0.777 |
1.12 |
0.744 |
0.766 |
1.15 |
0.765 |
0.788 |
| rs7683537 |
4 |
185.805-185.914 |
MLF1IP |
T/C |
1.23 |
0.811 |
0.843 |
1.13 |
0.832 |
0.848 |
1.34 |
0.834 |
0.872 |
| rs428073 |
12 |
117.706-117.315 |
TAOK3 |
T/C |
1.22 |
0.691 |
0.730 |
1.07 |
0.694 |
0.708 |
1.31 |
0.682 |
0.738 |
| rs497273 |
12 |
119.610-119.891 |
SPPL3 |
G/C |
1.19 |
0.649 |
0.690 |
1.03 |
0.663 |
0.670 |
1.16 |
0.618 |
0.660 |
| |
|
|
|
|
|
|
|
|
|
|
|
|
|
| rs1861525 |
7 |
25.097-25.183 |
CYCS |
G/A |
1.52 |
0.054 |
0.068 |
1.14 |
0.041 |
0.047 |
1.96 |
0.017 |
0.032 |
| rs921916 |
7 |
50.193-50.205 |
IKZF1 |
C/T |
1.20 |
0.187 |
0.211 |
1.08 |
0.189 |
0.200 |
1.27 |
0.152 |
0.185 |
| rs7333671 |
13 |
73.177-73.198 |
KLF12 |
G/A |
1.32 |
0.085 |
0.107 |
1.08 |
0.082 |
0.088 |
1.35 |
0.066 |
0.087 |
| rs12992463 |
2 |
22.312-22.464 |
LOC645949 |
A/C |
1.20 |
0.499 |
0.538 |
1.04 |
0.510 |
0.521 |
1.15 |
0.495 |
0.531 |
| rs12620999 |
2 |
237.616-237.770 |
COPS8 |
C/T |
1.27 |
0.190 |
0.217 |
1.12 |
0.180 |
0.198 |
1.03 |
0.185 |
0.190 |
| rs503425 |
11 |
118.079-118.198 |
DDX6 |
C/T |
1.18 |
0.206 |
0.233 |
1.20 |
0.194 |
0.224 |
1.06 |
0.198 |
0.206 |
| rs10742326 |
11 |
34.733-34.809 |
APIP |
G/A |
1.18 |
0.585 |
0.625 |
1.11 |
0.591 |
0.617 |
1.09 |
0.577 |
0.601 |
| rs4766921 |
12 |
117.835-117.883 |
KIAA1853 |
G/A |
1.22 |
0.668 |
0.707 |
n.a. |
n.a. |
n.a. |
1.15 |
0.662 |
0.689 |
| rs11951576 |
5 |
6.741-6.866 |
POLS/SRD5A |
C/T |
1.22 |
0.686 |
0.727 |
1.04 |
0.691 |
0.700 |
1.19 |
0.669 |
0.701 |
| rs6438700 |
3 |
123.355-123.454 |
CD86 |
C/T |
1.25 |
0.823 |
0.854 |
1.05 |
0.826 |
0.834 |
1.23 |
0.821 |
0.851 |
| rs6486730 |
12 |
127.830-127.840 |
SLC15A4 |
G/A |
1.19 |
0.405 |
0.446 |
1.06 |
0.420 |
0.436 |
1.14 |
0.422 |
0.450 |
| rs4748857 |
10 |
23.529-23.654 |
C10orf67 |
C/T |
1.22 |
0.715 |
0.741 |
1.10 |
0.763 |
0.780 |
1.35 |
0.742 |
0.791 |
| rs3914167 |
5 |
39.426-39.454 |
DAB2/C9 |
G/C |
1.19 |
0.274 |
0.312 |
1.08 |
0.276 |
0.291 |
1.20 |
0.262 |
0.294 |
| Critical Region here is defined as the minimal region containing variants with r2> 0.4 in the HapMap CEU population and is reported in HG18 coordinates. Allele frequencies
calculated from indicated case/control population (GWAS: 1310 case and 7859 control,
US: 1129 case and 2991 control, Sweden 834 case and 1338 control, Combined: 3273 case
and 12,188 control samples). Alleles are reported relative to + reference strand,
and all data refers to Allele 1 (A1). The odds ratio (OR) for each population is listed. |
Table 6. Candidate autoimmune loci with evidence of association to SLE.
| All alleles in the table were either identical to the reported variants or have r2> 0.8 to the reported variant and were the same risk allele with the same direction
of effect. Position (basepairs) is reported in HG18 coordinates. Samples, individual
and combined P values, risk allele frequency and OR are as described in Table 2 legend.
