BACKGROUND OF THE INVENTION
[0001] There are approximately 25,600 new cases of thyroid carcinoma diagnosed in the United
States each year, and 1,400 patients will die of the disease. About 75% of all thyroid
cancers belong to the papillary thyroid carcinoma type. The rest consist of 10% follicular
carcinoma, 5% to 9% medullary thyroid cancer, 1% to 2% anaplastic cancer, 1% to 3%
lymphoma, and less than 1% sarcoma and other rare tumors. Usually a lump (nodule)
in the thyroid is the first sign of thyroid cancer. There are 10 to 18 million people
in US with a single thyroid nodule, and approximately 490,000 become clinically apparent
each year. Fortunately only about 5% of these nodules are cancerous.
[0002] The commonly used method for thyroid cancer diagnosis is fine needle aspiration (FNA)
biopsy. FNA samples are examined cytologically to determine whether the nodules are
benign or cancerous. The sensitivity and specificity of FNA range from 68% to 98%,
and 72% to 100% respectively, depending on institutions and doctors. Unfortunately,
in 25% of the cases the specimens are either inadequate for diagnosis or indeterminable
by cytology. In current medical practice, patients with indeterminate results are
sent to surgery, with consequence that only 25% have cancer and 75% end up with unnecessary
surgery. A molecular assay with high sensitivity and a better specificity (higher
than 25%) would greatly improve current diagnostic accuracy of thyroid cancer, and
omit unnecessary surgery for non-cancerous patients.
[0003] Comparative genomic hybridization (CGH), serial analysis of gene expression (SAGE),
and DNA microarray have been used to identify genetic events occurring in thyroid
cancers such as loss of heterozygosity, up and down gene regulation, and genetic rearrangements.
PAX8 and PPARγ genetic rearrangement event has been demonstrated to be associated
with follicular thyroid cancer (FTC). Rearrangement of the ret proto-oncogene is related
to papillary thyroid cancer (PTC). Down-regulation of thyroid peroxidase (TPO) gene
is observed in both FTC and PTC. Galectin-3 was reported to be a candidate marker
to differentiate malignant thyroid neoplasms from benign lesions. However, there are
other studies demonstrating that Galectin-3 is not a cancer-specific marker. Many
genes purported to be useful in thyroid cancer diagnosis lack the sensitivity and
specificity required for an accurate molecular assay.
SUMMARY OF THE INVENTION
[0004] The present invention encompasses methods of diagnosing thyroid cancer by obtaining
a biological sample from a patient; and measuring the expression levels in the sample
of genes selected from the group consisting of those encoding mRNA: corresponding
to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding to SEQ ID NOs: 199, 207,
255 and 354; or recognized specifically by the probe sets selected from the group
consisting of psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted
in Table 25; and/or recognized specifically by the probe sets selected from the group
consisting of psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted
in Table 25; where the gene expression levels above or below pre-determined cut-off
levels are indicative of thyroid cancer.
[0005] The present invention encompasses methods of differentiating between thyroid carcinoma
and benign thyroid diseases by obtaining a sample from a patient; and measuring the
expression levels in the sample of genes selected from the group consisting of those
encoding mRNA: corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding
to SEQ ID NOs: 199, 207, 255 and 354; or recognized specifically by the probe sets
selected from the group consisting of psids corresponding to SEQ ID NOs: 36, 53, 73,
211 and 242 as depicted in Table 25; and/or recognized specifically by the probe sets
selected from the group consisting of psids corresponding to SEQ ID NOs: 199, 207,
255 and 354 as depicted in Table 25; where the gene expression levels above or below
pre-determined cut-off levels are indicative of thyroid carcinoma.
[0006] The present invention encompasses methods of testing indeterminate thyroid fine needle
aspirate (FNA) thyroid nodule samples by: obtaining a sample from a patient; and measuring
the expression levels in the sample of genes selected from the group consisting of
those encoding mRNA: corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or
corresponding to SEQ ID NOs: 199, 207, 255 and 354; or recognized specifically by
the probe sets selected from the group consisting of psids corresponding to SEQ ID
NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or recognized specifically
by the probe sets selected from the group consisting of psids corresponding to SEQ
ID NOs: 199, 207, 255 and 354 as depicted in Table 25; where the gene expression levels
above or below pre-determined cut-off levels are indicative of thyroid cancer.
[0007] The present invention encompasses methods of determining thyroid cancer patient treatment
protocol by: obtaining a biological sample from a thyroid cancer patient; and measuring
the expression levels in the sample of genes selected from the group consisting of
those encoding mRNA: corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or
corresponding to SEQ ID NOs: 199, 207, 255 and 354; or recognized specifically by
the probe sets selected from the group consisting of psids corresponding to SEQ ID
NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or recognized specifically
by the probe sets selected from the group consisting of psids corresponding to SEQ
ID NOs: 199, 207, 255 and 354 as depicted in Table 25; where the gene expression levels
above or below pre-determined cut-off levels are sufficiently indicative of cancer
to enable a physician to determine the type of surgery and/or therapy recommend to
treat the disease.
[0008] The present invention encompasses methods of treating a thyroid cancer patient by
obtaining a biological sample from a thyroid cancer patient; and measuring the expression
levels in the sample of genes selected from the group consisting of those encoding
mRNA: corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding to
SEQ ID NOs: 199, 207, 255 and 354; or recognized specifically by the probe sets selected
from the group consisting of psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and
242 as depicted in Table 25; and/or recognized specifically by the probe sets selected
from the group consisting of psids corresponding to SEQ ID NOs: 199, 207, 255 and
354 as depicted in Table 25; where the gene expression levels above or below pre-determined
cut-off levels are indicative of cancer; and treating the patient with a thyroidectomy
if they are cancer positive.
[0009] The present invention encompasses methods of cross validating a gene expression profile
for thyroid carcinoma patients by: a. obtaining gene expression data from a statistically
significant number of patient biological samples; b. randomizing sample order; c.
setting aside data from about 10% - 50% of samples; d. computing, for the remaining
samples, for factor of interest on all variables and selecting variables that meet
a p-value cutoff (p); e. selecting variables that fit a prediction model using a forward
search and evaluating the training error until it hits a predetermined error rate;
f. testing the prediction model on the left-out 10-50% of samples; g. repeating steps
c., -g. with a new set of samples removed; and h. continuing steps c) -g) until 100%
of samples have been tested and record classification performance.
[0010] The present invention encompasses methods of independently validating a gene expression
profile and gene profiles obtained thereby for thyroid carcinoma patients by obtaining
gene expression data from a statistically significant number of patient biological
samples; normalizing the source variabilities in the gene expression data; computing
for factor of interest on all variables that were selected previously; and testing
the prediction model on the sample and record classification performance.
[0011] The present invention encompasses a method of generating a posterior probability
score to enable diagnosis of thyroid carcinoma patients by: obtaining gene expression
data from a statistically significant number of patient biological samples; applying
linear discrimination analysis to the data to obtain selected genes; and applying
weighted expression levels to the selected genes with discriminate function factor
to obtain a prediction model that can be applied as a posterior probability score.
[0012] The present invention encompasses methods of generating a thyroid carcinoma prognostic
patient report and reports obtained thereby, by obtaining a biological sample from
the patient; measuring gene expression of the sample; applying a posterior probability
thereto; and using the results obtained thereby to generate the report.
[0013] The present invention encompasses compositions containing at least one probe set
selected from the group consisting of: SEQ ID NOs: 36, 53, 73, 211 and 242; and/or
SEQ ID NOs: 199, 207, 255 and 354; or the psids corresponding to SEQ ID NOs: 36, 53,
73, 211 and 242; and/or SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25.
[0014] The present invention encompasses kits for conducting an assay to determine thyroid
carcinoma diagnosis in a biological sample containing: materials for detecting isolated
nucleic acid sequences, their complements, or portions thereof of a combination of
genes selected from the group consisting of those encoding mRNA: corresponding to
SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding to SEQ ID NOs: 199, 207,
255 and 354; or recognized specifically by the probe sets selected from the group
consisting of psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted
in Table 25; and/or recognized specifically by the probe sets selected from the group
consisting of psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted
in Table 25.
[0015] The present invention encompasses articles for assessing thyroid carcinoma status
containing: materials for detecting isolated nucleic acid sequences, their complements,
or portions thereof of a combination of genes selected from the group consisting of
those encoding mRNA: corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or
corresponding to SEQ ID NOs: 199, 207, 255 and 354; or recognized specifically by
the probe sets selected from the group consisting of psids corresponding to SEQ ID
NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or recognized specifically
by the probe sets selected from the group consisting of psids corresponding to SEQ
ID NOs: 199, 207, 255 and 354 as depicted in Table 25.
[0016] The present invention encompasses microarrays or gene chips for performing the methods
provided herein.
[0017] The present invention encompasses diagnostic/prognostic portfolios containing isolated
nucleic acid sequences, their complements, or portions thereof of a combination of
genes selected from the group consisting of those encoding mRNA: corresponding to
SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding to SEQ ID NOs: 199, 207,
255 and 354; or recognized specifically by the probe sets selected from the group
consisting of psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted
in Table 25; and/or recognized specifically by the probe sets selected from the group
consisting of psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted
in Table 25 where the combination is sufficient to characterize thyroid carcinoma
status or risk of relapse in a biological sample.
BRIEF DESCRIPTION OF THE DRAWINGS
[0018]
Figure 1 is an ROC curve of the LOOCV of the 4-gene signature in 98 training samples.
Figure 2 is an ROC curve of the 5-gene signature in 98 training samples.
Figure 3a is an ROC curve of the 4-gene signature in 74 independent validation samples;
3b is an ROC curve of the 5-gene signature in 74 independent validation samples.
Figure 4a is an ROC curve of the 4-gene signature that is normalized to the three-thyroid
control genes; 4b is an ROC curve of the 5-gene signature that is normalized to the
three-thyroid control genes.
Figure 5a is an ROC curve of the 4-gene signature with one-round amplification in
47 thyroid samples; 5b is an ROC curve of the 4-gene signature with two-round amplification
in 47 thyroid samples; 5c is an ROC curve of the 5-gene signature with one-round amplification
in 47 thyroid samples; 5d is an ROC curve of the 5-gene signature with two-round amplification
in 47 thyroid samples.
Figures 6a and 6b depict the ROC curves for cross validation with the 83 independent
fresh frozen thyroid samples.
Figures 7a and 7b depict the ROC curves for signature validation with the 47 fine
needle aspirate (FNA) thyroid samples.
Figures 8a and 8b depict the ROC curves for signature performance in 28 paired fresh
frozen and FNA thyroid samples.
DETAILED DESCRIPTION
[0019] In this study the goal was to identify signatures that can be used in assays such
as DNA chip-based assay to differentiate thyroid carcinomas from benign thyroid diseases.
31 primary papillary thyroid tumors, 21 follicular thyroid cancers, 33 follicular
adenoma samples, and 13 benign thyroid diseases were analyzed by using the Affymetrix
human U133A Gene Chip. Comparison of gene expression profiles between thyroid cancers
and benign tissues has enabled us to identify two signatures: a 5-gene signature identified
by percentile analysis and manual selection, and a 4-gene signature selected by Linear
Discrimination Analysis (LDA) approach. These two signatures have the performance
of sensitivity/specificity 92%/70% and 92%/61%, respectively, and have been validated
in 74 independent thyroid samples. The results presented herein demonstrate that these
candidate signatures facilitate the diagnosis of thyroid cancers with better sensitivity
and specificity than currently available diagnostic procedures. These two signatures
are suitable for use in testing indeterminate FNA samples.
[0020] By performing gene profiling on 98 representative thyroid benign and tumor samples
on Affymetrix U133a chips, we have selected two gene signatures, a 5-gene signature
and a 4-gene signature, for thyroid FNA molecular assay. Signatures were selected
to achieve the best sensitivity of the assay at a close to 95%. Except for fibronectin
and thyroid peroxidase, the other seven genes from the two signatures have not been
implicated previously in thyroid tumorogenesis. Both signatures have been validated
with an independent 74 thyroid samples, and achieved performance that is equivalent
to the one in the 98 training samples. The performances of the two gene signatures
are 92% sensitivity and 70%/61% specificity, respectively. When these two signatures
are normalized to the specific thyroid control genes the performances are improved
relative to the ones of the non-normalized signatures. Furthermore, the signatures
performed equivalently with two different target preparations, namely one-round amplification
and two-round amplifications. This validation is extremely important for thyroid assays
that are FNA samples, which usually contain limited numbers of thyroid cells.
[0021] The mere presence or absence of particular nucleic acid sequences in a tissue sample
has only rarely been found to have diagnostic or prognostic value. Information about
the expression of various proteins, peptides or mRNA, on the other hand, is increasingly
viewed as important. The mere presence of nucleic acid sequences having the potential
to express proteins, peptides, or mRNA (such sequences referred to as "genes") within
the genome by itself is not determinative of whether a protein, peptide, or mRNA is
expressed in a given cell. Whether or not a given gene capable of expressing proteins,
peptides, or mRNA does so and to what extent such expression occurs, if at all, is
determined by a variety of complex factors. Irrespective of difficulties in understanding
and assessing these factors, assaying gene expression can provide useful information
about the occurrence of important events such as tumorogenesis, metastasis, apoptosis,
and other clinically relevant phenomena. Relative indications of the degree to which
genes are active or inactive can be found in gene expression profiles. The gene expression
profiles of this invention are used to provide a diagnosis and treat patients for
thyroid cancer.
[0022] Sample preparation requires the collection of patient samples. Patient samples used
in the inventive method are those that are suspected of containing diseased cells
such as cells taken from a nodule in a fine needle aspirate (FNA) of thyroid tissue.
Bulk tissue preparation obtained from a biopsy or a surgical specimen and laser capture
microdissection are also suitable for use. Laser Capture Microdissection (LCM) technology
is one way to select the cells to be studied, minimizing variability caused by cell
type heterogeneity. Consequently, moderate or small changes in gene expression between
normal or benign and cancerous cells can be readily detected. Samples can also comprise
circulating epithelial cells extracted from peripheral blood. These can be obtained
according to a number of methods but the most preferred method is the magnetic separation
technique described in
U.S. Patent 6,136,182. Once the sample containing the cells of interest has been obtained, RNA is extracted
and amplified and a gene expression profile is obtained, preferably via microarray,
for genes in the appropriate portfolios.
[0023] The present invention encompasses methods of diagnosing thyroid cancer by obtaining
a biological sample from a patient; and measuring the expression levels in the sample
of genes from those encoding mRNA: corresponding to SEQ ID NOs: 36, 53, 73, 211 and
242; and/or corresponding to SEQ ID NOs: 199, 207, 255 and 354; or recognized specifically
by the probe sets from psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242
as depicted in Table 25; and/or recognized specifically by the probe sets from psids
corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25; where
the gene expression levels above or below pre-determined cut-off levels are indicative
of thyroid cancer.
[0024] The present invention encompasses methods of differentiating between thyroid carcinoma
and benign thyroid diseases by obtaining a sample from a patient; and measuring the
expression levels in the sample of genes from those encoding mRNA: corresponding to
SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding to SEQ ID NOs: 199, 207,
255 and 354; or recognized specifically by the probe sets from psids corresponding
to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or recognized
specifically by the probe sets from psids corresponding to SEQ ID NOs: 199, 207, 255
and 354 as depicted in Table 25; where the gene expression levels above or below pre-determined
cut-off levels are indicative of thyroid carcinoma.
[0025] The present invention encompasses methods of testing indeterminate thyroid fine needle
aspirate (FNA) thyroid nodule samples by: obtaining a sample from a patient; and measuring
the expression levels in the sample of genes from those encoding mRNA: corresponding
to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding to SEQ ID NOs: 199, 207,
255 and 354; or recognized specifically by the probe sets from psids corresponding
to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or recognized
specifically by the probe sets from psids corresponding to SEQ ID NOs: 199, 207, 255
and 354 as depicted in Table 25; where the gene expression levels above or below pre-determined
cut-off levels are indicative of thyroid cancer.
[0026] The present invention encompasses methods of determining thyroid cancer patient treatment
protocol by: obtaining a biological sample from a thyroid cancer patient; and measuring
the expression levels in the sample of genes from those encoding mRNA: corresponding
to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding to SEQ ID NOs: 199, 207,
255 and 354; or recognized specifically by the probe sets from psids corresponding
to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or recognized
specifically by the probe sets from psids corresponding to SEQ ID NOs: 199, 207, 255
and 354 as depicted in Table 25; where the gene expression levels above or below pre-determined
cut-off levels are sufficiently indicative of cancer to enable a physician to determine
the type of surgery and/or therapy recommend to treat the disease.
[0027] The present invention encompasses methods of treating a thyroid cancer patient by
obtaining a biological sample from a thyroid cancer patient; and measuring the expression
levels in the sample of genes from those encoding mRNA: corresponding to SEQ ID NOs:
36, 53, 73, 211 and 242; and/or corresponding to SEQ ID NOs: 199, 207, 255 and 354;
or recognized specifically by the probe sets from psids corresponding to SEQ ID NOs:
36, 53, 73, 211 and 242 as depicted in Table 25; and/or recognized specifically by
the probe sets from psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted
in Table 25; where the gene expression levels above or below pre-determined cut-off
levels are indicative of cancer; and treating the patient with thyroidectomy if they
are cancer positive.
[0028] The SEQ ID NOs in the above methods can be 36, 53, 73, 211 and 242 or 199, 207, 255
and 354, or 45, 215, 65, 29, 190, 199, 207, 255 and 354.
[0029] The invention also encompasses the above methods containing the steps of further
measuring the expression level of at least one gene encoding mRNA: corresponding to
SEQ ID NOs: 142, 219 and 309; and/or corresponding to SEQ ID NOs: 9, 12 and 18; or
recognized specifically by the probe sets from psids corresponding to SEQ ID NOs:
130, 190 and 276 as depicted in Table 25; and/or recognized specifically by the probe
sets from psids corresponding to SEQ ID NOs: 9, 12 and 18 as depicted in Table 25.
The invention also encompasses the above methods containing the steps of further measuring
the expression level of at least one gene constitutively expressed in the sample.
[0031] In this invention, the most preferred method for analyzing the gene expression pattern
of a patient in the methods provided herein is through the use of a linear discrimination
analysis program. The present invention encompasses a method of generating a posterior
probability score to enable diagnosis of thyroid carcinoma patients by: obtaining
gene expression data from a statistically significant number of patient biological
samples; applying linear discrimination analysis to the data to obtain selected genes;
and applying weighted expression levels to the selected genes with discriminate function
factor to obtain a prediction model that can be applied as a posterior probability
score. Other analytical tools can also be used to answer the same question such as,
logistic regression and neural network approaches.
[0032] For instance, the following can be used for linear discriminant analysis:

where,
I
(psid) = The log base 2 intensity of the probe set enclosed in parenthesis.
d
(CP) = The discriminant function for the cancer positive class
d
(CN) = The discriminant function for the cancer negative class
P
(CP) = The posterior p-value for the cancer positive class
P
(CN) = The posterior p-value for the cancer negative class
[0033] Numerous other well-known methods of pattern recognition are available. The following
references provide some examples: Weighted Voting: Golub et al. (1999); Support Vector
Machines: Su et al. (2001); and Ramaswamy et al. (2001); K-nearest Neighbors: Ramaswamy
(2001); and Correlation Coefficients: van't Veer et al. (2002).
[0034] Preferably, portfolios are established such that the combination of genes in the
portfolio exhibit improved sensitivity and specificity relative to individual genes
or randomly selected combinations of genes. In the context of the instant invention,
the sensitivity of the portfolio can be reflected in the fold differences exhibited
by a gene's expression in the diseased state relative to the normal state. Specificity
can be reflected in statistical measurements of the correlation of the signaling of
gene expression with the condition of interest. For example, standard deviation can
be a used as such a measurement. In considering a group of genes for inclusion in
a portfolio, a small standard deviation in expression measurements correlates with
greater specificity. Other measurements of variation such as correlation coefficients
can also be used in this capacity. The invention also encompasses the above methods
where the specificity is at least about 40%, at least about 50% and at least about
60%. The invention also encompasses the above methods where the sensitivity is at
least at least about 90% and at least about 92%.
[0035] The invention also encompasses the above methods where the comparison of expression
patterns is conducted with pattern recognition methods. One method of the invention
involves comparing gene expression profiles for various genes (or portfolios) to ascribe
diagnoses. The gene expression profiles of each of the genes comprising the portfolio
are fixed in a medium such as a computer readable medium. This can take a number of
forms. For example, a table can be established into which the range of signals (e.g.,
intensity measurements) indicative of disease is input. Actual patient data can then
be compared to the values in the table to determine whether the patient samples are
normal, benign or diseased. In a more sophisticated embodiment, patterns of the expression
signals (e.g., fluorescent intensity) are recorded digitally or graphically. The gene
expression patterns from the gene portfolios used in conjunction with patient samples
are then compared to the expression patterns.
[0036] Pattern comparison software can then be used to determine whether the patient samples
have a pattern indicative of the disease. Of course, these comparisons can also be
used to determine whether the patient is not likely to experience the disease. The
expression profiles of the samples are then compared to the portfolio of a control
cell. If the sample expression patterns are consistent with the expression pattern
for cancer then (in the absence of countervailing medical considerations) the patient
is treated as one would treat a thyroid cancer patient. If the sample expression patterns
are consistent with the expression pattern from the normal/control cell then the patient
is diagnosed negative for cancer.
[0037] Preferably, levels of up and down regulation are distinguished based on fold changes
of the intensity measurements of hybridized microarray probes. A 1.5 fold difference
is preferred for making such distinctions (or a p-value less than 0.05). That is,
before a gene is said to be differentially expressed in diseased versus normal cells,
the diseased cell is found to yield at least about 1.5 times more, or 1.5 times less
intensity than the normal cells. The greater the fold difference, the more preferred
is use of the gene as a diagnostic or prognostic tool. Genes selected for the gene
expression profiles of this invention have expression levels that result in the generation
of a signal that is distinguishable from those of the normal or non-modulated genes
by an amount that exceeds background using clinical laboratory instrumentation.
[0038] Statistical values can be used to confidently distinguish modulated from non-modulated
genes and noise. Statistical tests find the genes most significantly different between
diverse groups of samples. The Student's T-test is an example of a robust statistical
test that can be used to find significant differences between two groups. The lower
the p-value, the more compelling the evidence that the gene is showing a difference
between the different groups. Nevertheless, since microarrays measure more than one
gene at a time, tens of thousands of statistical tests may be asked at one time. Because
of this, one is unlikely to see small p-values just by chance and adjustments for
this using a Sidak correction as well as a randomization/permutation experiment can
be made. A p-value less than 0.05 by the T-test is evidence that the gene is significantly
different. More compelling evidence is a p-value less then 0.05 after the Sidak correction
is factored in. For a large number of samples in each group, a p-value less than 0.05
after the randomization/permutation test is the most compelling evidence of a significant
difference.
[0039] The present invention encompasses microarrays or gene chips for performing the methods
provided herein. The microarrays can contain isolated nucleic acid sequences, their
complements, or portions thereof of a combination of genes from those encoding mRNA:
corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding to SEQ
ID NOs: 199, 207, 255 and 354; or recognized specifically by the probe sets from psids
corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or
recognized specifically by the probe sets from psids corresponding to SEQ ID NOs:
199, 207, 255 and 354 as depicted in Table 25 where the combination is sufficient
to characterize thyroid carcinoma or risk of relapse in a biological sample. The microarray
preferably measures or characterizes at least about 1.5-fold over- or under-expression,
provides a statistically significant p-value over- or under-expression, or a p-value
is less than 0.05. Preferably, the microarray contains a cDNA array or an oligonucleotide
array and may contain one or more internal control reagents. One preferred internal
control reagent is a method of detecting PAX8 gene expression which can be measured
using SEQ ID NOs: 409-411.
[0040] Preferably, an oligonucleotide in the array corresponds to the 3' non-coding region
of the gene the expression of which is being measured.
[0041] Another parameter that can be used to select genes that generate a signal that is
greater than that of the non-modulated gene or noise is the use of a measurement of
absolute signal difference. Preferably, the signal generated by the modulated gene
expression is at least 20% different than those of the normal or non-modulated gene
(on an absolute basis). It is even more preferred that such genes produce expression
patterns that are at least 30% different than those of normal or non-modulated genes.
[0042] Preferred methods for establishing gene expression profiles include determining the
amount of RNA that is produced by a gene that can code for a protein or peptide. This
is accomplished by reverse transcriptase PCR (RT-PCR), competitive RT-PCR, real time
RT-PCR, differential display RT-PCR, Northern Blot analysis and other related tests.
While it is possible to conduct these techniques using individual PCR reactions, it
is best to amplify complementary DNA (cDNA) or complementary RNA (cRNA) produced from
mRNA and analyze it via microarray. A number of different array configurations and
methods for their production are known to those of skill in the art and are described
in U.S. Patents such as: 5,445,934; 5,532,128; 5,556,752; 5,242,974; 5,384,261; 5,405,783;
5,412,087; 5,424,186; 5,429,807; 5,436,327; 5,472,672; 5,527,681; 5,529,756; 5,545,531;
5,554,501; 5,561,071; 5,571,639; 5,593,839; 5,599,695; 5,624,711; 5,658,734; and 5,700,637.
[0043] Microarray technology allows for the measurement of the steady-state mRNA level of
thousands of genes simultaneously thereby presenting a powerful tool for identifying
effects such as the onset, arrest, or modulation of uncontrolled cell proliferation.
Two microarray technologies are currently in wide use. The first are cDNA arrays and
the second are oligonucleotide arrays. Although differences exist in the construction
of these chips, essentially all downstream data analysis and output are the same.
The product of these analyses are typically measurements of the intensity of the signal
received from a labeled probe used to detect a cDNA sequence from the sample that
hybridizes to a nucleic acid sequence at a known location on the microarray. Typically,
the intensity of the signal is proportional to the quantity of cDNA, and thus mRNA,
expressed in the sample cells. A large number of such techniques are available and
useful. Preferred methods for determining gene expression can be found in
US Patents 6,271,002;
6,218,122;
6,218,114; and
6,004,755.
[0044] Analysis of the expression levels is conducted by comparing such signal intensities.
This is best done by generating a ratio matrix of the expression intensities of genes
in a test sample versus those in a control sample. For instance, the gene expression
intensities from a diseased tissue can be compared with the expression intensities
generated from benign or normal tissue of the same type. A ratio of these expression
intensities indicates the fold-change in gene expression between the test and control
samples.
[0045] Gene expression profiles can also be displayed in a number of ways. The most common
method is to arrange raw fluorescence intensities or ratio matrix into a graphical
dendogram where columns indicate test samples and rows indicate genes. The data are
arranged so genes that have similar expression profiles are proximal to each other.
The expression ratio for each gene is visualized as a color. For example, a ratio
less than one (indicating down-regulation) may appear in the blue portion of the spectrum
while a ratio greater than one (indicating up-regulation) may appear as a color in
the red portion of the spectrum. Commercially available computer software programs
are available to display such data including "GENESPRING" from Silicon Genetics, Inc.
and "DISCOVERY" and "INFER" software from Partek, Inc.
[0046] Modulated genes used in the methods of the invention are described in the Examples.
The genes that are differentially expressed are either up regulated or down regulated
in patients with thyroid cancer relative to those with benign thyroid diseases. Up
regulation and down regulation are relative terms meaning that a detectable difference
(beyond the contribution of noise in the system used to measure it) is found in the
amount of expression of the genes relative to some baseline. In this case, the baseline
is the measured gene expression of a benign disease patient. The genes of interest
in the diseased cells are then either up regulated or down regulated relative to the
baseline level using the same measurement method. Diseased, in this context, refers
to an alteration of the state of a body that interrupts or disturbs, or has the potential
to disturb, proper performance of bodily functions as occurs with the uncontrolled
proliferation of cells. Someone is diagnosed with a disease when some aspect of that
person's genotype or phenotype is consistent with the presence of the disease. However,
the act of conducting a diagnosis or prognosis includes the determination of disease/status
issues such as determining the likelihood of relapse, type of therapy and therapy
monitoring. In therapy monitoring, clinical judgments are made regarding the effect
of a given course of therapy by comparing the expression of genes over time to determine
whether the gene expression profiles have changed or are changing to patterns more
consistent with normal tissue.
[0047] Genes can be grouped so that information obtained about the set of genes in the group
provides a sound basis for making a clinically relevant judgment such as a diagnosis,
prognosis, or treatment choice. These sets of genes make up the portfolios of the
invention. As with most diagnostic markers, it is often desirable to use the fewest
number of markers sufficient to make a correct medical judgment. This prevents a delay
in treatment pending further analysis as well unproductive use of time and resources.
[0048] One method of establishing gene expression portfolios is through the use of optimization
algorithms such as the mean variance algorithm widely used in establishing stock portfolios.
This method is described in detail in
US patent publication number 20030194734. Essentially, the method calls for the establishment of a set of inputs (stocks in
financial applications, expression as measured by intensity here) that will optimize
the return (e.g., signal that is generated) one receives for using it while minimizing
the variability of the return. Many commercial software programs are available to
conduct such operations. "Wagner Associates Mean-Variance Optimization Application,"
referred to as "Wagner Software" throughout this specification, is preferred. This
software uses functions from the "Wagner Associates Mean-Variance Optimization Library"
to determine an efficient frontier and optimal portfolios in the Markowitz sense is
preferred. Use of this type of software requires that microarray data be transformed
so that it can be treated as an input in the way stock return and risk measurements
are used when the software is used for its intended financial analysis purposes.
[0049] The process of selecting a portfolio can also include the application of heuristic
rules. Preferably, such rules are formulated based on biology and an understanding
of the technology used to produce clinical results. More preferably, they are applied
to output from the optimization method. For example, the mean variance method of portfolio
selection can be applied to microarray data for a number of genes differentially expressed
in subjects with cancer. Output from the method would be an optimized set of genes
that could include some genes that are expressed in peripheral blood as well as in
diseased tissue. If samples used in the testing method are obtained from peripheral
blood and certain genes differentially expressed in instances of cancer could also
be differentially expressed in peripheral blood, then a heuristic rule can be applied
in which a portfolio is selected from the efficient frontier excluding those that
are differentially expressed in peripheral blood. Of course, the rule can be applied
prior to the formation of the efficient frontier by, for example, applying the rule
during data pre-selection.
[0050] Other heuristic rules can be applied that are not necessarily related to the biology
in question. For example, one can apply a rule that only a prescribed percentage of
the portfolio can be represented by a particular gene or group of genes. Commercially
available software such as the Wagner Software readily accommodates these types of
heuristics. This can be useful, for example, when factors other than accuracy and
precision (e.g., anticipated licensing fees) have an impact on the desirability of
including one or more genes.
[0051] The gene expression profiles of this invention can also be used in conjunction with
other non-genetic diagnostic methods useful in cancer diagnosis, prognosis, or treatment
monitoring. For example, in some circumstances it is beneficial to combine the diagnostic
power of the gene expression based methods described above with data from conventional
markers such as serum protein markers (e.g., Cancer Antigen 27.29 ("CA 27.29")). A
range of such markers exists including such analytes as CA 27.29. In one such method,
blood is periodically taken from a treated patient and then subjected to an enzyme
immunoassay for one of the serum markers described above. When the concentration of
the marker suggests the return of tumors or failure of therapy, a sample source amenable
to gene expression analysis is taken. Where a suspicious mass exists, a fine needle
aspirate (FNA) is taken and gene expression profiles of cells taken from the mass
are then analyzed as described above. Alternatively, tissue samples may be taken from
areas adjacent to the tissue from which a tumor was previously removed. This approach
can be particularly useful when other testing produces ambiguous results.
[0052] The present invention encompasses methods of cross validating a gene expression profile
and the profiles thus obtained, for thyroid carcinoma patients by: a. obtaining gene
expression data from a statistically significant number of patient biological samples;
b. randomizing sample order; c. setting aside data from about 10% - 50% of samples;
d. computing, for the remaining samples, for factor of interest on all variables and
selecting variables that meet a p-value cutoff (p); e. selecting variables that fit
a prediction model using a forward search and evaluating the training error until
it hits a predetermined error rate; f. testing the prediction model on the left-out
10-50% of samples; g. repeating steps c., -g. with a new set of samples removed; and
h. continuing steps c) -g) until 100% of samples have been tested and record classification
performance. In this method, preferably, the gene expression data obtained in step
h. is represented by genes from those encoding mRNA: corresponding to SEQ ID NOs:
1, 4, 7, 8, 10-11, 13-17, 19-24, 26-27, 29-31, 33-35, 37-38, 40-52, 54-72, 75-82,
84-135, 138-141, 144-151, 153-159, 161-162, 164, 166-173, 176-198, 200-201, 203-206,
208-209, 212-213, 215-218, 220-221, 223, 227-233, 235-241, 243-244, 246-249, 251,
253-254, 256-263, 265-289, 291-293, 295-308, 310-331, 333-341, 343-345, 347-348, 350-353
and 355-363; or recognized specifically by the probe sets from psids in Table 25 corresponding
to SEQ ID NOs: 1, 4, 7, 8, 10-11, 13-17, 19-24, 26-27, 29-31, 33-35, 37-38, 40-52,
54-72, 75-82, 84-135, 138-141, 144-151, 153-159, 161-162, 164, 166-173, 176-198, 200-201,
203-206, 208-209, 212-213, 215-218, 220-221, 223, 227-233, 235-241, 243-244, 246-249,
251, 253-254, 256-263, 265-289, 291-293, 295-308, 310-331, 333-341, 343-345, 347-348,
350-353 and 355-363.
[0053] The present invention encompasses methods of independently validating a gene expression
profile and the profiles thus obtained, for thyroid cancer patients by obtaining gene
expression data from a statistically significant number of patient biological samples;
normalizing the source variabilities in the gene expression data; computing for factor
of interest on all variables that were selected previously; and testing the prediction
model on the sample and record classification performance. In this method, preferably,
the gene expression data obtained in step d. is represented by genes from those encoding
mRNA: corresponding to SEQ ID NOs: 1, 4, 7, 8, 10-11, 13-17, 19-24, 26-27, 29-31,
33-35, 37-38, 40-52, 54-72, 75-82, 84-135, 138-141, 144-151, 153-159, 161-162, 164,
166-173, 176-198, 200-201, 203-206, 208-209, 212-213, 215-218, 220-221, 223, 227-233,
235-241, 243-244, 246-249, 251, 253-254, 256-263, 265-289, 291-293, 295-308, 310-331,
333-341, 343-345, 347-348, 350-353 and 355-363; or recognized specifically by the
probe sets from psids in Table 25 corresponding to SEQ ID NOs: 1, 4, 7, 8, 10-11,
13-17, 19-24, 26-27, 29-31, 33-35, 37-38, 40-52, 54-72, 75-82, 84-135, 138-141, 144-151,
153-159, 161-162, 164, 166-173, 176-198, 200-201, 203-206, 208-209, 212-213, 215-218,
220-221, 223, 227-233, 235-241, 243-244, 246-249, 251, 253-254, 256-263, 265-289,
291-293, 295-308, 310-331, 333-341, 343-345, 347-348, 350-353 and 355-363.
