Government Interests
[0001] This invention was made with government support under grant No. 1 U01 AI057315-01
awarded by the National Institutes of Health. The government has certain rights in
the invention.
Field of the Invention
[0002] The present invention relates to methods and compositions for high-throughput analysis
of populations of individual molecules, and more particularly, to methods and compositions
related to fabrication of single molecule arrays and applications thereof, especially
in high-throughput nucleic acid sequencing and genetic analysis.
BACKGROUND
[0003] Large-scale molecular analysis is central to understanding a wide range of biological
phenomena related to states of health and disease both in humans and in a host of
economically important plants and animals, e.g.
Collins et al (2003), Nature, 422: 835-847;
Hirschhorn et al (2005), Nature Reviews Genetics, 6: 95-108;
National Cancer Institute, Report of Working Group on Biomedical Technology, "Recommendation
for a Human Cancer Genome Project," (February, 2005). Miniaturization has proved to be extremely important for increasing the scale and
reducing the costs of such analyses, and an important route to miniaturization has
been the use of microarrays of probes or analytes. Such arrays play a key role in
most currently available, or emerging, large-scale genetic analysis and proteomic
techniques, including those for single nucleotide polymorphism detection, copy number
assessment, nucleic acid sequencing, and the like, e.g.
Kennedy et al (2003), Nature Biotechnology, 21: 1233-1237;
Gunderson et al (2005), Nature Genetics, 37: 549-554;
Pinkel and Albertson (2005), Nature Genetics Supplement, 37: S11-S17;
Leamon et al (2003), Electrophoresis, 24: 3769-3777;
Shendure et al (2005), Science, 309: 1728-1732;
Cowie et al (2004), Human Mutation, 24:261-271; and the like. However, the scale of microarrays currently used in such techniques
still falls short of that required to meet the goals of truly low cost analyses that
would make practical such operations as personal genome sequencing, environmental
sequencing to use changes in complex microbial communities as an indicator of states
of health, either personal or environmental, studies that associate genomic features
with complex traits, such as susceptibilities to cancer, diabetes, cardiovascular
disease, and the like, e.g. Collins et al (cited above); Hirschhorn et al (cited above);
Tringe et al (2005), Nature Reviews Genetics, 6: 805-814;
Service (2006), Science, 311: 1544-1546.
[0004] Increasing the scale of analysis in array-based schemes for DNA sequencing is particularly
challenging as the feature size of the array is decreased to molecular levels, since
most schemes require not only a procedure for forming high density arrays, but also
repeated cycles of complex biochemical steps that complicate the problems of array
integrity, signal generation, signal detection, and the like, e.g.
Metzker (2005), Genome Research, 15: 1767-1776;
Shendure et al (2004), Nature Reviews Genetics, 5: 335-344;
Weiss (1999), Science, 283: 1676-1683. Some approaches have employed high density arrays of unamplified target sequences,
which present serious signal-to-noise challenges, when "sequencing by synthesis" chemistries
have been used, e.g.
Balasubramanian et al, U.S. patent 6,787.308. Other approaches have employed in situ amplification of randomly disposed target
sequences, followed by application of "sequencing by synthesis" chemistries. Such
approaches also have given rise to various difficulties, including (i) significant
variability in the size of target sequence clusters, (ii) gradual loss of phase in
extension steps carried out by polymerases, (iii) lack of sequencing cycle efficiency
that inhibits read lengths, and the like, e.g.
Kartalov et al, Nucleic Acids Research, 32: 2873-2879 (2004);
Mitra et al, Anal. Biochem., 320: 55-65 (2003); Metzker (cited above).
US patent publication 2002/012930 describes methods and apparatus for sequencing a nucleic acid which involve a substrate
having a fiber optic surface which has pads of biotin therein.
WO02/074988 describes methods for producing a molecular array comprising a plurality of molecules
immobilised to a solid substrate at a density which allows individual immobilised
molecules to be individually resolved, wherein each individual molecule in the array
is spatially addressable and the identity of each molecule is known or determined
prior to immobilisation.
[0005] US patent publication 2002/076716 describes high density nucleic acid arrays and methods of synthesizing nucleic acid
sequences on a solid surface which involve the use of isothermal rolling circle amplification.
WO3/102231 describes a method the parallel sequencing of nucleic acids which utilises a porous
support and a continuous flow system.
Ladner et al (Laboratory Investigation, Aug 2001, Vol 81, no 8. pp 1079-1086) describes the use of rolling circle enabled universal micro-arrays to direct hotspot
mutations.
WO2004/076683 discloses methods and devices for analyzing nucleic acids which involve probe hybridisation.
US6355419 discloses methods of preparing a plurality of nucleic acid pools which are disclosed
as having a utility in hybridisation studies.
US 2004/248144 describes methods for producing a molecular array comprising a plurality of molecules
immobilised to a solid substrate at a density which allows individual immobilised
molecules to be individually resolved, wherein each individual molecule in the array
is spatially addressable and the identity of each molecule is known or determined
prior to immobilisation.
[0006] In view of the above, it would be advantageous for the medical, life science, and
agricultural fields if there were available molecular arrays and arraying techniques
that permitted efficient and convenient analysis of large numbers of individual molecules,
such as DNA fragments covering substantially an entire mammalian-sized genome, in
parallel in a single analytical operation.
SUMMARY OF THE INVENTION
[0007] In one aspect the invention provides a random array of DNA polynucleotides, wherein
said random array comprises:(a) a planar solid support comprising a surface, wherein
said surface comprises a regular array of discrete spaced apart regions defined on
said surface, and said discrete spaced apart regions are separated by inter-regional
areas, wherein said discrete spaced apart regions each have an area that permits the
capture of no more than a single concatemer, and (b) a plurality of DNA polynucleotides
randomly disposed on the discrete spaced apart regions, wherein each DNA polynucleotide
is a single stranded DNA concatemer that comprises multiple copies of a DNA fragment,
wherein the DNA concatemers do not bind the inter-regional areas, and wherein at least
a majority of the DNA concatemers attached to the array can be individually optically
resolved.
[0008] In one aspect the invention provides a method for making an array of the above mentioned
aspect, wherein said method comprises: disposing a composition comprising a plurality
of single stranded DNA concatemers on an article, said article comprising a planar
solid support and a surface wherein the concatemers have a size in the range of from
50 KB to 250 Kb and a coefficient of variation in molecular weight of less than about
30%, wherein the surface comprises a plurality of discrete spaced apart regions defined
on said surface, wherein said discrete spaced apart regions are arranged in a regular
array, and are separated by inter-regional areas to which concatemers do not bind,
and wherein the discrete spaced apart regions bind the DNA concatemers through attractive
noncovalent interactions, and wherein said discrete spaced apart regions each have
an area that permits the capture of no more than a single concatemer; thereby randomly
disposing DNA concatemers on said plurality of discrete spaced apart regions.
[0009] In one aspect the invention provides use of a random array of the invention for large-scale
parallel analysis of populations of DNA fragments.
[0010] In one aspect the invention provides a method of sequencing, said method comprising:
- a) providing a random array according to the invention, wherein a plurality of concatemers
on the array comprise multiple copies of DNA fragments from a patient b) conducting
parallel sequencing of concatemers on the random array.
[0011] In one aspect the invention provides a method of identifying a sequence of a target
polynucleotide, said method comprising: a) providing a random array according to claim
1, b) hybridizing one or more probes from a first set of probes to the random array
under conditions that permit the formation of perfectly matched duplexes between the
one or more probes and complementary sequences on target polynucleotides; c) hybridizing
one or more probes from a second set of probes to the random array under conditions
that permit the formation of perfectly matched duplexes between the one or more probes
and complementary sequences on target polynucleotides; d) ligating probes from the
first and second sets hybridized to a target polynucleotides at contiguous sites;
e) identifying the sequences of the ligated first and second probes; and f) repeating
steps (b) through (e) to determine sequence from the target polynucleotide based on
the identities of the ligated probes.
[0012] In one aspect, the disclosure provides high density single molecule arrays, methods
of making and using such compositions, and kits for implementing such methods. Compositions
of the disclosure in one form include random arrays of a plurality of different single
molecules disposed on a surface, where the single molecules each comprise a macromolecular
structure and at least one analyte, such that each macromolecular structure comprises
a plurality of attachment functionalities that are capable of forming bonds with one
or more functionalities on the surface. In one aspect, the analyte is a component
of the macromolecular structure, and in another aspect, the analyte is attached to
the macromolecular structure by a linkage between a unique functionality on such structure
and a reactive group or attachment moiety on the analyte. In another aspect, compositions
of the disclosure include random arrays of single molecules disposed on a surface,
where the single molecules each comprise a concatemer of at least one target polynucleotide
and each is attached to the surface by linkages formed between one or more functionalities
on the surface and complementary functionalities on the concatemer. In another form,
compositions of the disclosure include random arrays of single molecules disposed
on a surface, where the single molecules each comprise a concatemer of at least one
target polynucleotide and at least one adaptor oligonucleotide and each is attached
to such surface by the formation of duplexes between capture oligonucleotides on the
surface and the attachment oligonucleotides in the concatemer. In still another form,
compositions of the disclosure include random arrays of single molecules disposed
on a surface, where each single molecule comprises a bifunctional macromolecular structure
having a unique functionality and a plurality of complementary functionalities, and
where each single molecule is attached to the surface by linkages between one or more
functionalities on the surface and complementary functionalities on the bifunctional
macromolecular structure, the unique functionality having an orthogonal chemical reactivity
with respect to the complementary functionalities and being capable of forming a covalent
linkage with an analyte. In regard to the above compositions, in another aspect, such
single molecules are disposed in a planar array randomly distributed onto discrete
spaced apart regions having defined positions. Preferably, in this aspect, the discrete
spaced apart regions each have an area that permits the capture of no more than a
single molecule and each is surrounded by an inter-regional space that is substantially
free of other single molecules.
[0013] In one aspect, the disclosure includes an array of polymer molecules comprising:
(a) a support having a surface; and (b) a plurality of polymer molecules attached
to the surface, wherein each polymer molecule has a random coil state and comprises
a branched or linear structure of multiple copies of one or more linear polymeric
units, such that the polymer molecule is attached to the surface within a region substantially
equivalent to a projection of the random coil on the surface and randomly disposed
at a density such that at least thirty percent of the polymer molecules are separately
detectable. As discussed more fully below, whenever the polymer molecules are linear,
in one embodiment, "substantially equivalent" in reference to the above projection
means a substantially circular region with a diameter equal to the root mean square
of the end-to-end distance of such linear polymer. In another embodiment, for linear
or branched polymers, "substantially equivalent" means a substantially circular region
having a diameter that is one half or less than the total length of the polymer; or
in another embodiment one tenth or less; or in another embodiment, one hundredth or
less.
[0014] In another aspect the disclosure includes an array of polynucleotide molecules comprising:
(a) a support having a surface; and (b) a plurality of polynucleotide molecules attached
to the surface, wherein each polynucleotide molecule has a random coil state and comprises
a concatemer of multiple copies of a target sequence such that the polynucleotide
molecule is attached to the surface within a region substantially equivalent to a
projection of the random coil on the surface and randomly disposed at a density such
that at least thirty percent of the polynucleotide molecules have a nearest neighbour
distance of at least fifty nm.
[0015] A method of making arrays of provided polymer molecules wherein each polymer molecule
has a random coil or similar or other three-dimensional state and comprises a branched
or linear structure of multiple copies of one or more linear polymeric units, such
that the existing polymer molecule is attached to the surface within a region substantially
equivalent to a projection of the random coil on the surface or a region having size
that is one half or less, one tenth or less or one hundredth or less of the total
length of the polymer, and randomly disposed at a density such that at least twenty
or at least thirty percent of the polymer molecules are separately detectable.
[0016] In still another aspect, the disclosure provides an array of single molecules comprising:
(a) a support having a planar surface having a regular array of discrete spaced apart
regions, wherein each discrete spaced apart region has an area of less than 1µm
2 and contains reactive functionalities attached thereto; and (b) a plurality of single
molecules attached to the surface, wherein each single molecule comprises a macromolecular
structure and at least one analyte having an attachment moiety, such that each macromolecular
structure comprises a unique functionality and a plurality of attachment functionalities
that are capable of forming linkages with the reactive functionalities of the discrete
spaced apart regions, and such that the analyte is attached to the macromolecular
structure by a linkage between the unique functionality and the attachment moiety
of the analyte, wherein the plurality of single molecules are randomly disposed on
the discrete spaced apart regions such that at least a majority of the discrete spaced
apart regions contain only one single molecule.
[0017] In another aspect, the disclosure provides an array of polynucleotide molecules comprising:
(a) a support having a surface with capture oligonucleotides attached thereto; and
(b) a plurality of polynucleotide molecules attached to the surface, wherein each
polynucleotide molecule comprises a concatemer of multiple copies of a target sequence
and an adaptor oligonucleotide such that the polynucleotide molecule is attached to
the surface by one or more complexes formed between capture oligonucleotides and adaptor
oligonucleotides, the polynucleotide molecules being randomly disposed on the surface
at a density such that at least a majority of the polynucleotide molecules have a
nearest neighbour distance of at least fifty nm. In one embodiment of this aspect,
the surface is a planar surface having an array of discrete spaced apart regions,
wherein each discrete spaced apart region has a size equivalent to that of the polynucleotide
molecule and contains the capture oligonucleotides attached thereto and wherein substantially
all such regions have at most one of the polynucleotide molecules attached.
[0018] The disclosure further includes, a method of making an array of polynucleotide molecules
comprising the following steps: (a) generating a plurality of polynucleotide molecules
each comprising a concatemer of a DNA fragment from a source DNA and an adaptor oligonucleotide;
and (b) disposing the plurality of polynucleotide molecules onto a support having
a surface with capture oligonucleotides attached thereto so that the polynucleotide
molecules are fixed to the surface by one or more complexes formed between capture
oligonucleotides and adaptor oligonucleotides and so that the polynucleotide molecules
are randomly distributed on the surface at a density such that a majority of the polynucleotide
molecules have a nearest neighbour of at least fifty nm, thereby forming the array
of polynucleotide molecules.
[0019] In another aspect, the disclosure provides a method of determining a nucleotide sequence
of a target polynucleotide, the method comprising the steps of: (a) generating a plurality
of target concatemers from the target polynucleotide, each target concatemer comprising
multiple copies of a fragment of the target polynucleotide and the plurality of target
concatemers including a number of fragments that substantially covers the target polynucleotide;
(b) forming a random array of target concatemers fixed to a surface at a density such
that at least a majority of the target concatemers are optically resolvable; (c) identifying
a sequence of at least a portion of each fragment in each target concatemer; and (d)
reconstructing the nucleotide sequence of the target polynucleotide from the identities
of the sequences of the portions of fragments of the concatemers. In a preferred embodiment
of this aspect, the step of identifying includes the steps of (a) hybridizing one
or more probes from a first set of probes to the random array under conditions that
permit the formation of perfectly matched duplexes between the one or more probes
and complementary sequences on target concatemers; (b) hybridizing one or more probes
from a second set of probes to the random array under conditions that permit the formation
of perfectly matched duplexes between the one or more probes and complementary sequences
on target concatemers; (c) ligating probes from the first and second sets hybridized
to a target concatemer at contiguous sites; (d) identifying the sequences of the ligated
first and second probes; and (e) repeating steps (a) through (d) until the sequence
of the target polynucleotide can be determined from the identities of the sequences
of the ligated probes.
[0020] In another aspect, the disclosure includes kits for making random arrays of the invention
and for implementing applications of the random arrays of the invention, particularly
high-throughput analysis at one or more target polynucleotides.
[0021] The present invention provides a significant advance in the microarray field by providing
arrays of single molecules comprising linear polymer structures that may incorporate
or have attached target analyte molecules. In one form, such single molecules are
concatemers of target polynucleotides arrayed at densities that permit efficient high
resolution analysis of mammalian-sized genomes, including sequence determination of
all or substantial parts of such genomes, sequence determination of tagged fragments
from selected regions of multiple genomes, digital readouts of gene expression, and
genome-wide assessments of copy number patterns, methylation patterns, chromosomal
stability, individual genetic variation, and the like.
Brief Description of the Drawings
[0022]
Figs. 1A-1I illustrate various embodiments of the methods and compositions of the
invention.
Figs. 2A-2B illustrate methods of circularizing genomic DNA fragments for generating
concatemers of polynucleotide analytes.
Fig. 3 is an image of a glass surface containing a disposition of concatemers of E.coli
fragments.
Fig. 4 is an image of concatemers derived from two different organisms that are selectively
labelled using oligonucleotide probes.
Fig. 5 is an image of concatemers of DNA fragments that contain a degenerated base,
each of which is identified by a specific ligation probe.
Fig. 6 is an image of concatsmers of DNA fragments that contain a segment of degenerate
bases, pairs of which are identified by specific probes.
Fig. 7 is a scheme for identifying sequence differences between reference sequences
and test sequences using enzymatic mismatch detection and for constructing DNA circles
therefrom.
Fig. 8 is another for identifying sequence differences between a reference sequence
and a test sequence using enzymatic mismatch detection and for constructing DNA circles
therefrom.
DETAILED DESCRIPTION OF THE INVENTION
[0023] The practice of the present invention may employ, unless otherwise indicated, conventional
techniques and descriptions of organic chemistry, polymer technology, molecular biology
(including recombinant techniques), cell biology, biochemistry, and immunology, which
are within the skill of the art. Such conventional techniques include polymer array
synthesis, hybridization, ligation, and detection of hybridization using a label.
Specific illustrations of suitable techniques can be had by reference to the example
herein below. However, other equivalent conventional procedures can, of course, also
be used. Such conventional techniques and descriptions can be found in standard laboratory
manuals such as
Genome Anadysis: A Laboratory Manual Serves (Vols. I-IV), Using Anti bodies: A Laboratory
Manual, Cells: A Laboratory Manual, PCR Primer: A Laboratory Manual, and Molecular
Cloning: A Laboratory Manual (all from Cold Spring Harbor Laboratory Press),
Stryer, L. (1995) Biochemistry, (4th Ed.) Freeman, New York,
Gait, "Oliganucleotide Synthesis: A Practical Approach "1984, IRL Press, London, Nelson
and
Cox (2000), Lehninger, Principles of Biochemistry 3rd Ed., W. H. Freeman Pub., New
York, N.Y. and
Berg et al. (2002) Biochemisby, 5th Ed., W. H. Freeman Pub., New York, N.Y..
[0024] The disclosure provides Random single molecule arrays for large-scale parallel analysis
of populations of molecules, particularly DNA fragments, such as genomic DNA fragments.
Generally, single molecules of the disclosure comprise an attachment portion and an
analyte portion. The attachment portion comprises a macromolecular structure that
provides for multivalent attachment to a surface, particularly a compact or restricted
area on a surface so that signals generated from it or an attached analyte are concentrated.
That is, the macromolecular structure occupies a compact and limited region of the
surface. Macromolecular structures of the disclosure may be bound to a surface in
a variety of ways. Multi-valent bonds may be covalent or non-covalent. Non-covalent
bonds include formation of duplexes between capture oligonucleotides on the surface
and complementary sequences in the macromolecular structure, and adsorption to a surface
by attractive noncovalent interactions, such as Van der Waal forces, hydrogen bonding,
ionic and hydrophobic interactions, and the like. Multi-valent covalent bonding may
be accomplished, as described more fully below, by providing reactive functionalities
on the surface that can reactive with a plurality of complementary functionalities
in the macromolecular structures. An analyte portion may be attached to a macromolecular
structure by way of a unique linkage or it may form a part of, and be integral with,
the macromolecular structure. Single molecules of the disclosure are disposed randomly
on a surface of a support material, usually from a solution; thus, in one aspect,
single molecules are uniformly distributed on a surface in close approximation to
a Poisson distribution. In another aspect, single molecules are disposed on a surface
that contains discrete spaced apart regions in which single molecules are attached.
Preferably, macromolecular structures, preparation methods, and areas of such discrete
spaced apart regions are selected so that substantially all such regions contain at
most only one single molecule. Preferably, single molecules of the disclosure, particularly
concatemers, are roughly in a random coil configuration on a surface and are confined
to the area of a discrete spaced apart region. In one aspect, the discrete space apart
regions have defined locations in a regular array, which may correspond to a rectilinear
pattern, hexagonal pattern, or the like. A regular array of such regions is advantageous
for detection and data analysis of signals collected from the arrays during an analysis.
Also, single molecules confined to the restricted area of a discrete spaced apart
region provide a more concentrated or intense signal, particularly when fluorescent
probes are used in analytical operations, thereby providing higher signal-to-noise
values. Single molecules of the disclosure are randomly distributed on the discrete
spaced apart regions so that a given region usually is equally likely to receive any
of the different single molecules. In other words, the resulting arrays are not spatially
addressable immediately upon fabrication, but may be made so by carrying out an identification
or decoding operation. That is, the identities of the single molecules are discernable,
but not known. As described more fully below, in some aspects, there are subsets of
discrete spaced apart regions that receive single molecules only from corresponding
subsets, for example, as defined by complementary sequences of capture oligonucleotides
and adaptor oligonucleotides.
[0025] Macromolecular structures of the disclosure comprise polymers, either branched or
linear, and may be synthetic, e.g. branched DNA, or may be derived from natural sources,
e.g linear DNA fragments from a patient's genomic DNA. Usually, macromolecular structures
comprise concatemers of linear single stranded DNA fragments that can be synthetic,
derived from natural sources, or can be a combination of both. As used herein, the
term "target sequence" refers to either a synthetic nucleic acid or a nucleic acid
derived from a natural source, such as a patient specimen, or the like. Usually, target
sequences are part of a concatemer generated by methods of the disclosure, e.g. by
RCR, but may also be part of other structures, such as dendrimers, and other branched
structures. When target sequences are synthetic or derived from natural sources, they
are usually replicated by various methods in the process of forming macromolecular
structures or single molecules of the invention. It is understood that such methods
can introduce errors into copies, which nonetheless are encompassed by the term "target
sequence."
[0026] Particular features or components of macromolecular structures may be selected to
satisfy a variety of design objectives in particular aspects. For example, in some
aspects, it may be advantageous to maintain an analyte molecule as far from the surface
as possible, e.g. by providing an inflexible molecular spacer as part of a unique
linkage. As another example, reactive functionalities may be selected as having a
size that effectively prevents attachment of multiple macromolecular structures to
one discrete spaced apart region. As still another example, macromolecular structures
may be provided with other functionalities for a variety of other purposes, e.g. enhancing
solubility, promoting formation of secondary structures via hydrogen bonding, and
the like.
[0027] In one aspect, macromolecular structures are sufficiently large that their size,
e.g. a linear dimension (such as a diameter) of a volume occupied in a conventional
physiological saline solution, is approximately equivalent to that a discrete spaced
apart region. For macromolecular structures that are linear polynucleotides, in one
aspect, sizes may range from a few thousand nucleotides, e.g. 10,000, to several hundred
thousand nucleotides, e.g. 100-200 thousand. As explained more fully below, in several
aspects, such macromolecular structures are made by generating circular DNAs and then
replicating them in a rolling circle replication reaction to form concatemers of complements
of the circular DNAs.
[0028] The above concepts are illustrated more fully in the aspects shown schematically
in Figs. 1A-1G. After describing these figures, elements of the invention are disclosed
in additional detail and examples are given. As mentioned above, in one aspect, macromolecular
structures of the invention are single stranded polynucleotides comprising concatemer
of a target sequence or fragment. In particular, such polynucleotides may be concatemers
of a target sequence and an adaptor oligonucleotide. For example, source nucleic acid
(1000) is treated (1001) to form single stranded fragments (1006), preferably in the
range of from 50 to 600 nucleotides, and more preferably in the range of from 300
to 600 nucleotides, which are then ligated to adaptor oligonucleotides (1004) to form
a population of adaptor-fragment conjugates (1002). Source nucleic acid (1000) may
be genomic DNA extracted from a sample using conventional techniques, or a cDNA or
genomic library produced by conventional techniques, or synthetic DNA, or the like.
Treatment (1001) usually entails fragmentation by a conventional technique, such as
chemical fragmentation, enzymatic fragmentation, or mechanical fragmentation, followed
by denaturation to produce single stranded DNA fragments. Adaptor oligonucleotides
(1004), in this example, are used to form (1008) a population (1010) of DNA circles
by the method illustrated in Fig. 2A. In one aspect, each member of population (1010)
has an adaptor with an identical primer binding site and a DNA fragment from source
nucleic acid (1000). The adapter also may have other functional elements including,
but not limited to, tagging sequences, attachment sequences, palindromic sequences,
restriction sites, functionalization sequences, and the like. In other aspects, classes
of DNA circles may be created by providing adaptors having different primer binding
sites. After DNA circles (1010) are formed, a primer and rolling circle replication
(RCR) reagents may be added to generate (1011) in a conventional RCR reaction a population
(1012) of concatemers (1015) of the complements of the adaptor oligonucleotide and
DNA fragments, which population can then be isolated using conventional separation
techniques. Alternatively, RCR may be implemented by successive ligation of short
oligonucleotides, e.g. 6-mers, from a mixture containing all possible sequences, or
if circles are synthetic, a limited mixture of oligonucleotides having selected sequences
for circle replication. Concatemers may also be generated by ligation of target DNA
in the presence of a bridging template DNA complementary to both beginning and end
of the target molecule. A population of different target DNA may be converted in concatemers
by a mixture of corresponding bridging templates. Isolated concatemers (1014) are
then disposed (1016) onto support surface (1018) to form a random array of single
molecules. Attachment may also include wash steps of varying stringencies to remove
incompletely attached single molecules or other reagents present from earlier preparation
steps whose presence is undesirable or that are nonspecifically bound to surface (1018).
Concatemers (1020) can be fixed to surface (1018) by a variety of techniques, including
covalent attachment and non-covalent attachment. In one aspect, surface (1018) may
have attached capture oligonucleotides that form complexes, e.g. double stranded duplexes,
with a segment of the adaptor oligonucleotide, such as the primer binding site or
other elements. In other aspects, capture oligonucleotides may comprise oligonucleotide
clamps, or like structures, that form triplexes with adaptor oligonucleotides, e.g.
Gryaznov et al, U.S. patent 5,473,060. In another aspect, surface (1018) may have reactive functionalities that react with
complementary functionalities on the concatemers to form a covalent linkage, e.g.
by way of the same techniques used to attach cDNAs to microarrays, e.g.