Combined-Corrected P value is the Bonferonni corrected P value for the 35 previously
reported risk loci. Other autoimmunity associations: T1D = Type 1 diabetes, AMD =
age-related macular degeneration MS = multiple sclerosis IBD = inflammatory bowel
disease and PS = psoriasis. See Table 7 for expanded summary statistics and a complete
list of variants tested. a Indicates markers that were imputed, as described in Methods, from the GWAS samples
and directly genotyped in the replication samples. |
Table 7 (part 1). Confirmed autoimmune disease loci.
| SNP |
Chr. |
Position |
Locus |
A1/A2 |
GWAS |
US |
| P value |
OR |
Controls |
Cases |
P value |
OR |
Controls |
Cases |
| rs1990760 |
2 |
162832297 |
IFIH1 |
T/C |
3.2 x10-4 |
1.17 |
0.600 |
0.638 |
0.015 |
1.17 |
0.581 |
0.618 |
| rs641153 |
6 |
32022159 |
CFB |
G/A |
0.0079 |
1.22 |
0.910 |
0.926 |
n.a. |
n.a. |
n.a. |
n.a. |
| rs12708716 |
16 |
11087374 |
CLEC16A |
A/G |
0.15 |
1.06 |
0.635 |
0.651 |
1.3 x 10-4 |
1.29 |
0.616 |
0.674 |
| rs6887695 |
5 |
158755223 |
IL12B |
G/C |
0.014 |
1.12 |
0.683 |
0.706 |
0.040 |
1.11 |
0.676 |
0.699 |
| rs17696736 |
12 |
110971201 |
C12orf30 |
G/A |
0.0081 |
1.12 |
0.449 |
0.474 |
0.16 |
1.01 |
0.459 |
0.462 |
| rs3184504 |
12 |
110368991 |
SH2B3 |
T/C |
0.0036 |
1.13 |
0.503 |
0.530 |
0.12 |
1.04 |
0.499 |
0.508 |
| rs2812378 |
9 |
34700260 |
CCL21 |
G/A |
0.003 |
1.14 |
0.322 |
0.349 |
0.79 |
1.02 |
0.321 |
0.325 |
| rs3761847 |
9 |
122730060 |
TRAF1 |
G/A |
0.034 |
1.10 |
0.411 |
0.432 |
0.20 |
1.12 |
0.416 |
0.444 |
| rs6899540 |
6 |
43866302 |
VEGFA |
C/A |
8.1 x 10-4 |
1.22 |
0.172 |
0.196 |
0.90 |
1.00 |
0.166 |
0.166 |
| rs547154 |
6 |
32018917 |
C2 |
T/G |
n.a. |
n.a. |
n.a. |
n.a. |
0.28 |
0.94 |
0.080 |
0.075 |
| rs12044852 |
1 |
116889302 |
CD58 |
C/A |
0.099 |
1.12 |
0.886 |
0.893 |
0.25 |
1.04 |
0.900 |
0.903 |
| rs2542151 |
18 |
12769947 |
PTPN2 |
G/T |
0.15 |
1.09 |
0.152 |
0.162 |
n.a. |
n.a. |
n.a. |
n.a. |
| rs6897932 |
5 |
35910332 |
IL7R |
C/T |
0.18 |
1.06 |
0.740 |
0.751 |
0.25 |
1.05 |
0.743 |
0.752 |
| rs2230199 |
19 |
6669387 |
C3 |
C/G |
n.a. |
n.a. |
n.a. |
n.a. |
n.a. |
n.a. |
n.a. |
n.a. |
| rs3732378 |
3 |
39282166 |
CX3CR1 |
G/A |
0.13 |
1.09 |
0.833 |
0.843 |
0.063 |
1.12 |
0.829 |
0.845 |
| rs1678542 |
12 |
56254982 |
KIF5A |
C/G |
0.051 |
1.09 |
0.624 |
0.642 |
0.94 |
1.00 |
0.626 |
0.625 |
| rs1136287 |
17 |
1620026 |
SERPINF1 |
T/C |
0.64 |
1.02 |
0.641 |
0.637 |
0.19 |
1.02 |
0.647 |
0.652 |
| rs12247631 |
10 |
52485603 |
PRKG1 |
A/C |
0.32 |
1.56 |
0.004 |
0.004 |
0.051 |
1.48 |
0.005 |
0.007 |