[0054] The present invention encompasses methods of generating a posterior probability to
enable diagnosis of thyroid carcinoma patients by obtaining gene expression data from
a statistically significant number of patient biological samples; applying linear
discrimination analysis to the data to obtain selected genes; applying weighted expression
levels to the selected genes with discriminate function factor to obtain a prediction
model that can be applied as a posterior probability score. For instance, the following
can be used for Linear Discriminant Analysis:

where,
I
(psid) = The log base 2 intensity of the probe set enclosed in parenthesis.
d
(CP) = The discriminant function for the cancer positive class
d
(CN) = The discriminant function for the cancer negative class
P
(CP) = The posterior p-value for the cancer positive class
P
(CN) = The posterior p-value for the cancer negative class
[0055] The present invention encompasses methods of generating a thyroid carcinoma diagnostic
patient report and reports obtained thereby, by obtaining a biological sample from
the patient; measuring gene expression of the sample; applying a posterior probability
score thereto; and using the results obtained thereby to generate the report. The
report can also contain an assessment of patient outcome and/or probability of risk
relative to the patient population.
[0056] The present invention encompasses compositions containing at least one probe set
from: SEQ ID NOs: 36, 53, 73, 211 and 242; and/or SEQ ID NOs: 199, 207, 255 and 354;
or the psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or SEQ ID NOs:
199, 207, 255 and 354 as depicted in Table 25.
[0057] The present invention encompasses kits for conducting an assay to determine thyroid
carcinoma diagnosis in a biological sample containing: materials for detecting isolated
nucleic acid sequences, their complements, or portions thereof of a combination of
genes from those encoding mRNA: corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242;
and/or corresponding to SEQ ID NOs: 199, 207, 255 and 354; or recognized specifically
by the probe sets from psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242
as depicted in Table 25; and/or recognized specifically by the probe sets from psids
corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25. The SEQ
ID NOs. can be 36, 53, 73, 211 and 242, 199, 207, 255 and 354 and 45, 215, 65, 29,
190, 199, 207, 255 and 354.
[0058] Kits made according to the invention include formatted assays for determining the
gene expression profiles. These can include all or some of the materials needed to
conduct the assays such as reagents and instructions and a medium through which nucleic
acid sequences, their complements, or portions thereof are assayed.
[0059] Articles of this invention include representations of the gene expression profiles
useful for treating, diagnosing, prognosticating, and otherwise assessing diseases.
These profile representations are reduced to a medium that can be automatically read
by a machine such as computer readable media (magnetic, optical, and the like). The
articles can also include instructions for assessing the gene expression profiles
in such media. For example, the articles may comprise a CD ROM having computer instructions
for comparing gene expression profiles of the portfolios of genes described above.
The articles may also have gene expression profiles digitally recorded therein so
that they may be compared with gene expression data from patient samples. Alternatively,
the profiles can be recorded in different representational format. A graphical recordation
is one such format. Clustering algorithms such as those incorporated in "DISCOVERY"
and "INFER" software from Partek, Inc. mentioned above can best assist in the visualization
of such data.
[0060] Different types of articles of manufacture according to the invention are media or
formatted assays used to reveal gene expression profiles. These can comprise, for
example, microarrays in which sequence complements or probes are affixed to a matrix
to which the sequences indicative of the genes of interest combine creating a readable
determinant of their presence. Alternatively, articles according to the invention
can be fashioned into reagent kits for conducting hybridization, amplification, and
signal generation indicative of the level of expression of the genes of interest for
detecting cancer.
[0061] The present invention encompasses articles for assessing thyroid carcinoma status
containing: materials for detecting isolated nucleic acid sequences, their complements,
or portions thereof of a combination of genes from those encoding mRNA: corresponding
to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding to SEQ ID NOs: 199, 207,
255 and 354; or recognized specifically by the probe sets from psids corresponding
to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or recognized
specifically by the probe sets from psids corresponding to SEQ ID NOs: 199, 207, 255
and 354 as depicted in Table 25. The SEQ ID NOs. can be 36, 53, 73, 211 and 242; 199,
207, 255 and 354; or 45, 215, 65, 29, 190, 199, 207, 255 and 354.
[0062] The present invention encompasses diagnostic/prognostic portfolios containing isolated
nucleic acid sequences, their complements, or portions thereof of a combination of
genes from those encoding mRNA: corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242;
and/or corresponding to SEQ ID NOs: 199, 207, 255 and 354; or recognized specifically
by the probe sets from psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242
as depicted in Table 25; and/or recognized specifically by the probe sets from psids
corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25 where the
combination is sufficient to characterize thyroid carcinoma status or risk of relapse
in a biological sample. Preferably, the portfolio measures or characterizes at least
about 1.5-fold over- or under-expression or provides a statistically significant p-value
over- or under-expression. Preferably, the p-value is less than 0.05.
[0063] The invention further provides the following numbered embodiments:
- 1. A method of diagnosing thyroid cancer comprising the steps:
- a. obtaining a biological sample from a patient; and
- b. measuring the expression levels in the sample of genes selected from the group
consisting of those encoding mRNA:
- i. corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or
- ii. corresponding to SEQ ID NOs: 199, 207, 255 and 354; or
- iii. recognized specifically by the probe sets selected from the group consisting
of psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table
25; and/or
- iv. recognized specifically by the probe sets selected from the group consisting of
psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25
wherein the gene expression levels above or below pre-determined cut-off levels are
indicative of thyroid cancer.
- 2. A method of differentiating between thyroid carcinoma and benign thyroid diseases
comprising the steps:
a. obtaining a sample from a patient; and
b. measuring the expression levels in the sample of genes selected from the group
consisting of those encoding mRNA:
- i. corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or
- ii. corresponding to SEQ ID NOs: 199, 207, 255 and 354; or
- iii. recognized specifically by the probe sets selected from the group consisting
of psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table
25; and/or
- iv. recognized specifically by the probe sets selected from the group consisting of
psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25
wherein the gene expression levels above or below pre-deteimined cut-off levels are
indicative of thyroid carcinoma.
- 3. A method of testing indeterminate thyroid fine needle aspirate (FNA) thyroid nodule
samples comprising the steps:
- a. obtaining a sample from a patient; and
- b. measuring the expression levels in the sample of genes selected from the group
consisting of those encoding mRNA:
- i. corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or
- ii. corresponding to SEQ ID NOs: 199, 207, 255 and 354; or
- iii. recognized specifically by the probe sets selected from the group consisting
of psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table
25; and/or
- iv. recognized specifically by the probe sets selected from the group consisting of
psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25
wherein the gene expression levels above or below pre-determined cut-off levels are
indicative of thyroid cancer.
- 4. A method of determining thyroid cancer patient treatment protocol comprising the
steps:
- a. obtaining a biological sample from a thyroid cancer patient; and
- b. measuring the expression levels in the sample of genes selected from the group
consisting of those encoding mRNA:
- i. corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or
- ii. corresponding to SEQ ID NOs: 199, 207, 255 and 354; or
- iii. recognized specifically by the probe sets selected from the group consisting
of psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table
25; and/or
- iv. recognized specifically by the probe sets selected from the group consisting of
psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25
wherein the gene expression levels above or below pre-determined cut-off levels are
sufficiently indicative of cancer to enable a physician to determine the type of surgery
and/or therapy recommended to treat the disease.
- 5. A method of treating a thyroid cancer patient comprising the steps:
- a. obtaining a biological sample from a thyroid cancer patient; and
- b. measuring the expression levels in the sample of genes selected from the group
consisting of those encoding mRNA:
- i. corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or
- ii. corresponding to SEQ ID NOs: 199, 207, 255 and 354; or
- iii. recognized specifically by the probe sets selected from the group consisting
of psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table
25; and/or
- iv. recognized specifically by the probe sets selected from the group consisting of
psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25
wherein the gene expression levels above or below pre-determined cut-off levels are
indicative of cancer; and
- c. treating the patient with thyroidectomy if they are cancer positive.
- 6. The method of one of embodiments 1-5 wherein the SEQ ID NOs. are 36, 53, 73, 211
and 242.
- 7. The method of one of embodiments 1-5 wherein the SEQ ID NOs. are 199, 207, 255
and 354.
- 8. The method of one of embodiments 1-5 wherein the SEQ ID NOs. are 45, 215, 65, 29,
190, 199, 207, 255 and 354.
- 9. The method of one of embodiments 1-5 wherein the sample is prepared by a method
are selected from the group consisting of fine needle aspiration, bulk tissue preparation
and laser capture microdissection.
- 10. The method of embodiment 9 wherein the bulk tissue preparation is obtained from
a biopsy or a surgical specimen.
- 11. The method of one of embodiments 1-5 further comprising measuring the expression
level of at least one gene encoding mRNA:
- a. corresponding to SEQ ID NOs: 142, 219 and 309; and/or
- b. corresponding to SEQ ID NOs: 9, 12 and 18; or
- c. recognized specifically by the probe sets selected from the group consisting of
psids corresponding to SEQ ID NOs: 130, 190 and 276 as depicted in Table 25; and/or
- d. recognized specifically by the probe sets selected from the group consisting of
psids corresponding to SEQ ID NOs: 9, 12 and 18 as depicted in Table 25.
- 12. The method of one of embodiments 1-5 further comprising measuring the expression
level of at least one gene constitutively expressed in the sample.
- 13. The method of one of embodiments 1-5 wherein the specificity is at least about
40%.
- 14. The method of one of embodiments 1-5 wherein the specificity is at least about
50%.
- 15. The method of one of embodiments 1-5 wherein the specificity is at least about
60%.
- 16. The method of one of embodiments 1-5 wherein the sensitivity is at least at least
about 90%.
- 17. The method of one of embodiments 1-5 wherein the sensitivity is at least at least
about 92%.
- 18. The method of one of embodiments 1-5 wherein the comparison of expression patterns
is conducted with pattern recognition methods.
- 19. The method of embodiment 18 wherein the pattern recognition methods include the
use of a Cox proportional hazards analysis.
- 20. The method of one of embodiments 1-5 wherein the pre-determined cut-off levels
are at least about 1.5-fold over- or under- expression in the sample relative to benign
cells or normal tissue.
- 21. The method of one of embodiments 1-5 wherein the pre-determined cut-off levels
have at least a statistically significant p-value over-expression in the sample having
thyroid carcinoma cells relative to benign cells or normal tissue.
- 22. The method of embodiment 21 wherein the p-value is less than about 0.05.
- 23. The method of one of embodiments 1-5 wherein gene expression is measured on a
microarray or gene chip.
- 24. The method of embodiment 23 wherein the microarray is a cDNA array or an oligonucleotide
array.
- 25. The method of embodiment 24 wherein the microarray or gene chip further comprises
one or more internal control reagents.
- 26. The method of one of embodiments 1-5 wherein gene expression is determined by
nucleic acid amplification conducted by polymerase chain reaction (PCR) of RNA extracted
from the sample.
- 27. The method of embodiment 26 wherein said PCR is reverse transcription polymerase
chain reaction (RT-PCR).
- 28. The method of embodiment 27, wherein the RT-PCR further comprises one or more
internal control reagents.
- 29. The method of embodiment 28, wherein the internal control reagent is a method
of detecting PAX8 gene expression
- 30. The method of embodiment 29, wherein PAX8 gene expression is measured using SEQ
ID NOs: 409-411.
- 31. The method of one of embodiments 1-5 wherein gene expression is detected by measuring
or detecting a protein encoded by the gene.
- 32. The method of embodiment 31 wherein the protein is detected by an antibody specific
to the protein.
- 33. The method of one of embodiments 1-5 wherein gene expression is detected by measuring
a characteristic of the gene.
- 34. The method of embodiment 33 wherein the characteristic measured is selected from
the group consisting of DNA amplification, methylation, mutation and allelic variation.
- 35. A method of cross validating a gene expression profile for thyroid carcinoma patients
comprising the steps:
- a. obtaining gene expression data from a statistically significant number of patient
biological samples;
- b. randomizing sample order;
- c. setting aside data from about 10% - 50% of samples;
- d. computing, for the remaining samples, for factor of interest on all variables and
selecting variables that meet a p-value cutoff (p);
- e. selecting variables that fit a prediction model using a forward search and evaluating
the training error until it hits a predetermined error rate;
- f. testing the prediction model on the left-out 10-50% of samples;
- g. repeating steps c., -g. with a new set of samples removed; and
- h. continuing steps c) -g) until 100% of samples have been tested and record classification
performance.
- 36. The method according to embodiment 35 wherein the gene expression data obtained
in step h. is represented by genes selected from the group consisting of those encoding
mRNA:
- a. corresponding to SEQ ID NOs: 1, 4, 7, 8, 10-11, 13-17, 19-24, 26-27, 29-31, 33-35,
37-38, 40-52, 54-72, 75-82, 84-135, 138-141, 144-151, 153-159, 161-162, 164, 166-173,
176-198, 200-201, 203-206, 208-209, 212-213, 215-218, 220-221, 223, 227-233, 235-241,
243-244, 246-249, 251, 253-254, 256-263, 265-289, 291-293, 295-308, 310-331, 333-341,
343-345, 347-348, 350-353 and 355-363; or
- b. recognized specifically by the probe sets selected from the group consisting of
psids in Table 25 corresponding to SEQ ID NOs: 1, 4, 7, 8, 10-11, 13-17, 19-24, 26-27,
29-31, 33-35, 37-38, 40-52, 54-72, 75-82, 84-135, 138-141, 144-151, 153-159, 161-162,
164, 166-173, 176-198, 200-201, 203-206, 208-209, 212-213, 215-218, 220-221, 223,
227-233, 235-241, 243-244, 246-249, 251, 253-254, 256-263, 265-289, 291-293, 295-308,
310-331, 333-341, 343-345, 347-348, 350-353 and 355-363.
- 37. A method of independently validating a gene expression profile for thyroid carcinoma
patients comprising the steps:
a. obtaining gene expression data from a statistically significant number of patient
biological samples;
b. normalizing the source variabilities in the gene expression data;
c. computing for factor of interest on all variables that were selected previously;
and
d. testing the prediction model on the sample and record classification performance.
- 38. The method according to embodiment 37 wherein the gene expression data obtained
in step d. is represented by genes selected from the group consisting of those encoding
mRNA:
- a. corresponding to SEQ ID NOs: 1, 4, 7, 8, 10-11, 13-17, 19-24, 26-27, 29-31, 33-35,
37-38, 40-52, 54-72, 75-82, 84-135, 138-141, 144-151, 153-159, 161-162, 164, 166-173,
176-198, 200-201, 203-206, 208-209, 212-213, 215-218, 220-221, 223, 227-233, 235-241,
243-244, 246-249, 251, 253-254, 256-263, 265-289, 291-293, 295-308, 310-331, 333-341,
343-345, 347-348, 350-353 and 355-363; or
- b. recognized specifically by the probe sets selected from the group consisting of
psids in Table 25 corresponding to SEQ ID NOs: 1, 4, 7, 8, 10-11, 13-17, 19-24, 26-27,
29-31, 33-35, 37-38, 40-52, 54-72, 75-82, 84-135, 138-141, 144-151, 153-159, 161-162,
164, 166-173, 176-198, 200-201, 203-206, 208-209, 212-213, 215-218, 220-221, 223,
227-233, 235-241, 243-244, 246-249, 251, 253-254, 256-263, 265-289, 291-293, 295-308,
310-331, 333-341, 343-345, 347-348, 350-353 and 355-363.
- 39. A gene profile obtained by the method according to embodiment 37 or 38.
- 40. A method of generating a posterior probability score to enable diagnosis of thyroid
carcinoma patients comprising the steps:
- a. obtaining gene expression data from a statistically significant number of patient
biological samples;
- b. applying linear discrimination analysis to the data to obtain selected genes;
- c. applying weighted expression levels to the selected genes with discriminate function
factor to obtain a prediction model that can be applied as a posterior probability
score.
- 41. The method according to embodiment 40, wherein the linear discriminant analysis
is calculated using the equation:


where,
I(psid) = The log base 2 intensity of the probe set enclosed in parenthesis.
d(CP) = The discriminant function for the cancer positive class
d(CN) = The discriminant function for the cancer negative class
P(CP) = The posterior p-value for the cancer positive class
P(CN) = The posterior p-value for the cancer negative class
- 42. A method of generating a thyroid carcinoma prognostic patient report comprising
the steps:
a. obtaining a biological sample from the patient;
b. measuring gene expression of the sample;
c. applying a Relapse Hazard Score to the results of step b.; and
d. using the results obtained in step c. to generate the report.
- 43. The method of embodiment 42 wherein the report contains an assessment of patient
outcome and/or probability of risk relative to the patient population.
- 44. A patient report generated by the method according to embodiment 42.
- 45. A composition comprising at least one probe set selected from the group consisting
of: SEQ ID NOs: 36, 53, 73, 211 and 242; and/or SEQ ID NOs: 199, 207, 255 and 354;
or the psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or SEQ ID NOs:
199, 207, 255 and 354 as depicted in Table 25.
- 46. A kit for conducting an assay to determine thyroid carcinoma prognosis in a biological
sample comprising: materials for detecting isolated nucleic acid sequences, their
complements, or portions thereof of a combination of genes selected from the group
consisting of those encoding mRNA:
- a. corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or
- b. corresponding to SEQ ID NOs: 199, 207, 255 and 354; or
- c. recognized specifically by the probe sets selected from the group consisting of
psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25;
and/or
- d. recognized specifically by the probe sets selected from the group consisting of
psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25.
- 47. The kit of embodiment 46 wherein the SEQ ID NOs. are 36, 53, 73, 211 and 242.
- 48. The kit of embodiment 46 wherein the SEQ ID NOs. are 199, 207, 255 and 354.
- 49. The kit of embodiment 46 wherein the SEQ ID NOs. are 45, 215, 65, 29, 190, 199,
207, 255 and 354.
- 50. The kit of embodiment 46 further comprising reagents for conducting a microarray
analysis.
- 51. The kit of embodiment 46 further comprising a medium through which said nucleic
acid sequences, their complements, or portions thereof are assayed.
- 52. Articles for assessing thyroid carcinoma status comprising: materials for detecting
isolated nucleic acid sequences, their complements, or portions thereof of a combination
of genes selected from the group consisting of those encoding mRNA:
- a. corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or
- b. corresponding to SEQ ID NOs: 199, 207, 255 and 354; or
- c. recognized specifically by the probe sets selected from the group consisting of
psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25;
and/or
- d. recognized specifically by the probe sets selected from the group consisting of
psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25.
- 53. The articles of embodiment 52 wherein the SEQ ID NOs. are 36, 53, 73, 211 and
242.
- 54. The articles of embodiment 52 wherein the SEQ ID NOs. are 199, 207, 255 and 354.
- 55. The articles of embodiment 52 wherein the SEQ ID NOs. are 45, 215, 65, 29, 190,
199, 207, 255 and 354.
- 56. The articles of embodiment 52 further comprising reagents for conducting a microarray
analysis.
- 57. The articles of embodiment 52 further comprising a medium through which said nucleic
acid sequences, their complements, or portions thereof are assayed.
- 58. A microarray or gene chip for performing the method of one of embodiments 1-5.
- 59. The microarray of embodiment 58 comprising isolated nucleic acid sequences, their
complements, or portions thereof of a combination of genes selected from the group
consisting of those encoding mRNA:
- a. corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or
- b. corresponding to SEQ ID NOs: 199, 207, 255 and 354; or
- c. recognized specifically by the probe sets selected from the group consisting of
psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25;
and/or
- d. recognized specifically by the probe sets selected from the group consisting of
psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25
where the combination is sufficient to characterize thyroid carcinoma or risk of relapse
in a biological sample.
- 60. The microarray of embodiment 59 wherein the measurement or characterization is
at least about 1.5-fold over- or under-expression.
- 61. The microarray of embodiment 59 wherein the measurement provides a statistically
significant p-value over- or under-expression.
- 62. The microarray of embodiment 59 wherein the p-value is less than about 0.05.
- 63. The microarray of embodiment 59 comprising a cDNA array or an oligonucleotide
array.
- 64. The microarray of embodiment 59 further comprising or more internal control reagents.
- 65. A diagnostic/prognostic portfolio comprising isolated nucleic acid sequences,
their complements, or portions thereof of a combination of genes selected from the
group consisting of those encoding mRNA:
- a. corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or
- b. corresponding to SEQ ID NOs: 199, 207, 255 and 354; or
- c. recognized specifically by the probe sets selected from the group consisting of
psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25;
and/or
- d. recognized specifically by the probe sets selected from the group consisting of
psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25
where the combination is sufficient to characterize thyroid carcinoma status or risk
of relapse in a biological sample.
- 66. The portfolio of embodiment 65 wherein the measurement or characterization is
at least about 1.5-fold over- or under-expression.
- 67. The portfolio of embodiment 65 wherein the measurement provides a statistically
significant p-value over- or under-expression.
- 68. The portfolio of embodiment 65 wherein the p-value is less than about 0.05.
[0064] The following examples are provided to illustrate but not limit the claimed invention.
All references cited herein are hereby incorporated by reference herein.
Example 1
Materials and Methods
Tissue samples
[0065] Fresh frozen thyroid benign diseases, follicular adenoma, follicular carcinoma, and
papillary carcinoma samples were obtained from different commercial vendors including
Genomics Collaborative, Inc. (Cambridge, MA), Asterand (Detroit, MI), and Proteogenex
(Los Angeles, CA). All samples were collected according to an Institutional Review
Board approval protocol. Patients demographic and pathology information were also
collected. The histopathological features of each sample were reviewed to confirm
diagnosis, estimate sample preservation and tumor content.
RNA isolation
[0066] Standard TriZol protocol was used for all the RNA isolations. Tissue was homogenized
in TriZol reagent (Invitrogen, Carlsbad, CA). Total RNA was isolated from TriZol and
precipitated at -20°C with isopropyl alcohol. RNA pellets were washed with 75% ethanol,
dissolved in water and stored at -80°C until use. RNA integrity was examined with
Agilent 2100 Bioanalyzer RNA 6000 NanoAssay (Agilent Technologies, Palo Alto, CA).
Linear Discrimination Analysis
[0067] Linear Discriminant Analysis was performed using these steps: calculation of a common
(pooled) covariance matrix and within-group means; calculation of the set of linear
discriminant functions from the common covariance and the within-group means; and
classification using the linear discriminant functions.
[0068] Plugging the chip intensity readings for each probe into the following equation can
be used to derive the posterior probability of an unknown thyroid sample as either
cancer positive or negative. For example, if a thyroid sample is tested with the assay
and gives a p
(CP) > 0.5 this sample will be classified as thyroid cancer.
[0069] For the 4 gene signature:

[0070] For the 5 gene signature:

where,
I
(psid) = The log base 2 intensity of the probe set enclosed in parenthesis.
d
(CP) = The discriminant function for the cancer positive class
d
(CN) = The discriminant function for the cancer negative class
P
(CP) = The posterior p-value for the cancer positive class
P
(CN) = The posterior p-value for the cancer negative class
Two-round aRNA amplification
[0071] aRNA was amplified from 10 ng total RNA using the RiboBeast 2-Round Aminoallyl-aRNA
Amplification kit (Epicentre, WI), a T7 based RNA linear amplification protocol, with
some modifications. Total RNA was reverse transcribed using an oligo(dT) primer containing
a T7 RNA polymerase promoter sequence and Superscript III RT. The second-strand synthesis
was carried out using Bst DNA polymerase. An extra step of incubation with an exonuclease
mix of Exo I and Exo VII was performed to reduce background. The double-stranded cDNA
served as the template for T7-mediated linear amplification by in vitro transcription.
For the second round of amplification, instead of using the RiboBeast reagents, the
ENZO BioArray HighYield RNA Transcript Labeling kit (Affymetrix, CA) was used in place
of the in vitro transcription step of Aminoallyl-aRNA. The aRNA was quantified by
Agilent Nano Chip technology.
Example 2
Microarray analysis
[0072] Labeled cRNA was prepared and hybridized with the high-density oligonucleotide array
Hu133A Gene Chip (Affymetrix, Santa Clara, CA) containing a total of 22,000 probe
sets. Hybridization was performed according to a standard protocol provided by the
manufacturer. Arrays were scanned using Affymetrix protocols and scanners. For subsequent
analysis, each probe set was considered as an independent gene. Expression values
for each gene were calculated by using Affymetrix Gene Chip analysis software MAS
5.0. All chips met the following quality control standards: the percentage of "presence"
call, the scaling factor, the background level, and the noise level have to be within
the range of mean plus or minus 3 standard deviation. All chips used for subsequent
analysis have passed these quality control criteria. Sample collection for signature
selection and independent validation is summarized in Table 1.
Table 1. Sample collection for signature training and validation
Training Sample Set |
Category |
Number of Samples |
Follicular Adenoma (FA) |
33 |
Follicular Carcinoma (FC) |
21 |
Benign Diseases (BN) |
13 |
Papillary Carcinoma (PC) |
31 |
Validation Sample Set |
Category |
Number of Samples |
Follicular Adenoma (FA) |
38 |
Follicular Carcinoma (FC) |
5 |
Follicular Variant of Papillary Carcinoma (FVPTC) |
11 |
Papillary Carcinoma (PC) |
20 |
Example 3
Results Signature Identification
A. Gene Selection
[0073] A total of 98 samples including 31 primary papillary thyroid tumors, 21 follicular
thyroid cancers, 33 follicular adenoma, and 13 benign thyroid tissues were analyzed
by using Affymetrix human U133A gene chips. Five gene selection criteria were applied
to the entire data set to obtain a limited number of genes for subsequent gene marker
or signature identification:
- 1. Genes with at least one "Present Call" in this sample set were considered.
- 2. Genes with more than one "Present Call" in 12 PBL samples were excluded.
- 3. Only genes with chip intensity larger than 200 in all samples were selected.
- 4. Using genes that passed the above three criteria, we performed a variety of analyses,
as listed in Table 2, to identify genes that are either up-regulated or down-regulated
in thyroid tumors.
- 5. Finally, genes with expression change greater than 1.4-fold were selected.
Table 2. Summary of different types of percentile analyses
|
Type of Percentile Analysis |
1 |
20% FC vs 100% Benign |
2 |
30% FC vs 90% Benign |
3 |
30% PC vs 90% Benign |
4 |
70% FC vs 50% Benign |
5 |
70% PC vs 50% Benign |
6 |
90% Benign vs 30% FC |
7 |
90% Benign vs 30% PC |
[0074] The final number of selected genes for signature identification is 322, described
in Table 25, SEQ ID NOs: 1, 4, 7, 8, 10-11, 13-17, 19-24, 26-27, 29-31, 33-35, 37-38,
40-52, 54-72, 75-82, 84-135, 138-141, 144-151, 153-159, 161-162, 164, 166-173, 176-198,
200-201, 203-206, 208-209, 212-213, 215-218, 220-221, 223, 227-233, 235-241, 243-244,
246-249, 251, 253-254, 256-263, 265-289, 291-293, 295-308, 310-331, 333-341, 343-345,
347-348, 350-353 and 355-363. The data obtained from the 322 selected genes are provided
in Table 3 and summarized in Table 4.
Table 4. 4-Gene signature performance in 98 training samples
|
Tumor |
Benign |
Positive |
48 |
18 |
Negative |
4 |
28 |
Sensitivity |
92% (0.82, 0.97) |
Specificity |
61% (0.46, 0.74) |
B. Signature Identification using Linear Discrimination Analysis
[0075] We used a forward selection process that adds one gene at a time until the posterior
error as evaluated by a linear discriminator is less than or equal to 0.1. A four-gene
signature was discovered using this approach with the 322 genes. The identities of
these 4 genes are listed in Tables 5 and 16 and their chip data are shown in Tables
6 and 7.
[0076]
Table 5. 4-Gene Signature
SEQ ID NO: |
Gene Name |
354 |
Chemokine (C-C motif) ligand 18 (pulmonary and activation-regulated) |
199 |
Pulmonary surfactant-associated protein B (SP-B) |
207 |
K+ channel beta subunit |
255 |
Putative prostate cancer tumor suppressor |
[0077] Leave One Out Cross Validation (LOOCV) resulted in 92% sensitivity and 61% specificity,
shown in Table 4. The ROC curve gave an AUC of 0.897, as shown in Figure 1.