Smirnov et al (2004), Genes, Chromosomes & Cancer, 40: 72-77;
Beaucage (2001), Current Medicinal Chemistry, 8: 1213-1244. Long DNA molecules, e.g. several hundred nucleotides or larger, may also be efficiently
attached to hydrophobic surfaces, such as a clean glass surface that has a low concentration
of various reactive functionalities, such as -OH groups. Concatemers of DNA fragments
may be further amplified in situ after disposition of a surface. For example after
disposition, concatemer may be cleaved by reconstituting a restriction site in adaptor
sequences by hybridization of an oligonucleotide, after which the fragments are circularized
as described below and amplified in situ by a RCR reaction.
[0029] Fig. 1B illustrates a section (1102) of a surface of a random array of single molecules,
such as single stranded polynucleotides. Such molecules under conventional conditions
(a conventional DNA buffer, e.g. TE, SSC, SSPE, or the like, at room temperature)
form random coils that roughly fill a spherical volume in solution having a diameter
of from about 100 to 300 nm, which depends on the size of the DNA and buffer conditions,
in a manner well known in the art, e.g.
Edvinsson, "On the size and shape of polymers and polymer complexes," Dissertation
696 (University of Uppsala, 2002). One measure of the size of a random coil polymer, such as single stranded DNA,
is a root mean square of the end-to-end distance, which is roughly a measure of the
diameter of the randomly coiled structure. Such diameter, referred to herein as a
"random coil diameter," can be measured by light scatter, using instruments, such
as a Zetasizer Nano System (Malvern Instruments, UK), or like instrument. Additional
size measures of macromolecular structures of the disclosure include molecular weight,
e.g. in Daltons, and total polymer length, which in the case of a branched polymer
is the sum of the lengths of all its branches. Upon attachment to a surface, depending
on the attachment chemistry, density of linkages, the nature of the surface, and the
like, single stranded polynucleotides fill a flattened spheroidal volume that on average
is bounded by a region (1107) defined by dashed circles (1108) having a diameter (1110),
which is approximately equivalent to the diameter of a concatemer in random coil configuration.
Stated another way, in one aspect, macromolecular structures, e.g. concatemers, and
the like, are attached to surface (1102) within a region that is substantially equivalent
to a projection of its random coil state onto surface (1102), for example, as illustrated
by dashed circles (1108). An area occupied by a macromolecular structure can vary,
so that in some aspects, an expected area may be within the range of from 2-3 times
the area of projection (1108) to some fraction of such area, e.g. 25-50 percent. As
mentioned else where, preserving the compact form of the macromolecular structure
on the surface allows a more intense signal to be produced by probes, e.g. fluorescently
labeled oligonucleotides, specifically directed to components of a macromolecular
structure or concatemer. The size of diameter (1110) of regions (1107) and distance
(1106) to the nearest neighbor region containing a single molecule are two quantities
of interest in the fabrication of arrays. A variety of distance metrics may be employed
for measuring the closeness of single molecules on a surface, including center-to-center
distance of regions (1107), edge-to-edge distance of regions (1007), and the like.
Usually, center-to-center distances are employed herein. The selection of these parameters
in fabricating arrays of the disclosure depends in part on the signal generation and
detection systems used in the analytical processes. Generally, densities of single
molecules are selected that permit at least twenty percent, or at least thirty percent,
or at least forty percent, or at least a majority of the molecules to be resolved
individually by the signal generation and detection systems used. In one aspect, a
density is selected that permits at least seventy percent of the single molecules
to be individually resolved. In one aspect, whenever scanning electron microscopy
is employed, for example, with molecule-specific probes having gold nanoparticle labels,
e.g.
Nie et al (2006), Anal. Chem., 78: 1528-1534, a density is selected such that at least a majority of single molecules have a nearest
neighbor distance of 50 nm or greater; and in another aspect, such density is selected
to ensure that at least seventy percent of single molecules have a nearest neighbor
distance of 100 nm or greater. In another aspect, whenever optical microscopy is employed,
for example with molecule-specific probes having fluorescent labels, a density is
selected such that at least a majority of single molecules have a nearest neighbor
distance of 200 nm or greater; and in another aspect, such density is selected to
ensure that at least seventy percent of single molecules have a nearest neighbor distance
of 200 nm or greater. In still another aspect, whenever optical microscopy is employed,
for example with molecule-specific probes having fluorescent labels, a density is
selected such that at least a majority of single molecules have a nearest neighbor
distance of 300 nm or greater; and in another aspect, such density is selected to
ensure that at least seventy percent of single molecules have a nearest neighbor distance
of 300 nm or greater, or 400 nm or greater, or 500 nm or greater, or 600 nm or greater,
or 700 nm or greater, or 800 nm or greater. In still another aspect, whenever optical
microscopy is used, a density is selected such that at least a majority of single
molecules have a nearest neighbor distance of at least twice the minimal feature resolution
power of the microscope. In another aspect, polymer molecules of the disclosure are
disposed on a surface so that the density of separately detectable polymer molecules
is at least 1000 per µm
2, or at least 10,000 per µm
2, or at least 100,000 per µm
2.
[0030] In another aspect of the disclosure, illustrated for a particular aspect in Fig.
1C, the requirement of selecting densities of randomly disposed single molecules to
ensure desired nearest neighbor distances is obviated by providing on a surface discrete
spaced apart regions that are substantially the sole sites for attaching single molecules.
That is, in such aspect the regions on the surface between the discrete spaced apart
regions, referred to herein as "inter-regional areas," are inert in the sense that
concatemers, or other macromolecular structures, do not bind to such regions. In some
aspects, such inter-regional areas may be treated with blocking agents, e.g. DNAs
unrelated to concatemer DNA, other polymers, and the like As in Fig. 1A, source nucleic
acids (1000) are fragmented and adaptored (1002) for circularization (1010), after
which concatemers are formed by RCR (1012). Isolated concatemers (1014) are then applied
to surface (1120) that has a regular array of discrete spaced apart regions (1122)
that each have a nearest neighbor distance (1124) that is determined by the design
and fabrication of surface (1120). As described more fully below, arrays of discrete
spaced apart regions (1122) having micron and submicron dimensions for derivatizing
with capture oligonucleotides or reactive functionalities can be fabricated using
conventional semiconductor fabrication techniques, including electron beam lithography,
nano imprint technology, photolithography, and the like. Generally, the area of discrete
spaced apart regions (1122) is selected, along with attachment chemistries, macromolecular
structures employed, and the like, to correspond to the size of single molecules of
the disclosure so that when single molecules are applied to surface (1120) substantially
every region (1122) is occupied by no more than one single molecule. The likelihood
of having only one single molecule per discrete spaced apart region may be increased
by selecting a density of reactive functionalities or capture oligonucleotides that
results in fewer such moieties than their respective complements on single molecules.
Thus, a single molecule will "occupy" all linkages to the surface at a particular
discrete spaced apart region, thereby reducing the chance that a second single molecule
will also bind to the same region. In particular, in one aspect, substantially all
the capture oligonucleotides in a discrete spaced apart region hybridize to adaptor
oligonucleotides a single macromolecular structure. In one aspect, a discrete spaced
apart region contains a number of reactive functionalities or capture oligonucleotides
that is from about ten percent to about fifty percent of the number of complementary
functionalities or adaptor oligonucleotides of a single molecule. The length and sequence(s)
of capture oligonucleotides may vary widely, and may be selected in accordance with
well known principles, e.g.
Wetmur, Critical Reviews in Biochemistry and Molecular Biology, 26: 227-259 (1991);
Britten and Davidson, chapter 1 in Hames et al, editors, Nucleic Acid Hybridization:
A Practical Approach (IRL Press, Oxford, 1985). In one aspect, the lengths of capture oligonucleotides are in a range of from 6
to 30 nucleotides, and in another aspect, within a range of from 8 to 30 nucleotides,
or from 10 to 24 nucleotides. Lengths and sequences of capture oligonucleotides are
selected (i) to provide effective binding of macromolecular structures to a surface,
so that losses of macromolecular structures are minimized during steps of analytical
operations, such as washing, etc., and (ii) to avoid interference with analytical
operations on analyte molecules, particularly when analyte molecules are DNA fragments
in a concatemer. In regard to (i), in one aspect, sequences and lengths are selected
to provide duplexes between capture oligonucleotides and their complements that are
sufficiently stable so that they do not dissociate in a stringent wash. In regard
to (ii), if DNA fragments are from a particular species of organism, then databases,
when available, may be used to screen potential capture sequences that may form spurious
or undesired hybrids with DNA fragments. Other factors in selecting sequences for
capture oligonucleotides are similar to those considered in selecting primers, hybridization
probes, oligonucleotide tags, and the like, for which there is ample guidance, as
evidenced by the references cited below in the Definitions section. In some aspects,
a discrete spaced apart region may contain more than one kind of capture oligonucleotide,
and each different capture oligonucleotide may have a different length and sequence.
In one aspect employing regular arrays of discrete spaced apart regions, sequences
of capture oligonucleotides are selected so that sequences of capture oligonucleotide
at nearest neighbor regions have different sequences. In a rectilinear array, such
configurations are achieved by rows of alternating sequence types. In other aspects,
a surface may have a plurality of subarrays of discrete spaced apart regions wherein
each different subarray has capture oligonucleotides with distinct nucleotide sequences
different from those of the other subarrays. A plurality of subarrays may include
2 subarrays, or 4 or fewer subarrays, or 8 or fewer subarrays, or 16 or fewer subarrays,
or 32 or fewer subarrays, or 64 of fewer subarrays. In still other aspects, a surface
may include 5000 or fewer subarrays. In one aspect, capture oligonucleotides are attached
to the surface of an array by a spacer molecule, e.g. polyethylene glycol, or like
inert chain, as is done with microarrays, in order to minimize undesired affects of
surface groups or interactions with the capture oligonudeotides or other reagents.
[0031] In one aspect, the area of discrete spaced apart regions (1122) is less than 1 µm
2; and in another aspect, the area of discrete spaced apart regions (1122) is in the
range of from 0.04 µm
2 to 1 µm
2; and in still another aspect, the area of discrete spaced apart regions (1122) is
in the range of from 0.2 µm
2 to 1 µm
2. In another aspect, when discrete spaced apart regions are approximately circular
or square in shape so that their sizes can be indicated by a single linear dimension,
the size of such regions are in the range of from 125 nm to 250 nm, or in the range
of from 200 nm to 500 nm. In one aspect, center-to-center distances of nearest neighbors
of regions (1122) are in the range of from 0.25 µm to 20 µm; and in another aspect,
such distances are in the range of from 1 µm to 10 µm, or in the range from 50 to
1000nm. In one aspect, regions (1120) may be arranged on surface (1018) in virtually
any pattern in which regions (1122) have defined locations, i.e. in any regular array,
which makes signal collection and data analysis functions more efficient. Such patterns
include, but are not limited to, concentric circles of regions (1122), spiral patterns,
rectilinear patterns, hexagonal patterns, and the like. Preferably, regions (1122)
are arranged in a rectilinear or hexagonal pattern.
[0032] As illustrated in Fig. 1D, in certain aspects, DNA circles prepared from source nucleic
acid (1200) need not include an adaptor oligonucleotide. As before, source nucleic
acid (1200) is fragmented and denatured (1202) to form a population of single strand
fragments (1204), preferably in the size range of from about 50 to 600 nucleotides,
and more preferably in the size range of from about 300 to 600 nucleotides, after
which they are circularized in a non-template driven reaction with circularizing ligase,
such as CircLigasc (Epicentre Biotechnologies, Madison, WI), or the like. After formation
of DNA circles (1206), concatemers are generated by providing a mixture of primers
that bind to selected sequences. The mixture of primers may be selected so that only
a subset of the total number of DNA circles (1206) generate concatemers,. After concatemers
are generated (1208), they are isolated and applied to surface (1210) to form a random
array of the disclosure.
[0033] As mentioned above, single molecules of the disclosure comprise an attachment portion
and an analyte portion such that the attachment portion comprises a macromolecular
structure that provides multivalent attachment of the single molecule to a surface.
As illustrated in Fig. IE, macromolecular structures may be concatemers made by an
RCR reaction in which the DNA circles in the reaction are synthetic. An analyte portion
of a single molecule is then attached by way of a unique functionality on the concatemer,
Synthetic DNA circles of virtually any sequence can be produced using well-known techniques,
conveniently, in sizes up to several hundred nucleotides, e.g. 200, and with more
difficulty, in sizes of many hundreds of nucleotides, e.g. up to 500, e.g.
Kool, U.S. patent 5,426,180;
Dolinnaya et al (1993), Nucleic Acids Research, 21: 5403-5407;
Rubin et al (1995), Nucleic Acids Research, 23: 3547-3553; and the like Synthetic DNA circles (1300) that comprise primer binding sites (1301)
are combined with primer (1302) in an RCR reaction (1306) to produce concatemer (1308).
Usually, in this aspect, all circles have the same sequence, although different sequences
can be employed, for example, for directing subsets of concatemers to preselected
regions of an array via complementary attachment moieties, such as adaptor sequences
and capture oligonucleotides. Primer (1302) is synthesized with a functionality (1304,
designated as "R") at its 5' end that is capable of reacting with a complementary
functionality on an analyte to form a covalent linkage. Exemplary functionalities
include amino groups, sulfhydryl groups, and the like, that can be attached with commercially
available chemistries (e.g. Glen Research). Concatemers (1308) are applied to surface
(1310) to form an array (1314), after which analytes (1312) having an attachment moiety
are applied to array (1310) where a linkage is formed with a concatemer by reaction
of unique functionalities, R (1311) and attachment moiety (1312). Alternatively, prior
to application to array (1310), concatemers (1308) may be combined with analytes (1312)
so that attachment moieties and unique functionalities can react to form a linkage,
after which the resulting conjugate is applied to array (1310). There is abundant
guidance in the literature in selecting appropriate attachment moieties and unique
functionalities for linking concatemers (1308) and many classes of analyte. In one
aspect, for linking protein or peptide analytes to concatemers, many homo- and heterobifunctional
reagents are available commercially (e.g. Pierce) and are disclosed in references
such as
Hermanson, Bioconjugate Techniques (Academic Press, New York, 1996). For example, whenever the unique functionality is an amino group, then concatemers
(1308) can be linked to a sufhydryl group on an analyte using N-succinimidyl 3-(2-pyridyldithio)propionate
(SPDP), succinimidyloxycarbonyl-α-methyl-α-(2-pyridyldithio)toluene (SMPT), succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate
(SMCC), m-maleimidobenzoyl-N-hydroxysuccinimide ester (MBS), N-succinimidyl(4-iodoacetyl)aminobenzoate
(SIAB), succinimidyl 6-((iodoacetyl)amino)hexanoate (SIAX), and like reagents. Suitable
complementary functionalities, on analytes include amino groups, sulfhydryl groups,
carbonyl groups, which may occur naturally on analytes or may be added by reaction
with a suitable homo- or heterobifunctional reagent. Analyte molecules may also be
attached to macromolecular structures by way of non-covalent linkages, such as biotin-streptavidin
linkages, the formation of complexes, e.g. a duplexes, between a first oligonucleotide
attached to a concatemer and a complementary oligonucleotide attached to, or forming
part of, an analyte, or like linkages. Analyses include biomolecules, such as nucleic
acids, for example, DNA or RNA fragments, polysaccharides, proteins, and the like.
[0034] As mentioned above, macromolecular structures of the disclosure may comprise branched
polymers as well as linear polymers, such as concatemer of DNA fragments. Exemplary
branched polymer structures are illustrated in Figs. 1F and 1G. In Fig. 1F, a branched
DNA structure is illustrated that comprises a backbone polynucleotide (1400) and multiple
branch polynucleotides (1402) each connected to backbone polynucleotide (1400) by
their 5' ends to form a comb-like structure that has all 3' ends, except for a single
5' end (1404) on backbone polynucleotide (1400), which is derivatized to have a unique
functionality. As mentioned below, such unique functionality may be a reactive chemical
group, e.g. a protected or unprotected amine, sulfhydryl, or the like, or it may be
an oligonucleotide having a unique sequence for capturing an analyte having an oligonucleotide
with a complementary sequence thereto. Likewise, such unique functionality may be
a capture moiety, such as biotin, or the like. Such branched DNA structures are synthesized
using known techniques, e.g.
Gryaznov, U.S. patent 5,571,677;
Urdea et al, U.S. patent 5,124,246;
Seeman et al, U.S. patent 6,255,469; and the like. Whenever such macromolecular structures are polynucleotides, the sequences
of components thereof may be selected for facile self-assembly, or they may be linked
by way of specialized linking chemistries, e.g. as disclosed below, in which case
sequences are selected based on other factors, including, in some aspects, avoidance
of self-annealing, facile binding to capture oligonucleotides on a surface, and the
like. In Fig. 1G, a dentrimeric structure is illustrated that comprises oligonucleotide
(1406), which is derivatized with multiple tri-valent linking groups (1408) that each
have two functionalities (1410, designated by "R") by which additional polymers (1407),
e.g. polynucleotides, can be attached to form a linkage to oligonucleotide (1406)
thereby forming macromolecular structure (1409), which, in turn, if likewise derivatized
with multivalent linkers, can form a nucleic acid dendrimer. Trivalent linkers (1408)
for use with oligonucleotides are disclosed in
Iyer et al, U.S. patent 5,916,750, As illustrated in Fig. 1H, once such dendrimeric or branched structures (1411) are
constructed, they can be attached to array (1420) as described above for linear polynucleotides,
after which analytes (1430) can be attached via unique functionalities (1410). Optionally,
unreacted unique functionalities (1422) may be capped using conventional techniques.
Alternatively, dendrimeric or branched structures (1411) may be combined with analytes
(1430) first, e.g. in solution, so that conjugates are formed, and then the conjugates
are disposed on array (1420). When the analyte is a polynucleotide (1440) with a free
3' end, as shown in Fig. 1I, such end may be extended in an in situ RCR reaction to
form either concatemers of target sequences or other sequences for further additions.
Likewise, polynucleotide analytes may be extended by ligation using conventional techniques.
Source Nucleic Acids and Circularization of Target Sequences
[0035] In one aspect of the disclosure macromolecular structures comprise concatemers of
polynucleotide analytes, i.e. target sequences, which are extracted or derived from
a sample, such as genomic DNA or cDNAs from a patient, an organism of economic interest,
or the like. Random arrays of the disclosure comprising such single molecules are
useful in providing genome-wide analyses, including sequence determination, SNP measurement,
allele quantitation, copy number measurements, and the like. For mammalian-sized genomes,
preferably fragmentation is carried out in at least two stages, a first stage to generate
a population of fragments in a size range of from about 100 kilobases (Kb) to about
250 kilobases, and a second stage, applied separately to each 100-250Kb fragment,
to generate fragments in the size range of from about 50 to 600 nucleotides, and more
preferably in the range of from about 300 to 600 nucleotides, for generating concatemers
for a random array. In some aspects of the disclosure, the first stage of fragmentation
may also be employed to select a predetermined subset of such fragments, e.g. fragments
containing genes that encode proteins of a signal transduction pathway, or the like.
The amount of genomic DNA required for constructing arrays can vary widely. In one
aspect, for mammalian-sized genomes, fragments are generated from at least 10 genome-equivalents
of DNA; and in another aspect, fragments are generated from at least 30 genome-equivalents
of DNA; and in another aspect, fragments are generated from at least 60 gename-equivalents
of DNA.
[0036] Genomic DNA is obtained using conventional techniques, for example, as disclosed
in Sambrook et al., supra, 1999;
Current Protocols in Molecular Biology, Ausubel et al., eds.(John Wiley and Sons,
Inc., NY, 1999), or the like, Important factors for isolating genomic DNA include the following:
1) the DNA is free of DNA processing enzymes and contaminating salts; 2) the entire
genome is equally represented; and 3) the DNA fragments are between about 5,000 and
100,000 bp in length. In many cases, no digestion of the extracted DNA is required
because shear forces created during lysis and extraction will generate fragments in
the desired range. In another aspect, shorter fragments (1-5 kb) can be generated
by enzymatic fragmentation using restriction endonucleases. In one aspect, 10-100
genome-equivalents of DNA ensure that the population of fragments covers the entire
genome. In some cases, it is advantageous to provide carrier DNA, e.g. unrelated circular
synthetic double- stranded DNA, to be mixed and used with the sample DNA whenever
only small amounts of sample DNA are available and there is danger of losses through
nonspecific binding, e.g. to container walls and the like. In generating fragments
in either stage, fragments may be derived from either an entire genome or it may be
derived from a selected subset of a genome. Many techniques are available for isolating
or enriching fragments from a subset of a genome
Kandpal et al (1990), Nucleic Acids Research, 18: 1789-1795;
Callow et al, U.S. patent publication 2005/0019776;
Zabeau et al, U.S. patent 6,045,994;
Deugau et al, U.S. patent 5,508,169;
Sibson, U.S. patent 5,728,524;
Guilfayle et al, U.S. patent 5,994,068;
Jones et al, U.S. patent publication 2005/0142577;
Gullberg et al, U.S. patent publication 2005/0037356;
Matsuzaki et al, U.S. patent publication 2004/0067493; and the like.
[0037] For mammalian-sized genomes, an initial fragmentation of genomic DNA can be achieved
by digestion with one or more "rare" cutting restriction endonucleases, such as Not
I, Asc I, Bae I, CspC I, Pac I, Fse I, Sap I, Sfi I, Psr I, or the like. The resulting
fragments can be used directly, or for genomes that have been sequenced, specific
fragments may be isolated from such digested DNA for subsequent processing as illustrated
in Fig. 2B. Genomic DNA (230) is digested (232) with a rare cutting restriction endonuclease
to generate fragments (234), after which the fragments (234) are further digested
for a short period (i.e. the reaction is not allowed to run to completion) with a
5' single stranded exonuclease, such as λ exonuclease, to expose sequences (237) adjacent
to restriction site sequences at the end of the fragments. Such exposed sequences
will be unique for each fragment. Accordingly, biotinylated primers (241) specific
for the ends of desired fragments can be annealed to a capture oligonucleotide for
isolation; or alternatively, such fragments can be annealed to a primer having a capture
moiety, such as biotin, and extended with a DNA polymerase that does not have strand
displacement activity, such as Taq polymerase Stoffel fragment. After such extension,
the 3' end of primers (241) abut the top strand of fragments (242) such that they
can be ligated to form a continuous strand. The latter approach may also be implemented
with a DNA polymerase that does have strand displacement activity and replaces the
top strand (242) by synthesis. In either approach, the biotinylated fragments may
then be isolated (240) using a solid support (239) derivatized with streptavidin.
[0038] In another aspect, primer extension from a genomic DNA template is used to generate
a linear amplification of selected sequences greater than 10 kilobases surrounding
genomic regions of interest. For example, to create a population of defined-sized
targets, 20 cycles of linear amplification is performed with a forward primer followed
by 20 cycles with a reverse primer. Before applying the second primer, the first primer
is removed with a standard column for long DNA purification or degraded if a few uracil
bases are incorporated. A greater number of reverse strands are generated relative
to forward strands resulting in a population of double stranded molecules and single
stranded reverse strands. The reverse primer may be biotinylated for capture to streptavidin
beads which can be heated to melt any double stranded homoduplexes from being captured.
A11 attached molecules will be single stranded and representing one strand of the
original genomic DNA.
[0039] The products produced can be fragmented to 0.2-2 kb in size, or more preferably,
0.3-0.6 kb in size (effectively releasing them from the solid support) and circularized
for an RCR reaction. In one method of circularization, illustrated in Fig. 2A, after
genomic DNA (200) is fragmented and denatured (202), single stranded DNA fragments
(204) are first treated with a terminal transferase (206) to attach a poly dA tails
(208) to 3-prime ends. This is then followed by ligation (212) of the free ends intra-molecularly
with the aid of bridging oligonucleotide (210). that is complementary to the poly
dA tail at one end and complementary to any sequence at the other end by virtue of
a segment of degenerate nucleotides. Duplex region (214) of bridging oligonucleotide
(210) contains at least a primer binding site for RCR and, in some aspects, sequences
that provide complements to a capture oligonucleotide, which may be the same or different
from the primer binding site sequence, or which may overlap the primer binding site
sequence. The length of capture oligonucleotides may vary widely, In one aspect, capture
oligonucleotides and their complements in a bridging oligonucleotide have lengths
in the range of from 10 to 100 nucleotides; and more preferably, in the range of from
10 to 40 nucleotides. In some aspects, duplex region (214) may contain additional
elements, such as an oligonucleotide tag, for example, for identifying the source
nucleic acid from which its associated DNA fragment came. That is, in some circles
or adaptor ligation or concatemers from different source nucleic acids may be prepared
separately during which a bridging adaptor containing a unique tag is used, after
which they are mixed for concatemer preparation or application to a surface to produce
a random array. The associated fragments may be identified on such a random array
by hybridizing a labeled tag complement to its corresponding tag sequences in the
concatemers, or by sequencing the entire adaptor or the tag region of the adaptor.
Circular products (218) may be conveniently isolated by a conventional purification
column, digestion of non-circular DNA by one or more appropriate exonucleases, or
both.
[0040] As mentioned above, DNA fragments of the desired sized range, e.g. 50-600 nucleotides,
can also be circularized using circularizing enzymes, such as CircLigase, as single
stranded DNA ligase that circularizes single stranded DNA without the need of a template.
CircLigase is used in accordance with the manufacturer's instructions (Epicentre,
Madison, WI). A preferred protocol for forming single stranded DNA circles comprising
a DNA fragment and one or more adapters is to use standard ligase such as T4 ligase
for ligation an adapter to one end of DNA fragment and than to use CircLigase to close
the circle, as described more fully below.