| rs2227306 |
4 |
74825919 |
IL8 |
T/C |
0.036 |
1.11 |
0.407 |
0.426 |
0.42 |
0.98 |
0.415 |
0.409 |
| rs12521868 |
5 |
131812292 |
LOC441108 |
T/G |
0.085 |
1.08 |
0.424 |
0.440 |
0.87 |
0.99 |
0.406 |
0.405 |
| rs10490924 |
10 |
124204438 |
ARMS2 |
G/T |
0.13 |
1.09 |
0.787 |
0.798 |
0.56 |
1.03 |
0.780 |
0.786 |
| rs1793004 |
11 |
20655505 |
NELL1 |
G/C |
0.81 |
1.01 |
0.758 |
0.759 |
0.25 |
1.01 |
0.751 |
0.754 |
| rs10225965 |
7 |
92111514 |
CDK6 |
C/T |
0.033 |
1.12 |
0.802 |
0.817 |
0.61 |
0.91 |
0.820 |
0.805 |
| rs1410996 |
1 |
194963556 |
CFH |
A/G |
0.08 |
1.08 |
0.414 |
0.429 |
0.48 |
0.94 |
0.427 |
0.412 |
| rs3087243 |
2 |
204447164 |
CTLA4 |
G/A |
0.30 |
1.04 |
0.567 |
0.580 |
0.86 |
1.04 |
0.549 |
0.559 |
| rs2292239 |
12 |
54768447 |
ERBB3 |
T/G |
0.72 |
1.02 |
0.329 |
0.329 |
0.11 |
1.10 |
0.330 |
0.351 |
| rs12722489 |
10 |
6142018 |
IL2RA |
C/T |
0.89 |
1.01 |
0.849 |
0.851 |
n.a. |
n.a. |
n.a. |
n.a. |
| rs9332739 |
6 |
32011783 |
C2 |
C/G |
0.92 |
1.01 |
0.048 |
0.050 |
n.a. |
n.a. |
n.a. |
n.a. |
| rs2076756 |
16 |
49314382 |
NOD2 |
G/A |
0.44 |
1.04 |
0.273 |
0.280 |
0.71 |
1.00 |
0.256 |
0.256 |
| rs16853571 |
4 |
41447887 |
PHOX2B |
C/A |
0.51 |
1.06 |
0.065 |
0.067 |
0.79 |
0.99 |
0.065 |
0.065 |
| rs4810485 |
20 |
44181354 |
CD40 |
T/G |
0.37 |
1.04 |
0.264 |
0.274 |
n.a. |
n.a. |
n.a. |
n.a. |
| rs9340799 |
6 |
152205074 |
ESR1 |
A/G |
0.17 |
1.06 |
0.646 |
0.659 |
0.28 |
0.99 |
0.641 |
0.638 |
| rs3793784 |
10 |
50417545 |
ERCC6 |
C/G |
0.54 |
1.03 |
0.402 |
0.408 |
0.42 |
0.97 |
0.406 |
0.400 |
| rs2240340 |
1 |
17535226 |
PADI4 |
C/T |
0.64 |
1.02 |
0.579 |
0.585 |
0.13 |
0.93 |
0.590 |
0.574 |
| rs7517847 |
1 |
67454257 |
IL23R |
T/G |
0.79 |
1.01 |
0.569 |
0.567 |
0.86 |
1.06 |
0.419 |
0.433 |
| Variants in LD with above loci |
| rs1061170 |
1 |
194925860 |
CFH |
T/C |
n.a. |
n.a. |
n.a. |
n.a. |
n.a. |
n.a. |
n.a. |
n.a. |
| rs2234693 |
6 |
152205028 |
ESR1 |
T/C |
n.a. |
n.a. |
n.a. |
n.a. |
0.403 |
0.972 |
0.539 |
0.531 |
| rs1136287 |
17 |
1620026 |
SERPINF1 |
T/C |
0.642 |
1.021 |
0.641 |
0.637 |
0.190 |
1.023 |
0.647 |
0.652 |
| rs3024997 |
6 |
43853085 |
VEGFA |
A/G |
n.a. |
n.a. |
n.a. |
n.a. |
0.977 |
0.964 |
0.327 |
0.319 |
| rs3212227 |
5 |
158675528 |
IL12B |
T/G |
0.000 |
1.220 |
0.792 |
0.821 |
0.407 |
1.059 |
0.784 |
0.794 |
| rs2339898 |
10 |
53379358 |
PRKG1 |
C/T |
0.626 |
1.022 |
0.338 |
0.347 |
0.190 |
1.051 |
0.338 |
0.349 |
| rs42041 |
7 |
92084680 |
CDK6 |
G/C |
0.570 |
1.028 |
0.267 |
0.269 |
0.790 |
0.966 |
0.258 |
0.251 |
Table 7 (part 2). Confirmed autoimmune disease loci.