Table 6
|
Signal |
SEQ ID |
PC_984TT |
PC_986TT |
FA_987TT |
PC_988TT |
PC_989TT |
FA_992TT |
FA_993TT |
12 |
3399.2 |
7041.3 |
5438 |
6376.7 |
2734.6 |
3569.5 |
4305.9 |
18 |
6550.8 |
5870.6 |
5815.9 |
4265.1 |
8856.4 |
3454.4 |
20405.3 |
29 |
4578.6 |
6455.8 |
2329.4 |
4259 |
2666.8 |
3694 |
7531.2 |
|
FA_994TT |
FA_995TT |
FA_ 996TT |
FA_998TT |
FA_999TT |
FA_1001TT |
FA_1002TT |
12 |
2545.7 |
2451.8 |
4418 |
3938.3 |
3648.5 |
6834.5 |
4882 |
18 |
12566.4 |
9889.5 |
4341.5 |
5210.1 |
6639.5 |
4794.8 |
3921.9 |
29 |
2239.8 |
1834.5 |
4607.1 |
6424.1 |
3069.6 |
4301.4 |
3164 |
|
FA_1004TT |
FA_1005TT |
FA_1006TT |
FA_1010TT |
FA_1013TT |
FA_1014TT |
FA_1017TT |
12 |
2274.9 |
2644.2 |
3978.8 |
2999.7 |
4012.5 |
1724 |
5005.8 |
18 |
10402 |
7376.3 |
9985.1 |
1330.3 |
4618.8 |
6132 |
4562.6 |
29 |
1688.9 |
4771.2 |
3159.1 |
3082.6 |
6861.7 |
1465 |
3384.7 |
|
FA_1018TT |
FA_1020TT |
FA_1023TT |
FA_1024TT |
FA_1026TT |
FA_1027TT |
FA_1028TT |
12 |
2847.6 |
7102 |
7513.5 |
2086.3 |
2431.3 |
1318.2 |
1231 |
18 |
6388.5 |
2640.8 |
1967.7 |
6853.3 |
5068.5 |
2006.4 |
1804.9 |
29 |
3829.5 |
4235 |
4272.5 |
924 |
1702.3 |
1691.5 |
1731.3 |
|
FA_1029TT |
FA_1030TT |
FA_1031TT |
FA_1032TT |
FA_1034TT |
FA_1035TT |
FC_1037TT |
12 |
4607.6 |
2416.1 |
2203.7 |
6489.9 |
2095.3 |
1547.9 |
1847.4 |
18 |
3507.3 |
2270.8 |
8058 |
11247.5 |
8258.1 |
7485.8 |
8309 |
29 |
1530.5 |
5641.4 |
3460.1 |
4802.1 |
1650.7 |
854.6 |
2418.4 |
|
PC_1039TT |
PC_1040TT |
PC_1041TT |
PC_1042TT |
PC_1043TT |
PC_1044TT |
PC_1045TT |
12 |
8204.9 |
2638.5 |
4795 |
2607.8 |
6725.4 |
5178.7 |
2111.1 |
18 |
6454.7 |
10129.3 |
7964 |
4952.6 |
3663.3 |
1887.7 |
19840.6 |
29 |
8858.5 |
4136.8 |
8434 |
2230.7 |
3434 |
2770 |
2243.1 |
|
PC_1046TT |
PC_1047TT |
PC_1048TT |
PC_1049TT |
PC_1050TT |
PC_1051TT |
PC-FV_1052TT |
12 |
4403.6 |
9394.7 |
2262.5 |
4831.2 |
2826.9 |
1288.6 |
1953.2 |
18 |
2417.7 |
5678.4 |
6655.2 |
4325.2 |
1706 |
6904.8 |
4596.1 |
29 |
2319.8 |
20509.6 |
1176.1 |
5375.3 |
2053.1 |
4027.5 |
3332.3 |
|
PC 1053TT |
PC 1054TT |
PC 1055TT |
PC 1059TT |
PC 1060TT |
PC 1061TT |
PC_1062TT |
12 |
4150.4 |
6180.4 |
1835.7 |
2447.2 |
4201.3 |
4984.3 |
3399.3 |
18 |
5965.7 |
13847.6 |
3740.6 |
4167.7 |
14516.2 |
4896.7 |
8891.6 |
29 |
3718.1 |
4818.3 |
1728.8 |
2972.2 |
4851 |
3469 |
3718.6 |
|
PC-FV_1064TT |
PC-FV_1065TT |
PC-FV_1066TT |
PC-FV 1067TT |
PC-FV 1068TT |
PC-FV_1069TT |
PC-FV 1071TT |
12 |
4221 |
4884.5 |
7256.6 |
640 |
4055 |
3208.2 |
6301.3 |
18 |
4095 |
6627.6 |
1427.1 |
5405.5 |
10722 |
11509.9 |
10314.3 |
29 |
5896.7 |
5461.2 |
9437.3 |
1634.4 |
1344.2 |
2186.4 |
1794.8 |
|
PC-FV_1072TT |
FA_1073TT |
FA _1074TT |
FA-1075TT |
FA-1076TT |
FC_1077TT |
FC_1078TT |
12 |
1390.3 |
3325.5 |
1430.8 |
1784.4 |
1563.9 |
1999.4 |
1830.7 |
18 |
5629 |
10010.5 |
3459.2 |
11454 |
10807.8 |
1384.8 |
11906.2 |
29 |
2974.5 |
7133.1 |
3009 |
4184.9 |
1673.9 |
1044.5 |
4264.1 |
|
FC_1079TT |
PC-FV_1080TT |
PC-FV_1081TT |
FC_1082TT |
pb1 |
pb2 |
pb3 |
12 |
2856.2 |
2437.9 |
3541.2 |
4439.8 |
11.4 |
9.1 |
9.9 |
18 |
22738 |
4344.1 |
4108.3 |
3312.3 |
94.2 |
50.7 |
67.6 |
29 |
1092.8 |
3052.8 |
3302.6 |
2383 |
8.7 |
21.6 |
30.5 |
|
pb4 |
pb5' |
pb6' |
pb7' |
pb8' |
pd10 |
pd11 |
12 |
33.8 |
8.3 |
6.6 |
18.8 |
61.4 |
38.2 |
10.7 |
18 |
74.9 |
29.7 |
53.6 |
37.8 |
31.8 |
68.8 |
117.5 |
29 |
66.1 |
64.6 |
36.4 |
51.5 |
25.1 |
17.2 |
17.2 |
|
pd12 |
pd9 |
|
|
|
|
|
12 |
4.1 |
11.6 |
|
|
|
|
|
18 |
70.8 |
23.4 |
|
|
|
|
|
29 |
19.7 |
11 |
|
|
|
|
|
Table 7
|
Signal |
SEQ ID |
FA_987TT |
FA_992TT |
FA_993TT |
FA-994TT |
FA-995TT |
FA_996TT |
FA_998TT |
354 |
50.9 |
100.4 |
63.7 |
14 |
699.7 |
181.7 |
11.9 |
199 |
81.7 |
18 |
43.3 |
130.3 |
461.9 |
469.4 |
135.6 |
207 |
3844.9 |
1325.1 |
77.9 |
397.2 |
518.3 |
807.5 |
1084.3 |
255 |
1374.4 |
2332.1 |
1631 |
611.1 |
1616.7 |
419.2 |
230.7 |
|
FA_999TT |
FA_1001TT |
FA_1002TT |
FA_1004TT |
FA_1005TT |
FA_1006TT |
FA_1010TT |
354 |
194.7 |
2397.3 |
50.6 |
205.2 |
9.6 |
29.1 |
341.5 |
199 |
124.1 |
574.9 |
206 |
158.5 |
423.6 |
121 |
2489.4 |
207 |
1861.5 |
1325.1 |
846.6 |
308.8 |
1765.9 |
598.9 |
1067.7 |
255 |
266.5 |
186.7 |
324.2 |
94 |
1071.3 |
1098.5 |
1294 |
|
FA_1013TT |
FA_1014TT |
FA_1017TT |
FA_1018TT |
FA_1020TT |
FA_1023TT |
FA_1024TT |
354 |
207.5 |
69 |
21.7 |
20.1 |
64.7 |
87.4 |
372.5 |
199 |
440.8 |
99.8 |
221.6 |
226.9 |
108.2 |
155.2 |
112.6 |
207 |
535.7 |
1910.9 |
1185.2 |
571.8 |
1552.7 |
2739.5 |
692.6 |
255 |
437.2 |
655.6 |
165.1 |
178.4 |
86.4 |
436.5 |
40.7 |
|
FA_1026TT |
FA_1027TT |
FA_1028TT |
FA_1029TT |
FA_1030TT |
FA_1031TT |
FA_1032TT |
354 |
21.5 |
18.1 |
3.8 |
13.3 |
66 |
15.1 |
38.8 |
199 |
70.9 |
46.1 |
561.3 |
67.7 |
35.8 |
48 |
107.3 |
207 |
1230.4 |
80.5 |
732 |
3216.4 |
2253.5 |
1989.9 |
2115.2 |
255 |
479.9 |
226.5 |
35.9 |
1403.4 |
1144.3 |
247.9 |
1989.4 |
|
FA_1034TT |
FA_1035TT |
FA_1073TT |
FA_1074TT |
FA_1075TT |
FA_1076TT |
PC_984TT |
354 |
61.3 |
25.3 |
1355.7 |
188.5 |
14.7 |
8.9 |
97.5 |
199 |
216.5 |
56.1 |
1980.6 |
454.1 |
86.2 |
173.8 |
154.2 |
207 |
421.8 |
1493.5 |
771.6 |
1291.4 |
116.5 |
1169.9 |
759.2 |
255 |
489.2 |
229.5 |
205.3 |
655 |
152.7 |
156.3 |
152 |
|
PC_986TT |
PC_988TT |
PC_989TT |
PC_1039TT |
PC_1040TT |
PC_1041 TT |
PC_1042TT |
354 |
966.6 |
619 |
12.9 |
2577 |
540.4 |
1229.7 |
320 |
199 |
103.9 |
142.5 |
288.5 |
1006.6 |
3990.7 |
17402.7 |
1023.2 |
207 |
400.5 |
2357.5 |
1213.8 |
627.5 |
62.6 |
133.6 |
981.5 |
255 |
299.7 |
2137.5 |
131.9 |
500.6 |
2412.4 |
2763.1 |
303.4 |
|
PC_1043TT |
PC_1044TT |
PC_1045TT |
PC_1046TT |
PC_1047TT |
PC_1048TT |
PC_1049TT |
354 |
444.3 |
170.8 |
817.6 |
1095.1 |
966.8 |
1263.5 |
800.7 |
199 |
604.3 |
222.7 |
22961.4 |
9488.3 |
10311.6 |
1702.7 |
1366 |
207 |
1680.3 |
594.2 |
136.5 |
673.2 |
755 |
20.8 |
254.8 |
255 |
407.6 |
4162.4 |
872.5 |
2472.3 |
1497.3 |
2944.8 |
2399.9 |
|
PC_1050TT |
PC_1051TT |
PC_1053TT |
PC_1054TT |
PC_1055TT |
PC_1059TT |
PC_1060TT |
354 |
292.9 |
614.4 |
1035.4 |
1545.3 |
139.5 |
500.2 |
37.1 |
199 |
117 |
29233.8 |
1435 |
8550.5 |
242.8 |
13914.6 |
2377.3 |
207 |
87.8 |
113.4 |
73.3 |
187.7 |
491.6 |
158.4 |
207.3 |
255 |
2331.8 |
917.2 |
1505.9 |
2186.4 |
3033.2 |
2191.1 |
215.4 |
|
PC_1061TT |
PC_1062TT |
FC_1037TT |
FC_1077TT |
FC_1078TT |
FC_1079TT |
FC_1082TT |
354 |
71 |
23.8 |
18.4 |
28.9 |
87.2 |
13.5 |
27.7 |
199 |
6933.5 |
616.2 |
21.2 |
226.7 |
200.8 |
40.8 |
144.4 |
207 |
1088.5 |
1133.5 |
838.8 |
2012.3 |
24.9 |
196.8 |
1356.4 |
255 |
3084.8 |
1017.8 |
1355.3 |
199 |
1352.4 |
1578 |
1294.4 |
|
PC-FV_1052TT |
PC-FV_1064TT |
PC-FV_1065TT |
PC-FV_1066TT |
PC-FV_1067TT |
PC-FV_1068TT |
PC-FV_1069TT |
354 |
394.8 |
131.4 |
143.7 |
281.9 |
302.1 |
973.6 |
44.9 |
199 |
4620.7 |
1931 |
1613.2 |
170.8 |
579.2 |
20066.3 |
96.9 |
207 |
88.2 |
1033.1 |
705 |
244.1 |
2559 |
8.8 |
12.3 |
255 |
2479.7 |
242.2 |
1322 |
641.9 |
1222.8 |
1914.8 |
93.2 |
|
PC-FV_1071TT |
PC-FV_11072TT |
PC-FV_1080TT |
PC-FV_1081TT |
|
|
|
354 |
109.5 |
127.2 |
205.7 |
12.4 |
|
|
|
199 |
257.5 |
2302.7 |
320 |
206 |
|
|
|
207 |
42.9 |
72.2 |
2795.9 |
145 |
|
|
|
255 |
1128.1 |
2320.8 |
1705.2 |
196.8 |
|
|
|
C. Manual Selection of Markers
[0078] Individual genes were selected with an aim to formulate a RT-PCR based assay. Comparison
of gene expression profiles between thyroid cancers and non-cancer tissues has identified
a five-gene signature from these 322 genes. The identities of these five genes are
shown in Tables 8 and 16 and the chip data are shown in Table 9. The performance of
this signature was assessed using LDA in the 98 samples, and the signature gives 92%
sensitivity and 70% specificity, shown in Table 10. The ROC curve gave an AUC of 0.88,
as shown in Figure 2.
Table 8. 5-Gene signature
SEQ ID NO: |
Gene Name |
53 |
Cadherin 3, type 1 (P cadherin) |
242 |
Fibronectin |
73 |
Secretory granule, neuroendocrine protein 1 |
36 |
Testican-1 |
211 |
Thyroid Peroxidase (TPO) |
Table 9
SEQ ID |
BN_800TT |
BN_801TT |
BN_802TT |
BN_804TT |
BN_805TT |
BN_806TT |
BN_807TT |
36 |
908.3 |
247 |
118.9 |
349.7 |
425.1 |
229.8 |
227.7 |
53 |
48.6 |
25 |
24.1 |
34 |
17.8 |
32.2 |
16.7 |
76 |
252.3 |
272.9 |
75.2 |
260.6 |
169 |
587.1 |
189.8 |
242 |
22247.9 |
1204.2 |
676.7 |
2441.5 |
3900.1 |
2073.4 |
2060.1 |
211 |
24.2 |
16983.5 |
32579.5 |
20189.3 |
24480.5 |
14186.3 |
6488.1 |
|
BN_871TT |
BN_913TT |
BN_914TT |
BN_915TT |
FA_917TT |
FA_918TT |
FA_919TT |
36 |
897.2 |
435.1 |
442.3 |
508.7 |
169.6 |
184.3 |
213.3 |
53 |
192.4 |
28 |
76.1 |
44.2 |
67.7 |
135.7 |
25.7 |
76 |
2134.6 |
252.5 |
956.3 |
174.3 |
62 |
144 |
233.8 |
242 |
13722.5 |
10481.9 |
4172.9 |
1891.1 |
1654.2 |
11791 |
2788.1 |
211 |
6243.3 |
16339.1 |
14355 |
36350.1 |
29876.5 |
19395.7 |
15935.8 |
|
FA_818TT |
FA_819TT |
FA_820TT |
FA_821TT |
FA_822TT |
FA_842TT |
FA_862TT |
36 |
120.4 |
155.8 |
210.6 |
31.7 |
283.3 |
122.2 |
24.1 |
53 |
27.2 |
26.9 |
34 |
33.2 |
34.4 |
27.8 |
66.1 |
76 |
13 |
69.8 |
36.2 |
171.2 |
116.2 |
190.8 |
15.9 |
242 |
1433.3 |
2211.8 |
2714.7 |
325 |
2278 |
3959.5 |
1573.1 |
211 |
15976.6 |
19882.4 |
10029.6 |
29411.3 |
25179.3 |
12492.5 |
32721.4 |
|
FA_863TT |
FA_864TT |
FA_865TT |
FA_866TT |
FA_867TT |
FA_869TT |
FA_907TT |
36 |
955.1 |
173.1 |
400.5 |
230.8 |
233.5 |
2581.5 |
207.8 |
53 |
333.9 |
27.9 |
147.1 |
155 |
25 |
1224.9 |
52.8 |
76 |
2614.7 |
624.1 |
614.9 |
336.7 |
163.5 |
1921.3 |
38.5 |
242 |
930.4 |
1419.2 |
4708.4 |
2169.8 |
1081.9 |
3241.5 |
4555.3 |
211 |
19631.3 |
27382.8 |
29846 |
25011.6 |
30599.1 |
23680.6 |
35313.3 |
|
FA_908TT |
FA_920TT |
FA_938TT |
FA_940TT |
FA_941TT |
Fa_EA4037 4_921TT |
Fa_EA40376 _923TT |
36 |
329.6 |
165.4 |
331.5 |
298.8 |
267.4 |
211.3 |
188.6 |
53 |
35.8 |
28.5 |
21.7 |
291.4 |
45.3 |
23.8 |
62.8 |
76 |
253.8 |
64.7 |
3312.7 |
870.1 |
1038.3 |
153.3 |
236.1 |
242 |
1630.4 |
2452.4 |
6684 |
765 |
2229.5 |
1809.2 |
3314 |
211 |
21639.5 |
31897.6 |
26420.3 |
18786.4 |
31922.5 |
36025.3 |
15065.2 |
|
BN_EA40377_9 24TT |
Fa_EA40378_92 5TT |
Fa_EA40379_ 926TT |
BN_EA4038 0_927TT |
Fa_EA4038 7_955TT |
Fa_EA4038 8_956TT |
Fa_EA40389 _957TT |
36 |
1409.1 |
215.1 |
228.5 |
833.3 |
94.7 |
259.7 |
786.2 |
53 |
2294.2 |
40.5 |
496.1 |
64.9 |
197.4 |
230.4 |
17.3 |
76 |
624.1 |
149.1 |
211.3 |
501.1 |
2225.4 |
1443.7 |
223.7 |
242 |
21699.6 |
1079.3 |
21653.5 |
3263.3 |
2194.8 |
989.6 |
2107.8 |
211 |
664.1 |
12583.3 |
13036.6 |
43191.4 |
9409.2 |
19630.9 |
4160.9 |
|
Fa_EA40390_9 59TT |
Fa_EA40391_96 0TT |
Fa_EA40392_ 961TT |
Fa_EA40393 _962TT |
PC_829TT |
PC_830TT |
PC_831TT |
36 |
2496.1 |
175.3 |
58.2 |
1470.7 |
330.3 |
210.3 |
432.7 |
53 |
24.4 |
40.3 |
52.6 |
183 |
73 |
49.6 |
1916.2 |
76 |
2397 |
47.6 |
77.2 |
1048.1 |
758.4 |
576.2 |
394.3 |
242 |
1991.2 |
1042.5 |
1474.6 |
688.1 |
6760 |
6785 |
25733 |
211 |
38927.5 |
31764 |
34287.3 |
44314.7 |
25565 |
31930.4 |
138.4 |
|
PC_832TT |
PC_834TT |
PC_835TT |
PC_836TT |
PC_837TT |
PC_838TT |
PC_839TT |
36 |
1376.8 |
4076.8 |
1208.3 |
585 |
1015.5 |
1620.2 |
71 |
53 |
1909.1 |
2701 |
1178.5 |
710.7 |
1469.6 |
3009.9 |
41.2 |
76 |
433.6 |
665.5 |
654.3 |
2432.3 |
412.1 |
1946.7 |
327.2 |
242 |
9423.8 |
18037.6 |
23053.8 |
1044.8 |
22442.7 |
27313.9 |
3641 |
211 |
7174.2 |
1961.7 |
282.1 |
24646.9 |
15840.2 |
264.2 |
17049.3 |
|
PC_879TT |
PC_881TT |
PC_882TT |
PC_883TT |
PC_884TT |
PC_885TT |
PC_886TT |
36 |
457.4 |
1779.4 |
561.2 |
722.1 |
1129.2 |
552.5 |
1244.9 |
53 |
2036.8 |
3121.5 |
2072.4 |
2753 |
2221.1 |
1703.8 |
1325.9 |
76 |
1168 |
1829.9 |
1210.6 |
2663.6 |
1076 |
1232.2 |
1866.8 |
242 |
46283.3 |
32477.3 |
33142.3 |
38026.7 |
42087.5 |
49249 |
39172.5 |
211 |
86.8 |
613.5 |
48.3 |
126.2 |
1565.2 |
120 |
1553 |
|
PC_890TT |
PC_892TT |
PC_893TT |
PC_894TT |
PC_903TT |
PC_904TT |
PC_928TT |
36 |
813.3 |
2211.4 |
1046.2 |
585.3 |
3395 |
767.9 |
246.6 |
53 |
4685.6 |
3536.8 |
1363.5 |
1244.4 |
3057.5 |
199.9 |
41.1 |
76 |
3926.2 |
2787 |
2359.3 |
1020.3 |
1564 |
203.6 |
421.5 |
242 |
36114.4 |
31599.6 |
34700.3 |
41193.8 |
18485.8 |
19181.5 |
3729.4 |
211 |
1569.2 |
1703.6 |
234.5 |
1594 |
4063.1 |
5354.1 |
18199.2 |
|
PC_932TT |
PC_933TT |
Pc_EA40375_ 922TT |
Pc_EA40381 _945TT |
Pc_EA4038 2_946TT |
Pc_EA4038 3_947TT |
Pc_EA40384 _948TT |
36 |
352.4 |
920.3 |
316.8 |
818.6 |
3078.8 |
532.1 |
311.1 |
53 |
3447.4 |
788.3 |
41.8 |
803.9 |
2330.1 |
1337.6 |
1556.2 |
76 |
850.2 |
865.6 |
211.2 |
237.9 |
1830 |
1279.7 |
598 |
242 |
21913.7 |
24536 |
1758.5 |
13301.5 |
22076.9 |
31987.1 |
27579.2 |
211 |
490.5 |
13171.6 |
30959.7 |
331 |
857.8 |
2007.7 |
556.5 |
|
FC_823TT |
FC_824TT |
FC_825TT |
FC_827TT |
FC_828TT |
FC_840TT |
FC_896TT |
36 |
282.5 |
2413 |
1506.3 |
821.8 |
564.4 |
331.6 |
857.1 |
53 |
23.2 |
24.1 |
25.5 |
348.1 |
27.8 |
32.3 |
245.4 |
76 |
460.1 |
2833.9 |
1128.9 |
1421.6 |
705.3 |
341.8 |
358.9 |
242 |
12129 |
22000.8 |
874.8 |
2544.9 |
845.1 |
3459.7 |
1998.1 |
211 |
30520.5 |
496.2 |
7923.9 |
11508.2 |
33401.7 |
10882.8 |
1625.3 |
|
FC_898TT |
FC_899TT |
FC_900TT |
FC_901TT |
FC_902TT |
FC_909TT |
FC_910TT |
36 |
827.5 |
1152.4 |
778.8 |
11199.3 |
578.7 |
713 |
132.4 |
53 |
38.1 |
1949.7 |
2221 |
29.8 |
185.9 |
21.5 |
57.2 |
76 |
2517.5 |
1009.8 |
3523.8 |
28603.2 |
2201.1 |
195.6 |
4744.8 |
242 |
39786.8 |
38117 |
29127.6 |
4032.5 |
43673.6 |
3478.5 |
1273.2 |
211 |
1160.7 |
132.9 |
79.4 |
26.8 |
251.4 |
488 |
8979.7 |
|
Fc_EA40386_954TT |
Fc_EA40394_967TT |
Fc_EA40395_968TT |
Fc_EA40396_969TT |
Fc EA40397_970TT |
Fc_EA40405_982TT |
Fc_EA40406_983TT |
36 |
619.3 |
412.7 |
134 |
218.6 |
463 |
1233.6 |
234.6 |
53 |
15.8 |
31 |
23.8 |
55.9 |
65.5 |
31.6 |
120.8 |
76 |
4136.1 |
682.5 |
41.2 |
18.4 |
594.7 |
931 |
2232 |
242 |
969.6 |
5003.3 |
13867.1 |
2129.7 |
15742.7 |
4086.9 |
11985.6 |
211 |
20581.7 |
1509.8 |
2603.1 |
15427.4 |
369.3 |
30161.2 |
19869.7 |
Table 10. 5-Gene signature performance in 98 training samples
|
Tumor |
Benign |
Positive |
48 |
14 |
Negative |
4 |
32 |
Sensitivity |
92% (0.82, 0.97) |
Specificity |
70% (0.55, 0.81) |
D. Cross Validation with the 74 Independent Thyroid Samples
[0079] 74 independent thyroid samples were processed and profiled with the U133a chip, and
the chip data for these two signatures are shown in the Table 11. The performances
of the 4-gene and the 5-gene signatures were assessed with LDA. Both signatures gave
equivalent performance in these samples compared to the 98 training samples. The sensitivity
and specificity for both signatures are shown in Table 12, and the ROC curves are
demonstrated in Figure 3a and 3b.
Table 11
|
Signal |
SEQ ID |
FA_987TT |
FA_992TT |
FA_993TT |
FA_994TT |
FA_995TT |
FA_996TT |
FA_998TT |
36 |
92.8 |
437.8 |
640.5 |
4152.5 |
714.7 |
254.8 |
303.4 |
53 |
15.8 |
422.8 |
25.2 |
29.5 |
258.9 |
45.6 |
26.8 |
76 |
485.1 |
2536.5 |
1708.6 |
288.3 |
643.3 |
605.6 |
341 |
242 |
686.5 |
971.4 |
24532.8 |
895.7 |
6424.8 |
842.1 |
905.1 |
211 |
28269.8 |
14689.4 |
357.5 |
33711.6 |
34943.2 |
16131 |
22376.1 |
|
FA_999TT |
FA_1001TT |
FA_1002TT |
FA_1004TT |
FA_1005TT |
FA_1006TT |
FA_1010TT |
36 |
63.7 |
22.3 |
55.6 |
408.5 |
128.3 |
353 |
442 |
53 |
30.9 |
31.8 |
39.6 |
70.8 |
37.9 |
38.9 |
119.6 |
76 |
110.7 |
90.2 |
253.5 |
159.1 |
1559.6 |
413.7 |
1222.5 |
242 |
1550.6 |
1689.3 |
256.5 |
1668 |
3921.5 |
1013.2 |
1837.3 |
211 |
26779.6 |
15870.7 |
24525.5 |
43040.2 |
25392.9 |
32641.9 |
20140.7 |
|
FA_1013TT |
FA_1014TT |
FA_1017TT |
FA_1018TT |
FA_1020TT |
FA_1023TT |
FA_1024TT |
36 |
453.5 |
333.7 |
179.6 |
146.6 |
417.3 |
75.1 |
129.2 |
53 |
39.8 |
21.4 |
99.9 |
23.7 |
26.8 |
62.3 |
22.2 |
76 |
333.7 |
1231.2 |
241.1 |
131 |
1435.3 |
1491.6 |
260.8 |
242 |
1459.4 |
415 |
1696.3 |
287.1 |
617.5 |
1932.6 |
1689.2 |
211 |
7911.3 |
19359.4 |
18089 |
18222.8 |
30038.8 |
9053 |
15611.2 |
|
FA_1026TT |
FA_1027TT |
FA_1028TT |
FA_1029TT |
FA_1030TT |
FA_103HT |
FA_1032TT |
36 |
281.1 |
130.5 |
150.4 |
629.1 |
760.4 |
191.6 |
1671.5 |
53 |
125.5 |
62.3 |
118.2 |
230.7 |
420.5 |
27.7 |
519 |
76 |
77.4 |
111.9 |
184 |
2100.9 |
1741.3 |
338.1 |
3643.5 |
242 |
1091.6 |
754.3 |
705.9 |
684.7 |
372.4 |
1848.8 |
3094.7 |
211 |
21979.1 |
7890.5 |
26226 |
15344.1 |
10368 |
30439.9 |
23943.3 |
|
FA_1034TT |
FA_1035TT |
FA_1073TT |
FA_1074TT |
FA_1075TT |
FA_1076TT |
PC_984TT |
36 |
24.8 |
119.9 |
111.7 |
1010.9 |
26 |
224.5 |
303 |
53 |
29.6 |
30.4 |
366.7 |
96.9 |
94.3 |
31 |
37.2 |
76 |
289.3 |
239.7 |
167.4 |
326.8 |
818.9 |
248.5 |
198.3 |
242 |
1482.1 |
590.9 |
4842.5 |
2815.5 |
2726.8 |
754.8 |
785.1 |
211 |
38135.4 |
30510.6 |
29406.4 |
31075.4 |
20833.9 |
34960.4 |
24938.2 |
|
PC_986TT |
PC_988TT |
PC_989TT |
PC_1039TT |
PC_1040TT |
PC_1041TT |
PC_1042TT |
36 |
676.3 |
391.7 |
264.9 |
735.7 |
524.7 |
769.9 |
1125 |
53 |
32.5 |
395.6 |
305.5 |
655 |
1153.9 |
2194.1 |
111.5 |
76 |
287.9 |
1384.8 |
888.3 |
1048.4 |
1381.1 |
412.6 |
1384.9 |
242 |
2450.7 |
2243.2 |
698.6 |
20366.4 |
32090.9 |
27480.9 |
1915.7 |
211 |
2689.5 |
19903.2 |
32075.9 |
9197.7 |
152.2 |
1862.2 |
10375.9 |
|
PC_1043TT |
PC_1044TT |
PC_1045TT |
PC_1046TT |
PC_1047TT |
PC_1048TT |
PC_1049TT |
36 |
1013.6 |
1023.8 |
809.8 |
1811.1 |
1546.2 |
481.8 |
2491.9 |
53 |
730.7 |
2965.3 |
2533.7 |
2052.8 |
756.1 |
988.3 |
2000.6 |
76 |
1977.4 |
3380.4 |
422 |
4343.9 |
3570.2 |
1786.8 |
1619.4 |
242 |
3907.5 |
20074.8 |
41761.2 |
33253.5 |
28124.7 |
30516 |
21324.5 |
211 |
7015.5 |
11.5 |
136.1 |
59.1 |
3841.7 |
31.1 |
1476 |
|
PC_1050TT |
PC_1051TT |
PC_1053TT |
PC_1054TT |
PC_1055TT |
PC_1059TT |
PC_1060TT |
36 |
443.9 |
669 |
477.1 |
952.8 |
645.3 |
660.2 |
648.5 |
53 |
4037.8 |
1290.7 |
933.9 |
1336.9 |
2123.2 |
1353.8 |
66.9 |
76 |
856.7 |
1039 |
463.2 |
1399.8 |
4385 |
365.8 |
160.7 |
242 |
1261.6 |
58258.5 |
26004.9 |
21219.8 |
12760.8 |
26084.4 |
3277.6 |
211 |
1150.2 |
375.9 |
73.2 |
2575.8 |
400.5 |
24.2 |
1637.7 |
|
PC_1061TT |
PC_1062TT |
FC_1037TT |
FC_1077TT |
FC_1078TT |
FC_1079TT |
FC_1082TT |
36 |
3523.2 |
1912.5 |
234.2 |
128.3 |
825.1 |
297.5 |
1447.6 |
53 |
2348.3 |
975.7 |
97.6 |
46.2 |
15.8 |
38.5 |
254.6 |
76 |
4994.9 |
3891.7 |
5559.8 |
252 |
1103.5 |
700 |
1754.7 |
242 |
15397.4 |
2006.1 |
1826 |
2407.5 |
22661.8 |
1595.5 |
713.7 |
211 |
3379.4 |
2201.9 |
41570 |
15804.5 |
3572.1 |
4377.9 |
16863.7 |
|
PC-FV_1052TT |
PC-FV_1064TT |
PC-FV_1065TT |
PC-FV_1066TT |
PC-FV_1067TT |
PC-FV_1068TT |
PC-FV_1069TT |
36 |
1993.3 |
230.6 |
1128.8 |
708.4 |
1348 |
331.4 |
33.2 |
53 |
2450.3 |
72.7 |
610.3 |
72.5 |
146.4 |
1073.7 |
21.5 |
76 |
2075 |
451.3 |
1350.2 |
922.5 |
1743.7 |
950.5 |
332.8 |
242 |
21494 |
7110.9 |
10228.8 |
2206.3 |
3319.2 |
28034.2 |
430.1 |
211 |
1581.5 |
29936.9 |
1594.7 |
5693.1 |
11288.8 |
573.6 |
12485.5 |
|
PC- FV_1071TT |
PC-FV_1072TT |
PC-FV_1080TT |
PC-FV_1081TT |
|
|
|
36 |
148.9 |
332.2 |
1288.7 |
672 |
|
|
|
53 |
1836.9 |
1450.3 |
2221 |
22.9 |
|
|
|
76 |
4053 |
1628.6 |
2275.9 |
62.6 |
|
|
|
242 |
1810.6 |
26396.9 |
683.4 |
984 |
|
|
|
211 |
8.9 |
24 |
3416.7 |
2630.8 |
|
|
|
Table 12. 4-Gene and 5-gene signatures performance in 74 validation samples
4-Gene Signature |
|
Tumor |
Benign |
Positive |
33 |
12 |
Negative |
3 |
26 |
Sensitivity |
92% (0.78, 0.97) |
Specificity |
68% (0.53, 0.81) |
5-Gene Signature |
|
Tumor |
Benign |
Positive |
33 |
9 |
Negative |
3 |
29 |
Sensitivity |
92% (0.78, 0.97) |
Specificity |
76% (0.61, 0.87) |
E. Control Gene Marker Identification
[0080] With the 98 thyroid samples and 12 PBL samples we selected two groups of genes as
sampling control. One group consists of genes that are expressed in thyroid but not
in PBL, the second group includes genes that are expressed in PBL but not in thyroid.
The full gene list and corresponding chip data are shown in Tables 13a and 13b. From
these genes we selected six genes that are abundant and the differentiation between
thyroid and PBL is relatively large. Their expression profile was validated in the
74 independent thyroid samples. The identities of these six genes are listed in Table
14 and their chip data are shown in Tables 15a and 15b.