[0041] An exemplary protocol for generating a DNA circle comprising an adaptor oligonucleotide
and a target sequence using T4 ligase. The target sequence is a synthetic oligo T1N
(sequence : 5'-NNNNNNNNGCATANCACGANGTCATNATCGTNCAAACGTCAGTCCANGAATCNAGATCC ACTTAGANTGNCGNNNNNNNN-3')(SEQ
ID NO: 1). The adaptor is made up of 2 separate oligos. The adaptor oligo that joins
to the 5' end of T1N is BR2-ad (sequence : 5'-TATCATCTGGATGTTAGGAAGACAAAAGGAAGCTGAGGACATTAACGGAC-3')
(SEQ ID NO: 2) and the adaptor oligo that joins to the 3' end of T1N is UR3-ext (sequence
: 5'-ACCTTCAGACCAGAT-3') (SEQ ID NO: 3) UR3-ext contains a type IIs restriction enzyme
site (Acu I : CTTCAG) to provide a way to linearize the DNA circular for insertion
of a second adaptor. BR2-ad is annealed to BR2-temp (sequence 5'-NNNNNNNGTCCGTTAATGTCCTCAG-3')
(SEQ ID NO: 4) to form a double-stranded adaptor BR2 adaptor. UR3-ext is annealed
to biotinylated UR3-temp (sequence 5'-[BIOTIN]ATCTGGTCTGAAGGTNNNNNNN-3') (SEQ ID NO:
5) to form a double-stranded adaptor UR3 adaptor. 1 pmol of target T1N is ligated
to 25 pmol of BR2 adaptor and 10 pmol of UR3 adaptor in a single ligation reaction
containing 50mM Tris-Cl, pH7.8, 10% PEG, 1mM ATP, 50 mg/L BSA, 10mM MgCl
2, 0.3 unit/µl T4 DNA ligase (Epicentre Biotechnologies, WI) and 10 mM DTT) in a final
volume of 10 ul. The ligation reaction is incubated in a temperature cycling program
of 15°C for 11 min, 37°C for 1 min repeated 18 times. The reaction is terminated by
heating at 70°C for 10 min. Excess BR2 adaptors are removed by capturing the ligated
products with streptavidin magnetic beads (New England Biolabs, MA). 3.3 ul of 4x
binding buffer (2M NaCl, 80 mM Tris HCl pH7.5) is added to the ligation reaction which
is then combined with 15µg of streptavidin magnetic beads in 1x binding buffer (0.5M
NaCl, 20 mM Tris HCl pH7.5). After 15 min incubation in room temperature, the beads
are washed twice with 4 volumes of low salt buffer (0.15M NaCl, 20 mM Tris HCl pH7.5).
Elution buffer (10 mM Tris HCl pH7.5) is pre-warmed to 70 deg, 10 µl of which is added
to the beads at 70°C for 5 min. After magnetic separation, the supernatant is retained
as primary purified sample. This sample is further purified by removing the excess
UR3 adaptors with magnetic beads pre-bound with a biotinylated oligo BR-rc-bio (sequence
: 5'-[BIOTIN]CTTTTGTCTTCCTAACATCC-3') (SEQ ID NO: 6) that is reverse complementary
to BR2-ad similarly as described above. The concentration of the adaptor-target ligated
product in the final purified sample is estimated by urea polyacrylamide gel electrophoresis
analysis. The circularization is carried out by phosphorylating the ligation products
using 0.2unit/µl T4 polynucleotide kinase (Epicentre Biotechnologies) in 1 mM ATP
and standard buffer provided by the supplier, and circularized with ten-fold molar
excess of a splint oligo UR3-closing-88 (sequence 5'-AGATGATAATCTGGTC-3' (SEQ ID NO:
7) using 0.3 unit/µl of T4 DNA ligase (Epicentre Biotechnologies) and 1mM ATP. The
circularized product is validated by performing RCR reactions as described below.
Generating Polynucleotide Concatemers by Rolling Circle Replication
[0042] In one aspect, single molecules comprise concatemers of polynucleotides, usually
polynucleotide analytes, i.e. target sequences, that have been produce in a conventional
rolling circle replication (RCR) reaction. Guidance for selecting conditions and reagents
for RCR reactions is available in many references available to those of ordinary skill,
as evidence by the following :
Kool, U.S. patent 5,426,180;
Lizardi, U.S. patents 5,854,033 and
6,143,495;
Landegren, U.S. patent 5,871,921; and the like. Generally, RCR reaction components comprise single stranded DNA circles,
one or more primers that anneal to DNA circles, a DNA polymerase having strand displacement
activity to extend the 3' ends of primers annealed to DNA circles, nucleoside triphosphates,
and a conventional polymerase reaction buffer. Such components are combined under
conditions that permit primers to anneal to DNA circles and be extended by the DNA
polymerase to form concatemers of DNA circle complements. An exemplary RCR reaction
protocol is as follows: In a 50 µL reaction mixture, the following ingredients are
assembled: 2-50 pmol circular DNA, 0.5 units/µL phage ϕ29 DNA polymerase, 0.2 µg/µL
BSA, 3 mM dNTP, 1X ϕ29 DNA polymerase reaction buffer (Amersham). The RCR reaction
is carried out at 30°C for 12 hours. In some aspects, the concentration of circular
DNA in the polymerase reaction may be selected to be low (approximately 10-100 billion
circles per ml, or 10-100 circles per picoliter) to avoid entanglement and other intermolecular
interactions. Preferably, concatemers produced by RCR are approximately uniform in
size; accordingly, in some aspects, methods of making arrays may include a step of
size-selecting concatemers. For example, in one aspect, concatemers are selected that
as a population have a coefficient of variation in molecular weight of less than about
30%; and in another embodiment, less than about 20%. In one aspect, size uniformity
is further improved by adding low concentrations of chain terminators, such ddNTPs,
to the RCR reaction mixture to reduce the presence of very large concatemers, e.g.
produced by DNA circles that are synthesized at a higher rate by polymerases. In one
aspect, concentrations of ddNTPs are used that result in an expected concatemer size
in the range of from 50-250 Kb, or in the range of from 50-100 Kb. In another aspect,
concatemers may be enriched for a particular size range using a conventional separation
techniques, e.g. size-exclusion chromatography, membrane filtration, or the like.
Generation of Macromolecular Structures Comprising Branched Polymers and DNA Assemblies
[0043] In one aspect of the disclosure, macromolecular structures comprise polymers having
at least one unique functionality, which for polynucleotides is usually a functionality
at a 5' or 3' end, and a plurality of complementary functionalities that are capable
of specifically reacting with reactive functionalites of the surface of a solid support.
Macromolecular structures comprising branched polymers, especially branched polynucleotides,
may be synthesized in a variety of ways, as disclosed by Gryaznov (cited above), Urdea
(cited above), and like references. In one aspect, branched polymers disclosed hereininclude
comb-type branched polymers, which comprise a linear polymeric unit with one or more
branch points located at interior monomers and/or linkage moieties. Branched polymers
also include fork-type branched polymers, which comprise a linear polymeric unit with
one or two branch points located at terminal monomers and/or linkage moieties. Macromolecular
structures of the invention also include assemblies of linear and/or branched polynucleotides
bound together by one or more duplexes or triplexes. Such assemblies may be self-assembled
from component linear polynucleotide, e.g. as disclosed by
Goodman et al, Science, 310: 1661-1665 (2005);
Birac et al, J. Mol. Graph Model, (April 18, 2006);
Seeman et al, U.S. patent 6,255,469. In one aspect, linear polymeric units have the form: "--(M-L)n-" wherein L is a
linker moiety and M is a monomer that may be selected from a wide range of chemical
structures to provide a range of functions from serving as an inert non-sterically
hindering spacer moiety to providing a reactive functionality which can serve as a
branching point to attach other components, a site for attaching labels; a site for
attaching oligonucleotides or other binding polymers for hybridizing or binding to
amplifier strands or structures, e.g. as described by
Urdea et al, U.S. Pat. No. 5,124,246 or
Wang et al, U.S. Pat. No. 4,925,785; a site for attaching "hooks", e.g. as described in
Whiteley et al, U.S. Pat. No. 4,883,750; or as a site for attaching other groups for affecting solubility, promotion of duplex
and/or triplex formation, such as intercalators, alkylating agents, and the like.
The following references disclose several phosphoramidite and/or hydrogen phosphonate
monomers suitable for use in the present invention and provide guidance for their
synthesis and inclusion into oligonucleotides:
Newton et al, Nucleic Acids Research, 21: 1155-1162 (1993);
Griffin et al, J. Am. Chem. Soc., 114:7976-7982 (1992);
Jaschke et al, Tetrahedron Letters, 34:301-304 (1992);
Ma et al, International application PCT/CA92/00423; Zon et al, International application
PCT/US90/06630;
Durand et al, Nucleic Acids Research, 18:6353-6359 (1990);
Salunkhe et al, J. Am. Chem. Soc., 114:8768-8772 (1992);
Urdea et al, U.S. Pat. No. 5,093,232;
Ruth, U.S. Pat. No. 4,948,882;
Cruickshank, U.S. Pat. No. 5,091,519;
Haralambidis et al, Nucleic Acids Research, 15:4857-4876 (1987); and the like. More particularly, M is a straight chain, cyclic, or branched organic
molecular structure containing from 1 to 20 carbon atoms and from O to 10 heteroatoms
selected from the group consisting of oxygen, nitrogen, and sulfur. Preferably, M
is alkyl, alkoxy, alkenyl, or aryl containing from 1 to 16 carbon atoms; heterocyclic
having from 3 to 8 carbon atoms and from 1 to 3 heteroatoms selected from the group
consisting of oxygen, nitrogen, and sulfur; glycosyl; or nucleosidyl. More preferably,
M is alkyl, alkoxy, alkenyl, or aryl containing from 1 to 8 carbon atoms; glycosyl;
or nucleosidyl. Preferably, L is a phosphorus(V) linking group which may be phosphodiester,
phosphotriester, methyl or ethyl phosphonate, phosphorothioate, phosphorodithioate,
phosphoramidate, or the like. Generally, linkages derived from pho sphoramidite or
hydrogen phosphonate precursors are preferred so that the linear polymeric units can
be conveniently synthesized with commercial automated DNA synthesizers, e.g. Applied
Biosystems, Inc. (Foster City, Calif.) model 394, or the like. n may vary significantly
depending on the nature of M and L. Usually, n varies from about 3 to about 100. When
M is a nucleoside or analog thereof or a nucleoside-sized monomer and L is a phosphorus(V)
linkage, then n varies from about 12 to about 100. Preferably, when M is a nucleoside
or analog thereof or a nucleoside-sized monomer and L is a phosphorus(V) linkage,
then n varies from about 12 to about 40. Polymeric units are assembled by forming
one or more covalent bridges among them. In one aspect, bridges are formed by reacting
thiol, phosphorothioate, or phosphorodithioate groups on one or more components with
haloacyl- or haloalkylamimo groups on one or more other components to form one or
more thio- or ditluophosphorylacyl or thio- or dithiophosphorylalkyi bridges. Generally,
such bridges have one of the following forms: ---NHRSP(=Z)(O-)-- OR --NHRS--, wherein
R is alkyl or acyl and Z is sulfur or oxygen. The assembly reaction may involve from
2 to 20 components depending on the particular aspect; but preferably, it involves
from 2 to 8 components; and more preferably, it involves from 2 to 4 components. Preferably,
the haloacyl. or haloalkylamino groups are haloacetylamino groups; and more preferably,
the haloacetylamino groups are bromoacetylatnino groups. The acyl or alkyl moieties
of the haloacyl- or haloalkylamino groups contain from 1 to 12 carbon atoms; and more
preferably, such moieties contain from 1 to 8 carbon atoms. The reaction may take
place in a wide range of solvent systems; but generally, the assembly reaction takes
place under liquid aqueous conditions or in a frozen state in ice, e.g. obtained by
lowering the temperature of a liquid aqueous reaction mixture. Alternatively, formation
of thiophosphorylacetylamino bridges in DMSO/H2O has been reported by
Thuong et al, Tetrahedron Letters, 28:4157-4160 (1987); and
Francois et al, Proc. Natl. Acad. Sci., 86:9702-9706 (1989). Typical aqueous conditons include 4 µM of reactants in 25 mM NaCl and 15 mM phosphate
buffer (pH 7.0). The thio- or dithiophosphorylacyl- or thio- or dithiophosphorylalkylamino
bridges are preferred because they can be readily and selectively cleaved by oxidizing
agents, such as silver nitrate, potassium iodide, and the like. Preferably, the bridges
are cleaved with potassium iodide, KI
3, at a concentration equivalent to about a hundred molar excess of the bridges. Usually,
a KI
3 is employed at a concentration of about 0.1M. The facile cleavage of these bridges
is a great advantage in synthesis of complex macromolecular structures, as it provides
a convenient method for analyzing final products and for confirming that the structure
of the final product is correct. A 3'-haloacyl- or haloalkylamino (in this example,
haloacetylamino) derivatized oligonucleotide 1 is reacted with a 5'-phosphorothioate
derivatized oligonucleotide 2 according to the following scheme:
5'-BBB ... B-NHC(=O)CH
2X + (1)
S
-P(=O)(O-)-BBB ... B-3' → (2)
5'-BBB ... B-NHC(=O)CH
2SP(=O)(O-)O-BBB ... B-3'
wherein X is halo and B is a nucleotide. It is understood that the nucleotides are
merely exemplary of the more general polymeric units, (M-L)
n described above. Compound 1 can be prepared by reacting N-succinimidyl haloacetate
in N,N-dimethylformamide (DMF) with a 3'-aminodeoxyribonucleotide precursor in a sodium
borate buffer at room temperature. After about 35 minutes the mixture is diluted (e.g.
with H
2 O), desalted and, purified, e.g. by reverse phase HPLC. The Y-aminodeoxyribonucleotide
precursor can be prepared as described in
Gryaznov and Letsinger, Nucleic Acids Research, 20:3403-3409 (1992). Briefly, after deprotection, the 5' hydroxyl of a deoxythymidine linked to a support
via a standard succinyl linkage is phosphitylated by reaction with chloro-(diisopropylethylamino)-methoxyphosphine
in an appropriate solvent, such as dichloromethane/diisopropylethylamine. After activation
with tetrazole, the 5'-phosphitylated thymidine is reacted with a 5'-trityl-O-3'-amino-3'-deoxynucleoside
to form a nucleoside-thymidine dimer wherein the nucleoside moieties are covalently
joined by a phosphoramidate linkage. The remainder of the oligonucleotide is synthesized
by standard phosphoramidite chemistry. After cleaving the succinyl linkage, the oligonucleotide
with a 3' terminal amino group is generated by cleaving the phosphoramidate link by
acid treatment, e.g. 80% aqueous acetic acid for 18-20 hours at room temperature.
5'-monophosphorothioate oligonucleotide 2 is formed as follows: A 5' monophosphate
is attached to the 5' end of an oligonucleotide either chemically or enzymatically
with a kinase, e.g.
Sambrook et al, Molecular Cloning: A Laboratory Manual, 2nd Edition (Cold Spring Harbor
Laboratory, New York, 1989). Preferably, as a final step in oligonucleotide synthesis, a monophosphate is added
by chemical phosphorylation as described by
Thuong and Asscline, Chapter 12 in, Eckstein, editor, Oligonucleotides and Analogues
(IRL Press, Oxford, 1991) or by
Horn and Urdea, Tetrahedron Lett., 27:4705 (1986) (e.g. using commercially available reagents such as 5' Phosphate-ON.TM. from Clontech
Laboratories (Palo Alto, Calif.)). The 5'-monophosphate is then sulfurized using conventional
sulfurizing agents, e.g. treatment with a 5% solution of
Ss in pyfidine/CS
2 (1:1, v/v, 45 minutes at room temperature); or treatment with sulfurizing agent described
in
U.S. Pat. Nos. 5,003,097;
5,151,510; or
5,166,387. Monophosphorodithioates are prepared by analogous procedures, e.g. Froehler et al,
European patent publication
0 360 609 A2; Caruthers et al, International application
PCT/US89/02293; and the like. Likewise to the above, a 5'-haloacetylamino derivatized oligonucleotide
3 is reacted with a 3'monophosphorothioate oligonucleotide 4 according to the following
scheme:
3'-BBB ... B-NHC(=O)CH
2X + (3)
S-P(=O)(O-)O-BBB ... B-5' → (4)
3'-BBB ... B-NHC(=O)CH
2SP(=O)(O
-)-BBB ... B-5'
wherein the symbols are defined the same as above, except that the nucleotides monomers
of the j-and k-mers are in opposite orientations. In this case, Compound 3 can be
prepared by reacting N-succinimidyl haloacetate in N,N-dimethylformamide (DMF) with
a 5'-aminodeoxyribonucleotide precursor in a sodium borate buffer at room temperature,
as described above for the 3'-amino oligonucleotide. 5'-aminodeoxynucleosides are
prepared in accordance with
Glinski et al, J. Chem. Soc. Chem. Comm., 915-916 (1970);
Miller et al, J. Org. Chem. 29:1772 (1964);
Ozols et al, Synthesis, 7:557-559 (1980); and
Azhayev et al, Nucleic Acids Research, 6:625-643 (1979); The 3'-monophosphorothioate oligonucleotide 4 can be prepared as described by Thuong
and Asscline (cited above). Oligonucleotides 1 and 4 and 2 and 3 may be reacted to
form polymeric units having either two 5' termini or two 3' termini, respectively.
[0044] Reactive functionalities for the attachment of branches may be introduced at a variety
of sites. Preferably, amino functionalities are introduce on a polymeric unit or loop
at selected monomers or linking moieties which are then converted to haloacetylamino
groups as described above. Amino-derivatized bases of nucleoside monomers may be introduced
as taught by
Urdea et al, U.S. Pat. No. 5,093,232;
Ruth U.S. Pat. No. 4,948,882;
Haralambidis et al, Nucleic Acids Research, 15:4857-4876 (1987); or the like. Amino functionalities may also be introduced by a protected hydroxyamine
phosphoramidite commercially available from Clontech Laboratories (Palo Alto, Calif.)
as Aminomodifier II.TM.. Preferably, amino functionalities are introduced by generating
a derivatized phosphoramidate linkage by oxidation of a phosphite linkage with I
2 and an alkyldiamine, e.g. as taught by
Agrawal et al, Nucleic Acids Research, 18:5419-5423 (1990); and
Jager et al, Biochemistry, 27:7237-7246 (1988). Generally, for the above procedures, it is preferable that the haloacyl- or haloalkylamino
derivatized polymeric units be prepared separately from the phosphorothioate derivatized
polymeric units, otherwise the phosphorothioate moieties require protective groups.
Solid Phase Surfaces for Construction
Random Arrays
[0045] A wide variety of supports may be used with the disclosure. In one aspect, supports
are rigid solids that have a surface, preferably a substantially planar surface so
that single molecules to be interrogated are in the same plane. The latter feature
permits efficient signal collection by detection optics, for example. In another aspect,
solid supports of the disclosure are nonporous, particularly when random arrays of
single molecules are analyzed by hybridization reactions requiring small volumes.
Suitable solid support materials include materials such as glass, polyacrylamide-coated
glass, ceramics, silica, silicon, quartz, various plastics, and the like. In one aspect,
the area of a planar surface may be in the range of from 0.5 to 4 cm
2. In one aspect, the solid support is glass or quartz, such as a microscope slide,
having a surface that is uniformly silanized. This may be accomplished using conventional
protocols, e.g. acid treatment followed by immersion in a solution of 3-glycidoxypropyl
trimethoxysilane, N,N-diisopropylethylamine, and anhydrous xylene (8:1:24 v/v) at
80oC, which forms an epoxysilanized surface. e.g.
Beattie et a (1995), Molecular Biotechnology, 4: 213. Such a surface is readily treated to permit end-attachment of capture oligonucleotides,
e.g. by providing capture oligonucleotides with a 3' or 5' Methylene glycol phosphoryl
spacer (see Beattie et al, cited above) prior to application to the surface. Many
other protocols may be used for adding reactive functionalites to glass and other
surfaces, as evidenced by the disclosure in Beaucage (cited above).
[0046] Whenever enzymatic processing is not required, capture oligonucleotides may comprise
non-natural nucleosidic units and/or linkages that confer favorable properties, such
as increased duplex stability; such compounds include, but not limited to, peptide
nucleic acids (PNAs), locked nucleic acids (LNA), oligonucleotide N3'→P5' phosphoramidates,
oligo-2-O-alkylribonucleotides, and the like.
[0047] In aspect in which patterns of discrete spaced apart regions are required, photolithography,
electron beam lithography, nano imprint lithography, and nano printing may be used
to generate such patterns on a wide variety of surfaces, e.g.
Pirrung et al, U.S. patent 5,143,854;
Fodor et al, U.S. patent 5,774,305;
Guo, (2004) Journal of Physics D: Applied Physics, 37: R123-141.
[0048] In one aspect, surfaces containing a plurality of discrete spaced apart regions are
fabricated by photolithography. A Commercially available, optically flat, quartz substrate
is spin coated with a 100-500nm thick layer of photo-resist. The photo-resist is then
baked on to the quartz substrate. An image of a reticle with a pattern of regions
to be activated is projected onto the surface of the photo-resist, using a stepper.
After exposure, the photo-resist is developed, removing the areas of the projected
pattern which were exposed to the UV source. This is accomplished by plasma etching,
a dry developing technique capable of producing very fine detail. The substrate is
then baked to strengthen the remaining photo-resist. After baking, the quartz wafer
is ready for functionalization. The wafer is then subjected to vapor-deposition of
3-aminopropyldimethylethoxysilane. The density of the amino functionalized monomer
can be tightly controlled by varying the concentration of the monomer and the time
of exposure of the substrate. Only areas of quartz exposed by the plasma etching process
may react with and capture the monomer. The substrate is then baked again to cure
the monolayer ofarnino-functionalized monomer to the exposed quartz. After baking,
the remaining photo-resist may be removed using acetone. Because of the difference
in attachment chemistry between the resist and silane, aminosilane-functionalized
areas on the substrate may remain intact through the acetone rinse. These areas can
be further functionalized by reacting them with p-phenylenediisothiocyanate in a solution
of pyridine and N-N-dimethlyformamide. The substrate is then capable of reacting with
amine-modified oligonucleotides. Alternatively, oligonucleotides can be prepared with
a 5'-carboxy-modifier-c10 linker (Glen Research). This technique allows the oligonucleotide
to be attached directly to the amine modified support, thereby avoiding additional
functionalization steps.
[0049] In another aspect, surfaces containing a plurality of discrete spaced apart regions
are fabricated by nano-imprint lithography (NIL). For DNA array production, a quartz
substrate is spin coated with a layer of resist, commonly called the transfer layer.
A second type of resist is then applied over the transfer layer, commonly called the
imprint layer. The master imprint tool then makes an impression on the imprint layer.
The overall thickness of the imprint layer is then reduced by plasma etching until
the low areas of the imprint reach the transfer layer. Because the transfer layer
is harder to remove than the imprint layer, it remains largely untouched. The imprint
and transfer layers are then hardened by heating. The substrate is then put into a
plasma etcher until the low areas of the imprint reach the quartz. The substrate is
then derivatized by vapor deposition as described above.
[0050] In another aspect, surfaces containing a plurality of discrete spaced apart regions
are fabricated by nano printing. This process uses photo, imprint, or e-beam lithography
to create a master mold, which is a negative image of the features required on the
print head. Print heads are usually made of a soft, flexible polymer such as polydimethylsiloxane
(PDMS). This material, or layers of materials having different properties, are spin
coated onto a quartz substrate. The mold is then used to emboss the features onto
the top layer of resist material under controlled temperature and pressure conditions.
The print head is then subjected to a plasma based etching process to improve the
aspect ratio of the print head, and eliminate distortion of the print head due to
relaxation over time of the embossed material. Random array substrates are manufactured
using nano-printing by depositing a pattern of amine modified oligonucleotides onto
a homogenously derivatized surface. These oligo-nucleotides would serve as capture
probes for the RCR products. One potential advantage to nano-printing is the ability
to print interleaved patterns of different capture probes onto the random array support.
This would be accomplished by successive printing with multiple print heads, each
head having a differing pattern, and all patterns fitting together to form the final
structured support pattern. Such methods allow for some positional encoding of DNA
elements within the random array. For example, control concatemers containing a specific
sequence can be bound at regular intervals throughout a random array.
[0051] In still another aspect, a high density array of capture oligonucleotide spots of
sub micron size is prepared using a printing head or imprint-master prepared from
a bundle, or bundle of bundles, of about 10,000 to 100 million optical fibers with
a core and cladding material. By pulling and fusing fibers a unique material is produced
that has about 50-1000 nm cores separated by a similar or 2-5 fold smaller or larger
size cladding material. By differential etching (dissolving) of cladding material
a nano-printing head is obtained having a very large number of nano-sized posts. This
printing head may be used for depositing oligonucleotides or other biological (proteins,
oligopeptides, DNA, aptamers) or chemical compounds such as silane with various active
groups. In one aspect the glass fiber tool is used as a patterned support to deposit
oligonucleotides or other biological or chemical compounds. In this case only posts
created by etching may be contacted with material to be deposited. Also, a flat cut
of the fused fiber bundle may be used to guide light through cores and allow light-induced
chemistry to occur only at the tip surface of the cores, thus eliminating the need
for etching. In both cases, the same support may then be used as a light guiding/collection
device for imaging fluorescence labels used to tag oligonucleotides or other reactants.
This device provides a large field of view with a large numerical aperture (potentially
>1). Stamping or printing tools that perform active material or oligonucleotide deposition
may be used to print 2 to 100 different oligonucleotides in an interleaved pattern.
This process requires precise positioning of the print head to about 50-500 nm. This
type of oligonucleotide array may be used for attaching 2 to 100 different DNA populations
such as different source DNA. They also may be used for parallel reading from sublight
resolution spots by using DNA specific anchors or tags. Information can be accessed
by DNA specific tags, e.g. 16 specific anchors for 16 DNAs and read 2 bases by a combination
of 5-6 colors and using 16 ligation cycles or one ligation cycle and 16 decoding cycles.
This way of making arrays is efficient if limited information (e.g. a small number
of cycles) is required per fragment, thus providing more information per cycle or
more cycles per surface.
[0052] In one aspect "inert" concatemers are used to prepare a surface for attachment of
test concatemers. The surface is first covered by capture oligonucleotides complementary
to the binding site present on two types of synthetic concatemers; one is a capture
concatemer, the other is a spacer concatemer. The spacer concatemers do not have DNA
segments complementary to the adapter used in preparation of test concatemers and
they are used in about 5-50, preferably 10 x excess to capture concatemers. The surface
with capture oligonucleotide is "saturated" with a mix of synthetic concatemers (prepared
by chain ligation or by RCR) in which the spacer concatemers are used in about 10
-fold (or 5 to 50-fold) excess to capture concatemers. Because of the -10:1 ratio
between spacer and capture concatemers, the capture concatemers are mostly individual
islands in a sea of spacer concatemers. The 10:1 ratio provides that two capture concatemers
are on average separated by two spacer concatemers. If concatemers are about 200 nm
in diameter, then two capture concatemers are at about 600 nm center-to-center spacing.