| SNP |
Chr. |
Position |
Locus |
A1/A2 |
Sweden |
Replication |
Combined |
| P value |
OR |
Controls |
Cases |
P value |
P value |
| rs1990760 |
2 |
162832297 |
IFIH1 |
T/C |
0.0039 |
1.17 |
0.609 |
0.645 |
2.6 x 10-4 |
3.3 x 10-7 |
| rs641153 |
6 |
32022159 |
CFB |
G/A |
0.0011 |
1.47 |
0.915 |
0.939 |
0.0011 |
1.4 x 10-4 |
| rs12708716 |
16 |
11087374 |
CLEC16A |
A/G |
0.062 |
1.14 |
0.694 |
0.725 |
2.8 x 10-5 |
1.6 x 10-6 |
| rs6887695 |
5 |
158755223 |
IL12B |
G/C |
0.030 |
1.16 |
0.664 |
0.700 |
0.0034 |
1.7 x 10-6 |
| rs17696736 |
12 |
110971201 |
C12orf30 |
G/A |
0.019 |
1.16 |
0.437 |
0.474 |
0.01186 |
2.7 x 10-4 |
| rs3184504 |
12 |
110368991 |
SH2B3 |
T/C |
0.19 |
1.09 |
0.487 |
0.508 |
0.042 |
4.0 x 10-6 |
| rs2812378 |
9 |
34700260 |
CCL21 |
G/A |
0.061 |
1.14 |
0.333 |
0.354 |
0.19 |
1.8 x 10-4 |
| rs3761847 |
9 |
122730060 |
TRAF1 |
G/A |
0.12 |
1.08 |
0.456 |
0.475 |
0.053 |
0.0041 |
| rs6899540 |
6 |
43866302 |
VEGFA |
C/A |
0.68 |
1.04 |
0.176 |
0.180 |
0.73 |
0.0051 |
| rs547154 |
6 |
32018917 |
C2 |
T/G |
0.0012 |
0.65 |
0.085 |
0.057 |
0.011 |
0.011 |
| rs12044852 |
1 |
116889302 |
CD58 |
C/A |
0.33 |
1.10 |
0.872 |
0.883 |
0.13 |
0.026 |
| rs2542151 |
18 |
12769947 |
PTPN2 |
G/T |
0.077 |
1.16 |
0.154 |
0.178 |
0.077 |
0.037 |
| rs6897932 |
5 |
35910332 |
IL7R |
C/T |
0.23 |
1.06 |
0.712 |
0.725 |
0.10 |
0.038 |
| rs2230199 |
19 |
6669387 |
C3 |
C/G |
0.081 |
0.85 |
0.205 |
0.179 |
0.081 |
0.081 |
| rs3732378 |
3 |
39282166 |
CX3CR1 |
G/A |
0.24 |
0.90 |
0.844 |
0.829 |
0.42 |
0.093 |
| rs1678542 |
12 |
56254982 |
KIF5A |
C/G |
0.58 |
1.04 |
0.581 |
0.589 |
0.80 |
0.095 |
| rs1136287 |
17 |
1620026 |
SERPINF1 |
T/C |
0.16 |
1.05 |
0.637 |
0.648 |
0.059 |
0.12 |
| rs12247631 |
10 |
52485603 |
PRKG1 |
A/C |
0.27 |
n.a. |
0.000 |
0.001 |
0.25 |
0.14 |
| rs2227306 |
4 |
74825919 |
IL8 |
T/C |
0.57 |
1.04 |
0.461 |
0.463 |
0.75 |
0.16 |
| rs12521868 |
5 |
131812292 |
LOC441108 |
T/G |
0.65 |
1.03 |
0.418 |
0.415 |
0.90 |
0.16 |
| rs10490924 |
10 |
124204438 |
ARMS2 |
G/T |
0.58 |
0.96 |
0.768 |
0.760 |
0.89 |
0.21 |
| rs1793004 |
11 |
20655505 |
NELL1 |
G/C |
0.24 |
1.09 |
0.725 |
0.746 |
0.10 |
0.22 |
| rs10225965 |
7 |
92111514 |
CDK6 |
C/T |
0.69 |
0.97 |
0.797 |
0.787 |
0.52 |
0.22 |
| rs1410996 |
1 |
194963556 |
CFH |
A/G |
0.57 |
1.04 |
0.408 |
0.411 |
0.81 |
0.23 |
| rs3087243 |
2 |
204447164 |
CTLA4 |
G/A |
0.43 |
1.08 |
0.614 |
0.630 |
0.59 |
0.25 |
| rs2292239 |
12 |
54768447 |
ERBB3 |
T/G |
0.96 |
1.00 |
0.330 |
0.324 |
0.19 |
0.27 |
| rs12722489 |
10 |
6142018 |
IL2RA |
C/T |
0.042 |
1.19 |
0.808 |
0.835 |
0.042 |
0.31 |
| rs9332739 |
6 |
32011783 |
C2 |
C/G |
0.037 |
1.36 |
0.044 |
0.059 |
0.037 |
0.31 |
| rs2076756 |
16 |
49314382 |
NOD2 |
G/A |
0.78 |
1.01 |
0.200 |
0.203 |
0.64 |
0.37 |
| rs16853571 |
4 |
41447887 |
PHOX2B |
C/A |
0.33 |
1.20 |
0.056 |
0.067 |
0.73 |
0.47 |
| rs4810485 |
20 |
44181354 |
CD40 |
T/G |
0.85 |
0.99 |
0.246 |
0.249 |
0.85 |
0.47 |
| rs9340799 |
6 |
152205074 |
ESR1 |
A/G |
0.60 |
1.04 |
0.680 |
0.694 |
0.57 |
0.49 |
| rs3793784 |
10 |
50417545 |
ERCC6 |
C/G |
0.23 |
1.08 |
0.385 |
0.395 |
0.96 |
0.61 |
| rs2240340 |
1 |
17535226 |
PADI4 |
C/T |
0.91 |
0.99 |
0.594 |
0.585 |
0.19 |
0.64 |
| rs7517847 |
1 |
67454257 |
IL23R |
T/G |
0.33 |
0.98 |
0.531 |
0.525 |
0.48 |
0.80 |
| Variants in LD with above loci |
| rs1061170 |
1 |
194925860 |
CFH |
T/C |
0.339 |
0.914 |
0.404 |
0.382 |
0.339 |
0.339 |
| rs2234693 |
6 |
152205028 |
ESR1 |
T/C |
0.719 |
0.993 |
0.556 |
0.555 |
0.375 |
0.375 |
| rs1136287 |
17 |
1620026 |
SERPINF1 |
T/C |
0.159 |