Table 13a
|
13a1 |
|
|
|
|
|
|
|
|
|
|
ThyMixBen_......_Signal |
|
SEQ ID |
|
02014_40062_H 133A_800TT |
|
02014_40063_H 133A_801TT |
02014_40064_ H133A_802TT |
02014_40065_ H133A_804TT |
02014_40066_ H133A_805TT |
02014_40067_ H133A_806TT |
|
2 |
|
2789.6 |
|
2676.2 |
3009.2 |
2957.5 |
3644.5 |
|
|
3 |
|
6346.1 |
|
794.7 |
623.9 |
772 |
2977.3 |
622.7 |
|
5 |
|
845.5 |
|
3039.1 |
4452.6 |
2982.5 |
8283.2 |
1627.6 |
|
6 |
|
2730.4 |
|
1108.5 |
1155.6 |
2201.2 |
1954.3 |
1750 |
|
9 |
|
2248.9 |
|
12094.5 |
7529.2 |
2827.3 |
7701.7 |
1548.3 |
|
12 |
|
10625.3 |
|
3137.2 |
2382.7 |
5727.8 |
6238 |
4685.1 |
|
18 |
|
3171 |
|
5947.9 |
13241.7 |
10294.9 |
7849.3 |
4037.4 |
|
22 |
|
2715.2 |
|
9522.5 |
6429.7 |
2590.9 |
5294.3 |
6490.4 |
|
25 |
|
19159.3 |
|
1467.3 |
550.1 |
2838 |
11294.7 |
1374.2 |
|
28 |
|
722.7 |
|
835.1 |
727.1 |
568.1 |
1336.7 |
740.7 |
|
32 |
|
4160.6 |
|
8115.2 |
4061.8 |
6625.3 |
7348.9 |
3964.1 |
|
39 |
|
314.3 |
|
1243.1 |
1486.8 |
742.5 |
1027.7 |
1185.9 |
|
74 |
|
323.9 |
|
1227.6 |
1965.1 |
1281.5 |
760.1 |
505.4 |
|
78 |
|
250.8 |
|
677 |
1029.5 |
403.7 |
795.2 |
355 |
|
143 |
|
1337.3 |
|
1339.1 |
2607.9 |
1758.8 |
1933.5 |
1809 |
|
174 |
|
1263.1 |
|
4430.7 |
6041.6 |
3543.2 |
7346 |
3920.5 |
|
175 |
|
1996.3 |
|
1829.5 |
3632.7 |
1646.5 |
2847.5 |
3054.2 |
|
191 |
|
7108.4 |
|
848.3 |
2063 |
1133.9 |
1482.4 |
1149 |
|
212 |
|
258.2 |
|
1405.8 |
1196.9 |
882.4 |
1296.8 |
1790 |
|
222 |
|
20586.8 |
|
1371.2 |
2411.9 |
2573.9 |
1228.6 |
1342 |
|
233 |
|
1410.6 |
|
14126.8 |
3020.4 |
2186.1 |
8439.4 |
6024.4 |
|
234 |
|
5048.1 |
|
2183.3 |
3215.5 |
4103.9 |
4096.9 |
2220.2 |
|
237 |
|
905 |
|
3397.9 |
2525.1 |
2135.4 |
2822 |
2492.3 |
|
238 |
|
198 |
|
1937.7 |
1289.5 |
804.5 |
1538.6 |
1454.7 |
|
245 |
|
143.7 |
|
1598.5 |
1964.2 |
897.9 |
2276.6 |
1348.2 |
|
250 |
|
1300.9 |
|
777 |
1405.9 |
1466.4 |
1301.3 |
1865.3 |
|
252 |
|
945.6 |
|
1547.3 |
1210.2 |
1357 |
1437.1 |
1141.1 |
|
264 |
|
455.1 |
|
988.1 |
932.8 |
631.7 |
1253.9 |
845.4 |
|
290 |
|
345.6 |
|
327.2 |
533.1 |
470.2 |
700.5 |
231.9 |
|
294 |
|
1043 |
|
3655.8 |
4435.4 |
3563.9 |
4377.4 |
2734.8 |
|
296 |
|
845.5 |
|
1242.5 |
1068.6 |
1506.5 |
2423.4 |
1527.3 |
|
342 |
|
771.4 |
|
535.9 |
998.5 |
922.5 |
1108.1 |
605.4 |
|
13a2 |
|
|
|
|
|
|
|
|
|
|
Signal |
|
|
ThyMixBen_0201402014_40198 |
|
SEQ IID |
|
_4006807_TT |
H133A_8_T |
_H133A_871T |
02014_40321_ H133A_913TT |
02014_40322_ H133A_914TT |
02014_40323_ H133A_915TT |
02014_40324_H 133A_917TT |
|
2 |
|
1749.6 |
|
1571.1 |
2634.4 |
2419.2 |
2697.4 |
2901.1 |
|
3 |
|
377.2 |
|
508 |
2322.7 |
259.8 |
1123.4 |
875.2 |
|
5 |
|
2762.9 |
|
1795.8 |
6670.2 |
2094.7 |
11425.7 |
4957.2 |
|
6 |
|
1280.1 |
|
2033.3 |
1910.3 |
2543.7 |
2173.2 |
1358.7 |
|
9 |
|
3346 8 |
|
548 3 |
11398 5 |
953 4 |
2085 2 |
10684.4 |
|
12 |
|
6927.1 |
|
4060.5 |
6664 4 |
2730.5 |
4322.8 |
2616 2 |
|
18 |
|
7418 9 |
|
148604 |
3134 7 |
26576 3 |
9585.4 |
8588 9 |
|
22 |
|
1797.5 |
|
744 5 |
7334.3 |
317 9 |
5120 1 |
8611.7 |
|
25 |
|
1245.8 |
|
815.8 |
7201.1 |
253.7 |
2882.9 |
1053.4 |
|
28 |
|
301.1 |
|
640.8 |
1325.9 |
409.2 |
762.7 |
838.8 |
|
32 |
|
2992 4 |
|
3260 2 |
3588 1 |
792 5 |
5413.2 |
2581 |
|
39 |
|
435.8 |
|
958.1 |
1152.1 |
499.6 |
556.9 |
898.6 |
|
74 |
|
689.2 |
|
1453.7 |
491.7 |
736.6 |
986.9 |
1217 |
|
78 |
|
160.1 |
|
383 |
151.2 |
172.9 |
597.4 |
745.6 |
|
143 |
|
1338.8 |
|
1466.6 |
1069.9 |
2070.9 |
2377.2 |
1976.3 |
|
174 |
|
2464.3 |
|
1616.3 |
829.8 |
1365.2 |
4938 |
4804.3 |
|
175 |
|
1701 |
|
1511.5 |
1101.1 |
2325.4 |
2530.2 |
2237.6 |
|
191 |
|
763.6 |
|
2383.3 |
2013.2 |
1274.2 |
601.2 |
1100.2 |
|
212 |
|
481 |
|
1131.9 |
912.5 |
663.2 |
666.4 |
1081 |
|
222 |
|
280.8 |
|
1574 |
4944.1 |
342.2 |
1225.9 |
449 |
|
233 |
|
1289.5 |
|
1272.4 |
6285.6 |
866 8 |
1839.3 |
5797.4 |
|
234 |
|
1645.4 |
|
3271.1 |
2263.3 |
1789.3 |
6497.4 |
3416 |
|
237 |
|
1732.6 |
|
879.6 |
3780 |
1345.3 |
2154.2 |
2802.8 |
|
238 |
|
493.5 |
|
893.1 |
1098.7 |
405.9 |
592.8 |
1326.4 |
|
245 |
|
661 9 |
|
1378 3 |
1244 1 |
645 4 |
11242 |
1171.1 |
|
250 |
|
736.7 |
|
1305.6 |
633 |
1409.4 |
1368.9 |
1146.7 |
|
252 |
|
1145.8 |
|
1986 |
1203.2 |
1323.5 |
1544.6 |
757 |
|
264 |
|
462.7 |
|
891.3 |
629.4 |
649.7 |
872.1 |
1319.5 |
|
290 |
|
295.8 |
|
697.1 |
987.8 |
819.9 |
440.6 |
268.7 |
|
294 |
|
1909.1 |
|
1128.4 |
924.1 |
1519.2 |
3225.3 |
2954.9 |
|
296 |
|
898.4 |
|
1232.2 |
925.1 |
1290.3 |
738.1 |
1069.6 |
|
342 |
|
482.4 |
|
712.6 |
476.1 |
694.8 |
801.2 |
605.7 |
|
13a3 |
|
|
|
|
|
|
|
|
|
|
Signal |
|
|
|
|
|
|
ThyFolBen_0201 |
ThyFolBen_02014 |
ThyFolBen_02 |
ThyFolBen_020 |
|
SEQ ID |
|
02014_40325_ H133A_918TT |
|
02014_40326_ H133A_919TT |
4_40079_H133A_ _818TT |
40080_H133A_8 19TT |
014_40081_H 133A_820TT |
14_40082_H13 3A_821TT |
|
2 |
|
3457.7 |
|
2769.1 |
4234.5 |
5589.2 |
3035.3 |
2681.6 |
|
3 |
|
920.5 |
|
1289.3 |
627 |
690.9 |
585.4 |
610 |
|
5 |
|
1805.2 |
|
5184.1 |
1487.2 |
1942 |
2663.8 |
1231.8 |
|
6 |
|
1560.8 |
|
1519.3 |
996.2 |
1140.3 |
2093.4 |
841.6 |
|
9 |
|
11354 8 |
|
9921.9 |
3894 |
2165.4 |
7467 |
76856 |
|
12 |
|
7531 7 |
|
6887 2 |
1379.1 |
12924 |
5085.1 |
3585 9 |
|
18 |
|
8220.1 |
|
5452 2 |
7762.8 |
7277 4 |
5374 9 |
2379 1 |
|
22 |
|
4750 8 |
|
5739 1 |
5655 3 |
7618 6 |
6227 9 |
1551 9 |
|
25 |
|
1557.9 |
|
3017.5 |
1200.4 |
881.1 |
1279.8 |
406.4 |
|
28 |
|
886.6 |
|
1189.2 |
731.4 |
681.6 |
1225.7 |
473.9 |
|
32 |
|
4134 1 |
|
10964 4 |
9276 |
3075 2 |
2775 |
608.8 |
|
39 |
|
1259.2 |
|
1022.1 |
1423.7 |
1632.9 |
899.5 |
688.9 |
|
74 |
|
741.8 |
|
948.9 |
770 |
674.6 |
1139.7 |
213 |
|
78 |
|
447.9 |
|
488.2 |
790.6 |
602.8 |
776.3 |
332.1 |
|
143 |
|
3165.1 |
|
1865.5 |
2330.7 |
1160.7 |
1676 |
1672.4 |
|
174 |
|
607.5 |
|
2151.8 |
4026.2 |
4702.6 |
10677.1 |
3826.8 |
|
175 |
|
5358.5 |
|
2402.7 |
3765.6 |
1231.9 |
2531.9 |
2307.7 |
|
191 |
|
2685.9 |
|
1183.6 |
1661.4 |
1657.1 |
1377.8 |
368.2 |
|
212 |
|
1306.3 |
|
1072.1 |
2181.8 |
2035.6 |
954.2 |
1663.4 |
|
222 |
|
2332.8 |
|
431.2 |
1015.6 |
1651.7 |
3755.4 |
1669.9 |
|
233 |
|
5181 8 |
|
12377 |
3400 9 |
4679 3 |
2476 |
15066 |
|
234 |
|
3760.2 |
|
1988.2 |
3527.4 |
3971.4 |
4526.5 |
997.6 |
|
237 |
|
2712 |
|
3073.8 |
1930.6 |
3521.8 |
2951.3 |
2673.5 |
|
238 |
|
1552.2 |
|
1636.1 |
1333.5 |
837.6 |
1069.7 |
1860.5 |
|
245 |
|
1722.2 |
|
1981.5 |
1978 8 |
2170 |
7636 |
1392 9 |
|
250 |
|
1502.7 |
|
1094 |
1083.3 |
710.8 |
864.9 |
1823.2 |
|
252 |
|
1609.9 |
|
1679.3 |
1599.4 |
1463.9 |
1199.9 |
1019.2 |
|
264 |
|
860.1 |
|
835.6 |
1451.1 |
1315.6 |
1221.6 |
936.8 |
|
290 |
|
773.4 |
|
490.4 |
218.3 |
507.2 |
648.3 |
294.6 |
|
294 |
|
555.3 |
|
2490.7 |
1854.9 |
2997.4 |
7108.2 |
2160.7 |
|
296 |
|
1240.1 |
|
1863 |
1139.6 |
1245.4 |
1172.5 |
1318.3 |
|
342 |
|
738.7 |
|
509.3 |
1018.4 |
728.8 |
977.2 |
710.6 |
|
13a4 |
|
|
|
|
|
|
|
|
|
|
Signal |
|
SEQ ID |
|
ThyFolBen_02014_40 083_H133A_822TT |
|
fa_EA40173_V DX842TT |
fa_EA40191_fa_EA40192 VDX862TT |
_VDX863TT |
fa_EA40193 _VDX864TT |
fa_EA40194 _VDX865TT |
|
2 |
|
3403.4 |
|
3423.5 |
2246.6 |
2723.3 |
4130.4 |
2828.3 |
|
3 |
|
644.4 |
|
950.1 |
1313.2 |
344.4 |
1731.1 |
2576.9 |
|
5 |
|
3439.5 |
|
754.3 |
2119 |
3324.7 |
1663.9 |
4423 |
|
6 |
|
1373.7 |
|
987.7 |
834.7 |
1399.9 |
1115.4 |
1872.1 |
|
9 |
|
7457 5 |
|
2730 9 |
9307 8 |
7048 5 |
3775.7 |
6931 3 |
|
12 |
|
3978 9 |
|
9462.8 |
777.5 |
4280 8 |
4821 |
2268 2 |
|
18 |
|
6386.9 |
|
1591 2 |
9546.6 |
4979 5 |
5005.2 |
4409 5 |
|
22 |
|
2652 5 |
|
7124 7 |
11054 7 |
4669 9 |
4776 9 |
5782.5 |
|
25 |
|
1887.7 |
|
470.8 |
703.9 |
714.5 |
445.9 |
698.2 |
|
28 |
|
548.5 |
|
562.4 |
596.8 |
915.9 |
1194.1 |
1041 |
|
32 |
|
4425 |
|
2120.3 |
1084 1 |
2638.9 |
2593.1 |
1919.9 |
|
39 |
|
1103.1 |
|
1110.2 |
898.4 |
1375.1 |
1520.4 |
1744.1 |
|
74 |
|
285.9 |
|
895.8 |
532.1 |
841.2 |
1938.6 |
1109.5 |
|
78 |
|
643.1 |
|
346.6 |
533.3 |
680.5 |
621.5 |
385.8 |
|
143 |
|
1979.9 |
|
3302.9 |
1686.6 |
2406.6 |
2255.4 |
3419.1 |
|
174 |
|
5408.1 |
|
608.2 |
5072.8 |
5907.1 |
2956.1 |
2670.2 |
|
175 |
|
2650.3 |
|
6596.8 |
2600.8 |
4704.8 |
3123 |
5286.8 |
|
191 |
|
667.7 |
|
2665.7 |
1382.1 |
740.2 |
1133.3 |
3678.2 |
|
212 |
|
1357.8 |
|
2545.2 |
1590.2 |
1326.3 |
1135.1 |
1079 |
|
222 |
|
2239.9 |
|
471 |
548.8 |
584.1 |
899.4 |
1002.2 |
|
233 |
|
7318.7 |
|
11617 9 |
10868.4 |
6925.9 |
5416 9 |
14212.9 |
|
234 |
|
2395.9 |
|
2832.7 |
6005.3 |
2493.8 |
2128.8 |
6818.7 |
|
237 |
|
2275.3 |
|
2639.3 |
2406.6 |
2595.1 |
1857.2 |
2546.1 |
|
238 |
|
1181.8 |
|
2124.4 |
1586.7 |
2125.3 |
2039.5 |
1859.1 |
|
245 |
|
2082 5 |
|
2302 1 |
2846 4 |
2280 8 |
3973 8 |
1520 6 |
|
250 |
|
1684 |
|
1718 |
862.9 |
2782.6 |
1973.4 |
1594.3 |
|
252 |
|
1166.7 |
|
1579.6 |
590.4 |
1623.2 |
1735.2 |
1584.3 |
|
264 |
|
654.2 |
|
1604.2 |
3062.9 |
1460.8 |
1510.1 |
2018.9 |
|
290 |
|
342 |
|
431.8 |
458.8 |
602.3 |
745 |
977.6 |
|
294 |
|
2978.3 |
|
651.5 |
3533.7 |
4065.9 |
2720.4 |
2292.8 |
|
296 |
|
2132.4 |
|
1762.9 |
815.3 |
1040.3 |
1787.6 |
932.6 |
|
342 |
|
1058.5 |
|
488.3 |
475.4 |
759.3 |
658.3 |
851.2 |
|
13a5 |
|
|
|
|
|
|
|
|
|
|
|
Signal |
|
SEQ ID |
|
fa_EA40195_V DX866TT |
|
fa_EA40196_V DT867TT |
fa_EA40197_VDX869TT |
fa_EA40219 _VDX907TT |
fa_EA40220 _VDX908TT |
02014_40327_ H133A_920TT |
|
2 |
|
3243.6 |
|
2969.9 |
3761.4 |
3352.1 |
2486.7 |
3109.7 |
|
3 |
|
728.9 |
|
548.2 |
531.1 |
796 |
1204.6 |
981.6 |
|
5 |
|
2392.7 |
|
6268.7 |
3870.9 |
10216 |
3635.2 |
11319.3 |
|
6 |
|
1534 |
|
965.4 |
2782.8 |
2638.6 |
1155.7 |
2100.9 |
|
9 |
|
8238.3 |
|
8829 9 |
4175.6 |
16504 |
7363.2 |
3172 |
|
12 |
|
33346 |
|
2752 |
3382 5 |
3589 1 |
6717 7 |
3191 1 |
|
18 |
|
9146.3 |
|
8150.5 |
7796 3 |
8021 5 |
8185 |
8907 1 |
|
22 |
|
4665.5 |
|
8163.5 |
3812 |
4001.7 |
5539.5 |
6346.7 |
|
25 |
|
555.6 |
|
524.6 |
1592.8 |
2057.7 |
4103.3 |
886.1 |
|
28 |
|
1115.3 |
|
604 |
918.9 |
1190.9 |
999.1 |
998.2 |
|
32 |
|
1089.3 |
|
1808 7 |
1245 6 |
4202 |
7454.6 |
1100 2 |
|
39 |
|
1606.8 |
|
1418.2 |
1392.4 |
1443.3 |
949.8 |
1388.7 |
|
74 |
|
638.2 |
|
2085.2 |
694.7 |
1778.1 |
557.7 |
1486.9 |
|
78 |
|
480.6 |
|
603.6 |
959.8 |
1000.3 |
476 |
721.1 |
|
143 |
|
3003 |
|
2033.2 |
3441.7 |
3224.1 |
2461.3 |
2701.2 |
|
174 |
|
3322 |
|
4573.5 |
4168.2 |
5982 |
3022.2 |
5710.7 |
|
175 |
|
4747.7 |
|
2573.2 |
5834.5 |
4666.3 |
3540.8 |
3751 |
|
191 |
|
2724.1 |
|
726 |
831.2 |
1991.3 |
1556.8 |
643.4 |
|
212 |
|
2362.7 |
|
1705.9 |
2344.8 |
1259.8 |
1288.5 |
1033.6 |
|
222 |
|
271.7 |
|
2039.4 |
683.4 |
1370.8 |
728.8 |
1675.2 |
|
233 |
|
10892.9 |
|
6981 9 |
10048.5 |
6773.9 |
15803 |
3520.9 |
|
234 |
|
4015.4 |
|
3229.5 |
4734.4 |
7233.3 |
2712.8 |
8148.3 |
|
237 |
|
2159.9 |
|
2415.2 |
2194.8 |
2990.7 |
2565.8 |
2364 |
|
238 |
|
1451 |
|
1111.6 |
1037.4 |
914.9 |
1634.9 |
1078.9 |
|
245 |
|
2059 1 |
|
25486 |
2180.9 |
2093 2 |
1730 |
1329 4 |
|
250 |
|
3534.3 |
|
993.3 |
2513.3 |
878.9 |
686.3 |
980.4 |
|
252 |
|
1589.8 |
|
1334.1 |
2762.4 |
1267.3 |
1857.6 |
1608.2 |
|
264 |
|
1335.1 |
|
1560.1 |
1656.9 |
942.7 |
950.4 |
1076.1 |
|
290 |
|
496.3 |
|
626.2 |
584.9 |
549.5 |
309.7 |
613.4 |
|
294 |
|
2869.4 |
|
4842.4 |
2762.9 |
4119.2 |
2299.8 |
3497.8 |
|
296 |
|
1414.4 |
|
882.4 |
1284 |
1106.4 |
1493.4 |
888.5 |
|
342 |
|
595.6 |
|
660.6 |
1442.5 |
1050.3 |
607.5 |
1278.6 |
|
13a6 |
|
|
|
|
|
|
|
|
|
|
|
Signal |
|
SEQID |
|
02014_40332_ H133A_938TT |
|
02014_40335_ H133A_940TT |
02014_40334_H133A_941TT |
EA02014_40374 _H133A_921TT |
EA02014_40376 _H133A_923TT |
EA02014_40377 _H133A_924TT |
|
2 |
|
1963.7 |
|
2662.2 |
2416.5 |
3047.7 |
2043.6 |
3322 |
|
3 |
|
942.5 |
|
342 |
749.1 |
1300.6 |
549.3 |
1182 |
|
5 |
|
2218 |
|
3903.1 |
3011.1 |
1669.8 |
1508.3 |
1453.3 |
|
6 |
|
939.5 |
|
1239.9 |
1853.8 |
837.7 |
1477.8 |
1129.4 |
|
9 |
|
5245 3 |
|
1988 9 |
1165 8 |
4137 |
8735.7 |
4453 3 |
|
12 |
|
2500.4 |
|
2100 |
3597 7 |
5716 2 |
6694.6 |
3667 8 |
|
18 |
|
5929 7 |
|
7819 7 |
53354 |
4017.5 |
2899 7 |
5013 3 |
|
22 |
|
2265 8 |
|
6298 2 |
2112 7 |
3386 6 |
4519 5 |
4186 6 |
|
25 |
|
1160.2 |
|
916.5 |
614.7 |
1055.5 |
1184.4 |
828.4 |
|
28 |
|
617.6 |
|
408.5 |
740.7 |
477.3 |
701.3 |
550.8 |
|
32 |
|
2918.8 |
|
3242 3 |
3083 9 |
1411 4 |
4079 5 |
2063 5 |
|
39 |
|
1356.6 |
|
876.8 |
1855 |
1231.3 |
982.1 |
1248 |
|
74 |
|
1102.1 |
|
826.7 |
1384.4 |
296.9 |
632.9 |
787.7 |
|
78 |
|
361.5 |
|
383.5 |
482.7 |
578.5 |
351.8 |
389.9 |
|
143 |
|
1394.9 |
|
2889.2 |
1838.1 |
1776 |
1563 |
3881.9 |
|
174 |
|
2198.3 |
|
1887.5 |
3921.8 |
3076.4 |
1858.1 |
1967.3 |
|
175 |
|
1391.4 |
|
3677.8 |
2169.3 |
2169 |
2397.2 |
5896.8 |
|
191 |
|
1235.1 |
|
364.7 |
1283.5 |
616.4 |
1037.7 |
1957 |
|
212 |
|
1625.4 |
|
871.1 |
1083.8 |
1086.2 |
1450.7 |
981.1 |
|
222 |
|
503.4 |
|
638.5 |
320.1 |
1707.8 |
1089.4 |
640.8 |
|
233 |
|
8499.4 |
|
1999.9 |
4012 1 |
3345.8 |
10991 6 |
11095 5 |
|
234 |
|
2067.7 |
|
2973.7 |
2630.4 |
2027.1 |
1597 |
3240 |
|
237 |
|
2763.1 |
|
1501.1 |
2724 |
1997.9 |
2249.3 |
2941.1 |
|
238 |
|
1055.6 |
|
1055.7 |
1596.5 |
1035.6 |
1810.9 |
1257.5 |
|
245 |
|
751.4 |
|
1076 1 |
9152 |
27144 |
2120 1 |
1553.6 |
|
250 |
|
1050.6 |
|
1474.3 |
2517.1 |
1428.1 |
1169.4 |
2857.1 |
|
252 |
|
987.8 |
|
1382.5 |
2070.7 |
881.9 |
1589.3 |
2217.2 |
|
264 |
|
1278.3 |
|
1261.1 |
826.2 |
865.3 |
1055.9 |
1034.7 |
|
290 |
|
786.4 |
|
936.8 |
952.1 |
312.4 |
385.7 |
1231.1 |
|
294 |
|
2197.5 |
|
2064.7 |
2836.2 |
2573.5 |
1835.4 |
2657.6 |
|
296 |
|
635.2 |
|
572.8 |
700.9 |
1768.2 |
1426.3 |
2462.5 |
|
342 |
|
718.6 |
|
866.8 |
735.7 |
770.7 |
565.3 |
1695.1 |
|
13a7 |
|
|
|
|
|
|
|
|
|
|
EA02014_ Signal |
|
SEQ ID |
|
40378_H133A _925TT |
|
40379_H133A_ 926TT |
40380_H133A_9 27TT |
40387_H133A_9 55TT |
40388_H133A_9 56TT |
40389_H133A_9 57TT |
|
2 |
|
3274 |
|
3025.4 |
2424.9 |
2302.6 |
2724.6 |
2641.3 |
|
3 |
|
1545.1 |
|
1151.1 |
687.6 |
424.7 |
420.6 |
609.2 |
|
5 |
|
3661.8 |
|
1323.2 |
7949.9 |
4860 |
4059.3 |
4895.3 |
|
6 |
|
1371.5 |
|
1220.8 |
1831 |
2330.9 |
1642.8 |
1963.8 |
|
9 |
|
10387.7 |
|
11670 1 |
6402 7 |
3105 3 |
4256 6 |
8744 8 |
|
12 |
|
5829.9 |
|
6903 8 |
4783 9 |
2874 5 |
3494 1 |
2451 |
|
18 |
|
6648 |
|
4053 1 |
7410.2 |
4600 2 |
3912 9 |
16235 3 |
|
22 |
|
6859.7 |
|
6621 2 |
3008 1 |
1369.9 |
2480 5 |
4685 |
|
25 |
|
1035.6 |
|
3448.2 |
1347.1 |
365.3 |
1587.2 |
816.8 |
|
28 |
|
1087 |
|
917.1 |
747.8 |
1057 |
1169.8 |
974.1 |
|
32 |
|
5212 9 |
|
6841 6 |
3282.5 |
28142 |
4083 1 |
8121 2 |
|
39 |
|
1228.7 |
|
1245.7 |
762.4 |
904.9 |
1136.2 |
1862.7 |
|
74 |
|
823.9 |
|
721.6 |
1460.4 |
2781.4 |
970.2 |
839 |
|
78 |
|
713.8 |
|
377.6 |
621.3 |
212.8 |
421.3 |
891.4 |
|
143 |
|
1953.5 |
|
2925.7 |
2861.8 |
1243.3 |
2335.1 |
2564.3 |
|
174 |
|
3029 |
|
1818.4 |
5264.1 |
3925.2 |
4789.1 |
4553.5 |
|
175 |
|
3229.1 |
|
4827.2 |
3821.1 |
1561.7 |
4603.8 |
4098.3 |
|
191 |
|
1112.4 |
|
5308.2 |
841 |
861.6 |
865.2 |
1964.9 |
|
212 |
|
890.9 |
|
915.6 |
729.1 |
1264.1 |
1494.2 |
1177.2 |
|
222 |
|
480.1 |
|
2895.3 |
605.6 |
145.2 |
425.3 |
1712.4 |
|
233 |
|
6680 7 |
|
9190 5 |
2236 9 |
441 5 |
3626.6 |
11326 8 |
|
234 |
|
1871.2 |
|
4194.1 |
4428.8 |
1260.8 |
1599 |
4627.7 |
|
237 |
|
2758.4 |
|
2108.7 |
2070.1 |
1655.9 |
2140.3 |
2820.6 |
|
238 |
|
1210.7 |
|
1289.5 |
774.3 |
1017.9 |
1645.6 |
1150.6 |
|
245 |
|
2369 7 |
|
1585.8 |
785 1 |
1808 4 |
2014 9 |
1185 6 |
|
250 |
|
971.8 |
|
1387.3 |
1193.5 |
2014.8 |
2033 |
608.6 |
|
252 |
|
1417.1 |
|
990.9 |
1186.9 |
1561.4 |
2006.1 |
1838 |
|
264 |
|
1089.9 |
|
538.3 |
758.6 |
1340.4 |
1171.9 |
933.1 |
|
290 |
|
565.1 |
|
601.8 |
485.3 |
597.5 |
511.7 |
852.7 |
|
294 |
|
2574.6 |
|
1541.3 |
3862.3 |
2639.9 |
3968.8 |
3955.7 |
|
296 |
|
1821.8 |
|
1115.3 |
1015.1 |
1379.4 |
1444.1 |
867.3 |
|
342 |
|
621 |
|
757.4 |
791.6 |
504.5 |
671.6 |
1320.3 |
|
13a8 |
|
|
|
|
|
|
|
|
|
|
Signal |
|
SEQ ID |
|
EA02014_4039 0_H133A_959T |
|
EA02014_403 91 _H133A_96 0TT |
EA02014_40 392_H133A_ 961TT |
EA02014_403 93_H133A_96 2TT |
ThyPapCan_0201 4_40090_H133A_829TT |
ThyPapCan_02014_ 40091_H133A_830TT@IC |
|
2 |
|
1817.9 |
|
1937.6 |
2632.3 |
2613.7 |
2167.7 |
1372.7 |
|
3 |
|
605.6 |
|
546.8 |
697.5 |
480.4 |
1793.5 |
1236.1 |
|
5 |
|
8452.7 |
|
11532.9 |
5852.5 |
5194.8 |
3735.8 |
2822.7 |
|
6 |
|
2508.7 |
|
1035.1 |
1581.2 |
1561.5 |
1568.4 |
1723.3 |
|
9 |
|
1557.3 |
|
17159 3 |
4950 2 |
1272.3 |
3597.7 |
3243.8 |
|
12 |
|
84236 |
|
3364.4 |
3626 3 |
1198.7 |
59384 |
3878 6 |
|
18 |
|
9560.7 |
|
5478 7 |
8997.6 |
4601 2 |
6673 3 |
6322.9 |
|
22 |
|
57452 |
|
85846 |
5849.4 |
2275 2 |
4413.3 |
2539 9 |
|
25 |
|
2003.7 |
|
619.6 |
797.7 |
887.6 |
2860.8 |
3257.2 |
|
28 |
|
1280.7 |
|
1023.3 |
810.5 |
604.5 |
703.2 |
592.2 |
|
32 |
|
5819 5 |
|
1430 |
6760 1 |
736.3 |
5057 7 |
6877 1 |
|
39 |
|
844.6 |
|
1193.7 |
2035 |
1643.1 |
906.4 |
977.6 |
|
74 |
|
1794.4 |
|
871.9 |
1342.7 |
1207.3 |
873.7 |
438.1 |
|
78 |
|
1290.5 |
|
705.2 |
582.1 |
644.6 |
514.2 |
463 |
|
143 |
|
3606.5 |
|
1206.5 |
2610 |
3369.8 |
2462.6 |
1861.9 |
|
174 |
|
5367.9 |
|
3197 |
2890.4 |
2641.3 |
4481.7 |
4198.6 |
|
175 |
|
6112 |
|
1232.1 |
3258.2 |
5085.3 |
3246.9 |
2442.8 |
|
191 |
|
628.6 |
|
681.7 |
1024.6 |
538.5 |
913.3 |
723.7 |
|
212 |
|
762 |
|
850.9 |
1201 |
690.9 |
797.9 |
784 |
|
222 |
|
3380.6 |
|
2257.2 |
1397.9 |
127.7 |
892.4 |
646.7 |
|
233 |
|
1273 2 |
|
3459 2 |
5807 2 |
1846 1 |
4170.6 |
4565 3 |
|
234 |
|
4522.8 |
|
4556.7 |
4306.9 |
2687.8 |
3024.6 |
3006.1 |
|
237 |
|
1813.8 |
|
2740.9 |
2387.6 |
1999.7 |
1879.2 |
1708 |
|
238 |
|
1451 |
|
897.7 |
1411.1 |
1416.3 |
966.6 |
803.6 |
|
245 |
|
841.7 |
|
1542 |
14342 |
1628 4 |
1415.8 |
1521.5 |
|
250 |
|
834.9 |
|
839.6 |
1111.7 |
2545.8 |
1268.4 |
993.6 |
|
252 |
|
1612 |
|
1068.9 |
1122.2 |
1770.9 |
1379.1 |
1201.1 |
|
264 |
|
1720.7 |
|
1090.3 |
766.9 |
838.8 |
728.4 |
1170.1 |
|
290 |
|
548.7 |
|
268.4 |
292.1 |
366.4 |
284.9 |
221.6 |
|
294 |
|
4894.2 |
|
2878.6 |
1768.4 |
2181.6 |
2628.2 |
1888.8 |
|
296 |
|
1074.9 |
|
850.9 |
729.8 |
975.7 |
1061.8 |
946.4 |
|
342 |
|
1199.4 |
|
802.1 |
874.5 |
1428.7 |
842.7 |
661 |
|
13a9 |
|
|
|
|
|
|
|
|
|
|
ThyPapCan_02014_.... Signal |
|
SEQ ID |
|
40092_H133A_83 1TT |
40093_H |
133A_832TT |
40095_H133A_834TT |
40096_H133A_835TT |
40097_H133A _836TT |
40098_H133A_83 7TT@I2 |
|
2 |
|
2960.8 |
|
3724.8 |
3502.5 |
2185.5 |
2399.1 |
2900.3 |
|
3 |
|
1034.7 |
|
1002.2 |
539.6 |
891.3 |
452.9 |
1885.7 |
|
5 |
|
1648.6 |
|
2929.1 |
3651.5 |
1611.8 |
3731.1 |
3572.5 |
|
6 |
|
1182.8 |
|
1644.7 |
1603.7 |
966.3 |
2282.6 |
1818.1 |
|
9 |
|
1637.6 |
|
5720.9 |
3045.3 |
1451 |
5197.6 |
7768 2 |
|
12 |
|
4300 1 |
|
3654 1 |
3555 9 |
3946.6 |
2299 |
2877.5 |
|
18 |
|
6335 8 |
|
3922 6 |
35796 |
3282 2 |
3591 8 |
9567 |
|
22 |
|
3973 |
|
4533 |
5478 5 |
2546.7 |
2145 4 |
7779 3 |
|
25 |
|
7110.3 |
|
2680 |
2117.2 |
5212.6 |
869.3 |
8325.2 |
|
28 |
|
550.3 |
|
1205.7 |
660.4 |
730.8 |
642.1 |
734.4 |
|
32 |
|
3476 1 |
|
8075 3 |
2580 |
2524 9 |
2454 3 |
7864 8 |
|
39 |
|
973.9 |
|
1322.9 |
1283.6 |
847.1 |
1328.7 |
1793.3 |
|
74 |
|
611.8 |
|
1044.9 |
1510.9 |
831.5 |
519.6 |
513.4 |
|
78 |
|
179.8 |
|
404.5 |
344.8 |
133.7 |
582.7 |
482.5 |
|
143 |
|
2333.5 |
|
2803.8 |
3730.7 |
2073.1 |
2033.9 |
3437.3 |
|
174 |
|
2628.9 |
|
5254.6 |
2333.9 |
922.6 |
5487.5 |
2544 |
|
175 |
|
3237.9 |
|
5586.3 |
5010.7 |
2460.9 |
2800.9 |
4480.6 |
|
191 |
|
3519.9 |
|
1826.9 |
1761.9 |
1360.1 |
531.4 |
2426.7 |
|
212 |
|
957 |
|
1085.3 |
1218.4 |
764.9 |
1307.9 |
1161.5 |
|
222 |
|
3373.3 |
|
1016 |
723.7 |
3010.1 |
829.7 |
1642.5 |
|
233 |
|
11130 3 |
|
16096 3 |
16100 3 |
10534.6 |
2873 8 |
13024 1 |
|
234 |
|
2382.4 |
|
2253.4 |
2236.6 |
842.4 |
1767 |
3577 |
|
237 |
|
2141.4 |
|
2712.7 |
2749.7 |
2120.8 |
2269.8 |
2385.2 |
|
238 |
|
719.8 |
|
2489.2 |
1179.1 |
806.1 |
1516.4 |
1336.1 |
|
245 |
|
873 3 |
|
1325.6 |