This surface is then used to attach test concatemers or other molecular structures
that have a binding site complementary to a region of the capture concatemers but
not present on the spacer concatemers. Capture concatemers may be prepared to have
less copies than the number of binding sites in test concatemers to assure single
test concatemer attachment per capture concatemer spot. Because the test DNA can bind
only to capture concatemers, an array of test concatemers may be prepared that have
high site occupancy without congregation. Due to random attachment, some areas on
the surface may not have any concatemers attached, but these areas with free capture
oligonucleotide may not be able to bind test concatemers since they are designed not
to have binding sites for the capture oligonculeotide. An array of individual test
concatemers as described would not be arranged in a grid pattern. An ordered grid
pattern should simplify data collection because less pixels are needed and less sophisticated
image analysis systems are needed also.
[0053] In one aspect, multiple arrays of the disclosure may be place on a single surface.
For example, patterned array substrates may be produced to match the standard 96 or
384 well plate format. A production format can be an 8 x 12 pattern of 6mm x 6mm arrays
at 9mm pitch or 16x24 of 3.33mm x 3.33mm array at 4.5mm pitch, on a single piece of
glass or plastic and other optically compatible material. In one example each 6mm
x 6mm array consists of 36 million 250-500nm square regions at 1 micrometer pitch.
Hydrophobic or other surface or physical barriers may be used to prevent mixing different
reactions between unit arrays.
[0054] By way of example, binding sites (i.e. discrete spaced apart regions) for DNA samples
are prepared by silanization of lithographically defined sites on silicon dioxide
on silicon, quartz, or glass surfaces with 3-aminopropyldimethylethoxysilane or similar
silanization agent followed by derivatization with p-phenylenediisothiocyanate or
similar derivatization agent. For example, the binding sites may be square, circular
or regular/irregular polygons produced by photolithography, direct-write electron
beam, or nano-imprint lithography. Minimization of non-specific binding in regions
between binding site The wetability (hydrophobic v.hydrophilic) and reactivity of
the field surrounding the binding sites can be controlled to prevent DNA samples from
binding in the field; that is, in places other than the binding sites. For example,
the field may be prepared with hexamethyldisilazane (HMDS), or a similar agent covalently
bonded to the surface, to be hydrophobic and hence unsuitable to hydrophilic bonding
of the DNA samples. Similarly, the feld may be coated with a chemical agent such as
a fluorine-based carbon compound that renders it unreactive to DNA samples.
[0055] For the three surface fabrication processes listed in the prior paragraph, the follow
exemplary steps are followed. For photolithography:
- 1) Clean glass wafer
- 2) Prime surface with HMDS
- 3) Pattern binding sites in photoresist
- 4) Reactive ion etch binding site surface with oxygen to remove HMDS
- 5) Silanize with .3% 3-aminopropyldimethylethoxysilane
- 6) Coat with photoresist to protect wafer during sawing
- 7) Saw wafer into chips
- 8) Strip photoresist
- 9) Derivatize binding sites with solution of 10% pyridine and 90% N,N-Dimethylformaide
(DMF) using 2.25mg p-phenylenediisothiocyanate (PDC) per ml of solution for 2h followed
by methanol, acetone, and water rinses
[0056] For direct write electron beam surface fabrication:
- 1) Clean glass wafer
- 2) Prime surface with HMDS
- 3) Pattern binding sites in PMMA with electron beam
- 4) Reactive ion etch binding site surface with oxygen to remove HMDS
- 5) Silanize with .3% 3-aminopropyldimethylethoxysilane
- 6) Coat with photoresist to protect wafer during sawing
- 7) Saw wafer into chips
- 8) Strip photoresist
- 9) Derivatize binding sites with solution of 10% pyridine and 90% N,N Dimethylformaide
(DMF) using 2.25mg p-phenylenediisothiocyanate (PDC) per ml of solution for 2h followed
by methanol, acetone, and water rinses.
[0057] For nano imprint lithography surface fabrication:
- 1) Clean glass wafer
- 2) Prime surface with HMDS
- 3) Coat wafer with transfer layer
- 4) Contact print pattern with nano imprint template and photopolymer on top of transfer
layer
- 5) Dry etch pattern into transfer layer
- 6) Reactive ion etch binding site surface with oxygen to remove HMDS
- 7) Silanize with .3% 3-aminopropyldimethylethoxysilane
- 8) Coat with photoresist to protect wafer during sawing
- 9) Saw wafer into chips
- 10) Strip photoresist
- 11) Derivatize binding sites with solution of 10% pyridine and 90% N,N Dimethylformaide
(DMF) using 2.25mg p-phenylenediisothiocyanate (PDC) per ml of solution for 2h followed
by methanol, acetone, and water rinses.
[0058] As mentioned above, a glass surface may also be used for constructing random arrays
of the disclosure. For example, a suitable glass surface may be constructed from microscope
cover slips. Microscope cover slips (22mm sq ∼170um thick) are placed in Teflon racks.
They are soaked in 3 molar KOH in 95% ethanol/water for 2 minutes. They are then rinsed
in water, followed by an acetone rinse. This removes surface contamination and prepares
the glass for silanization. Plasma cleaning is an alternative to KOH cleaning. Fused
silica or quartz may also be substituted for glass. The clean, dry cover slips are
immersed in .3% 3-aminopropyldimethylethoxysilane, .3% water, in acetone. They are
left to react for 45 minutes. They are then rinsed in acetone and cured at 100°C for
1 hour. 3-aminopropyldimethylethoxysilane may be used as a replacement for 3-aminopropyltriethoxysilane
because it forms a mono-layer on the glass surface. The monolayer surface provides
a lower background. The silanization agent may also be applied using vapor deposition.
3-aminopropyltriethoxysilane tends to form more of a polymeric surface when deposited
in solution phase. The amino modified silane is then terminated with a thiocyanate
group. This is done in a solution of 10% pyridine and 90% N,N-Dimethylformaide (DMF)
using 2.25mg p-phenylenediisothiocyanate (PDC) per ml of solution. The reaction is
run for 2 hours, then the slide is washed in methanol, followed by acetone, and water
rinses. The cover slips are then dried and ready to bind probe. There are additional
chemistries that can be used to modify the amino group at the end of the silanization
agent. For example, glutaraldehyde can be used to modify the amino group at the end
of the silanization agent to a aldehyde group which can be coupled to an amino modified
oligonucleotide. _Capture oligonucleotides are bound to the surface of the cover slide
by applying a solution of 10-50 micromolar capture oligonucleotide in 100 millimolar
sodium bicarbonate in water to the surface. The solution is allowed to dry, and is
then washed in water.
It may be beneficial to avoid terminating the 3-amino group with PDC and perform a
direct conjugation (of the 3-amino end) to the capture oligonucleotide which has been
modified with either a carboxyl group or an aldehyde group at the 5' end. In the case
of the carboxyl group, the oligonucleotide is applied in a solution that contains
EDC (1-Ethyl-3-(3-dimethylaminopropyl)-carbodiimide). In the case of the aldehyde
group, the oligo is kept wet for 5-10 minutes then the surface is treated with a 1%
solution of sodium borohydride.
[0059] In another aspect of the disclosure, random arrays are prepared using nanometer-sized
beads. Sub-micron glass or other types of beads (e.g. in the 20-50nm range) are used
which are derivatized with a short oligonucleotide, e.g. 6-30 nucleotides, complementary
to an adaptor oligonucleotide in the circles used to generate concatemers. The number
of oligonucleotides on the bead and the length of the sequence can be controlled to
weakly bind the concatemers in solution. Reaction rate of the beads should be much
faster than that of the solid support alone.
After binding concatemers, the beads are then allowed to settle on the surface of
an array substrate. The array substrate has longer, more stable, more numerous oligonucleotides,
such that conditions may be selected to permit preferential binding to the surface,
thereby forming a spaced array of concatemers. If the beads are magnetic, a magnetic
field can be used to pull them to the surface, it may also be used to move them around
the surface. Alternatively, a centrifuge may be used to concentrate the beads on the
surface. An exemplary protocol is as follows: 1. A preparation of 20 ul of concatemer
solution with one million concatemers per 1 ul is mixed with 20 million nano-beads
with about 500 capture oligonucleotides about 8 bases in length (6-16 bases may be
use under different conditions). A 100 nm nano-bead there is approximately 40,000
nm2 and can hold up to 4000 short oligonucleotides. One way to control the density
of capture probes is to mix in this case about 8 times more of a 2-4 bases long oligonucleotieds
with the same attachment chemistry with the capture probe. Also, much smaller nano-beads
(20-50 nm) may be used. 2. Reaction conditions (temperature, pH, salt concentration)
are adjusted so that concatemers with over 300 copies will attach to nanobeads in
significant numbers. 3. The reaction is applied under the same stringent conditions
to a support with 4x4 mm of patterned surface with 16 million active sites about 200
nm in size, and nanobeads are allowed or forced to settle on the substrate surface
bringing large concatemer with them. The largest distance that a nano-bead-concatemer
has to travel is about 1mm. The vertical movement of beads minimizes number of potential
concatemer-concatemer encounters. The reaction solution may be applied in aliquots,
e.g. 4 applications 5 ul each. In this case the thickness of the applied solution
(e.g. the nano-bead maximal travel distance) is only about 250 microns. 4. Further
increase stringency of the reaction to release concatemers from nano-beads and attach
them to active sites on the support with ∼300 capture oligonucleotides 20-50 bases
in length. 5. Concatemers attached to nano-beads will predominately settle initially
between active sites on the support because there are 25 times more inactive than
active surface. Slight horizontal movement force (e.g. substrate tilting, and other
forces), may be applied to move nano-bead-concatemers about one to a few microns around.
Detection Instrumentation
[0060] As mentioned above, signals from single molecules on random arrays made in accordance
with the disclosure are generated and detected by a number of detection systems, including,
but not limited to, scanning electron microscopy, near field scanning optical microscopy
(NSOM), total internal reflection fluorescence microscopy (TIZFM), and the like. Abundant
guidance is found in the literature for applying such techniques for analyzing and
detecting nanoscale structures on surfaces, as evidenced by the following references:
Reimer et al, editors, Scanning Electron Microscopy: Physics of image Formation and
Microanalysis, 2nd Edition (Springer, 1998);
Nie et al, Anal. Chem., 78: 1528-1534 (2006);
Hecht et al, Journal Chemical Physics, 112: 7761-7774 (2000);
Zhu et al, editors, Near-Field Optics: Principles and Applications (World Scientific
Publishing, Singapore, 1999); Drmanac, International patent publication
WO 2004/076683;
Lehr et al, Anal. Chem., 75: 2414-2420 (2003);
Neuschafer et al, Biosensors & Bioelectronics, 18: 489-497 (2003);
Neuschafer et al, U.S. patent 6,289,144; and the like. Of particular interest is TIRFM, for example, as disclosed by
Neuschafer et al, U.S. patent 6,289,144; Lehr et al (cited above); and Drmanac, International patent publication
WO 2004/076683. In one aspect, instruments for use with arrays of the disclosure comprise three
basic components: (i) a fluidics system for storing and transferring detection and
processing reagents, e.g. probes, wash solutions, and the like, to an array; (ii)
a reaction chamber, or flow cell, holding or comprising an array and having flow-through
and temperature control capability; and (iii) an illumination and detection system.
In one aspect, a flow cell has a temperature control subsystem with ability to maintain
temperature in the range from about 5-95°C, or more specifically 10-85C, and can change
temperature with a rate of about 0.5-2°C per second.
[0061] In one aspect, a flow cell for 1 "square 170 micrometer thick cover slips can be
used that has been derivatized to bind macromolecular structures of the disclosure.
The cell encloses the "array" by sandwiching the glass and a gasket between two planes.
One plane has an opening of sufficient size to permit imaging, and an indexing pocket
for the cover slip. The other plane has an indexing pocket for the gasket, fluid ports,
and a temperature control system. One fluid port is connected to a syringe pump which
"pulls" or "pushes" fluid from the flow cell the other port is connected to a funnel
like mixing chamber. The chamber, in turn is equipped with a liquid level sensor.
The solutions are dispensed into the funnel, mixed if needed, then drawn into the
flow cell. When the level sensor reads air in the funnels connection to the flow cell
the pump is reversed a known amount to back the fluid up to the funnel. This prevents
air from entering the flow cell. The cover slip surface may be sectioned off and divided
into strips to accommodate fluid flow/capillary effects caused by sandwiching. Such
substrate may be housed in an "open air" / "open face" chamber to promote even flow
of the buffers over the substrate by eliminating capillary flow effects. Imaging may
be accomplished with a 100x objective using TIRF or epi illumination and a 1.3 mega
pixel Hamamatsu orca-er-ag on a Zeiss axiovert 200, or like system. This configuration
images RCR concatemers bound randomly to a substrate (non-ordered array). Imaging
speed may be improved by decreasing the objective magnification power, using grid
patterned arrays and increasing the number of pixels of data collected in each image.
For example, up to four or more cameras may be used, preferably in the 10-16 megapixel
range. Multiple band pass filters and dichroic mirrors may also be used to collect
pixel data across up to four or more emission spectra. To compensate for the lower
light collecting power of the decreased magnification objective, the power of the
excitation light source can be increased. Throughput can be increased by using one
or more flow chambers with each camera, so that the imaging system is not idle while
the samples are being hybridized/reacted. Because the probing of arrays can be non-sequential,
more than one imaging system can be used to collect data from a set of arrays, further
decreasing assay time.
[0062] During the imaging process, the substrate must remain in focus. Some key factors
in maintaining focus are the flatness of the substrate, orthogonality of the substrate
to the focus plane, and mechanical forces on the substrate that may deform it. Substrate
flatness can be well controlled, glass plates which have better than ¼ wave flatness
are readily obtained. Uneven mechanical forces on the substrate can be minimized through
proper design of the hybridization chamber. Orthogonality to the focus plane can be
achieved by a well adjusted, high precision stage. Auto focus routines generally take
additional time to run, so it is desirable to run them only if necessary. After each
image is acquired, it will be analyzed using a fast algorithm to determine if the
image is in focus. If the image is out of focus, the auto focus routine will run.
It will then store the objectives Z position information to be used upon return to
that section of that array during the next imaging cycle. By mapping the objectives
Z position at various locations on the substrate, we will reduce the time required
for substrate image acquisition.
[0063] A suitable illumination and detection system for fluorescence-based signal is a Zeiss
Axiovert 200 equipped with a TIRF slider coupled to a 80 milliwatt 532 nm solid state
laser. The slider illuminates the substrate through the objective at the correct TIRF
illumination angle. TIRF can also be accomplished without the use of the objective
by illuminating the substrate though a prism optically coupled to the substrate. Planar
wave guides can also be used to implement TIRF on the substrate Epi illumination can
also be employed. The light source can be rastered, spread beam, coherent, incoherent,
and originate from a single or multi-spectrum source.
[0064] One aspect for the imaging system contains a 20x lens with a 1.25mm field of view,
with detection being accomplished with a 10 megapixel camera. Such a system images
approx 1.5 million concatemers attached to the patterned array at 1 micron pitch.
Under this configuration there are approximately 6.4 pixels per concatemer. The number
of pixels per concatemer can be adjusted by increasing or decreasing the field of
view of the objective. For example a 1mm field of view would yield a value of 10 pixels
per concatemer and a 2mm field of view would yield a value of 2.5 pixels per concatemer.
The field of view may be adjusted relative to the magnification and NA of the objective
to yield the lowest pixel count per concatemer that is still capable of being resolved
by the optics, and image analysis software.
[0065] Both TIRF and EPI illumination allow for almost any light source to be used. One
illumination schema is to share a common set of monochromatic illumination sources
(about 4 lasers for 6-8 colors) amongst imagers. Each imager collects data at a different
wavelength at any given time and the light sources would be switched to the imagers
via an optical switching system. In such an aspect, the illumination source preferably
produces at least 6, but more preferably 8 different wavelengths. Such sources include
gas lasers, multiple diode pumped solid state lasers combined through a fiber coupler,
filtered Xenon Arc lamps, tunable lasers, or the more novel Spectralum Light Engine,
soon to be offered by Tidal Photonics. The Spectralum Light Engine uses prism to spectrally
separate light. The spectrum is projected onto a Texas Instruments Digital Light Processor,
which can selectively reflect any portion of the spectrum into a fiber or optical
connector. This system is capable of monitoring and calibrating the power output across
individual wavelengths to keep them constant so as to automatically compensate for
intensity differences as bulbs age or between bulb changes.
[0066] The following table represent examples of possible lasers, dyes and filters.
| excitation |
| laser |
filter |
emission filter |
Dye |
|
| 407nm |
405/12 |
436/12 |
Alexa-405 |
401/421 |
| 407nm |
405/12 |
546/10 |
cascade yellow |
409/558 |
| 488nm |
488/10 |
514/11 |
Alexa-488 |
492/517 |
| 543nm |
546/10 |
540/565 |
Tamra |
540/565 |
| |
|
|
Bodipy |
|
| 543nm |
546/10 |
620/12 |
577/618 |
577/618 |
| |
546/10 |
620/12 |
Alexa-594 |
594/613 |
| 635nm |
635/11 |
650/11 |
Alexa-635 |
632/647 |
| 635nm |
635/11 |
|
Alexa700 |
702/723 |
[0067] Successfully scoring 6 billion concatemers through ∼350 (∼60 per color) images per
region over 24 hours may require a combination of parallel image acquisition, increased
image acquisition speed, and increased field of view for each imager. Additionally,
the imager may support between six to eight colors. Commercially available microscopes
commonly image a ∼1mm field of view at 20x magnification with an NA of 0.8. At the
proposed concatemer pitch of 0.5 micron, this translates into roughly 4 million concatemers
per image. This yields approximately 1,500 images for 6 billion spots per hybridization
cycle, or 0.5 million images for 350 imaging cycles. In a large scale sequencing operation,
each imager preferably acquires ∼200,000 images per day, based on a 300 millisecond
exposure time to a 16 mega pixel CCD. Thus, a preferred instrument design is 4 imager
modules each serving 4 flow cells (16 flow cells total). The above described imaging
schema assumes that each imager has a CCD detector with 10 million pixels and be used
with an exposure time of roughly 300 milliseconds. This should be an acceptable method
for collecting data for 6 fluorophor labels. One possible drawback to this imaging
technique is that certain fluorophors may be unintentionally photo bleached by the
light source while other fluorophores are being imaged. Keeping the illumination power
low and exposure times to a minimum would greatly reduce photo bleaching. By using
intensified CCDs (ICCDs) data could be collected of roughly the same quality with
illumination intensities and exposure times that are orders of magnitude lower than
standard CCDs. ICCDs are generally available in the 1 - 1.4 megapixel range. Because
they require much shorter exposure times, a one megapixel ICCD can acquire ten or
more images in the time a standard CCD acquires a single image. Used in conjunction
with fast filter wheels, and a high speed flow cell stage, a one mega pixel ICCD should
be able to collect the same amount of data as a 10 megapixel standard CCD.
[0068] Optics capable of imaging larger fields of view with high numerical apertures can
be manufactured as custom lens assemblies. Indications are that 20x optics capable
of imaging a 3mm field of view with a NA >0.9 can be fabricated. Two such imaging
systems, in combination with high pixel count CCD's or CCD mosaic arrays should be
able to image the complete eight flow cell assay in roughly 14 hours. As described,
further gains can be realized by using 16 flow cells. Doubling the number of flow
cells would reduce imaging time to 9 hours by reducing the number of images per each
field of view.
[0069] The reaction efficiency on the concatemer and other random DNA arrays may depend
on the efficient use of probes, anchors or primers and enzymes. This may be achieved
by mixing liquids (such as pooling liquid back and forth in the flow through chamber),
applying agitations or using horizontal or vertical electric fields to bring DNA from
different parts of the reaction volume in the proximity of the surface. One approach
for efficient low cost assay reaction is to apply reaction mixes in a thin layer such
as droplets or layers of about one to a few microns, but preferably less than 10 microns,
in size/thickness. In a 1x1x1 micron volume designated for a 1x1micron spot area,
in 1pmol/1ul (1uM concentration) there would be about 1000 molecules of probe in close
proximity to 1-1000 copies of DNA. Using up to 100-300 molecules of probes would not
significantly reduce the probe concentration and it would provide enough reacted probes
to get significant signal. This approach may be used in an open reaction chamber that
may stay open or closed for removal and washing of the probes and enzyme.
[0070] As mentioned above, higher throughput can be achieved by using multiple cameras and
multiple flow cells. A single robotic liquid handling gantry may service, for example,
16 flow cells. In addition, all components of the system may share a common temperature
control system, and set of reagents. For combinatorial SBH sequencing operations,
the robot may prepare probe pools and ligation buffers to be dispensed into the flow
cell funnels. Dedicated syringe pumps may dispense wash and hybridization buffers
directly into the funnel ports for each flow cell. Each imager may service a group
of 2-4 flow cells. Each group of flow cells may be positioned on an XY motion platform,
similar to the automated plate stages commonly found on research microscopes. System
control and coordination between all system components may be performed via software
running on a master computer. The control software may run assay cycles asynchronously,
allowing each imager to run continuously throughout the assay. Flow cells are connected
to a temperature control system with one heater and one chiller allowing for heating
or cooling on demand of each flow cell or 2-4 blocks of cells independently. Each
flow cell temperature may be monitored, and if a flow cell temperature drops below
a set threshold, a valve may open to a hot water recirculation. Likewise, if a flow
cell temperature is above the set threshold a valve may open to a cold water recirculation.
If a flow cell is within a set temperature range neither valve may open. The hot and
cold recirculation water runs through the aluminum flow cell body, but remains separate
and isolated from the assay buffers and reagents.
Sequence Analysis of Random Arrays of Target Sequence Concatemers
[0071] As mentioned above, random arrays of biomolecules, such as genomic DNA fragments
or cDNA fragments, provides a platform for large scale sequence determination and
for genome-wide measurements based on counting sequence tags, in a manner similar
to measurements made by serial analysis of gene expression (SAGE) or massively parallel
signature sequencing, e.g.
Velculescu, et al, (1995), Science 270, 484-487; and
Brenner et al (2000), Nature Biotechnology, 18: 630-634. Such genome-wide measurements include, but are not limited to, determination of
polymorphisms, including nucleotide substitutions, deletions, and insertions, inversions,
and the like, determination of methylation patterns, copy number patterns, and the
like, such as could be carried out by a wide range of assays known to those with ordinary
skill in the art, e.g.
Syvanen (2005), Nature Genetics Supplement, 37: S5-S10;
Gunderson et al (2005), Nature Genetics, 37: 549-554;
Fan et al (2003), Cold Spring Harbor Symposia on Quantitative Biology, LXVIII: 69-78; and
U.S. patents 4,883,750;
6,858,412;
5,871,921;
6,355,431; and the like.
[0072] A variety of sequencing methodologies can be used with random arrays of the invention,
including, but not limited to, hybridization-based methods, such as disclosed in
Drmanac, U.S. patents 6,864,052;
6,309,824; and
6,401,267; and
Drmanac et al, U.S. patent publication 2005/0191656, sequencing by synthesis methods, e.g.
Nyren et al, U.S. patent 6,210,891;
Ronaghi, U.S. patent 6,828,100;
Ronaghi et al (1998), Science, 281: 363-365;
Balasubramanian, U.S. patent 6,833,246;
Quake, U.S. patent 6,911,345;
Li et al, Proc. Natl. Acad. Sci., 100: 414-419 (2003), and ligation-based methods, e.g.
Shendure et al (2005), Science, 309: 1728-1739. In one aspect, a method of determining a nucleotide sequence of a target polynucleotide
in accordance with the disclosure comprises the following steps: (a) generating a
plurality of target concatemers from the target polynucleotide, each target concatemer
comprising multiple copies of a fragment of the target polynucleotide and the plurality
of target concatemers including a number of fragments that substantially covers the
target polynucleotide; (b) forming a random array of target concatemers fixed to a
surface at a density such that at least a majority of the target concatemers are optically
resolvable; (c) identifying a sequence of at least a portion of each fragment in each
target concatemer; and (d) reconstructing the nucleotide sequence of the target polynucleotide
from the identities of the sequences of the portions of fragments of the concatemers.
Usually, "substantially covers" means that the amount of DNA analyzed contains an
equivalent of at least two copies of the target polynucleotide, or in another aspect,
at least ten copies, or in another aspect, at least twenty copies, or in another aspect,
at least 100 copies. Target polynucleotides may include DNA fragments, including genomic
DNA fragments and cDNA fragments, and RNA fragments.
[0073] In one aspect, a sequencing method for use with the disclosure for determining sequences
in a plurality of DNA or RNA fragments comprises the following steps: (a) generating
a plurality of polynucleotide molecules each comprising a concatemer of a DNA or RNA
fragment; (b) forming a random array of polynucleotide molecules fixed to a surface
at a density such that at least a majority of the target concatemers are optically
resolvable; and (c) identifying a sequence of at least a portion of each DNA or RNA
fragment in resolvable polynucleotides using at least one chemical reaction of an
optically detectable reactant. In one aspect, such optically detectable reactant is
an oligonucleotide. In another aspect, such optically detectable reactant is a nucleoside
triphosphate, e.g. a fluorescently labeled nucleoside triphosphate that may be used
to extend an oligonucleotide hybridized to a concatemer. In another aspect, such optically
detectable reagent is an oligonucleotide formed by ligating a first and second oligonucleotides
that form adjacent duplexes on a concatemer. In another aspect, such chemical reaction
is synthesis of DNA or RNA, e.g. by extending a primer hybridized to a concatemer.
In yet another aspect the above optically detectable reactant is a nucleic acid binding
oligopeptide or polypeptide or protein.