1.051 |
0.636 |
0.648 |
0.059 |
0.118 |
| rs3024997 |
6 |
43853085 |
VEGFA |
A/G |
0.662 |
1.006 |
0.293 |
0.294 |
0.847 |
0.847 |
| rs3212227 |
5 |
158675528 |
IL12B |
T/G |
0.636 |
1.042 |
0.810 |
0.817 |
0.342 |
4 x10-4 |
| rs2339898 |
10 |
53379358 |
PRKG1 |
C/T |
0.789 |
1.010 |
0.315 |
0.309 |
0.366 |
0.341 |
| rs42041 |
7 |
92084680 |
CDK6 |
G/C |
0.049 |
0.913 |
0.268 |
0.239 |
0.170 |
0.661 |
| Position (basepairs) is reported in HG18 coordinates. P values calculated from indicated
case/control population (GWAS: 1310 case and 7859 control, US: 1129 case and 2991
control, Sweden 834 case and 1338 control, Combined: 3273 case and 12,188 control
samples), and Combined P value calculated as described in the Methods above. The Replication
P value refers to the meta P values for the combined U.S. and Swedish samples. Alleles
are reported relative to + reference strand, and all data refers to Allele 1 (A1).
The odds ratio (OR) for each population is listed. |
Example 2
Re-sequencing and Identification of the Causal Allele for BLK
[0172] As discussed above,
BLK has been identified as a risk locus associated with SLE that achieves genome-wide
significance (P < 5 x 10
-8 ). To further characterize the genetic basis of this association and to identify
causal allele(s), we carried out re-sequencing studies of the
BLK locus and reporter gene expression assays as described below.
[0173] For the re-sequencing study, all 13 exons and 2.5 kb of upstream promoter sequence
of the
BLK locus in DNA isolated from 192 patients in the Autoimmune Biomarkers Collaborative
Network (ABCoN) (
Bauer et al., PLoS medicine 3(12):e491 (2006)), an NIH/NIAMS-funded repository, and 96 control individuals in New York Cancer
Project (NYCP) (
Mitchell et al., J. Urban Health 81:301-10 (2004)) was re-sequenced. Genomic DNA was whole-genome amplified according to the manufacturer's
protocol (Qiagen, Valencia, CA., Cat. No. 150045) prior to sequencing.
[0174] The re-sequencing results showed that 17 mutations (10 non-synonymous, 7 synonymous)
were found in the coding region of the
BLK gene (Table 8). None of these mutations showed significantly higher frequencies in
cases than in the controls. The overall frequency of non-synonymous mutation was not
significantly higher in cases (14/191) than in controls (7/96).
[0175] In addition, multiple common variations were identified in the non-coding region
of
BLK (shown in Table 9). Three SNPs (rs4840568, rs1382568 [a tri-allelic SNP (A/C/G);
C allele was previously identified as the risk allele], and rs922483 (SEQ ID NO: 13))
showed association with the loci previously identified from GWAS (
Hom et al., N Engl J Med 358:900-09 (2008)) (rs13277113, odds ratio, 1.39, P=1x10
-10) with r
2 > 0.5. Figure 4 shows a Linkage Disequilibrium (LD) block (shown in r
2) within the promoter region of
BLK that was generated using Haploview (software freely available at the URL www(dot)broadinstitute(dot)org(slash)haploview(slash)haploview;
see Barrett J.C., et al., Bioinformatics 21:263-65 (2005). The top portion of the figure shows a schematic diagram of the promoter region
of
BLK with the relative location of the identified SNPs indicated. The r
2 value between the listed SNPs is shown in the boxes. The strength of LD between two
SNPs is indicated by shading with darker shading showing higher r
2 values. The loci identified from GWAS (rs13277113) and the three SNPs identified
from re-sequencing (rs4840568, rs1382568, and rs922483 (SEQ ID NO: 13)) are indicated
in black border at the top of the figure.