1693 |
870.8 |
1916 1 |
1869.5 |
|
250 |
|
2074.6 |
|
1295 |
2234.8 |
1654.7 |
2588.9 |
1104.7 |
|
252 |
|
1496.7 |
|
2444.6 |
2031.7 |
1605.8 |
1808.1 |
1897.2 |
|
264 |
|
931.2 |
|
1035.7 |
1188 |
746.7 |
1074.1 |
1170.2 |
|
290 |
|
499.8 |
|
667.3 |
663.2 |
626.9 |
634.4 |
625.8 |
|
294 |
|
2010 |
|
4135.1 |
2098.4 |
1207.1 |
3722.1 |
2055.4 |
|
296 |
|
2128.8 |
|
2051.6 |
2507.5 |
2156.5 |
1001 |
2034.3 |
|
342 |
|
835.3 |
|
1453.2 |
1071.6 |
615.5 |
1084 |
1209 |
|
13a10 |
|
|
|
|
|
|
|
|
|
|
Signal |
|
SEQ ID |
|
ThyPapCan_02014_40 099_H133A_838TT |
|
02014_40317@I2_H133A_839TT |
pc_EA40200 _VDX879TT |
pc_EA40201 _VDX881TT |
pc_EA40202 _VDX882TT |
pc_EA40203_ VDX883TT |
|
2 |
|
3540.3 |
|
1657 |
3331 |
3253.1 |
3349.3 |
3642 |
|
3 |
|
1796.3 |
|
750.6 |
1334.9 |
1248.1 |
477.8 |
697.9 |
|
5 |
|
4954 |
|
2602 |
3011.2 |
2106.6 |
1504.9 |
2070.9 |
|
6 |
|
2558.4 |
|
1246.9 |
1008.5 |
1708.8 |
874.6 |
704.3 |
|
9 |
|
4538 |
|
3328.9 |
1097 2 |
1789 6 |
857 2 |
1327.3 |
|
12 |
|
2544 |
|
64206 |
5055.9 |
4641.7 |
3423 2 |
2283 |
|
18 |
|
9287.1 |
|
5085 |
6074 5 |
5157.6 |
7305 1 |
5996 2 |
|
22 |
|
5415 4 |
|
3850 |
3537 |
3100 8 |
25884 |
2125 9 |
|
25 |
|
12197.9 |
|
1296 |
3368.6 |
4941.8 |
1669.9 |
1166.3 |
|
28 |
|
915.5 |
|
631 |
842.7 |
869.9 |
606.5 |
459.6 |
|
32 |
|
4804 9 |
|
3883.4 |
3039.3 |
5722.3 |
3401.7 |
1964.8 |
|
39 |
|
1409.2 |
|
756 |
1855 |
1356 |
1421 |
1878.4 |
|
74 |
|
992.8 |
|
349.3 |
597.9 |
708.5 |
741.6 |
421.6 |
|
78 |
|
352 |
|
259.9 |
342.4 |
434.8 |
172.4 |
207.2 |
|
143 |
|
4199.6 |
|
1314.8 |
2573.1 |
5070.9 |
4302.9 |
3455.3 |
|
174 |
|
3924.5 |
|
1399.1 |
5622.6 |
4217.6 |
1231.4 |
1538.6 |
|
175 |
|
6697.7 |
|
1590 |
4211.2 |
7931.3 |
7786.3 |
5294.6 |
|
191 |
|
3745.9 |
|
816.2 |
4875.5 |
3853.9 |
2370.5 |
1807.8 |
|
212 |
|
1219.1 |
|
1064.8 |
1480.3 |
1571.7 |
1350.2 |
874.7 |
|
222 |
|
8593.9 |
|
434.6 |
1994.5 |
2235.1 |
980.8 |
748.4 |
|
233 |
|
20899.6 |
|
4657 |
37907 7 |
22959 2 |
12092.7 |
30504 2 |
|
234 |
|
3763.9 |
|
1496.4 |
3667.8 |
2431.2 |
1077.6 |
1447.8 |
|
237 |
|
2711.1 |
|
2046.9 |
1892.2 |
2919 |
2374.3 |
2011.2 |
|
238 |
|
994.1 |
|
1047.3 |
1092.4 |
929.6 |
877.7 |
776.8 |
|
245 |
|
1339 1 |
|
1019 4 |
2826 7 |
1538 1 |
1379 8 |
1254.9 |
|
250 |
|
1736 |
|
710.8 |
2570.5 |
1597.7 |
1899 |
1923.8 |
|
252 |
|
2933.1 |
|
1316.3 |
1849.2 |
2395.5 |
2621 |
1992.7 |
|
264 |
|
1426.6 |
|
987 |
2826.4 |
1272.7 |
2511.5 |
1495.4 |
|
290 |
|
666.3 |
|
368.1 |
487 |
665.4 |
692.1 |
706 |
|
294 |
|
3175.8 |
|
1237.3 |
4622.7 |
3449.7 |
976.8 |
1074.7 |
|
296 |
|
1837.4 |
|
899.1 |
2639 |
2217.5 |
2398.4 |
2049.3 |
|
342 |
|
1355.2 |
|
406.1 |
1662.9 |
803.3 |
1501.3 |
863 |
|
13a11 |
|
|
|
|
|
|
|
|
|
|
Signal |
|
SEQ ID |
|
pc_EA40204_VD X884TT |
pc_EA40205_ VDX885TT |
DX886TT |
pc_EA40206_V |
pc_EA40207_ VDX890TT |
pc_EA40208 _VDX892TT |
pc_EA40209_ VDX893TT |
|
2 |
|
2895.1 |
|
2994.7 |
3397.6 |
4328.1 |
4435.3 |
5980.3 |
|
3 |
|
1144 |
|
932.3 |
1277.6 |
3294.1 |
1361.2 |
475.7 |
|
5 |
|
1096.3 |
|
1151.4 |
4943.4 |
1741.8 |
3416.4 |
653.5 |
|
6 |
|
916.1 |
|
945 |
1696.2 |
1593.6 |
1278.6 |
740.7 |
|
9 |
|
2396 9 |
|
3699 9 |
1671.3 |
1488.6 |
2591 9 |
1644 7 |
|
12 |
|
3762 2 |
|
3308 4 |
3095.3 |
2865 4 |
5996.8 |
1644.2 |
|
18 |
|
9468 3 |
|
6669 2 |
10475.1 |
18044 8 |
9220 2 |
11224.4 |
|
22 |
|
3823 4 |
|
28134 |
4326 9 |
7811.1 |
7837 |
1650 1 |
|
25 |
|
1322.8 |
|
496 |
4227.5 |
4437.5 |
1271.9 |
878.1 |
|
28 |
|
563.6 |
|
333.7 |
602.3 |
782.9 |
724.2 |
636.5 |
|
32 |
|
4985.4 |
|
854 7 |
1788.8 |
24236 |
2099.4 |
629.4 |
|
39 |
|
963 |
|
1562 |
1937.7 |
1973.7 |
1774.1 |
1387.6 |
|
74 |
|
417 |
|
443.9 |
383.6 |
600.6 |
814.2 |
578.6 |
|
78 |
|
169.9 |
|
266.2 |
346.4 |
207.7 |
507.4 |
117.7 |
|
143 |
|
2357.9 |
|
2936.4 |
2961 |
6472.6 |
4513.4 |
3395.7 |
|
174 |
|
1096.5 |
|
2227.9 |
1825 |
1268.5 |
5715 |
380.6 |
|
175 |
|
3559.1 |
|
4964.6 |
5395 |
12711.3 |
7961.8 |
5835.7 |
|
191 |
|
5320.2 |
|
8526.6 |
4668.1 |
4129.5 |
8005 |
4597.4 |
|
212 |
|
1168.2 |
|
1634.1 |
1396.4 |
1197.9 |
1161.5 |
1523.4 |
|
222 |
|
805.9 |
|
739.2 |
2330.2 |
3890.4 |
873.8 |
1137.4 |
|
233 |
|
25920.6 |
|
37919 3 |
33438 |
7762.1 |
23325.9 |
20940.7 |
|
234 |
|
1882.8 |
|
1513.3 |
2438.5 |
4528.9 |
2232.7 |
1253.9 |
|
237 |
|
2950.6 |
|
1089.9 |
1886.5 |
2930.8 |
2484.4 |
2082.4 |
|
238 |
|
1037.6 |
|
1240 |
818.8 |
709.9 |
1096.2 |
877.7 |
|
245 |
|
1151 5 |
|
1872 7 |
2007.7 |
1316.8 |
2042 3 |
17174 |
|
250 |
|
3324 |
|
2153.4 |
2363.7 |
1885.4 |
2787.9 |
3192.2 |
|
252 |
|
1641 |
|
1236.4 |
1558.6 |
2605.7 |
1944.3 |
2613.4 |
|
264 |
|
1120.1 |
|
2994.2 |
1776.5 |
1401.3 |
1517.1 |
2362.8 |
|
290 |
|
624.5 |
|
516.4 |
692.1 |
520.9 |
778.6 |
1209.7 |
|
294 |
|
1273.1 |
|
3050.2 |
1557 |
1442.8 |
3564.9 |
424.1 |
|
296 |
|
2601.3 |
|
2023.6 |
2244.2 |
2054.1 |
2777.3 |
4347 |
|
342 |
|
723.2 |
|
973.5 |
587 |
2028.3 |
679.8 |
746.2 |
|
13a12 |
|
|
|
|
|
|
|
|
|
|
Signal |
|
SEQ ID |
|
pc_EA40210_ VDX894TT |
|
02014_40319_H 133A_903TT |
02014_40320_ H133A_904TT |
02014_40328_ H133A_928TT |
02014_40330_H 133A_932TT |
02014_40331_ H133A_933TT |
|
2 |
|
4563.8 |
|
3729.2 |
2859.9 |
2475.3 |
3977.2 |
3386.3 |
|
3 |
|
475.3 |
|
827.4 |
4626.7 |
246.3 |
2009.2 |
1481.9 |
|
5 |
|
1717.5 |
|
3130.1 |
1505.9 |
1737.4 |
1875.4 |
4763.8 |
|
6 |
|
698.9 |
|
1153.2 |
2668.3 |
1104 |
1295.6 |
1385.4 |
|
9 |
|
3017.4 |
|
3184.7 |
63162 |
1911 3 |
3801.9 |
2397 6 |
|
12 |
|
1662.3 |
|
4850 |
7880 2 |
3035 |
58742 |
3637 2 |
|
18 |
|
7186 |
|
6997.2 |
14099 |
11077 7 |
97246 |
10100 8 |
|
22 |
|
1195.2 |
|
35834 |
60582 |
4793 7 |
6322 5 |
4421.3 |
|
25 |
|
587.7 |
|
868.9 |
28372.6 |
667.2 |
3526 |
4180.2 |
|
28 |
|
728.8 |
|
621.5 |
1685.2 |
927.3 |
646.4 |
882.8 |
|
32 |
|
1503.2 |
|
2517.7 |
19668 7 |
3607 7 |
1986 9 |
6399.2 |
|
39 |
|
1609.6 |
|
1035.8 |
1140.8 |
1205 |
1028.3 |
1359.6 |
|
74 |
|
240.3 |
|
718.9 |
623.5 |
583.2 |
953 |
1021.1 |
|
78 |
|
196.7 |
|
180.1 |
370.1 |
543 |
465.1 |
373.7 |
|
143 |
|
1838.3 |
|
3062.8 |
1513.2 |
2903.2 |
3977.3 |
3056.1 |
|
174 |
|
1548.4 |
|
1810.3 |
1087.6 |
2910.3 |
3511.6 |
3939.4 |
|
175 |
|
2462.7 |
|
5545.8 |
1615.4 |
4518.2 |
7011.2 |
5184.6 |
|
191 |
|
3292.3 |
|
2497.1 |
3479.2 |
1085 |
5805.4 |
2286.3 |
|
212 |
|
1289.5 |
|
1230.1 |
645.1 |
1795.6 |
639 |
1130.8 |
|
222 |
|
502.2 |
|
315.3 |
8484.1 |
1685.8 |
4996.9 |
611.8 |
|
233 |
|
40786.7 |
|
16562 |
17697.8 |
3636 9 |
19787 1 |
4648.9 |
|
234 |
|
1248.4 |
|
1443.8 |
3706.7 |
2565.5 |
2733.9 |
2463.9 |
|
237 |
|
1286.1 |
|
2852.7 |
2832.7 |
2610.7 |
2178.6 |
2681.6 |
|
238 |
|
1382.7 |
|
1243.2 |
990.6 |
1636.4 |
1423.2 |
1469.2 |
|
245 |
|
2174 |
|
1000 7 |
703.1 |
2029 7 |
1000.1 |
1302.2 |
|
250 |
|
2738.6 |
|
2792.3 |
1076.8 |
1439.3 |
3692.8 |
2113.9 |
|
252 |
|
1078.4 |
|
1615.7 |
2091.1 |
2366.6 |
1895.9 |
2343.2 |
|
264 |
|
2550.8 |
|
948.7 |
659.3 |
1351 |
811.7 |
1104.5 |
|
290 |
|
518.9 |
|
745.9 |
1057.1 |
320.1 |
924.2 |
1016.3 |
|
294 |
|
1936.2 |
|
1348.3 |
757.5 |
2287.3 |
2252.8 |
2351.2 |
|
296 |
|
2194.3 |
|
1614.6 |
1446.4 |
729.6 |
2955.6 |
1690.2 |
|
342 |
|
612.9 |
|
748.4 |
366.7 |
1061 |
1424.5 |
894.4 |
|
13a13 |
|
|
|
|
|
|
|
|
|
|
Signal |
|
SEQ ID |
|
EA02014_403 75_H133A_92 2TT |
|
EA02014_40381 _H133A_945TT |
EA02014_40382 _H133A_946TT |
EA02014_40383_H133A_94 7TT |
EA02014_4038 4_H133A_948TT |
ThyFolCan_02014_40084_H133A_823TT |
|
2 |
|
1365.7 |
|
2250.1 |
3658.1 |
2299 |
3252.8 |
3923.8 |
|
3 |
|
935.6 |
|
1124.4 |
1023.9 |
2053.6 |
1187.9 |
1004.7 |
|
5 |
|
7421.5 |
|
656.7 |
3000.3 |
4151.2 |
1730.9 |
3450.3 |
|
6 |
|
1026.6 |
|
982.6 |
1628.3 |
1939.7 |
1023.9 |
1961.6 |
|
9 |
|
10992.7 |
|
1452.2 |
2478.2 |
4581.5 |
15676 |
3548 1 |
|
12 |
|
3007 |
|
2413.7 |
5402.5 |
7248.9 |
43826 |
6659 3 |
|
18 |
|
4106.5 |
|
1506 8 |
9107 3 |
6629 5 |
9741 9 |
7072 7 |
|
22 |
|
4766 3 |
|
5493.6 |
3034.7 |
4839.3 |
4984.8 |
4552 |
|
25 |
|
900.4 |
|
10351.1 |
1252.1 |
10112.4 |
3841.3 |
7385.3 |
|
28 |
|
685.8 |
|
1022.4 |
714.8 |
1191.6 |
656.5 |
625.4 |
|
32 |
|
3099 |
|
1984 |
3215.8 |
12202 3 |
3643.5 |
4762.1 |
|
39 |
|
1012.3 |
|
480.5 |
1173 |
1094.8 |
781.3 |
1099.1 |
|
74 |
|
987.5 |
|
61.1 |
894.2 |
877.1 |
629 |
887.2 |
|
78 |
|
418.8 |
|
111.9 |
529.1 |
188.7 |
371.9 |
650.2 |
|
143 |
|
2030.1 |
|
1411.5 |
3847.8 |
2492.6 |
2091.2 |
2930.6 |
|
174 |
|
2288.4 |
|
269.9 |
4741.5 |
2231.5 |
2488.1 |
7050.3 |
|
175 |
|
2412.3 |
|
2138.9 |
6427.7 |
3285.3 |
3691.4 |
4648.5 |
|
191 |
|
617.2 |
|
983.6 |
2182.4 |
2820.3 |
2081 |
1043.3 |
|
212 |
|
1018.3 |
|
208.9 |
1054.6 |
964.8 |
771.1 |
591.5 |
|
222 |
|
725.6 |
|
8103.4 |
443.9 |
4302.9 |
1433 |
10512.7 |
|
233 |
|
4450.9 |
|
1177.3 |
20110.2 |
19683 9 |
4061 3 |
2305 1 |
|
234 |
|
1926 |
|
2079.3 |
2095.5 |
2384.8 |
2482.7 |
6283.2 |
|
237 |
|
2547.1 |
|
2912.4 |
3040.2 |
2736.1 |
3005.4 |
2681.3 |
|
238 |
|
1822.6 |
|
264.6 |
1023.9 |
929.2 |
1088.1 |
1176.9 |
|
245 |
|
2699 8 |
|
113 4 |
1230.8 |
1359 8 |
887 |
10676 |
|
250 |
|
1198.1 |
|
249 |
1802.6 |
1764.8 |
2220.8 |
1112.4 |
|
252 |
|
1311.3 |
|
613.6 |
2434.6 |
2260.9 |
1332.7 |
1526.7 |
|
264 |
|
1364.1 |
|
382.4 |
1206.6 |
1095.1 |
1210.5 |
1451.3 |
|
290 |
|
463.8 |
|
1223.5 |
805.1 |
865.9 |
867.2 |
932.7 |
|
294 |
|
2024.9 |
|
340.9 |
4085.3 |
1859.8 |
2226.1 |
3796.8 |
|
296 |
|
1214 |
|
407.7 |
1761.4 |
1917.2 |
3476.1 |
1298.6 |
|
342 |
|
619 |
|
828.4 |
1154.4 |
639.7 |
934.8 |
1110 |
|
13a14 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Signal |
|
|
|
|
SEQ ID |
ThyFolCan_02014_ 40085_H133A_824 TT |
|
ThyFolCan_0201 4_40086_H133A _825TT |
|
ThyFolCan_0201 4_40088_H133A_ _827TT |
ThyFolCan_0201440089_H133A_8 28TT |
02014_4031 8_H133A_84 0TT |
fc_EA40212_VDX896TT |
|
2 |
|
4103.9 |
|
1719.4 |
2824.5 |
3008.4 |
2542.7 |
2391.5 |
|
3 |
|
2480.6 |
|
144.5 |
880.5 |
497.6 |
1222.4 |
1069.4 |
|
5 |
|
2190.2 |
|
1199.7 |
4743.6 |
2936.8 |
3696.7 |
776.8 |
|
6 |
|
678.7 |
|
2589.2 |
2824.2 |
1605.5 |
1411.7 |
1403.4 |
|
9 |
|
6166.7 |
|
326.1 |
5428 5 |
2131 9 |
9187.9 |
10000.2 |
|
12 |
|
2872 9 |
|
12574 |
4087 8 |
3981.7 |
7045.4 |
3506 5 |
|
18 |
|
2329.3 |
|
4765.3 |
11522.2 |
72662 |
30454 |
4683.8 |
|
22 |
|
4848.8 |
|
1224 5 |
3611.1 |
6001.8 |
8784 3 |
1719.5 |
|
25 |
|
11319.1 |
|
234.5 |
3308.3 |
557.1 |
3685.8 |
383.8 |
|
28 |
|
772.7 |
|
206.8 |
830.6 |
1057.1 |
1256.5 |
1118.8 |
|
32 |
|
2272 |
|
1393 6 |
5410.1 |
3330.7 |
13825 |
869 |
|
39 |
|
892.8 |
|
541.9 |
838.5 |
941.3 |
1041 |
3461.7 |
|
74 |
|
126.8 |
|
2071.9 |
988.3 |
1357.4 |
696.8 |
1290.4 |
|
78 |
|
253.6 |
|
307.6 |
635.6 |
920.6 |
422.6 |
705.5 |
|
143 |
|
2718.2 |
|
1570.7 |
2322.8 |
2621.6 |
1038.8 |
4569.2 |
|
174 |
|
323 |
|
1399.8 |
2817 |
9345.5 |
876 |
8849.8 |
|
175 |
|
4437.4 |
|
1584 |
4411.6 |
4784.9 |
1387.4 |
7804.9 |
|
191 |
|
2214.1 |
|
575.3 |
641 |
1208.4 |
1370.9 |
4609.8 |
|
212 |
|
1667.2 |
|
662.2 |
577.7 |
1864 |
1229 |
590.6 |
|
222 |
|
13107.5 |
|
470.6 |
1030.1 |
3020.4 |
431.9 |
641.9 |
|
233 |
|
3196 |
|
1087 3 |
2932.3 |
7081 |
12626 7 |
4567 8 |
|
234 |
|
1659.8 |
|
875 |
2243.3 |
1839.4 |
1328 |
7454.4 |
|
237 |
|
4693.9 |
|
830.4 |
3700.2 |
2563.5 |
3040.5 |
1008.9 |
|
238 |
|
206.3 |
|
244.8 |
1695.9 |
2546.2 |
1614.2 |
1880.4 |
|
245 |
|
248 7 |
|
425 |
1273.9 |
1215.4 |
1333 6 |
2807 1 |
|
250 |
|
935.9 |
|
379.8 |
2284.4 |
894.4 |
867.2 |
844.3 |
|
252 |
|
1005.5 |
|
1023.3 |
1166.6 |
1884.3 |
1524.6 |
678.4 |
|
264 |
|
231.5 |
|
589 |
1480.9 |
1740.6 |
670.9 |
2459.5 |
|
290 |
|
638.4 |
|
233 |
961.8 |
668.6 |
430.5 |
996 |
|
294 |
|
253.4 |
|
1349.8 |
3087.1 |
7034.2 |
1137.3 |
7044.6 |
|
296 |
|
1530.8 |
|
1570.6 |
1591.5 |
1110.6 |
1647.7 |
1498.9 |
|
342 |
|
1457.8 |
|
712.8 |
1052.1 |
946.9 |
436.8 |
1893.8 |
|
13a15 |
|
|
|
|
|
|
|
|
|
|
Signal |
|
SEQ ID |
fc_EA40214_ VDX898TT |
|
fc_EA40215_VDX899TT |
X900TT |
fc_EA40216_VD |
fc_EA40217 VDX901TT |
_fc_EA40218_ VDX902TT |
fc_EA40221_ VDX909TT |
|
2 |
|
2470.7 |
|
3328.2 |
4429.9 |
993.8 |
2649.9 |
4427.4 |
|
3 |
|
226.4 |
|
523.3 |
1216.2 |
230.6 |
417 |
2364.4 |
|
5 |
|
1037.2 |
|
3614.5 |
1440.6 |
3319 |
1487.4 |
9590 |
|
6 |
|
997 |
|
685.7 |
1641.1 |
967.8 |
2453.4 |
2537.2 |
|
9 |
|
384 9 |
|
1897 9 |
973.8 |
468.7 |
915.8 |
3339 3 |
|
12 |
|
9940.9 |
|
1131.5 |
4352 5 |
3202.2 |
4269.6 |
15203.8 |
|
18 |
|
4150 7 |
|
7715 2 |
5736.9 |
555.2 |
9139 4 |
7575.1 |
|
22 |
|
499.6 |
|
4466 |
2120 9 |
208.2 |
1563 8 |
1471.9 |
|
25 |
|
1721.2 |
|
1912 |
10485.2 |
826.1 |
1002 |
6640.8 |
|
28 |
|
232.1 |
|
706.8 |
501.4 |
122.6 |
779.4 |
645.5 |
|
32 |
|
2728 |
|
3753 |
2644 6 |
1820.8 |
3404 5 |
10045 3 |
|
39 |
|
1006.6 |
|
1103.3 |
1192.6 |
880.8 |
2310.8 |
346.3 |
|
74 |
|
2642.5 |
|
794.9 |
374.8 |
1621.8 |
1057.9 |
294 |
|
78 |
|
294.6 |
|
280.8 |
131.2 |
136.4 |
344.4 |
391.3 |
|
143 |
|
2141.4 |
|
2616.6 |
5902.7 |
3882.4 |
3860.3 |
2140.3 |
|
174 |
|
407.1 |
|
2263.7 |
4270 |
2006.5 |
2076.1 |
4365.1 |
|
175 |
|
2416.2 |
|
3697.7 |
9897.3 |
6489.5 |
5706.6 |
2832.4 |
|
191 |
|
1436.8 |
|
2900.8 |
5153.2 |
165.9 |
963.5 |
512.1 |
|
212 |
|
839.5 |
|
1241.8 |
173.4 |
186.6 |
451.1 |
539.9 |
|
222 |
|
293.5 |
|
1318.1 |
6645.4 |
426.3 |
623.3 |
2727.5 |
|
233 |
|
17314 7 |
|
18164.1 |
2971 6 |
2885.8 |
2068 7 |
15099.5 |
|
234 |
|
2834.4 |
|
1575.6 |
3547 |
904.6 |
3783.5 |
6440.1 |
|
237 |
|
945.9 |
|
3105.6 |
1268.9 |
2192.9 |
893.1 |
2333.7 |
|
238 |
|
702.9 |
|
1189 |
744.7 |
554.4 |
383.3 |
908.6 |
|
245 |
|
9146 |
|
1729.7 |
1038.5 |
8394 |
7842 |
459 1 |
|
250 |
|
845.9 |
|
2673.5 |
2175.8 |
702.9 |
1305.7 |
723.2 |
|
252 |
|
1300.4 |
|
2454.3 |
1377.7 |
1061.4 |
1235.8 |
2869.5 |
|
264 |
|
467.6 |
|
1277.4 |
638.7 |
2058 |
1076.7 |
569.3 |
|
290 |
|
573.7 |
|
617.2 |
993.4 |
767.4 |
1281.3 |
866.1 |
|
294 |
|
507.1 |
|
1922.1 |
2827.1 |
1753.3 |
1585.8 |
2926.6 |
|
296 |
|
2156.2 |
|
2563 |
1832.8 |
533.7 |
2130.3 |
2647.8 |
|
342 |
|
535.6 |
|
937.4 |
2261.2 |
1949.2 |
975.7 |
618.5 |
|
13a16 |
|
|
|
|
|
|
|
|
|
|
Signal |
|
SEQ ID |
fc_EA40222 _VDX910TT |
|
EA02014_40386_H133A_954TT |
|
EA02014_40394 _H133A_967TT |
EA02014_40395 _H133A_968TT |
EA02014_40396_H133A_969TT |
EA02014_40397 _H133A_970TT |
|
2 |
|
2362.1 |
|
1417 |
1834.4 |
2135.5 |
3006.2 |
1378.8 |
|
3 |
|
254.5 |
|
263.8 |
293.1 |
346.3 |
346.5 |
230.2 |
|
5 |
|
2789.1 |
|
8005.6 |
1358.8 |
637.3 |
1214.1 |
1214.7 |
|
6 |
|
1096.6 |
|
1050.7 |
1291.7 |
987.4 |
1223.8 |
2564.6 |
|
9 |
|
834 8 |
|
1052.4 |
2701.2 |
1171.4 |
6080 |
4404 |
|
12 |
|
2031.6 |
|
4283 7 |
2805 1 |
4294.1 |
4966.4 |
1686 4 |
|
18 |
|
9498.5 |
|
18893.2 |
15454.8 |
23854 |
3575 2 |
14192 8 |
22 |
|
|
1449.5 |
1020 |
888 3 |
25854 |
|
3721.5 |
727 2 |
25 |
|
|
541.3 |
253.5 |
572.5 |
3378.9 |
|
709.2 |
372 |
28 |
|
|
502.3 |
443 |
868.6 |
378.9 |
|
964.1 |
341.9 |
32 |
|
|
1205 9 |
7122 3 |
811 1 |
2553 9 |
|
797 |
1753 4 |
39 |
|
|
1215.4 |
1031.1 |
511 |
722 |
|
2166.1 |
527.2 |
74 |
|
|
1385.4 |
1477.5 |
509.1 |
1159.3 |
|
1031.4 |
495.4 |
78 |
|
|
367.5 |
834.2 |
200.7 |
235.3 |
|
433.7 |
262.9 |
143 |
|
|
1956.7 |
1083.1 |
1486.7 |
2746 |
|
2538.4 |
1943.7 |
174 |
|
|
4466.4 |
2823.7 |
1156.3 |
3547.9 |
|
1541.5 |
2214.3 |
175 |
|
|
1799.1 |
1264 |
1758.7 |
4539.5 |
|
3663.3 |
2264.4 |
191 |
|
|
560.2 |
1494 |
607.9 |
2943.2 |
|
2727.4 |
1474.7 |
212 |
|
|
1046.1 |
307.8 |
548.8 |
340.4 |
|
982.9 |
647 |
222 |
|
|
248.3 |
533.1 |
1356.4 |
1194.2 |
|
1169.8 |
228.2 |
233 |
|
|
1183 6 |
612 7 |
1063.5 |
5528 1 |
|
6265.3 |
1076 |
234 |
|
|
1886.7 |
3460.3 |
1207.2 |
2384.1 |
|
3860.6 |
3322.7 |
237 |
|
|
934.6 |
933.5 |
2133.3 |
791 |
|
1890.7 |
1257.5 |
238 |
|
|
834.9 |
291.1 |
1034.1 |
380.8 |
|
946.4 |
415 |
245 |
|
|
1509 7 |
786 |
657.1 |
384 9 |
|
47734 |
447.6 |
250 |
|
|
2406.8 |
1245.7 |
1247.1 |
659 |
|
1647.1 |
595 |
252 |
|
|
1536.8 |
1182.4 |
1035.6 |
526.7 |
|
893 |
1276.7 |
264 |
|
|
1315.8 |
582.8 |
1373.3 |
958 |
|
1622.3 |
508.6 |
290 |
|
|
732.4 |
835.3 |
683.8 |
1744.3 |
|
523 |
850.2 |
294 |
|
|
2817 |
2372.1 |
929.5 |
2611.8 |
|
1279.4 |
2097.3 |
296 |
|
|
1088.4 |
1541 |
2014.6 |
621.4 |
|
1368.3 |
981.8 |
342 |
|
|
763.6 |
866.9 |
722.2 |
559 |
|
594.3 |
445.9 |
13a17 |
|
|
|
|
|
|
|
|
|
|
Signal |
SEQ ID |
|
|
EA02014_40405_H133A_982TT |
EA02014_40406_ H133A_983TT |
pb1 |
pb2 |
pb3 |
pb4 |
pb5' |
2 |
|
|
3615.6 |
2106 |
204.1 |
324.2 |
178.6 |
206.6 |
249.1 |
3 |
|
|
765 |
372.2 |
171.5 |
303.8 |
159.1 |
61.1 |
90.2 |
5 |
|
|
2446.1 |
394 |
107.9 |
19.9 |
68.8 |
74.6 |
69 |
6 |
|
|
1051.6 |
1176 |
211.6 |
214.4 |
318.6 |
218.8 |
355.4 |
9 |
|
|
2059.2 |
1081.4 |
18 |
18.8 |
29 2 |
9.7 |
134 |
12 |
|
|
3520 |
391 5 |
11.4 |
9.1 |
9 9 |
33.8 |
8.3 |
18 |
|
|
46334 |
13339 |
942 |
50 7 |
67 6 |
74.9 |
29 7 |
22 |
|
|
6678 8 |
403.5 |
80.1 |
8.8 |
58 9 |
6.8 |
5 |
25 |
|
|
1229.9 |
601.5 |
197.1 |
106.7 |
65.2 |
18.7 |
87.1 |
28 |
|
|
778.2 |
197.6 |
11.4 |
9 |
6.6 |
11.3 |
1.7 |
32 |
|
|
1302 9 |
4182.6 |
8 7 |
216 |
30 5 |
66 1 |
646 |
39 |
|
|
2104 |
699 |
246.6 |
121.1 |
42.8 |
122.8 |
171.7 |
74 |
|
|
1189.7 |
1142.3 |
59.9 |
94.4 |
70.3 |
29 |
5.2 |
78 |
|
|
833.6 |
80.9 |
48 |
45.5 |
66.9 |
49.5 |
119.7 |
143 |
|
|
2842.2 |
1778.2 |
290 |
291.2 |
190.4 |
65.6 |
203.5 |
174 |
|
|
3307.3 |
329.8 |
29.8 |
42.8 |
25.8 |
11.5 |
13.9 |
175 |
|
|
3878.9 |
1966.8 |
165.7 |
282.2 |
158.3 |
67.2 |
249.2 |
191 |
|
|
3952.2 |
5278 |
46.8 |
181.4 |
148.2 |
97.3 |
152.1 |
212 |
|
|
2201.7 |
1134.3 |
70.4 |
55.7 |
3.5 |
87 |
99.8 |
222 |
|
|
469 |
451.7 |
120.4 |
148.4 |
57.7 |
49.6 |
58 |
233 |
|
|
11069 2 |
5607 |
13 |
9.8 |
76.9 |
7.6 |
5.6 |
234 |
|
|
3590 |
3449.5 |
186 |
201.3 |
165.3 |
54.8 |
141.1 |
237 |
|
|
2057.6 |
740.2 |
135.3 |
150.7 |
16.6 |
14.5 |
19 |
238 |
|
|
1679.4 |
432.3 |
22.5 |
43.8 |
11.4 |
6.2 |
5.1 |
245 |
2301.6 |
|
1040.5 |
7.1 |
12.7 |
22.5 |
5.9 |
4.6 |
250 |
434.6 |
|
1079.4 |
97.8 |
138.9 |
33.7 |
71.3 |
46.8 |
252 |
844.6 |
|
1446.1 |
35.6 |
80.3 |
29.6 |
63.3 |
88.5 |
264 |
1125.7 |
|
1084.5 |
102.8 |
31.6 |
147.6 |
101.5 |
163.3 |
290 |
347.9 |
|
466.9 |
35.8 |
7.3 |
14.4 |
87.2 |
71.7 |
294 |
1601.7 |
|
575.2 |
105.1 |
94.5 |
41.5 |
31.9 |
35.3 |
296 |
872.8 |
|
1349.1 |
217.8 |
162.6 |
186.2 |
171.2 |
212.5 |
342 |
948.7 |
|
482.8 |
296.5 |
220.2 |
308.1 |
126.3 |
298.6 |
13a18 |
|
|
|
|
|
|
|
|
|
|
Signal |
SEQ ID |
pb6' |
pb7' |
pb8' |
pd10 |
pd11 |
pd12 |
pd9 |
|
|
2 |
167.6 |
233.9 |
232.6 |
116.9 |
204.5 |
293.2 |
79.6 |
|
|
3 |
110.3 |
88 |
221 |
90.7 |
74.9 |
90.9 |
129.5 |
|
|
5 |
29.7 |
70.2 |
182.5 |
32.6 |
34.5 |
130.5 |
12.9 |
|
|
6 |
226.5 |
440.1 |
207 |
219.7 |
275.2 |
134.1 |
193.1 |
|
|
9 |
28.9 |
26.8 |
30.9 |
32.4 |
5.3 |
25.7 |
20.3 |
|
|
12 |
6.6 |
18.8 |
61.4 |
38.2 |
10.7 |
4.1 |
11.6 |
|
|
18 |
53.6 |
37.8 |
31.8 |
68.8 |
117.5 |
70.8 |
23.4 |
|
|
22 |
16.9 |
10.6 |
32.1 |
6.4 |
29.2 |
21.2 |
3.1 |
|
|
25 |
127 |
123.7 |
118.7 |
9.7 |
10.6 |
64.9 |
6.6 |
|
|
28 |
13.2 |
4.9 |
43.3 |
8 |
8.1 |
12 |
26.6 |
|
|
32 |
36.4 |
51.5 |
25.1 |
17.2 |
17.2 |
19.7 |
11 |
|
|
39 |
326.5 |
182.6 |
27.3 |
126.2 |
151.9 |
26 |
182.7 |
|
|
74 |
48.2 |
29 |
39.8 |
55.3 |
35.3 |
76.9 |
6.2 |
|
|
78 |
92.1 |
20 |
93.1 |
26.9 |
11.9 |
56.6 |
104.8 |
|
|
143 |
176.4 |
224.5 |
248.5 |
126.2 |
184.6 |
162.8 |
249.6 |
|
|
174 |
40.8 |
149.8 |
24.2 |
10.6 |
15.6 |
81.4 |
16.8 |
|
|
175 |
262.5 |
355.4 |
207.8 |
21.6 |
213.9 |
175.8 |
193.7 |
|
|
191 |
151.2 |
310.7 |
93.3 |
65.7 |
108.4 |
95.9 |
79.3 |
|
|
212 |
93.6 |
121.7 |
141.7 |
30.8 |
42.6 |
108.4 |
93.2 |
|
|
222 |
83.5 |
82.8 |
60.7 |
16.4 |
50 |
71.1 |
66.9 |
|
|
233 |
144.7 |
64.1 |
16.5 |
7 |
6.4 |
70.8 |
8.1 |
|
|
234 |
40.4 |
248.1 |
43.8 |
45.5 |
143.3 |
30.9 |
77.2 |
|
|
237 |
223.8 |
141.1 |
129.5 |
57.6 |
21.9 |
11.5 |
18.7 |
|
|
238 |
32.1 |
27.6 |
66.5 |
10.5 |
33.4 |
7.7 |
61.6 |
|
|
245 |
19.8 |