[0074] In one aspect, parallel sequencing of polynucleotide analytes of concatemers on a
random array is accomplished by combinatorial SBH (cSBH), as disclosed by Drmanac
in the above-cited patents. In one aspect, a first and second sets of oligonucleotide
probes are provide, wherein each sets has member probes that comprise oligonucleotides
having every possible sequence for the defined length of probes in the set. For example,
if a set contains probes of length six, then it contains 4096 (=4
6) probes. In another aspect, first and second sets of oligonucleotide probes comprise
probes having selected nucleotide sequences designed to detect selected sets of target
polynucleotides. Sequences are determined by hybridizing one probe or pool of probe,
hybridizing a second probe or a second pool of probes, ligating probes that form perfectly
matched duplexes on their target sequences, identifying those probes that are ligated
to obtain sequence information about the target sequence, repeating the steps until
all the probes or pools of probes have been hybridized, and determining the nucleotide
sequence of the target from the sequence information accumulated during the hybridization
and identification steps.
[0075] For sequencing operation, in some aspects, the sets may be divided into subsets that
are used together in pools, as disclosed in
U.S. patent 6,864,052. Probes from the first and second sets may be hybridized to target sequences either
together or in sequence, either as entire sets or as subsets, or pools. In one aspect,
lengths of the probes in the first or second sets are in the range of from 5 to 10
nucleotides, and in another aspect, in the range of from 5 to 7 nucleotides, so that
when ligated they form ligation products with a length in the range of from 10 to
20, and from 10 to 14, respectively.
[0076] In another aspect, using such techniques, the sequence identity of each attached
DNA concatemer may be determined by a "signature" approach. About 50 to 100 or possibly
200 probes are used such that about 25-50% or in some applications 10-30% of attached
concatemers will have a full match sequence for each probe. This type of data allows
each amplified DNA fragment within a concatemer to be mapped to the reference sequence.
For example, by such a process one can score 64 4-mers (i.e. 25% of all possible 256
4-mers) using 16 hybridization/stripoff cycles in a 4 colors labeling schema. On a
60-70 base fragment amplified in a concatemer about 16 of 64 probes will be positive
since there are 64 possible 4mers present in a 64 base long sequence (i.e. one quarter
of all possible 4mers). Unrelated 60-70 base fragments will have a very different
set of about 16 positive decoding probes. A combination of 16 probes out of 64 probes
has a random chance of occurrence in 1 of every one billion fragments which practically
provides a unique signature for that concatemer. Scoring 80 probes in 20 cycles and
generating 20 positive probes create a signature even more likely to be unique: occurrence
by chance is 1 in billion billions. Previously, a "signature" approach was used to
select novel genes from cDNA libraries. An implementation of a signature approach
is to sort obtained intensities of all tested probes and select up to a predefined
(expected) number of probes that satisfy the positive probe threshold. These probes
will be mapped to sequences of all DNA fragments (sliding window of a longer reference
sequence may be used) expected to be present in the array. The sequence that has all
or a statistically sufficient number of the selected positive probes is assigned as
the sequence of the DNA fragment in the given concatemer. In another approach an expected
signal can be defined for all used probes using their pre measured full match and
mismatch hybridization/ligation efficiency. In this case a measure similar to the
correlation factor can be calculated.
[0077] A preferred way to score 4-mers is to ligate pairs of probes, for example: N
(5-7)BBB with BN
(7-9), where B is the defined base and N is a degenerate base. For generating signatures
on longer DNA concatemer probes, more unique bases will be used. For example, a 25%
positive rate in a fragment 1000 bases in length would be achieved by N
(4-6)BBBB and BBN
(6-8). Note that longer fragments need the same number of about 60-80 probes (15-20 ligation
cycles using 4 colors).
[0078] In one aspect all probes of a given length (e.g. 4096 N
2-4BBBBBBN
2-4) or all ligation pairs may be used to determine complete sequence of the DNA in a
concatemer. For example, 1024 combinations of N
(5-7)B
3 and BBN
(6-8) may be scored (256 cycles if 4 colors are used) to determine sequence of DNA fragments
of up to about 250 bases, preferably up to about 100 bases.
[0079] The decoding of sequencing probes with large numbers of Ns may be prepared from multiple
syntheses of subsets of sequences at degenerated bases to minimize difference in the
efficiency. Each subset is added to the mix at a proper concentration. Also, some
subsets may have more degenerated positions than others. For example, each of 64 probes
from the set N
(5-7)BBB may be prepared in 4 different synthesis. One is regular all 5-7 bases to be fully
degenerated; second is N0-3(A,T)5BBB; third is N0-2(A,T)(G,C)(A,T)(G,C)(A,T)BBB, and
the fourth is N0-2(G,C)(A,T)(G,C)(A,T)(G,C)BBB.
[0080] Oligonucleotide preparation from the three specific syntheses is added in to regular
synthesis in experimentally determined amounts to increase hybrid generation with
target sequences that have in front of the BBB sequence an AT rich (e.g. AATAT) or
(A or T) and (G or C) alternating sequence (e.g. ACAGT or GAGAC). These sequences
are expected to be less efficient in forming a hybrid. All 1024 target sequences can
be tested for the efficiency to form hybrid with N
0-3NNNNNBBB probes and those types that give the weakest binding may be prepared in about
1-10 additional synthesis and added to the basic probe preparation.
[0081] Decoding by Signatures: a smaller number of probes for small number of distinct samples:
5-7 positive out of 20 probes (5 cycles using 4 colors) has capacity to distinct about
10-100 thousand distinct fragments
[0082] Decoding of 8-20mer RCR products. In this application arrays are formed as random
distributions of unique 8 to 20 base recognition sequences in the form of DNA concatemers.
The probes need to be decoded to determine the sequence of the 8-20 base probe region.
At least two options are available to do this and the following example describes
the process for a 12 mer. In the first, one half of the sequence is determined by
utilizing the hybridization specificity of short probes and the ligation specificity
of fully matched hybrids. Six to ten bases adjacent to the 12 mer are predefined and
act as a support for a 6mer to 10-mer oligonucleotide. This short 6mer will ligate
at its 3-prime end to one of 4 labeled 6-mers to 10-mers. These decoding probes consist
of a pool of 4 oligonucleotides in which each oligonucleotide consists of 4-9 degenerate
bases and 1 defined base. This oligonucleotide will also be labeled with one of four
fluorescent labels. Each of the 4 possible bases A, C, G, or T will therefore be represented
by a fluorescent dye. For example these 5 groups of 4 oligonucleotides and one universal
oligonucleotide (Us) can be used in the ligation assays to sequence first 5 bases
of 12-mers: B=each of 4 bases associated with a specific dye or tag at the end:
UUUUUUUU.BNNNNNNN*
UUUUUUUU.NBNNNNNN
UUUUUUUU.NNBNNNNN
UUUUUUUU.NNNBNNNN
UUUUUUUU.NNNNBNNN
[0083] Six or more bases can be sequences with additional probe pools. To improve discrimination
at positions near the center of the 12mer the 6mer oligonucleotide can be positioned
further into the 12mer sequence. This will necessitate the incorporation of degenerate
bases into the 3-prime end of the non-labeled oligonucleotide to accommodate the shift.
This is an example of decoding probes for position 6 and 7 in the 12-mer.
UUUUUUNN.NNNBNNNN
UUUUUUNN.NNNNBNNN
[0084] In a similar way the 6 bases from the right side of the 12mer can be decoded by using
a fixed oligonucleotide and 5-prime labeled probes. In the above described system
6 cycles are required to define 6 bases of one side of the 12mer. With redundant cycle
analysis of bases distant to the ligation site this may increase to 7 or 8 cycles.
In total then, complete sequencing of the 12mer could be accomplished with 12-16 cycles
of ligation. Partial or complete sequencing of arrayed DNA by combining two distinct
types of libraries of detector probes. In this approach one set has probes of the
general type N
3-8B
4-6 (anchors) that are ligated with the first 2 or 3 or 4 probes/probe pools from the
set BN
6-8, NBN
5-7, N
2BN
4-6, and N
3BN
3-5. The main requirement is to test in a few cycles a probe from the first set with
2-4 or even more probes from the second set to read longer continuous sequence such
as 5-6+3-4=8-10 in just 3-4 cycles. In one example, the process is:
- 1) Hybridize 1-4 4-mers or more 5-mer anchors to obtain 70-80% 1 or 2 anchors per
DNA. One way to discriminate which anchor is positive from the pool is to mix specific
probes with distinct hybrid stability (maybe different number of Ns in addition).
Anchors may be also tagged to determine which anchor from the pool is hybridized to
a spot. Tags, as additional DNA segment, may be used for adjustable displacement as
a detection method. For example, EEEEEEEENNNAAAAA and FFFFFFFFNNNCCCCC probes can
be after hybridization or hybridization and ligation differentially removed with two
corresponding displacers:
EEEEEEEENNNNN and FFFFFFFFNNNNNNNN where the second is more efficient.
Separate cycles may be used just to determine which anchor is positive. For this purpose
anchors labeled or tagged with multiple colors may be ligated to unlabeled N7-N10
supporter oligonucleotides.
- 2) Hybridize BNNNNNNNN probe with 4 colors corresponding to 4 bases; wash discriminatively
(or displace by complement to the tag) to read which of two scored bases is associated
to which anchor if two anchors are positive in one DNA. Thus, two 7-10 base sequences
can be scores at the same time.
[0085] In 2-4 cycles extend to 4-6 base anchor for additional 2-4 bases run 16 different
anchors per each array (32-64 physical cycles if 4 colors are used) to determine about
16 possible 8-mers (∼100 bases total) per each fragment (more then enough to map it
to the reference (probability that a 100-mer will have a set of 10 8-mers is less
than 1 in trillion trillions; (10exp-28). By combining data from different anchors
scored in parallel on the same fragment in another array complete sequence of that
fragment and by extension to entire genomes may be generated from overlapping 7-10-mers.
[0086] Tagging probes with DNA tags for larger multiplex of decoding or sequence determination
probes Instead of directly labeling probes they can be tagged with different oligonucleotide
sequences made of natural bases or new synthetic bases (such as isoG and isoC). Tags
can be designed to have very precise binding efficiency with their anti-tags using
different oligonucleotide lengths (about 6-24 bases) and/or sequence including GC
content. For example 4 different tags may be designed that can be recognized with
specific anti-tags in 4 consecutive cycles or in one hybridization cycle followed
by a discriminative wash. In the discriminative wash initial signal is reduced to
95-99%, 30-40%, 10-20% and 0-5% for each tag, respectively. In this case by obtaining
two images 4 measurements are obtained assuming that probes with different tags will
rarely hybridize to the same dot. Another benefit of having many different tags even
if they are consecutively decoded (or 2-16 at a time labeled with 2-16 distinct colors)
is the ability to use a large number of individually recognizable probes in one assay
reaction. This way a 4-64 times longer assay time (that may provide more specific
or stronger signal) may be affordable if the probes are decoded in short incubation
and removal reactions.
[0087] The decoding process requires the use of 48-96 or more decoding probes. These pools
will be further combined into 12-24 or more pools by encoding them with four fluorophores,
each having different emission spectra. Using a 20x objective, each 6mm x 6mm array
may require roughly 30 images for full coverage by using a 10 mega pixel camera with.
Each of 1 micrometer array areas is read by about 8 pixels. Each image is acquired
in 250 milliseconds, 150ms for exposure and 100ms to move the stage. Using this fast
acquisition it will take ∼7.5 seconds to image each array, or 12 minutes to image
the complete set of 96 arrays on each substrate. In one aspect of an imaging system,
this high image acquisition rate is achieved by using four ten-megapixel cameras,
each imaging the emission spectra of a different fluorophore. The cameras are coupled
to the microscope through a series of dichroic beam splitters. The autofocus routine,
which takes extra time, runs only if an acquired image is out of focus. It will then
store the Z axis position information to be used upon return to that section of that
array during the next imaging cycle. By mapping the autofocus position for each location
on the substrate we will drastically reduce the time required for image acquisition.
[0088] Each array requires about 12-24 cycles to decode. Each cycle consists of a hybridization,
wash, array imaging, and strip-off step. These steps, in their respective orders,
may take for the above example 5,2,12, and 5 minutes each, for a total of 24 minutes
each cycle, or roughly 5-10 hours for each array, if the operations were performed
linearly. The time to decode each array can be reduced by a factor of two by allowing
the system to image constantly. To accomplish this, the imaging of two separate substrates
on each microscope is staggered. While one substrate is being reacted, the other substrate
is imaged.
[0089] An exemplary decoding cycle using cSBH includes the following steps: (i) set temperature
of array to hybridization temperature (usually in the range 5-25°C); (ii) use robot
pipetter to pre mix a small amount of decoding probe with the appropriate amount of
hybridization buffer; (iii) pipette mixed reagents into hybridization chamber; (iv)
hybridize for predetermined time; (v) drain reagents from chamber using pump (syringe
or other); (vi) add a buffer to wash mismatches of non-hybrids; (vii) adjust chamber
temperature to appropriate wash temp (about 10-40 °C); (viii) drain chamber; (ix)
add more wash buffer if needed to improve imaging; (x) image each array, preferably
with a mid power (20x) microscope objective optically coupled to a high pixel count
high sensitivity ccd camera, or cameras; plate stage moves chambers (or perhaps flow-cells
with input funnels) over object, or objective-optics assembly moves under chamber;
certain optical arrangements, using di-chroic mirrors/beam-splitters can be employed
to collect multi-spectral images simultaneously, thus decreasing image acquisition
time; arrays can be imaged in sections or whole, depending on array/image size/pixel
density; sections can be assembled by aligning images using statistically significant
empty regions pre-coded onto substrate (during active site creation) or can be made
using a multi step nano-printing technique, for example sites (grid of activated sites)
can be printed using specific capture probe, leaving empty regions in the grid; then
print a different pattern or capture probe in that region using separate print head;
(xi) drain chamber and replace with probe strip buffer (or use the buffer already
loaded) then heat chamber to probe stripoff temperature (60-90 °C); high pH buffer
may be used in the strip-off step to reduce stripoff temperature; wait for the specified
time; (xii) remove buffer; (xiii) start next cycle with next decoding probe pool in
set.
Labels and Signal Generation by Probes Directed to Polynucleotides on Arrays of the
Invention
[0090] The oligonucleotide probes of the disclosure can be labeled in a variety of ways,
including the direct or indirect attachment of radioactive moieties, fluorescent moieties,
colorimetric moieties, chemiluminescent moieties, and the like. Many comprehensive
reviews of methodologies for labeling DNA and constructing DNA adaptors provide guidance
applicable to constructing oligonucleotide probes of the present disclosure.
[0091] Such reviews include
Kricka, Ann. Clin. Biochem., 39: 114-129 (2002);
Schaferling et al, Anal. Bioanal. Chem., (April 12, 2006);
Matthews et al, Anal. Biochem., Vol 169, pgs. 1-25 (1988);
Haugland, Handbook of Fluorescent Probes and Research Chemicals, Tenth Edition (Invitrogen/Molecular
Probes, Inc., Eugene, 2006);
Keller and Manak, DNA Probes, 2nd Edition (Stockton Press, New York, 1993); and
Eckstein, editor, Oligonucleotides and Analogues: A Practical Approach (IRL Press,
Oxford, 1991);
Wetmur, Critical Reviews in Biochemistry and Molecular Biology, 26: 227-259 (1991);
Hermanson, Bioconjugate Techniques (Academic Press, New York, 1996); and the like. Many more particular methodologies applicable to the disclosure are
disclosed in the following sample of references:
Fung et al, U.S. patent 4,757,141;
Hobbs, Jr., et al U.S. patent 5,151,507;
Cruickshank, U.S. patent 5,091,519; (synthesis of functionalized oligonucleotides for attachment of reporter groups);
Jablonski et al, Nucleic Acids Research, 14: 6115-6128 (1986)(enzyme-oligonucleotide conjugates);
Ju et al, Nature Medicine, 2: 246-249 (1996);
Bawendi et al, U.S. patent 6,326,144 (derivatized fluorescent nanocrytals);
Bruchez et al, U.S. patent 6,274,323 (derivatized fluorescent nanocrystals); and the like.
[0092] In one aspect, one or more fluorescent dyes are used as labels for the oligonucleotide
probes, e.g. as disclosed by
Menchen et al, U.S. patent 5,188,934 (4,7-dichlorofluorscein dyes);
Begot et al, U.S. patent 5,366,860 (spectrally resolvable rhodamine dyes);
Lee et al, U.S. patent 5, 847,162 (4,7-dichlororhodamine dyes);
Khanna et al, U.S. patent 4,318,846 (ether-substituted fluorescein dyes);
Lee et al, U.S. patent 5,800,996 (energy transfer dyes);
Lee et al, U.S. patent 5,066,580 (xanthene dyes):
Mathies et al, U.S. patent 5,688,648 (energy transfer dyes); and the like. Labeling can also be carried out with quantum
dots, as disclosed in the following patents and patent publications,
6,322,901;
6,576,291;
6,423,551;
6,251,303;
6,319,426;
6,426,513;
6,444,143;
5,990,479;
6,207,392;
2002/0045045;
2003/0017264; and the like. As used herein, the term "fluorescent signal generating moiety" means
a signaling means which conveys information through the fluorescent absorption and/or
emission properties of one or more molecules. Such fluorescent properties include
fluorescence intensity, fluorescence life time, emission spectrum characteristics,
energy transfer, and the like.
[0093] Commercially available fluorescent nucleotide analogues readily incorporated into
the labeling oligonucleotides include, for example, Cy3-dCTP, Cy3-dUTP, Cy5-dCTP,
Cy5-dUTP (Amersham Biosciences, Piscataway, New Jersey, USA), fluorescein-12-dUTP,
tetramethylrhodamine-6-dUTP, Texas Red®-5-dUTP, Cascade Blue®-7-dUTP, BODIPY® FL-14-dUTP,
BODIPY®R-14-dUTP, BODIPY® TR-14-dUTP, Rhodamine Green™-5-dUTP, Oregon Green® 488-5-dUTP,
Texas Red®-12-dUTP, BODIPY® 630/650-14-dUTP, BODIPY® 650/665-14-dUTP, Alexa Fluor®
488-5-dUTP, Alexa Fluor® 532-5-dUTP, Alexa Fluor® 568-5-dUTP, Alexa Fluor® 594-5-dUTP,
Alexa Fluor® 546-14-dUTP, fluorescein-12-UTP, tetramethylrhodamine-6-UTP, Texas Red®-5-UTP,
Cascade Blue®-7-UTP, BODIPY® FL-14-UTP, BODIPY® TMR-14-UTP, BODIPY® TR-14-UTP, Rhodamine
Green™-5-UTP, Alexa Fluor® 488-5-UTP, Alexa Fluor® 546-14-UTP (Molecular Probes, Inc.
Eugene, OR, USA).. Other fluorophores available for post-synthetic attachment include,
inter alia, Alexa Fluor® 350, Alexa Fluor® 532, Alexa Fluor® 546, Alexa Fluor® 568, Alexa Fluor®
594, Alexa Fluor® 647, BODIPY 493/503, BODIPY FL, BODIPY R6G, BODIPY 530/550, BODIPY
TMR, BODIPY 558/568, BODIPY 558/568, BODIPY 564/570, BODIPY 576/589, BODIPY 581/591,
BODIPY 630/650, BODIPY 650/665, Cascade Blue, Cascade Yellow, Dansyl, lissamine rhodamine
B, Marina Blue, Oregon Green 488, Oregon Green 514, Pacific Blue, rhodamine 6G, rhodamine
green, rhodamine red, tetramethylrhodamine, Texas Red (available from Molecular Probes,
Inc., Eugene, OR, USA), and Cy2, Cy3.5, Cy5.5, and Cy7 (Amersham Biosciences, Piscataway,
NJ USA, and others). FRET tandem fluorophores may also be used, such as PerCP-Cy5.5,
PE-Cy5, PE-Cy5.5, PE-Cy7, PE-Texas Red, and APC-Cy7; also, PE-Alexa dyes (610, 647,
680) and APC-Alexa dyes. Biotin, or a derivative thereof, may also be used as a label
on a detection oligonucleotide, and subsequently bound by a detectably labeled avidin/streptavidin
derivative (
e.
g. phycoerythrin-conjugated streptavidin), or a detectably labeled anti-biotin antibody.
Digoxigenin may be incorporated as a label and subsequently bound by a detectably
labeled anti-digoxigenin antibody (e.g. fluoresceinated anti-digoxigenin). An aminoallyl-dUTP
residue may be incorporated into a detection oligonucleotide and subsequently coupled
to an N-hydroxy succinimide (NHS) derivitized fluorescent dye, such as those listed
supra. In general, any member of a conjugate pair may be incorporated into a detection oligonucleotide
provided that a detectably labeled conjugate partner can be bound to permit detection.
As used herein, the term antibody refers to an antibody molecule of any class, or
any subfragment thereof, such as an Fab. Other suitable labels for detection oligonucleotides
may include fluorescein (FAM), digoxigenin, dinitrophenol (DNP), dansyl, biotin, bromodeoxyuridine
(BrdU), hexahistidine (6xHis), phosphor-amino acids (e.g. P-tyr, P-ser, P-thr), or
any other suitable label. In one aspect the following hapten/antibody pairs are used
for detection, in which each of the antibodies is derivatized with a detectable label:
biotin/α-biotin, digoxigenin/α-digoxigenin, dinitrophenol (DNP)/α-DNP, 5-Carboxyfluorescein
(FAM)/α-FAM. As described in schemes below, probes may also be indirectly labeled,
especially with a hapten that is then bound by a capture agent, e.g. as disclosed
in
Holtke et al, U.S. patent 5,344,757;
5,702,888; and
5,354,657;
Huber et al, U.S. patent 5,198,537;
Miyoshi, U.S. patent 4,849,336;
Misiura and Gait, PCT publication WO 91/17160; and the like. Many different hapten-capture agent pairs are available for use with
the disclosure. Exemplary, haptens include, biotin, des-biotin and other derivatives,
dinitrophenol, dansyl, fluorescein, CY5, and other dyes, digoxigenin, and the like.
For biotin, a capture agent may be avidin, streptavidin, or antibodies. Antibodies
may be used as capture agents for the other haptens (many dye-antibody pairs being
commercially available, e.g. Molecular Probes).
Kits of the Disclosure
[0094] In the commercialization of the methods described herein, certain kits for construction
of random arrays of the invention and for using the same for various applications
are particularly useful. Kits for applications of random arrays of the invention include,
but are not limited to, kits for determining the nucleotide sequence of a target polynucleotide,
kits for large-scale identification of differences between reference DNA sequences
and test DNA sequences, kits for profiling exons, and the like. A kit typically comprises
at least one support having a surface and one or more reagents necessary or useful
for constructing a random array of the invention or for carrying out an application
therewith. Such reagents include, without limitation, nucleic acid primers, probes,
adaptors, enzymes, and the like, and are each packaged in a container, such as, without
limitation, a vial, tube or bottle, in a package suitable for commercial distribution,
such as, without limitation, a box, a sealed pouch, a blister pack and a carton. The
package typically contains a label or packaging insert indicating the uses of the
packaged materials. As used herein, "packaging materials" includes any article used
in the packaging for distribution of reagents in a kit, including without limitation
containers, vials, tubes, bottles, pouches, blister packaging, labels, tags, instruction
sheets and package inserts.
[0095] In one aspect, a kit for making a random array of concatemers of DNA fragments from
a source nucleic acid comprising the following components: (i) a support having a
surface; and (ii) at least one adaptor oligonucleotide for ligating to each DNA fragment
and forming a DNA circle therewith, each DNA circle capable of being replicated by
a rolling circle replication reaction to form a concatemer that is capable of being
randomly disposed on the surface is disclosed herein. In such kits,
the surface may be a planar surface having an array of discrete spaced apart regions,
wherein each discrete spaced apart region has a size equivalent to that of said concatemers.
The discrete spaced apart regions may form a regular array with a nearest neighbor
distance in the range of from 0.1 to 20 µm. The concatemers on the discrete spaced
apart regions may have a nearest neighbor distance such that they are optically resolvable.
The discrete spaced apart regions may have capture oligonucleotides attached and the
adaptor oligonucleotides may each have a region complementary to the capture oligonucleotides
such that the concatemers are capable of being attached to the discrete spaced apart
regions by formation of complexes between the capture oligonucleotides and the complementary
regions of the adaptor oligonucleotides. In some aspects, the concatemers are randomly
distributed on said discrete spaced apart regions and the nearest neighbor distance
is in the range of from 0.3 to 3 µm. Such kits may further comprise (a) a terminal
transferase for attaching a homopolymer tail to said DNA fragments to provide a binding
site for a first end of said adaptor oligonucleotide, (b) a ligase for ligating a
strand of said adaptor oligonucleotide to ends of said DNA fragment to form said DNA
circle, (c) a primer for annealing to a region of the strand of said adaptor oligonucleotide,
and (d) a DNA polymerase for extending the primer annealed to the strand in a rolling
circle replication reaction. The above adaptor oligonucleotide may have a second end
having a number of degenerate bases in the range of from 4 to 12.
[0096] In another aspect the disclosure provides kits for sequencing a target polynucleotide
comprising the following components: (i) a support having a planar surface having
an array of optically resolvable discrete spaced apart regions, wherein each discrete
spaced apart region has an area of less than 1 µm
2; (ii) a first set of probes for hybridizing to a plurality of concatemers randomly
disposed on the discrete spaced apart regions, the concatemers each containing multiple
copies of a DNA fragment of the target polynucleotide; and (iii) a second set of probes
for hybridizing to the plurality of concatemers such that whenever a probe from the
first set hybridizes contiguously to a probe from the second set, the probes are ligated.
Such kits may further include a ligase, a ligase buffer, and a hybridization buffer.
In some aspects, the discrete spaced apart regions may have capture oligonucleotides
attached and the concatemers may each have a region complementary to the capture oligonucleotides
such that said concatemers are capable of being attached to the discrete spaced apart
regions by formation of complexes between the capture oligonucleotides and the complementary
regions of said concatemers.