[0176] This re-sequencing study did not reveal any common variation in the coding region
of
BLK. Three common variants (rs4840568, rs1382568, and rs922483 (SEQ ID NO: 13)) at the
promoter region, however, were identified as potential causal allele(s) of the biological
effects of
BLK associated with increased risk of SLE. Each of these variations was employed in luciferase
reporter assays described in detail below to further characterize the association.
Table 8. Mutations in the
BLK coding region
| Exon |
Amino Acid Change (Protein: NP_001706.2) |
Nucleotide Change (mRNA: NM_001715.2) |
dbSNP |
dbSNP |
Zygosity |
Non-synonymous |
Cases (n=191) |
Controls (n=96) |
| 2 |
39P>L |
697_C>T |
N/A |
N/A |
Heterozygous |
Yes |
1 |
0 |
| 4 |
71A>T |
792_G>A |
rs55758736 |
N/A |
Heterozygous |
Yes |
6 |
4 |
| 4 |
75R>R |
806_G>T |
N/A |
N/A |
Heterozygous |
No |
1 |
0 |
| 4 |
86Q>Q |
839_G>A |
rs56185487 |
N/A |
Heterozygous |
No |
2 |
0 |
| 6 |
131R>W |
972_C>T |
N/A |
N/A |
Heterozygous |
Yes |
2 |
0 |
| 6 |
137Q>Q |
992_G>A |
N/A |
N/A |
Heterozygous |
No |
0 |
1 |
| 7 |
180R>H |
1120_G>A |
N/A |
N/A |
Heterozygous |
Yes |
1 |
0 |
| 7 |
190S>S |
1151_C>T |
N/A |
N/A |
Homozygous |
No |
0 |
1 |
| 8 |
237P>P |
1292_C>T |
N/A |
N/A |
Heterozygous |
No |
1 |
1 |
| 8 |
238R>Q |
1294_G>A |
N/A |
N/A |
Heterozygous |
Yes |
1 |
0 |
| 10 |
325K>T |
1555_A>C |
N/A |
N/A |
Heterozygous |
Yes |
2 |
0 |
| 10 |
327D>V |
1561_A>T |
N/A |
N/A |
Heterozygous |
Yes |
0 |
1 |
| 10 |
331R>I |
1573_G>T |
N/A |
N/A |
Heterozygous |
Yes |
1 |
0 |
| 11 |
359R>C |
1656_C>T |
N/A |
N/A |
Heterozygous |
Yes |
0 |
1 |
| 12 |
425L>P |
1855_T>C |
N/A |
N/A |
Heterozygous |
Yes |
0 |
1 |
| 13 |
464L>L |
1973_G>A |
N/A |
N/A |
Heterozygous |
No |
1 |
0 |
| 13 |
474R>R |
2003_C>T |
N/A |
N/A |
Heterozygous |
No |
2 |
0 |
| |
|
|
|
|
|
|
|
|
| |
|
|
|
|
|
Non-synonymous mutation frequency |
14/191 |
7/96 |

[0177] Luciferase reporter gene assays were performed to investigate the effect of the three
SNPs, rs4840568, rs1382568, and rs922483 (SEQ ID NO: 13) on
BLK-mediated gene expression. An upstream sequence (-2256 to +55 bp) of
BLK was amplified using genomic DNA from individuals that carry risk or non-risk haplotype.
Each PCR product was cloned into pCR2.1-TOPO vector (Invitrogen, Carlsbad, CA; Cat.
No. K4500-01) and then sub-cloned into pGL4 luciferase reporter vector (Promega, Madison,
WI; Cat. No. E6651). A construct that carries non-risk haplotype was used as template
for mutagenesis (Stratagene, La Jolla, CA; Cat. No. 10519-5) to create various haplotypes.
[0178] The primers used in PCR amplification are as follows: forward: CCACCTCTCTTCCGCCTTTCTCAT
(SEQ ID NO.: 1); reverse:
TTTCATGGCTTGTGGCTTTCTGCC (SEQ ID NO.: 2). The primers used in mutagenesis are listed
in Table 10 below.