7.2 |
4.8 |
2.4 |
11.2 |
4.7 |
6.7 |
|
|
250 |
75.3 |
109.2 |
65.3 |
85.7 |
119.9 |
118.7 |
66.4 |
|
|
252 |
103.8 |
91.2 |
94.8 |
17 |
69.3 |
76.1 |
22.5 |
|
|
264 |
151 |
224.6 |
129.9 |
122.8 |
99.8 |
61.5 |
24.8 |
|
|
290 |
21.8 |
27.6 |
50.7 |
49.3 |
6.2 |
2.7 |
3 |
|
|
294 |
91.1 |
58.4 |
40 |
24.8 |
52.6 |
67.8 |
31.7 |
|
|
296 |
282.4 |
299.2 |
143.7 |
149.7 |
197.9 |
205.2 |
147.7 |
|
|
342 |
304.5 |
437.8 |
327.4 |
90.9 |
247.6 |
224.4 |
268.6 |
|
|
Table 13b
|
|
13b1 |
|
|
|
|
|
|
|
|
|
|
ThyMixBen_02014_....._Signal |
|
|
SEQ ID |
40062_H133A_ 800TT |
40063_H133A _801TT |
40064_H133 A_802TT |
40065_H133 A_804TT |
40066_H133A_ 805TT |
40067_H13 3A_806TT |
40068_H13 3A_807TT |
|
|
83 |
156.7 |
114.3 |
73.8 |
240.3 |
173 |
193.6 |
291.2 |
|
|
142 |
28.3 |
7.9 |
15 |
28.4 |
26.9 |
25.8 |
14.2 |
|
|
136 |
100.4 |
23.4 |
15.3 |
106.9 |
28.3 |
14.9 |
56 |
|
|
137 |
527.2 |
47 |
32.3 |
177.2 |
19.5 |
53.1 |
404.6 |
|
|
152 |
237 5 |
230 4 |
188 7 |
465 2 |
183 |
260 9 |
190 9 |
|
|
160 |
291.6 |
141.9 |
80.9 |
323.1 |
98.1 |
120.3 |
219.7 |
|
|
163 |
15.6 |
53.1 |
25.1 |
70.8 |
20.1 |
56.1 |
47.8 |
|
|
165 |
190.2 |
230.7 |
142.4 |
483.5 |
179.3 |
241.7 |
410.9 |
|
|
210 |
436.9 |
8.6 |
18 4 |
343 7 |
31 8 |
8 |
148 1 |
|
|
214 |
269.2 |
134.4 |
167.7 |
141.8 |
145.7 |
140.5 |
349.1 |
|
|
219 |
217 |
19.6 |
7.9 |
85.6 |
21.8 |
26 7 |
115 1 |
|
|
224 |
588.2 |
121.4 |
119.2 |
275.2 |
136.6 |
240.5 |
392.5 |
|
|
225 |
508.1 |
30.1 |
42.3 |
107.3 |
59.4 |
29.5 |
147.3 |
|
|
226 |
57.3 |
48.2 |
80.9 |
103.9 |
43.5 |
12.3 |
88.9 |
|
|
309 |
257 7 |
20 6 |
20 7 |
75 5 |
19 2 |
24 |
833 9 |
|
|
332 |
287.1 |
17 |
26.1 |
103.8 |
115.9 |
68.8 |
37.9 |
|
|
346 |
622.2 |
18.3 |
24 |
17.6 |
20.7 |
13.2 |
442.1 |
|
|
13b2 |
|
|
|
|
|
|
|
|
|
|
02014_...._Signal |
|
|
SEQ ID |
40198_H13 3A_871TT |
40321_H13 3A_913TT |
40322_H133A_914TT |
40323_H133 A_915TT |
40324_H133A_917TT |
40325_H133A_9 18TT |
40326_H133A_919TT |
|
|
83 |
39.5 |
90.2 |
76.4 |
255.8 |
150.8 |
109.7 |
142.6 |
|
|
142 |
253 |
225 |
129 |
34.4 |
85 |
206 |
67 7 |
|
|
136 |
9 8 |
31 8 |
16 8 |
132 |
115.4 |
130 |
7 2 |
|
|
137 |
227.8 |
53.6 |
68.7 |
60.1 |
29.6 |
133.2 |
29 |
|
|
152 |
1844 |
214.3 |
253.2 |
294.7 |
313 8 |
251 3 |
294 2 |
|
|
160 |
267.5 |
250.7 |
206.5 |
328.8 |
191.1 |
220.8 |
114.4 |
|
|
163 |
44.3 |
56.4 |
23.9 |
98.5 |
35.2 |
68 |
41.8 |
|
|
165 |
174.3 |
221.8 |
185.5 |
266.3 |
104.6 |
217.1 |
159.9 |
|
|
210 |
25.8 |
153.6 |
42 |
55.5 |
8.2 |
152 |
49.1 |
|
|
214 |
43.2 |
83.6 |
110.6 |
213.7 |
132.6 |
89.3 |
138.7 |
|
|
219 |
56.6 |
53 5 |
45.2 |
122 1 |
24.4 |
124 |
41 3 |
|
|
224 |
269.7 |
357.4 |
260 |
191.5 |
168.8 |
330.8 |
169.8 |
|
|
225 |
204.8 |
322.6 |
114.2 |
55.6 |
121.8 |
317.6 |
95.8 |
|
|
226 |
11.9 |
57.4 |
69.9 |
22 |
67.5 |
33.6 |
19.3 |
|
|
309 |
37 9 |
37 |
28.2 |
53 |
10 2 |
32.6 |
24.2 |
|
|
332 |
9.9 |
59.2 |
66.7 |
57.8 |
13 |
40.5 |
9 |
|
|
346 |
28.6 |
263.8 |
11.1 |
27.2 |
32.5 |
153.4 |
61.1 |
|
|
13b3 |
ThyFolBen_02014_...._Signal |
|
SEQ ID |
|
40079_H133A_818TT |
40080_H133A_819TT |
40081_H133A_8 20TT |
40082_H133A_8 21TT |
40083_H133A_822TT |
|
|
83 |
63.4 |
151.8 |
104.1 |
27.5 |
138.9 |
|
|
142 |
15 |
20 2 |
18.8 |
184 |
23 |
|
|
136 |
176 |
1354 |
771 |
317 7 |
177 |
|
|
137 |
24.7 |
36.1 |
18 |
28.4 |
42.6 |
|
|
152 |
62.1 |
176 7 |
1464 |
273 |
328 2 |
|
|
160 |
153 |
138.1 |
131 |
192.4 |
124.1 |
|
|
163 |
6.9 |
21.4 |
35 |
63.5 |
13.4 |
|
|
165 |
28.7 |
155.3 |
112.6 |
135.2 |
222.6 |
|
|
210 |
27.5 |
104 |
8 1 |
9.9 |
32 7 |
|
|
214 |
211.7 |
210.8 |
83.9 |
166.4 |
160.2 |
|
|
219 |
18.7 |
111 8 |
45 7 |
10.9 |
296 |
|
|
224 |
114.7 |
241.8 |
100 |
160.9 |
242.4 |
225 |
|
69.4 |
|
63.8 |
|
145.4 |
|
110.9 |
126.1 |
226 |
|
92.1 |
|
95.5 |
|
36.3 |
|
74.5 |
67.2 |
309 |
|
16 8 |
|
17 1 |
|
12 1 |
|
18.8 |
27 3 |
332 |
|
40 |
|
20.5 |
|
21 |
|
11 |
6.6 |
346 |
|
7.2 |
|
27.1 |
|
18.6 |
|
29.3 |
26.7 |
13b4 |
|
|
|
|
|
|
|
|
|
|
fa_EA40...._Signal |
SEQ ID |
191_VDX 862TT |
192_VDX 863TT |
193_VDX 864TT |
194_VDX 865TT |
195_VDX 866TT |
196_VDX 867TT |
197_VDX 869TT |
219_VDX 907TT |
220_VDX 908TT |
83 |
26.9 |
24.4 |
56.7 |
155.1 |
22.3 |
94.8 |
63 |
41.9 |
256 |
142 |
16 1 |
224 |
14 5 |
54.8 |
17.1 |
15 8 |
15 |
21 9 |
23.9 |
136 |
23 |
59 |
204 |
121.4 |
12 5 |
884 |
77.1 |
47.1 |
36 8 |
137 |
26.7 |
32.4 |
19.4 |
45.2 |
32.8 |
30.8 |
55.2 |
97 |
63.4 |
152 |
75.7 |
189 4 |
211.4 |
320.4 |
194 |
75 |
314 |
114.8 |
260 |
160 |
239.5 |
101.4 |
91.3 |
292.1 |
55.8 |
86.8 |
53.7 |
47.4 |
145.4 |
163 |
48.5 |
47.6 |
23.1 |
168.3 |
35.4 |
13.4 |
51.5 |
13.5 |
60.4 |
165 |
26.5 |
94.3 |
81.1 |
197.9 |
112.9 |
164.6 |
155.9 |
29.7 |
250.4 |
210 |
32 |
162 |
23.8 |
81 4 |
25 3 |
22 7 |
140.5 |
15 5 |
200.8 |
214 |
119.9 |
130.9 |
141.7 |
235.4 |
263.7 |
30.4 |
124.9 |
57 |
241 |
219 |
80.6 |
7.6 |
15.9 |
20.9 |
25 |
10 |
16.5 |
23 4 |
20.1 |
224 |
50.9 |
25.8 |
50 |
80 |
32.6 |
99.7 |
136.4 |
137.5 |
167 |
225 |
66.7 |
41.4 |
64.4 |
69.5 |
18.1 |
94.7 |
51.1 |
51.6 |
149.8 |
226 |
76 |
2.8 |
3.5 |
99.1 |
88.6 |
18.3 |
60.6 |
6.4 |
11.6 |
309 |
6.7 |
15 2 |
9 4 |
62.6 |
20.2 |
18.4 |
15.9 |
10.2 |
33.3 |
332 |
9.6 |
36.9 |
10.8 |
91.1 |
103 |
30.1 |
12.3 |
19.7 |
36.5 |
346 |
25.1 |
16.5 |
20.8 |
89.5 |
34.2 |
20.9 |
18.3 |
11.3 |
114.6 |
13b5 |
|
|
|
|
|
|
|
|
|
|
02014_...._Signal |
SEQ ID |
40327_H133A_920TT |
40332_H133A_938TT |
40334_H133A_941TT |
40335_H133A_940TT |
83 |
216.8 |
145.1 |
58.1 |
102.1 |
142 |
222 |
79 |
66 |
14.5 |
136 |
717 |
30.1 |
47 9 |
57 1 |
137 |
47 |
48.1 |
69.1 |
57.4 |
152 |
252 7 |
189 |
184 9 |
138 7 |
160 |
153.6 |
179.9 |
121.9 |
66.6 |
163 |
53.3 |
13 |
69.1 |
38.6 |
165 |
146.9 |
146.7 |
85.1 |
120 |
210 |
24 |
59 1 |
21 5 |
23.8 |
214 |
90.5 |
224.7 |
178.7 |
139.3 |
219 |
364 |
175 |
14.9 |
633 |
224 |
180.2 |
126.6 |
154.2 |
161 |
225 |
59.7 |
197.5 |
83.8 |
115.7 |
226 |
31.9 |
58.1 |
33.7 |
34.5 |
309 |
27.1 |
7.7 |
62 |
15.6 |
332 |
83.8 |
7.3 |
40.7 |
47.6 |
346 |
17 |
18.8 |
27.6 |
24.4 |
13b6 |
|
|
|
|
|
|
|
|
|
|
EA02014_...._Signal |
SEQ ID |
40374_H133A_921TT |
40376_H133A_923TT |
40377_H133A_924TT |
40378_H133A_925TT |
40379_H133A_926TT |
40380_H133A_927TT |
83 |
174.4 |
32.7 |
|
69.1 |
|
86.6 |
67.7 |
204.9 |
142 |
13 7 |
19 8 |
16 5 |
57 7 |
229 |
189 |
136 |
24 2 |
93 3 |
121 |
25 3 |
1904 |
163 |
137 |
38.3 |
143.4 |
28.2 |
77.5 |
156.1 |
255.2 |
152 |
178 2 |
230 8 |
155 |
237 4 |
235 7 |
70 |
160 |
125.2 |
133.5 |
74.9 |
197 |
170.1 |
234 |
163 |
54.4 |
4.9 |
35.5 |
46.1 |
65.2 |
59.9 |
165 |
218.9 |
155.1 |
206 |
85.6 |
158.1 |
532.5 |
210 |
36 8 |
25 |
20 6 |
25 8 |
19 8 |
551 3 |
214 |
126.7 |
186.1 |
167.2 |
114.1 |
191.9 |
161.4 |
219 |
32 3 |
25 5 |
153 |
10.2 |
956 |
185 |
224 |
220.8 |
301.9 |
129.7 |
178.8 |
308.2 |
270.9 |
225 |
158 |
221.8 |
127.9 |
65.6 |
269.4 |
60.6 |
226 |
37.5 |
33.4 |
9.6 |
57.2 |
80.8 |
18.1 |
309 |
26.1 |
16 |
17.8 |
31.8 |
32.6 |
49.2 |
332 |
26.3 |
38.5 |
6.7 |
11.6 |
73.5 |
21.6 |
346 |
20.7 |
151.4 |
21.6 |
19.2 |
179.4 |
53.6 |
13b7 |
|
|
|
|
|
|
|
|
|
|
EA02014_...._Signal |
SEQ ID |
40387_H133A_955TT |
40388_H133A_956TT |
40389_H133A _957TT |
40390_H13 3A_959TT |
40391 _H 133 A_960TT |
40392_H13 3A_961TT |
40393_H133A_962TT |
83 |
29.1 |
121.5 |
70.7 |
28.8 |
121.6 |
120.5 |
34 |
142 |
16 7 |
14 2 |
10.8 |
21.4 |
18 6 |
16 5 |
21 9 |
136 |
15.7 |
27 8 |
67 7 |
45 9 |
15.4 |
8.2 |
43 |
137 |
28.5 |
44.8 |
34.5 |
50 |
31.3 |
162.2 |
18.5 |
152 |
85.4 |
163 |
183.4 |
127.1 |
298.3 |
193 |
221 2 |
160 |
121.9 |
51.9 |
175 |
137.4 |
208.5 |
125.9 |
162.9 |
163 |
47 |
27.7 |
43.6 |
80.1 |
29.7 |
33.8 |
44.4 |
165 |
42.2 |
122.9 |
103.8 |
150.6 |
253.3 |
106.9 |
221.6 |
210 |
27 1 |
5.2 |
20 4 |
73.7 |
29.4 |
38 7 |
85 |
214 |
36.4 |
68.3 |
165.9 |
25.3 |
129.8 |
165.9 |
100.9 |
219 |
23.3 |
51 |
29.1 |
25.7 |
67 |
20 8 |
21 |
224 |
143.8 |
95.1 |
128.8 |
78.7 |
108.8 |
152 |
109 |
225 |
140.5 |
83.1 |
34.3 |
54 |
62.8 |
114.7 |
94.3 |
226 |
4.3 |
24.7 |
84.1 |
47.7 |
33.3 |
66.1 |
13.3 |
309 |
18.7 |
11 4 |
26.7 |
44 2 |
20 6 |
34.1 |
35 2 |
332 |
11.1 |
4 |
37.9 |
14.1 |
17.8 |
13.1 |
11.5 |
346 |
21.8 |
22.1 |
12.8 |
35.7 |
38.7 |
29.6 |
10.1 |
13b8 |
|
|
|
|
|
|
|
|
|
|
ThyPapCan_02014_...._Signal |
SEQ ID |
40090_H133A_829T T |
40091_H133A_830T T@IC T |
40092_H133A_831T T |
40093_H133A_832TT |
40095_H1 33A_834T |
40096_H133A_835TT |
40097_H133A_836T |
40098_H133A_837T T@I2 |
40099_H133A_838TTT@I2 |
83 |
304.3 |
199.4 |
258.5 |
171.4 |
112.3 |
186.5 |
28.5 |
137.1 |
85.9 |
142 |
26 |
34.7 |
22.4 |
19.1 |
16.4 |
25.8 |
12.1 |
22.5 |
15.4 |
136 |
122 |
116.6 |
21 7 |
27 3 |
30 7 |
110.2 |
143.8 |
14 1 |
140 7 |
137 |
40.7 |
72 |
23.8 |
36.8 |
19.5 |
31.5 |
29.6 |
29.4 |
32.5 |
152 |
611 5 |
6826 |
236 2 |
170.5 |
2006 |
104 |
1364 |
118 |
155.9 |
160 |
218.1 |
244.7 |
225.4 |
68.9 |
76.4 |
137.3 |
83.2 |
171.7 |
66.7 |
163 |
17.8 |
119.7 |
38.9 |
51.8 |
52.9 |
42.7 |
25.5 |
57.2 |
23.6 |
165 |
370.6 |
263.3 |
353.8 |
154.1 |
165.1 |
233.2 |
100.4 |
227.9 |
213.3 |
210 |
223 2 |
249.8 |
303 |
9 7 |
30 2 |
94 5 |
2.1 9 |
42 1 |
23 1 |
214 |
178.4 |
246.7 |
155.4 |
188.3 |
138.6 |
133.7 |
69 |
298.6 |
90.8 |
219 |
36 8 |
1364 |
64.9 |
24.3 |
19 1 |
25 9 |
11.7 |
13 6 |
23 8 |
224 |
364.7 |
427.6 |
180 |
191.1 |
163.6 |
211.5 |
36.2 |
303.4 |
164.5 |
225 |
333.9 |
213.5 |
221 |
124.6 |
137.2 |
195.1 |
46.9 |
145.6 |
34.3 |
226 |
179.2 |
142 |
57 |
15.4 |
13.7 |
91.8 |
33.5 |
132.6 |
38 |
309 |
88 8 |
1366 |
48 8 |
22.1 |
236 |
40 5 |
16 5 |
33.9 |
24 7 |
332 |
92 |
56.9 |
42.4 |
61.1 |
34.4 |
70.6 |
14.5 |
108.1 |
60.8 |
346 |
58.4 |
61 |
197.1 |
38 |
29.1 |
281.5 |
37.5 |
30.8 |
33 |
13b9 |
|
|
|
|
|
|
|
|
|
Signal |
SEQ ID |
02014_40317_H 133A_839TT |
pc-EA40200VDX879TT |
pc_EA40200_VDX381TT |
pc_EA40202_V DX883TT |
pc_EA40203_VDX884TT |
pc_EA40204_VDX884TT |
83 |
288.1 |
25.7 |
32.9 |
29.2 |
58.6 |
184.4 |
142 |
161 |
21.2 |
235 |
7 6 |
21.5 |
306 |
136 |
62 8 |
160 5 |
141 2 |
8 7 |
13.2 |
194 |
137 |
45.4 |
155.5 |
35.5 |
63.9 |
41.5 |
31.1 |
152 |
3834 |
197 |
90.6 |
123.7 |
188 |
240 |
160 |
142.9 |
79.7 |
181.6 |
205.4 |
157.5 |
137.8 |
163 |
60.7 |
102.6 |
138.6 |
54.2 |
51.3 |
9.1 |
165 |
238.4 |
123.6 |
227.1 |
113.8 |
224.6 |
241.9 |
210 |
134.1 |
184.4 |
28 4 |
42.7 |
12.1 |
10 |
214 |
189.2 |
173 |
50 |
164.7 |
109.2 |
250.7 |
219 |
26 8 |
304 |
13 |
78.6 |
34 3 |
34.8 |
224 |
215.8 |
139.5 |
255.3 |
96.9 |
181.3 |
163.2 |
225 |
167.5 |
35.2 |
98.1 |
32.4 |
221.4 |
54.3 |
226 |
49.4 |
43.4 |
84.3 |
16.4 |
141.3 |
27.2 |
309 |
3408 |
33.7 |
32 |
22 8 |
29.8 |
45 9 |
332 |
15.9 |
39.9 |
67.1 |
14.3 |
88.5 |
25.2 |
346 |
14.3 |
37.9 |
36.5 |
33.5 |
28.7 |
37.4 |
13b10 |
|
|
|
|
|
|
|
|
|
pc_EA40....Signal |
SEQ ID |
205_VDX885TT |
206_VDX886TT |
207_VDX890TT 2 |
08_VDX892TT |
209_VDX893TT |
210_VDX894TT |
83 |
22.9 |
81.5 |
34.1 |
159.2 |
88.7 |
43.6 |
142 |
26.4 |
22.6 |
8 7 |
10.8 |
18 5 |
23 6 |
136 |
28 1 |
182 |
96 |
146 |
17 3 |
22.5 |
137 |
207.7 |
94.4 |
68.8 |
83.7 |
17.8 |
140.4 |
152 |
77 3 |
225 5 |
227 5 |
95 5 |
301 1 |
59 9 |
160 |
294.5 |
164.6 |
110.3 |
84.5 |
105.6 |
163 |
163 |
140.9 |
34 |
25.9 |
9.3 |
41.9 |
83.5 |
165 |
241.8 |
101.4 |
193.6 |
161.9 |
112.8 |
190.6 |
210 |
416 8 |
24.1 |
45.5 |
15 1 |
26.9 |
15 6 |
214 |
323.3 |
139.5 |
148.2 |
174.1 |
104.5 |
142.1 |
219 |
131 8 |
12 |
25 9 |
48 9 |
14.4 |
96 2 |
224 |
215.3 |
136.2 |
126 |
193.8 |
195.4 |
67.1 |
225 |
49.5 |
105 |
54.2 |
97.4 |
33 |
38.8 |
226 |
181.1 |
55.2 |
34.1 |
4 |
15 |
125.1 |
309 |
89 7 |
474 |
58.6 |
17.8 |
23 5 |
72 3 |
332 |
73 |
|
66.8 |
48.2 |
27.5 |
41.1 |
25.3 |
|
346 |
|
13.6 |
107.7 |
145.3 |
12.7 |
18.3 |
20 |
|
|
|
|
13b11 |
|
|
|
|
|
|
02014_40...._Signal |
|
|
|
SEQ ID |
319_H133A_903TT |
320_H133A_904TT |
328_H133A_928TT |
330_H133A_932TT |
331_H133A_933TT |
|
|
|
83 |
58.3 |
226.6 |
92.7 |
79.2 |
106.8 |
|
|
|
142 |
14.5 |
118 3 |
7 4 |
8 |
13 |
|
|
|
136 |
18 9 |
87 |
29 4 |
86.9 |
9 3 |
|
|
|
137 |
24.4 |
174.5 |
25.7 |
135.9 |
31.8 |
|
|
|
152 |
178 1 |
137.4 |
176 6 |
151 1 |
166 2 |
|
|
|
160 |
83.2 |
205 |
93.5 |
103.6 |
73.3 |
|
|
|
163 |
31.5 |
100.2 |
19.2 |
40.5 |
33.4 |
|
|
|
165 |
223.6 |
235.9 |
161.5 |
132.8 |
132 |
|
|
|
210 |
35 5 |
99.9 |
164 |
124 9 |
17 |
|
|
|
214 |
118.8 |
178 |
25.6 |
115.6 |
117 |
|
|
|
219 |
15.1 |
80.2 |
27 7 |
54 2 |
38.2 |
|
|
|
224 |
174.5 |
323.7 |
223.3 |
203 |
185.3 |
|
|
|
225 |
170.3 |
200.3 |
180.3 |
157.3 |
157.2 |
|
|
|
226 |
65.2 |
26.9 |
25.2 |
4.6 |
35.7 |
|
|
|
309 |
11 1 |
270 7 |
15.9 |
91.5 |
18.6 |
|
|
|
332 |
12 |
77.4 |
15.1 |
7.2 |
7.3 |
|
|
|
346 |
30.4 |
387.2 |
25.4 |
204.4 |
14.7 |
|
|
|
13b12 |
|
|
|
|
|
|
EA02014_403...._Signal |
|
|
|
SEQ ID |
75_H 33A_922TT |
381 _H133A_945TT |
382_H133A_946TT |
383_H133A_947TT |
384_H133A_948TT |
|
|
|
83 |
88.1 |
22.1 |
193.5 |
166.9 |
73.7 |
|
|
|
142 |
12 |
19.6 |
13.2 |
216 |
16 9 |
|
|
|
136 |
11.8 |
12.3 |
52 |
46.7 |
107.9 |
|
|
|
137 |
51.3 |
182.2 |
43.4 |
23.9 |
14.5 |
|
|
|
152 |
341 |
139 |
248.1 |
299.5 |
84.2 |
|
|
|
160 |
95.6 |
102 |
99.5 |
184.6 |
90.4 |
|
|
|
163 |
77.6 |
41.6 |
25.9 |
51.7 |
4.9 |
|
|
|
165 |
254.8 |
63.5 |
172.6 |
209.2 |
81.1 |
|
|
|
210 |
8.8 |
78 8 |
28.8 |
44 |
92 5 |
|
|
|
214 |
79 |
94.5 |
148.7 |
101.7 |
82.7 |
|
|
|
219 |
22.7 |
31 8 |
63.9 |
23.8 |
18 1 |
|
|
|
224 |
190.5 |
194.7 |
212 |
278.9 |
201.1 |
|
|
|
225 |
48.8 |
135.5 |
46.8 |
274.4 |
97.5 |
|
|
|
226 |
20 |
24 |
90.8 |
45.3 |
8.8 |
|
|
|
309 |
30 5 |
195 |
29 7 |
53.4 |
37 9 |
|
|
|
332 |
10.4 |
4.2 |
9.2 |
75 |
44 |
|
|
|
346 |
19.1 |
298.1 |
35.4 |
251.2 |
37.2 |
|
|
|
13b13 |
|
|
|
|
|
|
ThyFolCan_02014_400...._Signal |
|
|
|
ID |
84_H133A_823TT |
SEQ 85_H133A_824TT 86_H133A_825TT |
|
88_H133A_827TT 89_H133A_828TT |
|
|
|
|
83 |
242 |
70.1 |
71.2 |
24.8 |
145.4 |
|
|
|
142 |
198 |
12 5 |
35 7 |
17 7 |
196 |
|
|
|
136 |
35.7 |
21 |
594 |
20.3 |
9 |
|
|
|
137 |
86.1 |
23.7 |
116.3 |
18.2 |
48.6 |
|
|
|
152 |
271 9 |
199 6 |
213 1 |
140 9 |
202 5 |
|
|
|
160 |
134.5 |
134.1 |
415.1 |
162.4 |
154 |
|
|
|
163 |
64.5 |
46.1 |
82.1 |
15.5 |
57.8 |
|
|
|
165 |
189.3 |
222.6 |
239 |
223.8 |
145.3 |
|
|
|
210 |
8 8 |
236.3 |
50 |
21 8 |
33.8 |
|
|
|
214 |
33.1 |
71.3 |
121.6 |
157.3 |
100.8 |
|
|
|
219 |
24.8 |
64.8 |
82.1 |
14 1 |
60.2 |
|
|
|
224 |
213 |
96.4 |
371.4 |
159.1 |
92.8 |
|
|
|
225 |
164.9 |
103.3 |
224.4 |
145.2 |
98.3 |
|
|
|
226 |
10.3 |
5 |
24 |
30.5 |
21.6 |
|
|
|
309 |
1.5 |
33 3 |
38.4 |
14 9 |
19 5 |
|
|
|
332 |
77.6 |
55.7 |
124.1 |
10.6 |
84.5 |
|
|
|
346 |
39 |
124.6 |
31.5 |
29.5 |
21.3 |
|
|
13b14 |
|
|
|
|
|
|
|
Signal |
|
|
SEQ ID |
02014_40318_ H133A_840TT |
fc_EA40212VDX896TT |
fc_EA40214VDX898 |
fc_EA40214VDX899TT |
_fc_EA40216 VDX900TT |
_fc_EA40217VDX901TT |
_fc_EA40218_VDX902TT |
|
|
83 |
189.9 |
110.7 |
51.4 |
35.8 |
104.6 |
22.8 |
44.7 |
|
|
142 |
18 9 |
20.5 |
246 2 |
18 5 |
20 7 |
25 |
8 28.6 |
|
|
136 |
22 6 |
1052 |
21 3 |
20 3 |
33.6 |
24 |
5 24 4 |
|
|
137 |
32.3 |
40.6 |
46.3 |
33.8 |
23.9 |
90.6 |
48.5 |
|
|
152 |
306 |
216.1 |
317.8 |
169.4 |
154 6 |
169 |
3 374.5 |
|
|
160 |
99.5 |
197.5 |
240.4 |
68.7 |
146.7 |
210.5 |
196.7 |
|
|
163 |
52.1 |
29.7 |
70.7 |
75.3 |
13.6 |
25.1 |
59.3 |
|
|
165 |
236.7 |
142.2 |
147 |
168 |
174.2 |
28.5 |
89.4 |
|
|
210 |
26.5 |
108.8 |
39.9 |
25.5 |
42.2 |
11 |
24.4 |
|
|
214 |
115.1 |
63.9 |
59 |
129.9 |
150.1 |
194.1 |
218.2 |
|
|
219 |
16.2 |
462 |
62.7 |
39.4 |
42.1 |
92.3 |
39.4 |
|
|
224 |
203.9 |
194.6 |
321.6 |
225.2 |
238 |
212.5 |
187.3 |
|
|
225 |
198 |
53.6 |
82.8 |
52.5 |
250.7 |
72 |
53.5 |
|
|
226 |
31 |
57.3 |
111.5 |
66.7 |
24.8 |
41 |
79.9 |
|
|
309 |
17 2 |
40 2 |
44 3 |
43 |
202 |
21.3 |
63.8 |
|
|
332 |
51.4 |
26.5 |
129.1 |
7.8 |
5.6 |
37.8 |
31.6 |
|
|
346 |
11 |
27.8 |
21.6 |
19.4 |
320.2 |
24.3 |
210.6 |
|
|
13b15 |
|
|
|
|
|
|
|
Signal |
|
|
SEQ ID |
fc_EA40 221_VDX909TT |
fc_EA40 222_VDX 910TT |
EA02014_40 386_H133A_954TT |
EA02014_4 A_967TT |
EA02014_40395 _H133A_968TT |
EA02014_40396 _H133A_969TT |
EA02014_40397 _H133A_970TT |
|
|
83 |
312.2 |
30.6 |
105.2 |
42.2 |
47.9 |
24.4 |
46.5 |
|
|
142 |
17 8 |
9 9 |
41 7 |
30 5 |
11 8 |
16 7 |
25 7 |
|
|
136 |
63 1 |
87 5 |
38 |
29.7 |
206.6 |
10.1 |
99 2 |
|
|
137 |
170.4 |
111.7 |
78.6 |
32.1 |
20.5 |
29.4 |
18.2 |
|
|
152 |
624 7 |
121 |
2154 |
212 7 |
160 9 |
216 7 |
214 3 |
|
|
160 |
257.9 |
30.5 |
247.6 |
161.6 |
192.1 |
87.9 |
538.8 |
|
|
163 |
21.6 |
27 |
43.5 |
50.7 |
56.9 |
72.4 |
48.7 |
|
|
165 |
251.9 |
105 |
92.7 |
136.3 |
166.5 |
123.8 |
180.7 |
|
|
210 |
34 |
37 1 |
49 |
43 9 |
21.1 |
7.4 |
167.3 |
|
|
214 |
257.9 |
176.9 |
168.4 |
69.9 |
113.6 |
140.1 |
14 |
|
|
219 |
117 7 |
25.9 |
43.2 |
42 1 |
24 |
12.6 |
57.9 |
|
|
224 |
55.1 |
150 |
176.9 |
280.1 |
184.5 |
194.4 |
374.4 |
225 |
|
205.8 |
42.3 |
66.7 |
320.3 |
27 |
66.2 |
54.6 |
|
226 |
|
84.9 |
14.8 |
148.6 |
26 |
47.6 |
36.9 |
21.7 |
|
309 |
|
745.6 |
9.7 |
53.6 |
42 |
23.5 |
14.6 |
71 |
|
332 |
|
15.9 |
7.6 |
69.9 |
10.3 |
63.6 |
13.3 |
26.8 |
|
346 |
|
48 |
25 |
54.7 |
142.6 |
73.6 |
16.6 |
79.7 |
|
13b16 |
|
|
|
|
|
|
|
|
|
Signal |
SEQ ID |
EA02014_ A_982TT |
40405_H133EA02014_40406_H133A_983TT |
pb1 |
pb2 |
pb3 |
pb4 |
pb5' |
|
|
83 |
|
58.1 |
37.8 |
524.7 |
768.1 |
855.6 |
1163.9 |
876.3 |
|
142 |
|
19.4 |
37.4 |
1289.3 |
1088.9 |
659.7 |
732.6 |
1415 |
|
136 |
|
94.2 |
11 |
1770.1 |
1622.7 |
523 |
979.3 |
617.3 |
|
137 |
|
17.6 |
111.2 |
1871 |
2554 |
1313.7 |
781.1 |
2087.1 |
|
152 |
|
255.8 |
37.6 |
9696.4 |
9404.8 |
1099.8 |
9900.7 |
7060 |
|
160 |
|
54.7 |
347.1 |
1273.2 |
1171.6 |
907 |
937.4 |
926.2 |
|
163 |
|
32.9 |
59.7 |
833 |
682.5 |
559.6 |
358.6 |
467.8 |
|
165 |
|
71.8 |
232.2 |
1217.8 |
986.3 |
1278.9 |
2537.1 |
1464.3 |
|
210 |
|
5.2 |
33.2 |
3401 |
2546.6 |
756.3 |
4893 |
1770.8 |
|
214 |
|
212.6 |
165 |
1384.3 |
1540 |
636.7 |
656.5 |
1213.9 |
|
219 |
|
14.1 |
43.6 |
1692.6 |
1911.7 |
912 |
2112.2 |
1417.9 |
|
224 |
|
137 |
228.2 |
2481.3 |
3104.2 |
1905.4 |
2292.4 |
2242.7 |
|
225 |
|
109.6 |
153.4 |
2367.8 |
2860.8 |
1887.6 |
2052.6 |
2116.6 |
|
226 |
|
41.6 |
11 |
797.2 |
969.9 |
617.1 |
626.6 |
920 |
|
309 |
|
20.7 |
30.6 |
5357.5 |
5904 |
3572.6 |
6641.9 |
3580.9 |
|
332 |
|
6.8 |
60.2 |
258.8 |
304.2 |
110.1 |
255.3 |
363.3 |
|
346 |
|
27 |
57.3 |
1584.2 |
1705.7 |
1507.5 |
1626.3 |
1587.1 |
|
13b17 |
|
|
|
|
|
|
|
|
|
Signal |
SEQ ID |
pb6' |
pb7' |
pb8' |
pd10 |
pd11 |
pd12 |
pd9 |
|
|
83 |
|
818.3 |
333.4 |
692.1 |
709.8 |
699.7 |
926.2 |
534.7 |
|
142 |
|
1287.9 |
565.2 |
2004.2 |
821.9 |
904.8 |
1619.6 |
282.5 |
|
136 |
|
1039 |
962.2 |
1013.5 |
1147.9 |
840.9 |
599.8 |
284 |
|
137 |
|
1881.4 |
667.8 |
2058.1 |
2182.1 |
1678.9 |
1632.9 |
912.1 |
|
152 |
|
3657.7 |
2025 |
2993.5 |
11129.5 |
11824.2 |
11963.5 |
1607 |
|
160 |
|
1154.5 |
301.4 |
473.2 |
1849.5 |
1424.7 |
660 |
242 |
|
163 |
|
628.5 |
6534.3 |
1863.4 |
148.7 |
247.4 |
230.2 |
4365.5 |
|
165 |
|
1485.2 |
889 |
1904.7 |
1404.2 |
1560.4 |
1123.6 |
1919.6 |
|
210 |
|
2729.4 |
595.1 |
5286.8 |
7026.5 |
3861.8 |
1028.8 |
1724.8 |
|
214 |
|
871.1 |
442.3 |
644.5 |
936.1 |
939.1 |
852 |
347.7 |
|
219 |
|
1216.7 |
411.6 |
959.7 |
1085.9 |
1974.4 |
1580.2 |
245.9 |
|
224 |
|
2039.1 |
1488.3 |
1844.2 |
2280.1 |
2823.4 |
1252.3 |
1246.6 |
|
225 |
|
2214.8 |
1494.6 |
2186 |
1961.1 |
2628.3 |
1184.1 |
1230.7 |
|
226 |
|
822.2 |
437.3 |
684.5 |
540.5 |
839.5 |
1062.8 |
273.7 |
|
309 |
|
3787.2 |
1401.5 |
3537 |
3522.1 |
4518.1 |
5118.1 |
931.7 |
|
332 |
|
218.7 |
630.6 |
462.4 |
168.4 |
220.4 |
242.2 |
322.8 |
|
346 |
|
1682.4 |
909 |
2317.6 |
1193.5 |
1748.9 |
2159 |
622.7 |
|
Table 14 Control Genes
Control Genes for Blood |
|
SEQ ID NO: |
Gene Name |
|
|
142 |
Bone marrow stromal cell antigen 1 (BST1) |
219 |
Leucocyte immunoglobulin-like receptor-6b (LIR-6) |
309 |
Bridging integrator 2 (BIN2) Control Genes for Thyroid |