[0097] In still another aspect, the provides kits for constructing a single molecule array
comprising the following components: (i) a support having a surface having reactive
functionalities; and (ii) a plurality of macromolecular structures each having a unique
functionality and multiple complementary functionalities, the macromolecular structures
being capable of being attached randomly on the surface wherein the attachment is
formed by one or more linkages formed by reaction of one or more reactive functionalities
with one or more complementary functionalities; and wherein the unique functionality
is capable of selectively reacting with a functionality on an analyte molecule to
form the single molecule array. In some aspects of such kits, the surface is a planar
surface having an array of discrete spaced apart regions containing said reactive
functionalities and wherein each discrete spaced apart region has an area less than
1 µm
2. In further aspects, the discrete spaced apart regions form a regular array with
a nearest neighbor distance in the range of from 0.1 to 20 µm. In further aspects,
the concatemers on the discrete spaced apart regions have a nearest neighbor distance
such that they are optically resolvable. In still further aspects, the macromolecular
structures may be concatemers of one or more DNA fragments and wherein the unique
functionalities are at a 3' end or a 5' end of the concatemers.
[0098] In another aspect, the disclosure includes kits for circularizing DNA fragments comprising
the components: (a) at least one adaptor oligonucleotide for ligating to one or more
DNA fragments and forming DNA circles therewith (b) a terminal transferase for attaching
a homopolymer tail to said DNA fragments to provide a binding site for a first end
of said adaptor oligonucleotide, (c) a ligase for ligating a strand of said adaptor
oligonucleotide to ends of said DNA fragment to form said DNA circle, (d) a primer
for annealing to a region of the strand of said adaptor oligonucleotide, and (e) a
DNA polymerase for extending the primer annealed to the strand in a rolling circle
replication reaction. In an aspect of such kit, the above adaptor oligonucleotide
may have a second end having a number of degenerate bases in the range of from 4 to
12. The above kit may further include reaction buffers for the terminal transferase,
ligase, and DNA polymerase. In still another aspect, the disclosure includes a kit
for circularizing DNA fragments using a Circligase enzyme (Epicentre Biotechnologies,
Madison, WI), which kit comprises a volume exclusion polymer. In another aspect, such
kit further includes the following components: (a) reaction buffer for controlling
pH and providing an optimized salt composition for Circligase, and (b) Circligase
cofactors. In another aspect, a reaction buffer for such kit comprises 0.5 M MOPS
(pH 7.5), 0.1 M KCl, 50 mM MgCl
2, and 10 mM DTT. In another aspect, such kit includes Circligase, e.g. 10-100 µL Circligase
solution (at 100 unit/µL). Exemplary volume exclusion polymers are disclosed in
U.S. patent 4,886,741, and include polyethylene glycol, polyvinylpyrrolidone, dextran sulfate, and like
polymers. In one aspect, polyethylene glycol (PEG) is 50% PEG4000. In one aspect,
a kit for circle formation includes the following:
| Amount |
Component |
Final Conc. |
| 2 µL |
Circligase 10X reaction buffer |
1X |
| 0.5 µL |
1 mM ATP |
25 µM |
| 0.5 µL |
50 mM MnCl2 |
1.25 mM |
| 4µL |
50% PEG4000 |
10% |
| 2 µL |
Circligase ssDNA ligase (100 units/µL) |
10 units/µL |
| |
single stranded DNA template |
0.5-10pmol/µL |
| |
sterile water |
|
[0099] Final reaction volume: 20 µL. The above components are used in the following protocol:
- 1. Heat DNA at 60- 96°C depending on the length of the DNA (ssDNA templates that have
a 5'-phosphate and a 3'-hydroxyl group).
- 2. Preheat 2.2X reaction mix at 60°C for about 5-10 min.
- 3. If DNA was preheated to 96°C cool it down at 60°C.
- 4. Mix DNA and buffer at 60°C without cooling it down and incubate for 2-3h.
- 5. Heat Inactivate enzyme to stop the ligation reaction.
Large-Scale Mutation Discovery by Mismatch Enzyme Cleavage
[0100] Arrays and sequencing methods of the disclosure used may be used for large-scale
identification of polymorphisms using mismatch cleavage techniques. Several approaches
to mutation detection employ a heteroduplex in which the mismatch itself is utilized
for cleavage recognition. Chemical cleavage with piperidine at mismatches modified
with hydroxylamine or osmium tetroxide provides one approach to release a cleaved
fragment. In a similar way the enzymesT7 endonuclease I or T4 endonuclease VII have
been used in the enzyme mismatch cleavage (EMC) techniques, e.g.
Youil et al, Proc. Natl. Acad. Sci., 92: 87-91 (1995);
Mashal et al, Nature Genetics, 9: 177-183 (1995);
Babon et al, Molecular Biotechnology, 23: 73-81 (2003);
Ellis et al, Nucleic Acids Research, 22: 2710-2711 (1994); and the like. Cleavase is used in the cleavage fragments length polymorphism (CFLP)
technique which has been commercialized by Third Wave Technologies. When single stranded
DNA is allowed to fold and adopt a secondary structure the DNA will form internal
hairpin loops at locations dependent upon the base sequence of the strand. Cleavase
will cut single stranded DNA five-prime of the loop and the fragments can then be
separated by PAGE or similar size resolving techniques. Mismatch binding proteins
such as Mut S and Mut Y also rely upon the formation of heteroduplexes for their ability
to identify mutation sites. Mismatches are usually repaired but the binding action
of the enzymes can be used for the selection of fragments through a mobility shift
in gel electrophoresis or by protection from exonucleases, e.g. Ellis et al (cited
above).
[0101] Templates for heteroduplex formation are prepared by primer extension from genomic
DNA. For the same genomic region of the reference DNA, an excess of the opposite strand
is prepared in the same way as the test DNA but in a separate reaction. The test DNA
strand produced is biotinylated and is attached to a streptavidin support. Homoduplex
formation is prevented by heating and removal of the complementary strand. The reference
preparation is now combined with the single stranded test preparation and annealed
to produce heteroduplexes. This heteroduplex is likely to contain a number of mismatches.
Residual DNA is washed away before the addition of the mismatch endonuclease, which,
if there is a mismatch every 1 kb would be expected to produce about 10 fragments
for a 10kb primer extension. After cleavage, each fragment can bind an adapter at
each end and enter the mismatch-fragment circle selection process. Capture of mismatch
cleaved DNA from Large genomic fragments. The 5-10 kb genomic fragments prepared from
large genomic fragments as described above are biotinylated by the addition of a biotinylated
dideoxy nucleotide at the 3-prime end with terminal transferase and excess biotinylated
nucleotide are removed by filtration. A reference BAC clone that covers the same region
of sequence is digested with the same six-base cutter to match the fragments generated
from the test DNA. The biotinylated genomic fragments are heat denatured in the presence
of the BAC reference DNA and slowly annealed to generate biotinylated heteroduplexes.
The reference BAC DNA is in large excess to the genomic DNA so the majority of biotinylated
products will be heteroduplexes. The biotinylated DNA can then be attached to the
surface for removal of the reference DNA. Residual DNA is washed away before the addition
of the mismatch endonuclease. After cleavage, each fragment can bind an adapter at
each end and enter the mismatch circle selection process as follows. (a) DNA is cleaved
on both sides of the mismatch. (b) 5-prime overhangs are generated that can be ligated.
(3' overhangs are also created by digesting with an appropriate restriction endonuclease
having a four base recognition site.) (c) An adapter is introduced that contains an
active overhang at one side. (d) An adapter is ligated to each of the two generated
fragments (only ligation to the right from the 5' phosphate after addition of sequences
to the 3' end of the top strand). (e) The molecule is phosphorylated and a bridging
oligonucleotide is used to ligate the two ends of the single stranded molecule. (f)
After circularization, a concatemer is generated by extending a primer in a RCR reaction.
Circle Formation from Mismatch Cleavage Products
[0102] Method I. The heteroduplexes generated above can be used for selection of small DNA
circles, as illustrated in Figs. 7 and 8. As shown in Fig. 7, in this process, heteroduplex
(700) of a sample is treated with the mismatch enzyme to create products cleaved on
both strands (704 and 706) surrounding the mutation site (702) to produce fragments
(707) and (705). T7 endonuclease I or similar enzyme cleaves 5-prime of the mutation
site to reveal a 5-prime overhang of varying length on both strands surrounding the
mutation. The next phase is to capture the cleaved products in a form suitable for
amplification and sequencing. Adapter (710) is ligated to the overhang produced by
the mismatch cutting (only fragment (705) shown), but because the nature of the overhang
is unknown, at least three adapters are needed and each adapter is synthesized with
degenerate bases to accommodate all possible ends. The adapter can be prepared with
an internal biotin (708) on the non-circularizing strand to allow capture for buffer
exchange and sample cleanup, and also for direct amplification on the surface if desired.
[0103] Because the intervening sequence between mutations does not need to be sequenced
and reduces the sequencing capacity of the system it is removed when studying genomic-derived
samples. Reduction of sequence complexity is accomplished by a type IIs enzyme that
cuts the DNA at a point away from the enzyme recognition sequence. In doing so, the
cut site and resultant overhangs will be a combination of all base variants. Enzymes
that can be used include MmeI (20 bases with 2 base 3' overhang) and Eco P15I (with
25 bases and 2 base 5' overhang). The adapter is about 50 bp in length to provide
sequences for initiation of rolling circle amplification and also provide stuffer
sequence for circle formation, as well as recognition site (715) for a type IIs restriction
endonuclease. Once the adapter has been ligated to the fragment the DNA is digested
(720) with the type IIs restriction enzyme to release all but 20-25 bases of sequence
containing the mutation site that remains attached to the adapter.
[0104] The adaptered DNA fragment is now attached to a streptavidin support for removal
of excess fragment DNA. Excess adapter that did not ligate to mismatch cleaved ends
will also bind to the streptavidin solid support. The new degenerate end created by
the type IIs enzyme can now be ligated to a second adapter through the phosphorylation
of one strand of the second adapter. The other strand is non-phosphorylated and blocked
at the 3-prime end with a dideoxy nucleotide. The structure formed is essentially
the genomic fragment of interest captured between two different adapters. To create
a circle from this structure would simply require both ends of the molecule coming
together and ligating, e.g. via formation of staggered ends by digesting at restriction
sites (722) and (724), followed by intra-molecular ligation. Although this event should
happen efficiently, there is also the possibility that the end of an alternative molecule
could ligate at the other end of the molecule creating a dimer molecule, or greater
multiples of each unit molecule. One way to minimize this is to perform the ligation
under dilute conditions so only intra-molecular ligation is favored, then re-concentrating
the sample for future steps. An alternative strategy to maximize the efficiency of
circle formation without inter-molecular ligation is to block excess adapters on the
surface. This can be achieved by using lambda exonuclease to digest the lower strand.
If second adapter has been attached then it will be protected from digestion because
there is no 5-prime phosphate available. If only the first adapter is attached to
the surface then the 5-prime phosphate is exposed for degradation of the lower strand
of the adapter. This will lead to loss of excess first adapter from the surface.
[0105] After lambda exonuclease treatment the 5 prime end of the top strand of the first
adapter is prepared for ligation to the 3-prime end of the second adapter. This can
be achieved by introducing a restriction enzyme site into the adapters so that re-circularization
of the molecule can occur with ligation. Amplification of DNA captured into the circular
molecules proceeds by a rolling circle amplification to form long linear concatemer
copies of the circle. If extension initiates 5-prime of the biotin, the circle and
newly synthesized strand is released into solution. Complementary oligonucleotides
on the surface are responsible for condensation and provide sufficient attachment
for downstream applications. One strand is a closed circle and acts as the template.
The other strand, with an exposed 3-prime end, acts as an initiating primer and is
extended.
[0106] Method II. This method, illustrated in Fig. 8, is similar to the procedure above
with the following modifications. 1) The adapter can be prepared with a 3-prime biotin
(808) on the non-circularized strand to allow capture for buffer exchange and sample
cleanup. 2) Reduction of sequence complexity of the 10 kb heteroduplex fragments described
above occurs through the use of 4-base cutting restriction enzymes, e.g. with restriction
sites (810), (812), and (814). Use of 2 or 3 enzymes in the one reaction could reduce
the genomic fragment size down to about 100 bases. The adapter-DNA fragment can be
attached to a streptavidin support for removal of excess fragment DNA. Excess adapter
that did not ligate to mismatch cleaved ends will also bind to the streptavidin solid
support. The biotinylated and phosphorylated strand can now be removed by lambda exonuclease
which will degrade from the 5-prime end but leave the non-phosphorylated strand intact.
To create a circle from this structure now requires both ends of the molecule coming
together and ligating to form the circle. Several approaches are available to form
the circle using a bridging oligonucleotide, as described above. A polynucleotide
can be added to the 3-prime end with terminal transferase to create a sequence for
one half of a bridge oligonucleotide (818) to hybridize to, shown as polyA tail (816).
The other half will bind to sequences in the adapter. Alternatively, before addition
of the exonuclease, an adapter can be added to the end generated by the 4-base cutter
which will provide sequence for the bridge to hybridize to after removal of one strand
by exonuclease. A key aspect of this selection procedure is the ability to select
the strand for circularization and amplification. This ensures that only the strand
with the original mutation (from the 5-prime overhang) and not the strand from the
adapter is amplified. If the 3-prime recessed strand was amplified then a mismatch
from the adapter could create a false base call at the site of or near to the mutation.
Amplification of DNA captured into the circular molecules proceeds by a rolling circle
amplification to form linear concatemer copies of the circle.
[0107] Alternative applications of mis-match derived circles. The mis-match derived small
circular DNA molecules may be amplified by other means such as PCR. Common primer
binding sites can be incorporated into the adapter sequences The amplified material
can be used for mutation detection by methods such as Sanger sequencing or array based
sequencing.
Cell-free clonal selection of cDNAs. Traditional methods of cloning have several drawbacks
including the propensity of bacteria to exclude sequences from plasmid replication
and the time consuming and reagent-intensive protocols required to generate clones
of individual cDNA molecules. Linear single-stranded can be made from amplifications
of DNA molecules that have been closed into a circular form. These large concatemeric,
linear forms arise from a single molecule and can act as efficient, isolated targets
for PCR when separated into a single reaction chamber, in much the same way a bacterial
colony is picked to retrieve the cDNA containing plasmid. We plan to develop this
approach as a means to select cDNA clones without having to pass through a cell-based
clonal selection step. The first step of this procedure will involve ligating a gene
specific oligonucleotide directed to the 5-prime end with a poly dA sequence for binding
to the poly dT sequence of the 3-prime end of the cDNA. This oligonucleotide acts
as a bridge to allow T4 DNA ligase to ligate the two ends and form a circle.
[0108] The second step of the reaction is to use a primer, or the bridging oligonucleotide,
for a strand displacing polymerase such as Phi 29 polymerase to create a concatemer
of the circle. The long linear molecules will then be diluted and arrayed in 1536
well plates such that wells with single molecules can be selected. To ensure about
10 % of the wells contain 1 molecule approximately 90% would have to be sacrificed
as having no molecules. To detect the wells that are positive a dendrimer that recognizes
a universal sequence in the target is hybridized to generate 10K-100K dye molecules
per molecule of target. Excess dendrimer is removed through hybridization to biotinylated
capture oligos. The wells are analyzed with a fluorescent plate reader and the presence
of DNA scored. Positive wells are then re-arrayed to consolidate the clones into plates
with complete wells for further amplification
Splice Variant Detection and Exon Profiling
[0109] The process described is based on random DNA arrays and "smart" probe pools for the
identification and quantification of expression levels of thousands of genes and their
splice variants. In eukaryotes, as the primary transcript emerges from the transcription
complex, spliceosomes interact with splice sites on the primary transcript to excise
out the introns, e.g.
Maniatis et al, Nature, 418: 236-243 (2002). However, because of either mutations that alter the splice site sequences, or external
factors that affect spliceosome interaction with splice sites, alternative splice
sites, or cryptic splice sites, could be selected resulting in expression of protein
variants encoded by mRNA with different sets of exons. Surveys of cDNA sequences from
large scale EST sequencing projects indicated that over 50 % of the genes have known
splice variants. In a recent study using a microarray-based approach, it was estimated
that as high as 75% of genes are alternatively spliced, e.g.
Johnson et al, Science, 302: 2141-2144 (2003).
[0110] The diversity of proteins generated through alternative splicing could partially
contribute to the complexity of biological processes in higher eukaryotes. This also
leads to the implication that the aberrant expression of variant protein forms could
be responsible for pathogenesis of diseases. Indeed, alternative splicing has been
found to associate with various diseases like growth hormone deficiency, Parkinson's
disease, cystic fibrosis and myotonic dystrophy, e.g.
Garcia-Blanco et al, Nature Biotechnology, 22: 535-546 (2004). Because of the difficulty in isolating and characterizing novel splice variants,
the evidence implicating roles of splice variants in cancer could represent the tip
of the iceberg. With the availability of tools that could rapidly and reliably characterize
splicing patterns of mRNA, it would help to elucidate the role of alternative splicing
in cancer and in disease development in general.
[0111] In one aspect, methods of the disclosure permit large-scale measurement of splice
variants with the following steps: (a) Prepare full length first strand cDNA for targeted
or all mRNAs. (b) Circularize the generated full length (or all) first strand cDNA
molecules by incorporating an adapter sequence. (c) By using primer complementary
to the adapter sequence perform rolling circle replication (RCR) of cDNA circles to
form concatemers with over 100 copies of initial cDNA. (d) Prepare random arrays by
attaching RCR produced "cDNA balls" to glass surface coated with capture oligonucleotide
complementary to a portion of the adapter sequence; with an advanced submicron patterned
surface one mm
2 can have between 1-10 million cDNA spots; note that the attachment is a molecular
process and does not require robotic spotting of individual "cDNA balls" or concatemers.
(e) Starting from pre-made universal libraries of 4096 6-mers and 1024 labeled 5-mers,
use a sophisticated computer program and a simple robotic pipettor to create 40-80
pools of about 200 6-mers and 20 5-mers for testing all 10,000 or more exons in targeted
1000 or more up to all known genes in the sample organism/tissue. (f) In a 4-8 hour
process, hybridize/ligate all probe pools in 40-80 cycles on the same random array
using an automated microscope-like instrument with a sensitive 10-mega pixel CCD detector
for generating an array image for each cycle. (g) Use a computer program to perform
spot signal intensity analysis to identify which cDNA is on which spot, and if any
of the expected exons is missing in any of the analyzed genes. Obtain exact expression
levels for each splice variant by counting occurrences in the array.
[0112] This system provides a complete analysis of the exon pattern on a single transcript,
instead of merely providing information on the ratios of exon usage or quantification
of splicing events over the entire population of transcribed genes using the current
expression arrays hybridized with labeled mRNA/cDNA. At the maximum limit of its sensitivity,
it allows a detailed analysis down to a single molecule of a mRNA type present in
only one in hundreds of other cells; this would provide unique potentials for early
diagnosis of cancer cells. The combination of selective cDNA preparation with an "array
of random arrays" in a standard 384-well format and with "smart" pools of universal
short probes provides great flexibility in designing assays; for examples, deep analysis
of a small number of genes in selected samples, or more general analysis in a larger
number of samples, or analysis of a large number of genes in smaller number of samples.
The analysis provides simultaneously 1) detection of each specific splice variant,
2) quantification of expression of wild type and alternatively spliced mRNAs. It can
also be used to monitor gross chromosomal alterations based on the detection of gene
deletions and gene translocations by loss of heterozygosity and presence of two sub-sets
of exons from two genes in the same transcript on a single spot on the random array.
The exceptional capacity and informativeness of this assay is coupled with simple
sample preparation from very small quantities of mRNA, fully-automated assay based
on all pre-made, validated reagents including libraries of universal labeled and unlabeled
probes and primers/adapters that will be ultimately developed for all human and model
organism genes. The proposed splice variant profiling process is equivalent to high
throughput sequencing of individual full length cDNA clones; rSBH throughput can reach
one billion cDNA molecules profiled in a 4-8 hour assay. This system will provide
a powerful tool to monitor changes in expression levels of various splice variants
during disease emergence and progression. It can enable discovery of novel splice
variants or validate known splice variants to serve as biomarkers to monitor cancer
progression. It can also provide means to further understanding the roles of alternative
splice variants and their possible uses as therapeutic targets. Universal nature and
flexibility of this low cost and high throughput assay provides great commercial opportunities
for cancer research and diagnostics and in all other biomedical areas. This high capacity
system is ideal for service providing labs or companies.
[0113] Preparation of templates for in vitro transcription. Exon sequences are cloned into
the multiple cloning sites (MCS) of plasmid pBluescript, or like vector. For the purposes
of demonstrating the usefulness of the probe pools, it is not necessary to clone the
contiguous full-length sequence, nor to maintain the proper protein coding frame.
For genes that are shorter than 1 kb, PCR products are generated from cDNA using gene
specific oligos for the full length sequence. For longer genes, PCR products are generated
comprising about 500 bp that corresponding to contiguous block of exons and ordered
the fragments by cloning into appropriate cloning sites in the MCS of pBluescript.
This is also the approach for cloning the alternative spliced versions, since the
desired variant might not be present in the cDNA source used for PCR.
[0114] The last site of the MCS is used to insert a string of 40 A's to simulate the polyA
tails of cellular mRNA. This is to control for the possibility that the polyA tail
might interfere with the sample preparation step described below, although it is not
expected to be a problem since a poly-dA tail is incorporated in sample preparation
of genomic fragments as described. T7 RNA polymerase will be used to generate the
run-off transcripts and the RNA generated will be purified with the standard methods.
[0115] Preparation of samples for arraying. Because the probe pools are designed for specific
genes, cDNA is prepared for those specific genes only. For priming the reverse transcription
reactions, gene-specific primers are used, therefore for 1000 genes, 1000 primers
are used. The location of the priming site for the reverse transcription is selected
with care, since it is not reasonable to expect the synthesis of cDNA >2kb to be of
high efficiency. It is quite common that the last exon would consist of the end of
the coding sequence and a long 3' untranslated region. In the case of CD44 for example,
although the full-length mRNA is about 5.7 kb, the 3' UTR comprises of 3kb, while
the coding region is only 2.2 kb. Therefore the logical location of the reverse transcription
primer site is usually immediately downstream of the end of the coding sequence. For
some splice variants, the alternative exons are often clustered together as a block
to create a region of variability. In the case of Tenascin C variants (8.5kb), the
most common isoform has a block of 8 extra exons, and there is evidence to suggest
that there is variability in exon usage in that region. So for Tenascin C, the primer
will be located just downstream of that region. Because of the concern of synthesizing
cDNA with length >2kb, for long genes, it might be necessary to divide the exons into
blocks of 2 kb with multiple primers.
[0116] Reverse transcription reactions may be carried out with commercial systems, e.g.
SuperScript III system from Invitrogen (Carlsbad, CA) and the StrataScript system
from Stratagene (La Jolla, CA). Once single stranded cDNA molecules are produced,
the rest of the procedures involved putting on the adaptor sequence, circularization
of the molecule and RCR as described above. The 5' ends of the cDNAs are basically
the incorporated gene-specific primers used for initiating the reverse transcription.
By incorporating a 7 base universal tag on the 5' end of the reverse-transcription
priming oligos, all the cDNA generated will carry the same 7 base sequence at the
5' end. Thus a single template oligonucleotide that is complementary to both the adaptor
sequence and the universal tag can be used to ligate the adaptor to all the target
molecules, without using the template oligonucleotide with degenerate bases. As for
the 3' end of the cDNA (5' end of the mRNA) which is usually ill-defined, it may be
treated like a random sequence end of a genomic fragment. Similar methods of adding
a polyA tail will be applied, thus the same circle closing reaction may also be used.
[0117] Reverse transcriptases are prone to terminate prematurely to create truncated cDNAs.
Severely truncated cDNAs probably will not have enough probe binding sites to be identified
with a gene assignment, thus would not be analyzed. cDNA molecules that are close,
but not quite full-length, may show up as splice variant with missing 5' exons. If
there are no corroborating evidence from a sequence database to support such variants,
they may be discounted. A way to avoid such problem is to select for only the full-length
cDNA (or those with the desired 3' end) to be compatible with circle closing reaction,
then any truncated molecules will not be circularized nor replicated. First a dideoxy-cytosine
residue can be added to the 3' end of all the cDNA to block ligation, then by using
a mismatch oligo targeting the desired sequence, a new 3' end can be generated by
enzyme mismatch cleavage using T4 endonuclease VII. With the new 3' end, the cDNA
can proceed with the adding a poly-dA tail and with the standard protocols of circularization
and replication.
[0118] Replicated and arrayed concatemers of the exon fragments may be carried out using
combinatorial SBH, as described above. The algorithm of the following steps may be
used to select 5-mer and 6-mer probes for use in the technique:
Step 1: Select 1000-2000 shortest exons (total about 20 - 50 kb), and find out matching
sequences for each of 1024 available labeled 5-mers. On average each 5-mer will occur
20 times over 20 kb, but some may occur over 50 or over 100 times. By selecting the
most frequent 5-mer, the largest number of short exons will be detected with the single
labeled probe. A goal would be to detect about 50-100 short exons (10%-20% of 500
exons) per cycle. Thus less than 10 labeled probes and 50-100 unlabeled 6-mers would
be sufficient. Small number of labeled probes is favorable because it minimizes overall
fluorescent background.
Step 2. Find out all 6-mers that are contiguous with all sites in all 1000 genes that
are complementary to 10 selected 5-mers. On average 20 such sites will exist in each
2kb gene. Total number of sites would be about 20,000, e.g., each 6-mer on average
will occur 5 times. Sort 6-mers by the hit frequency. The most frequent may have over
20 hits, e.g. such 6-mer will detect 20 genes through combinations with 10 labeled
probes. Thus, to get a single probe pair for each of the 500 genes a minimum of 25
6-mer probes would be required. Realistically, 100 to 200 6-mers may be required.
[0119] Due to benefits of combinatorial SBH that uses pre-made libraries of 6-mer and 5-mer
probes 40 probe pools are readily prepared with about 200 probes per pool using established
pipetting robotics. The information generated is equivalent to having over 3 probes
per exon, therefore the use of 8000 5-mers and 6-mers effectively replaces the 30,000
longer exons specific probes required for a single set of 1000 genes.
[0120] Exon profiling. The profiling of exons can be performed in two phases: the gene identification
phase and the exon identification phase. In the gene identification phase, each concatemer
on the array can be uniquely identified with a particular gene. In theory, 10 probe
pools or hybridization cycles will be enough to identify 1000 genes using the following
scheme. Each gene is assigned a unique binary code. The number of binary digits thus
depends on the total number of genes: 3 digits for 8 genes, 10 digits for 1024 genes.