Table 10. List of mutagenesis primers.
| Primer |
Sequence |
| rs4840568_G>A forward |
GATCCAAGACTATGAAGAGAGAAGAGAGAGCCCAC (SEQ ID NO.: 3) |
| rs4840568_G>A reverse |
GTGGGCTCTCTCTTCTCTCTTCATAGTCTTGGATC (SEQ ID NO.: 4) |
| rs1382568_A>C forward |
CCAGACACCACTCACCCCTCTAGATGTTGGGAT (SEQ ID NO.: 5) |
| rs1382568_A>C reverse |
ATCCCAACATCTAGAGGGGTGAGTGGTGTCTGG (SEQ ID NO.: 6) |
| rs1382568_A>G forward |
CCAGACACCACTCACCGCTCTAGATGTTGGGAT (SEQ ID NO.: 7) |
| rs1382568_A>G reverse |
ATCCCAACATCTAGAGCGGTGAGTGGTGTCTGG (SEQ ID NO.: 8) |
| rs1382568_G>A forward |
CCAGACACCACTCACCACTCTAGATGTTGGGAT (SEQ ID NO.: 9) |
| rs1382568_G>A reverse |
ATCCCAACATCTAGAGTGGTGAGTGGTGTCTGG (SEQ ID NO.: 10) |
| rs922483_C>T (SEQ ID NO: 13) forward |
CGGGGGTGCTGCTACCTCTGTCTGC (SEQ ID NO.: 11) |
| rs922483_C>T (SEQ ID NO: 13) reverse |
GCAGACAGAGGTAGCAGCACCCCCG (SEQ ID NO.: 12) |
[0179] Renilla luciferase control reporter vector pRL-TK (Promega, Madison, WI; Cat. No.
E2241) was used for normalization. The cell line BJAB (a continuous lymphoid cell
line with characteristics of B cells (bone marrow-derived), lacking the Epstein-Barr
virus genome and derived from three human lymphomas;
Klein et al., Proc. Natl. Acad. Sci. USA 71:3283-86 (1974)) or the Daudi cell line (American Type Culture Collection (ATCC) cat. No. CCL-213)
was used for transfections. For each transfection, 5x10
6 cells were transfected with 5 µg of DNA of each vector using an Amaxa® Nucleofector®
device (Lonza, Walkersville Inc., Walkersville, MD (Lonza Group Ltd., Switzerland);
Cat. No. AAD-1001). Cell line Nucleofector® Kit L (Lonza, Cat. No. VCA-1005) was used
for Daudi cells with Nucleofector® device Program A-030. Cell line Nucleofector® Kit
V (Lonza, Cat. No. VCA-1005) was used for BJAB cells with Nucleofector® device Program
T-020. All transfections were carried out either in duplicate or triplicate. Cells
were incubated at 37°C for 16 hours following transfection. Following that incubation,
cells were harvested and luciferase activity was measured using the Dual-Luciferase®
Reporter Assay System (Promega, Madison, WI; Cat. No. E1960) according to the manufacturer's
instructions.
[0180] The effects of each of the SNPs rs4840568, rs1382568, and rs922483 (SEQ ID NO: 13)
on
BLK-mediated gene expression as measured in the luciferase reporter assay system described
above are shown in Figure 5. The different haplotypes generated by mutagenesis were
compared with non-risk (wild-type) haplotype 22-GAC (stippled bar in each of Figs.
5A-F) and risk haplotype 22-ACT (hatched bar in each of Figs. 5A-F).
[0181] Figs. 5A and 5B show that SNP rs922483 (C>T) (SEQ ID NO: 13) led to a significant
effect on
BLK-mediated gene expression in both BJAB (Fig. 5A) and Daudi cells (Fig. 5B). Compared
to non-risk haplotype 22-GAC (stippled bar), haplotype 22-GAT showed reduced transcriptional
activity by almost 50% in both cell lines. Haplotypes with T allele showed consistently
lower activity than those with C alleles. Five independent experiments were done in
BJAB cells and six independent experiments were done in Daudi cells. Data shown represent
the mean +/- standard error of the mean (s.e.m.) in triplicate assays; *p<0.05, **p<0.01,
***p<0.001 (t-test).
[0182] Figs. 5C and 5D show that SNP rsl382568 (A>C/G>C) did not result in any significant
effect on
BLK-mediated expression in either cell line. Both haplotypes 22-GCC and 22-GGC showed
similar level of luciferase activity compared to non-risk haplotype 22-GAC. Five independent
experiments were done in BJAB cells and six independent experiments were done in Daudi
cells. Data shown represent the mean +/- s.e.m. in triplicate assays; *p<0.05, **p<0.01,
***p<0.001, ns=not significant (t-test).
[0183] Figs. 5E and 5F show that SNP rs4840568 (G>A) did not result in a significant effect
on
BLK-mediated expression in BJAB cells or Daudi cells. The difference between haplotype
22-AAC and non-risk haplotype 22-GAC (stippled bar) was not statistically significant
in BJAB cells (Fig. 5E), but it was statistically significant in Daudi cells (Fig.