9 |
Cysteine-rich, angiogenic inducer, 61 (CYR61) |
12 |
Selenoprotein P, plasma, 1 (SEPP1) |
18 |
Insulin-like growth factor-binding protein 4 (IGFBP4) |
Table 15a
SEQ ID |
BN_800TT |
BN_801TT |
BN_802TT |
BN_804TT |
BN_805TT |
BN_806TT |
BN_807TT |
142 |
28.3 |
7.9 |
15 |
28.4 |
26.9 |
25.8 |
14.2 |
219 |
217 |
19.6 |
7.9 |
85.6 |
21.8 |
26.7 |
115.1 |
309 |
257.7 |
20.6 |
20.7 |
75.5 |
19.2 |
24 |
833.9 |
|
BN_871TT |
BN_913TT |
BN_914TT |
BN_915TT |
FA_917TT |
FA_918TT |
FA_919TT |
142 |
25.3 |
22.5 |
12.9 |
34.4 |
8.5 |
20.6 |
67.7 |
219 |
56.6 |
53.5 |
45.2 |
122.1 |
24.4 |
124 |
41.3 |
309 |
37.9 |
37 |
28.2 |
53 |
10.2 |
32.6 |
24.2 |
|
FA_818TT |
FA_819TT |
FA_820TT |
FA_821TT |
FA_822TT |
FA_842TT |
FA_862TT |
142 |
15 |
20.2 |
18.8 |
18.4 |
23 |
10 |
16.1 |
219 |
18.7 |
111.8 |
45.7 |
10.9 |
29.6 |
28.9 |
80.6 |
309 |
16.8 |
17.1 |
12.1 |
18.8 |
27.3 |
15.2 |
6.7 |
|
FA_863TT |
FA_864TT |
FA_865TT |
FA_866TT |
FA_867TT |
FA_869TT |
FA_907TT |
142 |
22.4 |
14.5 |
54.8 |
17.1 |
15.8 |
15 |
21.9 |
219 |
7.6 |
15.9 |
20.9 |
25 |
10 |
16.5 |
23.4 |
309 |
15.2 |
9.4 |
62.6 |
20.2 |
18.4 |
15.9 |
10.2 |
|
FA_908TT |
FA_920TT |
FA_938TT |
FA_940TT |
FA_941TT |
Fa_EA40374 _921TT |
Fa_EA40376 _923TT |
142 |
23.9 |
22.2 |
7.9 |
6.6 |
14.5 |
13.7 |
19.8 |
219 |
20.1 |
36.4 |
17.5 |
14.9 |
63.3 |
32.3 |
25.5 |
309 |
33.3 |
27.1 |
7.7 |
6.2 |
15.6 |
26.1 |
16 |
|
BN_EA40377 _924TT |
Fa_EA40378 _925TT |
Fa_EA40379 _926TT |
BN_EA40380 _927TT |
Fa_EA40387 _955TT |
Fa_EA40388 _956TT |
Fa_EA40389 _957TT |
142 |
16.5 |
57.7 |
22.9 |
18.9 |
16.7 |
14.2 |
10.8 |
219 |
15.3 |
10.2 |
95.6 |
18.5 |
23.3 |
51 |
29.1 |
309 |
17.8 |
31.8 |
32.6 |
49.2 |
18.7 |
11.4 |
26.7 |
|
Fa_EA40390_ 959TT |
Fa_EA40391 _960TT |
Fa_EA40392 _961TT |
Fa_EA40393_ 962TT |
PC_829TT |
PC_830TT |
PC_831TT |
142 |
21.4 |
18.6 |
16.5 |
21.9 |
26 |
34.7 |
22.4 |
219 |
25.7 |
67 |
20.8 |
21 |
36.8 |
136.4 |
64.9 |
309 |
44.2 |
20.6 |
34.1 |
35.2 |
88.8 |
136.6 |
48.8 |
|
PC_832TT |
PC_834TT |
PC_835TT |
PC_836TT |
PC_837TT |
PC_838TT |
PC_839TT |
142 |
19.1 |
16.4 |
25.8 |
12.1 |
22.5 |
15.4 |
16.1 |
219 |
24.3 |
19.1 |
25.9 |
11.7 |
13.6 |
23.8 |
26.8 |
309 |
22.1 |
23.6 |
40.5 |
16.5 |
33.9 |
24.7 |
340.8 |
|
PC_879TT |
PC_881TT |
PC_882TT |
PC_883TT |
PC_884TT |
PC_885TT |
PC_886TT |
142 |
21.2 |
23.5 |
7.6 |
21.5 |
30.6 |
26.4 |
22.6 |
219 |
30.4 |
13.3 |
78.6 |
34.3 |
34.8 |
131.8 |
12 |
309 |
33.7 |
32 |
22.8 |
29.8 |
45.9 |
89.7 |
47.4 |
|
PC_890TT |
PC_892TT |
PC_893TT |
PC_894TT |
PC_903TT |
PC_904TT |
PC_928TT |
142 |
8.7 |
10.8 |
18.5 |
23.6 |
14.5 |
118.3 |
7.4 |
219 |
25.9 |
48.9 |
14.4 |
96.2 |
15.1 |
80.2 |
27.7 |
309 |
58.6 |
17.8 |
23.5 |
72.3 |
11.1 |
270.7 |
15.9 |
|
PC_932TT |
PC_933TT |
Pc_EA40375 _922TT |
Pc_EA40381_ 945TT |
Pc_EA40382 _946TT |
Pc_EA40383 _947TT |
Pc_EA40384 _948TT |
142 |
8 |
13 |
12 |
19.6 |
13.2 |
21.6 |
16.9 |
219 |
54.2 |
38.2 |
22.7 |
31.8 |
63.9 |
23.8 |
18.1 |
309 |
91.5 |
18.6 |
30.5 |
195 |
29.7 |
53.4 |
37.9 |
|
FC_823TT |
FC_824TT |
FC_825TT |
FC_827TT |
FC_828TT |
FC_840TT |
FC_896TT |
142 |
19.8 |
12.5 |
35.7 |
17.7 |
19.6 |
18.9 |
20.5 |
219 |
24.8 |
64.8 |
82.1 |
14.1 |
60.2 |
16.2 |
46.2 |
309 |
15 |
33.3 |
38.4 |
14.9 |
19.5 |
17.2 |
40.2 |
|
FC_898TT |
FC_899TT |
FC_900TT |
FC_901TT |
FC_902TT |
FC_909TT |
FC_910TT |
142 |
246.2 |
18.5 |
20.7 |
25.8 |
28.6 |
17.8 |
9.9 |
219 |
62.7 |
39.4 |
42.1 |
92.3 |
39.4 |
117.7 |
25.9 |
309 |
44.3 |
43 |
20.2 |
21.3 |
63.8 |
745.6 |
9.7 |
|
Fc_EA40386_954TT |
Fc_EA40394_967TT |
Fc_EA40395 _968TT |
Fc_EA40396_ 969TT |
Fc_EA40397 _970TT |
Fc_EA40405 _982TT |
Fc_EA40406 _983TT |
142 |
41.7 |
30.5 |
11.8 |
16.7 |
25.7 |
19.4 |
37.4 |
219 |
43.2 |
42.1 |
24 |
12.6 |
57.9 |
14.1 |
43.6 |
309 |
53.6 |
42 |
23.5 |
14.6 |
71 |
20.7 |
30.6 |
|
pb1_Signal |
pb2_Signal |
pb3_Signal |
pb4_Signal |
pb5'_Signal |
pb6'_Signal |
pb7'_Signal |
142 |
1289.3 |
1088.9 |
659.7 |
732.6 |
1415 |
1287.9 |
565.2 |
219 |
1692.6 |
1911.7 |
912 |
2112.2 |
1417.9 |
1216.7 |
411.6 |
309 |
5357.5 |
5904 |
3572.6 |
6641.9 |
3580.9 |
3787.2 |
1401.5 |
|
pb8'_Signal |
pd10_Signal |
pd11_Signal |
pd12_Signal |
pd9-Signal |
|
|
142 |
2004.2 |
821.9 |
904.8 |
1619.6 |
282.5 |
|
|
219 |
959.7 |
1085.9 |
1974.4 |
1580.2 |
245.9 |
|
|
309 |
3537 |
3522.1 |
4518.1 |
5118.1 |
931.7 |
|
|
Table 15b
Signal |
SEQ ID |
PC_984TT |
PC_986TT |
FA_987TT |
PC_988TT |
PC_989TT |
FA_992TT |
FA_993TT |
142 |
25.1 |
125.8 |
18.5 |
11.4 |
13.7 |
11.8 |
113.6 |
219 |
17.5 |
25.7 |
22.6 |
11.3 |
32.4 |
61.9 |
25.2 |
309 |
27.6 |
661.8 |
15.7 |
47.4 |
29.8 |
33.2 |
28.4 |
|
FA_994TT |
FA_995TT |
FA_996TT |
FA_998TT |
FA_999TT |
FA_1001TT |
FA_1002TT |
142 |
20.6 |
25.2 |
34.1 |
21.8 |
31.4 |
12.7 |
74.6 |
219 |
25.9 |
36.3 |
41.5 |
24.9 |
16.4 |
26.5 |
25.5 |
309 |
16.8 |
26.3 |
19.4 |
22.5 |
14.6 |
32.3 |
47.7 |
|
FA_1004TT |
FA_1005TT |
FA_1006TT |
FA_1010TT |
FA_1013TT |
FA_1014TT |
FA_1017TT |
142 |
24.7 |
20.1 |
67.7 |
14.9 |
48.9 |
29.8 |
26.9 |
219 |
27.5 |
11.7 |
53.3 |
112.9 |
35.1 |
39.5 |
27.2 |
309 |
39.5 |
10.3 |
34.6 |
83.2 |
46.8 |
20 |
25.7 |
|
FA_1018TT |
FA_1020TT |
FA_1023TT |
FA_1024TT |
FA_1026TT |
FA_1027TT |
FA_1028TT |
142 |
25.1 |
25.5 |
35.6 |
26.9 |
27.9 |
15.2 |
24.5 |
219 |
66.3 |
26 |
6.1 |
26 |
59.3 |
18.8 |
31.7 |
309 |
31 |
37.4 |
20.6 |
46.9 |
51.4 |
8.8 |
33.3 |
|
FA_1029TT |
FA_1030TT |
FA_1031TT |
FA_1032TT |
FA_1034TT |
FA_1035TT |
FC_1037TT |
142 |
10.6 |
14 |
20 |
21.6 |
31.9 |
17.1 |
17.8 |
219 |
12.5 |
33.5 |
15.1 |
15 |
68.5 |
25.6 |
63.5 |
309 |
20.7 |
13 |
21.5 |
32.2 |
52.6 |
24.6 |
26.2 |
|
PC_1039TT |
PC_1040TT |
PC_1041TT |
PC_1042TT |
PC_1043TT |
PC_1044TT |
PC_1045TT |
142 |
16.1 |
22.7 |
99.5 |
129.8 |
20.7 |
79.2 |
16.4 |
219 |
27.9 |
29.5 |
23.6 |
29 |
21.5 |
19.8 |
38.4 |
309 |
585.3 |
37.6 |
48.7 |
41 |
32.8 |
59.2 |
112.3 |
|
PC_1046TT |
PC_1047TT |
PC_1048TT |
PC_1049TT |
PC_1050TT |
PC_1051TT |
PC-FV_1052TT |
142 |
22.4 |
81.2 |
24.7 |
37.5 |
25.9 |
26.6 |
26.4 |
219 |
11.1 |
97.5 |
61.8 |
14.9 |
14.7 |
109.1 |
30.6 |
309 |
22.5 |
207.8 |
35.4 |
64 |
39.5 |
56.7 |
28.2 |
|
PC_1053TT |
PC_1054TT |
PC_1055TT |
PC_1059TT |
PC_1060TT |
PC_1061TT |
PC_1062TT |
142 |
12.8 |
18.5 |
24.4 |
22.7 |
24.6 |
15.8 |
25.6 |
219 |
12.6 |
19.6 |
10.2 |
24.5 |
82.6 |
53.7 |
20.7 |
309 |
20.4 |
22.1 |
24 |
18.9 |
32.3 |
54.5 |
29.1 |
|
PC-FV_1064TT |
PC-FV_1065TT |
PC-FV_1066TT |
PC-FV_1067TT |
PC-FV_1068TT |
PC-FV_1069TT |
PC-FV_1071TT |
142 |
16.7 |
11.3 |
25.5 |
17.4 |
17.5 |
14 |
16.7 |
219 |
174.4 |
20.3 |
132.4 |
24.8 |
12.3 |
14.8 |
18.8 |
309 |
30.4 |
169.6 |
49.4 |
16.9 |
135.5 |
18.1 |
7.6 |
|
PC-FV_1072TT |
FA_1073TT |
FA_1074TT |
FA_1075TT |
FA_1076TT |
FC_1077TT |
FC_1078TT |
142 |
14 |
25.5 |
22.7 |
27 |
16.4 |
15.8 |
38.9 |
219 |
8.7 |
73.2 |
57 |
54.3 |
69.9 |
20 |
17.1 |
309 |
29.9 |
145.4 |
21 |
53 |
24.3 |
9.1 |
32.9 |
|
FC_1079TT |
PC-FV_1080TT |
PC-FV_1081TT |
FC_1082TT |
pb1 |
pb2 |
pb3 |
142 |
31.9 |
10.2 |
22 |
19.5 |
1289.3 |
1088.9 |
659.7 |
219 |
40.1 |
17.4 |
38.3 |
88.1 |
1692.6 |
1911.7 |
912 |
309 |
27.1 |
23.4 |
40.8 |
12.9 |
5357.5 |
5904 |
3572.6 |
|
pb4 |
pb5' |
pb6' |
pb7' |
pb8' |
pd10 |
pd11 |
142 |
732.6 |
1415 |
1287.9 |
565.2 |
2004.2 |
821.9 |
904.8 |
219 |
2112.2 |
1417.9 |
1216.7 |
411.6 |
959.7 |
1085.9 |
1974.4 |
309 |
6641.9 |
3580.9 |
3787.2 |
1401.5 |
3537 |
3522.1 |
4518.1 |
|
pd12 |
pd9 |
|
|
|
|
|
142 |
1619.6 |
282.5 |
|
|
|
|
|
219 |
1580.2 |
245.9 |
|
|
|
|
|
309 |
5118.1 |
931.7 |
|
|
|
|
|
F. Signature Normalized to Control Genes
[0081] We further examined our 5-gene and 4-gene signatures by normalizing these genes to
the three selected thyroid control genes as an algorithm for gene chip data normalization.
The average fluorescent intensities of the three thyroid control genes were used for
signature gene signal normalization. The performance of both signatures improved slightly
when these two signatures were normalized. The sensitivity and specificity of the
two signatures are listed in Table 16, and the ROC curves are shown in Figure 4a and
4b.
Table 16. The performances of the 4-gene and 5-gene signatures normalized to control
genes 4-Gene Signature
|
Tumor |
Benign |
Positive |
33 |
11 |
Negative |
3 |
27 |
Sensitivity |
92% (0.78, 0.97) |
Specificity |
71% (0.55, 0.83) |
5-Gene Signature |
Positive |
33 |
8 |
Negative |
3 |
30 |
Sensitivity |
92% (0.78, 0.97) |
Specificity |
79% (0.64, 0.89) |
G. Signature Validation with Two-Round Amplified Probes
[0082] To determine if the FNA samples lack sufficient thyroid cells to provide enough probe
material for hybridizing to the Affymetrix U133a gene chips after one round of amplification,
two-round amplification of the target RNAs we performed two-round amplification with
47 samples that are among the 74 independent validation sample set. The data obtained
show that the performances of the 5-gene and 4-gene signatures are identical with
either one-round or two-round amplifications. The ROC curves of the two gene signatures
with two different target preparations are shown in Figures 5a, 5b, 5c, and 5d.
Example 4
Cross validation with independent samples
A. Cross Validation with the 83 Independent Fresh Frozen Thyroid Samples
[0083] 83 independent thyroid samples were processed and profiled with the U133a chip. The
number of samples in each category is list in Table 17.
Table 17. Fresh Frozen sample collection for signature validation
Sample Type |
Number of Samples |
Follicular Adenoma |
18 |
Follicular Thyroid Carcinoma |
1 |
Papillary Carcinoma, Follicular Variant |
18 |
Papillary Thyroid Carcinoma |
11 |
Adenomatoid Nodules |
18 |
Adenomatoid Nodules w/Hashimoto |
1 |
Multinodular Hyperplasia |
16 |
[0084] The performance of the 4-gene signature and the 5-gene signature was assessed with
LDA using the same cut-off value as in the training set. Both signatures gave equivalent
performance in these samples, and they are comparable with the performance in the
98 training set. The sensitivity and specificity for both signatures are shown in
Table 18, and the ROC curves are demonstrated in Figures 6a and 6b.
Table 18. 4-Gene and 5-gene signatures performance in 83 validation samples 4-Gene
Signature
|
Tumor |
Benign |
Positive |
20 |
11 |
Negative |
10 |
42 |
Sensitivity |
67% (0.49, 0.81) |
Specificity |
79% (0.67, 0.88) |
|
5-Gene Signature |
|
|
Tumor |
Benign |
Positive |
24 |
24 |
Negative |
6 |
29 |
Sensitivity |
80% (0.63, 0.90) |
Specificity |
55% (0.41, 0.67) |
B. Signature Validation with the 47 Fine Needle Aspirate (FNA) Thyroid Samples
[0085] 47 thyroid FNA samples were processed and profiled with the U133a chip. The number
of samples in each category is list in Table 19.
Table 19. FNA sample collection for signature validation
Sample Type |
Number of Samples |
Follicular Adenoma |
10 |
Follicular Thyroid Carcinoma |
2 |
Papillary Carcinoma, Follicular Variant |
3 |
Papillary Thyroid Carcinoma |
13 |
Adenomatoid Nodules |
10 |
Adenomatoid Nodules w/Hashimoto |
1 |
Multinodular Hyperplasia |
8 |
[0086] The performance of the 4-gene signature and the 5-gene signature was assessed with
LDA model. Both signatures gave equivalent performance in the FNA samples, and they
are comparable with the performance in the 98 training set. The sensitivity and specificity
for both signatures are shown in Table 20, and the ROC curves are demonstrated in
Figures 7a and 7b.
Table 20. 4-Gene and 5-gene signatures performance in 47 FNA samples 4-Gene Signature
|
Tumor |
Benign |
Positive |
15 |
4 |
Negative |
3 |
25 |
Sensitivity |
94% (0.74, 0.99) |
Specificity |
62% (0.44, 0.77) |
|
5-Gene Signature |
|
|
Tumor |
Benign |
Positive |
17 |
10 |
Negative |
1 |
19 |
Sensitivity |
94% (0.74, 0.99 |
Specificity |
66% (0.47, 0.80) |
C. Signature Performance in 28 Paired Fresh Frozen and FNA Thyroid Samples
[0087] Within the 83 fresh frozen and the 47 FNA sample collections there are 28 samples
that were from the same patient. The direct comparison of our signatures in these
paired samples demonstrates how well the signature will translate into the final molecular
assay. The performance of the 4-gene signature and the 5-gene signature was assessed
with the LDA model. Both signatures gave equivalent performance in the fresh frozen
and FNA samples. These results demonstrated that our 4-gene and 5-gene signatures
can perform equally well in both sample types, and proved the approach using fresh
frozen samples for gene/signature identification is valid. The sensitivity and specificity
for both signatures are shown in Table 21, and the ROC curves are demonstrated in
Figures 8a and 8b.
Table 21. 4-Gene and 5-gene signatures performance in 28 matched fresh frozen and
FNA samples
4-Gene Signature |
|
Fresh Frozen |
FNA |
|
Tumor |
Benign |
Tumor |
Benign |
Positive |
10 |
4 |
12 |
7 |
Negative |
3 |
11 |
1 |
8 |
Sensitivity |
77% (0.50 - 0.92) |
92% (0.67 - 0.99) |
Specificity |
73% (0.48 - 0.89) |
53% (0.30 - 0.75) |
5-Gene Signature |
|
Fresh Frozen |
FNA |
|
Tumor |
Benign |
Tumor |
Benign |
Positive |
11 |
7 |
12 |
7 |
Negative |
2 |
8 |
1 |
8 |
Sensitivity |
85% (0.58 - 0.96) |
92% (0.67 - 0.99) |
|
Specificity |
53% (0.30 - 0.75) |
53% (0.30 - 0.75) |
|
Example 5
Real-time quantitative RT-PCR
Sample Acquisition:
[0088] In order to determine whether a subset of the gene profiles and/or controls would
give adequate specificity and sensitivity with RT-PCR, the following experiment was
performed. The following has the advantage of requiring only one round of RNA amplification.
[0089] A total of 107 thyroid biopsies were analyzed in our study: 26 follicular adenoma,
23 follicular carcinoma, 38 papillary carcinoma, 5 normal, 3 papillary carcinoma follicular
variant, 3 Hashimoto thyroiditis, 2 microfollicular adenoma, 1 diffuse goiter, 1 goiter
with papillary hyperplasia, 1 Hurthle cell adenoma, 1 hyperplasia with papillary structure,
1 multinodular goiter, 1 oncocytic hyperplasia, 1 thyroiditis. Total RNA isolation
was extracted by using the Trizol reagent according to the manufacturer's instructions.
RNA concentrations were determined by absorbance readings at 260 nm with the Gene-Spec
(Hitachi) spectrophotometer. The isolated RNA was stored in RNase-free water at -80°C
until use.
Primer and Probe Design:
[0090] The primers and hydrolysis probes were designed using Oligo 6.0 and the Genebank
sequences for thyroid cancer status markers (Table 22). These primers and probe sets
were designed such that the annealing temperature of the primers was 62°C and the
probes 5-10°C higher and amplicon size ranges from 100-150bp. Genomic DNA amplification
was excluded by designing our primers around exon-intron splicing sites. Hydrolysis
probes were labeled at the 5' nucleotide with FAM as the reporter dye and at 3' nucleotide
with TAMRA as the quenching dye.
Table 22
Target |
Accession # |
Forward Primer (SEQ ID NO:) |
Reverse Primer (SEQ ID NO:) |
Probe Sequence (SEQ ID NO:) |
Product Length |
SGENE |
NM_003020 |
gaaagcggagqagtgtcaatcca (364) |
ggttttcqtctagcatcttctcttta (365) |
atctacaaggacagagactggataatgttg (366) |
130 |
TESTICAN1 |
AF231124 |
gtgagctgtgaagaggagcaggaa (367) |
ctttggtcccagctcccgttca(368) |
cctcaggggattttggcagtggtgggtccg (369) |
102 |
GABRE |
NM_004961 |
taaactccgccatcctcgtatcaa (370) |
cagtggtgacaatctggcacacaa (371) |
ccgtgcccatgccccgtacccatgca (372) |
113 |
CDH3 |
NM_001793 |
ctgaagcaggatacatatgacgtgca (373) |
aggatccagggcaggtttcgaca (374) |
catggcagtcgcacacagtggccctqa (375) |
124 |
FN1 |
NM_002026 |
tggtgccatgacaatggtgtgaacta (376) |
catcatcgtaacacattacctcatna (377) |
aagattgggagagaagtgggaccgtcaggga (378) |
148 |
TPO-1 |
NM_000547 |
catctgtqacaacactggcctca (379) |
gccacacttgtcgtcttgaggaa (380) |
caaattccccgaagactttgagtcttgtgacagc (381) |
148 |
TPO-2 |
NM_000547 |
aacctgcgtagactccgggaggc (382) |
gccagtgcgtgtccacctgca (383) |
ctcgggtgacttggatctccatqtcgctgg (384) |
124 |
KCNAB1-1 |
NM_003471 |
tgaaagttccagggcttcactgaa (385) |
agctgaggtagtgtgcatcccaga (386) |
ctaccagtggttgaaagaaagaattgtaagtgaag (387) |
138 |
KCNAB1-2 |
NM_003471 |
tagctgttgcgtggtgcctgagaa (388) |
tgatgtcatctttgggagaacctgaa (389) |
aaggtgtgagttctgtgctcctgggatcat (390) |
119 |
FABP4-1 |
NM_001442 |
gaaagaagtaggagtgggctttgcca (391) |
ggcccagtatgaaggaaatctcaata (392) |
aaaggtactttcagatttaatggtgatcacatccc (393) |
143 |
FABP4-2 |
NM_001442 |
aggaaagtcaagagcaccataacctta (394) |
gacgcattccaccaccagtttatca (395) |
ttgattttccatcccatttctgcacatgta (396) |
123 |
DOI1-1 |
NM_000792 |
gggtaaatctggcccttggaactaca (397) |
cccgttggtcacctagaattgagata (398) |
cccagaggaagttcgtqctgttctggaaaa (399) |
106 |
DOI1-2 |
NM_000792 |
tgcatcagatggctgggctttta (400) |
gctctggttctgcatggtgtcca (401) |
atgccctccccatgcatcctgcgt (402) |
142 |
B-ACTIN |
NM_001101 |
tcacccacactgtgcccatctacga (403) |
cagcggaaccgctcattgccaatgg (404) |
atgccctcccccatgccatcctgcgt (405) |
295 |
GOLGIN67 |
NM_015003 |
gcatggtgatctttgtgaggcga (406) |
ctcctggtggtcctgcatctca (407) |
ctcaccaacagcgtggagcctgcgcaagga (408) |
139 |
PAX8 |
BC001060 |
actccagcttgctgagttcccca (409) |
actccagcttgctgagttcccca (410) |
attattacagttccacatcaaggccgagtgca (411) |
125 |
HERC |
NM_003922 |
qqgtqcttttcatgaggtttgtgtca (412) |
tgaggtaggcagactgtcgtaaggcc (413) |
ccaacactgctgacatttctcagagatttcaaat (414) |
219 |
DDIT3 |
NM_004083 |
cctggaaatgaagaggaagaatcaa (415) |
agctctgactggaatctggagagtqa (416) |
aatcttcaccactcttgaccctgcttctctgg (417) |
142 |
ITM1 |
NM_152713 |
tggctggtcaggatatacaaggtaaa (418) |
tcaacgtcctaaatgtgatgtgctca(419) |
cctggataatcqaggcttgtcaaggacataaa (420) |
117 |
C1OF24 |
NM_052966 |
tctgaaagtgataaaggaagctgcta (421) |
ctttagatctgttaagctggacacac (422) |
cttgaagaaacacaacttatttgaagataacatg (423) |
103 |
MOT8 |
NM_018836 |
acggcctataacgagaccctgca (424) |
gaagaggagggtcggtttccattaa (425) |
ttctcacgagtgcgtcagggcatctgtgc (426) |
133 |
ARG2 |
NM_00172 |
atttgaccctacactggctccagc (427) |
gatccaatgctgatagcaaccctgta (428) |
actcctgttgtcgggggactaacctatcgaga (429) |
119 |
Real-Time Quantitative RT-PCR:
[0091] Gene specific real-time quantitative RT-PCR amplification of 21 thyroid cancer status
genes and a housekeeping gene was performed using the TaqMan One-Step RT-PCR Master
Mix (2x) (Applied Biosystems) and the ABI Prism 7900HT sequence detection system (Applied
Biosystems). In a 25 µl one-step reaction total RNA (10ng was added to a mix that
contained: 1x RT-PCR Master Mix, 0.25U/µl Multiscribe Enzyme, 0.6uM primers and 0.25µM
probe. Cycling parameters were 48°C for 30min and 95°C 10min, followed by 40 cycles
of 95°C 15sec and 62°C 1min. Real-time PCR monitoring was achieved by measuring fluorescent
signal at the end of the annealing phase for each cycle. The number of cycles to reach
the fluorescence threshold was defined as the cycle threshold (Ct value). To minimize
the errors arising from the integrity of the RNA in the samples β-actin mRNA was amplified
as an internal reference. External standards were prepared by 10-fold serial dilutions
of known thyroid cancer positive RNA and used to ensure linearity throughout our assays.
Results were expressed in mean Ct value and samples were excluded that had a standard
deviation greater then one. The results are provided in Tables 23a, 23b, 23c, 24a
and 24b.
[0092] The data show that the two gene signature shown in Table 23b is not as sensitive
and specific as the four-gene signature from which it was derived. Table 24 shows
that use of the PAX8 gene in an RT-PCR reaction as a control for thyroid-specific
tissue is effective in an RT-PCR reaction.
[0093] Although the foregoing invention has been described in some detail by way of illustration
and example for purposes of clarity of understanding, the descriptions and examples
should not be construed as limiting the scope of the invention.