Each probe pool is designed to correspond to a digit of the binary code and would
contain probes that would hit a unique combination of half of the genes and one hit
per gene only. Thus for each hybridization cycle, an unique half of the genes will
score a 1 for that digit and the other half will score zero. Ten hybridization cycles
with 10 probe pools will generate 1024 unique binary codes, enough to assign 1000
unique genes to all the concatemers on the array. To provide redundancy in the identification
data, 15-20 cycles would be used. If 20 cycles are used, it would provide 1 million
unique binary codes and there should be enough information to account for loss of
signals due to missing exons or gene deletions. It will also be equivalent to having
10 data points per gene (20 cycles of 500 data point each give 10,000 data points
total), or one positive probe-pair per exon, on average. At this point after 20 cycles,
this system is capable of making assignment of 1 million unique gene identities to
the ampliots. Therefore by counting gene identities of the ampliots, one can determine
quantitatively the expression level of all the genes (but not sub-typing of splice
variants) in any given samples.
[0121] After identifying each ampliot with a gene assignment, its exon pattern will be profiled
in the exon identification phase. For the exon identification phase, one exon per
gene in all or most of the genes is tested per hybridization cycle. In most cases
10-20 exon identification cycles should be sufficient. Thus, in the case of using
20 exon identification cycles we will obtain information of 2 probes per each of 10
exons in each gene. For genes with more than 20 exons, methods can be developed so
that 2 exons per gene can be probed at the same cycle. One possibility is using multiple
fluorophores of different colors, and another possibility is to exploit differential
hybrid stabilities of different ligation probe pairs.
[0122] In conclusion, a total of about 40 assay cycles will provide sufficient information
to obtain gene identity at each spot and to provide three matching probe-pairs for
each of 10,000 exons with enough informational redundancy to provide accurate identification
of missing exons due to alternative splicing or chromosomal deletions.
Example 1
Glass Cover Slip as Random Array Support:
Derivatization Protocol
[0123] In this example, a glass cover slip is prepared for use as a support for disposing
DNA concatemers. The following materials are used:
Millipore DI water
2.5 ml of 3-Aminopropyldimethylethoxysilane (Gelest)
1.6 grams p-phenylenediisothiocyanate (Acros Organics / fisher)
210 grams KOH (VWR)
Ethanol (VWR)
Methanol (VWR)
Pyridine (VWR)
N,N-dimethylformamide (VWR)
Acetone (VWR)
Equipment
100c oven
magnetic stir plate
1 2"x.5" magnetic stir bar
2 4 liter Nunc beaker
7 4"x8"x4" glass containers
1 liter graduated cylinder
1 100 ml graduated cylinder
1 lab scale
1 Metzler scale
1 large weigh boat
1 small weigh boat
1 pair thick nitrile gloves
1 large funnel
1 ml pipettman with filter tips
1 nalgene stir bar
1 airtight container (tupperware)
[0124] Using the large graduated cylinder measure 950ml of ethanol, add to the 4 liter Nunc
beaker. Measure 50ml of DI water in the small graduated cylinder and add to the same
nunc beaker. Measure out 210 grams of KOH pellets in a weigh boat on the lab scale.
Add stir bar and KOH pellets to the beaker. Place beaker on stir plate and stir at
low speed until KOH is completely dissolved. While KOH is dissolving, lay out 6 pre-washed
glass containers. fill containers 2-5 with DI water until ½ inch from top (∼800ml).
Fill container 6 with acetone ½" to top. Carefully pour dissolved KOH solution into
container 1 until ½" to top. Add racked cover slips to container 1 wait 3 minutes,
remove racks from container 1 and wash in containers 2-5 leaving racks in each container
a minimum of 15 seconds. Submerse racks briefly in container 6. Set aside racks, dispose
the solutions from containers 1 and 2 in the basic waste container using the large
funnel and thick nitrile gloves, clean and dry labware. Lay out 7 clean and dry glass
containers. Add 775 ml of acetone to container 1 add 2.5 ml of DI water to container
1. stir container 1 with pipette tip for 20 seconds. With a new pipette tip add 2.5
ml of 3-aminopropyldimethylethoxysilane to container 1. Stir with pipette tip for
10 seconds. Immerse all 5 racks of cover slips into container 1. Cover container 1
with polypropylene box top. Wait 45 minutes. 15 minutes prior to the completion of
the reaction, fill containers 2-4 until ½" to top with acetone, fill container 5 with
water ½" to top. Fill container 6 until ½" to top with acetone. Upon reaction completion
(45 minutes) transfer cover slip racks 1-5 from container 1 to container 2, wait 15
seconds. Repeat this though container 6. Place racks into empty container 7 and put
in 100c oven. Wait one hour.
[0125] Lay out 7 glass containers. After racks come out of oven, use the Meltzer scale to
weigh out 1.6 grams of p-phenylenediisothiocyanate (PDC) in the small weigh boat.
Pour 720 ml dimethylformamide into the cleaned 1 liter graduated cylinder, fill to
800ml with pyridine. Pour 50% this solution into a clean class container then pour
it back into the cylinder to mix (repeat once). Fill container 1 until ½" to top with
this solution. Add the PDC from the weigh boat to container 1. Use stir bar to mix
solution. Crush PDC clumps that refuse to dissolve, then stir again. Cover slip racks
should be cool by now. Place all 5 racks into container one. Cover with polypropylene
box top. Wait 2 hours. 10 minutes prior to reaction completion fill containers 2 and
3 with methanol until ½" from top. Fill containers 4 and 5 with acetone until ½" from
top. Fill container 6 with 65% acetone 35% water until ½" from top. Fill container
7 with acetone. Successively transfer racks through all containers, waiting 15 seconds
between each transfer. Remove racks from container 7 dump contents of containers 1-7
into organic waste drum. Replace racks to container 7 and dry in oven for 15 minutes.
Place dry racks into airtight container, they are now ready for attachment.
Example 2
Preparation of RCR Products form E. coli Genomic DNA
and Disposition onto a Glass Cover Slip
[0126] E.coli genomic DNA (32 ug) (Sigma Chemical Co) was fragmented with 0.16 U of DnaseI
(Epicentre) at 37°C for 10 min and then heat inactivated at 95°C for 10 min. Reaction
products were distributed with an average size of 200 bp as determined by agarose
gel electrophoresis. If reaction products did not meet the required size distribution
they were further digested with the addition of fresh enzyme. The final concentration
was 200 ng/ul of genomic DNA.
[0127] The Dnase digested DNA (26 ng/ul) was reacted with Terminal deoxynucleotide transferase
(0.66 U/ul) from New England Biolabs (NEB) in reaction buffer supplied by NEB. The
reaction contained dATP (2 mM) and was performed at 37C for 30 min and then heat inactivated
at 70 C for 10 min. The DNA sample was then heated to 95C for 5 min before rapid cooling
on ice.
[0128] A synthetic DNA adapter was then ligated to the 5' end of the genomic DNA by first
forming a hybrid of a 65-base oligonucleotide
(TATCATCTACTGCACTGACCGGATGTTAGGAAGACAAAAGGAAGCTGAGGGTCACATTA ACGGAC)(SEQ ID NO: 8)
with a second oligonucleotide (NNNNNNNGTCCGTTAATGTGAC 3' 2'3'ddC) (SEQ ID NO: 9) at
the 3' end of the 65mer in which the 7 "Ns" form an overhang. The shorter oligo will
act as a splint for ligation of the 65mer to the 5' end of the genomic fragments.
The splint molecule consists of 7 degenerate bases at its 5' end to hybridize to variable
bases at the 5' end of the genomic DNA. The adapter hybrid was formed by slowly hybridizing
1200 pmol of adapter with 1200 pmol of splint in 52 ul from 95C to room temperature
over 1hr.
[0129] T4 DNA Ligase (0.3 U/ul) was combined with genomic DNA (17 ng/ul) and adapter-splint
(0.5 uM) in 1X ligase reaction buffer supplied by NEB. The ligation proceeded at 15C
for 30 min, 20C for 30 min and then inactivated at 70C for 10 min. A second splint
molecule (AGATGATATTTTTTTT 3' 2'3'ddC) (SEQ ID NO: 10) (0.6 uM) was then added to
the reaction and the mix was supplemented with more ligase buffer and T4 DNA ligase
(0.3 U/ul). The reaction proceeded at 15C for 30 min and then at 20C for 30 min before
inactivation for 10 min at 70C.
[0130] The ligation mix was then treated with exonuclease I (NEB) (1 U/ul) at 37 C for 60
min, followed by inactivation at 80C for 20 min
[0131] Rolling circle replication was performed in reaction buffer supplied by NEB with
BSA (0.1 ug/ul), 0.2 mM each dNTP, an initiating primer (TCAGCTTCCTTTTGTCTTCCTAAC)
(SEQ ID NO: 11) at 2 fmol/ul, exonuclease treated ligation of genomic DNA at 24 pg/ul,
and Phi 29 polymerase (0.2 U/ul). The reaction was performed for 1 hr at 30C and then
heat inactivated at 70C for 10 min.
[0132] RCR reaction products were attached to the surface of cover slips by first attaching
amine modified oligonucleotides to the surface of the cover slips. A capture probe
([AMINOC6][SP-C18][SP-C18]GGATGTTAGGAAGACAAAAGGAAGCTGAGG) (SEQ ID NO: 12) (50 uM)
was added to the DITC derivatized cover slips in 0.1 uM NaHCO3 and allowed to dry
at 40 C for about 30 min. The cover slips were rinsed in DDI water for 15 min and
dried. RCR reaction products (4.5 ul) were then combined with 0.5 ul of 20 X SSPE
and added to the center of the slide. The sample was allowed to air dry and non-attached
material was washed off for 10 min in 3x SSPE and then briefly in DDI water. The slide
was then dried before assembly on the microscope. Attached RCR products were visualized
by hybridizing an 11mer TAMRA labeled probe that is complementary to a region of the
adapter
[0133] RCR reaction products were formed from a single stranded 80mer synthetic DNA target
(NNNNNNNNGCATANCACGANGTCATNATCGTNCAAACGTCAGTCCANGAATCNAGATC CACTTAGANTAAAAAAAAAAAA)
(SEQ ID NO: 13) as above but without poly A addition with TDT. The RCR reaction contained
target molecules at an estimated 12.6 fmol/ul. Reaction products (5 ul) were combined
with SSPE (2X) and SDS (0.3%) in a total reaction volume of 20 ul. The sample was
applied to a cover-slip in which lines of capture probe ([AMINOC6][SP-C18][SP-C18]GGATGTTAGGAAGACAAAAGGAAGCTGAGG),deposited
in a solution of 50 uM with 0.1 uM NaHCO3, were dried onto the surface and left in
a humid chamber for 30 min. The solution was then washed off in 3x SSPE for 10 min
and then briefly in water.
[0134] Various reaction components were tested for their effect upon RCR product formation.
The addition of Phi 29 to the RCR reaction at a final concentration of 0.1 U/ul rather
than 0.2 U/ul was found to create a greater proportion of RCR products that were of
larger intensity after detection probe hybridization. The addition of initiating primer
at 10 to 100 fold molar ratio relative to estimated target concentration was also
found to be optimal. Increased extension times produced more intense fluorescent signals
but tended to produce more diffuse concatemers. With the current attachment protocols
a 2hr extension time produced enhanced signals relative to a 1hr incubation with minimal
detrimental impact upon RCR product morphology.
[0135] Further optimization of RCR products have been achieved by reducing the estimated
concentration of synthetic and genomic targets to 0.1 to 0.25 fmol/ul in the RCR reaction.
This typically results in distinct and unique RCR products on the surface of the microscope
slide using method 1 for attachment. For synthetic targets in which a higher concentration
of targets in the RCR reaction may be present (e.g. >5 fmol/ul), RCR products may
be attached by method 2. Attachment method 1. RCR reaction products (4.5 ul) were
combined with 0.5 ul of 20 X SSPE and added to the center of the slide. The sample
was allowed to air dry and non-attached material was washed off for 10 min in 3x SSPE
and then briefly in DDI water. The slide was then dried before assembly on the microscope.
Attached RCR products were visualized by hybridizing an 11mer TAMRA labeled probe
that is complementary to a region of the adapter. Attachment method 2. RCR reaction
products (1 ul) were combined with 50 ul of 3XSSPE and added to the center of the
cover slip with capture probe attached. Addition of SDS (0.3%) was found to promote
specific attachment to the capture probes and not to the derivatized surface. The
sample was incubated at room temperature for 30 min and non-attached material was
washed off for 10 min in 3x SSPE and then briefly in DDI water. The slide was then
dried before assembly on the microscope. Attached RCR products were visualized by
hybridizing an 11mer TAMRA labeled probe that is complementary to a region of the
adapter. The above protocols provide RCR product densities of about 1 RCR product
per 2-4 micron square. Exemplary image of a resulting cover slip is shown in Fig.
3.
Example 3
Distinguish RCR Products on Random Arrays
Using Fluorescently Labeled Probes
[0136] PCR products from diagnostic regions of Bacillus anthracis and Yersinia pestis were
converted into single stranded DNA and attached to a universal adaptor. These two
samples were then mixed and replicated together using RCR and deposited onto a glass
surface as a random array. Successive hybridization with amplicon specific probes
showed that each spot on the array corresponded uniquely to either one of the two
sequences and that they can be identified specifically with the probes, as illustrated
in Fig. 4. This result demonstrates sensitivity and specificity of identifying DNA
present in submicron sized DNA concatemers having about 100-1000 copies of a DNA fragment
generated by the RCR reaction. A 155 bp amplicon sequence from B. anthracis and a
275 bp amplicon sequence from Y. pestis were amplified using standard PCR techniques
with PCR primers in which one primer of the pair was phosphorylated. A single stranded
form of the PCR products was generated by degradation of the phosphorylated strand
using lambda exonuclease. The 5' end of the remaining strand was then phosphorylated
using T4 DNA polynucleotide kinase to allow ligation of the single stranded product
to the universal adaptor. The universal adaptor was ligated using T4 DNA ligase to
the 5' end of the target molecule, assisted by a template oligonucleotide complementary
to the 5' end of the targets and 3' end of the universal adaptor. The adaptor ligated
targets were then circularized using bridging oligonucleotides with bases complementary
to the adaptor and to the 3' end of the targets. Linear DNA molecules were removed
by treating with exonuclease I. RCR products (DNA concatemers) were generated by mixing
the single-stranded samples and using Phi29 polymerase to replicate around the circularized
adaptor-target molecules with the bridging oligonucleotides as the initiating primers.
[0137] To prepare the cover slips for attaching amine-modified oligonucleotides, the cover
slips were first cleaned in a potassium/ethanol solution followed by rinsing and drying.
They were then treated with a solution of 3-aminopropyldimethylethoxysilane, acetone,
and water for 45 minutes and cured in an oven at 100°C for 1 hour. As a final step,
the cover slips were treated with a solution of p-phenylenediisothiocyanate (PDC),
pyridine, and dimethylformamide for 2 hours. The capture oligonucleotide (sequence
5'-GGATGTTAGGAAGACAAAAGGAAGCTGAGG-3') (SEQ ID NO: 14) is complementary to the universal
adaptor sequence. and is modified at the 5' end with an amine group and 2 C-18 linkers.
For attachment, 10 µl of the capture oligo at 10 µM in 0.1M NaHCO
3 was spotted onto the center of the derivatized cover slip, dried for 10 minutes in
a 70°C oven and rinsed with water. To create an array of DNA concatemers, the RCR
reaction containing the DNA concatemers was diluted 10-folds with 3X SSPE, 20 µl of
which was then deposited over the immobilized capture oligonucleotides on the cover
slip surface for 30 minutes in a moisture saturated chamber. The cover slip with the
DNA concatemers was then assembled into a reaction chamber and was rinsed by 2 ml
of 3X SSPE. Arrayed target concatemer molecules derived from B. anthracis and Y. pestis
PCR amplicons were probed sequentially with TAMRA-labeled oligomer: probe BrPrb3 (sequence
: 5'-CATTAACGGAC-3' (SEQ ID NO: 15), specifically complementary to the universal adaptor
sequence), probe Ba3 (sequence : 5'-TGAGCGATTCG-3' (SEQ ID NO: 16), specifically complementary
to the Ba3 amplicon sequence), probe Yp3 (sequence : 5'-GGTGTCATGGA-3', specifically
complementary to the Yp3 amplicon sequence). The probes were hybridized to the array
at a concentration of 0.1 µM for 20 min in 3X SSPE at room temperature. Excess probes
were washed off with 2 ml of 3X SSPE. Images were taken with the TIRF microscope.
The probes were then stripped off with 1 ml of 3X SSPE at 80°C for 5 minutes to prepare
the arrayed target molecules for the next round of hybridization.
[0138] By overlaying the images obtained from successive hybridization of 3 probes, as shown
in Fig. 4, it can be seen that most of the arrayed molecules that hybridized with
the adaptor probe would only hybridize to either the amplicon 1 probe (e.g. "A" in
Fig. 4) or the amplicon 2 probe (e.g. "B" in Fig. 4), with very few that would hybridize
to both. This specific hybridization pattern demonstrates that each spot on the array
contains only one type of sequence, either the B anthracis amplicon or the Y. pestis
amplicon.
Example 4
Decoding a Base Position in Arrayed Concatemers Created
From a Synthetic 80-Mer Oligonucleotide Containing
a Degenerated Base
[0139] Individual molecules of a synthetic oligonucleotide containing a degenerate base
can be divided into 4 sub-populations, each may have either an A, C, G or T base at
that particular position. An array of concatemers created from this synthetic DNA
may have about 25% of spots with each of the bases. Successful identification of these
sub-populations of concatemers was demonstrated by four successive hybridization and
ligation of pairs of probes, specific to each of the 4 bases, as shown in Fig. 5.
A 5' phosphorylated, 3' TAMRA-labeled pentamer oligonucleotide was paired with one
of the four hexamer oligonucleotides. Each of these 4 ligation probe pairs should
hybridize to either an A, C, G or T containing version of the target. Discrimination
scores of greater than 3 were obtained for most targets, demonstrating the ability
to identify single base differences between the nanoball targets. The discrimination
score is the highest spot score divided by the average of the other 3 base-specific
signals of the same spot. By adjusting the assay conditions (buffer composition, concentrations
of all components, time and temperature of each step in the cycle) higher signal to
background and full match to mismatch ratios are expected. This was demonstrated with
a similar ligation assay performed on the spotted arrays of 6-mer probes. In this
case full-match/background ratio was about 50 and the average full match/mismatch
ratio was 30. The results further demonstrate the ability to determine partial or
complete sequences of DNA present in concatemers by increasing the number of consecutive
probe cycles or by using 4 or more probes labeled with different dyes per each cycle.
Synthetic oligonucleotide (T1A : 5'-NNNNNNNNGCATANCACGANGTCATNATCGTNCAAACGTCAGTCCANGAATCNAGATCC
ACTTAGANTAAAAAAAAAAAA-3') (SEQ ID NO: 13) contains at position 32 a degenerate base.
Universal adaptor was ligated to this oligonucleotide and the adaptor-T1A DNA was
circularized as described before. DNA concatemers made using the rolling circle replication
(RCR) reaction on this target were arrayed onto the random array. Because each spot
on this random array corresponded to tandemly replicated copies originated from a
single molecule of T1A, therefore DNA in a particular arrayed spot would contain either
an A, or a C, or a G, or a T at positions corresponding to position 32 of T1A. To
identify these sub-populations, a set of 4 ligation probes specific to each of the
4 bases was used. A 5' phosphorylated, 3' TAMRA-labeled pentamer oligonucleotide corresponding
to position 33-37 of T1A with sequence CAAAC (probe T1A9b) was paired with one of
the following hexamer oligonucleotides corresponding to position 27-32 : ACTGTA (probe
T1A9a), ACTGTC (probe T1A10a), ACTGTG (probe T1A11a), ACTGTT (probe T1A12a). Each
of these 4 ligation probe pairs should hybridize to either an A, C, G or T containing
version of T1A. For each hybridization cycle, the probes were incubated with the array
in a ligation/hybridization buffer containing T4 DNA ligase at 20°C for 5 minutes.
Excess probes were washed off at 20°C and images were taken with a TIRF microscope.
Bound probes were stripped to prepare for the next round of hybridization.
[0140] An adaptor specific probe (BrPrb3) was hybridized to the array to establish the positions
of all the spots. The 4 ligation probe pairs, at 0.4 µM, were then hybridized successively
to the array with the base identifications as illustrated for four spots in Fig. 5.
It is clear that most of the spots are associated with only one of the 4 ligation
probe pairs, and thus the nature of the base at position 32 of T1A can be determined
specifically.
Example 5
Decoding Two Degenerate Bases at the End of
a Synthetic 80-Mer Oligonucleotide
[0141] The same synthetic oligonucleotide described above contains 8 degenerate bases at
the 5' end to simulate random genomic DNA ends. The concatemers created from this
oligonucleotide may have these 8 degenerate bases placed directly next to the adaptor
sequence. To demonstrate the feasibility of sequencing the two unknown bases adjacent
to the known adaptor sequence, a 12-mer oligonucleotide (UK0-12 sequence 5'-ACATTAACGGAC-3')
(SEQ ID NO: 17) with a specific sequence to hybridize to the 3' end of the adaptor
sequence was used as the anchor, and a set of 16 TAMRA-labeled oligonucleotides in
the form of BBNNNNNN were used as the sequence-reading probes. For each hybridization
cycle, 0.2uM of UK0-12 anchor probe and 0.4uM of the BBNNNNNN probe were incubated
with the array in a ligation/hybridization buffer containing T4 DNA ligase at 20°C
for 10 minutes. Excess probes were washed off at 20°C and images were taken with a
TIRF microscope. Bound probes were stripped to prepare for the next round of hybridization.
Using a subset of the BBNNNNNN probe set (namely GA, GC, GG and GT in the place of
BB), spots were able to be identified spots on the concatemer array created from targets
that specifically bind to one of these 4 probes, with an average full match/mismatch
ratio of over 20, as shown in Fig. 6.
DEFINITIONS
[0142] Terms and symbols of nucleic acid chemistry, biochemistry, genetics, and molecular
biology used herein follow those of standard treatises and texts in the field, e.g.
Kornberg and Baker, DNA Replication, Second Edition (W.H. Freeman, New York, 1992);
Lehninger, Biochemistry, Second Edition (Worth Publishers, New York, 1975);
Strachan and Read, Human Molecular Genetics, Second Edition (Wiley-Liss, New York,
1999);
Eckstein, editor, Oligonucleotides and Analogs: A Practical Approach (Oxford University
Press, New York, 1991);
Gait, editor, Oligonucleotide Synthesis: A Practical Approach (IRL Press, Oxford,
1984); and the like.
[0143] "Amplicon" means the product of a polynucleotide amplification reaction. That is,
it is a population of polynucleotides, usually double stranded, that are replicated
from one or more starting sequences. The one or more starting sequences may be one
or more copies of the same sequence, or it may be a mixture of different sequences.
Amplicons may be produced by a variety of amplification reactions whose products are
multiple replicates of one or more target nucleic acids. Generally, amplification
reactions producing amplicons are "template-driven" in that base pairing of reactants,
either nucleotides or oligonucleotides, have complements in a template polynucleotide
that are required for the creation of reaction products. In one aspect, template-driven
reactions are primer extensions with a nucleic acid polymerase or oligonucleotide
ligations with a nucleic acid ligase. Such reactions include, but are not limited
to, polymerase chain reactions (PCRs), linear polymerase reactions, nucleic acid sequence-based
amplification (NASBAs), rolling circle amplifications, and the like, disclosed in
the following references :
Mullis et al, U.S. patents 4,683,195;
4,965,188;
4,683,202;
4,800,159 (PCR);
Gelfand et al, U.S. patent 5,210,015 (real-time PCR with "taqman" probes);
Wittwer et al, U.S. patent 6,174,670;
Kacian et al, U.S. patent 5,399,491 ("NASBA");
Lizardi, U.S. patent 5,854,033; Aono et al, Japanese patent publ.
JP 4-262799 (rolling circle amplification); and the like. In one aspect, amplicons of the disclosure
are produced by PCRs. An amplification reaction may be a "real-time" amplification
if a detection chemistry is available that permits a reaction product to be measured
as the amplification reaction progresses, e.g. "real-time PCR" described below, or
"real-time NASBA" as described in
Leone et al, Nucleic Acids Research, 26: 2150-2155 (1998), and like references. As used herein, the term "amplifying" means performing an
amplification reaction. A "reaction mixture" means a solution containing all the necessary
reactants for performing a reaction, which may include, but not be limited to, buffering
agents to maintain pH at a selected level during a reaction, salts, co-factors, scavengers,
and the like.
[0144] "Complementary or substantially complementary" refers to the hybridization or base
pairing or the formation of a duplex between nucleotides or nucleic acids, such as,
for instance, between the two strands of a double stranded DNA molecule or between
an oligonucleotide primer and a primer binding site on a single stranded nucleic acid.
Complementary nucleotides are, generally, A and T (or A and U), or C and G. Two single
stranded RNA or DNA molecules are said to be substantially complementary when the
nucleotides of one strand, optimally aligned and compared and with appropriate nucleotide
insertions or deletions, pair with at least about 80% of the nucleotides of the other
strand, usually at least about 90% to 95%, and more preferably from about 98 to 100%.
Alternatively, substantial complementarity exists when an RNA or DNA strand will hybridize
under selective hybridization conditions to its complement. Typically, selective hybridization
will occur when there is at least about 65% complementary over a stretch of at least
14 to 25 nucleotides, preferably at least about 75%, more preferably at least about
90% complementary. See,
M. Kanehisa Nucleic Acids Res. 12:203 (1984).
[0145] "Duplex" means at least two oligonucleotides and/or polynucleotides that are fully
or partially complementary undergo Watson-Crick type base pairing among all or most
of their nucleotides so that a stable complex is formed. The terms "annealing" and
"hybridization" are used interchangeably to mean the formation of a stable duplex.
"Perfectly matched" in reference to a duplex means that the poly- or oligonucleotide
strands making up the duplex form a double stranded structure with one another such
that every nucleotide in each strand undergoes Watson-Crick bascpairing with a nucleotide
in the other strand. The term "duplex" comprehends the pairing of nucleoside analogs,
such as deoxyinosine, nucleosides with 2-aminopurine bases, PNAs, and the like, that
may be employed. A "mismatch" in a duplex between two oligonucleotides or polynucleotides
means that a pair of nucleotides in the duplex fails to undergo Watson-Crick bonding.