5F). The likelihood of A allele being a causal allele is greatly reduced given the
fact that haplotype 22-ACC did not show any defect in luciferase activity compared
to the non-risk haplotype-GAC (Fig. 5F). Data shown represent the mean +/- s.e.m.
in triplicate assays; *p<0.05, **p<0.01, ***p<0.001, ns=not significant (t-test).
[0184] It was shown previously that the (GT) repeat in the region upstream of the
BLK promoter can function as an enhancer of
BLK gene expression (
Lin et al., J Biol Chem 270: 25968 (1995)). Therefore, we also tested whether the length of (GT) repeat can affect the transcriptional
activity of the
BLK promoter. To perform these experiments, genomic DNA samples from individuals that
carry both 18 (GT) repeats (SEQ ID NO: 14) or 22 (GT) repeats (SEQ ID NO: 15) were
selected for cloning using the strategy described above. Final vectors were sequenced
to confirm they contained the correct length of (GT) repeats. As shown in Fig. 6,
haplotypes with 18 (GT) repeats (SEQ ID NO: 14) displayed a similar level of transcriptional
activity compared to those with 22 (GT) repeats (SEQ ID NO: 15) in the luciferase
reporter assay. Data shown represent the mean +/- s.e.m in duplicate assays, ns=not
significant (t-test).
[0185] In summary, these results of the
BLK re-sequencing efforts and the results of the luciferase reporter gene assays indicate
that SNP rs922483 (C>T) (SEQ ID NO: 13) is the causal allele that results in decreased
transcription of
BLK, a biological effect which is associated with an increased risk of SLE. In addition,
the results showed that the T allele of rs922483 (SEQ ID NO: 13) reduced the level
of
BLK-mediated gene expression by 50%.
[0186] It is interesting to note that rs922483 (SEQ ID NO: 13) resides in an evolutionarily
conserved region in the first exon of BLK and within a possible human transcription
initiation site. A consensus sequence for the human Inr motif has been identified
as YYANWYY (IUPAC nucleotide code).
Juven-Gershon et al. Dev. Biol. 339:225-229 (2010). In the SNP rs922483 (SEQ ID NO: 13), the second base in the Inr region is altered
relative to the consensus motif. Accordingly, the SLE risk haplotype Inr sequence
is CTACCTC while the "wild type" haplotype Inr sequence is CCACCTC. We suggest that
the modification of the second base in the conserved Inr motif might alter the affinity
of the TFIID transcription complex resulting in the observed difference in transcription
described above.
SEQUENCE LISTING
[0187]
<110> GENENTECH, INC. et al.
<120> METHODS FOR TREATING, DIAGNOSING, AND MONITORING LUPUS
<130> P4325R1-WO
<140>
<141>
<150> 61/278,510
<151> 2009-10-07
<160> 15
<170> PatentIn version 3.5
<210> 1
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic primer
<400> 1
ccacctctct tccgcctttc tcat 24
<210> 2
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic primer
<400> 2
tttcatggct tgtggctttc tgcc 24
<210> 3
<211> 35
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic primer
<400> 3
gatccaagac tatgaagaga gaagagagag cccac 35
<210> 4
<211> 35
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic primer
<400> 4
gtgggctctc tcttctctct tcatagtctt ggatc 35
<210> 5
<211> 33
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic primer
<400> 5
ccagacacca ctcacccctc tagatgttgg gat 33
<210> 6
<211> 33
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic primer
<400> 6
atcccaacat ctagaggggt gagtggtgtc tgg 33
<210> 7
<211> 33
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic primer
<400> 7
ccagacacca ctcaccgctc tagatgttgg gat 33
<210> 8
<211> 33
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic primer
<400> 8
atcccaacat ctagagcggt gagtggtgtc tgg 33
<210> 9
<211> 33
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic primer
<400> 9
ccagacacca ctcaccactc tagatgttgg gat 33
<210> 10
<211> 33
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic primer
<400> 10
atcccaacat ctagagtggt gagtggtgtc tgg 33
<210> 11
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic primer
<400> 11
cgggggtgct gctacctctg tctgc 25
<210> 12
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic primer
<400> 12
gcagacagag gtagcagcac ccccg 25
<210> 13
<211> 52
<212> DNA
<213> Homo sapiens
<400> 13
ctctgatcgc agaccggggg tgctgcyacc tctgtctgct gccggcagaa ag 52
<210> 14
<211> 36
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic oligonucleotide
<400> 14
gtgtgtgtgt gtgtgtgtgt gtgtgtgtgt gtgtgt 36
<210> 15
<211> 44
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic oligonucleotide
<400> 15
gtgtgtgtgt gtgtgtgtgt gtgtgtgtgt gtgtgtgtgt gtgt 44