Table 25
Sequence identifications |
SEQ NO: |
psid |
Name |
Accession No. |
Description |
1 |
200635_s_at |
|
AU145351 |
Hs.75216 prot tyrosine phosphatase, rec. type, F |
2 |
200771_at |
|
NM_002293 |
laminin, gamma 1 |
3 |
201069_at |
|
NM_004530 |
matrix metalloproteinase 2 |
4 |
201117_s_at |
CPE |
NM_001873 |
carboxypeptidase E |
5 |
201150_s_at |
|
NM_000362 |
tissue inhibitor of metalloproteinase 3 |
6 |
201185_at |
|
NM_002775 |
protease, serine, 11 |
7 |
201203_s_at |
|
Al921320 |
ribosome binding protein 1 |
8 |
201212_at |
|
NM_005606 |
cysteine protease |
9 |
201289_at |
CYR61 |
NM_001554 |
cysteine-rich, angiogenic inducer, 61 |
10 |
201292_at |
|
NM_001067 |
topoisomerase (DNA) II alpha |
11 |
201418_s_at |
SOX4 |
NM_003107 |
SRY (sex determining region Y)-box 4 |
12 |
201427_s_at |
SEPP1 |
NM_005410 |
Selenoprotein P, plasma, 1 |
13 |
201430_s_at |
DPYSL3 |
NM_001387 |
dihydropvrimidinase-like 3 |
14 |
201431_s_at |
DPYSL3 |
NM_001387 |
dihydropyrimidinase-like 3 |
15 |
201438_at |
COL6A3 |
NM_004369 |
collagen, type VI, alpha 3 |
16 |
201474_s_at |
ITGA3 |
NM_002204 |
integrin, α 3 transcript variant a |
17 |
201505_at |
LAMB1 |
NM_002291 |
laminin, beta 1 |
18 |
201508_at |
IGFBP4 |
NM_001552 |
Insulin-like growth factor-binding protein 4 |
19 |
201525_at |
APOD |
NM_001647 |
apolipoprotein D |
20 |
201645_at |
HXB |
NM_002160 |
hexabrachion (tenascin C, cytotactin) |
21 |
201650_at |
KRT19 |
NM_002276 |
keratin 19 |
22 |
201667_at |
GJA1 |
NM_000165 |
gap junction protein, α 1, 43kD (connexin 43) |
23 |
201744_s_at |
LUM |
NM_002345 |
lumican |
24 |
201792_at |
AEBP1 |
NM_001129 |
AE-binding protein 1 |
25 |
201852_x_at |
|
Al813758 |
Collaqen, type III, alpha 1 |
26 |
201893_x_at |
|
AF138300 |
decorin variant A |
27 |
201983_s_at |
|
AW157070 |
epidermal growth factor receptor |
28 |
202133_at |
|
AA081084 |
Transcriptional co-activator w PDZ-binding motif |
29 |
202219_at |
SLC6A8 |
NM_005629 |
solute carrier family 6, member 8 |
30 |
202237_at |
NNMT |
NM_006169 |
nicotinamide N-methyltransferase |
31 |
202286_s_at |
|
NM_002353 |
tumor-associated calcium signal transducer 2 |
32 |
202291_s_at |
|
NM_000900 |
matrix Gla protein |
33 |
202310_s_at |
|
NM_000088 |
proalpha 1 (I) chain of type I procollagen |
34 |
202350_s_at |
MATN2 |
NM_002380 |
matrilin 2 precursor, transcript variant 1 |
35 |
202357_s_at |
BF |
NM_001710 |
B-factor, properdin |
36 |
202363_at |
|
AF231124 |
testican-1 |
37 |
202376_at |
SERPINA3 |
NM_001085 |
Ser (or Cys) proteinase inhib clade A mem 3 |
38 |
202404_s_at |
COL1A2 |
NM_000089 |
collagen, type I, alpha 2 |
39 |
202440_s_at |
|
NM_005418 |
suppression of tumorigenicity 5 |
40 |
202504_at |
ATDC |
NM_012101 |
ataxia-telangiectasia group D-assoc. protein |
41 |
202575_at |
CRABP2 |
NM_001878 |
cellular retinoic acid-binding protein 2 |
42 |
202588_at |
AK1 |
NM_000476 |
adenylate kinase 1 |
43 |
202712_s_at |
CKMT1 |
NM_020990 |
creatine kinase, mitochondrial 1 |
44 |
202796_at |
KIAA1029 |
NM_007286 |
synaptopodin |
45 |
202826_at |
SPINT1 |
NM_003710 |
serine protease inhibitor, Kunitz type 1 |
46 |
202834_at |
SERPINA8 |
NM_000029 |
Ser (or Cys) proteinase inhib, clade A mem 8 |
47 |
202898_at |
KIAA0468 |
NM_014654 |
KIAA0468 gene product |
48 |
202992_at |
C7 |
NM_000587 |
complement component 7 |
49 |
203021_at |
SLPI |
NM_003064 |
secretory leukocyte protease inhibitor |
50 |
203083_at |
THBS2 |
NM_003247 |
thrombospondin 2 |
51 |
203180_at |
ALDH1A3 |
NM_000693 |
aldehyde dehydrogenase 1 family, mem. A3 |
52 |
203228_at |
PAFAH1B3 |
NM_002573 |
platelet-activating factor acetylhydrolase, isoform lb, γ sub |
53 |
203256_at |
CDH3 |
NM_001793 |
cadherin 3, type 1, P-cadherin (placental) |
54 |
203349_s_at |
ETV5 |
NM_004454 |
ets variant gene 5 (ets-related molecule) |
55 |
203352_at |
ORC4L |
NM_002552 |
origin recognition complex, subunit 4-like |
56 |
203354_s_at |
|
NM_015310 |
|
57 |
203381_s_at |
|
NM_000041 |
|
58 |
203382_s_at |
APOE |
NM_000041 |
apolipoprotein E |
59 |
203407_at |
PPL |
NM_002705 |
periplakin |
60 |
203417_at |
MFAP2 |
NM_017459 |
microfibrillar-associated protein 2, tran var 1 |
61 |
203438_at |
|
NM_003714 |
stanniocalcin 2 |
62 |
203453_at |
SCNN1A |
NM_001038 |
sodium channel, nonvoltage-gated 1 α |
63 |
203499_at |
EPHA2 |
NM_004431 |
EphA2 |
64 |
203548_s_at |
|
NM_000237 |
lipoprotein lipase |
65 |
203570_at |
LOXL1 |
NM_005576 |
lysyl oxidase-like 1 |
66 |
203632_s_at |
GPRC5B |
NM_016235 |
G protein-coupled rec, fam C, group 5, mem B |
67 |
203673_at |
TG |
NM_003235 |
thyroglobulin |
68 |
203699_s_at |
|
NM_013989 |
type II iodothyronine deiodinase |
69 |
203700_s_at |
DIO2 |
NM_013989 |
deiodinase, iodothyronine, type II, tran var 1 |
70 |
203786_s_at |
TPD52L1 |
NM_003287 |
tumor protein D52-like 1 |
71 |
203851_at |
IGFBP6 |
NM_002178 |
insulin-like growth factor binding protein 6 |
72 |
203854_at |
IF |
NM_000204 |
I factor (complement) |
73 |
203859_s_at |
PALM |
NM_002579 |
paralemmin |
74 |
203875_at |
|
NM_003069 |
SWISNF related, matrix assoc, actin dep regulator of chromatin subfam a mem 1 |
75 |
203881_s_at |
|
NM_004010 |
dystrophin, includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270,
DXS272 (DMD), transcript variant Dp427p2 |
76 |
203889_at |
SGNE1 |
NM_003020 |
secretory granule, neuroendocrine protein 1 |
77 |
203911_at |
RAP1GA1 |
NM_002885 |
RAP1, GTPase activating protein 1 |
78 |
203934_at |
KDR |
NM_002253 |
kinase insert domain receptor |
79 |
203986_at |
GENX-3414 |
NM_003943 |
genethonin 1 |
80 |
204105_s_at |
NRCAM |
NM_005010 |
neuronal cell adhesion molecule |
81 |
204124_at |
NaPi-IIb |
AF146796 |
Na dependent phosphate transporter isoform |
82 |
204149_s_at |
GSTM4 |
NM_000850 |
glutathione S-transferase M4 |
83 |
204152_s_at |
|
AI738965 |
manic fringe (Drosophila) homolog |
84 |
204154_at |
CDO1 |
NM_001801 |
cysteine dioxygenase, type I |
85 |
204259_at |
MMP7 |
NM_002423 |
matrix metalloproteinase 7 (matrilysin, uterine) |
86 |
204260_at |
CHGB |
NM_001819 |
chromogranin B (secretogranin 1) |
87 |
204268_at |
S100A2 |
NM_005978 |
S100 calcium-binding protein A2 |
88 |
204288_s_at |
ARGBP2 |
NM_021069 |
ArgAbl-interacting prot ArgBP2, trans var 2 |
89 |
204298_s_at |
LOX |
NM_002317 |
lysyl oxidase |
90 |
204337_at |
|
NM_005613 |
regulator of G-protein signalling 4 |
91 |
204416_x_at |
APOC1 |
NM_001645 |
apolipoprotein C-I |
92 |
204424_s_at |
|
NM_018640 |
neuronal specific transcription factor DAT1 |
93 |
204433_s_at |
|
NM_006038 |
spermatogenesis associated PD1 |
94 |
204442_x_at |
LTBP4 |
NM_003573 |
latent transforming GFβ binding protein 4 |
95 |
204452_s_at |
|
NM_003505 |
frizzled 1 |
96 |
204476_s_at |
PC |
NM_022172 |
pyruvate carboxylase |
97 |
204503_at |
EVPL |
NM_001988 |
envoplakin |
98 |
204591_at |
CHL1 |
NM_006614 |
cell adhesion molecule w/ homology to homolog L1 |
99 |
204600_at |
EPHB3 |
NM_004443 |
EphB3 |
100 |
204623_at |
TFF3 |
NM_003226 |
trefoil factor 3 (intestinal) |
101 |
204625_s_at |
|
NM_000212 |
integrin, β 3 (platelet glycoprotein IIIa, CD61) |
102 |
204697_s_at |
CHGA |
NM_001275 |
chromogranin A |
103 |
204741_at |
BICD1 |
NM_001714 |
Bicaudal D (Drosophila) homolog 1 |
104 |
204753_s_at |
HLF |
NM_002126 |
hepatic leukemia factor |
105 |
204754_at |
HLF |
NM_002126 |
hepatic leukemia factor |
106 |
204755_x_at |
HLF |
NM_002126 |
hepatic leukemia factor |
107 |
204787_at |
Z391G |
NM_007268 |
Ig superfamily protein |
108 |
204797_s_at |
EMAPL |
NM_004434 |
echinoderm microtubule-associated pro-like |
109 |
204869_at |
|
AL031664 |
DNA seq RP4-531H16 chrom 20p11.22-12 |
110 |
204870_s_at |
PCSK2 |
NM_002594 |
proprotein convertase subtilisinkexin type 2 |
111 |
204933_s_at |
TNFRSF11 B |
NM_002546 |
TNFR superfamily, member 11b |
112 |
204934_s_at |
HPN |
NM_002151 |
hepsin (transmembrane protease, serine 1) |
113 |
204944_at |
PTPRG |
NM_002841 |
protein tyrosine phosphatase receptor type G |
114 |
204964_s_at |
SSPN |
NM_005086 |
sarcospan (Kras oncogene-associated gene) |
115 |
204975_at |
EMP2 |
NM_001424 |
epithelial membrane protein 2 |
116 |
204990_s_at |
ITGB4 |
NM_000213 |
integrin, beta 4 |
117 |
205051_s_at |
KIT |
NM_000222 |
v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog |
118 |
205110_s_at |
FGF13 |
NM_004114 |
fibroblast qrowth factor 13 |
119 |
205153_s_at |
TNFRSF5 |
NM_001250 |
TNFR superfamily, mem 5 |
120 |
205168_at |
DDR2 |
NM_006182 |
discoidin domain receptor family, member 2 |
121 |
205258_at |
INHBB |
NM_002193 |
inhibin, β B (activin AB β polypeptide) |
122 |
205286_at |
|
NM_003222 |
transcription factor AP-2 gamma |
123 |
205325_at |
KIAA0273 |
NM_014759 |
KIAA0273 gene product |
124 |
205336_at |
PVALB |
NM_002854 |
parvalbumin |
125 |
205402_x_at |
PRSS2 |
NM_002770 |
protease, serine, 2 (trypsin 2) |
126 |
205413_at |
C11ORF8 |
NM_001584 |
chromosome 11 open reading frame 8 |
127 |
205455_at |
MST1R |
NM_002447 |
macrophage stimulating 1 receptor |
128 |
205470_s_at |
KLK11 |
NM_006853 |
kallikrein 11 |
129 |
205479_s_at |
PLAU |
NM_002658 |
plasminogen activator, urokinase |
130 |
205481_at |
ADORA1 |
NM_000674 |
adenosine A1 receptor |
131 |
205485_at |
RYR1 |
NM_000540 |
ryanodine receptor 1 (skeletal) |
132 |
205490_x_at |
connexin 31 |
NM_024009 |
gap junction protein, beta 3, 31 kD |
133 |
205531_s_at |
GA |
NM_013267 |
breast cell glutaminase |
134 |
205593_s_at |
PDE9A |
NM_002606 |
phosphodiesterase 9A |
135 |
205614_x_at |
MST1 |
NM_020998 |
macrophage stimulating 1 |
136 |
205627_at |
|
NM_001785 |
cytidine deaminase |
137 |
205639_at |
|
NM_001637 |
acyloxyacyl hydrolase |
138 |
205683_x_at |
TPSB1 |
NM_003294 |
tryptase beta 1 |
139 |
205689_at |
KIAA0435 |
NM_014801 |
KIAA0435 gene product |
140 |
205700_at |
RODH |
NM_003725 |
oxidative 3 α hydroxysteroid dehydrogenase; retinol dehydrogenase; 3-hydroxysteroid
epimerase |
141 |
205710_at |
LRP2 |
NM_004525 |
low density lipoprotein-related protein 2 |
142 |
205715_at |
BST1 |
NM_004334 |
bone marrow stromal cell antigen 1 |
143 |
205717_x_at |
|
NM_002588 |
protocadherin gamma subfamily C, 3 |
144 |
205728_at |
|
AL022718 |
DNA seq from clone 1052M9 on chrom Xq25 |
145 |
205747_at |
CBLN1 |
NM_004352 |
cerebellin 1 precursor |
146 |
205778_at |
KLK7 |
NM_005046 |
kallikrein 7 (chymotryptic, stratum corneum) |
147 |
205858_at |
NGFR |
NM_002507 |
nerve growth factor receptor |
148 |
205927_s_at |
CTSE |
NM_001910 |
cathepsin E |
149 |
205980_s_at |
ARHGAP8 |
NM_015366 |
Rho GTPase activating protein 8 |
150 |
206002_at |
GPR64 |
NM_005756 |
G protein-coupled receptor 64 |
151 |
206114_at |
EPHA4 |
NM_004438 |
EphA4 |
152 |
206390_x_at |
|
NM_002619 |
platelet factor 4 |
153 |
206594_at |
KIAA0135 |
NM_015148 |
KIAA0135 protein |
154 |
206595_at |
CST6 |
NM_001323 |
cystatin EM |
155 |
206714_at |
ALOX15B |
NM_001141 |
arachidonate 15-lipoxygenase, second type |
156 |
206757_at |
PDE5A |
NM_001083 |
phosphodiesterase 5A, cGMP-specific |
157 |
206866_at |
CDH4 |
NM_001794 |
cadherin 4, type 1, R-cadherin (retinal) |
158 |
206884_s_at |
SCEL |
NM_003843 |
sciellin |
159 |
206912_at |
FOXE1 |
NM_004473 |
forkhead box E1(thyroid transcription factor2) |
160 |
207111_at |
|
NM_001974 |
egf-like module cont., mucin-like, hormone rec-like seq 1 |
161 |
207144_s_at |
CITED1 |
NM_004143 |
Cbpp300-interacting transactivator, with GluAsp-rich carboxy-terminal domain, 1 |
162 |
207173_s_at |
|
NM_001797 |
OB-cadherin-1 |
163 |
207674_at |
FCAR |
NM_002000 |
Fc fragment of IgA |
164 |
207695_s_at |
IGSF1 |
NM_001555 |
immunoglobulin superfamily, member 1 |
165 |
207795_s_at |
CD94 |
AB009597 |
|
166 |
207826_s_at |
ID3 |
NM_002167 |
inhibitor of DNA binding 3, dominant negative protein |
167 |
207923_s_at |
PAX8 |
NM_013953 |
paired box gene 8 |
168 |
208396_s_at |
PDE1A |
NM_005019 |
phosphodiesterase 1A, calmodulin-dependent |
169 |
208451_s_at |
C4B |
NM_000592 |
complement component 4B |
170 |
208712_at |
PRAD1 |
M73554 |
cyclinD1 |
171 |
208747_s_at |
|
NM_001734 |
subcomponent C1s, α- and β-chains |
172 |
209021_x_at |
|
BC001331 |
Similar to KIAA0652 gene product |
173 |
209035_at |
|
NM_002391 |
midkine |
174 |
209071_x_at |
|
AF159570 |
regulator of G-protein signalling 5 |
175 |
209079_x_at |
|
AF152318 |
protocadherin gamma A1 |
176 |
209173_at |
|
NM_006408 |
putative secreted protein XAG |
177 |
209208_at |
|
NM_004870 |
clone 015e11 My008 protein |
178 |
209228_x_at |
|
NM_006765 |
Putative prostate cancer tumor suppressor |
179 |
209270_at |
LAMB3 |
NM_000228 |
laminin S B3 chain |
180 |
209280_at |
|
NM_006039 |
chromosome 17 unknown product mRNA |
181 |
209291_at |
|
NM_001546 |
inhibitor of DNA binding 4, dominant negative helix-loop-helix protein |
182 |
209297_at |
ITSN |
AF114488 |
intersectin short isoform |
183 |
209335_at |
|
AI281593 |
|
184 |
209365_s_at |
ECM1 |
NM_004425 |
extracellular matrix protein 1 |
185 |
209386_at |
|
AI346835 |
transmembrane 4 superfamily member 1 |
186 |
209485_s_at |
ORP1 |
AF274714 |
oxysterol-binding protein-related protein |
187 |
209496_at |
|
BC000069 |
retinoic acid receptor responder 2 |
188 |
209505_at |
|
NM_005654 |
nuclear receptor subfam 2, group F, mem 1 |
189 |
209506_s_at |
|
BC004154 |
nuclear receptor subfam 2, group F, mem 1 |
190 |
209529_at |
|
AF047760 |
phosphatidic acid phosphohydrolase type-2c |
191 |
209596_at |
|
AF245505 |
adlican |
192 |
209598_at |
KIAA0883 |
AB020690 |
KIAA0883 protein |
193 |
209652_s_at |
|
BC001422 |
Similar to placental growth factor, vascular endothelial growth factor-related protein |
194 |
209691_s_at |
|
BC003541 |
hypothetical protein FLJ10488 |
195 |
209739_s_at |
|
AI814551 |
GS2 gene |
196 |
209772_s_at |
|
X69397 |
cell surface antigen |
197 |
209781_s_at |
T-Star |
AF069681 |
T-Star |
198 |
209792_s_at |
|
BC002710 |
kallikrein 10 |
199 |
209810_at |
SP-B |
J02761 |
pulmonary surfactant-associated protein B |
200 |
209897_s_at |
|
AF055585 |
neurogenic extracellular slit protein Slit2 |
201 |
209924_at |
|
AB000221 |
small inducible cytokine subfamily A (Cys-mem18, pulmonary/activation-reg |
202 |
209946_at |
|
U58111 |
FLT4 ligand |
203 |
209990_s_at |
|
NM_005458 |
GABA-B receptor |
204 |
210051_at |
CAMP-GEFI |
U78168 |
cAMP-regulated guanine nucleotide exchange factor I |
205 |
210055_at |
|
NM_000369 |
thyroid stimulating hormone receptor |
206 |
210072_at |
|
NM_006274 |
beta chemokine Exodus-3 |
207 |
210078_s_at |
|
L39833 |
K+ channel beta subunit |
208 |
210096_at |
|
NM_000779 |
lung cvtochrome P450 (IV subfamily) BI |
209 |
210298_x_at |
FHL1 |
AF098518 |
four and 1/2 LIM domains1 protein isoform B |
210 |
210321_at |
|
M36118 |
cytotoxin serine protease-C |
211 |
210342_s_at |
TPO |
NM_000547 |
thyroid peroxidase |
212 |
210372_s_at |
TPD52L2 |
AF208012 |
tumor protein D52-like 2 |
213 |
210397_at |
|
U73945 |
beta-defensin-1 |
214 |
210401_at |
|
U45448 |
P2x1 receptor |
215 |
210471_s_at |
|
U33428 |
K+ channel β 1a subunit mRNA, alt spliced |
216 |
210473_s_at |
p58GTA |
M37712 |
galactosyltransferase assoc protein kinase |
217 |
210605_s_at |
|
BC003610 |
Similar to milk fat globule-EGF factor 8 |
218 |
210640_s_at |
GPCR-Br |
U63917 |
G protein coupled receptor |
219 |
210660_at |
LIR-6 |
AF025529 |
leucocyte immunoglobulin-like receptor-6b |
220 |
210727_at |
|
NM_001741 |
Calcitonin, calcitonincalcitonin-rel polypeptide, α |
221 |
210762_s_at |
HP |
NM_006094 |
HP protein |
222 |
210809_s_at |
|
D13665 |
osf-2 mRNA for osteoblast specific factor 2 |
223 |
210827_s_at |
ESE-1 |
U73844 |
epithelial-specific transcription factor ESE-1 a |
224 |
211100_x_at |
|
U82278 |
immunoglobulin-like transcript 1c |
225 |
211101_x_at |
|
U82276 |
immunoglobulin-like transcript 1a |
226 |
211102_s_at |
|
U82277 |
immunoglobufin-like transcript 1b |
227 |
211161_s_at |
|
AF130082 |
collagen, type III, alpha 1 |
228 |
211217_s_at |
|
AF051426 |
slow delayed rectifier channel subunit |
229 |
211538_s_at |
|
U56725 |
heat shock 70kD protein 2 |
230 |
211564_s_at |
|
BC003096 |
Similar to LIM domain protein |
231 |
211679_x_at |
GABBR2 |
AF095784 |
GABA-B receptor R2 |
232 |
211813_x_at |
|
AF138303 |
decorin D |
233 |
211959_at |
IGFBP5 |
AW007532 |
insulin-like growth factor binding protein 5 |
234 |
211964_at |
|
AK025912 |
type IV collagen alpha (2) chain |
235 |
212067_s_at |
|
AL573058 |
complement component 1, r subcomponent |
236 |
212253_x_at |
KIAA0728 |
BG253119 |
KIAA0728 protein |
237 |
212294_at |
|
BG111761 |
DKFZp586B0918 |
238 |
212328_at |
KIAA1102 |
AB029025 |
KIAA1102 protein |
239 |
212344_at |
KIAA1077 |
AW043713 |
KIAA1077 protein |
240 |
212353_at |
KIAA1077 |
AI479175 |
KIAA1077 protein |
241 |
212354_at |
KIAA1077 |
BE500977 |
KIAA1077 protein |
242 |
212464_s_at |
FN |
X02761 |
fibronectin precursor |
243 |
212724_at |
|
NM 005168 |
ras homolog gene family, member E |
244 |
212738_at |
|
AV717623 |
|
245 |
212775_at |
|
AI978623 |
KIAA0657 protein |
246 |
212803_at |
|
NM_005967 |
NGFI-A binding protein 2 |
247 |
212806_at |
KIAA0367 |
AL138349 |
KIAA0367 protein |
248 |
212850_s_at |
|
AA584297 |
low density lipoprotein receptor-rel protein 4 |
249 |
212865_s_at |
|
BF449063 |
collagen, type XIV, alpha 1 (undulin) |
250 |
212912_at |
|
AI992251 |
Ribosomal pro S6 kinase, 90 kDa, polypep 2 |
251 |
212992_at |
|
AI935123 |
|
252 |
213029_at |
|
AL110126 |
DKFZp564H1916 |
253 |
213306_at |
|
AA917899 |
multiple PDZ domain protein |
254 |
213381_at |
|
N91149 |
DKFZp586M2022 |
255 |
213423_x_at |
|
AI884858 |
Putative prostate cancer tumor suppressor |
256 |
213553_x_at |
|
W79394 |
apolipoprotein C-I |
257 |
213668_s_at |
|
AI989477 |
SRY (sex determining region Y)-box 4 |
258 |
213693_s at |
|
AI610869 |
mucin 1, transmembrane |
259 |
213800_at |
|
X04697 |
complement factor H 38-kDa N-term frag |
260 |
213904_at |
|
AL390170 |
DKFZp547E184 |
261 |
213924_at |
FLJ11585 |
BF476502 |
hypothetical protein FLJ11585 |
262 |
214023_x_at |
|
AL533838 |
tubulin, beta polypeptide |
263 |
214175_x_at |
|
AI254547 |
LIM domain protein |
264 |
214239_x_at |
Mel-18 |
AI560455 |
Zinc finger protein 144 |
265 |
214307_at |
|
AI478172 |
homogentisate 1,2-dioxygenase |
266 |
214434_at |
KIAA0417 |
AB007877 |
KIAA0417 gene product |
267 |
214632_at |
|
NM_003872 |
neuropilin 2 |
268 |
214680_at |
|
BF674712 |
neurotrophic tyrosine kinase receptor 2 |
269 |
214702_at |
MSF-FN70 |
AJ276395 |
migration stimulation factor FN70 |
270 |
214763_at |
FLJ13875 |
AK023937 |
FLJ13875 |
271 |
214803_at |
|
BF344237 |
DKFZp564N1116 |
272 |
214955_at |
|
AI912086 |
DNA seq clone 1170K4 chrom 22q12.2-13.1 |
273 |
214977_at |
FLJ13790 |
AK023852 |
FLJ13790 |
274 |
215016_x_at |
KIAA0728 |
BC004912 |
KIAA0728 protein |
275 |
215034_s_at |
FLJ13302 |
AI189753 |
FLJ13302 |
276 |
215076_s_at |
FLJ11428 |
AU144167 |
FLJ11428 |
277 |
215243_s_at |
GJB3 |
AF099730 |
connexin 31 |
278 |
215388_s_at |
|
X56210 |
complement Factor H-related protein 1 |
279 |
215442_s_at |
|
BE740743 |
thyroid stimulating hormone receptor |
280 |
215443_at |
|
BE740743 |
thyroid stimulating hormone receptor |
281 |
215506_s_at |
|
AK021882 |
highly sim to putative tumor sup NOEY2 |
282 |
215536_at |
LMP7, |
X87344 |
DMA, DMB, HLA-Z1, IPP2, LMP2, TAP1, TAP2, DOB, DQB2 and RING8, 9, 13, 14 genes |
283 |
216356_x_at |
KIAA0734 |
AB018277 |
KIAA0734 protein |
284 |
216470_x_at |
|
AF009664 |
T cell receptor β locus, 3 trypsinogen repeats |
285 |
216569_at |
FABP3-ps |
U72237 |
fatty acid-binding protein pseudogene |
286 |
217546_at |
|
R06655 |
|
287 |
217561_at |
|
BF447272 |
|
288 |
217592_at |
|
AV684859 |
|
289 |
217767_at |
|
NM 000064 |
|
290 |
217820_s_at |
FLJ10773 |
NM_018212 |
hypothetical protein FLJ10773 |
291 |
217875_s_at |
TMEPAI |
NM_020182 |
transmem, prostate androgen induced RNA |
292 |
218002_s_at |
SCYB14 |
NM_004887 |
small inducible cytokine subfam B (Cys-X-mem 14 (BRAK) |
293 |
218182_s_at |
CLDN1 |
NM_021101 |
claudin 1 |
294 |
218353_at |
|
NM_025226 |
MSTP032 protein |
295 |
218368_s_at |
FN14 |
NM_016639 |
type I transmembrane protein Fn14 |
296 |
218418_s_at |
|
NM_015493 |
DKFZP434N161 |
297 |
218469_at |
CKTSF1B1 |
NM_013372 |
Cvs knot superfamily 1, BMP antagonist 1 |
298 |
218537_at |
FLJ20568 |
NM_017885 |
hypothetical protein FLJ20568 |
299 |
218546_at |
FLJ14146 |
NM_024709 |
hypothetical protein FLJ14146 |
300 |
218613_at |
|
NM_018422 |
hypothetical protein DKFZp761K1423 |
301 |
218653_at |
SLC25A15 |
NM_014252 |
solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 15 |
302 |
218691_s at |
RIL |
NM_003687 |
reversion-induced LIM protein |
303 |
218844_at |
FLJ20920 |
NM_025149 |
hypothetical protein FLJ20920 |
304 |
218856_at |
LOC51323 |
NM_016629 |
hypothetical protein LOC51323 |
305 |
218952_at |
SAAS |
NM_013271 |
granin-like neuroendocrine peptide precursor |
306 |
218960_at |
TMPRSS4 |
NM_016425 |
transmembrane protease, serine 4 |
307 |
219010_at |
FLJ10901 |
NM_018265 |
hypothetical protein FLJ10901 |
308 |
219127_at |
MGC11242 |
NM_024320 |
hypothetical protein MGC11242 |
309 |
219191_s_at |
BIN2 |
NM_016293 |
bridging integrator 2 |
310 |
219195_at |
PPARGC1 |
NM_013261 |
peroxisome proliferative activated receptor, y, coactivator 1 |
311 |
219211_at |
USP18 |
NM_017414 |
ubiquitin specific protease 18 |
312 |
219277_s_at |
FLJ10851 |
NM_018245 |
hypothetical protein FLJ10851 |
313 |
219331_s_at |
FLJ10748 |
NM_018203 |
hypothetical protein FLJ10748 |
314 |
219416_at |
CSR1 |
NM_016240 |
CSR1 protein |
315 |
219436_s_at |
LOC51705 |
NM_016242 |
endomucin-2 |
316 |
219440_at |
RAI2 |
NM_021785 |
retinoic acid induced 2 |
317 |
219463_at |
HS1119D91 |
NM_012261 |
sim to S68401 (cattle) glucose induced gene |
318 |
219476_at |
MGC4309 |
NM_024115 |
hypothetical protein MGC4309 |
319 |
219525_at |
FLJ10847 |
NM_018242 |
hypothetical protein FLJ10847 |
320 |
219527_at |
FLJ20605 |
NM_017898 |
hypothetical protein FLJ20605 |
321 |
219561_at |
LOC51226 |
NM_016429 |
COPZ2 for nonclathrin coat protein zeta-COP |
322 |
219596_at |
LOC56906 |
NM_020147 |
hyp protein from EUROIMAGE 511235 |
323 |
219597_s_at |
DUOX1 |
NM_017434 |
dual oxidase 1 |
324 |
219743_at |
HEY2 |
NM_012259 |
hairyenhancer-of-split rel with YRPW motif 2 |
325 |
219749_at |
FLJ20967 |
NM_022071 |
hypothetical protein FLJ20967 |
326 |
219836_at |
MGC10796 |
NM_024508 |
hypothetical protein MGC10796 |
327 |
219855_at |
FLJ10628 |
NM_018159 |
hypothetical protein FLJ10628 |
328 |
219856_at |
MGC2742 |
NM_023938 |
hypothetical protein MGC2742 |
329 |
219926_at |
POP3 |
NM_022361 |
popeye protein 3 |
330 |
219932_at |
VLCS-H 1 |
NM_014031 |
v long-chain acyl-CoA synthetase homolog 1 |
331 |
219958_at |
FLJ11190 |
NM_018354 |
hypothetical protein FLJ11190 |
332 |
220034_at |
|
NM_007199 |
interleukin-1 receptor-associated kinase M |
333 |
220108_at |
GNA14 |
NM_004297 |
guanine nucl binding protein (G protein), α 14 |
334 |
220332_at |
CLDN16 |
NM_006580 |
claudin 16 |
335 |
220595_at |
DKFZp434B0 417 |
NM_013377 |
hypothetical protein DKFZp434B0417 |
336 |
220751_s_at |
C5ORF4 |
NM_016348 |
chromosome 5 open reading frame 4 |
337 |
221009_s_at |
PGAR |
NM_016109 |
PPAR(gamma) angiopoietin related protein |
338 |
221073_s_at |
NOD1 |
NM_006092 |
caspase recruitment domain 4 |
339 |
221147_x_at |
WWOX |
NM_018560 |
WW domain-containing oxidoreductase |
340 |
221266_s_at |
LOC81501 |
NM_030788 |
DC-specific transmembrane protein |
341 |
221270_s_at |
TGT |
NM_031209 |
tRNA-guanine transglycosylase |
342 |
221489_s_at |
|
AF227517 |
sprouty (Drosophila) homolog 4 |
343 |
221577_x_at |
|
AF003934 |
prostate differentiation factor |
344 |
221636_s_at |
|
AL136931 |
DKFZp586G2122 |
345 |
221701_s_at |
|
AF352728 |
STRA6 isoform 1 mRNA, alternatively spliced |
346 |
221724_s_at |
|
AF200738 |
C-type lectin DDB27 short form |
347 |
221795_at |
|
AI346341 |
Similar to hypothetical protein FLJ20093 |
348 |
221796_at |
|
AA707199 |
Similar to hypothetical protein FLJ20093 |
349 |
221799_at |
KIAA1402 |
AB037823 |
KIAA1402 protein |
350 |
221870_at |
|
AI417917 |
FLJ22356 fis |
351 |
221900_at |
|
AI806793 |
collagen, type VIII, alpha 2 |
352 |
221928_at |
|
AI057637 |
Weakly sim to 2109260A B cell growth factor |
353 |
221959_at |
|
BE672313 |
highly sim to HSU79298 Human clone 23803 |
354 |
32128_at |
|
Y13710 |
alternative activated macrophage specific CC chemokine 1 |
355 |
37004_at |
SP-B |
J02761 |
pulmonary surfactant-associated protein B |
356 |
37117_at |
|
Z83838 |
GTPase-activating protein sim to rhoGAP protein. ribosomal protein L6 pseudogene |
357 |
37152_at |
|
L07592 |
peroxisome proliferator activated receptor |
358 |
37408_at |
KIAA0709 |
AB014609 |
KIAA0709 protein |
359 |
38691_s at |
SP5 |
J03553 |
pulmonary surfactant protein |
360 |
45297_at |
|
AI417917 |
|
361 |
63305_at |
|
D81792 |
|
362 |
823_at |
|
HSU84487 |
CX3C chemokine precursor, alt spliced |
363 |
91920_at |
|
AI205180 |
|
364 |
|
|
|
SGENE forward primer |
365 |
|
|
|
SGENE reverse primer |
366 |
|
|
|
SGENE probe |
367 |
|
|
|
TESTICAN1 forward primer |
368 |
|
|
|
TESTICAN1 reverse primer |
369 |
|
|
|
TESTICAN1 probe |
370 |
|
|
|
GABRE forward primer |
371 |
|
|
|
GABRE reverse primer |
372 |
|
|
|
GABRE probe |
373 |
|
|
|
CDH3 forward primer |
374 |
|
|
|
CDH3 reverse primer |
375 |
|
|
|
CDH3 probe |
376 |
|
|
|
FN1 forward primer |
377 |
|
|
|
FN1 reverse primer |
378 |
|
|
|
FN1 probe |
379 |
|
|
|
TPO-1 forward primer |
380 |
|
|
|
TPO-1 reverse primer |
381 |
|
|
|
TPO-1 probe |
382 |
|
|
|
TPO-2 forward primer |
383 |
|
|
|
TPO-2 reverse primer |
384 |
|
|
|
TPO-2 probe |
385 |
|
|
|
KCNAB1-1 forward primer |
386 |
|
|
|
KCNAB1-1 reverse primer |
387 |
|
|
|
KCNAB1-1 probe |
388 |
|
|
|
KCNAB1-2 forward primer |
389 |
|
|
|
KCNAB1-2 reverse primer |
390 |
|
|
|
KCNAB1-2 probe |
391 |
|
|
|
FABP4-1 forward primer |
392 |
|
|
|
FABP4-1 reverse primer |
393 |
|
|
|
FABP4-1 probe |
394 |
|
|
|
FABP4-2 forward primer |
395 |
|
|
|
FABP4-2 reverse primer |
396 |
|
|
|
FABP4-2 probe |
397 |
|
|
|
DOI1-1 forward primer |
398 |
|
|
|
DOI1-1 reverse primer |
399 |
|
|
|
DOI1-1 probe |
400 |
|
|
|
DOI1-2 forward primer |
401 |
|
|
|
DOI1-2 reverse primer |
402 |
|
|
|
DOI1-2 probe |
403 |
|
|
|
B-ACTIN forward primer |
404 |
|
|
|
B-ACTIN reverse primer |
405 |
|
|
|
B-ACTIN probe |
406 |
|
|
|
GOLGIN67 forward primer |
407 |
|
|
|
GOLGIN67 reverse primer |
408 |
|
|
|
GOLGIN67 probe |
409 |
|
|
|
PAX8 forward primer |
410 |
|
|
|
PAX8 reverse primer |
411 |
|
|
|
PAX8 probe |
412 |
|
|
|
HERC forward primer |
413 |
|
|
|
HERC reverse primer |
414 |
|
|
|
HERC probe |
415 |
|
|
|
DDIT3 forward primer |
416 |
|
|
|
DDIT3 reverse primer |
417 |
|
|
|
DDIT3 probe |
418 |
|
|
|
ITM1 forward primer |
419 |
|
|
|
ITM1 reverse primer |
420 |
|
|
|
ITM1 probe |
421 |
|
|
|
C1OF24 forward primer |
422 |
|
|
|
C1OF24 reverse primer |
423 |
|
|
|
C1OF24 probe |
424 |
|
|
|
MOT8 forward primer |
425 |
|
|
|
MOT8 reverse primer |
426 |
|
|
|
MOT8 probe |
427 |
|
|
|
ARG2 forward primer |
428 |
|
|
|
ARG2 reverse primer |
429 |
|
|
|
ARG2 probe |