[0146] "Genetic locus," or "locus" in reference to a genome or target polynucleotide, means
a contiguous subregion or segment of the genome or target polynucleotide. As used
herein, genetic locus, or locus, may refer to the position of a nucleotide, a gene,
or a portion of a gene in a genome, including mitochondrial DNA, or it may refer to
any contiguous portion of genomic sequence whether or not it is within, or associated
with, a gene. In one aspect, a genetic locus refers to any portion of genomic sequence,
including mitochondrial DNA, from a single nucleotide to a segment of few hundred
nucleotides, e.g. 100-300, in length.
[0147] "Genetic variant" means a substitution, inversion, insertion, or deletion of one
or more nucleotides at genetic locus, or a translocation of DNA from one genetic locus
to another genetic locus. In one aspect, genetic variant means an alternative nucleotide
sequence at a genetic locus that may be present in a population of individuals and
that includes nucleotide substitutions, insertions, and deletions with respect to
other members of the population. In another aspect, insertions or deletions at a genetic
locus comprises the addition or the absence of from 1 to 10 nucleotides at such locus,
in comparison with the same locus in another individual of a population.
[0148] "hybridization" refers to the process in which two single-stranded polynucleotides
bind non-covalently to form a stable double-stranded polynucleotide. The term "hybridization"
may also refer to triple-stranded hybridization. The resulting (usually) double-stranded
polynucleotide is a "hybrid" or "duplex." "Hybridization conditions" will typically
include salt concentrations of less than about 1M, more usually less than about 500
mM and less than about 200 mM. A "hybridization buffer" is a buffered salt solution
such as 5X SSPE, or the like. Hybridization temperatures can be as low as 5° C., but
are typically greater than 22° C., more typically greater than about 30° C., and preferably
in excess of about 37° C. Hybridizations are usually performed under stringent conditions,
i.e. conditions under which a probe will hybridize to its target subsequence. Stringent
conditions are sequence-dependent and are different in different circumstances. Longer
fragments may require higher hybridization temperatures for specific hybridization.
As other factors may affect the stringency of hybridization, including base composition
and length of the complementary strands, presence of organic solvents and extent of
base mismatching, the combination of parameters is more important than the absolute
measure of any one alone. Generally, stringent conditions are selected to be about
5° C. lower than the T
m for the specific sequence at s defined ionic strength and pH. Exemplary stringent
conditions include salt concentration of at least 0.01 M to no more than 1 M Na ion
concentration (or other salts) at a pH 7.0 to 8.3 and a temperature of at least 25°
C. For example, conditions of 5×SSPE (750 mM NaCl, 50 mM NaPhosphate, 5 mM EDTA, pH
7.4) and a temperature of 25-30° C. are suitable for allele-specific probe hybridizations.
For stringent conditions, see for example,
Sambrook, Fritsche and Maniatis. "Molecular Cloning A laboratory Manual" 2nd Ed. Cold
Spring Harbor Press (1989) and
Anderson "Nucleic Acid Hybridization" 1st Ed., BIOS Scientific Publishers Limited
(1999). "Hybridizing specifically to" or "specifically hybridizing to" or like expressions
refer to the binding, duplexing, or hybridizing of a molecule substantially to or
only to a particular nucleotide sequence or sequences under stringent conditions when
that sequence is present in a complex mixture (e.g., total cellular) DNA or RNA.
[0149] "Ligation" means to form a covalent bond or linkage between the termini of two or
more nucleic acids, e.g. oligonucleotides and/or polynucleotides, in a template-driven
reaction. The nature of the bond or linkage may vary widely and the ligation may be
carried out enzymatically or chemically. As used herein, ligations are usually carried
out enzymatically to form a phosphodiester linkage between a 5' carbon of a terminal
nucleotide of one oligonucleotide with 3' carbon of another oligonucleotide. A variety
of template-driven ligation reactions are described in the following references:
Whitely et al, U.S. patent 4,883,750;
Letsinger et al, U.S. patent 5,476,930;
Fung et al, U.S. patent 5,593,826;
Kool, U.S. patent 5,426,180;
Landegren et al, U.S. patent 5,871,921;
Xu and Kool, Nucleic Acids Research, 27: 875-881 (1999);
Higgins et al, Methods in Enzymology, 68: 50-71 (1979);
Engler et al, The Enzymes, 15: 3-29 (1982); and
Namsaraev, U.S. patent publication 2004/0110213. Enzymatic ligation usually takes place in a ligase buffer, which is a buffered salt
solution containing any required divalent cations, cofactors, and the like, for the
particular ligase employed.
[0150] "Microarray" or "array" refers to a solid phase support having a surface, usually
planar or substantially planar, which carries an array of sites containing nucleic
acids, such that each member site of the array comprises identical copies of immobilized
oligonucleotides or polynucleotides and is spatially defined and not overlapping with
other member sites of the array; that is, the sites are spatially discrete. In some
cases, sites of a microarray may also be spaced apart as well as discrete; that is,
different sites do not share boundaries, but are separated by inter-site regions,
usually free of bound nucleic acids. Spatially defined hybridization sites may additionally
be "addressable" in that its location and the identity of its immobilized oligonucleotide
are known or predetermined, for example, prior to its use. In some aspects, the oligonucleotides
or polynucleotides are single stranded and are covalently attached to the solid phase
support, usually by a 5'-end or a 3'-end. In other aspects, oligonucleotides or polynucleotides
are attached to the solid phase support non-covalently, e.g. by a biotin-streptavidin
linkage, hybridization to a capture oligonucleotide that is covalently bound, and
the like. Conventional microarray technology is reviewed in the following references:
Schena, Editor, Microarrays: A Practical Approach (IRL Press, Oxford, 2000);
Southern, Current Opin. Chem. Biol., 2: 404-410 (1998);
Nature Genetics Supplement, 21: 1-60 (1999). As used herein, "random array" or "random microarray" refers to a microarray whose
spatially discrete regions of oligonucleotides or polynucleotides are not spatially
addressed. That is, the identity of the attached oligonucleoties or polynucleotides
is not discernable, at least initially, from its location, but may be determined by
a particular operation on the array, e.g. sequencing, hybridizing decoding probes,
or the like. Random microarrays are frequently formed from a planar array of microbeads,
e.g.
Brenner et al, Nature Biotechnology, 18: 630-634 (2000);
Tulley et al, U.S. patent 6,133,043;
Stuelpnagel et al, U.S. patent 6,396,995;
Chee et al, U.S. patent 6,544,732; and the like.
[0151] "Mismatch" means a base pair between any two of the bases A, T (or U for RNA), G,
and C other than the Watson-Crick base pairs G-C and A-T. The eight possible mismatches
are A-A, T-T, G-G, C-C, T-G, C-A, T-C, and A-G.
[0152] "Mutation" and "polymorphism" are usually used somewhat interchangeably to mean a
DNA molecule, such as a gene, that differs in nucleotide sequence from a reference
DNA sequence, or wild type sequence, or normal tissue sequence, by one or more bases,
insertions, and/or deletions. In some contexts, the usage of Cotton (Mutation Detection,
Oxford University Press, Oxford, 1997) is followed in that a mutation is understood
to be any base change whether pathological to an organism or not, whereas a polymorphism
is usually understood to be a base change with no direct pathological consequences.
[0153] "Nucleoside" as used herein includes the natural nucleosides, including 2'-deoxy
and 2'-hydroxyl forms, e.g. as described in
Kornberg and Baker, DNA Replication, 2nd Ed. (Freeman, San Francisco, 1992). "Analogs" in reference to nucleosides includes synthetic nucleosides having modified
base moieties and/or modified sugar moieties, e.g. described by
Scheit, Nucleotide Analogs (John Wiley, New York, 1980);
Uhlman and Peyman, Chemical Reviews, 90: 543-584 (1990), or the like, with the proviso that they are capable of specific hybridization.
Such analogs include synthetic nucleosides designed to enhance binding properties,
reduce complexity, increase specificity, and the like. Polynucleotides comprising
analogs with enhanced hybridization or nuclease resistance properties are described
in Uhlman and Peyman (cited above);
Crooke et al, Exp. Opin. Ther. Patents, 6: 855-870 (1996);
Mesmaeker et al, Current Opinion in Structual Biology, 5: 343-355 (1995); and the like. Exemplary types of polynucleotides that are capable of enhancing
duplex stability include oligonucleotide N3'→P5' phosphoramidates (referred to herein
as "amidates"), peptide nucleic acids (referred to herein as "PNAs"), oligo-2'-O-alkylribonucleotides,
polynucleotides containing C-5 propynylpyrimidines, locked nucleic acids (LNAs), and
like compounds. Such oligonucleotides are either available commercially or may be
synthesized using methods described in the literature.
[0154] "Polymerase chain reaction," or "PCR," means a reaction for the in vitro amplification
of specific DNA sequences by the simultaneous primer extension of complementary strands
of DNA. In other words, PCR is a reaction for making multiple copies or replicates
of a target nucleic acid flanked by primer binding sites, such reaction comprising
one or more repetitions of the following steps: (i) denaturing the target nucleic
acid, (ii) annealing primers to the primer binding sites, and (iii) extending the
primers by a nucleic acid polymerase in the presence of nucleoside triphosphates.
Usually, the reaction is cycled through different temperatures optimized for each
step in a thermal cycler instrument. Particular temperatures, durations at each step,
and rates of change between steps depend on many factors well-known to those of ordinary
skill in the art, e.g. exemplified by the references:
McPherson et al, editors, PCR: A Practical Approach and PCR2: A Practical Approach
(IRL Press, Oxford, 1991 and 1995, respectively). For example, in a conventional PCR using Taq DNA polymerase, a double
stranded target nucleic acid may be denatured at a temperature >90°C, primers annealed
at a temperature in the range 50-75°C, and primers extended at a temperature in the
range 72-78°C. The term "PCR" encompasses derivative forms of the reaction, including
but not limited to, RT-PCR, real-time PCR, nested PCR, quantitative PCR, multiplexed
PCR, and the like. Reaction volumes range from a few hundred nanoliters, e.g. 200
nL, to a few hundred µL, e.g. 200 µL. "Reverse transcription PCR," or "RT-PCR," means
a PCR that is preceded by a reverse transcription reaction that converts a target
RNA to a complementary single stranded DNA, which is then amplified, e.g.
Tecott et al, U.S. patent 5,168,038. "Real-time PCR" means a PCR for which the amount of reaction product, i.e. amplicon,
is monitored as the reaction proceeds. There are many forms of real-time PCR that
differ mainly in the detection chemistries used for monitoring the reaction product,
e.g.
Gelfand et al, U.S. patent 5,210,015 ("taqman");
Wittwer et al, U.S. patents 6,174,670 and
6,569,627 (intercalating dyes);
Tyagi et al, U.S. patent 5,925,517 (molecular beacons). Detection chemistries for real-time PCR are reviewed in
Mackay et al. Nucleic Acids Research, 30: 1292-1305 (2002), "Nested PCR" means a two-stage PCR wherein the amplicon of a first PCR becomes
the sample for a second PCR using a new set of primers, at least one of which binds
to an interior location of the first amplicon. As used herein, "initial primers" in
reference to a nested amplification reaction mean the primers used to generate a first
amplicon, and "secondary primers" mean the one or more primers used to generate a
second, or nested, amplicon. "Multiplexed PCR" means a PCR wherein multiple target
sequences (or a single target sequence and one or more reference sequences) are simultaneously
carried out in the same reaction mixture, e.g.
Bernard et al, Anal. Biochem., 273: 221-228 (1999)(two-color real-time PCR). Usually, distinct sets ofprimers are employed for each
sequence being amplified. "Quantitative PCR" means a PCR designed to measure the abundance
of one or more specific target sequences in a sample or specimen. Quantitative PCR
includes both absolute quantitation and relative quantitation of such target sequences.
Quantitative measurements are made using one or more reference sequences that may
be assayed separately or together with a target sequence. The reference sequence may
be endogenous or exogenous to a sample or specimen, and in the latter case, may comprise
one or more competitor templates. Typical endogenous reference sequences include segments
of transcripts of the following genes: β-action, GAPDH, β
2-microglobulin, ribosomal RNA, and the like. Techniques for quantitative PCR are well-known
to those of ordinary skill in the art, as exemplified in the following references:
Freeman et al, Biotechniques, 26: 112-126 (1999);
Becker-Andre et al, Nucleic Acids Research, 17: 9437-9447 (1989);
Zimmerman et al, Biotechniques, 21: 268-279 (1996);
Diviacco et al, Gene, 122: 3013-3020 (1992);
Becker-Andre et al, Nucleic Acids Research, 17: 9437-9446 (1989); and the like.
[0155] "Polynucleotide" or "oligonucleotide" are used interchangeably and each mean a linear
polymer of nucleotide monomers. As used herein, the terms may also refer to double
stranded forms. Monomers making up polynucleotides and oligonucleotides are capable
of specifically binding to a natural polynucleotide by way of a regular pattern of
monomer-to-monomer interactions, such as Watson-Crick type of base pairing, base stacking,
Hoogsteen or reverse Hoogsteen types of base pairing, or the like, to form duplex
or triplex forms. Such monomers and their internucleosidic linkages may be naturally
occurring or may be analogs thereof, e.g. naturally occurring or non-naturally occurring
analogs. Non-naturally occurring analogs may include PNAs, phosphorothioate internucleosidic
linkages, bases containing linking groups permitting the attachment of labels, such
as fluorophores, or haptens, and the like. Whenever the use of an oligonucleotide
or polynucleotide requires enzymatic processing, such as extension by a polymerase,
ligation by a ligase, or the like, one of ordinary skill would understand that oligonucleotides
or polynucleotides in those instances would not contain certain analogs of internucleosidic
linkages, sugar moities, or bases at any or some positions, when such analogs are
incompatable with enzymatic reactions. Polynucleotides typically range in size from
a few monomeric units, e.g. 5-40, when they are usually referred to as "oligonucleotides,"
to several thousand monomeric units. Whenever a polynucleotide or oligonucleotide
is represented by a sequence of letters (upper or lower case), such as "ATGCCTG,"
it will be understood that the nucleotides are in 5'→3' order from left to right and
that "A" denotes deoxyadenosine, "C" denotes deoxycytidine, "G" denotes deoxyguanosine,
and "T" denotes thymidine, "I" denotes deoxyinosine, "U" denotes uridine, unless otherwise
indicated or obvious from context. Unless otherwise noted the terminology and atom
numbering conventions will follow those disclosed in
Strachan and Read, Human Molecular Genetics 2 (Wiley-Liss, New York, 1999). Usually polynucleotides comprise the four natural nucleosides (e.g. deoxyadenosine,
deoxycytidine, deoxyguanosine, deoxythymidine for DNA or their ribose counterparts
for RNA) linked by phosphodiester linkages; however, they may also comprise non-natural
nucleotide analogs, e.g. including modified bases, sugars, or internucleosidic linkages.
It is clear to those skilled in the art that where an enzyme has specific oligonucleotide
or polynucleotide substrate requirements for activity, e.g. single stranded DNA, RNA/DNA
duplex, or the like, then selection of appropriate composition for the oligonucleotide
or polynucleotide substrates is well within the knowledge of one of ordinary skill,
especially with guidance from treatises, such as
Sambrook et al, Molecular Cloning, Second Edition (Cold Spring Harbor Laboratory,
New York, 1989), and like references.
[0156] "Primer" means an oligonucleotide, either natural or synthetic, that is capable,
upon forming a duplex with a polynucleotide template, of acting as a point of initiation
of nucleic acid synthesis and being extended from its 3' end along the template so
that an extended duplex is formed. The sequence of nucleotides added during the extension
process are determined by the sequence of the template polynucleotide. Usually primers
are extended by a DNA polymerase. Primers usually have a length in the range of from
9 to 40 nucleotides, or in some aspects, from 14 to 36 nucleotides.
[0157] "Readout" means a parameter, or parameters, which are measured and/or detected that
can be converted to a number or value. In some contexts, readout may refer to an actual
numerical representation of such collected or recorded data. For example, a readout
of fluorescent intensity signals from a microarray is the position and fluorescence
intensity of a signal being generated at each hybridization site of the microarray;
thus, such a readout may be registered or stored in various ways, for example, as
an image of the microarray, as a table of numbers, or the like.
[0158] "Solid support", "support", and "solid phase support" are used interchangeably and
refer to a material or group of materials having a rigid or semi-rigid surface or
surfaces. In many aspects, at least one surface of the solid support will be substantially
flat, although in some aspects it may be desirable to physically separate synthesis
regions for different compounds with, for example, wells, raised regions, pins, etched
trenches, or the like. According to other aspects, the solid support(s) will take
the form of beads, resins, gels, microspheres, or other geometric configurations.
Microarrays usually comprise at least one planar solid phase support, such as a glass
microscope slide.
[0159] "Reference sequence" or "reference population" of DNA refers to individual DNA sequences
or a collection of DNAs (or RNAs derived from it) which is compared to a test population
of DNA or RNA, (or "test DNA sequence," or "test DNA population") by the formation
of heteroduplexes between the complementary strands of the reference DNA population
and test DNA population. If perfectly matched heteroduplexes form, then the respective
members of the reference and test populations are identical; otherwise, they are variants
of one another. Typically, the nucleotide sequences of members of the reference population
are known and the sequences typically are listed in sequence databases, such as Genbank,
Embl, or the like. In one aspect, a reference population of DNA may comprise a cDNA
library or genomic library from a known cell type or tissue source. For example, a
reference population of DNA may comprise a cDNA library or a genomic library derived
from the tissue of a healthy individual and a test population of DNA may comprise
a cDNA library or genomic library derived from the same tissue of a diseased individual.
Reference populations of DNA may also comprise an assembled collection of individual
polynucleotides, cDNAs, genes, or exons thereof, e.g. genes or exons encoding all
or a subset of known p53 variants, genes of a signal transduction pathway, or the
like.
[0160] "Specific" or "specificity" in reference to the binding of one molecule to another
molecule, such as a labeled target sequence for a probe, means the recognition, contact,
and formation of a stable complex between the two molecules, together with substantially
less recognition, contact, or complex formation of that molecule with other molecules.
In one aspect, "specific" in reference to the binding of a first molecule to a second
molecule means that to the extent the first molecule recognizes and forms a complex
with another molecules in a reaction or sample, it forms the largest number of the
complexes with the second molecule. Preferably, this largest number is at least fifty
percent. Generally, molecules involved in a specific binding event have areas on their
surfaces or in cavities giving rise to specific recognition between the molecules
binding to each other. Examples of specific binding include antibody-antigen interactions,
enzyme-substrate interactions, formation of duplexes or triplexes among polynucleotides
and/or oligonucleotides, receptor-ligand interactions, and the like. As used herein,
"contact" in reference to specificity or specific binding means two molecules are
close enough that weak noncovalent chemical interactions, such as Van der Waal forces,
hydrogen bonding, base-stacking interactions, ionic and hydrophobic interactions,
and the like, dominate the interaction of the molecules.
[0161] As used herein, the term "T
m" is used in reference to the "melting temperature." The melting temperature is the
temperature at which a population of double-stranded nucleic acid molecules becomes
half dissociated into single strands. Several equations for calculating the Tm of
nucleic acids are well known in the art. As indicated by standard references, a simple
estimate of the Tm value may be calculated by the equation. Tm = 81.5 + 0.41 (% G
+ C), when a nucleic acid is in aqueous solution at 1 M NaCl (see e.g.,
Anderson and Young, Quantitative Filter Hybridization, in Nucleic Acid Hybridization
(1985). Other references (e.g.,
Allawi, H.T. & SantaLucia, J., Jr., Biochemistry 36, 10581-94 (1997)) include alternative methods of computation which take structural and environmental,
as well as sequence characteristics into account for the calculation of Tm.
[0162] "Sample" usually means a quantity of material from a biological, environmental, medical,
or patient source in which detection, measurement, or labeling of target nucleic acids
is sought. On the one hand it is meant to include a specimen or culture (e.g., microbiological
cultures). On the other hand, it is meant to include both biological and environmental
samples. A sample may include a specimen of synthetic origin. Biological samples may
be animal, including human, fluid, solid (e.g., stool) or tissue, as well as liquid
and solid food and feed products and ingredients such as dairy items, vegetables,
meat and meat by-products, and waste. Biological samples may include materials taken
from a patient including, but not limited to cultures, blood, saliva, cerebral spinal
fluid, pleural fluid, milk, lymph, sputum, semen, needle aspirates, and the like.
Biological samples may be obtained from all of the various families of domestic animals,
as well as feral or wild animals, including, but not limited to, such animals as ungulates,
bear, fish, rodents, etc. Environmental samples include environmental material such
as surface matter, soil, water and industrial samples, as well as samples obtained
from food and dairy processing instruments, apparatus, equipment, utensils, disposable
and non-disposable items. These examples are not to be construed as limiting the sample
types applicable to the present invention.
[0163] The above teachings are intended to illustrate the invention and do not by their
details limit the scope of the claims of the invention.
SEQUENCE LISTING
[0164]
<110> Callida Genomics, Inc.
Drmanac, Radoje
Callow, Matthew
Drmanac, Snezana
Hauser, Brian
Yeung, George
<120> SINGLE MOLECULE ARRAYS FOR GENETIC AND CHEMICAL ANALYSIS
<130> 701.01
<150> US 60/776,415
<151> 2006-02-24
<150> US 60/725,116
<151> 2005-10-07
<150> US 60/690,771
<151> 2005-06-15
<160> 17
<170> PatentIn version 3.3
<210> 1
<211> 80
<212> DNA
<213> Unknown
<220>
<223> probe
<220>
<221> misc_feature
<222> (1)..(8)
<223> n is a, c, g, or t
<220>
<221> misc_feature
<222> (14)..(14)
<223> n is a, c, g, or t
<220>
<221> misc_feature
<222> (20)..(20)
<223> n is a, c, g, or t
<220>
<221> misc_feature
<222> (26)..(26)
<223> n is a, c, g, or t
<220>
<221> misc_feature
<222> (32)..(32)
<223> n is a, c, g, or t
<220>
<221> misc_feature
<222> (47)..(47)
<223> n is a, c, g, or t
<220>
<221> misc_feature
<222> (53)..(53)
<223> n is a, c, g, or t
<220>
<221> misc_feature
<222> (67)..(67)
<223> n is a, c, g, or t
<220>
<221> misc_feature
<222> (70)..(70)
<223> n is a, c, g, or t
<220>
<221> misc_feature
<222> (73)..(80)
<223> n is a, c, g, or t
<400> 1

<210> 2
<211> 50
<212> DNA
<213> Unknown
<220>
<223> adaptor
<400> 2
tatcatctgg atgttaggaa gacaaaagga agctgaggac attaacggac 50
<210> 3
<211> 15
<212> DNA
<213> Unknown
<220>
<223> adaptor
<400> 3
accttcagac cagat 15
<210> 4
<211> 25
<212> DNA
<213> Unknown
<220>
<223> adaptor
<220>
<221> misc_feature
<222> (1)..(7)
<223> n is a, c, g, or t
<400> 4
nnnnnnngtc cgttaatgtc ctcag 25
<210> 5
<211> 22
<212> DNA
<213> Unknown
<220>
<223> adaptor
<220>
<221> misc_feature
<222> (1)..(1)
<223> biotinylated base
<220>
<221> misc_feature
<222> (16)..(22)
<223> n is a, c, g, or t
<400> 5
atctggtctg aaggtnnnnn nn 22
<210> 6
<211> 20
<212> DNA
<213> Unknown
<220>
<223> adaptor
<220>
<221> misc_feature
<222> (1)..(1)
<223> biotinylated base
<400> 6
cttttgtctt cctaacatcc 20
<210> 7
<211> 16
<212> DNA
<213> Unknown
<220>
<223> adaptor
<400> 7
agatgataat ctggtc 16
<210> 8
<211> 65
<212> DNA
<213> Unknown
<220>
<223> adaptor
<400> 8

<210> 9
<211> 23
<212> DNA
<213> Unknown
<220>
<223> adaptor
<220>
<221> misc_feature
<222> (1)..(7)
<223> n is a, c, g, or t
<220>
<221> misc_feature
<222> (23)..(23)
<223> dideoxynucleotide
<400> 9
nnnnnnngtc cgttaatgtg acc 23
<210> 10
<211> 17
<212> DNA
<213> Unknown
<220>
<223> adaptor
<220>
<221> misc_feature
<222> (17)..(17)
<223> didexoynucleotide
<400> 10
agatgatatt tttttt 17
<210> 11
<211> 24
<212> DNA
<213> Unknown
<220>
<223> primer
<400> 11
tcagcttcct tttgtcttcc taac 24
<210> 12
<211> 30
<212> DNA
<213> Unknown
<220>
<223> probe
<400> 12
ggatgttagg aagacaaaag gaagctgagg 30
<210> 13
<211> 80
<212> DNA
<213> Unknown
<220>
<223> probe
<220>
<221> misc_feature
<222> (1)..(8)
<223> n is a, c, g, or t
<220>
<221> misc_feature
<222> (14)..(14)
<223> n is a, c, g, or t
<220>
<221> misc_feature
<222> (20)..(20)
<223> n is a, c, g, or t
<220>
<221> misc_feature
<222> (26).. (26)
<223> n is a, c, g, or t
<220>
<221> misc_feature
<222> (32)..(32)
<223> n is a, c, g, or t
<220>
<221> misc_feature
<222> (47)..(47)
<223> n is a, c, g, or t
<220>
<221> misc_feature
<222> (53)..(53)
<223> n is a, c, g, or t
<220>
<221> misc_feature
<222> (67)..(67)
<223> n is a, c, g, or t
<400> 13

<210> 14
<211> 30
<212> DNA
<213> Unknown
<220>
<223> probe
<400> 14
ggatgttagg aagacaaaag gaagctgagg 30
<210> 15
<211> 11
<212> DNA
<213> Unknown
<220>
<223> probe
<400> 15
cattaacgga c 11
<210> 16
<211> 11
<212> DNA
<213> Unknown
<220>
<223> probe
<400> 16
tgagcgattc g 11
<210> 17
<211> 12
<212> DNA
<213> Unknown
<220>
<223> adaptor
<400> 17
acattaacgg ac 12